Identification and verification of hybridoma-derived monoclonal antibody variable region sequences using recombinant DNA technology and mass spectrometry

USDA-ARS?s Scientific Manuscript database

Antibody engineering requires the identification of antigen binding domains or variable regions (VR) unique to each antibody. It is the VR that define the unique antigen binding properties and proper sequence identification is essential for functional evaluation and performance of recombinant antibo...

Rapid Detection and Identification of a Pathogen's DNA Using Phi29 DNA Polymerase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Y.; Dunn, J.; Gao, S.

2008-10-31

Zoonotic pathogens including those transmitted by insect vectors are some of the most deadly of all infectious diseases known to mankind. A number of these agents have been further weaponized and are widely recognized as being potentially significant biothreat agents. We describe a novel method based on multiply-primed rolling circle in vitro amplification for profiling genomic DNAs to permit rapid, cultivation-free differential detection and identification of circular plasmids in infectious agents. Using Phi29 DNA polymerase and a two-step priming reaction we could reproducibly detect and characterize by DNA sequencing circular DNA from Borrelia burgdorferi B31 in DNA samples containing asmore » little as 25 pg of Borrelia DNA amongst a vast excess of human DNA. This simple technology can ultimately be adapted as a sensitive method to detect specific DNA from both known and unknown pathogens in a wide variety of complex environments.« less

Development of a DNA microarray for species identification of quarantine aphids.

PubMed

Lee, Won Sun; Choi, Hwalran; Kang, Jinseok; Kim, Ji-Hoon; Lee, Si Hyeock; Lee, Seunghwan; Hwang, Seung Yong

2013-12-01

Aphid pests are being brought into Korea as a result of increased crop trading. Aphids exist on growth areas of plants, and thus plant growth is seriously affected by aphid pests. However, aphids are very small and have several sexual morphs and life stages, so it is difficult to identify species on the basis of morphological features. This problem was approached using DNA microarray technology. DNA targets of the cytochrome c oxidase subunit I gene were generated with a fluorescent dye-labelled primer and were hybridised onto a DNA microarray consisting of specific probes. After analysing the signal intensity of the specific probes, the unique patterns from the DNA microarray, consisting of 47 species-specific probes, were obtained to identify 23 aphid species. To confirm the accuracy of the developed DNA microarray, ten individual blind samples were used in blind trials, and the identifications were completely consistent with the sequencing data of all individual blind samples. A microarray has been developed to distinguish aphid species. DNA microarray technology provides a rapid, easy, cost-effective and accurate method for identifying aphid species for pest control management. © 2013 Society of Chemical Industry.

Simultaneous detection of human mitochondrial DNA and nuclear-inserted mitochondrial-origin sequences (NumtS) using forensic mtDNA amplification strategies and pyrosequencing technology.

PubMed

Bintz, Brittania J; Dixon, Groves B; Wilson, Mark R

2014-07-01

Next-generation sequencing technologies enable the identification of minor mitochondrial DNA variants with higher sensitivity than Sanger methods, allowing for enhanced identification of minor variants. In this study, mixtures of human mtDNA control region amplicons were subjected to pyrosequencing to determine the detection threshold of the Roche GS Junior(®) instrument (Roche Applied Science, Indianapolis, IN). In addition to expected variants, a set of reproducible variants was consistently found in reads from one particular amplicon. A BLASTn search of the variant sequence revealed identity to a segment of a 611-bp nuclear insertion of the mitochondrial control region (NumtS) spanning the primer-binding sites of this amplicon (Nature 1995;378:489). Primers (Hum Genet 2012;131:757; Hum Biol 1996;68:847) flanking the insertion were used to confirm the presence or absence of the NumtS in buccal DNA extracts from twenty donors. These results further our understanding of human mtDNA variation and are expected to have a positive impact on the interpretation of mtDNA profiles using deep-sequencing methods in casework. © 2014 American Academy of Forensic Sciences.

Using DNA chips for identification of tephritid pest species.

PubMed

Chen, Yen-Hou; Liu, Lu-Yan; Tsai, Wei-Huang; Haymer, David S; Lu, Kuang-Hui

2014-08-01

The ability correctly to identify species in a rapid and reliable manner is critical in many situations. For insects in particular, the primary tools for such identification rely on adult-stage morphological characters. For a number of reasons, however, there is a clear need for alternatives. This paper reports on the development of a new method employing DNA biochip technology for the identification of pest species within the family Tephritidae. The DNA biochip developed and tested here quickly and efficiently identifies and discriminates between several tephritid species, except for some that are members of a complex of closely related taxa and that may in fact not represent distinct biological species. The use of these chips offers a number of potential advantages over current methods. Results can be obtained in less than 5 h using material from any stage of the life cycle and with greater sensitivity than other methods currently available. This technology provides a novel tool for the rapid and reliable identification of several major pest species that may be intercepted in imported fruits or other commodities. The existing chips can also easily be expanded to incorporate additional markers and species as needed. © 2013 Society of Chemical Industry.

Identification of Bacterial DNA Markers for the Detection of Human and Cattle Fecal Pollution - SLIDES

EPA Science Inventory

Technological advances in DNA sequencing and computational biology allow scientists to compare entire microbial genomes. However, the use of these approaches to discern key genomic differences between natural microbial communities remains prohibitively expensive for most laborato...

IDENTIFICATION OF BACTERIAL DNA MARKERS FOR THE DETECTION OF HUMAN AND CATTLE FECAL POLLUTION

EPA Science Inventory

Technological advances in DNA sequencing and computational biology allow scientists to compare entire microbial genomes. However, the use of these approaches to discern key genomic differences between natural microbial communities remains prohibitively expensive for most laborato...

The Biotechnology Revolution: Distinguishing Fact from Fantasy and Folly?

ERIC Educational Resources Information Center

Edmondston, Joanne

2000-01-01

Biotechnology and its applications, such as the discovery of DNA used in the identification of genes, are now having significant impact on everyday life. Discusses the impacts of DNA technology and genetic modification practices. Introduces the Human Genome Project whose aim is to determine the order of each of the 3.3 billion bases of human DNA.…

A next generation semiconductor based sequencing approach for the identification of meat species in DNA mixtures.

PubMed

Bertolini, Francesca; Ghionda, Marco Ciro; D'Alessandro, Enrico; Geraci, Claudia; Chiofalo, Vincenzo; Fontanesi, Luca

2015-01-01

The identification of the species of origin of meat and meat products is an important issue to prevent and detect frauds that might have economic, ethical and health implications. In this paper we evaluated the potential of the next generation semiconductor based sequencing technology (Ion Torrent Personal Genome Machine) for the identification of DNA from meat species (pig, horse, cattle, sheep, rabbit, chicken, turkey, pheasant, duck, goose and pigeon) as well as from human and rat in DNA mixtures through the sequencing of PCR products obtained from different couples of universal primers that amplify 12S and 16S rRNA mitochondrial DNA genes. Six libraries were produced including PCR products obtained separately from 13 species or from DNA mixtures containing DNA from all species or only avian or only mammalian species at equimolar concentration or at 1:10 or 1:50 ratios for pig and horse DNA. Sequencing obtained a total of 33,294,511 called nucleotides of which 29,109,688 with Q20 (87.43%) in a total of 215,944 reads. Different alignment algorithms were used to assign the species based on sequence data. Error rate calculated after confirmation of the obtained sequences by Sanger sequencing ranged from 0.0003 to 0.02 for the different species. Correlation about the number of reads per species between different libraries was high for mammalian species (0.97) and lower for avian species (0.70). PCR competition limited the efficiency of amplification and sequencing for avian species for some primer pairs. Detection of low level of pig and horse DNA was possible with reads obtained from different primer pairs. The sequencing of the products obtained from different universal PCR primers could be a useful strategy to overcome potential problems of amplification. Based on these results, the Ion Torrent technology can be applied for the identification of meat species in DNA mixtures.

A Next Generation Semiconductor Based Sequencing Approach for the Identification of Meat Species in DNA Mixtures

PubMed Central

Bertolini, Francesca; Ghionda, Marco Ciro; D’Alessandro, Enrico; Geraci, Claudia; Chiofalo, Vincenzo; Fontanesi, Luca

2015-01-01

The identification of the species of origin of meat and meat products is an important issue to prevent and detect frauds that might have economic, ethical and health implications. In this paper we evaluated the potential of the next generation semiconductor based sequencing technology (Ion Torrent Personal Genome Machine) for the identification of DNA from meat species (pig, horse, cattle, sheep, rabbit, chicken, turkey, pheasant, duck, goose and pigeon) as well as from human and rat in DNA mixtures through the sequencing of PCR products obtained from different couples of universal primers that amplify 12S and 16S rRNA mitochondrial DNA genes. Six libraries were produced including PCR products obtained separately from 13 species or from DNA mixtures containing DNA from all species or only avian or only mammalian species at equimolar concentration or at 1:10 or 1:50 ratios for pig and horse DNA. Sequencing obtained a total of 33,294,511 called nucleotides of which 29,109,688 with Q20 (87.43%) in a total of 215,944 reads. Different alignment algorithms were used to assign the species based on sequence data. Error rate calculated after confirmation of the obtained sequences by Sanger sequencing ranged from 0.0003 to 0.02 for the different species. Correlation about the number of reads per species between different libraries was high for mammalian species (0.97) and lower for avian species (0.70). PCR competition limited the efficiency of amplification and sequencing for avian species for some primer pairs. Detection of low level of pig and horse DNA was possible with reads obtained from different primer pairs. The sequencing of the products obtained from different universal PCR primers could be a useful strategy to overcome potential problems of amplification. Based on these results, the Ion Torrent technology can be applied for the identification of meat species in DNA mixtures. PMID:25923709

Comparison of DNA-based techniques for differentiation of production strains of ale and lager brewing yeast.

PubMed

Kopecká, J; Němec, M; Matoulková, D

2016-06-01

Brewing yeasts are classified into two species-Saccharomyces pastorianus and Saccharomyces cerevisiae. Most of the brewing yeast strains are natural interspecies hybrids typically polyploids and their identification is thus often difficult giving heterogenous results according to the method used. We performed genetic characterization of a set of the brewing yeast strains coming from several yeast culture collections by combination of various DNA-based techniques. The aim of this study was to select a method for species-specific identification of yeast and discrimination of yeast strains according to their technological classification. A group of 40 yeast strains were characterized using PCR-RFLP analysis of ITS-5·8S, NTS, HIS4 and COX2 genes, multiplex PCR, RAPD-PCR of genomic DNA, mtDNA-RFLP and electrophoretic karyotyping. Reliable differentiation of yeast to the species level was achieved by PCR-RFLP of HIS4 gene. Numerical analysis of the obtained RAPD-fingerprints and karyotype revealed species-specific clustering corresponding with the technological classification of the strains. Taxonomic position and partial hybrid nature of strains were verified by multiplex PCR. Differentiation among species using the PCR-RFLP of ITS-5·8S and NTS region was shown to be unreliable. Karyotyping and RFLP of mitochondrial DNA evinced small inaccuracies in strain categorization. PCR-RFLP of HIS4 gene and RAPD-PCR of genomic DNA are reliable and suitable methods for fast identification of yeast strains. RAPD-PCR with primer 21 is a fast and reliable method applicable for differentiation of brewing yeasts with only 35% similarity of fingerprint profile between the two main technological groups (ale and lager) of brewing strains. It was proved that PCR-RFLP method of HIS4 gene enables precise discrimination among three technologically important Saccharomyces species. Differentiation of brewing yeast to the strain level can be achieved using the RAPD-PCR technique. © 2016 The Society for Applied Microbiology.

Chimeric proteins for detection and quantitation of DNA mutations, DNA sequence variations, DNA damage and DNA mismatches

DOEpatents

McCutchen-Maloney, Sandra L.

2002-01-01

Chimeric proteins having both DNA mutation binding activity and nuclease activity are synthesized by recombinant technology. The proteins are of the general formula A-L-B and B-L-A where A is a peptide having DNA mutation binding activity, L is a linker and B is a peptide having nuclease activity. The chimeric proteins are useful for detection and identification of DNA sequence variations including DNA mutations (including DNA damage and mismatches) by binding to the DNA mutation and cutting the DNA once the DNA mutation is detected.

Sequencing of adenine in DNA by scanning tunneling microscopy

NASA Astrophysics Data System (ADS)

Tanaka, Hiroyuki; Taniguchi, Masateru

2017-08-01

The development of DNA sequencing technology utilizing the detection of a tunnel current is important for next-generation sequencer technologies based on single-molecule analysis technology. Using a scanning tunneling microscope, we previously reported that dI/dV measurements and dI/dV mapping revealed that the guanine base (purine base) of DNA adsorbed onto the Cu(111) surface has a characteristic peak at V s = -1.6 V. If, in addition to guanine, the other purine base of DNA, namely, adenine, can be distinguished, then by reading all the purine bases of each single strand of a DNA double helix, the entire base sequence of the original double helix can be determined due to the complementarity of the DNA base pair. Therefore, the ability to read adenine is important from the viewpoint of sequencing. Here, we report on the identification of adenine by STM topographic and spectroscopic measurements using a synthetic DNA oligomer and viral DNA.

Towards writing the encyclopaedia of life: an introduction to DNA barcoding

PubMed Central

Savolainen, Vincent; Cowan, Robyn S; Vogler, Alfried P; Roderick, George K; Lane, Richard

2005-01-01

An international consortium of major natural history museums, herbaria and other organizations has launched an ambitious project, the ‘Barcode of Life Initiative’, to promote a process enabling the rapid and inexpensive identification of the estimated 10 million species on Earth. DNA barcoding is a diagnostic technique in which short DNA sequence(s) can be used for species identification. The first international scientific conference on Barcoding of Life was held at the Natural History Museum in London in February 2005, and here we review the scientific challenges discussed during this conference and in previous publications. Although still controversial, the scientific benefits of DNA barcoding include: (i) enabling species identification, including any life stage or fragment, (ii) facilitating species discoveries based on cluster analyses of gene sequences (e.g. cox1=CO1, in animals), (iii) promoting development of handheld DNA sequencing technology that can be applied in the field for biodiversity inventories and (iv) providing insight into the diversity of life. PMID:16214739

Forensic DNA Banding Patterns: How to Simulate & Explain DNA Fingerprinting in a Classroom with No Budget

ERIC Educational Resources Information Center

Christensen, Doug

2013-01-01

Understanding how DNA banding patterns in a gel can aid in the conviction or exoneration of suspects and be utilized for positive identification of biological fathers in paternity cases can be intimidating. In reality, the logistics and technology used in such cases are rather straightforward. This exercise is designed for use in high school…

How-To-Do-It: Recombinant DNA Technology in the High School Biology Laboratory.

ERIC Educational Resources Information Center

Myers, Richard

1988-01-01

Describes a basic biotechnology investigation that includes restriction and ligation of plasmid DNA, transformation of bacteria and cloning of these bacterial cells. Discusses laboratory procedures and another activity in the identification of unknown plasmids by studying agarose gel electrophoresis photographs. (CW)

Comparison of sequencing-based methods to profile DNA methylation and identification of monoallelic epigenetic modifications

USDA-ARS?s Scientific Manuscript database

Analysis of DNA methylation patterns relies increasingly on sequencing-based profiling methods. The four most frequently used sequencing-based technologies are the bisulfite-based methods MethylC-seq and reduced representation bisulfite sequencing (RRBS), and the enrichment-based techniques methylat...

Predictive Medicine: Recombinant DNA Technology and Adult-Onset Genetic Disorders

PubMed Central

Hayden, Michael

1988-01-01

Genetic factors are of great importance in common adult-onset disorders such as atherosclerosis, cancer, and neuro-degenerative diseases. Advances in DNA technology now allow identification of persons at high-risk of developing some of these diseases. This advance is leading to predictive medicine. In some genetic disorders, such as those leading to atherosclerosis and cancer, identification of high-risk individuals allows intervention which alters the natural history of the disorder. In other diseases, for which there is no treatment, such as Huntington's disease, the application of this technology provides information that relieves uncertainty and may affect quality of life, but does not alter the course of the illness. General implementation of predictive testing programs awaits the results of pilot projects, which will demonstrate the needs, appropriate levels of support, and guidelines for delivery of such testing. PMID:21253100

DNA marker technology for wildlife conservation

PubMed Central

Arif, Ibrahim A.; Khan, Haseeb A.; Bahkali, Ali H.; Al Homaidan, Ali A.; Al Farhan, Ahmad H.; Al Sadoon, Mohammad; Shobrak, Mohammad

2011-01-01

Use of molecular markers for identification of protected species offers a greater promise in the field of conservation biology. The information on genetic diversity of wildlife is necessary to ascertain the genetically deteriorated populations so that better management plans can be established for their conservation. Accurate classification of these threatened species allows understanding of the species biology and identification of distinct populations that should be managed with utmost care. Molecular markers are versatile tools for identification of populations with genetic crisis by comparing genetic diversities that in turn helps to resolve taxonomic uncertainties and to establish management units within species. The genetic marker analysis also provides sensitive and useful tools for prevention of illegal hunting and poaching and for more effective implementation of the laws for protection of the endangered species. This review summarizes various tools of DNA markers technology for application in molecular diversity analysis with special emphasis on wildlife conservation. PMID:23961128

A Glance at Microsatellite Motifs from 454 Sequencing Reads of Watermelon Genomic DNA

USDA-ARS?s Scientific Manuscript database

A single 454 (Life Sciences Sequencing Technology) run of Charleston Gray watermelon (Citrullus lanatus var. lanatus) genomic DNA was performed and sequence data were assembled. A large scale identification of simple sequence repeat (SSR) was performed and SSR sequence data were used for the develo...

Cell-Based Selection Expands the Utility of DNA-Encoded Small-Molecule Library Technology to Cell Surface Drug Targets: Identification of Novel Antagonists of the NK3 Tachykinin Receptor.

PubMed

Wu, Zining; Graybill, Todd L; Zeng, Xin; Platchek, Michael; Zhang, Jean; Bodmer, Vera Q; Wisnoski, David D; Deng, Jianghe; Coppo, Frank T; Yao, Gang; Tamburino, Alex; Scavello, Genaro; Franklin, G Joseph; Mataruse, Sibongile; Bedard, Katie L; Ding, Yun; Chai, Jing; Summerfield, Jennifer; Centrella, Paolo A; Messer, Jeffrey A; Pope, Andrew J; Israel, David I

2015-12-14

DNA-encoded small-molecule library technology has recently emerged as a new paradigm for identifying ligands against drug targets. To date, this technology has been used with soluble protein targets that are produced and used in a purified state. Here, we describe a cell-based method for identifying small-molecule ligands from DNA-encoded libraries against integral membrane protein targets. We use this method to identify novel, potent, and specific inhibitors of NK3, a member of the tachykinin family of G-protein coupled receptors (GPCRs). The method is simple and broadly applicable to other GPCRs and integral membrane proteins. We have extended the application of DNA-encoded library technology to membrane-associated targets and demonstrate the feasibility of selecting DNA-tagged, small-molecule ligands from complex combinatorial libraries against targets in a heterogeneous milieu, such as the surface of a cell.

Potential concerns with analytical Methods Used for the detection of Batrachochytrium salamandrivorans from archived DNA of amphibian swab samples, Oregon, USA

USGS Publications Warehouse

Iwanowicz, Deborah; Olson, Deanna H.; Adams, Michael J.; Adams, Cynthia; Anderson, Chauncey; Blaustein, Andrew R; Densmore, Christine L.; Figiel, Chester; Schill, William B.; Chestnut, Tara

2017-01-01

Taxonomic identification of pollen has historically been accomplished via light microscopy but requires specialized knowledge and reference collections, particularly when identification to lower taxonomic levels is necessary. Recently, next-generation sequencing technology has been used as a cost-effective alternative for identifying bee-collected pollen; however, this novel approach has not been tested on a spatially or temporally robust number of pollen samples. Here, we compare pollen identification results derived from light microscopy and DNA sequencing techniques with samples collected from honey bee colonies embedded within a gradient of intensive agricultural landscapes in the Northern Great Plains throughout the 2010–2011 growing seasons. We demonstrate that at all taxonomic levels, DNA sequencing was able to discern a greater number of taxa, and was particularly useful for the identification of infrequently detected species. Importantly, substantial phenological overlap did occur for commonly detected taxa using either technique, suggesting that DNA sequencing is an appropriate, and enhancing, substitutive technique for accurately capturing the breadth of bee-collected species of pollen present across agricultural landscapes. We also show that honey bees located in high and low intensity agricultural settings forage on dissimilar plants, though with overlap of the most abundantly collected pollen taxa. We highlight practical applications of utilizing sequencing technology, including addressing ecological issues surrounding land use, climate change, importance of taxa relative to abundance, and evaluating the impact of conservation program habitat enhancement efforts.

Short-read, high-throughput sequencing technology for STR genotyping

PubMed Central

Bornman, Daniel M.; Hester, Mark E.; Schuetter, Jared M.; Kasoji, Manjula D.; Minard-Smith, Angela; Barden, Curt A.; Nelson, Scott C.; Godbold, Gene D.; Baker, Christine H.; Yang, Boyu; Walther, Jacquelyn E.; Tornes, Ivan E.; Yan, Pearlly S.; Rodriguez, Benjamin; Bundschuh, Ralf; Dickens, Michael L.; Young, Brian A.; Faith, Seth A.

2013-01-01

DNA-based methods for human identification principally rely upon genotyping of short tandem repeat (STR) loci. Electrophoretic-based techniques for variable-length classification of STRs are universally utilized, but are limited in that they have relatively low throughput and do not yield nucleotide sequence information. High-throughput sequencing technology may provide a more powerful instrument for human identification, but is not currently validated for forensic casework. Here, we present a systematic method to perform high-throughput genotyping analysis of the Combined DNA Index System (CODIS) STR loci using short-read (150 bp) massively parallel sequencing technology. Open source reference alignment tools were optimized to evaluate PCR-amplified STR loci using a custom designed STR genome reference. Evaluation of this approach demonstrated that the 13 CODIS STR loci and amelogenin (AMEL) locus could be accurately called from individual and mixture samples. Sensitivity analysis showed that as few as 18,500 reads, aligned to an in silico referenced genome, were required to genotype an individual (>99% confidence) for the CODIS loci. The power of this technology was further demonstrated by identification of variant alleles containing single nucleotide polymorphisms (SNPs) and the development of quantitative measurements (reads) for resolving mixed samples. PMID:25621315

A Review on the Applications of Next Generation Sequencing Technologies as Applied to Food-Related Microbiome Studies

PubMed Central

Cao, Yu; Fanning, Séamus; Proos, Sinéad; Jordan, Kieran; Srikumar, Shabarinath

2017-01-01

The development of next generation sequencing (NGS) techniques has enabled researchers to study and understand the world of microorganisms from broader and deeper perspectives. The contemporary advances in DNA sequencing technologies have not only enabled finer characterization of bacterial genomes but also provided deeper taxonomic identification of complex microbiomes which in its genomic essence is the combined genetic material of the microorganisms inhabiting an environment, whether the environment be a particular body econiche (e.g., human intestinal contents) or a food manufacturing facility econiche (e.g., floor drain). To date, 16S rDNA sequencing, metagenomics and metatranscriptomics are the three basic sequencing strategies used in the taxonomic identification and characterization of food-related microbiomes. These sequencing strategies have used different NGS platforms for DNA and RNA sequence identification. Traditionally, 16S rDNA sequencing has played a key role in understanding the taxonomic composition of a food-related microbiome. Recently, metagenomic approaches have resulted in improved understanding of a microbiome by providing a species-level/strain-level characterization. Further, metatranscriptomic approaches have contributed to the functional characterization of the complex interactions between different microbial communities within a single microbiome. Many studies have highlighted the use of NGS techniques in investigating the microbiome of fermented foods. However, the utilization of NGS techniques in studying the microbiome of non-fermented foods are limited. This review provides a brief overview of the advances in DNA sequencing chemistries as the technology progressed from first, next and third generations and highlights how NGS provided a deeper understanding of food-related microbiomes with special focus on non-fermented foods. PMID:29033905

Current genetic methodologies in the identification of disaster victims and in forensic analysis.

PubMed

Ziętkiewicz, Ewa; Witt, Magdalena; Daca, Patrycja; Zebracka-Gala, Jadwiga; Goniewicz, Mariusz; Jarząb, Barbara; Witt, Michał

2012-02-01

This review presents the basic problems and currently available molecular techniques used for genetic profiling in disaster victim identification (DVI). The environmental conditions of a mass disaster often result in severe fragmentation, decomposition and intermixing of the remains of victims. In such cases, traditional identification based on the anthropological and physical characteristics of the victims is frequently inconclusive. This is the reason why DNA profiling became the gold standard for victim identification in mass-casualty incidents (MCIs) or any forensic cases where human remains are highly fragmented and/or degraded beyond recognition. The review provides general information about the sources of genetic material for DNA profiling, the genetic markers routinely used during genetic profiling (STR markers, mtDNA and single-nucleotide polymorphisms [SNP]) and the basic statistical approaches used in DNA-based disaster victim identification. Automated technological platforms that allow the simultaneous analysis of a multitude of genetic markers used in genetic identification (oligonucleotide microarray techniques and next-generation sequencing) are also presented. Forensic and population databases containing information on human variability, routinely used for statistical analyses, are discussed. The final part of this review is focused on recent developments, which offer particularly promising tools for forensic applications (mRNA analysis, transcriptome variation in individuals/populations and genetic profiling of specific cells separated from mixtures).

Review and future prospects for DNA barcoding methods in forensic palynology.

PubMed

Bell, Karen L; Burgess, Kevin S; Okamoto, Kazufusa C; Aranda, Roman; Brosi, Berry J

2016-03-01

Pollen can be a critical forensic marker in cases where determining geographic origin is important, including investigative leads, missing persons cases, and intelligence applications. However, its use has previously been limited by the need for a high level of specialization by expert palynologists, slow speeds of identification, and relatively poor taxonomic resolution (typically to the plant family or genus level). By contrast, identification of pollen through DNA barcoding has the potential to overcome all three of these limitations, and it may seem surprising that the method has not been widely implemented. Despite what might seem a straightforward application of DNA barcoding to pollen, there are technical issues that have delayed progress. However, recent developments of standard methods for DNA barcoding of pollen, along with improvements in high-throughput sequencing technology, have overcome most of these technical issues. Based on these recent methodological developments in pollen DNA barcoding, we believe that now is the time to start applying these techniques in forensic palynology. In this article, we discuss the potential for these methods, and outline directions for future research to further improve on the technology and increase its applicability to a broader range of situations. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Escherichia Coli--Key to Modern Genetics.

ERIC Educational Resources Information Center

Bregegere, Francois

1982-01-01

Mid-nineteenth century work by Mendel on plant hybrids and by Pasteur on fermentation gave birth by way of bacterial genetics to modern-day molecular biology. The bacterium Escherichia Coli has occupied a key position in genetic studies leading from early gene identification with DNA to current genetic engineering using recombinant DNA technology.…

The changing epitome of species identification – DNA barcoding

PubMed Central

Ajmal Ali, M.; Gyulai, Gábor; Hidvégi, Norbert; Kerti, Balázs; Al Hemaid, Fahad M.A.; Pandey, Arun K.; Lee, Joongku

2014-01-01

The discipline taxonomy (the science of naming and classifying organisms, the original bioinformatics and a basis for all biology) is fundamentally important in ensuring the quality of life of future human generation on the earth; yet over the past few decades, the teaching and research funding in taxonomy have declined because of its classical way of practice which lead the discipline many a times to a subject of opinion, and this ultimately gave birth to several problems and challenges, and therefore the taxonomist became an endangered race in the era of genomics. Now taxonomy suddenly became fashionable again due to revolutionary approaches in taxonomy called DNA barcoding (a novel technology to provide rapid, accurate, and automated species identifications using short orthologous DNA sequences). In DNA barcoding, complete data set can be obtained from a single specimen irrespective to morphological or life stage characters. The core idea of DNA barcoding is based on the fact that the highly conserved stretches of DNA, either coding or non coding regions, vary at very minor degree during the evolution within the species. Sequences suggested to be useful in DNA barcoding include cytoplasmic mitochondrial DNA (e.g. cox1) and chloroplast DNA (e.g. rbcL, trnL-F, matK, ndhF, and atpB rbcL), and nuclear DNA (ITS, and house keeping genes e.g. gapdh). The plant DNA barcoding is now transitioning the epitome of species identification; and thus, ultimately helping in the molecularization of taxonomy, a need of the hour. The ‘DNA barcodes’ show promise in providing a practical, standardized, species-level identification tool that can be used for biodiversity assessment, life history and ecological studies, forensic analysis, and many more. PMID:24955007

Disaster victim investigation recommendations from two simulated mass disaster scenarios utilized for user acceptance testing CODIS 6.0.

PubMed

Bradford, Laurie; Heal, Jennifer; Anderson, Jeff; Faragher, Nichole; Duval, Kristin; Lalonde, Sylvain

2011-08-01

Members of the National DNA Data Bank (NDDB) of Canada designed and searched two simulated mass disaster (MD) scenarios for User Acceptance Testing (UAT) of the Combined DNA Index System (CODIS) 6.0, developed by the Federal Bureau of Investigation (FBI) and the US Department of Justice. A simulated airplane MD and inland Tsunami MD were designed representing a closed and open environment respectively. An in-house software program was written to randomly generate DNA profiles from a mock Caucasian population database. As part of the UAT, these two MDs were searched separately using CODIS 6.0. The new options available for identity and pedigree searching in addition to the inclusion of mitochondrial DNA (mtDNA) and Y-STR (short tandem repeat) information in CODIS 6.0, led to rapid identification of all victims. A Joint Pedigree Likelihood Ratio (JPLR) was calculated from the pedigree searches and ranks were stored in Rank Manager providing confidence to the user in assigning an Unidentified Human Remain (UHR) to a pedigree tree. Analyses of the results indicated that primary relatives were more useful in Disaster Victim Identification (DVI) compared to secondary or tertiary relatives and that inclusion of mtDNA and/or Y-STR technologies helped to link family units together as shown by the software searches. It is recommended that UHRs have as many informative loci possible to assist with their identification. CODIS 6.0 is a valuable technological tool for rapidly and confidently identifying victims of mass disasters. Crown Copyright © 2010. Published by Elsevier Ireland Ltd. All rights reserved.

DNA evidence: current perspective and future challenges in India.

PubMed

Verma, Sunil K; Goswami, Gajendra K

2014-08-01

Since the discovery of DNA fingerprinting technology in 1985 it has been used extensively as evidence in the court of law world-wide to establish the individual identity both in civil and criminal matters. In India, the first case of parentage dispute solved by the use of DNA fingerprinting technology was in 1989. Since then till date, the DNA technology has been used not only to resolve the cases of paternity and maternity disputes, but also for the establishment of individual identity in various criminal cases and for wildlife forensic identification. Since last half a decade, India is exercising to enact legislation on the use of DNA in the judicial realm and the draft 'Human DNA Bill-2012' is pending in the parliament. Largely, the promoters of forensic DNA testing have anticipated that DNA tests are nearly infallible and DNA technology could be the greatest single advance step in search for truth, conviction of the perpetrator, and acquittal of the innocent. The current article provides a comprehensive review on the status of DNA testing in India and elucidates the consequences of the admissibility of DNA as 'evidence' in the judicial dominion. In this backdrop of civil and criminal laws and changing ethical and societal attitudes, it is concluded that the DNA legislation in India and world-wide needs to be designed with utmost care. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Isolation and identification of female DNA on postcoital penile swabs.

PubMed

Cina, S J; Collins, K A; Pettenati, M J; Fitts, M

2000-06-01

After sexual assault, cells originating from the assailant may be recovered from the victim. Through polymerase chain reaction (PCR)-based technology, positive scientific identification of the assailant may be made from these cells. Described is a prospective study describing a method for positively identifying cells from a female sex partner obtained from postcoital swabs of the penis of the male sex partner. Swabs were taken from the penis of a man at 1- to 24-hour intervals after coitus. DNA was isolated from each swab through standard organic extraction methods. The presence of female DNA was detected using the gender-specific amelogenin marker. Extracted DNA was amplified for eight different genetic loci using the Promega PowerPlex kit (Promega) and Amplitaq Gold (Perkin Elmer). Amplified samples were electrophoresed on precast sequencing gels (Hitachi) and were analyzed fluorescently using Hitachi's FMBIO 2 fluorescent scanner and software. Each sample obtained from a penile swab or condom was compared to male and female buccal controls. Female DNA was isolated from all postcoital penile swabs as determined by exclusive amplification of the X-chromosome specific 212 base pair amelogenin marker. In all cases, scientific identification of the female DNA from the swabs was determined by coamplification of eight STR loci (PowerPlex) and was compared to female and male control profiles. Cells shed from a female victim during sexual intercourse can be retrieved from the penis of a male offender after sexual intercourse during a 1- to 24-hour postcoital interval. DNA can be extracted from these cells and can be used to scientifically identify the female sexual participant through PCR-based technology. It is suggested that penile swabs be taken from alleged perpetrators of sexual assaults to associate them with a female victim.

Improvement and automation of a real-time PCR assay for vaginal fluids.

PubMed

De Vittori, E; Giampaoli, S; Barni, F; Baldi, M; Berti, A; Ripani, L; Romano Spica, V

2016-05-01

The identification of vaginal fluids is crucial in forensic science. Several molecular protocols based on PCR amplification of mfDNA (microflora DNA) specific for vaginal bacteria are now available. Unfortunately mfDNA extraction and PCR reactions require manual optimization of several steps. The aim of present study was the verification of a partial automatization of vaginal fluids identification through two instruments widely diffused in forensic laboratories: EZ1 Advanced robot and Rotor Gene Q 5Plex HRM. Moreover, taking advantage of 5-plex thermocycler technology, the ForFluid kit performances were improved by expanding the mfDNA characterization panel with a new bacterial target for vaginal fluids and with an internal positive control (IPC) to monitor PCR inhibition. Results underlined the feasibility of a semi-automated extraction of mfDNA using a BioRobot and demonstrated the analytical improvements of the kit. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

[Integrated DNA barcoding database for identifying Chinese animal medicine].

PubMed

Shi, Lin-Chun; Yao, Hui; Xie, Li-Fang; Zhu, Ying-Jie; Song, Jing-Yuan; Zhang, Hui; Chen, Shi-Lin

2014-06-01

In order to construct an integrated DNA barcoding database for identifying Chinese animal medicine, the authors and their cooperators have completed a lot of researches for identifying Chinese animal medicines using DNA barcoding technology. Sequences from GenBank have been analyzed simultaneously. Three different methods, BLAST, barcoding gap and Tree building, have been used to confirm the reliabilities of barcode records in the database. The integrated DNA barcoding database for identifying Chinese animal medicine has been constructed using three different parts: specimen, sequence and literature information. This database contained about 800 animal medicines and the adulterants and closely related species. Unknown specimens can be identified by pasting their sequence record into the window on the ID page of species identification system for traditional Chinese medicine (www. tcmbarcode. cn). The integrated DNA barcoding database for identifying Chinese animal medicine is significantly important for animal species identification, rare and endangered species conservation and sustainable utilization of animal resources.

DNA-based identification of invasive alien species in relation to Canadian federal policy and law, and the basis of rapid-response management.

PubMed

Thomas, Vernon G; Hanner, Robert H; Borisenko, Alex V

2016-11-01

Managing invasive alien species in Canada requires reliable taxonomic identification as the basis of rapid-response management. This can be challenging, especially when organisms are small and lack morphological diagnostic features. DNA-based techniques, such as DNA barcoding, offer a reliable, rapid, and inexpensive toolkit for taxonomic identification of individual or bulk samples, forensic remains, and even environmental DNA. Well suited for this requirement, they could be more broadly deployed and incorporated into the operating policy and practices of Canadian federal departments and should be authorized under these agencies' articles of law. These include Fisheries and Oceans Canada, Canadian Food Inspection Agency, Transport Canada, Environment Canada, Parks Canada, and Health Canada. These efforts should be harmonized with the appropriate provisions of provincial jurisdictions, for example, the Ontario Invasive Species Act. This approach necessitates that a network of accredited, certified laboratories exists, and that updated DNA reference libraries are readily accessible. Harmonizing this approach is vital among Canadian federal agencies, and between the federal and provincial levels of government. Canadian policy and law must also be harmonized with that of the USA when detecting, and responding to, invasive species in contiguous lands and waters. Creating capacity in legislation for use of DNA-based identifications brings the authority to fund, train, deploy, and certify staff, and to refine further developments in this molecular technology.

Transcriptionally active PCR for antigen identification and vaccine development: in vitro genome-wide screening and in vivo immunogenicity

PubMed Central

Regis, David P.; Dobaño, Carlota; Quiñones-Olson, Paola; Liang, Xiaowu; Graber, Norma L.; Stefaniak, Maureen E.; Campo, Joseph J.; Carucci, Daniel J.; Roth, David A.; He, Huaping; Felgner, Philip L.; Doolan, Denise L.

2009-01-01

We have evaluated a technology called Transcriptionally Active PCR (TAP) for high throughput identification and prioritization of novel target antigens from genomic sequence data using the Plasmodium parasite, the causative agent of malaria, as a model. First, we adapted the TAP technology for the highly AT-rich Plasmodium genome, using well-characterized P. falciparum and P. yoelii antigens and a small panel of uncharacterized open reading frames from the P. falciparum genome sequence database. We demonstrated that TAP fragments encoding six well-characterized P. falciparum antigens and five well-characterized P. yoelii antigens could be amplified in an equivalent manner from both plasmid DNA and genomic DNA templates, and that uncharacterized open reading frames could also be amplified from genomic DNA template. Second, we showed that the in vitro expression of the TAP fragments was equivalent or superior to that of supercoiled plasmid DNA encoding the same antigen. Third, we evaluated the in vivo immunogenicity of TAP fragments encoding a subset of the model P. falciparum and P. yoelii antigens. We found that antigen-specific antibody and cellular immune responses induced by the TAP fragments in mice were equivalent or superior to those induced by the corresponding plasmid DNA vaccines. Finally, we developed and demonstrated proof-of-principle for an in vitro humoral immunoscreening assay for down-selection of novel target antigens. These data support the potential of a TAP approach for rapid high throughput functional screening and identification of potential candidate vaccine antigens from genomic sequence data. PMID:18164079

Transcriptionally active PCR for antigen identification and vaccine development: in vitro genome-wide screening and in vivo immunogenicity.

PubMed

Regis, David P; Dobaño, Carlota; Quiñones-Olson, Paola; Liang, Xiaowu; Graber, Norma L; Stefaniak, Maureen E; Campo, Joseph J; Carucci, Daniel J; Roth, David A; He, Huaping; Felgner, Philip L; Doolan, Denise L

2008-03-01

We have evaluated a technology called transcriptionally active PCR (TAP) for high throughput identification and prioritization of novel target antigens from genomic sequence data using the Plasmodium parasite, the causative agent of malaria, as a model. First, we adapted the TAP technology for the highly AT-rich Plasmodium genome, using well-characterized P. falciparum and P. yoelii antigens and a small panel of uncharacterized open reading frames from the P. falciparum genome sequence database. We demonstrated that TAP fragments encoding six well-characterized P. falciparum antigens and five well-characterized P. yoelii antigens could be amplified in an equivalent manner from both plasmid DNA and genomic DNA templates, and that uncharacterized open reading frames could also be amplified from genomic DNA template. Second, we showed that the in vitro expression of the TAP fragments was equivalent or superior to that of supercoiled plasmid DNA encoding the same antigen. Third, we evaluated the in vivo immunogenicity of TAP fragments encoding a subset of the model P. falciparum and P. yoelii antigens. We found that antigen-specific antibody and cellular immune responses induced by the TAP fragments in mice were equivalent or superior to those induced by the corresponding plasmid DNA vaccines. Finally, we developed and demonstrated proof-of-principle for an in vitro humoral immunoscreening assay for down-selection of novel target antigens. These data support the potential of a TAP approach for rapid high throughput functional screening and identification of potential candidate vaccine antigens from genomic sequence data.

European securitization and biometric identification: the uses of genetic profiling.

PubMed

Johnson, Paul; Williams, Robin

2007-01-01

The recent loss of confidence in textual and verbal methods for validating the identity claims of individual subjects has resulted in growing interest in the use of biometric technologies to establish corporeal uniqueness. Once established, this foundational certainty allows changing biographies and shifting category memberships to be anchored to unchanging bodily surfaces, forms or features. One significant source for this growth has been the "securitization" agendas of nation states that attempt the greater control and monitoring of population movement across geographical borders. Among the wide variety of available biometric schemes, DNA profiling is regarded as a key method for discerning and recording embodied individuality. This paper discusses the current limitations on the use of DNA profiling in civil identification practices and speculates on future uses of the technology with regard to its interoperability with other biometric databasing systems.

Mitochondrial sequence analysis for forensic identification using pyrosequencing technology.

PubMed

Andréasson, H; Asp, A; Alderborn, A; Gyllensten, U; Allen, M

2002-01-01

Over recent years, requests for mtDNA analysis in the field of forensic medicine have notably increased, and the results of such analyses have proved to be very useful in forensic cases where nuclear DNA analysis cannot be performed. Traditionally, mtDNA has been analyzed by DNA sequencing of the two hypervariable regions, HVI and HVII, in the D-loop. DNA sequence analysis using the conventional Sanger sequencing is very robust but time consuming and labor intensive. By contrast, mtDNA analysis based on the pyrosequencing technology provides fast and accurate results from the human mtDNA present in many types of evidence materials in forensic casework. The assay has been developed to determine polymorphic sites in the mitochondrial D-loop as well as the coding region to further increase the discrimination power of mtDNA analysis. The pyrosequencing technology for analysis of mtDNA polymorphisms has been tested with regard to sensitivity, reproducibility, and success rate when applied to control samples and actual casework materials. The results show that the method is very accurate and sensitive; the results are easily interpreted and provide a high success rate on casework samples. The panel of pyrosequencing reactions for the mtDNA polymorphisms were chosen to result in an optimal discrimination power in relation to the number of bases determined.

[Identification and analysis of Corydalis boweri, Meconopsis horridula and their close related species of the same genus by using ITS2 DNA barcode].

PubMed

Dou, Rong-kun; Bi, Zhen-fei; Bai, Rui-xue; Ren, Yao-yao; Tan, Rui; Song, Liang-ke; Li, Di-qiang; Mao, Can-quan

2015-04-01

The study is aimed to ensure the quality and safety of medicinal plants by using ITS2 DNA barcode technology to identify Corydalis boweri, Meconopsis horridula and their close related species. The DNA of 13 herb samples including C. boweri and M. horridula from Lhasa of Tibet was extracted, ITS PCR were amplified and sequenced. Both assembled and web downloaded 71 ITS2 sequences were removed of 5. 8S and 28S. Multiple sequence alignment was completed and the intraspecific and interspecific genetic distances were calculated by MEGA 5.0, while the neighbor-joining phylogenetic trees were constructed. We also predicted the ITS2 secondary structure of C. boweri, M. horridula and their close related species. The results showed that ITS2 as DNA barcode was able to identify C. boweri, M. horridula as well as well as their close related species effectively. The established based on ITS2 barcode method provides the regular and safe detection technology for identification of C. boweri, M. horridula and their close related species, adulterants and counterfeits, in order to ensure their quality control, safe medication, reasonable development and utilization.

Chemocoding as an identification tool where morphological- and DNA-based methods fall short: Inga as a case study.

PubMed

Endara, María-José; Coley, Phyllis D; Wiggins, Natasha L; Forrister, Dale L; Younkin, Gordon C; Nicholls, James A; Pennington, R Toby; Dexter, Kyle G; Kidner, Catherine A; Stone, Graham N; Kursar, Thomas A

2018-04-01

The need for species identification and taxonomic discovery has led to the development of innovative technologies for large-scale plant identification. DNA barcoding has been useful, but fails to distinguish among many species in species-rich plant genera, particularly in tropical regions. Here, we show that chemical fingerprinting, or 'chemocoding', has great potential for plant identification in challenging tropical biomes. Using untargeted metabolomics in combination with multivariate analysis, we constructed species-level fingerprints, which we define as chemocoding. We evaluated the utility of chemocoding with species that were defined morphologically and subject to next-generation DNA sequencing in the diverse and recently radiated neotropical genus Inga (Leguminosae), both at single study sites and across broad geographic scales. Our results show that chemocoding is a robust method for distinguishing morphologically similar species at a single site and for identifying widespread species across continental-scale ranges. Given that species are the fundamental unit of analysis for conservation and biodiversity research, the development of accurate identification methods is essential. We suggest that chemocoding will be a valuable additional source of data for a quick identification of plants, especially for groups where other methods fall short. © 2018 The Authors. New Phytologist © 2018 New Phytologist Trust.

A comparison of honey bee-collected pollen from working agricultural lands using light microscopy and ITS metabarcoding

USGS Publications Warehouse

Smart, Matthew; Cornman, Robert S.; Iwanowicz, Deborah; McDermott-Kubeczko, Margaret; Pettis, Jeff S; Spivak, Marla S; Otto, Clint R.

2017-01-01

Taxonomic identification of pollen has historically been accomplished via light microscopy but requires specialized knowledge and reference collections, particularly when identification to lower taxonomic levels is necessary. Recently, next-generation sequencing technology has been used as a cost-effective alternative for identifying bee-collected pollen; however, this novel approach has not been tested on a spatially or temporally robust number of pollen samples. Here, we compare pollen identification results derived from light microscopy and DNA sequencing techniques with samples collected from honey bee colonies embedded within a gradient of intensive agricultural landscapes in the Northern Great Plains throughout the 2010–2011 growing seasons. We demonstrate that at all taxonomic levels, DNA sequencing was able to discern a greater number of taxa, and was particularly useful for the identification of infrequently detected species. Importantly, substantial phenological overlap did occur for commonly detected taxa using either technique, suggesting that DNA sequencing is an appropriate, and enhancing, substitutive technique for accurately capturing the breadth of bee-collected species of pollen present across agricultural landscapes. We also show that honey bees located in high and low intensity agricultural settings forage on dissimilar plants, though with overlap of the most abundantly collected pollen taxa. We highlight practical applications of utilizing sequencing technology, including addressing ecological issues surrounding land use, climate change, importance of taxa relative to abundance, and evaluating the impact of conservation program habitat enhancement efforts.

Noninvasive Prenatal Screening for Genetic Diseases Using Massively Parallel Sequencing of Maternal Plasma DNA

PubMed Central

Chitty, Lyn S.; Lo, Y. M. Dennis

2015-01-01

The identification of cell-free fetal DNA (cffDNA) in maternal plasma in 1997 heralded the most significant change in obstetric care for decades, with the advent of safer screening and diagnosis based on analysis of maternal blood. Here, we describe how the technological advances offered by next-generation sequencing have allowed for the development of a highly sensitive screening test for aneuploidies as well as definitive prenatal molecular diagnosis for some monogenic disorders. PMID:26187875

Medico-legal investigations of the Airbus, A320 crash upon Mount Ste-Odile, France.

PubMed

Ludes, B; Tracqui, A; Pfitzinger, H; Kintz, P; Levy, F; Disteldorf, M; Hutt, J M; Kaess, B; Haag, R; Memheld, B

1994-09-01

The authors present the medico-legal investigations and identification after the aircrash of the Airbus A320 upon the Mount Sainte-Odile (France). The identification team comprising investigators from the gendarmerie, forensic pathologists, odontologists, and scientists of the Institute from Legal Medecine rapidly retrieved and identified 85 of the 87 victims, with 17 being identified through DNA typing, three through fingerprints and the remaining through dental records and specific physical or X-ray findings. Full autopsies were performed on all fatalities to determine patterns of injury and cause of death. Results lead us to point out the importance of a multidisciplinary team of forensic practitioners especially trained for managing medico-legal investigation in mass disaster and the ability of DNA technology to solve complex identification problems.

Enhancer Linking by Methylation/Expression Relationships (ELMER) | Informatics Technology for Cancer Research (ITCR)

Cancer.gov

R tool for analysis of DNA methylation and expression datasets. Integrative analysis allows reconstruction of in vivo transcription factor networks altered in cancer along with identification of the underlying gene regulatory sequences.

Ancient DNA in historical parchments - identifying a procedure for extraction and amplification of genetic material.

PubMed

Lech, T

2016-05-06

Historical parchments in the form of documents, manuscripts, books, or letters, make up a large portion of cultural heritage collections. Their priceless historical value is associated with not only their content, but also the information hidden in the DNA deposited on them. Analyses of ancient DNA (aDNA) retrieved from parchments can be used in various investigations, including, but not limited to, studying their authentication, tracing the development of the culture, diplomacy, and technology, as well as obtaining information on the usage and domestication of animals. This article proposes and verifies a procedure for aDNA recovery from historical parchments and its appropriate preparation for further analyses. This study involved experimental selection of an aDNA extraction method with the highest efficiency and quality of extracted genetic material, from among the multi-stage phenol-chloroform extraction methods, and the modern, column-based techniques that use selective DNA-binding membranes. Moreover, current techniques to amplify entire genetic material were questioned, and the possibility of using mitochondrial DNA for species identification was analyzed. The usefulness of the proposed procedure was successfully confirmed in identification tests of historical parchments dating back to the 13-16th century AD.

Sequencing to Station in 12 Months (Targeting Orbital 5 Launch, March 30th)

NASA Technical Reports Server (NTRS)

Smith, David J.; Burton, Aaron Steven

2015-01-01

The Biomolecule Sequencer is a Commercial Off-The-Shelf device developed by Oxford Nanopore Technologies and implements a method of DNA sequencing unlike any other current sequencers. The device measures changes in electrical current through a nanopore depending on the sequence of the DNA strand that is passing through it. Since the technology is built on nanometer-scale ion pores, the hardware itself is exceptionally small (3 x 1 x 58 inches), lightweight (less than 120 grams with USB cable), and powered only by a USB connection. The sequencing device is permanent, while the flow cells, to which the samples are added, are periodically replaced. The goal of our upcoming technology demonstration on ISS is to provide evidence that DNA sequencing in space is possible, which holds the exciting potential to enable the identification of microorganisms, monitor changes in microbes and humans in response to spaceflight, and possibly aid in the detection of DNA-based life elsewhere in the universe.

Potential of DNA barcoding for detecting quarantine fungi.

PubMed

Gao, Ruifang; Zhang, Guiming

2013-11-01

The detection of live quarantine pathogenic fungi plays an important role in guaranteeing regional biological safety. DNA barcoding, an emerging species identification technology, holds promise for the reliable, quick, and accurate detection of quarantine fungi. International standards for phytosanitary guidelines are urgently needed. The varieties of quarantine fungi listed for seven countries/regions, the currently applied detection methods, and the status of DNA barcoding for detecting quarantine fungi are summarized in this study. Two approaches have been proposed to apply DNA barcoding to fungal quarantine procedures: (i) to verify the reliability of known internal transcribed spacer (ITS)/cytochrome c oxidase subunit I (COI) data for use as barcodes, and (ii) to determine other barcodes for species that cannot be identified by ITS/COI. As a unique, standardizable, and universal species identification tool, DNA barcoding offers great potential for integrating detection methods used in various countries/regions and establishing international detection standards based on accepted DNA barcodes. Through international collaboration, interstate disputes can be eased and many problems related to routine quarantine detection methods can be solved for global trade.

Labeling milk along its production chain with DNA encapsulated in silica.

PubMed

Bloch, Madeleine S; Paunescu, Daniela; Stoessel, Philipp R; Mora, Carlos A; Stark, Wendelin J; Grass, Robert N

2014-10-29

The capability of tracing a food product along its production chain is important to ensure food safety and product authenticity. For this purpose and as an application example, recently developed Silica Particles with Encapsulated DNA (SPED) were added to milk at concentrations ranging from 0.1 to 100 ppb (μg per kg milk). Thereby the milk, as well as the milk-derived products yoghurt and cheese, could be uniquely labeled with a DNA tag. Procedures for the extraction of the DNA tags from the food matrixes were elaborated and allowed identification and quantification of previously marked products by quantitative polymerase chain reaction (qPCR) with detection limits below 1 ppb of added particles. The applicability of synthetic as well as naturally occurring DNA sequences was shown. The usage of approved food additives as DNA carrier (silica = E551) and the low cost of the technology (<0.1 USD per ton of milk labeled with 10 ppb of SPED) display the technical applicability of this food labeling technology.

PanGEA: identification of allele specific gene expression using the 454 technology.

PubMed

Kofler, Robert; Teixeira Torres, Tatiana; Lelley, Tamas; Schlötterer, Christian

2009-05-14

Next generation sequencing technologies hold great potential for many biological questions. While mainly used for genomic sequencing, they are also very promising for gene expression profiling. Sequencing of cDNA does not only provide an estimate of the absolute expression level, it can also be used for the identification of allele specific gene expression. We developed PanGEA, a tool which enables a fast and user-friendly analysis of allele specific gene expression using the 454 technology. PanGEA allows mapping of 454-ESTs to genes or whole genomes, displaying gene expression profiles, identification of SNPs and the quantification of allele specific gene expression. The intuitive GUI of PanGEA facilitates a flexible and interactive analysis of the data. PanGEA additionally implements a modification of the Smith-Waterman algorithm which deals with incorrect estimates of homopolymer length as occuring in the 454 technology To our knowledge, PanGEA is the first tool which facilitates the identification of allele specific gene expression. PanGEA is distributed under the Mozilla Public License and available at: http://www.kofler.or.at/bioinformatics/PanGEA

PanGEA: Identification of allele specific gene expression using the 454 technology

PubMed Central

Kofler, Robert; Teixeira Torres, Tatiana; Lelley, Tamas; Schlötterer, Christian

2009-01-01

Background Next generation sequencing technologies hold great potential for many biological questions. While mainly used for genomic sequencing, they are also very promising for gene expression profiling. Sequencing of cDNA does not only provide an estimate of the absolute expression level, it can also be used for the identification of allele specific gene expression. Results We developed PanGEA, a tool which enables a fast and user-friendly analysis of allele specific gene expression using the 454 technology. PanGEA allows mapping of 454-ESTs to genes or whole genomes, displaying gene expression profiles, identification of SNPs and the quantification of allele specific gene expression. The intuitive GUI of PanGEA facilitates a flexible and interactive analysis of the data. PanGEA additionally implements a modification of the Smith-Waterman algorithm which deals with incorrect estimates of homopolymer length as occuring in the 454 technology Conclusion To our knowledge, PanGEA is the first tool which facilitates the identification of allele specific gene expression. PanGEA is distributed under the Mozilla Public License and available at: PMID:19442283

Identification of forensic samples by using an infrared-based automatic DNA sequencer.

PubMed

Ricci, Ugo; Sani, Ilaria; Klintschar, Michael; Cerri, Nicoletta; De Ferrari, Francesco; Giovannucci Uzielli, Maria Luisa

2003-06-01

We have recently introduced a new protocol for analyzing all core loci of the Federal Bureau of Investigation's (FBI) Combined DNA Index System (CODIS) with an infrared (IR) automatic DNA sequencer (LI-COR 4200). The amplicons were labeled with forward oligonucleotide primers, covalently linked to a new infrared fluorescent molecule (IRDye 800). The alleles were displayed as familiar autoradiogram-like images with real-time detection. This protocol was employed for paternity testing, population studies, and identification of degraded forensic samples. We extensively analyzed some simulated forensic samples and mixed stains (blood, semen, saliva, bones, and fixed archival embedded tissues), comparing the results with donor samples. Sensitivity studies were also performed for the four multiplex systems. Our results show the efficiency, reliability, and accuracy of the IR system for the analysis of forensic samples. We also compared the efficiency of the multiplex protocol with ultraviolet (UV) technology. Paternity tests, undegraded DNA samples, and real forensic samples were analyzed with this approach based on IR technology and with UV-based automatic sequencers in combination with commercially-available kits. The comparability of the results with the widespread UV methods suggests that it is possible to exchange data between laboratories using the same core group of markers but different primer sets and detection methods.

Can identification of a fourth domain of life be made from sequence data alone, and could it be done on Mars?

PubMed

Poole, Anthony M; Willerslev, Eske

2007-10-01

A central question in astrobiology is whether life exists elsewhere in the universe. If so, is it related to Earth life? Technologies exist that enable identification of DNA- or RNA-based microbial life directly from environmental samples here on Earth. Such technologies could, in principle, be applied to the search for life elsewhere; indeed, efforts are underway to initiate such a search. However, surveying for nucleic acid-based life on other planets, if attempted, must be carried out with caution, owing to the risk of contamination by Earth-based life. Here we argue that the null hypothesis must be that any DNA discovered and sequenced from samples taken elsewhere in the universe are Earth-based contaminants. Experience from studies of low-biomass ancient DNA demonstrates that some results, by their very nature, will not enable complete rejection of the null hypothesis. In terms of eliminating contamination as an explanation of the data, there may be value in identification of sequences that lie outside the known diversity of the three domains of life. We therefore have examined whether a fourth domain could be readily identified from environmental DNA sequence data alone. We concluded that, even on Earth, this would be far from trivial, and we illustrate this point by way of examples drawn from the literature. Overall, our conclusions do not bode well for planned PCR-based surveys for life on Mars, and we argue that other independent biosignatures will be essential in corroborating any claims for the presence of life based on nucleic acid sequences.

DNA barcode goes two-dimensions: DNA QR code web server.

PubMed

Liu, Chang; Shi, Linchun; Xu, Xiaolan; Li, Huan; Xing, Hang; Liang, Dong; Jiang, Kun; Pang, Xiaohui; Song, Jingyuan; Chen, Shilin

2012-01-01

The DNA barcoding technology uses a standard region of DNA sequence for species identification and discovery. At present, "DNA barcode" actually refers to DNA sequences, which are not amenable to information storage, recognition, and retrieval. Our aim is to identify the best symbology that can represent DNA barcode sequences in practical applications. A comprehensive set of sequences for five DNA barcode markers ITS2, rbcL, matK, psbA-trnH, and CO1 was used as the test data. Fifty-three different types of one-dimensional and ten two-dimensional barcode symbologies were compared based on different criteria, such as coding capacity, compression efficiency, and error detection ability. The quick response (QR) code was found to have the largest coding capacity and relatively high compression ratio. To facilitate the further usage of QR code-based DNA barcodes, a web server was developed and is accessible at http://qrfordna.dnsalias.org. The web server allows users to retrieve the QR code for a species of interests, convert a DNA sequence to and from a QR code, and perform species identification based on local and global sequence similarities. In summary, the first comprehensive evaluation of various barcode symbologies has been carried out. The QR code has been found to be the most appropriate symbology for DNA barcode sequences. A web server has also been constructed to allow biologists to utilize QR codes in practical DNA barcoding applications.

A Comparison of Honey Bee-Collected Pollen From Working Agricultural Lands Using Light Microscopy and ITS Metabarcoding.

PubMed

Smart, M D; Cornman, R S; Iwanowicz, D D; McDermott-Kubeczko, M; Pettis, J S; Spivak, M S; Otto, C R V

2017-02-01

Taxonomic identification of pollen has historically been accomplished via light microscopy but requires specialized knowledge and reference collections, particularly when identification to lower taxonomic levels is necessary. Recently, next-generation sequencing technology has been used as a cost-effective alternative for identifying bee-collected pollen; however, this novel approach has not been tested on a spatially or temporally robust number of pollen samples. Here, we compare pollen identification results derived from light microscopy and DNA sequencing techniques with samples collected from honey bee colonies embedded within a gradient of intensive agricultural landscapes in the Northern Great Plains throughout the 2010-2011 growing seasons. We demonstrate that at all taxonomic levels, DNA sequencing was able to discern a greater number of taxa, and was particularly useful for the identification of infrequently detected species. Importantly, substantial phenological overlap did occur for commonly detected taxa using either technique, suggesting that DNA sequencing is an appropriate, and enhancing, substitutive technique for accurately capturing the breadth of bee-collected species of pollen present across agricultural landscapes. We also show that honey bees located in high and low intensity agricultural settings forage on dissimilar plants, though with overlap of the most abundantly collected pollen taxa. We highlight practical applications of utilizing sequencing technology, including addressing ecological issues surrounding land use, climate change, importance of taxa relative to abundance, and evaluating the impact of conservation program habitat enhancement efforts. Published by Oxford University Press on behalf of Entomological Society of America 2016. This work is written by US Government employees and is in the public domain in the US.

Mapping of transcription factor binding regions in mammalian cells by ChIP: Comparison of array- and sequencing-based technologies

PubMed Central

Euskirchen, Ghia M.; Rozowsky, Joel S.; Wei, Chia-Lin; Lee, Wah Heng; Zhang, Zhengdong D.; Hartman, Stephen; Emanuelsson, Olof; Stolc, Viktor; Weissman, Sherman; Gerstein, Mark B.; Ruan, Yijun; Snyder, Michael

2007-01-01

Recent progress in mapping transcription factor (TF) binding regions can largely be credited to chromatin immunoprecipitation (ChIP) technologies. We compared strategies for mapping TF binding regions in mammalian cells using two different ChIP schemes: ChIP with DNA microarray analysis (ChIP-chip) and ChIP with DNA sequencing (ChIP-PET). We first investigated parameters central to obtaining robust ChIP-chip data sets by analyzing STAT1 targets in the ENCODE regions of the human genome, and then compared ChIP-chip to ChIP-PET. We devised methods for scoring and comparing results among various tiling arrays and examined parameters such as DNA microarray format, oligonucleotide length, hybridization conditions, and the use of competitor Cot-1 DNA. The best performance was achieved with high-density oligonucleotide arrays, oligonucleotides ≥50 bases (b), the presence of competitor Cot-1 DNA and hybridizations conducted in microfluidics stations. When target identification was evaluated as a function of array number, 80%–86% of targets were identified with three or more arrays. Comparison of ChIP-chip with ChIP-PET revealed strong agreement for the highest ranked targets with less overlap for the low ranked targets. With advantages and disadvantages unique to each approach, we found that ChIP-chip and ChIP-PET are frequently complementary in their relative abilities to detect STAT1 targets for the lower ranked targets; each method detected validated targets that were missed by the other method. The most comprehensive list of STAT1 binding regions is obtained by merging results from ChIP-chip and ChIP-sequencing. Overall, this study provides information for robust identification, scoring, and validation of TF targets using ChIP-based technologies. PMID:17568005

Identification of Forensically Important Calliphoridae and Sarcophagidae Species Collected in Korea Using SNaPshot Multiplex System Targeting the Cytochrome c Oxidase Subunit I Gene

PubMed Central

Park, Ji Hye

2018-01-01

Estimation of postmortem interval (PMI) is paramount in modern forensic investigation. After the disappearance of the early postmortem phenomena conventionally used to estimate PMI, entomologic evidence provides important indicators for PMI estimation. The age of the oldest fly larvae or pupae can be estimated to pinpoint the time of oviposition, which is considered the minimum PMI (PMImin). The development rate of insects is usually temperature dependent and species specific. Therefore, species identification is mandatory for PMImin estimation using entomological evidence. The classical morphological identification method cannot be applied when specimens are damaged or have not yet matured. To overcome this limitation, some investigators employ molecular identification using mitochondrial cytochrome c oxidase subunit I (COI) nucleotide sequences. The molecular identification method commonly uses Sanger's nucleotide sequencing and molecular phylogeny, which are complex and time consuming and constitute another obstacle for forensic investigators. In this study, instead of using conventional Sanger's nucleotide sequencing, single-nucleotide polymorphisms (SNPs) in the COI gene region, which are unique between fly species, were selected and targeted for single-base extension (SBE) technology. These SNPs were genotyped using a SNaPshot® kit. Eleven Calliphoridae and seven Sarcophagidae species were covered. To validate this genotyping, fly DNA samples (103 adults, 84 larvae, and 4 pupae) previously confirmed by DNA barcoding were used. This method worked quickly with minimal DNA, providing a potential alternative to conventional DNA barcoding. Consisting of only a few simple electropherogram peaks, the results were more straightforward compared with those of the conventional DNA barcoding produced by Sanger's nucleotide sequencing. PMID:29682531

DNA typing in forensic medicine and in criminal investigations: a current survey.

PubMed

Benecke, M

1997-05-01

Since 1985 DNA typing of biological material has become one of the most powerful tools for personal identification in forensic medicine and in criminal investigations [1-6]. Classical DNA "fingerprinting" is increasingly being replaced by polymerase chain reaction (PCR) based technology which detects very short polymorphic stretches of DNA [7-15]. DNA loci which forensic scientists study do not code for proteins, and they are spread over the whole genome [16, 17]. These loci are neutral, and few provide any information about individuals except for their identity. Minute amounts of biological material are sufficient for DNA typing. Many European countries are beginning to establish databases to store DNA profiles of crime scenes and known offenders. A brief overview is given of past and present DNA typing and the establishment of forensic DNA databases in Europe.

DNA typing in forensic medicine and in criminal investigations: a current survey

NASA Astrophysics Data System (ADS)

Benecke, Mark

Since 1985 DNA typing of biological material has become one of the most powerful tools for personal identification in forensic medicine and in criminal investigations [1-6]. Classical DNA "fingerprinting" is increasingly being replaced by polymerase chain reaction (PCR) based technology which detects very short polymorphic stretches of DNA [7-15]. DNA loci which forensic scientists study do not code for proteins, and they are spread over the whole genome [16, 17]. These loci are neutral, and few provide any information about individuals except for their identity. Minute amounts of biological material are sufficient for DNA typing. Many European countries are beginning to establish databases to store DNA profiles of crime scenes and known offenders. A brief overview is given of past and present DNA typing and the establishment of forensic DNA databases in Europe.

Discovery of Potent and Selective Inhibitors for ADAMTS-4 through DNA-Encoded Library Technology (ELT).

PubMed

Ding, Yun; O'Keefe, Heather; DeLorey, Jennifer L; Israel, David I; Messer, Jeffrey A; Chiu, Cynthia H; Skinner, Steven R; Matico, Rosalie E; Murray-Thompson, Monique F; Li, Fan; Clark, Matthew A; Cuozzo, John W; Arico-Muendel, Christopher; Morgan, Barry A

2015-08-13

The aggrecan degrading metalloprotease ADAMTS-4 has been identified as a novel therapeutic target for osteoarthritis. Here, we use DNA-encoded Library Technology (ELT) to identify novel ADAMTS-4 inhibitors from a DNA-encoded triazine library by affinity selection. Structure-activity relationship studies based on the selection information led to the identification of potent and highly selective inhibitors. For example, 4-(((4-(6,7-dimethoxy-3,4-dihydroisoquinolin-2(1H)-yl)-6-(((4-methylpiperazin-1-yl)methyl)amino)-1,3,5-triazin-2-yl)amino)methyl)-N-ethyl-N-(m-tolyl)benzamide has IC50 of 10 nM against ADAMTS-4, with >1000-fold selectivity over ADAMT-5, MMP-13, TACE, and ADAMTS-13. These inhibitors have no obvious zinc ligand functionality.

Discovery of Potent and Selective Inhibitors for ADAMTS-4 through DNA-Encoded Library Technology (ELT)

PubMed Central

2015-01-01

The aggrecan degrading metalloprotease ADAMTS-4 has been identified as a novel therapeutic target for osteoarthritis. Here, we use DNA-encoded Library Technology (ELT) to identify novel ADAMTS-4 inhibitors from a DNA-encoded triazine library by affinity selection. Structure–activity relationship studies based on the selection information led to the identification of potent and highly selective inhibitors. For example, 4-(((4-(6,7-dimethoxy-3,4-dihydroisoquinolin-2(1H)-yl)-6-(((4-methylpiperazin-1-yl)methyl)amino)-1,3,5-triazin-2-yl)amino)methyl)-N-ethyl-N-(m-tolyl)benzamide has IC50 of 10 nM against ADAMTS-4, with >1000-fold selectivity over ADAMT-5, MMP-13, TACE, and ADAMTS-13. These inhibitors have no obvious zinc ligand functionality. PMID:26288689

Fast Technology Analysis (FTA) Enables Identification of Species and Genotypes of Latent Microsporidia Infections in Healthy Native Cameroonians

PubMed Central

Ndzi, Edward S.; Asonganyi, Tazoacha; Nkinin, Mary Bello; Xiao, Lihua; Didier, Elizabeth S.; Bowers, Lisa C.; Nkinin, Stephenson W.; Kaneshiro, Edna S.

2015-01-01

Several enteric microsporidia species have been detected in humans and other vertebrates and their identifications at the genotype level are currently being elucidated. As advanced methods, reagents, and disposal kits for detecting and identifying pathogens become commercially available, it is important to test them in settings other than in laboratories with “state-of-the-art” equipment and well-trained staff members. In the present study, we sought to detect microsporidia DNA preserved and extracted from FTA (fast technology analysis) cards spotted with human fecal suspensions obtained from Cameroonian volunteers living in the capital city of Yaoundé to preclude the need for employing spore-concentrating protocols. Further, we tested whether amplicon nucleotide sequencing approaches could be used on small aliquots taken from the cards to elucidate the diversity of microsporidia species and strains infecting native residents. Of 196 samples analyzed, 12 (6.1%) were positive for microsporidia DNA; Enterocytozoon bieneusi (Type IV and KIN-1), Encephalitozoon cuniculi, and Encephalitozoon intestinalis were identified. These data demonstrate the utility of the FTA cards in identifying genotypes of microsporidia DNA in human fecal samples that may be applied to field testing for prevalence studies. PMID:26303263

Multiplex Identification of Microbes ▿ †

PubMed Central

Hyman, Richard W.; St.Onge, Robert P.; Allen, Edward A.; Miranda, Molly; Aparicio, Ana Maria; Fukushima, Marilyn; Davis, Ronald W.

2010-01-01

We have adapted molecular inversion probe technology to identify microbes in a highly multiplexed procedure. This procedure does not require growth of the microbes. Rather, the technology employs DNA homology twice: once for the molecular probe to hybridize to its homologous DNA and again for the 20-mer oligonucleotide barcode on the molecular probe to hybridize to a commercially available molecular barcode array. As proof of concept, we have designed, tested, and employed 192 molecular probes for 40 microbes. While these particular molecular probes are aimed at our interest in the microbes in the human vagina, this molecular probe method could be employed to identify the microbes in any ecological niche. PMID:20418427

A novel technology for the detection, enrichment, and separation of trace amounts of target DNA based on amino-modified fluorescent magnetic composite nanoparticles.

PubMed

Wang, Guannan; Su, Xingguang

2010-06-01

A novel, highly sensitive technology for the detection, enrichment, and separation of trace amounts of target DNA was developed on the basis of amino-modified fluorescent magnetic composite nanoparticles (AFMN). In this study, the positively charged amino-modified composite nanoparticles conjugate with the negatively charged capture DNA through electrostatic binding. The optimal combination of AFMN and capture DNA was measured by dynamic light scattering (DLS) and UV-vis absorption spectroscopy. The highly sensitive detection of trace amounts of target DNA was achieved through enrichment by means of AFMN. The detection limit for target DNA is 0.4 pM, which could be further improved by using a more powerful magnet. Because of their different melting temperatures, single-base mismatched target DNA could be separated from perfectly complementary target DNA. In addition, the photoluminescence (PL) signals of perfectly complementary target DNA and single-base mismatched DNA as well as the hybridization kinetics of different concentrations of target DNA at different reaction times have also been studied. Most importantly, the detection, enrichment, and separation ability of AFMN was further verified with milk. Simple and satisfactory results were obtained, which show the great potential in the fields of mutation identification and clinical diagnosis.

The 'dark matter' in the plant genomes: non-coding and unannotated DNA sequences associated with open chromatin.

PubMed

Jiang, Jiming

2015-04-01

Sequencing of complete plant genomes has become increasingly more routine since the advent of the next-generation sequencing technology. Identification and annotation of large amounts of noncoding but functional DNA sequences, including cis-regulatory DNA elements (CREs), have become a new frontier in plant genome research. Genomic regions containing active CREs bound to regulatory proteins are hypersensitive to DNase I digestion and are called DNase I hypersensitive sites (DHSs). Several recent DHS studies in plants illustrate that DHS datasets produced by DNase I digestion followed by next-generation sequencing (DNase-seq) are highly valuable for the identification and characterization of CREs associated with plant development and responses to environmental cues. DHS-based genomic profiling has opened a door to identify and annotate the 'dark matter' in sequenced plant genomes. Copyright © 2015 Elsevier Ltd. All rights reserved.

Mass spectrometry-based cDNA profiling as a potential tool for human body fluid identification.

PubMed

Donfack, Joseph; Wiley, Anissa

2015-05-01

Several mRNA markers have been exhaustively evaluated for the identification of human venous blood, saliva, and semen in forensic genetics. As new candidate human body fluid specific markers are discovered, evaluated, and reported in the scientific literature, there is an increasing trend toward determining the ideal markers for cDNA profiling of body fluids of forensic interest. However, it has not been determined which molecular genetics-based technique(s) should be utilized to assess the performance of these markers. In recent years, only a few confirmatory, mRNA/cDNA-based methods have been evaluated for applications in body fluid identification. The most frequently described methods tested to date include quantitative polymerase chain reaction (qPCR) and capillary electrophoresis (CE). However these methods, in particular qPCR, often favor narrow multiplex PCR due to the availability of a limited number of fluorescent dyes/tags. In an attempt to address this technological constraint, this study explored matrix-assisted laser desorption/ionization-time of flight mass spectrometry (MALDI-TOF MS) for human body fluid identification via cDNA profiling of venous blood, saliva, and semen. Using cDNA samples at 20pg input phosphoglycerate kinase 1 (PGK1) amounts, body fluid specific markers for the candidate genes were amplified in their corresponding body fluid (i.e., venous blood, saliva, or semen) and absent in the remaining two (100% specificity). The results of this study provide an initial indication that MALDI-TOF MS is a potential fluorescent dye-free alternative method for body fluid identification in forensic casework. However, the inherent issues of low amounts of mRNA, and the damage caused to mRNA by environmental exposures, extraction processes, and storage conditions are important factors that significantly hinder the implementation of cDNA profiling into forensic casework. Published by Elsevier Ireland Ltd.

