DNA Polymerase κ Is a Key Cellular Factor for the Formation of Covalently Closed Circular DNA of Hepatitis B Virus.

PubMed

Qi, Yonghe; Gao, Zhenchao; Xu, Guangwei; Peng, Bo; Liu, Chenxuan; Yan, Huan; Yao, Qiyan; Sun, Guoliang; Liu, Yang; Tang, Dingbin; Song, Zilin; He, Wenhui; Sun, Yinyan; Guo, Ju-Tao; Li, Wenhui

2016-10-01

Hepatitis B virus (HBV) infection of hepatocytes begins by binding to its cellular receptor sodium taurocholate cotransporting polypeptide (NTCP), followed by the internalization of viral nucleocapsid into the cytoplasm. The viral relaxed circular (rc) DNA genome in nucleocapsid is transported into the nucleus and converted into covalently closed circular (ccc) DNA to serve as a viral persistence reservoir that is refractory to current antiviral therapies. Host DNA repair enzymes have been speculated to catalyze the conversion of rcDNA to cccDNA, however, the DNA polymerase(s) that fills the gap in the plus strand of rcDNA remains to be determined. Here we conducted targeted genetic screening in combination with chemical inhibition to identify the cellular DNA polymerase(s) responsible for cccDNA formation, and exploited recombinant HBV with capsid coding deficiency which infects HepG2-NTCP cells with similar efficiency of wild-type HBV to assure cccDNA synthesis is exclusively from de novo HBV infection. We found that DNA polymerase κ (POLK), a Y-family DNA polymerase with maximum activity in non-dividing cells, substantially contributes to cccDNA formation during de novo HBV infection. Depleting gene expression of POLK in HepG2-NTCP cells by either siRNA knockdown or CRISPR/Cas9 knockout inhibited the conversion of rcDNA into cccDNA, while the diminished cccDNA formation in, and hence the viral infection of, the knockout cells could be effectively rescued by ectopic expression of POLK. These studies revealed that POLK is a crucial host factor required for cccDNA formation during a de novo HBV infection and suggest that POLK may be a potential target for developing antivirals against HBV.

Sequence Discrimination by Alternatively Spliced Isoforms of a DNA Binding Zinc Finger Domain

NASA Astrophysics Data System (ADS)

Gogos, Joseph A.; Hsu, Tien; Bolton, Jesse; Kafatos, Fotis C.

1992-09-01

Two major developmentally regulated isoforms of the Drosophila chorion transcription factor CF2 differ by an extra zinc finger within the DNA binding domain. The preferred DNA binding sites were determined and are distinguished by an internal duplication of TAT in the site recognized by the isoform with the extra finger. The results are consistent with modular interactions between zinc fingers and trinucleotides and also suggest rules for recognition of AT-rich DNA sites by zinc finger proteins. The results show how modular finger interactions with trinucleotides can be used, in conjunction with alternative splicing, to alter the binding specificity and increase the spectrum of sites recognized by a DNA binding domain. Thus, CF2 may potentially regulate distinct sets of target genes during development.

The Reach of Linear Protein-DNA Dimerizers

PubMed Central

Stafford, Ryan L.; Dervan, Peter B.

2008-01-01

A protein-DNA dimerizer constructed from a DNA-binding pyrrole-imidazole polyamide and the peptide FYPWMK facilitates binding of the natural transcription factor Exd to an adjacent DNA site. Previous dimerizers have been constructed with the peptide attached to an internal pyrrole monomer in an overall branched oligomer. Linear oligomers constructed by attaching the peptide to the polyamide C-terminus expand the range of protein-DNA dimerization to six additional DNA sites. Replacing the FYPWMK hexapeptide with a WM dipeptide, which was previously functional in branched compounds, does not lead to a functional linear dimerizer. Instead, inserting an additional lysine generates a minimal, linear WMK tripeptide conjugate that maintains the activity of the larger FYPWMK dimerizers in a single DNA-binding site orientation. These studies provide insight into the importance of linker length and composition, binding site spacing and orientation, and the protein-binding domain content that are important for the optimization of protein DNA-dimerizers suitable for biological experiments. PMID:17949089

The NMR solution structure of a mutant of the Max b/HLH/LZ free of DNA: insights into the specific and reversible DNA binding mechanism of dimeric transcription factors.

PubMed

Sauvé, Simon; Tremblay, Luc; Lavigne, Pierre

2004-09-17

Basic region-helix1-loop-helix2-leucine zipper (b/H(1)LH(2)/LZ) transcription factors bind specific DNA sequence in their target gene promoters as dimers. Max, a b/H(1)LH(2)/LZ transcription factor, is the obligate heterodimeric partner of the related b/H(1)LH(2)/LZ proteins of the Myc and Mad families. These heterodimers specifically bind E-box DNA sequence (CACGTG) to activate (e.g. c-Myc/Max) and repress (e.g. Mad1/Max) transcription. Max can also homodimerize and bind E-box sequences in c-Myc target gene promoters. While the X-ray structure of the Max b/H(1)LH(2)/LZ/DNA complex and that of others have been reported, the precise sequence of events leading to the reversible and specific binding of these important transcription factors is still largely unknown. In order to provide insights into the DNA binding mechanism, we have solved the NMR solution structure of a covalently homodimerized version of a Max b/H(1)LH(2)/LZ protein with two stabilizing mutations in the LZ, and characterized its backbone dynamics from (15)N spin-relaxation measurements in the absence of DNA. Apart from minor differences in the pitch of the LZ, possibly resulting from the mutations in the construct, we observe that the packing of the helices in the H(1)LH(2) domain is almost identical to that of the two crystal structures, indicating that no important conformational change in these helices occurs upon DNA binding. Conversely to the crystal structures of the DNA complexes, the first 14 residues of the basic region are found to be mostly unfolded while the loop is observed to be flexible. This indicates that these domains undergo conformational changes upon DNA binding. On the other hand, we find the last four residues of the basic region form a persistent helical turn contiguous to H(1). In addition, we provide evidence of the existence of internal motions in the backbone of H(1) that are of larger amplitude and longer time-scale (nanoseconds) than the ones in the H(2) and LZ domain. Most interestingly, we note that conformers in the ensemble of calculated structures have highly conserved basic residues (located in the persistent helical turn of the basic region and in the loop) known to be important for specific binding in a conformation that matches that of the DNA-bound state. These partially prefolded conformers can directly fit into the major groove of DNA and as such are proposed to lie on the pathway leading to the reversible and specific DNA binding. In these conformers, the conserved basic side-chains form a cluster that elevates the local electrostatic potential and could provide the necessary driving force for the generation of the internal motions localized in the H(1) and therefore link structural determinants with the DNA binding function. Overall, our results suggests that the Max homodimeric b/H(1)LH(2)/LZ can rapidly and preferentially bind DNA sequence through transient and partially prefolded states and subsequently, adopt the fully helical bound state in a DNA-assisted mechanism or induced-fit.

Interactions of Ku70/80 with Double-Strand DNA: Energetic, Dynamics, and Functional Implications

NASA Technical Reports Server (NTRS)

Hu, Shaowen; Cucinotta, Francis A.

2010-01-01

Space radiation is a proficient inducer of DNA damage leading to mutation, aberrant cell signaling, and cancer formation. Ku is among the first responding proteins in nucleus to recognize and bind the DNA double strand breaks (DSBs) whenever they are introduced. Once loaded Ku works as a scaffold to recruit other repair factors of non-homologous end joining and facilitates the following repair processes. The crystallographic study of the Ku70/80 heterodimer indicate the core structure of this protein shows virtually no conformational change after binding with DNA. To investigate the dynamical features as well as the energetic characteristics of Ku-DNA binding, we conduct multi-nanosecond molecular dynamics simulations of a modeled Ku70/80 structure and several complexes with two 24-bp DNA duplexes. Free energy calculations show significant energy differences between the complexes with Ku bound at DSBs and those with Ku associated at an internal site of a chromosome. The results also reveal detailed interactions between different nucleotides and the amino acids along the DNA-binding cradle of Ku, indicating subtle binding preference of Ku at specific DNA sequences. The covariance matrix analyses along the trajectories demonstrate the protein is stimulated to undergo correlated motions of different domains once bound to DNA ends. Additionally, principle component analyses identify these low frequency collective motions suitable for binding with and translocation along duplex DNA. It is proposed that the modification of dynamical properties of Ku upon binding with DSBs may provide a signal for the further recruitment of other repair factors such as DNA-PKcs, XLF, and XRCC4.

Nitrative DNA damage induced by multi-walled carbon nanotube via endocytosis in human lung epithelial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guo, Feiye, E-mail: zhizi0269@doc.medic.mie-u.ac.jp; Ma, Ning, E-mail: maning@suzuka-u.ac.jp; Horibe, Yoshiteru, E-mail: violinteru@yahoo.co.jp

Carbon nanotube (CNT) has a promising usage in the field of material science for industrial purposes because of its unique physicochemical property. However, intraperitoneal administration of CNT was reported to cause mesothelioma in experimental animals. Chronic inflammation may contribute to carcinogenesis induced by fibrous materials. 8-Nitroguanine is a mutagenic DNA lesion formed during inflammation and may play a role in CNT-induced carcinogenesis. In this study, we examined 8-nitroguanine formation in A549 human lung alveolar epithelial cells treated with multi-walled CNT (MWCNT) by fluorescent immunocytochemistry. Both MWCNTs with diameter of 20–30 nm (CNT20) and 40–70 nm (CNT40) significantly induced 8-nitroguanine formationmore » at 5 and 10 μg/ml (p < 0.05), which persisted for 24 h, although there was no significant difference in DNA-damaging abilities of these MWCNTs. MWCNTs significantly induced the expression of inducible nitric oxide synthase (iNOS) for 24 h (p < 0.05). MWCNTs also significantly increased the level of nitrite, a hydrolysis product of oxidized NO, in the culture supernatant at 4 and 8 h (p < 0.05). MWCNT-induced 8-nitroguanine formation and iNOS expression were largely suppressed by inhibitors of iNOS (1400 W), nuclear factor-κB (Bay11-7082), actin polymerization (cytochalasin D), caveolae-mediated endocytosis (methyl-β-cyclodextrin, MBCD) and clathrin-mediated endocytosis (monodansylcadaverine, MDC). Electron microscopy revealed that MWCNT was mainly located in vesicular structures in the cytoplasm, and its cellular internalization was reduced by MBCD and MDC. These results suggest that MWCNT is internalized into cells via clathrin- and caveolae-mediated endocytosis, leading to inflammatory reactions including iNOS expression and resulting nitrative DNA damage, which may contribute to carcinogenesis. Highlights: ►Multi-walled carbon nanotube (MWCNT) caused DNA damage in A549 cells. ►MWCNT formed 8-nitroguanine, a DNA lesion associated with inflammatory response. ►MWCNT was internalized into cells via caveolin- and clathrin-mediated endocytosis. ►8-Nitroguanine formation and iNOS expression involved these types of endocytosis. ►Internalized MWCNT plays a key role in inflammatory response and DNA damage.« less

Tribute to dr louis keith: twin and physician extraordinaire/twin research reports: influences on asthma severity; chimerism revisited; DNA strand break repair/media reports: twins born apart; elevated twin frequencies; celebrity father of twins; conjoined twinning.

PubMed

Segal, Nancy L

2014-10-01

The International Society for Twin Studies has lost a valued friend and colleague. Dr Louis Keith, Emeritus Professor of Obstetrics and Gynecology at Northwestern University, in Chicago, passed away on Sunday, July 6, 2014. His life and work with twins will be acknowledged at the November 2014 International Twin Congress in Budapest, Hungary. Next, twin research reports on the severity of asthma symptoms, a case of chimerism, and factors affecting DNA breakage and repair mechanisms are reviewed. Media reports cover twins born apart, elevated twin frequencies, a celebrity father of twins, and a family's decision to keep conjoined twins together.

Long Non-coding RNA, PANDA, Contributes to the Stabilization of p53 Tumor Suppressor Protein.

PubMed

Kotake, Yojiro; Kitagawa, Kyoko; Ohhata, Tatsuya; Sakai, Satoshi; Uchida, Chiharu; Niida, Hiroyuki; Naemura, Madoka; Kitagawa, Masatoshi

2016-04-01

P21-associated noncoding RNA DNA damage-activated (PANDA) is induced in response to DNA damage and represses apoptosis by inhibiting the function of nuclear transcription factor Y subunit alpha (NF-YA) transcription factor. Herein, we report that PANDA affects regulation of p53 tumor-suppressor protein. U2OS cells were transfected with PANDA siRNAs. At 72 h post-transfection, cells were subjected to immunoblotting and quantitative reverse transcription-polymerase chain reaction. Depletion of PANDA was associated with decreased levels of p53 protein, but not p53 mRNA. The stability of p53 protein was markedly reduced by PANDA silencing. Degradation of p53 protein by silencing PANDA was prevented by treatment of MG132, a proteasome inhibitor. Moreover, depletion of PANDA prevented accumulation of p53 protein, as a result of DNA damage, induced by the genotoxic agent etoposide. These results suggest that PANDA stabilizes p53 protein in response to DNA damage, and provide new insight into the regulatory mechanisms of p53. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Chapter 23: International Standard reagents for harmonization of HPV serology and DNA assays--an update.

PubMed

Pagliusi, Sonia R; Dillner, Joakim; Pawlita, Michael; Quint, Wim G V; Wheeler, Cosette M; Ferguson, M

2006-08-31

International reference materials such as International Standard reagents facilitate quality assurance of essential biopharmaceutical products and related in vitro diagnostic tests. Standardization of antibody and DNA measurements and harmonization of laboratory procedures are key to the success of cancer prevention strategies through screening methods as well as for development and implementation of vaccination against the human papillomavirus (HPV). The WHO supported the preparation and initial analysis of a panel of candidate serological and DNA reference reagents aimed at facilitating inter-laboratory comparisons and detection of HPV worldwide. Two international collaborative studies assessed the performance of various HPV antibody and HPV-DNA detection assays and examined the feasibility of generating HPV antibody and DNA standard reagents. These studies showed that improvement in performance and comparability of assays is urgently needed and that the use of the same International Standard reference reagent could significantly improve performance and comparability. It is hoped that the establishment of International Units and International Standards for HPV antibody and DNA analysis will be pursued with high priority.

Beyond the Central Dogma: Bringing Epigenetics into the Classroom

ERIC Educational Resources Information Center

Drits-Esser, Dina; Malone, Molly; Barber, Nicola C.; Stark, Louisa A.

2014-01-01

Epigenetics is the study of how external factors and internal cellular signals can lead to changes in the packaging and processing of DNA sequences, thereby altering the expression of genes and traits. Exploring the epigenome introduces students to environmental influences on our genes and the complexities of gene expression. A supplemental…

The H3-H4 N-Terminal Tail Domains Are the Primary Mediators of Transcription Factor IIIA Access to 5S DNA within a Nucleosome

PubMed Central

Vitolo, Joseph M.; Thiriet, Christophe; Hayes, Jeffrey J.

2000-01-01

Reconstitution of a DNA fragment containing a Xenopus borealis somatic type 5S rRNA gene into a nucleosome greatly restricts the binding of transcription factor IIIA (TFIIIA) to its cognate DNA sequence within the internal promoter of the gene. Removal of all core histone tail domains by limited trypsin proteolysis or acetylation of the core histone tails significantly relieves this inhibition and allows TFIIIA to exhibit high-affinity binding to nucleosomal DNA. Since only a single tail or a subset of tails may be primarily responsible for this effect, we determined whether removal of the individual tail domains of the H2A-H2B dimer or the H3-H4 tetramer affects TFIIIA binding to its cognate DNA site within the 5S nucleosome in vitro. The results show that the tail domains of H3 and H4, but not those of H2A and/or H2B, directly modulate the ability of TFIIIA to bind nucleosomal DNA. In vitro transcription assays carried out with nucleosomal templates lacking individual tail domains show that transcription efficiency parallels the binding of TFIIIA. In addition, we show that the stoichiometry of core histones within the 5S DNA-core histone-TFIIIA triple complex is not changed upon TFIIIA association. Thus, TFIIIA binding occurs by displacement of H2A-H2B–DNA contacts but without complete loss of the dimer from the nucleoprotein complex. These data, coupled with previous reports (M. Vettese-Dadey, P. A. Grant, T. R. Hebbes, C. Crane-Robinson, C. D. Allis, and J. L. Workman, EMBO J. 15:2508–2518, 1996; L. Howe, T. A. Ranalli, C. D. Allis, and J. Ausio, J. Biol. Chem. 273:20693–20696, 1998), suggest that the H3/H4 tails are the primary arbiters of transcription factor access to intranucleosomal DNA. PMID:10688663

Designed Transcriptional Regulation in Mammalian Cells Based on TALE- and CRISPR/dCas9.

PubMed

Lebar, Tina; Jerala, Roman

2018-01-01

Transcriptional regulation lies at the center of many cellular processes and is the result of cellular response to different external and internal signals. Control of transcription of selected genes enables an unprecedented access to shape the cellular response. While orthogonal transcription factors from bacteria, yeast, plants, or other cells have been used to introduce new cellular logic into mammalian cells, the discovery of designable modular DNA binding domains, such as Transcription Activator-Like Effectors (TALEs) and the CRISPR system, enable targeting of almost any selected DNA sequence. Fusion or conditional association of DNA targeting domain with transcriptional effector domains enables controlled regulation of almost any endogenous or ectopic gene. Moreover, the designed regulators can be linked into genetic circuits to implement complex responses, such as different types of Boolean functions and switches. In this chapter, we describe the protocols for achieving efficient transcriptional regulation with TALE- and CRISPR-based designed transcription factors in mammalian cells.

Evaluating droplet digital PCR for the quantification of human genomic DNA: converting copies per nanoliter to nanograms nuclear DNA per microliter.

PubMed

Duewer, David L; Kline, Margaret C; Romsos, Erica L; Toman, Blaza

2018-05-01

The highly multiplexed polymerase chain reaction (PCR) assays used for forensic human identification perform best when used with an accurately determined quantity of input DNA. To help ensure the reliable performance of these assays, we are developing a certified reference material (CRM) for calibrating human genomic DNA working standards. To enable sharing information over time and place, CRMs must provide accurate and stable values that are metrologically traceable to a common reference. We have shown that droplet digital PCR (ddPCR) limiting dilution end-point measurements of the concentration of DNA copies per volume of sample can be traceably linked to the International System of Units (SI). Unlike values assigned using conventional relationships between ultraviolet absorbance and DNA mass concentration, entity-based ddPCR measurements are expected to be stable over time. However, the forensic community expects DNA quantity to be stated in terms of mass concentration rather than entity concentration. The transformation can be accomplished given SI-traceable values and uncertainties for the number of nucleotide bases per human haploid genome equivalent (HHGE) and the average molar mass of a nucleotide monomer in the DNA polymer. This report presents the considerations required to establish the metrological traceability of ddPCR-based mass concentration estimates of human nuclear DNA. Graphical abstract The roots of metrological traceability for human nuclear DNA mass concentration results. Values for the factors in blue must be established experimentally. Values for the factors in red have been established from authoritative source materials. HHGE stands for "haploid human genome equivalent"; there are two HHGE per diploid human genome.

Multicomponent DNA carrier with a vesicular stomatitis virus G-peptide greatly enhances liver-targeted gene expression in mice.

PubMed

Schuster, M J; Wu, G Y; Walton, C M; Wu, C H

1999-01-01

Genes can be targeted to hepatocytes in vitro and in vivo by the use of asialoorosomucoid-polylysine conjugates. After systemic application, this nonviral vector is recognized by highly selective asialoglycoprotein (AsGP) receptors on the sinusoidal liver cell membrane and is taken up via receptor-mediated endocytosis. As most of the DNA is rapidly transferred to lysosomes where it is degraded, transfection efficiency is low and gene expression transient. To address this problem, we incorporated a pH-dependent synthetic hemolytic peptide derived of the G-protein of Vesicular Stomatitis Virus (VSV) into the gene transfer system, to increase endosomal escape of internalized DNA. The multicomponent carrier binds DNA in a nondamaging way, is still recognized by the AsGP receptor, and is targeted to the liver in vivo. Injection of DNA complexes containing a luciferase marker gene resulted in luciferase expression of 29 000 pg/g liver which corresponded to an increase of a factor of 10(3) overexpression after injection of DNA complexes without endosomolytic peptide. Furthermore, the amount of intact transgene within isolated liver cell nuclei was increased by a factor of 10(1)-10(2) by the use of the multicomponent carriers. These results demonstrate that incorporation of a hemolytic peptide into a nonviral vector can greatly increase gene expression while retaining cell type targetability in vivo.

Effects of radiation on DNA's double helix

NASA Technical Reports Server (NTRS)

2003-01-01

The blueprint of life, DNA's double helix is found in the cells of everything from bacteria to astronauts. Exposure to radiation(depicted at right) such as X-rays (upper) or heavy ion particles (lower), can damage DNA and cause dire consequences both to the organism itself and to future generations. One of NASA's main goals is to develop better radiation shielding materials to protect astronauts from destructive radiation in space. This is particularly important for long space missions. NASA has selected researchers to study materials that provide better shielding. This research is managed by NASA's Office of Biological and Physical Research and is supported by the Microgravity Science and Applications Department at NASA's Marshall Center. During International Space Station Expedition Six, the Extravehicular Activity Radiation Monitoring (EVARM) will continue to measure radiation dosage encountered by the eyes, internal organs and skin during specific spacewalks, and relate it to the type of activity, location and other factors. An analysis of this information may be useful in mitigating potential exposure to space walkers in the future. (Illustration by Dr. Frank Cucinotta, NASA/Johnson Space Center, and Prem Saganti, Lockheed Martin)

Discovery of a Regulatory Motif for Human Satellite DNA Transcription in Response to BATF2 Overexpression.

PubMed

Bai, Xuejia; Huang, Wenqiu; Zhang, Chenguang; Niu, Jing; Ding, Wei

2016-03-01

One of the basic leucine zipper transcription factors, BATF2, has been found to suppress cancer growth and migration. However, little is known about the genes downstream of BATF2. HeLa cells were stably transfected with BATF2, then chromatin immunoprecipitation-sequencing was employed to identify the DNA motifs responsive to BATF2. Comprehensive bioinformatics analyses indicated that the most significant motif discovered as TTCCATT[CT]GATTCCATTC[AG]AT was primarily distributed among the chromosome centromere regions and mostly within human type II satellite DNA. Such motifs were able to prime the transcription of type II satellite DNA in a directional and asymmetrical manner. Consistently, satellite II transcription was up-regulated in BATF2-overexpressing cells. The present study provides insight into understanding the role of BATF2 in tumours and the importance of satellite DNA in the maintenance of genomic stability. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Sensitive single-stage PCR using custom-synthesized internal controls.

PubMed

Zimmermann, K; Rieger, M; Gross, P; Turecek, P L; Schwarz, H P

2000-04-01

A new approach for an internally controlled PCR was developed using a custom-synthesized oligonucleotide as the internal control. Three different PCR setups demonstrated the usefulness of this approach: (i) the addition of the respective internal control to samples containing ssDNA virus Parvo B19; (ii) the co-extraction of plasma samples and the respective internal control for the detection of the ssDNA virus TTV; and (iii) the addition of the respective internal control to a crude lysate of tail pieces for the genotyping of FVIII knockout mice, demonstrating that this approach is also applicable for dsDNA.

A biological evaluation of DNA damage detected by comet assay in healthy populations residing in areas that differ in lung cancer incidence.

PubMed

Heepchantree, Worapa; Paratasilpin, Thipmani; Kangwanpong, Daoroong

2006-06-01

The comet assay was performed to evaluate the effect of environmental exposure between human populations residing in two areas that differ in lung cancer incidence, Saraphi (n = 91) and Chom Thong (n = 94). Three parameters, the tail length, tail intensity, and tail moment, were used to detect DNA damage in peripheral blood and stimulated lymphocytes with and without the DNA repair inhibitor, aphidicolin. Internal standards, cryopreserved isolated lymphocytes, and isolated lymphocytes irradiated with 2 Gy gamma rays, were used to correct the interexperimental variability. Results revealed a significant difference between two populations only when the tail length was used to measure DNA damage. The evaluation of various potential confounding factors, such as gender, pesticide exposure, smoking, alcohol drinking, and fermented tea leaf or betel nut chewing, indicated no significant influence in DNA damage. In conclusion, significant difference in DNA damage, detected only by tail length between the two populations residing in the areas with different incidence of lung cancer, may reflect a nonhazardous level of exposure to toxic substances.

Factors influencing parents' decision to donate their healthy infant's DNA for minimal-risk genetic research.

PubMed

Hatfield, Linda A; Pearce, Margaret M

2014-11-01

To examine factors that influence a parent's decision to donate their healthy infant's DNA for minimal-risk genetic research. Grounded theory, using semi-structured interviews conducted with 35 postpartum mother or mother-father dyads in an urban teaching hospital. Data were collected from July 2011 to January 2012. Audiorecorded semistructured interviews were conducted in private rooms with mothers or mother-father dyads 24 to 48 hr after the birth of their healthy, full-term infant. Data-driven content analysis using selected principles of grounded theory was performed. Parents' willingness to donate their healthy infant's DNA for minimal-risk pediatric genetic research emerged as a process involving three interacting components: the parents, the scientist, and the comfort of the child embedded within the context of benefit to the child. The purpose of the study and parents' perception of their commitment of time and resources determined their willingness to participate. The scientist's ability to communicate trust in the research process influenced parents' decisions. Physical discomfort of the child shaped parents' decision to donate DNA. Parental perception of a direct benefit to their child affected their willingness to discuss genetic research and its outcomes. Significant gaps and misunderstandings in parental knowledge of pediatric genetic research may affect parental willingness to donate their healthy child's DNA. Nurses knowledgeable about the decision-making process parents utilize to donate their healthy infant's DNA for minimal-risk genetic research and the factors influencing that decision are well positioned to educate parents about the role of genetics in health and illness and reassure potential research participants of the value and safeguards in pediatric genetic research. © 2014 Sigma Theta Tau International.

Bacteriophage T4 capsid packaging and unpackaging of DNA and proteins.

PubMed

Mullaney, Julienne M; Black, Lindsay W

2014-01-01

Bacteriophage T4 has proven itself readily amenable to phage-based DNA and protein packaging, expression, and display systems due to its physical resiliency and genomic flexibility. As a large dsDNA phage with dispensable internal proteins and dispensable outer capsid proteins it can be adapted to package both DNA and proteins of interest within the capsid and to display peptides and proteins externally on the capsid. A single 170 kb linear DNA, or single or multiple copies of shorter linear DNAs, of any sequence can be packaged by the large terminase subunit in vitro into protein-containing proheads and give full or partially full capsids. The prohead receptacles for DNA packaging can also display peptides or full-length proteins from capsid display proteins HOC and SOC. Our laboratory has also developed a protein expression, packaging, and processing (PEPP) system which we have found to have advantages over mammalian and bacterial cell systems, including high yield, increased stability, and simplified downstream processing. Proteins that we have produced by the phage PEPP platform include human HIV-1 protease, micrococcal endonuclease from Staphylococcus aureus, restriction endonuclease EcoRI, luciferase, human granulocyte colony stimulating factor (GCSF), green fluorescent protein (GFP), and the 99 amino acid C-terminus of amyloid precursor protein (APP). Difficult to produce proteins that are toxic in mammalian protein expression systems are easily produced, packaged, and processed with the PEPP platform. APP is one example of such a highly refractory protein that has been produced successfully. The methods below describe the procedures for in vitro packaging of proheads with DNA and for producing recombinant T4 phage that carry a gene of interest in the phage genome and produce and internally package the corresponding protein of interest.

Construction and Evaluation of Internal Control DNA for PCR Amplification of Chlamydia trachomatis DNA from Urine Samples

PubMed Central

Betsou, Fotini; Beaumont, Katy; Sueur, Jean Marie; Orfila, Jeanne

2003-01-01

An internal control DNA (ICD) with the same primer binding sequences as the target Chlamydia trachomatis DNA was constructed and evaluated in a PCR assay with immunoenzymatic detection. One hundred urine specimens were tested, and 23 were found to contain inhibitors of the PCR, if not subjected to DNA extraction prior to amplification. Coamplification and detection of the ICD appeared to be a useful method for estimating the effects of inhibitors on C. trachomatis DNA amplification. PMID:12624066

Epigenetics Research on the International Space Station

NASA Technical Reports Server (NTRS)

Love, John; Cooley, Vic

2016-01-01

The International Space Station (ISS) is a state-of-the orbiting laboratory focused on advancing science and technology research. Experiments being conducted on the ISS include investigations in the emerging field of Epigenetics. Epigenetics refers to stably heritable changes in gene expression or cellular phenotype (the transcriptional potential of a cell) resulting from changes in a chromosome without alterations to the underlying DNA nucleotide sequence (the genetic code), which are caused by external or environmental factors, such as spaceflight microgravity. Molecular mechanisms associated with epigenetic alterations regulating gene expression patterns include covalent chemical modifications of DNA (e.g., methylation) or histone proteins (e.g., acetylation, phorphorylation, or ubiquitination). For example, Epigenetics ("Epigenetics in Spaceflown C. elegans") is a recent JAXA investigation examining whether adaptations to microgravity transmit from one cell generation to another without changing the basic DNA of the organism. Mouse Epigenetics ("Transcriptome Analysis and Germ-Cell Development Analysis of Mice in Space") investigates molecular alterations in organ-specific gene expression patterns and epigenetic modifications, and analyzes murine germ cell development during long term spaceflight, as well as assessing changes in offspring DNA. NASA's first foray into human Omics research, the Twins Study ("Differential effects of homozygous twin astronauts associated with differences in exposure to spaceflight factors"), includes investigations evaluating differential epigenetic effects via comprehensive whole genome analysis, the landscape of DNA and RNA methylation, and biomolecular changes by means of longitudinal integrated multi-omics research. And the inaugural Genes in Space student challenge experiment (Genes in Space-1) is aimed at understanding how epigenetics plays a role in immune system dysregulation by assaying DNA methylation in immune cells directly in space using miniPCR technology. In addition, NASA's geneLAB campaign covers the epigenome as part of the "expressome", by employing an innovative open source science platform for multi-investigator high throughput utilization of the ISS. Earth benefits of Epigenetics research onboard the ISS range from contributions to the fundamental understanding of epigenetic phenomena with applications in countermeasure development for biomedical conditions, to the generation of integrated strategies for personalized medicine based on unique physiological responses.

Allosteric control of transcription in GntR family of transcription regulators: A structural overview.

PubMed

Jain, Deepti

2015-07-01

The GntR family of transcription regulators constitutes one of the most abundant family of transcription factors. These modulators are involved in a variety of mechanisms controlling various metabolic processes. GntR family members are typically two domain proteins with a smaller N-terminus domain (NTD) with conserved architecture of winged-helix-turn-helix (wHTH) for DNA binding and a larger C-terminus domain (CTD) or the effector binding domain which is also involved in oligomerization. Interestingly, the CTD shows structural heterogeneity depending upon the type of effector molecule that it binds and displays structural homology to various classes of proteins. Binding of the effector molecule to the CTD brings about a conformational change in the transcription factor such that its affinity for its cognate DNA sequence is altered. This review summarizes the structural information available on the members of GntR family and discusses the common features of the DNA binding and operator recognition within the family. The variation in the allosteric mechanism employed by the members of this family is also discussed. © 2015 International Union of Biochemistry and Molecular Biology.

Analytical Validation of Quantitative Real-Time PCR Methods for Quantification of Trypanosoma cruzi DNA in Blood Samples from Chagas Disease Patients

PubMed Central

Ramírez, Juan Carlos; Cura, Carolina Inés; Moreira, Otacilio da Cruz; Lages-Silva, Eliane; Juiz, Natalia; Velázquez, Elsa; Ramírez, Juan David; Alberti, Anahí; Pavia, Paula; Flores-Chávez, María Delmans; Muñoz-Calderón, Arturo; Pérez-Morales, Deyanira; Santalla, José; Guedes, Paulo Marcos da Matta; Peneau, Julie; Marcet, Paula; Padilla, Carlos; Cruz-Robles, David; Valencia, Edward; Crisante, Gladys Elena; Greif, Gonzalo; Zulantay, Inés; Costales, Jaime Alfredo; Alvarez-Martínez, Miriam; Martínez, Norma Edith; Villarroel, Rodrigo; Villarroel, Sandro; Sánchez, Zunilda; Bisio, Margarita; Parrado, Rudy; Galvão, Lúcia Maria da Cunha; da Câmara, Antonia Cláudia Jácome; Espinoza, Bertha; de Noya, Belkisyole Alarcón; Puerta, Concepción; Riarte, Adelina; Diosque, Patricio; Sosa-Estani, Sergio; Guhl, Felipe; Ribeiro, Isabela; Aznar, Christine; Britto, Constança; Yadón, Zaida Estela; Schijman, Alejandro G.

2015-01-01

An international study was performed by 26 experienced PCR laboratories from 14 countries to assess the performance of duplex quantitative real-time PCR (qPCR) strategies on the basis of TaqMan probes for detection and quantification of parasitic loads in peripheral blood samples from Chagas disease patients. Two methods were studied: Satellite DNA (SatDNA) qPCR and kinetoplastid DNA (kDNA) qPCR. Both methods included an internal amplification control. Reportable range, analytical sensitivity, limits of detection and quantification, and precision were estimated according to international guidelines. In addition, inclusivity and exclusivity were estimated with DNA from stocks representing the different Trypanosoma cruzi discrete typing units and Trypanosoma rangeli and Leishmania spp. Both methods were challenged against 156 blood samples provided by the participant laboratories, including samples from acute and chronic patients with varied clinical findings, infected by oral route or vectorial transmission. kDNA qPCR showed better analytical sensitivity than SatDNA qPCR with limits of detection of 0.23 and 0.70 parasite equivalents/mL, respectively. Analyses of clinical samples revealed a high concordance in terms of sensitivity and parasitic loads determined by both SatDNA and kDNA qPCRs. This effort is a major step toward international validation of qPCR methods for the quantification of T. cruzi DNA in human blood samples, aiming to provide an accurate surrogate biomarker for diagnosis and treatment monitoring for patients with Chagas disease. PMID:26320872

High content analysis of differentiation and cell death in human adipocytes.

PubMed

Doan-Xuan, Quang Minh; Sarvari, Anitta K; Fischer-Posovszky, Pamela; Wabitsch, Martin; Balajthy, Zoltan; Fesus, Laszlo; Bacso, Zsolt

2013-10-01

Understanding adipocyte biology and its homeostasis is in the focus of current obesity research. We aimed to introduce a high-content analysis procedure for directly visualizing and quantifying adipogenesis and adipoapoptosis by laser scanning cytometry (LSC) in a large population of cell. Slide-based image cytometry and image processing algorithms were used and optimized for high-throughput analysis of differentiating cells and apoptotic processes in cell culture at high confluence. Both preadipocytes and adipocytes were simultaneously scrutinized for lipid accumulation, texture properties, nuclear condensation, and DNA fragmentation. Adipocyte commitment was found after incubation in adipogenic medium for 3 days identified by lipid droplet formation and increased light absorption, while terminal differentiation of adipocytes occurred throughout day 9-14 with characteristic nuclear shrinkage, eccentric nuclei localization, chromatin condensation, and massive lipid deposition. Preadipocytes were shown to be more prone to tumor necrosis factor alpha (TNFα)-induced apoptosis compared to mature adipocytes. Importantly, spontaneous DNA fragmentation was observed at early stage when adipocyte commitment occurs. This DNA damage was independent from either spontaneous or induced apoptosis and probably was part of the differentiation program. © 2013 International Society for Advancement of Cytometry. Copyright © 2013 International Society for Advancement of Cytometry.

Transformable DNA Nanocarriers for Plasma Membrane Targeted Delivery of Cytokine

PubMed Central

Sun, Wujin; Ji, Wenyan; Hu, Quanyin; Yu, Jicheng; Wang, Chao; Qian, Chenggen; Hochu, Gabrielle; Gu, Zhen

2016-01-01

Direct delivery of cytokines using nanocarriers holds great promise for cancer therapy. However, the nanometric scale of the vehicles made them susceptible to size-dependent endocytosis, reducing the plasma membrane-associated apoptosis signalling. Herein, we report a tumor microenvironment-responsive and transformable nanocarrier for cell membrane targeted delivery of cytokine. This formulation is comprised of a phospholipase A2 (PLA2) degradable liposome as a shell, and complementary DNA nanostructures (designated as nanoclews) decorated with cytokines as the cores. Utilizing the tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) as a model cytokine, we demonstrate that the TRAIL loaded DNA nanoclews are capable of transforming into nanofibers after PLA2 activation. The nanofibers with micro-scaled lengths efficiently present the loaded TRAIL to death receptors on the cancer cell membrane and amplified the apoptotic signalling with reduced TRAIL internalization. PMID:27131597

Nucleolar Association and Transcriptional Inhibition through 5S rDNA in Mammals

PubMed Central

Fedoriw, Andrew M.; Starmer, Joshua; Yee, Della; Magnuson, Terry

2012-01-01

Changes in the spatial positioning of genes within the mammalian nucleus have been associated with transcriptional differences and thus have been hypothesized as a mode of regulation. In particular, the localization of genes to the nuclear and nucleolar peripheries is associated with transcriptional repression. However, the mechanistic basis, including the pertinent cis- elements, for such associations remains largely unknown. Here, we provide evidence that demonstrates a 119 bp 5S rDNA can influence nucleolar association in mammals. We found that integration of transgenes with 5S rDNA significantly increases the association of the host region with the nucleolus, and their degree of association correlates strongly with repression of a linked reporter gene. We further show that this mechanism may be functional in endogenous contexts: pseudogenes derived from 5S rDNA show biased conservation of their internal transcription factor binding sites and, in some cases, are frequently associated with the nucleolus. These results demonstrate that 5S rDNA sequence can significantly contribute to the positioning of a locus and suggest a novel, endogenous mechanism for nuclear organization in mammals. PMID:22275877

Autoinhibitory mechanisms of ERG studied by molecular dynamics simulations

NASA Astrophysics Data System (ADS)

Lu, Yan; Salsbury, Freddie R.

2015-01-01

ERG, an ETS-family transcription factor, acts as a regulator of differentiation of early hematopoietic cells. It contains an autoinhibitory domain, which negatively regulates DNA-binding. The mechanism of autoinhibitory is still illusive. To understand the mechanism, we study the dynamical properties of ERG protein by molecular dynamics simulations. These simulations suggest that DNA binding autoinhibition associates with the internal dynamics of ERG. Specifically, we find that (1), The N-C terminal correlation in the inhibited ERG is larger than that in uninhibited ERG that contributes to the autoinhibition of DNA-binding. (2), DNA-binding changes the property of the N-C terminal correlation from being anti-correlated to correlated, that is, changing the relative direction of the correlated motions and (3), For the Ets-domain specifically, the inhibited and uninhibited forms exhibit essentially the same dynamics, but the binding of the DNA decreases the fluctuation of the Ets-domain. We also find from PCA analysis that the three systems, even with quite different dynamics, do have highly similar free energy surfaces, indicating that they share similar conformations.

Internal Associations of the Acidic Region of Upstream Binding Factor Control Its Nucleolar Localization.

PubMed

Ueshima, Shuhei; Nagata, Kyosuke; Okuwaki, Mitsuru

2017-11-15

Upstream binding factor (UBF) is a member of the high-mobility group (HMG) box protein family, characterized by multiple HMG boxes and a C-terminal acidic region (AR). UBF is an essential transcription factor for rRNA genes and mediates the formation of transcriptionally active chromatin in the nucleolus. However, it remains unknown how UBF is specifically localized to the nucleolus. Here, we examined the molecular mechanisms that localize UBF to the nucleolus. We found that the first HMG box (HMG box 1), the linker region (LR), and the AR cooperatively regulate the nucleolar localization of UBF1. We demonstrated that the AR intramolecularly associates with and attenuates the DNA binding activity of HMG boxes and confers the structured DNA preference to HMG box 1. In contrast, the LR was found to serve as a nuclear localization signal and compete with HMG boxes to bind the AR, permitting nucleolar localization of UBF1. The LR sequence binds DNA and assists the stable chromatin binding of UBF. We also showed that the phosphorylation status of the AR does not clearly affect the localization of UBF1. Our results strongly suggest that associations of the AR with HMG boxes and the LR regulate UBF nucleolar localization. Copyright © 2017 American Society for Microbiology.

Influence of Internal DNA Pressure on Stability and Infectivity of Phage λ

PubMed Central

Bauer, D. W.; Evilevitch, A.

2016-01-01

Viruses must remain infectious while in harsh extracellular environments. An important aspect of viral particle stability for double-stranded DNA viruses is the energetically unfavorable state of the tightly confined DNA chain within the virus capsid creating pressures of tens of atmospheres. Here we study the influence of internal genome pressure on the thermal stability of viral particles. Using differential scanning calorimetry (DSC) to monitor genome loss upon heating, we find that internal pressure destabilizes the virion, resulting in a smaller activation energy barrier to trigger DNA release. These experiments are complemented by plaque assay and electron microscopy measurements to determine the influence of intra-capsid DNA pressure on the rates of viral infectivity loss. At higher temperatures (65 – 75 °C), failure to retain the packaged genome is the dominant mechanism of viral inactivation. Conversely, at lower temperatures (40 – 55 ºC), a separate inactivation mechanism dominates, which results in non-infectious particles that still retain their packaged DNA. Most significantly, both mechanisms of infectivity loss are directly influenced by internal DNA pressure, with higher pressure resulting in a more rapid rate of inactivation at all temperatures. PMID:26254570

The Budding Yeast Nucleus

PubMed Central

Taddei, Angela; Schober, Heiko; Gasser, Susan M.

2010-01-01

The budding yeast nucleus, like those of other eukaryotic species, is highly organized with respect to both chromosomal sequences and enzymatic activities. At the nuclear periphery interactions of nuclear pores with chromatin, mRNA, and transport factors promote efficient gene expression, whereas centromeres, telomeres, and silent chromatin are clustered and anchored away from pores. Internal nuclear organization appears to be function-dependent, reflecting localized sites for tRNA transcription, rDNA transcription, ribosome assembly, and DNA repair. Recent advances have identified new proteins involved in the positioning of chromatin and have allowed testing of the functional role of higher-order chromatin organization. The unequal distribution of silent information regulatory factors and histone modifying enzymes, which arises in part from the juxtaposition of telomeric repeats, has been shown to influence chromatin-mediated transcriptional repression. Other localization events suppress unwanted recombination. These findings highlight the contribution budding yeast genetics and cytology have made to dissecting the functional role of nuclear structure. PMID:20554704

Potential of DNA barcoding for detecting quarantine fungi.

PubMed

Gao, Ruifang; Zhang, Guiming

2013-11-01

The detection of live quarantine pathogenic fungi plays an important role in guaranteeing regional biological safety. DNA barcoding, an emerging species identification technology, holds promise for the reliable, quick, and accurate detection of quarantine fungi. International standards for phytosanitary guidelines are urgently needed. The varieties of quarantine fungi listed for seven countries/regions, the currently applied detection methods, and the status of DNA barcoding for detecting quarantine fungi are summarized in this study. Two approaches have been proposed to apply DNA barcoding to fungal quarantine procedures: (i) to verify the reliability of known internal transcribed spacer (ITS)/cytochrome c oxidase subunit I (COI) data for use as barcodes, and (ii) to determine other barcodes for species that cannot be identified by ITS/COI. As a unique, standardizable, and universal species identification tool, DNA barcoding offers great potential for integrating detection methods used in various countries/regions and establishing international detection standards based on accepted DNA barcodes. Through international collaboration, interstate disputes can be eased and many problems related to routine quarantine detection methods can be solved for global trade.

α-Phellandrene alters expression of genes associated with DNA damage, cell cycle, and apoptosis in murine leukemia WEHI-3 cells.

PubMed

Lin, Jen-Jyh; Yu, Chien-Chih; Lu, Kung-Wen; Chang, Shu-Jen; Yu, Fu-Shun; Liao, Ching-Lung; Lin, Jaung-Geng; Chung, Jing-Gung

2014-08-01

α-phellandrene (α-PA) is a cyclic monoterpene, present in natural plants such as Schinus molle L. α-PA promotes immune responses in mice in vivo. However, there is no available information on whether α-PA affects gene expression in leukemia cells. The present study determined effects of α-PA on expression levels of genes associated with DNA damage, cell cycle and apoptotic cell death in mouse leukemia WEHI-3 cells. WEHI-3 cells were treated with 10 μM α-PA for 24 h, cells were harvested and total RNA was extracted, and gene expression was analyzed by cDNA microarray. Results indicated that α-PA up-regulated 10 genes 4-fold, 13 by over 3-fold and 175 by over 2-fold; 21 genes were down-regulated by over 4-fold, 26 genes by over 3-fold and expression of 204 genes was altered by at leas 2-fold compared with the untreated control cells. DNA damage-associated genes such as DNA damage-inducer transcript 4 and DNA fragmentation factor were up-regulated by 4-fold and over 2-fold, respectively; cell-cycle check point genes such as cyclin G2 and cyclin-dependent kinases inhibitor 2D and IA (p21) were up-regulated by over 3-fold and over 2-fold, respectively; apoptosis-associated genes such as BCL2/adenovirus EIB interacting protein 3, XIAP-associated factor 1, BCL2 modifying factor, caspase-8 and FADD-like apoptosis regulator were over 2-fold up-regulated. Furthermore, DNA damage-associated gene TATA box binding protein was over 4-fold down-regulated, and D19Ertd652c (DNA segment) over 2-fold down-regulated; cell cycle-associated gene cyclin E2 was over 2-fold down-regulated; apoptosis associated gene growth arrest-specific 5 was over 9-fold down-regulated, Gm5426 (ATP synthase) was over 3-fold down-regulated, and death box polypeptide 33 was over 2-fold down-regulated. Based on these observations, α-PA altered gene expression in WEHI-3 cells in vitro. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Detection of Methylated Circulating DNA as Noninvasive Biomarkers for Breast Cancer Diagnosis

PubMed Central

Cheuk, Isabella Wai Yin; Shin, Vivian Yvonne

2017-01-01

Internationally, breast cancer is the most common female cancer, and is induced by a combination of environmental, genetic, and epigenetic risk factors. Despite the advancement of imaging techniques, invasive sampling of breast epithelial cells is the only definitive diagnostic procedure for patients with breast cancer. To date, molecular biomarkers with high sensitivity and specificity for the screening and early detection of breast cancer are lacking. Recent evidence suggests that the detection of methylated circulating cell-free DNA in the peripheral blood of patients with cancer may be a promising quantitative and noninvasive method for cancer diagnosis. Methylation detection based on a multi-gene panel, rather than on the methylation status of a single gene, may be used to increase the sensitivity and specificity of breast cancer screening. In this review, the results of 14 relevant studies, investigating the efficacy of cell-free DNA methylation screening for breast cancer diagnosis, have been summarized. The genetic risk factors for breast cancer, the methods used for breast cancer detection, and the techniques and limitations related to the detection of cell-free DNA methylation status, have also been reviewed and discussed. From this review, we conclude that the analysis of peripheral blood or other samples to detect differentially methylated cell-free DNA is a promising technique for use in clinical settings, and may improve the sensitivity of screening for both, early detection and disease relapse, and thus improve the future prognosis of patients with breast cancer. PMID:28382090

The microviridae: Diversity, assembly, and experimental evolution.

PubMed

Doore, Sarah M; Fane, Bentley A

2016-04-01

The Microviridae, comprised of ssDNA, icosahedral bacteriophages, are a model system for studying morphogenesis and the evolution of assembly. Historically limited to the φX174-like viruses, recent results demonstrate that this richly diverse family is broadly divided into two groups. The defining feature appears to be whether one or two scaffolding proteins are required for assembly. The single-scaffolding systems contain an internal scaffolding protein, similar to many dsDNA viruses, and have a more complex coat protein fold. The two-scaffolding protein systems (φX174-like) encode an internal and external species, as well as an additional structural protein: a spike on the icosahedral vertices. Here, we discuss recent in silico and in vivo evolutionary analyses conducted with chimeric viruses and/or chimeric proteins. The results suggest 1) how double scaffolding systems can evolve into single and triple scaffolding systems; and 2) how assembly is the critical factor governing adaptation and the maintenance of species boundaries. Copyright © 2016 Elsevier Inc. All rights reserved.

Phylogeny and taxonomy of the genus Gliocephalotrichum.

PubMed

Lombard, L; Serrato-Diaz, L M; Cheewangkoon, R; French-Monar, R D; Decock, C; Crous, P W

2014-06-01

Species in the genus Gliocephalotrichum (= Leuconectria) (Hypocreales, Nectriaceae) are soilborne fungi, associated with post-harvest fruit spoilage of several important tropical fruit crops. Contemporary taxonomic studies of these fungi have relied on morphology and DNA sequence comparisons of the internal transcribed spacer region of the nuclear rDNA (ITS) and the β-tubulin gene regions. Employing DNA sequence data from four loci (β-tubulin, histone H3, ITS, and translation elongation factor 1-alpha) and morphological comparisons, the taxonomic status of the genus Gliocephalotrichum was re-evaluated. As a result five species are newly described, namely G. humicola (Taiwan, soil), G. mexicanum (rambutan fruit from Mexico), G. nephelii (rambutan fruit from Guatemala), G. queenslandicum (Australia, endophytic isolations) and G. simmonsii (rambutan fruit from Guatemala). Although species of Gliocephalotrichum are generally not regarded as important plant pathogens, their ability to cause post-harvest fruit rot could have an impact on fruit export and storage.

Internal vs Fishhook Hairpin DNA: Unzipping Locations and Mechanisms in the α-Hemolysin Nanopore

PubMed Central

2015-01-01

Studies on the interaction of hairpin DNA with the α-hemolysin (α-HL) nanopore have determined hairpin unzipping kinetics, thermodynamics, and sequence-dependent DNA/protein interactions. Missing from these results is a systematic study comparing the unzipping process for fishhook (one-tail) vs internal (two-tail) hairpins when they are electrophoretically driven from the cis to the trans side of α-HL via a 30-mer single-stranded tail. In the current studies, fishhook hairpins showed long unzipping times with one deep blockage current level. In contrast, the internal hairpins demonstrated relatively fast unzipping and a characteristic pulse-like current pattern. These differences were further explored with respect to stem length and sequence context. Further, a series of internal hairpins with asymmetric tails were studied, for which it was determined that a second tail longer than 12 nucleotides results in internal hairpin unzipping behavior, while tail lengths of 6 nucleotides behaved like fishhook hairpins. Interestingly, these studies were able to resolve a current difference of ∼6% between hairpin DNA immobilized in the nanopore waiting to unzip vs the translocating unzipped DNA, with the latter showing a deeper current blockage level. This demonstration of different currents for immobilized and translocating DNA has not been described previously. These results were interpreted as fishhook hairpins unzipping inside the vestibule, while the internal hairpins unzip outside the vestibule of α-HL. Lastly, we used this knowledge to study the unzipping of a long double-stranded DNA (>50 base pairs) outside the vestibule of α-HL. The conclusions drawn from these studies are anticipated to be beneficial in future application of nanopore analysis of nucleic acids. PMID:25333648

Development of internal amplification controls for DNA profiling with the AmpFℓSTR(®) SGM Plus(®) kit.

PubMed

Zahra, Nathalie; Hadi, Sibte; Smith, Judith A; Iyengar, Arati; Goodwin, William

2011-06-01

DNA extracted from forensic samples can be degraded and also contain co-extracted contaminants that inhibit PCR. The effects of DNA degradation and PCR inhibition are often indistinguishable when examining a DNA profile. Two internal amplification controls (IACs) were developed to improve quality control of PCR using the AmpFℓSTR® SGM Plus® kit. The co-amplification of these controls with DNA samples was used to monitor amplification efficiency and detect PCR inhibitors. IAC fragments of 90 and 410 bp (IAC₉₀ and IAC₄₁₀) were generated from the plasmid pBR322 using tailed primers and then amplified with ROX-labelled primers. Co-amplification of IAC₉₀ and IAC₄₁₀ was performed with varying amounts of template DNA, degraded DNA and DNA contaminated with humic acid, heme and indigo dye. Both IAC₉₀ and IAC₄₁₀ were successfully amplified with human DNA without significantly affecting the quality of the DNA profile, even with DNA amounts lower than 0.5 ng. In the presence of inhibitors, the IAC₉₀ signal was still present after all human DNA loci fail to amplify; in contrast, the IAC₄₁₀ signal was reduced or absent at low levels of inhibition. Amplification of the two IACs provided an internal PCR control and allowed partial profiles caused by inhibition to be distinguished from degraded DNA profiles. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The study of genomic DNA adsorption and subsequent interactions using total internal reflection ellipsometry.

PubMed

Nabok, Alexei; Tsargorodskaya, Anna; Davis, Frank; Higson, Séamus P J

2007-10-31

The adsorption of genomic DNA and subsequent interactions between adsorbed and solvated DNA was studied using a novel sensitive optical method of total internal reflection ellipsometry (TIRE), which combines spectroscopic ellipsometry with surface plasmon resonance (SPR). Single strands of DNA of two species of fish (herring and salmon) were electrostatically adsorbed on top of polyethylenimine films deposited upon gold coated glass slides. The ellipsometric spectra were recorded and data fitting utilized to extract optical parameters (thickness and refractive index) of adsorbed DNA layers. The further adsorption of single stranded DNA from an identical source, i.e. herring ss-DNA on herring ss-DNA or salmon ss-DNA on salmon ss-DNA, on the surface was observed to give rise to substantial film thickness increases at the surface of about 20-21 nm. Conversely adsorption of DNA from alternate species, i.e. salmon ss-DNA on herring ss-DNA or herring ss-DNA on salmon ss-DNA, yielded much smaller changes in thickness of 3-5 nm. AFM studies of the surface roughness of adsorbed layers were in line with the TIRE data.

Cellular Response to Bleomycin-Induced DNA Damage in Human Fibroblast Cells in Space

NASA Technical Reports Server (NTRS)

Lu, Tao; Zhang, Ye; Wong, Michael; Stodieck, Louis; Karouia, Fathi; Wu, Honglu

2015-01-01

Outside the protection of the geomagnetic field, astronauts and other living organisms are constantly exposed to space radiation that consists of energetic protons and other heavier charged particles. Whether spaceflight factors, microgravity in particular, have effects on cellular responses to DNA damage induced by exposure to radiation or cytotoxic chemicals is still unknown, as is their impact on the radiation risks for astronauts and on the mutation rate in microorganisms. Although possible synergistic effects of space radiation and other spaceflight factors have been investigated since the early days of the human space program, the published results were mostly conflicting and inconsistent. To investigate effects of spaceflight on cellular responses to DNA damages, human fibroblast cells flown to the International Space Station (ISS) were treated with bleomycin for three hours in the true microgravity environment, which induced DNA damages including double-strand breaks (DSB) similar to the ionizing radiation. Damages in the DNA were measured by the phosphorylation of a histone protein H2AX (g-H2AX), which showed slightly more foci in the cells on ISS than in the ground control. The expression of genes involved in DNA damage response was also analyzed using the PCR array. Although a number of the genes, including CDKN1A and PCNA, were significantly altered in the cells after bleomycin treatment, no significant difference in the expression profile of DNA damage response genes was found between the flight and ground samples. At the time of the bleomycin treatment, the cells on the ISS were found to be proliferating faster than the ground control as measured by the percentage of cells containing positive Ki-67 signals. Our results suggested that the difference in g-H2AX focus counts between flight and ground was due to the faster growth rate of the cells in space, but spaceflight did not affect initial transcriptional responses of the DNA damage response genes to bleomycin treatment.

Cellular Response to Bleomycin-Induced DNA Damage in Human Fibroblast Cells in Space

NASA Technical Reports Server (NTRS)

Lu, Tao; Zhang, Ye; Wong, Michael; Stodieck, Louis; Karouia, Fathi; Wu, Honglu

2015-01-01

Living organisms are constantly exposed to space radiation that consists of energetic protons and other heavier charged particles. Whether spaceflight factors, microgravity in particular, affects on the cellular response to DNA damage induced by exposures to radiation or other toxic chemicals will have an impact on the radiation risks for the astronauts, as well as on the mutation rate in microorganisms, is still an open question. Although the possible synergistic effects of space radiation and other spaceflight factors have been investigated since the early days of the human space program, the published results were mostly conflicting and inconsistent. To investigate the effects of spaceflight on the cellular response to DNA damages, human fibroblast cells flown to the International Space Station (ISS) were treated with bleomycin for three hours in the true microgravity environment, which induces DNA damages including the double strand breaks (DSB) similar to the ionizing radiation. Damage in the DNA was measured by the phosphorylation of a histone protein H2AX (-H2AX), which showed slightly more foci in the cells on ISS than in the ground control. The expression of genes involved in the DNA damage response was also analyzed using the PCR array. Although a number of the genes, including CDKN1A and PCNA, were significantly altered in the cells after bleomycin treatment, no significant difference in the expression profile of DNA damage response genes was found between the flight and ground samples. At the time of the bleomycin treatment, the cells on the ISS were found to be proliferating faster than the ground control as measured by the percentage of cells containing positive Ti-67 signals. Our results suggested that the difference in -H2AX between flight and ground was due to the faster growth rate of the cells in space, but spaceflight did not affect the response of the DNA damage response genes to bleomycin treatment.

Langevin Equation for DNA Dynamics

NASA Astrophysics Data System (ADS)

Grych, David; Copperman, Jeremy; Guenza, Marina

Under physiological conditions, DNA oligomers can contain well-ordered helical regions and also flexible single-stranded regions. We describe the site-specific motion of DNA with a modified Rouse-Zimm Langevin equation formalism that describes DNA as a coarse-grained polymeric chain with global structure and local flexibility. The approach has successfully described the protein dynamics in solution and has been extended to nucleic acids. Our approach provides diffusive mode analytical solutions for the dynamics of global rotational diffusion and internal motion. The internal DNA dynamics present a rich energy landscape that accounts for an interior where hydrogen bonds and base-stacking determine structure and experience limited solvent exposure. We have implemented several models incorporating different coarse-grained sites with anisotropic rotation, energy barrier crossing, and local friction coefficients that include a unique internal viscosity and our models reproduce dynamics predicted by atomistic simulations. The models reproduce bond autocorrelation along the sequence as compared to that directly calculated from atomistic molecular dynamics simulations. The Langevin equation approach captures the essence of DNA dynamics without a cumbersome atomistic representation.

DNA barcoding in the media: does coverage of cool science reflect its social context?

PubMed

Geary, Janis; Camicioli, Emma; Bubela, Tania

2016-09-01

Paul Hebert and colleagues first described DNA barcoding in 2003, which led to international efforts to promote and coordinate its use. Since its inception, DNA barcoding has generated considerable media coverage. We analysed whether this coverage reflected both the scientific and social mandates of international barcoding organizations. We searched newspaper databases to identify 900 English-language articles from 2003 to 2013. Coverage of the science of DNA barcoding was highly positive but lacked context for key topics. Coverage omissions pose challenges for public understanding of the science and applications of DNA barcoding; these included coverage of governance structures and issues related to the sharing of genetic resources across national borders. Our analysis provided insight into how barcoding communication efforts have translated into media coverage; more targeted communication efforts may focus media attention on previously omitted, but important topics. Our analysis is timely as the DNA barcoding community works to establish the International Society for the Barcode of Life.

Multiple Intrinsically Disordered Sequences Alter DNA Binding by the Homeodomain of the Drosophila Hox Protein Ultrabithorax*S⃞

PubMed Central

Liu, Ying; Matthews, Kathleen S.; Bondos, Sarah E.

2008-01-01

During animal development, distinct tissues, organs, and appendages are specified through differential gene transcription by Hox transcription factors. However, the conserved Hox homeodomains bind DNA with high affinity yet low specificity. We have therefore explored the structure of the Drosophila melanogaster Hox protein Ultrabithorax and the impact of its nonhomeodomain regions on DNA binding properties. Computational and experimental approaches identified several conserved, intrinsically disordered regions outside the homeodomain of Ultrabithorax that impact DNA binding by the homeodomain. Full-length Ultrabithorax bound to target DNA 2.5-fold weaker than its isolated homeodomain. Using N-terminal and C-terminal deletion mutants, we demonstrate that the YPWM region and the disordered microexons (termed the I1 region) inhibit DNA binding ∼2-fold, whereas the disordered I2 region inhibits homeodomain-DNA interaction a further ∼40-fold. Binding is restored almost to homeodomain affinity by the mostly disordered N-terminal 174 amino acids (R region) in a length-dependent manner. Both the I2 and R regions contain portions of the activation domain, functionally linking DNA binding and transcription regulation. Given that (i) the I1 region and a portion of the R region alter homeodomain-DNA binding as a function of pH and (ii) an internal deletion within I1 increases Ultrabithorax-DNA affinity, I1 must directly impact homeodomain-DNA interaction energetics. However, I2 appears to indirectly affect DNA binding in a manner countered by the N terminus. The amino acid sequences of I2 and much of the I1 and R regions vary significantly among Ultrabithorax orthologues, potentially diversifying Hox-DNA interactions. PMID:18508761

Identification of potential internal control genes for real-time PCR analysis during stress response in Pyropia haitanensis

NASA Astrophysics Data System (ADS)

Wang, Xia; Feng, Jianhua; Huang, Aiyou; He, Linwen; Niu, Jianfeng; Wang, Guangce

2017-11-01

Pyropia haitanensis has prominent stress-resistance characteristics and is endemic to China. Studies into the stress responses in these algae could provide valuable information on the stress-response mechanisms in the intertidal Rhodophyta. Here, the effects of salinity and light intensity on the quantum yield of photosystem II in Py. haitanensis were investigated using pulse-amplitude-modulation fluorometry. Total RNA and genomic DNA of the samples under different stress conditions were isolated. By normalizing to the genomic DNA quantity, the RNA content in each sample was evaluated. The cDNA was synthesized and the expression levels of seven potential internal control genes were evaluated using qRT-PCR method. Then, we used geNorm, a common statistical algorithm, to analyze the qRT-PCR data of seven reference genes. Potential genes that may constantly be expressed under different conditions were selected, and these genes showed stable expression levels in samples under a salinity treatment, while tubulin, glyceraldehyde-3-phosphate dehydrogenase and actin showed stability in samples stressed by strong light. Based on the results of the pulse amplitude-modulation fluorometry, an absolute quantification was performed to obtain gene copy numbers in certain stress-treated samples. The stably expressed genes as determined by the absolute quantification in certain samples conformed to the results of the geNorm screening. Based on the results of the software analysis and absolute quantification, we proposed that elongation factor 3 and 18S ribosomal RNA could be used as internal control genes when the Py. haitanensis blades were subjected to salinity stress, and that α-tubulin and 18S ribosomal RNA could be used as the internal control genes when the stress was from strong light. In general, our findings provide a convenient reference for the selection of internal control genes when designing experiments related to stress responses in Py. haitanensis.

Lead inhibition of DNA-binding mechanism of Cys(2)His(2) zinc finger proteins.

PubMed

Hanas, J S; Rodgers, J S; Bantle, J A; Cheng, Y G

1999-11-01

The association of lead with chromatin in cells suggests that deleterious metal effects may in part be mediated through alterations in gene function. To elucidate if and how lead may alter DNA binding of cysteine-rich zinc finger proteins, lead ions were analyzed for their ability to alter the DNA binding mechanism of the Cys(2)His(2) zinc finger protein transcription factor IIIA (TFIIIA). As assayed by DNase I protection, the interaction of TFIIIA with the 50-bp internal control region of the 5S ribosomal gene was partially inhibited by 5 microM lead ions and completely inhibited by 10 to 20 microM lead ions. Preincubation of free TFIIIA with lead resulted in DNA-binding inhibition, whereas preincubation of a TFIIIA/5S RNA complex with lead did not result in DNA-binding inhibition. Because 5S RNA binds TFIIIA zinc fingers, this result is consistent with an inhibition mechanism via lead binding to zinc fingers. The complete loss of DNase I protection on the 5S gene indicates the mechanism of inhibition minimally involves the N-terminal fingers of TFIIIA. Inhibition was not readily reversible and occurred in the presence of an excess of beta-mercaptoethanol. Inhibition kinetics were fast, progressing to completion in approximately 5 min. Millimolar concentrations of sulfhydryl-specific arsenic ions were not inhibitory for TFIIIA binding. Micromolar concentrations of lead inhibited DNA binding by Sp1, another Cys(2)His(2) finger protein, but not by the nonfinger protein AP2. Inhibition of Cys(2)His(2) zinc finger transcription factors by lead ions at concentrations near those known to have deleterious physiological effects points to new molecular mechanisms for lead toxicity in promoting disease.

CHRONICITY OF DEPRESSION AND MOLECULAR MARKERS IN A LARGE SAMPLE OF HAN CHINESE WOMEN.

PubMed

Edwards, Alexis C; Aggen, Steven H; Cai, Na; Bigdeli, Tim B; Peterson, Roseann E; Docherty, Anna R; Webb, Bradley T; Bacanu, Silviu-Alin; Flint, Jonathan; Kendler, Kenneth S

2016-04-25

Major depressive disorder (MDD) has been associated with changes in mean telomere length and mitochondrial DNA (mtDNA) copy number. This study investigates if clinical features of MDD differentially impact these molecular markers. Data from a large, clinically ascertained sample of Han Chinese women with recurrent MDD were used to examine whether symptom presentation, severity, and comorbidity were related to salivary telomere length and/or mtDNA copy number (maximum N = 5,284 for both molecular and phenotypic data). Structural equation modeling revealed that duration of longest episode was positively associated with mtDNA copy number, while earlier age of onset of most severe episode and a history of dysthymia were associated with shorter telomeres. Other factors, such as symptom presentation, family history of depression, and other comorbid internalizing disorders, were not associated with these molecular markers. Chronicity of depressive symptoms is related to more pronounced telomere shortening and increased mtDNA copy number among individuals with a history of recurrent MDD. As these molecular markers have previously been implicated in physiological aging and morbidity, individuals who experience prolonged depressive symptoms are potentially at greater risk of adverse medical outcomes. © 2016 Wiley Periodicals, Inc.

Employing 454 amplicon pyrosequencing to reveal intragenomic divergence in the internal transcribed spacer rDNA region in fungi

Treesearch

Daniel L. Lindner; Tor Carlsen; Henrik Nilsson; Marie Davey; Trond Schumacher; Havard. Kauserud

2013-01-01

The rDNA internal transcribed spacer (ITS) region has been accepted as a DNA barcoding marker for fungi and is widely used in phylogenetic studies; however, intragenomic ITS variability has been observed in a broad range of taxa, including prokaryotes, plants, animals, and fungi, and this variability has the potential to inflate species richness estimates in molecular...

Rapid and Simple Detection of Hot Spot Point Mutations of Epidermal Growth Factor Receptor, BRAF, and NRAS in Cancers Using the Loop-Hybrid Mobility Shift Assay

PubMed Central

Matsukuma, Shoichi; Yoshihara, Mitsuyo; Kasai, Fumio; Kato, Akinori; Yoshida, Akira; Akaike, Makoto; Kobayashi, Osamu; Nakayama, Haruhiko; Sakuma, Yuji; Yoshida, Tsutomu; Kameda, Yoichi; Tsuchiya, Eiju; Miyagi, Yohei

2006-01-01

A simple and rapid method to detect the epidermal growth factor receptor hot spot mutation L858R in lung adenocarcinoma was developed based on principles similar to the universal heteroduplex generator technology. A single-stranded oligonucleotide with an internal deletion was used to generate heteroduplexes (loop-hybrids) bearing a loop in the complementary strand derived from the polymerase chain reaction product of the normal or mutant allele. By placing deletion in the oligonucleotide adjacent to the mutational site, difference in electrophoretic mobility between loop-hybrids with normal and mutated DNA was distinguishable in a native polyacrylamide gel. The method was also modified to detect in-frame deletion mutations of epidermal growth factor receptor in lung adenocarcinomas. In addition, the method was adapted to detect hot spot mutations in the B-type Raf kinase (BRAF) at V600 and in a Ras-oncogene (NRAS) at Q61, the mutations commonly found in thyroid carcinomas. Our mutation detection system, designated the loop-hybrid mobility shift assay was sensitive enough to detect mutant DNA comprising 7.5% of the total DNA. As a simple and straightforward mutation detection technique, loop-hybrid mobility shift assay may be useful for the molecular diagnosis of certain types of clinical cancers. Other applications are also discussed. PMID:16931592

Transition between Two Regimes Describing Internal Fluctuation of DNA in a Nanochannel

PubMed Central

Su, Tianxiang; Das, Somes K.; Xiao, Ming; Purohit, Prashant K.