DNA Barcode Goes Two-Dimensions: DNA QR Code Web Server

PubMed Central

Li, Huan; Xing, Hang; Liang, Dong; Jiang, Kun; Pang, Xiaohui; Song, Jingyuan; Chen, Shilin

2012-01-01

The DNA barcoding technology uses a standard region of DNA sequence for species identification and discovery. At present, “DNA barcode” actually refers to DNA sequences, which are not amenable to information storage, recognition, and retrieval. Our aim is to identify the best symbology that can represent DNA barcode sequences in practical applications. A comprehensive set of sequences for five DNA barcode markers ITS2, rbcL, matK, psbA-trnH, and CO1 was used as the test data. Fifty-three different types of one-dimensional and ten two-dimensional barcode symbologies were compared based on different criteria, such as coding capacity, compression efficiency, and error detection ability. The quick response (QR) code was found to have the largest coding capacity and relatively high compression ratio. To facilitate the further usage of QR code-based DNA barcodes, a web server was developed and is accessible at http://qrfordna.dnsalias.org. The web server allows users to retrieve the QR code for a species of interests, convert a DNA sequence to and from a QR code, and perform species identification based on local and global sequence similarities. In summary, the first comprehensive evaluation of various barcode symbologies has been carried out. The QR code has been found to be the most appropriate symbology for DNA barcode sequences. A web server has also been constructed to allow biologists to utilize QR codes in practical DNA barcoding applications. PMID:22574113

Transcription factors as readers and effectors of DNA methylation.

PubMed

Zhu, Heng; Wang, Guohua; Qian, Jiang

2016-08-01

Recent technological advances have made it possible to decode DNA methylomes at single-base-pair resolution under various physiological conditions. Many aberrant or differentially methylated sites have been discovered, but the mechanisms by which changes in DNA methylation lead to observed phenotypes, such as cancer, remain elusive. The classical view of methylation-mediated protein-DNA interactions is that only proteins with a methyl-CpG binding domain (MBD) can interact with methylated DNA. However, evidence is emerging to suggest that transcription factors lacking a MBD can also interact with methylated DNA. The identification of these proteins and the elucidation of their characteristics and the biological consequences of methylation-dependent transcription factor-DNA interactions are important stepping stones towards a mechanistic understanding of methylation-mediated biological processes, which have crucial implications for human development and disease.

Transcription factors as readers and effectors of DNA methylation

PubMed Central

Zhu, Heng; Wang, Guohua; Qian, Jiang

2017-01-01

Recent technological advances have made it possible to decode DNA methylomes at single-base-pair resolution under various physiological conditions. Many aberrant or differentially methylated sites have been discovered, but the mechanisms by which changes in DNA methylation lead to observed phenotypes, such as cancer, remain elusive. The classical view of methylation-mediated protein-DNA interactions is that only proteins with a methyl-CpG binding domain (MBD) can interact with methylated DNA. However, evidence is emerging to suggest that transcription factors lacking a MBD can also interact with methylated DNA. The identification of these proteins and the elucidation of their characteristics and the biological consequences of methylation-dependent transcription factor-DNA interactions are important stepping stones towards a mechanistic understanding of methylation-mediated biological processes, which have crucial implications for human development and disease. PMID:27479905

PCR-Free Detection of Genetically Modified Organisms Using Magnetic Capture Technology and Fluorescence Cross-Correlation Spectroscopy

PubMed Central

Zhou, Xiaoming; Xing, Da; Tang, Yonghong; Chen, Wei R.

2009-01-01

The safety of genetically modified organisms (GMOs) has attracted much attention recently. Polymerase chain reaction (PCR) amplification is a common method used in the identification of GMOs. However, a major disadvantage of PCR is the potential amplification of non-target DNA, causing false-positive identification. Thus, there remains a need for a simple, reliable and ultrasensitive method to identify and quantify GMO in crops. This report is to introduce a magnetic bead-based PCR-free method for rapid detection of GMOs using dual-color fluorescence cross-correlation spectroscopy (FCCS). The cauliflower mosaic virus 35S (CaMV35S) promoter commonly used in transgenic products was targeted. CaMV35S target was captured by a biotin-labeled nucleic acid probe and then purified using streptavidin-coated magnetic beads through biotin-streptavidin linkage. The purified target DNA fragment was hybridized with two nucleic acid probes labeled respectively by Rhodamine Green and Cy5 dyes. Finally, FCCS was used to detect and quantify the target DNA fragment through simultaneously detecting the fluorescence emissions from the two dyes. In our study, GMOs in genetically engineered soybeans and tomatoes were detected, using the magnetic bead-based PCR-free FCCS method. A detection limit of 50 pM GMOs target was achieved and PCR-free detection of GMOs from 5 µg genomic DNA with magnetic capture technology was accomplished. Also, the accuracy of GMO determination by the FCCS method is verified by spectrophotometry at 260 nm using PCR amplified target DNA fragment from GM tomato. The new method is rapid and effective as demonstrated in our experiments and can be easily extended to high-throughput and automatic screening format. We believe that the new magnetic bead-assisted FCCS detection technique will be a useful tool for PCR-free GMOs identification and other specific nucleic acids. PMID:19956680

Identifying Fishes through DNA Barcodes and Microarrays.

PubMed

Kochzius, Marc; Seidel, Christian; Antoniou, Aglaia; Botla, Sandeep Kumar; Campo, Daniel; Cariani, Alessia; Vazquez, Eva Garcia; Hauschild, Janet; Hervet, Caroline; Hjörleifsdottir, Sigridur; Hreggvidsson, Gudmundur; Kappel, Kristina; Landi, Monica; Magoulas, Antonios; Marteinsson, Viggo; Nölte, Manfred; Planes, Serge; Tinti, Fausto; Turan, Cemal; Venugopal, Moleyur N; Weber, Hannes; Blohm, Dietmar

2010-09-07

International fish trade reached an import value of 62.8 billion Euro in 2006, of which 44.6% are covered by the European Union. Species identification is a key problem throughout the life cycle of fishes: from eggs and larvae to adults in fisheries research and control, as well as processed fish products in consumer protection. This study aims to evaluate the applicability of the three mitochondrial genes 16S rRNA (16S), cytochrome b (cyt b), and cytochrome oxidase subunit I (COI) for the identification of 50 European marine fish species by combining techniques of "DNA barcoding" and microarrays. In a DNA barcoding approach, neighbour Joining (NJ) phylogenetic trees of 369 16S, 212 cyt b, and 447 COI sequences indicated that cyt b and COI are suitable for unambiguous identification, whereas 16S failed to discriminate closely related flatfish and gurnard species. In course of probe design for DNA microarray development, each of the markers yielded a high number of potentially species-specific probes in silico, although many of them were rejected based on microarray hybridisation experiments. None of the markers provided probes to discriminate the sibling flatfish and gurnard species. However, since 16S-probes were less negatively influenced by the "position of label" effect and showed the lowest rejection rate and the highest mean signal intensity, 16S is more suitable for DNA microarray probe design than cty b and COI. The large portion of rejected COI-probes after hybridisation experiments (>90%) renders the DNA barcoding marker as rather unsuitable for this high-throughput technology. Based on these data, a DNA microarray containing 64 functional oligonucleotide probes for the identification of 30 out of the 50 fish species investigated was developed. It represents the next step towards an automated and easy-to-handle method to identify fish, ichthyoplankton, and fish products.

Historical Perspective, Development and Applications of Next-Generation Sequencing in Plant Virology

PubMed Central

Barba, Marina; Czosnek, Henryk; Hadidi, Ahmed

2014-01-01

Next-generation high throughput sequencing technologies became available at the onset of the 21st century. They provide a highly efficient, rapid, and low cost DNA sequencing platform beyond the reach of the standard and traditional DNA sequencing technologies developed in the late 1970s. They are continually improved to become faster, more efficient and cheaper. They have been used in many fields of biology since 2004. In 2009, next-generation sequencing (NGS) technologies began to be applied to several areas of plant virology including virus/viroid genome sequencing, discovery and detection, ecology and epidemiology, replication and transcription. Identification and characterization of known and unknown viruses and/or viroids in infected plants are currently among the most successful applications of these technologies. It is expected that NGS will play very significant roles in many research and non-research areas of plant virology. PMID:24399207

Utility of 16S rDNA Sequencing for Identification of Rare Pathogenic Bacteria.

PubMed

Loong, Shih Keng; Khor, Chee Sieng; Jafar, Faizatul Lela; AbuBakar, Sazaly

2016-11-01

Phenotypic identification systems are established methods for laboratory identification of bacteria causing human infections. Here, the utility of phenotypic identification systems was compared against 16S rDNA identification method on clinical isolates obtained during a 5-year study period, with special emphasis on isolates that gave unsatisfactory identification. One hundred and eighty-seven clinical bacteria isolates were tested with commercial phenotypic identification systems and 16S rDNA sequencing. Isolate identities determined using phenotypic identification systems and 16S rDNA sequencing were compared for similarity at genus and species level, with 16S rDNA sequencing as the reference method. Phenotypic identification systems identified ~46% (86/187) of the isolates with identity similar to that identified using 16S rDNA sequencing. Approximately 39% (73/187) and ~15% (28/187) of the isolates showed different genus identity and could not be identified using the phenotypic identification systems, respectively. Both methods succeeded in determining the species identities of 55 isolates; however, only ~69% (38/55) of the isolates matched at species level. 16S rDNA sequencing could not determine the species of ~20% (37/187) of the isolates. The 16S rDNA sequencing is a useful method over the phenotypic identification systems for the identification of rare and difficult to identify bacteria species. The 16S rDNA sequencing method, however, does have limitation for species-level identification of some bacteria highlighting the need for better bacterial pathogen identification tools. © 2016 Wiley Periodicals, Inc.

Correlation dynamics and enhanced signals for the identification of serial biomolecules and DNA bases.

PubMed

Ahmed, Towfiq; Haraldsen, Jason T; Rehr, John J; Di Ventra, Massimiliano; Schuller, Ivan; Balatsky, Alexander V

2014-03-28

Nanopore-based sequencing has demonstrated a significant potential for the development of fast, accurate, and cost-efficient fingerprinting techniques for next generation molecular detection and sequencing. We propose a specific multilayered graphene-based nanopore device architecture for the recognition of single biomolecules. Molecular detection and analysis can be accomplished through the detection of transverse currents as the molecule or DNA base translocates through the nanopore. To increase the overall signal-to-noise ratio and the accuracy, we implement a new 'multi-point cross-correlation' technique for identification of DNA bases or other molecules on the single molecular level. We demonstrate that the cross-correlations between each nanopore will greatly enhance the transverse current signal for each molecule. We implement first-principles transport calculations for DNA bases surveyed across a multilayered graphene nanopore system to illustrate the advantages of the proposed geometry. A time-series analysis of the cross-correlation functions illustrates the potential of this method for enhancing the signal-to-noise ratio. This work constitutes a significant step forward in facilitating fingerprinting of single biomolecules using solid state technology.

The Potential Power of Bar-HRM Technology in Herbal Medicine Identification

PubMed Central

Sun, Wei; Li, Jing-jian; Xiong, Chao; Zhao, Bo; Chen, Shi-lin

2016-01-01

The substitution of low-cost or adulterated herbal products for high-priced herbs makes it important to be able to identify and trace herbal plant species and their processed products in the drug supply chain. PCR-based methods play an increasing role in monitoring the safety of herbal medicines by detecting adulteration. Recent studies have shown the potential of DNA barcoding combined with high resolution melting (Bar-HRM) analysis in herbal medicine identification. This method involves precisely monitoring the change in fluorescence caused by the release of an intercalating DNA dye from a DNA duplex as it is denatured by a gradual increase in temperature. Since the melting profile depends on the GC content, length, and strand complementarity of the amplification product, Bar-HRM analysis opens up the possibility of detecting single-base variants or species-specific differences in a short region of DNA. This review summarizes key factors affecting Bar-HRM analysis and describes how Bar-HRM is performed. We then discuss advances in Bar-HRM analysis of medicinal plant ingredients (herbal materia medica) as a contribution toward safe and effective herbal medicines. PMID:27066026

The Potential Power of Bar-HRM Technology in Herbal Medicine Identification.

PubMed

Sun, Wei; Li, Jing-Jian; Xiong, Chao; Zhao, Bo; Chen, Shi-Lin

2016-01-01

The substitution of low-cost or adulterated herbal products for high-priced herbs makes it important to be able to identify and trace herbal plant species and their processed products in the drug supply chain. PCR-based methods play an increasing role in monitoring the safety of herbal medicines by detecting adulteration. Recent studies have shown the potential of DNA barcoding combined with high resolution melting (Bar-HRM) analysis in herbal medicine identification. This method involves precisely monitoring the change in fluorescence caused by the release of an intercalating DNA dye from a DNA duplex as it is denatured by a gradual increase in temperature. Since the melting profile depends on the GC content, length, and strand complementarity of the amplification product, Bar-HRM analysis opens up the possibility of detecting single-base variants or species-specific differences in a short region of DNA. This review summarizes key factors affecting Bar-HRM analysis and describes how Bar-HRM is performed. We then discuss advances in Bar-HRM analysis of medicinal plant ingredients (herbal materia medica) as a contribution toward safe and effective herbal medicines.

Biometric Identification Verification Technology Status and Feasibility Study

DTIC Science & Technology

1994-09-01

L’., .- CONTRACT No. DNA 001 -93-C-01 37 Approved for public release;T distribution Is unlimited. ~v 94g’ Destroy this report when it is no longer...DISTRIBUI ION/AVAILABILITY STATEMENT 12b. DISTRIBUTION CODE Approved for public release; distribution is unlimited. 13. ABSTRACT (Maximurm 200 wvrds) DoD...guys." 4lie issue is then reduced to one of positive identification and control. Traditiozal~y, this has beeýu accomplished by posting a guard or entry

Evaluation of diversity among common beans (Phaseolus vulgaris L.) from two centers of domestication using 'omics' technologies

PubMed Central

2010-01-01

Background Genetic diversity among wild accessions and cultivars of common bean (Phaseolus vulgaris L.) has been characterized using plant morphology, seed protein allozymes, random amplified polymorphic DNA, restriction fragment length polymorphisms, DNA sequence analysis, chloroplast DNA, and microsatellite markers. Yet, little is known about whether these traits, which distinguish among genetically distinct types of common bean, can be evaluated using omics technologies. Results Three 'omics' approaches: transcriptomics, proteomics, and metabolomics were used to qualitatively evaluate the diversity of common bean from two Centers of Domestication (COD). All three approaches were able to classify common bean according to their COD using unsupervised analyses; these findings are consistent with the hypothesis that differences exist in gene transcription, protein expression, and synthesis and metabolism of small molecules among common bean cultivars representative of different COD. Metabolomic analyses of multiple cultivars within two common bean gene pools revealed cultivar differences in small molecules that were of sufficient magnitude to allow identification of unique cultivar fingerprints. Conclusions Given the high-throughput and low cost of each of these 'omics' platforms, significant opportunities exist for their use in the rapid identification of traits of agronomic and nutritional importance as well as to characterize genetic diversity. PMID:21126341

Efficient sequence-specific isolation of DNA fragments and chromatin by in vitro enChIP technology using recombinant CRISPR ribonucleoproteins.

PubMed

Fujita, Toshitsugu; Yuno, Miyuki; Fujii, Hodaka

2016-04-01

The clustered regularly interspaced short palindromic repeats (CRISPR) system is widely used for various biological applications, including genome editing. We developed engineered DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP) using CRISPR to isolate target genomic regions from cells for their biochemical characterization. In this study, we developed 'in vitro enChIP' using recombinant CRISPR ribonucleoproteins (RNPs) to isolate target genomic regions. in vitro enChIP has the great advantage over conventional enChIP of not requiring expression of CRISPR complexes in cells. We first showed that in vitro enChIP using recombinant CRISPR RNPs can be used to isolate target DNA from mixtures of purified DNA in a sequence-specific manner. In addition, we showed that this technology can be used to efficiently isolate target genomic regions, while retaining their intracellular molecular interactions, with negligible contamination from irrelevant genomic regions. Thus, in vitro enChIP technology is of potential use for sequence-specific isolation of DNA, as well as for identification of molecules interacting with genomic regions of interest in vivo in combination with downstream analysis. © 2016 The Authors. Genes to Cells published by Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

Extraction of High Molecular Weight DNA from Fungal Rust Spores for Long Read Sequencing.

PubMed

Schwessinger, Benjamin; Rathjen, John P

2017-01-01

Wheat rust fungi are complex organisms with a complete life cycle that involves two different host plants and five different spore types. During the asexual infection cycle on wheat, rusts produce massive amounts of dikaryotic urediniospores. These spores are dikaryotic (two nuclei) with each nucleus containing one haploid genome. This dikaryotic state is likely to contribute to their evolutionary success, making them some of the major wheat pathogens globally. Despite this, most published wheat rust genomes are highly fragmented and contain very little haplotype-specific sequence information. Current long-read sequencing technologies hold great promise to provide more contiguous and haplotype-phased genome assemblies. Long reads are able to span repetitive regions and phase structural differences between the haplomes. This increased genome resolution enables the identification of complex loci and the study of genome evolution beyond simple nucleotide polymorphisms. Long-read technologies require pure high molecular weight DNA as an input for sequencing. Here, we describe a DNA extraction protocol for rust spores that yields pure double-stranded DNA molecules with molecular weight of >50 kilo-base pairs (kbp). The isolated DNA is of sufficient purity for PacBio long-read sequencing, but may require additional purification for other sequencing technologies such as Nanopore and 10× Genomics.

Development of a Novel Self-Enclosed Sample Preparation Device for DNA/RNA Isolation in Space

NASA Technical Reports Server (NTRS)

Zhang, Ye; Mehta, Satish K.; Pensinger, Stuart J.; Pickering, Karen D.

2011-01-01

Modern biology techniques present potentials for a wide range of molecular, cellular, and biochemistry applications in space, including detection of infectious pathogens and environmental contaminations, monitoring of drug-resistant microbial and dangerous mutations, identification of new phenotypes of microbial and new life species. However, one of the major technological blockades in enabling these technologies in space is a lack of devices for sample preparation in the space environment. To overcome such an obstacle, we constructed a prototype of a DNA/RNA isolation device based on our novel designs documented in the NASA New Technology Reporting System (MSC-24811-1/3-1). This device is self-enclosed and pipette free, purposely designed for use in the absence of gravity. Our design can also be modified easily for preparing samples in space for other applications, such as flowcytometry, immunostaining, cell separation, sample purification and separation according to its size and charges, sample chemical labeling, and sample purification. The prototype of our DNA/RNA isolation device was tested for efficiencies of DNA and RNA isolation from various cell types for PCR analysis. The purity and integrity of purified DNA and RNA were determined as well. Results showed that our developed DNA/RNA isolation device offers similar efficiency and quality in comparison to the samples prepared using the standard protocol in the laboratory.

Detection of mitochondrial DNA with the compact bead array sensor system (cBASS)

NASA Astrophysics Data System (ADS)

Mulvaney, Shawn P.; Ibe, Carol N.; Caldwell, Jane M.; Levine, Jay F.; Whitman, Lloyd J.; Tamanaha, Cy R.

2009-02-01

Enteric pathogens are a significant contaminant in surface waters used for recreation, fish and shellfish harvesting, crop irrigation, and human consumption. The need for water monitoring becomes more pronounced when industrial, agricultural, and residential lands are found in close proximity. Fecal contamination is particularly problematic and identification of the pollution source essential to remediation efforts. Standard monitoring for fecal contamination relies on indicator organisms, but the technique is too broad to identify the source of contamination. Instead, real-time PCR of mitochondrial DNA (mtDNA) is an emerging method for identification of the contamination source. Presented herein, we evaluate an alternative technology, the compact Bead Array Sensor System (cBASS®) and its assay approach Fluidic Force Discrimination (FFD), for the detection of mtDNA. Previously, we achieved multiplexed, attomolar detection of toxins and femtomolar detection of nucleic acids in minutes with FFD assays. More importantly, FFD assays are compatible with a variety of complex matrices and therefore potentially applicable for samples where the matrix would interfere with PCR amplification. We have designed a triplex assay for the NADH gene found in human, swine, and bovine mtDNA and demonstrated the specific detection of human mtDNA spiked into a waste water sample.

On site DNA barcoding by nanopore sequencing

PubMed Central

Menegon, Michele; Cantaloni, Chiara; Rodriguez-Prieto, Ana; Centomo, Cesare; Abdelfattah, Ahmed; Rossato, Marzia; Bernardi, Massimo; Xumerle, Luciano; Loader, Simon; Delledonne, Massimo

2017-01-01

Biodiversity research is becoming increasingly dependent on genomics, which allows the unprecedented digitization and understanding of the planet’s biological heritage. The use of genetic markers i.e. DNA barcoding, has proved to be a powerful tool in species identification. However, full exploitation of this approach is hampered by the high sequencing costs and the absence of equipped facilities in biodiversity-rich countries. In the present work, we developed a portable sequencing laboratory based on the portable DNA sequencer from Oxford Nanopore Technologies, the MinION. Complementary laboratory equipment and reagents were selected to be used in remote and tough environmental conditions. The performance of the MinION sequencer and the portable laboratory was tested for DNA barcoding in a mimicking tropical environment, as well as in a remote rainforest of Tanzania lacking electricity. Despite the relatively high sequencing error-rate of the MinION, the development of a suitable pipeline for data analysis allowed the accurate identification of different species of vertebrates including amphibians, reptiles and mammals. In situ sequencing of a wild frog allowed us to rapidly identify the species captured, thus confirming that effective DNA barcoding in the field is possible. These results open new perspectives for real-time-on-site DNA sequencing thus potentially increasing opportunities for the understanding of biodiversity in areas lacking conventional laboratory facilities. PMID:28977016

[Biomarkers of radiation-induced DNA repair processes].

PubMed

Vallard, Alexis; Rancoule, Chloé; Guy, Jean-Baptiste; Espenel, Sophie; Sauvaigo, Sylvie; Rodriguez-Lafrasse, Claire; Magné, Nicolas

2017-11-01

The identification of DNA repair biomarkers is of paramount importance. Indeed, it is the first step in the process of modulating radiosensitivity and radioresistance. Unlike tools of detection and measurement of DNA damage, DNA repair biomarkers highlight the variations of DNA damage responses, depending on the dose and the dose rate. The aim of the present review is to describe the main biomarkers of radiation-induced DNA repair. We will focus on double strand breaks (DSB), because of their major role in radiation-induced cell death. The most important DNA repair biomarkers are DNA damage signaling proteins, with ATM, DNA-PKcs, 53BP1 and γ-H2AX. They can be analyzed either using immunostaining, or using lived cell imaging. However, to date, these techniques are still time and money consuming. The development of "omics" technologies should lead the way to new (and usable in daily routine) DNA repair biomarkers. Copyright © 2017 Société Française du Cancer. Published by Elsevier Masson SAS. All rights reserved.

Quantification of false positive reduction in nucleic acid purification on hemorrhagic fever DNA.

DOE Office of Scientific and Technical Information (OSTI.GOV)

James, Conrad D.; Pohl, Kenneth Roy; Derzon, Mark Steven

2006-11-01

Columbia University has developed a sensitive highly multiplexed system for genetic identification of nucleic acid targets. The primary obstacle to implementing this technology is the high rate of false positives due to high levels of unbound reporters that remain within the system after hybridization. The ability to distinguish between free reporters and reporters bound to targets limits the use of this technology. We previously demonstrated a new electrokinetic method for binary separation of kb pair long DNA molecules and oligonucleotides. The purpose of this project 99864 is to take these previous demonstrations and further develop the technique and hardware formore » field use. Specifically, our objective was to implement separation in a heterogeneous sample (containing target DNA and background oligo), to perform the separation in a flow-based device, and to develop all of the components necessary for field testing a breadboard prototype system.« less

Chemical Biology Probes from Advanced DNA-encoded Libraries.

PubMed

Salamon, Hazem; Klika Škopić, Mateja; Jung, Kathrin; Bugain, Olivia; Brunschweiger, Andreas

2016-02-19

The identification of bioactive compounds is a crucial step toward development of probes for chemical biology studies. Screening of DNA-encoded small molecule libraries (DELs) has emerged as a validated technology to interrogate vast chemical space. DELs consist of chimeric molecules composed of a low-molecular weight compound that is conjugated to a DNA identifier tag. They are screened as pooled libraries using selection to identify "hits." Screening of DELs has identified numerous bioactive compounds. Some of these molecules were instrumental in gaining a deeper understanding of biological systems. One of the main challenges in the field is the development of synthesis methodology for DELs.

BioBarcode: a general DNA barcoding database and server platform for Asian biodiversity resources.

PubMed

Lim, Jeongheui; Kim, Sang-Yoon; Kim, Sungmin; Eo, Hae-Seok; Kim, Chang-Bae; Paek, Woon Kee; Kim, Won; Bhak, Jong

2009-12-03

DNA barcoding provides a rapid, accurate, and standardized method for species-level identification using short DNA sequences. Such a standardized identification method is useful for mapping all the species on Earth, particularly when DNA sequencing technology is cheaply available. There are many nations in Asia with many biodiversity resources that need to be mapped and registered in databases. We have built a general DNA barcode data processing system, BioBarcode, with open source software - which is a general purpose database and server. It uses mySQL RDBMS 5.0, BLAST2, and Apache httpd server. An exemplary database of BioBarcode has around 11,300 specimen entries (including GenBank data) and registers the biological species to map their genetic relationships. The BioBarcode database contains a chromatogram viewer which improves the performance in DNA sequence analyses. Asia has a very high degree of biodiversity and the BioBarcode database server system aims to provide an efficient bioinformatics protocol that can be freely used by Asian researchers and research organizations interested in DNA barcoding. The BioBarcode promotes the rapid acquisition of biological species DNA sequence data that meet global standards by providing specialized services, and provides useful tools that will make barcoding cheaper and faster in the biodiversity community such as standardization, depository, management, and analysis of DNA barcode data. The system can be downloaded upon request, and an exemplary server has been constructed with which to build an Asian biodiversity system http://www.asianbarcode.org.

Improved Sensitivity for Molecular Detection of Bacterial and Candida Infections in Blood

PubMed Central

Bacconi, Andrea; Richmond, Gregory S.; Baroldi, Michelle A.; Laffler, Thomas G.; Blyn, Lawrence B.; Carolan, Heather E.; Frinder, Mark R.; Toleno, Donna M.; Metzgar, David; Gutierrez, Jose R.; Massire, Christian; Rounds, Megan; Kennel, Natalie J.; Rothman, Richard E.; Peterson, Stephen; Carroll, Karen C.; Wakefield, Teresa; Ecker, David J.

2014-01-01

The rapid identification of bacteria and fungi directly from the blood of patients with suspected bloodstream infections aids in diagnosis and guides treatment decisions. The development of an automated, rapid, and sensitive molecular technology capable of detecting the diverse agents of such infections at low titers has been challenging, due in part to the high background of genomic DNA in blood. PCR followed by electrospray ionization mass spectrometry (PCR/ESI-MS) allows for the rapid and accurate identification of microorganisms but with a sensitivity of about 50% compared to that of culture when using 1-ml whole-blood specimens. Here, we describe a new integrated specimen preparation technology that substantially improves the sensitivity of PCR/ESI-MS analysis. An efficient lysis method and automated DNA purification system were designed for processing 5 ml of whole blood. In addition, PCR amplification formulations were optimized to tolerate high levels of human DNA. An analysis of 331 specimens collected from patients with suspected bloodstream infections resulted in 35 PCR/ESI-MS-positive specimens (10.6%) compared to 18 positive by culture (5.4%). PCR/ESI-MS was 83% sensitive and 94% specific compared to culture. Replicate PCR/ESI-MS testing from a second aliquot of the PCR/ESI-MS-positive/culture-negative specimens corroborated the initial findings in most cases, resulting in increased sensitivity (91%) and specificity (99%) when confirmed detections were considered true positives. The integrated solution described here has the potential to provide rapid detection and identification of organisms responsible for bloodstream infections. PMID:24951806

Screening for Protein-DNA Interactions by Automatable DNA-Protein Interaction ELISA

PubMed Central

Schüssler, Axel; Kolukisaoglu, H. Üner; Koch, Grit; Wallmeroth, Niklas; Hecker, Andreas; Thurow, Kerstin; Zell, Andreas; Harter, Klaus; Wanke, Dierk

2013-01-01

DNA-binding proteins (DBPs), such as transcription factors, constitute about 10% of the protein-coding genes in eukaryotic genomes and play pivotal roles in the regulation of chromatin structure and gene expression by binding to short stretches of DNA. Despite their number and importance, only for a minor portion of DBPs the binding sequence had been disclosed. Methods that allow the de novo identification of DNA-binding motifs of known DBPs, such as protein binding microarray technology or SELEX, are not yet suited for high-throughput and automation. To close this gap, we report an automatable DNA-protein-interaction (DPI)-ELISA screen of an optimized double-stranded DNA (dsDNA) probe library that allows the high-throughput identification of hexanucleotide DNA-binding motifs. In contrast to other methods, this DPI-ELISA screen can be performed manually or with standard laboratory automation. Furthermore, output evaluation does not require extensive computational analysis to derive a binding consensus. We could show that the DPI-ELISA screen disclosed the full spectrum of binding preferences for a given DBP. As an example, AtWRKY11 was used to demonstrate that the automated DPI-ELISA screen revealed the entire range of in vitro binding preferences. In addition, protein extracts of AtbZIP63 and the DNA-binding domain of AtWRKY33 were analyzed, which led to a refinement of their known DNA-binding consensi. Finally, we performed a DPI-ELISA screen to disclose the DNA-binding consensus of a yet uncharacterized putative DBP, AtTIFY1. A palindromic TGATCA-consensus was uncovered and we could show that the GATC-core is compulsory for AtTIFY1 binding. This specific interaction between AtTIFY1 and its DNA-binding motif was confirmed by in vivo plant one-hybrid assays in protoplasts. Thus, the value and applicability of the DPI-ELISA screen for de novo binding site identification of DBPs, also under automatized conditions, is a promising approach for a deeper understanding of gene regulation in any organism of choice. PMID:24146751

Application of MALDI-TOF MS Systems in the Rapid Identification of Campylobacter spp. of Public Health Importance.

PubMed

Hsieh, Ying-Hsin; Wang, Yun F; Moura, Hercules; Miranda, Nancy; Simpson, Steven; Gowrishankar, Ramnath; Barr, John; Kerdahi, Khalil; Sulaiman, Irshad M

2018-05-01

Campylobacteriosis is an infectious gastrointestinal disease caused by Campylobacter spp. In most cases, it is either underdiagnosed or underreported due to poor diagnostics and limited databases. Several DNA-based molecular diagnostic techniques, including 16S ribosomal RNA (rRNA) sequence typing, have been widely used in the species identification of Campylobacter. Nevertheless, these assays are time-consuming and require a high quality of bacterial DNA. Matrix-assisted laser desorption ionization (MALDI) time-of-flight (TOF) MS is an emerging diagnostic technology that can provide the rapid identification of microorganisms by using their intact cells without extraction or purification. In this study, we analyzed 24 American Type Culture Collection reference isolates of 16 Campylobacter spp. and five unknown clinical bacterial isolates for rapid identification utilizing two commercially available MADI-TOF MS platforms, namely the bioMérieux VITEK® MS and Bruker Biotyper systems. In addition, 16S rRNA sequencing was performed to confirm the species-level identification of the unknown clinical isolates. Both MALDI-TOF MS systems identified the isolates of C. jejuni, C. coli, C. lari, and C. fetus. The results of this study suggest that the MALDI-TOF MS technique can be used in the identification of Campylobacter spp. of public health importance.

DNA-Encoded Chemical Libraries: A Selection System Based on Endowing Organic Compounds with Amplifiable Information.

PubMed

Neri, Dario; Lerner, Richard A

2018-06-20

The discovery of organic ligands that bind specifically to proteins is a central problem in chemistry, biology, and the biomedical sciences. The encoding of individual organic molecules with distinctive DNA tags, serving as amplifiable identification bar codes, allows the construction and screening of combinatorial libraries of unprecedented size, thus facilitating the discovery of ligands to many different protein targets. Fundamentally, one links powers of genetics and chemical synthesis. After the initial description of DNA-encoded chemical libraries in 1992, several experimental embodiments of the technology have been reduced to practice. This review provides a historical account of important milestones in the development of DNA-encoded chemical libraries, a survey of relevant ongoing research activities, and a glimpse into the future.

Current status and future perspectives on molecular and serological methods in diagnostic mycology.

PubMed

Lau, Anna; Chen, Sharon; Sleiman, Sue; Sorrell, Tania

2009-11-01

Invasive fungal infections are an important cause of infectious morbidity. Nonculture-based methods are increasingly used for rapid, accurate diagnosis to improve patient outcomes. New and existing DNA amplification platforms have high sensitivity and specificity for direct detection and identification of fungi in clinical specimens. Since laboratories are increasingly reliant on DNA sequencing for fungal identification, measures to improve sequence interpretation should support validation of reference isolates and quality control in public gene repositories. Novel technologies (e.g., isothermal and PNA FISH methods), platforms enabling high-throughput analyses (e.g., DNA microarrays and Luminex xMAP) and/or commercial PCR assays warrant further evaluation for routine diagnostic use. Notwithstanding the advantages of molecular tests, serological assays remain clinically useful for patient management. The serum Aspergillus galactomannan test has been incorporated into diagnostic algorithms of invasive aspergillosis. Both the galactomannan and the serum beta-D-glucan test have value for diagnosing infection and monitoring therapeutic response.

Targeted next-generation sequencing identification of mutations in disease resistance gene anologs (RGAs) in wild and cultivated beets

USDA-ARS?s Scientific Manuscript database

Resistance gene analogs (RGAs) were searched bioinformatically in the sugar beet (Beta vulgaris L.) genome as potential candidates for improving resistance against different diseases. In the present study, Ion Torrent sequencing technology was used to identify mutations in 21 RGAs. The DNA samples o...

[Application and progress of RNA in forensic science].

PubMed

Gao, Lin-Lin; Li, You-Ying; Yan, Jiang-Wei; Liu, Ya-Cheng

2011-12-01

With the development of molecular biology, the evidences of genetics has been used widely in forensic sciences. DNA technology has played an important role in individual identification and paternity testing, RNA technology is showing more and more wide application in prospect. This article reviews the application and progress of RNA in forensic science including estimation of postmortem interval, bloodstain age, wound age, as well as determination of cause of death and the source of body fluids.

A commentary on the role of molecular technology and automation in clinical diagnostics

PubMed Central

O’Connor, Ciara; Fitzgibbon, Marie; Powell, James; Barron, Denis; O’Mahony, Jim; Power, Lorraine; O’Connell, Nuala H; Dunne, Colum

2014-01-01

Historically, the identification of bacterial or yeast isolates has been based on phenotypic characteristics such as growth on defined media, colony morphology, Gram stain, and various biochemical reactions, with significant delay in diagnosis. Clinical microbiology as a medical specialty has embraced advances in molecular technology for rapid species identification with broad-range 16S rDNA polymerase chain reaction (PCR) and matrix-assisted laser desorption and/or ionization time of flight (MALDI-TOF) mass spectrometry demonstrated as accurate, rapid, and cost-effective methods for the identification of most, but not all, bacteria and yeasts. Protracted conventional incubation times previously necessary to identify certain species have been mitigated, affording patients quicker diagnosis with associated reduction in exposure to empiric broad-spectrum antimicrobial therapy and shortened hospital stay. This short commentary details such molecular advances and their implications in the clinical microbiology setting. PMID:24658184

A commentary on the role of molecular technology and automation in clinical diagnostics.

PubMed

O'Connor, Ciara; Fitzgibbon, Marie; Powell, James; Barron, Denis; O'Mahony, Jim; Power, Lorraine; O'Connell, Nuala H; Dunne, Colum

2014-01-01

Historically, the identification of bacterial or yeast isolates has been based on phenotypic characteristics such as growth on defined media, colony morphology, Gram stain, and various biochemical reactions, with significant delay in diagnosis. Clinical microbiology as a medical specialty has embraced advances in molecular technology for rapid species identification with broad-range 16S rDNA polymerase chain reaction (PCR) and matrix-assisted laser desorption and/or ionization time of flight (MALDI-TOF) mass spectrometry demonstrated as accurate, rapid, and cost-effective methods for the identification of most, but not all, bacteria and yeasts. Protracted conventional incubation times previously necessary to identify certain species have been mitigated, affording patients quicker diagnosis with associated reduction in exposure to empiric broad-spectrum antimicrobial therapy and shortened hospital stay. This short commentary details such molecular advances and their implications in the clinical microbiology setting.

Successful isolation and PCR amplification of DNA from National Institute of Standards and Technology herbal dietary supplement standard reference material powders and extracts.

PubMed

Cimino, Matthew T

2010-03-01

Twenty-four herbal dietary supplement powder and extract reference standards provided by the National Institute of Standards and Technology (NIST) were investigated using three different commercially available DNA extraction kits to evaluate DNA availability for downstream nucleotide-based applications. The material included samples of Camellia, Citrus, Ephedra, Ginkgo, Hypericum, Serenoa, And Vaccinium. Protocols from Qiagen, MoBio, and Phytopure were used to isolate and purify DNA from the NIST standards. The resulting DNA concentration was quantified using SYBR Green fluorometry. Each of the 24 samples yielded DNA, though the concentration of DNA from each approach was notably different. The Phytopure method consistently yielded more DNA. The average yield ratio was 22 : 3 : 1 (ng/microL; Phytopure : Qiagen : MoBio). Amplification of the internal transcribed spacer II region using PCR was ultimately successful in 22 of the 24 samples. Direct sequencing chromatograms of the amplified material suggested that most of the samples were comprised of mixtures. However, the sequencing chromatograms of 12 of the 24 samples were sufficient to confirm the identity of the target material. The successful extraction, amplification, and sequencing of DNA from these herbal dietary supplement extracts and powders supports a continued effort to explore nucleotide sequence-based tools for the authentication and identification of plants in dietary supplements. (c) Georg Thieme Verlag KG Stuttgart . New York.

eSensor®: A Microarray Technology Based on Electrochemical Detection of Nucleic Acids and Its Application to Cystic Fibrosis Carrier Screening

NASA Astrophysics Data System (ADS)

Reed, Michael R.; Coty, William A.

We have developed a test for identification of carriers for cystic fibrosis using the eSensor® DNA detection technology. Oligonucleotide probes are deposited within self-assembled monolayers on gold electrodes arrayed upon printed circuit boards. These probes allow sequence-specific capture of amplicons containing a panel of mutation sites associated with cystic fibrosis. DNA targets are detected and mutations genotyped using a “sandwich” assay methodology employing electrochemical detection of ferrocene-labeled oligonucleotides for discrimination of carrier and non-carrier alleles. Performance of the cystic fibrosis application demonstrates sufficient accuracy and reliability for clinical diagnostic use, and the procedure can be performed by trained medical technologists available in the hospital laboratory.

Fidelity by design: Yoctoreactor and binder trap enrichment for small-molecule DNA-encoded libraries and drug discovery.

PubMed

Blakskjaer, Peter; Heitner, Tara; Hansen, Nils Jakob Vest

2015-06-01

DNA-encoded small-molecule library (DEL) technology allows vast drug-like small molecule libraries to be efficiently synthesized in a combinatorial fashion and screened in a single tube method for binding, with an assay readout empowered by advances in next generation sequencing technology. This approach has increasingly been applied as a viable technology for the identification of small-molecule modulators to protein targets and as precursors to drugs in the past decade. Several strategies for producing and for screening DELs have been devised by both academic and industrial institutions. This review highlights some of the most significant and recent strategies along with important results. A special focus on the production of high fidelity DEL technologies with the ability to eliminate screening noise and false positives is included: using a DNA junction called the Yoctoreactor, building blocks (BBs) are spatially confined at the center of the junction facilitating both the chemical reaction between BBs and encoding of the synthetic route. A screening method, known as binder trap enrichment, permits DELs to be screened robustly in a homogeneous manner delivering clean data sets and potent hits for even the most challenging targets. Copyright © 2015 Elsevier Ltd. All rights reserved.

Deciphering the Epigenetic Code: An Overview of DNA Methylation Analysis Methods

PubMed Central

Umer, Muhammad

2013-01-01

Abstract Significance: Methylation of cytosine in DNA is linked with gene regulation, and this has profound implications in development, normal biology, and disease conditions in many eukaryotic organisms. A wide range of methods and approaches exist for its identification, quantification, and mapping within the genome. While the earliest approaches were nonspecific and were at best useful for quantification of total methylated cytosines in the chunk of DNA, this field has seen considerable progress and development over the past decades. Recent Advances: Methods for DNA methylation analysis differ in their coverage and sensitivity, and the method of choice depends on the intended application and desired level of information. Potential results include global methyl cytosine content, degree of methylation at specific loci, or genome-wide methylation maps. Introduction of more advanced approaches to DNA methylation analysis, such as microarray platforms and massively parallel sequencing, has brought us closer to unveiling the whole methylome. Critical Issues: Sensitive quantification of DNA methylation from degraded and minute quantities of DNA and high-throughput DNA methylation mapping of single cells still remain a challenge. Future Directions: Developments in DNA sequencing technologies as well as the methods for identification and mapping of 5-hydroxymethylcytosine are expected to augment our current understanding of epigenomics. Here we present an overview of methodologies available for DNA methylation analysis with special focus on recent developments in genome-wide and high-throughput methods. While the application focus relates to cancer research, the methods are equally relevant to broader issues of epigenetics and redox science in this special forum. Antioxid. Redox Signal. 18, 1972–1986. PMID:23121567

Implementation options for DNA-based identification into ecological status assessment under the European Water Framework Directive.

PubMed

Hering, Daniel; Borja, Angel; Jones, J Iwan; Pont, Didier; Boets, Pieter; Bouchez, Agnes; Bruce, Kat; Drakare, Stina; Hänfling, Bernd; Kahlert, Maria; Leese, Florian; Meissner, Kristian; Mergen, Patricia; Reyjol, Yorick; Segurado, Pedro; Vogler, Alfried; Kelly, Martyn

2018-07-01

Assessment of ecological status for the European Water Framework Directive (WFD) is based on "Biological Quality Elements" (BQEs), namely phytoplankton, benthic flora, benthic invertebrates and fish. Morphological identification of these organisms is a time-consuming and expensive procedure. Here, we assess the options for complementing and, perhaps, replacing morphological identification with procedures using eDNA, metabarcoding or similar approaches. We rate the applicability of DNA-based identification for the individual BQEs and water categories (rivers, lakes, transitional and coastal waters) against eleven criteria, summarised under the headlines representativeness (for example suitability of current sampling methods for DNA-based identification, errors from DNA-based species detection), sensitivity (for example capability to detect sensitive taxa, unassigned reads), precision of DNA-based identification (knowledge about uncertainty), comparability with conventional approaches (for example sensitivity of metrics to differences in DNA-based identification), cost effectiveness and environmental impact. Overall, suitability of DNA-based identification is particularly high for fish, as eDNA is a well-suited sampling approach which can replace expensive and potentially harmful methods such as gill-netting, trawling or electrofishing. Furthermore, there are attempts to replace absolute by relative abundance in metric calculations. For invertebrates and phytobenthos, the main challenges include the modification of indices and completing barcode libraries. For phytoplankton, the barcode libraries are even more problematic, due to the high taxonomic diversity in plankton samples. If current assessment concepts are kept, DNA-based identification is least appropriate for macrophytes (rivers, lakes) and angiosperms/macroalgae (transitional and coastal waters), which are surveyed rather than sampled. We discuss general implications of implementing DNA-based identification into standard ecological assessment, in particular considering any adaptations to the WFD that may be required to facilitate the transition to molecular data. Copyright © 2018 Elsevier Ltd. All rights reserved.

Then and now: use of 16S rDNA gene sequencing for bacterial identification and discovery of novel bacteria in clinical microbiology laboratories.

PubMed

Woo, P C Y; Lau, S K P; Teng, J L L; Tse, H; Yuen, K-Y

2008-10-01

In the last decade, as a result of the widespread use of PCR and DNA sequencing, 16S rDNA sequencing has played a pivotal role in the accurate identification of bacterial isolates and the discovery of novel bacteria in clinical microbiology laboratories. For bacterial identification, 16S rDNA sequencing is particularly important in the case of bacteria with unusual phenotypic profiles, rare bacteria, slow-growing bacteria, uncultivable bacteria and culture-negative infections. Not only has it provided insights into aetiologies of infectious disease, but it also helps clinicians in choosing antibiotics and in determining the duration of treatment and infection control procedures. With the use of 16S rDNA sequencing, 215 novel bacterial species, 29 of which belong to novel genera, have been discovered from human specimens in the past 7 years of the 21st century (2001-2007). One hundred of the 215 novel species, 15 belonging to novel genera, have been found in four or more subjects. The largest number of novel species discovered were of the genera Mycobacterium (n = 12) and Nocardia (n = 6). The oral cavity/dental-related specimens (n = 19) and the gastrointestinal tract (n = 26) were the most important sites for discovery and/or reservoirs of novel species. Among the 100 novel species, Streptococcus sinensis, Laribacter hongkongensis, Clostridium hathewayi and Borrelia spielmanii have been most thoroughly characterized, with the reservoirs and routes of transmission documented, and S. sinensis, L. hongkongensis and C. hathewayi have been found globally. One of the greatest hurdles in putting 16S rDNA sequencing into routine use in clinical microbiology laboratories is automation of the technology. The only step that can be automated at the moment is input of the 16S rDNA sequence of the bacterial isolate for identification into one of the software packages that will generate the result of the identity of the isolate on the basis of its sequence database. However, studies on the accuracy of the software packages have given highly varied results, and interpretation of results remains difficult for most technicians, and even for clinical microbiologists. To fully utilize 16S rDNA sequencing in clinical microbiology, better guidelines are needed for interpretation of the identification results, and additional/supplementary methods are necessary for bacterial species that cannot be identified confidently by 16S rDNA sequencing alone.

Single-molecule optical genome mapping of a human HapMap and a colorectal cancer cell line.

PubMed

Teo, Audrey S M; Verzotto, Davide; Yao, Fei; Nagarajan, Niranjan; Hillmer, Axel M

2015-01-01

Next-generation sequencing (NGS) technologies have changed our understanding of the variability of the human genome. However, the identification of genome structural variations based on NGS approaches with read lengths of 35-300 bases remains a challenge. Single-molecule optical mapping technologies allow the analysis of DNA molecules of up to 2 Mb and as such are suitable for the identification of large-scale genome structural variations, and for de novo genome assemblies when combined with short-read NGS data. Here we present optical mapping data for two human genomes: the HapMap cell line GM12878 and the colorectal cancer cell line HCT116. High molecular weight DNA was obtained by embedding GM12878 and HCT116 cells, respectively, in agarose plugs, followed by DNA extraction under mild conditions. Genomic DNA was digested with KpnI and 310,000 and 296,000 DNA molecules (≥ 150 kb and 10 restriction fragments), respectively, were analyzed per cell line using the Argus optical mapping system. Maps were aligned to the human reference by OPTIMA, a new glocal alignment method. Genome coverage of 6.8× and 5.7× was obtained, respectively; 2.9× and 1.7× more than the coverage obtained with previously available software. Optical mapping allows the resolution of large-scale structural variations of the genome, and the scaffold extension of NGS-based de novo assemblies. OPTIMA is an efficient new alignment method; our optical mapping data provide a resource for genome structure analyses of the human HapMap reference cell line GM12878, and the colorectal cancer cell line HCT116.

Novel Antigen Identification Method for Discovery of Protective Malaria Antigens by Rapid Testing of DNA Vaccines Encoding Exons from the Parasite Genome

PubMed Central

Haddad, Diana; Bilcikova, Erika; Witney, Adam A.; Carlton, Jane M.; White, Charles E.; Blair, Peter L.; Chattopadhyay, Rana; Russell, Joshua; Abot, Esteban; Charoenvit, Yupin; Aguiar, Joao C.; Carucci, Daniel J.; Weiss, Walter R.

2004-01-01

We describe a novel approach for identifying target antigens for preerythrocytic malaria vaccines. Our strategy is to rapidly test hundreds of DNA vaccines encoding exons from the Plasmodium yoelii yoelii genomic sequence. In this antigen identification method, we measure reduction in parasite burden in the liver after sporozoite challenge in mice. Orthologs of protective P. y. yoelii genes can then be identified in the genomic databases of Plasmodium falciparum and Plasmodium vivax and investigated as candidate antigens for a human vaccine. A pilot study to develop the antigen identification method approach used 192 P. y. yoelii exons from genes expressed during the sporozoite stage of the life cycle. A total of 182 (94%) exons were successfully cloned into a DNA immunization vector with the Gateway cloning technology. To assess immunization strategies, mice were vaccinated with 19 of the new DNA plasmids in addition to the well-characterized protective plasmid encoding P. y. yoelii circumsporozoite protein. Single plasmid immunization by gene gun identified a novel vaccine target antigen which decreased liver parasite burden by 95% and which has orthologs in P. vivax and P. knowlesi but not P. falciparum. Intramuscular injection of DNA plasmids produced a different pattern of protective responses from those seen with gene gun immunization. Intramuscular immunization with plasmid pools could reduce liver parasite burden in mice despite the fact that none of the plasmids was protective when given individually. We conclude that high-throughput cloning of exons into DNA vaccines and their screening is feasible and can rapidly identify new malaria vaccine candidate antigens. PMID:14977966

A review of state legislation on DNA forensic data banking.

PubMed Central

McEwen, J. E.; Reilly, P. R.

1994-01-01

Recent advances in DNA identification technology are making their way into the criminal law. States across the country are enacting legislation to create repositories for the storage both of DNA samples collected from convicted offenders and of the DNA profiles derived from them. These data banks will be used to assist in the resolution of future crimes. This study surveys existing state statues, pending legislation, and administrative regulations that govern these DNA forensic data banks. We critically analyzed these laws with respect to their treatment of the collection, storage, analysis, retrieval, and use of DNA and DNA data. We found much variation among data-banking laws and conclude that, while DNA forensic data banking carries tremendous potential for law enforcement, many states, in their rush to create data banks, have paid little attention to issues of quality control, quality assurance, and privacy. In addition, the sweep of some laws is unnecessarily broad. Legislative modifications are needed in many states to better safeguard civil liberties and individual privacy. PMID:8198138

From barcoding single individuals to metabarcoding biological communities: towards an integrative approach to the study of global biodiversity.

PubMed

Cristescu, Melania E

2014-10-01

DNA-based species identification, known as barcoding, transformed the traditional approach to the study of biodiversity science. The field is transitioning from barcoding individuals to metabarcoding communities. This revolution involves new sequencing technologies, bioinformatics pipelines, computational infrastructure, and experimental designs. In this dynamic genomics landscape, metabarcoding studies remain insular and biodiversity estimates depend on the particular methods used. In this opinion article, I discuss the need for a coordinated advancement of DNA-based species identification that integrates taxonomic and barcoding information. Such an approach would facilitate access to almost 3 centuries of taxonomic knowledge and 1 decade of building repository barcodes. Conservation projects are time sensitive, research funding is becoming restricted, and informed decisions depend on our ability to embrace integrative approaches to biodiversity science. Copyright © 2014 Elsevier Ltd. All rights reserved.

Evaluation of DNA barcode candidates for the discrimination of Artemisia L.

PubMed

Liu, Geyu; Ning, Huixia; Ayidaerhan, Nurbolati; Aisa, Haji Akber

2017-11-01

Because of the very similar morphologies and wide diversity of Artemisia L. varieties, they are difficult to identify, and there have been many arguments about the systematic classification Artemisia L., especially concerning the division of species. DNA barcode technology is used to rapidly identify species based on standard short DNA sequences. To evaluate seven candidate DNA barcodes (ITS, ITS2, psbA-trnH, rbcL, matK, rpoB, and rpoC1) regarding their ability to identify closely related species of the Artemisia genus in Xinjiang. The corresponding PCR amplification efficiency, detectable genetic divergence, identification efficiency and phylogenetic tree were assessed. We found that the internal transcribed spacer (ITS) region exhibited the highest interspecific divergence, which was significantly higher than the observed intraspecific variation and showed the highest identification efficiency, followed by ITS2, psbA-trnH and, finally, rpoB. matK, rbcL, and rpoC1 performed poorly in this evaluation. ITS, ITS2, and psbA-trnH were able to perfectly identify the tested species Artemisia annua, A. absinthium, A. rupestris, A. tonurnefortiana, A. austriaca, A. dracunculus, A. vulgaris, and A. macrocephala. Therefore, we propose the ITS, ITS2, and psbA-trnH regions as promising DNA barcodes for the closely related species of Artemisia L. in Xinjiang.

Assessing macroinvertebrate biodiversity in freshwater ecosystems: Advances and challenges in dna-based approaches

USGS Publications Warehouse

Pfrender, M.E.; Ferrington, L.C.; Hawkins, C.P.; Hartzell, P.L.; Bagley, M.; Jackson, S.; Courtney, G.W.; Larsen, D.P.; Creutzburg, B.R.; Levesque, C.A.; Epler, J.H.; Morse, J.C.; Fend, S.; Petersen, M.J.; Ruiter, D.; Schindel, D.; Whiting, M.

2010-01-01

Assessing the biodiversity of macroinvertebrate fauna in freshwater ecosystems is an essential component of both basic ecological inquiry and applied ecological assessments. Aspects of taxonomic diversity and composition in freshwater communities are widely used to quantify water quality and measure the efficacy of remediation and restoration efforts. The accuracy and precision of biodiversity assessments based on standard morphological identifications are often limited by taxonomic resolution and sample size. Morphologically based identifications are laborious and costly, significantly constraining the sample sizes that can be processed. We suggest that the development of an assay platform based on DNA signatures will increase the precision and ease of quantifying biodiversity in freshwater ecosystems. Advances in this area will be particularly relevant for benthic and planktonic invertebrates, which are often monitored by regulatory agencies. Adopting a genetic assessment platform will alleviate some of the current limitations to biodiversity assessment strategies. We discuss the benefits and challenges associated with DNA-based assessments and the methods that are currently available. As recent advances in microarray and next-generation sequencing technologies will facilitate a transition to DNA-based assessment approaches, future research efforts should focus on methods for data collection, assay platform development, establishing linkages between DNA signatures and well-resolved taxonomies, and bioinformatics. ?? 2010 by The University of Chicago Press.

A Hybrid Approach for the Automated Finishing of Bacterial Genomes

PubMed Central

Robins, William P.; Chin, Chen-Shan; Webster, Dale; Paxinos, Ellen; Hsu, David; Ashby, Meredith; Wang, Susana; Peluso, Paul; Sebra, Robert; Sorenson, Jon; Bullard, James; Yen, Jackie; Valdovino, Marie; Mollova, Emilia; Luong, Khai; Lin, Steven; LaMay, Brianna; Joshi, Amruta; Rowe, Lori; Frace, Michael; Tarr, Cheryl L.; Turnsek, Maryann; Davis, Brigid M; Kasarskis, Andrew; Mekalanos, John J.; Waldor, Matthew K.; Schadt, Eric E.

2013-01-01

Dramatic improvements in DNA sequencing technology have revolutionized our ability to characterize most genomic diversity. However, accurate resolution of large structural events has remained challenging due to the comparatively shorter read lengths of second-generation technologies. Emerging third-generation sequencing technologies, which yield markedly increased read length on rapid time scales and for low cost, have the potential to address assembly limitations. Here we combine sequencing data from second- and third-generation DNA sequencing technologies to assemble the two-chromosome genome of a recent Haitian cholera outbreak strain into two nearly finished contigs at > 99.9% accuracy. Complex regions with clinically significant structure were completely resolved. In separate control assemblies on experimental and simulated data for the canonical N16961 reference we obtain 14 and 8 scaffolds greater than 1kb, respectively, correcting several errors in the underlying source data. This work provides a blueprint for the next generation of rapid microbial identification and full-genome assembly. PMID:22750883

BioBarcode: a general DNA barcoding database and server platform for Asian biodiversity resources

PubMed Central

2009-01-01

Background DNA barcoding provides a rapid, accurate, and standardized method for species-level identification using short DNA sequences. Such a standardized identification method is useful for mapping all the species on Earth, particularly when DNA sequencing technology is cheaply available. There are many nations in Asia with many biodiversity resources that need to be mapped and registered in databases. Results We have built a general DNA barcode data processing system, BioBarcode, with open source software - which is a general purpose database and server. It uses mySQL RDBMS 5.0, BLAST2, and Apache httpd server. An exemplary database of BioBarcode has around 11,300 specimen entries (including GenBank data) and registers the biological species to map their genetic relationships. The BioBarcode database contains a chromatogram viewer which improves the performance in DNA sequence analyses. Conclusion Asia has a very high degree of biodiversity and the BioBarcode database server system aims to provide an efficient bioinformatics protocol that can be freely used by Asian researchers and research organizations interested in DNA barcoding. The BioBarcode promotes the rapid acquisition of biological species DNA sequence data that meet global standards by providing specialized services, and provides useful tools that will make barcoding cheaper and faster in the biodiversity community such as standardization, depository, management, and analysis of DNA barcode data. The system can be downloaded upon request, and an exemplary server has been constructed with which to build an Asian biodiversity system http://www.asianbarcode.org. PMID:19958506

MotifMark: Finding regulatory motifs in DNA sequences.

PubMed

Hassanzadeh, Hamid Reza; Kolhe, Pushkar; Isbell, Charles L; Wang, May D

2017-07-01

The interaction between proteins and DNA is a key driving force in a significant number of biological processes such as transcriptional regulation, repair, recombination, splicing, and DNA modification. The identification of DNA-binding sites and the specificity of target proteins in binding to these regions are two important steps in understanding the mechanisms of these biological activities. A number of high-throughput technologies have recently emerged that try to quantify the affinity between proteins and DNA motifs. Despite their success, these technologies have their own limitations and fall short in precise characterization of motifs, and as a result, require further downstream analysis to extract useful and interpretable information from a haystack of noisy and inaccurate data. Here we propose MotifMark, a new algorithm based on graph theory and machine learning, that can find binding sites on candidate probes and rank their specificity in regard to the underlying transcription factor. We developed a pipeline to analyze experimental data derived from compact universal protein binding microarrays and benchmarked it against two of the most accurate motif search methods. Our results indicate that MotifMark can be a viable alternative technique for prediction of motif from protein binding microarrays and possibly other related high-throughput techniques.

The usefulness of DNA sequencing after extraction by Whatman FTA filter matrix technology and phenotypic tests for differentiation of Candida albicans and Candida dubliniensis.

PubMed

Kiraz, Nuri; Oz, Yasemin; Aslan, Huseyin; Muslumanoglu, Hamza

2014-02-01

Since C. dubliniensis is similar to C. albicans phenotypically, it can be misidentified as C. albicans. We aimed to investigate the prevalence of C. dubliniensis among isolates previously identified as C. albicans in our stocks and to compare the phenotypic methods and DNA sequencing of D1/D2 region on the ribosomal large subunit (rLSU) gene. A total of 850 isolates included in this study. Phenotypic identification was performed based on germ tube formation, chlamydospore production, colony colors on chromogenic agar, inability of growth at 45 °C and growth on hypertonic Sabouraud dextrose agar. Eighty isolates compatible with C. dubliniensis by at least one phenotypic test were included in the sequence analysis. Nested PCR amplification of D1/D2 region of the rLSU gene was performed after the fungal DNA extraction by Whatman FTA filter paper technology. The sequencing analysis of PCR products carried out by an automated capillary gel electrophoresis device. The rate of C. dubliniensis was 2.35 % (n = 20) among isolates previously described as C. albicans. Consequently, none of the phenotypic tests provided satisfactory performance alone in our study, and molecular methods required special equipment and high cost. Thus, at least two phenotypic methods can be used for identification of C. dubliniensis, and molecular methods can be used for confirmation.

Fluorescent signatures for variable DNA sequences

PubMed Central

Rice, John E.; Reis, Arthur H.; Rice, Lisa M.; Carver-Brown, Rachel K.; Wangh, Lawrence J.

2012-01-01

Life abounds with genetic variations writ in sequences that are often only a few hundred nucleotides long. Rapid detection of these variations for identification of genetic diseases, pathogens and organisms has become the mainstay of molecular science and medicine. This report describes a new, highly informative closed-tube polymerase chain reaction (PCR) strategy for analysis of both known and unknown sequence variations. It combines efficient quantitative amplification of single-stranded DNA targets through LATE-PCR with sets of Lights-On/Lights-Off probes that hybridize to their target sequences over a broad temperature range. Contiguous pairs of Lights-On/Lights-Off probes of the same fluorescent color are used to scan hundreds of nucleotides for the presence of mutations. Sets of probes in different colors can be combined in the same tube to analyze even longer single-stranded targets. Each set of hybridized Lights-On/Lights-Off probes generates a composite fluorescent contour, which is mathematically converted to a sequence-specific fluorescent signature. The versatility and broad utility of this new technology is illustrated in this report by characterization of variant sequences in three different DNA targets: the rpoB gene of Mycobacterium tuberculosis, a sequence in the mitochondrial cytochrome C oxidase subunit 1 gene of nematodes and the V3 hypervariable region of the bacterial 16 s ribosomal RNA gene. We anticipate widespread use of these technologies for diagnostics, species identification and basic research. PMID:22879378

Pyrosequencing for Microbial Identification and Characterization

PubMed Central

Cummings, Patrick J.; Ahmed, Ray; Durocher, Jeffrey A.; Jessen, Adam; Vardi, Tamar; Obom, Kristina M.

2013-01-01

Pyrosequencing is a versatile technique that facilitates microbial genome sequencing that can be used to identify bacterial species, discriminate bacterial strains and detect genetic mutations that confer resistance to anti-microbial agents. The advantages of pyrosequencing for microbiology applications include rapid and reliable high-throughput screening and accurate identification of microbes and microbial genome mutations. Pyrosequencing involves sequencing of DNA by synthesizing the complementary strand a single base at a time, while determining the specific nucleotide being incorporated during the synthesis reaction. The reaction occurs on immobilized single stranded template DNA where the four deoxyribonucleotides (dNTP) are added sequentially and the unincorporated dNTPs are enzymatically degraded before addition of the next dNTP to the synthesis reaction. Detection of the specific base incorporated into the template is monitored by generation of chemiluminescent signals. The order of dNTPs that produce the chemiluminescent signals determines the DNA sequence of the template. The real-time sequencing capability of pyrosequencing technology enables rapid microbial identification in a single assay. In addition, the pyrosequencing instrument, can analyze the full genetic diversity of anti-microbial drug resistance, including typing of SNPs, point mutations, insertions, and deletions, as well as quantification of multiple gene copies that may occur in some anti-microbial resistance patterns. PMID:23995536

Pyrosequencing for microbial identification and characterization.

PubMed

Cummings, Patrick J; Ahmed, Ray; Durocher, Jeffrey A; Jessen, Adam; Vardi, Tamar; Obom, Kristina M

2013-08-22

Pyrosequencing is a versatile technique that facilitates microbial genome sequencing that can be used to identify bacterial species, discriminate bacterial strains and detect genetic mutations that confer resistance to anti-microbial agents. The advantages of pyrosequencing for microbiology applications include rapid and reliable high-throughput screening and accurate identification of microbes and microbial genome mutations. Pyrosequencing involves sequencing of DNA by synthesizing the complementary strand a single base at a time, while determining the specific nucleotide being incorporated during the synthesis reaction. The reaction occurs on immobilized single stranded template DNA where the four deoxyribonucleotides (dNTP) are added sequentially and the unincorporated dNTPs are enzymatically degraded before addition of the next dNTP to the synthesis reaction. Detection of the specific base incorporated into the template is monitored by generation of chemiluminescent signals. The order of dNTPs that produce the chemiluminescent signals determines the DNA sequence of the template. The real-time sequencing capability of pyrosequencing technology enables rapid microbial identification in a single assay. In addition, the pyrosequencing instrument, can analyze the full genetic diversity of anti-microbial drug resistance, including typing of SNPs, point mutations, insertions, and deletions, as well as quantification of multiple gene copies that may occur in some anti-microbial resistance patterns.

Analysis of mutations in oral poliovirus vaccine by hybridization with generic oligonucleotide microchips.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Proudnikov, D.; Kirillov, E.; Chumakov, K.

2000-01-01

This paper describes use of a new technology of hybridization with a micro-array of immobilized oligonucleotides for detection and quantification of neurovirulent mutants in Oral Poliovirus Vaccine (OPV). We used a micro-array consisting of three-dimensional gel-elements containing all possible hexamers (total of 4096 probes). Hybridization of fluorescently labelled viral cDNA samples with such microchips resulted in a pattern of spots that was registered and quantified by a computer-linked CCD camera, so that the sequence of the original cDNA could be deduced. The method could reliably identify single point mutations, since each of them affected fluorescence intensity of 12 micro-array elements.more » Micro-array hybridization of DNA mixtures with varying contents of point mutants demonstrated that the method can detect as little as 10% of revertants in a population of vaccine virus. This new technology should be useful for quality control of live viral vaccines, as well as for other applications requiring identification and quantification of point mutations.« less

Microfluidic droplet enrichment for targeted sequencing

PubMed Central

Eastburn, Dennis J.; Huang, Yong; Pellegrino, Maurizio; Sciambi, Adam; Ptáček, Louis J.; Abate, Adam R.

2015-01-01

Targeted sequence enrichment enables better identification of genetic variation by providing increased sequencing coverage for genomic regions of interest. Here, we report the development of a new target enrichment technology that is highly differentiated from other approaches currently in use. Our method, MESA (Microfluidic droplet Enrichment for Sequence Analysis), isolates genomic DNA fragments in microfluidic droplets and performs TaqMan PCR reactions to identify droplets containing a desired target sequence. The TaqMan positive droplets are subsequently recovered via dielectrophoretic sorting, and the TaqMan amplicons are removed enzymatically prior to sequencing. We demonstrated the utility of this approach by generating an average 31.6-fold sequence enrichment across 250 kb of targeted genomic DNA from five unique genomic loci. Significantly, this enrichment enabled a more comprehensive identification of genetic polymorphisms within the targeted loci. MESA requires low amounts of input DNA, minimal prior locus sequence information and enriches the target region without PCR bias or artifacts. These features make it well suited for the study of genetic variation in a number of research and diagnostic applications. PMID:25873629

Beyond DNA Sequencing in Space: Current and Future Omics Capabilities of the Biomolecule Sequencer Payload

NASA Technical Reports Server (NTRS)

Wallace, Sarah

2017-01-01

Why do we need a DNA sequencer to support the human exploration of space? (A) Operational environmental monitoring; (1) Identification of contaminating microbes, (2) Infectious disease diagnosis, (3) Reduce down mass (sample return for environmental monitoring, crew health, etc.). (B) Research; (1) Human, (2) Animal, (3) Microbes/Cell lines, (4) Plant. (C) Med Ops; (1) Response to countermeasures, (2) Radiation, (3) Real-time analysis can influence medical intervention. (C) Support astrobiology science investigations; (1) Technology superiorly suited to in situ nucleic acid-based life detection, (2) Functional testing for integration into robotics for extraplanetary exploration mission.

A Review of Conventional PCR Assays for the Detection of Selected Phytopathogens of Wheat.

PubMed

Kuzdraliński, Adam; Kot, Anna; Szczerba, Hubert; Nowak, Michał; Muszyńska, Marta

2017-01-01

Infection of phyllosphere (stems, leaves, husks, and grains) by pathogenic fungi reduces the wheat yield and grain quality. Detection of the main wheat pathogenic fungi provides information about species composition and allows effective and targeted plant treatment. Since conventional procedures for the detection of these organisms are unreliable and time consuming, diagnostic DNA-based methods are required. Nucleic acid amplification technologies are independent of the morphological and biochemical characteristics of fungi. Microorganisms do not need to be cultured. Therefore, a number of PCR-based methodologies have been developed for the identification of key pathogenic fungi, such as Fusarium spp., Puccinia spp., Zymoseptoria tritici, Parastagonospora nodorum, Blumeria graminis f. sp. tritici, and Pyrenophora tritici-repentis. This article reviews frequently used DNA regions for fungus identification and discusses already known PCR assays for detection of the aforementioned wheat pathogens. We demonstrate that PCR-based wheat pathogen identification assays require further research. In particular, the number of diagnostic tests for Fusarium graminearum, Puccinia spp., and P. tritici-repentis are insufficient. © 2017 S. Karger AG, Basel.

Genetic identification of missing persons: DNA analysis of human remains and compromised samples.

PubMed

Alvarez-Cubero, M J; Saiz, M; Martinez-Gonzalez, L J; Alvarez, J C; Eisenberg, A J; Budowle, B; Lorente, J A

2012-01-01

Human identification has made great strides over the past 2 decades due to the advent of DNA typing. Forensic DNA typing provides genetic data from a variety of materials and individuals, and is applied to many important issues that confront society. Part of the success of DNA typing is the generation of DNA databases to help identify missing persons and to develop investigative leads to assist law enforcement. DNA databases house DNA profiles from convicted felons (and in some jurisdictions arrestees), forensic evidence, human remains, and direct and family reference samples of missing persons. These databases are essential tools, which are becoming quite large (for example the US Database contains 10 million profiles). The scientific, governmental and private communities continue to work together to standardize genetic markers for more effective worldwide data sharing, to develop and validate robust DNA typing kits that contain the reagents necessary to type core identity genetic markers, to develop technologies that facilitate a number of analytical processes and to develop policies to make human identity testing more effective. Indeed, DNA typing is integral to resolving a number of serious criminal and civil concerns, such as solving missing person cases and identifying victims of mass disasters and children who may have been victims of human trafficking, and provides information for historical studies. As more refined capabilities are still required, novel approaches are being sought, such as genetic testing by next-generation sequencing, mass spectrometry, chip arrays and pyrosequencing. Single nucleotide polymorphisms offer the potential to analyze severely compromised biological samples, to determine the facial phenotype of decomposed human remains and to predict the bioancestry of individuals, a new focus in analyzing this type of markers. Copyright © 2012 S. Karger AG, Basel.

28 CFR 28.11 - Definitions.

Code of Federal Regulations, 2010 CFR

2010-07-01

... Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM DNA Sample Collection, Analysis, and Indexing § 28.11 Definitions. DNA analysis means analysis of the deoxyribonucleic acid (DNA) identification information in a bodily sample. DNA sample means a tissue, fluid, or other bodily sample of an individual on...

28 CFR 28.11 - Definitions.

Code of Federal Regulations, 2011 CFR

2011-07-01

... Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM DNA Sample Collection, Analysis, and Indexing § 28.11 Definitions. DNA analysis means analysis of the deoxyribonucleic acid (DNA) identification information in a bodily sample. DNA sample means a tissue, fluid, or other bodily sample of an individual on...

28 CFR 28.11 - Definitions.

Code of Federal Regulations, 2013 CFR

2013-07-01

... Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM DNA Sample Collection, Analysis, and Indexing § 28.11 Definitions. DNA analysis means analysis of the deoxyribonucleic acid (DNA) identification information in a bodily sample. DNA sample means a tissue, fluid, or other bodily sample of an individual on...

28 CFR 28.11 - Definitions.

Code of Federal Regulations, 2012 CFR

2012-07-01

... Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM DNA Sample Collection, Analysis, and Indexing § 28.11 Definitions. DNA analysis means analysis of the deoxyribonucleic acid (DNA) identification information in a bodily sample. DNA sample means a tissue, fluid, or other bodily sample of an individual on...

28 CFR 28.11 - Definitions.

Code of Federal Regulations, 2014 CFR

2014-07-01

... Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM DNA Sample Collection, Analysis, and Indexing § 28.11 Definitions. DNA analysis means analysis of the deoxyribonucleic acid (DNA) identification information in a bodily sample. DNA sample means a tissue, fluid, or other bodily sample of an individual on...

Biomolecule Sequencer: Next-Generation DNA Sequencing Technology for In-Flight Environmental Monitoring, Research, and Beyond

NASA Technical Reports Server (NTRS)

Smith, David J.; Burton, Aaron; Castro-Wallace, Sarah; John, Kristen; Stahl, Sarah E.; Dworkin, Jason Peter; Lupisella, Mark L.

2016-01-01

On the International Space Station (ISS), technologies capable of rapid microbial identification and disease diagnostics are not currently available. NASA still relies upon sample return for comprehensive, molecular-based sample characterization. Next-generation DNA sequencing is a powerful approach for identifying microorganisms in air, water, and surfaces onboard spacecraft. The Biomolecule Sequencer payload, manifested to SpaceX-9 and scheduled on the Increment 4748 research plan (June 2016), will assess the functionality of a commercially-available next-generation DNA sequencer in the microgravity environment of ISS. The MinION device from Oxford Nanopore Technologies (Oxford, UK) measures picoamp changes in electrical current dependent on nucleotide sequences of the DNA strand migrating through nanopores in the system. The hardware is exceptionally small (9.5 x 3.2 x 1.6 cm), lightweight (120 grams), and powered only by a USB connection. For the ISS technology demonstration, the Biomolecule Sequencer will be powered by a Microsoft Surface Pro3. Ground-prepared samples containing lambda bacteriophage, Escherichia coli, and mouse genomic DNA, will be launched and stored frozen on the ISS until experiment initiation. Immediately prior to sequencing, a crew member will collect and thaw frozen DNA samples, connect the sequencer to the Surface Pro3, inject thawed samples into a MinION flow cell, and initiate sequencing. At the completion of the sequencing run, data will be downlinked for ground analysis. Identical, synchronous ground controls will be used for data comparisons to determine sequencer functionality, run-time sequence, current dynamics, and overall accuracy. We will present our latest results from the ISS flight experiment the first time DNA has ever been sequenced in space and discuss the many potential applications of the Biomolecule Sequencer for environmental monitoring, medical diagnostics, higher fidelity and more adaptable Space Biology Human Research Program investigations, and even life detection experiments for astrobiology missions.

DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries.

PubMed

Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg

2014-04-15

DNA-encoded chemical libraries (DECLs) represent a promising tool in drug discovery. DECL technology allows the synthesis and screening of chemical libraries of unprecedented size at moderate costs. In analogy to phage-display technology, where large antibody libraries are displayed on the surface of filamentous phage and are genetically encoded in the phage genome, DECLs feature the display of individual small organic chemical moieties on DNA fragments serving as amplifiable identification barcodes. The DNA-tag facilitates the synthesis and allows the simultaneous screening of very large sets of compounds (up to billions of molecules), because the hit compounds can easily be identified and quantified by PCR-amplification of the DNA-barcode followed by high-throughput DNA sequencing. Several approaches have been used to generate DECLs, differing both in the methods used for library encoding and for the combinatorial assembly of chemical moieties. For example, DECLs can be used for fragment-based drug discovery, displaying a single molecule on DNA or two chemical moieties at the extremities of complementary DNA strands. DECLs can vary substantially in the chemical structures and the library size. While ultralarge libraries containing billions of compounds have been reported containing four or more sets of building blocks, also smaller libraries have been shown to be efficient for ligand discovery. In general, it has been found that the overall library size is a poor predictor for library performance and that the number and diversity of the building blocks are rather important indicators. Smaller libraries consisting of two to three sets of building blocks better fulfill the criteria of drug-likeness and often have higher quality. In this Account, we present advances in the DECL field from proof-of-principle studies to practical applications for drug discovery, both in industry and in academia. DECL technology can yield specific binders to a variety of target proteins and is likely to become a standard tool for pharmaceutical hit discovery, lead expansion, and Chemical Biology research. The introduction of new methodologies for library encoding and for compound synthesis in the presence of DNA is an exciting research field and will crucially contribute to the performance and the propagation of the technology.

Identification of Dendrobium species by a candidate DNA barcode sequence: the chloroplast psbA-trnH intergenic region.

PubMed

Yao, Hui; Song, Jing-Yuan; Ma, Xin-Ye; Liu, Chang; Li, Ying; Xu, Hong-Xi; Han, Jian-Ping; Duan, Li-Sheng; Chen, Shi-Lin

2009-05-01

DNA barcoding is a novel technology that uses a standard DNA sequence to facilitate species identification. Although a consensus has not been reached regarding which DNA sequences can be used as the best plant barcodes, the psbA-trnH spacer region has been tested extensively in recent years. In this study, we hypothesize that the psbA-trnH spacer regions are also effective barcodes for Dendrobium species. We have sequenced the chloroplast psbA-trnH intergenic spacers of 17 Dendrobium species to test this hypothesis. The sequences were found to be significantly different from those of other species, with percentages of variation ranging from 0.3 % to 2.3 % and an average of 1.2 %. In contrast, the intraspecific variation among the Dendrobium species studied ranged from 0 % to 0.1 %. The sequence difference between the psbA-trnH sequences of 17 Dendrobium species and one Bulbophyllum odoratissimum ranged from 2.0 % to 3.1 %, with an average of 2.5 %. Our results support the notion that the psbA-trnH intergenic spacer region could be used as a barcode to distinguish various Dendrobium species and to differentiate Dendrobium species from other adulterating species. Copyright Georg Thieme Verlag KG Stuttgart. New York.

Potential for DNA-based identification of Great Lakes fauna: Match and mismatch between taxa inventories and DNA barcode libraries

EPA Science Inventory

DNA-based identification of mixed-organism samples offers the potential to greatly reduce the need for resource-intensive morphological identification, which would be of value both to biotic condition assessment and non-native species early-detection monitoring. However, the abi...

High-throughput multiplex HLA-typing by ligase detection reaction (LDR) and universal array (UA) approach.

PubMed

Consolandi, Clarissa

2009-01-01

One major goal of genetic research is to understand the role of genetic variation in living systems. In humans, by far the most common type of such variation involves differences in single DNA nucleotides, and is thus termed single nucleotide polymorphism (SNP). The need for improvement in throughput and reliability of traditional techniques makes it necessary to develop new technologies. Thus the past few years have witnessed an extraordinary surge of interest in DNA microarray technology. This new technology offers the first great hope for providing a systematic way to explore the genome. It permits a very rapid analysis of thousands genes for the purpose of gene discovery, sequencing, mapping, expression, and polymorphism detection. We generated a series of analytical tools to address the manufacturing, detection and data analysis components of a microarray experiment. In particular, we set up a universal array approach in combination with a PCR-LDR (polymerase chain reaction-ligation detection reaction) strategy for allele identification in the HLA gene.

Laser mass spectrometry for DNA fingerprinting for forensic applications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, C.H.; Tang, K.; Taranenko, N.I.

The application of DNA fingerprinting has become very broad in forensic analysis, patient identification, diagnostic medicine, and wildlife poaching, since every individual`s DNA structure is identical within all tissues of their body. DNA fingerprinting was initiated by the use of restriction fragment length polymorphisms (RFLP). In 1987, Nakamura et al. found that a variable number of tandem repeats (VNTR) often occurred in the alleles. The probability of different individuals having the same number of tandem repeats in several different alleles is very low. Thus, the identification of VNTR from genomic DNA became a very reliable method for identification of individuals.more » DNA fingerprinting is a reliable tool for forensic analysis. In DNA fingerprinting, knowledge of the sequence of tandem repeats and restriction endonuclease sites can provide the basis for identification. The major steps for conventional DNA fingerprinting include (1) specimen processing (2) amplification of selected DNA segments by PCR, and (3) gel electrophoresis to do the final DNA analysis. In this work we propose to use laser desorption mass spectrometry for fast DNA fingerprinting. The process and advantages are discussed.« less

Potential for DNA-based identification of Great Lakes fauna: match and mismatch between taxa inventories and DNA barcode libraries.

PubMed

Trebitz, Anett S; Hoffman, Joel C; Grant, George W; Billehus, Tyler M; Pilgrim, Erik M

2015-07-22

DNA-based identification of mixed-organism samples offers the potential to greatly reduce the need for resource-intensive morphological identification, which would be of value both to bioassessment and non-native species monitoring. The ability to assign species identities to DNA sequences found depends on the availability of comprehensive DNA reference libraries. Here, we compile inventories for aquatic metazoans extant in or threatening to invade the Laurentian Great Lakes and examine the availability of reference mitochondrial COI DNA sequences (barcodes) in the Barcode of Life Data System for them. We found barcode libraries largely complete for extant and threatening-to-invade vertebrates (100% of reptile, 99% of fish, and 92% of amphibian species had barcodes). In contrast, barcode libraries remain poorly developed for precisely those organisms where morphological identification is most challenging; 46% of extant invertebrates lacked reference barcodes with rates especially high among rotifers, oligochaetes, and mites. Lack of species-level identification for many aquatic invertebrates also is a barrier to matching DNA sequences with physical specimens. Attaining the potential for DNA-based identification of mixed-organism samples covering the breadth of aquatic fauna requires a concerted effort to build supporting barcode libraries and voucher collections.

Potential for DNA-based identification of Great Lakes fauna: match and mismatch between taxa inventories and DNA barcode libraries

NASA Astrophysics Data System (ADS)

Trebitz, Anett S.; Hoffman, Joel C.; Grant, George W.; Billehus, Tyler M.; Pilgrim, Erik M.

2015-07-01

DNA-based identification of mixed-organism samples offers the potential to greatly reduce the need for resource-intensive morphological identification, which would be of value both to bioassessment and non-native species monitoring. The ability to assign species identities to DNA sequences found depends on the availability of comprehensive DNA reference libraries. Here, we compile inventories for aquatic metazoans extant in or threatening to invade the Laurentian Great Lakes and examine the availability of reference mitochondrial COI DNA sequences (barcodes) in the Barcode of Life Data System for them. We found barcode libraries largely complete for extant and threatening-to-invade vertebrates (100% of reptile, 99% of fish, and 92% of amphibian species had barcodes). In contrast, barcode libraries remain poorly developed for precisely those organisms where morphological identification is most challenging; 46% of extant invertebrates lacked reference barcodes with rates especially high among rotifers, oligochaetes, and mites. Lack of species-level identification for many aquatic invertebrates also is a barrier to matching DNA sequences with physical specimens. Attaining the potential for DNA-based identification of mixed-organism samples covering the breadth of aquatic fauna requires a concerted effort to build supporting barcode libraries and voucher collections.

Disaster victim identification of military aircrew, 1945-2002.

PubMed

Smith, Adrian

2003-11-01

Aviation accident fatalities are characterized by substantial tissue disruption and fragmentation, limiting the usefulness of traditional identification methods. This study examines the success of disaster victim identification (DVI) in military aviation accident fatalities in the Australian Defense Force (ADF). Accident reports and autopsy records of aircrew fatalities during the period 1945-2002 were examined to identify difficulties experienced during the DVI process or injuries that would prevent identification of remains using non-DNA methods. The ADF had 301 aircraft fatalities sustained in 144 accidents during the period 1945-2002. The autopsy reports for 117 fatalities were reviewed (covering 73.7% of aircrew fatalities from 1960-2002). Of the 117 victims, 38 (32.4%) sustained injuries which were severe enough to prevent identification by traditional (non-DNA) comparative scientific DVI techniques of fingerprint and dental analysis. Many of the ADF fatalities who could not be positively identified in the past could be identified today through the use of DNA techniques. Successful DNA identification, however, depends on having a reference DNA profile. This paper recommends the establishment of a DNA repository to store reference blood samples to facilitate the identification of ADF aircrew remains without causing additional distress to family members.

DNA barcoding reveals a cryptic nemertean invasion in Atlantic and Mediterranean waters

NASA Astrophysics Data System (ADS)

Fernández-Álvarez, Fernando Ángel; Machordom, Annie

2013-09-01

For several groups, like nemerteans, morphology-based identification is a hard discipline, but DNA barcoding may help non-experts in the identification process. In this study, DNA barcoding is used to reveal the cryptic invasion of Pacific Cephalothrix cf. simula into Atlantic and Mediterranean coasts. Although DNA barcoding is a promising method for the identification of Nemertea, only 6 % of the known number of nemertean species is currently associated with a correct DNA barcode. Therefore, additional morphological and molecular studies are necessary to advance the utility of DNA barcoding in the characterisation of possible nemertean alien invasions.

Evaluation of massively parallel sequencing for forensic DNA methylation profiling.

PubMed

Richards, Rebecca; Patel, Jayshree; Stevenson, Kate; Harbison, SallyAnn

2018-05-11

Epigenetics is an emerging area of interest in forensic science. DNA methylation, a type of epigenetic modification, can be applied to chronological age estimation, identical twin differentiation and body fluid identification. However, there is not yet an agreed, established methodology for targeted detection and analysis of DNA methylation markers in forensic research. Recently a massively parallel sequencing-based approach has been suggested. The use of massively parallel sequencing is well established in clinical epigenetics and is emerging as a new technology in the forensic field. This review investigates the potential benefits, limitations and considerations of this technique for the analysis of DNA methylation in a forensic context. The importance of a robust protocol, regardless of the methodology used, that minimises potential sources of bias is highlighted. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Benefits and challenges to using DNA-based identification methods: An example study of larval fish from nearshore areas of Lake Superior

EPA Science Inventory

DNA-based identification methods could increase the ability of aquatic resource managers to track patterns of invasive species, especially for taxa that are difficult to identify morphologically. Nonetheless, use of DNA-based identification methods in aquatic surveys is still unc...

The impact of chimerism in DNA-based forensic sex determination analysis.

PubMed

George, Renjith; Donald, Preethy Mary; Nagraj, Sumanth Kumbargere; Idiculla, Jose Joy; Hj Ismail, Rashid

2013-01-01

Sex determination is the most important step in personal identification in forensic investigations. DNA-based sex determination analysis is comparatively more reliable than the other conventional methods of sex determination analysis. Advanced technology like real-time polymerase chain reaction (PCR) offers accurate and reproducible results and is at the level of legal acceptance. But still there are situations like chimerism where an individual possess both male and female specific factors together in their body. Sex determination analysis in such cases can give erroneous results. This paper discusses the phenomenon of chimerism and its impact on sex determination analysis in forensic investigations.

[Application of mtDNA polymorphism in species identification of sarcosaphagous insects].

PubMed

Li, Xiang; Cai, Ji-feng

2011-04-01

Species identification of sarcosaphagous insects is one of the important steps in forensic research based on the knowledge of entomology. Recent studies reveal that the application of molecular biology, especially the mtDNA sequences analysis, works well in the species identification of sarcosaphagous insects. The molecular biology characteristics, structures, polymorphism of mtDNA of sarcosaphagous insects, and the recent studies in species identification of sarcosaphagous insects are reviewed in this article.

Development of DNA-based Identification methods to track the ...

EPA Pesticide Factsheets

The ability to track the identity and abundance of larval fish, which are ubiquitous during spawning season, may lead to a greater understanding of fish species distributions in Great Lakes nearshore areas including early-detection of invasive fish species before they become established. However, larval fish are notoriously hard to identify using traditional morphological techniques. While DNA-based identification methods could increase the ability of aquatic resource managers to determine larval fish composition, use of these methods in aquatic surveys is still uncommon and presents many challenges. In response to this need, we have been working with the U. S. Fish and Wildlife Service to develop field and laboratory methods to facilitate the identification of larval fish using DNA-meta-barcoding. In 2012, we initiated a pilot-project to develop a workflow for conducting DNA-based identification, and compared the species composition at sites within the St. Louis River Estuary of Lake Superior using traditional identification versus DNA meta-barcoding. In 2013, we extended this research to conduct DNA-identification of fish larvae collected from multiple nearshore areas of the Great Lakes by the USFWS. The species composition of larval fish generally mirrored that of fish species known from the same areas, but was influenced by the timing and intensity of sampling. Results indicate that DNA-based identification needs only very low levels of biomass to detect pre

Molecular species identification with rich floristic sampling: DNA barcoding the pteridophyte flora of Japan.

PubMed

Ebihara, Atsushi; Nitta, Joel H; Ito, Motomi

2010-12-08

DNA barcoding is expected to be an effective identification tool for organisms with heteromorphic generations such as pteridophytes, which possess a morphologically simple gametophyte generation. Although a reference data set including complete coverage of the target local flora/fauna is necessary for accurate identification, DNA barcode studies including such rich taxonomic sampling on a countrywide scale are lacking. The Japanese pteridophyte flora (733 taxa including subspecies and varieties) was used to test the utility of two plastid DNA barcode regions (rbcL and trnH-psbA) with the intention of developing an identification system for native gametophytes. DNA sequences were obtained from each of 689 (94.0%) taxa for rbcL and 617 (84.2%) taxa for trnH-psbA. Mean interspecific divergence values across all taxon pairs (K2P genetic distances) did not reveal a significant difference in rate between trnH-psbA and rbcL, but mean K2P distances of each genus showed significant heterogeneity according to systematic position. The minimum fail rate of taxon discrimination in an identification test using BLAST (12.52%) was obtained when rbcL and trnH-psbA were combined, and became lower in datasets excluding infraspecific taxa or apogamous taxa, or including sexual diploids only. This study demonstrates the overall effectiveness of DNA barcodes for species identification in the Japanese pteridophyte flora. Although this flora is characterized by a high occurrence of apogamous taxa that pose a serious challenge to identification using DNA barcodes, such taxa are limited to a small number of genera, and only minimally detract from the overall success rate. In the case that a query sequence is matched to a known apogamous genus, routine species identification may not be possible. Otherwise, DNA barcoding is a practical tool for identification of most Japanese pteridophytes, and is especially anticipated to be helpful for identification of non-hybridizing gametophytes.

Forensic identification of CITES protected slimming cactus (Hoodia) using DNA barcoding.

PubMed

Gathier, Gerard; van der Niet, Timotheus; Peelen, Tamara; van Vugt, Rogier R; Eurlings, Marcel C M; Gravendeel, Barbara

2013-11-01

Slimming cactus (Hoodia), found only in southwestern Africa, is a well-known herbal product for losing weight. Consequently, Hoodia extracts are sought-after worldwide despite a CITES Appendix II status. The failure to eradicate illegal trade is due to problems with detecting and identifying Hoodia using morphological and chemical characters. Our aim was to evaluate the potential of molecular identification of Hoodia based on DNA barcoding. Screening of nrITS1 and psbA-trnH DNA sequences from 26 accessions of Ceropegieae resulted in successful identification, while conventional chemical profiling using DLI-MS led to inaccurate detection and identification of Hoodia. The presence of Hoodia in herbal products was also successfully established using DNA sequences. A validation procedure of our DNA barcoding protocol demonstrated its robustness to changes in PCR conditions. We conclude that DNA barcoding is an effective tool for Hoodia detection and identification which can contribute to preventing illegal trade. © 2013 American Academy of Forensic Sciences.

Back to BAC: The Use of Infectious Clone Technologies for Viral Mutagenesis

PubMed Central

Hall, Robyn N.; Meers, Joanne; Fowler, Elizabeth; Mahony, Timothy

2012-01-01

Bacterial artificial chromosome (BAC) vectors were first developed to facilitate the propagation and manipulation of large DNA fragments in molecular biology studies for uses such as genome sequencing projects and genetic disease models. To facilitate these studies, methodologies have been developed to introduce specific mutations that can be directly applied to the mutagenesis of infectious clones (icBAC) using BAC technologies. This has resulted in rapid identification of gene function and expression at unprecedented rates. Here we review the major developments in BAC mutagenesis in vitro. This review summarises the technologies used to construct and introduce mutations into herpesvirus icBAC. It also explores developing technologies likely to provide the next leap in understanding these important viruses. PMID:22470833

Identifying Bacterial Immune Evasion Proteins Using Phage Display.

PubMed

Fevre, Cindy; Scheepmaker, Lisette; Haas, Pieter-Jan

2017-01-01

Methods aimed at identification of immune evasion proteins are mainly rely on in silico prediction of sequence, structural homology to known evasion proteins or use a proteomics driven approach. Although proven successful these methods are limited by a low efficiency and or lack of functional identification. Here we describe a high-throughput genomic strategy to functionally identify bacterial immune evasion proteins using phage display technology. Genomic bacterial DNA is randomly fragmented and ligated into a phage display vector that is used to create a phage display library expressing bacterial secreted and membrane bound proteins. This library is used to select displayed bacterial secretome proteins that interact with host immune components.

The National DNA Data Bank of Canada: a Quebecer perspective

PubMed Central

Milot, Emmanuel; Lecomte, Marie M. J.; Germain, Hugo; Crispino, Frank

2013-01-01

The Canadian National DNA Database was created in 1998 and first used in the mid-2000. Under management by the RCMP, the National DNA Data Bank of Canada offers each year satisfactory reported statistics for its use and efficiency. Built on two indexes (convicted offenders and crime scene indexes), the database not only provides increasing matches to offenders or linked traces to the various police forces of the nation, but offers a memory repository for cold cases. Despite these achievements, the data bank is now facing new challenges that will inevitably defy the way the database is currently used. These arise from the increasing power of detection of DNA traces, the diversity of demands from police investigators and the growth of the bank itself. Examples of new requirements from the database now include familial searches, low-copy-number analyses and the correct interpretation of mixed samples. This paper aims to develop on the original way set in Québec to address some of these challenges. Nevertheless, analytic and technological advances will inevitably lead to the introduction of new technologies in forensic laboratories, such as single cell sequencing, phenotyping, and proteomics. Furthermore, it will not only request a new holistic/global approach of the forensic molecular biology sciences (through academia and a more investigative role in the laboratory), but also new legal developments. Far from being exhaustive, this paper highlights some of the current use of the database, its potential for the future, and opportunity to expand as a result of recent technological developments in molecular biology, including, but not limited to DNA identification. PMID:24312124

The National DNA Data Bank of Canada: a Quebecer perspective.

PubMed

Milot, Emmanuel; Lecomte, Marie M J; Germain, Hugo; Crispino, Frank

2013-11-20

The Canadian National DNA Database was created in 1998 and first used in the mid-2000. Under management by the RCMP, the National DNA Data Bank of Canada offers each year satisfactory reported statistics for its use and efficiency. Built on two indexes (convicted offenders and crime scene indexes), the database not only provides increasing matches to offenders or linked traces to the various police forces of the nation, but offers a memory repository for cold cases. Despite these achievements, the data bank is now facing new challenges that will inevitably defy the way the database is currently used. These arise from the increasing power of detection of DNA traces, the diversity of demands from police investigators and the growth of the bank itself. Examples of new requirements from the database now include familial searches, low-copy-number analyses and the correct interpretation of mixed samples. This paper aims to develop on the original way set in Québec to address some of these challenges. Nevertheless, analytic and technological advances will inevitably lead to the introduction of new technologies in forensic laboratories, such as single cell sequencing, phenotyping, and proteomics. Furthermore, it will not only request a new holistic/global approach of the forensic molecular biology sciences (through academia and a more investigative role in the laboratory), but also new legal developments. Far from being exhaustive, this paper highlights some of the current use of the database, its potential for the future, and opportunity to expand as a result of recent technological developments in molecular biology, including, but not limited to DNA identification.

DNA Barcodes for Forensically Important Fly Species in Brazil.

PubMed

Koroiva, Ricardo; de Souza, Mirian S; Roque, Fabio de Oliveira; Pepinelli, Mateus

2018-04-07

Here, we analyze 248 DNA barcode sequences of 35 fly species of forensic importance in Brazil. DNA barcoding can be effectively used for specimen identification of these species, allowing the unambiguous identification of 31 species, an overall success rate of 88%. Our results show a high rate of success for molecular identification using DNA barcoding sequences and open new perspectives for immature species identification, a subject on which limited forensic investigations exist in Tropical regions. We also address the implications of building a robust forensic DNA barcode database. A geographic bias is recognized for the COI dataset available for forensically important fly species in Brazil, with concentration of sequences from specimens collected mainly in sites located in the Cerrado, Mata Atlântica, and Pampa biomes.

[Principles for molecular identification of traditional Chinese materia medica using DNA barcoding].

PubMed

Chen, Shi-Lin; Yao, Hui; Han, Jian-Ping; Xin, Tian-Yi; Pang, Xiao-Hui; Shi, Lin-Chun; Luo, Kun; Song, Jing-Yuan; Hou, Dian-Yun; Shi, Shang-Mei; Qian, Zhong-Zhi

2013-01-01

Since the research of molecular identification of Chinese Materia Medica (CMM) using DNA barcode is rapidly developing and popularizing, the principle of this method is approved to be listed in the Supplement of the Pharmacopoeia of the People's Republic of China. Based on the study on comprehensive samples, the DNA barcoding systems have been established to identify CMM, i.e. ITS2 as a core barcode and psbA-trnH as a complementary locus for identification of planta medica, and COI as a core barcode and ITS2 as a complementary locus for identification of animal medica. This article introduced the principle of molecular identification of CMM using DNA barcoding and its drafting instructions. Furthermore, its application perspective was discussed.

Rapid Identification of Micro-Organisms.

DTIC Science & Technology

1985-08-26

mixed cell populations to which this technology has been applied, although many similarities exist as well. In most applications of flow cytometry, it...specific nucleic acid sequences detectable with DNA probes, are applicable only to organisms previously know to and available to the laboratory workers...peak of phycoerythrin, and the 585/593 nm yellow emission from He-Ne lasers now in development is well suited for excitation of phycocyanin . Any of the

DNA-mounted self-assembly: new approaches for genomic analysis and SNP detection.

PubMed

Bichenkova, Elena V; Lang, Zhaolei; Yu, Xuan; Rogert, Candelaria; Douglas, Kenneth T

2011-01-01

This article presents an overview of new emerging approaches for nucleic acid detection via hybridization techniques that can potentially be applied to genomic analysis and SNP identification in clinical diagnostics. Despite the availability of a diverse variety of SNP genotyping technologies on the diagnostic market, none has truly succeeded in dominating its competitors thus far. Having been designed for specific diagnostic purposes or clinical applications, each of the existing bio-assay systems (briefly outlined here) is usually limited to a relatively narrow aspect or format of nucleic acid detection, and thus cannot entirely satisfy all the varieties of commercial requirements and clinical demands. This drives the diagnostic sector to pursue novel, cost-effective approaches to ensure rapid and reliable identification of pathogenic or hereditary human diseases. Hence, the purpose of this review is to highlight some new strategic directions in DNA detection technologies in order to inspire development of novel molecular diagnostic tools and bio-assay systems with superior reliability, reproducibility, robustness, accuracy and sensitivity at lower assay cost. One approach to improving the sensitivity of an assay to confidently discriminate between single point mutations is based on the use of target assembled, split-probe systems, which constitutes the main focus of this review. Copyright © 2010 Elsevier B.V. All rights reserved.

Blood meal identification and parasite detection in laboratory-fed and field-captured Lutzomyia longipalpis by PCR using FTA databasing paper

PubMed Central

Sant’Anna, Mauricio R.V.; Jones, Nathaniel G.; Hindley, Jonathan A.; Mendes-Sousa, Antonio F.; Dillon, Rod J.; Cavalcante, Reginaldo R.; Alexander, Bruce; Bates, Paul A.

2008-01-01

The phlebotomine sand fly Lutzomyia longipalpis takes blood from a variety of wild and domestic animals and transmits Leishmania (Leishmania) infantum chagasi, etiological agent of American visceral leishmaniasis. Blood meal identification in sand flies has depended largely on serological methods but a new protocol described here uses filter-based technology to stabilise and store blood meal DNA, allowing subsequent PCR identification of blood meal sources, as well as parasite detection, in blood-fed sand flies. This technique revealed that 53.6% of field-collected sand flies captured in the back yards of houses in Teresina (Brazil) had fed on chickens. The potential applications of this technique in epidemiological studies and strategic planning for leishmaniasis control programmes are discussed. PMID:18606150

The ability of human nuclear DNA to cause false positive low-abundance heteroplasmy calls varies across the mitochondrial genome.

PubMed

Albayrak, Levent; Khanipov, Kamil; Pimenova, Maria; Golovko, George; Rojas, Mark; Pavlidis, Ioannis; Chumakov, Sergei; Aguilar, Gerardo; Chávez, Arturo; Widger, William R; Fofanov, Yuriy

2016-12-12

Low-abundance mutations in mitochondrial populations (mutations with minor allele frequency ≤ 1%), are associated with cancer, aging, and neurodegenerative disorders. While recent progress in high-throughput sequencing technology has significantly improved the heteroplasmy identification process, the ability of this technology to detect low-abundance mutations can be affected by the presence of similar sequences originating from nuclear DNA (nDNA). To determine to what extent nDNA can cause false positive low-abundance heteroplasmy calls, we have identified mitochondrial locations of all subsequences that are common or similar (one mismatch allowed) between nDNA and mitochondrial DNA (mtDNA). Performed analysis revealed up to a 25-fold variation in the lengths of longest common and longest similar (one mismatch allowed) subsequences across the mitochondrial genome. The size of the longest subsequences shared between nDNA and mtDNA in several regions of the mitochondrial genome were found to be as low as 11 bases, which not only allows using these regions to design new, very specific PCR primers, but also supports the hypothesis of the non-random introduction of mtDNA into the human nuclear DNA. Analysis of the mitochondrial locations of the subsequences shared between nDNA and mtDNA suggested that even very short (36 bases) single-end sequencing reads can be used to identify low-abundance variation in 20.4% of the mitochondrial genome. For longer (76 and 150 bases) reads, the proportion of the mitochondrial genome where nDNA presence will not interfere found to be 44.5 and 67.9%, when low-abundance mutations at 100% of locations can be identified using 417 bases long single reads. This observation suggests that the analysis of low-abundance variations in mitochondria population can be extended to a variety of large data collections such as NCBI Sequence Read Archive, European Nucleotide Archive, The Cancer Genome Atlas, and International Cancer Genome Consortium.

Comprehensive viral enrichment enables sensitive respiratory virus genomic identification and analysis by next generation sequencing.

PubMed

O'Flaherty, Brigid M; Li, Yan; Tao, Ying; Paden, Clinton R; Queen, Krista; Zhang, Jing; Dinwiddie, Darrell L; Gross, Stephen M; Schroth, Gary P; Tong, Suxiang

2018-06-01

Next generation sequencing (NGS) technologies have revolutionized the genomics field and are becoming more commonplace for identification of human infectious diseases. However, due to the low abundance of viral nucleic acids (NAs) in relation to host, viral identification using direct NGS technologies often lacks sufficient sensitivity. Here, we describe an approach based on two complementary enrichment strategies that significantly improves the sensitivity of NGS-based virus identification. To start, we developed two sets of DNA probes to enrich virus NAs associated with respiratory diseases. The first set of probes spans the genomes, allowing for identification of known viruses and full genome sequencing, while the second set targets regions conserved among viral families or genera, providing the ability to detect both known and potentially novel members of those virus groups. Efficiency of enrichment was assessed by NGS testing reference virus and clinical samples with known infection. We show significant improvement in viral identification using enriched NGS compared to unenriched NGS. Without enrichment, we observed an average of 0.3% targeted viral reads per sample. However, after enrichment, 50%-99% of the reads per sample were the targeted viral reads for both the reference isolates and clinical specimens using both probe sets. Importantly, dramatic improvements on genome coverage were also observed following virus-specific probe enrichment. The methods described here provide improved sensitivity for virus identification by NGS, allowing for a more comprehensive analysis of disease etiology. © 2018 O'Flaherty et al.; Published by Cold Spring Harbor Laboratory Press.

DNA analysis in Disaster Victim Identification.

PubMed

Montelius, Kerstin; Lindblom, Bertil

2012-06-01

DNA profiling and matching is one of the primary methods to identify missing persons in a disaster, as defined by the Interpol Disaster Victim Identification Guide. The process to identify a victim by DNA includes: the collection of the best possible ante-mortem (AM) samples, the choice of post-mortem (PM) samples, DNA-analysis, matching and statistical weighting of the genetic relationship or match. Each disaster has its own scenario, and each scenario defines its own methods for identification of the deceased.

DNA barcode-based molecular identification system for fish species.

PubMed

Kim, Sungmin; Eo, Hae-Seok; Koo, Hyeyoung; Choi, Jun-Kil; Kim, Won

2010-12-01

In this study, we applied DNA barcoding to identify species using short DNA sequence analysis. We examined the utility of DNA barcoding by identifying 53 Korean freshwater fish species, 233 other freshwater fish species, and 1339 saltwater fish species. We successfully developed a web-based molecular identification system for fish (MISF) using a profile hidden Markov model. MISF facilitates efficient and reliable species identification, overcoming the limitations of conventional taxonomic approaches. MISF is freely accessible at http://bioinfosys.snu.ac.kr:8080/MISF/misf.jsp .

Case report: on the use of the HID-Ion AmpliSeq™ Ancestry Panel in a real forensic case.

PubMed

Hollard, C; Keyser, C; Delabarde, T; Gonzalez, A; Vilela Lamego, C; Zvénigorosky, V; Ludes, B

2017-03-01

In the absence of any other conclusive forensic evidence, DNA profiling is the method of choice for body identification. This study focuses on the case of a carbonized corpse whose complete autosomal short tandem repeat (STR) profile could not lead to direct identification by the investigators. To assist in the progress of investigation, we endeavoured to determine the biogeographical origin and eye colour of the deceased individual. Along with Y chromosome and mitochondrial DNA analyses, we applied a next-generation sequencing (NGS) approach to the study of ancestry informative markers (AIMs) using the HID-Ion AmpliSeq™ Ancestry Panel launched by Thermo Fisher Scientific. This work gave us the opportunity to test this new technology in a real forensic case. Although this study highlights the benefits of such a combined approach, as it markedly improves the specificity of the biogeographical profile, it also underlines the need for the accurate characterization of a larger collection of reference populations and the necessity of caution in data interpretation.

Molecular contributions to conservation

USGS Publications Warehouse

Haig, Susan M.

1998-01-01

Recent advances in molecular technology have opened a new chapter in species conservation efforts, as well as population biology. DNA sequencing, MHC (major histocompatibility complex), minisatellite, microsatellite, and RAPD (random amplified polymorphic DNA) procedures allow for identification of parentage, more distant relatives, founders to new populations, unidentified individuals, population structure, effective population size, population-specific markers, etc. PCR (polymerase chain reaction) amplification of mitochondrial DNA, nuclear DNA, ribosomal DNA, chloroplast DNA, and other systems provide for more sophisticated analyses of metapopulation structure, hybridization events, and delineation of species, subspecies, and races, all of which aid in setting species recovery priorities. Each technique can be powerful in its own right but is most credible when used in conjunction with other molecular techniques and, most importantly, with ecological and demographic data collected from the field. Surprisingly few taxa of concern have been assayed with any molecular technique. Thus, rather than showcasing exhaustive details from a few well-known examples, this paper attempts to present a broad range of cases in which molecular techniques have been used to provide insight into conservation efforts.

Multiplex pyrosequencing of InDel markers for forensic DNA analysis.

PubMed

Bus, Magdalena M; Karas, Ognjen; Allen, Marie

2016-12-01

The capillary electrophoresis (CE) technology is commonly used for fragment length separation of markers in forensic DNA analysis. In this study, pyrosequencing technology was used as an alternative and rapid tool for the analysis of biallelic InDel (insertion/deletion) markers for individual identification. The DNA typing is based on a subset of the InDel markers that are included in the Investigator ® DIPplex Kit, which are sequenced in a multiplex pyrosequencing analysis. To facilitate the analysis of degraded DNA, the polymerase chain reaction (PCR) fragments were kept short in the primer design. Samples from individuals of Swedish origin were genotyped using the pyrosequencing strategy and analysis of the Investigator ® DIPplex markers with CE. A comparison between the pyrosequencing and CE data revealed concordant results demonstrating a robust and correct genotyping by pyrosequencing. Using optimal marker combination and a directed dispensation strategy, five markers could be multiplexed and analyzed simultaneously. In this proof-of-principle study, we demonstrate that multiplex InDel pyrosequencing analysis is possible. However, further studies on degraded samples, lower DNA quantities, and mixtures will be required to fully optimize InDel analysis by pyrosequencing for forensic applications. Overall, although CE analysis is implemented in most forensic laboratories, multiplex InDel pyrosequencing offers a cost-effective alternative for some applications. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Nonculture molecular techniques for diagnosis of bacterial disease in animals: a diagnostic laboratory perspective.

PubMed

Cai, H Y; Caswell, J L; Prescott, J F

2014-03-01

The past decade has seen remarkable technical advances in infectious disease diagnosis, and the pace of innovation is likely to continue. Many of these techniques are well suited to pathogen identification directly from pathologic or clinical samples, which is the focus of this review. Polymerase chain reaction (PCR) and gene sequencing are now routinely performed on frozen or fixed tissues for diagnosis of bacterial infections of animals. These assays are most useful for pathogens that are difficult to culture or identify phenotypically, when propagation poses a biosafety hazard, or when suitable fresh tissue is not available. Multiplex PCR assays, DNA microarrays, in situ hybridization, massive parallel DNA sequencing, microbiome profiling, molecular typing of pathogens, identification of antimicrobial resistance genes, and mass spectrometry are additional emerging technologies for the diagnosis of bacterial infections from pathologic and clinical samples in animals. These technical advances come, however, with 2 caveats. First, in the age of molecular diagnosis, quality control has become more important than ever to identify and control for the presence of inhibitors, cross-contamination, inadequate templates from diagnostic specimens, and other causes of erroneous microbial identifications. Second, the attraction of these technologic advances can obscure the reality that medical diagnoses cannot be made on the basis of molecular testing alone but instead through integrated consideration of clinical, pathologic, and laboratory findings. Proper validation of the method is required. It is critical that veterinary diagnosticians understand not only the value but also the limitations of these technical advances for routine diagnosis of infectious disease.

DNA typing for the identification of old skeletal remains from Korean War victims.

PubMed

Lee, Hwan Young; Kim, Na Young; Park, Myung Jin; Sim, Jeong Eun; Yang, Woo Ick; Shin, Kyoung-Jin

2010-11-01

The identification of missing casualties of the Korean War (1950-1953) has been performed using mitochondrial DNA (mtDNA) profiles, but recent advances in DNA extraction techniques and approaches using smaller amplicons have significantly increased the possibility of obtaining DNA profiles from highly degraded skeletal remains. Therefore, 21 skeletal remains of Korean War victims and 24 samples from biological relatives of the supposed victims were selected based on circumstantial evidence and/or mtDNA-matching results and were analyzed to confirm the alleged relationship. Cumulative likelihood ratios were obtained from autosomal short tandem repeat, Y-chromosomal STR, and mtDNA-genotyping results, and mainly confirmed the alleged relationship with values over 10⁵. The present analysis emphasizes the value of mini- and Y-STR systems as well as an efficient DNA extraction method in DNA testing for the identification of old skeletal remains. © 2010 American Academy of Forensic Sciences.

The clinical potential of Enhanced-ice-COLD-PCR.

PubMed

Tost, Jörg

2016-01-01

Enhanced-ice-COLD-PCR (E-ice-COLD-PCR) is a novel assay format that allows for the efficient enrichment and sensitive detection of all mutations in a region of interest using a chemically modified blocking oligonucleotide, which impedes the amplification of wild-type sequences. The assay is compatible with DNA extracted from tissue and cell-free circulating DNA. The main features of E-ice-COLD-PCR are the simplicity of the setup and the optimization of the assay, the use of standard laboratory equipment and the very short time to results (~4 h including DNA extraction, enrichment and sequence-based identification of mutations). E-ice-COLD-PCR is therefore a highly promising technology for a number of basic research as well as clinical applications including detection of clinically relevant mutated subclones and monitoring of treatment response or disease recurrence.

Harnessing CRISPR-Cas systems for bacterial genome editing.

PubMed

Selle, Kurt; Barrangou, Rodolphe

2015-04-01

Manipulation of genomic sequences facilitates the identification and characterization of key genetic determinants in the investigation of biological processes. Genome editing via clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated (Cas) constitutes a next-generation method for programmable and high-throughput functional genomics. CRISPR-Cas systems are readily reprogrammed to induce sequence-specific DNA breaks at target loci, resulting in fixed mutations via host-dependent DNA repair mechanisms. Although bacterial genome editing is a relatively unexplored and underrepresented application of CRISPR-Cas systems, recent studies provide valuable insights for the widespread future implementation of this technology. This review summarizes recent progress in bacterial genome editing and identifies fundamental genetic and phenotypic outcomes of CRISPR targeting in bacteria, in the context of tool development, genome homeostasis, and DNA repair. Copyright © 2015 Elsevier Ltd. All rights reserved.

Examples of kinship analysis where Profiler Plus™ was not discriminatory enough for the identification of victims using DNA identification.

PubMed

Hartman, D; Benton, L; Morenos, L; Beyer, J; Spiden, M; Stock, A

2011-02-25

The identification of the victims of the 2009 Victorian bushfires disaster, as in other mass disasters, relied on a number of scientific disciplines - including DNA analysis. As part of the DVI response, DNA analysis was performed to assist in the identification of victims through kinship (familial matching to relatives) or direct (self source of sample) matching of DNA profiles. The majority of the DNA identifications made (82%) were achieved through kinship matching of familial reference samples to post mortem (PM) samples obtained from the victims. Although each location affected by the bushfires could be treated as a mini-disaster (having a small closed-set of victims), with many such sites spread over vast areas, DNA analysis requires that the short tandem repeat (STR) system used be able to afford enough discrimination between all the DVI cases to assign a match. This publication highlights that although a 9-loci multiplex was sufficient for a DVI of this nature, there were instances that brought to light the short comings of using a 9-loci multiplex for kinship matching--particularly where multiple family members are victims. Moreso it serves to reinforce the recommendation that a minimum of 12 autosomal STR markers (plus Amelogenin) be used for DNA identification of victims which relies heavily on kinship matching. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

[Identification of antler powder components based on DNA barcoding technology].

PubMed

Jia, Jing; Shi, Lin-chun; Xu, Zhi-chao; Xin, Tian-yi; Song, Jing-yuan; Chen Shi, Lin

2015-10-01

In order to authenticate the components of antler powder in the market, DNA barcoding technology coupled with cloning method were used. Cytochrome c oxidase subunit I (COI) sequences were obtained according to the DNA barcoding standard operation procedure (SOP). For antler powder with possible mixed components, the cloning method was used to get each COI sequence. 65 COI sequences were successfully obtained from commercial antler powders via sequencing PCR products. The results indicates that only 38% of these samples were derived from Cervus nippon Temminck or Cervus elaphus Linnaeus which is recorded in the 2010 edition of "Chinese Pharmacopoeia", while 62% of them were derived from other species. Rangifer tarandus Linnaeus was the most frequent species among the adulterants. Further analysis showed that some samples collected from different regions, companies and prices, contained adulterants. Analysis of 36 COI sequences obtained by the cloning method showed that C. elaphus and C. nippon were main components. In addition, some samples were marked clearly as antler powder on the label, however, C. elaphus or R. tarandus were their main components. In summary, DNA barcoding can accurately and efficiently distinguish the exact content in the commercial antler powder, which provides a new technique to ensure clinical safety and improve quality control of Chinese traditional medicine

Simultaneous detection of ricin and abrin DNA by real-time PCR (qPCR).

PubMed

Felder, Eva; Mossbrugger, Ilona; Lange, Mirko; Wölfel, Roman

2012-09-01

Ricin and abrin are two of the most potent plant toxins known and may be easily obtained in high yield from the seeds using rather simple technology. As a result, both toxins are potent and available toxins for criminal or terrorist acts. However, as the production of highly purified ricin or abrin requires sophisticated equipment and knowledge, it may be more likely that crude extracts would be used by non-governmental perpetrators. Remaining plant-specific nucleic acids in these extracts allow the application of a real-time PCR (qPCR) assay for the detection and identification of abrin or ricin genomic material. Therefore, we have developed a duplex real-time PCR assays for simultaneous detection of ricin and abrin DNA based on the OmniMix HS bead PCR reagent mixture. Novel primers and hybridization probes were designed for detection on a SmartCycler instrument by using 5'-nuclease technology. The assay was thoroughly optimized and validated in terms of analytical sensitivity. Evaluation of the assay sensitivity by probit analysis demonstrated a 95% probability of detection at 3 genomes per reaction for ricin DNA and 1.2 genomes per reaction for abrin DNA. The suitability of the assays was exemplified by detection of ricin and abrin contaminations in a food matrix.

Identification of Belgian mosquito species (Diptera: Culicidae) by DNA barcoding.

PubMed

Versteirt, V; Nagy, Z T; Roelants, P; Denis, L; Breman, F C; Damiens, D; Dekoninck, W; Backeljau, T; Coosemans, M; Van Bortel, W

2015-03-01

Since its introduction in 2003, DNA barcoding has proven to be a promising method for the identification of many taxa, including mosquitoes (Diptera: Culicidae). Many mosquito species are potential vectors of pathogens, and correct identification in all life stages is essential for effective mosquito monitoring and control. To use DNA barcoding for species identification, a reliable and comprehensive reference database of verified DNA sequences is required. Hence, DNA sequence diversity of mosquitoes in Belgium was assessed using a 658 bp fragment of the mitochondrial cytochrome oxidase I (COI) gene, and a reference data set was established. Most species appeared as well-supported clusters. Intraspecific Kimura 2-parameter (K2P) distances averaged 0.7%, and the maximum observed K2P distance was 6.2% for Aedes koreicus. A small overlap between intra- and interspecific K2P distances for congeneric sequences was observed. Overall, the identification success using best match and the best close match criteria were high, that is above 98%. No clear genetic division was found between the closely related species Aedes annulipes and Aedes cantans, which can be confused using morphological identification only. The members of the Anopheles maculipennis complex, that is Anopheles maculipennis s.s. and An. messeae, were weakly supported as monophyletic taxa. This study showed that DNA barcoding offers a reliable framework for mosquito species identification in Belgium except for some closely related species. © 2014 John Wiley & Sons Ltd.

DNA barcoding: an efficient tool to overcome authentication challenges in the herbal market.

PubMed

Mishra, Priyanka; Kumar, Amit; Nagireddy, Akshitha; Mani, Daya N; Shukla, Ashutosh K; Tiwari, Rakesh; Sundaresan, Velusamy

2016-01-01

The past couple of decades have witnessed global resurgence of herbal-based health care. As a result, the trade of raw drugs has surged globally. Accurate and fast scientific identification of the plant(s) is the key to success for the herbal drug industry. The conventional approach is to engage an expert taxonomist, who uses a mix of traditional and modern techniques for precise plant identification. However, for bulk identification at industrial scale, the process is protracted and time-consuming. DNA barcoding, on the other hand, offers an alternative and feasible taxonomic tool box for rapid and robust species identification. For the success of DNA barcode, the barcode loci must have sufficient information to differentiate unambiguously between closely related plant species and discover new cryptic species. For herbal plant identification, matK, rbcL, trnH-psbA, ITS, trnL-F, 5S-rRNA and 18S-rRNA have been used as successful DNA barcodes. Emerging advances in DNA barcoding coupled with next-generation sequencing and high-resolution melting curve analysis have paved the way for successful species-level resolution recovered from finished herbal products. Further, development of multilocus strategy and its application has provided new vistas to the DNA barcode-based plant identification for herbal drug industry. For successful and acceptable identification of herbal ingredients and a holistic quality control of the drug, DNA barcoding needs to work harmoniously with other components of the systems biology approach. We suggest that for effectively resolving authentication challenges associated with the herbal market, DNA barcoding must be used in conjunction with metabolomics along with need-based transcriptomics and proteomics. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Molecular identification of Amazonian stingless bees using polymerase chain reaction single-strand conformation polymorphism.

PubMed

Souza, M T; Carvalho-Zilse, G A

2014-07-25

In countries containing a mega diversity of wildlife, such as Brazil, identifying and characterizing biological diversity is a continuous process for the scientific community, even in face of technological and scientific advances. This activity demands initiatives for the taxonomic identification of highly diverse groups, such as stingless bees, including molecular analysis strategies. This type of bee is distributed in all of the Brazilian states, with the highest species diversity being found in the State of Amazônia. However, the estimated number of species diverges among taxonomists. These bees are considered the main pollinators in the Amazon rainforest, in which they obtain food and shelter; however, their persistence is constantly threatened by deforestation pressure. Hence, it is important to classify the number and abundance of bee specie, to measure their decline and implement meaningful, priority conservation strategies. This study aims to maximize the implementation of more direct, economic and successful techniques for the taxonomic identification of stingless bees. Specifically, the genes 16S rRNA and COI from mitochondrial DNA were used as molecular markers to differentiate 9 species of Amazonian stingless bees based on DNA polymorphism, using the polymerase chain reaction-single-strand conformation polymorphism technique. We registered different, exclusive SSCP haplotypes for both genes in all species analyzed. These results demonstrate that SSCP is a simple and cost-effective technique that is applicable to the molecular identification of stingless bee species.

Species From Feces: Order-Wide Identification of Chiroptera From Guano and Other Non-Invasive Genetic Samples

PubMed Central

Williamson, Charles H. D.; Sanchez, Daniel E.; Sobek, Colin J.; Chambers, Carol L.

2016-01-01

Bat guano is a relatively untapped reservoir of information, having great utility as a DNA source because it is often available at roosts even when bats are not and is an easy type of sample to collect from a difficult-to-study mammalian order. Recent advances from microbial community studies in primer design, sequencing, and analysis enable fast, accurate, and cost-effective species identification. Here, we borrow from this discipline to develop an order-wide DNA mini-barcode assay (Species from Feces) based on a segment of the mitochondrial gene cytochrome c oxidase I (COI). The assay works effectively with fecal DNA and is conveniently transferable to low-cost, high-throughput Illumina MiSeq technology that also allows simultaneous pairing with other markers. Our PCR primers target a region of COI that is highly discriminatory among Chiroptera (92% species-level identification of barcoded species), and are sufficiently degenerate to allow hybridization across diverse bat taxa. We successfully validated our system with 54 bat species across both suborders. Despite abundant arthropod prey DNA in guano, our primers were highly specific to bats; no arthropod DNA was detected in thousands of feces run on Sanger and Illumina platforms. The assay is extendable to fecal pellets of unknown age as well as individual and pooled guano, to allow for individual (using singular fecal pellets) and community (using combined pellets collected from across long-term roost sites) analyses. We developed a searchable database (http://nau.edu/CEFNS/Forestry/Research/Bats/Search-Tool/) that allows users to determine the discriminatory capability of our markers for bat species of interest. Our assay has applications worldwide for examining disease impacts on vulnerable species, determining species assemblages within roosts, and assessing the presence of bat species that are vulnerable or facing extinction. The development and analytical pathways are rapid, reliable, and inexpensive, and can be applied to ecology and conservation studies of other taxa. PMID:27654850

Species From Feces: Order-Wide Identification of Chiroptera From Guano and Other Non-Invasive Genetic Samples.

PubMed

Walker, Faith M; Williamson, Charles H D; Sanchez, Daniel E; Sobek, Colin J; Chambers, Carol L

Bat guano is a relatively untapped reservoir of information, having great utility as a DNA source because it is often available at roosts even when bats are not and is an easy type of sample to collect from a difficult-to-study mammalian order. Recent advances from microbial community studies in primer design, sequencing, and analysis enable fast, accurate, and cost-effective species identification. Here, we borrow from this discipline to develop an order-wide DNA mini-barcode assay (Species from Feces) based on a segment of the mitochondrial gene cytochrome c oxidase I (COI). The assay works effectively with fecal DNA and is conveniently transferable to low-cost, high-throughput Illumina MiSeq technology that also allows simultaneous pairing with other markers. Our PCR primers target a region of COI that is highly discriminatory among Chiroptera (92% species-level identification of barcoded species), and are sufficiently degenerate to allow hybridization across diverse bat taxa. We successfully validated our system with 54 bat species across both suborders. Despite abundant arthropod prey DNA in guano, our primers were highly specific to bats; no arthropod DNA was detected in thousands of feces run on Sanger and Illumina platforms. The assay is extendable to fecal pellets of unknown age as well as individual and pooled guano, to allow for individual (using singular fecal pellets) and community (using combined pellets collected from across long-term roost sites) analyses. We developed a searchable database (http://nau.edu/CEFNS/Forestry/Research/Bats/Search-Tool/) that allows users to determine the discriminatory capability of our markers for bat species of interest. Our assay has applications worldwide for examining disease impacts on vulnerable species, determining species assemblages within roosts, and assessing the presence of bat species that are vulnerable or facing extinction. The development and analytical pathways are rapid, reliable, and inexpensive, and can be applied to ecology and conservation studies of other taxa.

Detecting and overcoming systematic bias in high-throughput screening technologies: a comprehensive review of practical issues and methodological solutions.

PubMed

Caraus, Iurie; Alsuwailem, Abdulaziz A; Nadon, Robert; Makarenkov, Vladimir

2015-11-01

Significant efforts have been made recently to improve data throughput and data quality in screening technologies related to drug design. The modern pharmaceutical industry relies heavily on high-throughput screening (HTS) and high-content screening (HCS) technologies, which include small molecule, complementary DNA (cDNA) and RNA interference (RNAi) types of screening. Data generated by these screening technologies are subject to several environmental and procedural systematic biases, which introduce errors into the hit identification process. We first review systematic biases typical of HTS and HCS screens. We highlight that study design issues and the way in which data are generated are crucial for providing unbiased screening results. Considering various data sets, including the publicly available ChemBank data, we assess the rates of systematic bias in experimental HTS by using plate-specific and assay-specific error detection tests. We describe main data normalization and correction techniques and introduce a general data preprocessing protocol. This protocol can be recommended for academic and industrial researchers involved in the analysis of current or next-generation HTS data. © The Author 2015. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

Application of Next-generation Sequencing Technology in Forensic Science

PubMed Central

Yang, Yaran; Xie, Bingbing; Yan, Jiangwei

2014-01-01

Next-generation sequencing (NGS) technology, with its high-throughput capacity and low cost, has developed rapidly in recent years and become an important analytical tool for many genomics researchers. New opportunities in the research domain of the forensic studies emerge by harnessing the power of NGS technology, which can be applied to simultaneously analyzing multiple loci of forensic interest in different genetic contexts, such as autosomes, mitochondrial and sex chromosomes. Furthermore, NGS technology can also have potential applications in many other aspects of research. These include DNA database construction, ancestry and phenotypic inference, monozygotic twin studies, body fluid and species identification, and forensic animal, plant and microbiological analyses. Here we review the application of NGS technology in the field of forensic science with the aim of providing a reference for future forensics studies and practice. PMID:25462152

DNA barcoding and morphological identification of neotropical ichthyoplankton from the Upper Paraná and São Francisco.

PubMed

Becker, R A; Sales, N G; Santos, G M; Santos, G B; Carvalho, D C

2015-07-01

The identification of fish larvae from two neotropical hydrographic basins using traditional morphological taxonomy and DNA barcoding revealed no conflicting results between the morphological and barcode identification of larvae. A lower rate (25%) of correct morphological identification of eggs as belonging to migratory or non-migratory species was achieved. Accurate identification of ichthyoplankton by DNA barcoding is an important tool for fish reproductive behaviour studies, correct estimation of biodiversity by detecting eggs from rare species, as well as defining environmental and management strategies for fish conservation in the neotropics. © 2015 The Fisheries Society of the British Isles.

Display technologies: application for the discovery of drug and gene delivery agents

PubMed Central

Sergeeva, Anna; Kolonin, Mikhail G.; Molldrem, Jeffrey J.; Pasqualini, Renata; Arap, Wadih

2007-01-01

Recognition of molecular diversity of cell surface proteomes in disease is essential for the development of targeted therapies. Progress in targeted therapeutics requires establishing effective approaches for high-throughput identification of agents specific for clinically relevant cell surface markers. Over the past decade, a number of platform strategies have been developed to screen polypeptide libraries for ligands targeting receptors selectively expressed in the context of various cell surface proteomes. Streamlined procedures for identification of ligand-receptor pairs that could serve as targets in disease diagnosis, profiling, imaging and therapy have relied on the display technologies, in which polypeptides with desired binding profiles can be serially selected, in a process called biopanning, based on their physical linkage with the encoding nucleic acid. These technologies include virus/phage display, cell display, ribosomal display, mRNA display and covalent DNA display (CDT), with phage display being by far the most utilized. The scope of this review is the recent advancements in the display technologies with a particular emphasis on molecular mapping of cell surface proteomes with peptide phage display. Prospective applications of targeted compounds derived from display libraries in the discovery of targeted drugs and gene therapy vectors are discussed. PMID:17123658

High-Throughput Block Optical DNA Sequence Identification.

PubMed

Sagar, Dodderi Manjunatha; Korshoj, Lee Erik; Hanson, Katrina Bethany; Chowdhury, Partha Pratim; Otoupal, Peter Britton; Chatterjee, Anushree; Nagpal, Prashant

2018-01-01

Optical techniques for molecular diagnostics or DNA sequencing generally rely on small molecule fluorescent labels, which utilize light with a wavelength of several hundred nanometers for detection. Developing a label-free optical DNA sequencing technique will require nanoscale focusing of light, a high-throughput and multiplexed identification method, and a data compression technique to rapidly identify sequences and analyze genomic heterogeneity for big datasets. Such a method should identify characteristic molecular vibrations using optical spectroscopy, especially in the "fingerprinting region" from ≈400-1400 cm -1 . Here, surface-enhanced Raman spectroscopy is used to demonstrate label-free identification of DNA nucleobases with multiplexed 3D plasmonic nanofocusing. While nanometer-scale mode volumes prevent identification of single nucleobases within a DNA sequence, the block optical technique can identify A, T, G, and C content in DNA k-mers. The content of each nucleotide in a DNA block can be a unique and high-throughput method for identifying sequences, genes, and other biomarkers as an alternative to single-letter sequencing. Additionally, coupling two complementary vibrational spectroscopy techniques (infrared and Raman) can improve block characterization. These results pave the way for developing a novel, high-throughput block optical sequencing method with lossy genomic data compression using k-mer identification from multiplexed optical data acquisition. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Species identification of medicinal pteridophytes by a DNA barcode marker, the chloroplast psbA-trnH intergenic region.

PubMed

Ma, Xin-Ye; Xie, Cai-Xiang; Liu, Chang; Song, Jing-Yuan; Yao, Hui; Luo, Kun; Zhu, Ying-Jie; Gao, Ting; Pang, Xiao-Hui; Qian, Jun; Chen, Shi-Lin

2010-01-01

Medicinal pteridophytes are an important group used in traditional Chinese medicine; however, there is no simple and universal way to differentiate various species of this group by morphological traits. A novel technology termed "DNA barcoding" could discriminate species by a standard DNA sequence with universal primers and sufficient variation. To determine whether DNA barcoding would be effective for differentiating pteridophyte species, we first analyzed five DNA sequence markers (psbA-trnH intergenic region, rbcL, rpoB, rpoC1, and matK) using six chloroplast genomic sequences from GeneBank and found psbA-trnH intergenic region the best candidate for availability of universal primers. Next, we amplified the psbA-trnH region from 79 samples of medicinal pteridophyte plants. These samples represented 51 species from 24 families, including all the authentic pteridophyte species listed in the Chinese pharmacopoeia (2005 version) and some commonly used adulterants. We found that the sequence of the psbA-trnH intergenic region can be determined with both high polymerase chain reaction (PCR) amplification efficiency (94.1%) and high direct sequencing success rate (81.3%). Combined with GeneBank data (54 species cross 12 pteridophyte families), species discriminative power analysis showed that 90.2% of species could be separated/identified successfully by the TaxonGap method in conjunction with the Basic Local Alignment Search Tool 1 (BLAST1) method. The TaxonGap method results further showed that, for 37 out of 39 separable species with at least two samples each, between-species variation was higher than the relevant within-species variation. Thus, the psbA-trnH intergenic region is a suitable DNA marker for species identification in medicinal pteridophytes.

20 years since the introduction of DNA barcoding: from theory to application.

PubMed

Fišer Pečnikar, Živa; Buzan, Elena V

2014-02-01

Traditionally, taxonomic identification has relied upon morphological characters. In the last two decades, molecular tools based on DNA sequences of short standardised gene fragments, termed DNA barcodes, have been developed for species discrimination. The most common DNA barcode used in animals is a fragment of the cytochrome c oxidase (COI) mitochondrial gene, while for plants, two chloroplast gene fragments from the RuBisCo large subunit (rbcL) and maturase K (matK) genes are widely used. Information gathered from DNA barcodes can be used beyond taxonomic studies and will have far-reaching implications across many fields of biology, including ecology (rapid biodiversity assessment and food chain analysis), conservation biology (monitoring of protected species), biosecurity (early identification of invasive pest species), medicine (identification of medically important pathogens and their vectors) and pharmacology (identification of active compounds). However, it is important that the limitations of DNA barcoding are understood and techniques continually adapted and improved as this young science matures.

Identification of body fluid-specific DNA methylation markers for use in forensic science.

PubMed

Park, Jong-Lyul; Kwon, Oh-Hyung; Kim, Jong Hwan; Yoo, Hyang-Sook; Lee, Han-Chul; Woo, Kwang-Man; Kim, Seon-Young; Lee, Seung-Hwan; Kim, Yong Sung

2014-11-01

DNA methylation, which occurs at the 5'-position of the cytosine in CpG dinucleotides, has great potential for forensic identification of body fluids, because tissue-specific patterns of DNA methylation have been demonstrated, and DNA is less prone to degradation than proteins or RNA. Previous studies have reported several body fluid-specific DNA methylation markers, but DNA methylation differences are sometimes low in saliva and vaginal secretions. Moreover, specific DNA methylation markers in four types of body fluids (blood, saliva, semen, and vaginal secretions) have not been investigated with genome-wide profiling. Here, we investigated novel DNA methylation markers for identification of body fluids for use in forensic science using the Illumina HumanMethylation 450K bead array, which contains over 450,000 CpG sites. Using methylome data from 16 samples of blood, saliva, semen, and vaginal secretions, we first selected 2986 hypermethylated or hypomethylated regions that were specific for each type of body fluid. We then selected eight CpG sites as novel, forensically relevant DNA methylation markers: cg06379435 and cg08792630 for blood, cg26107890 and cg20691722 for saliva, cg23521140 and cg17610929 for semen, and cg01774894 and cg14991487 for vaginal secretions. These eight selected markers were evaluated in 80 body fluid samples using pyrosequencing, and all showed high sensitivity and specificity for identification of the target body fluid. We suggest that these eight DNA methylation markers may be good candidates for developing an effective molecular assay for identification of body fluids in forensic science. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Nanopore sequencing technology: a new route for the fast detection of unauthorized GMO.

PubMed

Fraiture, Marie-Alice; Saltykova, Assia; Hoffman, Stefan; Winand, Raf; Deforce, Dieter; Vanneste, Kevin; De Keersmaecker, Sigrid C J; Roosens, Nancy H C

2018-05-21

In order to strengthen the current genetically modified organism (GMO) detection system for unauthorized GMO, we have recently developed a new workflow based on DNA walking to amplify unknown sequences surrounding a known DNA region. This DNA walking is performed on transgenic elements, commonly found in GMO, that were earlier detected by real-time PCR (qPCR) screening. Previously, we have demonstrated the ability of this approach to detect unauthorized GMO via the identification of unique transgene flanking regions and the unnatural associations of elements from the transgenic cassette. In the present study, we investigate the feasibility to integrate the described workflow with the MinION Next-Generation-Sequencing (NGS). The MinION sequencing platform can provide long read-lengths and deal with heterogenic DNA libraries, allowing for rapid and efficient delivery of sequences of interest. In addition, the ability of this NGS platform to characterize unauthorized and unknown GMO without any a priori knowledge has been assessed.

Identification of Neoceratitis asiatica (Becker) (Diptera: Tephritidae) based on morphological characteristics and DNA barcode.

PubMed

Guo, Shaokun; He, Jia; Zhao, Zihua; Liu, Lijun; Gao, Liyuan; Wei, Shuhua; Guo, Xiaoyu; Zhang, Rong; Li, Zhihong

2017-12-12

Neoceratitis asiatica (Becker), which especially infests wolfberry (Lycium barbarum L.), could cause serious economic losses every year in China, especially to organic wolfberry production. In some important wolfberry plantings, it is difficult and time-consuming to rear the larvae or pupae to adults for morphological identification. Molecular identification based on DNA barcode is a solution to the problem. In this study, 15 samples were collected from Ningxia, China. Among them, five adults were identified according to their morphological characteristics. The utility of mitochondrial DNA (mtDNA) cytochrome c oxidase I (COI) gene sequence as DNA barcode in distinguishing N. asiatica was evaluated by analysing Kimura 2-parameter distances and phylogenetic trees. There were significant differences between intra-specific and inter-specific genetic distances according to the barcoding gap analysis. The uncertain larval and pupal samples were within the same cluster as N. asiatica adults and formed sister cluster to N. cyanescens. A combination of morphological and molecular methods enabled accurate identification of N. asiatica. This is the first study using DNA barcode to identify N. asiatica and the obtained DNA sequences will be added to the DNA barcode database.

DNA analysis in perpetrator identification of terrorism-related disaster: suicide bombing of the Australian Embassy in Jakarta 2004.

PubMed

Sudoyo, Herawati; Widodo, Putut T; Suryadi, Helena; Lie, Yuliana S; Safari, Dodi; Widjajanto, Agung; Kadarmo, D Aji; Hidayat, Soegeng; Marzuki, Sangkot

2008-06-01

We report the strategy that we employed to identify the perpetrator of a suicide car bombing in front of the Australian Embassy in Jakarta, Indonesia, on 9 September 2004. The bomb was so massive that only small tissue pieces of the perpetrator could be recovered, preventing conventional approach to the identification of the bomber, necessitating the introduction of DNA analysis as the primary means for perpetrator identification. Crime scene investigation revealed the trajectory of the bomb blast, which was used to guide the collection of charred tissue fragments of the perpetrator. Mitochondrial DNA analysis was first conducted on 17 tissue fragments, recovered over large areas of the trajectory to, (a) confirm that they are of a common source, i.e. the perpetrator, and thus (b) establish the mtDNA HV1 sequence profile of the perpetrator. The mtDNA of the perpetrator matches that of a maternally related family member of one of four suspects. Standard autosomal STR analysis confirmed the identification. This case is of interest as an illustration of a successful application of DNA analysis as the primary means of disaster perpetrator identification.

Patient identification error among prostate needle core biopsy specimens--are we ready for a DNA time-out?

PubMed

Suba, Eric J; Pfeifer, John D; Raab, Stephen S

2007-10-01

Patient identification errors in surgical pathology often involve switches of prostate or breast needle core biopsy specimens among patients. We assessed strategies for decreasing the occurrence of these uncommon and yet potentially catastrophic events. Root cause analyses were performed following 3 cases of patient identification error involving prostate needle core biopsy specimens. Patient identification errors in surgical pathology result from slips and lapses of automatic human action that may occur at numerous steps during pre-laboratory, laboratory and post-laboratory work flow processes. Patient identification errors among prostate needle biopsies may be difficult to entirely prevent through the optimization of work flow processes. A DNA time-out, whereby DNA polymorphic microsatellite analysis is used to confirm patient identification before radiation therapy or radical surgery, may eliminate patient identification errors among needle biopsies.

The Impact of DNA Topology and Guide Length on Target Selection by a Cytosine-Specific Cas9.

PubMed

Tsui, Tsz Kin Martin; Hand, Travis H; Duboy, Emily C; Li, Hong

2017-06-16

Cas9 is an RNA-guided DNA cleavage enzyme being actively developed for genome editing and gene regulation. To be cleaved by Cas9, a double stranded DNA, or the protospacer, must be complementary to the guide region, typically 20-nucleotides in length, of the Cas9-bound guide RNA, and adjacent to a short Cas9-specific element called Protospacer Adjacent Motif (PAM). Understanding the correct juxtaposition of the protospacer- and PAM-interaction with Cas9 will enable development of versatile and safe Cas9-based technology. We report identification and biochemical characterization of Cas9 from Acidothermus cellulolyticus (AceCas9). AceCas9 depends on a 5'-NNNCC-3' PAM and is more efficient in cleaving negative supercoils than relaxed DNA. Kinetic as well as in vivo activity assays reveal that AceCas9 achieves optimal activity when combined with a guide RNA containing a 24-nucleotide complementarity region. The cytosine-specific, DNA topology-sensitive, and extended guide-dependent properties of AceCas9 may be explored for specific genome editing applications.

DNA Barcoding of Neotropical Sand Flies (Diptera, Psychodidae, Phlebotominae): Species Identification and Discovery within Brazil

PubMed Central

Pinto, Israel de Souza; Chagas, Bruna Dias das; Rodrigues, Andressa Alencastre Fuzari; Ferreira, Adelson Luiz; Rezende, Helder Ricas; Bruno, Rafaela Vieira; Falqueto, Aloisio; Andrade-Filho, José Dilermando; Galati, Eunice Aparecida Bianchi; Shimabukuro, Paloma Helena Fernandes; Brazil, Reginaldo Peçanha

2015-01-01

DNA barcoding has been an effective tool for species identification in several animal groups. Here, we used DNA barcoding to discriminate between 47 morphologically distinct species of Brazilian sand flies. DNA barcodes correctly identified approximately 90% of the sampled taxa (42 morphologically distinct species) using clustering based on neighbor-joining distance, of which four species showed comparatively higher maximum values of divergence (range 4.23–19.04%), indicating cryptic diversity. The DNA barcodes also corroborated the resurrection of two species within the shannoni complex and provided an efficient tool to differentiate between morphologically indistinguishable females of closely related species. Taken together, our results validate the effectiveness of DNA barcoding for species identification and the discovery of cryptic diversity in sand flies from Brazil. PMID:26506007

DNA Barcoding of Neotropical Sand Flies (Diptera, Psychodidae, Phlebotominae): Species Identification and Discovery within Brazil.

PubMed

Pinto, Israel de Souza; Chagas, Bruna Dias das; Rodrigues, Andressa Alencastre Fuzari; Ferreira, Adelson Luiz; Rezende, Helder Ricas; Bruno, Rafaela Vieira; Falqueto, Aloisio; Andrade-Filho, José Dilermando; Galati, Eunice Aparecida Bianchi; Shimabukuro, Paloma Helena Fernandes; Brazil, Reginaldo Peçanha; Peixoto, Alexandre Afranio

2015-01-01

DNA barcoding has been an effective tool for species identification in several animal groups. Here, we used DNA barcoding to discriminate between 47 morphologically distinct species of Brazilian sand flies. DNA barcodes correctly identified approximately 90% of the sampled taxa (42 morphologically distinct species) using clustering based on neighbor-joining distance, of which four species showed comparatively higher maximum values of divergence (range 4.23-19.04%), indicating cryptic diversity. The DNA barcodes also corroborated the resurrection of two species within the shannoni complex and provided an efficient tool to differentiate between morphologically indistinguishable females of closely related species. Taken together, our results validate the effectiveness of DNA barcoding for species identification and the discovery of cryptic diversity in sand flies from Brazil.

Simple and efficient identification of rare recessive pathologically important sequence variants from next generation exome sequence data.

PubMed

Carr, Ian M; Morgan, Joanne; Watson, Christopher; Melnik, Svitlana; Diggle, Christine P; Logan, Clare V; Harrison, Sally M; Taylor, Graham R; Pena, Sergio D J; Markham, Alexander F; Alkuraya, Fowzan S; Black, Graeme C M; Ali, Manir; Bonthron, David T

2013-07-01

Massively parallel ("next generation") DNA sequencing (NGS) has quickly become the method of choice for seeking pathogenic mutations in rare uncharacterized monogenic diseases. Typically, before DNA sequencing, protein-coding regions are enriched from patient genomic DNA, representing either the entire genome ("exome sequencing") or selected mapped candidate loci. Sequence variants, identified as differences between the patient's and the human genome reference sequences, are then filtered according to various quality parameters. Changes are screened against datasets of known polymorphisms, such as dbSNP and the 1000 Genomes Project, in the effort to narrow the list of candidate causative variants. An increasing number of commercial services now offer to both generate and align NGS data to a reference genome. This potentially allows small groups with limited computing infrastructure and informatics skills to utilize this technology. However, the capability to effectively filter and assess sequence variants is still an important bottleneck in the identification of deleterious sequence variants in both research and diagnostic settings. We have developed an approach to this problem comprising a user-friendly suite of programs that can interactively analyze, filter and screen data from enrichment-capture NGS data. These programs ("Agile Suite") are particularly suitable for small-scale gene discovery or for diagnostic analysis. © 2013 WILEY PERIODICALS, INC.

Epigenomics in cancer management

PubMed Central

Costa, Fabricio F

2010-01-01

The identification of all epigenetic modifications implicated in gene expression is the next step for a better understanding of human biology in both normal and pathological states. This field is referred to as epigenomics, and it is defined as epigenetic changes (ie, DNA methylation, histone modifications and regulation by noncoding RNAs such as microRNAs) on a genomic scale rather than a single gene. Epigenetics modulate the structure of the chromatin, thereby affecting the transcription of genes in the genome. Different studies have already identified changes in epigenetic modifications in a few genes in specific pathways in cancers. Based on these epigenetic changes, drugs against different types of tumors were developed, which mainly target epimutations in the genome. Examples include DNA methylation inhibitors, histone modification inhibitors, and small molecules that target chromatin-remodeling proteins. However, these drugs are not specific, and side effects are a major problem; therefore, new DNA sequencing technologies combined with epigenomic tools have the potential to identify novel biomarkers and better molecular targets to treat cancers. The purpose of this review is to discuss current and emerging epigenomic tools and to address how these new technologies may impact the future of cancer management. PMID:21188117

Identification and characterization of Highlands J virus from a Mississippi sandhill crane using unbiased next-generation sequencing

USGS Publications Warehouse

Ip, Hon S.; Wiley, Michael R.; Long, Renee; Gustavo, Palacios; Shearn-Bochsler, Valerie; Whitehouse, Chris A.

2014-01-01

Advances in massively parallel DNA sequencing platforms, commonly termed next-generation sequencing (NGS) technologies, have greatly reduced time, labor, and cost associated with DNA sequencing. Thus, NGS has become a routine tool for new viral pathogen discovery and will likely become the standard for routine laboratory diagnostics of infectious diseases in the near future. This study demonstrated the application of NGS for the rapid identification and characterization of a virus isolated from the brain of an endangered Mississippi sandhill crane. This bird was part of a population restoration effort and was found in an emaciated state several days after Hurricane Isaac passed over the refuge in Mississippi in 2012. Post-mortem examination had identified trichostrongyliasis as the possible cause of death, but because a virus with morphology consistent with a togavirus was isolated from the brain of the bird, an arboviral etiology was strongly suspected. Because individual molecular assays for several known arboviruses were negative, unbiased NGS by Illumina MiSeq was used to definitively identify and characterize the causative viral agent. Whole genome sequencing and phylogenetic analysis revealed the viral isolate to be the Highlands J virus, a known avian pathogen. This study demonstrates the use of unbiased NGS for the rapid detection and characterization of an unidentified viral pathogen and the application of this technology to wildlife disease diagnostics and conservation medicine.