2011-01-01

We measure the thermal fluctuation of the internal segments of a piece of DNA confined in a nanochannel about 50100 nm wide. This local thermodynamic property is key to accurate measurement of distances in genomic analysis. For DNA in 100 nm channels, we observe a critical length scale 10 m for the mean extension of internal segments, below which the de Gennes' theory describes the fluctuations with no fitting parameters, and above which the fluctuation data falls into Odijk's deflection theory regime. By analyzing the probability distributions of the extensions of the internal segments, we infer that folded structures of length 150250 nm, separated by 10 m exist in the confined DNA during the transition between the two regimes. For 50 nm channels we find that the fluctuation is significantly reduced since the Odijk regime appears earlier. This is critical for genomic analysis. We further propose a more detailed theory based on small fluctuations and incorporating the effects of confinement to explicitly calculate the statistical properties of the internal fluctuations. Our theory is applicable to polymers with heterogeneous mechanical properties confined in non-uniform channels. We show that existing theories for the end-to-end extension/fluctuation of polymers can be used to study the internal fluctuations only when the contour length of the polymer is many times larger than its persistence length. Finally, our results suggest that introducing nicks in the DNA will not change its fluctuation behavior when the nick density is below 1 nick per kbp DNA. PMID:21423606

Phylogeny, divergence time and historical biogeography of Laetiporus (Basidiomycota, Polyporales).

PubMed

Song, Jie; Cui, Bao-Kai

2017-04-20

The aim of this study was to characterize the molecular relationship, origin and historical biogeography of the species in important brown rot fungal genus Laetiporus from East Asia, Europe, Pan-America, Hawaii and South Africa. We used six genetic markers to estimate a genus-level phylogeny including (1) the internal transcribed spacer (ITS), (2) nuclear large subunit rDNA (nrLSU), (3) nuclear small subunit rDNA (nrSSU), (4) translation elongation factor 1-α (EF-1α), (5) DNA-directed RNA polymerase II subunit 2 (RPB2), and (6) mitochondrial small subunit rDNA (mtSSU). Results of multi-locus phylogenetic analyses show clade support for at least seventeen species-level lineages including two new Laetiporus in China. Molecular dating using BEAST estimated the present crown group diverged approximately 20.16 million years ago (Mya) in the early Miocene. Biogeographic analyses using RASP indicated that Laetiporus most likely originated in temperate zones with East Asia and North America having the highest probability (48%) of being the ancestral area. Four intercontinental dispersal routes and a possible concealed dispersal route were established for the first time.

Evaluation of DNA damage induced by Auger electrons from 137Cs.

PubMed

Watanabe, Ritsuko; Hattori, Yuya; Kai, Takeshi

2016-11-01

To understand the biological effect of external and internal exposure from 137 Cs, DNA damage spectrum induced by directly emitted electrons (γ-rays, internal conversion electrons, Auger electrons) from 137 Cs was compared with that induced by 137 Cs γ-rays. Monte Carlo track simulation method was used to calculate the microscopic energy deposition pattern in liquid water. Simulation was performed for the two simple target systems in microscale. Radiation sources were placed inside for one system and outside for another system. To simulate the energy deposition by directly emitted electrons from 137 Cs placed inside the system, the multiple ejections of electrons after internal conversion were considered. In the target systems, induction process of DNA damage was modeled and simulated for both direct energy deposition and the water radical reaction on the DNA. The yield and spatial distribution of simple and complex DNA damage including strand breaks and base lesions were calculated for irradiation by electrons and γ-rays from 137 Cs. The simulation showed that the significant difference in DNA damage spectrum was not caused by directly ejected electrons and γ-rays from 137 Cs. The result supports the existing perception that the biological effects by internal and external exposure by 137 Cs are equivalent.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Batal, Mohamed; Département de Toxicologie et Risques Chimiques, Unité de Brûlure Chimique, Institut de Recherche Biomédicale des Armées, Antenne de La Tronche, BP87, F-38702 La Tronche Cedex; Boudry, Isabelle

Sulphur mustard (SM) is a chemical warfare agent that attacks mainly skin, eye and lungs. Due to its lipophilic properties, SM is also able to diffuse through the skin and reach internal organs. DNA represents one of the most critical molecular targets of this powerful alkylating agent which modifies DNA structure by forming monoadducts and biadducts. These DNA lesions are involved in the acute toxicity of SM as well as its long-term carcinogenicity. In the present work we studied the formation and persistence of guanine and adenine monoadducts and guanine biadducts in the DNA of brain, lungs, kidneys, spleen, andmore » liver of SKH-1 mice cutaneously exposed to 2, 6 and 60 mg/kg of SM. SM-DNA adducts were detected in all studied organs, except in liver at the two lowest doses. Brain and lungs were the organs with the highest level of SM-DNA adducts, followed by kidney, spleen and liver. Monitoring the level of adducts for three weeks after cutaneous exposure showed that the lifetime of adducts were not the same in all organs, lungs being the organ with the longest persistence. Diffusion from skin to internal organs was much more efficient at the highest compared to the lowest dose investigated as the result of the loss of the skin barrier function. These data provide novel information on the distribution of SM in tissues following cutaneous exposures and indicate that brain is an important target. - Highlights: • Sulphur mustard reaches internal organs after skin exposure • Adducts are detected in the DNA of internal organs • Brain is the organ with the highest level of DNA damage • The barrier function of skin is lost at high dose of sulphur mustard • DNA adducts persist in organs for 2 or 3 weeks.« less

DNA internalized via caveolae requires microtubule-dependent, Rab7-independent transport to the late endocytic pathway for delivery to the nucleus.

PubMed

Wong, Athena W; Scales, Suzie J; Reilly, Dorothea E

2007-08-03

Using cationic liposomes to mediate gene delivery by transfection has the advantages of improved safety and simplicity of use over viral gene therapy. Understanding the mechanism by which cationic liposome:DNA complexes are internalized and delivered to the nucleus should help identify which transport steps might be manipulated in order to improve transfection efficiencies. We therefore examined the endocytosis and trafficking of two cationic liposomes, DMRIE-C and Lipofectamine LTX, in CHO cells. We found that DMRIE-C-transfected DNA is internalized via caveolae, while LTX-transfected DNA is internalized by clathrin-mediated endocytosis, with both pathways converging at the late endosome or lysosome. Inhibition of microtubule-dependent transport with nocodazole revealed that DMRIE-C:DNA complexes cannot enter the cytosol directly from caveosomes. Lysosomal degradation of transfected DNA has been proposed to be a major reason for poor transfection efficiency. However, in our system dominant negatives of both Rab7 and its effector RILP inhibited late endosome to lysosome transport of DNA complexes and LDL, but did not affect DNA delivery to the nucleus. This suggests that DNA is able to escape from late endosomes without traversing lysosomes and that caveosome to late endosome transport does not require Rab7 function. Lysosomal inhibition with chloroquine likewise had no effect on transfection product titers. These data suggest that DMRIE-C and LTX transfection complexes are endocytosed by separate pathways that converge at the late endosome or lysosome, but that blocking lysosomal traffic does not improve transfection product yields, identifying late endosome/lysosome to nuclear delivery as a step for future study.

21 CFR 864.7280 - Factor V Leiden DNA mutation detection systems.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Factor V Leiden DNA mutation detection systems....7280 Factor V Leiden DNA mutation detection systems. (a) Identification. Factor V Leiden deoxyribonucleic acid (DNA) mutation detection systems are devices that consist of different reagents and...

21 CFR 864.7280 - Factor V Leiden DNA mutation detection systems.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Factor V Leiden DNA mutation detection systems....7280 Factor V Leiden DNA mutation detection systems. (a) Identification. Factor V Leiden deoxyribonucleic acid (DNA) mutation detection systems are devices that consist of different reagents and...

21 CFR 864.7280 - Factor V Leiden DNA mutation detection systems.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Factor V Leiden DNA mutation detection systems....7280 Factor V Leiden DNA mutation detection systems. (a) Identification. Factor V Leiden deoxyribonucleic acid (DNA) mutation detection systems are devices that consist of different reagents and...

21 CFR 864.7280 - Factor V Leiden DNA mutation detection systems.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Factor V Leiden DNA mutation detection systems....7280 Factor V Leiden DNA mutation detection systems. (a) Identification. Factor V Leiden deoxyribonucleic acid (DNA) mutation detection systems are devices that consist of different reagents and...

21 CFR 864.7280 - Factor V Leiden DNA mutation detection systems.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Factor V Leiden DNA mutation detection systems....7280 Factor V Leiden DNA mutation detection systems. (a) Identification. Factor V Leiden deoxyribonucleic acid (DNA) mutation detection systems are devices that consist of different reagents and...

The difference in the stimulation by putrescine of DNA synthesis using DNA polymerase extracts of normal rat liver or of tumour tissue or host liver from tumour-bearing rats.

PubMed

Taguchi, Takahiko; Kurata, Sumiko; Ohashi, Mochihiko

2002-09-01

Putrescine biosynthesis is elevated before DNA replication, and a stimulation of DNA synthesis by 20 mM putrescine has been found using an in vitro DNA synthesizing system. Furthermore, this stimulation of DNA synthesis by putrescine involves a particular factor (factor PA). This factor PA stimulates DNA polymerases alpha, beta, and gamma, and is present in nuclei and mitochondria but not in cytoplasm. Factor PA loses about 80% of its activity by heating at 45 degrees C for 15 min or by hydrolysis with 100 mg ml(-1) Enzygel trypsin. These properties indicate that factor PA is a protein. Its size is estimated to be about 2.1 S. DNA synthesis in nuclear and mitochondrial DNA polymerase extracts from tumour tissues and host livers of tumour-bearing rats are not stimulated by 20 mM putrescine. However, the addition of excess factor PA to DNA synthesizing systems using DNA polymerase extracts from proliferative tissues again results in a stimulation of DNA synthesis by exogenous putrescine. These findings indicate that the stimulatory effect of DNA synthesis in vitro by exogenous putrescine is controlled by the ratio between factor PA and endogenously synthesized putrescine in proliferative tissues or that sent by the bloodstream from proliferative tissues. These results suggest that a non-stimulatory effect of putrescine on DNA synthesis may be diagnostic in tumour-bearing patients. Copyright 2002 John Wiley & Sons, Ltd.

Trace DNA analysis: do you know what your neighbour is doing? A multi-jurisdictional survey.

PubMed

Raymond, Jennifer J; van Oorschot, Roland A H; Walsh, Simon J; Roux, Claude

2008-01-01

Since 1997 the analysis of DNA recovered from handled objects, or 'trace' DNA, has become routine and is frequently demanded from crime scene examinations. However, this analysis often produces unpredictable results. The factors affecting the recovery of full profiles are numerous, and include varying methods of collection and analysis. Communication between forensic laboratories in Australia and New Zealand has been limited in the past, due in some part to sheer distance. Because of its relatively small population and low number of forensic jurisdictions this region is in an excellent position to provide a collective approach. However, the protocols, training methods and research of each jurisdiction had not been widely exchanged. A survey was developed to benchmark the current practices involved in trace DNA analysis, aiming to provide information for training programs and research directions, and to identify factors contributing to the success or failure of the analysis. The survey was divided in to three target groups: crime scene officers, DNA laboratory scientists, and managers of these staff. In late 2004 surveys were sent to forensic organisations in every Australian jurisdiction and New Zealand. A total of 169 completed surveys were received with a return rate of 54%. Information was collated regarding sampling, extraction, amplification and analysis methods, contamination prevention, samples collected, success rates, personnel training and education, and concurrent fingerprinting. The data from the survey responses provided an insight into aspects of trace DNA analysis, from crime scene to interpretation and management. Several concerning factors arose from the survey. Results collation is a significant issue being identified as poor and differing widely, preventing inter-jurisdictional comparison and intra-jurisdictional assessment of both the processes and outputs. A second point of note is the widespread lack of refresher training and proficiency testing, with no set standard for initial training courses. A common theme to these and other issues was the need for a collective approach to training and methodology in trace DNA analysis. Trace DNA is a small fraction of the evidence available in current investigations, and parallels to these results and problems will no doubt be found in other forensic disciplines internationally. The significant point to be realised from this study is the need for effective communication lines between forensic organisations to ensure that best practice is followed, ideally with a cohesive pan-jurisdictional approach.

Role of the DNA Damage Response in Human Papillomavirus RNA Splicing and Polyadenylation.

PubMed

Nilsson, Kersti; Wu, Chengjun; Schwartz, Stefan

2018-06-12

Human papillomaviruses (HPVs) have evolved to use the DNA repair machinery to replicate its DNA genome in differentiated cells. HPV activates the DNA damage response (DDR) in infected cells. Cellular DDR factors are recruited to the HPV DNA genome and position the cellular DNA polymerase on the HPV DNA and progeny genomes are synthesized. Following HPV DNA replication, HPV late gene expression is activated. Recent research has shown that the DDR factors also interact with RNA binding proteins and affects RNA processing. DDR factors activated by DNA damage and that associate with HPV DNA can recruit splicing factors and RNA binding proteins to the HPV DNA and induce HPV late gene expression. This induction is the result of altered alternative polyadenylation and splicing of HPV messenger RNA (mRNA). HPV uses the DDR machinery to replicate its DNA genome and to activate HPV late gene expression at the level of RNA processing.

Energetics of genome ejection from phage revealed by isothermal titration calorimetry

NASA Astrophysics Data System (ADS)

Jeembaeva, Meerim; Jonsson, Bengt; Castelnovo, Martin; Evilevitch, Alex

2009-03-01

It has been experimentally shown that ejection of double-stranded DNA from phage is driven by internal pressure reaching tens of atmospheres. This internal pressure is partially responsible for delivery of DNA into the host cell. While several theoretical models and simulations nicely describe the experimental data of internal forces either resisting active packaging or equivalently favoring spontaneous ejection, there are no direct energy measurements available that would help to verify how quantitative these theories are. We performed direct measurements of the enthalpy responsible for DNA ejection from phage λ, using Isothermal Titration Calorimetry. The phage capsids were ``opened'' in vitro by titrating λ into a solution with LamB receptor and the enthalpy of DNA ejection process was measured. In his way, enthalpy stored in λ was determined as a function of packaged DNA length comparing wild-type phage λ (48.5 kb) with a shorter λ-DNA length mutant (37.7 kb). The temperature dependence of the ejection enthalpy was also investigated. The values obtained were in good agreement with existing models and provide a better understanding of ds- DNA packaging and release mechanisms in motor-packaged viruses (e.g., tailed bacteriophages, Herpes Simplex, and adenoviruses).

Functional interaction of the DNA-binding transcription factor Sp1 through its DNA-binding domain with the histone chaperone TAF-I.

PubMed

Suzuki, Toru; Muto, Shinsuke; Miyamoto, Saku; Aizawa, Kenichi; Horikoshi, Masami; Nagai, Ryozo

2003-08-01

Transcription involves molecular interactions between general and regulatory transcription factors with further regulation by protein-protein interactions (e.g. transcriptional cofactors). Here we describe functional interaction between DNA-binding transcription factor and histone chaperone. Affinity purification of factors interacting with the DNA-binding domain of the transcription factor Sp1 showed Sp1 to interact with the histone chaperone TAF-I, both alpha and beta isoforms. This interaction was specific as Sp1 did not interact with another histone chaperone CIA nor did other tested DNA-binding regulatory factors (MyoD, NFkappaB, p53) interact with TAF-I. Interaction of Sp1 and TAF-I occurs both in vitro and in vivo. Interaction with TAF-I results in inhibition of DNA-binding, and also likely as a result of such, inhibition of promoter activation by Sp1. Collectively, we describe interaction between DNA-binding transcription factor and histone chaperone which results in negative regulation of the former. This novel regulatory interaction advances our understanding of the mechanisms of eukaryotic transcription through DNA-binding regulatory transcription factors by protein-protein interactions, and also shows the DNA-binding domain to mediate important regulatory interactions.

Rapid discrimination of sequences flanking and within T-DNA insertions in the Arabidopsis genome.

PubMed

Ponce, M R; Quesada, V; Micol, J L

1998-05-01

An improvement to previous methods for recovering Arabidopsis thaliana genomic DNA flanking T-DNA insertions is presented that allows for the avoidance of some of the cloning difficulties caused by the concatameric nature of T-DNA inserts. The principle of the procedure is to categorize by size restriction fragments of mutant DNA, produced in separate digestions with NdeI and Bst1107I. Given that the sites for these two enzymes are contiguous within the pGV3850:1003 T-DNA construct, the restriction fragments obtained fall into two categories: those showing identical size in both digestions, which correspond to sequences internal to T-DNA concatamers; and those of different sizes, that contain the junctions between plant DNA and the T-DNA insert. Such a criterion makes it possible to easily distinguish the digestion products corresponding to internal T-DNA parts, which do not deserve further attention, and those which presumably include a segment of the locus of interest. Discrimination between restriction fragments of genomic mutant DNA can be made on rescued plasmids, inverse PCR amplification products or bands in a genomic blot.

Assessment of Telomere Length, Phenotype, and DNA Content

PubMed Central

Kelesidis, Theodoros; Schmid, Ingrid

2017-01-01

Telomere sequences at the end of chromosomes control somatic cell division; therefore, telomere length in a given cell population provides information about its replication potential. This unit describes a method for flow cytometric measurement of telomere length in subpopulations using fluorescence in situ hybridization of fluorescently-labeled probes (Flow-FISH) without prior cell separation. After cells are stained for surface immunofluorescence, antigen-antibody complexes are covalently cross-linked onto cell membranes before FISH with a telomere-specific probe. Cells with long telomeres are included as internal standards. Addition of a DNA dye permits exclusion of proliferating cells during data analysis. DNA ploidy measurements of cells of interest and internal standard are performed on separate aliquots in parallel to Flow-FISH. Telomere fluorescence of G0/1 cells of subpopulations and internal standards obtained from Flow-FISH are normalized for DNA ploidy, and telomere length in subsets of interest is expressed as a fraction of the internal standard telomere length. PMID:28055113

Assessment of Telomere Length, Phenotype, and DNA Content.

PubMed

Kelesidis, Theodoros; Schmid, Ingrid

2017-01-05

Telomere sequences at the end of chromosomes control somatic cell division; therefore, telomere length in a given cell population provides information about its replication potential. This unit describes a method for flow cytometric measurement of telomere length in subpopulations using fluorescence in situ hybridization of fluorescently-labeled probes (Flow-FISH) without prior cell separation. After cells are stained for surface immunofluorescence, antigen-antibody complexes are covalently cross-linked onto cell membranes before FISH with a telomere-specific probe. Cells with long telomeres are included as internal standards. Addition of a DNA dye permits exclusion of proliferating cells during data analysis. DNA ploidy measurements of cells of interest and internal standard are performed on separate aliquots in parallel to Flow-FISH. Telomere fluorescence of G 0/1 cells of subpopulations and internal standards obtained from Flow-FISH are normalized for DNA ploidy, and telomere length in subsets of interest is expressed as a fraction of the internal standard telomere length. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

Competitor internal standards for quantitative detection of mycoplasma DNA.

PubMed

Sidhu, M K; Rashidbaigi, A; Testa, D; Liao, M J

1995-05-01

Homologous internal controls were used as competitor DNA in the polymerase chain reaction for the quantitative detection of mycoplasma DNA. PCR primer sets were designed on the basis of the most conserved nucleotide sequences of the 16S rRNA gene of mycoplasma species. Amplification of this gene was examined in five different mycoplasma species: Mycoplasma orale, M. hyorhinus, M. synoviae, M. gallisepticum and M. pneumoniae. To evaluate the primers, a number of different cell lines were assayed for the detection of mycoplasma infections. All positive cell lines showed a distinct product on agarose gels while uninfected cells showed no DNA amplification. Neither bacterial nor eukaryotic DNA produced any cross-reaction with the primers used, thus confirming their specificity. Internal control DNA to be used for quantitation was constructed by modifying the sizes of the wild-type amplified products and cloning them in plasmid vectors. These controls used the same primer binding sites as the wild-type and the amplified products were differentiated by a size difference. The detection limits for all the mycoplasma species by competitive quantitative PCR were estimated to range from 4 to 60 genome copies per assay as determined by ethidium bromide-stained agarose gels. These internal standards also serve as positive controls in PCR-based detection of mycoplasma DNA, and therefore accidental contamination of test samples with wild-type positive controls can be eliminated. The quantitative PCR method developed will be useful in monitoring the progression and significance of mycoplasma in the disease process.

Advances in Biotechnology and Genetic Engineering: Implications for the Development of New Biological Warfare Agents

DTIC Science & Technology

1996-06-01

GenPharm International, Inc. created the first transgenic dairy cow . The cow was used to produce human milk proteins for infant formula. 1990 A four...engineering techniques, biological compounds such as human insulin , growth hormone, and blood clotting factors can be produced in fermentors containing...the gene for rat insulin . 1977 Walter Gilbert and Allan Maxam at Harvard University devised a method for sequencing DNA using chemicals rather than

Biotechnology

NASA Image and Video Library

2003-01-22

The blueprint of life, DNA's double helix is found in the cells of everything from bacteria to astronauts. Exposure to radiation(depicted at right) such as X-rays (upper) or heavy ion particles (lower), can damage DNA and cause dire consequences both to the organism itself and to future generations. One of NASA's main goals is to develop better radiation shielding materials to protect astronauts from destructive radiation in space. This is particularly important for long space missions. NASA has selected researchers to study materials that provide better shielding. This research is managed by NASA's Office of Biological and Physical Research and is supported by the Microgravity Science and Applications Department at NASA's Marshall Center. During International Space Station Expedition Six, the Extravehicular Activity Radiation Monitoring (EVARM) will continue to measure radiation dosage encountered by the eyes, internal organs and skin during specific spacewalks, and relate it to the type of activity, location and other factors. An analysis of this information may be useful in mitigating potential exposure to space walkers in the future. (Illustration by Dr. Frank Cucinotta, NASA/Johnson Space Center, and Prem Saganti, Lockheed Martin)

Proteopedia: 3D Visualization and Annotation of Transcription Factor-DNA Readout Modes

ERIC Educational Resources Information Center

Dantas Machado, Ana Carolina; Saleebyan, Skyler B.; Holmes, Bailey T.; Karelina, Maria; Tam, Julia; Kim, Sharon Y.; Kim, Keziah H.; Dror, Iris; Hodis, Eran; Martz, Eric; Compeau, Patricia A.; Rohs, Remo

2012-01-01

3D visualization assists in identifying diverse mechanisms of protein-DNA recognition that can be observed for transcription factors and other DNA binding proteins. We used Proteopedia to illustrate transcription factor-DNA readout modes with a focus on DNA shape, which can be a function of either nucleotide sequence (Hox proteins) or base pairing…

Detection of herpes simplex virus and varicella-zoster virus in clinical swabs: frequent inhibition of PCR as determined by internal controls.

PubMed

Bezold, G; Volkenandt, M; Gottlöber, P; Peter, R U

2000-12-01

PCR-based detection of microorganisms is widely used for diagnostic purposes. Most routine PCR applications do not control for inhibition of PCR, thus leading to false-negative results. One hundred eighteen swab samples obtained from skin and mucosa were investigated for the presence of herpes simplex virus (HSV), varicella-zoster virus (VZV), and the control gene betaglobin by internally controlled PCR with purified and unpurified DNA in parallel. With unpurified DNA, inhibition of PCR was detected in 23% of betaglobin PCRs, 25% of VZV PCRs, and 16% of HSV PCRs versus 3% each for purified DNA. Approximately 20% of the samples with positive results for HSV or VZV had negative or inhibited results using unpurified DNA. These results indicate that PCR from clinical swab specimens should be performed exclusively with internal controls because the positive control alone cannot exclude PCR inhibition in individual samples. Purification of DNA will decrease, but not exclude, PCR inhibition.

The Development and Use of Internal Amplification Controls (IACs) with DNA Profiling Kits for Forensic DNA Analysis.

PubMed

Zahra, Nathalie; Goodwin, William

2016-01-01

Biological samples recovered for forensic investigations are often degraded and/or have low amounts of DNA; in addition, in some instances the samples may be contaminated with chemicals that can act as PCR inhibitors. As a consequence this can make interpretation of the results challenging with the possibility of having partial profiles and false negative results. Because of the impact of DNA analysis on forensic investigations, it is important to monitor the process of DNA profiling, in particular the amplification reaction. In this chapter we describe a method for the in-house generation and use of internal amplification controls (IACs) with DNA profiling kits to monitor the success of the PCR proces. In the example we show the use of the SGM Plus® kit. These controls can also be used to aid the interpretation of the DNA profile.

Paramecium tetraurelia chromatin assembly factor-1-like protein PtCAF-1 is involved in RNA-mediated control of DNA elimination.

PubMed

Ignarski, Michael; Singh, Aditi; Swart, Estienne C; Arambasic, Miroslav; Sandoval, Pamela Y; Nowacki, Mariusz

2014-10-29

Genome-wide DNA remodelling in the ciliate Paramecium is ensured by RNA-mediated trans-nuclear crosstalk between the germline and the somatic genomes during sexual development. The rearrangements include elimination of transposable elements, minisatellites and tens of thousands non-coding elements called internally eliminated sequences (IESs). The trans-nuclear genome comparison process employs a distinct class of germline small RNAs (scnRNAs) that are compared against the parental somatic genome to select the germline-specific subset of scnRNAs that subsequently target DNA elimination in the progeny genome. Only a handful of proteins involved in this process have been identified so far and the mechanism of DNA targeting is unknown. Here we describe chromatin assembly factor-1-like protein (PtCAF-1), which we show is required for the survival of sexual progeny and localizes first in the parental and later in the newly developing macronucleus. Gene silencing shows that PtCAF-1 is required for the elimination of transposable elements and a subset of IESs. PTCAF-1 depletion also impairs the selection of germline-specific scnRNAs during development. We identify specific histone modifications appearing during Paramecium development which are strongly reduced in PTCAF-1 depleted cells. Our results demonstrate the importance of PtCAF-1 for the epigenetic trans-nuclear cross-talk mechanism. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Candida adriatica sp. nov. and Candida molendinolei sp. nov., two yeast species isolated from olive oil and its by-products.

PubMed

Čadež, Neža; Raspor, Peter; Turchetti, Benedetta; Cardinali, Gianluigi; Ciafardini, Gino; Veneziani, Gianluca; Péter, Gábor

2012-09-01

Thirteen strains isolated from virgin olive oil or its by-products in several Mediterranean countries were found to be phenotypically and genetically divergent from currently recognized yeast species. Sequence analysis of the large subunit (LSU) rDNA D1/D2 domain and internal transcribed spacer regions/5.8S rDNA revealed that the strains represented two novel species described as Candida adriatica sp. nov. (type strain ZIM 2334(T) = CBS 12504(T) = NCAIM Y.02001(T)) and Candida molendinolei sp. nov. (type strain DBVPG 5508(T) = CBS 12508(T) = NCAIM Y.02000(T)). Phylogenetic analysis based on concatenated sequences of the small subunit rRNA gene, the D1/D2 region of the LSU rDNA and the translation elongation factor-1α gene suggested that C. adriatica sp. nov. and C. molendinolei sp. nov. should be placed within the Lindnera and Nakazawaea clades, respectively.

The first liquid biopsy test approved. Is it a new era of mutation testing for non-small cell lung cancer?

PubMed Central

2017-01-01

Specific mutations in epidermal growth factor receptor (EGFR) gene are predictive for response to the EGFR tyrosine kinase inhibitors (TKIs) in non-small cell lung cancer patients (NSCLC). According to international guidelines, the molecular testing in patients with advanced NSCLC of a non-squamous subtype is recommended. However, obtain a tissue sample could be challenging. Liquid biopsy allows to determine patients suitable for EGFR-targeted therapy by analysis of circulating-free tumor DNA (cfDNA) in peripheral blood samples and might replace tissue biopsy. It allows to acquire a material in convenient minimally invasive manner, is easily repeatable, could be used for molecular identification and molecular changes monitoring. Many studies show a high concordance rate between tissue and plasma samples testing. When U.S. Food and Drug Administration (FDA) approved the first liquid biopsy test, analysis of driver gene mutation from cfDNA becomes a reality in clinical practice for patients with NSCLC. PMID:28251125

Brief Guide to Genomics: DNA, Genes and Genomes

MedlinePlus

... Sheets A Brief Guide to Genomics About NHGRI Research About the International HapMap Project Biological Pathways Chromosome Abnormalities Chromosomes Cloning Comparative Genomics DNA Microarray Technology DNA Sequencing Deoxyribonucleic Acid ( ...

Deletion endpoint allele-specificity in the developmentally regulated elimination of an internal sequence (IES) in Paramecium.

PubMed Central

Dubrana, K; Le Mouël, A; Amar, L

1997-01-01

Ciliated protozoa undergo thousands of site-specific DNA deletion events during the programmed development of micronuclear genomes to macronuclear genomes. Two deletion elements, W1 and W2, were identified in the Paramecium primaurelia wild-type 156 strain. Here, we report the characterization of both elements in wild-type strain 168 and show that they display variant deletion patterns when compared with those of strain 156. The W1 ( 168 ) element is defective for deletion. The W2 ( 168 ) element is excised utilizing two alternative boundaries on one side, both are different from the boundary utilized to excise the W2156 element. By crossing the 156 and 168 strains, we demonstrate that the definition of all deletion endpoints are each controlled by cis -acting determinant(s) rather than by strain-specific trans-acting factor(s). Sequence comparison of all deleted DNA segments indicates that the 5'-TA-3'terminal sequence is strictly required at their ends. Furthermore the identity of the first eight base pairs of these ends to a previously established consensus sequence correlates with the frequency of the corresponding deletion events. Our data implies the existence of an adaptive convergent evolution of these Paramecium deleted DNA segment end sequences. PMID:9171098

Adolescent idiopathic scoliosis (AIS), environment, exposome and epigenetics: a molecular perspective of postnatal normal spinal growth and the etiopathogenesis of AIS with consideration of a network approach and possible implications for medical therapy

PubMed Central

2011-01-01

Genetic factors are believed to play an important role in the etiology of adolescent idiopathic scoliosis (AIS). Discordant findings for monozygotic (MZ) twins with AIS show that environmental factors including different intrauterine environments are important in etiology, but what these environmental factors may be is unknown. Recent evidence for common chronic non-communicable diseases suggests epigenetic differences may underlie MZ twin discordance, and be the link between environmental factors and phenotypic differences. DNA methylation is one important epigenetic mechanism operating at the interface between genome and environment to regulate phenotypic plasticity with a complex regulation across the genome during the first decade of life. The word exposome refers to the totality of environmental exposures from conception onwards, comprising factors in external and internal environments. The word exposome is used here also in relation to physiologic and etiopathogenetic factors that affect normal spinal growth and may induce the deformity of AIS. In normal postnatal spinal growth we propose a new term and concept, physiologic growth-plate exposome for the normal processes particularly of the internal environments that may have epigenetic effects on growth plates of vertebrae. In AIS, we propose a new term and concept pathophysiologic scoliogenic exposome for the abnormal processes in molecular pathways particularly of the internal environment currently expressed as etiopathogenetic hypotheses; these are suggested to have deforming effects on the growth plates of vertebrae at cell, tissue, structure and/or organ levels that are considered to be epigenetic. New research is required for chromatin modifications including DNA methylation in AIS subjects and vertebral growth plates excised at surgery. In addition, consideration is needed for a possible network approach to etiopathogenesis by constructing AIS diseasomes. These approaches may lead through screening, genetic, epigenetic, biochemical, metabolic phenotypes and pharmacogenomic research to identify susceptible individuals at risk and modulate abnormal molecular pathways of AIS. The potential of epigenetic-based medical therapy for AIS cannot be assessed at present, and must await new research derived from the evaluation of epigenetic concepts of spinal growth in health and deformity. The tenets outlined here for AIS are applicable to other musculoskeletal growth disorders including infantile and juvenile idiopathic scoliosis. PMID:22136338

Mechanism of One-Way Traffic of Hexameric Phi29 DNA Packaging Motor with Four Electropositive Relaying Layers Facilitating Antiparallel Revolution

PubMed Central

2013-01-01

The importance of nanomotors in nanotechnology is akin to that of mechanical engines to daily life. The AAA+ superfamily is a class of nanomotors performing various functions. Their hexagonal arrangement facilitates bottom-up assembly for stable structures. The bacteriophage phi29 DNA translocation motor contains three coaxial rings: a dodecamer channel, a hexameric ATPase ring, and a hexameric pRNA ring. The viral DNA packaging motor has been believed to be a rotational machine. However, we discovered a revolution mechanism without rotation. By analogy, the earth revolves around the sun while rotating on its own axis. One-way traffic of dsDNA translocation is facilitated by five factors: (1) ATPase changes its conformation to revolve dsDNA within a hexameric channel in one direction; (2) the 30° tilt of the channel subunits causes an antiparallel arrangement between two helices of dsDNA and channel wall to advance one-way translocation; (3) unidirectional flow property of the internal channel loops serves as a ratchet valve to prevent reversal; (4) 5′–3′ single-direction movement of one DNA strand along the channel wall ensures single direction; and (5) four electropositive layers interact with one strand of the electronegative dsDNA phosphate backbone, resulting in four relaying transitional pauses during translocation. The discovery of a riding system along one strand provides a motion nanosystem for cargo transportation and a tool for studying force generation without coiling, friction, and torque. The revolution of dsDNA among 12 subunits offers a series of recognition sites on the DNA backbone to provide additional spatial variables for nucleotide discrimination for sensing applications. PMID:23510192

Direct single-stranded DNA binding by Teb1 mediates the recruitment of Tetrahymena thermophila telomerase to telomeres.

PubMed

Upton, Heather E; Hong, Kyungah; Collins, Kathleen

2014-11-15

The eukaryotic reverse transcriptase telomerase copies its internal RNA template to synthesize telomeric DNA repeats at chromosome ends in balance with sequence loss during cell proliferation. Previous work has established several factors involved in telomerase recruitment to telomeres in yeast and mammalian cells; however, it remains unclear what determines the association of telomerase with telomeres in other organisms. Here we investigate the cell cycle dependence of telomere binding by each of the seven Tetrahymena thermophila telomerase holoenzyme proteins TERT, p65, Teb1, p50, p75, p45, and p19. We observed coordinate cell cycle-regulated recruitment and release of all of the subunits, including the telomeric-repeat DNA-binding subunit Teb1. Using domain truncation and mutagenesis approaches, we investigated which subunits govern the interaction of telomerase holoenzyme with telomeres. Our results show that Teb1 is critical for telomere interaction of other holoenzyme subunits and demonstrate that high-affinity Teb1 DNA-binding activity is necessary and sufficient for cell cycle-regulated telomere association. Overall, these and additional findings indicate that in the ciliate Tetrahymena, telomerase recruitment to telomeres requires direct binding to single-stranded DNA, unlike the indirect DNA recognition through telomere-bound proteins essential in yeast and mammalian cells. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Transcultural Diabetes Nutrition Algorithm (tDNA): Venezuelan Application

PubMed Central

Nieto-Martínez, Ramfis; Hamdy, Osama; Marante, Daniel; Inés Marulanda, María; Marchetti, Albert; Hegazi, Refaat A.; Mechanick, Jeffrey I.

2014-01-01

Medical nutrition therapy (MNT) is a necessary component of comprehensive type 2 diabetes (T2D) management, but optimal outcomes require culturally-sensitive implementation. Accordingly, international experts created an evidence-based transcultural diabetes nutrition algorithm (tDNA) to improve understanding of MNT and to foster portability of current guidelines to various dysglycemic populations worldwide. This report details the development of tDNA-Venezuelan via analysis of region-specific cardiovascular disease (CVD) risk factors, lifestyles, anthropometrics, and resultant tDNA algorithmic modifications. Specific recommendations include: screening for prediabetes (for biochemical monitoring and lifestyle counseling); detecting obesity using Latin American cutoffs for waist circumference and Venezuelan cutoffs for BMI; prescribing MNT to people with prediabetes, T2D, or high CVD risk; specifying control goals in prediabetes and T2D; and describing regional differences in prevalence of CVD risk and lifestyle. Venezuelan deliberations involved evaluating typical food-based eating patterns, correcting improper dietary habits through adaptation of the Mediterranean diet with local foods, developing local recommendations for physical activity, avoiding stigmatizing obesity as a cosmetic problem, avoiding misuse of insulin and metformin, circumscribing bariatric surgery to appropriate indications, and using integrated health service networks to implement tDNA. Finally, further research, national surveys, and validation protocols focusing on CVD risk reduction in Venezuelan populations are necessary. PMID:24699193

Multifunctional centromere binding factor 1 is essential for chromosome segregation in the human pathogenic yeast Candida glabrata.

PubMed

Stoyan, T; Gloeckner, G; Diekmann, S; Carbon, J

2001-08-01

The CBF1 (centromere binding factor 1) gene of Candida glabrata was cloned by functional complementation of the methionine biosynthesis defect of a Saccharomyces cerevisiae cbf1 deletion mutant. The C. glabrata-coded protein, CgCbf1, contains a basic-helix-loop-helix leucine zipper domain and has features similar to those of other budding yeast Cbf1 proteins. CgCbf1p binds in vitro to the centromere DNA element I (CDEI) sequence GTCACATG with high affinity (0.9 x 10(9) M(-1)). Bandshift experiments revealed a pattern of protein-DNA complexes on CgCEN DNA different from that known for S. cerevisiae. We examined the effect of altering the CDEI binding site on CEN plasmid segregation, using a newly developed colony-sectoring assay. Internal deletion of the CDEI binding site led only to a fivefold increase in rates of plasmid loss, indicating that direct binding of Cbf1p to the centromere DNA is not required for full function. Additional deletion of sequences to the left of CDEI, however, led to a 70-fold increase in plasmid loss rates. Deletion of the CBF1 gene proved to be lethal in C. glabrata. C. glabrata cells containing the CBF1 gene under the influence of a shutdown promoter (tetO-ScHOP) arrested their growth after 5 h of cultivation in the presence of the reactive drug doxycycline. DAPI (4',6'-diamidino-2-phenylindole) staining of the arrested cells revealed a significant increase in the number of large-budded cells with single nuclei, 2C DNA content, and short spindles, indicating a defect in the G(2)/M transition of the cell cycle. Thus, we conclude that Cbf1p is required for chromosome segregation in C. glabrata.

AP1 Keeps Chromatin Poised for Action | Center for Cancer Research

Cancer.gov

The human genome harbors gene-encoding DNA, the blueprint for building proteins that regulate cellular function. Embedded across the genome, in non-coding regions, are DNA elements to which regulatory factors bind. The interaction of regulatory factors with DNA at these sites modifies gene expression to modulate cell activity. In cells, DNA exists in a complex with proteins called chromatin that compacts the DNA in the nucleus, strongly restricting access to DNA sequences. As a result, regulatory factors only interact with a small subset of their potential binding elements in a given cell to regulate genes. How factors recognize and select sites in chromatin across the genome is not well understood -- but several discoveries in CCR’s Laboratory of Receptor Biology and Gene Expression (LRBGE) have shed light on the mechanisms that direct factors to DNA.

Three-dimensional characterization of tethered microspheres by total internal reflection fluorescence microscopy

NASA Technical Reports Server (NTRS)

Blumberg, Seth; Gajraj, Arivalagan; Pennington, Matthew W.; Meiners, Jens-Christian

2005-01-01

Tethered particle microscopy is a powerful tool to study the dynamics of DNA molecules and DNA-protein complexes in single-molecule experiments. We demonstrate that stroboscopic total internal reflection microscopy can be used to characterize the three-dimensional spatiotemporal motion of DNA-tethered particles. By calculating characteristic measures such as symmetry and time constants of the motion, well-formed tethers can be distinguished from defective ones for which the motion is dominated by aberrant surface effects. This improves the reliability of measurements on tether dynamics. For instance, in observations of protein-mediated DNA looping, loop formation is distinguished from adsorption and other nonspecific events.

Relaxation dynamics of internal segments of DNA chains in nanochannels

NASA Astrophysics Data System (ADS)

Jain, Aashish; Muralidhar, Abhiram; Dorfman, Kevin; Dorfman Group Team

We will present relaxation dynamics of internal segments of a DNA chain confined in nanochannel. The results have direct application in genome mapping technology, where long DNA molecules containing sequence-specific fluorescent probes are passed through an array of nanochannels to linearize them, and then the distances between these probes (the so-called ``DNA barcode'') are measured. The relaxation dynamics of internal segments set the experimental error due to dynamic fluctuations. We developed a multi-scale simulation algorithm, combining a Pruned-Enriched Rosenbluth Method (PERM) simulation of a discrete wormlike chain model with hard spheres with Brownian dynamics (BD) simulations of a bead-spring chain. Realistic parameters such as the bead friction coefficient and spring force law parameters are obtained from PERM simulations and then mapped onto the bead-spring model. The BD simulations are carried out to obtain the extension autocorrelation functions of various segments, which furnish their relaxation times. Interestingly, we find that (i) corner segments relax faster than the center segments and (ii) relaxation times of corner segments do not depend on the contour length of DNA chain, whereas the relaxation times of center segments increase linearly with DNA chain size.

Intracellular pathways and nuclear localization signal peptide-mediated gene transfection by cationic polymeric nanovectors.

PubMed

Hu, Qinglian; Wang, Jinlei; Shen, Jie; Liu, Min; Jin, Xue; Tang, Guping; Chu, Paul K

2012-02-01

Polyethylenimine (PEI) - based polymers are promising cationic nanovectors. A good understanding of the mechanism by which cationic polymers/DNA complexes are internalized and delivered to nuclei helps to identify which transport steps may be manipulated in order to improve the transfection efficiency. In this work, cell internalization and trafficking of PEI-CyD (PC) composed of β-cyclodextrin (β-CyD) and polyethylenimine (PEI, Mw 600) are studied. The results show that the PC transfected DNA is internalized by binding membrane-associated proteoglycans. The endocytic pathway of the PC particles is caveolae- and clathrin-dependent with both pathways converging to the lysosome. The intracellular fate of the PC provides visual evidence that it can escape from the lysosome. Lysosomal inhibition with chloroquine has no effect on PC mediated transfection implying that blocking the lysosomal traffic does not improve transfection. To improve the nuclear delivery of PC transfected DNA, nuclear localization signal (NLS) peptides are chosen to conjugate and combine with the PC. Compared to PC/pDNA, PC-NLS/pDNA, and PC/pDNA/NLS can effectively improve gene transfection in dividing and non-dividing cells. Copyright © 2011 Elsevier Ltd. All rights reserved.

Genome-wide inference of transcription factor-DNA binding specificity in cell regeneration using a combination strategy.

PubMed

Wang, Xiaofeng; Zhang, Aiqun; Ren, Weizheng; Chen, Caiyu; Dong, Jiahong

2012-11-01

The cell growth, development, and regeneration of tissue and organ are associated with a large number of gene regulation events, which are mediated in part by transcription factors (TFs) binding to cis-regulatory elements involved in the genome. Predicting the binding affinity and inferring the binding specificity of TF-DNA interactions at the genomic level would be fundamentally helpful for our understanding of the molecular mechanism and biological implication underlying sequence-specific TF-DNA recognition. In this study, we report the development of a combination method to characterize the interaction behavior of a 11-mer oligonucleotide segment and its mutations with the Gcn4p protein, a homodimeric, basic leucine zipper TF, and to predict the binding affinity and specificity of potential Gcn4p binders in the genome-wide scale. In this procedure, a position-mutated energy matrix is created based on molecular modeling analysis of native and mutated Gcn4p-DNA complex structures to describe the position-independent interaction energy profile of Gcn4p with different nucleotide types at each position of the oligonucleotide, and the energy terms extracted from the matrix and their interactives are then correlated with experimentally measured affinities of 19268 distinct oligonucleotides using statistical modeling methodology. Subsequently, the best one of built regression models is successfully applied to screen those of potential high-affinity Gcn4p binders from the complete genome. The findings arising from this study are briefly listed below: (i) The 11 positions of oligonucleotides are highly interactive and non-additive in contribution to Gcn4p-DNA binding affinity; (ii) Indirect conformational effects upon nucleotide mutations as well as associated subtle changes in interfacial atomic contacts, but not the direct nonbonded interactions, are primarily responsible for the sequence-specific recognition; (iii) The intrinsic synergistic effects among the sequence positions of oligonucleotides determine Gcn4p-DNA binding affinity and specificity; (iv) Linear regression models in conjunction with variable selection seem to perform fairly well in capturing the internal dependences hidden in the Gcn4p-DNA system, albeit ignoring nonlinear factors may lead the models to systematically underestimate and overestimate high- and low-affinity samples, respectively. © 2012 John Wiley & Sons A/S.

Mitochondrial Haplogroups as a Risk Factor for Herpes Zoster.

PubMed

Levinson, Rebecca T; Hulgan, Todd; Kalams, Spyros A; Fessel, Joshua P; Samuels, David C

2016-10-01

Background.  Herpes zoster, or shingles, is a common, painful reactivation of latent varicella zoster virus infection. Understanding host factors that predispose to herpes zoster may permit development of more effective prevention strategies. Our objective was to examine mitochondrial haplogroups as a potential host factor related to herpes zoster incidence. Methods.  Study participants were drawn from BioVU, a deoxyribonucleic acid (DNA) biobank connected to deidentified electronic medical records (EMRs) from Vanderbilt University Medical Center. Our study used 9691 Caucasian individuals with herpes zoster status determined by International Classification of Diseases, Ninth Revision codes 053-053.9. Cases and controls were matched on sex and date of birth within 5 years. Mitochondrial haplogroups were defined from mitochondrial DNA variants genotyped on the Illumina 660W or Illumina Infinium Human-Exome Beadchip. Sex and date of birth were extracted from the EMR. Results.  European mitochondrial haplogroup H had a protective association with herpes zoster status (odds ratio [OR] = .82; 95% confidence interval [CI], .71-.94; P = .005), whereas haplogroup clade IWX was a risk factor for herpes zoster status (OR = 1.38; 95% CI, 1.07-1.77; P = .01). Conclusions.  Mitochondrial haplogroup influences herpes zoster risk. Knowledge of a patient's mitochondrial haplogroup could allow for a precision approach to the management of herpes zoster risk through vaccination strategies and management of other modifiable risk factors.

Photocarcinogenesis and Skin Cancer Prevention Strategies.

PubMed

Seebode, Christina; Lehmann, Janin; Emmert, Steffen

2016-03-01

In this review the basic principles of UV-induced carcinogenesis are summarized and the state of the art diagnosis and therapeutic strategies are discussed. The prevalent keratinocyte-derived neoplasms of the skin are basal cell and squamous cell carcinomas. Cutaneous melanoma is less frequent but associated with high mortality. Common risk factors for all three tumor entities include sun exposure and DNA-repair deficiencies. Photocarcinogenesis follows a multistep model of cancer development in which ultraviolet-induced DNA damage leads to mutations resulting in activation of oncogenes or silencing of tumor-suppressor genes. This ends in a cellular mutator phenotype even more prone to mutation acquisition. DNA repair, especially the nucleotide excision repair (NER) pathway, counteracts mutation formation and skin cancer development. This is vividly demonstrated by the NER-defective disorder xeroderma pigmentosum. Primary skin cancer preventative strategies, therefore, include reduction of DNA photodamage by protection from the sun. Secondary preventative strategies include skin cancer screening. This implies standard examination techniques with the naked eye, an epiluminescence microscope, or digital epiluminescence microscopy. More advanced techniques include confocal laser scan microscopy. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Developmentally programmed DNA splicing in Paramecium reveals short-distance crosstalk between DNA cleavage sites

PubMed Central

Gratias, Ariane; Lepère, Gersende; Garnier, Olivier; Rosa, Sarah; Duharcourt, Sandra; Malinsky, Sophie; Meyer, Eric; Bétermier, Mireille

2008-01-01

Somatic genome assembly in the ciliate Paramecium involves the precise excision of thousands of short internal eliminated sequences (IESs) that are scattered throughout the germline genome and often interrupt open reading frames. Excision is initiated by double-strand breaks centered on the TA dinucleotides that are conserved at each IES boundary, but the factors that drive cleavage site recognition remain unknown. A degenerate consensus was identified previously at IES ends and genetic analyses confirmed the participation of their nucleotide sequence in efficient excision. Even for wild-type IESs, however, variant excision patterns (excised or nonexcised) may be inherited maternally through sexual events, in a homology-dependent manner. We show here that this maternal epigenetic control interferes with the targeting of DNA breaks at IES ends. Furthermore, we demonstrate that a mutation in the TA at one end of an IES impairs DNA cleavage not only at the mutant end but also at the wild-type end. We conclude that crosstalk between both ends takes place prior to their cleavage and propose that the ability of an IES to adopt an excision-prone conformation depends on the combination of its nucleotide sequence and of additional determinants. PMID:18420657

Influence of internal viscoelastic modes on the Brownian motion of a λ-DNA coated colloid.

PubMed

Yanagishima, Taiki; Laohakunakorn, Nadanai; Keyser, Ulrich F; Eiser, Erika; Tanaka, Hajime

2014-03-21

We study the influence of grafted polymers on the diffusive behaviour of a colloidal particle. Our work demonstrates how such additional degrees of freedom influence the Brownian motion of the particle, focusing on internal viscoelastic coupling between the polymer and colloid. Specifically, we study the mean-squared displacements (MSDs) of λ-DNA grafted colloids using Brownian dynamics simulation. Our simulations reveal the non-trivial effect of internal modes, which gives rise to a crossover from the short-time viscoelastic to long-time diffusional behaviour. We also show that basic features can be captured by a simple theoretical model considering the relative motion of a colloid to a part of the polymer corona. This model describes well a MSD calculated from an extremely long trajectory of a single λ-DNA coated colloid from experiment and allows characterisation of the λ-DNA hairs. Our study suggests that the access to the internal relaxation modes via the colloid trajectory offers a novel method for the characterisation of soft attachments to a colloid.

DNA Barcoding in Fragaria L. (Strawberry) Species

USDA-ARS?s Scientific Manuscript database

DNA barcoding for species identification using a short DNA sequence has been successful in animals due to rapid mutation rates of the mitochondrial genome where the animal DNA barocode, cytochrome c oxidase 1 gene is located. The chloroplast PsbA-trnH spacer and the nuclear ribosomal internal transc...

International congress on DNA damage and repair: Book of abstracts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

This document contains the abstracts of 105 papers presented at the Congress. Topics covered include the Escherichia coli nucleotide excision repair system, DNA repair in malignant transformations, defective DNA repair, and gene regulation. (TEM)

Efficient DNA binding and nuclear uptake by distamycin derivatives conjugated to octa-arginine sequences.

PubMed

Vázquez, Olalla; Blanco-Canosa, Juan B; Vázquez, M Eugenio; Martínez-Costas, Jose; Castedo, Luis; Mascareñas, José L

2008-11-24

Efficient targeting of DNA by designed molecules requires not only careful fine-tuning of their DNA-recognition properties, but also appropriate cell internalization of the compounds so that they can reach the cell nucleus in a short period of time. Previous observations in our group on the relatively high affinity displayed by conjugates between distamycin derivatives and bZIP basic regions for A-rich DNA sites, led us to investigate whether the covalent attachment of a positively charged cell-penetrating peptide to a distamycin-like tripyrrole might yield high affinity DNA binders with improved cell internalization properties. Our work has led to the discovery of synthetic tripyrrole-octa-arginine conjugates that are capable of targeting specific DNA sites that contain A-rich tracts with low nanomolar affinity; they simultaneously exhibit excellent membrane and nuclear translocation properties in living HeLa cells.

Successful amplification of DNA aboard the International Space Station.

PubMed

Boguraev, Anna-Sophia; Christensen, Holly C; Bonneau, Ashley R; Pezza, John A; Nichols, Nicole M; Giraldez, Antonio J; Gray, Michelle M; Wagner, Brandon M; Aken, Jordan T; Foley, Kevin D; Copeland, D Scott; Kraves, Sebastian; Alvarez Saavedra, Ezequiel

2017-01-01

As the range and duration of human ventures into space increase, it becomes imperative that we understand the effects of the cosmic environment on astronaut health. Molecular technologies now widely used in research and medicine will need to become available in space to ensure appropriate care of astronauts. The polymerase chain reaction (PCR) is the gold standard for DNA analysis, yet its potential for use on-orbit remains under-explored. We describe DNA amplification aboard the International Space Station (ISS) through the use of a miniaturized miniPCR system. Target sequences in plasmid, zebrafish genomic DNA, and bisulfite-treated DNA were successfully amplified under a variety of conditions. Methylation-specific primers differentially amplified bisulfite-treated samples as would be expected under standard laboratory conditions. Our findings establish proof of concept for targeted detection of DNA sequences during spaceflight and lay a foundation for future uses ranging from environmental monitoring to on-orbit diagnostics.

Characterization of the host factors required for hepadnavirus covalently closed circular (ccc) DNA formation.

PubMed

Guo, Haitao; Xu, Chunxiao; Zhou, Tianlun; Block, Timothy M; Guo, Ju-Tao

2012-01-01

Synthesis of the covalently closed circular (ccc) DNA is a critical, but not well-understood step in the life cycle of hepadnaviruses. Our previous studies favor a model that removal of genome-linked viral DNA polymerase occurs in the cytoplasm and the resulting deproteinized relaxed circular DNA (DP-rcDNA) is subsequently transported into the nucleus and converted into cccDNA. In support of this model, our current study showed that deproteinization of viral double-stranded linear (dsl) DNA also took place in the cytoplasm. Furthermore, we demonstrated that Ku80, a component of non-homologous end joining DNA repair pathway, was essential for synthesis of cccDNA from dslDNA, but not rcDNA. In an attempt to identify additional host factors regulating cccDNA biosynthesis, we found that the DP-rcDNA was produced in all tested cell lines that supported DHBV DNA replication, but cccDNA was only synthesized in the cell lines that accumulated high levels of DP-rcDNA, except for NCI-H322M and MDBK cells, which failed to synthesize cccDNA despite of the existence of nuclear DP-rcDNA. The results thus imply that while removal of the genome-linked viral DNA polymerase is most likely catalyzed by viral or ubiquitous host function(s), nuclear factors required for the conversion of DP-rcDNA into cccDNA and/or its maintenance are deficient in the above two cell lines, which could be useful tools for identification of the elusive host factors essential for cccDNA biosynthesis or maintenance.

Risk factors for anti-MRSA drug resistance.

PubMed

Abe, Yasuhisa; Shigemura, Katsumi; Yoshida, Hiroyuki; Fujisawa, Masato; Arakawa, Soichi

2012-11-01

Meticillin-resistant Staphylococcus aureus (MRSA)-related infections have recently been spreading and are difficult to control, partly because affected patients are frequently in a poor condition. This study retrospectively investigated recent MRSA-related infections focusing on the relationship between clinical risk factors and anti-MRSA drug resistance. The patients with MRSA-related infections in Kobe University Hospital (Kobe, Japan) in 2009 were enrolled in the study. The relationships between various clinical risk factors as well as MRSA bacterial DNA concentration with minimum inhibitory concentrations (MICs) of anti-MRSA drugs were examined. In total, 44 patients were enrolled in the study and MRSA was isolated from blood (23 patients), urine (12 patients) and nasal secretions (9 patients). There was only one resistant strain to linezolid (LZD) among the anti-MRSA drugs tested, and this strain was considered staphylococcal cassette chromosome mec (SCCmec) type IIa from phage open-reading frame typing analyses. Statistical analyses showed that MRSA bacterial DNA concentration, cancer and use of a respirator, respectively, had a significant relationship with the MICs of LZD (P=0.0058) and arbekacin (ABK) (P=0.0003), of quinupristin/dalfopristin (Q/D) (P=0.0500) and ABK (P=0.0133), and of Q/D (P=0.0198) and vancomycin (P=0.0036). In conclusion, bacterial DNA concentration, cancer and use of a respirator were found to be significant risk factors for lower susceptibilities to anti-MRSA drugs; one strain was resistant to LZD. We suggest that further investigation and surveillance for MRSA-related infection are necessary for preventing the spread of MRSA-related infections. Copyright © 2012 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

Real-time PCR assays using internal controls for quantitation of HPV-16 and beta-globin DNA in cervicovaginal lavages.

PubMed

Lefevre, Jonas; Hankins, Catherine; Pourreaux, Karina; Voyer, Hélène; Coutlée, François

2003-12-01

High-risk human papillomavirus 16 (HPV-16) DNA viral load has been measured with real-time PCR assays by amplifying HPV-16 and a human gene. However, these assays have not used internal controls (ICs) to screen for the presence of inhibitors contained in samples. To quantitate HPV-16 DNA and cell content with real-time PCR, ICs for HPV-16 DNA and beta-globin were synthesised and used to control for inhibition. The assays were sensitive and linear over 5 logs. Good reproducibility was achieved with inter-run coefficients of variation of 23% (10(2) HPV-16 copies), 12% (10(4) HPV-16 copies), 17% (274 beta-globin DNA copies) and 7% (27,400 beta-globin DNA copies). Samples containing 56,800,000, 306,000, 18,000, and 4,070 HPV-16 copies/microg of cellular DNA were tested blindly and estimated to contain 48,800,000, 479,000, 20,300, and 6,620 HPV-16 copies/microg of DNA (mean ratio of measured to expected viral load of 1.27+/-0.32). Inhibition of amplification of HPV-16 and beta-globin ICs by six samples known to contain PCR inhibitors was variable: four inhibited both ICs while two inhibited only the HPV-16 IC. The use of internal controls with real-time PCR for HPV-16 quantitation allows to screen for the presence of inhibitors that do not affect equally primer-driven genomic amplification.

Charomers—Interleukin-6 Receptor Specific Aptamers for Cellular Internalization and Targeted Drug Delivery

PubMed Central

2017-01-01

Interleukin-6 (IL-6) is a key player in inflammation and the main factor for the induction of acute phase protein biosynthesis. Further to its central role in many aspects of the immune system, IL-6 regulates a variety of homeostatic processes. To interfere with IL-6 dependent diseases, such as various autoimmune diseases or certain cancers like multiple myeloma or hepatocellular carcinoma associated with chronic inflammation, it might be a sensible strategy to target human IL-6 receptor (hIL-6R) presenting cells with aptamers. We therefore have selected and characterized different DNA and RNA aptamers specifically binding IL-6R. These IL-6R aptamers, however, do not interfere with the IL-6 signaling pathway but are internalized with the receptor and thus can serve as vehicles for the delivery of different cargo molecules like therapeutics. We succeeded in the construction of a chlorin e6 derivatized aptamer to be delivered for targeted photodynamic therapy (PDT). Furthermore, we were able to synthesize an aptamer intrinsically comprising the cytostatic 5-Fluoro-2′-deoxy-uridine for targeted chemotherapy. The α6β4 integrin specific DNA aptamer IDA, also selected in our laboratory is internalized, too. All these aptamers can serve as vehicles for targeted drug delivery into cells. We call them charomers—in memory of Charon, the ferryman in Greek mythology, who ferried the deceased into the underworld. PMID:29211023

Charomers-Interleukin-6 Receptor Specific Aptamers for Cellular Internalization and Targeted Drug Delivery.

PubMed

Hahn, Ulrich

2017-12-06

Interleukin-6 (IL-6) is a key player in inflammation and the main factor for the induction of acute phase protein biosynthesis. Further to its central role in many aspects of the immune system, IL-6 regulates a variety of homeostatic processes. To interfere with IL-6 dependent diseases, such as various autoimmune diseases or certain cancers like multiple myeloma or hepatocellular carcinoma associated with chronic inflammation, it might be a sensible strategy to target human IL-6 receptor (hIL-6R) presenting cells with aptamers. We therefore have selected and characterized different DNA and RNA aptamers specifically binding IL-6R. These IL-6R aptamers, however, do not interfere with the IL-6 signaling pathway but are internalized with the receptor and thus can serve as vehicles for the delivery of different cargo molecules like therapeutics. We succeeded in the construction of a chlorin e6 derivatized aptamer to be delivered for targeted photodynamic therapy (PDT). Furthermore, we were able to synthesize an aptamer intrinsically comprising the cytostatic 5-Fluoro-2'-deoxy-uridine for targeted chemotherapy. The α6β4 integrin specific DNA aptamer IDA, also selected in our laboratory is internalized, too. All these aptamers can serve as vehicles for targeted drug delivery into cells. We call them charomers-in memory of Charon, the ferryman in Greek mythology, who ferried the deceased into the underworld.

In-stem labelling allows visualization of DNA strand displacements by distinct fluorescent colour change.

PubMed

Barrois, Sebastian; Wagenknecht, Hans-Achim

2013-05-21

The combination of thiazole orange (TO) and thiazole red (TR) as an internal pair of fluorescent DNA base surrogates ("DNA traffic lights") allows us to follow at least two consecutive DNA strand displacements in real time through a distinct fluorescence colour change from green to red and vice versa.

Mold Species in Dust from the International Space Station Identified and Quantified by Mold Specific Quantitative PCR - MCEARD

EPA Science Inventory

Dust was collected over a period of several weeks in 2007 from HEPA filters in the U.S. Laboratory Module of the International Space Station (ISS). The dust was returned on the Space Shuttle Atlantis, mixed, sieved, and the DNA was extracted. Using a DNA-based method called mo...

Mold Species in Dust from the International Space Station Identified and Quantified by Mold Specific Quantitative PCR

EPA Science Inventory

Dust was collected over a period of several weeks in 2007 from HEPA filters in the U.S. Laboratory Module of the International Space Station (ISS). The dust was returned on the Space Shuttle Atlantis, mixed, sieved, and the DNA was extracted. Using a DNA-based method called mol...

Comparative epigenetics: relevance to the regulation of production and health traits in cattle.

PubMed

Doherty, Rachael; O' Farrelly, Cliona; Meade, Kieran G

2014-08-01

With the development of genomic, transcriptomic and bioinformatic tools, recent advances in molecular technologies have significantly impacted bovine bioscience research and are revolutionising animal selection and breeding. Integration of epigenetic information represents yet another challenging molecular frontier. Epigenetics is the study of biochemical modifications to DNA and to histones, the proteins that provide stability to DNA. These epigenetic changes are induced by environmental stimuli; they alter gene expression and are potentially heritable. Epigenetics research holds the key to understanding how environmental factors contribute to phenotypic variation in traits of economic importance in cattle including development, nutrition, behaviour and health. In this review, we discuss the potential applications of epigenetics in bovine research, using breakthroughs in human and murine research to signpost the way. © 2014 Stichting International Foundation for Animal Genetics.

A survey of DNA diagnostic laboratories regarding DNA banking.

PubMed Central

McEwen, J E; Reilly, P R

1995-01-01

This article reports the findings of a survey of 148 academically based and commercial DNA diagnostic labs regarding DNA banking (defined as the storage of individual DNA samples in some form with identifiers for later retrieval). The population surveyed consisted of all laboratories listed with HELIX, a national directory of DNA diagnostic labs that includes a fairly comprehensive listing of clinical service labs as well as a large number of research labs. The survey was concerned primarily with the legal and ethical issues that the long-term storage of DNA may raise. The survey inquired into the respondents' policies and procedures concerning (1) the extent of DNA banking and of interest in developing DNA banking in academia and industry and (2) the degree to which DNA banks had developed written internal policies and/or a written depositor's agreement (a signed document defining the rights and obligations of the person from whom the sample was taken and the bank) designed to anticipate or prevent some of the ethical and legal problems that can arise from the long-term retention of DNA. Our research suggests that (1) the activity of DNA banking is growing, particularly in the academic setting, and (2) most academically based DNA banks lack written internal policies, written depositor's agreements, or other relevant documentation regarding important aspects of this activity. PMID:7762571

DNA residence time is a regulatory factor of transcription repression

PubMed Central

Clauß, Karen; Popp, Achim P.; Schulze, Lena; Hettich, Johannes; Reisser, Matthias; Escoter Torres, Laura; Uhlenhaut, N. Henriette

2017-01-01

Abstract Transcription comprises a highly regulated sequence of intrinsically stochastic processes, resulting in bursts of transcription intermitted by quiescence. In transcription activation or repression, a transcription factor binds dynamically to DNA, with a residence time unique to each factor. Whether the DNA residence time is important in the transcription process is unclear. Here, we designed a series of transcription repressors differing in their DNA residence time by utilizing the modular DNA binding domain of transcription activator-like effectors (TALEs) and varying the number of nucleotide-recognizing repeat domains. We characterized the DNA residence times of our repressors in living cells using single molecule tracking. The residence times depended non-linearly on the number of repeat domains and differed by more than a factor of six. The factors provoked a residence time-dependent decrease in transcript level of the glucocorticoid receptor-activated gene SGK1. Down regulation of transcription was due to a lower burst frequency in the presence of long binding repressors and is in accordance with a model of competitive inhibition of endogenous activator binding. Our single molecule experiments reveal transcription factor DNA residence time as a regulatory factor controlling transcription repression and establish TALE-DNA binding domains as tools for the temporal dissection of transcription regulation. PMID:28977492

Hybrid male sterility is caused by mitochondrial DNA deletion.

PubMed

Hayashida, Kenji; Kohno, Shigeru

2009-07-01

Although it is known that the hybrid male mouse is sterile just like any other animal's heterogametic sex, the reason why only the male germ cells are impaired has yet to be discovered. TdT-mediated dUTP nick end labeling assay using a confocal fluorescence microscope and DNA fragmentation assay of hybrid testis indicated destruction of the mitochondrial DNA (mtDNA) rather than the nuclear DNA. Previously we reported that maternal mtDNA inheritance is through selective sperm mtDNA elimination based on the sperm factor and two egg factors, and expression of these three factors was recognized in the hybrid testis. It was thereby assumed that mtDNA destruction caused by the expression of maternal mtDNA inheritance system in male germ cells is implicated in the hybrid male sterility of mice.

DNA-based approaches to identify forest fungi in Pacific Islands: A pilot study

Treesearch

Anna E. Case; Sara M. Ashiglar; Phil G. Cannon; Ernesto P. Militante; Edwin R. Tadiosa; Mutya Quintos-Manalo; Nelson M. Pampolina; John W. Hanna; Fred E. Brooks; Amy L. Ross-Davis; Mee-Sook Kim; Ned B. Klopfenstein

2013-01-01

DNA-based diagnostics have been successfully used to characterize diverse forest fungi (e.g., Hoff et al. 2004, Kim et al. 2006, Glaeser & Lindner 2011). DNA sequencing of the internal transcribed spacer (ITS) and large subunit (LSU) regions of nuclear ribosomal DNA (rDNA) has proved especially useful (Sonnenberg et al. 2007, Seifert 2009, Schoch et al. 2012) for...

Characterization of North American Armillaria species: Genetic relationships determined by ribosomal DNA sequences and AFLP markers

Treesearch

M. -S. Kim; N. B. Klopfenstein; J. W. Hanna; G. I. McDonald

2006-01-01

Phylogenetic and genetic relationships among 10 North American Armillaria species were analysed using sequence data from ribosomal DNA (rDNA), including intergenic spacer (IGS-1), internal transcribed spacers with associated 5.8S (ITS + 5.8S), and nuclear large subunit rDNA (nLSU), and amplified fragment length polymorphism (AFLP) markers. Based on rDNA sequence data,...

Release of extracellular DNA influences renal ischemia reperfusion injury by platelet activation and formation of neutrophil extracellular traps.

PubMed

Jansen, Marcel P B; Emal, Diba; Teske, Gwendoline J D; Dessing, Mark C; Florquin, Sandrine; Roelofs, Joris J T H

2017-02-01

Acute kidney injury is often the result of ischemia reperfusion injury, which leads to activation of coagulation and inflammation, resulting in necrosis of renal tubular epithelial cells. Platelets play a central role in coagulation and inflammatory processes, and it has been shown that platelet activation exacerbates acute kidney injury. However, the mechanism of platelet activation during ischemia reperfusion injury and how platelet activation leads to tissue injury are largely unknown. Here we found that renal ischemia reperfusion injury in mice leads to increased platelet activation in immediate proximity of necrotic cell casts. Furthermore, platelet inhibition by clopidogrel decreased cell necrosis and inflammation, indicating a link between platelet activation and renal tissue damage. Necrotic tubular epithelial cells were found to release extracellular DNA, which, in turn, activated platelets, leading to platelet-granulocyte interaction and formation of neutrophil extracellular traps ex vivo. Renal ischemia reperfusion injury resulted in increased DNA-platelet and DNA-platelet-granulocyte colocalization in tissue and elevated levels of circulating extracellular DNA and platelet factor 4 in mice. After renal ischemia reperfusion injury, neutrophil extracellular traps were formed within renal tissue, which decreased when mice were treated with the platelet inhibitor clopidogrel. Thus, during renal ischemia reperfusion injury, necrotic cell-derived DNA leads to platelet activation, platelet-granulocyte interaction, and subsequent neutrophil extracellular trap formation, leading to renal inflammation and further increase in tissue injury. Copyright © 2016 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.

DNA decontamination methods for internal quality management in clinical PCR laboratories.

PubMed

Wu, Yingping; Wu, Jianyong; Zhang, Zhihui; Cheng, Chen

2018-03-01

The polymerase chain reaction (PCR) technique, one of the most commonly applied methods in diagnostic and molecular biology, has a frustrating downside: the occurrence of false-positive signals due to contamination. In previous research, various DNA decontamination methods have been developed to overcome this limitation. Unfortunately, the use of random or poorly focused sampling methods for monitoring air and/or object surfaces leads to the incomplete elimination during decontamination procedures. We herein attempted to develop a novel DNA decontamination method (environmental surveillance, including surface and air sampling) and quality management program for clinical molecular diagnostic laboratories (or clinical PCR laboratories). Here, we performed a step-by-step evaluation of current DNA decontamination methods and developed an effective procedure for assessing the presence of decontaminating DNA via PCR analysis. Performing targeted environmental surveillance by sampling, which reached optimal performance over 2 weeks, and the decontamination process had been verified as reliable. Additionally, the process was validated to not affect PCR amplification efficiency based on a comparative study. In this study, effective guidelines for DNA decontamination were developed. The method employed ensured that surface DNA contamination could be effectively identified and eliminated. Furthermore, our study highlighted the importance of overall quality assurance and good clinical laboratory practices for preventing contamination, which are key factors for compliance with regulatory or accreditation requirements. Taken together, we provided the evidence that the presented scheme ranged from troubleshooting to the elimination of surface contamination, could serve as critical foundation for developing regular environmental surveillance guidelines for PCR laboratories. © 2017 Wiley Periodicals, Inc.

An Efficient Method for Electroporation of Small Interfering RNAs into ENCODE Project Tier 1 GM12878 and K562 Cell Lines.

PubMed

Muller, Ryan Y; Hammond, Ming C; Rio, Donald C; Lee, Yeon J

2015-12-01

The Encyclopedia of DNA Elements (ENCODE) Project aims to identify all functional sequence elements in the human genome sequence by use of high-throughput DNA/cDNA sequencing approaches. To aid the standardization, comparison, and integration of data sets produced from different technologies and platforms, the ENCODE Consortium selected several standard human cell lines to be used by the ENCODE Projects. The Tier 1 ENCODE cell lines include GM12878, K562, and H1 human embryonic stem cell lines. GM12878 is a lymphoblastoid cell line, transformed with the Epstein-Barr virus, that was selected by the International HapMap Project for whole genome and transcriptome sequencing by use of the Illumina platform. K562 is an immortalized myelogenous leukemia cell line. The GM12878 cell line is attractive for the ENCODE Projects, as it offers potential synergy with the International HapMap Project. Despite the vast amount of sequencing data available on the GM12878 cell line through the ENCODE Project, including transcriptome, chromatin immunoprecipitation-sequencing for histone marks, and transcription factors, no small interfering siRNA-mediated knockdown studies have been performed in the GM12878 cell line, as cationic lipid-mediated transfection methods are inefficient for lymphoid cell lines. Here, we present an efficient and reproducible method for transfection of a variety of siRNAs into the GM12878 and K562 cell lines, which subsequently results in targeted protein depletion.

Rif1 Binding and Control of Chromosome-Internal DNA Replication Origins Is Limited by Telomere Sequestration.

PubMed

Hafner, Lukas; Lezaja, Aleksandra; Zhang, Xu; Lemmens, Laure; Shyian, Maksym; Albert, Benjamin; Follonier, Cindy; Nunes, Jose Manuel; Lopes, Massimo; Shore, David; Mattarocci, Stefano

2018-04-24

The Saccharomyces cerevisiae telomere-binding protein Rif1 plays an evolutionarily conserved role in control of DNA replication timing by promoting PP1-dependent dephosphorylation of replication initiation factors. However, ScRif1 binding outside of telomeres has never been detected, and it has thus been unclear whether Rif1 acts directly on the replication origins that it controls. Here, we show that, in unperturbed yeast cells, Rif1 primarily regulates late-replicating origins within 100 kb of a telomere. Using the chromatin endogenous cleavage ChEC-seq technique, we robustly detect Rif1 at late-replicating origins that we show are targets of its inhibitory action. Interestingly, abrogation of Rif1 telomere association by mutation of its Rap1-binding module increases Rif1 binding and origin inhibition elsewhere in the genome. Our results indicate that Rif1 inhibits replication initiation by interacting directly with origins and suggest that Rap1-dependent sequestration of Rif1 increases its effective concentration near telomeres, while limiting its action at chromosome-internal sites. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

Modulation of DNA binding by gene-specific transcription factors.

PubMed

Schleif, Robert F

2013-10-01

The transcription of many genes, particularly in prokaryotes, is controlled by transcription factors whose activity can be modulated by controlling their DNA binding affinity. Understanding the molecular mechanisms by which DNA binding affinity is regulated is important, but because forming definitive conclusions usually requires detailed structural information in combination with data from extensive biophysical, biochemical, and sometimes genetic experiments, little is truly understood about this topic. This review describes the biological requirements placed upon DNA binding transcription factors and their consequent properties, particularly the ways that DNA binding affinity can be modulated and methods for its study. What is known and not known about the mechanisms modulating the DNA binding affinity of a number of prokaryotic transcription factors, including CAP and lac repressor, is provided.

Xeroderma pigmentosum, complementation group D expression in H1299 lung cancer cells following benzo[a]pyrene exposure as well as in head and neck cancer patients.

PubMed

Lin, Chang-Shen; Chiou, Wen-Yen; Lee, Ka-Wo; Chen, Tzu-Fen; Lin, Yuan-Jen; Huang, Jau-Ling

2016-01-01

DNA repair genes play critical roles in response to carcinogen-induced and anticancer therapy-induced DNA damage. Benzo[a]pyrene (BaP), the most carcinogenic polycyclic aromatic hydrocarbon (PAH), is classified as a group 1 carcinogen by International Agency for Research on Cancer. The aims of this study were to (1) evaluate the effects of BaP on DNA repair activity and expression of DNA repair genes in vitro and (2) examine the role of xeroderma pigmentosum, complementation group D (XPD) mRNA expression in human head and neck cancers. Host cell reactivation assay showed that BaP inhibited nucleotide excision repair in H1299 lung cancer cells. DNA repair through the non-homologous end-joining pathway was not affected by BaP. Real-time quantitative reverse-transcription polymerase chain reaction (RT-PCR) and Western blot demonstrated that XPD was downregulated by BaP treatment. BaP exposure did not apparently affect expression of another 11 DNA repair genes. BaP treatment increased the DNA damage marker γ-H2AX and ultraviolet (UV) sensitivity, supporting an impairment of DNA repair in BaP-treated cells. XPD expression was also examined by quantitative RT-PCR in 68 head and neck cancers, and a lower XPD mRNA level was found in smokers' cancer specimens. Importantly, reduced XPD expression was correlated with patient 5-year overall survival rate (35 vs. 56%) and was an independent prognostic factor (hazard ratio: 2.27). Data demonstrated that XPD downregulation was correlated with BaP exposure and human head and neck cancer survival.

Mitochondrial DNA Haplogroups and Neurocognitive Impairment During HIV Infection

PubMed Central

Hulgan, Todd; Samuels, David C.; Bush, William; Ellis, Ronald J.; Letendre, Scott L.; Heaton, Robert K.; Franklin, Donald R.; Straub, Peter; Murdock, Deborah G.; Clifford, David B.; Collier, Ann C.; Gelman, Benjamin B.; Marra, Christina M.; McArthur, Justin C.; McCutchan, J. Allen; Morgello, Susan; Simpson, David M.; Grant, Igor; Kallianpur, Asha R.

2015-01-01

Background. Neurocognitive impairment (NCI) remains an important complication in persons infected with human immunodeficiency virus (HIV). Ancestry-related mitochondrial DNA (mtDNA) haplogroups have been associated with outcomes of HIV infection and combination antiretroviral therapy (CART), and with neurodegenerative diseases. We hypothesize that mtDNA haplogroups are associated with NCI in HIV-infected adults and performed a genetic association study in the CNS HIV Antiretroviral Therapy Effects Research (CHARTER) cohort. Methods. CHARTER is an observational study of ambulatory HIV-infected adults. Haplogroups were assigned using mtDNA sequence, and principal components were derived from ancestry-informative nuclear DNA variants. Outcomes were cross-sectional global deficit score (GDS) as a continuous measure, GDS impairment (GDS ≥ 0.50), and HIV-associated neurocognitive disorder (HAND) using international criteria. Multivariable models were adjusted for comorbidity status (incidental vs contributing), current CART, plasma HIV RNA, reading ability, and CD4 cell nadir. Results. Haplogroups were available from 1027 persons; median age 43 years, median CD4 nadir 178 cells/mm3, 72% on CART, and 46% with HAND. The 102 (9.9%) persons of genetically determined admixed Hispanic ancestry had more impairment by GDS or HAND than persons of European or African ancestry (P < .001 for all). In multivariate models including persons of admixed Hispanic ancestry, those with haplogroup B had lower GDS (β = −0.34; P = .008) and less GDS impairment (odds ratio = 0.16; 95% confidence interval, .04, .63; P = .009) than other haplogroups. There were no significant haplogroup associations among persons of European or African ancestry. Conclusions. In these mostly CART-treated persons, mtDNA haplogroup B was associated with less NCI among persons of genetically determined Hispanic ancestry. mtDNA variation may represent an ancestry-specific factor influencing NCI in HIV-infected persons. PMID:26129753

Automated quantification of Epstein-Barr Virus in whole blood of hematopoietic stem cell transplant patients using the Abbott m2000 system.

PubMed

Salmona, Maud; Fourati, Slim; Feghoul, Linda; Scieux, Catherine; Thiriez, Aline; Simon, François; Resche-Rigon, Matthieu; LeGoff, Jérôme

2016-08-01

Accurate quantification of Epstein-Barr virus (EBV) load in blood is essential for the management of post-transplant lymphoproliferative disorders. The automation of DNA extraction and amplification may improve accuracy and reproducibility. We evaluated the EBV PCR Kit V1 with fully automated DNA extraction and amplification on the m2000 system (Abbott assay). Conversion factor between copies and international units (IU), lower limit of quantification, imprecision and linearity were determined in a whole blood (WB) matrix. Results from 339 clinical WB specimens were compared with a home-brew real-time PCR assay used in our laboratory (in-house assay). The conversion factor between copies and IU was 3.22 copies/IU. The lower limit of quantification (LLQ) was 1000 copies/mL. Intra- and inter-assay coefficients of variation were 3.1% and 7.9% respectively for samples with EBV load higher than the LLQ. The comparison between Abbott assay and in-house assay showed a good concordance (kappa = 0.77). Loads were higher with the Abbott assay (mean difference = 0.62 log10 copies/mL). The EBV PCR Kit V1 assay on the m2000 system provides a reliable and easy-to-use method for quantification of EBV DNA in WB. Copyright © 2016 Elsevier Inc. All rights reserved.

Arrested development of the myxozoan parasite, Myxobolus cerebralis, in certain populations of mitochondrial 16S lineage III Tubifex tubifex.

PubMed

Baxa, D V; Kelley, G O; Mukkatira, K S; Beauchamp, K A; Rasmussen, C; Hedrick, R P

2008-01-01

Laboratory populations of Tubifex tubifex from mitochondrial (mt)16S ribosomal DNA (rDNA) lineage III were generated from single cocoons of adult worms releasing the triactinomyxon stages (TAMs) of the myxozoan parasite, Myxobolus cerebralis. Subsequent worm populations from these cocoons, referred to as clonal lines, were tested for susceptibility to infection with the myxospore stages of M. cerebralis. Development and release of TAMs occurred in five clonal lines, while four clonal lines showed immature parasitic forms that were not expelled from the worm (non-TAM producers). Oligochaetes from TAM- and non-TAM-producing clonal lines were confirmed as lineage III based on mt16S rDNA and internal transcribed spacer region 1 (ITS1) sequences, but these genes did not differentiate these phenotypes. In contrast, random amplified polymorphic DNA analyses of genomic DNA demonstrated unique banding patterns that distinguished the phenotypes. Cohabitation of parasite-exposed TAM- and non-TAM-producing phenotypes showed an overall decrease in expected TAM production compared to the same exposure dose of the TAM-producing phenotype without cohabitation. These studies suggest that differences in susceptibility to parasite infection can occur in genetically similar T. tubifex populations, and their coexistence may affect overall M. cerebralis production, a factor that may influence the severity of whirling disease in wild trout populations.

The DNA-bending protein HMGB1 is a cellular cofactor of Sleeping Beauty transposition.

PubMed

Zayed, Hatem; Izsvák, Zsuzsanna; Khare, Dheeraj; Heinemann, Udo; Ivics, Zoltán

2003-05-01

Sleeping Beauty (SB) is the most active Tc1/ mariner-type transposon in vertebrates. SB contains two transposase-binding sites (DRs) at the end of each terminal inverted repeat (IR), a feature termed the IR/DR structure. We investigated the involvement of cellular proteins in the regulation of SB transposition. Here, we establish that the DNA-bending, high-mobility group protein, HMGB1 is a host-encoded cofactor of SB transposition. Transposition was severely reduced in mouse cells deficient in HMGB1. This effect was rescued by transient over-expression of HMGB1, and was partially complemented by HMGB2, but not with the HMGA1 protein. Over-expression of HMGB1 in wild-type mouse cells enhanced transposition, indicating that HMGB1 can be a limiting factor of transposition. SB transposase was found to interact with HMGB1 in vivo, suggesting that the transposase may recruit HMGB1 to transposon DNA. HMGB1 stimulated preferential binding of the transposase to the DR further from the cleavage site, and promoted bending of DNA fragments containing the transposon IR. We propose that the role of HMGB1 is to ensure that transposase-transposon complexes are first formed at the internal DRs, and subsequently to promote juxtaposition of functional sites in transposon DNA, thereby assisting the formation of synaptic complexes.

1H NMR studies of the 5-(hydroxymethyl)-2'-deoxyuridine containing TF1 binding site.

PubMed

Pasternack, L B; Bramham, J; Mayol, L; Galeone, A; Jia, X; Kearns, D R

1996-07-15

The pyrimidine base 5-(hydroxymethyl)-2'-deoxyuridine (HmU) is a common nucleotide in SPO1 phage DNA. Numerous transcriptional proteins bind HmU-containing DNA preferentially implicating a regulatory function of HmU. We have investigated the conformation and dynamics of d-(5'-CHmUCHmUACACGHmUGHmUAGAG-OH-3')2 (HmU-DNA). This oligonucleotide mimics the consensus sequence of Transcription Factor 1 (TF1). The HmU-DNA was compared to the thymine-containing oligonucleotide. NOESY and DQF COSY spectroscopy provided resonance assignments of nonexchangeable and exchangeable protons, intranucleotide, internucleotide and intrastrand proton-proton distances, and dihedral angle constraints. Methylene protons of the hydroxymethyl group are nonequivalent protons and the hydroxymethyl group is not freely rotating. The hydroxymethyl group adopts a specific orientation with the OH group oriented on the 3' side of the plane of the base. Analysis of imino proton resonances and NOEs indicates additional end base pair fraying and a temperature-induced transition to a conformation in which the internal HmU-A base pairs are disrupted or have reduced lifetimes. Orientation of the hydroxymethyl group indicates the presence of internucleotide intrastrand hydrogen bonding between the HmU12C5 hydroxyl group and A13. All sugars in both DNAs show a C2'endo conformation (typical of B-DNA).

Arrested development of the myxozoan parasite, Myxobolus cerebralis, in certain populations of mitochondrial 16S lineage III Tubifex tubifex

USGS Publications Warehouse

Baxa, D.V.; Kelley, G.O.; Mukkatira, K.S.; Beauchamp, K.A.; Rasmussen, C.; Hedrick, R.P.

2008-01-01

Laboratory populations of Tubifex tubifex from mitochondrial (mt)16S ribosomal DNA (rDNA) lineage III were generated from single cocoons of adult worms releasing the triactinomyxon stages (TAMs) of the myxozoan parasite, Myxobolus cerebralis. Subsequent worm populations from these cocoons, referred to as clonal lines, were tested for susceptibility to infection with the myxospore stages of M. cerebralis. Development and release of TAMs occurred in five clonal lines, while four clonal lines showed immature parasitic forms that were not expelled from the worm (non-TAM producers). Oligochaetes from TAM- and non-TAM-producing clonal lines were confirmed as lineage III based on mt16S rDNA and internal transcribed spacer region 1 (ITS1) sequences, but these genes did not differentiate these phenotypes. In contrast, random amplified polymorphic DNA analyses of genomic DNA demonstrated unique banding patterns that distinguished the phenotypes. Cohabitation of parasite-exposed TAM- and non-TAM-producing phenotypes showed an overall decrease in expected TAM production compared to the same exposure dose of the TAM-producing phenotype without cohabitation. These studies suggest that differences in susceptibility to parasite infection can occur in genetically similar T. tubifex populations, and their coexistence may affect overall M. cerebralis production, a factor that may influence the severity of whirling disease in wild trout populations. ?? 2007 Springer-Verlag.

Studying DNA looping by single-molecule FRET.

PubMed

Le, Tung T; Kim, Harold D

2014-06-28

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.

Studying DNA Looping by Single-Molecule FRET

PubMed Central

Le, Tung T.; Kim, Harold D.

2014-01-01

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA. PMID:24998459

Evaluation of single-nucleotide polymorphisms as internal controls in prenatal diagnosis of fetal blood groups.

PubMed

Doescher, Andrea; Petershofen, Eduard K; Wagner, Franz F; Schunter, Markus; Müller, Thomas H

2013-02-01

Determination of fetal blood groups in maternal plasma samples critically depends on adequate amplification of fetal DNA. We evaluated the routine inclusion of 52 single-nucleotide polymorphisms (SNPs) as internal reference in our polymerase chain reaction (PCR) settings to obtain a positive internal control for fetal DNA. DNA from 223 plasma samples of pregnant women was screened for RHD Exons 3, 4, 5, and 7 in a multiplex PCR including 52 SNPs divided into four primer pools. Amplicons were analyzed by single-base extension and the GeneScan method in a genetic analyzer. Results of D screening were compared to standard RHD genotyping of amniotic fluid or real-time PCR of fetal DNA from maternal plasma. The vast majority of all samples (97.8%) demonstrated differences in maternal and fetal SNP patterns when tested with four primer pools. These differences were not observed in less than 2.2% of the samples most probably due to an extraction failure for adequate amounts of fetal DNA. Comparison of the fetal genotypes with independent results did not reveal a single false-negative case among samples (n = 42) with positive internal control and negative fetal RHD typing. Coamplification of 52 SNPs with RHD-specific sequences for fetal blood group determination introduces a valid positive control for the amplification of fetal DNA to avoid false-negative results. This new approach does not require a paternal blood sample. It may also be applicable to other assays for fetal genotyping in maternal blood samples. © 2012 American Association of Blood Banks.

21st International Conference on DNA Computing and Molecular Programming: 8.1 Biochemistry

DTIC Science & Technology

include information storage and biological applications of DNA systems, biomolecular chemical reaction networks, applications of self -assembled DNA...nanostructures, tile self -assembly and computation, principles and models of self -assembly, and strand displacement and biomolecular circuits. The fund

The electrostatic role of the Zn-Cys2His2 complex in binding of operator DNA with transcription factors: mouse EGR-1 from the Cys2His2 family.

PubMed

Chirgadze, Y N; Boshkova, E A; Polozov, R V; Sivozhelezov, V S; Dzyabchenko, A V; Kuzminsky, M B; Stepanenko, V A; Ivanov, V V

2018-01-07

The mouse factor Zif268, known also as early growth response protein EGR-1, is a classical representative for the Cys2His2 transcription factor family. It is required for binding the RNA polymerase with operator dsDNA to initialize the transcription process. We have shown that only in this family of total six Zn-finger protein families the Zn complex plays a significant role in the protein-DNA binding. Electrostatic feature of this complex in the binding of factor Zif268 from Mus musculus with operator DNA has been considered. The factor consists of three similar Zn-finger units which bind with triplets of coding DNA. Essential contacts of the factor with the DNA phosphates are formed by three conservative His residues, one in each finger. We describe here the results of calculations of the electrostatic potentials for the Zn-Cys2His2 complex, Zn-finger unit 1, and the whole transcription factor. The potential of Zif268 has a positive area on the factor surface, and it corresponds exactly to the binding sites of each of Zn-finger units. The main part of these areas is determined by conservative His residues, which form contacts with the DNA phosphate groups. Our result shows that the electrostatic positive potential of this histidine residue is enhanced due to the Zn complex. The other contacts of the Zn-finger with DNA are related to nucleotide bases, and they are responsible for the sequence-specific binding with DNA. This result may be extended to all other members of the Cys2His2 transcription factor family.

A SHORT SEQUENCE IMMEDIATELY UPSTREAM OF THE INTERNAL REPEAT ELEMENTS IS CRITICAL FOR KSHV LANA MEDIATED DNA REPLICATION AND IMPACTS EPISOME PERSISTENCE

PubMed Central

León Vázquez, Erika De; Juillard, Franceline; Rosner, Bernard; Kaye, Kenneth M.

2013-01-01

Kaposi’s sarcoma-associated herpesvirus LANA (1162 residues) mediates episomal persistence of viral genomes during latency. LANA mediates viral DNA replication and segregates episomes to daughter nuclei. A 59 residue deletion immediately upstream of the internal repeat elements rendered LANA highly deficient for DNA replication and modestly deficient for the ability to segregate episomes, while smaller deletions did not. The 59 amino acid deletion reduced LANA episome persistence by ~14-fold, while sequentially smaller deletions resulted in ~3-fold, or no deficiency. Three distinct LANA regions reorganized heterochromatin, one of which contains the deleted sequence, but the deletion did not abolish LANA’s ability to alter chromatin. Therefore, this work identifies a short internal LANA sequence that is critical for DNA replication, has modest effects on episome segregation, and substantially impacts episome persistence; this region may exert its effects through an interacting host cell protein(s). PMID:24314665

Epigenomics

MedlinePlus

... Sheets A Brief Guide to Genomics About NHGRI Research About the International HapMap Project Biological Pathways Chromosome Abnormalities Chromosomes Cloning Comparative Genomics DNA Microarray Technology DNA Sequencing Deoxyribonucleic Acid ( ...

Cloning

MedlinePlus

... Sheets A Brief Guide to Genomics About NHGRI Research About the International HapMap Project Biological Pathways Chromosome Abnormalities Chromosomes Cloning Comparative Genomics DNA Microarray Technology DNA Sequencing Deoxyribonucleic Acid ( ...

Chromosomes

MedlinePlus

... Sheets A Brief Guide to Genomics About NHGRI Research About the International HapMap Project Biological Pathways Chromosome Abnormalities Chromosomes Cloning Comparative Genomics DNA Microarray Technology DNA Sequencing Deoxyribonucleic Acid ( ...

Transcriptome

MedlinePlus

... Sheets A Brief Guide to Genomics About NHGRI Research About the International HapMap Project Biological Pathways Chromosome Abnormalities Chromosomes Cloning Comparative Genomics DNA Microarray Technology DNA Sequencing Deoxyribonucleic Acid ( ...

DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

PubMed

Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

2013-03-29

The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

PubMed Central

Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

2013-01-01

The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

DNA damage mediated transcription arrest: Step back to go forward.

PubMed

Mullenders, Leon

2015-12-01

The disturbance of DNA helix conformation by bulky DNA damage poses hindrance to transcription elongating due to stalling of RNA polymerase at transcription blocking lesions. Stalling of RNA polymerase provokes the formation of R-loops, i.e. the formation of a DNA-RNA hybrid and a displaced single stranded DNA strand as well as displacement of spliceosomes. R-loops are processed into DNA single and double strand breaks by NER factors depending on TC-NER factors leading to genome instability. Moreover, stalling of RNA polymerase induces a strong signal for cell cycle arrest and apoptosis. These toxic and mutagenic effects are counteracted by a rapid recruitment of DNA repair proteins to perform transcription coupled nucleotide excision repair (TC-NER) to remove the blocking DNA lesions and to restore transcription. Recent studies have highlighted the role of backtracking of RNA polymerase to facilitate TC-NER and identified novel factors that play key roles in TC-NER and in restoration of transcription. On the molecular level these factors facilitate stability of the repair complex by promotion and regulation of various post-translational modifications of NER factors and chromatin substrate. In addition, the continuous flow of new factors that emerge from screening assays hints to several regulatory levels to safeguard the integrity of transcription elongation after disturbance by DNA damage that have yet to be explored. Copyright © 2015 Elsevier B.V. All rights reserved.

Genetic Mapping

MedlinePlus

... Sheets A Brief Guide to Genomics About NHGRI Research About the International HapMap Project Biological Pathways Chromosome Abnormalities Chromosomes Cloning Comparative Genomics DNA Microarray Technology DNA Sequencing Deoxyribonucleic Acid ( ...

Biological Pathways

MedlinePlus

... Sheets A Brief Guide to Genomics About NHGRI Research About the International HapMap Project Biological Pathways Chromosome Abnormalities Chromosomes Cloning Comparative Genomics DNA Microarray Technology DNA Sequencing Deoxyribonucleic Acid ( ...

[The validation of kit of reagents for quantitative detection of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode].

PubMed

Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu

2014-04-01

The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.

FUNGAL-SPECIFIC PCR PRIMERS DEVELOPED FOR ANALYSIS OF THE ITS REGION OF ENVIRONMENTAL DNA EXTRACTS

EPA Science Inventory

Background The Internal Transcribed Spacer (ITS) regions of fungal ribosomal DNA (rDNA) are highly variable sequences of great importance in distinguishing fungal species by PCR analysis. Previously published PCR primers available for amplifying these sequences from environmenta...

INTERNAL TRANSCRIBED SPACER (ITS), AN IDEAL DNA BARCODE FOR SPECIES DISCRIMINATION IN CRAWFURDIA WALL. (GENTIANACEAE).

PubMed

Zhang, Dequan; Jiang, Bei; Duan, Lizhen; Zhou, Nong

2016-01-01

DNA barcoding is a technique used to identify species based on species-specific differences in short regions of their DNA. It is widely used in species discrimination of medicinal plants and traditional medicines. In the present study, four potential DNA barcodes, namely rbcL , matK , trnH-psbA and ITS (nuclear ribosomal internal transcribed spacer) were adopted for species discrimination in Crawfurdia Wall (Genetiaceae). Identification ability of these DNA barcodes and combinations were evaluated using three classic methods (Distance, Blast and Tree-Building). As a result, ITS, trnH-psbA and rbcL regions showed great universality for a success rate of 100%; whereas matK was disappointing for which only 65% samples gained useful DNA sequences. ITS region, which could clearly and effectively identify the five species in Crawfurdia , performed very well in this study. On the contrary, trnH-psbA and rbcL performed poorly in discrimination among these species. ITS marker was an ideal DNA barcode in Crawfurdia and it should be incorporated into one of the core barcodes for seed plants.

First Molecular Identification and Phylogeny of Moroccan Anopheles sergentii (Diptera: Culicidae) Based on Second Internal Transcribed Spencer (ITS2) and Cytochrome c Oxidase I (COI) Sequences.

PubMed

Benabdelkrim Filali, Oumama; Kabine, Mostafa; El Hamouchi, Adil; Lemrani, Meryem; Debboun, Mustapha; Sarih, M'hammed

2018-06-05

Anopheles sergentii known as the "oasis vector" or the "desert malaria vector" is considered the main vector of malaria in the southern parts of Morocco. Its presence in Morocco is confirmed for the first time through sequencing of mitochondrial DNA (mDNA) cytochrome c oxidase subunit I (COI) barcodes and nuclear ribosomal DNA (rDNA) second internal transcribed spacer (ITS2) sequences and direct comparison with specimens of A. sergentii of other countries. The DNA barcodes (n = 39) obtained from A. sergentii collected in 2015 and 2016 showed more diversity with 10 haplotypes, compared with 3 haplotypes obtained from ITS2 sequences (n = 59). Moreover, the comparison using the ITS2 sequences showed closer evolutionary relationship between the Moroccan and Egyptian strains than the Iranian strain. Nevertheless, genetic differences due to geographical segregation were also observed. This study provides the first report on the sequence of rDNA-ITS2 and mtDNA COI, which could be used to better understand the biodiversity of A. sergentii.

DNA damage in internal organs after cutaneous exposure to sulphur mustard.

PubMed

Batal, Mohamed; Boudry, Isabelle; Mouret, Stéphane; Cléry-Barraud, Cécile; Wartelle, Julien; Bérard, Izabel; Douki, Thierry

2014-07-01

Sulphur mustard (SM) is a chemical warfare agent that attacks mainly skin, eye and lungs. Due to its lipophilic properties, SM is also able to diffuse through the skin and reach internal organs. DNA represents one of the most critical molecular targets of this powerful alkylating agent which modifies DNA structure by forming monoadducts and biadducts. These DNA lesions are involved in the acute toxicity of SM as well as its long-term carcinogenicity. In the present work we studied the formation and persistence of guanine and adenine monoadducts and guanine biadducts in the DNA of brain, lungs, kidneys, spleen, and liver of SKH-1 mice cutaneously exposed to 2, 6 and 60mg/kg of SM. SM-DNA adducts were detected in all studied organs, except in liver at the two lowest doses. Brain and lungs were the organs with the highest level of SM-DNA adducts, followed by kidney, spleen and liver. Monitoring the level of adducts for three weeks after cutaneous exposure showed that the lifetime of adducts were not the same in all organs, lungs being the organ with the longest persistence. Diffusion from skin to internal organs was much more efficient at the highest compared to the lowest dose investigated as the result of the loss of the skin barrier function. These data provide novel information on the distribution of SM in tissues following cutaneous exposures and indicate that brain is an important target. Copyright © 2014 Elsevier Inc. All rights reserved.

SIRT6 stabilizes DNA-dependent Protein Kinase at chromatin for DNA double-strand break repair

PubMed Central

McCord, Ronald A.; Michishita, Eriko; Hong, Tao; Berber, Elisabeth; Boxer, Lisa D.; Kusumoto, Rika; Guan, Shenheng; Shi, Xiaobing; Gozani, Or; Burlingame, Alma L.; Bohr, Vilhelm A.; Chua, Katrin F.

2009-01-01

The Sir2 chromatin regulatory factor links maintenance of genomic stability to life span extension in yeast. The mammalian Sir2 family member SIRT6 has been proposed to have analogous functions, because SIRT6-deficiency leads to shortened life span and an aging-like degenerative phenotype in mice, and SIRT6 knockout cells exhibit genomic instability and DNA damage hypersensitivity. However, the molecular mechanisms underlying these defects are not fully understood. Here, we show that SIRT6 forms a macromolecular complex with the DNA double-strand break (DSB) repair factor DNA-PK (DNA-dependent protein kinase) and promotes DNA DSB repair. In response to DSBs, SIRT6 associates dynamically with chromatin and is necessary for an acute decrease in global cellular acetylation levels on histone H3 Lysine 9. Moreover, SIRT6 is required for mobilization of the DNA-PK catalytic subunit (DNA-PKcs) to chromatin in response to DNA damage and stabilizes DNA-PKcs at chromatin adjacent to an induced site-specific DSB. Abrogation of these SIRT6 activities leads to impaired resolution of DSBs. Together, these findings elucidate a mechanism whereby regulation of dynamic interaction of a DNA repair factor with chromatin impacts on the efficiency of repair, and establish a link between chromatin regulation, DNA repair, and a mammalian Sir2 factor. PMID:20157594

Histone H1 functions as a stimulatory factor in backup pathways of NHEJ

PubMed Central

Rosidi, Bustanur; Wang, Minli; Wu, Wenqi; Sharma, Aparna; Wang, Huichen; Iliakis, George

2008-01-01

DNA double-strand breaks (DSBs) induced in the genome of higher eukaryotes by ionizing radiation (IR) are predominantly removed by two pathways of non-homologous end-joining (NHEJ) termed D-NHEJ and B-NHEJ. While D-NHEJ depends on the activities of the DNA-dependent protein kinase (DNA-PK) and DNA ligase IV/XRCC4/XLF, B-NHEJ utilizes, at least partly, DNA ligase III/XRCC1 and PARP-1. Using in vitro end-joining assays and protein fractionation protocols similar to those previously applied for the characterization of DNA ligase III as an end-joining factor, we identify here histone H1 as an additional putative NHEJ factor. H1 strongly enhances DNA-end joining and shifts the product spectrum from circles to multimers. While H1 enhances the DNA-end-joining activities of both DNA Ligase IV and DNA Ligase III, the effect on ligase III is significantly stronger. Histone H1 also enhances the activity of PARP-1. Since histone H1 has been shown to counteract D-NHEJ, these observations and the known functions of the protein identify it as a putative alignment factor operating preferentially within B-NHEJ. PMID:18250087

What triggers differential DNA methylation of genes and TEs: contribution of body methylation?

PubMed

Inagaki, S; Kakutani, T

2012-01-01

Transposable elements (TEs) are epigenetically silenced with extensive DNA methylation. The silent epigenetic marks should, however, be excluded from active genes. By genetic approaches, we study mechanisms to remove the heterochromatin marks from transcribed genes. Based on our observations on control of TE transcription, we propose a possible trigger for the TE-specific accumulation of DNA methylation. A critical difference between TEs and genes could be their responses to the DNA methylation in the internal part of transcribed regions. When their internal region is methylated, genes are still transcribed, but TEs could be silenced, which may reflect the obligatory position of every critical cis-acting element within the TE itself. This initial difference of TEs and genes will be amplified by positive feedback loops to stabilize active or silent states. Thus, the mechanisms to accumulate heterochromatin marks within transcribed regions could provide a trigger to induce differential DNA methylation between genes and TEs.

Evaluating the role of coherent delocalized phonon-like modes in DNA cyclization

DOE PAGES

Alexandrov, Ludmil B.; Rasmussen, Kim Ø.; Bishop, Alan R.; ...

2017-08-29

The innate flexibility of a DNA sequence is quantified by the Jacobson-Stockmayer’s J-factor, which measures the propensity for DNA loop formation. Recent studies of ultra-short DNA sequences revealed a discrepancy of up to six orders of magnitude between experimentally measured and theoretically predicted J-factors. These large differences suggest that, in addition to the elastic moduli of the double helix, other factors contribute to loop formation. We develop a new theoretical model that explores how coherent delocalized phonon-like modes in DNA provide single-stranded ”flexible hinges” to assist in loop formation. We also combine the Czapla-Swigon-Olson structural model of DNA with ourmore » extended Peyrard-Bishop-Dauxois model and, without changing any of the parameters of the two models, apply this new computational framework to 86 experimentally characterized DNA sequences. Our results demonstrate that the new computational framework can predict J-factors within an order of magnitude of experimental measurements for most ultra-short DNA sequences, while continuing to accurately describe the J-factors of longer sequences. Furthermore, we demonstrate that our computational framework can be used to describe the cyclization of DNA sequences that contain a base pair mismatch. Overall, our results support the conclusion that coherent delocalized phonon-like modes play an important role in DNA cyclization.« less

Evaluating the role of coherent delocalized phonon-like modes in DNA cyclization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alexandrov, Ludmil B.; Rasmussen, Kim Ø.; Bishop, Alan R.

The innate flexibility of a DNA sequence is quantified by the Jacobson-Stockmayer’s J-factor, which measures the propensity for DNA loop formation. Recent studies of ultra-short DNA sequences revealed a discrepancy of up to six orders of magnitude between experimentally measured and theoretically predicted J-factors. These large differences suggest that, in addition to the elastic moduli of the double helix, other factors contribute to loop formation. We develop a new theoretical model that explores how coherent delocalized phonon-like modes in DNA provide single-stranded ”flexible hinges” to assist in loop formation. We also combine the Czapla-Swigon-Olson structural model of DNA with ourmore » extended Peyrard-Bishop-Dauxois model and, without changing any of the parameters of the two models, apply this new computational framework to 86 experimentally characterized DNA sequences. Our results demonstrate that the new computational framework can predict J-factors within an order of magnitude of experimental measurements for most ultra-short DNA sequences, while continuing to accurately describe the J-factors of longer sequences. Furthermore, we demonstrate that our computational framework can be used to describe the cyclization of DNA sequences that contain a base pair mismatch. Overall, our results support the conclusion that coherent delocalized phonon-like modes play an important role in DNA cyclization.« less

Light-controlled cellular internalization and cytotoxicity of nucleic acid-binding agents. Studies in vitro and in zebrafish embryos

PubMed Central

Penas, Cristina; Sánchez, Mateo I.; Guerra-Varela, Jorge; Sanchez-Piñón, Laura; Vázquez, M. Eugenio; Mascareñas, José L.

2016-01-01

We have synthesized oligoarginine conjugates of selected DNA-binding agents (a bisbenzamidine, acridine and thiazole orange) and demonstrated that the DNA binding and cell internalization properties of such conjugates can be inhibited by appending a negatively charged oligoglutamic tail through a photolabile linker. Irradiation with UV light releases the parent octaarginine conjugates, thus restoring their cell internalization and biological activity. Preliminary assays using zebrafish embryos demonstrates the potential of this prodrug strategy for controlling in vivo cytotoxicity. PMID:26534774

Mitochondrial DNA and trade data support multiple origins of Helicoverpa armigera (Lepidoptera, Noctuidae) in Brazil

PubMed Central

Tay, Wee Tek; Walsh, Thomas K.; Downes, Sharon; Anderson, Craig; Jermiin, Lars S.; Wong, Thomas K. F.; Piper, Melissa C.; Chang, Ester Silva; Macedo, Isabella Barony; Czepak, Cecilia; Behere, Gajanan T.; Silvie, Pierre; Soria, Miguel F.; Frayssinet, Marie; Gordon, Karl H. J.

2017-01-01

The Old World bollworm Helicoverpa armigera is now established in Brazil but efforts to identify incursion origin(s) and pathway(s) have met with limited success due to the patchiness of available data. Using international agricultural/horticultural commodity trade data and mitochondrial DNA (mtDNA) cytochrome oxidase I (COI) and cytochrome b (Cyt b) gene markers, we inferred the origins and incursion pathways into Brazil. We detected 20 mtDNA haplotypes from six Brazilian states, eight of which were new to our 97 global COI-Cyt b haplotype database. Direct sequence matches indicated five Brazilian haplotypes had Asian, African, and European origins. We identified 45 parsimoniously informative sites and multiple substitutions per site within the concatenated (945 bp) nucleotide dataset, implying that probabilistic phylogenetic analysis methods are needed. High diversity and signatures of uniquely shared haplotypes with diverse localities combined with the trade data suggested multiple incursions and introduction origins in Brazil. Increasing agricultural/horticultural trade activities between the Old and New Worlds represents a significant biosecurity risk factor. Identifying pest origins will enable resistance profiling that reflects countries of origin to be included when developing a resistance management strategy, while identifying incursion pathways will improve biosecurity protocols and risk analysis at biosecurity hotspots including national ports. PMID:28350004

Mitochondrial DNA and trade data support multiple origins of Helicoverpa armigera (Lepidoptera, Noctuidae) in Brazil.

PubMed

Tay, Wee Tek; Walsh, Thomas K; Downes, Sharon; Anderson, Craig; Jermiin, Lars S; Wong, Thomas K F; Piper, Melissa C; Chang, Ester Silva; Macedo, Isabella Barony; Czepak, Cecilia; Behere, Gajanan T; Silvie, Pierre; Soria, Miguel F; Frayssinet, Marie; Gordon, Karl H J

2017-03-28

The Old World bollworm Helicoverpa armigera is now established in Brazil but efforts to identify incursion origin(s) and pathway(s) have met with limited success due to the patchiness of available data. Using international agricultural/horticultural commodity trade data and mitochondrial DNA (mtDNA) cytochrome oxidase I (COI) and cytochrome b (Cyt b) gene markers, we inferred the origins and incursion pathways into Brazil. We detected 20 mtDNA haplotypes from six Brazilian states, eight of which were new to our 97 global COI-Cyt b haplotype database. Direct sequence matches indicated five Brazilian haplotypes had Asian, African, and European origins. We identified 45 parsimoniously informative sites and multiple substitutions per site within the concatenated (945 bp) nucleotide dataset, implying that probabilistic phylogenetic analysis methods are needed. High diversity and signatures of uniquely shared haplotypes with diverse localities combined with the trade data suggested multiple incursions and introduction origins in Brazil. Increasing agricultural/horticultural trade activities between the Old and New Worlds represents a significant biosecurity risk factor. Identifying pest origins will enable resistance profiling that reflects countries of origin to be included when developing a resistance management strategy, while identifying incursion pathways will improve biosecurity protocols and risk analysis at biosecurity hotspots including national ports.

Mitochondrial DNA and trade data support multiple origins of Helicoverpa armigera (Lepidoptera, Noctuidae) in Brazil

NASA Astrophysics Data System (ADS)

Tay, Wee Tek; Walsh, Thomas K.; Downes, Sharon; Anderson, Craig; Jermiin, Lars S.; Wong, Thomas K. F.; Piper, Melissa C.; Chang, Ester Silva; Macedo, Isabella Barony; Czepak, Cecilia; Behere, Gajanan T.; Silvie, Pierre; Soria, Miguel F.; Frayssinet, Marie; Gordon, Karl H. J.

2017-03-01

The Old World bollworm Helicoverpa armigera is now established in Brazil but efforts to identify incursion origin(s) and pathway(s) have met with limited success due to the patchiness of available data. Using international agricultural/horticultural commodity trade data and mitochondrial DNA (mtDNA) cytochrome oxidase I (COI) and cytochrome b (Cyt b) gene markers, we inferred the origins and incursion pathways into Brazil. We detected 20 mtDNA haplotypes from six Brazilian states, eight of which were new to our 97 global COI-Cyt b haplotype database. Direct sequence matches indicated five Brazilian haplotypes had Asian, African, and European origins. We identified 45 parsimoniously informative sites and multiple substitutions per site within the concatenated (945 bp) nucleotide dataset, implying that probabilistic phylogenetic analysis methods are needed. High diversity and signatures of uniquely shared haplotypes with diverse localities combined with the trade data suggested multiple incursions and introduction origins in Brazil. Increasing agricultural/horticultural trade activities between the Old and New Worlds represents a significant biosecurity risk factor. Identifying pest origins will enable resistance profiling that reflects countries of origin to be included when developing a resistance management strategy, while identifying incursion pathways will improve biosecurity protocols and risk analysis at biosecurity hotspots including national ports.

Internal-Modified Dithiol DNA–Directed Au Nanoassemblies: Geometrically Controlled Self–Assembly and Quantitative Surface–Enhanced Raman Scattering Properties

PubMed Central

Yan, Yuan; Shan, Hangyong; Li, Min; Chen, Shu; Liu, Jianyu; Cheng, Yanfang; Ye, Cui; Yang, Zhilin; Lai, Xuandi; Hu, Jianqiang

2015-01-01

In this work, a hierarchical DNA–directed self–assembly strategy to construct structure–controlled Au nanoassemblies (NAs) has been demonstrated by conjugating Au nanoparticles (NPs) with internal–modified dithiol single-strand DNA (ssDNA) (Au–B–A or A–B–Au–B–A). It is found that the dithiol–ssDNA–modified Au NPs and molecule quantity of thiol–modified ssDNA grafted to Au NPs play critical roles in the assembly of geometrically controlled Au NAs. Through matching Au–DNA self–assembly units, geometrical structures of the Au NAs can be tailored from one–dimensional (1D) to quasi–2D and 2D. Au–B–A conjugates readily give 1D and quasi–2D Au NAs while 2D Au NAs can be formed by A–B–Au–B–A building blocks. Surface-enhanced Raman scattering (SERS) measurements and 3D finite–difference time domain (3D-FDTD) calculation results indicate that the geometrically controllable Au NAs have regular and linearly “hot spots”–number–depended SERS properties. For a certain number of NPs, the number of “hot spots” and accordingly enhancement factor of Au NAs can be quantitatively evaluated, which open a new avenue for quantitative analysis based on SERS technique. PMID:26581251

Epigenetics, chromatin and genome organization: recent advances from the ENCODE project.

PubMed

Siggens, L; Ekwall, K

2014-09-01

The organization of the genome into functional units, such as enhancers and active or repressed promoters, is associated with distinct patterns of DNA and histone modifications. The Encyclopedia of DNA Elements (ENCODE) project has advanced our understanding of the principles of genome, epigenome and chromatin organization, identifying hundreds of thousands of potential regulatory regions and transcription factor binding sites. Part of the ENCODE consortium, GENCODE, has annotated the human genome with novel transcripts including new noncoding RNAs and pseudogenes, highlighting transcriptional complexity. Many disease variants identified in genome-wide association studies are located within putative enhancer regions defined by the ENCODE project. Understanding the principles of chromatin and epigenome organization will help to identify new disease mechanisms, biomarkers and drug targets, particularly as ongoing epigenome mapping projects generate data for primary human cell types that play important roles in disease. © 2014 The Association for the Publication of the Journal of Internal Medicine.

Molecular Identification of Leishmania spp. in Sand Flies (Diptera: Psychodidae, Phlebotominae) From Ecuador

PubMed Central

Cevallos, Varsovia; Morales, Diego; Baldeón, Manuel E; Cárdenas, Paúl; Rojas-Silva, Patricio; Ponce, Patricio

2017-01-01

Abstract The detection and identification of natural infections in sand flies by Leishmania protozoan species in endemic areas is a key factor in assessing the risk of leishmaniasis and in designing prevention and control measures for this infectious disease. In this study, we analyzed the Leishmania DNA using nuclear ribosomal internal transcript spacer (ITS) sequences. Parasite DNA was extracted from naturally infected, blood-fed sand flies collected in nine localities considered leishmaniasis-endemic foci in Ecuador. The species of parasites identified in sand flies were Leishmania major-like, Leishmania naiffi, Leishmania mexicana, Leishmania lainsoni, and “Leishmania sp. siamensis”. Sand fly specimens of Brumptomyia leopoldoi, Mycropigomyia cayennensis, Nyssomyia yuilli yuilli, Nyssomyia trapidoi, Pressatia triacantha, Pressatia dysponeta, Psychodopygus carrerai carrerai, Psychodopygus panamensis, and Trichophoromyia ubiquitalis were found positive for Leishmania parasite. These findings contribute to a better understanding of the epidemiology and transmission dynamics of the disease in high-risk areas of Ecuador. PMID:28981860

Genetic networks controlled by the bacterial replication initiator and transcription factor DnaA in Bacillus subtilis.

PubMed

Washington, Tracy A; Smith, Janet L; Grossman, Alan D

2017-10-01

DnaA is the widely conserved bacterial AAA+ ATPase that functions as both the replication initiator and a transcription factor. In many organisms, DnaA controls expression of its own gene and likely several others during growth and in response to replication stress. To evaluate the effects of DnaA on gene expression, separate from its role in replication initiation, we analyzed changes in mRNA levels in Bacillus subtilis cells with and without dnaA, using engineered strains in which dnaA is not essential. We found that dnaA was required for many of the changes in gene expression in response to replication stress. We also found that dnaA indirectly affected expression of several regulons during growth, including those controlled by the transcription factors Spo0A, AbrB, PhoP, SinR, RemA, Rok and YvrH. These effects were largely mediated by the effects of DnaA on expression of sda. DnaA activates transcription of sda, and Sda inhibits histidine protein kinases required for activation of the transcription factor Spo0A. We also found that loss of dnaA caused a decrease in the development of genetic competence. Together, our results indicate that DnaA plays an important role in modulating cell physiology, separate from its role in replication initiation. © 2017 John Wiley & Sons Ltd.

Global Analysis of Transcription Factor-Binding Sites in Yeast Using ChIP-Seq

PubMed Central

Lefrançois, Philippe; Gallagher, Jennifer E. G.; Snyder, Michael

2016-01-01

Transcription factors influence gene expression through their ability to bind DNA at specific regulatory elements. Specific DNA-protein interactions can be isolated through the chromatin immunoprecipitation (ChIP) procedure, in which DNA fragments bound by the protein of interest are recovered. ChIP is followed by high-throughput DNA sequencing (Seq) to determine the genomic provenance of ChIP DNA fragments and their relative abundance in the sample. This chapter describes a ChIP-Seq strategy adapted for budding yeast to enable the genome-wide characterization of binding sites of transcription factors (TFs) and other DNA-binding proteins in an efficient and cost-effective way. Yeast strains with epitope-tagged TFs are most commonly used for ChIP-Seq, along with their matching untagged control strains. The initial step of ChIP involves the cross-linking of DNA and proteins. Next, yeast cells are lysed and sonicated to shear chromatin into smaller fragments. An antibody against an epitope-tagged TF is used to pull down chromatin complexes containing DNA and the TF of interest. DNA is then purified and proteins degraded. Specific barcoded adapters for multiplex DNA sequencing are ligated to ChIP DNA. Short DNA sequence reads (28–36 base pairs) are parsed according to the barcode and aligned against the yeast reference genome, thus generating a nucleotide-resolution map of transcription factor-binding sites and their occupancy. PMID:25213249

Mitochondrial DNA Damage and Diseases.

PubMed

Singh, Gyanesh; Pachouri, U C; Khaidem, Devika Chanu; Kundu, Aman; Chopra, Chirag; Singh, Pushplata

2015-01-01

Various endogenous and environmental factors can cause mitochondrial DNA (mtDNA) damage.  One of the reasons for enhanced mtDNA damage could be its proximity to the source of oxidants, and lack of histone-like protective proteins. Moreover, mitochondria contain inadequate DNA repair pathways, and, diminished DNA repair capacity may be one of the factors responsible for high mutation frequency of the mtDNA. mtDNA damage might cause impaired mitochondrial function, and, unrepaired mtDNA damage has been frequently linked with several diseases. Exploration of mitochondrial perspective of diseases might lead to a better understanding of several diseases, and will certainly open new avenues for detection, cure, and prevention of ailments.

Characterizing nuclear and mitochondrial DNA in spent embryo culture media: genetic contamination identified.

PubMed

Hammond, Elizabeth R; McGillivray, Brent C; Wicker, Sophie M; Peek, John C; Shelling, Andrew N; Stone, Peter; Chamley, Larry W; Cree, Lynsey M

2017-01-01

To characterize nuclear and mitochondrial DNA (mtDNA) in spent culture media from normally developing blastocysts to determine whether it could be used for noninvasive genetic assessment. Prospective embryo cohort study. Academic center and private in vitro fertilization (IVF) clinic. Seventy patients undergoing intracytoplasmic sperm injection (ICSI) and 227 blastocysts. Culture media assessment, artificial blastocoele fluid collapse and DNA analysis using digital polymerase chain reaction (dPCR), long-range PCR, quantitative PCR (qPCR), and DNA fingerprinting. Presence of nuclear and mtDNA in three different commercial culture media from Vitrolife and Irvine Scientific, spent embryo media assessment at the cleavage and blastocyst stages of development, and analysis of the internal media controls for each patient that had been exposed to identical conditions as embryo media but did not come into contact with embryos. Higher levels of nuclear and mtDNA were observed in the culture media that had been exposed to embryos compared with the internal media controls. Nuclear DNA (∼4 copies) and mtDNA (∼600 copies) could be detected in spent media, and the levels increased at the blastocyst stage. No increase in DNA was detected after artificial blastocoele fluid collapse. Mixed sex chromosome DNA was detected. This originated from contamination in the culture media and from maternal (cumulus) cells. Due to the limited amount of template, the presence of embryonic nuclear DNA could not be confirmed by DNA fingerprinting analysis. Currently DNA from culture media cannot be used for genetic assessment because embryo-associated structures release DNA into the culture medium and the DNA is of mixed origin. Copyright © 2016 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

Fluorescence studies with DNA probes: dynamic aspects of DNA structure and DNA-protein interactions

NASA Astrophysics Data System (ADS)

Millar, David P.; Carver, Theodore E.

1994-08-01

Time-resolved fluorescence measurements of optical probes incorporated at specific sites in DNA provides a new approach to studies of DNA structure and DNA:protein interactions. This approach can be used to study complex multi-state behavior, such as the folding of DNA into alternative higher order structures or the transfer of DNA between multiple binding sites on a protein. In this study, fluorescence anisotropy decay of an internal dansyl probe attached to 17/27-mer oligonucleotides was used to monitor the distribution of DNA 3' termini bound at either the polymerase of 3' to 5' exonuclease sites of the Klenow fragment of DNA polymerase I. Partitioning of the primer terminus between the two active sites of the enzyme resulted in a heterogeneous probe environment, reflected in the associative behavior of the fluorescence anisotropy decay. Analysis of the anisotropy decay with a two state model of solvent-exposed and protein-associated dansyl probes was used to determine the fraction of DNA bound at each site. We examined complexes of Klenow fragment with DNAs containing various base mismatches. Single mismatches at the primer terminus caused a 3-fold increase in the equilibrium partitioning of DNA into the exonuclease site, while two or more consecutive G:G mismatches caused the DNA to bind exclusively at the exonuclease site, with a partitioning constant at least 250- fold greater than that of the corresponding matched DNA sequence. Internal single mismatches located up to four bases from the primer terminus produced larger effects than the same mismatch at the primer terminus. These results provide insight into the recognition mechanisms that enable DNA polymerases to proofread misincorporated bases during DNA replication.

Nuclear internal transcribed spacer-1 as a sensitive genetic marker for environmental DNA studies in common carp Cyprinus carpio.

PubMed

Minamoto, Toshifumi; Uchii, Kimiko; Takahara, Teruhiko; Kitayoshi, Takumi; Tsuji, Satsuki; Yamanaka, Hiroki; Doi, Hideyuki

2017-03-01

The recently developed environmental DNA (eDNA) analysis has been used to estimate the distribution of aquatic vertebrates by using mitochondrial DNA (mtDNA) as a genetic marker. However, mtDNA markers have certain drawbacks such as variable copy number and maternal inheritance. In this study, we investigated the potential of using nuclear DNA (ncDNA) as a more reliable genetic marker for eDNA analysis by using common carp (Cyprinus carpio). We measured the copy numbers of cytochrome b (CytB) gene region of mtDNA and internal transcribed spacer 1 (ITS1) region of ribosomal DNA of ncDNA in various carp tissues and then compared the detectability of these markers in eDNA samples. In the DNA extracted from the brain and gill tissues and intestinal contents, CytB was detected at 95.1 ± 10.7 (mean ± 1 standard error), 29.7 ± 1.59 and 24.0 ± 4.33 copies per cell, respectively, and ITS1 was detected at 1760 ± 343, 2880 ± 503 and 1910 ± 352 copies per cell, respectively. In the eDNA samples from mesocosm, pond and lake water, the copy numbers of ITS1 were about 160, 300 and 150 times higher than those of CytB, respectively. The minimum volume of pond water required for quantification was 33 and 100 mL for ITS1 and CytB, respectively. These results suggested that ITS1 is a more sensitive genetic marker for eDNA studies of C. carpio. © 2016 John Wiley & Sons Ltd.

Methylation Sensitive Amplification Polymorphism Sequencing (MSAP-Seq)-A Method for High-Throughput Analysis of Differentially Methylated CCGG Sites in Plants with Large Genomes.

PubMed

Chwialkowska, Karolina; Korotko, Urszula; Kosinska, Joanna; Szarejko, Iwona; Kwasniewski, Miroslaw

2017-01-01

Epigenetic mechanisms, including histone modifications and DNA methylation, mutually regulate chromatin structure, maintain genome integrity, and affect gene expression and transposon mobility. Variations in DNA methylation within plant populations, as well as methylation in response to internal and external factors, are of increasing interest, especially in the crop research field. Methylation Sensitive Amplification Polymorphism (MSAP) is one of the most commonly used methods for assessing DNA methylation changes in plants. This method involves gel-based visualization of PCR fragments from selectively amplified DNA that are cleaved using methylation-sensitive restriction enzymes. In this study, we developed and validated a new method based on the conventional MSAP approach called Methylation Sensitive Amplification Polymorphism Sequencing (MSAP-Seq). We improved the MSAP-based approach by replacing the conventional separation of amplicons on polyacrylamide gels with direct, high-throughput sequencing using Next Generation Sequencing (NGS) and automated data analysis. MSAP-Seq allows for global sequence-based identification of changes in DNA methylation. This technique was validated in Hordeum vulgare . However, MSAP-Seq can be straightforwardly implemented in different plant species, including crops with large, complex and highly repetitive genomes. The incorporation of high-throughput sequencing into MSAP-Seq enables parallel and direct analysis of DNA methylation in hundreds of thousands of sites across the genome. MSAP-Seq provides direct genomic localization of changes and enables quantitative evaluation. We have shown that the MSAP-Seq method specifically targets gene-containing regions and that a single analysis can cover three-quarters of all genes in large genomes. Moreover, MSAP-Seq's simplicity, cost effectiveness, and high-multiplexing capability make this method highly affordable. Therefore, MSAP-Seq can be used for DNA methylation analysis in crop plants with large and complex genomes.

Methylation Sensitive Amplification Polymorphism Sequencing (MSAP-Seq)—A Method for High-Throughput Analysis of Differentially Methylated CCGG Sites in Plants with Large Genomes

PubMed Central

Chwialkowska, Karolina; Korotko, Urszula; Kosinska, Joanna; Szarejko, Iwona; Kwasniewski, Miroslaw

2017-01-01

Epigenetic mechanisms, including histone modifications and DNA methylation, mutually regulate chromatin structure, maintain genome integrity, and affect gene expression and transposon mobility. Variations in DNA methylation within plant populations, as well as methylation in response to internal and external factors, are of increasing interest, especially in the crop research field. Methylation Sensitive Amplification Polymorphism (MSAP) is one of the most commonly used methods for assessing DNA methylation changes in plants. This method involves gel-based visualization of PCR fragments from selectively amplified DNA that are cleaved using methylation-sensitive restriction enzymes. In this study, we developed and validated a new method based on the conventional MSAP approach called Methylation Sensitive Amplification Polymorphism Sequencing (MSAP-Seq). We improved the MSAP-based approach by replacing the conventional separation of amplicons on polyacrylamide gels with direct, high-throughput sequencing using Next Generation Sequencing (NGS) and automated data analysis. MSAP-Seq allows for global sequence-based identification of changes in DNA methylation. This technique was validated in Hordeum vulgare. However, MSAP-Seq can be straightforwardly implemented in different plant species, including crops with large, complex and highly repetitive genomes. The incorporation of high-throughput sequencing into MSAP-Seq enables parallel and direct analysis of DNA methylation in hundreds of thousands of sites across the genome. MSAP-Seq provides direct genomic localization of changes and enables quantitative evaluation. We have shown that the MSAP-Seq method specifically targets gene-containing regions and that a single analysis can cover three-quarters of all genes in large genomes. Moreover, MSAP-Seq's simplicity, cost effectiveness, and high-multiplexing capability make this method highly affordable. Therefore, MSAP-Seq can be used for DNA methylation analysis in crop plants with large and complex genomes. PMID:29250096

Different susceptibility of cells of porcine skin and internal organs to ultraviolet A-induced breaking of nuclear DNA.

PubMed

Brozyna, Anna; Chwirot, Barbara W

2005-01-01

There is a continuously growing interest in medical applications of ultraviolet radiation (UV-A and long-wavelength UV-B) especially for laser surgery, phototherapy and photodiagnostics of human internal organs. UV-B and UV-A radiation is potentially mutagenic, however, there has been very little information published to date concerning the significance of possible deleterious action of such photons on cells of internal tissues. The aim of this study is to compare the sensitivities of skin cells to those of internal organs upon exposure to UV-A. To assess this sensitivity we have determined the UV-A dose-dependent frequency of nuclear DNA breaks detected with the terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate-biotin nick end-labeling (TUNEL) technique. The materials for the study were macroscopic samples of porcine skin, colon and esophagus. The UV-A dose ranged from 0.1 to 1000 mJ/cm2, which is similar to doses received by cells in regions examined with laser-induced fluorescence or by cells surrounding areas subject to a laser ablation. To reduce the influence of DNA repair processes the tissue samples were kept at a low temperature during the irradiation and were deep frozen immediately after completing the irradiation procedure. The cells of the internal organs are much more susceptible to UV-A-induced breaking of DNA than the skin cells. The percentage fractions and the spatial distributions of the damaged cells and the characteristics of the UV-A dose dependence seem to vary by type of internal organ.

Two sides of the same coin: TFIIH complexes in transcription and DNA repair.

PubMed

Zhovmer, Alexander; Oksenych, Valentyn; Coin, Frédéric

2010-04-13

TFIIH is organized into a seven-subunit core associated with a three-subunit Cdk-activating kinase (CAK) module. TFIIH has roles in both transcription initiation and DNA repair. During the last 15 years, several studies have been conducted to identify the composition of the TFIIH complex involved in DNA repair. Recently, a new technique combining chromatin immunoprecipitation and western blotting resolved the hidden nature of the TFIIH complex participating in DNA repair. Following the recruitment of TFIIH to the damaged site, the CAK module is released from the core TFIIH, and the core subsequently associates with DNA repair factors. The release of the CAK is specifically driven by the recruitment of the DNA repair factor XPA and is required to promote the incision/excision of the damaged DNA. Once the DNA lesions have been repaired, the CAK module returns to the core TFIIH on the chromatin, together with the release of the repair factors. These data highlight the dynamic composition of a fundamental cellular factor that adapts its subunit composition to the cell needs.

Liposomal gene transfer of keratinocyte growth factor improves wound healing by altering growth factor and collagen expression.

PubMed

Pereira, Clifford T; Herndon, David N; Rocker, Roland; Jeschke, Marc G

2007-05-15

Growth factors affect the complex cascade of wound healing; however, interaction between different growth factors during dermal and epidermal regeneration are still not entirely defined. In the present study, we thought to determine the interaction between keratinocyte growth factor (KGF) administered as liposomal cDNA with other dermal and epidermal growth factors and collagen synthesis in an acute wound. Rats received an acute wound and were divided into two groups to receive weekly subcutaneous injections of liposomes plus the Lac-Z gene (0.22 microg, vehicle), or liposomes plus the KGF cDNA (2.2 microg) and Lac-Z gene (0.22 microg). Histological and immunohistochemical techniques were used to determine growth factor, collagen expression, and dermal and epidermal structure. KGF cDNA increased insulin-like growth factor-I (IGF-I), insulin-like growth factor binding protein-3 (IGFBP-3), and fibroblast growth factor (FGF), decreased transforming growth factor-beta (TGF-beta), while it had no effect on platelet-derived growth factor (PDGF) levels in the wound. KGF cDNA significantly increased collagen Type IV at both the wound edge as well as the wound bed, while it had no effect on collagen Type I and III. KGF cDNA increased re-epithelialization, improved dermal regeneration, and increased neovascularization. Exogenous administered KGF cDNA causes increases in IGF-I, IGF-BP3, FGF, and collagen IV and decreases TGF-beta concentration. KGF gene transfer accelerates wound healing without causing an increase in collagen I or III.

Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays.

PubMed

Kimura, Yasumasa; Soma, Takahiro; Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J L; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias

2016-01-01

Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download.

Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays

PubMed Central

Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J. L.; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias

2016-01-01

Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download. PMID:26863543

A comparative study of RNA and DNA as internal gene expression controls early in the developmental cycle of Chlamydia pneumoniae.

PubMed

Engström, Patrik; Bailey, Leslie; Onskog, Thomas; Bergström, Sven; Johansson, Jörgen

2010-03-01

Many microbial pathogens invade and proliferate within host cells and the molecular mechanism underlying this behavior is currently being revealed for several bacterial species. Testing clinically relevant antibacterial compounds and elucidating their effects on gene expression requires adequate controls, especially when studying genetically intractable organisms such as Chlamydia spp., for which various gene fusions cannot be constructed. Until now, relative mRNA levels in Chlamydia have been measured using different internal gene expression controls, including 16S rRNA, mRNAs, and DNA. Here, we compared the advantages and disadvantages of various internal expression controls during the early phase of Chlamydia pneumoniae development. The relative abundance of target mRNAs varied using the different internal control RNAs. This was partly due to variation in the transcript stability of the RNA species. Also, seven out of nine of the analyzed RNAs increased fivefold or more between 2 and 14 h postinfection, while the amount of DNA and number of cells remained essentially unaltered. Our results suggest that RNA should not be used as a gene expression control during the early phase of Chlamydia development, and that intrinsic bacterial DNA is preferable for that purpose because it is stable, abundant, and its relative amount is generally correlated with bacterial numbers.

Up regulation of serum tumor necrosis factor-related apoptosis inducing ligand in juvenile-onset systemic lupus erythematosus: relations with disease activity, antibodies to double -stranded DNA, nephritis and neutropenia.

PubMed

Ezzat, Mohamed H M; El-Gammasy, Tarek M A; Shaheen, Kareem Y A; El-Mezdawi, Ramzi A M; Youssef, Mervat S M

2013-06-01

Apoptosis is induced by binding of death receptor ligands, members of the tumor necrosis factor (TNF) superfamily, to their cognate receptors. It is suggested that TNF-related apoptosis inducing ligand (TRAIL) is involved in pathogenesis of juvenile-onset systemic lupus erythematosus (JSLE). This study aimed to assess TRAIL concentrations in sera of JSLE children and to determine their potential relationship with disease activity, anti-double-stranded DNA (anti-dsDNA) levels, neutropenia and renal involvement. Circulating levels of TRAIL were measured by enzyme-linked immunosorbent assay (ELISA) in serum samples obtained from 40 JSLE patients (20 with active and 20 with inactive disease) and 20 controls. The mean (SEM) serum TRAIL concentration in JSLE was 1750.7 (440.2) pg/mL. Serum TRAIL concentrations in patients were higher than those in controls (P < 0.01). Serum TRAIL concentrations for children with inactive disease (1854.8 [485.4] pg/mL) and those with activity (1646.6 [390.6] pg/mL) were statistically comparable. JSLE children with positive anti-dsDNA antibodies had significantly higher TRAIL levels (mean = 1846 [456] vs. 1455 [325] pg/mL; P < 0.05). Serum TRAIL concentrations were significantly higher in classes III and IV nephritis compared to classes I and II nephritis (1970 [512] vs. 1330 [331] pg/mL; P < 0.01). Serum TRAIL concentrations in patients with neutropenia were higher than those without neutropenia (1805 [505] vs. 1516 [400] pg/mL; P = 0.042) and in controls (P = 0.024). Our data indicate that an increased level of TRAIL is a feature of JSLE that correlates with disease activity, anti-dsDNA titers neutropenia and lupus nephritis. © 2013 The Authors International Journal of Rheumatic Diseases © 2013 Asia Pacific League of Associations for Rheumatology and Wiley Publishing Asia Pty Ltd.

One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

PubMed

Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

2015-12-01

The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

Breathing, bubbling, and bending: DNA flexibility from multimicrosecond simulations.

PubMed

Zeida, Ari; Machado, Matías Rodrigo; Dans, Pablo Daniel; Pantano, Sergio

2012-08-01

Bending of the seemingly stiff DNA double helix is a fundamental physical process for any living organism. Specialized proteins recognize DNA inducing and stabilizing sharp curvatures of the double helix. However, experimental evidence suggests a high protein-independent flexibility of DNA. On the basis of coarse-grained simulations, we propose that DNA experiences thermally induced kinks associated with the spontaneous formation of internal bubbles. Comparison of the protein-induced DNA curvature calculated from the Protein Data Bank with that sampled by our simulations suggests that thermally induced distortions can account for ~80% of the DNA curvature present in experimentally solved structures.

DNA Commission of the International Society for Forensic Genetics: revised and extended guidelines for mitochondrial DNA typing.

PubMed

Parson, W; Gusmão, L; Hares, D R; Irwin, J A; Mayr, W R; Morling, N; Pokorak, E; Prinz, M; Salas, A; Schneider, P M; Parsons, T J

2014-11-01

The DNA Commission of the International Society of Forensic Genetics (ISFG) regularly publishes guidelines and recommendations concerning the application of DNA polymorphisms to the question of human identification. Previous recommendations published in 2000 addressed the analysis and interpretation of mitochondrial DNA (mtDNA) in forensic casework. While the foundations set forth in the earlier recommendations still apply, new approaches to the quality control, alignment and nomenclature of mitochondrial sequences, as well as the establishment of mtDNA reference population databases, have been developed. Here, we describe these developments and discuss their application to both mtDNA casework and mtDNA reference population databasing applications. While the generation of mtDNA for forensic casework has always been guided by specific standards, it is now well-established that data of the same quality are required for the mtDNA reference population data used to assess the statistical weight of the evidence. As a result, we introduce guidelines regarding sequence generation, as well as quality control measures based on the known worldwide mtDNA phylogeny, that can be applied to ensure the highest quality population data possible. For both casework and reference population databasing applications, the alignment and nomenclature of haplotypes is revised here and the phylogenetic alignment proffered as acceptable standard. In addition, the interpretation of heteroplasmy in the forensic context is updated, and the utility of alignment-free database searches for unbiased probability estimates is highlighted. Finally, we discuss statistical issues and define minimal standards for mtDNA database searches. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Covalently bound DNA on naked iron oxide nanoparticles: Intelligent colloidal nano-vector for cell transfection.