DNA barcode data accurately assign higher spider taxa

PubMed Central

Coddington, Jonathan A.; Agnarsson, Ingi; Cheng, Ren-Chung; Čandek, Klemen; Driskell, Amy; Frick, Holger; Gregorič, Matjaž; Kostanjšek, Rok; Kropf, Christian; Kweskin, Matthew; Lokovšek, Tjaša; Pipan, Miha; Vidergar, Nina

2016-01-01

The use of unique DNA sequences as a method for taxonomic identification is no longer fundamentally controversial, even though debate continues on the best markers, methods, and technology to use. Although both existing databanks such as GenBank and BOLD, as well as reference taxonomies, are imperfect, in best case scenarios “barcodes” (whether single or multiple, organelle or nuclear, loci) clearly are an increasingly fast and inexpensive method of identification, especially as compared to manual identification of unknowns by increasingly rare expert taxonomists. Because most species on Earth are undescribed, a complete reference database at the species level is impractical in the near term. The question therefore arises whether unidentified species can, using DNA barcodes, be accurately assigned to more inclusive groups such as genera and families—taxonomic ranks of putatively monophyletic groups for which the global inventory is more complete and stable. We used a carefully chosen test library of CO1 sequences from 49 families, 313 genera, and 816 species of spiders to assess the accuracy of genus and family-level assignment. We used BLAST queries of each sequence against the entire library and got the top ten hits. The percent sequence identity was reported from these hits (PIdent, range 75–100%). Accurate assignment of higher taxa (PIdent above which errors totaled less than 5%) occurred for genera at PIdent values >95 and families at PIdent values ≥ 91, suggesting these as heuristic thresholds for accurate generic and familial identifications in spiders. Accuracy of identification increases with numbers of species/genus and genera/family in the library; above five genera per family and fifteen species per genus all higher taxon assignments were correct. We propose that using percent sequence identity between conventional barcode sequences may be a feasible and reasonably accurate method to identify animals to family/genus. However, the quality of the underlying database impacts accuracy of results; many outliers in our dataset could be attributed to taxonomic and/or sequencing errors in BOLD and GenBank. It seems that an accurate and complete reference library of families and genera of life could provide accurate higher level taxonomic identifications cheaply and accessibly, within years rather than decades. PMID:27547527

Binary electrokinetic separation of target DNA from background DNA primers.

DOE Office of Scientific and Technical Information (OSTI.GOV)

James, Conrad D.; Derzon, Mark Steven

2005-10-01

This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting themore » entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.« less

Submicrometre geometrically encoded fluorescent barcodes self-assembled from DNA

NASA Astrophysics Data System (ADS)

Lin, Chenxiang; Jungmann, Ralf; Leifer, Andrew M.; Li, Chao; Levner, Daniel; Church, George M.; Shih, William M.; Yin, Peng

2012-10-01

The identification and differentiation of a large number of distinct molecular species with high temporal and spatial resolution is a major challenge in biomedical science. Fluorescence microscopy is a powerful tool, but its multiplexing ability is limited by the number of spectrally distinguishable fluorophores. Here, we used (deoxy)ribonucleic acid (DNA)-origami technology to construct submicrometre nanorods that act as fluorescent barcodes. We demonstrate that spatial control over the positioning of fluorophores on the surface of a stiff DNA nanorod can produce 216 distinct barcodes that can be decoded unambiguously using epifluorescence or total internal reflection fluorescence microscopy. Barcodes with higher spatial information density were demonstrated via the construction of super-resolution barcodes with features spaced by ˜40 nm. One species of the barcodes was used to tag yeast surface receptors, which suggests their potential applications as in situ imaging probes for diverse biomolecular and cellular entities in their native environments.

Sub-micrometer Geometrically Encoded Fluorescent Barcodes Self-Assembled from DNA

PubMed Central

Lin, Chenxiang; Jungmann, Ralf; Leifer, Andrew M.; Li, Chao; Levner, Daniel; Church, George M.; Shih, William M.; Yin, Peng

2012-01-01

The identification and differentiation of a large number of distinct molecular species with high temporal and spatial resolution is a major challenge in biomedical science. Fluorescence microscopy is a powerful tool, but its multiplexing ability is limited by the number of spectrally distinguishable fluorophores. Here we use DNA-origami technology to construct sub-micrometer nanorods that act as fluorescent barcodes. We demonstrate that spatial control over the positioning of fluorophores on the surface of a stiff DNA nanorod can produce 216 distinct barcodes that can be unambiguously decoded using epifluorescence or total internal reflection fluorescence (TIRF) microscopy. Barcodes with higher spatial information density were demonstrated via the construction of super-resolution barcodes with features spaced by ~40 nm. One species of the barcodes was used to tag yeast surface receptors, suggesting their potential applications as in situ imaging probes for diverse biomolecular and cellular entities in their native environments. PMID:23000997

An integrated strategy combining DNA walking and NGS to detect GMOs.

PubMed

Fraiture, Marie-Alice; Herman, Philippe; Papazova, Nina; De Loose, Marc; Deforce, Dieter; Ruttink, Tom; Roosens, Nancy H

2017-10-01

Recently, we developed a DNA walking system for the detection and characterization of a broad spectrum of GMOs in routine analysis of food/feed matrices. Here, we present a new version with improved throughput and sensitivity by coupling the DNA walking system to Pacific Bioscience® Next-generation sequencing technology. The performance of the new strategy was thoroughly assessed through several assays. First, we tested its detection and identification capability on grains with high or low GMO content. Second, the potential impacts of food processing were investigated using rice noodle samples. Finally, GMO mixtures and a real-life sample were analyzed to illustrate the applicability of the proposed strategy in routine GMO analysis. In all tested samples, the presence of multiple GMOs was unambiguously proven by the characterization of transgene flanking regions and the combinations of elements that are typical for transgene constructs. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Validating DNA barcodes: A non-destructive extraction protocol enables simultaneous vouchering of DNA and morphological vouchers

USDA-ARS?s Scientific Manuscript database

Morphology-based keys support accurate identification of many taxa. However, identification can be difficult for taxa that are not well studied, very small, members of cryptic species complexes, or represented by immature stages. For such cases, DNA barcodes may provide diagnostic characters. Ecolog...

DNA preservation in skeletal elements from the World Trade Center disaster: recommendations for mass fatality management.

PubMed

Mundorff, Amy Z; Bartelink, Eric J; Mar-Cash, Elaine

2009-07-01

The World Trade Center (WTC) victim identification effort highlights taphonomic influences on the degradation of DNA from victims of mass fatality incidents. This study uses a subset of the WTC-Human Remains Database to evaluate differential preservation of DNA by skeletal element. Recovery location, sex, and victim type (civilian, firefighter, or plane passenger) do not appear to influence DNA preservation. Results indicate that more intact elements, as well as elements encased in soft tissue, produced slightly higher identification rates than more fragmented remains. DNA identification rates by element type conform to previous findings, with higher rates generally found in denser, weight-bearing bones. However, smaller bones including patellae, metatarsals, and foot phalanges yielded rates comparable to both femora and tibiae. These elements can be easily sampled with a disposable scalpel, and thus reduce potential DNA contamination. These findings have implications for DNA sampling guidelines in future mass fatality incidents.

Combined analysis of transcriptome and proteome data as a tool for the identification of candidate biomarkers in renal cell carcinoma

PubMed Central

Seliger, Barbara; Dressler, Sven P.; Wang, Ena; Kellner, Roland; Recktenwald, Christian V.; Lottspeich, Friedrich; Marincola, Francesco M.; Baumgärtner, Maja; Atkins, Derek; Lichtenfels, Rudolf

2012-01-01

Results obtained from expression profilings of renal cell carcinoma using different “ome”-based approaches and comprehensive data analysis demonstrated that proteome-based technologies and cDNA microarray analyses complement each other during the discovery phase for disease-related candidate biomarkers. The integration of the respective data revealed the uniqueness and complementarities of the different technologies. While comparative cDNA microarray analyses though restricted to upregulated targets largely revealed genes involved in controlling gene/protein expression (19%) and signal transduction processes (13%), proteomics/PROTEOMEX-defined candidate biomarkers include enzymes of the cellular metabolism (36%), transport proteins (12%) and cell motility/structural molecules (10%). Candidate biomarkers defined by proteomics and PROTEOMEX are frequently shared, whereas the sharing rate between cDNA microarray and proteome-based profilings is limited. Putative candidate biomarkers provide insights into their cellular (dys)function and their diagnostic/prognostic value but still warrant further validation in larger patient numbers. Based on the fact that merely 3 candidate biomarkers were shared by all applied technologies, namely annexin A4, tubulin alpha-1A chain and ubiquitin carboxyl-terminal hydrolase L1 the analysis at a single hierarchical level of biological regulation seems to provide only limited results thus emphasizing the importance and benefit of performing rather combinatorial screenings which can complement the standard clinical predictors. PMID:19235166

Development of a DNA Microarray-Based Assay for the Detection of Sugar Beet Root Rot Pathogens.

PubMed

Liebe, Sebastian; Christ, Daniela S; Ehricht, Ralf; Varrelmann, Mark

2016-01-01

Sugar beet root rot diseases that occur during the cropping season or in storage are accompanied by high yield losses and a severe reduction of processing quality. The vast diversity of microorganism species involved in rot development requires molecular tools allowing simultaneous identification of many different targets. Therefore, a new microarray technology (ArrayTube) was applied in this study to improve diagnosis of sugar beet root rot diseases. Based on three marker genes (internal transcribed spacer, translation elongation factor 1 alpha, and 16S ribosomal DNA), 42 well-performing probes enabled the identification of prevalent field pathogens (e.g., Aphanomyces cochlioides), storage pathogens (e.g., Botrytis cinerea), and ubiquitous spoilage fungi (e.g., Penicillium expansum). All probes were proven for specificity with pure cultures from 73 microorganism species as well as for in planta detection of their target species using inoculated sugar beet tissue. Microarray-based identification of root rot pathogens in diseased field beets was successfully confirmed by classical detection methods. The high discriminatory potential was proven by Fusarium species differentiation based on a single nucleotide polymorphism. The results demonstrate that the ArrayTube constitute an innovative tool allowing a rapid and reliable detection of plant pathogens particularly when multiple microorganism species are present.

History of retinoic acid receptors.

PubMed

Benbrook, Doris M; Chambon, Pierre; Rochette-Egly, Cécile; Asson-Batres, Mary Ann

2014-01-01

The discovery of retinoic acid receptors arose from research into how vitamins are essential for life. Early studies indicated that Vitamin A was metabolized into an active factor, retinoic acid (RA), which regulates RNA and protein expression in cells. Each step forward in our understanding of retinoic acid in human health was accomplished by the development and application of new technologies. Development cDNA cloning techniques and discovery of nuclear receptors for steroid hormones provided the basis for identification of two classes of retinoic acid receptors, RARs and RXRs, each of which has three isoforms, α, β and ɣ. DNA manipulation and crystallographic studies revealed that the receptors contain discrete functional domains responsible for binding to DNA, ligands and cofactors. Ligand binding was shown to induce conformational changes in the receptors that cause release of corepressors and recruitment of coactivators to create functional complexes that are bound to consensus promoter DNA sequences called retinoic acid response elements (RAREs) and that cause opening of chromatin and transcription of adjacent genes. Homologous recombination technology allowed the development of mice lacking expression of retinoic acid receptors, individually or in various combinations, which demonstrated that the receptors exhibit vital, but redundant, functions in fetal development and in vision, reproduction, and other functions required for maintenance of adult life. More recent advancements in sequencing and proteomic technologies reveal the complexity of retinoic acid receptor involvement in cellular function through regulation of gene expression and kinase activity. Future directions will require systems biology approaches to decipher how these integrated networks affect human stem cells, health, and disease.

Recent advances in rice genome and chromosome structure research by fluorescence in situ hybridization (FISH).

PubMed

Ohmido, Nobuko; Fukui, Kiichi; Kinoshita, Toshiro

2010-01-01

Fluorescence in situ hybridization (FISH) is an effective method for the physical mapping of genes and repetitive DNA sequences on chromosomes. Physical mapping of unique nucleotide sequences on specific rice chromosome regions was performed using a combination of chromosome identification and highly sensitive FISH. Increases in the detection sensitivity of smaller DNA sequences and improvements in spatial resolution have ushered in a new phase in FISH technology. Thus, it is now possible to perform in situ hybridization on somatic chromosomes, pachytene chromosomes, and even on extended DNA fibers (EDFs). Pachytene-FISH allows the integration of genetic linkage maps and quantitative chromosome maps. Visualization methods using FISH can reveal the spatial organization of the centromere, heterochromatin/euchromatin, and the terminal structures of rice chromosomes. Furthermore, EDF-FISH and the DNA combing technique can resolve a spatial distance of 1 kb between adjacent DNA sequences, and the detection of even a 300-bp target is now feasible. The copy numbers of various repetitive sequences and the sizes of various DNA molecules were quantitatively measured using the molecular combing technique. This review describes the significance of these advances in molecular cytology in rice and discusses future applications in plant studies using visualization techniques.

DNA identification of human remains in Disaster Victim Identification (DVI): An efficient sampling method for muscle, bone, bone marrow and teeth.

PubMed

de Boer, Hans H; Maat, George J R; Kadarmo, D Aji; Widodo, Putut T; Kloosterman, Ate D; Kal, Arnoud J

2018-06-04

In disaster victim identification (DVI), DNA profiling is considered to be one of the most reliable and efficient means to identify bodies or separated body parts. This requires a post mortem DNA sample, and an ante mortem DNA sample of the presumed victim or their biological relative(s). Usually the collection of an adequate ante mortem sample is technically simple, but the acquisition of a good quality post mortem sample under unfavourable DVI circumstances is complicated due to the variable degree of preservation of the human remains and the high risk of DNA (cross) contamination. This paper provides the community with an efficient method to collect post-mortem DNA samples from muscle, bone, bone marrow and teeth, with a minimal risk of contamination. Our method has been applied in a recent, challenging DVI operation (i.e. the identification of the 298 victims of the MH17 airplane crash in 2014). 98,2% of the collected PM samples provided the DVI team with highly informative DNA genotyping results without the risk of contamination and consequent mistyping the victim's DNA. Moreover, the method is easy, cheap and quick. This paper provides the DVI community with a step-wise instructions with recommendations for the type of tissue to be sampled and the site of excision (preferably the upper leg). Although initially designed for DVI purposes, the method is also suited for the identification of individual victims. Copyright © 2018 Elsevier B.V. All rights reserved.

Structured oligonucleotides for target indexing to allow single-vessel PCR amplification and solid support microarray hybridization

PubMed Central

Girard, Laurie D.; Boissinot, Karel; Peytavi, Régis; Boissinot, Maurice; Bergeron, Michel G.

2014-01-01

The combination of molecular diagnostic technologies is increasingly used to overcome limitations on sensitivity, specificity or multiplexing capabilities, and provide efficient lab-on-chip devices. Two such techniques, PCR amplification and microarray hybridization are used serially to take advantage of the high sensitivity and specificity of the former combined with high multiplexing capacities of the latter. These methods are usually performed in different buffers and reaction chambers. However, these elaborate methods have a high complexity cost related to reagent requirements, liquid storage and the number of reaction chambers to integrate into automated devices. Furthermore, microarray hybridizations have a sequence dependent efficiency not always predictable. In this work, we have developed the concept of a structured oligonucleotide probe which is activated by cleavage from polymerase exonuclease activity. This technology is called SCISSOHR for Structured Cleavage Induced Single-Stranded Oligonucleotide Hybridization Reaction. The SCISSOHR probes enable indexing the target sequence to a tag sequence. The SCISSOHR technology also allows the combination of nucleic acid amplification and microarray hybridization in a single vessel in presence of the PCR buffer only. The SCISSOHR technology uses an amplification probe that is irreversibly modified in presence of the target, releasing a single-stranded DNA tag for microarray hybridization. Each tag is composed of a 3-nucleotidesequence-dependent segment and a unique “target sequence-independent” 14-nucleotide segment allowing for optimal hybridization with minimal cross-hybridization. We evaluated the performance of five (5) PCR buffers to support microarray hybridization, compared to a conventional hybridization buffer. Finally, as a proof of concept, we developed a multiplexed assay for the amplification, detection, and identification of three (3) DNA targets. This new technology will facilitate the design of lab-on-chip microfluidic devices, while also reducing consumable costs. At term, it will allow the cost-effective automation of highly multiplexed assays for detection and identification of genetic targets. PMID:25489607

Structured oligonucleotides for target indexing to allow single-vessel PCR amplification and solid support microarray hybridization.

PubMed

Girard, Laurie D; Boissinot, Karel; Peytavi, Régis; Boissinot, Maurice; Bergeron, Michel G

2015-02-07

The combination of molecular diagnostic technologies is increasingly used to overcome limitations on sensitivity, specificity or multiplexing capabilities, and provide efficient lab-on-chip devices. Two such techniques, PCR amplification and microarray hybridization are used serially to take advantage of the high sensitivity and specificity of the former combined with high multiplexing capacities of the latter. These methods are usually performed in different buffers and reaction chambers. However, these elaborate methods have high complexity and cost related to reagent requirements, liquid storage and the number of reaction chambers to integrate into automated devices. Furthermore, microarray hybridizations have a sequence dependent efficiency not always predictable. In this work, we have developed the concept of a structured oligonucleotide probe which is activated by cleavage from polymerase exonuclease activity. This technology is called SCISSOHR for Structured Cleavage Induced Single-Stranded Oligonucleotide Hybridization Reaction. The SCISSOHR probes enable indexing the target sequence to a tag sequence. The SCISSOHR technology also allows the combination of nucleic acid amplification and microarray hybridization in a single vessel in presence of the PCR buffer only. The SCISSOHR technology uses an amplification probe that is irreversibly modified in presence of the target, releasing a single-stranded DNA tag for microarray hybridization. Each tag is composed of a 3-nucleotide sequence-dependent segment and a unique "target sequence-independent" 14-nucleotide segment allowing for optimal hybridization with minimal cross-hybridization. We evaluated the performance of five (5) PCR buffers to support microarray hybridization, compared to a conventional hybridization buffer. Finally, as a proof of concept, we developed a multiplexed assay for the amplification, detection, and identification of three (3) DNA targets. This new technology will facilitate the design of lab-on-chip microfluidic devices, while also reducing consumable costs. At term, it will allow the cost-effective automation of highly multiplexed assays for detection and identification of genetic targets.

Nucleotide Sequence Database Comparison for Routine Dermatophyte Identification by Internal Transcribed Spacer 2 Genetic Region DNA Barcoding.

PubMed

Normand, A C; Packeu, A; Cassagne, C; Hendrickx, M; Ranque, S; Piarroux, R

2018-05-01

Conventional dermatophyte identification is based on morphological features. However, recent studies have proposed to use the nucleotide sequences of the rRNA internal transcribed spacer (ITS) region as an identification barcode of all fungi, including dermatophytes. Several nucleotide databases are available to compare sequences and thus identify isolates; however, these databases often contain mislabeled sequences that impair sequence-based identification. We evaluated five of these databases on a clinical isolate panel. We selected 292 clinical dermatophyte strains that were prospectively subjected to an ITS2 nucleotide sequence analysis. Sequences were analyzed against the databases, and the results were compared to clusters obtained via DNA alignment of sequence segments. The DNA tree served as the identification standard throughout the study. According to the ITS2 sequence identification, the majority of strains (255/292) belonged to the genus Trichophyton , mainly T. rubrum complex ( n = 184), T. interdigitale ( n = 40), T. tonsurans ( n = 26), and T. benhamiae ( n = 5). Other genera included Microsporum (e.g., M. canis [ n = 21], M. audouinii [ n = 10], Nannizzia gypsea [ n = 3], and Epidermophyton [ n = 3]). Species-level identification of T. rubrum complex isolates was an issue. Overall, ITS DNA sequencing is a reliable tool to identify dermatophyte species given that a comprehensive and correctly labeled database is consulted. Since many inaccurate identification results exist in the DNA databases used for this study, reference databases must be verified frequently and amended in line with the current revisions of fungal taxonomy. Before describing a new species or adding a new DNA reference to the available databases, its position in the phylogenetic tree must be verified. Copyright © 2018 American Society for Microbiology.

The influence of diet on faecal DNA amplification and sex identification in brown bears (Ursus arctos)

USGS Publications Warehouse

Murphy, M.A.; Waits, L.P.; Kendall, K.C.

2003-01-01

To evaluate the influence of diet on faecal DNA amplification, 11 captive brown bears (Ursus arctos) were placed on six restricted diets: grass (Trifolium spp., Haplopappus hirtus and Poa pratensis), alfalfa (Lupinus spp.), carrots (Daucus spp.), white-tailed deer (Odocoileus virginianus), blueberries (Vaccinium spp.) and salmon (Salmo spp.). DNA was extracted from 50 faecal samples of each restricted diet, and amplification of brown bear DNA was attempted for a mitochondrial DNA (mtDNA) locus and nuclear DNA (nDNA) locus. For mtDNA, no significant differences were observed in amplification success rates across diets. For nDNA, amplification success rates for salmon diet extracts were significantly lower than all other diet extracts (P < 0.001). To evaluate the accuracy of faecal DNA sex identification when female carnivores consume male mammalian prey, female bears were fed male white-tailed deer. Four of 10 extracts amplified, and all extracts were incorrectly scored as male due to amplification of X and Y-chromosome fragments. The potential biases highlighted in this study have broad implications for researchers using faecal DNA for individual and sex identification, and should be evaluated in other species.

Single-Stranded DNA Aptamers against Pathogens and Toxins: Identification and Biosensing Applications

PubMed Central

Hong, Ka Lok

2015-01-01

Molecular recognition elements (MREs) can be short sequences of single-stranded DNA, RNA, small peptides, or antibody fragments. They can bind to user-defined targets with high affinity and specificity. There has been an increasing interest in the identification and application of nucleic acid molecular recognition elements, commonly known as aptamers, since they were first described in 1990 by the Gold and Szostak laboratories. A large number of target specific nucleic acids MREs and their applications are currently in the literature. This review first describes the general methodologies used in identifying single-stranded DNA (ssDNA) aptamers. It then summarizes advancements in the identification and biosensing application of ssDNA aptamers specific for bacteria, viruses, their associated molecules, and selected chemical toxins. Lastly, an overview of the basic principles of ssDNA aptamer-based biosensors is discussed. PMID:26199940

Dental DNA fingerprinting in identification of human remains

PubMed Central

Girish, KL; Rahman, Farzan S; Tippu, Shoaib R

2010-01-01

The recent advances in molecular biology have revolutionized all aspects of dentistry. DNA, the language of life yields information beyond our imagination, both in health or disease. DNA fingerprinting is a tool used to unravel all the mysteries associated with the oral cavity and its manifestations during diseased conditions. It is being increasingly used in analyzing various scenarios related to forensic science. The technical advances in molecular biology have propelled the analysis of the DNA into routine usage in crime laboratories for rapid and early diagnosis. DNA is an excellent means for identification of unidentified human remains. As dental pulp is surrounded by dentin and enamel, which forms dental armor, it offers the best source of DNA for reliable genetic type in forensic science. This paper summarizes the recent literature on use of this technique in identification of unidentified human remains. PMID:21731342

Pneumococcal Capsules and Their Types: Past, Present, and Future

PubMed Central

Geno, K. Aaron; Gilbert, Gwendolyn L.; Song, Joon Young; Skovsted, Ian C.; Klugman, Keith P.; Jones, Christopher; Konradsen, Helle B.

2015-01-01

SUMMARY Streptococcus pneumoniae (the pneumococcus) is an important human pathogen. Its virulence is largely due to its polysaccharide capsule, which shields it from the host immune system, and because of this, the capsule has been extensively studied. Studies of the capsule led to the identification of DNA as the genetic material, identification of many different capsular serotypes, and identification of the serotype-specific nature of protection by adaptive immunity. Recent studies have led to the determination of capsular polysaccharide structures for many serotypes using advanced analytical technologies, complete elucidation of genetic basis for the capsular types, and the development of highly effective pneumococcal conjugate vaccines. Conjugate vaccine use has altered the serotype distribution by either serotype replacement or switching, and this has increased the need to serotype pneumococci. Due to great advances in molecular technologies and our understanding of the pneumococcal genome, molecular approaches have become powerful tools to predict pneumococcal serotypes. In addition, more-precise and -efficient serotyping methods that directly detect polysaccharide structures are emerging. These improvements in our capabilities will greatly enhance future investigations of pneumococcal epidemiology and diseases and the biology of colonization and innate immunity to pneumococcal capsules. PMID:26085553

Pneumococcal Capsules and Their Types: Past, Present, and Future.

PubMed

Geno, K Aaron; Gilbert, Gwendolyn L; Song, Joon Young; Skovsted, Ian C; Klugman, Keith P; Jones, Christopher; Konradsen, Helle B; Nahm, Moon H

2015-07-01

Streptococcus pneumoniae (the pneumococcus) is an important human pathogen. Its virulence is largely due to its polysaccharide capsule, which shields it from the host immune system, and because of this, the capsule has been extensively studied. Studies of the capsule led to the identification of DNA as the genetic material, identification of many different capsular serotypes, and identification of the serotype-specific nature of protection by adaptive immunity. Recent studies have led to the determination of capsular polysaccharide structures for many serotypes using advanced analytical technologies, complete elucidation of genetic basis for the capsular types, and the development of highly effective pneumococcal conjugate vaccines. Conjugate vaccine use has altered the serotype distribution by either serotype replacement or switching, and this has increased the need to serotype pneumococci. Due to great advances in molecular technologies and our understanding of the pneumococcal genome, molecular approaches have become powerful tools to predict pneumococcal serotypes. In addition, more-precise and -efficient serotyping methods that directly detect polysaccharide structures are emerging. These improvements in our capabilities will greatly enhance future investigations of pneumococcal epidemiology and diseases and the biology of colonization and innate immunity to pneumococcal capsules. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Identification of apple cultivars on the basis of simple sequence repeat markers.

PubMed

Liu, G S; Zhang, Y G; Tao, R; Fang, J G; Dai, H Y

2014-09-12

DNA markers are useful tools that play an important role in plant cultivar identification. They are usually based on polymerase chain reaction (PCR) and include simple sequence repeats (SSRs), inter-simple sequence repeats, and random amplified polymorphic DNA. However, DNA markers were not used effectively in the complete identification of plant cultivars because of the lack of known DNA fingerprints. Recently, a novel approach called the cultivar identification diagram (CID) strategy was developed to facilitate the use of DNA markers for separate plant individuals. The CID was designed whereby a polymorphic maker was generated from each PCR that directly allowed for cultivar sample separation at each step. Therefore, it could be used to identify cultivars and varieties easily with fewer primers. In this study, 60 apple cultivars, including a few main cultivars in fields and varieties from descendants (Fuji x Telamon) were examined. Of the 20 pairs of SSR primers screened, 8 pairs gave reproducible, polymorphic DNA amplification patterns. The banding patterns obtained from these 8 primers were used to construct a CID map. Each cultivar or variety in this study was distinguished from the others completely, indicating that this method can be used for efficient cultivar identification. The result contributed to studies on germplasm resources and the seedling industry in fruit trees.

Measuring the Electronic Properties of DNA-Specific Schottky Diodes Towards Detecting and Identifying Basidiomycetes DNA

PubMed Central

Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta’ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa

2016-01-01

The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology. PMID:27435636

Measuring the Electronic Properties of DNA-Specific Schottky Diodes Towards Detecting and Identifying Basidiomycetes DNA

NASA Astrophysics Data System (ADS)

Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta'Ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa

2016-07-01

The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology.

A grass molecular identification system for forensic botany: a critical evaluation of the strengths and limitations.

PubMed

Ward, Jodie; Gilmore, Simon R; Robertson, James; Peakall, Rod

2009-11-01

Plant material is frequently encountered in criminal investigations but often overlooked as potential evidence. We designed a DNA-based molecular identification system for 100 Australian grasses that consisted of a series of polymerase chain reaction assays that enabled the progressive identification of grasses to different taxonomic levels. The identification system was based on DNA sequence variation at four chloroplast and two mitochondrial loci. Seventeen informative indels and 68 single-nucleotide polymorphisms were utilized as molecular markers for subfamily to species-level identification. To identify an unknown sample to subfamily level required a minimum of four markers or nine markers for species identification. The accuracy of the system was confirmed by blind tests. We have demonstrated "proof of concept" of a molecular identification system for trace botanical samples. Our evaluation suggests that the adoption of a system that combines this approach with DNA sequencing could assist the morphological identification of grasses found as forensic evidence.

The application of the high throughput sequencing technology in the transposable elements.

PubMed

Liu, Zhen; Xu, Jian-hong

2015-09-01

High throughput sequencing technology has dramatically improved the efficiency of DNA sequencing, and decreased the costs to a great extent. Meanwhile, this technology usually has advantages of better specificity, higher sensitivity and accuracy. Therefore, it has been applied to the research on genetic variations, transcriptomics and epigenomics. Recently, this technology has been widely employed in the studies of transposable elements and has achieved fruitful results. In this review, we summarize the application of high throughput sequencing technology in the fields of transposable elements, including the estimation of transposon content, preference of target sites and distribution, insertion polymorphism and population frequency, identification of rare copies, transposon horizontal transfers as well as transposon tagging. We also briefly introduce the major common sequencing strategies and algorithms, their advantages and disadvantages, and the corresponding solutions. Finally, we envision the developing trends of high throughput sequencing technology, especially the third generation sequencing technology, and its application in transposon studies in the future, hopefully providing a comprehensive understanding and reference for related scientific researchers.

Direct-to-PCR tissue preservation for DNA profiling.

PubMed

Sorensen, Amy; Berry, Clare; Bruce, David; Gahan, Michelle Elizabeth; Hughes-Stamm, Sheree; McNevin, Dennis

2016-05-01

Disaster victim identification (DVI) often occurs in remote locations with extremes of temperatures and humidities. Access to mortuary facilities and refrigeration are not always available. An effective and robust DNA sampling and preservation procedure would increase the probability of successful DNA profiling and allow faster repatriation of bodies and body parts. If the act of tissue preservation also released DNA into solution, ready for polymerase chain reaction (PCR), the DVI process could be further streamlined. In this study, we explored the possibility of obtaining DNA profiles without DNA extraction, by adding aliquots of preservative solutions surrounding fresh human muscle and decomposing human muscle and skin tissue samples directly to PCR. The preservatives consisted of two custom preparations and two proprietary solutions. The custom preparations were a salt-saturated solution of dimethyl sulfoxide (DMSO) with ethylenediaminetetraacetic (EDTA) and TENT buffer (Tris, EDTA, NaCl, Tween 20). The proprietary preservatives were DNAgard (Biomatrica(®)) and Tissue Stabilising Kit (DNA Genotek). We obtained full PowerPlex(®) 21 (Promega) and GlobalFiler(®) (Life Technologies) DNA profiles from fresh and decomposed tissue preserved at 35 °C for up to 28 days for all four preservatives. The preservative aliquots removed from the fresh muscle tissue samples had been stored at -80 °C for 4 years, indicating that long-term archival does not diminish the probability of successful DNA typing. Rather, storage at -80 °C seems to reduce PCR inhibition.

A Polymerase Chain Reaction-Based Method for Isolating Clones from a Complimentary DNA Library in Sheep

PubMed Central

Friis, Thor Einar; Stephenson, Sally; Xiao, Yin; Whitehead, Jon

2014-01-01

The sheep (Ovis aries) is favored by many musculoskeletal tissue engineering groups as a large animal model because of its docile temperament and ease of husbandry. The size and weight of sheep are comparable to humans, which allows for the use of implants and fixation devices used in human clinical practice. The construction of a complimentary DNA (cDNA) library can capture the expression of genes in both a tissue- and time-specific manner. cDNA libraries have been a consistent source of gene discovery ever since the technology became commonplace more than three decades ago. Here, we describe the construction of a cDNA library using cells derived from sheep bones based on the pBluescript cDNA kit. Thirty clones were picked at random and sequenced. This led to the identification of a novel gene, C12orf29, which our initial experiments indicate is involved in skeletal biology. We also describe a polymerase chain reaction-based cDNA clone isolation method that allows the isolation of genes of interest from a cDNA library pool. The techniques outlined here can be applied in-house by smaller tissue engineering groups to generate tools for biomolecular research for large preclinical animal studies and highlights the power of standard cDNA library protocols to uncover novel genes. PMID:24447069

Biological Sexing of a 4000-Year-Old Egyptian Mummy Head to Assess the Potential of Nuclear DNA Recovery from the Most Damaged and Limited Forensic Specimens

PubMed Central

Loreille, Odile; Ratnayake, Shashikala; Stockwell, Timothy B.; Mallick, Swapan; Skoglund, Pontus; Onorato, Anthony J.; Bergman, Nicholas H.; Reich, David; Irwin, Jodi A.

2018-01-01

High throughput sequencing (HTS) has been used for a number of years in the field of paleogenomics to facilitate the recovery of small DNA fragments from ancient specimens. Recently, these techniques have also been applied in forensics, where they have been used for the recovery of mitochondrial DNA sequences from samples where traditional PCR-based assays fail because of the very short length of endogenous DNA molecules. Here, we describe the biological sexing of a ~4000-year-old Egyptian mummy using shotgun sequencing and two established methods of biological sex determination (RX and RY), by way of mitochondrial genome analysis as a means of sequence data authentication. This particular case of historical interest increases the potential utility of HTS techniques for forensic purposes by demonstrating that data from the more discriminatory nuclear genome can be recovered from the most damaged specimens, even in cases where mitochondrial DNA cannot be recovered with current PCR-based forensic technologies. Although additional work remains to be done before nuclear DNA recovered via these methods can be used routinely in operational casework for individual identification purposes, these results indicate substantial promise for the retrieval of probative individually identifying DNA data from the most limited and degraded forensic specimens. PMID:29494531

Mechanisms of Enhanced Catalysis in Enzyme-DNA Nanostructures Revealed through Molecular Simulations and Experimental Analysis.

PubMed

Gao, Yingning; Roberts, Christopher C; Toop, Aaron; Chang, Chia-En A; Wheeldon, Ian

2016-08-03

Understanding and controlling the molecular interactions between enzyme substrates and DNA nanostructures has important implications in the advancement of enzyme-DNA technologies as solutions in biocatalysis. Such hybrid nanostructures can be used to create enzyme systems with enhanced catalysis by controlling the local chemical and physical environments and the spatial organization of enzymes. Here we have used molecular simulations with corresponding experiments to describe a mechanism of enhanced catalysis due to locally increased substrate concentrations. With a series of DNA nanostructures conjugated to horseradish peroxidase, we show that binding interactions between substrates and the DNA structures can increase local substrate concentrations. Increased local substrate concentrations in HRP(DNA) nanostructures resulted in 2.9- and 2.4-fold decreases in the apparent Michaelis constants of tetramethylbenzidine and 4-aminophenol, substrates of HRP with tunable binding interactions to DNA nanostructures with dissociation constants in the micromolar range. Molecular simulations and kinetic analysis also revealed that increased local substrate concentrations enhanced the rates of substrate association. Identification of the mechanism of increased local concentration of substrates in close proximity to enzymes and their active sites adds to our understanding of nanostructured biocatalysis from which we can develop guidelines for enhancing catalysis in rationally designed systems. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Evaluation of suitable DNA regions for molecular identification of high value medicinal plants in genus Kaempferia.

PubMed

Osathanunkul, Maslin; Dheeranupattana, Srisulak; Rotarayanont, Siriphron; Sookkhee, Siriwoot; Osathanunkul, Khukrit; Madesis, Panagiotis

2017-12-02

DNA barcoding coupled high resolution melting (Bar-HRM) is an emerging method for species discrimination based on DNA dissociation kinetics. The aim of this work was to evaluate the suitability of different primer sets, derived from selected DNA regions, for Bar-HRM analysis of species in Kaempferia (Zingiberaceae). Four primer pairs were evaluated (rbcL, rpoC, trnL and ITS1). It was observed that the ITS1 barcode was the most useful DNA barcoding region overall for species discrimination out of all of the regions and primers assessed. Thus, the primer pair derived from the ITS1 region was the single most effective region for the identification of the tested species, whereas the rbcL primer pair gave the lowest resolution. Our Bar-HRM developed here would not only be useful for identification of Kaempferia plant specimens lacking essential parts for morphological identification but will be useful for authenticating products in powdered form of a high value medicinal species Kaempferia parviflora, in particular.

Identification of Early Response Genes in Human Peripheral Leukocytes Infected with Orientia tsutsugamushi: The Emergent of a Unique Gene Expression Profile for Diagnosis of O. tsutsugamush Infection

DTIC Science & Technology

2010-01-01

dynein to move from the cell periphery to the microtubule organizing center [22]. Therefore, the initial interactions between host and intracellular...used to study host-pathogen interactions , mainly by identifying genes from pathogens that may be involved in pathogenecity and by surveying the scope...toward understanding the host-Orientia tsutsugamushi interaction at the molecular level, we used human cDNA microarray technology to examine in detail

[Do Multiplex PCR techniques displace classical cultures in microbiology?].

PubMed

Auckenthaler, Raymond; Risch, Martin

2015-02-01

Multiplex PCR technologies progressively find their way in clinical microbiology. This technique allows the simultaneous amplification of multiple DNA targets in a single test run for the identification of pathogens up to the species level. Various pathogens of infectious diseases can be detected by a symptom-oriented approach clearly and quickly with high reliability. Essentially multiplex PCR panels are available for clarification of gastrointestinal, respiratory, sexually transmitted infections and meningitis. Today's offer from industry, university hospitals and large private laboratories of Switzerland is tabulated and commented.

[Research progress on identification and quality evaluation of glues medicines].

PubMed

Li, Hui-Hu; Ren, Gang; Chen, Li-Min; Zhong, Guo-Yue

2018-01-01

Glues medicines is a special kind of traditional Chinese medicine.As the market demand is large, the raw materials are in short supply and lacks proper quality evaluation technology, which causes inconsistent quality of products on the market. Its authentic identification and evaluation stay a problem to be solved. In this paper, the research progress of the methods and techniques of the evaluation of the identification and quality of glues medicines were reviewed. The researches of medicinal glue type identification and quality evaluation mainly concentrated in four aspects of medicinal materials of physical and chemical properties, trace elements, organic chemicals and biological genetic methods and techniques. The methods of physicochemical properties include thermal analysis, gel electrophoresis, isoelectric focusing electrophoresis, infrared spectroscopy, gel exclusion chromatography, and circular dichroism. The methods including atomic absorption spectrometry, X-ray fluorescence spectrometry, plasma emission spectrometry and visible spectrophotometry were used for the study of the trace elements of glues medicines. The organic chemical composition was studied by methods of composition of amino acids, content detection, odor detection, lipid soluble component, organic acid detection. Methods based on the characteristics of biogenetics include DNA, polypeptide and amino acid sequence difference analysis. Overall, because of relative components similarity of the glues medicines (such as amino acids, proteins and peptides), its authenticity and quality evaluation index is difficult to judge objectively, all sorts of identification evaluation methods have different characteristics, but also their limitations. It indicates that further study should focus on identification of evaluation index and various technology integrated application combining with the characteristics of the production process. Copyright© by the Chinese Pharmaceutical Association.

DNA Identification of Skeletal Remains from World War II Mass Graves Uncovered in Slovenia

PubMed Central

Marjanović, Damir; Durmić-Pašić, Adaleta; Bakal, Narcisa; Haverić, Sanin; Kalamujić, Belma; Kovačević, Lejla; Ramić, Jasmin; Pojskić, Naris; Škaro, Vedrana; Projić, Petar; Bajrović, Kasim; Hadžiselimović, Rifat; Drobnič, Katja; Huffine, Ed; Davoren, Jon; Primorac, Dragan

2007-01-01

Aim To present the joint effort of three institutions in the identification of human remains from the World War II found in two mass graves in the area of Škofja Loka, Slovenia. Methods The remains of 27 individuals were found in two small and closely located mass graves. The DNA was isolated from bone and teeth samples using either standard phenol/chloroform alcohol extraction or optimized Qiagen DNA extraction procedure. Some recovered samples required the employment of additional DNA purification methods, such as N-buthanol treatment. QuantifilerTM Human DNA Quantification Kit was used for DNA quantification. PowerPlex 16 kit was used to simultaneously amplify 15 short tandem repeat (STR) loci. Matching probabilities were estimated using the DNA View program. Results Out of all processed samples, 15 remains were fully profiled at all 15 STR loci. The other 12 profiles were partial. The least successful profile included 13 loci. Also, 69 referent samples (buccal swabs) from potential living relatives were collected and profiled. Comparison of victims' profile against referent samples database resulted in 4 strong matches. In addition, 5 other profiles were matched to certain referent samples with lower probability. Conclusion Our results show that more than 6 decades after the end of the World War II, DNA analysis may significantly contribute to the identification of the remains from that period. Additional analysis of Y-STRs and mitochondrial DNA (mtDNA) markers will be performed in the second phase of the identification project. PMID:17696306

The effect on cadaver blood DNA identification by the use of targeted and whole body post-mortem computed tomography angiography.

PubMed

Rutty, Guy N; Barber, Jade; Amoroso, Jasmin; Morgan, Bruno; Graham, Eleanor A M

2013-12-01

Post-mortem computed tomography angiography (PMCTA) involves the injection of contrast agents. This could have both a dilution effect on biological fluid samples and could affect subsequent post-contrast analytical laboratory processes. We undertook a small sample study of 10 targeted and 10 whole body PMCTA cases to consider whether or not these two methods of PMCTA could affect post-PMCTA cadaver blood based DNA identification. We used standard methodology to examine DNA from blood samples obtained before and after the PMCTA procedure. We illustrate that neither of these PMCTA methods had an effect on the alleles called following short tandem repeat based DNA profiling, and therefore the ability to undertake post-PMCTA blood based DNA identification.

IDENTIFICATION OF STEROCHEMICAL CONFIGERATION OF CYCLOPENTA[CD]PYRENE-DNA ADDUCTS IN STRAIN A/J MOUSE LUNG AND C3H10T1/2CL8

EPA Science Inventory

The definitive identification of stereochemical configurations of DNA adducts detected by 32P-postlabeling requires co-chromatography of adducts with synthetic chromatographic standards. Four major and several minor DNA adducts are formed by cyclopenta[cd]pyrene (CPP) in strain A...

Serogroup-level resolution of the “Super-7” Shiga toxin-producing Escherichia coli using nanopore single-molecule DNA sequencing

USDA-ARS?s Scientific Manuscript database

DNA sequencing and other DNA-based methods, such as PCR, are now broadly used for detection and identification of bacterial foodborne pathogens. For the identification of foodborne bacterial pathogens, it is important to make taxonomic assignments to the species, or even subspecies level. Long-read ...

Integrating a DNA barcoding project with an ecological survey: a case study on temperate intertidal polychaete communities in Qingdao, China

NASA Astrophysics Data System (ADS)

Zhou, Hong; Zhang, Zhinan; Chen, Haiyan; Sun, Renhua; Wang, Hui; Guo, Lei; Pan, Haijian

2010-07-01

In this study, we integrated a DNA barcoding project with an ecological survey on intertidal polychaete communities and investigated the utility of CO1 gene sequence as a DNA barcode for the classification of the intertidal polychaetes. Using 16S rDNA as a complementary marker and combining morphological and ecological characterization, some of dominant and common polychaete species from Chinese coasts were assessed for their taxonomic status. We obtained 22 haplotype gene sequences of 13 taxa, including 10 CO1 sequences and 12 16S rDNA sequences. Based on intra- and inter-specific distances, we built phylogenetic trees using the neighbor-joining method. Our study suggested that the mitochondrial CO1 gene was a valid DNA barcoding marker for species identification in polychaetes, but other genes, such as 16S rDNA, could be used as a complementary genetic marker. For more accurate species identification and effective testing of species hypothesis, DNA barcoding should be incorporated with morphological, ecological, biogeographical, and phylogenetic information. The application of DNA barcoding and molecular identification in the ecological survey on the intertidal polychaete communities demonstrated the feasibility of integrating DNA taxonomy and ecology.

Pitfalls of Establishing DNA Barcoding Systems in Protists: The Cryptophyceae as a Test Case

PubMed Central

Hoef-Emden, Kerstin

2012-01-01

A DNA barcode is a preferrably short and highly variable region of DNA supposed to facilitate a rapid identification of species. In many protistan lineages, a lack of species-specific morphological characters hampers an identification of species by light or electron microscopy, and difficulties to perform mating experiments in laboratory cultures also do not allow for an identification of biological species. Thus, testing candidate barcode markers as well as establishment of accurately working species identification systems are more challenging than in multicellular organisms. In cryptic species complexes the performance of a potential barcode marker can not be monitored using morphological characters as a feedback, but an inappropriate choice of DNA region may result in artifactual species trees for several reasons. Therefore a priori knowledge of the systematics of a group is required. In addition to identification of known species, methods for an automatic delimitation of species with DNA barcodes have been proposed. The Cryptophyceae provide a mixture of systematically well characterized as well as badly characterized groups and are used in this study to test the suitability of some of the methods for protists. As species identification method the performance of blast in searches against badly to well-sampled reference databases has been tested with COI-5P and 5′-partial LSU rDNA (domains A to D of the nuclear LSU rRNA gene). In addition the performance of two different methods for automatic species delimitation, fixed thresholds of genetic divergence and the general mixed Yule-coalescent model (GMYC), have been examined. The study demonstrates some pitfalls of barcoding methods that have to be taken care of. Also a best-practice approach towards establishing a DNA barcode system in protists is proposed. PMID:22970104

Pitfalls of establishing DNA barcoding systems in protists: the cryptophyceae as a test case.

PubMed

Hoef-Emden, Kerstin

2012-01-01

A DNA barcode is a preferrably short and highly variable region of DNA supposed to facilitate a rapid identification of species. In many protistan lineages, a lack of species-specific morphological characters hampers an identification of species by light or electron microscopy, and difficulties to perform mating experiments in laboratory cultures also do not allow for an identification of biological species. Thus, testing candidate barcode markers as well as establishment of accurately working species identification systems are more challenging than in multicellular organisms. In cryptic species complexes the performance of a potential barcode marker can not be monitored using morphological characters as a feedback, but an inappropriate choice of DNA region may result in artifactual species trees for several reasons. Therefore a priori knowledge of the systematics of a group is required. In addition to identification of known species, methods for an automatic delimitation of species with DNA barcodes have been proposed. The Cryptophyceae provide a mixture of systematically well characterized as well as badly characterized groups and are used in this study to test the suitability of some of the methods for protists. As species identification method the performance of blast in searches against badly to well-sampled reference databases has been tested with COI-5P and 5'-partial LSU rDNA (domains A to D of the nuclear LSU rRNA gene). In addition the performance of two different methods for automatic species delimitation, fixed thresholds of genetic divergence and the general mixed Yule-coalescent model (GMYC), have been examined. The study demonstrates some pitfalls of barcoding methods that have to be taken care of. Also a best-practice approach towards establishing a DNA barcode system in protists is proposed.

DNA Barcoding of Recently Diverged Species: Relative Performance of Matching Methods

PubMed Central

van Velzen, Robin; Weitschek, Emanuel; Felici, Giovanni; Bakker, Freek T.

2012-01-01

Recently diverged species are challenging for identification, yet they are frequently of special interest scientifically as well as from a regulatory perspective. DNA barcoding has proven instrumental in species identification, especially in insects and vertebrates, but for the identification of recently diverged species it has been reported to be problematic in some cases. Problems are mostly due to incomplete lineage sorting or simply lack of a ‘barcode gap’ and probably related to large effective population size and/or low mutation rate. Our objective was to compare six methods in their ability to correctly identify recently diverged species with DNA barcodes: neighbor joining and parsimony (both tree-based), nearest neighbor and BLAST (similarity-based), and the diagnostic methods DNA-BAR, and BLOG. We analyzed simulated data assuming three different effective population sizes as well as three selected empirical data sets from published studies. Results show, as expected, that success rates are significantly lower for recently diverged species (∼75%) than for older species (∼97%) (P<0.00001). Similarity-based and diagnostic methods significantly outperform tree-based methods, when applied to simulated DNA barcode data (P<0.00001). The diagnostic method BLOG had highest correct query identification rate based on simulated (86.2%) as well as empirical data (93.1%), indicating that it is a consistently better method overall. Another advantage of BLOG is that it offers species-level information that can be used outside the realm of DNA barcoding, for instance in species description or molecular detection assays. Even though we can confirm that identification success based on DNA barcoding is generally high in our data, recently diverged species remain difficult to identify. Nevertheless, our results contribute to improved solutions for their accurate identification. PMID:22272356

DNA barcoding of recently diverged species: relative performance of matching methods.

PubMed

van Velzen, Robin; Weitschek, Emanuel; Felici, Giovanni; Bakker, Freek T

2012-01-01

Recently diverged species are challenging for identification, yet they are frequently of special interest scientifically as well as from a regulatory perspective. DNA barcoding has proven instrumental in species identification, especially in insects and vertebrates, but for the identification of recently diverged species it has been reported to be problematic in some cases. Problems are mostly due to incomplete lineage sorting or simply lack of a 'barcode gap' and probably related to large effective population size and/or low mutation rate. Our objective was to compare six methods in their ability to correctly identify recently diverged species with DNA barcodes: neighbor joining and parsimony (both tree-based), nearest neighbor and BLAST (similarity-based), and the diagnostic methods DNA-BAR, and BLOG. We analyzed simulated data assuming three different effective population sizes as well as three selected empirical data sets from published studies. Results show, as expected, that success rates are significantly lower for recently diverged species (∼75%) than for older species (∼97%) (P<0.00001). Similarity-based and diagnostic methods significantly outperform tree-based methods, when applied to simulated DNA barcode data (P<0.00001). The diagnostic method BLOG had highest correct query identification rate based on simulated (86.2%) as well as empirical data (93.1%), indicating that it is a consistently better method overall. Another advantage of BLOG is that it offers species-level information that can be used outside the realm of DNA barcoding, for instance in species description or molecular detection assays. Even though we can confirm that identification success based on DNA barcoding is generally high in our data, recently diverged species remain difficult to identify. Nevertheless, our results contribute to improved solutions for their accurate identification.

Forensic Analysis of Human DNA from Samples Contamined with Bioweapons Agents

DTIC Science & Technology

2011-10-01

Forensic analysis of human DNA from samples contaminated with bioweapons agents Jason Timbers Kathryn Wright Royal Canadian Mounted...Police Forensic Science and Identification Service Prepared By: Royal Canadian Mounted Police RCMP Forensic Science Identification Services... Royal Canadian Mounted Police Forensic Science and Identification Service Prepared By: Royal Canadian Mounted Police RCMP Forensic Science

Data Acceptance Criteria for Standardized Human-Associated Fecal Source Identification Quantitative Real-Time PCR Methods.

PubMed

Shanks, Orin C; Kelty, Catherine A; Oshiro, Robin; Haugland, Richard A; Madi, Tania; Brooks, Lauren; Field, Katharine G; Sivaganesan, Mano

2016-05-01

There is growing interest in the application of human-associated fecal source identification quantitative real-time PCR (qPCR) technologies for water quality management. The transition from a research tool to a standardized protocol requires a high degree of confidence in data quality across laboratories. Data quality is typically determined through a series of specifications that ensure good experimental practice and the absence of bias in the results due to DNA isolation and amplification interferences. However, there is currently a lack of consensus on how best to evaluate and interpret human fecal source identification qPCR experiments. This is, in part, due to the lack of standardized protocols and information on interlaboratory variability under conditions for data acceptance. The aim of this study is to provide users and reviewers with a complete series of conditions for data acceptance derived from a multiple laboratory data set using standardized procedures. To establish these benchmarks, data from HF183/BacR287 and HumM2 human-associated qPCR methods were generated across 14 laboratories. Each laboratory followed a standardized protocol utilizing the same lot of reference DNA materials, DNA isolation kits, amplification reagents, and test samples to generate comparable data. After removal of outliers, a nested analysis of variance (ANOVA) was used to establish proficiency metrics that include lab-to-lab, replicate testing within a lab, and random error for amplification inhibition and sample processing controls. Other data acceptance measurements included extraneous DNA contamination assessments (no-template and extraction blank controls) and calibration model performance (correlation coefficient, amplification efficiency, and lower limit of quantification). To demonstrate the implementation of the proposed standardized protocols and data acceptance criteria, comparable data from two additional laboratories were reviewed. The data acceptance criteria proposed in this study should help scientists, managers, reviewers, and the public evaluate the technical quality of future findings against an established benchmark. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Recovery Based Nanowire Field-Effect Transistor Detection of Pathogenic Avian Influenza DNA

NASA Astrophysics Data System (ADS)

Lin, Chih-Heng; Chu, Chia-Jung; Teng, Kang-Ning; Su, Yi-Jr; Chen, Chii-Dong; Tsai, Li-Chu; Yang, Yuh-Shyong

2012-02-01

Fast and accurate diagnosis is critical in infectious disease surveillance and management. We proposed a DNA recovery system that can easily be adapted to DNA chip or DNA biosensor for fast identification and confirmation of target DNA. This method was based on the re-hybridization of DNA target with a recovery DNA to free the DNA probe. Functionalized silicon nanowire field-effect transistor (SiNW FET) was demonstrated to monitor such specific DNA-DNA interaction using high pathogenic strain virus hemagglutinin 1 (H1) DNA of avian influenza (AI) as target. Specific electric changes were observed in real-time for AI virus DNA sensing and device recovery when nanowire surface of SiNW FET was modified with complementary captured DNA probe. The recovery based SiNW FET biosensor can be further developed for fast identification and further confirmation of a variety of influenza virus strains and other infectious diseases.

Barcoding of fresh water fishes from Pakistan.

PubMed

Karim, Asma; Iqbal, Asad; Akhtar, Rehan; Rizwan, Muhammad; Amar, Ali; Qamar, Usman; Jahan, Shah

2016-07-01

DNA bar-coding is a taxonomic method that uses small genetic markers in organisms' mitochondrial DNA (mt DNA) for identification of particular species. It uses sequence diversity in a 658-base pair fragment near the 5' end of the mitochondrial cytochrome c oxidase subunit 1 (CO1) gene as a tool for species identification. DNA barcoding is more accurate and reliable method as compared with the morphological identification. It is equally useful in juveniles as well as adult stages of fishes. The present study was conducted to identify three farm fish species of Pakistan (Cyprinus carpio, Cirrhinus mrigala, and Ctenopharyngodon idella) genetically. All of them belonged to family cyprinidae. CO1 gene was amplified. PCR products were sequenced and analyzed by bioinformatic software. Conspecific, congenric, and confamilial k2P nucleotide divergence was estimated. From these findings, it was concluded that the gene sequence, CO1, may serve as milestone for the identification of related species at molecular level.

DNA analysis of hair and scat collected along snow tracks to document the presence of Canada Lynx.

Treesearch

Kevin S. McKelvey; Jeffrey von Kienast; Keith B. Aubry; Gary M. Koehler; Bejamin T. Maletzke; John R. Squires; Edward L. Lindquist; Steve Loch; Michael K. Schwartz

2006-01-01

Snow tracking is often used to inventory carnivore communities, but species identification using this method can produce ambiguous and misleading results. DNA can be extracted from hair and scat samples collected from tracks made in snow. Using DNA analysis could allow positive track identification across a broad range of snow conditions, thus increasing survey...

Plant-pathogen interactions: what microarray tells about it?

PubMed

Lodha, T D; Basak, J

2012-01-01

Plant defense responses are mediated by elementary regulatory proteins that affect expression of thousands of genes. Over the last decade, microarray technology has played a key role in deciphering the underlying networks of gene regulation in plants that lead to a wide variety of defence responses. Microarray is an important tool to quantify and profile the expression of thousands of genes simultaneously, with two main aims: (1) gene discovery and (2) global expression profiling. Several microarray technologies are currently in use; most include a glass slide platform with spotted cDNA or oligonucleotides. Till date, microarray technology has been used in the identification of regulatory genes, end-point defence genes, to understand the signal transduction processes underlying disease resistance and its intimate links to other physiological pathways. Microarray technology can be used for in-depth, simultaneous profiling of host/pathogen genes as the disease progresses from infection to resistance/susceptibility at different developmental stages of the host, which can be done in different environments, for clearer understanding of the processes involved. A thorough knowledge of plant disease resistance using successful combination of microarray and other high throughput techniques, as well as biochemical, genetic, and cell biological experiments is needed for practical application to secure and stabilize yield of many crop plants. This review starts with a brief introduction to microarray technology, followed by the basics of plant-pathogen interaction, the use of DNA microarrays over the last decade to unravel the mysteries of plant-pathogen interaction, and ends with the future prospects of this technology.

[DNA barcoding and its utility in commonly-used medicinal snakes].

PubMed

Huang, Yong; Zhang, Yue-yun; Zhao, Cheng-jian; Xu, Yong-li; Gu, Ying-le; Huang, Wen-qi; Lin, Kui; Li, Li

2015-03-01

Identification accuracy of traditional Chinese medicine is crucial for the traditional Chinese medicine research, production and application. DNA barcoding based on the mitochondrial gene coding for cytochrome c oxidase subunit I (COI), are more and more used for identification of traditional Chinese medicine. Using universal barcoding primers to sequence, we discussed the feasibility of DNA barcoding method for identification commonly-used medicinal snakes (a total of 109 samples belonging to 19 species 15 genera 6 families). The phylogenetic trees using Neighbor-joining were constructed. The results indicated that the mean content of G + C(46.5%) was lower than that of A + T (53.5%). As calculated by Kimera-2-parameter model, the mean intraspecies genetic distance of Trimeresurus albolabris, Ptyas dhumnades and Lycodon rufozonatus was greater than 2%. Further phylogenetic relationship results suggested that identification of one sample of T. albolabris was erroneous. The identification of some samples of P. dhumnades was also not correct, namely originally P. korros was identified as P. dhumnades. Factors influence on intraspecific genetic distance difference of L. rufozonatus need to be studied further. Therefore, DNA barcoding for identification of medicinal snakes is feasible, and greatly complements the morphological classification method. It is necessary to further study in identification of traditional Chinese medicine.

Proteomics to study DNA-bound and chromatin-associated gene regulatory complexes

PubMed Central

Wierer, Michael; Mann, Matthias

2016-01-01

High-resolution mass spectrometry (MS)-based proteomics is a powerful method for the identification of soluble protein complexes and large-scale affinity purification screens can decode entire protein interaction networks. In contrast, protein complexes residing on chromatin have been much more challenging, because they are difficult to purify and often of very low abundance. However, this is changing due to recent methodological and technological advances in proteomics. Proteins interacting with chromatin marks can directly be identified by pulldowns with synthesized histone tails containing posttranslational modifications (PTMs). Similarly, pulldowns with DNA baits harbouring single nucleotide polymorphisms or DNA modifications reveal the impact of those DNA alterations on the recruitment of transcription factors. Accurate quantitation – either isotope-based or label free – unambiguously pinpoints proteins that are significantly enriched over control pulldowns. In addition, protocols that combine classical chromatin immunoprecipitation (ChIP) methods with mass spectrometry (ChIP-MS) target gene regulatory complexes in their in-vivo context. Similar to classical ChIP, cells are crosslinked with formaldehyde and chromatin sheared by sonication or nuclease digested. ChIP-MS baits can be proteins in tagged or endogenous form, histone PTMs, or lncRNAs. Locus-specific ChIP-MS methods would allow direct purification of a single genomic locus and the proteins associated with it. There, loci can be targeted either by artificial DNA-binding sites and corresponding binding proteins or via proteins with sequence specificity such as TAL or nuclease deficient Cas9 in combination with a specific guide RNA. We predict that advances in MS technology will soon make such approaches generally applicable tools in epigenetics. PMID:27402878

Quantification of Global DNA Methylation Levels by Mass Spectrometry.

PubMed

Fernandez, Agustin F; Valledor, Luis; Vallejo, Fernando; Cañal, Maria Jesús; Fraga, Mario F

2018-01-01

Global DNA methylation was classically considered the relative percentage of 5-methylcysine (5mC) with respect to total cytosine (C). Early approaches were based on the use of high-performance separation technologies and UV detection. However, the recent development of protocols using mass spectrometry for the detection has increased sensibility and permitted the precise identification of peak compounds based on their molecular masses. This allows work to be conducted with much less genomic DNA starting material and also to quantify 5-hydroxymethyl-cytosine (5hmC), a recently identified form of methylated cytosine that could play an important role in active DNA demethylation. Here, we describe the protocol that we currently use in our laboratory to analyze 5mC and 5hmC by mass spectrometry. The protocol, which is based on the method originally developed by Le and colleagues using Ultra Performance Liquid Chromatography (UPLC) and mass spectrometry (triple Quadrupole (QqQ)) detection, allows for the rapid and accurate quantification of relative global 5mC and 5hmC levels starting from just 1 μg of genomic DNA, which allows for the rapid and accurate quantification of relative global 5mC and 5hmC levels.

Molecular cardiology and genetics in the 21st century--a primer.

PubMed

Roberts, Robert; Gollob, Michael

2006-10-01

The terminology and technology of molecular genetics and recombinant DNA have become an essential part of academic cardiology and will soon be applied at the bedside. The treatise includes a brief summary of the essentials of the DNA molecule, the more common techniques, and their application to genetics and molecular cardiology. It is written to be understood by physicians, scientists, and paramedical personnel who would not necessarily have a background in molecular biology. Inherent in the DNA molecule are three properties fundamental to all of the diagnostic and therapeutic applications, namely, the ability of DNA to separate into single strands, recombine (annealment or hybridization), and the presence of the negative charge enables DNA fragments to be separated easily by electrophoresis. Genetic linkage analysis of a family with an inherited disease enables one to identify the gene without knowing its protein product. Over 50 diseases in cardiology due to single-gene disorders have been identified and multiple mutations have been detected. The new therapeutic frontier will be stem cells and nuclear transfer. Identification of genes responsible for coronary artery disease made possible by genome-wide single nucleotide polymorphism (SNP) mapping techniques paves the way for personalized medicine.

A low density microarray method for the identification of human papillomavirus type 18 variants.

PubMed

Meza-Menchaca, Thuluz; Williams, John; Rodríguez-Estrada, Rocío B; García-Bravo, Aracely; Ramos-Ligonio, Ángel; López-Monteon, Aracely; Zepeda, Rossana C

2013-09-26

We describe a novel microarray based-method for the screening of oncogenic human papillomavirus 18 (HPV-18) molecular variants. Due to the fact that sequencing methodology may underestimate samples containing more than one variant we designed a specific and sensitive stacking DNA hybridization assay. This technology can be used to discriminate between three possible phylogenetic branches of HPV-18. Probes were attached covalently on glass slides and hybridized with single-stranded DNA targets. Prior to hybridization with the probes, the target strands were pre-annealed with the three auxiliary contiguous oligonucleotides flanking the target sequences. Screening HPV-18 positive cell lines and cervical samples were used to evaluate the performance of this HPV DNA microarray. Our results demonstrate that the HPV-18's variants hybridized specifically to probes, with no detection of unspecific signals. Specific probes successfully reveal detectable point mutations in these variants. The present DNA oligoarray system can be used as a reliable, sensitive and specific method for HPV-18 variant screening. Furthermore, this simple assay allows the use of inexpensive equipment, making it accessible in resource-poor settings.

A Low Density Microarray Method for the Identification of Human Papillomavirus Type 18 Variants

PubMed Central

Meza-Menchaca, Thuluz; Williams, John; Rodríguez-Estrada, Rocío B.; García-Bravo, Aracely; Ramos-Ligonio, Ángel; López-Monteon, Aracely; Zepeda, Rossana C.

2013-01-01

We describe a novel microarray based-method for the screening of oncogenic human papillomavirus 18 (HPV-18) molecular variants. Due to the fact that sequencing methodology may underestimate samples containing more than one variant we designed a specific and sensitive stacking DNA hybridization assay. This technology can be used to discriminate between three possible phylogenetic branches of HPV-18. Probes were attached covalently on glass slides and hybridized with single-stranded DNA targets. Prior to hybridization with the probes, the target strands were pre-annealed with the three auxiliary contiguous oligonucleotides flanking the target sequences. Screening HPV-18 positive cell lines and cervical samples were used to evaluate the performance of this HPV DNA microarray. Our results demonstrate that the HPV-18's variants hybridized specifically to probes, with no detection of unspecific signals. Specific probes successfully reveal detectable point mutations in these variants. The present DNA oligoarray system can be used as a reliable, sensitive and specific method for HPV-18 variant screening. Furthermore, this simple assay allows the use of inexpensive equipment, making it accessible in resource-poor settings. PMID:24077317

Authentication of Cordyceps sinensis by DNA Analyses: Comparison of ITS Sequence Analysis and RAPD-Derived Molecular Markers.

PubMed

Lam, Kelly Y C; Chan, Gallant K L; Xin, Gui-Zhong; Xu, Hong; Ku, Chuen-Fai; Chen, Jian-Ping; Yao, Ping; Lin, Huang-Quan; Dong, Tina T X; Tsim, Karl W K

2015-12-15

Cordyceps sinensis is an endoparasitic fungus widely used as a tonic and medicinal food in the practice of traditional Chinese medicine (TCM). In historical usage, Cordyceps specifically is referring to the species of C. sinensis. However, a number of closely related species are named themselves as Cordyceps, and they are sold commonly as C. sinensis. The substitutes and adulterants of C. sinensis are often introduced either intentionally or accidentally in the herbal market, which seriously affects the therapeutic effects or even leads to life-threatening poisoning. Here, we aim to identify Cordyceps by DNA sequencing technology. Two different DNA-based approaches were compared. The internal transcribed spacer (ITS) sequences and the random amplified polymorphic DNA (RAPD)-sequence characterized amplified region (SCAR) were developed here to authenticate different species of Cordyceps. Both approaches generally enabled discrimination of C. sinensis from others. The application of the two methods, supporting each other, increases the security of identification. For better reproducibility and faster analysis, the SCAR markers derived from the RAPD results provide a new method for quick authentication of Cordyceps.

When forensic odontology met biochemistry: Multidisciplinary approach in forensic human identification.

PubMed

Adserias-Garriga, Joe; Thomas, Christian; Ubelaker, Douglas H; C Zapico, Sara

2018-03-01

When human remains are found, the priority of the investigation is to ascertain the identity of the deceased. A positive identification is a key factor in providing closure for the family of the deceased; it is also required to issue the death certificate and therefore, to settle legal affairs. Moreover, it is difficult for any forensic investigation involving human remains to be solved without the determination of an identity. Therefore, personal identification is necessary for social, legal and forensic reasons. In the last thirty years forensic odontology has experienced an important transformation, from primarily involving occasional dental identification into a broader role, contributing to the determination of the biological profile. In the same way, "DNA fingerprinting" has evolved not only in terms of improving its technology, but also in its application beyond the "classical": helping with the estimation of sex, age and ancestry. As these two forensic disciplines have developed independently, their pathways have crossed several times through human identification operations, especially the ones that require a multidisciplinary approach. Thus, the aim of this review is to describe the contributions of both forensic odontology and molecular biology/biochemistry to human identification, demonstrating how a multidisciplinary approach can lead to a better and more efficient identification. Copyright © 2017 Elsevier Ltd. All rights reserved.

Development and validation of a multi-locus DNA metabarcoding method to identify endangered species in complex samples

PubMed Central

Arulandhu, Alfred J.; Staats, Martijn; Hagelaar, Rico; Voorhuijzen, Marleen M.; Prins, Theo W.; Scholtens, Ingrid; Costessi, Adalberto; Duijsings, Danny; Rechenmann, François; Gaspar, Frédéric B.; Barreto Crespo, Maria Teresa; Holst-Jensen, Arne; Birck, Matthew; Burns, Malcolm; Haynes, Edward; Hochegger, Rupert; Klingl, Alexander; Lundberg, Lisa; Natale, Chiara; Niekamp, Hauke; Perri, Elena; Barbante, Alessandra; Rosec, Jean-Philippe; Seyfarth, Ralf; Sovová, Tereza; Van Moorleghem, Christoff; van Ruth, Saskia; Peelen, Tamara

2017-01-01

Abstract DNA metabarcoding provides great potential for species identification in complex samples such as food supplements and traditional medicines. Such a method would aid Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) enforcement officers to combat wildlife crime by preventing illegal trade of endangered plant and animal species. The objective of this research was to develop a multi-locus DNA metabarcoding method for forensic wildlife species identification and to evaluate the applicability and reproducibility of this approach across different laboratories. A DNA metabarcoding method was developed that makes use of 12 DNA barcode markers that have demonstrated universal applicability across a wide range of plant and animal taxa and that facilitate the identification of species in samples containing degraded DNA. The DNA metabarcoding method was developed based on Illumina MiSeq amplicon sequencing of well-defined experimental mixtures, for which a bioinformatics pipeline with user-friendly web-interface was developed. The performance of the DNA metabarcoding method was assessed in an international validation trial by 16 laboratories, in which the method was found to be highly reproducible and sensitive enough to identify species present in a mixture at 1% dry weight content. The advanced multi-locus DNA metabarcoding method assessed in this study provides reliable and detailed data on the composition of complex food products, including information on the presence of CITES-listed species. The method can provide improved resolution for species identification, while verifying species with multiple DNA barcodes contributes to an enhanced quality assurance. PMID:29020743

Development and validation of a multi-locus DNA metabarcoding method to identify endangered species in complex samples.

PubMed

Arulandhu, Alfred J; Staats, Martijn; Hagelaar, Rico; Voorhuijzen, Marleen M; Prins, Theo W; Scholtens, Ingrid; Costessi, Adalberto; Duijsings, Danny; Rechenmann, François; Gaspar, Frédéric B; Barreto Crespo, Maria Teresa; Holst-Jensen, Arne; Birck, Matthew; Burns, Malcolm; Haynes, Edward; Hochegger, Rupert; Klingl, Alexander; Lundberg, Lisa; Natale, Chiara; Niekamp, Hauke; Perri, Elena; Barbante, Alessandra; Rosec, Jean-Philippe; Seyfarth, Ralf; Sovová, Tereza; Van Moorleghem, Christoff; van Ruth, Saskia; Peelen, Tamara; Kok, Esther

2017-10-01

DNA metabarcoding provides great potential for species identification in complex samples such as food supplements and traditional medicines. Such a method would aid Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) enforcement officers to combat wildlife crime by preventing illegal trade of endangered plant and animal species. The objective of this research was to develop a multi-locus DNA metabarcoding method for forensic wildlife species identification and to evaluate the applicability and reproducibility of this approach across different laboratories. A DNA metabarcoding method was developed that makes use of 12 DNA barcode markers that have demonstrated universal applicability across a wide range of plant and animal taxa and that facilitate the identification of species in samples containing degraded DNA. The DNA metabarcoding method was developed based on Illumina MiSeq amplicon sequencing of well-defined experimental mixtures, for which a bioinformatics pipeline with user-friendly web-interface was developed. The performance of the DNA metabarcoding method was assessed in an international validation trial by 16 laboratories, in which the method was found to be highly reproducible and sensitive enough to identify species present in a mixture at 1% dry weight content. The advanced multi-locus DNA metabarcoding method assessed in this study provides reliable and detailed data on the composition of complex food products, including information on the presence of CITES-listed species. The method can provide improved resolution for species identification, while verifying species with multiple DNA barcodes contributes to an enhanced quality assurance. © The Authors 2017. Published by Oxford University Press.

Identifying insects with incomplete DNA barcode libraries, African fruit flies (Diptera: Tephritidae) as a test case.

PubMed

Virgilio, Massimiliano; Jordaens, Kurt; Breman, Floris C; Backeljau, Thierry; De Meyer, Marc

2012-01-01

We propose a general working strategy to deal with incomplete reference libraries in the DNA barcoding identification of species. Considering that (1) queries with a large genetic distance with their best DNA barcode match are more likely to be misidentified and (2) imposing a distance threshold profitably reduces identification errors, we modelled relationships between identification performances and distance thresholds in four DNA barcode libraries of Diptera (n = 4270), Lepidoptera (n = 7577), Hymenoptera (n = 2067) and Tephritidae (n = 602 DNA barcodes). In all cases, more restrictive distance thresholds produced a gradual increase in the proportion of true negatives, a gradual decrease of false positives and more abrupt variations in the proportions of true positives and false negatives. More restrictive distance thresholds improved precision, yet negatively affected accuracy due to the higher proportions of queries discarded (viz. having a distance query-best match above the threshold). Using a simple linear regression we calculated an ad hoc distance threshold for the tephritid library producing an estimated relative identification error <0.05. According to the expectations, when we used this threshold for the identification of 188 independently collected tephritids, less than 5% of queries with a distance query-best match below the threshold were misidentified. Ad hoc thresholds can be calculated for each particular reference library of DNA barcodes and should be used as cut-off mark defining whether we can proceed identifying the query with a known estimated error probability (e.g. 5%) or whether we should discard the query and consider alternative/complementary identification methods.

Identifying Insects with Incomplete DNA Barcode Libraries, African Fruit Flies (Diptera: Tephritidae) as a Test Case

PubMed Central

Virgilio, Massimiliano; Jordaens, Kurt; Breman, Floris C.; Backeljau, Thierry; De Meyer, Marc

2012-01-01

We propose a general working strategy to deal with incomplete reference libraries in the DNA barcoding identification of species. Considering that (1) queries with a large genetic distance with their best DNA barcode match are more likely to be misidentified and (2) imposing a distance threshold profitably reduces identification errors, we modelled relationships between identification performances and distance thresholds in four DNA barcode libraries of Diptera (n = 4270), Lepidoptera (n = 7577), Hymenoptera (n = 2067) and Tephritidae (n = 602 DNA barcodes). In all cases, more restrictive distance thresholds produced a gradual increase in the proportion of true negatives, a gradual decrease of false positives and more abrupt variations in the proportions of true positives and false negatives. More restrictive distance thresholds improved precision, yet negatively affected accuracy due to the higher proportions of queries discarded (viz. having a distance query-best match above the threshold). Using a simple linear regression we calculated an ad hoc distance threshold for the tephritid library producing an estimated relative identification error <0.05. According to the expectations, when we used this threshold for the identification of 188 independently collected tephritids, less than 5% of queries with a distance query-best match below the threshold were misidentified. Ad hoc thresholds can be calculated for each particular reference library of DNA barcodes and should be used as cut-off mark defining whether we can proceed identifying the query with a known estimated error probability (e.g. 5%) or whether we should discard the query and consider alternative/complementary identification methods. PMID:22359600

enDNA-Prot: identification of DNA-binding proteins by applying ensemble learning.