PubMed

Magro, Massimiliano; Martinello, Tiziana; Bonaiuto, Emanuela; Gomiero, Chiara; Baratella, Davide; Zoppellaro, Giorgio; Cozza, Giorgio; Patruno, Marco; Zboril, Radek; Vianello, Fabio

2017-11-01

Conversely to common coated iron oxide nanoparticles, novel naked surface active maghemite nanoparticles (SAMNs) can covalently bind DNA. Plasmid (pDNA) harboring the coding gene for GFP was directly chemisorbed onto SAMNs, leading to a novel DNA nanovector (SAMN@pDNA). The spontaneous internalization of SAMN@pDNA into cells was compared with an extensively studied fluorescent SAMN derivative (SAMN@RITC). Moreover, the transfection efficiency of SAMN@pDNA was evaluated and explained by computational model. SAMN@pDNA was prepared and characterized by spectroscopic and computational methods, and molecular dynamic simulation. The size and hydrodynamic properties of SAMN@pDNA and SAMN@RITC were studied by electron transmission microscopy, light scattering and zeta-potential. The two nanomaterials were tested by confocal scanning microscopy on equine peripheral blood-derived mesenchymal stem cells (ePB-MSCs) and GFP expression by SAMN@pDNA was determined. Nanomaterials characterized by similar hydrodynamic properties were successfully internalized and stored into mesenchymal stem cells. Transfection by SAMN@pDNA occurred and GFP expression was higher than lipofectamine procedure, even in the absence of an external magnetic field. A computational model clarified that transfection efficiency can be ascribed to DNA availability inside cells. Direct covalent binding of DNA on naked magnetic nanoparticles led to an extremely robust gene delivery tool. Hydrodynamic and chemical-physical properties of SAMN@pDNA were responsible of the successful uptake by cells and of the efficiency of GFP gene transfection. SAMNs are characterized by colloidal stability, excellent cell uptake, persistence in the host cells, low toxicity and are proposed as novel intelligent DNA nanovectors for efficient cell transfection. Copyright © 2017 Elsevier B.V. All rights reserved.

Drosophila nuclear factor DREF regulates the expression of the mitochondrial DNA helicase and mitochondrial transcription factor B2 but not the mitochondrial translation factor B1

PubMed Central

Fernández-Moreno, Miguel A.; Hernández, Rosana; Adán, Cristina; Roberti, Marina; Bruni, Francesco; Polosa, Paola Loguercio; Cantatore, Palmiro; Matsushima, Yuichi; Kaguni, Laurie S.; Garesse, Rafael

2016-01-01

DREF [DRE (DNA replication-related element)-binding factor] controls the transcription of numerous genes in Drosophila, many involved in nuclear DNA (nDNA) replication and cell proliferation, three in mitochondrial DNA (mtDNA) replication and two in mtDNA transcription termination. In this work, we have analysed the involvement of DREF in the expression of the known remaining genes engaged in the minimal mtDNA replication (d-mtDNA helicase) and transcription (the activator d-mtTFB2) machineries and of a gene involved in mitochondrial mRNA translation (d-mtTFB1). We have identified their transcriptional initiation sites and DRE sequences in their promoter regions. Gel-shift and chromatin immunoprecipitation assays demonstrate that DREF interacts in vitro and in vivo with the d-mtDNA helicase and d-mtTFB2, but not with the d-mtTFB1 promoters. Transient transfection assays in Drosophila S2 cells with mutated DRE motifs and truncated promoter regions show that DREF controls the transcription of d-mtDNA helicase and d-mtTFB2, but not that of d-mtTFB1. RNA interference of DREF in S2 cells reinforces these results showing a decrease in the mRNA levels of d-mtDNA helicase and d-mtTFB2 and no changes in those of the d-mtTFB1. These results link the genetic regulation of nuclear DNA replication with the genetic control of mtDNA replication and transcriptional activation in Drosophila. PMID:23916463

The RNA Splicing Response to DNA Damage.

PubMed

Shkreta, Lulzim; Chabot, Benoit

2015-10-29

The number of factors known to participate in the DNA damage response (DDR) has expanded considerably in recent years to include splicing and alternative splicing factors. While the binding of splicing proteins and ribonucleoprotein complexes to nascent transcripts prevents genomic instability by deterring the formation of RNA/DNA duplexes, splicing factors are also recruited to, or removed from, sites of DNA damage. The first steps of the DDR promote the post-translational modification of splicing factors to affect their localization and activity, while more downstream DDR events alter their expression. Although descriptions of molecular mechanisms remain limited, an emerging trend is that DNA damage disrupts the coupling of constitutive and alternative splicing with the transcription of genes involved in DNA repair, cell-cycle control and apoptosis. A better understanding of how changes in splice site selection are integrated into the DDR may provide new avenues to combat cancer and delay aging.

The RNA Splicing Response to DNA Damage

PubMed Central

Shkreta, Lulzim; Chabot, Benoit

2015-01-01

The number of factors known to participate in the DNA damage response (DDR) has expanded considerably in recent years to include splicing and alternative splicing factors. While the binding of splicing proteins and ribonucleoprotein complexes to nascent transcripts prevents genomic instability by deterring the formation of RNA/DNA duplexes, splicing factors are also recruited to, or removed from, sites of DNA damage. The first steps of the DDR promote the post-translational modification of splicing factors to affect their localization and activity, while more downstream DDR events alter their expression. Although descriptions of molecular mechanisms remain limited, an emerging trend is that DNA damage disrupts the coupling of constitutive and alternative splicing with the transcription of genes involved in DNA repair, cell-cycle control and apoptosis. A better understanding of how changes in splice site selection are integrated into the DDR may provide new avenues to combat cancer and delay aging. PMID:26529031

On the Internal Structure of Bacteriophage Lambda

PubMed Central

Kaiser, A. D.

1966-01-01

The structure of bacteriophage lambda has been studied by electron microscopy of negatively stained particles. The phage particles will eject their DNA if they are heated or dialyzed against a chelating agent. The ghost particles, so formed, have a channel running down their tails. Since the channel is not visible in normal particles, the channel may be filled with part of the DNA molecule. Up to 30% of the ghosts contain round objects about half the internal diameter of the head. The round objects, called "cores," have the same buoyant density as the coat protein. The core may be a protein spool about which the phage DNA is wound. PMID:5967429

Use of Lambda Phage DNA as a Hybrid Internal Control in a PCR-Enzyme Immunoassay To Detect Chlamydia pneumoniae

PubMed Central

Pham, Dien G.; Madico, Guillermo E.; Quinn, Thomas C.; Enzler, Mark J.; Smith, Thomas F.; Gaydos, Charlotte A.

1998-01-01

An inherent problem in the diagnostic PCR assay is the presence of ill-defined inhibitors of amplification which may cause false-negative results. Addition of an amplifiable fragment of foreign DNA in the PCR to serve as a hybrid internal control (HIC) would allow for a simple way to identify specimens containing inhibitors. Two oligonucleotide hybrid primers were synthesized to contain nucleic acid sequences of the Chlamydia pneumoniae 16S rRNA primers in a position flanking two primers that target the sequences of a 650-bp lambda phage DNA segment. By using the hybrid primers, hybrid DNA comprising a large sequence of lambda phage DNA flanked by short pieces of chlamydia DNA was subsequently generated by PCR, cloned into a plasmid vector, and purified. Plasmids containing the hybrid DNA were diluted and used as a HIC by adding them to each C. pneumoniae PCR test. Consequently, C. pneumoniae primers were able to amplify both chlamydia DNA and the HIC DNA. The production of a 689-bp HIC DNA band on an acrylamide gel indicated that the specimen contained no inhibitors and that internal conditions were compatible with PCR. Subsequently, a biotinylated RNA probe for the HIC was transcribed from a nested sequence of the HIC and was used for its hybridization. Detection of the HIC DNA-RNA hybrid was achieved by enzyme immunoassay (EIA). This PCR-EIA system with a HIC was initially tested with 12 previously PCR-positive and 14 previously PCR-negative specimens. Of the 12 PCR-positive specimens, 11 were reconfirmed as positive; 1 had a negative HIC value, indicating inhibition. Of the 14 previously PCR-negative specimens, 13 were confirmed as true negative; 1 had a negative HIC value, indicating inhibition. The assay was then used with 237 nasopharyngeal specimens from patients with pneumonia. Twenty-one of 237 (8.9%) were positive for C. pneumoniae, and 42 (17.7%) were found to inhibit the PCR. Specimens showing inhibitory activity were diluted 1:10 and were retested. Ten specimens were still inhibitory to the PCR and required further DNA purification. No additional positive samples were detected and 3 nasopharyngeal specimens remained inhibitory to PCR. Coamplification of a HIC DNA can help confirm true-negative PCR results by ruling out the presence of inhibitors of DNA amplification. PMID:9650936

Aberrant topoisomerase-1 DNA lesions are pathogenic in neurodegenerative genome instability syndromes.

PubMed

Katyal, Sachin; Lee, Youngsoo; Nitiss, Karin C; Downing, Susanna M; Li, Yang; Shimada, Mikio; Zhao, Jingfeng; Russell, Helen R; Petrini, John H J; Nitiss, John L; McKinnon, Peter J

2014-06-01

DNA damage is considered to be a prime factor in several spinocerebellar neurodegenerative diseases; however, the DNA lesions underpinning disease etiology are unknown. We observed the endogenous accumulation of pathogenic topoisomerase-1 (Top1)-DNA cleavage complexes (Top1ccs) in murine models of ataxia telangiectasia and spinocerebellar ataxia with axonal neuropathy 1. We found that the defective DNA damage response factors in these two diseases cooperatively modulated Top1cc turnover in a non-epistatic and ATM kinase-independent manner. Furthermore, coincident neural inactivation of ATM and DNA single-strand break repair factors, including tyrosyl-DNA phosphodiesterase-1 or XRCC1, resulted in increased Top1cc formation and excessive DNA damage and neurodevelopmental defects. Notably, direct Top1 poisoning to elevate Top1cc levels phenocopied the neuropathology of the mouse models described above. Our results identify a critical endogenous pathogenic lesion associated with neurodegenerative syndromes arising from DNA repair deficiency, indicating that genome integrity is important for preventing disease in the nervous system.

Mitochondrial DNA Damage and Diseases

PubMed Central

Singh, Gyanesh; Pachouri, U C; Khaidem, Devika Chanu; Kundu, Aman; Chopra, Chirag; Singh, Pushplata

2015-01-01

Various endogenous and environmental factors can cause mitochondrial DNA (mtDNA) damage.  One of the reasons for enhanced mtDNA damage could be its proximity to the source of oxidants, and lack of histone-like protective proteins. Moreover, mitochondria contain inadequate DNA repair pathways, and, diminished DNA repair capacity may be one of the factors responsible for high mutation frequency of the mtDNA. mtDNA damage might cause impaired mitochondrial function, and, unrepaired mtDNA damage has been frequently linked with several diseases. Exploration of mitochondrial perspective of diseases might lead to a better understanding of several diseases, and will certainly open new avenues for detection, cure, and prevention of ailments. PMID:27508052

An Intrinsically Disordered APLF Links Ku, DNA-PKcs, and XRCC4-DNA Ligase IV in an Extended Flexible Non-homologous End Joining Complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hammel, Michal; Yu, Yaping; Radhakrishnan, Sarvan K.

DNA double-strand break (DSB) repair by non-homologous end joining (NHEJ) in human cells is initiated by Ku heterodimer binding to a DSB, followed by recruitment of core NHEJ factors including DNA-dependent protein kinase catalytic subunit (DNA-PKcs), XRCC4-like factor (XLF), and XRCC4 (X4)-DNA ligase IV (L4). Ku also interacts with accessory factors such as aprataxin and polynucleotide kinase/phosphatase-like factor (APLF). But, how these factors interact to tether, process, and ligate DSB ends while allowing regulation and chromatin interactions remains enigmatic. Here, small angle X-ray scattering (SAXS) and mutational analyses show APLF is largely an intrinsically disordered protein that binds Ku, Ku/DNA-PKcsmore » (DNA-PK), and X4L4 within an extended flexible NHEJ core complex. X4L4 assembles with Ku heterodimers linked to DNA-PKcs via flexible Ku80 C-terminal regions (Ku80CTR) in a complex stabilized through APLF interactions with Ku, DNA-PK, and X4L4. Our collective results unveil the solution architecture of the six-protein complex and suggest cooperative assembly of an extended flexible NHEJ core complex that supports APLF accessibility while possibly providing flexible attachment of the core complex to chromatin. The resulting dynamic tethering furthermore, provides geometric access of L4 catalytic domains to the DNA ends during ligation and of DNA-PKcs for targeted phosphorylation of other NHEJ proteins as well as trans-phosphorylation of DNA-PKcs on the opposing DSB without disrupting the core ligation complex. Overall the results shed light on evolutionary conservation of Ku, X4, and L4 activities, while explaining the observation that Ku80CTR and DNA-PKcs only occur in a subset of higher eukaryotes.« less

An Intrinsically Disordered APLF Links Ku, DNA-PKcs, and XRCC4-DNA Ligase IV in an Extended Flexible Non-homologous End Joining Complex

DOE PAGES

Hammel, Michal; Yu, Yaping; Radhakrishnan, Sarvan K.; ...

2016-11-14

DNA double-strand break (DSB) repair by non-homologous end joining (NHEJ) in human cells is initiated by Ku heterodimer binding to a DSB, followed by recruitment of core NHEJ factors including DNA-dependent protein kinase catalytic subunit (DNA-PKcs), XRCC4-like factor (XLF), and XRCC4 (X4)-DNA ligase IV (L4). Ku also interacts with accessory factors such as aprataxin and polynucleotide kinase/phosphatase-like factor (APLF). But, how these factors interact to tether, process, and ligate DSB ends while allowing regulation and chromatin interactions remains enigmatic. Here, small angle X-ray scattering (SAXS) and mutational analyses show APLF is largely an intrinsically disordered protein that binds Ku, Ku/DNA-PKcsmore » (DNA-PK), and X4L4 within an extended flexible NHEJ core complex. X4L4 assembles with Ku heterodimers linked to DNA-PKcs via flexible Ku80 C-terminal regions (Ku80CTR) in a complex stabilized through APLF interactions with Ku, DNA-PK, and X4L4. Our collective results unveil the solution architecture of the six-protein complex and suggest cooperative assembly of an extended flexible NHEJ core complex that supports APLF accessibility while possibly providing flexible attachment of the core complex to chromatin. The resulting dynamic tethering furthermore, provides geometric access of L4 catalytic domains to the DNA ends during ligation and of DNA-PKcs for targeted phosphorylation of other NHEJ proteins as well as trans-phosphorylation of DNA-PKcs on the opposing DSB without disrupting the core ligation complex. Overall the results shed light on evolutionary conservation of Ku, X4, and L4 activities, while explaining the observation that Ku80CTR and DNA-PKcs only occur in a subset of higher eukaryotes.« less

DNA-histone complexes as ligands amplify cell penetration and nuclear targeting of anti-DNA antibodies via energy-independent mechanisms.

PubMed

Zannikou, Markella; Bellou, Sofia; Eliades, Petros; Hatzioannou, Aikaterini; Mantzaris, Michael D; Carayanniotis, George; Avrameas, Stratis; Lymberi, Peggy

2016-01-01

We have generated three monoclonal cell-penetrating antibodies (CPAbs) from a non-immunized lupus-prone (NZB × NZW)F1 mouse that exhibited high anti-DNA serum titres. These CPAbs are polyreactive because they bind to DNA and other cellular components, and localize mainly in the nucleus of HeLa cells, albeit with a distinct nuclear labelling profile. Herein, we have examined whether DNA-histone complexes (DHC) binding to CPAbs, before cell entry, could modify the cell penetration of CPAbs or their nuclear staining properties. By applying confocal microscopy and image analysis, we found that extracellular binding of purified CPAbs to DHC significantly enhanced their subsequent cell-entry, both in terms of percentages of positively labelled cells and fluorescence intensity (internalized CPAb amount), whereas there was a variable effect on their nuclear staining profile. Internalization of CPAbs, either alone or bound to DHC, remained unaltered after the addition of endocytosis-specific inhibitors at 37° or assay performance at 4°, suggesting the involvement of energy-independent mechanisms in the internalization process. These findings assign to CPAbs a more complex pathogenetic role in systemic lupus erythematosus where both CPAbs and nuclear components are abundant. © 2015 John Wiley & Sons Ltd.

Development of PCR internal controls for DNA profiling with the AmpFℓSTR® SGM Plus® amplification kit.

PubMed

Nathalie, Zahra; Hadi, Sibte; Goodwin, William

2012-09-01

Forensic DNA profiling uses a series of commercial kits that co-amplify several loci in one reaction; the products of the PCR are fluorescently labelled and analysed using CE. Before CE, an aliquot of the PCR is mixed with formamide and an internal lane size standard. Using the SGM Plus amplification kit, we have developed two internal non-amplified controls of 80 bp and 380 bp that are labelled with ROX fluorescent dye and added to the PCR. Combined with two internal amplification controls of 90 bp and 410 bp, they provide additional controls for the PCR, electrokinetic injection, and CE and also function as an internal size standard. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Demonstrating Interactions of Transcription Factors with DNA by Electrophoretic Mobility Shift Assay.

PubMed

Yousaf, Nasim; Gould, David

2017-01-01

Confirming the binding of a transcription factor with a particular DNA sequence may be important in characterizing interactions with a synthetic promoter. Electrophoretic mobility shift assay is a powerful approach to demonstrate the specific DNA sequence that is bound by a transcription factor and also to confirm the specific transcription factor involved in the interaction. In this chapter we describe a method we have successfully used to demonstrate interactions of endogenous transcription factors with sequences derived from endogenous and synthetic promoters.

Transcription factors as readers and effectors of DNA methylation.

PubMed

Zhu, Heng; Wang, Guohua; Qian, Jiang

2016-08-01

Recent technological advances have made it possible to decode DNA methylomes at single-base-pair resolution under various physiological conditions. Many aberrant or differentially methylated sites have been discovered, but the mechanisms by which changes in DNA methylation lead to observed phenotypes, such as cancer, remain elusive. The classical view of methylation-mediated protein-DNA interactions is that only proteins with a methyl-CpG binding domain (MBD) can interact with methylated DNA. However, evidence is emerging to suggest that transcription factors lacking a MBD can also interact with methylated DNA. The identification of these proteins and the elucidation of their characteristics and the biological consequences of methylation-dependent transcription factor-DNA interactions are important stepping stones towards a mechanistic understanding of methylation-mediated biological processes, which have crucial implications for human development and disease.

Low-dose environmental radiation, DNA damage, and cancer: the possible contribution of psychological factors.

PubMed

Cwikel, Julie G; Gidron, Yori; Quastel, Michael

2010-01-01

Radiation causes DNA damage, increases risk of cancer, and is associated with psychological stress responses. This article proposes an evidence-based integrative model in which psychological factors could interact with radiation by either augmenting or moderating the adverse effects of radiation on DNA integrity and eventual tumorigenesis. Based on a review of the literature, we demonstrate the following: (1) the effects of low-dose radiation exposures on DNA integrity and on tumorigenesis; (2) the effects of low-dose radiation exposure on psychological distress; (3) the relationship between psychological factors and DNA damage; and (4) the possibility that psychological stress augments and that psychological resource variables moderate radiation-induced DNA damage and risk of cancer. The additional contribution of psychological processes to radiation-DNA damage-cancer relationships needs further study, and if verified, has clinical implications.

Transcription factors as readers and effectors of DNA methylation

PubMed Central

Zhu, Heng; Wang, Guohua; Qian, Jiang

2017-01-01

Recent technological advances have made it possible to decode DNA methylomes at single-base-pair resolution under various physiological conditions. Many aberrant or differentially methylated sites have been discovered, but the mechanisms by which changes in DNA methylation lead to observed phenotypes, such as cancer, remain elusive. The classical view of methylation-mediated protein-DNA interactions is that only proteins with a methyl-CpG binding domain (MBD) can interact with methylated DNA. However, evidence is emerging to suggest that transcription factors lacking a MBD can also interact with methylated DNA. The identification of these proteins and the elucidation of their characteristics and the biological consequences of methylation-dependent transcription factor-DNA interactions are important stepping stones towards a mechanistic understanding of methylation-mediated biological processes, which have crucial implications for human development and disease. PMID:27479905

Prevalence of nucleic acid sequences specific for human parvoviruses, hepatitis A and hepatitis E viruses in coagulation factor concentrates.

PubMed

Modrow, S; Wenzel, J J; Schimanski, S; Schwarzbeck, J; Rothe, U; Oldenburg, J; Jilg, W; Eis-Hübinger, A M

2011-05-01

Due to their high resistance to inactivation procedures, nonenveloped viruses such as parvovirus B19, human bocavirus (HBoV), human parvovirus 4 (PARV4), hepatitis A (HAV) and hepatitis E virus (HEV) pose a particular threat to blood products. Virus transmission to patients treated with blood products presents an additional burden to disease. We determined the frequency and the amount of nucleic acid specific for nonenveloped viruses in recently manufactured preparations of commercial coagulation factor concentrates. At least three different batches of each of 13 different plasma-derived and recombinant coagulation factor products were tested for the presence and the amount of nucleic acid for parvovirus B19, HBoV, human parvovirus 4, hepatitis A virus and HEV by using quantitative polymerase chain reaction. Whereas none of the recombinant products tested positive for any of these viruses, parvovirus B19 DNA with amounts ranging between 2×10(1) and 1.3×10(3) genome equivalents/ml was detected in five plasma-derived products. In addition to parvovirus B19 genotype 1, genotypes 2 and 3 were observed in two batches of a factor VIII/von-Willebrand factor product. In two products (one factor VIII concentrate and one activated prothrombin complex concentrate), a combination of both genotypes 1 and 2 of parvovirus B19 was detected. The data show that nucleic acids from several relevant nonenveloped viruses are not found at detectable levels in coagulation factor concentrates. In some cases, parvovirus B19 DNA was detectable at low levels. Testing of the plasma pools for the full range of parvovirus genotypes is advocated for ensuring product safety. © 2010 The Author(s). Vox Sanguinis © 2010 International Society of Blood Transfusion.

The nucleosome: orchestrating DNA damage signaling and repair within chromatin.

PubMed

Agarwal, Poonam; Miller, Kyle M

2016-10-01

DNA damage occurs within the chromatin environment, which ultimately participates in regulating DNA damage response (DDR) pathways and repair of the lesion. DNA damage activates a cascade of signaling events that extensively modulates chromatin structure and organization to coordinate DDR factor recruitment to the break and repair, whilst also promoting the maintenance of normal chromatin functions within the damaged region. For example, DDR pathways must avoid conflicts between other DNA-based processes that function within the context of chromatin, including transcription and replication. The molecular mechanisms governing the recognition, target specificity, and recruitment of DDR factors and enzymes to the fundamental repeating unit of chromatin, i.e., the nucleosome, are poorly understood. Here we present our current view of how chromatin recognition by DDR factors is achieved at the level of the nucleosome. Emerging evidence suggests that the nucleosome surface, including the nucleosome acidic patch, promotes the binding and activity of several DNA damage factors on chromatin. Thus, in addition to interactions with damaged DNA and histone modifications, nucleosome recognition by DDR factors plays a key role in orchestrating the requisite chromatin response to maintain both genome and epigenome integrity.

Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi

USDA-ARS?s Scientific Manuscript database

Six DNA regions were evaluated in a multi-national, multi-laboratory consortium as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it...

Optical tweezers reveal force plateau and internal friction in PEG-induced DNA condensation.

PubMed

Ojala, Heikki; Ziedaite, Gabija; Wallin, Anders E; Bamford, Dennis H; Hæggström, Edward

2014-03-01

The simplified artificial environments in which highly complex biological systems are studied do not represent the crowded, dense, salty, and dynamic environment inside the living cell. Consequently, it is important to investigate the effect of crowding agents on DNA. We used a dual-trap optical tweezers instrument to perform force spectroscopy experiments at pull speeds ranging from 0.3 to 270 μm/s on single dsDNA molecules in the presence of poly(ethylene glycol) (PEG) and monovalent salt. PEG of sizes 1,500 and 4,000 Da condensed DNA, and force-extension data contained a force plateau at approximately 1 pN. The level of the force plateau increased with increasing pull speed. During slow pulling the dissipated work increased linearly with pull speed. The calculated friction coefficient did not depend on amount of DNA incorporated in the condensate, indicating internal friction is independent of the condensate size. PEG300 had no effect on the dsDNA force-extension curve. The force plateau implies that condensation induced by crowding agents resembles condensation induced by multivalent cations.

Clinical Utility of Epstein-Barr Virus DNA Testing in the Treatment of Nasopharyngeal Carcinoma Patients.

PubMed

Kim, Kelly Y; Le, Quynh-Thu; Yom, Sue S; Ng, Raymond H W; Chan, K C Allen; Bratman, Scott V; Welch, John J; Divi, Rao L; Petryshyn, Raymond A; Conley, Barbara A

2017-08-01

Epstein-Barr virus (EBV) DNA analysis has been shown to be useful for early detection, prognostication, and monitoring of treatment response of nasopharyngeal carcinoma (NPC), and the recent literature provides growing evidence of the clinical utility of EBV DNA testing, particularly to inform treatment decisions for NPC patients. Despite the fact that NPC is a rare disease, the NRG Oncology cooperative group has successfully activated a phase 2/3 randomized clinical trial for NPC with international partners and in that process has discovered that the development of a harmonized EBV DNA test is absolutely critical for integration into clinical trials and for future deployment in clinical and central laboratories. In November 2015, the National Cancer Institute (NCI) convened a workshop of international experts in the treatment of NPC and EBV testing to provide a forum for discussing the state of EBV DNA testing and its clinical utility, and to stimulate consideration of future studies and clinical practice guidelines for EBV DNA. This review provides a summary of that discussion. Published by Elsevier Inc.

In vitro molecular machine learning algorithm via symmetric internal loops of DNA.

PubMed

Lee, Ji-Hoon; Lee, Seung Hwan; Baek, Christina; Chun, Hyosun; Ryu, Je-Hwan; Kim, Jin-Woo; Deaton, Russell; Zhang, Byoung-Tak

2017-08-01

Programmable biomolecules, such as DNA strands, deoxyribozymes, and restriction enzymes, have been used to solve computational problems, construct large-scale logic circuits, and program simple molecular games. Although studies have shown the potential of molecular computing, the capability of computational learning with DNA molecules, i.e., molecular machine learning, has yet to be experimentally verified. Here, we present a novel molecular learning in vitro model in which symmetric internal loops of double-stranded DNA are exploited to measure the differences between training instances, thus enabling the molecules to learn from small errors. The model was evaluated on a data set of twenty dialogue sentences obtained from the television shows Friends and Prison Break. The wet DNA-computing experiments confirmed that the molecular learning machine was able to generalize the dialogue patterns of each show and successfully identify the show from which the sentences originated. The molecular machine learning model described here opens the way for solving machine learning problems in computer science and biology using in vitro molecular computing with the data encoded in DNA molecules. Copyright © 2017. Published by Elsevier B.V.

Single-particle tracking and modulation of cell entry pathways of a tetrahedral DNA nanostructure in live cells.

PubMed

Liang, Le; Li, Jiang; Li, Qian; Huang, Qing; Shi, Jiye; Yan, Hao; Fan, Chunhai

2014-07-21

DNA is typically impermeable to the plasma membrane due to its polyanionic nature. Interestingly, several different DNA nanostructures can be readily taken up by cells in the absence of transfection agents, which suggests new opportunities for constructing intelligent cargo delivery systems from these biocompatible, nonviral DNA nanocarriers. However, the underlying mechanism of entry of the DNA nanostructures into the cells remains unknown. Herein, we investigated the endocytotic internalization and subsequent transport of tetrahedral DNA nanostructures (TDNs) by mammalian cells through single-particle tracking. We found that the TDNs were rapidly internalized by a caveolin-dependent pathway. After endocytosis, the TDNs were transported to the lysosomes in a highly ordered, microtubule-dependent manner. Although the TDNs retained their structural integrity within cells over long time periods, their localization in the lysosomes precludes their use as effective delivery agents. To modulate the cellular fate of the TDNs, we functionalized them with nuclear localization signals that directed their escape from the lysosomes and entry into the cellular nuclei. This study improves our understanding of the entry into cells and transport pathways of DNA nanostructures, and the results can be used as a basis for designing DNA-nanostructure-based drug delivery nanocarriers for targeted therapy. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Cloning and restriction enzyme mapping of ribosomal DNA of Giardia duodenalis, Giardia ardeae and Giardia muris.

PubMed

van Keulen, H; Campbell, S R; Erlandsen, S L; Jarroll, E L

1991-06-01

In an attempt to study Giardia at the DNA sequence level, the rRNA genes of three species, Giardia duodenalis, Giardia ardeae and Giardia muris were cloned and restriction enzyme maps were constructed. The rDNA repeats of these Giardia show completely different restriction enzyme recognition patterns. The size of the rDNA repeat ranges from approximately 5.6 kb in G. duodenalis to 7.6 kb in both G. muris and G. ardeae. These size differences are mainly attributable to the variation in length of the spacer. Minor differences exist among these Giardia in the sizes of their small subunit rRNA and the internal transcribed spacer between small and large subunit rRNA. The genetic maps were constructed by sequence analysis of the DNA around the 5' and 3' ends of the mature rRNA genes and between the rRNA covering the 5.8S rRNA gene and internal transcribed spacer. Comparison of the 5.8S rDNA and 3' end of large subunit rDNA from these three Giardia species showed considerable sequence variation, but the rDNA sequences of G. duodenalis and G. ardeae appear more closely related to each other than to G. muris.

Droplet digital PCR-based EGFR mutation detection with an internal quality control index to determine the quality of DNA.

PubMed

Kim, Sung-Su; Choi, Hyun-Jeung; Kim, Jin Ju; Kim, M Sun; Lee, In-Seon; Byun, Bohyun; Jia, Lina; Oh, Myung Ryurl; Moon, Youngho; Park, Sarah; Choi, Joon-Seok; Chae, Seoung Wan; Nam, Byung-Ho; Kim, Jin-Soo; Kim, Jihun; Min, Byung Soh; Lee, Jae Seok; Won, Jae-Kyung; Cho, Soo Youn; Choi, Yoon-La; Shin, Young Kee

2018-01-11

In clinical translational research and molecular in vitro diagnostics, a major challenge in the detection of genetic mutations is overcoming artefactual results caused by the low-quality of formalin-fixed paraffin-embedded tissue (FFPET)-derived DNA (FFPET-DNA). Here, we propose the use of an 'internal quality control (iQC) index' as a criterion for judging the minimum quality of DNA for PCR-based analyses. In a pre-clinical study comparing the results from droplet digital PCR-based EGFR mutation test (ddEGFR test) and qPCR-based EGFR mutation test (cobas EGFR test), iQC index ≥ 0.5 (iQC copies ≥ 500, using 3.3 ng of FFPET-DNA [1,000 genome equivalents]) was established, indicating that more than half of the input DNA was amplifiable. Using this criterion, we conducted a retrospective comparative clinical study of the ddEGFR and cobas EGFR tests for the detection of EGFR mutations in non-small cell lung cancer (NSCLC) FFPET-DNA samples. Compared with the cobas EGFR test, the ddEGFR test exhibited superior analytical performance and equivalent or higher clinical performance. Furthermore, iQC index is a reliable indicator of the quality of FFPET-DNA and could be used to prevent incorrect diagnoses arising from low-quality samples.

A Proteomic Characterization of Factors Enriched at Nascent DNA Molecules

PubMed Central

Lopez-Contreras, Andres J.; Ruppen, Isabel; Nieto-Soler, Maria; Murga, Matilde; Rodriguez-Acebes, Sara; Remeseiro, Silvia; Rodrigo-Perez, Sara; Rojas, Ana M.; Mendez, Juan; Muñoz, Javier; Fernandez-Capetillo, Oscar

2013-01-01

SUMMARY DNA replication is facilitated by multiple factors that concentrate in the vicinity of replication forks. Here, we developed an approach that combines the isolation of proteins on nascent DNA chains with mass spectrometry (iPOND-MS), allowing a comprehensive proteomic characterization of the human replisome and replisome-associated factors. In addition to known replisome components, we provide a broad list of proteins that reside in the vicinity of the replisome, some of which were not previously associated with replication. For instance, our data support a link between DNA replication and the Williams-Beuren syndrome and identify ZNF24 as a replication factor. In addition, we reveal that SUMOylation is wide-spread for factors that concentrate near replisomes, which contrasts with lower UQylation levels at these sites. This resource provides a panoramic view of the proteins that concentrate in the surroundings of the replisome, which should facilitate future investigations on DNA replication and genome maintenance. PMID:23545495

Biologically important conformational features of DNA as interpreted by quantum mechanics and molecular mechanics computations of its simple fragments.

PubMed

Poltev, V; Anisimov, V M; Dominguez, V; Gonzalez, E; Deriabina, A; Garcia, D; Rivas, F; Polteva, N A

2018-02-01

Deciphering the mechanism of functioning of DNA as the carrier of genetic information requires identifying inherent factors determining its structure and function. Following this path, our previous DFT studies attributed the origin of unique conformational characteristics of right-handed Watson-Crick duplexes (WCDs) to the conformational profile of deoxydinucleoside monophosphates (dDMPs) serving as the minimal repeating units of DNA strand. According to those findings, the directionality of the sugar-phosphate chain and the characteristic ranges of dihedral angles of energy minima combined with the geometric differences between purines and pyrimidines determine the dependence on base sequence of the three-dimensional (3D) structure of WCDs. This work extends our computational study to complementary deoxydinucleotide-monophosphates (cdDMPs) of non-standard conformation, including those of Z-family, Hoogsteen duplexes, parallel-stranded structures, and duplexes with mispaired bases. For most of these systems, except Z-conformation, computations closely reproduce experimental data within the tolerance of characteristic limits of dihedral parameters for each conformation family. Computation of cdDMPs with Z-conformation reveals that their experimental structures do not correspond to the internal energy minimum. This finding establishes the leading role of external factors in formation of the Z-conformation. Energy minima of cdDMPs of non-Watson-Crick duplexes demonstrate different sequence-dependence features than those known for WCDs. The obtained results provide evidence that the biologically important regularities of 3D structure distinguish WCDs from duplexes having non-Watson-Crick nucleotide pairing.

Alcohol-Derived Acetaldehyde Exposure in the Oral Cavity

PubMed Central

Guidolin, Valeria; Balbo, Silvia

2018-01-01

Alcohol is classified by the International Agency for Research on Cancer (IARC) as a human carcinogen and its consumption has been associated to an increased risk of liver, breast, colorectum, and upper aerodigestive tract (UADT) cancers. Its mechanisms of carcinogenicity remain unclear and various hypotheses have been formulated depending on the target organ considered. In the case of UADT cancers, alcohol’s major metabolite acetaldehyde seems to play a crucial role. Acetaldehyde reacts with DNA inducing modifications, which, if not repaired, can result in mutations and lead to cancer development. Despite alcohol being mainly metabolized in the liver, several studies performed in humans found higher levels of acetaldehyde in saliva compared to those found in blood immediately after alcohol consumption. These results suggest that alcohol-derived acetaldehyde exposure may occur in the oral cavity independently from liver metabolism. This hypothesis is supported by our recent results showing the presence of acetaldehyde-related DNA modifications in oral cells of monkeys and humans exposed to alcohol, overall suggesting that the alcohol metabolism in the oral cavity is an independent cancer risk factor. This review article will focus on illustrating the factors modulating alcohol-derived acetaldehyde exposure and effects in the oral cavity. PMID:29342885

Smart Carbon Nanotubes with Laser-Controlled Behavior in Gene Delivery and Therapy through a Non-Digestive Trafficking Pathway.

PubMed

Kong, Fenfen; Liu, Fei; Li, Wei; Guo, Xiaomeng; Wang, Zuhua; Zhang, Hanbo; Li, Qingpo; Luo, Lihua; Du, Yongzhong; Jin, Yi; You, Jian

2016-12-01

Near-infrared (NIR) laser-controlled gene delivery presents some benefits in gene therapy, inducing enhanced gene transfection efficiency. In this study, a "photothermal transfection" agent is obtained by wrapping poly(ethylenimine)-cholesterol derivatives (PEI-Chol) around single-walled carbon nanotubes (SWNTs). The PEI-Chol modified SWNTs (PCS) are effective in compressing DNA molecules and protecting them from DNaseI degradation. Compared to the complexes formed by PEI with DNA (PEI/DNA), complexes of PCS and DNA that are formed (PCS/DNA) exhibit a little lower toxicity to HEK293 and HeLa cells under the same PEI molecule weight and weight ratios. Notably, caveolae-mediated cellular uptake of PCS/DNA occurs, which results in a safer intracellular transport of the gene due to the decreased lysosomal degradation in comparison with that of PEI/DNA whose internalization mainly depends on clathrin rather than caveolae. Furthermore, unlike PEI/DNA, PCS/DNA exhibits a photothermal conversion ability, which promotes DNA release from PCS under NIR laser irradiation. The NIR laser-mediated photothermal transfection of PCS 10K /plasmid TP53 (pTP53) results in more apoptosis and necrosis of HeLa cells in vitro than other groups, and achieves a higher tumor-growth inhibition in vivo than naked pTP53, PEI 25K /pTP53, and PCS 10K /pTP53 alone. The enhanced transfection efficiency of PCS/DNA can be attributed to more efficient DNA internalization into the tumor cells, promotes detachment of DNA from PCS under the mediation of NIR laser and higher DNA stability in the cells due to caveolae-mediated cellular uptake of the complexes. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Forces from the Portal Govern the Late-Stage DNA Transport in a Viral DNA Packaging Nanomotor.

PubMed

Jing, Peng; Burris, Benjamin; Zhang, Rong

2016-07-12

In the Phi29 bacteriophage, the DNA packaging nanomotor packs its double-stranded DNA genome into the virus capsid. At the late stage of DNA packaging, the negatively charged genome is increasingly compacted at a higher density in the capsid with a higher internal pressure. During the process, two Donnan effects, osmotic pressure and Donnan equilibrium potentials, are significantly amplified, which, in turn, affect the channel activity of the portal protein, GP10, embedded in the semipermeable capsid shell. In the research, planar lipid bilayer experiments were used to study the channel activities of the viral protein. The Donnan effect on the conformational changes of the viral protein was discovered, indicating GP10 may not be a static channel at the late stage of DNA packaging. Due to the conformational changes, GP10 may generate electrostatic forces that govern the DNA transport. For the section of the genome DNA that remains outside of the connector channel, a strong repulsive force from the viral protein would be generated against the DNA entry; however, for the section of the genome DNA within the channel, the portal protein would become a Brownian motor, which adopts the flash Brownian ratchet mechanism to pump the DNA against the increasingly built-up internal pressure (up to 20 atm) in the capsid. Therefore, the DNA transport in the nanoscale viral channel at the late stage of DNA packaging could be a consequence of Brownian movement of the genomic DNA, which would be rectified and harnessed by the forces from the interior wall of the viral channel under the influence of the Donnan effect. Copyright © 2016 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Programmed Protection of Foreign DNA from Restriction Allows Pathogenicity Island Exchange during Pneumococcal Transformation

PubMed Central

Johnston, Calum; Martin, Bernard; Granadel, Chantal; Polard, Patrice; Claverys, Jean-Pierre

2013-01-01

In bacteria, transformation and restriction-modification (R-M) systems play potentially antagonistic roles. While the former, proposed as a form of sexuality, relies on internalized foreign DNA to create genetic diversity, the latter degrade foreign DNA to protect from bacteriophage attack. The human pathogen Streptococcus pneumoniae is transformable and possesses either of two R-M systems, DpnI and DpnII, which respectively restrict methylated or unmethylated double-stranded (ds) DNA. S. pneumoniae DpnII strains possess DpnM, which methylates dsDNA to protect it from DpnII restriction, and a second methylase, DpnA, which is induced during competence for genetic transformation and is unusual in that it methylates single-stranded (ss) DNA. DpnA was tentatively ascribed the role of protecting internalized plasmids from DpnII restriction, but this seems unlikely in light of recent results establishing that pneumococcal transformation was not evolved to favor plasmid exchange. Here we validate an alternative hypothesis, showing that DpnA plays a crucial role in the protection of internalized foreign DNA, enabling exchange of pathogenicity islands and more generally of variable regions between pneumococcal isolates. We show that transformation of a 21.7 kb heterologous region is reduced by more than 4 logs in dpnA mutant cells and provide evidence that the specific induction of dpnA during competence is critical for full protection. We suggest that the integration of a restrictase/ssDNA-methylase couplet into the competence regulon maintains protection from bacteriophage attack whilst simultaneously enabling exchange of pathogenicicy islands. This protective role of DpnA is likely to be of particular importance for pneumococcal virulence by allowing free variation of capsule serotype in DpnII strains via integration of DpnI capsule loci, contributing to the documented escape of pneumococci from capsule-based vaccines. Generally, this finding is the first evidence for a mechanism that actively promotes genetic diversity of S. pneumoniae through programmed protection and incorporation of foreign DNA. PMID:23459610

High-affinity copper transport and Snq2 export permease of saccharomyces cerevisiae modulate cytotoxicity of PR-10 from Theobroma cacao.

PubMed

Pungartnik, Cristina; da Silva, Aline Clara; de Melo, Sarah Alves; Gramacho, Karina Peres; de Mattos Cascardo, Júlio Cézar; Brendel, Martin; Micheli, Fabienne; da Silva Gesteira, Abelmon

2009-01-01

A pathogenesis-related (PR) protein from Theobroma cacao (TcPR-10) was identified from a cacao-Moniliophthora perniciosa interaction cDNA library. Nucleotide and amino acid sequences showed homology with other PR-10 proteins having P loop motif and Betv1 domain. Recombinant TcPR-10 showed in vitro and in vivo ribonuclease activity, and antifungal activity against the basidiomycete cacao pathogen M. perniciosa and the yeast Saccharomyces cerevisiae. Fluorescein isothiocyanate-labeled TcPR-10 was internalized by M. perniciosa hyphae and S. cerevisiae cells and inhibited growth of both fungi. Energy and temperature-dependent internalization of the TcPR-10 suggested an active importation into the fungal cells. Chronical exposure to TcPR-10 of 29 yeast mutants with single gene defects in DNA repair, general membrane transport, metal transport, and antioxidant defenses was tested. Two yeast mutants were hyperresistant compared with their respective isogenic wild type: ctr3Delta mutant, lacking the high-affinity plasma membrane copper transporter and mac1Delta, the copper-sensing transcription factor involved in regulation of high-affinity copper transport. Acute exposure of exponentially growing yeast cells revealed that TcPR-10 resistance is also enhanced in the Snq2 export permease-lacking mutant which has reduced intracellular presence of TcPR-10.

Towards an ethically sensitive implementation of non invasive prenatal screening in the global context

PubMed Central

Mozersky, Jessica; Ravitsky, Vardit; Rapp, Rayna; Michie, Marsha; Chandrasekharan, Subhashini; Allyse, Megan

2017-01-01

Cell-free DNA (cfDNA) screening is an emerging prenatal technology available in 90 countries. Despite its rapid global diffusion, there is a gap in knowledge about its implementation outside of North America and Europe including low to middle income countries. To address this, we organized an international comparative workshop to explore the ethical and social implications of the global expansion of cfDNA screening. We describe 8 key insights that arose from discussions to illustrate how bioethical discussions and normative frameworks that originate and reflect North American and European ethical priorities can be enriched by attending to the importance of local context. The utility and ethical implications of cfDNA screening are highly variable and dependent upon local healthcare systems, cultural, economic, and socio-political contexts and needs. We call for a more subtle, dynamic and contextual understanding of the international spread of cfDNA screening, which will evoke diverse challenges across different contexts. PMID:28301696

Towards writing the encyclopaedia of life: an introduction to DNA barcoding

PubMed Central

Savolainen, Vincent; Cowan, Robyn S; Vogler, Alfried P; Roderick, George K; Lane, Richard

2005-01-01

An international consortium of major natural history museums, herbaria and other organizations has launched an ambitious project, the ‘Barcode of Life Initiative’, to promote a process enabling the rapid and inexpensive identification of the estimated 10 million species on Earth. DNA barcoding is a diagnostic technique in which short DNA sequence(s) can be used for species identification. The first international scientific conference on Barcoding of Life was held at the Natural History Museum in London in February 2005, and here we review the scientific challenges discussed during this conference and in previous publications. Although still controversial, the scientific benefits of DNA barcoding include: (i) enabling species identification, including any life stage or fragment, (ii) facilitating species discoveries based on cluster analyses of gene sequences (e.g. cox1=CO1, in animals), (iii) promoting development of handheld DNA sequencing technology that can be applied in the field for biodiversity inventories and (iv) providing insight into the diversity of life. PMID:16214739

AP1 Keeps Chromatin Poised for Action | Center for Cancer Research

Cancer.gov

The human genome harbors gene-encoding DNA, the blueprint for building proteins that regulate cellular function. Embedded across the genome, in non-coding regions, are DNA elements to which regulatory factors bind. The interaction of regulatory factors with DNA at these sites modifies gene expression to modulate cell activity. In cells, DNA exists in a complex with proteins

Oxidized ultrashort nanotubes as carbon scaffolds for the construction of cell-penetrating NF-kappaB decoy molecules.

PubMed

Crinelli, Rita; Carloni, Elisa; Menotta, Michele; Giacomini, Elisa; Bianchi, Marzia; Ambrosi, Gianluca; Giorgi, Luca; Magnani, Mauro

2010-05-25

Oligonucleotide (ODN) decoys are synthetic ODNs containing the DNA binding sequence of a transcription factor. When delivered to cells, these molecules can compete with endogenous sequences for binding the transcription factor, thus inhibiting its ability to activate the expression of target genes. Modulation of gene expression by decoy ODNs against nuclear factor-kappaB (NF-kappaB), a transcription factor regulating many genes involved in immunity, has been achieved in a variety of immune/inflammatory disorders. However, the successful use of transcription factor decoys depends on an efficient means to bring the synthetic DNA to target cells. It is known that single-walled carbon nanotubes (SWCNTs), under certain conditions, are able to cross the cell membrane. Thus, we have evaluated the possibility to functionalize SWCNTs with decoy ODNs against NF-kappaB in order to improve their intracellular delivery. To couple ODNs to CNTs, we have exploited the carbodiimide chemistry which allows covalent binding of amino-modified ODNs to carboxyl groups introduced onto SWCNTs through oxidation. The effective binding of ODNs to nanotubes has been demonstrated by a combination of microscopic, spectroscopic, and electrophoretic techniques. The uptake and subcellular distribution of ODN decoys bound to SWCNTs was analyzed by fluorescence microscopy. ODNs were internalized into macrophages and accumulated in the cytosol. Moreover, no cytotoxicity associated with SWCNT administration was observed. Finally, NF-kappaB-dependent gene expression was significantly reduced in cells receiving nanomolar concentrations of SWCNT-NF-kappaB decoys compared to cells receiving SWCNTs or SWCNTs functionalized with a nonspecific ODN sequence, demonstrating both efficacy and specificity of the approach.

Cancer: Bad Luck or Punishment?

PubMed

Lichtenstein, A V

2017-01-01

Contrasting opinions on the role of extrinsic and intrinsic factors in cancer etiology (Tomasetti, C., and Vogelstein, B. (2015) Science, 347, 78-81; Wu, S., et al. (2016) Nature, 529, 43-47) variously define priorities in the war on cancer. The correlation between the lifetime risk of several types of cancer and the total number of divisions of normal self-renewing cells revealed by the authors has given them grounds to put forward the "bad luck" hypothesis. It assumes that ~70% of cancer variability is attributed to random errors arising during DNA replication in normal, noncancerous stem cells, i.e. to internal factors, which is impossible either to expect or to prevent. This assumption caused many critical responses that emphasize, on the contrary, the defining role of extrinsic factors in cancer etiology. The analysis of epidemiological and genetic data presented in this work testifies in favor of the "bad luck" hypothesis.

Relationship between DNA damage response, initiated by camptothecin or oxidative stress, and DNA replication, analyzed by quantitative 3D image analysis.

PubMed

Berniak, K; Rybak, P; Bernas, T; Zarębski, M; Biela, E; Zhao, H; Darzynkiewicz, Z; Dobrucki, J W

2013-10-01

A method of quantitative analysis of spatial (3D) relationship between discrete nuclear events detected by confocal microscopy is described and applied in analysis of a dependence between sites of DNA damage signaling (γH2AX foci) and DNA replication (EdU incorporation) in cells subjected to treatments with camptothecin (Cpt) or hydrogen peroxide (H2O2). Cpt induces γH2AX foci, likely reporting formation of DNA double-strand breaks (DSBs), almost exclusively at sites of DNA replication. This finding is consistent with the known mechanism of induction of DSBs by DNA topoisomerase I (topo1) inhibitors at the sites of collisions of the moving replication forks with topo1-DNA "cleavable complexes" stabilized by Cpt. Whereas an increased level of H2AX histone phosphorylation is seen in S-phase of cells subjected to H2O2, only a minor proportion of γH2AX foci coincide with DNA replication sites. Thus, the increased level of H2AX phosphorylation induced by H2O2 is not a direct consequence of formation of DNA lesions at the sites of moving DNA replication forks. These data suggest that oxidative stress induced by H2O2 and formation of the primary H2O2-induced lesions (8-oxo-7,8-dihydroguanosine) inhibits replication globally and triggers formation of γH2AX at various distances from replication forks. Quantitative analysis of a frequency of DNA replication sites and γH2AX foci suggests also that stalling of replicating forks by Cpt leads to activation of new DNA replication origins. © 2013 International Society for Advancement of Cytometry. Copyright © 2013 International Society for Advancement of Cytometry.

Potential role of DNA methylation as a facilitator of target search processes for transcription factors through interplay with methyl-CpG-binding proteins

PubMed Central

Kemme, Catherine A.; Marquez, Rolando; Luu, Ross H.

2017-01-01

Abstract Eukaryotic genomes contain numerous non-functional high-affinity sequences for transcription factors. These sequences potentially serve as natural decoys that sequester transcription factors. We have previously shown that the presence of sequences similar to the target sequence could substantially impede association of the transcription factor Egr-1 with its targets. In this study, using a stopped-flow fluorescence method, we examined the kinetic impact of DNA methylation of decoys on the search process of the Egr-1 zinc-finger protein. We analyzed its association with an unmethylated target site on fluorescence-labeled DNA in the presence of competitor DNA duplexes, including Egr-1 decoys. DNA methylation of decoys alone did not affect target search kinetics. In the presence of the MeCP2 methyl-CpG-binding domain (MBD), however, DNA methylation of decoys substantially (∼10-30-fold) accelerated the target search process of the Egr-1 zinc-finger protein. This acceleration did not occur when the target was also methylated. These results suggest that when decoys are methylated, MBD proteins can block them and thereby allow Egr-1 to avoid sequestration in non-functional locations. This effect may occur in vivo for DNA methylation outside CpG islands (CGIs) and could facilitate localization of some transcription factors within regulatory CGIs, where DNA methylation is rare. PMID:28486614

DNA replication initiator Cdc6 also regulates ribosomal DNA transcription initiation.

PubMed

Huang, Shijiao; Xu, Xiaowei; Wang, Guopeng; Lu, Guoliang; Xie, Wenbing; Tao, Wei; Zhang, Hongyin; Jiang, Qing; Zhang, Chuanmao

2016-04-01

RNA-polymerase-I-dependent ribosomal DNA (rDNA) transcription is fundamental to rRNA processing, ribosome assembly and protein synthesis. However, how this process is initiated during the cell cycle is not fully understood. By performing a proteomic analysis of transcription factors that bind RNA polymerase I during rDNA transcription initiation, we identified that the DNA replication initiator Cdc6 interacts with RNA polymerase I and its co-factors, and promotes rDNA transcription in G1 phase in an ATPase-activity-dependent manner. We further showed that Cdc6 is targeted to the nucleolus during late mitosis and G1 phase in a manner that is dependent on B23 (also known as nucleophosmin, NPM1), and preferentially binds to the rDNA promoter through its ATP-binding domain. Overexpression of Cdc6 increases rDNA transcription, whereas knockdown of Cdc6 results in a decreased association of both RNA polymerase I and the RNA polymerase I transcription factor RRN3 with rDNA, and a reduction of rDNA transcription. Furthermore, depletion of Cdc6 impairs the interaction between RRN3 and RNA polymerase I. Taken together, our data demonstrate that Cdc6 also serves as a regulator of rDNA transcription initiation, and indicate a mechanism by which initiation of rDNA transcription and DNA replication can be coordinated in cells. © 2016. Published by The Company of Biologists Ltd.

XLS (c9orf142) is a new component of mammalian DNA double-stranded break repair.

PubMed

Craxton, A; Somers, J; Munnur, D; Jukes-Jones, R; Cain, K; Malewicz, M

2015-06-01

Repair of double-stranded DNA breaks (DSBs) in mammalian cells primarily occurs by the non-homologous end-joining (NHEJ) pathway, which requires seven core proteins (Ku70/Ku86, DNA-PKcs (DNA-dependent protein kinase catalytic subunit), Artemis, XRCC4-like factor (XLF), XRCC4 and DNA ligase IV). Here we show using combined affinity purification and mass spectrometry that DNA-PKcs co-purifies with all known core NHEJ factors. Furthermore, we have identified a novel evolutionary conserved protein associated with DNA-PKcs-c9orf142. Computer-based modelling of c9orf142 predicted a structure very similar to XRCC4, hence we have named c9orf142-XLS (XRCC4-like small protein). Depletion of c9orf142/XLS in cells impaired DSB repair consistent with a defect in NHEJ. Furthermore, c9orf142/XLS interacted with other core NHEJ factors. These results demonstrate the existence of a new component of the NHEJ DNA repair pathway in mammalian cells.

11th International Conference of Radiation Research

DOE Office of Scientific and Technical Information (OSTI.GOV)

NONE

1999-07-18

Topics discussed in the conference included the following: Radiation Physics, Radiation Chemistry and modelling--Radiation physics and dosimetry; Electron transfer in biological media; Radiation chemistry; Biophysical and biochemical modelling; Mechanisms of DNA damage; Assays of DNA damage; Energy deposition in micro volumes; Photo-effects; Special techniques and technologies; Oxidative damage. Molecular and cellular effects-- Photobiology; Cell cycle effects; DNA damage: Strand breaks; DNA damage: Bases; DNA damage Non-targeted; DNA damage: other; Chromosome aberrations: clonal; Chromosomal aberrations: non-clonal; Interactions: Heat/Radiation/Drugs; Biochemical effects; Protein expression; Gene induction; Co-operative effects; ``Bystander'' effects; Oxidative stress effects; Recovery from radiation damage. DNA damage and repair -- DNAmore » repair genes; DNA repair deficient diseases; DNA repair enzymology; Epigenetic effects on repair; and Ataxia and ATM.« less

Predictive and Prognostic Factors in Definition of Risk Groups in Endometrial Carcinoma

PubMed Central

Sorbe, Bengt

2012-01-01

Background. The aim was to evaluate predictive and prognostic factors in a large consecutive series of endometrial carcinomas and to discuss pre- and postoperative risk groups based on these factors. Material and Methods. In a consecutive series of 4,543 endometrial carcinomas predictive and prognostic factors were analyzed with regard to recurrence rate and survival. The patients were treated with primary surgery and adjuvant radiotherapy. Two preoperative and three postoperative risk groups were defined. DNA ploidy was included in the definitions. Eight predictive or prognostic factors were used in multivariate analyses. Results. The overall recurrence rate of the complete series was 11.4%. Median time to relapse was 19.7 months. In a multivariate logistic regression analysis, FIGO grade, myometrial infiltration, and DNA ploidy were independent and statistically predictive factors with regard to recurrence rate. The 5-year overall survival rate was 73%. Tumor stage was the single most important factor with FIGO grade on the second place. DNA ploidy was also a significant prognostic factor. In the preoperative risk group definitions three factors were used: histology, FIGO grade, and DNA ploidy. Conclusions. DNA ploidy was an important and significant predictive and prognostic factor and should be used both in preoperative and postoperative risk group definitions. PMID:23209924

Characterization of the growth of murine fibroblasts that express human insulin receptors. II. Interaction of insulin with other growth factors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Randazzo, P.A.; Jarett, L.

1990-09-01

The effects of insulin-like growth factor-1 (IGF-1), epidermal growth factor (EGF), platelet-derived growth factor (PDGF), and insulin on DNA synthesis were studied in murine fibroblasts transfected with an expression vector containing human insulin receptor cDNA (NIH 3T3/HIR) and the parental NIH 3T3 cells. In NIH 3T3/HIR cells, individual growth factors in serum-free medium stimulated DNA synthesis with the following relative efficacies: insulin greater than or equal to 10% fetal calf serum greater than PDGF greater than IGF-1 much greater than EGF. In comparison, the relative efficacies of these factors in stimulating DNA synthesis by NIH 3T3 cells were 10% fetalmore » calf serum greater than PDGF greater than EGF much greater than IGF-1 = insulin. In NIH 3T3/HIR cells, EGF was synergistic with 1-10 ng/ml insulin but not with 100 ng/ml insulin or more. Synergy of PDGF or IGF-1 with insulin was not detected. In the parental NIH 3T3 cells, insulin and IGF-1 were found to be synergistic with EGF (1 ng/ml), PDGF (100 ng/ml), and PDGF plus EGF. In NIH 3T3/HIR cells, the lack of interaction of insulin with other growth factors was also observed when the percentage of cells synthesizing DNA was examined. Despite insulin's inducing only 60% of NIH 3T3/HIR cells to incorporate thymidine, addition of PDGF, EGF, or PDGF plus EGF had no further effect. In contrast, combinations of growth factors resulted in 95% of the parental NIH 3T3 cells synthesizing DNA. The independence of insulin-stimulated DNA synthesis from other mitogens in the NIH 3T3/HIR cells is atypical for progression factor-stimulated DNA synthesis and is thought to be partly the result of insulin receptor expression in an inappropriate context or quantity.« less

TFBSshape: a motif database for DNA shape features of transcription factor binding sites.

PubMed

Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W; Gordân, Raluca; Rohs, Remo

2014-01-01

Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein-DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone.

TFBSshape: a motif database for DNA shape features of transcription factor binding sites

PubMed Central

Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W.; Gordân, Raluca; Rohs, Remo

2014-01-01

Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein–DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone. PMID:24214955

Isolation, characterization, and development of WRKY genes as useful genetic markers in Theobroma cacao.

PubMed

Borrone, James W; Kuhn, David N; Schnell, Raymond J

2004-08-01

There is currently an international effort in improving disease resistance and crop yield in Theobroma cacao L., an economically important crop of the tropics, using marker-assisted selection for breeding. We are developing molecular genetic markers focusing upon gene families involved with disease resistance. One such family is the WRKY proteins, which are plant-specific transcriptional factors associated with regulating defense responses to both abiotic and biotic stresses. Degenerate PCR primers were designed to the highly conserved DNA-binding domain and other conserved motifs of group I and group II, subgroups a-c, WRKY genes. Sixteen individual WRKY fragments were isolated from a mixture of T. cacao DNA using one pair of primers. Of the 16 WRKY loci investigated, seven contained single nucleotide polymorphisms within the intron as detected by sequence comparison of the PCR products. Four of these were successfully converted into molecular markers and mapped in an F2 population by capillary electrophoresis-single strand conformation polymorphism analysis. This is the first report of a pair of degenerate primers amplifying WRKY loci directly from genomic DNA and demonstrates a simple method for developing useful genetic markers from members of a large gene family. Copyright 2004 Springer-Verlag

Detection of Streptococcus mutans Genomic DNA in Human DNA Samples Extracted from Saliva and Blood

PubMed Central

Vieira, Alexandre R.; Deeley, Kathleen B.; Callahan, Nicholas F.; Noel, Jacqueline B.; Anjomshoaa, Ida; Carricato, Wendy M.; Schulhof, Louise P.; DeSensi, Rebecca S.; Gandhi, Pooja; Resick, Judith M.; Brandon, Carla A.; Rozhon, Christopher; Patir, Asli; Yildirim, Mine; Poletta, Fernando A.; Mereb, Juan C.; Letra, Ariadne; Menezes, Renato; Wendell, Steven; Lopez-Camelo, Jorge S.; Castilla, Eduardo E.; Orioli, Iêda M.; Seymen, Figen; Weyant, Robert J.; Crout, Richard; McNeil, Daniel W.; Modesto, Adriana; Marazita, Mary L.

2011-01-01

Caries is a multifactorial disease, and studies aiming to unravel the factors modulating its etiology must consider all known predisposing factors. One major factor is bacterial colonization, and Streptococcus mutans is the main microorganism associated with the initiation of the disease. In our studies, we have access to DNA samples extracted from human saliva and blood. In this report, we tested a real-time PCR assay developed to detect copies of genomic DNA from Streptococcus mutans in 1,424 DNA samples from humans. Our results suggest that we can determine the presence of genomic DNA copies of Streptococcus mutans in both DNA samples from caries-free and caries-affected individuals. However, we were not able to detect the presence of genomic DNA copies of Streptococcus mutans in any DNA samples extracted from peripheral blood, which suggests the assay may not be sensitive enough for this goal. Values of the threshold cycle of the real-time PCR reaction correlate with higher levels of caries experience in children, but this correlation could not be detected for adults. PMID:21731912

A verotoxin 1 B subunit-lambda CRO chimeric protein specifically binds both DNA and globotriaosylceramide (Gb(3)) to effect nuclear targeting of exogenous DNA in Gb(3) positive cells.

PubMed

Facchini, L M; Lingwood, C A

2001-09-10

Inefficient nuclear incorporation of foreign DNA remains a critical roadblock in the development of effective nonviral gene delivery systems. DNA delivered by traditional protocols remains within endosomal/lysosomal vesicles, or is rapidly degraded in the cytoplasm. Verotoxin I (VT), an AB(5) subunit toxin produced by enterohaemorrhagic Escherichia coli, binds to the cell surface glycolipid, globotriaosylceramide (Gb(3)) and is internalized into preendosomes. VT is then retrograde transported to the Golgi, endoplasmic reticulum (ER), and nucleus of highly VT-sensitive cells. We have utilized this nuclear targeting of VT to design a unique delivery system which transports exogenous DNA via vesicular traffic to the nucleus. The nontoxic VT binding subunit (VTB) was fused to the lambda Cro DNA-binding repressor, generating a 14-kDa VTB-Cro chimera. VTB-Cro binds specifically via the Cro domain to a 25-bp DNA fragment containing the consensus Cro operator. VTB-Cro demonstrates simultaneous specific binding to Gb(3). Treatment of Vero cells with fluorescent-labeled Cro operator DNA in the presence of VTB-Cro, results in DNA internalization to the Golgi, ER, and nucleus, whereas fluorescent DNA alone is incorporated poorly and randomly within the cytoplasm. VTB-Cro mediated nuclear DNA transport is prevented by brefeldin A, consistent with Golgi/ER intracellular routing. Pretreatment with filipin had no effect, indicating that caveoli are not involved. This novel VTB-Cro shuttle protein may find practical applications in the fields of intracellular targeting, gene delivery, and gene therapy. Copyright 2001 Academic Press.

DNA damage in children and adolescents with cardiovascular disease risk factors.

PubMed

Kliemann, Mariele; Prá, Daniel; Müller, Luiza L; Hermes, Liziane; Horta, Jorge A; Reckziegel, Miriam B; Burgos, Miria S; Maluf, Sharbel W; Franke, Silvia I R; Silva, Juliana da

2012-09-01

The risk of developing cardiovascular disease (CVD) is related to lifestyle (e.g. diet, physical activity and smoking) as well as to genetic factors. This study aimed at evaluating the association between CVD risk factors and DNA damage levels in children and adolescents. Anthropometry, diet and serum CVD risk factors were evaluated by standard procedures. DNA damage levels were accessed by the comet assay (Single cell gel electrophoresis; SCGE) and cytokinesis-blocked micronucleus (CBMN) assays in leukocytes. A total of 34 children and adolescents selected from a population sample were divided into three groups according to their level of CVD risk. Moderate and high CVD risk subjects showed significantly higher body fat and serum CVD risk markers than low risk subjects (P<0.05). High risk subjects also showed a significant increase in DNA damage, which was higher than that provided by low and moderate risk subjects according to SCGE, but not according to the CBMN assay. Vitamin C intake was inversely correlated with DNA damage by SCGE, and micronucleus (MN) was inversely correlated with folate intake. The present results indicate an increase in DNA damage that may be a consequence of oxidative stress in young individuals with risk factors for CVD, indicating that the DNA damage level can aid in evaluating the risk of CVD.

Diversity of environmental single-stranded DNA phages revealed by PCR amplification of the partial major capsid protein

PubMed Central

Hopkins, Max; Kailasan, Shweta; Cohen, Allison; Roux, Simon; Tucker, Kimberly Pause; Shevenell, Amelia; Agbandje-McKenna, Mavis; Breitbart, Mya

2014-01-01

The small single-stranded DNA (ssDNA) bacteriophages of the subfamily Gokushovirinae were traditionally perceived as narrowly targeted, niche-specific viruses infecting obligate parasitic bacteria, such as Chlamydia. The advent of metagenomics revealed gokushoviruses to be widespread in global environmental samples. This study expands knowledge of gokushovirus diversity in the environment by developing a degenerate PCR assay to amplify a portion of the major capsid protein (MCP) gene of gokushoviruses. Over 500 amplicons were sequenced from 10 environmental samples (sediments, sewage, seawater and freshwater), revealing the ubiquity and high diversity of this understudied phage group. Residue-level conservation data generated from multiple alignments was combined with a predicted 3D structure, revealing a tendency for structurally internal residues to be more highly conserved than surface-presenting protein–protein or viral–host interaction domains. Aggregating this data set into a phylogenetic framework, many gokushovirus MCP clades contained samples from multiple environments, although distinct clades dominated the different samples. Antarctic sediment samples contained the most diverse gokushovirus communities, whereas freshwater springs from Florida were the least diverse. Whether the observed diversity is being driven by environmental factors or host-binding interactions remains an open question. The high environmental diversity of this previously overlooked ssDNA viral group necessitates further research elucidating their natural hosts and exploring their ecological roles. PMID:24694711

Signatures of DNA target selectivity by ETS transcription factors

PubMed Central

Kim, Hye Mi

2017-01-01

ABSTRACT The ETS family of transcription factors is a functionally heterogeneous group of gene regulators that share a structurally conserved, eponymous DNA-binding domain. DNA target specificity derives from combinatorial interactions with other proteins as well as intrinsic heterogeneity among ETS domains. Emerging evidence suggests molecular hydration as a fundamental feature that defines the intrinsic heterogeneity in DNA target selection and susceptibility to epigenetic DNA modification. This perspective invokes novel hypotheses in the regulation of ETS proteins in physiologic osmotic stress, their pioneering potential in heterochromatin, and the effects of passive and pharmacologic DNA demethylation on ETS regulation. PMID:28301293

Signatures of DNA target selectivity by ETS transcription factors.

PubMed

Poon, Gregory M K; Kim, Hye Mi

2017-05-27

The ETS family of transcription factors is a functionally heterogeneous group of gene regulators that share a structurally conserved, eponymous DNA-binding domain. DNA target specificity derives from combinatorial interactions with other proteins as well as intrinsic heterogeneity among ETS domains. Emerging evidence suggests molecular hydration as a fundamental feature that defines the intrinsic heterogeneity in DNA target selection and susceptibility to epigenetic DNA modification. This perspective invokes novel hypotheses in the regulation of ETS proteins in physiologic osmotic stress, their pioneering potential in heterochromatin, and the effects of passive and pharmacologic DNA demethylation on ETS regulation.

N-Acetyl-L-cysteine protects thyroid cells against DNA damage induced by external and internal irradiation.

PubMed

Kurashige, Tomomi; Shimamura, Mika; Nagayama, Yuji

2017-11-01

We evaluated the effect of the antioxidant N-acetyl-L-cysteine (NAC) on the levels of reactive oxygen species (ROS), DNA double strand breaks (DSB) and micronuclei (MN) induced by internal and external irradiation using a rat thyroid cell line PCCL3. In internal irradiation experiments, ROS and DSB levels increased immediately after 131 I addition and then gradually declined, resulting in very high levels of MN at 24 and 48 h. NAC administration both pre- and also post- 131 I addition suppressed ROS, DSB and MN. In external irradiation experiments with a low dose (0.5 Gy), ROS and DSB increased shortly and could be prevented by NAC administration pre-, but not post-irradiation. In contrast, external irradiation with a high dose (5 Gy) increased ROS and DSB in a bimodal way: ROS and DSB levels increased immediately after irradiation, quickly returned to the basal levels and gradually rose again after >24 h. The second phase was in parallel with an increase in 4-hydroxy-2-nonenal. The number of MN induced by the second wave of ROS/DSB elevations was much higher than that by the first peak. In this situation, NAC administered pre- and post-irradiation comparably suppressed MN induced by a delayed ROS elevation. In conclusion, a prolonged ROS increase during internal irradiation and a delayed ROS increase after external irradiation with a high dose caused serious DNA damage, which were efficiently prevented by NAC. Thus, NAC administration even both after internal or external irradiation prevents ROS increase and eventual DNA damage.