PubMed

Xu, Ruifeng; Zhou, Jiyun; Liu, Bin; Yao, Lin; He, Yulan; Zou, Quan; Wang, Xiaolong

2014-01-01

DNA-binding proteins are crucial for various cellular processes, such as recognition of specific nucleotide, regulation of transcription, and regulation of gene expression. Developing an effective model for identifying DNA-binding proteins is an urgent research problem. Up to now, many methods have been proposed, but most of them focus on only one classifier and cannot make full use of the large number of negative samples to improve predicting performance. This study proposed a predictor called enDNA-Prot for DNA-binding protein identification by employing the ensemble learning technique. Experiential results showed that enDNA-Prot was comparable with DNA-Prot and outperformed DNAbinder and iDNA-Prot with performance improvement in the range of 3.97-9.52% in ACC and 0.08-0.19 in MCC. Furthermore, when the benchmark dataset was expanded with negative samples, the performance of enDNA-Prot outperformed the three existing methods by 2.83-16.63% in terms of ACC and 0.02-0.16 in terms of MCC. It indicated that enDNA-Prot is an effective method for DNA-binding protein identification and expanding training dataset with negative samples can improve its performance. For the convenience of the vast majority of experimental scientists, we developed a user-friendly web-server for enDNA-Prot which is freely accessible to the public.

Development of biometric DNA ink for authentication security.

PubMed

Hashiyada, Masaki

2004-10-01

Among the various types of biometric personal identification systems, DNA provides the most reliable personal identification. It is intrinsically digital and unchangeable while the person is alive, and even after his/her death. Increasing the number of DNA loci examined can enhance the power of discrimination. This report describes the development of DNA ink, which contains synthetic DNA mixed with printing inks. Single-stranded DNA fragments encoding a personalized set of short tandem repeats (STR) were synthesized. The sequence was defined as follows. First, a decimal DNA personal identification (DNA-ID) was established based on the number of STRs in the locus. Next, this DNA-ID was encrypted using a binary, 160-bit algorithm, using a hashing function to protect privacy. Since this function is irreversible, no one can recover the original information from the encrypted code. Finally, the bit series generated above is transformed into base sequences, and double-stranded DNA fragments are amplified by the polymerase chain reaction (PCR) to protect against physical attacks. Synthesized DNA was detected successfully after samples printed in DNA ink were subjected to several resistance tests used to assess the stability of printing inks. Endurance test results showed that this DNA ink would be suitable for practical use as a printing ink and was resistant to 40 hours of ultraviolet exposure, performance commensurate with that of photogravure ink. Copyright 2004 Tohoku University Medical Press

[Molecular biology in clinical cancer research: the example of digestive cancers].

PubMed

Lièvre, A; Laurent-Puig, P

2005-06-01

Cancer is a DNA disease characterized by uncontrolled cell proliferation due to the accumulation of genetic alterations. Recent progress in molecular biology allowed the identification of markers potentially usefull for patients management through the identification of these genetic alterations and a best understanding of chemotherapy molecular targets. Several examples in digestive oncology underline the relevance of molecular biology in clinical research. If almost all colorectal cancers (CRC) correspond to the same histopathological type (adenocarcinoma), molecular biology allowed the identification of two different molecular mechanisms of colorectal carcinogenesis: chromosomal instability characterized by recurrent allelic losses on chromosomes 17, 5, 18, 8 and 22 that contribute to the inactivation of tumor suppressor genes, and genetic instability characterized by the instability of microsatellite loci due to an alteration of DNA mismatch repair leading to the accumulation of mutations in genes involved in the control of cell cycle and apoptosis. These data are potentially interesting for the management of CRC patients. Indeed, microsatellite instability seems not only to be a good prognostic factor but also a molecular factor that can predict response to adjuvant 5-fluorouracil based chemotherapy. Therapeutic clinical trials taking into account these molecular parameters are still going on. DNA microarray-based gene expression profiling technology that allows the simultaneous analysis of thousand of tumor genes represents also an interesting approach in oncology with the recent identification of a "genetic signature" as a risk factor of tumor recurrence in stage II CRC, a setting in which the benefit of adjuvant chemotherapy remains on debate. At last, a best understanding of chemotherapy molecular targets allowed the identification of genetic markers that can predict the response and/or the toxicity of anti-cancer drugs used in gastrointestinal cancers, which could be helpful in the future to propose for each patient a personalized treatment. Mutations that can predict the response of new target therapies such as the inhibitors of the c-KIT tyrosine kinase activity in gastrointestinal stromal tumors have also been found and will allow the selection of patients who can have benefit from these new therapeutic drugs.

DNA sequencing methods in human genetics and disease research

PubMed Central

2013-01-01

DNA sequencing has revolutionized biological and medical research, and is poised to have a similar impact in medicine. This tool is just one of a number of developments in our capability to identify, quantitate and functionally characterize the components of the biological networks keeping us healthy or making us sick, but in many respects it has played the leading role in this process. The new technologies do, however, also provide a bridge between genotype and phenotype, both in man and model (as well as all other) organisms, revolutionize the identification of elements involved in a multitude of human diseases or other phenotypes, and generate a wealth of medically relevant information on every single person, as the basis of a truly personalized medicine of the future. PMID:24049638

Characterization of a novel Lactobacillus species closely related to Lactobacillus johnsonii using a combination of molecular and comparative genomics methods.

PubMed

Sarmiento-Rubiano, Luz-Adriana; Berger, Bernard; Moine, Déborah; Zúñiga, Manuel; Pérez-Martínez, Gaspar; Yebra, María J

2010-09-17

Comparative genomic hybridization (CGH) constitutes a powerful tool for identification and characterization of bacterial strains. In this study we have applied this technique for the characterization of a number of Lactobacillus strains isolated from the intestinal content of rats fed with a diet supplemented with sorbitol. Phylogenetic analysis based on 16S rRNA gene, recA, pheS, pyrG and tuf sequences identified five bacterial strains isolated from the intestinal content of rats as belonging to the recently described Lactobacillus taiwanensis species. DNA-DNA hybridization experiments confirmed that these five strains are distinct but closely related to Lactobacillus johnsonii and Lactobacillus gasseri. A whole genome DNA microarray designed for the probiotic L. johnsonii strain NCC533 was used for CGH analysis of L. johnsonii ATCC 33200T, L. johnsonii BL261, L. gasseri ATCC 33323T and L. taiwanensis BL263. In these experiments, the fluorescence ratio distributions obtained with L. taiwanensis and L. gasseri showed characteristic inter-species profiles. The percentage of conserved L. johnsonii NCC533 genes was about 83% in the L. johnsonii strains comparisons and decreased to 51% and 47% for L. taiwanensis and L. gasseri, respectively. These results confirmed the separate status of L. taiwanensis from L. johnsonii at the level of species, and also that L. taiwanensis is closer to L. johnsonii than L. gasseri is to L. johnsonii. Conventional taxonomic analyses and microarray-based CGH analysis have been used for the identification and characterization of the newly species L. taiwanensis. The microarray-based CGH technology has been shown as a remarkable tool for the identification and fine discrimination between phylogenetically close species, and additionally provided insight into the adaptation of the strain L. taiwanensis BL263 to its ecological niche.

IDENTIFICATION OF STEREOCHEMICAL CONFIGURATIONS OF CYCLOPENTA[CD]PYRENE-DNA ADDUCTS IN STRAIN A/J MOUSE LUNG AND C3H10T1/2CL8 CELLS

EPA Science Inventory

Identification of Sterochemical Configurations of Cyclopent A[cd]Pyrene DNA Adducts in Strain A/J Mouse Lung and C3H10T1/2CL8 Cells.

Four major and several minor DNA adducts were resolved by 32P-postlabeling analysis of DNA from strain A/J mouse lung and C3H10T1/2CL8 (C3H...

Extensive 5.8S nrDNA polymorphism in Mammillaria (Cactaceae) with special reference to the identification of pseudogenic internal transcribed spacer regions.

PubMed

Harpke, Doerte; Peterson, Angela

2008-05-01

The internal transcribed spacer (ITS) region (ITS1, 5.8S rDNA, ITS2) represents the most widely applied nuclear marker in eukaryotic phylogenetics. Although this region has been assumed to evolve in concert, the number of investigations revealing high degrees of intra-individual polymorphism connected with the presence of pseudogenes has risen. The 5.8S rDNA is the most important diagnostic marker for functionality of the ITS region. In Mammillaria, intra-individual 5.8S rDNA polymorphisms of up to 36% and up to nine different types have been found. Twenty-eight of 30 cloned genomic Mammillaria sequences were identified as putative pseudogenes. For the identification of pseudogenic ITS regions, in addition to formal tests based on substitution rates, we attempted to focus on functional features of the 5.8S rDNA (5.8S motif, secondary structure). The importance of functional data for the identification of pseudogenes is outlined and discussed. The identification of pseudogenes is essential, because they may cause erroneous phylogenies and taxonomic problems.

DNA Identification of Commingled Human Remains from the Cemetery Relocated by Flooding in Central Bosnia and Herzegovina.

PubMed

Čakar, Jasmina; Pilav, Amela; Džehverović, Mirela; Ahatović, Anesa; Haverić, Sanin; Ramić, Jasmin; Marjanović, Damir

2018-01-01

The floods in Bosnia and Herzegovina in May 2014 caused landslides all over the country. In the small village of Šerići, near the town of Zenica, a landslide destroyed the local cemetery, relocated graves, and commingled skeletal remains. As the use of other physical methods of identification (facial recognition, fingerprint analysis, dental analysis, etc.) was not possible, DNA analysis was applied. DNA was isolated from 20 skeletal remains (bone and tooth samples) and six reference samples (blood from living relatives) and amplified using PowerPlex ® Fusion and PowerPlex ® Y23 kits. DNA profiles were generated for all reference samples and 17 skeletal remains. A statistical analysis (calculation of paternity, maternity, and sibling indexes and matching probabilities) resulted in 10 positive identifications. In this study, 5 individuals were identified based on one reference sample. This has once again demonstrated the significance of DNA analysis in resolving the most complicated cases, such as the identification of commingled human skeletal remains. © 2017 American Academy of Forensic Sciences.

Utility of GenBank and the Barcode of Life Data Systems (BOLD) for the identification of forensically important Diptera from Belgium and France

PubMed Central

Sonet, Gontran; Jordaens, Kurt; Braet, Yves; Bourguignon, Luc; Dupont, Eréna; Backeljau, Thierry; De Meyer, Marc; Desmyter, Stijn

2013-01-01

Abstract Fly larvae living on dead corpses can be used to estimate post-mortem intervals. The identification of these flies is decisive in forensic casework and can be facilitated by using DNA barcodes provided that a representative and comprehensive reference library of DNA barcodes is available. We constructed a local (Belgium and France) reference library of 85 sequences of the COI DNA barcode fragment (mitochondrial cytochrome c oxidase subunit I gene), from 16 fly species of forensic interest (Calliphoridae, Muscidae, Fanniidae). This library was then used to evaluate the ability of two public libraries (GenBank and the Barcode of Life Data Systems – BOLD) to identify specimens from Belgian and French forensic cases. The public libraries indeed allow a correct identification of most specimens. Yet, some of the identifications remain ambiguous and some forensically important fly species are not, or insufficiently, represented in the reference libraries. Several search options offered by GenBank and BOLD can be used to further improve the identifications obtained from both libraries using DNA barcodes. PMID:24453564

Rapid polymerase chain reaction-based screening assay for bacterial biothreat agents.

PubMed

Yang, Samuel; Rothman, Richard E; Hardick, Justin; Kuroki, Marcos; Hardick, Andrew; Doshi, Vishal; Ramachandran, Padmini; Gaydos, Charlotte A

2008-04-01

To design and evaluate a rapid polymerase chain reaction (PCR)-based assay for detecting Eubacteria and performing early screening for selected Class A biothreat bacterial pathogens. The authors designed a two-step PCR-based algorithm consisting of an initial broad-based universal detection step, followed by specific pathogen identification targeted for identification of the Class A bacterial biothreat agents. A region in the bacterial 16S rRNA gene containing a highly variable sequence flanked by clusters of conserved sequences was chosen as the target for the PCR assay design. A previously described highly conserved region located within the 16S rRNA amplicon was selected as the universal probe (UniProbe, Integrated DNA Technology, Coralville, IA). Pathogen-specific TaqMan probes were designed for Bacillus anthracis, Yersinia pestis, and Francisella tularensis. Performance of the assay was assessed using genomic DNA extracted from the aforementioned biothreat-related organisms (inactivated or surrogate) and other common bacteria. The UniProbe detected the presence of all tested Eubacteria (31/31) with high analytical sensitivity. The biothreat-specific probes accurately identified organisms down to the closely related species and genus level, but were unable to discriminate between very close surrogates, such as Yersinia philomiragia and Bacillus cereus. A simple, two-step PCR-based assay proved capable of both universal bacterial detection and identification of select Class A bacterial biothreat and biothreat-related pathogens. Although this assay requires confirmatory testing for definitive species identification, the method has great potential for use in ED-based settings for rapid diagnosis in cases of suspected Category A bacterial biothreat agents.

Identification of Missing Norwegian World War II Soldiers, in Karelia Russia.

PubMed

Morild, Inge; Hamre, Stian S; Huel, Rene; Parsons, Thomas J

2015-07-01

This article presents the multidisciplinary effort in trying to identify the skeletal remains of 100 Norwegian soldiers serving in the German army, killed in Karelia Russia in 1944, from the recovery of the remains through the final identification using DNA. Of the 150 bone samples sent for DNA testing, 93 DNA profiles were obtained relating to 57 unique individuals. The relatives could not be directly contacted as the soldiers were considered as traitors to Norway; therefore, only 45 reference samples, relating to 42 cases of the missing, were donated. DNA matches for 14 soldiers and 12 additional body part re-associations for these individuals were found. Another 24 bone samples were re-associated with 16 individuals, but no familial match was found. More than six decades after the end of WWII, DNA analysis can significantly contribute to the identification of the remains. © 2015 American Academy of Forensic Sciences.

Identification of the skeletal remains of a murder victim by DNA analysis.

PubMed

Hagelberg, E; Gray, I C; Jeffreys, A J

1991-08-01

There is considerable anthropological and forensic interest in the possibility of DNA typing skeletal remains. Trace amounts of DNA can be recovered even from 5,500-year-old bones and multicopy human mitochondrial DNA sequences can frequently be amplified from such DNA using the polymerase chain reaction (PCR). But given the sensitivity of PCR, it is very difficult to exclude contaminating material. We now report the successful identification of the 8-year-old skeletal remains of a murder victim, by comparative typing of nuclear microsatellite markers in the remains and in the presumptive parents of the victim. This analysis establishes the authenticity of the bone DNA and the feasibility of bone DNA typing in forensic investigations.

Flow cytometry enables identification of sporophytic eliciting stress treatments in gametic cells.

PubMed

Ribalta, F M; Croser, J S; Ochatt, S J

2012-01-01

Flow cytometry was used to quantify the effect of individual and combined stress treatments on elicitation of androgenesis by analyzing the relative nuclear DNA content of in vitro cultured microspores of Pisum sativum L. Differences in relative nuclear DNA content of microspores within anthers after stress treatments were clearly evident from the flow cytometry profiles, and permitted us to predict whether a combination of stresses were elicitors or enhancers of androgenesis. This is the first report to assess the effect of various stress treatments in a plant species based on relative nuclear DNA content and to use this information to categorize them as 'elicitors' or 'enhancers'. Flow cytometry represents a simple, quick and reliable way to analyze and discriminate the effect of various stress treatments on elicitation of androgenesis. These results form a solid basis for further efforts designed to enhance responses and to extend double haploid technology to other legumes. Copyright © 2011 Elsevier GmbH. All rights reserved.

Genetics and Forensics: Making the National DNA Database

PubMed Central

Johnson, Paul; Williams, Robin; Martin, Paul

2005-01-01

This paper is based on a current study of the growing police use of the epistemic authority of molecular biology for the identification of criminal suspects in support of crime investigation. It discusses the development of DNA profiling and the establishment and development of the UK National DNA Database (NDNAD) as an instance of the ‘scientification of police work’ (Ericson and Shearing 1986) in which the police uses of science and technology have a recursive effect on their future development. The NDNAD, owned by the Association of Chief Police Officers of England and Wales, is the first of its kind in the world and currently contains the genetic profiles of more than 2 million people. The paper provides a framework for the examination of this socio-technical innovation, begins to tease out the dense and compact history of the database and accounts for the way in which changes and developments across disparate scientific, governmental and policing contexts, have all contributed to the range of uses to which it is put. PMID:16467921

Molecular detection of fungal pathogens in clinical specimens by 18S rDNA high-throughput screening in comparison to ITS PCR and culture.

PubMed

Wagner, K; Springer, B; Pires, V P; Keller, P M

2018-05-03

The rising incidence of invasive fungal infections and the expanding spectrum of fungal pathogens makes early and accurate identification of the causative pathogen a daunting task. Diagnostics using molecular markers enable rapid identification of fungi, offer new insights into infectious disease dynamics, and open new possibilities for infectious disease control and prevention. We performed a retrospective study using clinical specimens (N = 233) from patients with suspected fungal infection previously subjected to culture and/or internal transcribed spacer (ITS) PCR. We used these specimens to evaluate a high-throughput screening method for fungal detection using automated DNA extraction (QIASymphony), fungal ribosomal small subunit (18S) rDNA RT-PCR and amplicon sequencing. Fungal sequences were compared with sequences from the curated, commercially available SmartGene IDNS database for pathogen identification. Concordance between 18S rDNA RT-PCR and culture results was 91%, and congruence between 18S rDNA RT-PCR and ITS PCR results was 94%. In addition, 18S rDNA RT-PCR and Sanger sequencing detected fungal pathogens in culture negative (N = 13) and ITS PCR negative specimens (N = 12) from patients with a clinically confirmed fungal infection. Our results support the use of the 18S rDNA RT-PCR diagnostic workflow for rapid and accurate identification of fungal pathogens in clinical specimens.

DEVELOPMENT OF DNA-BASED TOOLS FOR IDENTIFICATION AND MONITORING OF AQUATIC INTRODUCED SPECIES

EPA Science Inventory

Claims for potential applications of DNA taxonomy range from identification of unknown specimens and the discovery of new species to the study of biodiversity through comprehensive characterizations of complex biotic communities drawn from environmental samples. Recently, these a...

Wound Healing Finally Enters the Age of Molecular Diagnostic Medicine

PubMed Central

Tatum, Owatha L.; Dowd, Scot E.

2012-01-01

Background Many wounds are difficult to heal because of the large, complex community of microbes present within the wound. The Problem Classical laboratory culture methods do not provide an accurate picture of the microbial interactions or representation of microorganisms within a wound. There is an inherent bias in diagnosis based upon classical culture stemming from the ability of certain organisms to thrive in culture while others are underrepresented or fail to be identified in culture altogether. Chronic wounds also contain polymicrobial infections existing as a cooperative community that is resistant to antibiotic therapy. Basic/Clinical Science Advances New methods in molecular diagnostic medicine allow the identification of nearly all organisms present in a wound irrespective of the ability of these organisms to be grown in culture. Advances in DNA analyses allow absolute identification of microorganisms from very small clinical specimens. These new methods also provide a quantitative representation of all microorganisms contributing to these polymicrobial infections. Clinical Care Relevance Technological advances in laboratory diagnostics can significantly shorten the time required to heal chronic wounds. Identification of the genetic signatures of organisms present within a wound allows clinicians to identify and treat the primary organisms responsible for nonhealing wounds. Conclusion Advanced genetic technologies targeting the specific needs of wound care patients are now accessible to all wound care clinicians. PMID:24527290

Nanopore Technology: A Simple, Inexpensive, Futuristic Technology for DNA Sequencing.

PubMed

Gupta, P D

2016-10-01

In health care, importance of DNA sequencing has been fully established. Sanger's Capillary Electrophoresis DNA sequencing methodology is time consuming, cumbersome, hence become more expensive. Lately, because of its versatility DNA sequencing became house hold name, and therefore, there is an urgent need of simple, fast, inexpensive, DNA sequencing technology. In the beginning of this century efforts were made, and Nanopore DNA sequencing technology was developed; still it is infancy, nevertheless, it is the futuristic technology.

Characteristics of Populations of the Russian Federation over the Panel of Fifteen Loci Used for DNA Identification and in Forensic Medical Examination

PubMed Central

A Stepanov, V.; Balanovsky, O.P.; Melnikov, A.V.; Lash-Zavada, A.Yu.; Khar’kov, V.N.; Tyazhelova, T.V.; Akhmetova, V.L.; Zhukova, O.V.; Shneider, Yu.V.; Shil’nikova, I.N.; Borinskaya, S.A.; Marusin, A.V.; Spiridonova, M.G.; Simonova, K.V.; Khitrinskaya, I.Yu.; Radzhabov, M.O.; Romanov, A.G.; Shtygasheva, O.V.; Koshel’, S.M.; Balanovskaya, E.V.; Rybakova, A.V.; Khusnutdinova, E.K.; Puzyrev, V.P.; Yankovsky, N.K.

2011-01-01

Seventeen population groups within the Russian Federation were characterized for the first time using a panel of 15 genetic markers that are used for DNA identification and in forensic medical examinations. The degree of polymorphism and population diversity of microsatellite loci within the Power Plex system (Promega) in Russian populations; the distribution of alleles and genotypes within the populations of six cities and 11 ethnic groups of the Russian Federation; the levels of intra- and interpopulation genetic differentiation of population; genetic relations between populations; and the identification and forensic medical characteristics of the system of markers under study were determined. Significant differences were revealed between the Russian populations and the U.S. reference base that was used recently in the forensic medical examination of the RF. A database of the allelic frequencies of 15 microsatellite loci that are used for DNA identification and forensic medical examination was created; the database has the potential of becoming the reference for performing forensic medical examinations in Russia. The spatial organization of genetic diversity over the panel of the STR markers that are used for DNA identification was revealed. It represents the general regularities of geographical clusterization of human populations over various types of genetic markers. The necessity to take into account a population’s genetic structure during forensic medical examinations and DNA identification of criminal suspects was substantiated. PMID:22649684

Development of a multilocus-based approach for sponge (phylum Porifera) identification: refinement and limitations.

PubMed

Yang, Qi; Franco, Christopher M M; Sorokin, Shirley J; Zhang, Wei

2017-02-02

For sponges (phylum Porifera), there is no reliable molecular protocol available for species identification. To address this gap, we developed a multilocus-based Sponge Identification Protocol (SIP) validated by a sample of 37 sponge species belonging to 10 orders from South Australia. The universal barcode COI mtDNA, 28S rRNA gene (D3-D5), and the nuclear ITS1-5.8S-ITS2 region were evaluated for their suitability and capacity for sponge identification. The highest Bit Score was applied to infer the identity. The reliability of SIP was validated by phylogenetic analysis. The 28S rRNA gene and COI mtDNA performed better than the ITS region in classifying sponges at various taxonomic levels. A major limitation is that the databases are not well populated and possess low diversity, making it difficult to conduct the molecular identification protocol. The identification is also impacted by the accuracy of the morphological classification of the sponges whose sequences have been submitted to the database. Re-examination of the morphological identification further demonstrated and improved the reliability of sponge identification by SIP. Integrated with morphological identification, the multilocus-based SIP offers an improved protocol for more reliable and effective sponge identification, by coupling the accuracy of different DNA markers.

Development of a multilocus-based approach for sponge (phylum Porifera) identification: refinement and limitations

PubMed Central

Yang, Qi; Franco, Christopher M. M.; Sorokin, Shirley J.; Zhang, Wei

2017-01-01

For sponges (phylum Porifera), there is no reliable molecular protocol available for species identification. To address this gap, we developed a multilocus-based Sponge Identification Protocol (SIP) validated by a sample of 37 sponge species belonging to 10 orders from South Australia. The universal barcode COI mtDNA, 28S rRNA gene (D3–D5), and the nuclear ITS1-5.8S-ITS2 region were evaluated for their suitability and capacity for sponge identification. The highest Bit Score was applied to infer the identity. The reliability of SIP was validated by phylogenetic analysis. The 28S rRNA gene and COI mtDNA performed better than the ITS region in classifying sponges at various taxonomic levels. A major limitation is that the databases are not well populated and possess low diversity, making it difficult to conduct the molecular identification protocol. The identification is also impacted by the accuracy of the morphological classification of the sponges whose sequences have been submitted to the database. Re-examination of the morphological identification further demonstrated and improved the reliability of sponge identification by SIP. Integrated with morphological identification, the multilocus-based SIP offers an improved protocol for more reliable and effective sponge identification, by coupling the accuracy of different DNA markers. PMID:28150727

Peptide biomarkers as a way to determine meat authenticity.

PubMed

Sentandreu, Miguel Angel; Sentandreu, Enrique

2011-11-01

Meat fraud implies many illegal procedures affecting the composition of meat and meat products, something that is commonly done with the aim to increase profit. These practices need to be controlled by legal authorities by means of robust, accurate and sensitive methodologies capable to assure that fraudulent or accidental mislabelling does not arise. Common strategies traditionally used to assess meat authenticity have been based on methods such as chemometric analysis of a large set of data analysis, immunoassays or DNA analysis. The identification of peptide biomarkers specific of a particular meat species, tissue or ingredient by proteomic technologies constitutes an interesting and promising alternative to existing methodologies due to its high discriminating power, robustness and sensitivity. The possibility to develop standardized protein extraction protocols, together with the considerably higher resistance of peptide sequences to food processing as compared to DNA sequences, would overcome some of the limitations currently existing for quantitative determinations of highly processed food samples. The use of routine mass spectrometry equipment would make the technology suitable for control laboratories. Copyright © 2011 Elsevier Ltd. All rights reserved.

Complete DNA barcode reference library for a country's butterfly fauna reveals high performance for temperate Europe

PubMed Central

Dincă, Vlad; Zakharov, Evgeny V.; Hebert, Paul D. N.; Vila, Roger

2011-01-01

DNA barcoding aims to accelerate species identification and discovery, but performance tests have shown marked differences in identification success. As a consequence, there remains a great need for comprehensive studies which objectively test the method in groups with a solid taxonomic framework. This study focuses on the 180 species of butterflies in Romania, accounting for about one third of the European butterfly fauna. This country includes five eco-regions, the highest of any in the European Union, and is a good representative for temperate areas. Morphology and DNA barcodes of more than 1300 specimens were carefully studied and compared. Our results indicate that 90 per cent of the species form barcode clusters allowing their reliable identification. The remaining cases involve nine closely related species pairs, some whose taxonomic status is controversial or that hybridize regularly. Interestingly, DNA barcoding was found to be the most effective identification tool, outperforming external morphology, and being slightly better than male genitalia. Romania is now the first country to have a comprehensive DNA barcode reference database for butterflies. Similar barcoding efforts based on comprehensive sampling of specific geographical regions can act as functional modules that will foster the early application of DNA barcoding while a global system is under development. PMID:20702462

Gender-Associated Mitochondrial DNA Heteroplasmy in Somatic Tissues of the Endangered Freshwater Mussel Unio crassus (Bivalvia: Unionidae): Implications for Sex Identification and Phylogeographical Studies.

PubMed

Mioduchowska, Monika; Kaczmarczyk, Agnieszka; Zając, Katarzyna; Zając, Tadeusz; Sell, Jerzy

2016-11-01

Some bivalve species possess two independent mitochondrial DNA lineages: maternally (F-type) and paternally (M-type) inherited. This phenomenon is called doubly uniparental inheritance. It is generally agreed that F-type mtDNA is typically present in female somatic and gonadal tissues as well as in male somatic tissues, whereas the M-type mtDNA occurs only in male germ line and gonadal tissue. In the present study, the mtDNA heteroplasmy (for both F and M genomes) in male somatic tissues of Unio crassus (Philipsson, 1788), species threatened with extinction, has been confirmed. Taking advantage from the presence of Mcox1 marker only in male somatic tissues, we developed a new method of sex identification in this endangered species, using nondestructive tissue sampling. Probability of correct sex identification was estimated at 97.5%. The present study is the first report on gender-associated mitochondrial DNA heteroplasmy in male somatic tissues of thick-shelled river mussel and first approach to U. crassus sex identification at molecular level. Our study also confirmed the utility of paternally inherited Mcox1 gene fragment as a complementary molecular tool for resolving phylogeographical relationships among populations of thick-shelled river mussel. © 2017 Wiley Periodicals, Inc.

Genomic Approaches to Zebrafish Cancer

PubMed Central

2017-01-01

The zebrafish has emerged as an important model for studying cancer biology. Identification of DNA, RNA and chromatin abnormalities can give profound insight into the mechanisms of tumorigenesis and the there are many techniques for analyzing the genomes of these tumors. Here, I present an overview of the available technologies for analyzing tumor genomes in the zebrafish, including array based methods as well as next-generation sequencing technologies. I also discuss the ways in which zebrafish tumor genomes can be compared to human genomes using cross-species oncogenomics, which act to filter genomic noise and ultimately uncover central drivers of malignancy. Finally, I discuss downstream analytic tools, including network analysis, that can help to organize the alterations into coherent biological frameworks that can then be investigated further. PMID:27165352

Highlights of DNA Barcoding in identification of salient microorganisms like fungi.

PubMed

Dulla, E L; Kathera, C; Gurijala, H K; Mallakuntla, T R; Srinivasan, P; Prasad, V; Mopati, R D; Jasti, P K

2016-12-01

Fungi, the second largest kingdom of eukaryotic life, are diverse and widespread. Fungi play a distinctive role in the production of different products on industrial scale, like fungal enzymes, antibiotics, fermented foods, etc., to give storage stability and improved health to meet major global challenges. To utilize algae perfectly for human needs, and to pave the way for getting a healthy relationship with fungi, it is important to identify them in a quick and robust manner with molecular-based identification system. So, there is a technique that aims to provide a well-organized method for species level identifications and to contribute powerfully to taxonomic and biodiversity research is DNA Barcoding. DNA Barcoding is generally achieved by the retrieval of a short DNA sequence - the 'barcode' - from a standard part of the genome and that barcode is then compared with a library of reference barcode sequences derived from individuals of known identity for identification. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Evaluation of partial 16S ribosomal DNA sequencing for identification of nocardia species by using the MicroSeq 500 system with an expanded database.

PubMed

Cloud, Joann L; Conville, Patricia S; Croft, Ann; Harmsen, Dag; Witebsky, Frank G; Carroll, Karen C

2004-02-01

Identification of clinically significant nocardiae to the species level is important in patient diagnosis and treatment. A study was performed to evaluate Nocardia species identification obtained by partial 16S ribosomal DNA (rDNA) sequencing by the MicroSeq 500 system with an expanded database. The expanded portion of the database was developed from partial 5' 16S rDNA sequences derived from 28 reference strains (from the American Type Culture Collection and the Japanese Collection of Microorganisms). The expanded MicroSeq 500 system was compared to (i). conventional identification obtained from a combination of growth characteristics with biochemical and drug susceptibility tests; (ii). molecular techniques involving restriction enzyme analysis (REA) of portions of the 16S rRNA and 65-kDa heat shock protein genes; and (iii). when necessary, sequencing of a 999-bp fragment of the 16S rRNA gene. An unknown isolate was identified as a particular species if the sequence obtained by partial 16S rDNA sequencing by the expanded MicroSeq 500 system was 99.0% similar to that of the reference strain. Ninety-four nocardiae representing 10 separate species were isolated from patient specimens and examined by using the three different methods. Sequencing of partial 16S rDNA by the expanded MicroSeq 500 system resulted in only 72% agreement with conventional methods for species identification and 90% agreement with the alternative molecular methods. Molecular methods for identification of Nocardia species provide more accurate and rapid results than the conventional methods using biochemical and susceptibility testing. With an expanded database, the MicroSeq 500 system for partial 16S rDNA was able to correctly identify the human pathogens N. brasiliensis, N. cyriacigeorgica, N. farcinica, N. nova, N. otitidiscaviarum, and N. veterana.

DNA Barcoding for Species Identification of Insect Skins: A Test on Chironomidae (Diptera) Pupal Exuviae

PubMed Central

Ekrem, Torbjørn; Stur, Elisabeth

2017-01-01

Abstract Chironomidae (Diptera) pupal exuviae samples are commonly used for biological monitoring of aquatic habitats. DNA barcoding has proved useful for species identification of chironomid life stages containing cellular tissue, but the barcoding success of chironomid pupal exuviae is unknown. We assessed whether standard DNA barcoding could be efficiently used for species identification of chironomid pupal exuviae when compared with morphological techniques and if there were differences in performance between temperate and tropical ecosystems, subfamilies, and tribes. PCR, sequence, and identification success differed significantly between geographic regions and taxonomic groups. For Norway, 27 out of 190 (14.2%) of pupal exuviae resulted in high-quality chironomid sequences that match species. For Costa Rica, 69 out of 190 (36.3%) Costa Rican pupal exuviae resulted in high-quality sequences, but none matched known species. Standard DNA barcoding of chironomid pupal exuviae had limited success in species identification of unknown specimens due to contaminations and lack of matching references in available barcode libraries, especially from Costa Rica. Therefore, we recommend future biodiversity studies that focus their efforts on understudied regions, to simultaneously use morphological and molecular identification techniques to identify all life stages of chironomids and populate the barcode reference library with identified sequences.

A new strategy for complete identification of sea buckthorn cultivars by using random amplified polymorphic DNA markers.

PubMed

Yang, G; Ding, J; Wu, L R; Duan, Y D; Li, A Y; Shan, J Y; Wu, Y X

2015-03-13

DNA fingerprinting is both a popular and important technique with several advantages in plant cultivar identification. However, this technique has not been used widely and efficiently in practical plant identification because the analysis and recording of data generated from fingerprinting and genotyping are tedious and difficult. We developed a novel approach known as a cultivar identification diagram (CID) strategy that uses DNA markers to separate plant individuals in a more efficient, practical, and referable manner. A CID was manually constructed and a polymorphic marker was generated from each polymerase chain reaction for sample separation. In this study, 67 important sea buckthorn cultivars cultivated in China were successfully separated with random amplified polymorphic DNA markers using the CID analysis strategy, with only seven 11-nucleotide primers employed. The utilization of the CID of these 67 sea buckthorn cultivars was verified by identifying 2 randomly chosen groups of cultivars among the 67 cultivars. The main advantages of this identification strategy include fewer primers used and separation of all cultivars using the corresponding primers. This sea buckthorn CID was able to separate any sea buckthorn cultivars among the 67 studied, which is useful for sea buckthorn cultivar identification, cultivar-right-protection, and for the sea buckthorn nursery industry in China.

The effectiveness of three regions in mitochondrial genome for aphid DNA barcoding: a case in Lachininae.

PubMed

Chen, Rui; Jiang, Li-Yun; Qiao, Ge-Xia

2012-01-01

The mitochondrial gene COI has been widely used by taxonomists as a standard DNA barcode sequence for the identification of many animal species. However, the COI region is of limited use for identifying certain species and is not efficiently amplified by PCR in all animal taxa. To evaluate the utility of COI as a DNA barcode and to identify other barcode genes, we chose the aphid subfamily Lachninae (Hemiptera: Aphididae) as the focus of our study. We compared the results obtained using COI with two other mitochondrial genes, COII and Cytb. In addition, we propose a new method to improve the efficiency of species identification using DNA barcoding. Three mitochondrial genes (COI, COII and Cytb) were sequenced and were used in the identification of over 80 species of Lachninae. The COI and COII genes demonstrated a greater PCR amplification efficiency than Cytb. Species identification using COII sequences had a higher frequency of success (96.9% in "best match" and 90.8% in "best close match") and yielded lower intra- and higher interspecific genetic divergence values than the other two markers. The use of "tag barcodes" is a new approach that involves attaching a species-specific tag to the standard DNA barcode. With this method, the "barcoding overlap" can be nearly eliminated. As a result, we were able to increase the identification success rate from 83.9% to 95.2% by using COI and the "best close match" technique. A COII-based identification system should be more effective in identifying lachnine species than COI or Cytb. However, the Cytb gene is an effective marker for the study of aphid population genetics due to its high sequence diversity. Furthermore, the use of "tag barcodes" can improve the accuracy of DNA barcoding identification by reducing or removing the overlap between intra- and inter-specific genetic divergence values.

Use of rbcL and trnL-F as a Two-Locus DNA Barcode for Identification of NW-European Ferns: An Ecological Perspective

PubMed Central

de Groot, G. Arjen; During, Heinjo J.; Maas, Jan W.; Schneider, Harald; Vogel, Johannes C.; Erkens, Roy H. J.

2011-01-01

Although consensus has now been reached on a general two-locus DNA barcode for land plants, the selected combination of markers (rbcL + matK) is not applicable for ferns at the moment. Yet especially for ferns, DNA barcoding is potentially of great value since fern gametophytes—while playing an essential role in fern colonization and reproduction—generally lack the morphological complexity for morphology-based identification and have therefore been underappreciated in ecological studies. We evaluated the potential of a combination of rbcL with a noncoding plastid marker, trnL-F, to obtain DNA-identifications for fern species. A regional approach was adopted, by creating a reference database of trusted rbcL and trnL-F sequences for the wild-occurring homosporous ferns of NW-Europe. A combination of parsimony analyses and distance-based analyses was performed to evaluate the discriminatory power of the two-region barcode. DNA was successfully extracted from 86 tiny fern gametophytes and was used as a test case for the performance of DNA-based identification. Primer universality proved high for both markers. Based on the combined rbcL + trnL-F dataset, all genera as well as all species with non-equal chloroplast genomes formed their own well supported monophyletic clade, indicating a high discriminatory power. Interspecific distances were larger than intraspecific distances for all tested taxa. Identification tests on gametophytes showed a comparable result. All test samples could be identified to genus level, species identification was well possible unless they belonged to a pair of Dryopteris species with completely identical chloroplast genomes. Our results suggest a high potential of the combined use of rbcL and trnL-F as a two-locus cpDNA barcode for identification of fern species. A regional approach may be preferred for ecological tests. We here offer such a ready-to-use barcoding approach for ferns, which opens the way for answering a whole range of questions previously unaddressed in fern gametophyte ecology. PMID:21298108

Application of HLA-DRB1 genotyping by oligonucleotide micro-array technology in forensic medicine.

PubMed

Jiang, Bin; Li, Yao; Wu, Hai; He, Xianmin; Li, Chengtao; Li, Li; Tang, Rong; Xie, Yi; Mao, Yumin

2006-10-16

The human leukocyte antigen (HLA) system is known to be the most complex polymorphic system in the human genome. Among all of the HLA loci, HLA-DRB1 has the second largest number of alleles. The purpose of this study is to develop an oligonucleotide micro-array based HLA-DRB1 typing system for use in forensic identification, anthropology, tissue transplantation, and other genetic research fields. The system was developed by analyzing the HLA-DRB1 (DRB1) genotypes in 1198 unrelated healthy Chinese Han individuals originating from various parts of China and residing in Shanghai, China. Polymerase chain reaction (PCR) coupled with the oligonucleotide micro-array technology was used to detect and type HLA-DRB1 alleles of the sample individuals. The reliability, sensitivity, consistency and specificity were evaluated for use in forensic identification. Furthermore, a meta-analysis was carried out by comparing the allele frequencies of the HLA-DRB1 locus with those of other Chinese Han groups, Chinese minorities and other ethnic populations. All the DNA samples yielded a 273 bp amplification product, with no other amplification products in this length range. The minimum quantity of DNA detected by this method is 15 ng in a PCR reaction system of 25 microl. The population studied appeared to be not in Hardy-Weinberg equilibrium. Observed heterozygosity (Ho), expected heterozygosity (He), expected probability of exclusion (PE), polymorphic information content (PIC), and discrimination power (DP) of the HLA-DRB1 locus from the Shanghai Han ethnic group were evaluated to be 0.8022, 0.8870, 0.7741, 0.8771, 0.9750, respectively. A total of 25 HLA-DRB1 alleles were identified. HLA-DRB1*09XX, *04XX, *12XX and *15XX were the most frequent DRB1 alleles, which were observed in 58.76% of the sample. One hundred and sixteen genotypes were found. The five most frequent genotypes were: *04XX/*04XX (0.0626), *09XX/*09XX (0.0593), *04XX/*09XX (0.0551), *09XX/*15XX (0.0384) and *08XX/*12XX (0.0351). The meta-analysis showed that there were uniquely distributed features of DRB1 alleles among various ethnic populations and among the studied population groups from various regions with the same ethnic origin. An HLA-DRB1 genotyping system has been developed and established based on the oligonucleotide micro-array technology. The HLA-DRB1 typing of the Han population in Shanghai has revealed a relatively high heterogeneity. Information obtained in this study will be useful for medical and forensic applications as well as in anthropology research. Large-scale micro-array detection is highly accurate and reliable for DNA-based HLA-DRB1 genotyping. These results suggest that HLA-DRB1 DNA polymorphisms and the database of the Shanghai Han group have useful applications in processing forensic casework (as personal identification, paternity test), tracing population migration and genetic diagnosis.

Recent patents for detecting the species of origin in animal feedstuff, and raw and processed meat products.

PubMed

Rogberg-Muñoz, Andrés; Posik, Diego M; Rípoli, María V; Falomir Lockhart, Agustín H; Peral-García, Pilar; Giovambattista, Guillermo

2013-04-01

The value of the traceability and labeling of food is attributable to two main aspects: health safety and/or product or process certification. The identification of the species related to meat production is still a major concern for economic, religious and health reasons. Many approaches and technologies have been used for species identification in animal feedstuff and food. The early methods for meat products identification include physical, anatomical, histological and chemical. Since 1970, a variety of methods were developed, these include electrophoresis (i.e. isoelectrofocusing), chromatography (i.e. HPLC), immunological techniques (i.e. ELISA), Nuclear Magnetic Resonance, Mass Spectrometry and PCR (DNA and RNA based methods). The recent patents on species detection in animal feedstuffs, raw meat and meat processed products, listed in this work, are mainly based on monoclonal antibodies and PCR, especially RT-PCR. The new developments under research are looking for more sensible, specific, less time consuming and quantitatively detection methods, which can be used in highly processed or heated treated meat food.

Identification of unique repeated patterns, location of mutation in DNA finger printing using artificial intelligence technique.

PubMed

Mukunthan, B; Nagaveni, N

2014-01-01

In genetic engineering, conventional techniques and algorithms employed by forensic scientists to assist in identification of individuals on the basis of their respective DNA profiles involves more complex computational steps and mathematical formulae, also the identification of location of mutation in a genomic sequence in laboratories is still an exigent task. This novel approach provides ability to solve the problems that do not have an algorithmic solution and the available solutions are also too complex to be found. The perfect blend made of bioinformatics and neural networks technique results in efficient DNA pattern analysis algorithm with utmost prediction accuracy.

Patent and product piracy

NASA Astrophysics Data System (ADS)

Ignat, V.

2016-08-01

Advanced industrial countries are affected by technology theft. German industry annually loses more than 50 billion euros. The main causes are industrial espionage and fraudulent copying patents and industrial products. Many Asian countries are profiteering saving up to 65% of production costs. Most affected are small medium enterprises, who do not have sufficient economic power to assert themselves against some powerful countries. International organizations, such as Interpol and World Customs Organization - WCO - work together to combat international economic crime. Several methods of protection can be achieved by registering patents or specific technical methods for recognition of product originality. They have developed more suitable protection, like Hologram, magnetic stripe, barcode, CE marking, digital watermarks, DNA or Nano-technologies, security labels, radio frequency identification, micro color codes, matrix code, cryptographic encodings. The automotive industry has developed the method “Manufactures against Product Piracy”. A sticker on the package features original products and it uses a Data Matrix verifiable barcode. The code can be recorded with a smartphone camera. The smartphone is connected via Internet to a database, where the identification numbers of the original parts are stored.

Potential for DNA-based ID of Great Lakes fauna: Species inventories vs. barcode libraries

EPA Science Inventory

DNA-based identification of mixed-organism samples offers the potential to greatly reduce the need for resource-intensive morphological identification, which would be of value both to biotic condition assessment and non-native species early-detection monitoring. However the abil...

Using SDS-PAGE gel fingerprinting to identify soft-bodied wood-boring insect larvae to species.

PubMed

O'Neill, Mark A; Denos, Mia; Reed, Daniel

2018-03-01

This paper describes the progress that we have made in assessing the feasibility of 'fingerprinting' using imaged SDS-PAGE gels of haemolymph proteins, to identify soft-bodied wood-boring insect larvae such as the Asian longhorn beetle, Anoplophora glabripennis (Motscholsky, 1853) (Coleoptera: Cerambycidae). Because of stringent import restrictions and difficulty in obtaining licences to work with these organisms, we opted to work with four species of scarab beetle, Mecynorhina polyphemus (Fabricius, 1781), Pachnoda sinuata (Fabricius, 1775), Eucidella shiratica (Csiki, 1909) and Eucidella shultzeorum (Kolbe, 1906) which have near identical larval morphologies. We show that this technology when combined with an advanced pattern matching system (Digital Automated Identification SYstem - DAISY) can classify soft-bodied insect larvae that are almost identical morphologically to species at a level of accuracy is in excess of 98%. The study also indicates that the technology copes well with noisy data and small training sets. The experience gained in undertaking this study gives us confidence that we will be able to develop a field deployable system in the medium term. We believe that as a high-throughput identification tool, this technology is superior to competitor technologies (e.g. fingerprinting of imaged DNA gels) in terms of speed, cost and ease of use; and therefore, is suitable for low-cost deployment in the field. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Identification of Rays through DNA Barcoding: An Application for Ecologists

PubMed Central

Cerutti-Pereyra, Florencia; Meekan, Mark G.; Wei, Nu-Wei V.; O'Shea, Owen; Bradshaw, Corey J. A.; Austin, Chris M.

2012-01-01

DNA barcoding potentially offers scientists who are not expert taxonomists a powerful tool to support the accuracy of field studies involving taxa that are diverse and difficult to identify. The taxonomy of rays has received reasonable attention in Australia, although the fauna in remote locations such as Ningaloo Reef, Western Australia is poorly studied and the identification of some species in the field is problematic. Here, we report an application of DNA-barcoding to the identification of 16 species (from 10 genera) of tropical rays as part of an ecological study. Analysis of the dataset combined across all samples grouped sequences into clearly defined operational taxonomic units, with two conspicuous exceptions: the Neotrygon kuhlii species complex and the Aetobatus species complex. In the field, the group that presented the most difficulties for identification was the spotted whiptail rays, referred to as the ‘uarnak’ complex. Two sets of problems limited the successful application of DNA barcoding: (1) the presence of cryptic species, species complexes with unresolved taxonomic status and intra-specific geographical variation, and (2) insufficient numbers of entries in online databases that have been verified taxonomically, and the presence of lodged sequences in databases with inconsistent names. Nevertheless, we demonstrate the potential of the DNA barcoding approach to confirm field identifications and to highlight species complexes where taxonomic uncertainty might confound ecological data. PMID:22701556

[Two cases of personal identification from dental information].

PubMed

Yamaguchi, T; Yamada, Y; Ohtani, S; Kogure, T; Nagao, M; Takatori, T; Ohira, H; Yamamoto, I; Watanabe, A

1997-08-01

We describe two cases in which unknown bodies were positively identified from dental information and biochemical examination using tooth materials. In one case, a charred body was positively identified with little effort by comparison of antemortem dental records (dental chart and dental X-ray film) with postmortem data. In the other case, although the unknown individual had dental treatment, the police were unable to obtain the antemortem dental records of the victim. We then conducted biochemical analysis of teeth, facilitating personal identification using DNA analysis and age estimation based on aspartic acid racemization. The mutation obtained from the sequence of mtDNA and the genotypes of HLADQ alpha, HPRTB and ABO blood groups including the data for estimated age supported the kinship between the unknown individual and his mother. The data for maternally inherited mtDNA were of great importance in this case, since it was possible to obtain DNA from the mother. Dental identification in one of the most accurate methods of personal identification if suitable antemortem records are available. In the absence of such records, biochemical analysis of teeth also makes it possible to increase the probability of correct personal identification.

Next generation sequencing (NGS): a golden tool in forensic toolkit.

PubMed

Aly, S M; Sabri, D M

The DNA analysis is a cornerstone in contemporary forensic sciences. DNA sequencing technologies are powerful tools that enrich molecular sciences in the past based on Sanger sequencing and continue to glowing these sciences based on Next generation sequencing (NGS). Next generation sequencing has excellent potential to flourish and increase the molecular applications in forensic sciences by jumping over the pitfalls of the conventional method of sequencing. The main advantages of NGS compared to conventional method that it utilizes simultaneously a large number of genetic markers with high-resolution of genetic data. These advantages will help in solving several challenges such as mixture analysis and dealing with minute degraded samples. Based on these new technologies, many markers could be examined to get important biological data such as age, geographical origins, tissue type determination, external visible traits and monozygotic twins identification. It also could get data related to microbes, insects, plants and soil which are of great medico-legal importance. Despite the dozens of forensic research involving NGS, there are requirements before using this technology routinely in forensic cases. Thus, there is a great need to more studies that address robustness of these techniques. Therefore, this work highlights the applications of forensic sciences in the era of massively parallel sequencing.

Review: Properties of sperm and seminal fluid, informed by research on reproduction and contraception.

PubMed

Cotton, Robin W; Fisher, Matthew B

2015-09-01

Forensic DNA testing is grounded in molecular biology and population genetics. The technologies that were the basis of restriction length polymorphism testing (RFLP) have given way to PCR based technologies. While PCR has been the pillar of short tandem repeat (STR) methods and will continue to be used as DNA sequencing and analysis of single nucleotide polymorphisms (SNPs) are introduced into human identification, the molecular biology techniques in use today represent significant advances since the introduction of STR testing. Large forensic laboratories with dedicated research teams and forensic laboratories which are part of academic institutions have the resources to keep track of advances which can then be considered for further research or incorporated into current testing methods. However, many laboratories have limited ability to keep up with research advances outside of the immediate area of forensic science and may not have access to a large university library systems. This review focuses on filling this gap with respect to areas of research that intersect with selected methods used in forensic biology. The review summarizes information collected from several areas of the scientific literature where advances in molecular biology have produced information relevant to DNA analysis of sexual assault evidence and methods used in presumptive and confirmatory identification of semen. Older information from the literature is also included where this information may not be commonly known and is relevant to current methods. The topics selected highlight (1) information from applications of proteomics to sperm biology and human reproduction, (2) seminal fluid proteins and prostate cancer diagnostics, (3) developmental biology of sperm from the fertility literature and (4) areas where methods are common to forensic analysis and research in contraceptive use and monitoring. Information and progress made in these areas coincide with the research interests of forensic biology and cross-talk between these disciplines may benefit both. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

BoolFilter: an R package for estimation and identification of partially-observed Boolean dynamical systems.

PubMed

Mcclenny, Levi D; Imani, Mahdi; Braga-Neto, Ulisses M

2017-11-25

Gene regulatory networks govern the function of key cellular processes, such as control of the cell cycle, response to stress, DNA repair mechanisms, and more. Boolean networks have been used successfully in modeling gene regulatory networks. In the Boolean network model, the transcriptional state of each gene is represented by 0 (inactive) or 1 (active), and the relationship among genes is represented by logical gates updated at discrete time points. However, the Boolean gene states are never observed directly, but only indirectly and incompletely through noisy measurements based on expression technologies such as cDNA microarrays, RNA-Seq, and cell imaging-based assays. The Partially-Observed Boolean Dynamical System (POBDS) signal model is distinct from other deterministic and stochastic Boolean network models in removing the requirement of a directly observable Boolean state vector and allowing uncertainty in the measurement process, addressing the scenario encountered in practice in transcriptomic analysis. BoolFilter is an R package that implements the POBDS model and associated algorithms for state and parameter estimation. It allows the user to estimate the Boolean states, network topology, and measurement parameters from time series of transcriptomic data using exact and approximated (particle) filters, as well as simulate the transcriptomic data for a given Boolean network model. Some of its infrastructure, such as the network interface, is the same as in the previously published R package for Boolean Networks BoolNet, which enhances compatibility and user accessibility to the new package. We introduce the R package BoolFilter for Partially-Observed Boolean Dynamical Systems (POBDS). The BoolFilter package provides a useful toolbox for the bioinformatics community, with state-of-the-art algorithms for simulation of time series transcriptomic data as well as the inverse process of system identification from data obtained with various expression technologies such as cDNA microarrays, RNA-Seq, and cell imaging-based assays.

Quantum-Sequencing: Fast electronic single DNA molecule sequencing

NASA Astrophysics Data System (ADS)

Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

2014-03-01

A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

Identification of human remains from the Second World War mass graves uncovered in Bosnia and Herzegovina

PubMed Central

Marjanović, Damir; Hadžić Metjahić, Negra; Čakar, Jasmina; Džehverović, Mirela; Dogan, Serkan; Ferić, Elma; Džijan, Snježana; Škaro, Vedrana; Projić, Petar; Madžar, Tomislav; Rod, Eduard; Primorac, Dragan

2015-01-01

Aim To present the results obtained in the identification of human remains from World War II found in two mass graves in Ljubuški, Bosnia and Herzegovina. Methods Samples from 10 skeletal remains were collected. Teeth and femoral fragments were collected from 9 skeletons and only a femoral fragment from 1 skeleton. DNA was isolated from bone and teeth samples using an optimized phenol/chloroform DNA extraction procedure. All samples required a pre-extraction decalcification with EDTA and additional post-extraction DNA purification using filter columns. Additionally, DNA from 12 reference samples (buccal swabs from potential living relatives) was extracted using the Qiagen DNA extraction method. QuantifilerTM Human DNA Quantification Kit was used for DNA quantification. PowerPlex ESI kit was used to simultaneously amplify 15 autosomal short tandem repeat (STR) loci, and PowerPlex Y23 was used to amplify 23 Y chromosomal STR loci. Matching probabilities were estimated using a standard statistical approach. Results A total of 10 samples were processed, 9 teeth and 1 femoral fragment. Nine of 10 samples were profiled using autosomal STR loci, which resulted in useful DNA profiles for 9 skeletal remains. A comparison of established victims' profiles against a reference sample database yielded 6 positive identifications. Conclusion DNA analysis may efficiently contribute to the identification of remains even seven decades after the end of the World War II. The significant percentage of positively identified remains (60%), even when the number of the examined possible living relatives was relatively small (only 12), proved the importance of cooperation with the members of the local community, who helped to identify the closest missing persons’ relatives and collect referent samples from them. PMID:26088850

Identification of human remains from the Second World War mass graves uncovered in Bosnia and Herzegovina.

PubMed

Marjanović, Damir; Hadžić Metjahić, Negra; Čakar, Jasmina; Džehverović, Mirela; Dogan, Serkan; Ferić, Elma; Džijan, Snježana; Škaro, Vedrana; Projić, Petar; Madžar, Tomislav; Rod, Eduard; Primorac, Dragan

2015-06-01

To present the results obtained in the identification of human remains from World War II found in two mass graves in Ljubuški, Bosnia and Herzegovina. Samples from 10 skeletal remains were collected. Teeth and femoral fragments were collected from 9 skeletons and only a femoral fragment from 1 skeleton. DNA was isolated from bone and teeth samples using an optimized phenol/chloroform DNA extraction procedure. All samples required a pre-extraction decalcification with EDTA and additional post-extraction DNA purification using filter columns. Additionally, DNA from 12 reference samples (buccal swabs from potential living relatives) was extracted using the Qiagen DNA extraction method. QuantifilerTM Human DNA Quantification Kit was used for DNA quantification. PowerPlex ESI kit was used to simultaneously amplify 15 autosomal short tandem repeat (STR) loci, and PowerPlex Y23 was used to amplify 23 Y chromosomal STR loci. Matching probabilities were estimated using a standard statistical approach. A total of 10 samples were processed, 9 teeth and 1 femoral fragment. Nine of 10 samples were profiled using autosomal STR loci, which resulted in useful DNA profiles for 9 skeletal remains. A comparison of established victims' profiles against a reference sample database yielded 6 positive identifications. DNA analysis may efficiently contribute to the identification of remains even seven decades after the end of the World War II. The significant percentage of positively identified remains (60%), even when the number of the examined possible living relatives was relatively small (only 12), proved the importance of cooperation with the members of the local community, who helped to identify the closest missing persons' relatives and collect referent samples from them.

Forensic DNA methylation profiling from minimal traces: How low can we go?

PubMed

Naue, Jana; Hoefsloot, Huub C J; Kloosterman, Ate D; Verschure, Pernette J

2018-03-01

Analysis of human DNA methylation (DNAm) can provide additional investigative leads in crime cases, e.g. the type of tissue or body fluid, the chronological age of an individual, and differentiation between identical twins. In contrast to the genetic profile, the DNAm level is not the same in every cell. At the single cell level, DNAm represents a binary event at a defined CpG site (methylated versus non-methylated). The DNAm level from a DNA extract however represents the average level of methylation of the CpG of interest of all molecules in the forensic sample. The variance of DNAm levels between replicates is often attributed to technological issues, i.e. degradation of DNA due to bisulfite treatment, preferential amplification of DNA, and amplification failure. On the other hand, we show that stochastic variations can lead to gross fluctuation in the analysis of methylation levels in samples with low DNA levels. This stochasticity in DNAm results is relevant since low DNA amounts (1pg - 1ng) is rather the norm than the exception when analyzing forensic DNA samples. This study describes a conceptual analysis of DNAm profiling and its dependence on the amount of input DNA. We took a close look at the variation of DNAm analysis due to DNA input and its consequences for different DNAm-based forensic applications. As can be expected, the 95%-confidence interval of measured DNAm becomes narrower with increasing amounts of DNA. We compared this aspect for two different DNAm-based forensic applications: body fluid identification and chronological age determination. Our study shows that DNA amount should be well considered when using DNAm for forensic applications. Copyright © 2017 Elsevier B.V. All rights reserved.

Identification of Species in Tripterygium (Celastraceae) Based on DNA Barcoding.

PubMed

Zhang, Xiaomei; Li, Na; Yao, Yuanyuan; Liang, Xuming; Qu, Xianyou; Liu, Xiang; Zhu, Yingjie; Yang, Dajian; Sun, Wei

2016-11-01

Species of genus Tripterygium (Celastraceae) have attracted much attention owing to their excellent effect on treating autoimmune and inflammatory diseases. However, due to high market demand causing overexploitation, natural populations of genus Tripterygium have rapidly declined. Tripterygium medicinal materials are mainly collected from the wild, making the quality of medicinal materials unstable. Additionally, identification of herbal materials from Tripterygium species and their adulterants is difficult based on morphological characters. Therefore, an accurate, convenient, and stability method is urgently needed. In this wok, we developed a DNA barcoding technique to distinguish T. wilfordii HOOK. f., T. hypoglaucum (LÉVL.) HUTCH, and T. regelii SPRAGUE et TAKEDA and their adulterants based on four uniform and standard DNA regions (internal transcribed spacer 2 (ITS2), matK, rbcL, and psbA-trnH). DNA was extracted from 26 locations of fresh leaves. Phylogenetic tree was constructed with Neighbor-Joining (NJ) method, while barcoding gap was analyzed to assess identification efficiency. Compared with the other DNA barcodes applied individually or in combination, ITS2+psbA-trnH was demonstrated as the optimal barcode. T. hypoglaucum and T. wilfordii can be considered as conspecific, while T. regelii was recognized as a separate species. Furthermore, identification of commercial Tripterygium samples was conducted using BLAST against GenBank and Species Identification System for Traditional Chinese Medicine. Our results indicated that DNA barcoding is a convenient, effective, and stability method to identify and distinguish Tripterygium and its adulterants, and could be applied as the quality control for Tripterygium medicinal preparations and monitoring of the medicinal herb trade in markets.

Identification of food and beverage spoilage yeasts from DNA sequence analyses

USDA-ARS?s Scientific Manuscript database

Detection, identification, and classification of yeasts has undergone a major transformation in the last decade and a half following application of gene sequence analyses and genome comparisons. Development of a database (barcode) of easily determined DNA sequences from domains 1 and 2 (D1/D2) of th...

Identifying the true oysters (Bivalvia: Ostreidae) with mitochondrial phylogeny and distance-based DNA barcoding.

PubMed

Liu, Jun; Li, Qi; Kong, Lingfeng; Yu, Hong; Zheng, Xiaodong

2011-09-01

Oysters (family Ostreidae), with high levels of phenotypic plasticity and wide geographic distribution, are a challenging group for taxonomists and phylogenetics. As a useful tool for molecular species identification, DNA barcoding might offer significant potential for oyster identification and taxonomy. This study used two mitochondrial fragments, cytochrome c oxidase I (COI) and the large ribosomal subunit (16S rDNA), to assess whether oyster species could be identified by phylogeny and distance-based DNA barcoding techniques. Relationships among species were estimated by the phylogenetic analyses of both genes, and then pairwise inter- and intraspecific genetic divergences were assessed. Species forming well-differentiated clades in the molecular phylogenies were identical for both genes even when the closely related species were included. Intraspecific variability of 16S rDNA overlapped with interspecific divergence. However, average intra- and interspecific genetic divergences for COI were 0-1.4% (maximum 2.2%) and 2.6-32.2% (minimum 2.2%), respectively, indicating the existence of a barcoding gap. These results confirm the efficacy of species identification in oysters via DNA barcodes and phylogenetic analysis. © 2011 Blackwell Publishing Ltd.

DNA in a bottle-Rapid metabarcoding survey for early alerts of invasive species in ports.

PubMed

Borrell, Yaisel J; Miralles, Laura; Do Huu, Hoang; Mohammed-Geba, Khaled; Garcia-Vazquez, Eva

2017-01-01

Biota monitoring in ports is increasingly needed for biosecurity reasons and safeguarding marine biodiversity from biological invasion. Present and future international biosecurity directives can be accomplished only if the biota acquired by maritime traffic in ports is controlled. Methodologies for biota inventory are diverse and now rely principally on extensive and labor-intensive sampling along with taxonomic identification by experts. In this study, we employed an extremely simplified environmental DNA (eDNA) sampling methodology from only three 1-L bottles of water per port, followed by metabarcoding (high-throughput sequencing and DNA-based species identification) using 18S rDNA and Cytochrome oxidase I as genetic barcodes. Eight Bay of Biscay ports with available inventory of fouling invertebrates were employed as a case study. Despite minimal sampling efforts, three invasive invertebrates were detected: the barnacle Austrominius modestus, the tubeworm Ficopomatus enigmaticus and the polychaete Polydora triglanda. The same species have been previously found from visual and DNA barcoding (genetic identification of individuals) surveys in the same ports. The current costs of visual surveys, conventional DNA barcoding and this simplified metabarcoding protocol were compared. The results encourage the use of metabarcoding for early biosecurity alerts.

Logical Framework of Forensic Identification: Ability to Resist Fabricated DNA.

PubMed

Wang, Zheng; Zhou, Di; Zhang, Suhua; Bian, Yingnan; Hu, Zhen; Zhu, Ruxin; Lu, Daru; Li, Chengtao

2015-12-01

Over the past 30 years, DNA analysis has revolutionized forensic science and has become the most useful single tool in the multifaceted fight against crime. Today, DNA profiling with sets of highly polymorphic autosomal short tandem repeat markers is widely employed and accepted in the courts due to its high discriminating power and reliability. However, an artificial bloodstain purposefully created using molecular biology techniques succeeded in tricking a leading forensic DNA laboratory. The disturbing possibility that a forensic DNA profile can be faked shocked the general public and the mass media, and generated serious discussion about the credibility of DNA evidence. Herein, we present two exemplary assays based on tissue-specific methylation patterns and cell-specific mRNA expression, respectively. These two assays can be integrated into the DNA analysis pipelines without consumption of additional samples. We show that the two assays can not only distinguish between artificial and genuine samples, but also provide information on tissue origin. The two assays were tested on natural and artificial bloodstains (generated by polymerase chain reaction and whole genome amplification technique) and the results illustrated that the logical framework of forensic identification is still useful for forensic identification with the high credibility.

DNA in a bottle—Rapid metabarcoding survey for early alerts of invasive species in ports

PubMed Central

Miralles, Laura; Do Huu, Hoang; Mohammed-Geba, Khaled; Garcia-Vazquez, Eva

2017-01-01

Biota monitoring in ports is increasingly needed for biosecurity reasons and safeguarding marine biodiversity from biological invasion. Present and future international biosecurity directives can be accomplished only if the biota acquired by maritime traffic in ports is controlled. Methodologies for biota inventory are diverse and now rely principally on extensive and labor-intensive sampling along with taxonomic identification by experts. In this study, we employed an extremely simplified environmental DNA (eDNA) sampling methodology from only three 1-L bottles of water per port, followed by metabarcoding (high-throughput sequencing and DNA-based species identification) using 18S rDNA and Cytochrome oxidase I as genetic barcodes. Eight Bay of Biscay ports with available inventory of fouling invertebrates were employed as a case study. Despite minimal sampling efforts, three invasive invertebrates were detected: the barnacle Austrominius modestus, the tubeworm Ficopomatus enigmaticus and the polychaete Polydora triglanda. The same species have been previously found from visual and DNA barcoding (genetic identification of individuals) surveys in the same ports. The current costs of visual surveys, conventional DNA barcoding and this simplified metabarcoding protocol were compared. The results encourage the use of metabarcoding for early biosecurity alerts. PMID:28873426

DNA Barcoding of Malagasy Rosewoods: Towards a Molecular Identification of CITES-Listed Dalbergia Species.

PubMed

Hassold, Sonja; Lowry, Porter P; Bauert, Martin R; Razafintsalama, Annick; Ramamonjisoa, Lolona; Widmer, Alex

2016-01-01

Illegal selective logging of tropical timber is of increasing concern worldwide. Madagascar is a biodiversity hotspot and home to some of the world's most sought after tropical timber species. Malagasy rosewoods belong to the genus Dalbergia (Fabaceae), which is highly diverse and has a pantropical distribution, but these timber species are among the most threatened as a consequence of intensive illegal selective logging and deforestation. Reliable identification of Dalbergia species from Madagascar is important for law enforcement but is almost impossible without fertile plant material, which is often unavailable during forest inventories or when attempting to identify logged trees of cut wood. DNA barcoding has been promoted as a promising tool for species identification in such cases. In this study we tested whether DNA barcoding with partial sequences of three plastid markers (matK, rbcL and trnL (UAA)) can distinguish between Dalbergia from Madagascar and from other areas of its distributional range, and whether Malagasy species can be distinguished from one another. Phylogenetic analyses revealed that the Malagasy Dalbergia species studied form two monophyletic groups, each containing two subgroups, only one of which corresponds to a single species. We characterized diagnostic polymorphisms in the three DNA barcoding markers that allow rapid discrimination between Dalbergia from Madagascar and from other areas of its distribution range. Species identification success based on individual barcoding markers or combinations was poor, whereas subgroup identification success was much higher (up to 98%), revealing both the value and limitations of a DNA barcoding approach for the identification of closely related Malagasy rosewoods.

28 CFR 28.12 - Collection of DNA samples.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Collection of DNA samples. 28.12 Section 28.12 Judicial Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM DNA Sample Collection, Analysis, and Indexing § 28.12 Collection of DNA samples. (a) The Bureau of Prisons shall collect a DNA...

28 CFR 28.12 - Collection of DNA samples.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 28 Judicial Administration 1 2011-07-01 2011-07-01 false Collection of DNA samples. 28.12 Section 28.12 Judicial Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM DNA Sample Collection, Analysis, and Indexing § 28.12 Collection of DNA samples. (a) The Bureau of Prisons shall collect a DNA...

28 CFR 28.12 - Collection of DNA samples.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 28 Judicial Administration 1 2012-07-01 2012-07-01 false Collection of DNA samples. 28.12 Section 28.12 Judicial Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM DNA Sample Collection, Analysis, and Indexing § 28.12 Collection of DNA samples. (a) The Bureau of Prisons shall collect a DNA...

28 CFR 28.12 - Collection of DNA samples.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 28 Judicial Administration 1 2014-07-01 2014-07-01 false Collection of DNA samples. 28.12 Section 28.12 Judicial Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM DNA Sample Collection, Analysis, and Indexing § 28.12 Collection of DNA samples. (a) The Bureau of Prisons shall collect a DNA...

28 CFR 28.12 - Collection of DNA samples.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 28 Judicial Administration 1 2013-07-01 2013-07-01 false Collection of DNA samples. 28.12 Section 28.12 Judicial Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM DNA Sample Collection, Analysis, and Indexing § 28.12 Collection of DNA samples. (a) The Bureau of Prisons shall collect a DNA...

Gender identification of Grasshopper Sparrows comparing behavioral, morphological, and molecular techniques

USGS Publications Warehouse

Ammer, F.K.; Wood, P.B.; McPherson, R.J.

2008-01-01

Correct gender identification in monomorphic species is often difficult especially if males and females do not display obvious behavioral and breeding differences. We compared gender specific morphology and behavior with recently developed DNA techniques for gender identification in the monomorphic Grasshopper Sparrow (Ammodramus savannarum). Gender was ascertained with DNA in 213 individuals using the 2550F/2718R primer set and 3% agarose gel electrophoresis. Field observations using behavior and breeding characteristics to identify gender matched DNA analyses with 100% accuracy for adult males and females. Gender was identified with DNA for all captured juveniles that did not display gender specific traits or behaviors in the field. The molecular techniques used offered a high level of accuracy and may be useful in studies of dispersal mechanisms and winter assemblage composition in monomorphic species.

Sliding Window Analyses for Optimal Selection of Mini-Barcodes, and Application to 454-Pyrosequencing for Specimen Identification from Degraded DNA

PubMed Central

Boyer, Stephane; Brown, Samuel D. J.; Collins, Rupert A.; Cruickshank, Robert H.; Lefort, Marie-Caroline; Malumbres-Olarte, Jagoba; Wratten, Stephen D.

2012-01-01

DNA barcoding remains a challenge when applied to diet analyses, ancient DNA studies, environmental DNA samples and, more generally, in any cases where DNA samples have not been adequately preserved. Because the size of the commonly used barcoding marker (COI) is over 600 base pairs (bp), amplification fails when the DNA molecule is degraded into smaller fragments. However, relevant information for specimen identification may not be evenly distributed along the barcoding region, and a shorter target can be sufficient for identification purposes. This study proposes a new, widely applicable, method to compare the performance of all potential ‘mini-barcodes’ for a given molecular marker and to objectively select the shortest and most informative one. Our method is based on a sliding window analysis implemented in the new R package SPIDER (Species IDentity and Evolution in R). This method is applicable to any taxon and any molecular marker. Here, it was tested on earthworm DNA that had been degraded through digestion by carnivorous landsnails. A 100 bp region of 16 S rDNA was selected as the shortest informative fragment (mini-barcode) required for accurate specimen identification. Corresponding primers were designed and used to amplify degraded earthworm (prey) DNA from 46 landsnail (predator) faeces using 454-pyrosequencing. This led to the detection of 18 earthworm species in the diet of the snail. We encourage molecular ecologists to use this method to objectively select the most informative region of the gene they aim to amplify from degraded DNA. The method and tools provided here, can be particularly useful (1) when dealing with degraded DNA for which only small fragments can be amplified, (2) for cases where no consensus has yet been reached on the appropriate barcode gene, or (3) to allow direct analysis of short reads derived from massively parallel sequencing without the need for bioinformatic consolidation. PMID:22666489

A collaborative exercise on DNA methylation based body fluid typing.

PubMed

Jung, Sang-Eun; Cho, Sohee; Antunes, Joana; Gomes, Iva; Uchimoto, Mari L; Oh, Yu Na; Di Giacomo, Lisa; Schneider, Peter M; Park, Min Sun; van der Meer, Dieudonne; Williams, Graham; McCord, Bruce; Ahn, Hee-Jung; Choi, Dong Ho; Lee, Yang Han; Lee, Soong Deok; Lee, Hwan Young

2016-10-01

A collaborative exercise on DNA methylation based body fluid identification was conducted by seven laboratories. For this project, a multiplex methylation SNaPshot reaction composed of seven CpG markers was used for the identification of four body fluids, including blood, saliva, semen, and vaginal fluid. A total of 30 specimens were prepared and distributed to participating laboratories after thorough testing. The required experiments included four increasingly complex tasks: (1) CE of a purified single-base extension reaction product, (2) multiplex PCR and multiplex single-base extension reaction of bisulfite-modified DNA, (3) bisulfite conversion of genomic DNA, and (4) extraction of genomic DNA from body fluid samples. In tasks 2, 3 and 4, one or more mixtures were analyzed, and specimens containing both known and unknown body fluid sources were used. Six of the laboratories generated consistent body fluid typing results for specimens of bisulfite-converted DNA and genomic DNA. One laboratory failed to set up appropriate conditions for capillary analysis of reference single-base extension products. In general, variation in the values obtained for DNA methylation analysis between laboratories increased with the complexity of the required experiments. However, all laboratories concurred on the interpretation of the DNA methylation profiles produced. Although the establishment of interpretational guidelines on DNA methylation based body fluid identification has yet to be performed, this study supports the addition of DNA methylation profiling to forensic body fluid typing. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Systematics of gastrointestinal nematodes of domestic ruminants: advances between 1992 and 1995 and proposals for future research.