Relationships in subtribe Diocleinae (Leguminosae; Papilionoideae) inferred from internal transcribed spacer sequences from nuclear ribosomal DNA.

PubMed

Varela, Eduardo S; Lima, João P M S; Galdino, Alexsandro S; Pinto, Luciano da S; Bezerra, Walderly M; Nunes, Edson P; Alves, Maria A O; Grangeiro, Thalles B

2004-01-01

The complete sequences of nuclear ribosomal DNA (nrDNA) internal transcribed spacer regions (ITS/5.8S) were determined for species belonging to six genera from the subtribe Diocleinae as well as for the anomalous genera Calopogonium and Pachyrhizus. Phylogenetic trees constructed by distance matrix, maximum parsimony and maximum likelihood methods showed that Calopogonium and Pachyrhizus were outside the clade Diocleinae (Canavalia, Camptosema, Cratylia, Dioclea, Cymbosema, and Galactia). This finding supports previous morphological, phytochemical, and molecular evidence that Calopogonium and Pachyrhizus do not belong to the subtribe Diocleinae. Within the true Diocleinae clade, the clustering of genera and species were congruent with morphology-based classifications, suggesting that ITS/5.8S sequences can provide enough informative sites to allow resolution below the genus level. This is the first evidence of the phylogeny of subtribe Diocleinae based on nuclear DNA sequences.

Luciferase assay to study the activity of a cloned promoter DNA fragment.

PubMed

Solberg, Nina; Krauss, Stefan

2013-01-01

Luciferase based assays have become an invaluable tool for the analysis of cloned promoter DNA fragments, both for verifying the ability of a potential promoter fragment to drive the expression of a luciferase reporter gene in various cellular contexts, and for dissecting binding elements in the promoter. Here, we describe the use of the Dual-Luciferase(®) Reporter Assay System created by Promega (Promega Corporation, Wisconsin, USA) to study the cloned 6.7 kilobases (kb) mouse (m) Tcf3 promoter DNA fragment in mouse embryonic derived neural stem cells (NSC). In this system, the expression of the firefly luciferase driven by the cloned mTcf3 promoter DNA fragment (including transcription initiation sites) is correlated with a co-transfected control reporter expressing Renilla luciferase from the herpes simplex virus (HSV) thymidine kinase promoter. Using an internal control reporter allows to normalize the activity of the experimental reporter to the internal control, which minimizes experimental variability.

Rapid internal contraction boosts DNA friction.

PubMed

Otto, Oliver; Sturm, Sebastian; Laohakunakorn, Nadanai; Keyser, Ulrich F; Kroy, Klaus

2013-01-01

Macroscopic objects are usually manipulated by force and observed with light. On the nanoscale, however, this is often done oppositely: individual macromolecules are manipulated by light and monitored with force. This procedure, which is the basis of single-molecule force spectroscopy, has led to much of our quantitative understanding of how DNA works, and is now routinely applied to explore molecular structure and interactions, DNA-protein reactions and protein folding. Here we develop the technique further by introducing a dynamic force spectroscopy set-up for a non-invasive inspection of the tension dynamics in a taut strand of DNA. The internal contraction after a sudden release of the molecule is shown to give rise to a drastically enhanced viscous friction, as revealed by the slow relaxation of an attached colloidal tracer. Our systematic theory explains the data quantitatively and provides a powerful tool for the rational design of new dynamic force spectroscopy assays.

Relation Between Deoxyribonucleic Acid and Intracytoplasmic Membranes in Escherichia coli O111a11

PubMed Central

Altenburg, Betty C.; Suit, Joan C.

1970-01-01

The possibility of a relationship between intracytoplasmic membranes and deoxyribonucleic acid (DNA) in Escherichia coli O111a1 has been investigated. To facilitate this investigation, a simple enzymatic assay for the amount of internal membrane present in a culture was developed. This assay was then used to show that the appearance of intracytoplasmic membranes is accompanied by an increase in the DNA content of the cells. Electron micrographs have confirmed this observation and have shown DNA to be in contact with the intracytoplasmic membranes. Extensive membranes were observed at sites of apparently unsuccessful attempts at cell division. These observations led to the conclusion that the internal membrane formed by strain O111a1 represents “extra” membrane, which is functional in that it contains sites for DNA replication, but is produced in excess because the organism is somehow defective in its regulation of membrane synthesis. Images PMID:4192984

Data-Independent Mass Spectrometry Approach for Screening and Identification of DNA Adducts.

PubMed

Guo, Jingshu; Villalta, Peter W; Turesky, Robert J

2017-11-07

Long-term exposures to environmental toxicants and endogenous electrophiles are causative factors for human diseases including cancer. DNA adducts reflect the internal exposure to genotoxicants and can serve as biomarkers for risk assessment. Liquid chromatography-multistage mass spectrometry (LC-MS n ) is the most common method for biomonitoring DNA adducts, generally targeting single exposures and measuring up to several adducts. However, the data often provide limited evidence for a role of a chemical in the etiology of cancer. An "untargeted" method is required that captures global exposures to chemicals, by simultaneously detecting their DNA adducts in the genome; some of which may induce cancer-causing mutations. We established a wide selected ion monitoring tandem mass spectrometry (wide-SIM/MS 2 ) screening method utilizing ultraperformance-LC nanoelectrospray ionization Orbitrap MS n with online trapping to enrich bulky, nonpolar adducts. Wide-SIM scan events are followed by MS 2 scans to screen for modified nucleosides by coeluting peaks containing precursor and fragment ions differing by -116.0473 Da, attributed to the neutral loss of deoxyribose. Wide-SIM/MS 2 was shown to be superior in sensitivity, specificity, and breadth of adduct coverage to other tested adductomic methods with detection possible at adduct levels as low as 4 per 10 9 nucleotides. Wide-SIM/MS 2 data can be analyzed in a "targeted" fashion by generation of extracted ion chromatograms or in an "untargeted" fashion where a chromatographic peak-picking algorithm can be used to detect putative DNA adducts. Wide-SIM/MS 2 successfully detected DNA adducts, derived from chemicals in the diet and traditional medicines and from lipid peroxidation products, in human prostate and renal specimens.

Advances in the understanding of mitochondrial DNA as a pathogenic factor in inflammatory diseases

PubMed Central

Boyapati, Ray K.; Tamborska, Arina; Dorward, David A.; Ho, Gwo-Tzer

2017-01-01

Mitochondrial DNA (mtDNA) has many similarities with bacterial DNA because of their shared common ancestry. Increasing evidence demonstrates mtDNA to be a potent danger signal that is recognised by the innate immune system and can directly modulate the inflammatory response. In humans, elevated circulating mtDNA is found in conditions with significant tissue injury such as trauma and sepsis and increasingly in chronic organ-specific and systemic illnesses such as steatohepatitis and systemic lupus erythematosus. In this review, we examine our current understanding of mtDNA-mediated inflammation and how the mechanisms regulating mitochondrial homeostasis and mtDNA release represent exciting and previously under-recognised important factors in many human inflammatory diseases, offering many new translational opportunities. PMID:28299196

A systematic analysis of factors localized to damaged chromatin reveals PARP-dependent recruitment of transcription factors

PubMed Central

Izhar, Lior; Adamson, Britt; Ciccia, Alberto; Lewis, Jedd; Pontano-Vaites, Laura; Leng, Yumei; Liang, Anthony C.; Westbrook, Thomas F.; Harper, J. Wade; Elledge, Stephen J.

2015-01-01

Localization to sites of DNA damage is a hallmark of DNA damage response (DDR) proteins. To identify new DDR factors, we screened epitope-tagged proteins for localization to sites of chromatin damaged by UV laser microirradiation and found >120 proteins that localize to damaged chromatin. These include the BAF tumor suppressor complex and the ALS candidate protein TAF15. TAF15 contains multiple domains that bind damaged chromatin in a PARP-dependent manner, suggesting a possible role as glue that tethers multiple PAR chains together. Many positives were transcription factors and >70% of randomly tested transcription factors localized to sites of DNA damage and approximately 90% were PARP-dependent for localization. Mutational analyses showed that localization to damaged chromatin is DNA-binding domain-dependent. By examining Hoechst staining patterns at damage sites, we see evidence of chromatin decompaction that is PARP-dependent. We propose that PARP-regulated chromatin remodeling at sites of damage allows transient accessibility of DNA-binding proteins. PMID:26004182

Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process.

PubMed

Reshetnikov, Roman V; Sponer, Jiri; Rassokhina, Olga I; Kopylov, Alexei M; Tsvetkov, Philipp O; Makarov, Alexander A; Golovin, Andrey V

2011-12-01

A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. © The Author(s) 2011. Published by Oxford University Press.

A new cultivation independent approach to detect and monitor common Trichoderma species in soils.

PubMed

Hagn, Alexandra; Wallisch, Stefanie; Radl, Viviane; Charles Munch, Jean; Schloter, Michael

2007-04-01

A set of primers was developed for the detection, identification and quantification of common Trichoderma species in soil samples. Based on a broad range master alignment primers were derived to amplify an approximate 540 bp fragment comprising the internal transcribed spacer region 1 (ITS 1), 5.8S rDNA and internal transcribed spacer region 2 (ITS 2) from all taxonomic Clades of the genus Trichoderma. The primer set was applied to test strains as well as community DNA isolated from arable and forest soil. For all tested isolates the corresponding internal transcribed spacer regions of Trichoderma spp. strains were amplified, but none of non-Trichoderma origin. PCR with community DNA from soil yielded products of the expected size. Analysis of a clone library established for an arable site showed that all amplified sequences originated exclusively from Trichoderma species mainly being representatives of the Clades Hamatum, Harzianum and Pachybasioides and comprising most of the species known for biocontrol ability. In a realtime PCR approach the primer set uTf/uTr also proved to be a suitable system to quantify DNA of Trichoderma spp. in soils.

Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process

PubMed Central

Reshetnikov, Roman V.; Sponer, Jiri; Rassokhina, Olga I.; Kopylov, Alexei M.; Tsvetkov, Philipp O.; Makarov, Alexander A.; Golovin, Andrey V.

2011-01-01

A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. PMID:21893589

DNA replication machinery is required for development in Drosophila.

PubMed

Kohzaki, Hidetsugu; Asano, Maki; Murakami, Yota

2018-01-01

 In Drosophila , some factors involved in chromosome replication seem to be involved in gene amplification and endoreplication, which are actively utilized in particular tissue development, but direct evidence has not been shown. Therefore, we examined the effect of depletion of replication factors on these processes. First, we confirmed RNAi knockdown can be used for the depletion of replication factors by comparing the phenotypes of RNAi knockdown and deletion or point mutants of the components of DNA licensing factor, MCM2, MCM4 and Cdt1. Next, we found that tissue-specific RNAi knockdown of replication factors caused tissue-specific defects, probably due to defects in DNA replication. In particular, we found that depletion inhibited gene amplification of the chorion gene in follicle cells and endoreplication in salivary glands, showing that chromosomal DNA replication factors are required for these processes. Finally, using RNAi, we screened the genes for chromosomal DNA replication that affected tissue development. Interestingly, wing specific knockdown of Mcm10 induced wing formation defects. These results suggest that some components of chromosomal replication machinery are directly involved in tissue development.

The DNA of Bacteria of the World Ocean and the Earth in Cosmic Dust at the International Space Station

PubMed Central

Grebennikova, T. V.; Syroeshkin, A. V.; Shubralova, E. V.; Eliseeva, O. V.; Kostina, L. V.; Kulikova, N. Y.; Latyshev, O. E.; Morozova, M. A.; Yuzhakov, A. G.; Chichaeva, M. A.; Tsygankov, O. S.

2018-01-01

Cosmic dust samples from the surface of the illuminator of the International Space Station (ISS) were collected by a crew member during his spacewalk. The sampler with tampon in a vacuum container was delivered to the Earth. Washouts from the tampon's material and the tampon itself were analyzed for the presence of bacterial DNA by the method of nested PCR with primers specific to DNA of the genus Mycobacteria, DNA of the strains of capsular bacteria Bacillus, and DNA encoding 16S ribosomal RNA. The results of amplification followed by sequencing and phylogenetic analysis indicated the presence of the bacteria of the genus Mycobacteria and the extreme bacterium of the genus Delftia in the samples of cosmic dust. It was shown that the DNA sequence of one of the bacteria of the genus Mycobacteria was genetically similar to that previously observed in superficial micro layer at the Barents and Kara seas' coastal zones. The presence of the wild land and marine bacteria DNA on the ISS suggests their possible transfer from the stratosphere into the ionosphere with the ascending branch of the global electric circuit. Alternatively, the wild land and marine bacteria as well as the ISS bacteria may all have an ultimate space origin. PMID:29849510

The DNA of Bacteria of the World Ocean and the Earth in Cosmic Dust at the International Space Station.

PubMed

Grebennikova, T V; Syroeshkin, A V; Shubralova, E V; Eliseeva, O V; Kostina, L V; Kulikova, N Y; Latyshev, O E; Morozova, M A; Yuzhakov, A G; Zlatskiy, I A; Chichaeva, M A; Tsygankov, O S

2018-01-01

Cosmic dust samples from the surface of the illuminator of the International Space Station (ISS) were collected by a crew member during his spacewalk. The sampler with tampon in a vacuum container was delivered to the Earth. Washouts from the tampon's material and the tampon itself were analyzed for the presence of bacterial DNA by the method of nested PCR with primers specific to DNA of the genus Mycobacteria , DNA of the strains of capsular bacteria Bacillus , and DNA encoding 16S ribosomal RNA. The results of amplification followed by sequencing and phylogenetic analysis indicated the presence of the bacteria of the genus Mycobacteria and the extreme bacterium of the genus Delftia in the samples of cosmic dust. It was shown that the DNA sequence of one of the bacteria of the genus Mycobacteria was genetically similar to that previously observed in superficial micro layer at the Barents and Kara seas' coastal zones. The presence of the wild land and marine bacteria DNA on the ISS suggests their possible transfer from the stratosphere into the ionosphere with the ascending branch of the global electric circuit. Alternatively, the wild land and marine bacteria as well as the ISS bacteria may all have an ultimate space origin.

Effects of Spaceflight on Molecular and Cellular Responses to Bleomycin-induced DNA Damages in Confluent Human Fibroblasts

NASA Astrophysics Data System (ADS)

Lu, Tao; Wu, Honglu; Karouia, Fathi; Stodieck, Louis; Zhang, Ye; Wong, Michael

2016-07-01

Spaceflights expose human beings to various risk factors. Among them are microgravity related physiological stresses in immune, cytoskeletal, and cardiovascular systems, and space radiation related elevation of cancer risk. Cosmic radiation consists of energetic protons and other heavier charged particles that induce DNA damages. Effective DNA damage response and repair mechanism is important to maintain genomic integrity and reduce cancer risk. There were studies on effects of spaceflight and microgravity on DNA damage response in cell and animal models, but the published results were mostly conflicting and inconsistent. To investigate effects of spaceflight on molecular and cellular responses to DNA damages, bleomycin, an anti-cancer drug and radiomimetic reagent, was used to induce DNA damages in confluent human fibroblasts flown to the International Space Station (ISS) and on ground. After exposure to 1.0 mg/ml bleomycin for 3 hours, cells were fixed for immunofluorescence assays and for RNA preparation. Extents of DNA damages were quantified by focus pattern and focus number counting of phosphorylated histone protein H2AX (γg-H2AX). The cells on the ISS showed modestly increased average focus counts per nucleus while the distribution of patterns was similar to that on the ground. PCR array analysis showed that expressions of several genes, including CDKN1A and PCNA, were significantly changed in response to DNA damages induced by bleomycin in both flight and ground control cells. However, there were no significant differences in the overall expression profiles of DNA damage response genes between the flight and ground samples. Analysis of cellular proliferation status with Ki-67 staining showed a slightly higher proliferating population in cells on the ISS than those on ground. Our results suggested that the difference in γg-H2AX focus counts between flight and ground was due to the higher percentage of proliferating cells in space, but spaceflight did not significantly affect initial transcriptional responses to bleomycin treatment in the selected genes in the DNA damage signaling pathways.

DNA Dosimetry Assessment for Sunscreen Genotoxic Photoprotection

PubMed Central

Schuch, André Passaglia; Lago, Juliana Carvalhães; Yagura, Teiti; Menck, Carlos Frederico Martins

2012-01-01

Background Due to the increase of solar ultraviolet radiation (UV) incidence over the last few decades, the use of sunscreen has been widely adopted for skin protection. However, considering the high efficiency of sunlight-induced DNA lesions, it is critical to improve upon the current approaches that are used to evaluate protection factors. An alternative approach to evaluate the photoprotection provided by sunscreens against daily UV radiation-induced DNA damage is provided by the systematic use of a DNA dosimeter. Methodology/Principal Findings The Sun Protection Factor for DNA (DNA-SPF) is calculated by using specific DNA repair enzymes, and it is defined as the capacity for inhibiting the generation of cyclobutane pyrimidine dimers (CPD) and oxidised DNA bases compared with unprotected control samples. Five different commercial brands of sunscreen were initially evaluated, and further studies extended the analysis to include 17 other products representing various formulations and Sun Protection Factors (SPF). Overall, all of the commercial brands of SPF 30 sunscreens provided sufficient protection against simulated sunlight genotoxicity. In addition, this DNA biosensor was useful for rapidly screening the biological protection properties of the various sunscreen formulations. Conclusions/Significance The application of the DNA dosimeter is demonstrated as an alternative, complementary, and reliable method for the quantification of sunscreen photoprotection at the level of DNA damage. PMID:22768281

A Novel RNA Polymerase I Transcription Initiation Factor, TIF-IE, Commits rRNA Genes by Interaction with TIF-IB, Not by DNA Binding

PubMed Central

Al-Khouri, Anna Maria; Paule, Marvin R.

2002-01-01

In the small, free-living amoeba Acanthamoeba castellanii, rRNA transcription requires, in addition to RNA polymerase I, a single DNA-binding factor, transcription initiation factor IB (TIF-IB). TIF-IB is a multimeric protein that contains TATA-binding protein (TBP) and four TBP-associated factors that are specific for polymerase I transcription. TIF-IB is required for accurate and promoter-specific initiation of rRNA transcription, recruiting and positioning the polymerase on the start site by protein-protein interaction. In A. castellanii, partially purified TIF-IB can form a persistent complex with the ribosomal DNA (rDNA) promoter while homogeneous TIF-IB cannot. An additional factor, TIF-IE, is required along with homogeneous TIF-IB for the formation of a stable complex on the rDNA core promoter. We show that TIF-IE by itself, however, does not bind to the rDNA promoter and thus differs in its mechanism from the upstream binding factor and upstream activating factor, which carry out similar complex-stabilizing functions in vertebrates and yeast, respectively. In addition to its presence in impure TIF-IB, TIF-IE is found in highly purified fractions of polymerase I, with which it associates. Renaturation of polypeptides excised from sodium dodecyl sulfate-polyacrylamide gels showed that a 141-kDa polypeptide possesses all the known activities of TIF-IE. PMID:11784852

A novel RNA polymerase I transcription initiation factor, TIF-IE, commits rRNA genes by interaction with TIF-IB, not by DNA binding.

PubMed

Al-Khouri, Anna Maria; Paule, Marvin R

2002-02-01

In the small, free-living amoeba Acanthamoeba castellanii, rRNA transcription requires, in addition to RNA polymerase I, a single DNA-binding factor, transcription initiation factor IB (TIF-IB). TIF-IB is a multimeric protein that contains TATA-binding protein (TBP) and four TBP-associated factors that are specific for polymerase I transcription. TIF-IB is required for accurate and promoter-specific initiation of rRNA transcription, recruiting and positioning the polymerase on the start site by protein-protein interaction. In A. castellanii, partially purified TIF-IB can form a persistent complex with the ribosomal DNA (rDNA) promoter while homogeneous TIF-IB cannot. An additional factor, TIF-IE, is required along with homogeneous TIF-IB for the formation of a stable complex on the rDNA core promoter. We show that TIF-IE by itself, however, does not bind to the rDNA promoter and thus differs in its mechanism from the upstream binding factor and upstream activating factor, which carry out similar complex-stabilizing functions in vertebrates and yeast, respectively. In addition to its presence in impure TIF-IB, TIF-IE is found in highly purified fractions of polymerase I, with which it associates. Renaturation of polypeptides excised from sodium dodecyl sulfate-polyacrylamide gels showed that a 141-kDa polypeptide possesses all the known activities of TIF-IE.

DNA Methylation: An Epigenetic Risk Factor in Preterm Birth

PubMed Central

Menon, Ramkumar; Conneely, Karen N.; Smith, Alicia K.

2012-01-01

Spontaneous preterm birth (PTB; birth prior to 37 weeks of gestation) is a complex phenotype with multiple risk factors that complicate our understanding of its etiology. A number of recent studies have supported the hypothesis that epigenetic modifications such as DNA methylation induced by pregnancy-related risk factors may influence the risk of PTB or result in changes that predispose a neonate to adult-onset diseases. The critical role of timing of gene expression in the etiology of PTB makes it a highly relevant disorder in which to examine the potential role of epigenetic changes. Because changes in DNA methylation patterns can result in long-term consequences, it is of critical interest to identify the epigenetic patterns associated with adverse pregnancy outcomes. This review examines the potential role of DNA methylation as a risk factor for PTB and discusses several issues and limitations that should be considered when planning DNA methylation studies. PMID:22228737

Potential role of DNA methylation as a facilitator of target search processes for transcription factors through interplay with methyl-CpG-binding proteins.

PubMed

Kemme, Catherine A; Marquez, Rolando; Luu, Ross H; Iwahara, Junji

2017-07-27

Eukaryotic genomes contain numerous non-functional high-affinity sequences for transcription factors. These sequences potentially serve as natural decoys that sequester transcription factors. We have previously shown that the presence of sequences similar to the target sequence could substantially impede association of the transcription factor Egr-1 with its targets. In this study, using a stopped-flow fluorescence method, we examined the kinetic impact of DNA methylation of decoys on the search process of the Egr-1 zinc-finger protein. We analyzed its association with an unmethylated target site on fluorescence-labeled DNA in the presence of competitor DNA duplexes, including Egr-1 decoys. DNA methylation of decoys alone did not affect target search kinetics. In the presence of the MeCP2 methyl-CpG-binding domain (MBD), however, DNA methylation of decoys substantially (∼10-30-fold) accelerated the target search process of the Egr-1 zinc-finger protein. This acceleration did not occur when the target was also methylated. These results suggest that when decoys are methylated, MBD proteins can block them and thereby allow Egr-1 to avoid sequestration in non-functional locations. This effect may occur in vivo for DNA methylation outside CpG islands (CGIs) and could facilitate localization of some transcription factors within regulatory CGIs, where DNA methylation is rare. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Studies on DNA-binding selectivity of WRKY transcription factors lend structural clues into WRKY-domain function.

PubMed

Ciolkowski, Ingo; Wanke, Dierk; Birkenbihl, Rainer P; Somssich, Imre E

2008-09-01

WRKY transcription factors have been shown to play a major role in regulating, both positively and negatively, the plant defense transcriptome. Nearly all studied WRKY factors appear to have a stereotypic binding preference to one DNA element termed the W-box. How specificity for certain promoters is accomplished therefore remains completely unknown. In this study, we tested five distinct Arabidopsis WRKY transcription factor subfamily members for their DNA binding selectivity towards variants of the W-box embedded in neighboring DNA sequences. These studies revealed for the first time differences in their binding site preferences, which are partly dependent on additional adjacent DNA sequences outside of the TTGACY-core motif. A consensus WRKY binding site derived from these studies was used for in silico analysis to identify potential target genes within the Arabidopsis genome. Furthermore, we show that even subtle amino acid substitutions within the DNA binding region of AtWRKY11 strongly impinge on its binding activity. Additionally, all five factors were found localized exclusively to the plant cell nucleus and to be capable of trans-activating expression of a reporter gene construct in vivo.

In Vitro and In Vivo Characterization of a Fully Felinized Therapeutic Anti-Nerve Growth Factor Monoclonal Antibody for the Treatment of Pain in Cats.

PubMed

Gearing, D P; Huebner, M; Virtue, E R; Knight, K; Hansen, P; Lascelles, B D X; Gearing, R P; Drew, A C

2016-07-01

Limited options are available for the treatment of pain in cats. Monoclonal antibodies (mAbs) that neutralize nerve growth factor (NGF) have demonstrated analgesic capacity in rodent models, people with osteoarthritis, and dogs with degenerative joint disease. This study describes the design and characterization of a fully felinized anti-NGF monoclonal antibody. In vitro potency, pharmacokinetics, and the ability of the antibody to treat pain in a self-resolving, acute inflammation model were investigated in cats. Thirty-eight cats at a research colony at Charles River Laboratories, Ireland. Felinized anti-NGF mAb, NV-02, was produced using a complementary DNA (cDNA)-based method (PETization). Purified NV-02 was tested for affinity, potency, and immunoreactivity in vitro, then for safety and plasma pharmacokinetic distribution in vivo, and analgesic efficacy in a model of kaolin-induced inflammatory pain. Anti-NGF mAb, NV-02 neutralized NGF with high affinity and potency and did not bind complement. NV-02-administered SC had a plasma half-life of 7-15 days and was well tolerated at dosages up to 28 mg/kg. A dosage of 2 mg/kg NV-02 SC significantly decreased signs of lameness on day 2 (P = .0027), day 3 (P = .016), day 4, (P = .0063), day 5 (P = .0085), day 6 (P = .0014), and day 7 (P = .0034) after induction of inflammation. The high affinity, long plasma half-life, safety, and analgesic efficacy of felinized anti-NGF mAb (NV-02) support further investigation of the analgesic potential of this antibody in the cat. Copyright © 2016 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

DNA-inorganic hybrid nanovaccine for cancer immunotherapy.

PubMed

Zhu, Guizhi; Liu, Yijing; Yang, Xiangyu; Kim, Young-Hwa; Zhang, Huimin; Jia, Rui; Liao, Hsien-Shun; Jin, Albert; Lin, Jing; Aronova, Maria; Leapman, Richard; Nie, Zhihong; Niu, Gang; Chen, Xiaoyuan

2016-03-28

Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy.

Phenazine virulence factor binding to extracellular DNA is important for Pseudomonas aeruginosa biofilm formation.

PubMed

Das, Theerthankar; Kutty, Samuel K; Tavallaie, Roya; Ibugo, Amaye I; Panchompoo, Janjira; Sehar, Shama; Aldous, Leigh; Yeung, Amanda W S; Thomas, Shane R; Kumar, Naresh; Gooding, J Justin; Manefield, Mike

2015-02-11

Bacterial resistance to conventional antibiotics necessitates the identification of novel leads for infection control. Interference with extracellular phenomena, such as quorum sensing, extracellular DNA integrity and redox active metabolite release, represents a new frontier to control human pathogens such as Pseudomonas aeruginosa and hence reduce mortality. Here we reveal that the extracellular redox active virulence factor pyocyanin produced by P. aeruginosa binds directly to the deoxyribose-phosphate backbone of DNA and intercalates with DNA nitrogenous base pair regions. Binding results in local perturbations of the DNA double helix structure and enhanced electron transfer along the nucleic acid polymer. Pyocyanin binding to DNA also increases DNA solution viscosity. In contrast, antioxidants interacting with DNA and pyocyanin decrease DNA solution viscosity. Biofilms deficient in pyocyanin production and biofilms lacking extracellular DNA show similar architecture indicating the interaction is important in P. aeruginosa biofilm formation.

Phenazine virulence factor binding to extracellular DNA is important for Pseudomonas aeruginosa biofilm formation

PubMed Central

Das, Theerthankar; Kutty, Samuel K.; Tavallaie, Roya; Ibugo, Amaye I.; Panchompoo, Janjira; Sehar, Shama; Aldous, Leigh; Yeung, Amanda W. S.; Thomas, Shane R.; Kumar, Naresh; Gooding, J. Justin; Manefield, Mike

2015-01-01

Bacterial resistance to conventional antibiotics necessitates the identification of novel leads for infection control. Interference with extracellular phenomena, such as quorum sensing, extracellular DNA integrity and redox active metabolite release, represents a new frontier to control human pathogens such as Pseudomonas aeruginosa and hence reduce mortality. Here we reveal that the extracellular redox active virulence factor pyocyanin produced by P. aeruginosa binds directly to the deoxyribose-phosphate backbone of DNA and intercalates with DNA nitrogenous base pair regions. Binding results in local perturbations of the DNA double helix structure and enhanced electron transfer along the nucleic acid polymer. Pyocyanin binding to DNA also increases DNA solution viscosity. In contrast, antioxidants interacting with DNA and pyocyanin decrease DNA solution viscosity. Biofilms deficient in pyocyanin production and biofilms lacking extracellular DNA show similar architecture indicating the interaction is important in P. aeruginosa biofilm formation. PMID:25669133

Development and validation of a multi-locus DNA metabarcoding method to identify endangered species in complex samples

PubMed Central

Arulandhu, Alfred J.; Staats, Martijn; Hagelaar, Rico; Voorhuijzen, Marleen M.; Prins, Theo W.; Scholtens, Ingrid; Costessi, Adalberto; Duijsings, Danny; Rechenmann, François; Gaspar, Frédéric B.; Barreto Crespo, Maria Teresa; Holst-Jensen, Arne; Birck, Matthew; Burns, Malcolm; Haynes, Edward; Hochegger, Rupert; Klingl, Alexander; Lundberg, Lisa; Natale, Chiara; Niekamp, Hauke; Perri, Elena; Barbante, Alessandra; Rosec, Jean-Philippe; Seyfarth, Ralf; Sovová, Tereza; Van Moorleghem, Christoff; van Ruth, Saskia; Peelen, Tamara

2017-01-01

Abstract DNA metabarcoding provides great potential for species identification in complex samples such as food supplements and traditional medicines. Such a method would aid Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) enforcement officers to combat wildlife crime by preventing illegal trade of endangered plant and animal species. The objective of this research was to develop a multi-locus DNA metabarcoding method for forensic wildlife species identification and to evaluate the applicability and reproducibility of this approach across different laboratories. A DNA metabarcoding method was developed that makes use of 12 DNA barcode markers that have demonstrated universal applicability across a wide range of plant and animal taxa and that facilitate the identification of species in samples containing degraded DNA. The DNA metabarcoding method was developed based on Illumina MiSeq amplicon sequencing of well-defined experimental mixtures, for which a bioinformatics pipeline with user-friendly web-interface was developed. The performance of the DNA metabarcoding method was assessed in an international validation trial by 16 laboratories, in which the method was found to be highly reproducible and sensitive enough to identify species present in a mixture at 1% dry weight content. The advanced multi-locus DNA metabarcoding method assessed in this study provides reliable and detailed data on the composition of complex food products, including information on the presence of CITES-listed species. The method can provide improved resolution for species identification, while verifying species with multiple DNA barcodes contributes to an enhanced quality assurance. PMID:29020743

Development and validation of a multi-locus DNA metabarcoding method to identify endangered species in complex samples.

PubMed

Arulandhu, Alfred J; Staats, Martijn; Hagelaar, Rico; Voorhuijzen, Marleen M; Prins, Theo W; Scholtens, Ingrid; Costessi, Adalberto; Duijsings, Danny; Rechenmann, François; Gaspar, Frédéric B; Barreto Crespo, Maria Teresa; Holst-Jensen, Arne; Birck, Matthew; Burns, Malcolm; Haynes, Edward; Hochegger, Rupert; Klingl, Alexander; Lundberg, Lisa; Natale, Chiara; Niekamp, Hauke; Perri, Elena; Barbante, Alessandra; Rosec, Jean-Philippe; Seyfarth, Ralf; Sovová, Tereza; Van Moorleghem, Christoff; van Ruth, Saskia; Peelen, Tamara; Kok, Esther

2017-10-01

DNA metabarcoding provides great potential for species identification in complex samples such as food supplements and traditional medicines. Such a method would aid Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) enforcement officers to combat wildlife crime by preventing illegal trade of endangered plant and animal species. The objective of this research was to develop a multi-locus DNA metabarcoding method for forensic wildlife species identification and to evaluate the applicability and reproducibility of this approach across different laboratories. A DNA metabarcoding method was developed that makes use of 12 DNA barcode markers that have demonstrated universal applicability across a wide range of plant and animal taxa and that facilitate the identification of species in samples containing degraded DNA. The DNA metabarcoding method was developed based on Illumina MiSeq amplicon sequencing of well-defined experimental mixtures, for which a bioinformatics pipeline with user-friendly web-interface was developed. The performance of the DNA metabarcoding method was assessed in an international validation trial by 16 laboratories, in which the method was found to be highly reproducible and sensitive enough to identify species present in a mixture at 1% dry weight content. The advanced multi-locus DNA metabarcoding method assessed in this study provides reliable and detailed data on the composition of complex food products, including information on the presence of CITES-listed species. The method can provide improved resolution for species identification, while verifying species with multiple DNA barcodes contributes to an enhanced quality assurance. © The Authors 2017. Published by Oxford University Press.

Linkage map of the fragments of herpesvirus papio DNA.

PubMed Central

Lee, Y S; Tanaka, A; Lau, R Y; Nonoyama, M; Rabin, H

1981-01-01

Herpesvirus papio (HVP), an Epstein-Barr-like virus, causes lymphoblastoid disease in baboons. The physical map of HVP DNA was constructed for the fragments produced by cleavage of HVP DNA with restriction endonucleases EcoRI, HindIII, SalI, and PvuI, which produced 12, 12, 10, and 4 fragments, respectively. The total molecular size of HVP DNA was calculated as close to 110 megadaltons. The following methods were used for construction of the map; (i) fragments near the ends of HVP DNA were identified by treating viral DNA with lambda exonuclease before restriction enzyme digestion; (ii) fragments containing nucleotide sequences in common with fragments from the second enzyme digest of HVP DNA were examined by Southern blot hybridization; and (iii) the location of some fragments was determined by isolating individual fragments from agarose gels and redigesting the isolated fragments with a second restriction enzyme. Terminal heterogeneity and internal repeats were found to be unique features of HVP DNA molecule. One to five repeats of 0.8 megadaltons were found at both terminal ends. Although the repeats of both ends shared a certain degree of homology, it was not determined whether they were identical repeats. The internal repeat sequence of HVP DNA was found in the EcoRI-C region, which extended from 8.4 to 23 megadaltons from the left end of the molecule. The average number of the repeats was calculated to be seven, and the molecular size was determined to be 1.8 megadaltons. Similar unique features have been reported in EBV DNA (D. Given and E. Kieff, J. Virol. 28:524-542, 1978). Images PMID:6261015

DNA repair and aging: the impact of the p53 family.

PubMed

Nicolai, Sara; Rossi, Antonello; Di Daniele, Nicola; Melino, Gerry; Annicchiarico-Petruzzelli, Margherita; Raschellà, Giuseppe

2015-12-01

Cells are constantly exposed to endogenous and exogenous factors that threaten the integrity of their DNA. The maintenance of genome stability is of paramount importance in the prevention of both cancer and aging processes. To deal with DNA damage, cells put into operation a sophisticated and coordinated mechanism, collectively known as DNA damage response (DDR). The DDR orchestrates different cellular processes, such as DNA repair, senescence and apoptosis. Among the key factors of the DDR, the related proteins p53, p63 and p73, all belonging to the same family of transcription factors, play multiple relevant roles. Indeed, the members of this family are directly involved in the induction of cell cycle arrest that is necessary to allow the cells to repair. Alternatively, they can promote cell death in case of prolonged or irreparable DNA damage. They also take part in a more direct task by modulating the expression of core factors involved in the process of DNA repair or by directly interacting with them. In this review we will analyze the fundamental roles of the p53 family in the aging process through their multifaceted function in DDR.

DNA repair and aging: the impact of the p53 family

PubMed Central

Nicolai, Sara; Rossi, Antonello; Di Daniele, Nicola; Melino, Gerry; Annicchiarico-Petruzzelli, Margherita; Raschellà, Giuseppe

2015-01-01

Cells are constantly exposed to endogenous and exogenous factors that threaten the integrity of their DNA. The maintenance of genome stability is of paramount importance in the prevention of both cancer and aging processes. To deal with DNA damage, cells put into operation a sophisticated and coordinated mechanism, collectively known as DNA damage response (DDR). The DDR orchestrates different cellular processes, such as DNA repair, senescence and apoptosis. Among the key factors of the DDR, the related proteins p53, p63 and p73, all belonging to the same family of transcription factors, play multiple relevant roles. Indeed, the members of this family are directly involved in the induction of cell cycle arrest that is necessary to allow the cells to repair. Alternatively, they can promote cell death in case of prolonged or irreparable DNA damage. They also take part in a more direct task by modulating the expression of core factors involved in the process of DNA repair or by directly interacting with them. In this review we will analyze the fundamental roles of the p53 family in the aging process through their multifaceted function in DDR. PMID:26668111

Neisseria conserved protein DMP19 is a DNA mimic protein that prevents DNA binding to a hypothetical nitrogen-response transcription factor

PubMed Central

Wang, Hao-Ching; Ko, Tzu-Ping; Wu, Mao-Lun; Ku, Shan-Chi; Wu, Hsing-Ju; Wang, Andrew H.-J.

2012-01-01

DNA mimic proteins occupy the DNA binding sites of DNA-binding proteins, and prevent these sites from being accessed by DNA. We show here that the Neisseria conserved hypothetical protein DMP19 acts as a DNA mimic. The crystal structure of DMP19 shows a dsDNA-like negative charge distribution on the surface, suggesting that this protein should be added to the short list of known DNA mimic proteins. The crystal structure of another related protein, NHTF (Neisseria hypothetical transcription factor), provides evidence that it is a member of the xenobiotic-response element (XRE) family of transcriptional factors. NHTF binds to a palindromic DNA sequence containing a 5′-TGTNAN11TNACA-3′ recognition box that controls the expression of an NHTF-related operon in which the conserved nitrogen-response protein [i.e. (Protein-PII) uridylyltransferase] is encoded. The complementary surface charges between DMP19 and NHTF suggest specific charge–charge interaction. In a DNA-binding assay, we found that DMP19 can prevent NHTF from binding to its DNA-binding sites. Finally, we used an in situ gene regulation assay to provide evidence that NHTF is a repressor of its down-stream genes and that DMP19 can neutralize this effect. We therefore conclude that the interaction of DMP19 and NHTF provides a novel gene regulation mechanism in Neisseria spps. PMID:22373915

Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites

PubMed Central

Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot

2013-01-01

Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958

DNA recognition by synthetic constructs.

PubMed

Pazos, Elena; Mosquera, Jesús; Vázquez, M Eugenio; Mascareñas, José L

2011-09-05

The interaction of transcription factors with specific DNA sites is key for the regulation of gene expression. Despite the availability of a large body of structural data on protein-DNA complexes, we are still far from fully understanding the molecular and biophysical bases underlying such interactions. Therefore, the development of non-natural agents that can reproduce the DNA-recognition properties of natural transcription factors remains a major and challenging goal in chemical biology. In this review we summarize the basics of double-stranded DNA recognition by transcription factors, and describe recent developments in the design and preparation of synthetic DNA binders. We mainly focus on synthetic peptides that have been designed by following the DNA interaction of natural proteins, and we discuss how the tools of organic synthesis can be used to make artificial constructs equipped with functionalities that introduce additional properties to the recognition process, such as sensing and controllability. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Amino acid-dependent signaling via S6K1 and MYC is essential for regulation of rDNA transcription

PubMed Central

Kang, Jian; Kusnadi, Eric P.; Ogden, Allison J.; Hicks, Rodney J.; Bammert, Lukas; Kutay, Ulrike; Hung, Sandy; Sanij, Elaine; Hannan, Ross D.; Hannan, Katherine M.; Pearson, Richard B.

2016-01-01

Dysregulation of RNA polymerase I (Pol I)-dependent ribosomal DNA (rDNA) transcription is a consistent feature of malignant transformation that can be targeted to treat cancer. Understanding how rDNA transcription is coupled to the availability of growth factors and nutrients will provide insight into how ribosome biogenesis is maintained in a tumour environment characterised by limiting nutrients. We demonstrate that modulation of rDNA transcription initiation, elongation and rRNA processing is an immediate, co-regulated response to altered amino acid abundance, dependent on both mTORC1 activation of S6K1 and MYC activity. Growth factors regulate rDNA transcription initiation while amino acids modulate growth factor-dependent rDNA transcription by primarily regulating S6K1-dependent rDNA transcription elongation and processing. Thus, we show for the first time amino acids regulate rRNA synthesis by a distinct, post-initiation mechanism, providing a novel model for integrated control of ribosome biogenesis that has implications for understanding how this process is dysregulated in cancer. PMID:27385002

XLS (c9orf142) is a new component of mammalian DNA double-stranded break repair

PubMed Central

Craxton, A; Somers, J; Munnur, D; Jukes-Jones, R; Cain, K; Malewicz, M

2015-01-01

Repair of double-stranded DNA breaks (DSBs) in mammalian cells primarily occurs by the non-homologous end-joining (NHEJ) pathway, which requires seven core proteins (Ku70/Ku86, DNA-PKcs (DNA-dependent protein kinase catalytic subunit), Artemis, XRCC4-like factor (XLF), XRCC4 and DNA ligase IV). Here we show using combined affinity purification and mass spectrometry that DNA-PKcs co-purifies with all known core NHEJ factors. Furthermore, we have identified a novel evolutionary conserved protein associated with DNA-PKcs—c9orf142. Computer-based modelling of c9orf142 predicted a structure very similar to XRCC4, hence we have named c9orf142—XLS (XRCC4-like small protein). Depletion of c9orf142/XLS in cells impaired DSB repair consistent with a defect in NHEJ. Furthermore, c9orf142/XLS interacted with other core NHEJ factors. These results demonstrate the existence of a new component of the NHEJ DNA repair pathway in mammalian cells. PMID:25941166

CpG DNA: A pathogenic factor in systemic lupus erythematosus?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krieg, A.M.

1995-11-01

Systemic lupus erythematosus (SLE) is a multifactorial disease of unknown etiology. Characteristic features of SLE include (1) polyclonal B cell activation, (2) overexpression of the immune stimulatory cytokine interleukin-6 (IL-6), (3) defective tolerance to self antigens, and (4) production of anti-DNA antibodies (Ab). Bacterial infection has been suspected as a triggering factor for lupus. Bacterial DNA differs from vertebrate DNA in the frequency and methylation of CpG dinucleotides. These CpG motifs in bacterial DNA induce a variety of immune effects, including (1) polyclonal activation of murine and human B cells, (2) IL-6 secretion, and (3) resistance to apoptosis, thereby potentiallymore » allowing the survival of autoreactive cells. These results suggest that microbial DNA could therefore be a pathogenic factor in SLE. SLE patients have elevated levels of circulating plasma DNA which is reportedly enriched in hypomethylated CpGs. Genomic DNA is also hypomethylated in SLE. The purpose of this review is to summarize the immune effects of CpG motifs and to present the evidence for their possible involvement in the pathogenesis of SLE. 77 refs.« less

Allosteric analysis of glucocorticoid receptor-DNA interface induced by cyclic Py-Im polyamide: a molecular dynamics simulation study.

PubMed

Wang, Yaru; Ma, Na; Wang, Yan; Chen, Guangju

2012-01-01

It has been extensively developed in recent years that cell-permeable small molecules, such as polyamide, can be programmed to disrupt transcription factor-DNA interfaces and can silence aberrant gene expression. For example, cyclic pyrrole-imidazole polyamide that competes with glucocorticoid receptor (GR) for binding to glucocorticoid response elements could be expected to affect the DNA dependent binding by interfering with the protein-DNA interface. However, how such small molecules affect the transcription factor-DNA interfaces and gene regulatory pathways through DNA structure distortion is not fully understood so far. In the present work, we have constructed some models, especially the ternary model of polyamides+DNA+GR DNA-binding domain (GRDBD) dimer, and carried out molecular dynamics simulations and free energy calculations for them to address how polyamide molecules disrupt the GRDBD and DNA interface when polyamide and protein bind at the same sites on opposite grooves of DNA. We found that the cyclic polyamide binding in minor groove of DNA can induce a large structural perturbation of DNA, i.e. a >4 Å widening of the DNA minor groove and a compression of the major groove by more than 4 Å as compared with the DNA molecule in the GRDBD dimer+DNA complex. Further investigations for the ternary system of polyamides+DNA+GRDBD dimer and the binary system of allosteric DNA+GRDBD dimer revealed that the compression of DNA major groove surface causes GRDBD to move away from the DNA major groove with the initial average distance of ∼4 Å to the final average distance of ∼10 Å during 40 ns simulation course. Therefore, this study straightforward explores how small molecule targeting specific sites in the DNA minor groove disrupts the transcription factor-DNA interface in DNA major groove, and consequently modulates gene expression.

Measurements of nonlinear Hall-driven reconnection in the reversed field pinch

NASA Astrophysics Data System (ADS)

Tharp, Timothy D.

Complex organisms are able to develop because of the complex regulatory systems that control their gene expression. The first step in this regulation, transcription initiation, is controlled by transcription factors. Transcription factors are modular proteins composed of two distinct domains, the DNA binding domain and the regulatory domain. These molecules are involved in a plethora of important biological processes including embryogenesis, development, cell health, and cancer. Tissue enriched transcription factors Nkx-2.5 and Gata4 are involved in cardiac development and cardiac health. In this thesis the DNA binding specificity of Nkx-2.5 will be analyzed using a high throughput double stranded DNA platform called Cognate Site Identifier (CSI) arrays (Chapter 2). The full DNA binding specificity of Nkx-2.5 and Nkx-2.5 mutants will be visualized using Sequence Specificity Landscapes (SSLs). In Chapter 3, the definition of binding specificity will be investigated by evaluating a number of different DNA binding folds by CSI and SSLs. CSI and SSLs will also be used to evaluate different pyrrole/imidazole hairpin polyamides in order to better characterize these small molecule DNA binding domains. CSI and SSL data will be applied to the genome in order to explain the biological function an artificial transcription factor. Chapter 4 will discuss the mechanism of nonspecific DNA binding. The historical means of predicting DNA binding will be challenged by utilizing high throughput experiments. The effect of salt concentration on both specific and nonspecific binding will also be investigated. Finally, in Chapter 5, a generation of Protein DNA Dimerizer will be discussed. A PDD that regulates transcription on genomic DNA by binding cooperatively with the heart IF Gata4 will be characterized. These studies provide understanding of, and a means to control, how transcription factors sample the endless sea of DNA in the genome in order to regulate gene expression with such wonderful specificity.

Cloning and characterization of the gene encoding the endopolygalacturonase-inhibiting protein (PGIP) of Phaseolus vulgaris L.

PubMed

Toubart, P; Desiderio, A; Salvi, G; Cervone, F; Daroda, L; De Lorenzo, G

1992-05-01

Polygalacturonase-inhibiting protein (PGIP) is a cell wall protein purified from hypocotyls of true bean (Phaseolus vulgaris L.). PGIP inhibits fungal endopolygalacturonases and is considered to be an important factor for plant resistance to phytopathogenic fungi (Albersheim and Anderson, 1971; Cervone et al., 1987). The amino acid sequences of the N-terminus and one internal tryptic peptide of the PGIP purified from P. vulgaris cv. Pinto were used to design redundant oligonucleotides that were successfully utilized as primers in a polymerase chain reaction (PCR) with total DNA of P. vulgaris as a template. A DNA band of 758 bp (a specific PCR amplification product of part of the gene coding for PGIP) was isolated and cloned. By using the 758-bp DNA as a hybridization probe, a lambda clone containing the PGIP gene was isolated from a genomic library of P. vulgaris cv. Saxa. The coding and immediate flanking regions of the PGIP gene, contained on a subcloned 3.3 kb SalI-SalI DNA fragment, were sequenced. A single, continuous ORF of 1026 nt (342 amino acids) was present in the genomic clone. The nucleotide and deduced amino acid sequences of the PGIP gene showed no significant similarity with any known databank sequence. Northern blotting analysis of poly(A)+ RNAs, isolated from various tissues of bean seedlings or from suspension-cultured bean cells, were also performed using the cloned PCR-generated DNA as a probe. A 1.2 kb transcript was detected in suspension-cultured cells and, to a lesser extent, in leaves, hypocotyls, and flowers.(ABSTRACT TRUNCATED AT 250 WORDS)

The HLA Dictionary 2004: a summary of HLA-A, -B, -C, -DRB1/3/4/5 and -DQB1 alleles and their association with serologically defined HLA-A, -B, -C, -DR and -DQ antigens.

PubMed

Schreuder, G M Th; Hurley, C K; Marsh, S G E; Lau, M; Fernandez-Vina, M; Noreen, H J; Setterholm, M; Maiers, M

2005-01-01

This report presents serologic equivalents of human leucocyte antigen (HLA)-A, -B, -C, -DRB1, -DRB3, -DRB4, -DRB5 and -DQB1 alleles. The dictionary is an update of the one published in 2001. The data summarize equivalents obtained by the World Health Organization Nomenclature Committee for factors of the HLA System, the International Cell Exchange, the National Marrow Donor Program, recent publications and individual laboratories. This latest update of the dictionary is enhanced by the inclusion of results from studies performed during the 13th International Histocompatibility Workshop and from neural network analyses. A summary of the data as recommended serologic equivalents is presented as expert assigned types. The tables include remarks for alleles, which are or may be expressed as antigens with serologic reaction patterns that differ from the well-established HLA specificities. The equivalents provided will be useful in guiding searches for unrelated hematopoietic stem cell donors in which patients and/or potential donors are typed by either serology or DNA-based methods. The serological DNA equivalent dictionary will also aid in typing and matching procedures for organ transplant programs whose waiting lists of potential donors and recipients comprise of mixtures of serologic and DNA-based typings. The tables with HLA equivalents and a questionnaire for submission of serologic reaction patterns for poorly identified allelic products will be made available through the WMDA web page: www.worldmarrow.org. and in the near future also in a searchable form on the IMGT/HLA database.

The HLA Dictionary 2004: a summary of HLA-A, -B, -C, -DRB1/3/4/5 and -DQB1 alleles and their association with serologically defined HLA-A, -B, -C, -DR and -DQ antigens.

PubMed

Schreuder, G M Th; Hurley, C K; Marsh, S G E; Lau, M; Fernandez-Vina, M; Noreen, H J; Setterholm, M; Maiers, M

2005-02-01

This report presents serological equivalents of HLA-A, -B, -C, -DRB1, -DRB3, -DRB4, -DRB5 and -DQB1 alleles. The dictionary is an update of that published in 2001. The data summarize equivalents obtained by the World Health Organization Nomenclature Committee for Factors of the HLA System, the International Cell Exchange (UCLA), the National Marrow Donor Program (NMDP), recent publications and individual laboratories. This latest update of the dictionary is enhanced by the inclusion of results from studies performed during the 13th International Histocompatibility Workshop and from neural network analyses. A summary of the data as recommended serological equivalents is presented as expert assigned types. The tables include remarks for alleles, which are or may be expressed as antigens with serological reaction patterns that differ from the well-established HLA specificities. The equivalents provided will be useful in guiding searches for unrelated haematopoietic stem cell donors in which patients and/or potential donors are typed by either serology or DNA-based methods. The serological DNA equivalent dictionary will also aid in typing and matching procedures for organ transplant programmes whose waiting lists of potential donors and recipients comprise mixtures of serological and DNA-based typings. The tables with HLA equivalents and a questionnaire for submission of serological reaction patterns for poorly identified allelic products will be made available through the WMDA web page (http://www.worldmarrow.org) and, in the near future, also in a searchable form on the IMGT/HLA database.

Host cell interactions of outer membrane vesicle-associated virulence factors of enterohemorrhagic Escherichia coli O157: Intracellular delivery, trafficking and mechanisms of cell injury

PubMed Central

Greune, Lilo; Jarosch, Kevin-André; Steil, Daniel; Zhang, Wenlan; He, Xiaohua; Lloubes, Roland; Fruth, Angelika; Kim, Kwang Sik; Schmidt, M. Alexander; Dobrindt, Ulrich; Mellmann, Alexander; Karch, Helge

2017-01-01

Outer membrane vesicles (OMVs) are important tools in bacterial virulence but their role in the pathogenesis of infections caused by enterohemorrhagic Escherichia coli (EHEC) O157, the leading cause of life-threatening hemolytic uremic syndrome, is poorly understood. Using proteomics, electron and confocal laser scanning microscopy, immunoblotting, and bioassays, we investigated OMVs secreted by EHEC O157 clinical isolates for virulence factors cargoes, interactions with pathogenetically relevant human cells, and mechanisms of cell injury. We demonstrate that O157 OMVs carry a cocktail of key virulence factors of EHEC O157 including Shiga toxin 2a (Stx2a), cytolethal distending toxin V (CdtV), EHEC hemolysin, and flagellin. The toxins are internalized by cells via dynamin-dependent endocytosis of OMVs and differentially separate from vesicles during intracellular trafficking. Stx2a and CdtV-B, the DNase-like CdtV subunit, separate from OMVs in early endosomes. Stx2a is trafficked, in association with its receptor globotriaosylceramide within detergent-resistant membranes, to the Golgi complex and the endoplasmic reticulum from where the catalytic Stx2a A1 fragment is translocated to the cytosol. CdtV-B is, after its retrograde transport to the endoplasmic reticulum, translocated to the nucleus to reach DNA. CdtV-A and CdtV-C subunits remain OMV-associated and are sorted with OMVs to lysosomes. EHEC hemolysin separates from OMVs in lysosomes and targets mitochondria. The OMV-delivered CdtV-B causes cellular DNA damage, which activates DNA damage responses leading to G2 cell cycle arrest. The arrested cells ultimately die of apoptosis induced by Stx2a and CdtV via caspase-9 activation. By demonstrating that naturally secreted EHEC O157 OMVs carry and deliver into cells a cocktail of biologically active virulence factors, thereby causing cell death, and by performing first comprehensive analysis of intracellular trafficking of OMVs and OMV-delivered virulence factors, we provide new insights into the pathogenesis of EHEC O157 infections. Our data have implications for considering O157 OMVs as vaccine candidates. PMID:28158302

DNA-binding activity of TNF-{alpha} inducing protein from Helicobacter pylori

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuzuhara, T.; Suganuma, M.; Oka, K.

2007-11-03

Tumor necrosis factor-{alpha} (TNF-{alpha}) inducing protein (Tip{alpha}) is a carcinogenic factor secreted from Helicobacter pylori (H. pylori), mediated through both enhanced expression of TNF-{alpha} and chemokine genes and activation of nuclear factor-{kappa}B. Since Tip{alpha} enters gastric cancer cells, the Tip{alpha} binding molecules in the cells should be investigated. The direct DNA-binding activity of Tip{alpha} was observed by pull down assay using single- and double-stranded genomic DNA cellulose. The surface plasmon resonance assay, indicating an association between Tip{alpha} and DNA, revealed that the affinity of Tip{alpha} for (dGdC)10 is 2400 times stronger than that of del-Tip{alpha}, an inactive Tip{alpha}. This suggestsmore » a strong correlation between DNA-binding activity and carcinogenic activity of Tip{alpha}. And the DNA-binding activity of Tip{alpha} was first demonstrated with a molecule secreted from H. pylori.« less

Scraping and stapling of end-grafted DNA chains by a bioadhesive spreading vesicle to reveal chain internal friction and topological complexity.

PubMed

Nam, Gimoon; Hisette, Marie Laure; Sun, Yuting Liang; Gisler, Thomas; Johner, Albert; Thalmann, Fabrice; Schröder, André Pierre; Marques, Carlos Manuel; Lee, Nam-Kyung

2010-08-20

Stained end-grafted DNA molecules about 20 μm long are scraped away and stretched out by the spreading front of a bioadhesive vesicle. Tethered biotin ligands bind the vesicle bilayer to a streptavidin substrate, stapling the DNAs into frozen confinement paths. Image analysis of the stapled DNA gives access, within optical resolution, to the local stretching values of individual DNA molecules swept by the spreading front, and provides evidence of self-entanglements.

Isolation of a cDNA for a Growth Factor of Vascular Endothelial Cells from Human Lung Cancer Cells: Its Identity with Insulin‐like Growth Factor II

PubMed Central

Hagiwara, Koichi; Kobayashi, Tatsuo; Tobita, Masato; Kikyo, Nobuaki; Yazaki, Yoshio

1995-01-01

We have found growth‐promoting activity for vascular endothelial cells in the conditioned medium of a human lung cancer cell line, T3M‐11. Purification and characterization of the growth‐promoting activity have been carried out using ammonium sulfate precipitation and gel‐exclusion chromatography. The activity migrated as a single peak just after ribonuclease. It did not bind to a heparin affinity column. These results suggest that the activity is not a heparin‐binding growth factor (including fibroblast growth factors) or a vascular endothelial growth factor. To identify the molecule exhibiting the growth‐promoting activity, a cDNA encoding the growth factor was isolated through functional expression cloning in COS‐1 cells from a cDNA library prepared from T3M‐11 cells. The nucleotide sequence encoded by the cDNA proved to be identical with that of insulin‐like growth factor II. PMID:7730145

Deregulation of DNA-dependent protein kinase catalytic subunit contributes to human hepatocarcinogenesis development and has a putative prognostic value.

PubMed

Evert, M; Frau, M; Tomasi, M L; Latte, G; Simile, M M; Seddaiu, M A; Zimmermann, A; Ladu, S; Staniscia, T; Brozzetti, S; Solinas, G; Dombrowski, F; Feo, F; Pascale, R M; Calvisi, D F

2013-11-12

The DNA-repair gene DNA-dependent kinase catalytic subunit (DNA-PKcs) favours or inhibits carcinogenesis, depending on the cancer type. Its role in human hepatocellular carcinoma (HCC) is unknown. DNA-dependent protein kinase catalytic subunit, H2A histone family member X (H2AFX) and heat shock transcription factor-1 (HSF1) levels were assessed by immunohistochemistry and/or immunoblotting and qRT-PCR in a collection of human HCC. Rates of proliferation, apoptosis, microvessel density and genomic instability were also determined. Heat shock factor-1 cDNA or DNA-PKcs-specific siRNA were used to explore the role of both genes in HCC. Activator protein 1 (AP-1) binding to DNA-PKcs promoter was evaluated by chromatin immunoprecipitation. Kaplan-Meier curves and multivariate Cox model were used to study the impact on clinical outcome. Total and phosphorylated DNA-PKcs and H2AFX were upregulated in HCC. Activated DNA-PKcs positively correlated with HCC proliferation, genomic instability and microvessel density, and negatively with apoptosis and patient's survival. Proliferation decline and massive apoptosis followed DNA-PKcs silencing in HCC cell lines. Total and phosphorylated HSF1 protein, mRNA and activity were upregulated in HCC. Mechanistically, we demonstrated that HSF1 induces DNA-PKcs upregulation through the activation of the MAPK/JNK/AP-1 axis. DNA-dependent protein kinase catalytic subunit transduces HSF1 effects in HCC cells, and might represent a novel target and prognostic factor in human HCC.

Action of CMG with strand-specific DNA blocks supports an internal unwinding mode for the eukaryotic replicative helicase

PubMed Central

Langston, Lance; O’Donnell, Mike

2017-01-01

Replicative helicases are ring-shaped hexamers that encircle DNA for duplex unwinding. The currently accepted view of hexameric helicase function is by steric exclusion, where the helicase encircles one DNA strand and excludes the other, acting as a wedge with an external DNA unwinding point during translocation. Accordingly, strand-specific blocks only affect these helicases when placed on the tracking strand, not the excluded strand. We examined the effect of blocks on the eukaryotic CMG and, contrary to expectations, blocks on either strand inhibit CMG unwinding. A recent cryoEM structure of yeast CMG shows that duplex DNA enters the helicase and unwinding occurs in the central channel. The results of this report inform important aspects of the structure, and we propose that CMG functions by a modified steric exclusion process in which both strands enter the helicase and the duplex unwinding point is internal, followed by exclusion of the non-tracking strand. DOI: http://dx.doi.org/10.7554/eLife.23449.001 PMID:28346143

Development and evaluation of specific PCR primers targeting the ribosomal DNA-internal transcribed spacer (ITS) region of peritrich ciliates in environmental samples

NASA Astrophysics Data System (ADS)

Su, Lei; Zhang, Qianqian; Gong, Jun

2017-07-01

Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.

Extensive 5.8S nrDNA polymorphism in Mammillaria (Cactaceae) with special reference to the identification of pseudogenic internal transcribed spacer regions.

PubMed

Harpke, Doerte; Peterson, Angela

2008-05-01

The internal transcribed spacer (ITS) region (ITS1, 5.8S rDNA, ITS2) represents the most widely applied nuclear marker in eukaryotic phylogenetics. Although this region has been assumed to evolve in concert, the number of investigations revealing high degrees of intra-individual polymorphism connected with the presence of pseudogenes has risen. The 5.8S rDNA is the most important diagnostic marker for functionality of the ITS region. In Mammillaria, intra-individual 5.8S rDNA polymorphisms of up to 36% and up to nine different types have been found. Twenty-eight of 30 cloned genomic Mammillaria sequences were identified as putative pseudogenes. For the identification of pseudogenic ITS regions, in addition to formal tests based on substitution rates, we attempted to focus on functional features of the 5.8S rDNA (5.8S motif, secondary structure). The importance of functional data for the identification of pseudogenes is outlined and discussed. The identification of pseudogenes is essential, because they may cause erroneous phylogenies and taxonomic problems.

Molecular Identification of Leishmania spp. in Sand Flies (Diptera: Psychodidae, Phlebotominae) From Ecuador.

PubMed

Quiroga, Cristina; Cevallos, Varsovia; Morales, Diego; Baldeón, Manuel E; Cárdenas, Paúl; Rojas-Silva, Patricio; Ponce, Patricio

2017-11-07

The detection and identification of natural infections in sand flies by Leishmania protozoan species in endemic areas is a key factor in assessing the risk of leishmaniasis and in designing prevention and control measures for this infectious disease. In this study, we analyzed the Leishmania DNA using nuclear ribosomal internal transcript spacer (ITS) sequences. Parasite DNA was extracted from naturally infected, blood-fed sand flies collected in nine localities considered leishmaniasis-endemic foci in Ecuador.The species of parasites identified in sand flies were Leishmania major-like, Leishmania naiffi, Leishmania mexicana, Leishmania lainsoni, and "Leishmania sp. siamensis". Sand fly specimens of Brumptomyia leopoldoi, Mycropigomyia cayennensis, Nyssomyia yuilli yuilli, Nyssomyia trapidoi, Pressatia triacantha, Pressatia dysponeta, Psychodopygus carrerai carrerai, Psychodopygus panamensis, and Trichophoromyia ubiquitalis were found positive for Leishmania parasite. These findings contribute to a better understanding of the epidemiology and transmission dynamics of the disease in high-risk areas of Ecuador. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America.

Natural Infection of Phlebotomus sergenti by Leishmania tropica in Libya.

PubMed

Dokhan, Mostafa Ramadhan; Jaouadi, Kaouther; Salem, Sadok; Zenbil, Osama; Gonzalez, Jean Paul; Ben Salah, Afif; Annajar, Badreddin Bashir

2018-03-12

Cutaneous leishmaniasis (CL) is a public health concern caused by Leishmania ( L. ) major and ( L. ) tropica in Libya. Information on sandfly vectors, as well as their associated Leishmania species, is of paramount importance because vector dispersion is one of the major factors responsible for pathogen dissemination. A number of 515 sandflies (275 males and 240 females) were collected during June-November 2012 using the CDC miniature light traps from Al Rabta, northwest of Libya. Two hundred and forty unfed females were identified; Phlebotomus ( Ph. ) papatasi ( N = 97), Ph. sergenti ( N = 27), Ph. longicuspis ( N = 32), Sergentomyia ( Se. ) minuta ( N = 38), and Se. fallax ( N = 46). These flies were screened for Leishmania DNA using the polymerase chain reaction-restriction fragment length polymorphism analysis of the internal transcribed spacer 1 and sequencing. Two Ph. sergenti were found positive to L. tropica DNA. This finding should be considered for any further vector surveillance and epidemiological studies of CL in endemic areas across Libya.

On binding specificity of (6-4) photolyase to a T(6-4)T DNA photoproduct*

NASA Astrophysics Data System (ADS)

Jepsen, Katrine Aalbæk; Solov'yov, Ilia A.

2017-06-01

Different factors lead to DNA damage and if it is not repaired in due time, the damaged DNA could initiate mutagenesis and cancer. To avoid this deadly scenario, specific enzymes can scavenge and repair the DNA, but the enzymes have to bind first to the damaged sites. We have investigated this binding for a specific enzyme called (6-4) photolyase, which is capable of repairing certain UV-induced damage in DNA. Through molecular dynamics simulations we describe the binding between photolyase and the DNA and reveal that several charged amino acid residues in the enzyme, such as arginines and lysines turn out to be important. Especially R421 is crucial, as it keeps the DNA strands at the damaged site inside the repair pocket of the enzyme separated. DNA photolyase is structurally highly homologous to a protein called cryptochrome. Both proteins are biologically activated similarly, namely through flavin co-factor photoexcitation. It is, however, striking that cryptochrome cannot repair UV-damaged DNA. The present investigation allowed us to conclude on the small but, apparently, critical differences between photolyase and cryptochrome. The performed analysis gives insight into important factors that govern the binding of UV-damaged DNA and reveal why cryptochrome cannot have this functionality.

Influence of quasi-specific sites on kinetics of target DNA search by a sequence-specific DNA-binding protein.

PubMed

Kemme, Catherine A; Esadze, Alexandre; Iwahara, Junji

2015-11-10

Functions of transcription factors require formation of specific complexes at particular sites in cis-regulatory elements of genes. However, chromosomal DNA contains numerous sites that are similar to the target sequences recognized by transcription factors. The influence of such "quasi-specific" sites on functions of the transcription factors is not well understood at present by experimental means. In this work, using fluorescence methods, we have investigated the influence of quasi-specific DNA sites on the efficiency of target location by the zinc finger DNA-binding domain of the inducible transcription factor Egr-1, which recognizes a 9 bp sequence. By stopped-flow assays, we measured the kinetics of Egr-1's association with a target site on 143 bp DNA in the presence of various competitor DNAs, including nonspecific and quasi-specific sites. The presence of quasi-specific sites on competitor DNA significantly decelerated the target association by the Egr-1 protein. The impact of the quasi-specific sites depended strongly on their affinity, their concentration, and the degree of their binding to the protein. To quantitatively describe the kinetic impact of the quasi-specific sites, we derived an analytical form of the apparent kinetic rate constant for the target association and used it for fitting to the experimental data. Our kinetic data with calf thymus DNA as a competitor suggested that there are millions of high-affinity quasi-specific sites for Egr-1 among the 3 billion bp of genomic DNA. This study quantitatively demonstrates that naturally abundant quasi-specific sites on DNA can considerably impede the target search processes of sequence-specific DNA-binding proteins.

Influence of Quasi-Specific Sites on Kinetics of Target DNA Search by a Sequence-Specific DNA-Binding Protein

PubMed Central

2015-01-01

Functions of transcription factors require formation of specific complexes at particular sites in cis-regulatory elements of genes. However, chromosomal DNA contains numerous sites that are similar to the target sequences recognized by transcription factors. The influence of such “quasi-specific” sites on functions of the transcription factors is not well understood at present by experimental means. In this work, using fluorescence methods, we have investigated the influence of quasi-specific DNA sites on the efficiency of target location by the zinc finger DNA-binding domain of the inducible transcription factor Egr-1, which recognizes a 9 bp sequence. By stopped-flow assays, we measured the kinetics of Egr-1’s association with a target site on 143 bp DNA in the presence of various competitor DNAs, including nonspecific and quasi-specific sites. The presence of quasi-specific sites on competitor DNA significantly decelerated the target association by the Egr-1 protein. The impact of the quasi-specific sites depended strongly on their affinity, their concentration, and the degree of their binding to the protein. To quantitatively describe the kinetic impact of the quasi-specific sites, we derived an analytical form of the apparent kinetic rate constant for the target association and used it for fitting to the experimental data. Our kinetic data with calf thymus DNA as a competitor suggested that there are millions of high-affinity quasi-specific sites for Egr-1 among the 3 billion bp of genomic DNA. This study quantitatively demonstrates that naturally abundant quasi-specific sites on DNA can considerably impede the target search processes of sequence-specific DNA-binding proteins. PMID:26502071

Double-stranded DNA translocase activity of transcription factor TFIIH and the mechanism of RNA polymerase II open complex formation.