PubMed

Lichtenfels, J R; Hoberg, E P; Zarlenga, D S

1997-11-01

The systematics of trichostrongyloid nematodes of ruminants provides a foundation for diagnostics and responds to the need to identify eggs in feces, free-living larvae from pastures or fecal cultures and larval or adult nematodes collected from hosts. These needs are associated with diagnostic problems or research projects. Difficulties in identifying all developmental stages of trichostrongyloid nematodes of domestic ruminants still severely limit the effective diagnosis and control of these parasites. Phylogenetic hypotheses as the basis for predictive classifications have been developed only for the subfamilies of the Trichostrongylidae. This report briefly describes recent progress in the development of improved tools for identification, phylogenetic analyses and predictive classifications. It also describes future research needed on the identification and classification of trichostrongyloid nematode parasites of domestic ruminants. Nematodes included are species of the super-family Trichostrongyloidea known to be important pathogens of domestic ruminants. The information summarized is presented by nematode developmental stage and by taxonomic groups. Eggs: While eggs of some trichostrongyloid nematode parasites of ruminants can be readily identified to their genus (Nematodirus), and some to species (e.g. Nematodirus battus), most of the important pathogens (including the Ostertagiinae and Haemonchinae) cannot be identified morphologically or morphometrically even to family level. However, DNA technology has been developed for determining not only the presence of specific pathogens in eggs from fecal samples, but also for estimating the percentage of the total eggs that each pathogen comprises. This new method will make possible a rapid determination of which individual animals in a herd should be treated. Larvae: The most commonly-used method for identifying infective larvae is time-consuming (several weeks), unreliable for estimating intensities of individual species as components of mixed populations and requires highly trained specialists. Available identification keys for larvae are not well illustrated and need to be augmented. Adults: Recent advances in the identification of adult trichostrongyloids and their systematics are organized by taxonomic group. Genera included are Ostertagia, Haemonchus, Cooperia, Trichostrongylus and Nematodirus. Recently, the first phylogenetic analysis of the Trichostrongylidae family established monophyly for the family. A similar analysis of the Molineidae is needed. Ostertagia: Several studies of polymorphism summarized the phenomenon and listed 19 polymorphic species in five genera. Two studies of DNA differences within and among polymorphic species of Ostertagiinae supported earlier hypotheses that the species pairs represent polymorphic species. A phylogenetic analysis of the Ostertagiinae and generic concepts are needed. Haemonchus: A key to three species of Haemonchus provides, for the first time, morphological characteristics for the microscopical identification to species of individual adult nematodes of either sex. The Food and Drug Administration is now requiring that results of drug trials include identification of Haemonchus to species. Cooperia: Studies using random amplified polymorphic DNA methods showed a high degree of variation within and among C. oncophora/C. surnabada, but supported a polymorphic relationship for the species pair. A phylogenetic analysis of the Cooperiinae is needed. Trichostrongylus: Restriction Fragment Length Polymorphisms (RFLPs) of genomic DNA of two strains of T. colubriformis indicated a high degree of intra- and inter-strain DNA polymorphism. However, other studies demonstrated expected species level differences between T. colubriformis and T. vitrinus using Random Amplified Polymorphic DNA (RAPD) methods. Sequences of the second Internal Transcribed Spacer Region (ITS-2) ribosomal repeat showed sequence differences of 1.3-7.6% among five

Comparison of DNA Microarray, Loop-Mediated Isothermal Amplification (LAMP) and Real-Time PCR with DNA Sequencing for Identification of Fusarium spp. Obtained from Patients with Hematologic Malignancies.

PubMed

de Souza, Marcela; Matsuzawa, Tetsuhiro; Sakai, Kanae; Muraosa, Yasunori; Lyra, Luzia; Busso-Lopes, Ariane Fidelis; Levin, Anna Sara Shafferman; Schreiber, Angélica Zaninelli; Mikami, Yuzuru; Gonoi, Tohoru; Kamei, Katsuhiko; Moretti, Maria Luiza; Trabasso, Plínio

2017-08-01

The performance of three molecular biology techniques, i.e., DNA microarray, loop-mediated isothermal amplification (LAMP), and real-time PCR were compared with DNA sequencing for properly identification of 20 isolates of Fusarium spp. obtained from blood stream as etiologic agent of invasive infections in patients with hematologic malignancies. DNA microarray, LAMP and real-time PCR identified 16 (80%) out of 20 samples as Fusarium solani species complex (FSSC) and four (20%) as Fusarium spp. The agreement among the techniques was 100%. LAMP exhibited 100% specificity, while DNA microarray, LAMP and real-time PCR showed 100% sensitivity. The three techniques had 100% agreement with DNA sequencing. Sixteen isolates were identified as FSSC by sequencing, being five Fusarium keratoplasticum, nine Fusarium petroliphilum and two Fusarium solani. On the other hand, sequencing identified four isolates as Fusarium non-solani species complex (FNSSC), being three isolates as Fusarium napiforme and one isolate as Fusarium oxysporum. Finally, LAMP proved to be faster and more accessible than DNA microarray and real-time PCR, since it does not require a thermocycler. Therefore, LAMP signalizes as emerging and promising methodology to be used in routine identification of Fusarium spp. among cases of invasive fungal infections.

A new disaster victim identification management strategy targeting "near identification-threshold" cases: Experiences from the Boxing Day tsunami.

PubMed

Wright, Kirsty; Mundorff, Amy; Chaseling, Janet; Forrest, Alexander; Maguire, Christopher; Crane, Denis I

2015-05-01

The international disaster victim identification (DVI) response to the Boxing Day tsunami, led by the Royal Thai Police in Phuket, Thailand, was one of the largest and most complex in DVI history. Referred to as the Thai Tsunami Victim Identification operation, the group comprised a multi-national, multi-agency, and multi-disciplinary team. The traditional DVI approach proved successful in identifying a large number of victims quickly. However, the team struggled to identify certain victims due to incomplete or poor quality ante-mortem and post-mortem data. In response to these challenges, a new 'near-threshold' DVI management strategy was implemented to target presumptive identifications and improve operational efficiency. The strategy was implemented by the DNA Team, therefore DNA kinship matches that just failed to reach the reporting threshold of 99.9% were prioritized, however the same approach could be taken by targeting, for example, cases with partial fingerprint matches. The presumptive DNA identifications were progressively filtered through the Investigation, Dental and Fingerprint Teams to add additional information necessary to either strengthen or conclusively exclude the identification. Over a five-month period 111 victims from ten countries were identified using this targeted approach. The new identifications comprised 87 adults, 24 children and included 97 Thai locals. New data from the Fingerprint Team established nearly 60% of the total near-threshold identifications and the combined DNA/Physical method was responsible for over 30%. Implementing the new strategy, targeting near-threshold cases, had positive management implications. The process initiated additional ante-mortem information collections, and established a much-needed, distinct "end-point" for unresolved cases. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Statistical genetics concepts and approaches in schizophrenia and related neuropsychiatric research.

PubMed

Schork, Nicholas J; Greenwood, Tiffany A; Braff, David L

2007-01-01

Statistical genetics is a research field that focuses on mathematical models and statistical inference methodologies that relate genetic variations (ie, naturally occurring human DNA sequence variations or "polymorphisms") to particular traits or diseases (phenotypes) usually from data collected on large samples of families or individuals. The ultimate goal of such analysis is the identification of genes and genetic variations that influence disease susceptibility. Although of extreme interest and importance, the fact that many genes and environmental factors contribute to neuropsychiatric diseases of public health importance (eg, schizophrenia, bipolar disorder, and depression) complicates relevant studies and suggests that very sophisticated mathematical and statistical modeling may be required. In addition, large-scale contemporary human DNA sequencing and related projects, such as the Human Genome Project and the International HapMap Project, as well as the development of high-throughput DNA sequencing and genotyping technologies have provided statistical geneticists with a great deal of very relevant and appropriate information and resources. Unfortunately, the use of these resources and their interpretation are not straightforward when applied to complex, multifactorial diseases such as schizophrenia. In this brief and largely nonmathematical review of the field of statistical genetics, we describe many of the main concepts, definitions, and issues that motivate contemporary research. We also provide a discussion of the most pressing contemporary problems that demand further research if progress is to be made in the identification of genes and genetic variations that predispose to complex neuropsychiatric diseases.

Molecular identification and distribution profile of Candida species isolated from Iranian patients.

PubMed

Mohammadi, Rasoul; Mirhendi, Hossein; Rezaei-Matehkolaei, Ali; Ghahri, Mohammad; Shidfar, Mohammad Reza; Jalalizand, Nilufar; Makimura, Koichi

2013-08-01

A total of 855 yeast strains isolated from different clinical specimens, mainly nail (42%) and vulva-vagina (25%) were identified by a set of polymerase chain reaction-restriction fragment length polymorphisms (PCR-RFLP). Genomic DNA was extracted from fresh colonies using Whatman FTA Card technology. PCR assays were performed on the complete ribosomal DNA internal transcribed spacer (rDNA-ITS) region for all isolates and species identification was carried out through their specific electrophoretic profiles after digestion with the enzyme MspI. Those isolates suspected as Candida parapsilosis group were then subjected to amplification of the secondary alcohol dehydrogenase (SADH) gene and restriction digestion with NlaIII enzyme. In total, 71.1% of the strains were obtained from females and 28.9% from males. The age group of 31-40 years consisted of the highest frequency of patients with candidiasis. Candida albicans was the predominant species (58.6%) followed by C. parapsilosis (11.0%), C. glabrata (8.3%), C. tropicalis (7.0%), C. kefyr (5.8%), C. krusei (4.4%), C. orthopsilosis (2.1%), and C. guilliermondii (0.6%). A few strains of C. lusitaniae, C. rugosa, C. intermedia, C. inconspicua, C. neoformans and S. cerevisiae were isolated. We could not identify 8 (0.9%) isolates. Candida albicans remains the most frequently species isolated from Iranian patients; however, the number of non-C. albicans Candida species looks to be increasing. The simple and reliable PCR-RFLP system used in the study has the potential to identify most clinically isolated yeasts.

DNA Barcoding for Identification of ‘Candidatus Phytoplasmas’ Using a Fragment of the Elongation Factor Tu Gene

PubMed Central

Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta; Kawube, Geofrey; Bertaccini, Assunta; Nicolaisen, Mogens

2012-01-01

Background Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf) gene for phytoplasma identification is reported. Methodology/Principal Findings We designed a new set of primers and amplified a 420–444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX). Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed that the tuf tree is highly congruent with the 16S rRNA tree and had higher inter- and intra- group sequence divergence. Mean K2P inter−/intra- group divergences of the tuf barcode did not overlap and had approximately one order of magnitude difference for most groups, suggesting the presence of a DNA barcoding gap. The use of the tuf barcode allowed separation of main ribosomal groups and most of their subgroups. Phytoplasma tuf barcodes were deposited in the NCBI GenBank and Q-bank databases. Conclusions/Significance This study demonstrates that DNA barcoding principles can be applied for identification of phytoplasmas. Our findings suggest that the tuf barcode performs as well or better than a 1.2 kbp fragment of the 16S rRNA gene and thus provides an easy procedure for phytoplasma identification. The obtained sequences were used to create a publicly available reference database that can be used by plant health services and researchers for online phytoplasma identification. PMID:23272216

DNA-based identification of Brassica vegetable species for the juice industry.

PubMed

Etoh, Kazumi; Niijima, Noritaka; Yokoshita, Masahiko; Fukuoka, Shin-Ichi

2003-10-01

Since kale (Brassica oleracea var. acephala), a cruciferous vegetable with a high level of vitamins and functional compounds beneficial to health and wellness, has become widely used in the juice industry, a precise method for quality control of vegetable species is necessary. We describe here a DNA-based identification method to distinguish kale from cabbage (Brassica oleracea var. capitata), a closely related species, which can be inadvertently mixed with kale during the manufacturing process. Using genomic DNA from these vegetables and combinatory sets of nucleotide primers, we screened for random amplified polymorphic DNA (RAPD) fragments and found three cabbage-specific fragments. These RAPD fragments, with lengths of 1.4, 0.5, and 1.5 kb, were purified, subcloned, and sequenced. Based on sequence-tagged sites (STS), we designed sets of primers to detect cabbage-specific identification (CAI) DNA markers. Utilizing the CAI markers, we successfully distinguished more than 10 different local cabbage accessions from 20 kale accessions, and identified kale juices experimentally spiked with different amounts of cabbage.

gene GIS: Computational Tools for Spatial Analyses of DNA Profiles with Associated Photo-Identification and Telemetry Records of Marine Mammals

DTIC Science & Technology

2011-09-30

DNA profiles. Referred to as geneGIS, the program will provide the ability to display, browse, select, filter and summarize spatial or temporal...of the SPLASH photo-identification records and available DNA profiles is underway through integration and crosschecking by Cascadia and MMI . An...Darwin Core standards where possible and can accommodate the current databases developed for telemetry data at MMI and SPLASH collection records at

Single Nucleobase Identification Using Biophysical Signatures from Nanoelectronic Quantum Tunneling.

PubMed

Korshoj, Lee E; Afsari, Sepideh; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

2017-03-01

Nanoelectronic DNA sequencing can provide an important alternative to sequencing-by-synthesis by reducing sample preparation time, cost, and complexity as a high-throughput next-generation technique with accurate single-molecule identification. However, sample noise and signature overlap continue to prevent high-resolution and accurate sequencing results. Probing the molecular orbitals of chemically distinct DNA nucleobases offers a path for facile sequence identification, but molecular entropy (from nucleotide conformations) makes such identification difficult when relying only on the energies of lowest-unoccupied and highest-occupied molecular orbitals (LUMO and HOMO). Here, nine biophysical parameters are developed to better characterize molecular orbitals of individual nucleobases, intended for single-molecule DNA sequencing using quantum tunneling of charges. For this analysis, theoretical models for quantum tunneling are combined with transition voltage spectroscopy to obtain measurable parameters unique to the molecule within an electronic junction. Scanning tunneling spectroscopy is then used to measure these nine biophysical parameters for DNA nucleotides, and a modified machine learning algorithm identified nucleobases. The new parameters significantly improve base calling over merely using LUMO and HOMO frontier orbital energies. Furthermore, high accuracies for identifying DNA nucleobases were observed at different pH conditions. These results have significant implications for developing a robust and accurate high-throughput nanoelectronic DNA sequencing technique. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Species Identification of Fox-, Mink-, Dog-, and Rabbit-Derived Ingredients by Multiplex PCR and Real-Time PCR Assay.

PubMed

Wu, Qingqing; Xiang, Shengnan; Wang, Wenjun; Zhao, Jinyan; Xia, Jinhua; Zhen, Yueran; Liu, Bang

2018-05-01

Various detection methods have been developed to date for identification of animal species. New techniques based on PCR approach have raised the hope of developing better identification methods, which can overcome the limitations of the existing methods. PCR-based methods used the mitochondrial DNA (mtDNA) as well as nuclear DNA sequences. In this study, by targeting nuclear DNA, multiplex PCR and real-time PCR methods were developed to assist with qualitative and quantitative analysis. The multiplex PCR was found to simultaneously and effectively distinguish four species (fox, dog, mink, and rabbit) ingredients by the different sizes of electrophoretic bands: 480, 317, 220, and 209 bp. Real-time fluorescent PCR's amplification profiles and standard curves showed good quantitative measurement responses and linearity, as indicated by good repeatability and coefficient of determination R 2  > 0.99. The quantitative results of quaternary DNA mixtures including mink, fox, dog, and rabbit DNA are in line with our expectations: R.D. (relative deviation) varied between 1.98 and 12.23% and R.S.D. (relative standard deviation) varied between 3.06 and 11.51%, both of which are well within the acceptance criterion of ≤ 25%. Combining the two methods is suitable for the rapid identification and accurate quantification of fox-, dog-, mink-, and rabbit-derived ingredients in the animal products.

[Hydrophidae identification through analysis on Cyt b gene barcode].

PubMed

Liao, Li-xi; Zeng, Ke-wu; Tu, Peng-fei

2015-08-01

Hydrophidae, one of the precious traditional Chinese medicines, is generally drily preserved to prevent corruption, but it is hard to identify the species of Hydrophidae through the appearance because of the change due to the drying process. The identification through analysis on gene barcode, a new technique in species identification, can avoid the problem. The gene barcodes of the 6 species of Hydrophidae like Lapemis hardwickii were aquired through DNA extraction and gene sequencing. These barcodes were then in sequence alignment and test the identification efficency by BLAST. Our results revealed that the barcode sequences performed high identification efficiency, and had obvious difference between intra- and inter-species. These all indicated that Cyt b DNA barcoding can confirm the Hydrophidae identification.

Identification of Forensic Samples via Mitochondrial DNA in the Undergraduate Biochemistry Laboratory

NASA Astrophysics Data System (ADS)

Millard, Julie T.; Pilon, André M.

2003-04-01

A recent forensic approach for identification of unknown biological samples is mitochondrial DNA (mtDNA) sequencing. We describe a laboratory exercise suitable for an undergraduate biochemistry course in which the polymerase chain reaction is used to amplify a 440 base pair hypervariable region of human mtDNA from a variety of "crime scene" samples (e.g., teeth, hair, nails, cigarettes, envelope flaps, toothbrushes, and chewing gum). Amplification is verified via agarose gel electrophoresis and then samples are subjected to cycle sequencing. Sequence alignments are made via the program CLUSTAL W, allowing students to compare samples and solve the "crime."

DNA methylation: the future of crime scene investigation?

PubMed

Gršković, Branka; Zrnec, Dario; Vicković, Sanja; Popović, Maja; Mršić, Gordan

2013-07-01

Proper detection and subsequent analysis of biological evidence is crucial for crime scene reconstruction. The number of different criminal acts is increasing rapidly. Therefore, forensic geneticists are constantly on the battlefield, trying hard to find solutions how to solve them. One of the essential defensive lines in the fight against the invasion of crime is relying on DNA methylation. In this review, the role of DNA methylation in body fluid identification and other DNA methylation applications are discussed. Among other applications of DNA methylation, age determination of the donor of biological evidence, analysis of the parent-of-origin specific DNA methylation markers at imprinted loci for parentage testing and personal identification, differentiation between monozygotic twins due to their different DNA methylation patterns, artificial DNA detection and analyses of DNA methylation patterns in the promoter regions of circadian clock genes are the most important ones. Nevertheless, there are still a lot of open chapters in DNA methylation research that need to be closed before its final implementation in routine forensic casework.

Polymerase chain reaction amplification of DNA from aged blood stains: quantitative evaluation of the "suitability for purpose" of four filter papers as archival media.

PubMed

Kline, Margaret C; Duewer, David L; Redman, Janette W; Butler, John M; Boyer, David A

2002-04-15

In collaboration with the Armed Forces Institute of Pathology's Department of Defense DNA Registry, the National Institute of Standards and Technology recently evaluated the performance of a short tandem repeat multiplex with dried whole blood stains on four different commercially available identification card matrixes. DNA from 70 stains that had been stored for 19 months at ambient temperature was extracted or directly amplified and then processed using routine methods. All four storage media provided fully typeable (qualitatively identical) samples. After standardization, the average among-locus fluorescence intensity (electropherographic peak height or area) provided a suitable metric for quantitative analysis of the relative amounts of amplifiable DNA in an archived sample. The amounts of DNA in Chelex extracts from stains on two untreated high-purity cotton linter pulp papers and a paper treated with a DNA-binding coating were essentially identical. Average intensities for the aqueous extracts from a paper treated with a DNA-releasing coating were somewhat lower but also somewhat less variable than for the Chelex extracts. Average intensities of directly amplified punches of the DNA-binding paper were much larger but somewhat more variable than the Chelex extracts. Approximately 25% of the observed variation among the intensity measurements is shared among the four media and thus can be attributed to intrinsic variation in white blood count among the donors. All of the evaluated media adequately "bank" forensically useful DNA in well-dried whole blood stains for at least 19 months at ambient temperature.

Lynch syndrome and Lynch syndrome mimics: The growing complex landscape of hereditary colon cancer

PubMed Central

Carethers, John M; Stoffel, Elena M

2015-01-01

Hereditary non-polyposis colorectal cancer (HNPCC) was previously synonymous with Lynch syndrome; however, identification of the role of germline mutations in the DNA mismatch repair (MMR) genes has made it possible to differentiate Lynch syndrome from other conditions associated with familial colorectal cancer (CRC). Broadly, HNPCC may be dichotomized into conditions that demonstrate defective DNA MMR and microsatellite instability (MSI) vs those conditions that demonstrate intact DNA MMR. Conditions characterized by MMR deficient CRCs include Lynch syndrome (germline MMR mutation), Lynch-like syndrome (biallelic somatic MMR mutations), constitutional MMR deficiency syndrome (biallelic germline MMR mutations), and sporadic MSI CRC (somatic biallelic methylation of MLH1). HNPCC conditions with intact DNA MMR associated with familial CRC include polymerase proofreading associated polyposis and familial colorectal cancer type X. Although next generation sequencing technologies have elucidated the genetic cause for some HNPCC conditions, others remain genetically undefined. Differentiating between Lynch syndrome and the other HNPCC disorders has profound implications for cancer risk assessment and surveillance of affected patients and their at-risk relatives. Clinical suspicion coupled with molecular tumor analysis and testing for germline mutations can help differentiate the clinical mimicry within HNPCC and facilitate diagnosis and management. PMID:26309352

Lynch syndrome and Lynch syndrome mimics: The growing complex landscape of hereditary colon cancer.

PubMed

Carethers, John M; Stoffel, Elena M

2015-08-21

Hereditary non-polyposis colorectal cancer (HNPCC) was previously synonymous with Lynch syndrome; however, identification of the role of germline mutations in the DNA mismatch repair (MMR) genes has made it possible to differentiate Lynch syndrome from other conditions associated with familial colorectal cancer (CRC). Broadly, HNPCC may be dichotomized into conditions that demonstrate defective DNA MMR and microsatellite instability (MSI) vs those conditions that demonstrate intact DNA MMR. Conditions characterized by MMR deficient CRCs include Lynch syndrome (germline MMR mutation), Lynch-like syndrome (biallelic somatic MMR mutations), constitutional MMR deficiency syndrome (biallelic germline MMR mutations), and sporadic MSI CRC (somatic biallelic methylation of MLH1). HNPCC conditions with intact DNA MMR associated with familial CRC include polymerase proofreading associated polyposis and familial colorectal cancer type X. Although next generation sequencing technologies have elucidated the genetic cause for some HNPCC conditions, others remain genetically undefined. Differentiating between Lynch syndrome and the other HNPCC disorders has profound implications for cancer risk assessment and surveillance of affected patients and their at-risk relatives. Clinical suspicion coupled with molecular tumor analysis and testing for germline mutations can help differentiate the clinical mimicry within HNPCC and facilitate diagnosis and management.

Elucidating the Burden of HIV in Tissues Using Multiplexed Immunofluorescence and In Situ Hybridization: Methods for the Single-Cell Phenotypic Characterization of Cells Harboring HIV In Situ.

PubMed

Vasquez, Joshua J; Hussien, Rajaa; Aguilar-Rodriguez, Brandon; Junger, Henrik; Dobi, Dejan; Henrich, Timothy J; Thanh, Cassandra; Gibson, Erica; Hogan, Louise E; McCune, Joseph; Hunt, Peter W; Stoddart, Cheryl A; Laszik, Zoltan G

2018-06-01

Persistent tissue reservoirs of HIV present a major barrier to cure. Defining subsets of infected cells in tissues is a major focus of HIV cure research. Herein, we describe a novel multiplexed in situ hybridization (ISH) (RNAscope) protocol to detect HIV-DNA (vDNA) and HIV-RNA (vRNA) in formalin-fixed paraffin-embedded (FFPE) human tissues in combination with immunofluorescence (IF) phenotyping of the infected cells. We show that multiplexed IF and ISH (mIFISH) is suitable for quantitative assessment of HIV vRNA and vDNA and that multiparameter IF phenotyping allows precise identification of the cellular source of the ISH signal. We also provide semi-quantitative data on the impact of various tissue fixatives on the detectability of vDNA and vRNA with RNAscope technology. Finally, we describe methods to quantitate the ISH signal on whole-slide digital images and validation of the quantitative ISH data with quantitative real-time PCR for vRNA. It is our hope that this approach will provide insight into the biology of HIV tissue reservoirs and to inform strategies aimed at curing HIV.

Nonparametric Bayesian clustering to detect bipolar methylated genomic loci.

PubMed

Wu, Xiaowei; Sun, Ming-An; Zhu, Hongxiao; Xie, Hehuang

2015-01-16

With recent development in sequencing technology, a large number of genome-wide DNA methylation studies have generated massive amounts of bisulfite sequencing data. The analysis of DNA methylation patterns helps researchers understand epigenetic regulatory mechanisms. Highly variable methylation patterns reflect stochastic fluctuations in DNA methylation, whereas well-structured methylation patterns imply deterministic methylation events. Among these methylation patterns, bipolar patterns are important as they may originate from allele-specific methylation (ASM) or cell-specific methylation (CSM). Utilizing nonparametric Bayesian clustering followed by hypothesis testing, we have developed a novel statistical approach to identify bipolar methylated genomic regions in bisulfite sequencing data. Simulation studies demonstrate that the proposed method achieves good performance in terms of specificity and sensitivity. We used the method to analyze data from mouse brain and human blood methylomes. The bipolar methylated segments detected are found highly consistent with the differentially methylated regions identified by using purified cell subsets. Bipolar DNA methylation often indicates epigenetic heterogeneity caused by ASM or CSM. With allele-specific events filtered out or appropriately taken into account, our proposed approach sheds light on the identification of cell-specific genes/pathways under strong epigenetic control in a heterogeneous cell population.

Development of real-time PCR assay for genetic identification of the mottled skate, Beringraja pulchra.

PubMed

Hwang, In Kwan; Lee, Hae Young; Kim, Min-Hee; Jo, Hyun-Su; Choi, Dong-Ho; Kang, Pil-Won; Lee, Yang-Han; Cho, Nam-Soo; Park, Ki-Won; Chae, Ho Zoon

2015-10-01

The mottled skate, Beringraja pulchra is one of the commercially important fishes in the market today. However, B. pulchra identification methods have not been well developed. The current study reports a novel real-time PCR method based on TaqMan technology developed for the genetic identification of B. pulchra. The mitochondrial cytochrome oxidase subunit 1 (COI) nucleotide sequences of 29 B. pulchra, 157 skates and rays reported in GenBank DNA database were comparatively analyzed and the COI sequences specific to B. pulchra was identified. Based on this information, a system of specific primers and Minor Groove Binding (MGB) TaqMan probe were designed. The assay successfully discriminated in 29 specimens of B. pulchra and 27 commercial samples with unknown species identity. For B. pulchra DNA, an average Threshold Cycle (Ct) value of 19.1±0.1 was obtained. Among 27 commercial samples, two samples showed average Ct values 19.1±0.0 and 26.7±0.1, respectively and were confirmed to be B. pulchra based on sequencing. The other samples tested showed undetectable or extremely weak signals for the target fragment, which was also consistent with the sequencing results. These results reveal that the method developed is a rapid and efficient tool to identify B. pulchra and might prevent fraud or mislabeling during the distribution of B. pulchra products. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Identification of species based on DNA barcode using k-mer feature vector and Random forest classifier.

PubMed

Meher, Prabina Kumar; Sahu, Tanmaya Kumar; Rao, A R

2016-11-05

DNA barcoding is a molecular diagnostic method that allows automated and accurate identification of species based on a short and standardized fragment of DNA. To this end, an attempt has been made in this study to develop a computational approach for identifying the species by comparing its barcode with the barcode sequence of known species present in the reference library. Each barcode sequence was first mapped onto a numeric feature vector based on k-mer frequencies and then Random forest methodology was employed on the transformed dataset for species identification. The proposed approach outperformed similarity-based, tree-based, diagnostic-based approaches and found comparable with existing supervised learning based approaches in terms of species identification success rate, while compared using real and simulated datasets. Based on the proposed approach, an online web interface SPIDBAR has also been developed and made freely available at http://cabgrid.res.in:8080/spidbar/ for species identification by the taxonomists. Copyright © 2016 Elsevier B.V. All rights reserved.

Using DNA barcoding to differentiate invasive Dreissena species (Mollusca, Bivalvia)

PubMed Central

Marescaux, Jonathan; Van Doninck, Karine

2013-01-01

Abstract The zebra mussel (Dreissena polymorpha) and the quagga mussel (Dreissena rostriformis bugensis) are considered as the most competitive invaders in freshwaters of Europe and North America. Although shell characteristics exist to differentiate both species, phenotypic plasticity in the genus Dreissena does not always allow a clear identification. Therefore, the need to find an accurate identification method is essential. DNA barcoding has been proven to be an adequate procedure to discriminate species. The cytochrome c oxidase subunit I mitochondrial gene (COI) is considered as the standard barcode for animals. We tested the use of this gene as an efficient DNA barcode and found that it allow rapid and accurate identification of adult Dreissena individuals. PMID:24453560

Detection of hepatitis B virus core antigen by phage display mediated TaqMan real-time immuno-PCR.

PubMed

Monjezi, Razieh; Tan, Sheau Wei; Tey, Beng Ti; Sieo, Chin Chin; Tan, Wen Siang

2013-01-01

The core antigen (HBcAg) of hepatitis B virus (HBV) is one of the markers for the identification of the viral infection. The main purpose of this study was to develop a TaqMan real-time detection assay based on the concept of phage display mediated immuno-PCR (PD-IPCR) for the detection of HBcAg. PD-IPCR combines the advantages of immuno-PCR (IPCR) and phage display technology. IPCR integrates the versatility of enzyme-linked immunosorbent assay (ELISA) with the sensitivity and signal generation power of PCR. Whereas, phage display technology exploits the physical association between the displayed peptide and the encoding DNA within the same phage particle. In this study, a constrained peptide displayed on the surface of an M13 recombinant bacteriophage that interacts tightly with HBcAg was applied as a diagnostic reagent in IPCR. The phage displayed peptide and its encoding DNA can be used to replace monoclonal antibody (mAb) and chemically bound DNA, respectively. This method is able to detect as low as 10ng of HBcAg with 10(8)pfu/ml of the recombinant phage which is about 10,000 times more sensitive than the phage-ELISA. The PD-IPCR provides an alternative means for the detection of HBcAg in human serum samples. Copyright © 2012 Elsevier B.V. All rights reserved.

Capillary array scanner for time-resolved detection and identification of fluorescently labelled DNA fragments.

PubMed

Neumann, M; Herten, D P; Dietrich, A; Wolfrum, J; Sauer, M

2000-02-25

The first capillary array scanner for time-resolved fluorescence detection in parallel capillary electrophoresis based on semiconductor technology is described. The system consists essentially of a confocal fluorescence microscope and a x,y-microscope scanning stage. Fluorescence of the labelled probe molecules was excited using a short-pulse diode laser emitting at 640 nm with a repetition rate of 50 MHz. Using a single filter system the fluorescence decays of different labels were detected by an avalanche photodiode in combination with a PC plug-in card for time-correlated single-photon counting (TCSPC). The time-resolved fluorescence signals were analyzed and identified by a maximum likelihood estimator (MLE). The x,y-microscope scanning stage allows for discontinuous, bidirectional scanning of up to 16 capillaries in an array, resulting in longer fluorescence collection times per capillary compared to scanners working in a continuous mode. Synchronization of the alignment and measurement process were developed to allow for data acquisition without overhead. Detection limits in the subzeptomol range for different dye molecules separated in parallel capillaries have been achieved. In addition, we report on parallel time-resolved detection and separation of more than 400 bases of single base extension DNA fragments in capillary array electrophoresis. Using only semiconductor technology the presented technique represents a low-cost alternative for high throughput DNA sequencing in parallel capillaries.

The barley EST DNA Replication and Repair Database (bEST-DRRD) as a tool for the identification of the genes involved in DNA replication and repair.

PubMed

Gruszka, Damian; Marzec, Marek; Szarejko, Iwona

2012-06-14

The high level of conservation of genes that regulate DNA replication and repair indicates that they may serve as a source of information on the origin and evolution of the species and makes them a reliable system for the identification of cross-species homologs. Studies that had been conducted to date shed light on the processes of DNA replication and repair in bacteria, yeast and mammals. However, there is still much to be learned about the process of DNA damage repair in plants. These studies, which were conducted mainly using bioinformatics tools, enabled the list of genes that participate in various pathways of DNA repair in Arabidopsis thaliana (L.) Heynh to be outlined; however, information regarding these mechanisms in crop plants is still very limited. A similar, functional approach is particularly difficult for a species whose complete genomic sequences are still unavailable. One of the solutions is to apply ESTs (Expressed Sequence Tags) as the basis for gene identification. For the construction of the barley EST DNA Replication and Repair Database (bEST-DRRD), presented here, the Arabidopsis nucleotide and protein sequences involved in DNA replication and repair were used to browse for and retrieve the deposited sequences, derived from four barley (Hordeum vulgare L.) sequence databases, including the "Barley Genome version 0.05" database (encompassing ca. 90% of barley coding sequences) and from two databases covering the complete genomes of two monocot models: Oryza sativa L. and Brachypodium distachyon L. in order to identify homologous genes. Sequences of the categorised Arabidopsis queries are used for browsing the repositories, which are located on the ViroBLAST platform. The bEST-DRRD is currently used in our project during the identification and validation of the barley genes involved in DNA repair. The presented database provides information about the Arabidopsis genes involved in DNA replication and repair, their expression patterns and models of protein interactions. It was designed and established to provide an open-access tool for the identification of monocot homologs of known Arabidopsis genes that are responsible for DNA-related processes. The barley genes identified in the project are currently being analysed to validate their function.

Rapid identification of the Asian gypsy moth and its related species based on mitochondrial DNA.

PubMed

Wu, Ying; Du, Qiuyang; Qin, Haiwen; Shi, Juan; Wu, Zhiyi; Shao, Weidong

2018-02-01

The gypsy moth- Lymantria dispar (Linnaeus)-is a worldwide forest defoliator and is of two types: the European gypsy moth and the Asian gypsy moth. Because of multiple invasions of the Asian gypsy moth, the North American Plant Protection Organization officially approved Regional Standards for Phytosanitary Measures No. 33. Accordingly, special quarantine measures have been implemented for 30 special focused ports in the epidemic areas of the Asian gypsy moth, including China, which has imposed great inconvenience on export trade. The Asian gypsy moth and its related species (i.e., Lymantria monocha and Lymantria xylina ) intercepted at ports are usually at different life stages, making their identification difficult. Furthermore, Port quarantine requires speedy clearance. As such, it is difficult to identify the Asian gypsy moth and its related species only by their morphological characteristics in a speedy measure. Therefore, this study aimed to use molecular biology technology to rapidly identify the Asian gypsy moth and its related species based on the consistency of mitochondrial DNA in different life stages. We designed 10 pairs of specific primers from different fragments of the Asian gypsy moth and its related species, and their detection sensitivity met the need for rapid identification. In addition, we determined the optimal polymerase chain reaction amplification temperature of the 10 pairs of specific primers, including three pairs of specific primers for the Asian gypsy moth ( L. dispar asiatic ), four pairs of specific primers for the nun moth ( L. monocha ), and three pairs of specific primers for the casuarina moth ( L. xylina ). In conclusion, using our designed primers, direct rapid identification of the Asian gypsy moth and its related species is possible, and this advancement can help improve export trade in China.

A molecular identification system for grasses: a novel technology for forensic botany.

PubMed

Ward, J; Peakall, R; Gilmore, S R; Robertson, J

2005-09-10

Our present inability to rapidly, accurately and cost-effectively identify trace botanical evidence remains the major impediment to the routine application of forensic botany. Grasses are amongst the most likely plant species encountered as forensic trace evidence and have the potential to provide links between crime scenes and individuals or other vital crime scene information. We are designing a molecular DNA-based identification system for grasses consisting of several PCR assays that, like a traditional morphological taxonomic key, provide criteria that progressively identify an unknown grass sample to a given taxonomic rank. In a prior study of DNA sequences across 20 phylogenetically representative grass species, we identified a series of potentially informative indels in the grass mitochondrial genome. In this study we designed and tested five PCR assays spanning these indels and assessed the feasibility of these assays to aid identification of unknown grass samples. We confirmed that for our control set of 20 samples, on which the design of the PCR assays was based, the five primer combinations produced the expected results. Using these PCR assays in a 'blind test', we were able to identify 25 unknown grass samples with some restrictions. Species belonging to genera represented in our control set were all correctly identified to genus with one exception. Similarly, genera belonging to tribes in the control set were correctly identified to the tribal level. Finally, for those samples for which neither the tribal or genus specific PCR assays were designed, we could confidently exclude these samples from belonging to certain tribes and genera. The results confirmed the utility of the PCR assays and the feasibility of developing a robust full-scale usable grass identification system for forensic purposes.

Forensic dentistry in human identification: A review of the literature.

PubMed

Ata-Ali, Javier; Ata-Ali, Fadi

2014-04-01

An update is provided of the literature on the role of odontology in human identification, based on a PubMed-Medline search of the last 5 years and using the terms: "forensic dentistry" (n = 464 articles), "forensic odontology" (n = 141 articles) and "forensic dentistry identification" (n = 169 articles). Apart from these initial 774 articles, others considered to be important and which were generated by a manual search and cited as references in review articles were also included. Forensic dentistry requires interdisciplinary knowledge, since the data obtained from the oral cavity can contribute to identify an individual or provide information needed in a legal process. Furthermore, the data obtained from the oral cavity can narrow the search range of an individual and play a key role in the victim identification process following mass disasters or catastrophes. This literature search covering the last 5 years describes the novelties referred to buccodental studies in comparative identification, buccodental evaluation in reconstructive identification, human bites as a method for identifying the aggressor, and the role of DNA in dental identification. The oral cavity is a rich and noninvasive source of DNA, and can be used to solve problems of a social, economic or legal nature. Key words:Forensic identification, DNA, forensic dentistry, rugoscopy, cheiloscopy, saliva.

Identification and characterization of a DnaJ gene from red alga Pyropia yezoensis (Bangiales, Rhodophyta)

NASA Astrophysics Data System (ADS)

Liu, Jiao; Li, Xianchao; Tang, Xuexi; Zhou, Bin

2016-03-01

Members of the DnaJ family are proteins that play a pivotal role in various cellular processes, such as protein folding, protein transport and cellular responses to stress. In the present study, we identified and characterized the full-length DnaJ cDNA sequence from expressed sequence tags of Pyropia yezoensis ( PyDnaJ) via rapid identification of cDNA ends. This cDNA encoded a protein of 429 amino acids, which shared high sequence similarity with other identified DnaJ proteins, such as a heat shock protein 40/DnaJ from Pyropia haitanensis. The relative mRNA expression level of PyDnaJ was investigated using real-time PCR to determine its specific expression during the algal life cycle and during desiccation. The relative mRNA expression level in sporophytes was higher than that in gametophytes and significantly increased during the whole desiccation process. These results indicate that PyDnaJ is an authentic member of the DnaJ family in plants and red algae and might play a pivotal role in mitigating damage to P. yezoensis during desiccation.

DNA-based identification and phylogeny of North American Armillaria species

Treesearch

Amy L. Ross-Davis; John W. Hanna; Ned B. Klopfenstein

2011-01-01

Because Armillaria species display different ecological behaviors across diverse forest ecosystems, it is critical to identify Armillaria species accurately for any assessment of forest health. To further develop DNA-based identification methods, partial sequences of the translation elongation factor-1 alpha (EF-1α) gene were used to examine the phylogenetic...

Comparison of Radio Frequency Distinct Native Attribute and Matched Filtering Techniques for Device Discrimination and Operation Identification

DTIC Science & Technology

identification. URE from ten MSP430F5529 16-bit microcontrollers were analyzed using: 1) RF distinct native attributes (RF-DNA) fingerprints paired with multiple...discriminant analysis/maximum likelihood (MDA/ML) classification, 2) RF-DNA fingerprints paired with generalized relevance learning vector quantized

Genomics dataset of unidentified disclosed isolates.

PubMed

Rekadwad, Bhagwan N

2016-09-01

Analysis of DNA sequences is necessary for higher hierarchical classification of the organisms. It gives clues about the characteristics of organisms and their taxonomic position. This dataset is chosen to find complexities in the unidentified DNA in the disclosed patents. A total of 17 unidentified DNA sequences were thoroughly analyzed. The quick response codes were generated. AT/GC content of the DNA sequences analysis was carried out. The QR is helpful for quick identification of isolates. AT/GC content is helpful for studying their stability at different temperatures. Additionally, a dataset on cleavage code and enzyme code studied under the restriction digestion study, which helpful for performing studies using short DNA sequences was reported. The dataset disclosed here is the new revelatory data for exploration of unique DNA sequences for evaluation, identification, comparison and analysis.

Base-resolution detection of N 4-methylcytosine in genomic DNA using 4mC-Tet-assisted-bisulfite-sequencing

DOE PAGES

Yu, Miao; Ji, Lexiang; Neumann, Drexel A.; ...

2015-07-15

Restriction-modification (R-M) systems pose a major barrier to DNA transformation and genetic engineering of bacterial species. Systematic identification of DNA methylation in R-M systems, including N 6-methyladenine (6mA), 5-methylcytosine (5mC) and N 4-methylcytosine (4mC), will enable strategies to make these species genetically tractable. Although single-molecule, real time (SMRT) sequencing technology is capable of detecting 4mC directly for any bacterial species regardless of whether an assembled genome exists or not, it is not as scalable to profiling hundreds to thousands of samples compared with the commonly used next-generation sequencing technologies. Here, we present 4mC-Tet-assisted bisulfite-sequencing (4mC-TAB-seq), a next-generation sequencing method thatmore » rapidly and cost efficiently reveals the genome-wide locations of 4mC for bacterial species with an available assembled reference genome. In 4mC-TAB-seq, both cytosines and 5mCs are read out as thymines, whereas only 4mCs are read out as cytosines, revealing their specific positions throughout the genome. We applied 4mC-TAB-seq to study the methylation of a member of the hyperthermophilc genus, Caldicellulosiruptor, in which 4mC-related restriction is a major barrier to DNA transformation from other species. Lastly, in combination with MethylC-seq, both 4mC- and 5mC-containing motifs are identified which can assist in rapid and efficient genetic engineering of these bacteria in the future.« less

Application of forensic DNA testing in the legal system.

PubMed

Primorac, D; Schanfield, M S

2000-03-01

DNA technology has taken an irreplaceable position in the field of the forensic sciences. Since 1985, when Peter Gill and Alex Jeffreys first applied DNA technology to forensic problems, to the present, more than 50,000 cases worldwide have been solved through the use of DNA based technology. Although the development of DNA typing in forensic science has been extremely rapid, today we are witnessing a new era of DNA technology including automation and miniaturization. In forensic science, DNA analysis has become "the new form of scientific evidence" and has come under public scrutiny and the demand to show competence. More and more courts admit the DNA based evidence. We believe that in the near future this technology will be generally accepted in the legal system. There are two main applications of DNA analysis in forensic medicine: criminal investigation and paternity testing. In this article we present background information on DNA, human genetics, and the application of DNA analysis to legal problems, as well as the commonly applied respective mathematics.

Geographic origin and individual assignment of Shorea platyclados (Dipterocarpaceae) for forensic identification

PubMed Central

Diway, Bibian; Khoo, Eyen

2017-01-01

The development of timber tracking methods based on genetic markers can provide scientific evidence to verify the origin of timber products and fulfill the growing requirement for sustainable forestry practices. In this study, the origin of an important Dark Red Meranti wood, Shorea platyclados, was studied by using the combination of seven chloroplast DNA and 15 short tandem repeats (STRs) markers. A total of 27 natural populations of S. platyclados were sampled throughout Malaysia to establish population level and individual level identification databases. A haplotype map was generated from chloroplast DNA sequencing for population identification, resulting in 29 multilocus haplotypes, based on 39 informative intraspecific variable sites. Subsequently, a DNA profiling database was developed from 15 STRs allowing for individual identification in Malaysia. Cluster analysis divided the 27 populations into two genetic clusters, corresponding to the region of Eastern and Western Malaysia. The conservativeness tests showed that the Malaysia database is conservative after removal of bias from population subdivision and sampling effects. Independent self-assignment tests correctly assigned individuals to the database in an overall 60.60−94.95% of cases for identified populations, and in 98.99−99.23% of cases for identified regions. Both the chloroplast DNA database and the STRs appear to be useful for tracking timber originating in Malaysia. Hence, this DNA-based method could serve as an effective addition tool to the existing forensic timber identification system for ensuring the sustainably management of this species into the future. PMID:28430826

Identification of a forensic case using microscopy and forensically informative nucleotide sequencing (FINS): a case study of small Indian civet (Viverricula indica).

PubMed

Sahajpal, Vivek; Goyal, S P

2010-06-01

The exhibits obtained in wildlife offence cases quite often present a challenging situation for the forensic expert. The selection of proper approach for analysis is vital for a successful analysis. A generalised forensic analysis approach should proceed from the use of non-destructive techniques (morphological and microscopic examination) to partially destructive and finally destructive techniques (DNA analysis). The findings of non-destructive techniques may sometime be inconclusive but they definitely help in steering further forensic analysis in a proper direction. We describe a recent case where a very small dried skin piece (<0.05 mg) with just one small trimmed guard hair (0.4 cm) on it was received for species identification. The single guard hair was examined microscopically to get an indication of the type of species. We also describe the extraction procedure with a lower amount of sample, using an automated extraction method (Qiagen Biorobot EZ1) and PCR amplification of three mitochondrial genes (16s rRNA, 12s rRNA and cytochrome b) for species identification. Microscopic examination of the single hair indicated a viverrid species but the initial DNA analysis with 16s rRNA (through NCBI BLAST) showed the highest homology (93%) with a hyaenid species (Hyaena hyaena). However, further DNA analysis based on 12s rRNA and cytochrome b gene proved that the species was indeed a viverrid i.e. Viverricula indica (small Indian civet). The highest homology shown with a Hyaenid species by the 16s rRNA sequence from the case sample was due to lack of a 16s rRNA sequence for Viverricula indica in the NCBI data base. The case highlights the importance of morphological and microscopic examinations in wildlife offence cases. With respect to DNA extraction technology we found that automatic extraction method of Biorobot EZ1 (Qiagen) is quite useful with less amount of sample (much below recommended amount). Copyright 2009 Forensic Science Society. Published by Elsevier Ireland Ltd. All rights reserved.

DNA barcoding a nightmare taxon: assessing barcode index numbers and barcode gaps for sweat bees.

PubMed

Gibbs, Jason

2018-01-01

There is an ongoing campaign to DNA barcode the world's >20 000 bee species. Recent revisions of Lasioglossum (Dialictus) (Hymenoptera: Halictidae) for Canada and the eastern United States were completed using integrative taxonomy. DNA barcode data from 110 species of L. (Dialictus) are examined for their value in identification and discovering additional taxonomic diversity. Specimen identification success was estimated using the best close match method. Error rates were 20% relative to current taxonomic understanding. Barcode Index Numbers (BINs) assigned using Refined Single Linkage Analysis (RESL) and barcode gaps using the Automatic Barcode Gap Discovery (ABGD) method were also assessed. RESL was incongruent for 44.5% of species, although some cryptic diversity may exist. Forty-three of 110 species were part of merged BINs with multiple species. The barcode gap is non-existent for the data set as a whole and ABGD showed levels of discordance similar to the RESL. The viridatum species-group is particularly problematic, so that DNA barcodes alone would be misleading for species delimitation and specimen identification. Character-based methods using fixed nucleotide substitutions could improve specimen identification success in some cases. The use of DNA barcoding for species discovery for standard taxonomic practice in the absence of a well-defined barcode gap is discussed.

Challenges to a molecular approach to prey identification in the Burmese python, Python molurus bivittatus

USGS Publications Warehouse

Falk, Bryan; Reed, Robert N.

2015-01-01

Molecular approaches to prey identification are increasingly useful in elucidating predator–prey relationships, and we aimed to investigate the feasibility of these methods to document the species identities of prey consumed by invasive Burmese pythons in Florida. We were particularly interested in the diet of young snakes, because visual identification of prey from this size class has proven difficult. We successfully extracted DNA from the gastrointestinal contents of 43 young pythons, as well as from several control samples, and attempted amplification of DNA mini-barcodes, a 130-bp region of COX1. Using a PNA clamp to exclude python DNA, we found that prey DNA was not present in sufficient quality for amplification of this locus in 86% of our samples. All samples from the GI tracts of young pythons contained only hair, and the six samples we were able to identify to species were hispid cotton rats. This suggests that young Burmese pythons prey predominantly on small mammals and that prey diversity among snakes of this size class is low. We discuss prolonged gastrointestinal transit times and extreme gastric breakdown as possible causes of DNA degradation that limit the success of a molecular approach to prey identification in Burmese pythons

DNA barcoding and morphological analysis for rapid identification of most economically important crop-infesting Sunn pests belonging to Eurygaster Laporte, 1833 (Hemiptera, Scutelleridae).

PubMed

Syromyatnikov, Mikhail Y; Golub, Victor B; Kokina, Anastasia V; Victoria A Soboleva; Popov, Vasily N

2017-01-01

The genus Eurygaster Laporte, 1833 includes ten species five of which inhabit the European part of Russia. The harmful species of the genus is E. integriceps . Eurygaster species identification based on the morphological traits is very difficult, while that of the species at the egg or larval stages is extremely difficult or impossible. Eurygaster integriceps , E. maura , and E. testudinaria differ only slightly between each other morphologically, E. maura and E. testudinaria being almost indiscernible. DNA barcoding based on COI sequences have shown that E. integriceps differs significantly from these closely related species, which enables its rapid and accurate identification. Based on COI nucleotide sequences, three species of Sunn pests, E. maura , E. testudinarius , E. dilaticollis , could not be differentiated from each other through DNA barcoding. The difference in the DNA sequences between the COI gene of E. integriceps and COI genes of E. maura and E. testudinarius was more than 4%. In the present study DNA barcoding of two Eurygaster species was performed for the first time on E. integriceps , the most dangerous pest in the genus, and E. dilaticollis that only inhabits natural ecosystems. The PCR-RFLP method was developed in this work for the rapid identification of E. integriceps .

DNA barcoding and morphological analysis for rapid identification of most economically important crop-infesting Sunn pests belonging to Eurygaster Laporte, 1833 (Hemiptera, Scutelleridae)

PubMed Central

Syromyatnikov, Mikhail Y.; Golub, Victor B.; Kokina, Anastasia V.; Victoria A. Soboleva; Popov, Vasily N.

2017-01-01

Abstract The genus Eurygaster Laporte, 1833 includes ten species five of which inhabit the European part of Russia. The harmful species of the genus is E. integriceps. Eurygaster species identification based on the morphological traits is very difficult, while that of the species at the egg or larval stages is extremely difficult or impossible. Eurygaster integriceps, E. maura, and E. testudinaria differ only slightly between each other morphologically, E. maura and E. testudinaria being almost indiscernible. DNA barcoding based on COI sequences have shown that E. integriceps differs significantly from these closely related species, which enables its rapid and accurate identification. Based on COI nucleotide sequences, three species of Sunn pests, E. maura, E. testudinarius, E. dilaticollis, could not be differentiated from each other through DNA barcoding. The difference in the DNA sequences between the COI gene of E. integriceps and COI genes of E. maura and E. testudinarius was more than 4%. In the present study DNA barcoding of two Eurygaster species was performed for the first time on E. integriceps, the most dangerous pest in the genus, and E. dilaticollis that only inhabits natural ecosystems. The PCR-RFLP method was developed in this work for the rapid identification of E. integriceps. PMID:29118620

DNA extraction and barcode identification of development stages of forensically important flies in the Czech Republic.

PubMed

Olekšáková, Tereza; Žurovcová, Martina; Klimešová, Vanda; Barták, Miroslav; Šuláková, Hana

2018-04-01

Several methods of DNA extraction, coupled with 'DNA barcoding' species identification, were compared using specimens from early developmental stages of forensically important flies from the Calliphoridae and Sarcophagidae families. DNA was extracted at three immature stages - eggs, the first instar larvae, and empty pupal cases (puparia) - using four different extraction methods, namely, one simple 'homemade' extraction buffer protocol and three commercial kits. The extraction conditions, including the amount of proteinase K and incubation times, were optimized. The simple extraction buffer method was successful for half of the eggs and for the first instar larval samples. The DNA Lego Kit and DEP-25 DNA Extraction Kit were useful for DNA extractions from the first instar larvae samples, and the DNA Lego Kit was also successful regarding the extraction from eggs. The QIAamp DNA mini kit was the most effective; the extraction was successful with regard to all sample types - eggs, larvae, and pupari.

Evaluation of the PCR method for identification of Bifidobacterium species.

PubMed

Youn, S Y; Seo, J M; Ji, G E

2008-01-01

Bifidobacterium species are known for their beneficial effects on health and their wide use as probiotics. Although various polymerase chain reaction (PCR) methods for the identification of Bifidobacterium species have been published, the reliability of these methods remains open to question. In this study, we evaluated 37 previously reported PCR primer sets designed to amplify 16S rDNA, 23S rDNA, intergenic spacer regions, or repetitive DNA sequences of various Bifidobacterium species. Ten of 37 experimental primer sets showed specificity for B. adolescentis, B. angulatum, B. pseudocatenulatum, B. breve, B. bifidum, B. longum, B. longum biovar infantis and B. dentium. The results suggest that published Bifidobacterium primer sets should be re-evaluated for both reproducibility and specificity for the identification of Bifidobacterium species using PCR. Improvement of existing PCR methods will be needed to facilitate identification of other Bifidobacterium strains, such as B. animalis, B. catenulatum, B. thermophilum and B. subtile.

Possibilities in identification of genomic species of Burkholderia cepacia complex by PCR and RFLP.

PubMed

Navrátilová, Lucie; Chromá, Magdalena; Hanulík, Vojtech; Raclavský, Vladislav

2013-01-01

The strains belonging to Burkholderia cepacia complex are important opportunistic pathogens in immunocompromised patients and cause serious diseases. It is possible to obtain isolates from soil, water, plants and human samples. Taxonomy of this group is difficult. Burkholderia cepacia complex consists of seventeen genomic species and the genetic scheme is based on recA gene. Commonly, first five genomovars occurre in humans, mostly genomovars II and III, subdivision IIIA. Within this study we tested identification of first five genomovars by PCR with following melting analysis and RFLP. The experiments were targeted on eubacterial 16S rDNA and specific gene recA, which allowed identification of all five genomovars. RecA gene appeared as more suitable than 16S rDNA, which enabled direct identification of only genomovars II and V; genomovars I, III and IV were similar within 16S rDNA sequence.

Identification of hallucinogenic fungi from the genera Psilocybe and Panaeolus by amplified fragment length polymorphism.

PubMed

Lee, J C; Cole, M; Linacre, A

2000-05-01

Unambiguous identification of the hallucinogenic fungi of the genera Psilocybe and Panaeolus is required by national and international drug control legislation. We report on a DNA-based test using the technique of amplified fragment length polymorphism (AFLP). AFLP can differentiate species of the two genera Psilocybe and Panaeolus by using different primer sets. The identification of hallucinogenic fungi using a DNA-based test, which can be used in conjunction with morphological features, will assist in forensic investigations.

DNA methods for identification of Chinese medicinal materials

PubMed Central

Yip, Pui Ying; Chau, Chi Fai; Mak, Chun Yin; Kwan, Hoi Shan

2007-01-01

As adulterated and substituted Chinese medicinal materials are common in the market, therapeutic effectiveness of such materials cannot be guaranteed. Identification at species-, strain- and locality-levels, therefore, is required for quality assurance/control of Chinese medicine. This review provides an informative introduction to DNA methods for authentication of Chinese medicinal materials. Technical features and examples of the methods based on sequencing, hybridization and polymerase chain reaction (PCR) are described and their suitability for different identification objectives is discussed. PMID:17803808

Genetic alteration and mutation profiling of circulating cell-free tumor DNA (cfDNA) for diagnosis and targeted therapy of gastrointestinal stromal tumors.

PubMed

Yan, Weixin; Zhang, Aiguo; Powell, Michael J

2016-07-21

Gastrointestinal stromal tumors (GISTs) have been recognized as a biologically distinctive type of tumor, different from smooth muscle and neural tumors of the gastrointestinal tract. The identification of genetic aberrations in proto-oncogenes that drive the growth of GISTs is critical for improving the efficacy of cancer therapy by matching targeted drugs to specific mutations. Research into the oncogenic mechanisms of GISTs has found that these tumors frequently contain activating gene mutations in either platelet-derived growth factor receptor A (PDGFRA) or a receptor tyrosine protein associated with a mast cell growth factor receptor encoded by the KIT gene. Mutant cancer subpopulations have the potential to disrupt durable patient responses to molecularly targeted therapy for GISTs, yet the prevalence and size of subpopulations remain largely unexplored. Detection of the cancer subpopulations that harbor low-frequency mutant alleles of target proto-oncogenes through the use of molecular genetic methods, such as polymerase chain reaction (PCR) target amplification technology, is hampered by the high abundance of wild-type alleles, which limit the sensitivity of detection of these minor mutant alleles. This is especially true in the case of mutant tumor DNA derived "driver" and "drug-resistant" alleles that are present in the circulating cell-free tumor DNA (cfDNA) in the peripheral blood circulation of GIST patients. So-called "liquid biopsy" allows for the dynamic monitoring of the patients' tumor status during treatment using minimally invasive sampling. New methodologies, such as a technology that employs a xenonucleic acid (XNA) clamping probe to block the PCR amplification of wild-type templates, have allowed improved molecular detection of these low-frequency alleles both in tissue biopsy samples and in cfDNA. These new methodologies could be widely applied for minimally invasive molecular testing in the therapeutic management of GISTs.

Development of Rapid Isothermal Amplification Assays for Detection of Phytophthora spp. in Plant Tissue.

PubMed

Miles, Timothy D; Martin, Frank N; Coffey, Michael D

2015-02-01

Several isothermal amplification techniques recently have been developed that are tolerant of inhibitors present in many plant extracts, which can reduce the need for obtaining purified DNA for running diagnostic assays. One such commercially available technique that has similarities with real-time polymerase chain reaction (PCR) for designing primers and a labeled probe is recombinase polymerase amplification (RPA). This technology was used to develop two simple and rapid approaches for detection of Phytophthora spp.: one genus-specific assay multiplexed with a plant internal control and the other species-specific assays for Phytophthora ramorum and P. kernoviae. All assays were tested for sensitivity (ranging from 3 ng to 1 fg of DNA) and specificity using DNA extracted from more than 136 Phytophthora taxa, 21 Pythium spp., 1 Phytopythium sp., and a wide range of plant species. The lower limit of linear detection using purified DNA was 200 to 300 fg of DNA in all pathogen RPA assays. Six different extraction buffers were tested for use during plant tissue maceration and the assays were validated in the field by collecting 222 symptomatic plant samples from over 50 different hosts. Only 56 samples were culture positive for Phytophthora spp. whereas 91 were positive using the Phytophthora genus-specific RPA test and a TaqMan real-time PCR assay. A technique for the generation of sequencing templates from positive RPA amplifications to confirm species identification was also developed. These RPA assays have added benefits over traditional technologies because they are rapid (results can be obtained in as little as 15 min), do not require DNA extraction or extensive training to complete, use less expensive portable equipment than PCR-based assays, and are significantly more specific than current immunologically based methods. This should provide a rapid, field-deployable capability for pathogen detection that will facilitate point-of-sample collection processing, thereby reducing the time necessary for accurate diagnostics and making management decisions.

Inconsistent identification of pit bull-type dogs by shelter staff.

PubMed

Olson, K R; Levy, J K; Norby, B; Crandall, M M; Broadhurst, J E; Jacks, S; Barton, R C; Zimmerman, M S

2015-11-01

Shelter staff and veterinarians routinely make subjective dog breed identification based on appearance, but their accuracy regarding pit bull-type breeds is unknown. The purpose of this study was to measure agreement among shelter staff in assigning pit bull-type breed designations to shelter dogs and to compare breed assignments with DNA breed signatures. In this prospective cross-sectional study, four staff members at each of four different shelters recorded their suspected breed(s) for 30 dogs; there was a total of 16 breed assessors and 120 dogs. The terms American pit bull terrier, American Staffordshire terrier, Staffordshire bull terrier, pit bull, and their mixes were included in the study definition of 'pit bull-type breeds.' Using visual identification only, the median inter-observer agreements and kappa values in pair-wise comparisons of each of the staff breed assignments for pit bull-type breed vs. not pit bull-type breed ranged from 76% to 83% and from 0.44 to 0.52 (moderate agreement), respectively. Whole blood was submitted to a commercial DNA testing laboratory for breed identification. Whereas DNA breed signatures identified only 25 dogs (21%) as pit bull-type, shelter staff collectively identified 62 (52%) dogs as pit bull-type. Agreement between visual and DNA-based breed assignments varied among individuals, with sensitivity for pit bull-type identification ranging from 33% to 75% and specificity ranging from 52% to 100%. The median kappa value for inter-observer agreement with DNA results at each shelter ranged from 0.1 to 0.48 (poor to moderate). Lack of consistency among shelter staff indicated that visual identification of pit bull-type dogs was unreliable. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

Identification and reassessment of the specific status of some tropical freshwater midges (Diptera: Chironomidae) using DNA barcode data.

PubMed

Pramual, Pairot; Simwisat, Kusumart; Martin, Jon

2016-01-28

Chironomidae are a highly diverse group of insects. Members of this family are often included in programs monitoring the health of freshwater ecosystems. However, a difficulty in morphological identification, particularly of larval stages is the major obstacle to this application. In this study, we tested the efficiency of mitochondrial cytochrome c oxidase I (COI) sequences as the DNA barcoding region for species identification of Chironomidae in Thailand. The results revealed 14 species with a high success rate (>90%) for the correct species identification, which suggests the potential usefulness of the technique. However, some morphological species possess high (>3%) intraspecific genetic divergence that suggests these species could be species complexes and need further morphological or cytological examination. Sequence-based species delimitation analyses indicated that most specimens identified as Chironomus kiiensis, Tokunaga 1936, in Japan are conspecific with C. striatipennis, Kieffer 1912, although a small number form a separate cluster. A review of the descriptions of Kiefferulus tainanus (Kieffer 1912) and its junior synonym, K. biroi (Kieffer 1918), following our results, suggests that this synonymy is probably not correct and that K. tainanus occurs in Japan, China and Singapore, while K. biroi occurs in India and Thailand. Our results therefore revealed the usefulness of DNA barcoding for correct species identification of Chironomidae, particularly the immature stages. In addition, DNA barcodes could also uncover hidden diversity that can guide further taxonomic study, and offer a more efficient way to identify species than morphological analysis where large numbers of specimens are involved, provided the identifications of DNA barcodes in the databases are correct. Our studies indicate that this is not the case, and we identify cases of misidentifications for C. flaviplumus, Tokunaga 1940 and K. tainanus.

Electronic Properties of Synthetic Shrimp Pathogens-derived DNA Schottky Diodes.

PubMed

Rizan, Nastaran; Yew, Chan Yen; Niknam, Maryam Rajabpour; Krishnasamy, Jegenathan; Bhassu, Subha; Hong, Goh Zee; Devadas, Sridevi; Din, Mohamed Shariff Mohd; Tajuddin, Hairul Anuar; Othman, Rofina Yasmin; Phang, Siew Moi; Iwamoto, Mitsumasa; Periasamy, Vengadesh

2018-01-17

The exciting discovery of the semiconducting-like properties of deoxyribonucleic acid (DNA) and its potential applications in molecular genetics and diagnostics in recent times has resulted in a paradigm shift in biophysics research. Recent studies in our laboratory provide a platform towards detecting charge transfer mechanism and understanding the electronic properties of DNA based on the sequence-specific electronic response, which can be applied as an alternative to identify or detect DNA. In this study, we demonstrate a novel method for identification of DNA from different shrimp viruses and bacteria using electronic properties of DNA obtained from both negative and positive bias regions in current-voltage (I-V) profiles. Characteristic electronic properties were calculated and used for quantification and further understanding in the identification process. Aquaculture in shrimp industry is a fast-growing food sector throughout the world. However, shrimp culture in many Asian countries faced a huge economic loss due to disease outbreaks. Scientists have been using specific established methods for detecting shrimp infection, but those methods do have their significant drawbacks due to many inherent factors. As such, we believe that this simple, rapid, sensitive and cost-effective tool can be used for detection and identification of DNA from different shrimp viruses and bacteria.

Results of a collaborative study on DNA identification of aged bone samples

PubMed Central

Vanek, Daniel; Budowle, Bruce; Dubska-Votrubova, Jitka; Ambers, Angie; Frolik, Jan; Pospisek, Martin; Al Afeefi, Ahmed Anwar; Al Hosani, Khalid Ismaeil; Allen, Marie; Al Naimi, Khudooma Saeed; Al Salafi, Dina; Al Tayyari, Wafa Ali Rashid; Arguetaa, Wendy; Bottinelli, Michel; Bus, Magdalena M.; Cemper-Kiesslich, Jan; Cepil, Olivier; De Cock, Greet; Desmyter, Stijn; El Amri, Hamid; El Ossmani, Hicham; Galdies, Ruth; Grün, Sebastian; Guidet, Francois; Hoefges, Anna; Iancu, Cristian Bogdan; Lotz, Petra; Maresca, Alessandro; Nagy, Marion; Novotny, Jindrich; Rachid, Hajar; Rothe, Jessica; Stenersen, Marguerethe; Stephenson, Mishel; Stevanovitch, Alain; Strien, Juliane; Sumita, Denilce R.; Vella, Joanna; Zander, Judith

2017-01-01

Aim A collaborative exercise with several institutes was organized by the Forensic DNA Service (FDNAS) and the Institute of the Legal Medicine, 2nd Faculty of Medicine, Charles University in Prague, Czech Republic, with the aim to test performance of different laboratories carrying out DNA analysis of relatively old bone samples. Methods Eighteen laboratories participating in the collaborative exercise were asked to perform DNA typing of two samples of bone powder. Two bone samples provided by the National Museum and the Institute of Archaelogy in Prague, Czech Republic, came from archeological excavations and were estimated to be approximately 150 and 400 years old. The methods of genetic characterization including autosomal, gonosomal, and mitochondrial markers was selected solely at the discretion of the participating laboratory. Results Although the participating laboratories used different extraction and amplification strategies, concordant results were obtained from the relatively intact 150 years old bone sample. Typing was more problematic with the analysis of the 400 years old bone sample due to poorer quality. Conclusion The laboratories performing identification DNA analysis of bone and teeth samples should regularly test their ability to correctly perform DNA-based identification on bone samples containing degraded DNA and potential inhibitors and demonstrate that risk of contamination is minimized. PMID:28613037

The Knowledge of DNA and DNA Technologies among Pre-Service Science Teachers

ERIC Educational Resources Information Center

Cardak, Osman; Dikmenli, Musa

2008-01-01

The purpose of this study is to determine the alternative conceptions of elementary school pre-service science teachers regarding DNA and DNA technologies. The questions asked in the study related to subjects including the structure and role of DNA molecule, structure of genes, some genetic technologies, Genetically Modified Organism (GMO) plants,…

Gene Identification Algorithms Using Exploratory Statistical Analysis of Periodicity

NASA Astrophysics Data System (ADS)

Mukherjee, Shashi Bajaj; Sen, Pradip Kumar

2010-10-01

Studying periodic pattern is expected as a standard line of attack for recognizing DNA sequence in identification of gene and similar problems. But peculiarly very little significant work is done in this direction. This paper studies statistical properties of DNA sequences of complete genome using a new technique. A DNA sequence is converted to a numeric sequence using various types of mappings and standard Fourier technique is applied to study the periodicity. Distinct statistical behaviour of periodicity parameters is found in coding and non-coding sequences, which can be used to distinguish between these parts. Here DNA sequences of Drosophila melanogaster were analyzed with significant accuracy.

Use of mitochondrial COI gene for the identification of family Salticidae and Lycosidae of spiders.

PubMed

Naseem, Sajida; Tahir, Hafiz Muhammad

2018-01-01

In recent years, DNA barcoding has become quite popular for molecular identification of species because it is simple, quick and an affordable method. Present study was conducted to identify spiders of most abundant families, i.e. Salticidae and Lycosidae from citrus orchards in Sargodha district using DNA barcoding. A total of 160 specimens were subjected to DNA barcoding but, sequences up to 600 bp were recovered for 156 specimens. This molecular approach proved helpful to assign the exact taxon to those specimens which were misidentified through morphological characters in the study. We were succeeded to discriminate six species of Lycosidae and nine species of Salticidae through DNA barcoding. Results revealed the presence of clear barcode gap (discontinuity in intra- and inter-specific divergences) for members of both families. Furthermore, the maximum intra-specific divergence was less than NN (nearest neighbour) distance for all species. This suggested the reliability of DNA barcoding for spider's identification up to species level. We got 98% success in our study. It is concluded from present study that DNA barcoding is more reliable tool especially for immature spiders, when morphological characters are ambiguous.

Noninvasive genome sampling in chimpanzees.

PubMed

Kohn, Michael H

2010-12-01

The inevitable has happened: genomic technologies have been added to our noninvasive genetic sampling repertoire. In this issue of Molecular Ecology, Perry et al. (2010) demonstrate how DNA extraction from chimpanzee faeces, followed by a series of steps to enrich for target loci, can be coupled with next-generation sequencing. These authors collected sequence and single-nucleotide polymorphism (SNP) data at more than 600 genomic loci (chromosome 21 and the X) and the complete mitochondrial DNA. By design, each locus was 'deep sequenced' to enable SNP identification. To demonstrate the reliability of their data, the work included samples from six captive chimps, which allowed for a comparison between presumably genuine SNPs obtained from blood and potentially flawed SNPs deduced from faeces. Thus, with this method, anyone with the resources, skills and ambition to do genome sequencing of wild, elusive, or protected mammals can enjoy all of the benefits of noninvasive sampling. © 2010 Blackwell Publishing Ltd.

Using Informatics-, Bioinformatics- and Genomics-Based Approaches for the Molecular Surveillance and Detection of Biothreat Agents

NASA Astrophysics Data System (ADS)

Seto, Donald

The convergence and wealth of informatics, bioinformatics and genomics methods and associated resources allow a comprehensive and rapid approach for the surveillance and detection of bacterial and viral organisms. Coupled with the continuing race for the fastest, most cost-efficient and highest-quality DNA sequencing technology, that is, "next generation sequencing", the detection of biological threat agents by `cheaper and faster' means is possible. With the application of improved bioinformatic tools for the understanding of these genomes and for parsing unique pathogen genome signatures, along with `state-of-the-art' informatics which include faster computational methods, equipment and databases, it is feasible to apply new algorithms to biothreat agent detection. Two such methods are high-throughput DNA sequencing-based and resequencing microarray-based identification. These are illustrated and validated by two examples involving human adenoviruses, both from real-world test beds.

Prioritizing multiple therapeutic targets in parallel using automated DNA-encoded library screening

NASA Astrophysics Data System (ADS)

Machutta, Carl A.; Kollmann, Christopher S.; Lind, Kenneth E.; Bai, Xiaopeng; Chan, Pan F.; Huang, Jianzhong; Ballell, Lluis; Belyanskaya, Svetlana; Besra, Gurdyal S.; Barros-Aguirre, David; Bates, Robert H.; Centrella, Paolo A.; Chang, Sandy S.; Chai, Jing; Choudhry, Anthony E.; Coffin, Aaron; Davie, Christopher P.; Deng, Hongfeng; Deng, Jianghe; Ding, Yun; Dodson, Jason W.; Fosbenner, David T.; Gao, Enoch N.; Graham, Taylor L.; Graybill, Todd L.; Ingraham, Karen; Johnson, Walter P.; King, Bryan W.; Kwiatkowski, Christopher R.; Lelièvre, Joël; Li, Yue; Liu, Xiaorong; Lu, Quinn; Lehr, Ruth; Mendoza-Losana, Alfonso; Martin, John; McCloskey, Lynn; McCormick, Patti; O'Keefe, Heather P.; O'Keeffe, Thomas; Pao, Christina; Phelps, Christopher B.; Qi, Hongwei; Rafferty, Keith; Scavello, Genaro S.; Steiginga, Matt S.; Sundersingh, Flora S.; Sweitzer, Sharon M.; Szewczuk, Lawrence M.; Taylor, Amy; Toh, May Fern; Wang, Juan; Wang, Minghui; Wilkins, Devan J.; Xia, Bing; Yao, Gang; Zhang, Jean; Zhou, Jingye; Donahue, Christine P.; Messer, Jeffrey A.; Holmes, David; Arico-Muendel, Christopher C.; Pope, Andrew J.; Gross, Jeffrey W.; Evindar, Ghotas

2017-07-01

The identification and prioritization of chemically tractable therapeutic targets is a significant challenge in the discovery of new medicines. We have developed a novel method that rapidly screens multiple proteins in parallel using DNA-encoded library technology (ELT). Initial efforts were focused on the efficient discovery of antibacterial leads against 119 targets from Acinetobacter baumannii and Staphylococcus aureus. The success of this effort led to the hypothesis that the relative number of ELT binders alone could be used to assess the ligandability of large sets of proteins. This concept was further explored by screening 42 targets from Mycobacterium tuberculosis. Active chemical series for six targets from our initial effort as well as three chemotypes for DHFR from M. tuberculosis are reported. The findings demonstrate that parallel ELT selections can be used to assess ligandability and highlight opportunities for successful lead and tool discovery.

Identification of HIV Mutation as Diagnostic Biomarker through Next Generation Sequencing.

PubMed

Shaw, Wen Hui; Lin, Qianqian; Muhammad, Zikry Zhiwei Bin Roslee; Lee, Jia Jun; Khong, Wei Xin; Ng, Oon Tek; Tan, Eng Lee; Li, Peng

2016-07-01

Current clinical detection of Human immunodeficiency virus 1 (HIV-1) is used to target viral genes and proteins. However, the immunoassay, such as viral culture or Polymerase Chain Reaction (PCR), lacks accuracy in the diagnosis, as these conventional assays rely on the stable genome and HIV-1 is a highly-mutated virus. Next generation sequencing (NGS) promises to be transformative for the practice of infectious disease, and the rapidly reducing cost and processing time mean that this will become a feasible technology in diagnostic and research laboratories in the near future. The technology offers the superior sensitivity to detect the pathogenic viruses, including unknown and unexpected strains. To leverage the NGS technology in order to improve current HIV-1 diagnosis and genotyping methods. Ten blood samples were collected from HIV-1 infected patients which were diagnosed by RT PCR at Singapore Communicable Disease Centre, Tan Tock Seng Hospital from October 2014 to March 2015. Viral RNAs were extracted from blood plasma and reversed into cDNA. The HIV-1 cDNA samples were cleaned up using a PCR purification kit and the sequencing library was prepared and identified through MiSeq. Two common mutations were observed in all ten samples. The common mutations were identified at genome locations 1908 and 2104 as missense and silent mutations respectively, conferring S37N and S3S found on aspartic protease and reverse transcriptase subunits. The common mutations identified in this study were not previously reported, therefore suggesting the potential for them to be used for identification of viral infection, disease transmission and drug resistance. This was especially the case for, missense mutation S37N which could cause an amino acid change in viral proteases thus reducing the binding affinity of some protease inhibitors. Thus, the unique common mutations identified in this study could be used as diagnostic biomarkers to indicate the origin of infection as being from Singapore.

DNA barcoding insect–host plant associations

PubMed Central

Jurado-Rivera, José A.; Vogler, Alfried P.; Reid, Chris A.M.; Petitpierre, Eduard; Gómez-Zurita, Jesús

2008-01-01

Short-sequence fragments (‘DNA barcodes’) used widely for plant identification and inventorying remain to be applied to complex biological problems. Host–herbivore interactions are fundamental to coevolutionary relationships of a large proportion of species on the Earth, but their study is frequently hampered by limited or unreliable host records. Here we demonstrate that DNA barcodes can greatly improve this situation as they (i) provide a secure identification of host plant species and (ii) establish the authenticity of the trophic association. Host plants of leaf beetles (subfamily Chrysomelinae) from Australia were identified using the chloroplast trnL(UAA) intron as barcode amplified from beetle DNA extracts. Sequence similarity and phylogenetic analyses provided precise identifications of each host species at tribal, generic and specific levels, depending on the available database coverage in various plant lineages. The 76 species of Chrysomelinae included—more than 10 per cent of the known Australian fauna—feed on 13 plant families, with preference for Australian radiations of Myrtaceae (eucalypts) and Fabaceae (acacias). Phylogenetic analysis of beetles shows general conservation of host association but with rare host shifts between distant plant lineages, including a few cases where barcodes supported two phylogenetically distant host plants. The study demonstrates that plant barcoding is already feasible with the current publicly available data. By sequencing plant barcodes directly from DNA extractions made from herbivorous beetles, strong physical evidence for the host association is provided. Thus, molecular identification using short DNA fragments brings together the detection of species and the analysis of their interactions. PMID:19004756

Sorting through the chaff, nDNA gene trees for phylogenetic inference and hybrid identification of annual sunflowers (Helianthus sect. Helianthus).

PubMed

Moody, Michael L; Rieseberg, Loren H

2012-07-01

The annual sunflowers (Helianthus sect. Helianthus) present a formidable challenge for phylogenetic inference because of ancient hybrid speciation, recent introgression, and suspected issues with deep coalescence. Here we analyze sequence data from 11 nuclear DNA (nDNA) genes for multiple genotypes of species within the section to (1) reconstruct the phylogeny of this group, (2) explore the utility of nDNA gene trees for detecting hybrid speciation and introgression; and (3) test an empirical method of hybrid identification based on the phylogenetic congruence of nDNA gene trees from tightly linked genes. We uncovered considerable topological heterogeneity among gene trees with or without three previously identified hybrid species included in the analyses, as well as a general lack of reciprocal monophyly of species. Nonetheless, partitioned Bayesian analyses provided strong support for the reciprocal monophyly of all species except H. annuus (0.89 PP), the most widespread and abundant annual sunflower. Previous hypotheses of relationships among taxa were generally strongly supported (1.0 PP), except among taxa typically associated with H. annuus, apparently due to the paraphyly of the latter in all gene trees. While the individual nDNA gene trees provided a useful means for detecting recent hybridization, identification of ancient hybridization was problematic for all ancient hybrid species, even when linkage was considered. We discuss biological factors that affect the efficacy of phylogenetic methods for hybrid identification.

Evaluation of reliability on STR typing at leukemic patients used for forensic purposes.

PubMed

Filoglu, G; Bulbul, O; Rayimoglu, G; Yediay, F E; Zorlu, T; Ongoren, S; Altuncul, H

2014-06-01

Over the past decades, main advances in the field of molecular biology, coupled with benefits in genomic technologies, have led to detailed molecular investigations in the genetic diversity generated by researchers. Short tandem repeat (STR) loci are polymorphic loci found throughout all eukaryotic genome. DNA profiling identification, parental testing and kinship analysis by analysis of STR loci have been widely used in forensic sciences since 1993. Malignant tissues may sometimes be the source of biological material for forensic analysis, including identification of individuals or paternity testing. There are a number of studies on microsatellite instability in different types of tumors by comparing the STR profiles of malignant and healthy tissues on the same individuals. Defects in DNA repair pathways (non-repair or mis-repair) and metabolism lead to an accumulation of microsatellite alterations in genomic DNA of various cancer types that result genomic instabilities on forensic analyses. Common forms of genomic instability are loss of heterozygosity (LOH) and microsatellite instability (MSI). In this study, the applicability of autosomal STR markers, which are routinely used in forensic analysis, were investigated in order to detect genotypes in blood samples collected from leukemic patients to estimate the reliability of the results when malignant tissues are used as a source of forensic individual identification. Specimens were collected from 90 acute and 10 chronic leukemia volunteers with oral swabs as well as their paired peripheral blood samples from the Oncology Centre of the Department of Hematology at Istanbul University, during the years 2010-2011. Specimens were tested and compared with 16 somatic STR loci (CSFIPO, THO1, TPOX, vWA, D2S1338, D3S1358, D5S818, D7S820, D8S1179, D13S317, D16S539, D18S51, D19S433, D21S11 and FGA) widely used in forensic identification and kinship. Only two STR instabilities were encountered among 100 specimens. An MSI in the FGA loci and a LOH in the D2S1338 loci were determined in two individuals separately. Our results demonstrate that the use of the biological samples from leukemia patients in forensic identification and kinship testing is questionable, especially if known microsatellite instability is available. Genetic instabilities may alter the STR polymorphism, leading to potential errors on forensic identification of individuals. Therefore, typing of autosomal STRs from leukemia patients should be performed with both healthy and malignant tissue samples of individual as references.

Interlaboratory comparison of real-time pcr protocols for quantification of general fecal indicator bacteria

USGS Publications Warehouse

Shanks, O.C.; Sivaganesan, M.; Peed, L.; Kelty, C.A.; Blackwood, A.D.; Greene, M.R.; Noble, R.T.; Bushon, R.N.; Stelzer, E.A.; Kinzelman, J.; Anan'Eva, T.; Sinigalliano, C.; Wanless, D.; Griffith, J.; Cao, Y.; Weisberg, S.; Harwood, V.J.; Staley, C.; Oshima, K.H.; Varma, M.; Haugland, R.A.

2012-01-01

The application of quantitative real-time PCR (qPCR) technologies for the rapid identification of fecal bacteria in environmental waters is being considered for use as a national water quality metric in the United States. The transition from research tool to a standardized protocol requires information on the reproducibility and sources of variation associated with qPCR methodology across laboratories. This study examines interlaboratory variability in the measurement of enterococci and Bacteroidales concentrations from standardized, spiked, and environmental sources of DNA using the Entero1a and GenBac3 qPCR methods, respectively. Comparisons are based on data generated from eight different research facilities. Special attention was placed on the influence of the DNA isolation step and effect of simplex and multiplex amplification approaches on interlaboratory variability. Results suggest that a crude lysate is sufficient for DNA isolation unless environmental samples contain substances that can inhibit qPCR amplification. No appreciable difference was observed between simplex and multiplex amplification approaches. Overall, interlaboratory variability levels remained low (<10% coefficient of variation) regardless of qPCR protocol. ?? 2011 American Chemical Society.

An efficient and reliable DNA-based sex identification method for archaeological Pacific salmonid (Oncorhynchus spp.) remains.

PubMed

Royle, Thomas C A; Sakhrani, Dionne; Speller, Camilla F; Butler, Virginia L; Devlin, Robert H; Cannon, Aubrey; Yang, Dongya Y

2018-01-01

Pacific salmonid (Oncorhynchus spp.) remains are routinely recovered from archaeological sites in northwestern North America but typically lack sexually dimorphic features, precluding the sex identification of these remains through morphological approaches. Consequently, little is known about the deep history of the sex-selective salmonid fishing strategies practiced by some of the region's Indigenous peoples. Here, we present a DNA-based method for the sex identification of archaeological Pacific salmonid remains that integrates two PCR assays that each co-amplify fragments of the sexually dimorphic on the Y chromosome (sdY) gene and an internal positive control (Clock1a or D-loop). The first assay co-amplifies a 95 bp fragment of sdY and a 108 bp fragment of the autosomal Clock1a gene, whereas the second assay co-amplifies the same sdY fragment and a 249 bp fragment of the mitochondrial D-loop region. This method's reliability, sensitivity, and efficiency, were evaluated by applying it to 72 modern Pacific salmonids from five species and 75 archaeological remains from six Pacific salmonids. The sex identities assigned to each of the modern samples were concordant with their known phenotypic sex, highlighting the method's reliability. Applications of the method to dilutions of modern DNA samples indicate it can correctly identify the sex of samples with as little as ~39 pg of total genomic DNA. The successful sex identification of 70 of the 75 (93%) archaeological samples further demonstrates the method's sensitivity. The method's reliance on two co-amplifications that preferentially amplify sdY helps validate the sex identities assigned to samples and reduce erroneous identifications caused by allelic dropout and contamination. Furthermore, by sequencing the D-loop fragment used as a positive control, species-level and sex identifications can be simultaneously assigned to samples. Overall, our results indicate the DNA-based method reported in this study is a sensitive and reliable sex identification method for ancient salmonid remains.

Should DNA sequence be incorporated with other taxonomical data for routine identifying of plant species?

PubMed

Suesatpanit, Tanakorn; Osathanunkul, Kitisak; Madesis, Panagiotis; Osathanunkul, Maslin

2017-08-31

A variety of plants in Acanthaceae have long been used in traditional Thai ailment and commercialised with significant economic value. Nowadays medicinal plants are sold in processed forms and thus morphological authentication is almost impossible. Full identification requires comparison of the specimen with some authoritative sources, such as a full and accurate description and verification of the species deposited in herbarium. Intake of wrong herbals can cause adverse effects. Identification of both raw materials and end products is therefore needed. Here, the potential of a DNA-based identification method, called Bar-HRM (DNA barcoding coupled with High Resolution Melting analysis), in raw material species identification is investigated. DNA barcode sequences from five regions (matK, rbcL, trnH-psbA spacer region, trnL and ITS2) of Acanthaceae species were retrieved for in silico analysis. Then the specific primer pairs were used in HRM assay to generate unique melting profiles for each plants species. The method allows identification of samples lacking necessary morphological parts. In silico analyses of all five selected regions suggested that ITS2 is the most suitable marker for Bar-HRM in this study. The HRM analysis on dried samples of 16 Acanthaceae medicinal species was then performed using primer pair derived from ITS2 region. 100% discrimination of the tested samples at both genus and species level was observed. However, two samples documented as Clinacanthus nutans and Clinacanthus siamensis were recognised as the same species from the HRM analysis. Further investigation reveals that C. siamensis is now accepted as C. nutans. The results here proved that Bar-HRM is a promising technique in species identification of the studied medicinal plants in Acanthaceae. In addition, molecular biological data is currently used in plant taxonomy and increasingly popular in recent years. Here, DNA barcode sequence data should be incorporated with morphological characters in the species identification.

Dangers resulting from DNA profiling of biological materials derived from patients after allogeneic hematopoietic stem cell transplantation (allo-HSCT) with regard to forensic genetic analysis.

PubMed

Jacewicz, R; Lewandowski, K; Rupa-Matysek, J; Jędrzejczyk, M; Berent, J

The study documents the risk that comes with DNA analysis of materials derived from patients after allogeneic hematopoietic stem cell transplantation (allo-HSCT) in forensic genetics. DNA chimerism was studied in 30 patients after allo-HSCT, based on techniques applied in contemporary forensic genetics, i.e. real-time PCR and multiplex PCR-STR with the use of autosomal DNA as well as Y-DNA markers. The results revealed that the DNA profile of the recipient's blood was identical with the donor's in the majority of cases. Therefore, blood analysis can lead to false conclusions in personal identification as well as kinship analysis. An investigation of buccal swabs revealed a mixture of DNA in the majority of recipients. Consequently, personal identification on the basis of stain analysis of the same origin may be impossible. The safest (but not ideal) material turned out to be the hair root. Its analysis based on autosomal DNA revealed 100% of the recipient's profile. However, an analysis based on Y-chromosome markers performed in female allo-HSCT recipients with male donors demonstrated the presence of donor DNA in hair cells - similarly to the blood and buccal swabs. In the light of potential risks arising from DNA profiling of biological materials derived from persons after allotransplantation in judicial aspects, certain procedures were proposed to eliminate such dangers. The basic procedures include abandoning the approach based exclusively on blood collection, both for kinship analysis and personal identification; asking persons who are to be tested about their history of allo-HSCT before sample collection and profile entry in the DNA database, and verification of DNA profiling based on hair follicles in uncertain cases.

Short, interspersed, and repetitive DNA sequences in Spiroplasma species.

PubMed

Nur, I; LeBlanc, D J; Tully, J G

1987-03-01

Small fragments of DNA from an 8-kbp plasmid, pRA1, from a plant pathogenic strain of Spiroplasma citri were shown previously to be present in the chromosomal DNA of at least two species of Spiroplasma. We describe here the shot-gun cloning of chromosomal DNA from S. citri Maroc and the identification of two distinct sequences exhibiting homology to pRA1. Further subcloning experiments provided specific molecular probes for the identification of these two sequences in chromosomal DNA from three distinct plant pathogenic species of Spiroplasma. The results of Southern blot hybridization indicated that each of the pRA1-associated sequences is present as multiple copies in short, dispersed, and repetitive sequences in the chromosomes of these three strains. None of the sequences was detectable in chromosomal DNA from an additional nine Spiroplasma strains examined.

qPMS9: An Efficient Algorithm for Quorum Planted Motif Search

NASA Astrophysics Data System (ADS)

Nicolae, Marius; Rajasekaran, Sanguthevar

2015-01-01

Discovering patterns in biological sequences is a crucial problem. For example, the identification of patterns in DNA sequences has resulted in the determination of open reading frames, identification of gene promoter elements, intron/exon splicing sites, and SH RNAs, location of RNA degradation signals, identification of alternative splicing sites, etc. In protein sequences, patterns have led to domain identification, location of protease cleavage sites, identification of signal peptides, protein interactions, determination of protein degradation elements, identification of protein trafficking elements, discovery of short functional motifs, etc. In this paper we focus on the identification of an important class of patterns, namely, motifs. We study the (l, d) motif search problem or Planted Motif Search (PMS). PMS receives as input n strings and two integers l and d. It returns all sequences M of length l that occur in each input string, where each occurrence differs from M in at most d positions. Another formulation is quorum PMS (qPMS), where the motif appears in at least q% of the strings. We introduce qPMS9, a parallel exact qPMS algorithm that offers significant runtime improvements on DNA and protein datasets. qPMS9 solves the challenging DNA (l, d)-instances (28, 12) and (30, 13). The source code is available at https://code.google.com/p/qpms9/.

Forensic dentistry in human identification: A review of the literature

PubMed Central

Ata-Ali, Fadi

2014-01-01

An update is provided of the literature on the role of odontology in human identification, based on a PubMed-Medline search of the last 5 years and using the terms: “forensic dentistry” (n = 464 articles), “forensic odontology” (n = 141 articles) and “forensic dentistry identification” (n = 169 articles). Apart from these initial 774 articles, others considered to be important and which were generated by a manual search and cited as references in review articles were also included. Forensic dentistry requires interdisciplinary knowledge, since the data obtained from the oral cavity can contribute to identify an individual or provide information needed in a legal process. Furthermore, the data obtained from the oral cavity can narrow the search range of an individual and play a key role in the victim identification process following mass disasters or catastrophes. This literature search covering the last 5 years describes the novelties referred to buccodental studies in comparative identification, buccodental evaluation in reconstructive identification, human bites as a method for identifying the aggressor, and the role of DNA in dental identification. The oral cavity is a rich and noninvasive source of DNA, and can be used to solve problems of a social, economic or legal nature. Key words:Forensic identification, DNA, forensic dentistry, rugoscopy, cheiloscopy, saliva. PMID:24790717

Interspecific Introgression in Cetaceans: DNA Markers Reveal Post-F1 Status of a Pilot Whale

PubMed Central

Miralles, Laura; Lens, Santiago; Rodríguez-Folgar, Antonio; Carrillo, Manuel; Martín, Vidal; Mikkelsen, Bjarni; Garcia-Vazquez, Eva

2013-01-01

Visual species identification of cetacean strandings is difficult, especially when dead specimens are degraded and/or species are morphologically similar. The two recognised pilot whale species (Globicephala melas and Globicephala macrorhynchus) are sympatric in the North Atlantic Ocean. These species are very similar in external appearance and their morphometric characteristics partially overlap; thus visual identification is not always reliable. Genetic species identification ensures correct identification of specimens. Here we have employed one mitochondrial (D-Loop region) and eight nuclear loci (microsatellites) as genetic markers to identify six stranded pilot whales found in Galicia (Northwest Spain), one of them of ambiguous phenotype. DNA analyses yielded positive amplification of all loci and enabled species identification. Nuclear microsatellite DNA genotypes revealed mixed ancestry for one individual, identified as a post-F1 interspecific hybrid employing two different Bayesian methods. From the mitochondrial sequence the maternal species was Globicephala melas. This is the first hybrid documented between Globicephala melas and G. macrorhynchus, and the first post-F1 hybrid genetically identified between cetaceans, revealing interspecific genetic introgression in marine mammals. We propose to add nuclear loci to genetic databases for cetacean species identification in order to detect hybrid individuals. PMID:23990883

The significance of gtf genes in caries expression: a rapid identification of Streptococcus mutans from dental plaque of child patients.

PubMed

Mishra, Apurva; Pandey, Ramesh K; Manickam, Natesan

2015-01-01

Rapid phylogenetic and functional gene (gtfB) identification of S. mutans from the dental plaque derived from children. Dental plaque collected from fifteen patients of age group 7-12 underwent centrifugation followed by genomic DNA extraction for S. mutans. Genomic DNA was processed with S. mutans specific primers in suitable PCR condtions for phylogenetic and functional gene (gtfB) identification. The yield and results were confirmed by agarose gel electrophoresis. 1% agarose gel electrophoresis depicts the positive PCR amplification at 1,485 bp when compared with standard 1 kbp indicating the presence of S. mutans in the test sample. Another PCR reaction was set using gtfB primers specific for S. mutans for functional gene identification. 1.2% agarose gel electrophoresis was done and a positive amplication was observed at 192 bp when compared to 100 bp standards. With the advancement in molecular biology techniques, PCR based identification and quantification of the bacterial load can be done within hours using species-specific primers and DNA probes. Thus, this technique may reduce the laboratory time spend in conventional culture methods, reduces the possibility of colony identification errors and is more sensitive to culture techniques.

[Molecular identification and detection of moon jellyfish (Aurelia sp.) based on partial sequencing of mitochondrial 16S rDNA and COI].

PubMed

Wang, Jian-Yan; Zhen, Yu; Wang, Guo-shan; Mi, Tie-Zhu; Yu, Zhi-gang

2013-03-01

Taking the moon jellyfish Aurelia sp. commonly found in our coastal sea areas as test object, its genome DNA was extracted, the partial sequences of mt-16S rDNA (650 bp) and mt-COI (709 bp) were PCR-amplified, and, after purification, cloning, and sequencing, the sequences obtained were BLASTn-analyzed. The sequences of greater difference with those of the other jellyfish were chosen, and eight specific primers for the mt-16S rDNA and mt-COI of Aurelia sp. were designed, respectively. The specificity test indicated that the primer AS3 for the mt-16S rDNA and the primer AC3 for the mt-COI were excellent in rapidly detecting the target jellyfish from Rhopilema esculentum, Nemopilema nomurai, Cyanea nozakii, Acromitus sp., and Aurelia sp., and thus, the techniques for the molecular identification and detection of moon jellyfish were preliminarily established, which could get rid of the limitations in classical morphological identification of Aurelia sp. , being able to find the Aurelia sp. in the samples more quickly and accurately.

Integrative taxonomy detects cryptic and overlooked fish species in a neotropical river basin.

PubMed

Gomes, Laís Carvalho; Pessali, Tiago Casarim; Sales, Naiara Guimarães; Pompeu, Paulo Santos; Carvalho, Daniel Cardoso

2015-10-01

The great freshwater fish diversity found in the neotropical region makes management and conservation actions challenging. Due to shortage of taxonomists and insufficient infrastructure to deal with such great biodiversity (i.e. taxonomic impediment), proposed remedies to accelerate species identification and descriptions include techniques that combine DNA-based identification and concise morphological description. The building of a DNA barcode reference database correlating meristic and genetic data was developed for 75 % of the Mucuri River basin's freshwater fish. We obtained a total of 141 DNA barcode sequences from 37 species belonging to 30 genera, 19 families, and 5 orders. Genetic distances within species, genera, and families were 0.74, 9.5, and 18.86 %, respectively. All species could be clearly identified by the DNA barcodes. Divergences between meristic morphological characteristics and DNA barcodes revealed two cryptic species among the Cyphocharax gilbert and Astyanax gr. bimaculatus specimens, and helped to identify two overlooked species within the Gymnotus and Astyanax taxa. Therefore, using a simplified model of neotropical biodiversity, we tested the efficiency of an integrative taxonomy approach for species discovery, identification of cryptic diversity, and accelerating biodiversity descriptions.

Attomole-level Genomics with Single-molecule Direct DNA, cDNA and RNA Sequencing Technologies.

PubMed

Ozsolak, Fatih

2016-01-01

With the introduction of next-generation sequencing (NGS) technologies in 2005, the domination of microarrays in genomics quickly came to an end due to NGS's superior technical performance and cost advantages. By enabling genetic analysis capabilities that were not possible previously, NGS technologies have started to play an integral role in all areas of biomedical research. This chapter outlines the low-quantity DNA and cDNA sequencing capabilities and applications developed with the Helicos single molecule DNA sequencing technology.

Combining multiple ChIP-seq peak detection systems using combinatorial fusion.

PubMed

Schweikert, Christina; Brown, Stuart; Tang, Zuojian; Smith, Phillip R; Hsu, D Frank

2012-01-01

Due to the recent rapid development in ChIP-seq technologies, which uses high-throughput next-generation DNA sequencing to identify the targets of Chromatin Immunoprecipitation, there is an increasing amount of sequencing data being generated that provides us with greater opportunity to analyze genome-wide protein-DNA interactions. In particular, we are interested in evaluating and enhancing computational and statistical techniques for locating protein binding sites. Many peak detection systems have been developed; in this study, we utilize the following six: CisGenome, MACS, PeakSeq, QuEST, SISSRs, and TRLocator. We define two methods to merge and rescore the regions of two peak detection systems and analyze the performance based on average precision and coverage of transcription start sites. The results indicate that ChIP-seq peak detection can be improved by fusion using score or rank combination. Our method of combination and fusion analysis would provide a means for generic assessment of available technologies and systems and assist researchers in choosing an appropriate system (or fusion method) for analyzing ChIP-seq data. This analysis offers an alternate approach for increasing true positive rates, while decreasing false positive rates and hence improving the ChIP-seq peak identification process.

Molecular Mapping of Restriction-Site Associated DNA Markers In Allotetraploid Upland Cotton.

PubMed

Wang, Yangkun; Ning, Zhiyuan; Hu, Yan; Chen, Jiedan; Zhao, Rui; Chen, Hong; Ai, Nijiang; Guo, Wangzhen; Zhang, Tianzhen

2015-01-01

Upland cotton (Gossypium hirsutum L., 2n = 52, AADD) is an allotetraploid, therefore the discovery of single nucleotide polymorphism (SNP) markers is difficult. The recent emergence of genome complexity reduction technologies based on the next-generation sequencing (NGS) platform has greatly expedited SNP discovery in crops with highly repetitive and complex genomes. Here we applied restriction-site associated DNA (RAD) sequencing technology for de novo SNP discovery in allotetraploid cotton. We identified 21,109 SNPs between the two parents and used these for genotyping of 161 recombinant inbred lines (RILs). Finally, a high dense linkage map comprising 4,153 loci over 3500-cM was developed based on the previous result. Using this map quantitative trait locus (QTLs) conferring fiber strength and Verticillium Wilt (VW) resistance were mapped to a more accurate region in comparison to the 1576-cM interval determined using the simple sequence repeat (SSR) genetic map. This suggests that the newly constructed map has more power and resolution than the previous SSR map. It will pave the way for the rapid identification of the marker-assisted selection in cotton breeding and cloning of QTL of interest traits.

28 CFR 28.13 - Analysis and indexing of DNA samples.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 28 Judicial Administration 1 2011-07-01 2011-07-01 false Analysis and indexing of DNA samples. 28.13 Section 28.13 Judicial Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM DNA Sample Collection, Analysis, and Indexing § 28.13 Analysis and indexing of DNA samples. (a) The Federal Bureau of...

28 CFR 28.13 - Analysis and indexing of DNA samples.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Analysis and indexing of DNA samples. 28.13 Section 28.13 Judicial Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM DNA Sample Collection, Analysis, and Indexing § 28.13 Analysis and indexing of DNA samples. (a) The Federal Bureau of...

28 CFR 28.13 - Analysis and indexing of DNA samples.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 28 Judicial Administration 1 2012-07-01 2012-07-01 false Analysis and indexing of DNA samples. 28.13 Section 28.13 Judicial Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM DNA Sample Collection, Analysis, and Indexing § 28.13 Analysis and indexing of DNA samples. (a) The Federal Bureau of...

28 CFR 28.13 - Analysis and indexing of DNA samples.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 28 Judicial Administration 1 2014-07-01 2014-07-01 false Analysis and indexing of DNA samples. 28.13 Section 28.13 Judicial Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM DNA Sample Collection, Analysis, and Indexing § 28.13 Analysis and indexing of DNA samples. (a) The Federal Bureau of...

28 CFR 28.13 - Analysis and indexing of DNA samples.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 28 Judicial Administration 1 2013-07-01 2013-07-01 false Analysis and indexing of DNA samples. 28.13 Section 28.13 Judicial Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM DNA Sample Collection, Analysis, and Indexing § 28.13 Analysis and indexing of DNA samples. (a) The Federal Bureau of...

Criminal genomic pragmatism: prisoners' representations of DNA technology and biosecurity.

PubMed

Machado, Helena; Silva, Susana

2012-01-01

Within the context of the use of DNA technology in crime investigation, biosecurity is perceived by different stakeholders according to their particular rationalities and interests. Very little is known about prisoners' perceptions and assessments of the uses of DNA technology in solving crime. To propose a conceptual model that serves to analyse and interpret prisoners' representations of DNA technology and biosecurity. A qualitative study using an interpretative approach based on 31 semi-structured tape-recorded interviews was carried out between May and September 2009, involving male inmates in three prisons located in the north of Portugal. The content analysis focused on the following topics: the meanings attributed to DNA and assessments of the risks and benefits of the uses of DNA technology and databasing in forensic applications. DNA was described as a record of identity, an exceptional material, and a powerful biometric identifier. The interviewees believed that DNA can be planted to incriminate suspects. Convicted offenders argued for the need to extend the criteria for the inclusion of DNA profiles in forensic databases and to restrict the removal of profiles. The conceptual model entitled criminal genomic pragmatism allows for an understanding of the views of prison inmates regarding DNA technology and biosecurity.

Comprehensive proteomic analysis of bovine spermatozoa of varying fertility rates and identification of biomarkers associated with fertility.

PubMed

Peddinti, Divyaswetha; Nanduri, Bindu; Kaya, Abdullah; Feugang, Jean M; Burgess, Shane C; Memili, Erdogan

2008-02-22

Male infertility is a major problem for mammalian reproduction. However, molecular details including the underlying mechanisms of male fertility are still not known. A thorough understanding of these mechanisms is essential for obtaining consistently high reproductive efficiency and to ensure lower cost and time-loss by breeder. Using high and low fertility bull spermatozoa, here we employed differential detergent fractionation multidimensional protein identification technology (DDF-Mud PIT) and identified 125 putative biomarkers of fertility. We next used quantitative Systems Biology modeling and canonical protein interaction pathways and networks to show that high fertility spermatozoa differ from low fertility spermatozoa in four main ways. Compared to sperm from low fertility bulls, sperm from high fertility bulls have higher expression of proteins involved in: energy metabolism, cell communication, spermatogenesis, and cell motility. Our data also suggests a hypothesis that low fertility sperm DNA integrity may be compromised because cell cycle: G2/M DNA damage checkpoint regulation was most significant signaling pathway identified in low fertility spermatozoa. This is the first comprehensive description of the bovine spermatozoa proteome. Comparative proteomic analysis of high fertility and low fertility bulls, in the context of protein interaction networks identified putative molecular markers associated with high fertility phenotype.

Molecular tests potentially improving HPV screening and genotyping for cervical cancer prevention

PubMed Central

Gradíssimo, Ana

2018-01-01

INTRODUCTION Human papillomavirus (HPV)-related cancers can be averted by type-specific vaccination (primary prevention) and/or through detection and ablation of precancerous cervical lesions (secondary prevention). This review presents current challenges to cervical cancer screening programs, focusing on recent molecular advances in HPV testing and potential improvements on risk stratification. AREAS COVERED High-risk (HR)-HPV DNA detection has been progressively incorporated into cervix cancer prevention programs based on its increased sensitivity. Advances in next-generation sequencing (NGS) are being rapidly applied to HPV typing. However, current HPV DNA tests lack specificity for identification of cervical precancer (CIN3). HPV typing methods were reviewed based on published literature, with a focus on these applications for screening and risk stratification in the emerging complex clinical scenario post-vaccine introduction. In addition, the potential for NGS technologies to increase specificity is discussed in regards to reflex testing of specimens for emerging biomarkers for cervix precancer/cancer. EXPERT COMMENTARY Integrative multi-disciplinary molecular tests accurately triaging exfoliated cervical specimens will improve cervical cancer prevention programs while simplifying healthcare procedures in HPV-infected women. Hence, the concept of a “liquid-biopsy” (i.e., “molecular” Pap test) highly specific for early identification of cervical precancerous lesions is of critical importance in the years to come. PMID:28277144

Comprehensive proteomic analysis of bovine spermatozoa of varying fertility rates and identification of biomarkers associated with fertility

PubMed Central

Peddinti, Divyaswetha; Nanduri, Bindu; Kaya, Abdullah; Feugang, Jean M; Burgess, Shane C; Memili, Erdogan

2008-01-01

Background Male infertility is a major problem for mammalian reproduction. However, molecular details including the underlying mechanisms of male fertility are still not known. A thorough understanding of these mechanisms is essential for obtaining consistently high reproductive efficiency and to ensure lower cost and time-loss by breeder. Results Using high and low fertility bull spermatozoa, here we employed differential detergent fractionation multidimensional protein identification technology (DDF-Mud PIT) and identified 125 putative biomarkers of fertility. We next used quantitative Systems Biology modeling and canonical protein interaction pathways and networks to show that high fertility spermatozoa differ from low fertility spermatozoa in four main ways. Compared to sperm from low fertility bulls, sperm from high fertility bulls have higher expression of proteins involved in: energy metabolism, cell communication, spermatogenesis, and cell motility. Our data also suggests a hypothesis that low fertility sperm DNA integrity may be compromised because cell cycle: G2/M DNA damage checkpoint regulation was most significant signaling pathway identified in low fertility spermatozoa. Conclusion This is the first comprehensive description of the bovine spermatozoa proteome. Comparative proteomic analysis of high fertility and low fertility bulls, in the context of protein interaction networks identified putative molecular markers associated with high fertility phenotype. PMID:18294385

A Mismatch EndoNuclease Array-Based Methodology (MENA) for Identifying Known SNPs or Novel Point Mutations.

PubMed

Comeron, Josep M; Reed, Jordan; Christie, Matthew; Jacobs, Julia S; Dierdorff, Jason; Eberl, Daniel F; Manak, J Robert

2016-04-05

Accurate and rapid identification or confirmation of single nucleotide polymorphisms (SNPs), point mutations and other human genomic variation facilitates understanding the genetic basis of disease. We have developed a new methodology (called MENA (Mismatch EndoNuclease Array)) pairing DNA mismatch endonuclease enzymology with tiling microarray hybridization in order to genotype both known point mutations (such as SNPs) as well as identify previously undiscovered point mutations and small indels. We show that our assay can rapidly genotype known SNPs in a human genomic DNA sample with 99% accuracy, in addition to identifying novel point mutations and small indels with a false discovery rate as low as 10%. Our technology provides a platform for a variety of applications, including: (1) genotyping known SNPs as well as confirming newly discovered SNPs from whole genome sequencing analyses; (2) identifying novel point mutations and indels in any genomic region from any organism for which genome sequence information is available; and (3) screening panels of genes associated with particular diseases and disorders in patient samples to identify causative mutations. As a proof of principle for using MENA to discover novel mutations, we report identification of a novel allele of the beethoven (btv) gene in Drosophila, which encodes a ciliary cytoplasmic dynein motor protein important for auditory mechanosensation.

Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

PubMed

Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

2017-07-19

Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

Coval: Improving Alignment Quality and Variant Calling Accuracy for Next-Generation Sequencing Data

PubMed Central

Kosugi, Shunichi; Natsume, Satoshi; Yoshida, Kentaro; MacLean, Daniel; Cano, Liliana; Kamoun, Sophien; Terauchi, Ryohei

2013-01-01

Accurate identification of DNA polymorphisms using next-generation sequencing technology is challenging because of a high rate of sequencing error and incorrect mapping of reads to reference genomes. Currently available short read aligners and DNA variant callers suffer from these problems. We developed the Coval software to improve the quality of short read alignments. Coval is designed to minimize the incidence of spurious alignment of short reads, by filtering mismatched reads that remained in alignments after local realignment and error correction of mismatched reads. The error correction is executed based on the base quality and allele frequency at the non-reference positions for an individual or pooled sample. We demonstrated the utility of Coval by applying it to simulated genomes and experimentally obtained short-read data of rice, nematode, and mouse. Moreover, we found an unexpectedly large number of incorrectly mapped reads in ‘targeted’ alignments, where the whole genome sequencing reads had been aligned to a local genomic segment, and showed that Coval effectively eliminated such spurious alignments. We conclude that Coval significantly improves the quality of short-read sequence alignments, thereby increasing the calling accuracy of currently available tools for SNP and indel identification. Coval is available at http://sourceforge.net/projects/coval105/. PMID:24116042

Estimation and quantification of human DNA in dental calculus: A pilot study.

PubMed

Singh, Udita; Goel, Saurabh

2017-01-01

Identification using DNA has proved its accuracy multiple times in the field of forensic investigations. Investigators usually rely on either teeth or bone as the DNA reservoirs. However, there are instances where the skeletal or dental remains are not available or not preserved properly. Moreover, due to religious beliefs, the family members of the dead do not allow the investigating team to damage the remains for the sole purpose of identification. To investigate the presence of human DNA in dental calculus and to quantify the amount, if present. This prospective single-blinded pilot study included twenty subjects selected from the patients visiting a dental college. The samples of dental calculus were collected from the thickest portion of calculus deposited on the lingual surfaces of mandibular incisors. These samples were decontaminated and subjected to gel electrophoresis for DNA extraction. DNA was found in 85% cases. The amount of DNA varied from 21 to 37 μg/ml of dental calculus. Dental calculus is a rich reservoir of human DNA.

Diagnosis of clinical samples spotted on FTA cards using PCR-based methods.

PubMed

Jamjoom, Manal; Sultan, Amal H

2009-04-01

The broad clinical presentation of Leishmaniasis makes the diagnosis of current and past cases of this disease rather difficult. Differential diagnosis is important because diseases caused by other aetiologies and a clinical spectrum similar to that of leishmaniasis (e.g. leprosy, skin cancers and tuberculosis for CL; malaria and schistosomiasis for VL) are often present in endemic areas of endemicity. Presently, a variety of methods have been developed and tested to aid the identification and diagnosis of Leishmania. The advent of the PCR technology has opened new channels for the diagnosis of leishmaniasis in a variety of clinical materials. PCR is a simple, rapid procedure that has been adapted for diagnosis of leishmaniasis. A range of tools is currently available for the diagnosis and identification of leishmaniasis and Leishmania species, respectively. However, none of these diagnostic tools are examined and tested using samples spotted on FTA cards. Three different PCR-based approaches were examined including: kDNA minicircle, Leishmania 18S rRNA gene and PCR-RFLP of Intergenic region of ribosomal protein. PCR primers were designed that sit within the coding sequences of genes (relatively well conserved) but which amplify across the intervening intergenic sequence (relatively variable). These were used in PCR-RFLP on reference isolates of 10 of the most important Leishmania species: L. donovani, L. infantum, L. major & L. tropica. Digestion of PCR products with restriction enzymes produced species-specific restriction patterns allowed discrimination of reference isolates. The kDNA minicircle primers are highly sensitive in diagnosis of both bone marrow and skin smears from FTA cards. Leishmania 18S rRNA gene conserved region is sensitive in identification of bone marrow smear but less sensitive in diagnosing skin smears. The intergenic nested PCR-RFLP using P5 & P6 as well as P1 & P2 newly designed primers showed high level of reproducibility and sensitivity. Though, it was less sensitive than kDNA minicircle primers, but easily discriminated between Leishmania species.

Characterization of a novel Lactobacillus species closely related to Lactobacillus johnsonii using a combination of molecular and comparative genomics methods

PubMed Central

2010-01-01

Background Comparative genomic hybridization (CGH) constitutes a powerful tool for identification and characterization of bacterial strains. In this study we have applied this technique for the characterization of a number of Lactobacillus strains isolated from the intestinal content of rats fed with a diet supplemented with sorbitol. Results Phylogenetic analysis based on 16S rRNA gene, recA, pheS, pyrG and tuf sequences identified five bacterial strains isolated from the intestinal content of rats as belonging to the recently described Lactobacillus taiwanensis species. DNA-DNA hybridization experiments confirmed that these five strains are distinct but closely related to Lactobacillus johnsonii and Lactobacillus gasseri. A whole genome DNA microarray designed for the probiotic L. johnsonii strain NCC533 was used for CGH analysis of L. johnsonii ATCC 33200T, L. johnsonii BL261, L. gasseri ATCC 33323T and L. taiwanensis BL263. In these experiments, the fluorescence ratio distributions obtained with L. taiwanensis and L. gasseri showed characteristic inter-species profiles. The percentage of conserved L. johnsonii NCC533 genes was about 83% in the L. johnsonii strains comparisons and decreased to 51% and 47% for L. taiwanensis and L. gasseri, respectively. These results confirmed the separate status of L. taiwanensis from L. johnsonii at the level of species, and also that L. taiwanensis is closer to L. johnsonii than L. gasseri is to L. johnsonii. Conclusion Conventional taxonomic analyses and microarray-based CGH analysis have been used for the identification and characterization of the newly species L. taiwanensis. The microarray-based CGH technology has been shown as a remarkable tool for the identification and fine discrimination between phylogenetically close species, and additionally provided insight into the adaptation of the strain L. taiwanensis BL263 to its ecological niche. PMID:20849602

Charging YOYO-1 on Capillary Wall for Online DNA Intercalation and Integrating This Approach with Multiplex PCR and Bare Narrow Capillary–Hydrodynamic Chromatography for Online DNA Analysis

PubMed Central

2016-01-01

Multiplex polymerase chain reaction (PCR) has been widely utilized for high-throughput pathogen identification. Often, a dye is used to intercalate the amplified DNA fragments, and identifications of the pathogens are carried out by DNA melting curve analysis or gel electrophoresis. Integrating DNA amplification and identification is a logic path toward maximizing the benefit of multiplex PCR. Although PCR and gel electrophoresis have been integrated, replenishing the gels after each run is tedious and time-consuming. In this technical note, we develop an approach to address this issue. We perform multiplex PCR inside a capillary, transfer the amplified fragments to a bare narrow capillary, and measure their lengths online using bare narrow capillary–hydrodynamic chromatography (BaNC-HDC), a new technique recently developed in our laboratory for free-solution DNA separation. To intercalate the DNA with YOYO-1 (a fluorescent dye) for BaNC-HDC, we flush the capillary column with a YOYO-1 solution; positively charged YOYO-1 is adsorbed (or charged) onto the negatively charged capillary wall. As DNA molecules are driven down the column for separation, they react with the YOYO-1 stored on the capillary wall and are online-intercalated with the dye. With a single YOYO-1 charging, the column can be used for more than 40 runs, although the fluorescence signal intensities of the DNA peaks decrease gradually. Although the dye-DNA intercalation occurs during the separation, it does not affect the retention times, separation efficiencies, or resolutions. PMID:25555111

Digging up the recent Spanish memory: genetic identification of human remains from mass graves of the Spanish Civil War and posterior dictatorship.

PubMed

Baeta, Miriam; Núñez, Carolina; Cardoso, Sergio; Palencia-Madrid, Leire; Herrasti, Lourdes; Etxeberria, Francisco; de Pancorbo, Marian M

2015-11-01

The Spanish Civil War (1936-1939) and posterior dictatorship (until 1970s) stands as one of the major conflicts in the recent history of Spain. It led to nearly two hundred thousand men and women executed or murdered extra-judicially or after dubious legal procedures. Nowadays, most of them remain unidentified or even buried in irretraceable mass graves across Spain. Here, we present the genetic identification of human remains found in 26 mass graves located in Northern Spain. A total of 252 post-mortem remains were analyzed and compared to 186 relatives, allowing the identification of 87 victims. Overall, a significant success of DNA profiling was reached, since informative profiles (≥ 12 STRs and/or mitochondrial DNA profile) were obtained in 85.71% of the remains. This high performance in DNA profiling from challenging samples demonstrated the efficacy of DNA extraction and amplification methods used herein, given that only around 14.29% of the samples did not provide an informative genetic profile for the analysis performed, probably due to the presence of degraded and/or limited DNA in these remains. However, this study shows a partial identification success rate, which is clearly a consequence of the lack of both appropriate family members for genetic comparisons and accurate information about the victims' location. Hence, further perseverance in the exhumation of other intact graves as well as in the search of more alleged relatives is crucial in order to facilitate and increase the number of genetic identifications. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

A Guide to Computational Tools and Design Strategies for Genome Editing Experiments in Zebrafish Using CRISPR/Cas9.

PubMed

Prykhozhij, Sergey V; Rajan, Vinothkumar; Berman, Jason N

2016-02-01

The development of clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology for mainstream biotechnological use based on its discovery as an adaptive immune mechanism in bacteria has dramatically improved the ability of molecular biologists to modify genomes of model organisms. The zebrafish is highly amenable to applications of CRISPR/Cas9 for mutation generation and a variety of DNA insertions. Cas9 protein in complex with a guide RNA molecule recognizes where to cut the homologous DNA based on a short stretch of DNA termed the protospacer-adjacent motif (PAM). Rapid and efficient identification of target sites immediately preceding PAM sites, quantification of genomic occurrences of similar (off target) sites and predictions of cutting efficiency are some of the features where computational tools play critical roles in CRISPR/Cas9 applications. Given the rapid advent and development of this technology, it can be a challenge for researchers to remain up to date with all of the important technological developments in this field. We have contributed to the armamentarium of CRISPR/Cas9 bioinformatics tools and trained other researchers in the use of appropriate computational programs to develop suitable experimental strategies. Here we provide an in-depth guide on how to use CRISPR/Cas9 and other relevant computational tools at each step of a host of genome editing experimental strategies. We also provide detailed conceptual outlines of the steps involved in the design and execution of CRISPR/Cas9-based experimental strategies, such as generation of frameshift mutations, larger chromosomal deletions and inversions, homology-independent insertion of gene cassettes and homology-based knock-in of defined point mutations and larger gene constructs.

How effective are DNA barcodes in the identification of African rainforest trees?

PubMed

Parmentier, Ingrid; Duminil, Jérôme; Kuzmina, Maria; Philippe, Morgane; Thomas, Duncan W; Kenfack, David; Chuyong, George B; Cruaud, Corinne; Hardy, Olivier J

2013-01-01

DNA barcoding of rain forest trees could potentially help biologists identify species and discover new ones. However, DNA barcodes cannot always distinguish between closely related species, and the size and completeness of barcode databases are key parameters for their successful application. We test the ability of rbcL, matK and trnH-psbA plastid DNA markers to identify rain forest trees at two sites in Atlantic central Africa under the assumption that a database is exhaustive in terms of species content, but not necessarily in terms of haplotype diversity within species. We assess the accuracy of identification to species or genus using a genetic distance matrix between samples either based on a global multiple sequence alignment (GD) or on a basic local alignment search tool (BLAST). Where a local database is available (within a 50 ha plot), barcoding was generally reliable for genus identification (95-100% success), but less for species identification (71-88%). Using a single marker, best results for species identification were obtained with trnH-psbA. There was a significant decrease of barcoding success in species-rich clades. When the local database was used to identify the genus of trees from another region and did include all genera from the query individuals but not all species, genus identification success decreased to 84-90%. The GD method performed best but a global multiple sequence alignment is not applicable on trnH-psbA. Barcoding is a useful tool to assign unidentified African rain forest trees to a genus, but identification to a species is less reliable, especially in species-rich clades, even using an exhaustive local database. Combining two markers improves the accuracy of species identification but it would only marginally improve genus identification. Finally, we highlight some limitations of the BLAST algorithm as currently implemented and suggest possible improvements for barcoding applications.

How Effective Are DNA Barcodes in the Identification of African Rainforest Trees?

PubMed Central

Parmentier, Ingrid; Duminil, Jérôme; Kuzmina, Maria; Philippe, Morgane; Thomas, Duncan W.; Kenfack, David; Chuyong, George B.; Cruaud, Corinne; Hardy, Olivier J.

2013-01-01

Background DNA barcoding of rain forest trees could potentially help biologists identify species and discover new ones. However, DNA barcodes cannot always distinguish between closely related species, and the size and completeness of barcode databases are key parameters for their successful application. We test the ability of rbcL, matK and trnH-psbA plastid DNA markers to identify rain forest trees at two sites in Atlantic central Africa under the assumption that a database is exhaustive in terms of species content, but not necessarily in terms of haplotype diversity within species. Methodology/Principal Findings We assess the accuracy of identification to species or genus using a genetic distance matrix between samples either based on a global multiple sequence alignment (GD) or on a basic local alignment search tool (BLAST). Where a local database is available (within a 50 ha plot), barcoding was generally reliable for genus identification (95–100% success), but less for species identification (71–88%). Using a single marker, best results for species identification were obtained with trnH-psbA. There was a significant decrease of barcoding success in species-rich clades. When the local database was used to identify the genus of trees from another region and did include all genera from the query individuals but not all species, genus identification success decreased to 84–90%. The GD method performed best but a global multiple sequence alignment is not applicable on trnH-psbA. Conclusions/Significance Barcoding is a useful tool to assign unidentified African rain forest trees to a genus, but identification to a species is less reliable, especially in species-rich clades, even using an exhaustive local database. Combining two markers improves the accuracy of species identification but it would only marginally improve genus identification. Finally, we highlight some limitations of the BLAST algorithm as currently implemented and suggest possible improvements for barcoding applications. PMID:23565134

Multimodal biometric digital watermarking on immigrant visas for homeland security

NASA Astrophysics Data System (ADS)

Sasi, Sreela; Tamhane, Kirti C.; Rajappa, Mahesh B.

2004-08-01

Passengers with immigrant Visa's are a major concern to the International Airports due to the various fraud operations identified. To curb tampering of genuine Visa, the Visa's should contain human identification information. Biometric characteristic is a common and reliable way to authenticate the identity of an individual [1]. A Multimodal Biometric Human Identification System (MBHIS) that integrates iris code, DNA fingerprint, and the passport number on the Visa photograph using digital watermarking scheme is presented. Digital Watermarking technique is well suited for any system requiring high security [2]. Ophthalmologists [3], [4], [5] suggested that iris scan is an accurate and nonintrusive optical fingerprint. DNA sequence can be used as a genetic barcode [6], [7]. While issuing Visa at the US consulates, the DNA sequence isolated from saliva, the iris code and passport number shall be digitally watermarked in the Visa photograph. This information is also recorded in the 'immigrant database'. A 'forward watermarking phase' combines a 2-D DWT transformed digital photograph with the personal identification information. A 'detection phase' extracts the watermarked information from this VISA photograph at the port of entry, from which iris code can be used for identification and DNA biometric for authentication, if an anomaly arises.

IDENTIFICATION OF CHICKEN-SPECIFIC FECAL MICROBIAL SEQUENCES USING A METAGENOMIC APPROACH

EPA Science Inventory

In this study, we applied a genome fragment enrichment (GFE) method to select for genomic regions that differ between different fecal metagenomes. Competitive DNA hybridizations were performed between chicken fecal DNA and pig fecal DNA (C-P) and between chicken fecal DNA and an ...

Identification and removal of low-complexity sites in allele-specific analysis of ChIP-seq data.

PubMed

Waszak, Sebastian M; Kilpinen, Helena; Gschwind, Andreas R; Orioli, Andrea; Raghav, Sunil K; Witwicki, Robert M; Migliavacca, Eugenia; Yurovsky, Alisa; Lappalainen, Tuuli; Hernandez, Nouria; Reymond, Alexandre; Dermitzakis, Emmanouil T; Deplancke, Bart

2014-01-15

High-throughput sequencing technologies enable the genome-wide analysis of the impact of genetic variation on molecular phenotypes at unprecedented resolution. However, although powerful, these technologies can also introduce unexpected artifacts. We investigated the impact of library amplification bias on the identification of allele-specific (AS) molecular events from high-throughput sequencing data derived from chromatin immunoprecipitation assays (ChIP-seq). Putative AS DNA binding activity for RNA polymerase II was determined using ChIP-seq data derived from lymphoblastoid cell lines of two parent-daughter trios. We found that, at high-sequencing depth, many significant AS binding sites suffered from an amplification bias, as evidenced by a larger number of clonal reads representing one of the two alleles. To alleviate this bias, we devised an amplification bias detection strategy, which filters out sites with low read complexity and sites featuring a significant excess of clonal reads. This method will be useful for AS analyses involving ChIP-seq and other functional sequencing assays. The R package abs filter for library clonality simulations and detection of amplification-biased sites is available from http://updepla1srv1.epfl.ch/waszaks/absfilter

Identification and functional validation of HPV-mediated hypermethylation in head and neck squamous cell carcinoma

PubMed Central

2013-01-01

Background Human papillomavirus-positive (HPV+) head and neck squamous cell carcinoma (HNSCC) represents a distinct clinical and epidemiological condition compared with HPV-negative (HPV-) HNSCC. To test the possible involvement of epigenetic modulation by HPV in HNSCC, we conducted a genome-wide DNA-methylation analysis. Methods Using laser-capture microdissection of 42 formalin-fixed paraffin wax-embedded (FFPE) HNSCCs, we generated DNA-methylation profiles of 18 HPV+ and 14 HPV- samples, using Infinium 450 k BeadArray technology. Methylation data were validated in two sets of independent HPV+/HPV- HNSCC samples (fresh-frozen samples and cell lines) using two independent methods (Infinium 450 k and whole-genome methylated DNA immunoprecipitation sequencing (MeDIP-seq)). For the functional analysis, an HPV- HNSCC cell line was transduced with lentiviral constructs containing the two HPV oncogenes (E6 and E7), and effects on methylation were assayed using the Infinium 450 k technology. Results and discussion Unsupervised clustering over the methylation variable positions (MVPs) with greatest variation showed that samples segregated in accordance with HPV status, but also that HPV+ tumors are heterogeneous. MVPs were significantly enriched at transcriptional start sites, leading to the identification of a candidate CpG island methylator phenotype in a sub-group of the HPV+ tumors. Supervised analysis identified a strong preponderance (87%) of MVPs towards hypermethylation in HPV+ HNSCC. Meta-analysis of our HNSCC and publicly available methylation data in cervical and lung cancers confirmed the observed DNA-methylation signature to be HPV-specific and tissue-independent. Grouping of MVPs into functionally more significant differentially methylated regions identified 43 hypermethylated promoter DMRs, including for three cadherins of the Polycomb group target genes. Integration with independent expression data showed strong negative correlation, especially for the cadherin gene-family members. Combinatorial ectopic expression of the two HPV oncogenes (E6 and E7) in an HPV- HNSCC cell line partially phenocopied the hypermethylation signature seen in HPV+ HNSCC tumors, and established E6 as the main viral effector gene. Conclusions Our data establish that archival FFPE tissue is very suitable for this type of methylome analysis, and suggest that HPV modulates the HNSCC epigenome through hypermethylation of Polycomb repressive complex 2 target genes such as cadherins, which are implicated in tumor progression and metastasis. PMID:23419152

Morphometric Comparison of Clavicle Outlines from 3D Bone Scans and 2D Chest Radiographs: A Short-listing Tool to Assist Radiographic Identification of Human Skeletons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stephan, Carl N.; Amidan, Brett G.; Trease, Harold E.

This paper describes a computerized clavicle identification system, primarily designed to resolve the identities of unaccounted for US soldiers who fought in the Korean War. Elliptical Fourier analysis is used to quantify the clavicle outline shape from skeletons and postero-anterior antemortem chest radiographs to rank individuals in terms of metric distance. Similar to leading fingerprint identification systems, shortlists of the top matching candidates are extracted for subsequent human visual assessment. Two independent tests of the computerized system using 17 field-recovered skeletons and 409 chest radiographs demonstrate that true positive matches are captured within the top 5% of the sample 75%more » of the time. These results are outstanding given the eroded state of some field-recovered skeletons and the faintness of the 1950’s photoflurographs. These methods enhance the capability to resolve several hundred cold cases for which little circumstantial information exists and current DNA and dental record technologies cannot be applied.« less

Accurate and exact CNV identification from targeted high-throughput sequence data.

PubMed

Nord, Alex S; Lee, Ming; King, Mary-Claire; Walsh, Tom

2011-04-12

Massively parallel sequencing of barcoded DNA samples significantly increases screening efficiency for clinically important genes. Short read aligners are well suited to single nucleotide and indel detection. However, methods for CNV detection from targeted enrichment are lacking. We present a method combining coverage with map information for the identification of deletions and duplications in targeted sequence data. Sequencing data is first scanned for gains and losses using a comparison of normalized coverage data between samples. CNV calls are confirmed by testing for a signature of sequences that span the CNV breakpoint. With our method, CNVs can be identified regardless of whether breakpoints are within regions targeted for sequencing. For CNVs where at least one breakpoint is within targeted sequence, exact CNV breakpoints can be identified. In a test data set of 96 subjects sequenced across ~1 Mb genomic sequence using multiplexing technology, our method detected mutations as small as 31 bp, predicted quantitative copy count, and had a low false-positive rate. Application of this method allows for identification of gains and losses in targeted sequence data, providing comprehensive mutation screening when combined with a short read aligner.

Identification of Aspergillus fumigatus and Related Species by Nested PCR Targeting Ribosomal DNA Internal Transcribed Spacer Regions

PubMed Central

Zhao, Jun; Kong, Fanrong; Li, Ruoyu; Wang, Xiaohong; Wan, Zhe; Wang, Duanli

2001-01-01

Aspergillus fumigatus is the most common species that causes invasive aspergillosis. In order to identify A. fumigatus, partial ribosomal DNA (rDNA) from two to six strains of five different Aspergillus species was sequenced. By comparing sequence data from GenBank, we designed specific primer pairs targeting rDNA internal transcribed spacer (ITS) regions of A. fumigatus. A nested PCR method for identification of other A. fumigatus-related species was established by using the primers. To evaluate the specificities and sensitivities of those primers, 24 isolates of A. fumigatus and variants, 8 isolates of Aspergillus nidulans, 7 isolates of Aspergillus flavus and variants, 8 isolates of Aspergillus terreus, 9 isolates of Aspergillus niger, 1 isolate each of Aspergillus parasiticus, Aspergillus penicilloides, Aspergillus versicolor, Aspergillus wangduanlii, Aspergillus qizutongii, Aspergillus beijingensis, and Exophiala dermatitidis, 4 isolates of Candida, 4 isolates of bacteria, and human DNA were used. The nested PCR method specifically identified the A. fumigatus isolates and closely related species and showed a high degree of sensitivity. Additionally, four A. fumigatus strains that were recently isolated from our clinic were correctly identified by this method. Our results demonstrate that these primers are useful for the identification of A. fumigatus and closely related species in culture and suggest further studies for the identification of Aspergillus fumigatus species in clinical specimens. PMID:11376067

Identification of Amazonian trees with DNA barcodes.

PubMed

Gonzalez, Mailyn Adriana; Baraloto, Christopher; Engel, Julien; Mori, Scott A; Pétronelli, Pascal; Riéra, Bernard; Roger, Aurélien; Thébaud, Christophe; Chave, Jérôme

2009-10-16

Large-scale plant diversity inventories are critical to develop informed conservation strategies. However, the workload required for classic taxonomic surveys remains high and is particularly problematic for megadiverse tropical forests. Based on a comprehensive census of all trees in two hectares of a tropical forest in French Guiana, we examined whether plant DNA barcoding could contribute to increasing the quality and the pace of tropical plant biodiversity surveys. Of the eight plant DNA markers we tested (rbcLa, rpoC1, rpoB, matK, ycf5, trnL, psbA-trnH, ITS), matK and ITS had a low rate of sequencing success. More critically, none of the plastid markers achieved a rate of correct plant identification greater than 70%, either alone or combined. The performance of all barcoding markers was noticeably low in few species-rich clades, such as the Laureae, and the Sapotaceae. A field test of the approach enabled us to detect 130 molecular operational taxonomic units in a sample of 252 juvenile trees. Including molecular markers increased the identification rate of juveniles from 72% (morphology alone) to 96% (morphology and molecular) of the individuals assigned to a known tree taxon. We conclude that while DNA barcoding is an invaluable tool for detecting errors in identifications and for identifying plants at juvenile stages, its limited ability to identify collections will constrain the practical implementation of DNA-based tropical plant biodiversity programs.

STATIC AND KINETIC SITE-SPECIFIC PROTEIN-DNA PHOTOCROSSLINKING: ANALYSIS OF BACTERIAL TRANSCRIPTION INITIATION COMPLEXES

PubMed Central

Naryshkin, Nikolai; Druzhinin, Sergei; Revyakin, Andrei; Kim, Younggyu; Mekler, Vladimir; Ebright, Richard H.

2009-01-01

Static site-specific protein-DNA photocrosslinking permits identification of protein-DNA interactions within multiprotein-DNA complexes. Kinetic site-specific protein-DNA photocrosslinking--involving rapid-quench-flow mixing and pulsed-laser irradiation--permits elucidation of pathways and kinetics of formation of protein-DNA interactions within multiprotein-DNA complexes. We present detailed protocols for application of static and kinetic site-specific protein-DNA photocrosslinking to bacterial transcription initiation complexes. PMID:19378179

Identification of genes in anonymous DNA sequences. Final report: Report period, 15 April 1993--15 April 1994

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fields, C.A.

1994-09-01

This Report concludes the DOE Human Genome Program project, ``Identification of Genes in Anonymous DNA Sequence.`` The central goals of this project have been (1) understanding the problem of identifying genes in anonymous sequences, and (2) development of tools, primarily the automated identification system gm, for identifying genes. The activities supported under the previous award are summarized here to provide a single complete report on the activities supported as part of the project from its inception to its completion.

Current sequencing technology makes microhaplotypes a powerful new type of genetic marker for forensics.

PubMed

Kidd, Kenneth K; Pakstis, Andrew J; Speed, William C; Lagacé, Robert; Chang, Joseph; Wootton, Sharon; Haigh, Eva; Kidd, Judith R

2014-09-01

SNPs that are molecularly very close (<10kb) will generally have extremely low recombination rates, much less than 10(-4). Multiple haplotypes will often exist because of the history of the origins of the variants at the different sites, rare recombinants, and the vagaries of random genetic drift and/or selection. Such multiallelic haplotype loci are potentially important in forensic work for individual identification, for defining ancestry, and for identifying familial relationships. The new DNA sequencing capabilities currently available make possible continuous runs of a few hundred base pairs so that we can now determine the allelic combination of multiple SNPs on each chromosome of an individual, i.e., the phase, for multiple SNPs within a small segment of DNA. Therefore, we have begun to identify regions, encompassing two to four SNPs with an extent of <200bp that define multiallelic haplotype loci. We have identified candidate regions and have collected pilot data on many candidate microhaplotype loci. Here we present 31 microhaplotype loci that have at least three alleles, have high heterozygosity, are globally informative, and are statistically independent at the population level. This study of microhaplotype loci (microhaps) provides proof of principle that such markers exist and validates their usefulness for ancestry inference, lineage-clan-family inference, and individual identification. The true value of microhaplotypes will come with sequencing methods that can establish alleles unambiguously, including disentangling of mixtures, because a single sequencing run on a single strand of DNA will encompass all of the SNPs. Copyright © 2014 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

Applying DNA barcoding to red macroalgae: a preliminary appraisal holds promise for future applications

PubMed Central

Saunders, Gary W

2005-01-01

Marine macroalgae, especially the Rhodophyta, can be notoriously difficult to identify owing to their relatively simple morphology and anatomy, convergence, rampant phenotypic plasticity, and alternation of heteromorphic generations. It is thus not surprising that algal systematists have come to rely heavily on genetic tools for molecular assisted alpha taxonomy. Unfortunately the number of suitable marker systems in the three available genomes is enormous and, although most workers have settled on one of three or four models, the lack of an accepted standard hinders the comparison of results between laboratories. The advantages of a standard system are obvious for practical purposes of species discovery and identification; as well, compliance with a universal marker, such as cox1 being developed under the label ‘DNA barcode’, would allow algal systematists to benefit from the rapidly emerging technologies. Novel primers were developed for red algae to PCR amplify and sequence the 5′ cox1 ‘barcode’ region and were used to assess three known species-complex questions: (i) Mazzaella species in the Northeast Pacific; (ii) species of the genera Dilsea and Neodilsea in the Northeast Pacific; and (iii) Asteromenia peltata from three oceans. These models were selected because they have all caused confusion with regards to species number, distribution, and identification in the field, and because they have all been studied with molecular tools. In all cases the DNA barcode resolved accurately and unequivocally species identities and, with the enhanced sampling here, turned up a variety of novel observations in need of further taxonomic investigation. PMID:16214745

Development of a miniaturized DNA microarray for identification of 66 virulence genes of Legionella pneumophila.

PubMed

Żak, Mariusz; Zaborowski, Piotr; Baczewska-Rej, Milena; Zasada, Aleksandra A; Matuszewska, Renata; Krogulska, Bożena

2011-12-20

For the last five years, Legionella sp. infections and legionnaire's disease in Poland have been receiving a lot of attention, because of the new regulations concerning microbiological quality of drinking water. This was the inspiration to search for and develop a new assay to identify many virulence genes of Legionella pneumophila to better understand their distribution in environmental and clinical strains. The method might be an invaluable help in infection risk assessment and in epidemiological investigations. The microarray is based on Array Tube technology. It contains 3 positive and 1 negative control. Target genes encode structural elements of T4SS, effector proteins and factors not related to T4SS. Probes were designed using OligoWiz software and data analyzed using IconoClust software. To isolate environmental and clinical strains, BAL samples and samples of hot water from different and independent hot water distribution systems of public utility buildings were collected. We have developed a miniaturized DNA microarray for identification of 66 virulence genes of L. pneumophila. The assay is specific to L. pneumophila sg 1 with sensitivity sufficient to perform the assay using DNA isolated from a single L. pneumophila colony. Seven environmental strains were analyzed. Two exhibited a hybridization pattern distinct from the reference strain. The method is time- and cost-effective. Initial studies have shown that genes encoding effector proteins may vary among environmental strains. Further studies might help to identify set of genes increasing the risk of clinical disease and to determine the pathogenic potential of environmental strains.

DNA typing of ancient parasite eggs from environmental samples identifies human and animal worm infections in Viking-age settlement.

PubMed

Søe, Martin Jensen; Nejsum, Peter; Fredensborg, Brian Lund; Kapel, Christian Moliin Outzen

2015-02-01

Ancient parasite eggs were recovered from environmental samples collected at a Viking-age settlement in Viborg, Denmark, dated 1018-1030 A.D. Morphological examination identified Ascaris sp., Trichuris sp., and Fasciola sp. eggs, but size and shape did not allow species identification. By carefully selecting genetic markers, PCR amplification and sequencing of ancient DNA (aDNA) isolates resulted in identification of: the human whipworm, Trichuris trichiura , using SSUrRNA sequence homology; Ascaris sp. with 100% homology to cox1 haplotype 07; and Fasciola hepatica using ITS1 sequence homology. The identification of T. trichiura eggs indicates that human fecal material is present and, hence, that the Ascaris sp. haplotype 07 was most likely a human variant in Viking-age Denmark. The location of the F. hepatica finding suggests that sheep or cattle are the most likely hosts. Further, we sequenced the Ascaris sp. 18S rRNA gene in recent isolates from humans and pigs of global distribution and show that this is not a suited marker for species-specific identification. Finally, we discuss ancient parasitism in Denmark and the implementation of aDNA analysis methods in paleoparasitological studies. We argue that when employing species-specific identification, soil samples offer excellent opportunities for studies of human parasite infections and of human and animal interactions of the past.

Assessing universality of DNA barcoding in geographically isolated selected desert medicinal species of Fabaceae and Poaceae

PubMed Central

Hussain, Fatma; Ahmed, Nisar; Ghorbani, Abdolbaset

2018-01-01

In pursuit of developing fast and accurate species-level molecular identification methods, we tested six DNA barcodes, namely ITS2, matK, rbcLa, ITS2+matK, ITS2+rbcLa, matK+rbcLa and ITS2+matK+rbcLa, for their capacity to identify frequently consumed but geographically isolated medicinal species of Fabaceae and Poaceae indigenous to the desert of Cholistan. Data were analysed by BLASTn sequence similarity, pairwise sequence divergence in TAXONDNA, and phylogenetic (neighbour-joining and maximum-likelihood trees) methods. Comparison of six barcode regions showed that ITS2 has the highest number of variable sites (209/360) for tested Fabaceae and (106/365) Poaceae species, the highest species-level identification (40%) in BLASTn procedure, distinct DNA barcoding gap, 100% correct species identification in BM and BCM functions of TAXONDNA, and clear cladding pattern with high nodal support in phylogenetic trees in both families. ITS2+matK+rbcLa followed ITS2 in its species-level identification capacity. The study was concluded with advocating the DNA barcoding as an effective tool for species identification and ITS2 as the best barcode region in identifying medicinal species of Fabaceae and Poaceae. Current research has practical implementation potential in the fields of pharmaco-vigilance, trade of medicinal plants and biodiversity conservation. PMID:29576968

How DNA barcoding can be more effective in microalgae identification: a case of cryptic diversity revelation in Scenedesmus (Chlorophyceae)

PubMed Central

Zou, Shanmei; Fei, Cong; Wang, Chun; Gao, Zhan; Bao, Yachao; He, Meilin; Wang, Changhai

2016-01-01

Microalgae identification is extremely difficult. The efficiency of DNA barcoding in microalgae identification involves ideal gene markers and approaches employed, which however, is still under the way. Although Scenedesmus has obtained much research in producing lipids its identification is difficult. Here we present a comprehensive coalescent, distance and character-based DNA barcoding for 118 Scenedesmus strains based on rbcL, tufA, ITS and 16S. The four genes, and their combined data rbcL + tufA + ITS + 16S, rbcL + tufA and ITS + 16S were analyzed by all of GMYC, P ID, PTP, ABGD, and character-based barcoding respectively. It was apparent that the three combined gene data showed a higher proportion of resolution success than the single gene. In comparison, the GMYC and PTP analysis produced more taxonomic lineages. The ABGD generated various resolution in discrimination among the single and combined data. The character-based barcoding was proved to be the most effective approach for species discrimination in both single and combined data which produced consistent species identification. All the integrated results recovered 11 species, five out of which were revealed as potential cryptic species. We suggest that the character-based DNA barcoding together with other approaches based on multiple genes and their combined data could be more effective in microalgae diversity revelation. PMID:27827440

How DNA barcoding can be more effective in microalgae identification: a case of cryptic diversity revelation in Scenedesmus (Chlorophyceae).

PubMed

Zou, Shanmei; Fei, Cong; Wang, Chun; Gao, Zhan; Bao, Yachao; He, Meilin; Wang, Changhai

2016-11-09

Microalgae identification is extremely difficult. The efficiency of DNA barcoding in microalgae identification involves ideal gene markers and approaches employed, which however, is still under the way. Although Scenedesmus has obtained much research in producing lipids its identification is difficult. Here we present a comprehensive coalescent, distance and character-based DNA barcoding for 118 Scenedesmus strains based on rbcL, tufA, ITS and 16S. The four genes, and their combined data rbcL + tufA + ITS + 16S, rbcL + tufA and ITS + 16S were analyzed by all of GMYC, P ID, PTP, ABGD, and character-based barcoding respectively. It was apparent that the three combined gene data showed a higher proportion of resolution success than the single gene. In comparison, the GMYC and PTP analysis produced more taxonomic lineages. The ABGD generated various resolution in discrimination among the single and combined data. The character-based barcoding was proved to be the most effective approach for species discrimination in both single and combined data which produced consistent species identification. All the integrated results recovered 11 species, five out of which were revealed as potential cryptic species. We suggest that the character-based DNA barcoding together with other approaches based on multiple genes and their combined data could be more effective in microalgae diversity revelation.

Identification of ATM Protein Kinase Phosphorylation Sites by Mass Spectrometry.

PubMed

Graham, Mark E; Lavin, Martin F; Kozlov, Sergei V

2017-01-01

ATM (ataxia-telangiectasia mutated) protein kinase is a key regulator of cellular responses to DNA damage and oxidative stress. DNA damage triggers complex cascade of signaling events leading to numerous posttranslational modification on multitude of proteins. Understanding the regulation of ATM kinase is therefore critical not only for understanding the human genetic disorder ataxia-telangiectasia and potential treatment strategies, but essential for deciphering physiological responses of cells to stress. These responses play an important role in carcinogenesis, neurodegeneration, and aging. We focus here on the identification of DNA damage inducible ATM phosphorylation sites to understand the importance of autophosphorylation in the mechanism of ATM kinase activation. We demonstrate the utility of using immunoprecipitated ATM in quantitative LC-MS/MS workflow with stable isotope dimethyl labeling of ATM peptides for identification of phosphorylation sites.

Nanoscale Bio-engineering Solutions for Space Exploration: The Nanopore Sequencer

NASA Technical Reports Server (NTRS)

Stolc, Viktor; Cozmuta, Ioana

2004-01-01

Characterization of biological systems at the molecular level and extraction of essential information for nano-engineering design to guide the nano-fabrication of solid-state sensors and molecular identification devices is a computational challenge. The alpha hemolysin protein ion channel is used as a model system for structural analysis of nucleic acids like DNA. Applied voltage draws a DNA strand and surrounding ionic solution through the biological nanopore. The subunits in the DNA strand block ion flow by differing amounts. Atomistic scale simulations are employed using NASA supercomputers to study DNA translocation, with the aim to enhance single DNA subunit identification. Compared to protein channels, solid-state nanopores offer a better temporal control of the translocation of DNA and the possibility to easily tune its chemistry to increase the signal resolution. Potential applications for NASA missions, besides real-time genome sequencing include astronaut health, life detection and decoding of various genomes.

Nanoscale Bioengineering Solutions for Space Exploration the Nanopore Sequencer

NASA Technical Reports Server (NTRS)

Ioana, Cozmuta; Viktor, Stoic

2005-01-01

Characterization of biological systems at the molecular level and extraction of essential information for nano-engineering design to guide the nano-fabrication of solid-state sensors and molecular identification devices is a computational challenge. The alpha hemolysin protein ion channel is used as a model system for structural analysis of nucleic acids like DNA. Applied voltage draws a DNA strand and surrounding ionic solution through the biological nanopore. The subunits in the DNA strand block ion flow by differing amounts. Atomistic scale simulations are employed using NASA supercomputers to study DNA translocation. with the aim to enhance single DNA subunit identification. Compared to protein channels, solid-state nanopores offer a better temporal control of the translocation of DNA and the possibility to easily tune its chemistry to increase the signal resolution. Potential applications for NASA missions, besides real-time genome sequencing include astronaut health, life detection and decoding of various genomes. http://phenomrph.arc.nasa.gov/index.php

DNA-Catalyzed Amide Hydrolysis.