PubMed

Fishburn, James; Tomko, Eric; Galburt, Eric; Hahn, Steven

2015-03-31

Formation of the RNA polymerase II (Pol II) open complex (OC) requires DNA unwinding mediated by the transcription factor TFIIH helicase-related subunit XPB/Ssl2. Because XPB/Ssl2 binds DNA downstream from the location of DNA unwinding, it cannot function using a conventional helicase mechanism. Here we show that yeast TFIIH contains an Ssl2-dependent double-stranded DNA translocase activity. Ssl2 tracks along one DNA strand in the 5' → 3' direction, implying it uses the nontemplate promoter strand to reel downstream DNA into the Pol II cleft, creating torsional strain and leading to DNA unwinding. Analysis of the Ssl2 and DNA-dependent ATPase activity of TFIIH suggests that Ssl2 has a processivity of approximately one DNA turn, consistent with the length of DNA unwound during transcription initiation. Our results can explain why maintaining the OC requires continuous ATP hydrolysis and the function of TFIIH in promoter escape. Our results also suggest that XPB/Ssl2 uses this translocase mechanism during DNA repair rather than physically wedging open damaged DNA.

Radioprotection of Human Cell Nuclear DNA by Polyamines: Radiosensitivity of Chromatin is Influenced by Tightly Bound Spermine

NASA Technical Reports Server (NTRS)

Warters, Raymond L.; Newton, Gerald L.; Olive, Peggy L.; Fahey, Robert C.

1999-01-01

The polyamines putrescine (PUT) and spermine (SPM) were examined for their ability to protect human cell Deoxyribonucleic Acid (DNA) against the formation of radiation-induced double-strand breaks (DSBs). As observed previously, under conditions where polyamines were shown to be almost completely absent, association with nuclear matrix protein into a nucleoid, and organization into chromatin structure, protected DNA from induction of DSBs by factors of 4.5 and 95, respectively. At concentrations below 1 mM, PUT or SPM provided equivalent levels of protection to deproteinized nuclear DNA, consistent with their capacity to scavenge radiation-induced radicals. At constant ionic strength, 5 mM SPM protected deproteinized DNA and nucleoid DNA and DNA in nuclear chromatin by factors of 100 and 26, respectively. At 5 mM, SPM provided 15 times greater protection of deproteinized DNA than did PUT. Under physiologically relevant conditions, 5 mM SPM protected DNA in the intact nucleus from the induction of DSBs by a factor of 2 relative to DNA in the absence of SPM. Studies of SPM binding during cellular fractionation revealed that a significant fraction of the cellular SPM is tightly bound in the nucleus but can be removed by extended washing. Thus the association of SPM with nuclear chromatin appears to be a significant contributor to the resistance of the cell's DNA to the induction of DSBs.

H3K4me1 marks DNA regions hypomethylated during aging in human stem and differentiated cells

PubMed Central

Fernández, Agustín F.; Bayón, Gustavo F.; Urdinguio, Rocío G.; Toraño, Estela G.; García, María G.; Carella, Antonella; Petrus-Reurer, Sandra; Ferrero, Cecilia; Martinez-Camblor, Pablo; Cubillo, Isabel; García-Castro, Javier; Delgado-Calle, Jesús; Pérez-Campo, Flor M.; Riancho, José A.; Bueno, Clara; Menéndez, Pablo; Mentink, Anouk; Mareschi, Katia; Claire, Fabian; Fagnani, Corrado; Medda, Emanuela; Toccaceli, Virgilia; Brescianini, Sonia; Moran, Sebastián; Esteller, Manel; Stolzing, Alexandra; de Boer, Jan; Nisticò, Lorenza; Stazi, Maria A.

2015-01-01

In differentiated cells, aging is associated with hypermethylation of DNA regions enriched in repressive histone post-translational modifications. However, the chromatin marks associated with changes in DNA methylation in adult stem cells during lifetime are still largely unknown. Here, DNA methylation profiling of mesenchymal stem cells (MSCs) obtained from individuals aged 2 to 92 yr identified 18,735 hypermethylated and 45,407 hypomethylated CpG sites associated with aging. As in differentiated cells, hypermethylated sequences were enriched in chromatin repressive marks. Most importantly, hypomethylated CpG sites were strongly enriched in the active chromatin mark H3K4me1 in stem and differentiated cells, suggesting this is a cell type–independent chromatin signature of DNA hypomethylation during aging. Analysis of scedasticity showed that interindividual variability of DNA methylation increased during aging in MSCs and differentiated cells, providing a new avenue for the identification of DNA methylation changes over time. DNA methylation profiling of genetically identical individuals showed that both the tendency of DNA methylation changes and scedasticity depended on nongenetic as well as genetic factors. Our results indicate that the dynamics of DNA methylation during aging depend on a complex mixture of factors that include the DNA sequence, cell type, and chromatin context involved and that, depending on the locus, the changes can be modulated by genetic and/or external factors. PMID:25271306

Effects of nucleoside analog incorporation on DNA binding to the DNA binding domain of the GATA-1 erythroid transcription factor.

PubMed

Foti, M; Omichinski, J G; Stahl, S; Maloney, D; West, J; Schweitzer, B I

1999-02-05

We investigate here the effects of the incorporation of the nucleoside analogs araC (1-beta-D-arabinofuranosylcytosine) and ganciclovir (9-[(1,3-dihydroxy-2-propoxy)methyl] guanine) into the DNA binding recognition sequence for the GATA-1 erythroid transcription factor. A 10-fold decrease in binding affinity was observed for the ganciclovir-substituted DNA complex in comparison to an unmodified DNA of the same sequence composition. AraC substitution did not result in any changes in binding affinity. 1H-15N HSQC and NOESY NMR experiments revealed a number of chemical shift changes in both DNA and protein in the ganciclovir-modified DNA-protein complex when compared to the unmodified DNA-protein complex. These changes in chemical shift and binding affinity suggest a change in the binding mode of the complex when ganciclovir is incorporated into the GATA DNA binding site.

DNA Commission of the International Society for Forensic Genetics: Recommendations on the validation of software programs performing biostatistical calculations for forensic genetics applications.

PubMed

Coble, M D; Buckleton, J; Butler, J M; Egeland, T; Fimmers, R; Gill, P; Gusmão, L; Guttman, B; Krawczak, M; Morling, N; Parson, W; Pinto, N; Schneider, P M; Sherry, S T; Willuweit, S; Prinz, M

2016-11-01

The use of biostatistical software programs to assist in data interpretation and calculate likelihood ratios is essential to forensic geneticists and part of the daily case work flow for both kinship and DNA identification laboratories. Previous recommendations issued by the DNA Commission of the International Society for Forensic Genetics (ISFG) covered the application of bio-statistical evaluations for STR typing results in identification and kinship cases, and this is now being expanded to provide best practices regarding validation and verification of the software required for these calculations. With larger multiplexes, more complex mixtures, and increasing requests for extended family testing, laboratories are relying more than ever on specific software solutions and sufficient validation, training and extensive documentation are of upmost importance. Here, we present recommendations for the minimum requirements to validate bio-statistical software to be used in forensic genetics. We distinguish between developmental validation and the responsibilities of the software developer or provider, and the internal validation studies to be performed by the end user. Recommendations for the software provider address, for example, the documentation of the underlying models used by the software, validation data expectations, version control, implementation and training support, as well as continuity and user notifications. For the internal validations the recommendations include: creating a validation plan, requirements for the range of samples to be tested, Standard Operating Procedure development, and internal laboratory training and education. To ensure that all laboratories have access to a wide range of samples for validation and training purposes the ISFG DNA commission encourages collaborative studies and public repositories of STR typing results. Published by Elsevier Ireland Ltd.

Use of an internal control in a nested-PCR assay for Mycoplasma hyopneumoniae detection and quantification in tracheobronchiolar washings from pigs.

PubMed

Verdin, E; Kobisch, M; Bové, J M; Garnier, M; Saillard, C

2000-12-01

We have previously reported a nested PCR assay for the detection of Mycoplasma hyopneumoniae directly in tracheobronchiolar washings from living pigs in field conditions. Here, we describe the construction and use of an internal control to monitor the presence of PCR inhibitors. A PCR modified target DNA was constructed by insertion of a small DNA fragment into the M. hyopneumoniae specific DNA target. We have demonstrated that the internal control failed to be amplified in only three tracheobronchiolar washings samples out of the 362 tested. This control molecule was inserted in a Spiroplasma citri derived plasmid vector and introduced into S. citri cells by electroporation. After a few passages we ensured that the recombinant plasmid became inserted into the genome of S. citri. PCR amplification of the DNA of this transformed S. citri strain using nested PCR primers led to amplification of a 900-bp fragment which can be discriminated from the M. hyopneumoniae PCR product 700 bp. The S. citri transformants with the integrated internal control were added to the tracheobronchiolar washings prior to PCR and used as an internal control to check the efficiency of sample processing, and to demonstrate the presence of inhibitors. Furthermore, we have been able to estimate the number of mycoplasma cells in the tracheobronchiolar washings. Quantitation was performed by comparing the PCR signal intensity of the specific M. hyopneumoniae template with known concentrations of the S. citri competitor. The titer in tracheobronchiolar washings ranged approximatively from 10(4)to 10(8)M. hyopneumoniae cells per ml of clinical specimen. Quantitative PCR can be a useful tool for monitoring the progression of M. hyopneumoniae in the disease process. Copyright 2000 Academic Press.

Internal Proteins of the Procapsid and Mature Capsids of Herpes Simplex Virus 1 Mapped by Bubblegram Imaging

PubMed Central

Wu, Weimin; Newcomb, William W.; Cheng, Naiqian; Aksyuk, Anastasia; Winkler, Dennis C.

2016-01-01

ABSTRACT The herpes simplex virus 1 (HSV-1) capsid is a huge assembly, ∼1,250 Å in diameter, and is composed of thousands of protein subunits with a combined mass of ∼200 MDa, housing a 100-MDa genome. First, a procapsid is formed through coassembly of the surface shell with an inner scaffolding shell; then the procapsid matures via a major structural transformation, triggered by limited proteolysis of the scaffolding proteins. Three mature capsids are found in the nuclei of infected cells. A capsids are empty, B capsids retain a shrunken scaffolding shell, and C capsids—which develop into infectious virions—are filled with DNA and ostensibly have expelled the scaffolding shell. The possible presence of other internal proteins in C capsids has been moot as, in cryo-electron microscopy (cryo-EM), they would be camouflaged by the surrounding DNA. We have used bubblegram imaging to map internal proteins in all four capsids, aided by the discovery that the scaffolding protein is exceptionally prone to radiation-induced bubbling. We confirmed that this protein forms thick-walled inner shells in the procapsid and the B capsid. C capsids generate two classes of bubbles: one occupies positions beneath the vertices of the icosahedral surface shell, and the other is distributed throughout its interior. A likely candidate is the viral protease. A subpopulation of C capsids bubbles particularly profusely and may represent particles in which expulsion of scaffold and DNA packaging are incomplete. Based on the procapsid structure, we propose that the axial channels of hexameric capsomers afford the pathway via which the scaffolding protein is expelled. IMPORTANCE In addition to DNA, capsids of tailed bacteriophages and their distant relatives, herpesviruses, contain internal proteins. These proteins are often essential for infectivity but are difficult to locate within the virion. A novel adaptation of cryo-EM based on detecting gas bubbles generated by radiation damage was used to localize internal proteins of HSV-1, yielding insights into how capsid maturation is regulated. The scaffolding protein, which forms inner shells in the procapsid and B capsid, is exceptionally bubbling-prone. In the mature DNA-filled C capsid, a previously undetected protein was found to underlie the icosahedral vertices: this is tentatively assigned as a storage form of the viral protease. We also observed a capsid species that appears to contain substantial amounts of scaffolding protein as well as DNA, suggesting that DNA packaging and expulsion of the scaffolding protein are coupled processes. PMID:26984725

DNA Replication Arrest and DNA Damage Responses Induced by Alkylating Minor Groove Binders

DTIC Science & Technology

2001-05-01

We are interested in the molecular mechanisms involved in DNA replication arrest by the S phase DNA damage checkpoints. Using in vitro simian virus...40 DNA replication assays, we have found three factors that directly contribute to DNA damage-induced DNA replication arrest: Replication Protein A...trans-acting inhibitors. RPA is the major eukaryotic single-stranded DNA binding protein required for DNA replication , repair and recombination. Upon DNA

Epigenetic Signals on Plant Adaptation: a Biotic Stress Perspective.

PubMed

Neto, Jose Ribamar Costa Ferreira; da Silva, Manasses Daniel; Pandolfi, Valesca; Crovella, Sergio; Benko-Iseppon, Ana Maria; Kido, Ederson Akio

2017-01-01

For sessile organisms such as plants, regulatory mechanisms of gene expression are vital, since they remain exposed to climatic and biological threats. Thus, they have to face hazards with instantaneous reorganization of their internal environment. For this purpose, besides the use of transcription factors, the participation of chromatin as an active factor in the regulation of transcription is crucial. Chemical changes in chromatin structure affect the accessibility of the transcriptional machinery and acting in signaling, engaging/inhibiting factors that participate in the transcription processes. Mechanisms in which gene expression undergoes changes without the occurrence of DNA gene mutations in the monomers that make up DNA, are understood as epigenetic phenomena. These include (1) post-translational modifications of histones, which results in stimulation or repression of gene activity and (2) cytosine methylation in the promoter region of individual genes, both preventing access of transcriptional activators as well as signaling the recruitment of repressors. There is evidence that such modifications can pass on to subsequent generations of daughter cells and even generations of individuals. However, reports indicate that they persist only in the presence of a stressor factor (or an inductor of the above-mentioned modifications). In its absence, these modifications weaken or lose heritability, being eliminated in the next few generations. In this review, it is argued how epigenetic signals influence gene regulation, the mechanisms involved and their participation in processes of resistance to biotic stresses, controlling processes of the plant immune system. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

A novel and easy FxCycle™ violet based flow cytometric method for simultaneous assessment of DNA ploidy and six-color immunophenotyping.

PubMed

Tembhare, Prashant; Badrinath, Yajamanam; Ghogale, Sitaram; Patkar, Nikhil; Dhole, Nilesh; Dalavi, Pooja; Kunder, Nikesh; Kumar, Ashok; Gujral, Sumeet; Subramanian, P G

2016-03-01

Abnormal DNA ploidy is a valuable prognostic factor in many neoplasms, especially in hematological neoplasms like B-cell acute lymphoblastic leukemia (B-ALL) and multiple myeloma (MM). Current methods of flow-cytometric (FC) DNA-ploidy evaluation are either technically difficult or limited to three- to four-color immunophenotyping and hence, challenging to evaluate DNA-ploidy in minute tumor population with background rich of its normal counterpart cells and other hematopoietic cells. We standardized a novel sensitive and easy method of simultaneous evaluation of six- to seven-color immunophenotyping and DNA-ploidy using a dye-FxCycle Violet (FCV). Linearity, resolution, and coefficient of variation (CV) for FCV were studied using chicken erythrocyte nuclei. Ploidy results of FCV were compared with Propidium iodide (PI) in 20 samples and intra-assay variation for FCV was studied. Using this six-color immunophenotyping & FCV-protocol DNA-ploidy was determined in bone-marrow samples from 124 B-ALL & 50 MM patients. Dilution experiment was also conducted to determine the sensitivity in detection of aneuploidy in minute tumor population. FCV revealed high linearity and resolution in 450/50 channel. On comparison with PI, CV of Go/G1-peak with FCV (mean-CV 4.1%) was slightly higher than PI (mean-CV 2.9%) but had complete agreement in ploidy results. Dilution experiment showed that aneuploidy could be accurately detected up to the limit of 0.01% tumor cells. Intra-assay variation was very low with CV of 0.005%. In B-ALL, hypodiploidy was noted in 4%, hyperdiploidy in 24%, near-hyperdiploidy in 13% and remaining 59% were diploid. In MM, hypodiploidy was in 2%, hyperdiploidy in 58%, near-hyperdiploidy in 8% and remaining 30% were diploid. FCV-based DNA-ploidy method is a sensitive and easy method for simultaneous evaluation of six-color immunophenotyping and DNA analysis. It is useful in DNA-ploidy evaluation of minute tumor population in cases like minimal residual disease and MM precursor conditions. © 2015 International Society for Advancement of Cytometry.

A Systematic Analysis of Factors Localized to Damaged Chromatin Reveals PARP-Dependent Recruitment of Transcription Factors.

PubMed

Izhar, Lior; Adamson, Britt; Ciccia, Alberto; Lewis, Jedd; Pontano-Vaites, Laura; Leng, Yumei; Liang, Anthony C; Westbrook, Thomas F; Harper, J Wade; Elledge, Stephen J

2015-06-09

Localization to sites of DNA damage is a hallmark of DNA damage response (DDR) proteins. To identify DDR factors, we screened epitope-tagged proteins for localization to sites of chromatin damaged by UV laser microirradiation and found >120 proteins that localize to damaged chromatin. These include the BAF tumor suppressor complex and the amyotrophic lateral sclerosis (ALS) candidate protein TAF15. TAF15 contains multiple domains that bind damaged chromatin in a poly-(ADP-ribose) polymerase (PARP)-dependent manner, suggesting a possible role as glue that tethers multiple PAR chains together. Many positives were transcription factors; > 70% of randomly tested transcription factors localized to sites of DNA damage, and of these, ∼90% were PARP dependent for localization. Mutational analyses showed that localization to damaged chromatin is DNA-binding-domain dependent. By examining Hoechst staining patterns at damage sites, we see evidence of chromatin decompaction that is PARP dependent. We propose that PARP-regulated chromatin remodeling at sites of damage allows transient accessibility of DNA-binding proteins. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Relationships among DNA hypomethylation, Cd, and Pb exposure and risk of cigarette smoking-related urothelial carcinoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chung, Chi-Jung

Cigarette smoking and environmental exposure to heavy metals are important global health issues, especially for urothelial carcinoma (UC). However, the effects of cadmium and lead exposure, as well as the levels of DNA hypomethylation, on UC risk are limited. We evaluated the possible exposure sources of Cd and Pb and the relationship among DNA hypomethylation, urinary Cd and Pb levels, and UC risk. We recruited 209 patients with UC and 417 control patients for a hospital-based case–control study between June 2011 and August 2014. We collected environmental exposure-related information with questionnaires. Blood and urine samples were analyzed to measure themore » Cd and Pb exposure and 5-methyl-2′-deoxycytidine levels as a proxy for DNA methylation. Multivariate logistic regression and 95% confidence intervals were applied to estimate the risk for UC. Study participants with high Cd and Pb exposure in blood or urine had significantly increased risk of UC, especially among the smokers. After adjusting for age and gender, the possible connections of individual cumulative cigarette smoking or herb medicine exposure with the increased levels of Cd and Pb were observed in the controls. Participants with 8.66%–12.39% of DNA hypomethylation had significantly increased risk of UC compared with those with ≥ 12.39% of DNA hypomethylation. Environmental factors including cigarette smoking and herb medicine may contribute to the internal dose of heavy metals levels. Repeat measurements of heavy metals with different study design, detailed dietary information, and types of herb medicine should be recommended for exploring UC carcinogenesis in future studies. - Highlights: • Smoking and herb medicine ingestion is associated with increased urinary Cd and Pb levels. • Urinary levels of Cd and Pb are associated with increased risk of UC. • UC carcinogenesis might have partially resulted from DNA hypomethylation.« less

Endonuclease-independent LINE-1 retrotransposition at mammalian telomeres.

PubMed

Morrish, Tammy A; Garcia-Perez, José Luis; Stamato, Thomas D; Taccioli, Guillermo E; Sekiguchi, JoAnn; Moran, John V

2007-03-08

Long interspersed element-1 (LINE-1 or L1) elements are abundant, non-long-terminal-repeat (non-LTR) retrotransposons that comprise approximately 17% of human DNA. The average human genome contains approximately 80-100 retrotransposition-competent L1s (ref. 2), and they mobilize by a process that uses both the L1 endonuclease and reverse transcriptase, termed target-site primed reverse transcription. We have previously reported an efficient, endonuclease-independent L1 retrotransposition pathway (EN(i)) in certain Chinese hamster ovary (CHO) cell lines that are defective in the non-homologous end-joining (NHEJ) pathway of DNA double-strand-break repair. Here we have characterized EN(i) retrotransposition events generated in V3 CHO cells, which are deficient in DNA-dependent protein kinase catalytic subunit (DNA-PKcs) activity and have both dysfunctional telomeres and an NHEJ defect. Notably, approximately 30% of EN(i) retrotransposition events insert in an orientation-specific manner adjacent to a perfect telomere repeat (5'-TTAGGG-3'). Similar insertions were not detected among EN(i) retrotransposition events generated in controls or in XR-1 CHO cells deficient for XRCC4, an NHEJ factor that is required for DNA ligation but has no known function in telomere maintenance. Furthermore, transient expression of a dominant-negative allele of human TRF2 (also called TERF2) in XRCC4-deficient XR-1 cells, which disrupts telomere capping, enables telomere-associated EN(i) retrotransposition events. These data indicate that L1s containing a disabled endonuclease can use dysfunctional telomeres as an integration substrate. The findings highlight similarities between the mechanism of EN(i) retrotransposition and the action of telomerase, because both processes can use a 3' OH for priming reverse transcription at either internal DNA lesions or chromosome ends. Thus, we propose that EN(i) retrotransposition is an ancestral mechanism of RNA-mediated DNA repair associated with non-LTR retrotransposons that may have been used before the acquisition of an endonuclease domain.

Paternal levels of DNA damage in spermatozoa and maternal parity influence offspring mortality in an endangered ungulate.

PubMed

Ruiz-López, María José; Espeso, Gerardo; Evenson, Donald P; Roldan, Eduardo R S; Gomendio, Montserrat

2010-08-22

Understanding which factors influence offspring mortality rates is a major challenge since it influences population dynamics and may constrain the chances of recovery among endangered species. Most studies have focused on the effects of maternal and environmental factors, but little is known about paternal factors. Among most polygynous mammals, males only contribute the haploid genome to their offspring, but the possibility that sperm DNA integrity may influence offspring survival has not been explored. We examined several maternal, paternal and individual factors that may influence offspring survival in an endangered species (Gazella cuvieri). Levels of sperm DNA damage had the largest impact upon offspring mortality rates, followed by maternal parity. In addition, there was a significant interaction between these two variables, so that offspring born to primiparous mothers were more likely to die if their father had high levels of sperm DNA damage, but this was not the case among multiparous mothers. Thus, multiparous mothers seem to protect their offspring from the deleterious effects of sperm DNA damage. Since levels of sperm DNA damage seem to be higher among endangered species, more attention should be paid to the impact of this largely ignored factor among the viability of endangered species.

Fully automated, internally controlled quantification of hepatitis B Virus DNA by real-time PCR by use of the MagNA Pure LC and LightCycler instruments.

PubMed

Leb, Victoria; Stöcher, Markus; Valentine-Thon, Elizabeth; Hölzl, Gabriele; Kessler, Harald; Stekel, Herbert; Berg, Jörg

2004-02-01

We report on the development of a fully automated real-time PCR assay for the quantitative detection of hepatitis B virus (HBV) DNA in plasma with EDTA (EDTA plasma). The MagNA Pure LC instrument was used for automated DNA purification and automated preparation of PCR mixtures. Real-time PCR was performed on the LightCycler instrument. An internal amplification control was devised as a PCR competitor and was introduced into the assay at the stage of DNA purification to permit monitoring for sample adequacy. The detection limit of the assay was found to be 200 HBV DNA copies/ml, with a linear dynamic range of 8 orders of magnitude. When samples from the European Union Quality Control Concerted Action HBV Proficiency Panel 1999 were examined, the results were found to be in acceptable agreement with the HBV DNA concentrations of the panel members. In a clinical laboratory evaluation of 123 EDTA plasma samples, a significant correlation was found with the results obtained by the Roche HBV Monitor test on the Cobas Amplicor analyzer within the dynamic range of that system. In conclusion, the newly developed assay has a markedly reduced hands-on time, permits monitoring for sample adequacy, and is suitable for the quantitative detection of HBV DNA in plasma in a routine clinical laboratory.

The internal head protein Gp16 controls DNA ejection from the bacteriophage T7 virion.

PubMed

Struthers-Schlinke, J S; Robins, W P; Kemp, P; Molineux, I J

2000-08-04

A wild-type T7 virion ejects about 850 bp of the 40 kb genome into the bacterial cell by a transcription-independent process. Internalization of the remainder of the genome normally requires transcription. Inhibition of transcription-independent DNA translocation beyond the leading 850 bp is not absolute but the time taken by a population of phage genomes in overcoming the block averages about 20 minutes at 30 degrees C. There are additional blocks to transcription-independent translocation and less than 20 % of infecting DNA molecules completely penetrate the cell cytoplasm after four hours of infection. Mutant virions containing an altered gene 16 protein either prevent the blocks to transcription-independent DNA translocation or effect rapid release from blocking sites and allow the entire phage DNA molecule to enter the cell at a constant rate of about 75 bp per second. This rate is likely the same at which the leading 850 bp is ejected into the cell from a wild-type virion. All mutations fall into two clusters contained within 380 bp of the 4 kb gene 16, suggesting that a 127 residue segment of gp16 controls DNA ejection from the phage particle. We suggest that this segment of gp16 acts as a clamp to prevent transcription-independent DNA translocation. Copyright 2000 Academic Press.

Space-to-Ground: Genes in Space: 04/13/2018

NASA Image and Video Library

2018-04-12

Can the Polymerase Chain Reaction be used to study DNA alterations on the International Space Station? NASA's Space to Ground is your weekly update on what's happening aboard the International Space Station.

Pharyngeal and cervical cancer incidences significantly correlate with personal UV doses among whites in the United States.

PubMed

Godar, Dianne E; Tang, Rong; Merrill, Stephen J

2014-09-01

Because we found UV-exposed oral tissue cells have reduced DNA repair and apoptotic cell death compared with skin tissue cells, we asked if a correlation existed between personal UV dose and the incidences of oral and pharyngeal cancer in the United States. We analyzed the International Agency for Research on Cancer's incidence data for oral and pharyngeal cancers by race (white and black) and sex using each state's average annual personal UV dose. We refer to our data as 'white' rather than 'Caucasian,' which is a specific subgroup of whites, and 'black' rather than African-American because blacks from other countries around the world reside in the U.S. Most oropharyngeal carcinomas harboured human papilloma virus (HPV), so we included cervical cancer as a control for direct UV activation. We found significant correlations between increasing UV dose and pharyngeal cancer in white males (p=0.000808) and females (p=0.0031) but not in blacks. Shockingly, we also found cervical cancer in whites to significantly correlate with increasing UV dose (p=0.0154). Thus, because pharyngeal and cervical cancer correlate significantly with increasing personal UV dose in only the white population, both direct (DNA damage) and indirect (soluble factors) effects may increase the risk of HPV-associated cancer. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

A simple approach to the generation of heterologous competitive internal controls for real-time PCR assays on the LightCycler.

PubMed

Stöcher, Markus; Leb, Victoria; Hölzl, Gabriele; Berg, Jörg

2002-12-01

The real-time PCR technology allows convenient detection and quantification of virus derived DNA. This approach is used in many PCR based assays in clinical laboratories. Detection and quantification of virus derived DNA is usually performed against external controls or external standards. Thus, adequacy within a clinical sample is not monitored for. This can be achieved using internal controls that are co-amplified with the specific target within the same reaction vessel. We describe a convenient way to prepare heterologous internal controls as competitors for real-time PCR based assays. The internal controls were devised as competitors in real-time PCR, e.g. LightCycler-PCR. The bacterial neomycin phosphotransferase gene (neo) was used as source for heterologous DNA. Within the neo gene a box was chosen containing sequences for four differently spaced forward primers, one reverse primer, and a pair of neo specific hybridization probes. Pairs of primers were constructed to compose of virus-specific primer sequences and neo box specific primer sequences. Using those composite primers in conventional preparative PCR four types of internal controls were amplified from the neo box and subsequently cloned. A panel of the four differently sized internal controls was generated and tested by LightCycler PCR using their virus-specific primers. All four different PCR products were detected with the single pair of neo specific FRET-hybridization probes. The presented approach to generate competitive internal controls for use in LightCycler PCR assays proved convenient und rapid. The obtained internal controls match most PCR product sizes used in clinical routine molecular assays and will assist to discriminate true from false negative results.

Systematic analysis and evolution of 5S ribosomal DNA in metazoans.

PubMed

Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

2013-11-01

Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.

Systematic analysis and evolution of 5S ribosomal DNA in metazoans

PubMed Central

Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

2013-01-01

Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12 766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades. PMID:23838690

Competition between histone and transcription factor binding regulates the onset of transcription in zebrafish embryos

PubMed Central

Joseph, Shai R; Pálfy, Máté; Hilbert, Lennart; Kumar, Mukesh; Karschau, Jens; Zaburdaev, Vasily; Shevchenko, Andrej; Vastenhouw, Nadine L

2017-01-01

Upon fertilization, the genome of animal embryos remains transcriptionally inactive until the maternal-to-zygotic transition. At this time, the embryo takes control of its development and transcription begins. How the onset of zygotic transcription is regulated remains unclear. Here, we show that a dynamic competition for DNA binding between nucleosome-forming histones and transcription factors regulates zebrafish genome activation. Taking a quantitative approach, we found that the concentration of non-DNA-bound core histones sets the time for the onset of transcription. The reduction in nuclear histone concentration that coincides with genome activation does not affect nucleosome density on DNA, but allows transcription factors to compete successfully for DNA binding. In agreement with this, transcription factor binding is sensitive to histone levels and the concentration of transcription factors also affects the time of transcription. Our results demonstrate that the relative levels of histones and transcription factors regulate the onset of transcription in the embryo. DOI: http://dx.doi.org/10.7554/eLife.23326.001 PMID:28425915

Competition between histone and transcription factor binding regulates the onset of transcription in zebrafish embryos.

PubMed

Joseph, Shai R; Pálfy, Máté; Hilbert, Lennart; Kumar, Mukesh; Karschau, Jens; Zaburdaev, Vasily; Shevchenko, Andrej; Vastenhouw, Nadine L

2017-04-20

Upon fertilization, the genome of animal embryos remains transcriptionally inactive until the maternal-to-zygotic transition. At this time, the embryo takes control of its development and transcription begins. How the onset of zygotic transcription is regulated remains unclear. Here, we show that a dynamic competition for DNA binding between nucleosome-forming histones and transcription factors regulates zebrafish genome activation. Taking a quantitative approach, we found that the concentration of non-DNA-bound core histones sets the time for the onset of transcription. The reduction in nuclear histone concentration that coincides with genome activation does not affect nucleosome density on DNA, but allows transcription factors to compete successfully for DNA binding. In agreement with this, transcription factor binding is sensitive to histone levels and the concentration of transcription factors also affects the time of transcription. Our results demonstrate that the relative levels of histones and transcription factors regulate the onset of transcription in the embryo.

Single-molecule live-cell imaging of bacterial DNA repair and damage tolerance.

PubMed

Ghodke, Harshad; Ho, Han; van Oijen, Antoine M

2018-02-19

Genomic DNA is constantly under threat from intracellular and environmental factors that damage its chemical structure. Uncorrected DNA damage may impede cellular propagation or even result in cell death, making it critical to restore genomic integrity. Decades of research have revealed a wide range of mechanisms through which repair factors recognize damage and co-ordinate repair processes. In recent years, single-molecule live-cell imaging methods have further enriched our understanding of how repair factors operate in the crowded intracellular environment. The ability to follow individual biochemical events, as they occur in live cells, makes single-molecule techniques tremendously powerful to uncover the spatial organization and temporal regulation of repair factors during DNA-repair reactions. In this review, we will cover practical aspects of single-molecule live-cell imaging and highlight recent advances accomplished by the application of these experimental approaches to the study of DNA-repair processes in prokaryotes. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

Dynamic DNA binding licenses a repair factor to bypass roadblocks in search of DNA lesions.

PubMed

Brown, Maxwell W; Kim, Yoori; Williams, Gregory M; Huck, John D; Surtees, Jennifer A; Finkelstein, Ilya J

2016-02-03

DNA-binding proteins search for specific targets via facilitated diffusion along a crowded genome. However, little is known about how crowded DNA modulates facilitated diffusion and target recognition. Here we use DNA curtains and single-molecule fluorescence imaging to investigate how Msh2-Msh3, a eukaryotic mismatch repair complex, navigates on crowded DNA. Msh2-Msh3 hops over nucleosomes and other protein roadblocks, but maintains sufficient contact with DNA to recognize a single lesion. In contrast, Msh2-Msh6 slides without hopping and is largely blocked by protein roadblocks. Remarkably, the Msh3-specific mispair-binding domain (MBD) licences a chimeric Msh2-Msh6(3MBD) to bypass nucleosomes. Our studies contrast how Msh2-Msh3 and Msh2-Msh6 navigate on a crowded genome and suggest how Msh2-Msh3 locates DNA lesions outside of replication-coupled repair. These results also provide insights into how DNA repair factors search for DNA lesions in the context of chromatin.

A novel transcription factor gene FHS1 is involved in the DNA damage response in Fusarium graminearum

PubMed Central

Son, Hokyoung; Fu, Minmin; Lee, Yoonji; Lim, Jae Yun; Min, Kyunghun; Kim, Jin-Cheol; Choi, Gyung Ja; Lee, Yin-Won

2016-01-01

Cell cycle regulation and the maintenance of genome integrity are crucial for the development and virulence of the pathogenic plant fungus Fusarium graminearum. To identify transcription factors (TFs) related to these processes, four DNA-damaging agents were applied to screen a F. graminearum TF mutant library. Sixteen TFs were identified to be likely involved in DNA damage responses. Fhs1 is a fungal specific Zn(II)2Cys6 TF that localises exclusively to nuclei. fhs1 deletion mutants were hypersensitive to hydroxyurea and defective in mitotic cell division. Moreover, deletion of FHS1 resulted in defects in perithecia production and virulence and led to the accumulation of DNA damage. Our genetic evidence demonstrated that the FHS1-associated signalling pathway for DNA damage response is independent of the ATM or ATR pathways. This study identified sixteen genes involved in the DNA damage response and is the first to characterise the novel transcription factor gene FHS1, which is involved in the DNA damage response. The results provide new insights into mechanisms underlying DNA damage responses in fungi, including F. graminearum. PMID:26888604

Association between alterations in global DNA methylation and predisposing factors in diabetes: a high pressure liquid chromatography based study.

PubMed

Maghbooli, Z; Hossein-Nezhad, A; Larijani, B; Pasalar, P; Keshtkar, A A

2015-08-01

The aim of this study was to investigate the relationship between inter-individual global DNA methylation and diabetes predisposing factors. The 5-methyl cytosine content was assessed by reverse phase high pressure liquid chromatography (RP-HPLC) of peripheral blood leukocytes obtained from 178 type 2 diabetes patients to determine individual global DNA methylation status. There was a positive significant correlation between diabetes duration and DNA methylation levels (P=0.002) with increasing levels of DNA methylation associated with age (P=0.047). There was no significant correlation between DNA methylation levels and HbA1c (P=0.15). No significant differences were observed between patients with and without diabetes predisposing factors including: hypertension (P=0.772), dyslipidemia (P=0.617), insulin resistance (homeostatic model assessment index) (P=0.156) and obesity (P=0.609). As such, the duration of diabetes (>10 years) was the most important predictor of global DNA methylation levels in diabetic patients after adjusting for age and sex (P=0.023). Our findings indicate that chronic hyperglycemic exposure plays an independent role in global DNA methylation levels in type 2 diabetes patients.

The hunt for origins of DNA replication in multicellular eukaryotes

PubMed Central

Urban, John M.; Foulk, Michael S.; Casella, Cinzia

2015-01-01

Origins of DNA replication (ORIs) occur at defined regions in the genome. Although DNA sequence defines the position of ORIs in budding yeast, the factors for ORI specification remain elusive in metazoa. Several methods have been used recently to map ORIs in metazoan genomes with the hope that features for ORI specification might emerge. These methods are reviewed here with analysis of their advantages and shortcomings. The various factors that may influence ORI selection for initiation of DNA replication are discussed. PMID:25926981

Identification of Specific DNA Binding Residues in the TCP Family of Transcription Factors in Arabidopsis[W

PubMed Central

Aggarwal, Pooja; Das Gupta, Mainak; Joseph, Agnel Praveen; Chatterjee, Nirmalya; Srinivasan, N.; Nath, Utpal

2010-01-01

The TCP transcription factors control multiple developmental traits in diverse plant species. Members of this family share an ∼60-residue-long TCP domain that binds to DNA. The TCP domain is predicted to form a basic helix-loop-helix (bHLH) structure but shares little sequence similarity with canonical bHLH domain. This classifies the TCP domain as a novel class of DNA binding domain specific to the plant kingdom. Little is known about how the TCP domain interacts with its target DNA. We report biochemical characterization and DNA binding properties of a TCP member in Arabidopsis thaliana, TCP4. We have shown that the 58-residue domain of TCP4 is essential and sufficient for binding to DNA and possesses DNA binding parameters comparable to canonical bHLH proteins. Using a yeast-based random mutagenesis screen and site-directed mutants, we identified the residues important for DNA binding and dimer formation. Mutants defective in binding and dimerization failed to rescue the phenotype of an Arabidopsis line lacking the endogenous TCP4 activity. By combining structure prediction, functional characterization of the mutants, and molecular modeling, we suggest a possible DNA binding mechanism for this class of transcription factors. PMID:20363772

The Chromatin Remodeling Factor SMARCB1 Forms a Complex with Human Cytomegalovirus Proteins UL114 and UL44

PubMed Central

Ranneberg-Nilsen, Toril; Rollag, Halvor; Slettebakk, Ragnhild; Backe, Paul Hoff; Olsen, Øyvind; Luna, Luisa; Bjørås, Magnar

2012-01-01

Background Human cytomegalovirus (HCMV) uracil DNA glycosylase, UL114, is required for efficient viral DNA replication. Presumably, UL114 functions as a structural partner to other factors of the DNA-replication machinery and not as a DNA repair protein. UL114 binds UL44 (HCMV processivity factor) and UL54 (HCMV-DNA-polymerase). In the present study we have searched for cellular partners of UL114. Methodology/Principal Findings In a yeast two-hybrid screen SMARCB1, a factor of the SWI/SNF chromatin remodeling complex, was found to be an interacting partner of UL114. This interaction was confirmed in vitro by co-immunoprecipitation and pull-down. Immunofluorescence microscopy revealed that SMARCB1 along with BRG-1, BAF170 and BAF155, which are the core SWI/SNF components required for efficient chromatin remodeling, were present in virus replication foci 24–48 hours post infection (hpi). Furthermore a direct interaction was also demonstrated for SMARCB1 and UL44. Conclusions/Significance The core SWI/SNF factors required for efficient chromatin remodeling are present in the HCMV replication foci throughout infection. The proteins UL44 and UL114 interact with SMARCB1 and may participate in the recruitment of the SWI/SNF complex to the chromatinized virus DNA. Thus, the presence of the SWI/SNF chromatin remodeling complex in replication foci and its association with UL114 and with UL44 might imply its involvement in different DNA transactions. PMID:22479537

DNA barcoding of western North American taxa: Leymus (Poaceae) and Lepidium (Brassicaceae)

Treesearch

Catherine Mae Culumber

2007-01-01

My objective was to determine if polymorphic information from the 18S-5.8S-26S nuclear ribosomal DNA internal transcribed spacer regions and the trnK-psbA, trnK-rps16 chloroplast DNA spacer regions is sufficient 1) to identify a plant specimen to the species level, and 2) to establish the phylogenetic relationship between species. The first study examined the...

A Platform for Combined DNA and Protein Microarrays Based on Total Internal Reflection Fluorescence

PubMed Central

Asanov, Alexander; Zepeda, Angélica; Vaca, Luis

2012-01-01

We have developed a novel microarray technology based on total internal reflection fluorescence (TIRF) in combination with DNA and protein bioassays immobilized at the TIRF surface. Unlike conventional microarrays that exhibit reduced signal-to-background ratio, require several stages of incubation, rinsing and stringency control, and measure only end-point results, our TIRF microarray technology provides several orders of magnitude better signal-to-background ratio, performs analysis rapidly in one step, and measures the entire course of association and dissociation kinetics between target DNA and protein molecules and the bioassays. In many practical cases detection of only DNA or protein markers alone does not provide the necessary accuracy for diagnosing a disease or detecting a pathogen. Here we describe TIRF microarrays that detect DNA and protein markers simultaneously, which reduces the probabilities of false responses. Supersensitive and multiplexed TIRF DNA and protein microarray technology may provide a platform for accurate diagnosis or enhanced research studies. Our TIRF microarray system can be mounted on upright or inverted microscopes or interfaced directly with CCD cameras equipped with a single objective, facilitating the development of portable devices. As proof-of-concept we applied TIRF microarrays for detecting molecular markers from Bacillus anthracis, the pathogen responsible for anthrax. PMID:22438738

Integrity of the DNA and Cellular Ultrastructure of Cryptoendolithic Fungi in Space or Mars Conditions: A 1.5-Year Study at the International Space Station.

PubMed

Onofri, Silvano; Selbmann, Laura; Pacelli, Claudia; de Vera, Jean Pierre; Horneck, Gerda; Hallsworth, John E; Zucconi, Laura

2018-06-19

The black fungi Cryomyces antarcticus and Cryomyces minteri are highly melanized and are resilient to cold, ultra-violet, ionizing radiation and other extreme conditions. These microorganisms were isolated from cryptoendolithic microbial communities in the McMurdo Dry Valleys (Antarctica) and studied in Low Earth Orbit (LEO), using the EXPOSE-E facility on the International Space Station (ISS). Previously, it was demonstrated that C. antarcticus and C. minteri survive the hostile conditions of space (vacuum, temperature fluctuations, and the full spectrum of extraterrestrial solar electromagnetic radiation), as well as Mars conditions that were simulated in space for a 1.5-year period. Here, we qualitatively and quantitatively characterize damage to DNA and cellular ultrastructure in desiccated cells of these two species, within the frame of the same experiment. The DNA and cells of C. antarcticus exhibited a higher resistance than those of C. minteri . This is presumably attributable to the thicker (melanized) cell wall of the former. Generally, DNA was readily detected (by PCR) regardless of exposure conditions or fungal species, but the C. minteri DNA had been more-extensively mutated. We discuss the implications for using DNA, when properly shielded, as a biosignature of recently extinct or extant life.

Environmental Factors Can Influence Mitochondrial Inheritance in the Saccharomyces Yeast Hybrids.

PubMed

Hsu, Yu-Yi; Chou, Jui-Yu

2017-01-01

Mitochondria play a critical role in the generation of metabolic energy and are crucial for eukaryotic cell survival and proliferation. In most sexual eukaryotes, mitochondrial DNA (mtDNA) is inherited from only one parent in non-Mendelian inheritance in contrast to the inheritance of nuclear DNA. The model organism Saccharomyces cerevisiae is commonly used to study mitochondrial biology. It has two mating types: MATa and MATα. Previous studies have suggested that the mtDNA inheritance patterns in hybrid diploid cells depend on the genetic background of parental strains. However, the underlying mechanisms remain unclear. To elucidate the mechanisms, we examined the effects of environmental factors on the mtDNA inheritance patterns in hybrids obtained by crossing S. cerevisiae with its close relative S. paradoxus. The results demonstrated that environmental factors can influence mtDNA transmission in hybrid diploids, and that the inheritance patterns are strain dependent. The fitness competition assay results showed that the fitness differences can explain the mtDNA inheritance patterns under specific conditions. However, in this study, we found that fitness differences cannot fully be explained by mitochondrial activity in hybrids under stress conditions.

Diversification of transcription factor-DNA interactions and the evolution of gene regulatory networks.

PubMed

Rogers, Julia M; Bulyk, Martha L

2018-04-25

Sequence-specific transcription factors (TFs) bind short DNA sequences in the genome to regulate the expression of target genes. In the last decade, numerous technical advances have enabled the determination of the DNA-binding specificities of many of these factors. Large-scale screens of many TFs enabled the creation of databases of TF DNA-binding specificities, typically represented as position weight matrices (PWMs). Although great progress has been made in determining and predicting binding specificities systematically, there are still many surprises to be found when studying a particular TF's interactions with DNA in detail. Paralogous TFs' binding specificities can differ in subtle ways, in a manner that is not immediately apparent from looking at their PWMs. These differences affect gene regulatory outputs and enable TFs to rewire transcriptional networks over evolutionary time. This review discusses recent observations made in the study of TF-DNA interactions that highlight the importance of continued in-depth analysis of TF-DNA interactions and their inherent complexity. This article is categorized under: Biological Mechanisms > Regulatory Biology. © 2018 Wiley Periodicals, Inc.

International Study to Evaluate PCR Methods for Detection of Trypanosoma cruzi DNA in Blood Samples from Chagas Disease Patients

PubMed Central

Schijman, Alejandro G.; Bisio, Margarita; Orellana, Liliana; Sued, Mariela; Duffy, Tomás; Mejia Jaramillo, Ana M.; Cura, Carolina; Auter, Frederic; Veron, Vincent; Qvarnstrom, Yvonne; Deborggraeve, Stijn; Hijar, Gisely; Zulantay, Inés; Lucero, Raúl Horacio; Velazquez, Elsa; Tellez, Tatiana; Sanchez Leon, Zunilda; Galvão, Lucia; Nolder, Debbie; Monje Rumi, María; Levi, José E.; Ramirez, Juan D.; Zorrilla, Pilar; Flores, María; Jercic, Maria I.; Crisante, Gladys; Añez, Néstor; De Castro, Ana M.; Gonzalez, Clara I.; Acosta Viana, Karla; Yachelini, Pedro; Torrico, Faustino; Robello, Carlos; Diosque, Patricio; Triana Chavez, Omar; Aznar, Christine; Russomando, Graciela; Büscher, Philippe; Assal, Azzedine; Guhl, Felipe; Sosa Estani, Sergio; DaSilva, Alexandre; Britto, Constança; Luquetti, Alejandro; Ladzins, Janis

2011-01-01

Background A century after its discovery, Chagas disease still represents a major neglected tropical threat. Accurate diagnostics tools as well as surrogate markers of parasitological response to treatment are research priorities in the field. The purpose of this study was to evaluate the performance of PCR methods in detection of Trypanosoma cruzi DNA by an external quality evaluation. Methodology/Findings An international collaborative study was launched by expert PCR laboratories from 16 countries. Currently used strategies were challenged against serial dilutions of purified DNA from stocks representing T. cruzi discrete typing units (DTU) I, IV and VI (set A), human blood spiked with parasite cells (set B) and Guanidine Hidrochloride-EDTA blood samples from 32 seropositive and 10 seronegative patients from Southern Cone countries (set C). Forty eight PCR tests were reported for set A and 44 for sets B and C; 28 targeted minicircle DNA (kDNA), 13 satellite DNA (Sat-DNA) and the remainder low copy number sequences. In set A, commercial master mixes and Sat-DNA Real Time PCR showed better specificity, but kDNA-PCR was more sensitive to detect DTU I DNA. In set B, commercial DNA extraction kits presented better specificity than solvent extraction protocols. Sat-DNA PCR tests had higher specificity, with sensitivities of 0.05–0.5 parasites/mL whereas specific kDNA tests detected 5.10−3 par/mL. Sixteen specific and coherent methods had a Good Performance in both sets A and B (10 fg/µl of DNA from all stocks, 5 par/mL spiked blood). The median values of sensitivities, specificities and accuracies obtained in testing the Set C samples with the 16 tests determined to be good performing by analyzing Sets A and B samples varied considerably. Out of them, four methods depicted the best performing parameters in all three sets of samples, detecting at least 10 fg/µl for each DNA stock, 0.5 par/mL and a sensitivity between 83.3–94.4%, specificity of 85–95%, accuracy of 86.8–89.5% and kappa index of 0.7–0.8 compared to consensus PCR reports of the 16 good performing tests and 63–69%, 100%, 71.4–76.2% and 0.4–0.5, respectively compared to serodiagnosis. Method LbD2 used solvent extraction followed by Sybr-Green based Real time PCR targeted to Sat-DNA; method LbD3 used solvent DNA extraction followed by conventional PCR targeted to Sat-DNA. The third method (LbF1) used glass fiber column based DNA extraction followed by TaqMan Real Time PCR targeted to Sat-DNA (cruzi 1/cruzi 2 and cruzi 3 TaqMan probe) and the fourth method (LbQ) used solvent DNA extraction followed by conventional hot-start PCR targeted to kDNA (primer pairs 121/122). These four methods were further evaluated at the coordinating laboratory in a subset of human blood samples, confirming the performance obtained by the participating laboratories. Conclusion/Significance This study represents a first crucial step towards international validation of PCR procedures for detection of T. cruzi in human blood samples. PMID:21264349

Evaluation of methyl methanesulfonate, 2,6-diaminotoluene and 5-fluorouracil: Part of the Japanese center for the validation of alternative methods (JaCVAM) international validation study of the in vivo rat alkaline comet assay.

PubMed

Plappert-Helbig, Ulla; Junker-Walker, Ursula; Martus, Hans-Joerg

2015-07-01

As a part of the Japanese Center for the Validation of Alternative Methods (JaCVAM)-initiative international validation study of the in vivo rat alkaline comet assay (comet assay), we examined methyl methanesulfonate, 2,6-diaminotoluene, and 5-fluorouracil under coded test conditions. Rats were treated orally with the maximum tolerated dose (MTD) and two additional descending doses of the respective compounds. In the MMS treated groups liver and stomach showed significantly elevated DNA damage at each dose level and a significant dose-response relationship. 2,6-diaminotoluene induced significantly elevated DNA damage in the liver at each dose and a statistically significant dose-response relationship whereas no DNA damage was obtained in the stomach. 5-fluorouracil did not induce DNA damage in either liver or stomach. Copyright © 2015 Elsevier B.V. All rights reserved.

Introducing a true internal standard for the Comet assay to minimize intra- and inter-experiment variability in measures of DNA damage and repair

PubMed Central

Zainol, Murizal; Stoute, Julia; Almeida, Gabriela M.; Rapp, Alexander; Bowman, Karen J.; Jones, George D. D.

2009-01-01

The Comet assay (CA) is a sensitive/simple measure of genotoxicity. However, many features of CA contribute variability. To minimize these, we have introduced internal standard materials consisting of ‘reference’ cells which have their DNA substituted with BrdU. Using a fluorescent anti-BrdU antibody, plus an additional barrier filter, comets derived from these cells could be readily distinguished from the ‘test’-cell comets, present in the same gel. In experiments to evaluate the reference cell comets as external and internal standards, the reference and test cells were present in separate gels on the same slide or mixed together in the same gel, respectively, before their co-exposure to X-irradiation. Using the reference cell comets as internal standards led to substantial reductions in the coefficient of variation (CoV) for intra- and inter-experimental measures of comet formation and DNA damage repair; only minor reductions in CoV were noted when the reference and test cell comets were in separate gels. These studies indicate that differences between individual gels appreciably contribute to CA variation. Further studies using the reference cells as internal standards allowed greater significance to be obtained between groups of replicate samples. Ultimately, we anticipate that development will deliver robust quality assurance materials for CA. PMID:19828597

Investigation of arc repressor DNA-binding specificity by comparative molecular dynamics simulations.

PubMed

Song, Wei; Guo, Jun-Tao

2015-01-01

Transcription factors regulate gene expression through binding to specific DNA sequences. How transcription factors achieve high binding specificity is still not well understood. In this paper, we investigated the role of protein flexibility in protein-DNA-binding specificity by comparative molecular dynamics (MD) simulations. Protein flexibility has been considered as a key factor in molecular recognition, which is intrinsically a dynamic process involving fine structural fitting between binding components. In this study, we performed comparative MD simulations on wild-type and F10V mutant P22 Arc repressor in both free and complex conformations. The F10V mutant has lower DNA-binding specificity though both the bound and unbound main-chain structures between the wild-type and F10V mutant Arc are highly similar. We found that the DNA-binding motif of wild-type Arc is structurally more flexible than the F10V mutant in the unbound state, especially for the six DNA base-contacting residues in each dimer. We demonstrated that the flexible side chains of wild-type Arc lead to a higher DNA-binding specificity through forming more hydrogen bonds with DNA bases upon binding. Our simulations also showed a possible conformational selection mechanism for Arc-DNA binding. These results indicate the important roles of protein flexibility and dynamic properties in protein-DNA-binding specificity.

DNA methylation restricts lineage-specific functions of transcription factor Gata4 during embryonic stem cell differentiation.

PubMed

Oda, Masaaki; Kumaki, Yuichi; Shigeta, Masaki; Jakt, Lars Martin; Matsuoka, Chisa; Yamagiwa, Akiko; Niwa, Hitoshi; Okano, Masaki

2013-06-01

DNA methylation changes dynamically during development and is essential for embryogenesis in mammals. However, how DNA methylation affects developmental gene expression and cell differentiation remains elusive. During embryogenesis, many key transcription factors are used repeatedly, triggering different outcomes depending on the cell type and developmental stage. Here, we report that DNA methylation modulates transcription-factor output in the context of cell differentiation. Using a drug-inducible Gata4 system and a mouse embryonic stem (ES) cell model of mesoderm differentiation, we examined the cellular response to Gata4 in ES and mesoderm cells. The activation of Gata4 in ES cells is known to drive their differentiation to endoderm. We show that the differentiation of wild-type ES cells into mesoderm blocks their Gata4-induced endoderm differentiation, while mesoderm cells derived from ES cells that are deficient in the DNA methyltransferases Dnmt3a and Dnmt3b can retain their response to Gata4, allowing lineage conversion from mesoderm cells to endoderm. Transcriptome analysis of the cells' response to Gata4 over time revealed groups of endoderm and mesoderm developmental genes whose expression was induced by Gata4 only when DNA methylation was lost, suggesting that DNA methylation restricts the ability of these genes to respond to Gata4, rather than controlling their transcription per se. Gata4-binding-site profiles and DNA methylation analyses suggested that DNA methylation modulates the Gata4 response through diverse mechanisms. Our data indicate that epigenetic regulation by DNA methylation functions as a heritable safeguard to prevent transcription factors from activating inappropriate downstream genes, thereby contributing to the restriction of the differentiation potential of somatic cells.

Methyl-donor deficiency in adolescence affects memory and epigenetic status in the mouse hippocampus.

PubMed

Tomizawa, H; Matsuzawa, D; Ishii, D; Matsuda, S; Kawai, K; Mashimo, Y; Sutoh, C; Shimizu, E

2015-03-01

DNA methylation is one of the essential factors in the control of gene expression. Alteration of the DNA methylation pattern has been linked to various neurological, behavioral and neurocognitive dysfunctions. Recent studies have pointed out the importance of epigenetics in brain development and functions including learning and memory. Nutrients related to one-carbon metabolism are known to play important roles in the maintenance of genomic DNA methylation. Previous studies have shown that the long-term administration of a diet lacking essential one-carbon nutrients such as methionine, choline and folic acid (methyl donors) caused global DNA hypermethylation in the brain. Therefore, the long-term feeding of a methyl-donor-deficient diet may cause abnormal brain development including learning and memory. To confirm this hypothesis, 3-week-old mice were maintained on a folate-, methionine- and choline-deficient (FMCD) or control (CON) diet for 3 weeks. We found that the methyl-donor deficiency impaired both novel object recognition and fear extinction after 3 weeks of treatment. The FMCD group showed spontaneous recovery of fear that differed from that in CON. In addition, we found decreased Gria1 gene expression and specific CpG hypermethylation of the Gria1 promoter region in the FMCD hippocampus. Our data suggest that a chronic dietary lack of methyl donors in the developmental period affects learning, memory and gene expressions in the hippocampus. © 2015 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

Interactions of Escherichia coli σ70 within the transcription elongation complex

PubMed Central

Daube, Shirley S.; von Hippel, Peter H.

1999-01-01

A functional transcription elongation complex can be formed without passing through a promoter by adding a complementary RNA primer and core Escherichia coli RNA polymerase in trans to an RNA-primed synthetic bubble-duplex DNA framework. This framework consists of a double-stranded DNA sequence with an internal noncomplementary DNA “bubble” containing a hybridized RNA primer. On addition of core polymerase and the requisite NTPs, the RNA primer is extended in a process that manifests most of the properties of in vitro transcription elongation. This synthetic elongation complex can also be assembled by using holo rather than core RNA polymerase, and in this study we examine the interactions and fate of the σ70 specificity subunit of the holopolymerase in the assembly process. We show that the addition of holopolymerase to the bubble-duplex construct triggers the dissociation of the sigma factor from some complexes, whereas in others the RNA oligomer is released into solution instead. These results are consistent with an allosteric competition between σ70 and the nascent RNA strand within the elongation complex and suggest that both cannot be bound to the core polymerase simultaneously. However, the dissociation of σ70 from the complex can also be stimulated by binding of the holopolymerase to the DNA bubble duplex in the absence of a hybridized RNA primer, suggesting that the binding of the core polymerase to the bubble-duplex construct also triggers a conformational change that additionally weakens the sigma–core interaction. PMID:10411885

Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors.

PubMed

Bisarro Dos Reis, Mariana; Barros-Filho, Mateus Camargo; Marchi, Fábio Albuquerque; Beltrami, Caroline Moraes; Kuasne, Hellen; Pinto, Clóvis Antônio Lopes; Ambatipudi, Srikant; Herceg, Zdenko; Kowalski, Luiz Paulo; Rogatto, Silvia Regina

2017-11-01

Even though the majority of well-differentiated thyroid carcinoma (WDTC) is indolent, a number of cases display an aggressive behavior. Cumulative evidence suggests that the deregulation of DNA methylation has the potential to point out molecular markers associated with worse prognosis. To identify a prognostic epigenetic signature in thyroid cancer. Genome-wide DNA methylation assays (450k platform, Illumina) were performed in a cohort of 50 nonneoplastic thyroid tissues (NTs), 17 benign thyroid lesions (BTLs), and 74 thyroid carcinomas (60 papillary, 8 follicular, 2 Hürthle cell, 1 poorly differentiated, and 3 anaplastic). A prognostic classifier for WDTC was developed via diagonal linear discriminant analysis. The results were compared with The Cancer Genome Atlas (TCGA) database. A specific epigenetic profile was detected according to each histological subtype. BTLs and follicular carcinomas showed a greater number of methylated CpG in comparison with NTs, whereas hypomethylation was predominant in papillary and undifferentiated carcinomas. A prognostic classifier based on 21 DNA methylation probes was able to predict poor outcome in patients with WDTC (sensitivity 63%, specificity 92% for internal data; sensitivity 64%, specificity 88% for TCGA data). High-risk score based on the classifier was considered an independent factor of poor outcome (Cox regression, P < 0.001). The methylation profile of thyroid lesions exhibited a specific signature according to the histological subtype. A meaningful algorithm composed of 21 probes was capable of predicting the recurrence in WDTC. Copyright © 2017 Endocrine Society

Development of a quantitative-competitive PCR for quantification of human cytomegalovirus load and comparison with antigenaemia, viraemia and pp67 RNA detection by nucleic acid sequence-based amplification.

PubMed

Bergallo, M; Costa, C; Tarallo, S; Daniele, R; Merlino, C; Segoloni, G P; Negro Ponzi, A; Cavallo, R

2006-06-01

The human cytomegalovirus (HCMV) is an important pathogen in immunocompromised patients, such as transplant recipients. The use of sensitive and rapid diagnostic assays can have a great impact on antiviral prophylaxis and therapy monitoring and diagnosing active disease. Quantification of HCMV DNA may additionally have prognostic value and guide routine management. The aim of this study was to develop a reliable internally-controlled quantitative-competitive PCR (QC-PCR) for the detection and quantification of HCMV DNA viral load in peripheral blood and compare it with other methods: the HCMV pp65 antigenaemia assay in leukocyte fraction, the HCMV viraemia, both routinely employed in our laboratory, and the nucleic acid sequence-based amplification (NASBA) for detection of HCMV pp67-mRNA. Quantitative-competitive PCR is a procedure for nucleic acid quantification based on co-amplification of competitive templates, the target DNA and a competitor functioning as internal standard. In particular, a standard curve is generated by amplifying 10(2) to 10(5) copies of target pCMV-435 plasmid with 10(4) copies of competitor pCMV-C plasmid. Clinical samples derived from 40 kidney transplant patients were tested by spiking 10(4) copies of pCMV-C into the PCR mix as internal control, and comparing results with the standard curve. Of the 40 patients studied, 39 (97.5%) were positive for HCMV DNA by QC-PCR. While the correlation between the number of pp65-positive cells and the number of HCMV DNA genome copies/mL and the former and the pp67mRNA-positivity were statistically significant, there was no significant correlation between HCMV DNA viral load assayed by QC-PCR and HCMV viraemia. The QC-PCR assay could detect from 10(2) to over 10(7) copies of HCMV DNA with a range of linearity between 10(2) and 10(5) genomes.

Downregulation of Homologous Recombination DNA Repair Genes by HDAC Inhibition in Prostate Cancer Is Mediated through the E2F1 Transcription Factor

PubMed Central

Kachhap, Sushant K.; Rosmus, Nadine; Collis, Spencer J.; Kortenhorst, Madeleine S. Q.; Wissing, Michel D.; Hedayati, Mohammad; Shabbeer, Shabana; Mendonca, Janet; Deangelis, Justin; Marchionni, Luigi; Lin, Jianqing; Höti, Naseruddin; Nortier, Johan W. R.; DeWeese, Theodore L.; Hammers, Hans; Carducci, Michael A.

2010-01-01

Background Histone deacetylase inhibitors (HDACis) re-express silenced tumor suppressor genes and are currently undergoing clinical trials. Although HDACis have been known to induce gene expression, an equal number of genes are downregulated upon HDAC inhibition. The mechanism behind this downregulation remains unclear. Here we provide evidence that several DNA repair genes are downregulated by HDAC inhibition and provide a mechanism involving the E2F1 transcription factor in the process. Methodology/Principal Findings Applying Analysis of Functional Annotation (AFA) on microarray data of prostate cancer cells treated with HDACis, we found a number of genes of the DNA damage response and repair pathways are downregulated by HDACis. AFA revealed enrichment of homologous recombination (HR) DNA repair genes of the BRCA1 pathway, as well as genes regulated by the E2F1 transcription factor. Prostate cancer cells demonstrated a decreased DNA repair capacity and an increased sensitization to chemical- and radio-DNA damaging agents upon HDAC inhibition. Recruitment of key HR repair proteins to the site of DNA damage, as well as HR repair capacity was compromised upon HDACi treatment. Based on our AFA data, we hypothesized that the E2F transcription factors may play a role in the downregulation of key repair genes upon HDAC inhibition in prostate cancer cells. ChIP analysis and luciferase assays reveal that the downregulation of key repair genes is mediated through decreased recruitment of the E2F1 transcription factor and not through active repression by repressive E2Fs. Conclusions/Significance Our study indicates that several genes in the DNA repair pathway are affected upon HDAC inhibition. Downregulation of the repair genes is on account of a decrease in amount and promoter recruitment of the E2F1 transcription factor. Since HDAC inhibition affects several pathways that could potentially have an impact on DNA repair, compromised DNA repair upon HDAC inhibition could also be attributed to several other pathways besides the ones investigated in this study. However, our study does provide insights into the mechanism that governs downregulation of HR DNA repair genes upon HDAC inhibition, which can lead to rationale usage of HDACis in the clinics. PMID:20585447

SV40 Utilizes ATM Kinase Activity to Prevent Non-homologous End Joining of Broken Viral DNA Replication Products

PubMed Central

Sowd, Gregory A.; Mody, Dviti; Eggold, Joshua; Cortez, David; Friedman, Katherine L.; Fanning, Ellen

2014-01-01

Simian virus 40 (SV40) and cellular DNA replication rely on host ATM and ATR DNA damage signaling kinases to facilitate DNA repair and elicit cell cycle arrest following DNA damage. During SV40 DNA replication, ATM kinase activity prevents concatemerization of the viral genome whereas ATR activity prevents accumulation of aberrant genomes resulting from breakage of a moving replication fork as it converges with a stalled fork. However, the repair pathways that ATM and ATR orchestrate to prevent these aberrant SV40 DNA replication products are unclear. Using two-dimensional gel electrophoresis and Southern blotting, we show that ATR kinase activity, but not DNA-PKcs kinase activity, facilitates some aspects of double strand break (DSB) repair when ATM is inhibited during SV40 infection. To clarify which repair factors associate with viral DNA replication centers, we examined the localization of DSB repair proteins in response to SV40 infection. Under normal conditions, viral replication centers exclusively associate with homology-directed repair (HDR) and do not colocalize with non-homologous end joining (NHEJ) factors. Following ATM inhibition, but not ATR inhibition, activated DNA-PKcs and KU70/80 accumulate at the viral replication centers while CtIP and BLM, proteins that initiate 5′ to 3′ end resection during HDR, become undetectable. Similar to what has been observed during cellular DSB repair in S phase, these data suggest that ATM kinase influences DSB repair pathway choice by preventing the recruitment of NHEJ factors to replicating viral DNA. These data may explain how ATM prevents concatemerization of the viral genome and promotes viral propagation. We suggest that inhibitors of DNA damage signaling and DNA repair could be used during infection to disrupt productive viral DNA replication. PMID:25474690

Raman spectroscopy for DNA quantification in cell nucleus.

PubMed

Okotrub, K A; Surovtsev, N V; Semeshin, V F; Omelyanchuk, L V

2015-01-01

Here we demonstrate the feasibility of a novel approach to quantify DNA in cell nuclei. This approach is based on spectroscopy analysis of Raman light scattering, and avoids the problem of nonstoichiometric binding of dyes to DNA, as it directly measures the signal from DNA. Quantitative analysis of nuclear DNA contribution to Raman spectrum could be reliably performed using intensity of a phosphate mode at 1096 cm(-1) . When compared to the known DNA standards from cells of different animals, our results matched those values at error of 10%. We therefore suggest that this approach will be useful to expand the list of DNA standards, to properly adjust the duration of hydrolysis in Feulgen staining, to assay the applicability of fuchsines for DNA quantification, as well as to measure DNA content in cells with complex hydrolysis patterns, when Feulgen densitometry is inappropriate. © 2014 International Society for Advancement of Cytometry.

Scaffolded DNA origami of a DNA tetrahedron molecular container.

PubMed

Ke, Yonggang; Sharma, Jaswinder; Liu, Minghui; Jahn, Kasper; Liu, Yan; Yan, Hao

2009-06-01

We describe a strategy of scaffolded DNA origami to design and construct 3D molecular cages of tetrahedron geometry with inside volume closed by triangular faces. Each edge of the triangular face is approximately 54 nm in dimension. The estimated total external volume and the internal cavity of the triangular pyramid are about 1.8 x 10(-23) and 1.5 x 10(-23) m(3), respectively. Correct formation of the tetrahedron DNA cage was verified by gel electrophoresis, atomic force microscopy, transmission electron microscopy, and dynamic light scattering techniques.

Genetic characterization, at the mitochondrial and nuclear DNA levels, of five Canary Island dog breeds.

PubMed

Suárez, N M; Betancor, E; Fregel, R; Pestano, J

2013-08-01

Many studies presenting genetic analysis of dog breeds have been conducted without the inclusion of island dog breeds, although isolation can be one of the main factors in their origin. Here we report the genetic analysis at the nuclear and mitochondrial DNA levels of five Canary Island dog breeds (Canarian Warren Hound, Canary Island Mastiff, Garafiano Shepherd, La Palma Rat-Hunter and El Hierro Wolfhound) to fill this gap and, at the same time, genetically characterize these breeds. We identified 168 alleles in autosomal microsatellites and 16 mitochondrial haplotypes. Observed and expected heterozygosities ranged from 0.556 to 0.783 and from 0.737 to 0.943 respectively. Furthermore, three haplotypes were newly described and exclusive to a particular breed (A17+ in the Canary Island Mastiff; A33+ in the Canarian Warren Hound; Bi in the La Palma Rat-Hunter). The outcome of our analyses also revealed different breed histories consistent with historical documents and hypothetical origin designations. Although mtDNA haplotypes showed poor breed discriminating power, autosomal markers allowed a clear clustering of each single population. We expect that our results, together with further analyses, will help to make the population histories of island dog breeds clearer. © 2013 The Authors, Animal Genetics © 2013 Stichting International Foundation for Animal Genetics.

Controlling gene networks and cell fate with precision-targeted DNA-binding proteins and small-molecule-based genome readers

PubMed Central

Eguchi, Asuka; Lee, Garrett O.; Wan, Fang; Erwin, Graham S.; Ansari, Aseem Z.

2014-01-01

Transcription factors control the fate of a cell by regulating the expression of genes and regulatory networks. Recent successes in inducing pluripotency in terminally differentiated cells as well as directing differentiation with natural transcription factors has lent credence to the efforts that aim to direct cell fate with rationally designed transcription factors. Because DNA-binding factors are modular in design, they can be engineered to target specific genomic sequences and perform pre-programmed regulatory functions upon binding. Such precision-tailored factors can serve as molecular tools to reprogramme or differentiate cells in a targeted manner. Using different types of engineered DNA binders, both regulatory transcriptional controls of gene networks, as well as permanent alteration of genomic content, can be implemented to study cell fate decisions. In the present review, we describe the current state of the art in artificial transcription factor design and the exciting prospect of employing artificial DNA-binding factors to manipulate the transcriptional networks as well as epigenetic landscapes that govern cell fate. PMID:25145439

DNA methylation dynamics during in vivo differentiation of blood and skin stem cells

PubMed Central

Bock, Christoph; Beerman, Isabel; Lien, Wen-Hui; Smith, Zachary D.; Gu, Hongcang; Boyle, Patrick; Gnirke, Andreas; Fuchs, Elaine; Rossi, Derrick J.; Meissner, Alexander

2012-01-01

DNA methylation is a mechanism of epigenetic regulation that is common to all vertebrates. Functional studies underscore its relevance for tissue homeostasis, but the global dynamics of DNA methylation during in vivo differentiation remain underexplored. Here we report high-resolution DNA methylation maps of adult stem cell differentiation in mouse, focusing on 19 purified cell populations of the blood and skin lineages. DNA methylation changes were locus-specific and relatively modest in magnitude. They frequently overlapped with lineage-associated transcription factors and their binding sites, suggesting that DNA methylation may protect cells from aberrant transcription factor activation. DNA methylation and gene expression provided complementary information, and combining the two enabled us to infer the cellular differentiation hierarchy of the blood lineage directly from genomic data. In summary, these results demonstrate that in vivo differentiation of adult stem cells is associated with small but informative changes in the genomic distribution of DNA methylation. PMID:22841485

Efficient Production of Retroviruses Using PLGA/bPEI-DNA Nanoparticles and Application for Reprogramming Somatic Cells

PubMed Central

Do, Eun Kyoung; Cheon, Hyo Cheon; Heo, Soon Chul; Kwon, Yang Woo; Jeong, Geun Ok; Kim, Ba Reun; Kim, Jae Ho

2013-01-01

Reprogramming of somatic cells to pluripotent cells requires the introduction of factors driving fate switches. Viral delivery has been the most efficient method for generation of induced pluripotent stem cells. Transfection, which precedes virus production, is a commonly-used process for delivery of nucleic acids into cells. The aim of this study is to evaluate the efficiency of PLGA/ bPEI nanoparticles in transfection and virus production. Using a modified method of producing PLGA nanoparticles, PLGA/bPEI-DNA nanoparticles were examined for transfection efficiency and virus production yield in comparison with PLGA-DNA, bPEI-DNA nanoparticles or liposome-DNA complexes. After testing various ratios of PLGA, bPEI, and DNA, the ratio of 6:3:1 (PLGA:bPEI:DNA, w/w/w) was determined to be optimal, with acceptable cellular toxicity. PLGA/bPEI-DNA (6:3:1) nanoparticles showed superior transfection efficiency, especially in multiple gene transfection, and viral yield when compared with liposome-DNA complexes. The culture supernatants of HEK293FT cells transfected with PLGA/bPEI-DNA of viral constructs containing reprogramming factors (Oct4, Sox2, Klf4, or c-Myc) successfully and more efficiently generated induced pluripotent stem cell colonies from mouse embryonic fibroblasts. These results strongly suggest that PLGA/bPEI-DNA nanoparticles can provide significant advantages in studying the effect of multiple factor delivery such as in reprogramming or direct conversion of cell fate. PMID:24098810

H3K4me1 marks DNA regions hypomethylated during aging in human stem and differentiated cells.

PubMed

Fernández, Agustín F; Bayón, Gustavo F; Urdinguio, Rocío G; Toraño, Estela G; García, María G; Carella, Antonella; Petrus-Reurer, Sandra; Ferrero, Cecilia; Martinez-Camblor, Pablo; Cubillo, Isabel; García-Castro, Javier; Delgado-Calle, Jesús; Pérez-Campo, Flor M; Riancho, José A; Bueno, Clara; Menéndez, Pablo; Mentink, Anouk; Mareschi, Katia; Claire, Fabian; Fagnani, Corrado; Medda, Emanuela; Toccaceli, Virgilia; Brescianini, Sonia; Moran, Sebastián; Esteller, Manel; Stolzing, Alexandra; de Boer, Jan; Nisticò, Lorenza; Stazi, Maria A; Fraga, Mario F

2015-01-01

In differentiated cells, aging is associated with hypermethylation of DNA regions enriched in repressive histone post-translational modifications. However, the chromatin marks associated with changes in DNA methylation in adult stem cells during lifetime are still largely unknown. Here, DNA methylation profiling of mesenchymal stem cells (MSCs) obtained from individuals aged 2 to 92 yr identified 18,735 hypermethylated and 45,407 hypomethylated CpG sites associated with aging. As in differentiated cells, hypermethylated sequences were enriched in chromatin repressive marks. Most importantly, hypomethylated CpG sites were strongly enriched in the active chromatin mark H3K4me1 in stem and differentiated cells, suggesting this is a cell type-independent chromatin signature of DNA hypomethylation during aging. Analysis of scedasticity showed that interindividual variability of DNA methylation increased during aging in MSCs and differentiated cells, providing a new avenue for the identification of DNA methylation changes over time. DNA methylation profiling of genetically identical individuals showed that both the tendency of DNA methylation changes and scedasticity depended on nongenetic as well as genetic factors. Our results indicate that the dynamics of DNA methylation during aging depend on a complex mixture of factors that include the DNA sequence, cell type, and chromatin context involved and that, depending on the locus, the changes can be modulated by genetic and/or external factors. © 2015 Fernández et al.; Published by Cold Spring Harbor Laboratory Press.

The structure and intermolecular forces of DNA condensates.

PubMed

Yoo, Jejoong; Aksimentiev, Aleksei

2016-03-18

Spontaneous assembly of DNA molecules into compact structures is ubiquitous in biological systems. Experiment has shown that polycations can turn electrostatic self-repulsion of DNA into attraction, yet the physical mechanism of DNA condensation has remained elusive. Here, we report the results of atomistic molecular dynamics simulations that elucidated the microscopic structure of dense DNA assemblies and the physics of interactions that makes such assemblies possible. Reproducing the setup of the DNA condensation experiments, we measured the internal pressure of DNA arrays as a function of the DNA-DNA distance, showing a quantitative agreement between the results of our simulations and the experimental data. Analysis of the MD trajectories determined the DNA-DNA force in a DNA condensate to be pairwise, the DNA condensation to be driven by electrostatics of polycations and not hydration, and the concentration of bridging cations, not adsorbed cations, to determine the magnitude and the sign of the DNA-DNA force. Finally, our simulations quantitatively characterized the orientational correlations of DNA in DNA arrays as well as diffusive motion of DNA and cations. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Human papillomavirus hpv-16 DNA as an epitheliotropic virus that induces hyperproliferation in squamous penile tissue.

PubMed

Salazar, Edith L; Mercado, E; Calzada, L

2005-01-01

The prevalence of human papillomavirus HPV-16DNA sequences in 57 penile carcinoma biopsies was examined using the polymerase chain reaction (PCR) with type specific internal probes, employing HPV consensus primers from the L1 region. The cases comprised 39 typical squamous cell carcinoma and 18 specimens with different subtype. PCR products were analyzed and HPV-16DNA was detected in a high percentage of specimens. Thirty-eight biopsies were HPV-16DNA positive. This determination was correlated with cellular differentiation and growth pattern. Our data corroborates that squamous cell carcinoma was invariably associated with HPV-16DNA.

DNA testing in neurologic diseases.

PubMed

O'Brien, D P; Leeb, T

2014-01-01

DNA testing is available for a growing number of hereditary diseases in neurology and other specialties. In addition to guiding breeding decisions, DNA tests are important tools in the diagnosis of diseases, particularly in conditions for which clinical signs are relatively nonspecific. DNA testing also can provide valuable insight into the risk of hereditary disease when decisions about treating comorbidities are being made. Advances in technology and bioinformatics will make broad screening for potential disease-causing mutations available soon. As DNA tests come into more common use, it is critical that clinicians understand the proper application and interpretation of these test results. Copyright © 2014 by the American College of Veterinary Internal Medicine.

Treacher Collins syndrome TCOF1 protein cooperates with NBS1 in the DNA damage response.

PubMed

Ciccia, Alberto; Huang, Jen-Wei; Izhar, Lior; Sowa, Mathew E; Harper, J Wade; Elledge, Stephen J

2014-12-30

The signal transduction pathway of the DNA damage response (DDR) is activated to maintain genomic integrity following DNA damage. The DDR promotes genomic integrity by regulating a large network of cellular activities that range from DNA replication and repair to transcription, RNA splicing, and metabolism. In this study we define an interaction between the DDR factor NBS1 and TCOF1, a nucleolar protein that regulates ribosomal DNA (rDNA) transcription and is mutated in Treacher Collins syndrome. We show that NBS1 relocalizes to nucleoli after DNA damage in a manner dependent on TCOF1 and on casein kinase II and ATM, which are known to modify TCOF1 by phosphorylation. Moreover, we identify a putative ATM phosphorylation site that is required for NBS1 relocalization to nucleoli in response to DNA damage. Last, we report that TCOF1 promotes cellular resistance to DNA damaging agents. Collectively, our findings identify TCOF1 as a DDR factor that could cooperate with ATM and NBS1 to suppress inappropriate rDNA transcription and maintain genomic integrity after DNA damage.

Treacher Collins syndrome TCOF1 protein cooperates with NBS1 in the DNA damage response

PubMed Central

Ciccia, Alberto; Huang, Jen-Wei; Izhar, Lior; Sowa, Mathew E.; Harper, J. Wade; Elledge, Stephen J.

2014-01-01

The signal transduction pathway of the DNA damage response (DDR) is activated to maintain genomic integrity following DNA damage. The DDR promotes genomic integrity by regulating a large network of cellular activities that range from DNA replication and repair to transcription, RNA splicing, and metabolism. In this study we define an interaction between the DDR factor NBS1 and TCOF1, a nucleolar protein that regulates ribosomal DNA (rDNA) transcription and is mutated in Treacher Collins syndrome. We show that NBS1 relocalizes to nucleoli after DNA damage in a manner dependent on TCOF1 and on casein kinase II and ATM, which are known to modify TCOF1 by phosphorylation. Moreover, we identify a putative ATM phosphorylation site that is required for NBS1 relocalization to nucleoli in response to DNA damage. Last, we report that TCOF1 promotes cellular resistance to DNA damaging agents. Collectively, our findings identify TCOF1 as a DDR factor that could cooperate with ATM and NBS1 to suppress inappropriate rDNA transcription and maintain genomic integrity after DNA damage. PMID:25512513

Charge Structure and Counterion Distribution in Hexagonal DNA Liquid Crystal

PubMed Central

Dai, Liang; Mu, Yuguang; Nordenskiöld, Lars; Lapp, Alain; van der Maarel, Johan R. C.

2007-01-01

A hexagonal liquid crystal of DNA fragments (double-stranded, 150 basepairs) with tetramethylammonium (TMA) counterions was investigated with small angle neutron scattering (SANS). We obtained the structure factors pertaining to the DNA and counterion density correlations with contrast matching in the water. Molecular dynamics (MD) computer simulation of a hexagonal assembly of nine DNA molecules showed that the inter-DNA distance fluctuates with a correlation time around 2 ns and a standard deviation of 8.5% of the interaxial spacing. The MD simulation also showed a minimal effect of the fluctuations in inter-DNA distance on the radial counterion density profile and significant penetration of the grooves by TMA. The radial density profile of the counterions was also obtained from a Monte Carlo (MC) computer simulation of a hexagonal array of charged rods with fixed interaxial spacing. Strong ordering of the counterions between the DNA molecules and the absence of charge fluctuations at longer wavelengths was shown by the SANS number and charge structure factors. The DNA-counterion and counterion structure factors are interpreted with the correlation functions derived from the Poisson-Boltzmann equation, MD, and MC simulation. Best agreement is observed between the experimental structure factors and the prediction based on the Poisson-Boltzmann equation and/or MC simulation. The SANS results show that TMA is too large to penetrate the grooves to a significant extent, in contrast to what is shown by MD simulation. PMID:17098791

Non-parenchymal liver cells support the growth advantage in the first stages of hepatocarcinogenesis.

PubMed

Drucker, Claudia; Parzefall, Wolfram; Teufelhofer, Olga; Grusch, Michael; Ellinger, Adolf; Schulte-Hermann, Rolf; Grasl-Kraupp, Bettina

2006-01-01

Hepatocellular carcinoma almost always arises in chronically inflamed livers. We developed a culture model to study the role of non-parenchymal cells (NPCs) for inflammation-driven hepatocarcinogenesis. Rats were treated with the carcinogen N-nitrosomorpholine, which induced initiated hepatocytes expressing the marker placental glutathione-S-transferase (GSTp). After 21 days two preparations of hepatocytes were made: (i) conventional ones (Hep-conv) containing NPCs and (ii) hepatocytes purified of NPCs (Hep-pur). Initiated hepatocytes, being positive for GSTp (GSTp-pos) were present in both preparations and were cultured along with normal hepatocytes, being negative for GSTp (GSTp-neg). Under any culture condition DNA synthesis was approximately 4-fold higher in GSTp-pos than in GSTp-neg hepatocytes demonstrating the inherent growth advantage of the first stages of hepatocarcinogenesis. Hepatocytes showed approximately 3-fold lower rates of DNA synthesis in Hep-pur than in Hep-conv, which was elevated above Hep-conv levels by addition of NPC or NPC-supernatant. Pretreatment of NPCs with proinflammatory lipopolysaccharide (LPS) further increased DNA synthesis. Thus, NPCs release soluble growth stimulators. Next we investigated the effect of specific cytokines produced by NPCs. Tumour necrosis factor alpha and interleukin 6 barely altered DNA synthesis, whereas hepatocyte growth factor (HGF), keratinocyte growth factor (KGF) and the heparin-binding epidermal growth factor-like growth factor (HB-EGF) were potent inducers of DNA replication in both, GSTp-neg and GSTp-pos cells. In conclusion, DNA synthesis of hepatocytes is increased by factors released from NPCs, an effect augmented by LPS-stimulation. NPC-derived cytokines, such as KGF, HGF and HB-EGF, stimulate DNA synthesis preferentially in initiated hepatocytes, presumably resulting in tumour promotion. Similar mechanisms may contribute to carcinogenesis in human inflammatory liver diseases.

A mechanistic dissection of polyethylenimine mediated transfection of CHO cells: to enhance the efficiency of recombinant DNA utilization.

PubMed

Mozley, Olivia L; Thompson, Ben C; Fernandez-Martell, Alejandro; James, David C

2014-01-01

In this study, we examine the molecular and cellular interactions that underpin efficient internalization and utilization of polyethylenimine (PEI):DNA complexes (polyplexes) by Chinese Hamster Ovary (CHO) cells. Cell surface polyplex binding and internalization was a biphasic process, consisting of an initial rapid Phase (I), lasting approximately 15 min, followed by a slower second Phase (II), saturating at approximately 240 min post transfection. The second Phase accounted for the majority (60-70%) of polyplex internalization. While cell surface heparan sulphate proteoglycans (HSPGs) were rapidly cointernalized with polyplexes during Phase I, cell surface polyplex binding was not dependent on HSPGs. However, Phase II polyplex internalization and HSPG regeneration onto the surface of trypsinized cells occurred at similar rates, suggesting that the rate of recycling of HSPG-containing membrane to the plasma membrane limits Phase II internalization rate. Under optimal transfection conditions, polyplexes had a near neutral surface charge (zeta potential) and cell surface binding was dependent on hydrophobic interactions, being significantly inhibited by both chemical sequestration of cholesterol from the plasma membrane and addition of nonionic surfactant. Induced alterations in polyplex zeta potential, using ferric (III) citrate to decrease surface charge and varying PEI:DNA ratio to increase surface charge, served to inhibit polyplex binding or reduce secreted alkaline phosphatase reporter expression and cell viability, respectively. To increase polyplex hydrophobicity and internalization an alkylated derivative of PEI, propyl-PEI, was chemically synthesized. Using Design of Experiments-Response Surface Modeling to optimize the transfection process, the function of propyl-PEI was compared to that of unmodified PEI in both parental CHO-S cells and a subclone (Clone 4), which exhibited superior transgene expression via an increased resistance to polyplex cytotoxicity. The combination of propyl-PEI and Clone 4 doubled the efficiency of recombinant DNA utilization and reporter protein production. These data show that for maximal efficacy, strategies to increase polyplex internalization into cells must be used in concert with strategies to offset the inherent cytotoxicity of this process. © 2014 American Institute of Chemical Engineers.

The Arabidopsis thaliana TCP transcription factors: A broadening horizon beyond development

PubMed Central

Li, Shutian

2015-01-01

The TCP family of transcription factors is named after the first 4 characterized members, namely TEOSINTE BRANCHED1 (TB1) from maize (Zea mays), CYCLOIDEA (CYC) from snapdragon (Antirrhinum majus), as well as PROLIFERATING CELL NUCLEAR ANTIGEN FACTOR1 (PCF1) and PCF2 from rice (Oryza sativa). Phylogenic analysis of this plant-specific protein family unveils a conserved bHLH-containing DNA-binding motif known as the TCP domain. In accordance with the structure of this shared domain, TCP proteins are grouped into class I (TCP-P) and class II (TCP-C), which are suggested to antagonistically modulate plant growth and development via competitively binding similar cis-regulatory modules called site II elements. Over the last decades, TCPs across the plant kingdom have been demonstrated to control a plethora of plant processes. Notably, TCPs also regulate plant development and defense responses via stimulating the biosynthetic pathways of bioactive metabolites, such as brassinosteroid (BR), jasmonic acid (JA) and flavonoids. Besides, mutagenesis analysis coupled with biochemical experiments identifies several crucial amino acids located within the TCP domain, which confer the redox sensitivity of class I TCPs and determine the distinct DNA-binding properties of TCPs. In this review, developmental functions of TCPs in various biological pathways are briefly described with an emphasis on their involvement in the synthesis of bioactive substances. Furthermore, novel biochemical aspects of TCPs with respect to redox regulation and DNA-binding preferences are elaborated. In addition, the unexpected participation of TCPs in effector-triggered immunity (ETI) and defense against insects indicates that the widely recognized developmental regulators are capable of fine-tuning defense signaling and thereby enable plants to evade deleterious developmental phenotypes. Altogether, these recent impressive breakthroughs remarkably advance our understanding as to how TCPs integrate internal developmental cues with external environmental stimuli to orchestrate plant development. PMID:26039357

The Arabidopsis thaliana TCP transcription factors: A broadening horizon beyond development.

PubMed

Li, Shutian

2015-01-01

The TCP family of transcription factors is named after the first 4 characterized members, namely TEOSINTE BRANCHED1 (TB1) from maize (Zea mays), CYCLOIDEA (CYC) from snapdragon (Antirrhinum majus), as well as PROLIFERATING CELL NUCLEAR ANTIGEN FACTOR1 (PCF1) and PCF2 from rice (Oryza sativa). Phylogenic analysis of this plant-specific protein family unveils a conserved bHLH-containing DNA-binding motif known as the TCP domain. In accordance with the structure of this shared domain, TCP proteins are grouped into class I (TCP-P) and class II (TCP-C), which are suggested to antagonistically modulate plant growth and development via competitively binding similar cis-regulatory modules called site II elements. Over the last decades, TCPs across the plant kingdom have been demonstrated to control a plethora of plant processes. Notably, TCPs also regulate plant development and defense responses via stimulating the biosynthetic pathways of bioactive metabolites, such as brassinosteroid (BR), jasmonic acid (JA) and flavonoids. Besides, mutagenesis analysis coupled with biochemical experiments identifies several crucial amino acids located within the TCP domain, which confer the redox sensitivity of class I TCPs and determine the distinct DNA-binding properties of TCPs. In this review, developmental functions of TCPs in various biological pathways are briefly described with an emphasis on their involvement in the synthesis of bioactive substances. Furthermore, novel biochemical aspects of TCPs with respect to redox regulation and DNA-binding preferences are elaborated. In addition, the unexpected participation of TCPs in effector-triggered immunity (ETI) and defense against insects indicates that the widely recognized developmental regulators are capable of fine-tuning defense signaling and thereby enable plants to evade deleterious developmental phenotypes. Altogether, these recent impressive breakthroughs remarkably advance our understanding as to how TCPs integrate internal developmental cues with external environmental stimuli to orchestrate plant development.

SRY, like HMG1, recognizes sharp angles in DNA.

PubMed Central

Ferrari, S; Harley, V R; Pontiggia, A; Goodfellow, P N; Lovell-Badge, R; Bianchi, M E

1992-01-01

HMG boxes are DNA binding domains present in chromatin proteins, general transcription factors for nucleolar and mitochondrial RNA polymerases, and gene- and tissue-specific transcriptional regulators. The HMG boxes of HMG1, an abundant component of chromatin, interact specifically with four-way junctions, DNA structures that are cross-shaped and contain angles of approximately 60 and 120 degrees between their arms. We show here also that the HMG box of SRY, the protein that determines the expression of male-specific genes in humans, recognizes four-way junction DNAs irrespective of their sequence. In addition, when SRY binds to linear duplex DNA containing its specific target AACAAAG, it produces a sharp bend. Therefore, the interaction between HMG boxes and DNA appears to be predominantly structure-specific. The production of the recognition of a kink in DNA can serve several distinct functions, such as the repair of DNA lesions, the folding of DNA segments with bound transcriptional factors into productive complexes or the wrapping of DNA in chromatin. Images PMID:1425584

Structural Basis for Sequence-specific DNA Recognition by an Arabidopsis WRKY Transcription Factor*

PubMed Central

Yamasaki, Kazuhiko; Kigawa, Takanori; Watanabe, Satoru; Inoue, Makoto; Yamasaki, Tomoko; Seki, Motoaki; Shinozaki, Kazuo; Yokoyama, Shigeyuki

2012-01-01

The WRKY family transcription factors regulate plant-specific reactions that are mostly related to biotic and abiotic stresses. They share the WRKY domain, which recognizes a DNA element (TTGAC(C/T)) termed the W-box, in target genes. Here, we determined the solution structure of the C-terminal WRKY domain of Arabidopsis WRKY4 in complex with the W-box DNA by NMR. A four-stranded β-sheet enters the major groove of DNA in an atypical mode termed the β-wedge, where the sheet is nearly perpendicular to the DNA helical axis. Residues in the conserved WRKYGQK motif contact DNA bases mainly through extensive apolar contacts with thymine methyl groups. The importance of these contacts was verified by substituting the relevant T bases with U and by surface plasmon resonance analyses of DNA binding. PMID:22219184

Morphological and molecular characterization of a new genus and new species of parazoanthid (Anthozoa: Hexacorallia: Zoantharia) associated with Japanese Red Coral

NASA Astrophysics Data System (ADS)

Reimer, J. D.; Nonaka, M.; Sinniger, F.; Iwase, F.

2008-12-01

The Order Zoantharia has long been taxonomically neglected primarily due to difficulty in examining the internal morphology of sand-encrusted zoanthids. However, recent work using molecular markers has shown an unexpectedly high diversity of previously “hidden” taxa (families and genera) within Zoantharia (=Zoanthidea, Zoanthiniaria). In this study, unidentified sediment-encrusting zoanthid specimens ( n = 8) were collected from living Japanese Red Coral Paracorallium japonicum (Family Coralliidae) during precious coral harvesting by Remotely Operated Vehicle (ROV) and manned submersible (February 2004-January 2006) at depths of 194-250 m at six locations between Ishigaki-jima Island and Kikai-jima Island, southern Japan. DNA sequences (mitochondrial 16S ribosomal DNA [mt 16S rDNA], cytochrome oxidase subunit I [COI], nuclear internal transcribed spacer of ribosomal DNA [ITS-rDNA]) unambiguously place these specimens in a previously undescribed, new monophyletic lineage within the family Parazoanthidae. Corallizoanthus tsukaharai, gen. n. et sp. n. is the first reported zoanthid species associated with the family Coralliidae and unlike other described gorgonian-associated zoanthids ( Savalia spp .) does not secrete its own hard axis. Morphologically, C. tsukaharai sp. n. is characterized by generally unitary polyps and bright yellow external coloration.

Calibration of BK Virus Nucleic Acid Amplification Testing to the 1st WHO International Standard for BK Virus

PubMed Central

Tan, Susanna K.; Milligan, Stephen; Sahoo, Malaya K.; Taylor, Nathaniel

2017-01-01

ABSTRACT Significant interassay variability in the quantification of BK virus (BKV) DNA precludes establishing broadly applicable thresholds for the management of BKV infection in transplantation. The 1st WHO International Standard for BKV (primary standard) was introduced in 2016 as a common calibrator for improving the harmonization of BKV nucleic acid amplification testing (NAAT) and enabling comparisons of biological measurements worldwide. Here, we evaluated the Altona RealStar BKV assay (Altona) and calibrated the results to the international unit (IU) using the Exact Diagnostics BKV verification panel, a secondary standard traceable to the primary standard. The primary and secondary standards on Altona had nearly identical linear regression equations (primary standard, Y = 1.05X − 0.28, R2 = 0.99; secondary standard, Y = 1.04X − 0.26, R2 = 0.99) and conversion factors (primary standard, 1.11 IU/copy; secondary standard, 1.09 IU/copy). A comparison of Altona with a laboratory-developed BKV NAAT assay in IU/ml versus copies/ml using Passing-Bablok regression revealed similar regression lines, no proportional bias, and improvement in the systematic bias (95% confidence interval of intercepts: copies/ml, −0.52 to −1.01; IU/ml, 0.07 to −0.36). Additionally, Bland-Altman analyses revealed a clinically significant reduction of bias when results were reported in IU/ml (IU/ml, −0.10 log10; copies/ml, −0.70 log10). These results indicate that the use of a common calibrator improved the agreement between the two assays. As clinical laboratories worldwide use calibrators traceable to the primary standard to harmonize BKV NAAT results, we anticipate improved interassay comparisons with a potential for establishing broadly applicable quantitative BKV DNA load cutoffs for clinical practice. PMID:28053213

Identification of natural and artificial DNA substrates for the light-activated LOV-HTH transcription factor EL222

PubMed Central

Rivera-Cancel, Giomar; Motta-Mena, Laura B.; Gardner, Kevin H.

2012-01-01

Light-oxygen-voltage (LOV) domains serve as the photosensory modules for a wide range of plant and bacterial proteins, conferring blue light dependent regulation to effector activities as diverse as enzymes and DNA binding. LOV domains can also be engineered into a variety of exogenous targets, enabling similar regulation for new protein-based reagents. Common to these proteins is the ability for LOV domains to reversibly form a photochemical adduct between an internal flavin chromophore and the surrounding protein, using this to trigger conformational changes that affect output activity. Using the Erythrobacter litoralis protein EL222 model system which links LOV regulation to a helix-turn-helix (HTH) DNA binding domain, we demonstrated that the LOV domain binds and inhibits the HTH domain in the dark, releasing these interactions upon illumination [Nash et al. (2011) Proc. Natl. Acad. Sci. USA 108, 9449–9454]. Here we combine genomic and in vitro selection approaches to identify optimal DNA binding sites for EL222. Within the bacterial host, we observe binding several genomic sites using a 12 bp sequence consensus that is also found by in vitro selection methods. Sequence-specific alterations in the DNA consensus reduce EL222-binding affinity in a manner consistent with the expected binding mode: a protein dimer binding to two repeats. Finally, we demonstrate the light-dependent activation of transcription of two genes adjacent to an EL222 binding site. Taken together, these results shed light on the native function of EL222 and provide useful reagents for further basic and applications research of this versatile protein. PMID:23205774

Cellular responses and gene expression profile changes due to bleomycin-induced DNA damage in human fibroblasts in space

PubMed Central

Kidane, Yared; Feiveson, Alan; Stodieck, Louis; Karouia, Fathi; Ramesh, Govindarajan; Rohde, Larry; Wu, Honglu

2017-01-01

Living organisms in space are constantly exposed to radiation, toxic chemicals or reactive oxygen species generated due to increased levels of environmental and psychological stresses. Understanding the impact of spaceflight factors, microgravity in particular, on cellular responses to DNA damage is essential for assessing the radiation risk for astronauts and the mutation rate in microorganisms. In a study conducted on the International Space Station, confluent human fibroblasts in culture were treated with bleomycin for three hours in the true microgravity environment. The degree of DNA damage was quantified by immunofluorescence staining for γ-H2AX, which is manifested in three types of staining patterns. Although similar percentages of these types of patterns were found between flight and ground cells, there was a slight shift in the distribution of foci counts in the flown cells with countable numbers of γ-H2AX foci. Comparison of the cells in confluent and in exponential growth conditions indicated that the proliferation rate between flight and the ground may be responsible for such a shift. We also performed a microarray analysis of gene expressions in response to bleomycin treatment. A qualitative comparison of the responsive pathways between the flown and ground cells showed similar responses with the p53 network being the top upstream regulator. The microarray data was confirmed with a PCR array analysis containing a set of genes involved in DNA damage signaling; with BBC3, CDKN1A, PCNA and PPM1D being significantly upregulated in both flight and ground cells after bleomycin treatment. Our results suggest that whether microgravity affects DNA damage response in space can be dependent on the cell type and cell growth condition. PMID:28248986

True Lies: The Double Life of the Nucleotide Excision Repair Factors in Transcription and DNA Repair

PubMed Central

Le May, Nicolas; Egly, Jean-Marc; Coin, Frédéric

2010-01-01

Nucleotide excision repair (NER) is a major DNA repair pathway in eukaryotic cells. NER removes structurally diverse lesions such as pyrimidine dimers, arising upon UV irradiation or bulky chemical adducts, arising upon exposure to carcinogens and some chemotherapeutic drugs. NER defects lead to three genetic disorders that result in predisposition to cancers, accelerated aging, neurological and developmental defects. During NER, more than 30 polypeptides cooperate to recognize, incise, and excise a damaged oligonucleotide from the genomic DNA. Recent papers reveal an additional and unexpected role for the NER factors. In the absence of a genotoxic attack, the promoters of RNA polymerases I- and II-dependent genes recruit XPA, XPC, XPG, and XPF to initiate gene expression. A model that includes the growth arrest and DNA damage 45α protein (Gadd45α) and the NER factors, in order to maintain the promoter of active genes under a hypomethylated state, has been proposed but remains controversial. This paper focuses on the double life of the NER factors in DNA repair and transcription and describes the possible roles of these factors in the RNA synthesis process. PMID:20725631

Targeting CTCF to Control Virus Gene Expression: A Common Theme amongst Diverse DNA Viruses.

PubMed

Pentland, Ieisha; Parish, Joanna L

2015-07-06

All viruses target host cell factors for successful life cycle completion. Transcriptional control of DNA viruses by host cell factors is important in the temporal and spatial regulation of virus gene expression. Many of these factors are recruited to enhance virus gene expression and thereby increase virus production, but host cell factors can also restrict virus gene expression and productivity of infection. CCCTC binding factor (CTCF) is a host cell DNA binding protein important for the regulation of genomic chromatin boundaries, transcriptional control and enhancer element usage. CTCF also functions in RNA polymerase II regulation and in doing so can influence co-transcriptional splicing events. Several DNA viruses, including Kaposi's sarcoma-associated herpesvirus (KSHV), Epstein-Barr virus (EBV) and human papillomavirus (HPV) utilize CTCF to control virus gene expression and many studies have highlighted a role for CTCF in the persistence of these diverse oncogenic viruses. CTCF can both enhance and repress virus gene expression and in some cases CTCF increases the complexity of alternatively spliced transcripts. This review article will discuss the function of CTCF in the life cycle of DNA viruses in the context of known host cell CTCF functions.

An integrative model links multiple inputs and signaling pathways to the onset of DNA synthesis in hepatocytes

PubMed Central

Huard, Jérémy; Mueller, Stephanie; Gilles, Ernst D; Klingmüller, Ursula; Klamt, Steffen

2012-01-01

During liver regeneration, quiescent hepatocytes re-enter the cell cycle to proliferate and compensate for lost tissue. Multiple signals including hepatocyte growth factor, epidermal growth factor, tumor necrosis factor α, interleukin-6, insulin and transforming growth factor β orchestrate these responses and are integrated during the G1 phase of the cell cycle. To investigate how these inputs influence DNA synthesis as a measure for proliferation, we established a large-scale integrated logical model connecting multiple signaling pathways and the cell cycle. We constructed our model based upon established literature knowledge, and successively improved and validated its structure using hepatocyte-specific literature as well as experimental DNA synthesis data. Model analyses showed that activation of the mitogen-activated protein kinase and phosphatidylinositol 3-kinase pathways was sufficient and necessary for triggering DNA synthesis. In addition, we identified key species in these pathways that mediate DNA replication. Our model predicted oncogenic mutations that were compared with the COSMIC database, and proposed intervention targets to block hepatocyte growth factor-induced DNA synthesis, which we validated experimentally. Our integrative approach demonstrates that, despite the complexity and size of the underlying interlaced network, logical modeling enables an integrative understanding of signaling-controlled proliferation at the cellular level, and thus can provide intervention strategies for distinct perturbation scenarios at various regulatory levels. PMID:22443451

Experience with International Neuroblastoma Staging System and Pathology Classification

PubMed Central

Ikeda, H; Iehara, T; Tsuchida, Y; Kaneko, M; Hata, J; Naito, H; Iwafuchi, M; Ohnuma, N; Mugishima, H; Toyoda, Y; Hamazaki, M; Mimaya, J; Kondo, S; Kawa, K; Okada, A; Hiyama, E; Suita, S; Takamatsu, H

2002-01-01

The International Neuroblastoma Staging System and Pathology Classification were proposed in 1988 and in 1999, respectively, but their clinical value has not yet been fully studied in new patients. Six hundred and forty-four patients with neuroblastoma treated between January 1995 and December 1999 were analysed by these classifications. The 4-year overall survival rate of patients <12 months of age with INSS stages 1, 2A, 2B, 3 and 4S disease was 98.5%, which was significantly higher than the 73.1% rate in stage 4 patients <12 months (P<0.0001). When patients were ⩾12 months, the 4-year overall survival rate of patients with neuroblastoma at 1, 2A, 2B and 3 stages was 100% and that of patients at stage 4 was 48.5% (P<0.0001). As to the International Neuroblastoma Pathology Classification histology, the 4-year overall survival rate was 98.8% in patients with favourable histology and 60.7% in those with unfavourable histology in the <12 months group (P<0.0001). In the ⩾12 months group, the 4-year oral survival of patients with favourable histology was 95.3% and that of patients with unfavourable histology was 50.6% (P<0.0001). Among biological factors, MYCN amplification, DNA diploidy and 1p deletions were significantly associated with poor prognosis in patients <12 months, as were MYCN amplification and DNA diploidy in patients ⩾12 months of age. Multivariate analysis showed that the INSS stage (stage 4 vs other stages) and International Neuroblastoma Pathology Classification histology (unfavourable vs favourable) were significantly and independently associated with the survival of patients undergoing treatment, stratified by age, stage and MYCN amplification (P=0.0002 and P=0.0051, respectively). British Journal of Cancer (2002) 86, 1110–1116. DOI: 10.1038/sj/bjc/6600231 www.bjcancer.com © 2002 Cancer Research UK PMID:11953858

Versatile types of polysaccharide-based supramolecular polycation/pDNA nanoplexes for gene delivery

NASA Astrophysics Data System (ADS)

Hu, Yang; Zhao, Nana; Yu, Bingran; Liu, Fusheng; Xu, Fu-Jian

2014-06-01

Different polysaccharide-based supramolecular polycations were readily synthesized by assembling multiple β-cyclodextrin-cored star polycations with an adamantane-functionalized dextran via host-guest interaction in the absence or presence of bioreducible linkages. Compared with nanoplexes of the starting star polycation and pDNA, the supramolecular polycation/pDNA nanoplexes exhibited similarly low cytotoxicity, improved cellular internalization and significantly higher gene transfection efficiencies. The incorporation of disulfide linkages imparted the supramolecular polycation/pDNA nanoplexes with the advantage of intracellular bioreducibility, resulting in better gene delivery properties. In addition, the antitumor properties of supramolecular polycation/pDNA nanoplexes were also investigated using a suicide gene therapy system. The present study demonstrates that the proper assembly of cyclodextrin-cored polycations with adamantane-functionalized polysaccharides is an effective strategy for the production of new nanoplex delivery systems.Different polysaccharide-based supramolecular polycations were readily synthesized by assembling multiple β-cyclodextrin-cored star polycations with an adamantane-functionalized dextran via host-guest interaction in the absence or presence of bioreducible linkages. Compared with nanoplexes of the starting star polycation and pDNA, the supramolecular polycation/pDNA nanoplexes exhibited similarly low cytotoxicity, improved cellular internalization and significantly higher gene transfection efficiencies. The incorporation of disulfide linkages imparted the supramolecular polycation/pDNA nanoplexes with the advantage of intracellular bioreducibility, resulting in better gene delivery properties. In addition, the antitumor properties of supramolecular polycation/pDNA nanoplexes were also investigated using a suicide gene therapy system. The present study demonstrates that the proper assembly of cyclodextrin-cored polycations with adamantane-functionalized polysaccharides is an effective strategy for the production of new nanoplex delivery systems. Electronic supplementary information (ESI) available: 1H NMR assay and synthetic route of Dex-Ad and Dex-SS-Ad. See DOI: 10.1039/c4nr01590h

MCM interference during licensing of DNA replication in Xenopus egg extracts-Possible Role of a C-terminal region of MCM3.

PubMed

Mimura, Satoru; Kubota, Yumiko; Takisawa, Haruhiko

2018-01-01

The minichromosome maintenance (MCM) complex, consisting of six subunits, Mcm2-7, is loaded onto replication origins through loading factors (origin recognition complex [ORC], Cdc6, and Cdt1) and forms an MCM double hexamer that licenses the initiation of DNA replication. Previous studies with Xenopus egg extracts showed that loading factors, especially Cdc6, dissociate from chromatin on MCM loading, but the molecular mechanism and physiological significance remain largely unknown. Using a cell-free system for MCM loading onto plasmid DNA in Xenopus egg extracts, we found that MCM loaded onto DNA prevents DNA binding of the loading factors ORC, Cdc6, and Cdt1. We further report that a peptide of the C-terminal region of MCM3 (MCM3-C), previously implicated in the initial association with ORC/Cdc6 in budding yeast, prevents ORC/Cdc6/Cdt1 binding to DNA in the absence of MCM loading. ATP-γ-S suppresses inhibitory activities of both the MCM loaded onto DNA and the MCM3-C peptide. Other soluble factors in the extract, but neither MCM nor Cdt1, are required for the activity. Conservation of the amino acid sequences of MCM3-C and its activity in vertebrates implies a novel negative autoregulatory mechanism that interferes with MCM loading in the vicinity of licensed origins to ensure proper origin licensing.

Cell-free DNA testing after combined test: factors affecting the uptake.

PubMed

Maiz, Nerea; Alzola, Irune; Murua, Emerson J; Rodríguez Santos, Javier

2016-11-01

First, to assess what was the uptake of cell free DNA (cfDNA) testing after a combined test and the maternal and fetal factors that influenced this decision, and second, to assess the uptake and factors that influence the choice of invasive testing. This observational retrospective study included 1083 singleton pregnancies who had a combined test for screening for Down syndrome between 11 (+) (0) and 13 (+) (6) weeks. Multivariate logistic regression analysis was used to determine which factors affected the uptake of cfDNA test and invasive testing among risk for trisomies 21, 18, and 13, maternal characteristics and fetal nuchal translucency (NT) thickness. Two-hundred fifty-seven (23.7%) women had a cfDNA test, 89 (8.2%) had an invasive test, and 737 (68.1%) had no further test. The uptake of cfDNA increased with the risk for trisomies (p < 0.001), maternal age (p = 0.013), and was higher in nulliparous women (p = 0.004). The uptake of invasive test increased with the risk for trisomies (p < 0.001) and NT thickness (p < 0.001). This study shows that the uptake of cfDNA testing increases with the risk for trisomies, maternal age, and is higher in nulliparous, whereas the uptake of invasive testing increases with the risk for trisomies and NT thickness.

DNA barcoding of Mobulid Ray Gill Rakers for Implementing CITES on Elasmobranch in China

PubMed Central

Zeng, Yan; Wu, Zhongze; Zhang, Chunguang; Meng, Zhibin; Jiang, Zhigang; Zhang, Jie

2016-01-01

The Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) has been counted on for conserving threatened marine fish since it regulates the commercial international trade of these species. Implementation of the international treaty for Mantas included on CITES Appendix II is challenging due to insufficient information on species identification and markets management. To fill the gap in such aspects, we identified five species of Mobulid rays (Mobula spps. and Manta spp) by using COI and NADH2 mtDNA markers in dried ray gill rakers from Chinese markets, namely, Mobula japonica (representing 54.8% of the sample set), M. tarapacana (14.4%), M. kuhlii (13.3%), M. thurstoni (6.4%), along with Manta birostris (11.2%; CITES Appendix II). The utilization and conservation statuses of these species were discussed. Based on combination of DNA barcodes and key morphological characters, we developed a three-step process for identifying the gill rakers of Mobulid rays which has been adopted by frontline enforcement in China. We hope that our work can serve as a foundation and basis to reinforce objectives of international treaties, regulation of consumer-driven markets, regional cooperation, and national fishery management on endangered elasmobranchs in China as well as related countries. PMID:27876850

DNA barcoding of Mobulid Ray Gill Rakers for Implementing CITES on Elasmobranch in China.

PubMed

Zeng, Yan; Wu, Zhongze; Zhang, Chunguang; Meng, Zhibin; Jiang, Zhigang; Zhang, Jie

2016-11-23

The Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) has been counted on for conserving threatened marine fish since it regulates the commercial international trade of these species. Implementation of the international treaty for Mantas included on CITES Appendix II is challenging due to insufficient information on species identification and markets management. To fill the gap in such aspects, we identified five species of Mobulid rays (Mobula spps. and Manta spp) by using COI and NADH2 mtDNA markers in dried ray gill rakers from Chinese markets, namely, Mobula japonica (representing 54.8% of the sample set), M. tarapacana (14.4%), M. kuhlii (13.3%), M. thurstoni (6.4%), along with Manta birostris (11.2%; CITES Appendix II). The utilization and conservation statuses of these species were discussed. Based on combination of DNA barcodes and key morphological characters, we developed a three-step process for identifying the gill rakers of Mobulid rays which has been adopted by frontline enforcement in China. We hope that our work can serve as a foundation and basis to reinforce objectives of international treaties, regulation of consumer-driven markets, regional cooperation, and national fishery management on endangered elasmobranchs in China as well as related countries.

Cell- and virus-mediated regulation of the barrier-to-autointegration factor's phosphorylation state controls its DNA binding, dimerization, subcellular localization, and antipoxviral activity.

PubMed

Jamin, Augusta; Wicklund, April; Wiebe, Matthew S

2014-05-01

Barrier-to-autointegration factor (BAF) is a DNA binding protein with multiple cellular functions, including the ability to act as a potent defense against vaccinia virus infection. This antiviral function involves BAF's ability to condense double-stranded DNA and subsequently prevent viral DNA replication. In recent years, it has become increasingly evident that dynamic phosphorylation involving the vaccinia virus B1 kinase and cellular enzymes is likely a key regulator of multiple BAF functions; however, the precise mechanisms are poorly understood. Here we analyzed how phosphorylation impacts BAF's DNA binding, subcellular localization, dimerization, and antipoxviral activity through the characterization of BAF phosphomimetic and unphosphorylatable mutants. Our studies demonstrate that increased phosphorylation enhances BAF's mobilization from the nucleus to the cytosol, while dephosphorylation restricts BAF to the nucleus. Phosphorylation also impairs both BAF's dimerization and its DNA binding activity. Furthermore, our studies of BAF's antiviral activity revealed that hyperphosphorylated BAF is unable to suppress viral DNA replication or virus production. Interestingly, the unphosphorylatable BAF mutant, which is capable of binding DNA but localizes predominantly to the nucleus, was also incapable of suppressing viral replication. Thus, both DNA binding and localization are important determinants of BAF's antiviral function. Finally, our examination of how phosphatases are involved in regulating BAF revealed that PP2A dephosphorylates BAF during vaccinia infection, thus counterbalancing the activity of the B1 kinase. Altogether, these data demonstrate that phosphoregulation of BAF by viral and cellular enzymes modulates this protein at multiple molecular levels, thus determining its effectiveness as an antiviral factor and likely other functions as well. The barrier-to-autointegration factor (BAF) contributes to cellular genomic integrity in multiple ways, the best characterized of which are as a host defense against cytoplasmic DNA and as a regulator of mitotic nuclear reassembly. Although dynamic phosphorylation involving both viral and cellular enzymes is likely a key regulator of multiple BAF functions, the precise mechanisms involved are poorly understood. Here we demonstrate that phosphorylation coordinately regulates BAF's DNA binding, subcellular localization, dimerization, and antipoxviral activity. Overall, our findings provide new insights into how phosphoregulation of BAF modulates this protein at multiple levels and governs its effectiveness as an antiviral factor against foreign DNA.

Cyclophilins facilitate dissociation of the human papillomavirus type 16 capsid protein L1 from the L2/DNA complex following virus entry.

PubMed

Bienkowska-Haba, Malgorzata; Williams, Carlyn; Kim, Seong Man; Garcea, Robert L; Sapp, Martin

2012-09-01

Human papillomaviruses (HPV) are composed of the major and minor capsid proteins, L1 and L2, that encapsidate a chromatinized, circular double-stranded DNA genome. At the outset of infection, the interaction of HPV type 16 (HPV16) (pseudo)virions with heparan sulfate proteoglycans triggers a conformational change in L2 that is facilitated by the host cell chaperone cyclophilin B (CyPB). This conformational change results in exposure of the L2 N terminus, which is required for infectious internalization. Following internalization, L2 facilitates egress of the viral genome from acidified endosomes, and the L2/DNA complex accumulates at PML nuclear bodies. We recently described a mutant virus that bypasses the requirement for cell surface CyPB but remains sensitive to cyclosporine for infection, indicating an additional role for CyP following endocytic uptake of virions. We now report that the L1 protein dissociates from the L2/DNA complex following infectious internalization. Inhibition and small interfering RNA (siRNA)-mediated knockdown of CyPs blocked dissociation of L1 from the L2/DNA complex. In vitro, purified CyPs facilitated the dissociation of L1 pentamers from recombinant HPV11 L1/L2 complexes in a pH-dependent manner. Furthermore, CyPs released L1 capsomeres from partially disassembled HPV16 pseudovirions at slightly acidic pH. Taken together, these data suggest that CyPs mediate the dissociation of HPV L1 and L2 capsid proteins following acidification of endocytic vesicles.

Cyclophilins Facilitate Dissociation of the Human Papillomavirus Type 16 Capsid Protein L1 from the L2/DNA Complex following Virus Entry

PubMed Central

Bienkowska-Haba, Malgorzata; Williams, Carlyn; Kim, Seong Man; Garcea, Robert L.

2012-01-01

Human papillomaviruses (HPV) are composed of the major and minor capsid proteins, L1 and L2, that encapsidate a chromatinized, circular double-stranded DNA genome. At the outset of infection, the interaction of HPV type 16 (HPV16) (pseudo)virions with heparan sulfate proteoglycans triggers a conformational change in L2 that is facilitated by the host cell chaperone cyclophilin B (CyPB). This conformational change results in exposure of the L2 N terminus, which is required for infectious internalization. Following internalization, L2 facilitates egress of the viral genome from acidified endosomes, and the L2/DNA complex accumulates at PML nuclear bodies. We recently described a mutant virus that bypasses the requirement for cell surface CyPB but remains sensitive to cyclosporine for infection, indicating an additional role for CyP following endocytic uptake of virions. We now report that the L1 protein dissociates from the L2/DNA complex following infectious internalization. Inhibition and small interfering RNA (siRNA)-mediated knockdown of CyPs blocked dissociation of L1 from the L2/DNA complex. In vitro, purified CyPs facilitated the dissociation of L1 pentamers from recombinant HPV11 L1/L2 complexes in a pH-dependent manner. Furthermore, CyPs released L1 capsomeres from partially disassembled HPV16 pseudovirions at slightly acidic pH. Taken together, these data suggest that CyPs mediate the dissociation of HPV L1 and L2 capsid proteins following acidification of endocytic vesicles. PMID:22761365

Effect of C(60) fullerene on the duplex formation of i-motif DNA with complementary DNA in solution.

PubMed

Jin, Kyeong Sik; Shin, Su Ryon; Ahn, Byungcheol; Jin, Sangwoo; Rho, Yecheol; Kim, Heesoo; Kim, Seon Jeong; Ree, Moonhor

2010-04-15

The structural effects of fullerene on i-motif DNA were investigated by characterizing the structures of fullerene-free and fullerene-bound i-motif DNA, in the presence of cDNA and in solutions of varying pH, using circular dichroism and synchrotron small-angle X-ray scattering. To facilitate a direct structural comparison between the i-motif and duplex structures in response to pH stimulus, we developed atomic scale structural models for the duplex and i-motif DNA structures, and for the C(60)/i-motif DNA hybrid associated with the cDNA strand, assuming that the DNA strands are present in an ideal right-handed helical conformation. We found that fullerene shifted the pH-induced conformational transition between the i-motif and the duplex structure, possibly due to the hydrophobic interactions between the terminal fullerenes and between the terminal fullerenes and an internal TAA loop in the DNA strand. The hybrid structure showed a dramatic reduction in cyclic hysteresis.

Structural basis for DNA binding by replication initiator Mcm10

DOE Office of Scientific and Technical Information (OSTI.GOV)

Warren, Eric M.; Vaithiyalingam, Sivaraja; Haworth, Justin

2009-06-30

Mcm10 is an essential eukaryotic DNA replication protein required for assembly and progression of the replication fork. The highly conserved internal domain (Mcm10-ID) has been shown to physically interact with single-stranded (ss) DNA, DNA polymerase alpha, and proliferating cell nuclear antigen (PCNA). The crystal structure of Xenopus laevis Mcm10-ID presented here reveals a DNA binding architecture composed of an oligonucleotide/oligosaccharide-fold followed in tandem by a variant and highly basic zinc finger. NMR chemical shift perturbation and mutational studies of DNA binding activity in vitro reveal how Mcm10 uses this unique surface to engage ssDNA. Corresponding mutations in Saccharomyces cerevisiae resultmore » in increased sensitivity to replication stress, demonstrating the functional importance of DNA binding by this region of Mcm10 to replication. In addition, mapping Mcm10 mutations known to disrupt PCNA, polymerase alpha, and DNA interactions onto the crystal structure provides insight into how Mcm10 might coordinate protein and DNA binding within the replisome.« less

Extracellular DNA and histones: double-edged swords in immunothrombosis.

PubMed

Gould, T J; Lysov, Z; Liaw, P C

2015-06-01

The existence of extracellular DNA in human plasma, also known as cell-free DNA (cfDNA), was first described in the 1940s. In recent years, there has been a resurgence of interest in the functional significance of cfDNA, particularly in the context of neutrophil extracellular traps (NETs). cfDNA and histones are key components of NETs that aid in the host response to infection and inflammation. However, cfDNA and histones may also exert harmful effects by triggering coagulation, inflammation, and cell death and by impairing fibrinolysis. In this article, we will review the pathologic nature of cfDNA and histones in macrovascular and microvascular thrombosis, including venous thromboembolism, cancer, sepsis, and trauma. We will also discuss the prognostic value of cfDNA and histones in these disease states. Understanding the molecular and cellular pathways regulated by cfDNA and histones may provide novel insights to prevent pathological thrombus formation and vascular occlusion. © 2015 International Society on Thrombosis and Haemostasis.

Identification of an Intermediate in Hepatitis B Virus Covalently Closed Circular (CCC) DNA Formation and Sensitive and Selective CCC DNA Detection

PubMed Central

Luo, Jun; Cui, Xiuji; Gao, Lu

2017-01-01

ABSTRACT Hepatitis B virus (HBV) covalently closed circular (CCC) DNA functions as the only viral template capable of coding for all the viral RNA species and is thus essential to initiate and sustain viral replication. CCC DNA is converted, in a multistep and ill-understood process, from a relaxed circular (RC) DNA, in which neither of the two DNA strands is covalently closed. To detect putative intermediates during RC DNA to CCC DNA conversion, two 3′ exonucleases, exonuclease I (Exo I) and Exo III, were used in combination to degrade all DNA strands with a free 3′ end, which would nevertheless preserve closed circular DNA in either single-stranded (SS) or double-stranded (DS) form. Indeed, an RC DNA species with a covalently closed minus strand but an open plus strand (closed minus-strand RC DNA [cM-RC DNA]) was detected by this approach. Further analyses indicated that at least some of the plus strands in such a putative intermediate likely still retained the RNA primer that is attached to the 5′ end of the plus strand in RC DNA, suggesting that minus-strand closing can occur before plus-strand processing. Furthermore, the same nuclease treatment proved to be useful for sensitive and specific detection of CCC DNA by removing all DNA species other than closed circular DNA. Application of these and similar approaches may allow the identification of additional intermediates during CCC DNA formation and facilitate specific and sensitive detection of CCC DNA, which should help elucidate the pathways of CCC DNA formation and the factors involved. IMPORTANCE The hepatitis B virus (HBV) covalently closed circular (CCC) DNA, by serving as the viral transcriptional template, is the molecular basis of viral persistence. CCC DNA is converted, in a multistep and ill-understood process, from relaxed circular (RC) DNA. Little is currently understood about the pathways or factors involved in CCC DNA formation. We have now detected a likely intermediate during the conversion of RC DNA to CCC DNA, thus providing important clues to the pathways of CCC DNA formation. Furthermore, the same experimental approach that led to the detection of the intermediate could also facilitate specific and sensitive detection of CCC DNA, which has remained challenging. This and similar approaches will help identify additional intermediates during CCC DNA formation and elucidate the pathways and factors involved. PMID:28637752

HMG I(Y) interferes with the DNA binding of NF-AT factors and the induction of the interleukin 4 promoter in T cells

PubMed Central

Klein-Hessling, Stefan; Schneider, Günter; Heinfling, Annette; Chuvpilo, Sergei; Serfling, Edgar

1996-01-01

HMG I(Y) proteins bind to double-stranded A+T oligonucleotides longer than three base pairs. Such motifs form part of numerous NF-AT-binding sites of lymphokine promoters, including the interleukin 4 (IL-4) promoter. NF-AT factors share short homologous peptide sequences in their DNA-binding domain with NF-κB factors and bind to certain NF-κB sites. It has been shown that HMG I(Y) proteins enhance NF-κB binding to the interferon β promoter and virus-mediated interferon β promoter induction. We show that HMG I(Y) proteins exert an opposite effect on the DNA binding of NF-AT factors and the induction of the IL-4 promoter in T lymphocytes. Introduction of mutations into a high-affinity HMG I(Y)-binding site of the IL-4 promoter, which decreased HMG I(Y)-binding to a NF-AT-binding sequence, the Pu-bB (or P) site, distinctly increased the induction of the IL-4 promoter in Jurkat T leukemia cells. High concentrations of HMG I(Y) proteins are able to displace NF-ATp from its binding to the Pu-bB site. High HMG I(Y) concentrations are typical for Jurkat cells and peripheral blood T lymphocytes, whereas El4 T lymphoma cells and certain T helper type 2 cell clones contain relatively low HMG I(Y) concentrations. Our results indicate that HMG I(Y) proteins do not cooperate, but instead compete with NF-AT factors for the binding to DNA even though NF-AT factors share some DNA-binding properties with NF-kB factors. This competition between HMG I(Y) and NF-AT proteins for DNA binding might be due to common contacts with minor groove nucleotides of DNA and may be one mechanism contributing to the selective IL-4 expression in certain T lymphocyte populations, such as T helper type 2 cells. PMID:8986808

Pushing the limits for amplifying BrdU-labeled DNA encoding 16S rRNA: DNA polymerase as the determining factor.

PubMed

Roux-Michollet, Dad D; Schimel, Joshua P; Holden, Patricia A

2010-12-01

Identifying microorganisms that are active under specific conditions in ecosystems is a challenge in microbial ecology. Recently, the bromodeoxyuridine (BrdU) technique was developed to label actively growing cells. BrdU, a thymidine analog, is incorporated into newly synthesized DNA, and the BrdU-labeled DNA is then isolated from total extractable DNA by immunocapture using a BrdU-specific antibody. Analyzing the BrdU-labeled DNA allows for assessing the actively growing community, which can then be compared to the unlabeled DNA that represents the total community. However, applying the BrdU approach to study soils has been problematic due to low DNA amounts and soil contaminants. To address these challenges, we developed a protocol, optimizing specificity and reproducibility, to amplify BrdU-labeled gene fragments encoding 16S rRNA. We found that the determining factor was the DNA polymerase: among the 13 different polymerases we tested, only 3 provided adequate yields with minimal contamination, and only two of those three produced similar amplification patterns of community DNA. Copyright © 2010 Elsevier B.V. All rights reserved.

Dynamic DNA binding licenses a repair factor to bypass roadblocks in search of DNA lesions

PubMed Central

Brown, Maxwell W.; Kim, Yoori; Williams, Gregory M.; Huck, John D.; Surtees, Jennifer A.; Finkelstein, Ilya J.

2016-01-01

DNA-binding proteins search for specific targets via facilitated diffusion along a crowded genome. However, little is known about how crowded DNA modulates facilitated diffusion and target recognition. Here we use DNA curtains and single-molecule fluorescence imaging to investigate how Msh2–Msh3, a eukaryotic mismatch repair complex, navigates on crowded DNA. Msh2–Msh3 hops over nucleosomes and other protein roadblocks, but maintains sufficient contact with DNA to recognize a single lesion. In contrast, Msh2–Msh6 slides without hopping and is largely blocked by protein roadblocks. Remarkably, the Msh3-specific mispair-binding domain (MBD) licences a chimeric Msh2–Msh6(3MBD) to bypass nucleosomes. Our studies contrast how Msh2–Msh3 and Msh2–Msh6 navigate on a crowded genome and suggest how Msh2–Msh3 locates DNA lesions outside of replication-coupled repair. These results also provide insights into how DNA repair factors search for DNA lesions in the context of chromatin. PMID:26837705

Unique Helicase Determinants in the Essential Conjugative TraI Factor from Salmonella enterica Serovar Typhimurium Plasmid pCU1

DOE Office of Scientific and Technical Information (OSTI.GOV)

McLaughlin, K. J.; Nash, R. P.; Redinbo, M. R.

The widespread development of multidrug-resistant bacteria is a major health emergency. Conjugative DNA plasmids, which harbor a wide range of antibiotic resistance genes, also encode the protein factors necessary to orchestrate the propagation of plasmid DNA between bacterial cells through conjugative transfer. Successful conjugative DNA transfer depends on key catalytic components to nick one strand of the duplex DNA plasmid and separate the DNA strands while cell-to-cell transfer occurs. The TraI protein from the conjugative Salmonella plasmid pCU1 fulfills these key catalytic roles, as it contains both single-stranded DNA-nicking relaxase and ATP-dependent helicase domains within a single, 1,078-residue polypeptide. Inmore » this work, we unraveled the helicase determinants of Salmonella pCU1 TraI through DNA binding, ATPase, and DNA strand separation assays. TraI binds DNA substrates with high affinity in a manner influenced by nucleic acid length and the presence of a DNA hairpin structure adjacent to the nick site. TraI selectively hydrolyzes ATP, and mutations in conserved helicase motifs eliminate ATPase activity. Surprisingly, the absence of a relatively short (144-residue) domain at the extreme C terminus of the protein severely diminishes ATP-dependent strand separation. Collectively, these data define the helicase motifs of the conjugative factor TraI from Salmonella pCU1 and reveal a previously uncharacterized C-terminal functional domain that uncouples ATP hydrolysis from strand separation activity.« less

Trigger Factor can antagonize both SecB and DnaK/DnaJ chaperone functions in Escherichia coli

PubMed Central

Ullers, Ronald S.; Ang, Debbie; Schwager, Françoise; Georgopoulos, Costa; Genevaux, Pierre

2007-01-01

Polypeptides emerging from the ribosome are assisted by a pool of molecular chaperones and targeting factors, which enable them to efficiently partition as cytoplasmic, integral membrane, or exported proteins. In Escherichia coli, the chaperones SecB, Trigger Factor (TF), and DnaK are key players in this process. Here, we report that, as with dnaK or dnaJ mutants, a secB null strain exhibits a strong cold-sensitive (Cs) phenotype. Through suppressor analyses, we found that inactivating mutations in the tig gene encoding TF fully relieve both the Cs phenotype and protein aggregation observed in the absence of SecB. This antagonistic effect of TF depends on its ribosome-binding and chaperone activities but unrelated to its peptidyl-prolyl cis/trans isomerase (PPIase) activity. Furthermore, in contrast to the previously known synergistic action of TF and DnaK/DnaJ above 30°C, a tig null mutation partially suppresses the Cs phenotype exhibited by a compromised DnaK/DnaJ chaperone machine. The antagonistic role of TF is further exemplified by the fact that the secB dnaJ double mutant is viable only in the absence of TF. Finally, we show that, in the absence of TF, more SecA and ribosomes are associated with the inner membrane, suggesting that the presence of TF directly or indirectly interferes with the process of cotranslational protein targeting to the Sec translocon. PMID:17360615

Role of promoter DNA sequence variations on the binding of EGR1 transcription factor.

PubMed

Mikles, David C; Schuchardt, Brett J; Bhat, Vikas; McDonald, Caleb B; Farooq, Amjad

2014-05-01

In response to a wide variety of stimuli such as growth factors and hormones, EGR1 transcription factor is rapidly induced and immediately exerts downstream effects central to the maintenance of cellular homeostasis. Herein, our biophysical analysis reveals that DNA sequence variations within the target gene promoters tightly modulate the energetics of binding of EGR1 and that nucleotide substitutions at certain positions are much more detrimental to EGR1-DNA interaction than others. Importantly, the reduction in binding affinity poorly correlates with the loss of enthalpy and gain of entropy-a trend indicative of a complex interplay between underlying thermodynamic factors due to the differential role of water solvent upon nucleotide substitution. We also provide a rationale for the physical basis of the effect of nucleotide substitutions on the EGR1-DNA interaction at atomic level. Taken together, our study bears important implications on understanding the molecular determinants of a key protein-DNA interaction at the cross-roads of human health and disease. Copyright © 2014 Elsevier Inc. All rights reserved.

Molecular coevolution of mammalian ribosomal gene terminator sequences and the transcription termination factor TTF-I.

PubMed Central

Evers, R; Grummt, I

1995-01-01

Both the DNA elements and the nuclear factors that direct termination of ribosomal gene transcription exhibit species-specific differences. Even between mammals--e.g., human and mouse--the termination signals are not identical and the respective transcription termination factors (TTFs) which bind to the terminator sequence are not fully interchangeable. To elucidate the molecular basis for this species-specificity, we have cloned TTF-I from human and mouse cells and compared their structural and functional properties. Recombinant TTF-I exhibits species-specific DNA binding and terminates transcription both in cell-free transcription assays and in transfection experiments. Chimeric constructs of mouse TTF-I and human TTF-I reveal that the major determinant for species-specific DNA binding resides within the C terminus of TTF-I. Replacing 31 C-terminal amino acids of mouse TTF-I with the homologous human sequences relaxes the DNA-binding specificity and, as a consequence, allows the chimeric factor to bind the human terminator sequence and to specifically stop rDNA transcription. Images Fig. 2 Fig. 3 Fig. 4 PMID:7597036

Lifestyle impacts on the aging associated expression of biomarkers of DNA damage and telomere dysfunction in human blood

PubMed Central

Song, Zhangfa; von Figura, Guido; Liu, Yan; Kraus, Johann M.; Torrice, Chad; Dillon, Patric; Rudolph-Watabe, Masami; Ju, Zhenyu; Kestler, Hans A.; Sanoff, Hanna; Rudolph, K. Lenhard

2010-01-01

Summary Cellular aging is characterised by telomere shortening, which can lead to uncapping of chromosome ends (telomere dysfunction) and that activation of DNA damage responses. There is some evidence the DNA damage accumulates during human aging and that lifestyle factors contribute to the accumulation of DNA damage. Recent studies have identified a set of serum markers that are induced by telomere dysfunction and DNA damage and these markers showed an increased expression in blood during human aging. Here, we investigated the influence of lifestyle factors (such as exercise, smoking, body mass) on the aging associated expression of serum markers of DNA damage (CRAMP, EF-1α, Stathmin, n-acetyl-glucosaminidase, and chitinase) in comparison to other described markers of cellular aging (p16INK4a upregulation and telomere shortening) in human peripheral blood. The study shows that lifestyle factors have an age-independent impact on the expression level of biomarkers of DNA damage. Smoking and increased body mass indices were associated with elevated levels of biomarkers of DNA damage independent of the age of the individuals. In contrast, exercise was associated with an age-independent reduction in the expression of biomarkers of DNA damage in human blood. The expression of biomarkers of DNA damage correlated positively with p16INK4a expression and negatively with telomere length in peripheral blood T-lymphocytes. Together, these data provide experimental evidence that both aging and lifestyle impact on the accumulation of DNA damage during human aging. PMID:20560902

Structure of a Novel DNA-binding Domain of Helicase-like Transcription Factor (HLTF) and Its Functional Implication in DNA Damage Tolerance.

PubMed

Hishiki, Asami; Hara, Kodai; Ikegaya, Yuzu; Yokoyama, Hideshi; Shimizu, Toshiyuki; Sato, Mamoru; Hashimoto, Hiroshi

2015-05-22

HLTF (helicase-like transcription factor) is a yeast RAD5 homolog found in mammals. HLTF has E3 ubiquitin ligase and DNA helicase activities, and plays a pivotal role in the template-switching pathway of DNA damage tolerance. HLTF has an N-terminal domain that has been designated the HIRAN (HIP116 and RAD5 N-terminal) domain. The HIRAN domain has been hypothesized to play a role in DNA binding; however, the structural basis of, and functional evidence for, the HIRAN domain in DNA binding has remained unclear. Here we show for the first time the crystal structure of the HIRAN domain of human HLTF in complex with DNA. The HIRAN domain is composed of six β-strands and two α-helices, forming an OB-fold structure frequently found in ssDNA-binding proteins, including in replication factor A (RPA). Interestingly, this study reveals that the HIRAN domain interacts with not only with a single-stranded DNA but also with a duplex DNA. Furthermore, the structure unexpectedly clarifies that the HIRAN domain specifically recognizes the 3'-end of DNA. These results suggest that the HIRAN domain functions as a sensor to the 3'-end of the primer strand at the stalled replication fork and that the domain facilitates fork regression. HLTF is recruited to a damaged site through the HIRAN domain at the stalled replication fork. Furthermore, our results have implications for the mechanism of template switching. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Environmental Factors Can Influence Mitochondrial Inheritance in the Saccharomyces Yeast Hybrids

PubMed Central

Hsu, Yu-Yi; Chou, Jui-Yu

2017-01-01

Mitochondria play a critical role in the generation of metabolic energy and are crucial for eukaryotic cell survival and proliferation. In most sexual eukaryotes, mitochondrial DNA (mtDNA) is inherited from only one parent in non-Mendelian inheritance in contrast to the inheritance of nuclear DNA. The model organism Saccharomyces cerevisiae is commonly used to study mitochondrial biology. It has two mating types: MATa and MATα. Previous studies have suggested that the mtDNA inheritance patterns in hybrid diploid cells depend on the genetic background of parental strains. However, the underlying mechanisms remain unclear. To elucidate the mechanisms, we examined the effects of environmental factors on the mtDNA inheritance patterns in hybrids obtained by crossing S. cerevisiae with its close relative S. paradoxus. The results demonstrated that environmental factors can influence mtDNA transmission in hybrid diploids, and that the inheritance patterns are strain dependent. The fitness competition assay results showed that the fitness differences can explain the mtDNA inheritance patterns under specific conditions. However, in this study, we found that fitness differences cannot fully be explained by mitochondrial activity in hybrids under stress conditions. PMID:28081193

Promoter selection in human mitochondria involves binding of a transcription factor to orientation-independent upstream regulatory elements.