PubMed

Zhou, Cong; Avins, Joshua L; Klauser, Paul C; Brandsen, Benjamin M; Lee, Yujeong; Silverman, Scott K

2016-02-24

DNA catalysts (deoxyribozymes) for a variety of reactions have been identified by in vitro selection. However, for certain reactions this identification has not been achieved. One important example is DNA-catalyzed amide hydrolysis, for which a previous selection experiment instead led to DNA-catalyzed DNA phosphodiester hydrolysis. Subsequent efforts in which the selection strategy deliberately avoided phosphodiester hydrolysis led to DNA-catalyzed ester and aromatic amide hydrolysis, but aliphatic amide hydrolysis has been elusive. In the present study, we show that including modified nucleotides that bear protein-like functional groups (any one of primary amino, carboxyl, or primary hydroxyl) enables identification of amide-hydrolyzing deoxyribozymes. In one case, the same deoxyribozyme sequence without the modifications still retains substantial catalytic activity. Overall, these findings establish the utility of introducing protein-like functional groups into deoxyribozymes for identifying new catalytic function. The results also suggest the longer-term feasibility of deoxyribozymes as artificial proteases.

DNA-barcoding of forensically important blow flies (Diptera: Calliphoridae) in the Caribbean Region

PubMed Central

Agnarsson, Ingi

2017-01-01

Correct identification of forensically important insects, such as flies in the family Calliphoridae, is a crucial step for them to be used as evidence in legal investigations. Traditional identification based on morphology has been effective, but has some limitations when it comes to identifying immature stages of certain species. DNA-barcoding, using COI, has demonstrated potential for rapid and accurate identification of Calliphoridae, however, this gene does not reliably distinguish among some recently diverged species, raising questions about its use for delimitation of species of forensic importance. To facilitate DNA based identification of Calliphoridae in the Caribbean we developed a vouchered reference collection from across the region, and a DNA sequence database, and further added the nuclear ITS2 as a second marker to increase accuracy of identification through barcoding. We morphologically identified freshly collected specimens, did phylogenetic analyses and employed several species delimitation methods for a total of 468 individuals representing 19 described species. Our results show that combination of COI + ITS2 genes yields more accurate identification and diagnoses, and better agreement with morphological data, than the mitochondrial barcodes alone. All of our results from independent and concatenated trees and most of the species delimitation methods yield considerably higher diversity estimates than the distance based approach and morphology. Molecular data support at least 24 distinct clades within Calliphoridae in this study, recovering substantial geographic variation for Lucilia eximia, Lucilia retroversa, Lucilia rica and Chloroprocta idioidea, probably indicating several cryptic species. In sum, our study demonstrates the importance of employing a second nuclear marker for barcoding analyses and species delimitation of calliphorids, and the power of molecular data in combination with a complete reference database to enable identification of taxonomically and geographically diverse insects of forensic importance. PMID:28761780

DNA Barcoding in Fragaria L. (Strawberry) Species

USDA-ARS?s Scientific Manuscript database

DNA barcoding for species identification using a short DNA sequence has been successful in animals due to rapid mutation rates of the mitochondrial genome where the animal DNA barocode, cytochrome c oxidase 1 gene is located. The chloroplast PsbA-trnH spacer and the nuclear ribosomal internal transc...

21 CFR 864.7280 - Factor V Leiden DNA mutation detection systems.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Factor V Leiden DNA mutation detection systems....7280 Factor V Leiden DNA mutation detection systems. (a) Identification. Factor V Leiden deoxyribonucleic acid (DNA) mutation detection systems are devices that consist of different reagents and...

21 CFR 864.7280 - Factor V Leiden DNA mutation detection systems.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Factor V Leiden DNA mutation detection systems....7280 Factor V Leiden DNA mutation detection systems. (a) Identification. Factor V Leiden deoxyribonucleic acid (DNA) mutation detection systems are devices that consist of different reagents and...

21 CFR 864.7280 - Factor V Leiden DNA mutation detection systems.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Factor V Leiden DNA mutation detection systems....7280 Factor V Leiden DNA mutation detection systems. (a) Identification. Factor V Leiden deoxyribonucleic acid (DNA) mutation detection systems are devices that consist of different reagents and...

21 CFR 864.7280 - Factor V Leiden DNA mutation detection systems.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Factor V Leiden DNA mutation detection systems....7280 Factor V Leiden DNA mutation detection systems. (a) Identification. Factor V Leiden deoxyribonucleic acid (DNA) mutation detection systems are devices that consist of different reagents and...

21 CFR 864.7280 - Factor V Leiden DNA mutation detection systems.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Factor V Leiden DNA mutation detection systems....7280 Factor V Leiden DNA mutation detection systems. (a) Identification. Factor V Leiden deoxyribonucleic acid (DNA) mutation detection systems are devices that consist of different reagents and...

Massively multiplexed microbial identification using resequencing DNA microarrays for outbreak investigation

NASA Astrophysics Data System (ADS)

Leski, T. A.; Ansumana, R.; Jimmy, D. H.; Bangura, U.; Malanoski, A. P.; Lin, B.; Stenger, D. A.

2011-06-01

Multiplexed microbial diagnostic assays are a promising method for detection and identification of pathogens causing syndromes characterized by nonspecific symptoms in which traditional differential diagnosis is difficult. Also such assays can play an important role in outbreak investigations and environmental screening for intentional or accidental release of biothreat agents, which requires simultaneous testing for hundreds of potential pathogens. The resequencing pathogen microarray (RPM) is an emerging technological platform, relying on a combination of massively multiplex PCR and high-density DNA microarrays for rapid detection and high-resolution identification of hundreds of infectious agents simultaneously. The RPM diagnostic system was deployed in Sierra Leone, West Africa in collaboration with Njala University and Mercy Hospital Research Laboratory located in Bo. We used the RPM-Flu microarray designed for broad-range detection of human respiratory pathogens, to investigate a suspected outbreak of avian influenza in a number of poultry farms in which significant mortality of chickens was observed. The microarray results were additionally confirmed by influenza specific real-time PCR. The results of the study excluded the possibility that the outbreak was caused by influenza, but implicated Klebsiella pneumoniae as a possible pathogen. The outcome of this feasibility study confirms that application of broad-spectrum detection platforms for outbreak investigation in low-resource locations is possible and allows for rapid discovery of the responsible agents, even in cases when different agents are suspected. This strategy enables quick and cost effective detection of low probability events such as outbreak of a rare disease or intentional release of a biothreat agent.

Cloning and Identification of Recombinant Argonaute-Bound Small RNAs Using Next-Generation Sequencing.

PubMed

Gangras, Pooja; Dayeh, Daniel M; Mabin, Justin W; Nakanishi, Kotaro; Singh, Guramrit

2018-01-01

Argonaute proteins (AGOs) are loaded with small RNAs as guides to recognize target mRNAs. Since the target specificity heavily depends on the base complementarity between two strands, it is important to identify small guide and long target RNAs bound to AGOs. For this purpose, next-generation sequencing (NGS) technologies have extended our appreciation truly to the nucleotide level. However, the identification of RNAs via NGS from scarce RNA samples remains a challenge. Further, most commercial and published methods are compatible with either small RNAs or long RNAs, but are not equally applicable to both. Therefore, a single method that yields quantitative, bias-free NGS libraries to identify small and long RNAs from low levels of input will be of wide interest. Here, we introduce such a procedure that is based on several modifications of two published protocols and allows robust, sensitive, and reproducible cloning and sequencing of small amounts of RNAs of variable lengths. The method was applied to the identification of small RNAs bound to a purified eukaryotic AGO. Following ligation of a DNA adapter to RNA 3'-end, the key feature of this method is to use the adapter for priming reverse transcription (RT) wherein biotinylated deoxyribonucleotides specifically incorporated into the extended complementary DNA. Such RT products are enriched on streptavidin beads, circularized while immobilized on beads and directly used for PCR amplification. We provide a stepwise guide to generate RNA-Seq libraries, their purification, quantification, validation, and preparation for next-generation sequencing. We also provide basic steps in post-NGS data analyses using Galaxy, an open-source, web-based platform.

Laboratory Diagnosis and Susceptibility Testing for Mycobacterium tuberculosis.

PubMed

Procop, Gary W

2016-12-01

The laboratory, which utilizes some of the most sophisticated and rapidly changing technologies, plays a critical role in the diagnosis of tuberculosis. Some of these tools are being employed in resource-challenged countries for the rapid detection and characterization of Mycobacterium tuberculosis. Foremost, the laboratory defines appropriate specimen criteria for optimal test performance. The direct detection of mycobacteria in the clinical specimen, predominantly done by acid-fast staining, may eventually be replaced by rapid-cycle PCR. The widespread use of the Xpert MTB/RIF (Cepheid) assay, which detects both M. tuberculosis and key genetic determinants of rifampin resistance, is important for the early detection of multidrug-resistant strains. Culture, using both broth and solid media, remains the standard for establishing the laboratory-based diagnosis of tuberculosis. Cultured isolates are identified far less commonly by traditional biochemical profiling and more commonly by molecular methods, such as DNA probes and broad-range PCR with DNA sequencing. Non-nucleic acid-based methods of identification, such as high-performance liquid chromatography and, more recently, matrix-assisted laser desorption/ionization-time of flight mass spectrometry, may also be used for identification. Cultured isolates of M. tuberculosis should be submitted for susceptibility testing according to standard guidelines. The use of broth-based susceptibility testing is recommended to significantly decrease the time to result. Cultured isolates may also be submitted for strain typing for epidemiologic purposes. The use of massive parallel sequencing, also known as next-generation sequencing, promises to continue to this molecular revolution in mycobacteriology, as whole-genome sequencing provides identification, susceptibility, and typing information simultaneously.

Classification of Sharks in the Egyptian Mediterranean Waters Using Morphological and DNA Barcoding Approaches

PubMed Central

Moftah, Marie; Abdel Aziz, Sayeda H.; Elramah, Sara; Favereaux, Alexandre

2011-01-01

The identification of species constitutes the first basic step in phylogenetic studies, biodiversity monitoring and conservation. DNA barcoding, i.e. the sequencing of a short standardized region of DNA, has been proposed as a new tool for animal species identification. The present study provides an update on the composition of shark in the Egyptian Mediterranean waters off Alexandria, since the latest study to date was performed 30 years ago, DNA barcoding was used in addition to classical taxonomical methodologies. Thus, 51 specimen were DNA barcoded for a 667 bp region of the mitochondrial COI gene. Although DNA barcoding aims at developing species identification systems, some phylogenetic signals were apparent in the data. In the neighbor-joining tree, 8 major clusters were apparent, each of them containing individuals belonging to the same species, and most with 100% bootstrap value. This study is the first to our knowledge to use DNA barcoding of the mitochondrial COI gene in order to confirm the presence of species Squalus acanthias, Oxynotus centrina, Squatina squatina, Scyliorhinus canicula, Scyliorhinus stellaris, Mustelus mustelus, Mustelus punctulatus and Carcharhinus altimus in the Egyptian Mediterranean waters. Finally, our study is the starting point of a new barcoding database concerning shark composition in the Egyptian Mediterranean waters (Barcoding of Egyptian Mediterranean Sharks [BEMS], http://www.boldsystems.org/views/projectlist.php?&#Barcoding%20Fish%20%28FishBOL%29). PMID:22087242

Identification of the razor clam species Ensis arcuatus, E. siliqua, E. directus, E. macha, and Solen marginatus using PCR-RFLP analysis of the 5S rDNA region.

PubMed

Fernandez-Tajes, Juan; Méndez, Josefina

2007-09-05

Polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analysis of the 5S ribosomal DNA region has been applied to the establishment of DNA-based molecular markers for the identification of five razor clam species: Ensis arcuatus, E. siliqua, E. directus, E. macha, and Solen marginatus. PCR amplifications were carried out using a pair of universal primers from the coding region of 5S rDNA. S. marginatus was simply distinguished by the different size of the amplicons obtained. Species-specific restriction endonuclease patterns were found with the enzymes Hae III for E. arcuatus, E. siliqua, and E. directus, and Acs I for E. macha, and when two enzymes were combined, the four species were also identified. Thus, this work provides a simple, reliable, and rapid protocol for the accurate identification of Ensis and Solen species in fresh and canned products, which is very useful for traceability and to enforce labeling regulations.

Forensic identification of Indian snakeroot (Rauvolfia serpentina Benth. ex Kurz) using DNA barcoding.

PubMed

Eurlings, Marcel C M; Lens, Frederic; Pakusza, Csilla; Peelen, Tamara; Wieringa, Jan J; Gravendeel, Barbara

2013-05-01

Indian snakeroot (Rauvolfia serpentina) is a valuable forest product, root extracts of which are used as an antihypertensive drug. Increasing demand led to overharvesting in the wild. Control of international trade is hampered by the inability to identify root samples to the species level. We therefore evaluated the potential of molecular identification by searching for species-specific DNA polymorphisms. We found two species-specific indels in the rps16 intron region for R. serpentina. Our DNA barcoding method was tested for its specificity, reproducibility, sensitivity and stability. We included samples of various tissues and ages, which had been treated differently for preservation. DNA extractions were tested in a range of amplification settings and dilutions. Species-specific rps16 intron sequences were obtained from 79 herbarium accessions and one confiscated root, encompassing 39 different species. Our results demonstrate that molecular analysis provides new perspectives for forensic identification of Indian snakeroot. © 2013 American Academy of Forensic Sciences.

Comprehensive DNA barcoding of the herpetofauna of Germany.

PubMed

Hawlitschek, O; Morinière, J; Dunz, A; Franzen, M; Rödder, D; Glaw, F; Haszprunar, G

2016-01-01

We present the first comprehensive DNA barcoding study of German reptiles and amphibians representing likewise the first on the European herpetofauna. A total of 248 barcodes for all native species and subspecies in the country and a few additional taxa were obtained in the framework of the projects 'Barcoding Fauna Bavarica' (BFB) and 'German Barcode of Life' (GBOL). In contrast to many invertebrate groups, the success rate of the identification of mitochondrial lineages representing species via DNA barcode was almost 100% because no cases of Barcode Index Number (BIN) sharing were detected within German native reptiles and amphibians. However, as expected, a reliable identification of the hybridogenetic species complex in the frog genus Pelophylax was not possible. Deep conspecific lineages resulting in the identification of more than one BIN were found in Lissotriton vulgaris, Natrix natrix and the hybridogenetic Pelophylax complex. A high variety of lineages with different BINs was also found in the barcodes of wall lizards (Podarcis muralis), confirming the existence of many introduced lineages and the frequent occurrence of multiple introductions. Besides the reliable species identification of all life stages and even of tissue remains, our study highlights other potential applications of DNA barcoding concerning German amphibians and reptiles, such as the detection of allochthonous lineages, monitoring of gene flow and also noninvasive sampling via environmental DNA. DNA barcoding based on COI has now proven to be a reliable and efficient tool for studying most amphibians and reptiles as it is already for many other organism groups in zoology. © 2015 John Wiley & Sons Ltd.

Developing de novo human artificial chromosomes in embryonic stem cells using HSV-1 amplicon technology.

PubMed

Moralli, Daniela; Monaco, Zoia L

2015-02-01

De novo artificial chromosomes expressing genes have been generated in human embryonic stem cells (hESc) and are maintained following differentiation into other cell types. Human artificial chromosomes (HAC) are small, functional, extrachromosomal elements, which behave as normal chromosomes in human cells. De novo HAC are generated following delivery of alpha satellite DNA into target cells. HAC are characterized by high levels of mitotic stability and are used as models to study centromere formation and chromosome organisation. They are successful and effective as gene expression vectors since they remain autonomous and can accommodate larger genes and regulatory regions for long-term expression studies in cells unlike other viral gene delivery vectors currently used. Transferring the essential DNA sequences for HAC formation intact across the cell membrane has been challenging for a number of years. A highly efficient delivery system based on HSV-1 amplicons has been used to target DNA directly to the ES cell nucleus and HAC stably generated in human embryonic stem cells (hESc) at high frequency. HAC were detected using an improved protocol for hESc chromosome harvesting, which consistently produced high-quality metaphase spreads that could routinely detect HAC in hESc. In tumour cells, the input DNA often integrated in the host chromosomes, but in the host ES genome, it remained intact. The hESc containing the HAC formed embryoid bodies, generated teratoma in mice, and differentiated into neuronal cells where the HAC were maintained. The HAC structure and chromatin composition was similar to the endogenous hESc chromosomes. This review will discuss the technological advances in HAC vector delivery using HSV-1 amplicons and the improvements in the identification of de novo HAC in hESc.

Cell-free fetal nucleic acid testing: a review of the technology and its applications.

PubMed

Sayres, Lauren C; Cho, Mildred K

2011-07-01

Cell-free fetal nucleic acids circulating in the blood of pregnant women afford the opportunity for early, noninvasive prenatal genetic testing. The predominance of admixed maternal genetic material in circulation demands innovative means for identification and analysis of cell-free fetal DNA and RNA. Techniques using polymerase chain reaction, mass spectrometry, and sequencing have been developed for the purposes of detecting fetal-specific sequences, such as paternally inherited or de novo mutations, or determining allelic balance or chromosome dosage. Clinical applications of these methods include fetal sex determination and blood group typing, which are currently available commercially although not offered routinely in the United States. Other uses of cell-free fetal DNA and RNA being explored are the detection of single-gene disorders, chromosomal abnormalities, and inheritance of parental polymorphisms across the whole fetal genome. The concentration of cell-free fetal DNA may also provide predictive capabilities for pregnancy-associated complications. The roles that cell-free fetal nucleic acid testing assume in the existing framework of prenatal screening and invasive diagnostic testing will depend on factors such as costs, clinical validity and utility, and perceived benefit-risk ratios for different applications. As cell-free fetal DNA and RNA testing continues to be developed and translated, significant ethical, legal, and social questions will arise that will need to be addressed by those with a stake in the use of this technology. Obstetricians & Gynecologists and Family Physicians Learning Objectives: After participating in this activity, physicians should be better able to evaluate techniques and tools for analyzing cell-free fetal nucleic acids, assess clinical applications of prenatal testing, using cell-free fetal nucleic acids and barriers to implementation, and distinguish between relevant clinical features of cell-free fetal nucleic acid testing and existing prenatal genetic screening and diagnostic procedures.

Inclusion probability for DNA mixtures is a subjective one-sided match statistic unrelated to identification information

PubMed Central

Perlin, Mark William

2015-01-01

Background: DNA mixtures of two or more people are a common type of forensic crime scene evidence. A match statistic that connects the evidence to a criminal defendant is usually needed for court. Jurors rely on this strength of match to help decide guilt or innocence. However, the reliability of unsophisticated match statistics for DNA mixtures has been questioned. Materials and Methods: The most prevalent match statistic for DNA mixtures is the combined probability of inclusion (CPI), used by crime labs for over 15 years. When testing 13 short tandem repeat (STR) genetic loci, the CPI-1 value is typically around a million, regardless of DNA mixture composition. However, actual identification information, as measured by a likelihood ratio (LR), spans a much broader range. This study examined probability of inclusion (PI) mixture statistics for 517 locus experiments drawn from 16 reported cases and compared them with LR locus information calculated independently on the same data. The log(PI-1) values were examined and compared with corresponding log(LR) values. Results: The LR and CPI methods were compared in case examples of false inclusion, false exclusion, a homicide, and criminal justice outcomes. Statistical analysis of crime laboratory STR data shows that inclusion match statistics exhibit a truncated normal distribution having zero center, with little correlation to actual identification information. By the law of large numbers (LLN), CPI-1 increases with the number of tested genetic loci, regardless of DNA mixture composition or match information. These statistical findings explain why CPI is relatively constant, with implications for DNA policy, criminal justice, cost of crime, and crime prevention. Conclusions: Forensic crime laboratories have generated CPI statistics on hundreds of thousands of DNA mixture evidence items. However, this commonly used match statistic behaves like a random generator of inclusionary values, following the LLN rather than measuring identification information. A quantitative CPI number adds little meaningful information beyond the analyst's initial qualitative assessment that a person's DNA is included in a mixture. Statistical methods for reporting on DNA mixture evidence should be scientifically validated before they are relied upon by criminal justice. PMID:26605124

Inclusion probability for DNA mixtures is a subjective one-sided match statistic unrelated to identification information.

PubMed

Perlin, Mark William

2015-01-01

DNA mixtures of two or more people are a common type of forensic crime scene evidence. A match statistic that connects the evidence to a criminal defendant is usually needed for court. Jurors rely on this strength of match to help decide guilt or innocence. However, the reliability of unsophisticated match statistics for DNA mixtures has been questioned. The most prevalent match statistic for DNA mixtures is the combined probability of inclusion (CPI), used by crime labs for over 15 years. When testing 13 short tandem repeat (STR) genetic loci, the CPI(-1) value is typically around a million, regardless of DNA mixture composition. However, actual identification information, as measured by a likelihood ratio (LR), spans a much broader range. This study examined probability of inclusion (PI) mixture statistics for 517 locus experiments drawn from 16 reported cases and compared them with LR locus information calculated independently on the same data. The log(PI(-1)) values were examined and compared with corresponding log(LR) values. The LR and CPI methods were compared in case examples of false inclusion, false exclusion, a homicide, and criminal justice outcomes. Statistical analysis of crime laboratory STR data shows that inclusion match statistics exhibit a truncated normal distribution having zero center, with little correlation to actual identification information. By the law of large numbers (LLN), CPI(-1) increases with the number of tested genetic loci, regardless of DNA mixture composition or match information. These statistical findings explain why CPI is relatively constant, with implications for DNA policy, criminal justice, cost of crime, and crime prevention. Forensic crime laboratories have generated CPI statistics on hundreds of thousands of DNA mixture evidence items. However, this commonly used match statistic behaves like a random generator of inclusionary values, following the LLN rather than measuring identification information. A quantitative CPI number adds little meaningful information beyond the analyst's initial qualitative assessment that a person's DNA is included in a mixture. Statistical methods for reporting on DNA mixture evidence should be scientifically validated before they are relied upon by criminal justice.

Diagnostics of Neisseriaceae and Moraxellaceae by Ribosomal DNA Sequencing: Ribosomal Differentiation of Medical Microorganisms

PubMed Central

Harmsen, Dag; Singer, Christian; Rothgänger, Jörg; Tønjum, Tone; Sybren de Hoog, Gerrit; Shah, Haroun; Albert, Jürgen; Frosch, Matthias

2001-01-01

Fast and reliable identification of microbial isolates is a fundamental goal of clinical microbiology. However, in the case of some fastidious gram-negative bacterial species, classical phenotype identification based on either metabolic, enzymatic, or serological methods is difficult, time-consuming, and/or inadequate. 16S or 23S ribosomal DNA (rDNA) bacterial sequencing will most often result in accurate speciation of isolates. Therefore, the objective of this study was to find a hypervariable rDNA stretch, flanked by strongly conserved regions, which is suitable for molecular species identification of members of the Neisseriaceae and Moraxellaceae. The inter- and intrageneric relationships were investigated using comparative sequence analysis of PCR-amplified partial 16S and 23S rDNAs from a total of 94 strains. When compared to the type species of the genera Acinetobacter, Moraxella, and Neisseria, an average of 30 polymorphic positions was observed within the partial 16S rDNA investigated (corresponding to Escherichia coli positions 54 to 510) for each species and an average of 11 polymorphic positions was observed within the 202 nucleotides of the 23S rDNA gene (positions 1400 to 1600). Neisseria macacae and Neisseria mucosa subsp. mucosa (ATCC 19696) had identical 16S and 23S rDNA sequences. Species clusters were heterogeneous in both genes in the case of Acinetobacter lwoffii, Moraxella lacunata, and N. mucosa. Neisseria meningitidis isolates failed to cluster only in the 23S rDNA subset. Our data showed that the 16S rDNA region is more suitable than the partial 23S rDNA for the molecular diagnosis of Neisseriaceae and Moraxellaceae and that a reference database should include more than one strain of each species. All sequence chromatograms and taxonomic and disease-related information are available as part of our ribosomal differentiation of medical microorganisms (RIDOM) web-based service (http://www.ridom.hygiene.uni-wuerzburg.de/). Users can submit a sequence and conduct a similarity search against the RIDOM reference database for microbial identification purposes. PMID:11230407

Taxonomic challenges in freshwater fishes: a mismatch between morphology and DNA barcoding in fish of the north-eastern part of the Congo basin.

PubMed

Decru, Eva; Moelants, Tuur; De Gelas, Koen; Vreven, Emmanuel; Verheyen, Erik; Snoeks, Jos

2016-01-01

This study evaluates the utility of DNA barcoding to traditional morphology-based species identifications for the fish fauna of the north-eastern Congo basin. We compared DNA sequences (COI) of 821 samples from 206 morphologically identified species. Best match, best close match and all species barcoding analyses resulted in a rather low identification success of 87.5%, 84.5% and 64.1%, respectively. The ratio 'nearest-neighbour distance/maximum intraspecific divergence' was lower than 1 for 26.1% of the samples, indicating possible taxonomic problems. In ten genera, belonging to six families, the number of species inferred from mtDNA data exceeded the number of species identified using morphological features; and in four cases indications of possible synonymy were detected. Finally, the DNA barcodes confirmed previously known identification problems within certain genera of the Clariidae, Cyprinidae and Mormyridae. Our results underscore the large number of taxonomic problems lingering in the taxonomy of the fish fauna of the Congo basin and illustrate why DNA barcodes will contribute to future efforts to compile a reliable taxonomic inventory of the Congo basin fish fauna. Therefore, the obtained barcodes were deposited in the reference barcode library of the Barcode of Life Initiative. © 2015 John Wiley & Sons Ltd.

Integrating early detection with DNA barcoding: species identification of a non-native monitor lizard (Squamata: Varanidae) carcass in Mississippi, U.S.A.

USGS Publications Warehouse

Reed, Robert N.; Hopken, Matthew W.; Steen, David A.; Falk, Bryan G.; Piaggio, Antoinette J.

2016-01-01

Early detection of invasive species is critical to increasing the probability of successful management. At the primary stage of an invasion, invasive species are easier to control as the population is likely represented by just a few individuals. Detection of these first few individuals can be challenging, particularly if they are cryptic or otherwise characterized by low detectability. The engagement of members of the public may be critical to early detection as there are far more citizen s on the landscape than trained biologists. However, it can be difficult to assess the credibility of public reporting, especially when a diagnostic digital image or a physical specimen in good condition are lacking. DNA barcoding can be used for verification when morphological identification of a specimen is not possible or uncertain (i.e., degraded or partial specimen). DNA barcoding relies on obtaining a DNA sequence from a relatively small fragment of mitochondrial DNA and comparing it to a database of sequences containing a variety of expertly identified species. He rein we report the successful identification of a degraded specimen of a non-native, potentially invasive reptile species (Varanus niloticus) via DNA barcoding, after discovery and reporting by a member of the public.

Reverse genetics in high throughput: rapid generation of complete negative strand RNA virus cDNA clones and recombinant viruses thereof.

PubMed

Nolden, T; Pfaff, F; Nemitz, S; Freuling, C M; Höper, D; Müller, T; Finke, Stefan

2016-04-05

Reverse genetics approaches are indispensable tools for proof of concepts in virus replication and pathogenesis. For negative strand RNA viruses (NSVs) the limited number of infectious cDNA clones represents a bottleneck as clones are often generated from cell culture adapted or attenuated viruses, with limited potential for pathogenesis research. We developed a system in which cDNA copies of complete NSV genomes were directly cloned into reverse genetics vectors by linear-to-linear RedE/T recombination. Rapid cloning of multiple rabies virus (RABV) full length genomes and identification of clones identical to field virus consensus sequence confirmed the approache's reliability. Recombinant viruses were recovered from field virus cDNA clones. Similar growth kinetics of parental and recombinant viruses, preservation of field virus characters in cell type specific replication and virulence in the mouse model were confirmed. Reduced titers after reporter gene insertion indicated that the low level of field virus replication is affected by gene insertions. The flexibility of the strategy was demonstrated by cloning multiple copies of an orthobunyavirus L genome segment. This important step in reverse genetics technology development opens novel avenues for the analysis of virus variability combined with phenotypical characterization of recombinant viruses at a clonal level.

A Customized DNA Microarray for Microbial Source Tracking ...

EPA Pesticide Factsheets

It is estimated that more than 160, 000 miles of rivers and streams in the United States are impaired due to the presence of waterborne pathogens. These pathogens typically originate from human and other animal fecal pollution sources; therefore, a rapid microbial source tracking (MST) method is needed to facilitate water quality assessment and impaired water remediation. We report a novel qualitative DNA microarray technology consisting of 453 probes for the detection of general fecal and host-associated bacteria, viruses, antibiotic resistance, and other environmentally relevant genetic indicators. A novel data normalization and reduction approach is also presented to help alleviate false positives often associated with high-density microarray applications. To evaluate the performance of the approach, DNA and cDNA was isolated from swine, cattle, duck, goose and gull fecal reference samples, as well as soiled poultry liter and raw municipal sewage. Based on nonmetric multidimensional scaling analysis of results, findings suggest that the novel microarray approach may be useful for pathogen detection and identification of fecal contamination in recreational waters. The ability to simultaneously detect a large collection of environmentally important genetic indicators in a single test has the potential to provide water quality managers with a wide range of information in a short period of time. Future research is warranted to measure microarray performance i

Scaling up discovery of hidden diversity in fungi: impacts of barcoding approaches.

PubMed

Yahr, Rebecca; Schoch, Conrad L; Dentinger, Bryn T M

2016-09-05

The fungal kingdom is a hyperdiverse group of multicellular eukaryotes with profound impacts on human society and ecosystem function. The challenge of documenting and describing fungal diversity is exacerbated by their typically cryptic nature, their ability to produce seemingly unrelated morphologies from a single individual and their similarity in appearance to distantly related taxa. This multiplicity of hurdles resulted in the early adoption of DNA-based comparisons to study fungal diversity, including linking curated DNA sequence data to expertly identified voucher specimens. DNA-barcoding approaches in fungi were first applied in specimen-based studies for identification and discovery of taxonomic diversity, but are now widely deployed for community characterization based on sequencing of environmental samples. Collectively, fungal barcoding approaches have yielded important advances across biological scales and research applications, from taxonomic, ecological, industrial and health perspectives. A major outstanding issue is the growing problem of 'sequences without names' that are somewhat uncoupled from the traditional framework of fungal classification based on morphology and preserved specimens. This review summarizes some of the most significant impacts of fungal barcoding, its limitations, and progress towards the challenge of effective utilization of the exponentially growing volume of data gathered from high-throughput sequencing technologies.This article is part of the themed issue 'From DNA barcodes to biomes'. © 2016 The Authors.

Avatar DNA Nanohybrid System in Chip-on-a-Phone

NASA Astrophysics Data System (ADS)

Park, Dae-Hwan; Han, Chang Jo; Shul, Yong-Gun; Choy, Jin-Ho

2014-05-01

Long admired for informational role and recognition function in multidisciplinary science, DNA nanohybrids have been emerging as ideal materials for molecular nanotechnology and genetic information code. Here, we designed an optical machine-readable DNA icon on microarray, Avatar DNA, for automatic identification and data capture such as Quick Response and ColorZip codes. Avatar icon is made of telepathic DNA-DNA hybrids inscribed on chips, which can be identified by camera of smartphone with application software. Information encoded in base-sequences can be accessed by connecting an off-line icon to an on-line web-server network to provide message, index, or URL from database library. Avatar DNA is then converged with nano-bio-info-cogno science: each building block stands for inorganic nanosheets, nucleotides, digits, and pixels. This convergence could address item-level identification that strengthens supply-chain security for drug counterfeits. It can, therefore, provide molecular-level vision through mobile network to coordinate and integrate data management channels for visual detection and recording.

Avatar DNA Nanohybrid System in Chip-on-a-Phone

PubMed Central

Park, Dae-Hwan; Han, Chang Jo; Shul, Yong-Gun; Choy, Jin-Ho

2014-01-01

Long admired for informational role and recognition function in multidisciplinary science, DNA nanohybrids have been emerging as ideal materials for molecular nanotechnology and genetic information code. Here, we designed an optical machine-readable DNA icon on microarray, Avatar DNA, for automatic identification and data capture such as Quick Response and ColorZip codes. Avatar icon is made of telepathic DNA-DNA hybrids inscribed on chips, which can be identified by camera of smartphone with application software. Information encoded in base-sequences can be accessed by connecting an off-line icon to an on-line web-server network to provide message, index, or URL from database library. Avatar DNA is then converged with nano-bio-info-cogno science: each building block stands for inorganic nanosheets, nucleotides, digits, and pixels. This convergence could address item-level identification that strengthens supply-chain security for drug counterfeits. It can, therefore, provide molecular-level vision through mobile network to coordinate and integrate data management channels for visual detection and recording. PMID:24824876

Self-regulation of recombinant DNA technology in Japan in the 1970s.

PubMed

Nagai, Hiroyuki; Nukaga, Yoshio; Saeki, Koji; Akabayashi, Akira

2009-07-01

Recombinant DNA technology was developed in the United States in the early 1970s. Leading scientists held an international Asilomar Conference in 1975 to examine the self regulation of recombinant DNA technology, followed by the U.S. National Institutes of Health drafting the Recombinant DNA Research Guidelines in 1976. The result of this conference significantly affected many nations, including Japan. However, there have been few historical studies on the self-regulation of recombinant technologies conducted by scientists and government officials in Japan. The purpose of this paper is to analyze how the Science Council of Japan, the Ministry of Education, Science adn Culture, and the Science and Technology Agency developed self-regulation policies for recombinant DNA technology in Japan in the 1970s. Groups of molecular biologist and geneticists played a key role in establishing guidelines in cooperation with government officials. Our findings suggest that self-regulation policies on recombinant DNA technology have influenced safety management for the life sciences and establishment of institutions for review in Japan.

DNA barcoding of morphologically characterized mosquitoes belonging to the subfamily Culicinae from Sri Lanka.

PubMed

Weeraratne, Thilini Chathurika; Surendran, Sinnathamby Noble; Parakrama Karunaratne, S H P

2018-04-25

Vectors of mosquito-borne diseases in Sri Lanka, except for malaria, belong to the subfamily Culicinae, which includes nearly 84% of the mosquito fauna of the country. Hence, accurate and precise species identification of culicine mosquitoes is a crucial factor in implementing effective vector control strategies. During the present study, a combined effort using morphology and DNA barcoding was made to characterize mosquitoes of the subfamily Culicinae for the first time from nine districts of Sri Lanka. Cytochrome c oxidase subunit 1 (cox1) gene from the mitochondrial genome and the internal transcribed spacer 2 (ITS2) region from the nuclear ribosomal DNA were used for molecular characterization. According to morphological identification, the field collected adult mosquitoes belonged to 5 genera and 14 species, i.e. Aedes aegypti, Ae. albopictus, Ae. pallidostriatus, Aedes sp. 1, Armigeres sp. 1, Culex bitaeniorhynchus, Cx. fuscocephala, Cx. gelidus, Cx. pseudovishnui, Cx. quinquefasciatus, Cx. tritaeniorhynchus, Cx. whitmorei, Mansonia uniformis and Mimomyia chamberlaini. Molecular analyses of 62 cox1 and 36 ITS2 sequences were exclusively comparable with the morphological identifications of all the species except for Ae. pallidostriatus and Aedes sp. 1. Although the species identification of Armigeres sp. 1 specimens using morphological features was not possible during this study, DNA barcodes of the specimens matched 100% with the publicly available Ar. subalbatus sequences, giving their species status. Analysis of all the cox1 sequences (14 clades supported by strong bootstrap value in the Neighbor-Joining tree and interspecific distances of > 3%) showed the presence of 14 different species. This is the first available DNA sequence in the GenBank records for morphologically identified Ae. pallidostriatus. Aedes sp. 1 could not be identified morphologically or by publicly available sequences. Aedes aegypti, Ae. albopictus and all Culex species reported during the current study are vectors of human diseases. All these vector species showed comparatively high diversity. The current study reflects the significance of integrated systematic approach and use of cox1 and ITS genetic markers in mosquito taxonomy. Results of DNA barcoding were comparable with morphological identifications and, more importantly, DNA barcoding could accurately identify the species in the instances where the traditional morphological identification failed due to indistinguishable characters of damaged specimens and the presence of subspecies.

Identification of Biomolecular Building Blocks by Recognition Tunneling: Stride towards Nanopore Sequencing of Biomolecules

NASA Astrophysics Data System (ADS)

Sen, Suman

DNA, RNA and Protein are three pivotal biomolecules in human and other organisms, playing decisive roles in functionality, appearance, diseases development and other physiological phenomena. Hence, sequencing of these biomolecules acquires the prime interest in the scientific community. Single molecular identification of their building blocks can be done by a technique called Recognition Tunneling (RT) based on Scanning Tunneling Microscope (STM). A single layer of specially designed recognition molecule is attached to the STM electrodes, which trap the targeted molecules (DNA nucleoside monophosphates, RNA nucleoside monophosphates or amino acids) inside the STM nanogap. Depending on their different binding interactions with the recognition molecules, the analyte molecules generate stochastic signal trains accommodating their "electronic fingerprints". Signal features are used to detect the molecules using a machine learning algorithm and different molecules can be identified with significantly high accuracy. This, in turn, paves the way for rapid, economical nanopore sequencing platform, overcoming the drawbacks of Next Generation Sequencing (NGS) techniques. To read DNA nucleotides with high accuracy in an STM tunnel junction a series of nitrogen-based heterocycles were designed and examined to check their capabilities to interact with naturally occurring DNA nucleotides by hydrogen bonding in the tunnel junction. These recognition molecules are Benzimidazole, Imidazole, Triazole and Pyrrole. Benzimidazole proved to be best among them showing DNA nucleotide classification accuracy close to 99%. Also, Imidazole reader can read an abasic monophosphate (AP), a product from depurination or depyrimidination that occurs 10,000 times per human cell per day. In another study, I have investigated a new universal reader, 1-(2-mercaptoethyl)pyrene (Pyrene reader) based on stacking interactions, which should be more specific to the canonical DNA nucleosides. In addition, Pyrene reader showed higher DNA base-calling accuracy compare to Imidazole reader, the workhorse in our previous projects. In my other projects, various amino acids and RNA nucleoside monophosphates were also classified with significantly high accuracy using RT. Twenty naturally occurring amino acids and various RNA nucleosides (four canonical and two modified) were successfully identified. Thus, we envision nanopore sequencing biomolecules using Recognition Tunneling (RT) that should provide comprehensive betterment over current technologies in terms of time, chemical and instrumental cost and capability of de novo sequencing.

Applying plant DNA barcodes to identify species of Parnassia (Parnassiaceae).

PubMed

Yang, Jun-Bo; Wang, Yi-Ping; Möller, Michael; Gao, Lian-Ming; Wu, Ding

2012-03-01

DNA barcoding is a technique to identify species by using standardized DNA sequences. In this study, a total of 105 samples, representing 30 Parnassia species, were collected to test the effectiveness of four proposed DNA barcodes (rbcL, matK, trnH-psbA and ITS) for species identification. Our results demonstrated that all four candidate DNA markers have a maximum level of primer universality and sequencing success. As a single DNA marker, the ITS region provided the highest species resolution with 86.7%, followed by trnH-psbA with 73.3%. The combination of the core barcode regions, matK+rbcL, gave the lowest species identification success (63.3%) among any combination of multiple markers and was found unsuitable as DNA barcode for Parnassia. The combination of ITS+trnH-psbA achieved the highest species discrimination with 90.0% resolution (27 of 30 sampled species), equal to the four-marker combination and higher than any two or three marker combination including rbcL or matK. Therefore, matK and rbcL should not be used as DNA barcodes for the species identification of Parnassia. Based on the overall performance, the combination of ITS+trnH-psbA is proposed as the most suitable DNA barcode for identifying Parnassia species. DNA barcoding is a useful technique and provides a reliable and effective mean for the discrimination of Parnassia species, and in combination with morphology-based taxonomy, will be a robust approach for tackling taxonomically complex groups. In the light of our findings, we found among the three species not identified a possible cryptic speciation event in Parnassia. © 2011 Blackwell Publishing Ltd.

DNA capture and next-generation sequencing can recover whole mitochondrial genomes from highly degraded samples for human identification

PubMed Central

2013-01-01

Background Mitochondrial DNA (mtDNA) typing can be a useful aid for identifying people from compromised samples when nuclear DNA is too damaged, degraded or below detection thresholds for routine short tandem repeat (STR)-based analysis. Standard mtDNA typing, focused on PCR amplicon sequencing of the control region (HVS I and HVS II), is limited by the resolving power of this short sequence, which misses up to 70% of the variation present in the mtDNA genome. Methods We used in-solution hybridisation-based DNA capture (using DNA capture probes prepared from modern human mtDNA) to recover mtDNA from post-mortem human remains in which the majority of DNA is both highly fragmented (<100 base pairs in length) and chemically damaged. The method ‘immortalises’ the finite quantities of DNA in valuable extracts as DNA libraries, which is followed by the targeted enrichment of endogenous mtDNA sequences and characterisation by next-generation sequencing (NGS). Results We sequenced whole mitochondrial genomes for human identification from samples where standard nuclear STR typing produced only partial profiles or demonstrably failed and/or where standard mtDNA hypervariable region sequences lacked resolving power. Multiple rounds of enrichment can substantially improve coverage and sequencing depth of mtDNA genomes from highly degraded samples. The application of this method has led to the reliable mitochondrial sequencing of human skeletal remains from unidentified World War Two (WWII) casualties approximately 70 years old and from archaeological remains (up to 2,500 years old). Conclusions This approach has potential applications in forensic science, historical human identification cases, archived medical samples, kinship analysis and population studies. In particular the methodology can be applied to any case, involving human or non-human species, where whole mitochondrial genome sequences are required to provide the highest level of maternal lineage discrimination. Multiple rounds of in-solution hybridisation-based DNA capture can retrieve whole mitochondrial genome sequences from even the most challenging samples. PMID:24289217

Recent progress in DNA origami technology.

PubMed

Endo, Masayuki; Sugiyama, Hiroshi

2011-06-01

DNA origami is an emerging technology for designing defined two-dimensional DNA nanostructures. In this review, we focus on and describe several types of DNA origami-related studies, as follows: (1) programmed DNA origami assembly, (2) DNA origami-templated molecular assembly, (3) design and construction of various three-dimensional DNA origami structures, (4) programmed functionalization of DNA origami and combination with top-down nanotechnology, (5) single molecular observation on a designed DNA origami, and (6) DNA nanomachines working on a DNA origami. © 2011 by John Wiley & Sons, Inc.

"First generation" automated DNA sequencing technology.

PubMed

Slatko, Barton E; Kieleczawa, Jan; Ju, Jingyue; Gardner, Andrew F; Hendrickson, Cynthia L; Ausubel, Frederick M

2011-10-01

Beginning in the 1980s, automation of DNA sequencing has greatly increased throughput, reduced costs, and enabled large projects to be completed more easily. The development of automation technology paralleled the development of other aspects of DNA sequencing: better enzymes and chemistry, separation and imaging technology, sequencing protocols, robotics, and computational advancements (including base-calling algorithms with quality scores, database developments, and sequence analysis programs). Despite the emergence of high-throughput sequencing platforms, automated Sanger sequencing technology remains useful for many applications. This unit provides background and a description of the "First-Generation" automated DNA sequencing technology. It also includes protocols for using the current Applied Biosystems (ABI) automated DNA sequencing machines. © 2011 by John Wiley & Sons, Inc.

Large-scale DNA Barcode Library Generation for Biomolecule Identification in High-throughput Screens.

PubMed

Lyons, Eli; Sheridan, Paul; Tremmel, Georg; Miyano, Satoru; Sugano, Sumio

2017-10-24

High-throughput screens allow for the identification of specific biomolecules with characteristics of interest. In barcoded screens, DNA barcodes are linked to target biomolecules in a manner allowing for the target molecules making up a library to be identified by sequencing the DNA barcodes using Next Generation Sequencing. To be useful in experimental settings, the DNA barcodes in a library must satisfy certain constraints related to GC content, homopolymer length, Hamming distance, and blacklisted subsequences. Here we report a novel framework to quickly generate large-scale libraries of DNA barcodes for use in high-throughput screens. We show that our framework dramatically reduces the computation time required to generate large-scale DNA barcode libraries, compared with a naїve approach to DNA barcode library generation. As a proof of concept, we demonstrate that our framework is able to generate a library consisting of one million DNA barcodes for use in a fragment antibody phage display screening experiment. We also report generating a general purpose one billion DNA barcode library, the largest such library yet reported in literature. Our results demonstrate the value of our novel large-scale DNA barcode library generation framework for use in high-throughput screening applications.

Application of DNA Barcodes in Asian Tropical Trees--A Case Study from Xishuangbanna Nature Reserve, Southwest China.

PubMed

Huang, Xiao-cui; Ci, Xiu-qin; Conran, John G; Li, Jie

2015-01-01

Within a regional floristic context, DNA barcoding is more useful to manage plant diversity inventories on a large scale and develop valuable conservation strategies. However, there are no DNA barcode studies from tropical areas of China, which represents one of the biodiversity hotspots around the world. A DNA barcoding database of an Asian tropical trees with high diversity was established at Xishuangbanna Nature Reserve, Yunnan, southwest China using rbcL and matK as standard barcodes, as well as trnH-psbA and ITS as supplementary barcodes. The performance of tree species identification success was assessed using 2,052 accessions from four plots belonging to two vegetation types in the region by three methods: Neighbor-Joining, Maximum-Likelihood and BLAST. We corrected morphological field identification errors (9.6%) for the three plots using rbcL and matK based on Neighbor-Joining tree. The best barcode region for PCR and sequencing was rbcL (97.6%, 90.8%), followed by trnH-psbA (93.6%, 85.6%), while matK and ITS obtained relative low PCR and sequencing success rates. However, ITS performed best for both species (44.6-58.1%) and genus (72.8-76.2%) identification. With trnH-psbA slightly less effective for species identification. The two standard barcode rbcL and matK gave poor results for species identification (24.7-28.5% and 31.6-35.3%). Compared with other studies from comparable tropical forests (e.g. Cameroon, the Amazon and India), the overall performance of the four barcodes for species identification was lower for the Xishuangbanna Nature Reserve, possibly because of species/genus ratios and species composition between these tropical areas. Although the core barcodes rbcL and matK were not suitable for species identification of tropical trees from Xishuangbanna Nature Reserve, they could still help with identification at the family and genus level. Considering the relative sequence recovery and the species identification performance, we recommend the use of trnH-psbA and ITS in combination as the preferred barcodes for tropical tree species identification in China.

Time- and Cost-Efficient Identification of T-DNA Insertion Sites through Targeted Genomic Sequencing

PubMed Central

Lepage, Étienne; Zampini, Éric; Boyle, Brian; Brisson, Normand

2013-01-01

Forward genetic screens enable the unbiased identification of genes involved in biological processes. In Arabidopsis, several mutant collections are publicly available, which greatly facilitates such practice. Most of these collections were generated by agrotransformation of a T-DNA at random sites in the plant genome. However, precise mapping of T-DNA insertion sites in mutants isolated from such screens is a laborious and time-consuming task. Here we report a simple, low-cost and time efficient approach to precisely map T-DNA insertions simultaneously in many different mutants. By combining sequence capture, next-generation sequencing and 2D-PCR pooling, we developed a new method that allowed the rapid localization of T-DNA insertion sites in 55 out of 64 mutant plants isolated in a screen for gyrase inhibition hypersensitivity. PMID:23951038

Identification of Medically Important Yeasts Using PCR-Based Detection of DNA Sequence Polymorphisms in the Internal Transcribed Spacer 2 Region of the rRNA Genes

PubMed Central

Chen, Y. C.; Eisner, J. D.; Kattar, M. M.; Rassoulian-Barrett, S. L.; LaFe, K.; Yarfitz, S. L.; Limaye, A. P.; Cookson, B. T.

2000-01-01

Identification of medically relevant yeasts can be time-consuming and inaccurate with current methods. We evaluated PCR-based detection of sequence polymorphisms in the internal transcribed spacer 2 (ITS2) region of the rRNA genes as a means of fungal identification. Clinical isolates (401), reference strains (6), and type strains (27), representing 34 species of yeasts were examined. The length of PCR-amplified ITS2 region DNA was determined with single-base precision in less than 30 min by using automated capillary electrophoresis. Unique, species-specific PCR products ranging from 237 to 429 bp were obtained from 92% of the clinical isolates. The remaining 8%, divided into groups with ITS2 regions which differed by ≤2 bp in mean length, all contained species-specific DNA sequences easily distinguishable by restriction enzyme analysis. These data, and the specificity of length polymorphisms for identifying yeasts, were confirmed by DNA sequence analysis of the ITS2 region from 93 isolates. Phenotypic and ITS2-based identification was concordant for 427 of 434 yeast isolates examined using sequence identity of ≥99%. Seven clinical isolates contained ITS2 sequences that did not agree with their phenotypic identification, and ITS2-based phylogenetic analyses indicate the possibility of new or clinically unusual species in the Rhodotorula and Candida genera. This work establishes an initial database, validated with over 400 clinical isolates, of ITS2 length and sequence polymorphisms for 34 species of yeasts. We conclude that size and restriction analysis of PCR-amplified ITS2 region DNA is a rapid and reliable method to identify clinically significant yeasts, including potentially new or emerging pathogenic species. PMID:10834993

Molecular profiling of multiple myeloma: from gene expression analysis to next-generation sequencing.

PubMed

Agnelli, Luca; Tassone, Pierfrancesco; Neri, Antonino

2013-06-01

Multiple myeloma is a fatal malignant proliferation of clonal bone marrow Ig-secreting plasma cells, characterized by wide clinical, biological, and molecular heterogeneity. Herein, global gene and microRNA expression, genome-wide DNA profilings, and next-generation sequencing technology used to investigate the genomic alterations underlying the bio-clinical heterogeneity in multiple myeloma are discussed. High-throughput technologies have undoubtedly allowed a better comprehension of the molecular basis of the disease, a fine stratification, and early identification of high-risk patients, and have provided insights toward targeted therapy studies. However, such technologies are at risk of being affected by laboratory- or cohort-specific biases, and are moreover influenced by high number of expected false positives. This aspect has a major weight in myeloma, which is characterized by large molecular heterogeneity. Therefore, meta-analysis as well as multiple approaches are desirable if not mandatory to validate the results obtained, in line with commonly accepted recommendation for tumor diagnostic/prognostic biomarker studies.

Novel method for high-throughput colony PCR screening in nanoliter-reactors

PubMed Central

Walser, Marcel; Pellaux, Rene; Meyer, Andreas; Bechtold, Matthias; Vanderschuren, Herve; Reinhardt, Richard; Magyar, Joseph; Panke, Sven; Held, Martin

2009-01-01

We introduce a technology for the rapid identification and sequencing of conserved DNA elements employing a novel suspension array based on nanoliter (nl)-reactors made from alginate. The reactors have a volume of 35 nl and serve as reaction compartments during monoseptic growth of microbial library clones, colony lysis, thermocycling and screening for sequence motifs via semi-quantitative fluorescence analyses. nl-Reactors were kept in suspension during all high-throughput steps which allowed performing the protocol in a highly space-effective fashion and at negligible expenses of consumables and reagents. As a first application, 11 high-quality microsatellites for polymorphism studies in cassava were isolated and sequenced out of a library of 20 000 clones in 2 days. The technology is widely scalable and we envision that throughputs for nl-reactor based screenings can be increased up to 100 000 and more samples per day thereby efficiently complementing protocols based on established deep-sequencing technologies. PMID:19282448

DNA barcoding as an aid for species identification in austral black flies (Insecta: Diptera: Simuliidae).

PubMed

Hernández-Triana, Luis M; Montes De Oca, Fernanda; Prosser, Sean W J; Hebert, Paul D N; Gregory, T Ryan; McMurtrie, Shelley

2017-04-01

In this paper, the utility of a partial sequence of the COI gene, the DNA barcoding region, for the identification of species of black flies in the austral region was assessed. Twenty-eight morphospecies were analyzed: eight of the genus Austrosimulium (four species in the subgenus Austrosimulium s. str., three species in the subgenus Novaustrosimulium, and one species unassigned to subgenus), two of the genus Cnesia, eight of Gigantodax, three of Paracnephia, one of Paraustrosimulium, and six of Simulium (subgenera Morops, Nevermannia, and Pternaspatha). The neighbour-joining tree derived from the DNA barcode sequences grouped most specimens according to species or species groups recognized by morphotaxonomic studies. Intraspecific sequence divergences within morphologically distinct species ranged from 0% to 1.8%, while higher divergences (2%-4.2%) in certain species suggested the presence of cryptic diversity. The existence of well-defined groups within S. simile revealed the likely inclusion of cryptic diversity. DNA barcodes also showed that specimens identified as C. dissimilis, C. nr. pussilla, and C. ornata might be conspecific, suggesting possible synonymy. DNA barcoding combined with a sound morphotaxonomic framework would provide an effective approach for the identification of black flies in the region.

Potential of DNA sequences to identify zoanthids (Cnidaria: Zoantharia).

PubMed

Sinniger, Frederic; Reimer, James D; Pawlowski, Jan

2008-12-01

The order Zoantharia is known for its chaotic taxonomy and difficult morphological identification. One method that potentially could help for examining such troublesome taxa is DNA barcoding, which identifies species using standard molecular markers. The mitochondrial cytochrome oxidase subunit I (COI) has been utilized to great success in groups such as birds and insects; however, its applicability in many other groups is controversial. Recently, some studies have suggested that barcoding is not applicable to anthozoans. Here, we examine the use of COI and mitochondrial 16S ribosomal DNA for zoanthid identification. Despite the absence of a clear barcoding gap, our results show that for most of 54 zoanthid samples, both markers could separate samples to the species, or species group, level, particularly when easily accessible ecological or distributional data were included. Additionally, we have used the short V5 region of mt 16S rDNA to identify eight old (13 to 50 years old) museum samples. We discuss advantages and disadvantages of COI and mt 16S rDNA as barcodes for Zoantharia, and recommend that either one or both of these markers be considered for zoanthid identification in the future.

[PCR identification of DNA of hosts of the taiga tick nymphs (Ixodes persulcatus: Ixodinae) in St. Petersburg and its suburbs].

PubMed

Grigor'eva, L A; Markov, A V

2011-01-01

PCR identification of host DNA in unfed females and males of taiga tick Ixodes persulcatus was performed. Amplification of each sample was done using primers species-specific by 12S rDNA mitochondrial gene. Four species of small mammals (Apodemus uralensis, Clethrionomys glareolus, Microtus arvalis, and Sorex araneus) and two passeriform bird species (Fringilla coelebs and Parus major) were analysed. For one third of tick samples, hosts of previous stages were established using this method. In five cases, feeding on more than one host species was detected.

DNA barcoding the floras of biodiversity hotspots.

PubMed

Lahaye, Renaud; van der Bank, Michelle; Bogarin, Diego; Warner, Jorge; Pupulin, Franco; Gigot, Guillaume; Maurin, Olivier; Duthoit, Sylvie; Barraclough, Timothy G; Savolainen, Vincent

2008-02-26

DNA barcoding is a technique in which species identification is performed by using DNA sequences from a small fragment of the genome, with the aim of contributing to a wide range of ecological and conservation studies in which traditional taxonomic identification is not practical. DNA barcoding is well established in animals, but there is not yet any universally accepted barcode for plants. Here, we undertook intensive field collections in two biodiversity hotspots (Mesoamerica and southern Africa). Using >1,600 samples, we compared eight potential barcodes. Going beyond previous plant studies, we assessed to what extent a "DNA barcoding gap" is present between intra- and interspecific variations, using multiple accessions per species. Given its adequate rate of variation, easy amplification, and alignment, we identified a portion of the plastid matK gene as a universal DNA barcode for flowering plants. Critically, we further demonstrate the applicability of DNA barcoding for biodiversity inventories. In addition, analyzing >1,000 species of Mesoamerican orchids, DNA barcoding with matK alone reveals cryptic species and proves useful in identifying species listed in Convention on International Trade of Endangered Species (CITES) appendixes.

DNA barcoding the floras of biodiversity hotspots

PubMed Central

Lahaye, Renaud; van der Bank, Michelle; Bogarin, Diego; Warner, Jorge; Pupulin, Franco; Gigot, Guillaume; Maurin, Olivier; Duthoit, Sylvie; Barraclough, Timothy G.; Savolainen, Vincent

2008-01-01

DNA barcoding is a technique in which species identification is performed by using DNA sequences from a small fragment of the genome, with the aim of contributing to a wide range of ecological and conservation studies in which traditional taxonomic identification is not practical. DNA barcoding is well established in animals, but there is not yet any universally accepted barcode for plants. Here, we undertook intensive field collections in two biodiversity hotspots (Mesoamerica and southern Africa). Using >1,600 samples, we compared eight potential barcodes. Going beyond previous plant studies, we assessed to what extent a “DNA barcoding gap” is present between intra- and interspecific variations, using multiple accessions per species. Given its adequate rate of variation, easy amplification, and alignment, we identified a portion of the plastid matK gene as a universal DNA barcode for flowering plants. Critically, we further demonstrate the applicability of DNA barcoding for biodiversity inventories. In addition, analyzing >1,000 species of Mesoamerican orchids, DNA barcoding with matK alone reveals cryptic species and proves useful in identifying species listed in Convention on International Trade of Endangered Species (CITES) appendixes. PMID:18258745

Rapid Molecular Identification of Pathogenic Yeasts by Pyrosequencing Analysis of 35 Nucleotides of Internal Transcribed Spacer 2 ▿

PubMed Central

Borman, Andrew M.; Linton, Christopher J.; Oliver, Debra; Palmer, Michael D.; Szekely, Adrien; Johnson, Elizabeth M.

2010-01-01

Rapid identification of yeast species isolates from clinical samples is particularly important given their innately variable antifungal susceptibility profiles. Here, we have evaluated the utility of pyrosequencing analysis of a portion of the internal transcribed spacer 2 region (ITS2) for identification of pathogenic yeasts. A total of 477 clinical isolates encompassing 43 different fungal species were subjected to pyrosequencing analysis in a strictly blinded study. The molecular identifications produced by pyrosequencing were compared with those obtained using conventional biochemical tests (AUXACOLOR2) and following PCR amplification and sequencing of the D1-D2 portion of the nuclear 28S large rRNA gene. More than 98% (469/477) of isolates encompassing 40 of the 43 fungal species tested were correctly identified by pyrosequencing of only 35 bp of ITS2. Moreover, BLAST searches of the public synchronized databases with the ITS2 pyrosequencing signature sequences revealed that there was only minimal sequence redundancy in the ITS2 under analysis. In all cases, the pyrosequencing signature sequences were unique to the yeast species (or species complex) under investigation. Finally, when pyrosequencing was combined with the Whatman FTA paper technology for the rapid extraction of fungal genomic DNA, molecular identification could be accomplished within 6 h from the time of starting from pure cultures. PMID:20702674

Sequence-related amplified polymorphism (SRAP) marker as a new method for identification of endophytic fungi from Taxus.

PubMed

Ren, Na; Liu, Jiajia; Yang, Dongliang; Chen, Jianhua; Luan, Mingbao; Hong, Juan

2012-01-01

A total of 20 endophytic fungi stains were classified into four groups using traditional morphological identification method, and were studied for genetic diversity by sequence-related amplified polymorphism (SRAP) technique. Genomic DNA (deoxyribonucleic acid) of these strains was extracted with CTAB method. SRAP analysis was done with 24 pairs of primers. All strains could be uniquely distinguished with 584 bands and 446 polymorphism bands which generated 76.4% of polymorphic ratio. Unweighted pair-group method with arithmetical averages cluster analysis enabled construction of a dendrogram for estimating genetic distances between different strains. All strains, which were just divided into four groups by traditional morphology identification, were clustered into four major groups at GS = 0.603 and further separated into eight sub-groups at GS = 0.921. Dendrogram also revealed a large genetic variation in 20 strains; different primer combinations allowed them distinctly distinguished one from others with relatively low genetic similarity. The results show that the SRAP technology is more efficient than traditional morphology identification. It is found that SRAP markers could more really reflect the genetic diversity of endophytic fungi strains from Taxus, and also could be used as a method for identification of endophytic fungi from Taxus. It also suggests that SRAP can be used to establish foundation for further screening of taxol-producing endophytic fungi strains which can produce high levels of paclitaxel.

Mapping of protein- and chromatin-interactions at the nuclear lamina.

PubMed

Kubben, Nard; Voncken, Jan Willem; Misteli, Tom

2010-01-01

The nuclear envelope and the lamina define the nuclear periphery and are implicated in many nuclear processes including chromatin organization, transcription and DNA replication. Mutations in lamin A proteins, major components of the lamina, interfere with these functions and cause a set of phenotypically diverse diseases referred to as laminopathies. The phenotypic diversity of laminopathies is thought to be the result of alterations in specific protein- and chromatin interactions due to lamin A mutations. Systematic identification of lamin A-protein and -chromatin interactions will be critical to uncover the molecular etiology of laminopathies. Here we summarize and critically discuss recent technology to analyze lamina-protein and-chromatin interactions.

Identification and preparation of sperm for ART.

PubMed

Mehta, Akanksha; Sigman, Mark

2014-02-01

State-of-the-art techniques attempt to select sperm with the best functional capacity to produce pregnancy and, subsequently, healthy offspring. A variety of approaches are now being evaluated. Future approaches may allow for selection of sperm based on sperm DNA integrity, degree of aneuploidy, or apoptosis. Other approaches involve attempting to improve the in vitro function of sperm with exposure to compounds such as pentoxifylline or platelet activating factor. In the future, we are likely to see significant improvements in the ability to select the best sperm for assisted-reproductive-technology procedures and the use of these procedures in routine clinical practice. Copyright © 2014 Elsevier Inc. All rights reserved.

Issues and strategies in the DNA identification of World Trade Center victims.

PubMed

Brenner, C H; Weir, B S

2003-05-01

Identification of the nearly 3000 victims of the World Trade Center attack, represented by about 15,000 body parts, rests heavily on DNA. Reference DNA profiles are often from relatives rather than from the deceased themselves. With so large a set of victims, coincidental similarities between non-relatives abound. Therefore considerable care is necessary to succeed in correlating references with correct victims while avoiding spurious assignments. Typically multiple relatives are necessary to establish the identity of a victim. We describe a 3-stage paradigm--collapse, screen, test--to organize the work of sorting out the identities. Inter alia we present a simple and general formula for the likelihood ratio governing practically any potential relationship between two DNA profiles.

Single-cell manipulation and DNA delivery technology using atomic force microscopy and nanoneedle.

PubMed

Han, Sung-Woong; Nakamura, Chikashi; Miyake, Jun; Chang, Sang-Mok; Adachi, Taiji

2014-01-01

The recent single-cell manipulation technology using atomic force microscopy (AFM) not only allows high-resolution visualization and probing of biomolecules and cells but also provides spatial and temporal access to the interior of living cells via the nanoneedle technology. Here we review the development and application of single-cell manipulations and the DNA delivery technology using a nanoneedle. We briefly describe various DNA delivery methods and discuss their advantages and disadvantages. Fabrication of the nanoneedle, visualization of nanoneedle insertion into living cells, DNA modification on the nanoneedle surface, and the invasiveness of nanoneedle insertion into living cells are described. Different methods of DNA delivery into a living cell, such as lipofection, microinjection, and nanoneedles, are then compared. Finally, single-cell diagnostics using the nanoneedle and the perspectives of the nanoneedle technology are outlined. The nanoneedle-based DNA delivery technology provides new opportunities for efficient and specific introduction of DNA and other biomolecules into precious living cells with a high spatial resolution within a desired time frame. This technology has the potential to be applied for many basic cellular studies and for clinical studies such as single-cell diagnostics.

Triplex technology in studies of DNA damage, DNA repair, and mutagenesis.

PubMed

Mukherjee, Anirban; Vasquez, Karen M

2011-08-01

Triplex-forming oligonucleotides (TFOs) can bind to the major groove of homopurine-homopyrimidine stretches of double-stranded DNA in a sequence-specific manner through Hoogsteen hydrogen bonding to form DNA triplexes. TFOs by themselves or conjugated to reactive molecules can be used to direct sequence-specific DNA damage, which in turn results in the induction of several DNA metabolic activities. Triplex technology is highly utilized as a tool to study gene regulation, molecular mechanisms of DNA repair, recombination, and mutagenesis. In addition, TFO targeting of specific genes has been exploited in the development of therapeutic strategies to modulate DNA structure and function. In this review, we discuss advances made in studies of DNA damage, DNA repair, recombination, and mutagenesis by using triplex technology to target specific DNA sequences. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

[Analysis of genetic diversity of Russian regional populations based on common STR markers used in DNA identification].

PubMed

Pesik, V Yu; Fedunin, A A; Agdzhoyan, A T; Utevska, O M; Chukhraeva, M I; Evseeva, I V; Churnosov, M I; Lependina, I N; Bogunov, Yu V; Bogunova, A A; Ignashkin, M A; Yankovsky, N K; Balanovska, E V; Orekhov, V A; Balanovsky, O P

2014-06-01

We conducted the first genetic analysis of a wide a range of rural Russian populations in European Russia with a panel of common DNA markers commonly used in criminalistics genetic identification. We examined a total of 647 samples from indigenous ethnic Russian populations in Arkhangelsk, Belgorod, Voronezh, Kursk, Rostov, Ryazan, and Orel regions. We employed a multiplex genotyping kit, COrDIS Plus, to genotype Short Tandem Repeat (STR) loci, which included the genetic marker panel officially recommended for DNA identification in the Russian Federation, the United States, and the European Union. In the course of our study, we created a database of allelic frequencies, examined the distribution of alleles and genotypes in seven rural Russian populations, and defined the genetic relationships between these populations. We found that, although multidimensional analysis indicated a difference between the Northern gene pool and the rest of the Russian European populations, a pairwise comparison using 19 STR markers among all populations did not reveal significant differences. This is in concordance with previous studies, which examined up to 12 STR markers of urban Russian populations. Therefore, the database of allelic frequencies created in this study can be applied for forensic examinations and DNA identification among the ethnic Russian population over European Russia. We also noted a decrease in the levels of heterozygosity in the northern Russian population compared to ethnic populations in southern and central Russia, which is consistent with trends identified previously using classical gene markers and analysis of mitochondrial DNA.

HTSFinder: Powerful Pipeline of DNA Signature Discovery by Parallel and Distributed Computing

PubMed Central

Karimi, Ramin; Hajdu, Andras

2016-01-01

Comprehensive effort for low-cost sequencing in the past few years has led to the growth of complete genome databases. In parallel with this effort, a strong need, fast and cost-effective methods and applications have been developed to accelerate sequence analysis. Identification is the very first step of this task. Due to the difficulties, high costs, and computational challenges of alignment-based approaches, an alternative universal identification method is highly required. Like an alignment-free approach, DNA signatures have provided new opportunities for the rapid identification of species. In this paper, we present an effective pipeline HTSFinder (high-throughput signature finder) with a corresponding k-mer generator GkmerG (genome k-mers generator). Using this pipeline, we determine the frequency of k-mers from the available complete genome databases for the detection of extensive DNA signatures in a reasonably short time. Our application can detect both unique and common signatures in the arbitrarily selected target and nontarget databases. Hadoop and MapReduce as parallel and distributed computing tools with commodity hardware are used in this pipeline. This approach brings the power of high-performance computing into the ordinary desktop personal computers for discovering DNA signatures in large databases such as bacterial genome. A considerable number of detected unique and common DNA signatures of the target database bring the opportunities to improve the identification process not only for polymerase chain reaction and microarray assays but also for more complex scenarios such as metagenomics and next-generation sequencing analysis. PMID:26884678

HTSFinder: Powerful Pipeline of DNA Signature Discovery by Parallel and Distributed Computing.

PubMed

Karimi, Ramin; Hajdu, Andras

2016-01-01

Comprehensive effort for low-cost sequencing in the past few years has led to the growth of complete genome databases. In parallel with this effort, a strong need, fast and cost-effective methods and applications have been developed to accelerate sequence analysis. Identification is the very first step of this task. Due to the difficulties, high costs, and computational challenges of alignment-based approaches, an alternative universal identification method is highly required. Like an alignment-free approach, DNA signatures have provided new opportunities for the rapid identification of species. In this paper, we present an effective pipeline HTSFinder (high-throughput signature finder) with a corresponding k-mer generator GkmerG (genome k-mers generator). Using this pipeline, we determine the frequency of k-mers from the available complete genome databases for the detection of extensive DNA signatures in a reasonably short time. Our application can detect both unique and common signatures in the arbitrarily selected target and nontarget databases. Hadoop and MapReduce as parallel and distributed computing tools with commodity hardware are used in this pipeline. This approach brings the power of high-performance computing into the ordinary desktop personal computers for discovering DNA signatures in large databases such as bacterial genome. A considerable number of detected unique and common DNA signatures of the target database bring the opportunities to improve the identification process not only for polymerase chain reaction and microarray assays but also for more complex scenarios such as metagenomics and next-generation sequencing analysis.

A simplified protocol for molecular identification of Eimeria species in field samples.

PubMed

Haug, Anita; Thebo, Per; Mattsson, Jens G

2007-05-15

This study aimed to find a fast, sensitive and efficient protocol for molecular identification of chicken Eimeria spp. in field samples. Various methods for each of the three steps of the protocol were evaluated: oocyst wall rupturing methods, DNA extraction methods, and identification of species-specific DNA sequences by PCR. We then compared and evaluated five complete protocols. Three series of oocyst suspensions of known number of oocysts from Eimeria mitis, Eimeria praecox, Eimeria maxima and Eimeria tenella were prepared and ground using glass beads or mini-pestle. DNA was extracted from ruptured oocysts using commercial systems (GeneReleaser, Qiagen Stoolkit and Prepman) or phenol-chloroform DNA extraction, followed by identification of species-specific ITS-1 sequences by optimised single species PCR assays. The Stoolkit and Prepman protocols showed insufficient repeatability, and the former was also expensive and relatively time-consuming. In contrast, both the GeneReleaser protocol and phenol-chloroform protocols were robust and sensitive, detecting less than 0.4 oocysts of each species per PCR. Finally, we evaluated our new protocol on 68 coccidia positive field samples. Our data suggests that rupturing the oocysts by mini-pestle grinding, preparing the DNA with GeneReleaser, followed by optimised single species PCR assays, makes a robust and sensitive procedure for identifying chicken Eimeria species in field samples. Importantly, it also provides minimal hands-on-time in the pre-PCR process, lower contamination risk and no handling of toxic chemicals.

DNA barcodes reveal microevolutionary signals in fire response trait in two legume genera

PubMed Central

Bello, Abubakar; Daru, Barnabas H.; Stirton, Charles H.; Chimphango, Samson B. M.; van der Bank, Michelle; Maurin, Olivier; Muasya, A. Muthama

2015-01-01

Large-scale DNA barcoding provides a new technique for species identification and evaluation of relationships across various levels (populations and species) and may reveal fundamental processes in recently diverged species. Here, we analysed DNA sequence variation in the recently diverged legumes from the Psoraleeae (Fabaceae) occurring in the Cape Floristic Region (CFR) of southern Africa to test the utility of DNA barcodes in species identification and discrimination. We further explored the phylogenetic signal on fire response trait (reseeding and resprouting) at species and generic levels. We showed that Psoraleoid legumes of the CFR exhibit a barcoding gap yielding the combination of matK and rbcLa (matK + rbcLa) data set as a better barcode than single regions. We found a high score (100 %) of correct identification of individuals to their respective genera but a very low score (<50 %) in identifying them to species. We found a considerable match (54 %) between genetic species and morphologically delimited species. We also found that different lineages showed a weak but significant phylogenetic conservatism in their response to fire as reseeders or resprouters, with more clustering of resprouters than would be expected by chance. These novel microevolutionary patterns might be acting continuously over time to produce multi-scale regularities of biodiversity. This study provides the first insight into the DNA barcoding campaign of land plants in species identification and detection of the phylogenetic signal in recently diverged lineages of the CFR. PMID:26507570

Identification of Amazonian Trees with DNA Barcodes

PubMed Central

Gonzalez, Mailyn Adriana; Baraloto, Christopher; Engel, Julien; Mori, Scott A.; Pétronelli, Pascal; Riéra, Bernard; Roger, Aurélien; Thébaud, Christophe; Chave, Jérôme

2009-01-01

Background Large-scale plant diversity inventories are critical to develop informed conservation strategies. However, the workload required for classic taxonomic surveys remains high and is particularly problematic for megadiverse tropical forests. Methodology/Principal Findings Based on a comprehensive census of all trees in two hectares of a tropical forest in French Guiana, we examined whether plant DNA barcoding could contribute to increasing the quality and the pace of tropical plant biodiversity surveys. Of the eight plant DNA markers we tested (rbcLa, rpoC1, rpoB, matK, ycf5, trnL, psbA-trnH, ITS), matK and ITS had a low rate of sequencing success. More critically, none of the plastid markers achieved a rate of correct plant identification greater than 70%, either alone or combined. The performance of all barcoding markers was noticeably low in few species-rich clades, such as the Laureae, and the Sapotaceae. A field test of the approach enabled us to detect 130 molecular operational taxonomic units in a sample of 252 juvenile trees. Including molecular markers increased the identification rate of juveniles from 72% (morphology alone) to 96% (morphology and molecular) of the individuals assigned to a known tree taxon. Conclusion/Significance We conclude that while DNA barcoding is an invaluable tool for detecting errors in identifications and for identifying plants at juvenile stages, its limited ability to identify collections will constrain the practical implementation of DNA-based tropical plant biodiversity programs. PMID:19834612