PubMed

Fisher, R P; Topper, J N; Clayton, D A

1987-07-17

Selective transcription of human mitochondrial DNA requires a transcription factor (mtTF) in addition to an essentially nonselective RNA polymerase. Partially purified mtTF is able to sequester promoter-containing DNA in preinitiation complexes in the absence of mitochondrial RNA polymerase, suggesting a DNA-binding mechanism for factor activity. Functional domains, required for positive transcriptional regulation by mtTF, are identified within both major promoters of human mtDNA through transcription of mutant promoter templates in a reconstituted in vitro system. These domains are essentially coextensive with DNA sequences protected from nuclease digestion by mtTF-binding. Comparison of the sequences of the two mtTF-responsive elements reveals significant homology only when one sequence is inverted; the binding sites are in opposite orientations with respect to the predominant direction of transcription. Thus mtTF may function bidirectionally, requiring additional protein-DNA interactions to dictate transcriptional polarity. The mtTF-responsive elements are arrayed as direct repeats, separated by approximately 80 bp within the displacement-loop region of human mitochondrial DNA; this arrangement may reflect duplication of an ancestral bidirectional promoter, giving rise to separate, unidirectional promoters for each strand.

Sub-Ensemble Monitoring of DNA Strand Displacement Using Multiparameter Single-Molecule FRET.

PubMed

Baltierra-Jasso, Laura E; Morten, Michael J; Magennis, Steven W

2018-03-05

Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here, we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constant of 10 m -1  s -1 . We also followed the displacement from a DNA three-way junction (3WJ) by ssDNA. The presence of three internal mismatched bases in the middle of the invading strand did not prevent displacement from the 3WJ, but reduced the second-order rate constant by about 50 %. We attribute strand exchange in the dsDNA and 3WJ to a zero-toehold pathway from the blunt-ended duplex arms. The single-molecule approach demonstrated here will be useful for studying complex DNA networks. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Strip biosensor for amplified detection of nerve growth factor-beta based on a molecular translator and catalytic DNA circuit.

PubMed

Liu, Jun; Lai, Ting; Mu, Kejie; Zhou, Zheng

2014-10-07

We have demonstrated a new visual detection approach based on a molecular translator and a catalytic DNA circuit for the detection of nerve growth factor-beta (NGF-β). In this assay, a molecular translator based on the binding-induced DNA strand-displacement reaction was employed to convert the input protein to an output DNA signal. The molecular translator is composed of a target recognition element and a signal output element. Target recognition is achieved by the binding of the anti-NGF-β antibody to the target protein. Polyclonal anti-NGF-β antibody is conjugated to DNA1 and DNA2. The antibody conjugated DNA1 is initially hybridized to DNA3 to form a stable DNA1/DNA3 duplex. In the presence of NGF-β, the binding of the same target protein brings DNA1 and DNA2 into close proximity, resulting in an increase in their local effective concentration. This process triggers the strand-displacement reaction between DNA2 and DNA3 and releases the output DNA3. The released DNA3 is further amplified by a catalytic DNA circuit. The product of the catalytic DNA circuit is detected by a strip biosensor. This proposed assay has high sensitivity and selectivity with a dynamic response ranging from 10 fM to 10 pM, and its detection limit is 10 fM of NGF-β. This work provides a sensitive, enzyme-free, and universal strategy for the detection of other proteins.

Melatonin and human skin aging

PubMed Central

Kleszczynski, Konrad; Fischer, Tobias W.

2012-01-01

Like the whole organism, skin follows the process of aging during life-time. Additional to internal factors, several environmental factors, such as solar radiation, considerably contribute to this process. While fundamental mechanisms regarding skin aging are known, new aspects of anti-aging agents such as melatonin are introduced. Melatonin is a hormone produced in the glandula pinealis that follows a circadian light-dependent rhythm of secretion. It has been experimentally implicated in skin functions such as hair cycling and fur pigmentation, and melatonin receptors are expressed in many skin cell types including normal and malignant keratinocytes, melanocytes and fibroblasts. It possesses a wide range of endocrine properties as well as strong antioxidative activity. Regarding UV-induced solar damage, melatonin distinctly counteracts massive generation of reactive oxygen species, mitochondrial and DNA damage. Thus, there is considerable evidence for melatonin to be an effective anti-skin aging compound, and its various properties in this context are described in this review. PMID:23467217

Induction of cytotoxic T lymphocyte response against Mycobacterial antigen using domain I of anthrax edema factor as antigen delivery system

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chandra, Subhash; Kaur, Manpreet; Midha, Shuchi

2007-05-25

We have investigated the efficiency of N-terminal 1-260 residues of Edema factor (EFn) as a delivery system for ESAT-6, an antigenic protein of Mycobacterium tuberculosis H{sub 37}R{sub v}, into the cytosol of mammalian cells. The EFn.ESAT-6 recombinant protein was obtained by genetic fusion of EFn and ESAT-6 DNA. Our data shows that in the presence of PA, EFn.ESAT-6 fusion protein is internalized into the cytosol of antigen presenting cells, and the splenocytes produced both Th1 and Th2 cytokines in vitro. Further, EFn.ESAT-6 elicited effective cytotoxicT lymphocyte (CTL) response in an in vitro CTL assay. This study for the first timemore » demonstrates that EFn can be used as a vehicle to deliver heterologous proteins of therapeutic importance.« less

DNA-dependent protein kinase in nonhomologous end joining: a lock with multiple keys?

PubMed

Weterings, Eric; Chen, David J

2007-10-22

The DNA-dependent protein kinase (DNA-PK) is one of the central enzymes involved in DNA double-strand break (DSB) repair. It facilitates proper alignment of the two ends of the broken DNA molecule and coordinates access of other factors to the repair complex. We discuss the latest findings on DNA-PK phosphorylation and offer a working model for the regulation of DNA-PK during DSB repair.

Regulating DNA Self-assembly by DNA-Surface Interactions.

PubMed

Liu, Longfei; Li, Yulin; Wang, Yong; Zheng, Jianwei; Mao, Chengde

2017-12-14

DNA self-assembly provides a powerful approach for preparation of nanostructures. It is often studied in bulk solution and involves only DNA-DNA interactions. When confined to surfaces, DNA-surface interactions become an additional, important factor to DNA self-assembly. However, the way in which DNA-surface interactions influence DNA self-assembly is not well studied. In this study, we showed that weak DNA-DNA interactions could be stabilized by DNA-surface interactions to allow large DNA nanostructures to form. In addition, the assembly can be conducted isothermally at room temperature in as little as 5 seconds. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Identification of Intermediate in Hepatitis B Virus CCC DNA Formation and Sensitive and Selective CCC DNA Detection.

PubMed

Luo, Jun; Cui, Xiuji; Gao, Lu; Hu, Jianming

2017-06-21

The hepatitis B virus (HBV) covalently closed circular (CCC) DNA functions as the only viral template capable of coding for all the viral RNA species and is thus essential to initiate and sustain viral replication. CCC DNA is converted, in a multi-step and ill-understood process, from a relaxed circular (RC) DNA, in which neither of the two DNA strands is covalently closed. To detect putative intermediates during RC to CCC DNA conversion, two 3' exonucleases Exo I and Exo III, in combination were used to degrade all DNA strands with a free 3' end, which would nevertheless preserve closed circular DNA, either single-stranded (SS) or double-stranded (DS). Indeed, a RC DNA species with a covalently closed minus strand but an open plus strand (closed minus-strand RC DNA or cM-RC DNA) was detected by this approach. Further analyses indicated that at least some of the plus strands in such a putative intermediate likely still retained the RNA primer that is attached to the 5' end of the plus strand in RC DNA, suggesting that minus strand closing can occur before plus strand processing. Furthermore, the same nuclease treatment proved to be useful for sensitive and specific detection of CCC DNA by removing all DNA species other than closed circular DNA. Application of these and similar approaches may allow the identification of additional intermediates during CCC DNA formation and facilitate specific and sensitive detection of CCC DNA, which should help elucidate the pathways of CCC DNA formation and factors involved. IMPORTANCE The hepatitis B virus (HBV) covalently closed circular (CCC) DNA is the molecular basis of viral persistence, by serving as the viral transcriptional template. CCC DNA is converted, in a multi-step and ill-understood process, from a relaxed circular (RC) DNA. Little is currently understood about the pathways or factors involved in CCC DNA formation. We have now detected a likely intermediate during the conversion of RC to CCC DNA, thus providing important clues to the pathways of CCC DNA formation. Furthermore, the same experimental approach that led to the detection of the intermediate could also facilitate specific and sensitive detection of CCC DNA, which has remained challenging. This and similar approaches will help identify additional intermediates during CCC DNA formation and elucidate the pathways and factors involved. Copyright © 2017 American Society for Microbiology.

Sequence-Dependent Persistence Length of Long DNA

NASA Astrophysics Data System (ADS)

Chuang, Hui-Min; Reifenberger, Jeffrey G.; Cao, Han; Dorfman, Kevin D.

2017-12-01

Using a high-throughput genome-mapping approach, we obtained circa 50 million measurements of the extension of internal human DNA segments in a 41 nm ×41 nm nanochannel. The underlying DNA sequences, obtained by mapping to the reference human genome, are 2.5-393 kilobase pairs long and contain percent GC contents between 32.5% and 60%. Using Odijk's theory for a channel-confined wormlike chain, these data reveal that the DNA persistence length increases by almost 20% as the percent GC content increases. The increased persistence length is rationalized by a model, containing no adjustable parameters, that treats the DNA as a statistical terpolymer with a sequence-dependent intrinsic persistence length and a sequence-independent electrostatic persistence length.

Modeling the relaxation of internal DNA segments during genome mapping in nanochannels.

PubMed

Jain, Aashish; Sheats, Julian; Reifenberger, Jeffrey G; Cao, Han; Dorfman, Kevin D

2016-09-01

We have developed a multi-scale model describing the dynamics of internal segments of DNA in nanochannels used for genome mapping. In addition to the channel geometry, the model takes as its inputs the DNA properties in free solution (persistence length, effective width, molecular weight, and segmental hydrodynamic radius) and buffer properties (temperature and viscosity). Using pruned-enriched Rosenbluth simulations of a discrete wormlike chain model with circa 10 base pair resolution and a numerical solution for the hydrodynamic interactions in confinement, we convert these experimentally available inputs into the necessary parameters for a one-dimensional, Rouse-like model of the confined chain. The resulting coarse-grained model resolves the DNA at a length scale of approximately 6 kilobase pairs in the absence of any global hairpin folds, and is readily studied using a normal-mode analysis or Brownian dynamics simulations. The Rouse-like model successfully reproduces both the trends and order of magnitude of the relaxation time of the distance between labeled segments of DNA obtained in experiments. The model also provides insights that are not readily accessible from experiments, such as the role of the molecular weight of the DNA and location of the labeled segments that impact the statistical models used to construct genome maps from data acquired in nanochannels. The multi-scale approach used here, while focused towards a technologically relevant scenario, is readily adapted to other channel sizes and polymers.

Two methods for construction of internal amplification controls for the detection of Escherichia coli O157 by polymerase chain reaction.

PubMed

Abdulmawjood, A; Roth, S; Bülte, M

2002-10-01

For the detection of food born bacteria by polymerase chain reaction (PCR) in food products, an internal amplification control (IAC) is required in order to prevent false negative results that might be caused by PCR inhibitors. In the present study, two IACs were constructed using two different methods. These IACs were designed in a way that the same primer pair can be used to amplify the target DNA and coamplify the IAC. The first IAC with a size of approximately 200 bp was constructed by deleting a part of the amplicon of the original target DNA (500 bp) between the two primer sites to produce an IAC smaller than the target DNA. The second IAC with a size of approximately 600 bp was synthesized in a one step PCR reaction. The primers used in this reaction possessed 5' over-hanging ends, which were identical to the primers used in the diagnostic reaction, whereas their 3' ends were complementary to the (pUC19) predetermined DNA sequence of defined length and sequence. The concentration of IACs appeared to be critical. Too much IAC DNA template would out-compete the target DNA template, thus giving a false negative result. However the use of an optimal IAC concentration increased the reliability of the PCR assays and appeared to be useful for food diagnostics.

Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

PubMed

Clifford, Jacob; Adami, Christoph

2015-09-02

Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

pH Modulates the Binding of EGR1 Transcription Factor to DNA

PubMed Central

Mikles, David C.; Bhat, Vikas; Schuchardt, Brett J.; Deegan, Brian J.; Seldeen, Kenneth L.; McDonald, Caleb B.; Farooq, Amjad

2013-01-01

EGR1 transcription factor orchestrates a plethora of signaling cascades involved in cellular homeostasis and its down-regulation has been implicated in the development of prostate cancer. Herein, using a battery of biophysical tools, we show that the binding of EGR1 to DNA is tightly regulated by solution pH. Importantly, the binding affinity undergoes an enhancement of more than an order of magnitude with increasing pH from 5 to 8, implying that the deprotonation of an ionizable residue accounts for such behavior. This ionizable residue is identified as H382 by virtue of the fact that its substitution to non-ionizable residues abolishes pH-dependence of the binding of EGR1 to DNA. Notably, H382 inserts into the major groove of DNA and stabilizes the EGR1-DNA interaction via both hydrogen bonding and van der Waals contacts. Remarkably, H382 is predominantly conserved across other members of EGR1 family, implying that histidine protonation-deprotonation may serve as a molecular switch for modulating protein-DNA interactions central to this family of transcription factors. Collectively, our findings uncover an unexpected but a key step in the molecular recognition of EGR1 family of transcription factors and suggest that they may act as sensors of pH within the intracellular environment. PMID:23718776

Quantification of transcription factor-DNA binding affinity in a living cell

PubMed Central

Belikov, Sergey; Berg, Otto G.; Wrange, Örjan

2016-01-01

The apparent dissociation constant (Kd) for specific binding of glucocorticoid receptor (GR) and androgen receptor (AR) to DNA was determined in vivo in Xenopus oocytes. The total nuclear receptor concentration was quantified as specifically retained [3H]-hormone in manually isolated oocyte nuclei. DNA was introduced by nuclear microinjection of single stranded phagemid DNA, chromatin is then formed during second strand synthesis. The fraction of DNA sites occupied by the expressed receptor was determined by dimethylsulphate in vivo footprinting and used for calculation of the receptor-DNA binding affinity. The forkhead transcription factor FoxA1 enhanced the DNA binding by GR with an apparent Kd of ∼1 μM and dramatically stimulated DNA binding by AR with an apparent Kd of ∼0.13 μM at a composite androgen responsive DNA element containing one FoxA1 binding site and one palindromic hormone receptor binding site known to bind one receptor homodimer. FoxA1 exerted a weak constitutive- and strongly cooperative DNA binding together with AR but had a less prominent effect with GR, the difference reflecting the licensing function of FoxA1 at this androgen responsive DNA element. PMID:26657626

The Mitochondrial Transcription Factor TFAM Coordinates the Assembly of Multiple DNA Molecules into Nucleoid-like Structures

PubMed Central

Kaufman, Brett A.; Durisic, Nela; Mativetsky, Jeffrey M.; Costantino, Santiago; Hancock, Mark A.; Grutter, Peter

2007-01-01

Packaging DNA into condensed structures is integral to the transmission of genomes. The mammalian mitochondrial genome (mtDNA) is a high copy, maternally inherited genome in which mutations cause a variety of multisystem disorders. In all eukaryotic cells, multiple mtDNAs are packaged with protein into spheroid bodies called nucleoids, which are the fundamental units of mtDNA segregation. The mechanism of nucleoid formation, however, remains unknown. Here, we show that the mitochondrial transcription factor TFAM, an abundant and highly conserved High Mobility Group box protein, binds DNA cooperatively with nanomolar affinity as a homodimer and that it is capable of coordinating and fully compacting several DNA molecules together to form spheroid structures. We use noncontact atomic force microscopy, which achieves near cryo-electron microscope resolution, to reveal the structural details of protein–DNA compaction intermediates. The formation of these complexes involves the bending of the DNA backbone, and DNA loop formation, followed by the filling in of proximal available DNA sites until the DNA is compacted. These results indicate that TFAM alone is sufficient to organize mitochondrial chromatin and provide a mechanism for nucleoid formation. PMID:17581862

Seasonal variation in environmental DNA in relation to population size and environmental factors

PubMed Central

Buxton, Andrew S.; Groombridge, Jim J.; Zakaria, Nurulhuda B.; Griffiths, Richard A.

2017-01-01

Analysing DNA that organisms release into the environment (environmental DNA, or eDNA) has enormous potential for assessing rare and cryptic species. At present the method is only reliably used to assess the presence-absence of species in natural environments, as seasonal influences on eDNA in relation to presence, abundance, life stages and seasonal behaviours are poorly understood. A naturally colonised, replicated pond system was used to show how seasonal changes in eDNA were influenced by abundance of adults and larvae of great crested newts (Triturus cristatus). Peaks in eDNA were observed in early June when adult breeding was coming to an end, and between mid-July and mid-August corresponding to a peak in newt larval abundance. Changes in adult body condition associated with reproduction also influenced eDNA concentrations, as did temperature (but not rainfall or UV). eDNA concentration fell rapidly as larvae metamorphosed and left the ponds. eDNA concentration may therefore reflect relative abundance in different ponds, although environmental factors can affect the concentrations observed. Nevertheless, eDNA surveys may still represent an improvement over unadjusted counts which are widely used in population assessments but have unreliable relationships with population size. PMID:28393885

Comparative evaluation of the VERSANT HCV RNA 3.0, QUANTIPLEX HCV RNA 2.0, and COBAS AMPLICOR HCV MONITOR version 2.0 Assays for quantification of hepatitis C virus RNA in serum.

PubMed

Germer, Jeffrey J; Heimgartner, Paul J; Ilstrup, Duane M; Harmsen, W Scott; Jenkins, Greg D; Patel, Robin

2002-02-01

A comparison of quantitative results expressed in hepatitis C virus (HCV) international units per milliliter, obtained from the VERSANT HCV RNA 3.0 (bDNA-3.0) assay, the QUANTIPLEX HCV RNA 2.0 (bDNA-2.0) assay, and the COBAS AMPLICOR HCV MONITOR version 2.0 (HCM-2.0) test was performed. A total of 168 patient specimens submitted to the Mayo Clinic Molecular Microbiology Laboratory for HCV quantification or HCV genotyping were studied. Of the specimens tested, 97, 88, and 79% yielded quantitative results within the dynamic range of the bDNA-3.0, bDNA-2.0, and HCM-2.0 assays, respectively. Overall, there was substantial agreement between the results generated by all three assays. A total of 15 out of 29 (52%) of the specimens determined to contain viral loads of <31,746 IU/ml by the bDNA-3.0 assay were categorized as containing viral loads within the range of 31,746 to 500,000 IU/ml by the bDNA-2.0 assay. Although substantial agreement was noted between the results generated by the bDNA-2.0 and bDNA-3.0 assays, a bias toward higher viral titer by the bDNA-2.0 assay was noted (P = 0.001). Likewise, although substantial agreement was noted between the results generated by the HCM-2.0 and bDNA-3.0 assays, a bias toward higher viral titer by the bDNA-3.0 assay was noted (P < or = 0.001). The discrepancy between the HCM-2.0 and bDNA-3.0 results was more pronounced when viral loads were >500,000 IU/ml and resulted in statistically significant differences (P < or = 0.001) in determining whether viral loads were above or below 800,000 IU/ml of HCV RNA, the proposed threshold value for tailoring the duration of combination therapy. The expression of quantitative values in HCV international units per milliliter was a strength of both the bDNA-3.0 and HCM-2.0 assays.

Comparative Evaluation of the VERSANT HCV RNA 3.0, QUANTIPLEX HCV RNA 2.0, and COBAS AMPLICOR HCV MONITOR Version 2.0 Assays for Quantification of Hepatitis C Virus RNA in Serum

PubMed Central

Germer, Jeffrey J.; Heimgartner, Paul J.; Ilstrup, Duane M.; Harmsen, W. Scott; Jenkins, Greg D.; Patel, Robin

2002-01-01

A comparison of quantitative results expressed in hepatitis C virus (HCV) international units per milliliter, obtained from the VERSANT HCV RNA 3.0 (bDNA-3.0) assay, the QUANTIPLEX HCV RNA 2.0 (bDNA-2.0) assay, and the COBAS AMPLICOR HCV MONITOR version 2.0 (HCM-2.0) test was performed. A total of 168 patient specimens submitted to the Mayo Clinic Molecular Microbiology Laboratory for HCV quantification or HCV genotyping were studied. Of the specimens tested, 97, 88, and 79% yielded quantitative results within the dynamic range of the bDNA-3.0, bDNA-2.0, and HCM-2.0 assays, respectively. Overall, there was substantial agreement between the results generated by all three assays. A total of 15 out of 29 (52%) of the specimens determined to contain viral loads of <31,746 IU/ml by the bDNA-3.0 assay were categorized as containing viral loads within the range of 31,746 to 500,000 IU/ml by the bDNA-2.0 assay. Although substantial agreement was noted between the results generated by the bDNA-2.0 and bDNA-3.0 assays, a bias toward higher viral titer by the bDNA-2.0 assay was noted (P = 0.001). Likewise, although substantial agreement was noted between the results generated by the HCM-2.0 and bDNA-3.0 assays, a bias toward higher viral titer by the bDNA-3.0 assay was noted (P ≤ 0.001). The discrepancy between the HCM-2.0 and bDNA-3.0 results was more pronounced when viral loads were >500,000 IU/ml and resulted in statistically significant differences (P ≤ 0.001) in determining whether viral loads were above or below 800,000 IU/ml of HCV RNA, the proposed threshold value for tailoring the duration of combination therapy. The expression of quantitative values in HCV international units per milliliter was a strength of both the bDNA-3.0 and HCM-2.0 assays. PMID:11825962

Mediator MED23 Links Pigmentation and DNA Repair through the Transcription Factor MITF.

PubMed

Xia, Min; Chen, Kun; Yao, Xiao; Xu, Yichi; Yao, Jiaying; Yan, Jun; Shao, Zhen; Wang, Gang

2017-08-22

DNA repair is related to many physiological and pathological processes, including pigmentation. Little is known about the role of the transcriptional cofactor Mediator complex in DNA repair and pigmentation. Here, we demonstrate that Mediator MED23 plays an important role in coupling UV-induced DNA repair to pigmentation. The loss of Med23 specifically impairs the pigmentation process in melanocyte-lineage cells and in zebrafish. Med23 deficiency leads to enhanced nucleotide excision repair (NER) and less DNA damage following UV radiation because of the enhanced expression and recruitment of NER factors to chromatin for genomic stability. Integrative analyses of melanoma cells reveal that MED23 controls the expression of a melanocyte master regulator, Mitf, by modulating its distal enhancer activity, leading to opposing effects on pigmentation and DNA repair. Collectively, the Mediator MED23/MITF axis connects DNA repair to pigmentation, thus providing molecular insights into the DNA damage response and skin-related diseases. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Anthocyanin inhibits propidium iodide DNA fluorescence in Euphorbia pulcherrima: implications for genome size variation and flow cytometry.

PubMed

Bennett, Michael D; Price, H James; Johnston, J Spencer

2008-04-01

Measuring genome size by flow cytometry assumes direct proportionality between nuclear DNA staining and DNA amount. By 1997 it was recognized that secondary metabolites may affect DNA staining, thereby causing inaccuracy. Here experiments are reported with poinsettia (Euphorbia pulcherrima) with green leaves and red bracts rich in phenolics. DNA content was estimated as fluorescence of propidium iodide (PI)-stained nuclei of poinsettia and/or pea (Pisum sativum) using flow cytometry. Tissue was chopped, or two tissues co-chopped, in Galbraith buffer alone or with six concentrations of cyanidin-3-rutinoside (a cyanidin-3-rhamnoglucoside contributing to red coloration in poinsettia). There were large differences in PI staining (35-70 %) between 2C nuclei from green leaf and red bract tissue in poinsettia. These largely disappeared when pea leaflets were co-chopped with poinsettia tissue as an internal standard. However, smaller (2.8-6.9 %) differences remained, and red bracts gave significantly lower 1C genome size estimates (1.69-1.76 pg) than green leaves (1.81 pg). Chopping pea or poinsettia tissue in buffer with 0-200 microm cyanidin-3-rutinoside showed that the effects of natural inhibitors in red bracts of poinsettia on PI staining were largely reproduced in a dose-dependent way by this anthocyanin. Given their near-ubiquitous distribution, many suspected roles and known affects on DNA staining, anthocyanins are a potent, potential cause of significant error variation in genome size estimations for many plant tissues and taxa. This has important implications of wide practical and theoretical significance. When choosing genome size calibration standards it seems prudent to select materials producing little or no anthocyanin. Reviewing the literature identifies clear examples in which claims of intraspecific variation in genome size are probably artefacts caused by natural variation in anthocyanin levels or correlated with environmental factors known to induce variation in pigmentation.

Ordered Conformational Changes in Damaged DNA Induced by Nucleotide Excision Repair Factors*

PubMed Central

Tapias, Angels; Auriol, Jerome; Forget, Diane; Enzlin, Jacqueline H.; Schärer, Orlando D; Coin, Frederic; Coulombe, Benoit; Egly, Jean-Marc

2015-01-01

In response to genotoxic attacks, cells activate sophisticated DNA repair pathways such as nucleotide excision repair (NER), which consists of damage removal via dual incision and DNA resynthesis. Using permanganate footprinting as well as highly purified factors, we show that NER is a dynamic process that takes place in a number of successive steps during which the DNA is remodeled around the lesion in response to the various NER factors. XPC/HR23B first recognizes the damaged structure and initiates the opening of the helix from position −3 to +6. TFIIH is then recruited and, in the presence of ATP, extends the opening from position −6 to +6; it also displaces XPC downstream from the lesion, thereby providing the topological structure for recruiting XPA and RPA, which will enlarge the opening. Once targeted by XPG, the damaged DNA is further melted from position −19 to +8. XPG and XPF/ERCC1 endo-nucleases then cut the damaged DNA at the limit of the opened structure that was previously “labeled” by the positioning of XPC/HR23B and TFIIH. PMID:14981083

Involvement of oxidatively damaged DNA and repair in cancer development and aging

PubMed Central

Tudek, Barbara; Winczura, Alicja; Janik, Justyna; Siomek, Agnieszka; Foksinski, Marek; Oliński, Ryszard

2010-01-01

DNA damage and DNA repair may mediate several cellular processes, like replication and transcription, mutagenesis and apoptosis and thus may be important factors in the development and pathology of an organism, including cancer. DNA is constantly damaged by reactive oxygen species (ROS) and reactive nitrogen species (RNS) directly and also by products of lipid peroxidation (LPO), which form exocyclic adducts to DNA bases. A wide variety of oxidatively-generated DNA lesions are present in living cells. 8-oxoguanine (8-oxoGua) is one of the best known DNA lesions due to its mutagenic properties. Among LPO-derived DNA base modifications the most intensively studied are ethenoadenine and ethenocytosine, highly miscoding DNA lesions considered as markers of oxidative stress and promutagenic DNA damage. Although at present it is impossible to directly answer the question concerning involvement of oxidatively damaged DNA in cancer etiology, it is likely that oxidatively modified DNA bases may serve as a source of mutations that initiate carcinogenesis and are involved in aging (i.e. they may be causal factors responsible for these processes). To counteract the deleterious effect of oxidatively damaged DNA, all organisms have developed several DNA repair mechanisms. The efficiency of oxidatively damaged DNA repair was frequently found to be decreased in cancer patients. The present work reviews the basis for the biological significance of DNA damage, particularly effects of 8-oxoGua and ethenoadduct occurrence in DNA in the aspect of cancer development, drawing attention to the multiplicity of proteins with repair activities. PMID:20589166

Ex vivo study for the assessment of behavioral factor and gene polymorphisms in individual susceptibility to oxidative DNA damage metals-induced.

PubMed

Di Pietro, Angela; Baluce, Barbara; Visalli, Giuseppa; La Maestra, Sebastiano; Micale, Rosanna; Izzotti, Alberto

2011-06-01

Transition metals in fine particulate matter generated by combustion induce oxidative DNA damage and inflammation. However, there is remarkable inter-individual variability in susceptibility to these damages. To assess this variability, an ex vivo study was performed using lymphocytes of 47 Caucasian healthy subjects. Cell samples were exposed to a water solution of oil fly ash (OFA). This was formed by the distinctive transition metals vanadium, iron, and nickel. Oxidative DNA damage was evaluated by testing cell viability, intracellular ROS production and 8-oxo-dG. DNA fragmentation and DNA repair capacity were assessed by using the Alkaline-Halo assay. GSTM1, GSTT1, hOGG1, and C677T and A1298C MTHFR gene polymorphisms were tested. Demographic and behavioral factors, collected by questionnaire, were also considered. OFA induced damages showed: (a) a 20-fold variation in range among different subjects in ROS production, (b) a 7-fold variation in range of 8-oxo-dG, and (c) a 25-fold variation in range in DNA repair capacity. A significant increase in DNA damage was detected in GSTT1-deficent subjects compared with wild type genotype carriers. Increases in cytoplasmic ROS and decreases in DNA repair capacity (P<0.05) were observed in C677T and A1298C variants of MTHFR. A remarkable protective effect of high fruits and vegetable intake was observed for ROS production and DNA damage. Conversely, an adverse effect of meat intake was observed on ROS increase, DNA damage and repair capacity, probably due to the increased intake of bioavailable iron. Smoking decreased DNA repair capacity, while age increased OFA-induced DNA damage. The wide comparative analysis of the complex interactions network, between genetic and behavioral factors provides evidence of the remarkable role of several lifestyle factors. In comparison to genetic polymorphisms they seem to have a higher weight in determining individual susceptibility to the adverse effects of airborne pollutants as transition metals. Copyright © 2011 Elsevier GmbH. All rights reserved.

Preconcentration of DNA using magnetic ionic liquids that are compatible with real-time PCR for rapid nucleic acid quantification.

PubMed

Emaus, Miranda N; Clark, Kevin D; Hinners, Paige; Anderson, Jared L

2018-04-28

Nucleic acid extraction and purification represents a major bottleneck in DNA analysis. Traditional methods for DNA purification often require reagents that may inhibit quantitative polymerase chain reaction (qPCR) if not sufficiently removed from the sample. Approaches that employ magnetic beads may exhibit lower extraction efficiencies due to sedimentation and aggregation. In this study, four hydrophobic magnetic ionic liquids (MILs) were investigated as DNA extraction solvents with the goal of improving DNA enrichment factors and compatibility with downstream bioanalytical techniques. By designing custom qPCR buffers, we directly incorporated DNA-enriched MILs including trihexyl(tetradecyl)phosphonium tris(hexafluoroacetylaceto)nickelate(II) ([P 6,6,6,14 + ][Ni(hfacac) 3 - ]), [P 6,6,6,14 + ] tris(hexafluoroacetylaceto)colbaltate(II) ([Co(hfacac) 3 - ]), [P 6,6,6,14 + ] tris(hexafluoroacetylaceto)manganate(II) ([Mn(hfacac) 3 - ]), or [P 6,6,6,14 + ] tetrakis(hexafluoroacetylaceto)dysprosate(III) ([Dy(hfacac) 4 - ]) into reaction systems, thereby circumventing the need for time-consuming DNA recovery steps. Incorporating MILs into the reaction buffer did not significantly impact the amplification efficiency of the reaction (91.1%). High enrichment factors were achieved using the [P 6,6,6,14 + ][Ni(hfacac) 3 - ] MIL for the extraction of single-stranded and double-stranded DNA with extraction times as short as 2 min. When compared to a commercial magnetic bead-based platform, the [P 6,6,6,14 + ][Ni(hfacac) 3 - ] MIL was capable of producing higher enrichment factors for single-stranded DNA and similar enrichment factors for double-stranded DNA. The MIL-based method was applied for the extraction and direct qPCR amplification of mutation prone-KRAS oncogene fragment in plasma samples. Graphical abstract Magnetic ionic liquid solvents are shown to preconcentrate sufficient KRAS DNA template from an aqueous solution in as short as 2 min without using chaotropic salts or toxic organic solvents. By using custom-designed qPCR buffers, DNA can be directly amplified and quantified from four MILs examined in this study.

Road to Silicon Microsphere Fabrication and Mode Coupling

DTIC Science & Technology

2014-07-01

from optical fiber onto a microsphere in whispering gallery mode (courtesy of B. Butkus, Biophotonics International [2...Butkus, Biophotonics International [5]). 2 BACKGROUND SILICON MICROSPHERE FABRICATION METHODS Processes for forming spherical structures exist in...Sensitive DNA Detection.” October 2003. Biophotonics International. http://www.rowland.org/rjf/vollmer/images/biophotonics.pdf [6] James E. McDonald

The International Neuroblastoma Risk Group (INRG) Classification System: An INRG Task Force Report

PubMed Central

Cohn, Susan L.; Pearson, Andrew D.J.; London, Wendy B.; Monclair, Tom; Ambros, Peter F.; Brodeur, Garrett M.; Faldum, Andreas; Hero, Barbara; Iehara, Tomoko; Machin, David; Mosseri, Veronique; Simon, Thorsten; Garaventa, Alberto; Castel, Victoria; Matthay, Katherine K.

2009-01-01

Purpose Because current approaches to risk classification and treatment stratification for children with neuroblastoma (NB) vary greatly throughout the world, it is difficult to directly compare risk-based clinical trials. The International Neuroblastoma Risk Group (INRG) classification system was developed to establish a consensus approach for pretreatment risk stratification. Patients and Methods The statistical and clinical significance of 13 potential prognostic factors were analyzed in a cohort of 8,800 children diagnosed with NB between 1990 and 2002 from North America and Australia (Children's Oncology Group), Europe (International Society of Pediatric Oncology Europe Neuroblastoma Group and German Pediatric Oncology and Hematology Group), and Japan. Survival tree regression analyses using event-free survival (EFS) as the primary end point were performed to test the prognostic significance of the 13 factors. Results Stage, age, histologic category, grade of tumor differentiation, the status of the MYCN oncogene, chromosome 11q status, and DNA ploidy were the most highly statistically significant and clinically relevant factors. A new staging system (INRG Staging System) based on clinical criteria and tumor imaging was developed for the INRG Classification System. The optimal age cutoff was determined to be between 15 and 19 months, and 18 months was selected for the classification system. Sixteen pretreatment groups were defined on the basis of clinical criteria and statistically significantly different EFS of the cohort stratified by the INRG criteria. Patients with 5-year EFS more than 85%, more than 75% to ≤ 85%, ≥ 50% to ≤ 75%, or less than 50% were classified as very low risk, low risk, intermediate risk, or high risk, respectively. Conclusion By defining homogenous pretreatment patient cohorts, the INRG classification system will greatly facilitate the comparison of risk-based clinical trials conducted in different regions of the world and the development of international collaborative studies. PMID:19047291

Hide and seek: How do DNA glycosylases locate oxidatively damaged DNA bases amidst a sea of undamaged bases?

PubMed

Lee, Andrea J; Wallace, Susan S

2017-06-01

The first step of the base excision repair (BER) pathway responsible for removing oxidative DNA damage utilizes DNA glycosylases to find and remove the damaged DNA base. How glycosylases find the damaged base amidst a sea of undamaged bases has long been a question in the BER field. Single molecule total internal reflection fluorescence microscopy (SM TIRFM) experiments have allowed for an exciting look into this search mechanism and have found that DNA glycosylases scan along the DNA backbone in a bidirectional and random fashion. By comparing the search behavior of bacterial glycosylases from different structural families and with varying substrate specificities, it was found that glycosylases search for damage by periodically inserting a wedge residue into the DNA stack as they redundantly search tracks of DNA that are 450-600bp in length. These studies open up a wealth of possibilities for further study in real time of the interactions of DNA glycosylases and other BER enzymes with various DNA substrates. Copyright © 2016 Elsevier Inc. All rights reserved.

UK NHS pilot study on cell-free DNA testing in screening for fetal trisomies: factors affecting uptake.

PubMed

Gil, M M; Giunta, G; Macalli, E A; Poon, L C; Nicolaides, K H

2015-01-01

This study reports on the clinical implementation of cell-free DNA (cfDNA) testing, contingent on the results of the combined test, in screening for fetal trisomies 21, 18 and 13 in two UK National Health Service hospitals. Women with a combined-test risk of ≥ 1:100 (high risk) were offered the options of chorionic villus sampling (CVS), cfDNA testing or no further testing and those with a risk of 1:101 to 1:2500 (intermediate risk) were offered cfDNA or no further testing. The objective of the study was to examine the factors affecting patient decisions concerning their options. Combined screening was performed in 6651 singleton pregnancies in which the risk for trisomies was high in 260 (3.9%), intermediate in 2017 (30.3%) and low in 4374 (65.8%). Logistic regression analysis was used to determine which factors among maternal characteristics, fetal nuchal translucency thickness (NT) and risk for trisomies were significant predictors of opting for CVS in the high-risk group and opting for cfDNA testing in the intermediate-risk group. In the high-risk group, 104 (40.0%) women opted for CVS; predictors for CVS were increasing fetal NT and increasing risk for trisomies, while the predictor against CVS was being of Afro-Caribbean racial origin (r = 0.366). In the intermediate-risk group, 1850 (91.7%) women opted for cfDNA testing; predictors for cfDNA testing were increasing maternal age, increasing risk for trisomies and university education, while predictors against cfDNA testing were being of Afro-Caribbean racial origin, smoking and being parous (r = 0.105). This study has identified factors that can influence the decision of women undergoing combined screening in favor of or against CVS and in favor of or against cfDNA testing. Copyright © 2014 ISUOG. Published by John Wiley & Sons Ltd.

Accumulation of p21 proteins at DNA damage sites independent of p53 and core NHEJ factors following irradiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Koike, Manabu, E-mail: m_koike@nirs.go.jp; Yutoku, Yasutomo; Graduate School of Science, Chiba University, Chiba 263-8522

2011-08-19

Highlights: {yields} p21 accumulated rapidly at laser-irradiated sites via its C-terminal region. {yields} p21 colocalized with the DSB marker {gamma}-H2AX and the DSB sensor Ku80. {yields} Accumulation of p21 is dependent on PCNA, but not p53 and the NHEJ core factors. {yields} Accumulation activity of p21 was conserved among human and animal cells. {yields} p21 is a useful tool as a detection marker of DNA damaged sites. -- Abstract: The cyclin-dependent kinase (CDK) inhibitor p21 plays key roles in p53-dependent DNA-damage responses, i.e., cell cycle checkpoints, senescence, or apoptosis. p21 might also play a role in DNA repair. p21 focimore » arise at heavy-ion-irradiated DNA-double-strand break (DSB) sites, which are mainly repaired by nonhomologous DNA-end-joining (NHEJ). However, no mechanisms of p21 accumulation at double-strand break (DSB) sites have been clarified in detail. Recent works indicate that Ku70 and Ku80 are essential for the accumulation of other NHEJ core factors, e.g., DNA-PKcs, XRCC4 and XLF, and other DNA damage response factors, e.g., BRCA1. Here, we show that p21 foci arise at laser-irradiated sites in cells from various tissues from various species. The accumulation of EGFP-p21 was detected in not only normal cells, but also transformed or cancer cells. Our results also showed that EGFP-p21 accumulated rapidly at irradiated sites, and colocalized with the DSB marker {gamma}-H2AX and with the DSB sensor protein Ku80. On the other hand, the accumulation occurred in Ku70-, Ku80-, or DNA-PKcs-deficient cell lines and in human papillomavirus 18-positive cells, whereas the p21 mutant without the PCNA-binding region (EGFP-p21(1-146)) failed to accumulate at the irradiated sites. These findings suggest that the accumulation of p21, but not functional p53 and the NHEJ core factors, is dependent on PCNA. These findings also suggest that the accumulation activity of p21 at DNA damaged sites is conserved among human and animal cells, and p21 is a useful tool as a detection marker of DNA damaged sites.« less

Stimulation of ribosomal RNA gene promoter by transcription factor Sp1 involves active DNA demethylation by Gadd45-NER pathway.

PubMed

Rajput, Pallavi; Pandey, Vijaya; Kumar, Vijay

2016-08-01

The well-studied Pol II transcription factor Sp1 has not been investigated for its regulatory role in rDNA transcription. Here, we show that Sp1 bound to specific sites on rDNA and localized into the nucleoli during the G1 phase of cell cycle to activate rDNA transcription. It facilitated the recruitment of Pol I pre-initiation complex and impeded the binding of nucleolar remodeling complex (NoRC) to rDNA resulting in the formation of euchromatin active state. More importantly, Sp1 also orchestrated the site-specific binding of Gadd45a-nucleotide excision repair (NER) complex resulting in active demethylation and transcriptional activation of rDNA. Interestingly, knockdown of Sp1 impaired rDNA transcription due to reduced engagement of the Gadd45a-NER complex and hypermethylation of rDNA. Thus, the present study unveils a novel role of Sp1 in rDNA transcription involving promoter demethylation. Copyright © 2016 Elsevier B.V. All rights reserved.

Tyrosyl-DNA Phosphodiesterase I a critical survival factor for neuronal development and homeostasis

PubMed Central

van Waardenburg, Robert C.A.M.

2016-01-01

Tyrosyl-DNA phosphodiesterase I (TDP1), like most DNA repair associated proteins, is not essential for cell viability. However, dysfunctioning TDP1 or ATM (ataxia telangiectasia mutated) results in autosomal recessive neuropathology with similar phenotypes, including cerebellar atrophy. Dual inactivation of TDP1 and ATM causes synthetic lethality. A TDP1H493R catalytic mutant is associated with spinocerebellar ataxia with axonal neuropathy (SCAN1), and stabilizes the TDP1 catalytic obligatory enzyme-DNA covalent complex. The ATM kinase activates proteins early on in response to DNA damage. Tdp1−/− and Atm−/− mice exhibit accumulation of DNA topoisomerase I-DNA covalent complexes (TOPO1-cc) explicitly in neuronal tissue during development. TDP1 resolves 3’- and 5’-DNA adducts including trapped TOPO1-cc and TOPO1 protease resistant peptide-DNA complex. ATM appears to regulate the response to TOPO1-cc via a noncanonical function by regulating SUMO/ubiquitin-mediated TOPO1 degradation. In conclusion, TDP1 and ATM are critical factors for neuronal cell viability via two independent but cooperative pathways. PMID:27747316

Tyrosyl-DNA Phosphodiesterase I a critical survival factor for neuronal development and homeostasis.

PubMed

van Waardenburg, Robert C A M

2016-01-01

Tyrosyl-DNA phosphodiesterase I (TDP1), like most DNA repair associated proteins, is not essential for cell viability. However, dysfunctioning TDP1 or ATM (ataxia telangiectasia mutated) results in autosomal recessive neuropathology with similar phenotypes, including cerebellar atrophy. Dual inactivation of TDP1 and ATM causes synthetic lethality. A TDP1H 493 R catalytic mutant is associated with spinocerebellar ataxia with axonal neuropathy (SCAN1), and stabilizes the TDP1 catalytic obligatory enzyme-DNA covalent complex. The ATM kinase activates proteins early on in response to DNA damage. Tdp1-/- and Atm-/- mice exhibit accumulation of DNA topoisomerase I-DNA covalent complexes (TOPO1-cc) explicitly in neuronal tissue during development. TDP1 resolves 3'- and 5'-DNA adducts including trapped TOPO1-cc and TOPO1 protease resistant peptide-DNA complex. ATM appears to regulate the response to TOPO1-cc via a noncanonical function by regulating SUMO/ubiquitin-mediated TOPO1 degradation. In conclusion, TDP1 and ATM are critical factors for neuronal cell viability via two independent but cooperative pathways.

RNA/DNA Hybrid Interactome Identifies DXH9 as a Molecular Player in Transcriptional Termination and R-Loop-Associated DNA Damage.

PubMed

Cristini, Agnese; Groh, Matthias; Kristiansen, Maiken S; Gromak, Natalia

2018-05-08

R-loops comprise an RNA/DNA hybrid and displaced single-stranded DNA. They play important biological roles and are implicated in pathology. Even so, proteins recognizing these structures are largely undefined. Using affinity purification with the S9.6 antibody coupled to mass spectrometry, we defined the RNA/DNA hybrid interactome in HeLa cells. This consists of known R-loop-associated factors SRSF1, FACT, and Top1, and yet uncharacterized interactors, including helicases, RNA processing, DNA repair, and chromatin factors. We validate specific examples of these interactors and characterize their involvement in R-loop biology. A top candidate DHX9 helicase promotes R-loop suppression and transcriptional termination. DHX9 interacts with PARP1, and both proteins prevent R-loop-associated DNA damage. DHX9 and other interactome helicases are overexpressed in cancer, linking R-loop-mediated DNA damage and disease. Our RNA/DNA hybrid interactome provides a powerful resource to study R-loop biology in health and disease. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

A New Three-Dimensional Educational Model Kit for Building DNA and RNA Molecules: Development and Evaluation

ERIC Educational Resources Information Center

Beltramini, Leila Maria; Araujo, Ana Paula Ulian; de Oliveira, Tales Henrique Goncalves; dos Santos Abel, Luciano Douglas; da Silva, Aparecido Rodrigues; dos Santos, Neusa Fernandes

2006-01-01

International specialized literature focused on research in biology education is sadly scarce, especially regarding biochemical and molecular aspects. In this light, researchers from this Centre for Structural Molecular Biotechnology developed and evaluated a three-dimensional educational model named "Building Life Molecules DNA and RNA." The…

Phylogeographic patterns of Armillaria ostoyae in the western United States

Treesearch

J. W. Hanna; N. B. Klopfenstein; M. -S. Kim; G. I. McDonald; J. A. Moore

2007-01-01

Nuclear ribosomal DNA regions (i.e. large subunit, internal transcribed spacer, 5.8S and intergenic spacer) were sequenced using a direct-polymerase chain reaction method from Armillaria ostoyae genets collected from the western USA. Many of the A. ostoyae genets contained heterogeneity among rDNA repeats, indicating intragenomic variation and likely intraspecific...

Replication protein A: directing traffic at the intersection of replication and repair.

PubMed

Oakley, Greg G; Patrick, Steve M

2010-06-01

Since the initial discovery of replication protein A (RPA) as a DNA replication factor, much progress has been made on elucidating critical roles for RPA in other DNA metabolic pathways. RPA has been shown to be required for DNA replication, DNA repair, DNA recombination, and the DNA damage response pathway with roles in checkpoint activation. This review summarizes the current understanding of RPA structure, phosphorylation and protein-protein interactions in mediating these DNA metabolic processes.

Cryptic MCAT enhancer regulation in fibroblasts and smooth muscle cells. Suppression of TEF-1 mediated activation by the single-stranded DNA-binding proteins, Pur alpha, Pur beta, and MSY1.

PubMed

Carlini, Leslie E; Getz, Michael J; Strauch, Arthur R; Kelm, Robert J

2002-03-08

An asymmetric polypurine-polypyrimidine cis-element located in the 5' region of the mouse vascular smooth muscle alpha-actin gene serves as a binding site for multiple proteins with specific affinity for either single- or double-stranded DNA. Here, we test the hypothesis that single-stranded DNA-binding proteins are responsible for preventing a cryptic MCAT enhancer centered within this element from cooperating with a nearby serum response factor-interacting CArG motif to trans-activate the minimal promoter in fibroblasts and smooth muscle cells. DNA binding studies revealed that the core MCAT sequence mediates binding of transcription enhancer factor-1 to the double-stranded polypurine-polypyrimidine element while flanking nucleotides account for interaction of Pur alpha and Pur beta with the purine-rich strand and MSY1 with the complementary pyrimidine-rich strand. Mutations that selectively impaired high affinity single-stranded DNA binding by fibroblast or smooth muscle cell-derived Pur alpha, Pur beta, and MSY1 in vitro, released the cryptic MCAT enhancer from repression in transfected cells. Additional experiments indicated that Pur alpha, Pur beta, and MSY1 also interact specifically, albeit weakly, with double-stranded DNA and with transcription enhancer factor-1. These results are consistent with two plausible models of cryptic MCAT enhancer regulation by Pur alpha, Pur beta, and MSY1 involving either competitive single-stranded DNA binding or masking of MCAT-bound transcription enhancer factor-1.

Transcription Factor RFX1 Is Crucial for Maintenance of Genome Integrity in Fusarium graminearum

PubMed Central

Min, Kyunghun; Son, Hokyoung; Lim, Jae Yun; Choi, Gyung Ja; Kim, Jin-Cheol; Harris, Steven D.

2014-01-01

The survival of cellular organisms depends on the faithful replication and transmission of DNA. Regulatory factor X (RFX) transcription factors are well conserved in animals and fungi, but their functions are diverse, ranging from the DNA damage response to ciliary gene regulation. We investigated the role of the sole RFX transcription factor, RFX1, in the plant-pathogenic fungus Fusarium graminearum. Deletion of rfx1 resulted in multiple defects in hyphal growth, conidiation, virulence, and sexual development. Deletion mutants of rfx1 were more sensitive to various types of DNA damage than the wild-type strain. Septum formation was inhibited and micronuclei were produced in the rfx1 deletion mutants. The results of the neutral comet assay demonstrated that disruption of rfx1 function caused spontaneous DNA double-strand breaks (DSBs). The transcript levels of genes involved in DNA DSB repair were upregulated in the rfx1 deletion mutants. DNA DSBs produced micronuclei and delayed septum formation in F. graminearum. Green fluorescent protein (GFP)-tagged RFX1 localized in nuclei and exhibited high expression levels in growing hyphae and conidiophores, where nuclear division was actively occurring. RNA-sequencing-based transcriptomic analysis revealed that RFX1 suppressed the expression of many genes, including those required for the repair of DNA damage. Taken together, these findings indicate that the transcriptional repressor rfx1 performs crucial roles during normal cell growth by maintaining genome integrity. PMID:24465002

Genome-wide DNA methylation measurements in prostate tissues uncovers novel prostate cancer diagnostic biomarkers and transcription factor binding patterns.

PubMed

Kirby, Marie K; Ramaker, Ryne C; Roberts, Brian S; Lasseigne, Brittany N; Gunther, David S; Burwell, Todd C; Davis, Nicholas S; Gulzar, Zulfiqar G; Absher, Devin M; Cooper, Sara J; Brooks, James D; Myers, Richard M

2017-04-17

Current diagnostic tools for prostate cancer lack specificity and sensitivity for detecting very early lesions. DNA methylation is a stable genomic modification that is detectable in peripheral patient fluids such as urine and blood plasma that could serve as a non-invasive diagnostic biomarker for prostate cancer. We measured genome-wide DNA methylation patterns in 73 clinically annotated fresh-frozen prostate cancers and 63 benign-adjacent prostate tissues using the Illumina Infinium HumanMethylation450 BeadChip array. We overlaid the most significantly differentially methylated sites in the genome with transcription factor binding sites measured by the Encyclopedia of DNA Elements consortium. We used logistic regression and receiver operating characteristic curves to assess the performance of candidate diagnostic models. We identified methylation patterns that have a high predictive power for distinguishing malignant prostate tissue from benign-adjacent prostate tissue, and these methylation signatures were validated using data from The Cancer Genome Atlas Project. Furthermore, by overlaying ENCODE transcription factor binding data, we observed an enrichment of enhancer of zeste homolog 2 binding in gene regulatory regions with higher DNA methylation in malignant prostate tissues. DNA methylation patterns are greatly altered in prostate cancer tissue in comparison to benign-adjacent tissue. We have discovered patterns of DNA methylation marks that can distinguish prostate cancers with high specificity and sensitivity in multiple patient tissue cohorts, and we have identified transcription factors binding in these differentially methylated regions that may play important roles in prostate cancer development.

A "turn-on" fluorescent copper biosensor based on DNA cleavage-dependent graphene-quenched DNAzyme.

PubMed

Liu, Meng; Zhao, Huimin; Chen, Shuo; Yu, Hongtao; Zhang, Yaobin; Quan, Xie

2011-06-15

A novel and promising "turn-on" fluorescent Cu(2+) biosensor is designed based on graphene-DNAzyme catalytic beacon. Due to the essential surface and quenching properties of two-dimensional graphene, it can function as both "scaffold" and "quencher" of the Cu(2+)-dependent DNAzyme, facilitating the formation of self-assembled graphene-quenched DNAzyme complex. However, Cu(2+)-induced catalytic reaction disturbs the graphene-DNAzyme conformation, which will produce internal DNA cleavage-dependent effect. In this case, the quenched fluorescence in graphene-DNAzyme is quickly recovered to a large extent in 15 min. Compared with common DNAzyme-based sensors, the presented graphene-based catalytic beacon greatly improves the signal-to-background ratio, hence increasing the sensitivity (LOD=0.365 nM). Furthermore, the controllable DNA cleavage reaction provides an original and alternative internal method to regulate the interaction between graphene and DNA relative to the previous external sequence-specific hybridization-dependent regulation, which will open new opportunities for nucleic studies and sensing applications in the future. Copyright © 2011 Elsevier B.V. All rights reserved.

Internal twisting motion dependent conductance of an aperiodic DNA molecule

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

Designing easy DNA extraction: Teaching creativity through laboratory practice.

PubMed

Susantini, Endang; Lisdiana, Lisa; Isnawati; Tanzih Al Haq, Aushia; Trimulyono, Guntur

2017-05-01

Subject material concerning Deoxyribose Nucleic Acid (DNA) structure in the format of creativity-driven laboratory practice offers meaningful learning experience to the students. Therefore, a laboratory practice in which utilizes simple procedures and easy-safe-affordable household materials should be promoted to students to develop their creativity. This study aimed to examine whether designing and conducting DNA extraction with household materials could foster students' creative thinking. We also described how this laboratory practice affected students' knowledge and views. A total of 47 students participated in this study. These students were grouped and asked to utilize available household materials and modify procedures using hands-on worksheet. Result showed that this approach encouraged creative thinking as well as improved subject-related knowledge. Students also demonstrated positive views about content knowledge, social skills, and creative thinking skills. This study implies that extracting DNA with household materials is able to develop content knowledge, social skills, and creative thinking of the students. © 2016 by The International Union of Biochemistry and Molecular Biology, 45(3):216-225, 2017. © 2016 The International Union of Biochemistry and Molecular Biology.

Accurate Prediction of Inducible Transcription Factor Binding Intensities In Vivo

PubMed Central

Siepel, Adam; Lis, John T.

2012-01-01

DNA sequence and local chromatin landscape act jointly to determine transcription factor (TF) binding intensity profiles. To disentangle these influences, we developed an experimental approach, called protein/DNA binding followed by high-throughput sequencing (PB–seq), that allows the binding energy landscape to be characterized genome-wide in the absence of chromatin. We applied our methods to the Drosophila Heat Shock Factor (HSF), which inducibly binds a target DNA sequence element (HSE) following heat shock stress. PB–seq involves incubating sheared naked genomic DNA with recombinant HSF, partitioning the HSF–bound and HSF–free DNA, and then detecting HSF–bound DNA by high-throughput sequencing. We compared PB–seq binding profiles with ones observed in vivo by ChIP–seq and developed statistical models to predict the observed departures from idealized binding patterns based on covariates describing the local chromatin environment. We found that DNase I hypersensitivity and tetra-acetylation of H4 were the most influential covariates in predicting changes in HSF binding affinity. We also investigated the extent to which DNA accessibility, as measured by digital DNase I footprinting data, could be predicted from MNase–seq data and the ChIP–chip profiles for many histone modifications and TFs, and found GAGA element associated factor (GAF), tetra-acetylation of H4, and H4K16 acetylation to be the most predictive covariates. Lastly, we generated an unbiased model of HSF binding sequences, which revealed distinct biophysical properties of the HSF/HSE interaction and a previously unrecognized substructure within the HSE. These findings provide new insights into the interplay between the genomic sequence and the chromatin landscape in determining transcription factor binding intensity. PMID:22479205

The Regulatory Interactions of p21 and PCNA in Human Breast Cancer

DTIC Science & Technology

2002-07-01

Proliferating cell nuclear antigen (PCNA) is a multifunctional enzyme involved in multiple cellular processes including DNA replication and repair...During DNA replication , PCNA function as an accessory factor- for the DNA polymerases E arid and are part of a multiprotein DNA replication complex...a cyclin-dependent kinase inhibitor, p21WAF1 ability to inhibit DNA replication in response to DNA damage has been wall characterized. Interestingly

Two-step interrogation then recognition of DNA binding site by Integration Host Factor: an architectural DNA-bending protein.

PubMed

Velmurugu, Yogambigai; Vivas, Paula; Connolly, Mitchell; Kuznetsov, Serguei V; Rice, Phoebe A; Ansari, Anjum

2018-02-28

The dynamics and mechanism of how site-specific DNA-bending proteins initially interrogate potential binding sites prior to recognition have remained elusive for most systems. Here we present these dynamics for Integration Host factor (IHF), a nucleoid-associated architectural protein, using a μs-resolved T-jump approach. Our studies show two distinct DNA-bending steps during site recognition by IHF. While the faster (∼100 μs) step is unaffected by changes in DNA or protein sequence that alter affinity by >100-fold, the slower (1-10 ms) step is accelerated ∼5-fold when mismatches are introduced at DNA sites that are sharply kinked in the specific complex. The amplitudes of the fast phase increase when the specific complex is destabilized and decrease with increasing [salt], which increases specificity. Taken together, these results indicate that the fast phase is non-specific DNA bending while the slow phase, which responds only to changes in DNA flexibility at the kink sites, is specific DNA kinking during site recognition. Notably, the timescales for the fast phase overlap with one-dimensional diffusion times measured for several proteins on DNA, suggesting that these dynamics reflect partial DNA bending during interrogation of potential binding sites by IHF as it scans DNA.

Trigger Factor and DnaK possess overlapping substrate pools and binding specificities.

PubMed

Deuerling, Elke; Patzelt, Holger; Vorderwülbecke, Sonja; Rauch, Thomas; Kramer, Günter; Schaffitzel, Elke; Mogk, Axel; Schulze-Specking, Agnes; Langen, Hanno; Bukau, Bernd

2003-03-01

Ribosome-associated Trigger Factor (TF) and the DnaK chaperone system assist the folding of newly synthesized proteins in Escherichia coli. Here, we show that DnaK and TF share a common substrate pool in vivo. In TF-deficient cells, deltatig, depleted for DnaK and DnaJ the amount of aggregated proteins increases with increasing temperature, amounting to 10% of total soluble protein (approximately 340 protein species) at 37 degrees C. A similar population of proteins aggregated in DnaK depleted tig+ cells, albeit to a much lower extent. Ninety-four aggregated proteins isolated from DnaK- and DnaJ-depleted deltatig cells were identified by mass spectrometry and found to include essential cytosolic proteins. Four potential in vivo substrates were screened for chaperone binding sites using peptide libraries. Although TF and DnaK recognize different binding motifs, 77% of TF binding peptides also associated with DnaK. In the case of the nascent polypeptides TF and DnaK competed for binding, however, with competitive advantage for TF. In vivo, the loss of TF is compensated by the induction of the heat shock response and thus enhanced levels of DnaK. In summary, our results demonstrate that the co-operation of the two mechanistically distinct chaperones in protein folding is based on their overlap in substrate specificities.

Interplay of space radiation and microgravity in DNA damage and DNA damage response.

PubMed

Moreno-Villanueva, María; Wong, Michael; Lu, Tao; Zhang, Ye; Wu, Honglu

2017-01-01

In space, multiple unique environmental factors, particularly microgravity and space radiation, pose constant threat to the DNA integrity of living organisms. Specifically, space radiation can cause damage to DNA directly, through the interaction of charged particles with the DNA molecules themselves, or indirectly through the production of free radicals. Although organisms have evolved strategies on Earth to confront such damage, space environmental conditions, especially microgravity, can impact DNA repair resulting in accumulation of severe DNA lesions. Ultimately these lesions, namely double strand breaks, chromosome aberrations, micronucleus formation, or mutations, can increase the risk for adverse health effects, such as cancer. How spaceflight factors affect DNA damage and the DNA damage response has been investigated since the early days of the human space program. Over the years, these experiments have been conducted either in space or using ground-based analogs. This review summarizes the evidence for DNA damage induction by space radiation and/or microgravity as well as spaceflight-related impacts on the DNA damage response. The review also discusses the conflicting results from studies aimed at addressing the question of potential synergies between microgravity and radiation with regard to DNA damage and cellular repair processes. We conclude that further experiments need to be performed in the true space environment in order to address this critical question.

Real-Time PCR with an Internal Control for Detection of All Known Human Adenovirus Serotypes▿

PubMed Central

Damen, Marjolein; Minnaar, René; Glasius, Patricia; van der Ham, Alwin; Koen, Gerrit; Wertheim, Pauline; Beld, Marcel

2008-01-01

The “gold standard” for the diagnosis of adenovirus (AV) infection is virus culture, which is rather time-consuming. Especially for immunocompromised patients, in whom severe infections with AV have been described, rapid diagnosis is important. Therefore, an internally controlled AV real-time PCR assay detecting all known human AV serotypes was developed. Primers were chosen from the hexon region, which is the most conserved region, and in order to cover all known serotypes, degenerate primers were used. The internal control (IC) DNA contained the same primer binding sites as the AV DNA control but had a shuffled probe region compared to the conserved 24-nucleotide consensus AV hexon probe region (the target). The IC DNA was added to the clinical sample in order to monitor extraction and PCR efficiency. The sensitivity and the linearity of the AV PCR were determined. For testing the specificity of this PCR assay for human AVs, a selection of 51 AV prototype strains and 66 patient samples positive for other DNA viruses were tested. Moreover, a comparison of the AV PCR method described herein with culture and antigen (Ag) detection was performed with a selection of 151 clinical samples. All 51 AV serotypes were detected in the selection of AV prototype strains. Concordant results from culture or Ag detection and PCR were found for 139 (92.1%) of 151 samples. In 12 cases (7.9%), PCR was positive while the culture was negative. In conclusion, a sensitive, internally controlled nonnested AV real-time PCR assay which is able to detect all known AV serotypes with higher sensitivity than a culture or Ag detection method was developed. PMID:18923006

Hypoxia in Invasion and Metastasis

DTIC Science & Technology

2007-08-01

hypoxia and activating HIF-1 downregulate the DNA mismatch repair proteins ( mlh1 and/or msh2), a group of important proteins for maintaining genetic...Investigate the hypoxia and activating HIF-1 downregulate the DNA mismatch repair proteins ( mlh1 and/or msh2) (Month 7-12) Methods: We performed a parallel...inducible factors from invasive tumor cells. Changes in the level of multiple hypoxia related factor (HIF-1) and DNA mismatch repair proteins ( MLH1 , MSH2

STAT1:DNA sequence-dependent binding modulation by phosphorylation, protein:protein interactions and small-molecule inhibition

PubMed Central

Bonham, Andrew J.; Wenta, Nikola; Osslund, Leah M.; Prussin, Aaron J.; Vinkemeier, Uwe; Reich, Norbert O.

2013-01-01

The DNA-binding specificity and affinity of the dimeric human transcription factor (TF) STAT1, were assessed by total internal reflectance fluorescence protein-binding microarrays (TIRF-PBM) to evaluate the effects of protein phosphorylation, higher-order polymerization and small-molecule inhibition. Active, phosphorylated STAT1 showed binding preferences consistent with prior characterization, whereas unphosphorylated STAT1 showed a weak-binding preference for one-half of the GAS consensus site, consistent with recent models of STAT1 structure and function in response to phosphorylation. This altered-binding preference was further tested by use of the inhibitor LLL3, which we show to disrupt STAT1 binding in a sequence-dependent fashion. To determine if this sequence-dependence is specific to STAT1 and not a general feature of human TF biology, the TF Myc/Max was analysed and tested with the inhibitor Mycro3. Myc/Max inhibition by Mycro3 is sequence independent, suggesting that the sequence-dependent inhibition of STAT1 may be specific to this system and a useful target for future inhibitor design. PMID:23180800

[Development and validation of event-specific quantitative PCR method for genetically modified maize LY038].

PubMed

Mano, Junichi; Masubuchi, Tomoko; Hatano, Shuko; Futo, Satoshi; Koiwa, Tomohiro; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Takabatake, Reona; Kitta, Kazumi

2013-01-01

In this article, we report a novel real-time PCR-based analytical method for quantitation of the GM maize event LY038. We designed LY038-specific and maize endogenous reference DNA-specific PCR amplifications. After confirming the specificity and linearity of the LY038-specific PCR amplification, we determined the conversion factor required to calculate the weight-based content of GM organism (GMO) in a multilaboratory evaluation. Finally, in order to validate the developed method, an interlaboratory collaborative trial according to the internationally harmonized guidelines was performed with blind DNA samples containing LY038 at the mixing levels of 0, 0.5, 1.0, 5.0 and 10.0%. The precision of the method was evaluated as the RSD of reproducibility (RSDR), and the values obtained were all less than 25%. The limit of quantitation of the method was judged to be 0.5% based on the definition of ISO 24276 guideline. The results from the collaborative trial suggested that the developed quantitative method would be suitable for practical testing of LY038 maize.

Peptide-conjugated micelles as a targeting nanocarrier for gene delivery

NASA Astrophysics Data System (ADS)

Lin, Wen Jen; Chien, Wei Hsuan

2015-09-01

The aim of this study was to develop peptide-conjugated micelles possessing epidermal growth factor receptor (EGFR) targeting ability for gene delivery. A sequence-modified dodecylpeptide, GE11(2R), with enhancing EGF receptor binding affinity, was applied in this study as a targeting ligand. The active targeting micelles were composed of poly( d,l-lactide- co-glycolide)-poly(ethylene glycol) (PLGA-PEG) copolymer conjugated with GE11(2R)-peptide. The particle sizes of peptide-free and peptide-conjugated micelles were 277.0 ± 5.1 and 308.7 ± 14.5 nm, respectively. The peptide-conjugated micelles demonstrated the cellular uptake significantly higher than peptide-free micelles in EGFR high-expressed MDA-MB-231 and MDA-MB-468 cells due to GE11(2R)-peptide specificity. Furthermore, the peptide-conjugated micelles were able to encapsulate plasmid DNA and expressed cellular transfection higher than peptide-free micelles in EGFR high-expressed cells. The EGFR-targeting delivery micelles enhanced DNA internalized into cells and achieved higher cellular transfection in EGFR high-expressed cells.

Defining the phylogenetic position of Amanita species from Andean Colombia.

PubMed

Vargas, Natalia; Pardo-de La Hoz, Carlos José; Danies, Giovanna; Franco-Molano, Ana Esperanza; Jiménez, Pedro; Restrepo, Silvia; Grajales, Alejandro

2017-01-01

Amanita is a worldwide-distributed fungal genus, with approximately 600 known species. Most species within the genus are ectomycorrhizal (ECM), with some saprotrophic representatives. In this study, we constructed the first comprehensive phylogeny including ECM species from Colombia collected in native Quercus humboldtii forests and in introduced Pinus patula plantations. We included 8 species (A. brunneolocularis, A. colombiana, A. flavoconia, A. fuligineodisca, A. muscaria, A. rubescens, A. sororcula, and A. xylinivolva) out of 16 species reported for the country, two new reports: A. citrina and A. virosa, and a new variety A. brunneolocularis var. pallida. Morphological taxonomic keys together with a phylogenetic approach using three nuclear gene regions: partial nuc rDNA 28S nuc rDNA internal transcribed spacers ITS1 and ITS2 and partial translation elongation factor 1-α gene (TEF1), were used to classify the specimens. Several highly supported clades were obtained from the phylogenetic hypotheses obtained by Bayesian inference and maximum likelihood approaches, allowing us to position the Colombian collections in a coherent infrageneric level and to contribute to the knowledge of local Amanita diversity.

DNA barcoding survey of Trichoderma diversity in soil and litter of the Colombian lowland Amazonian rainforest reveals Trichoderma strigosellum sp. nov. and other species.

PubMed

López-Quintero, Carlos A; Atanasova, Lea; Franco-Molano, A Esperanza; Gams, Walter; Komon-Zelazowska, Monika; Theelen, Bart; Müller, Wally H; Boekhout, Teun; Druzhinina, Irina

2013-11-01

The diversity of Trichoderma (Hypocreales, Ascomycota) colonizing leaf litter as well as the rhizosphere of Garcinia macrophylla (Clusiaceae) was investigated in primary and secondary rain forests in Colombian Amazonia. DNA barcoding of 107 strains based on the internal transcribed spacers 1 and 2 (ITS1 and 2) of the ribosomal RNA gene cluster and the partial sequence of the translation elongation factor 1 alpha (tef1) gene revealed that the diversity of Trichoderma was dominated (71 %) by three common cosmopolitan species, namely Trichoderma harzianum sensu lato (41 %), Trichoderma spirale (17 %) and Trichoderma koningiopsis (13 %). Four ITS 1 and 2 phylotypes (13 strains) could not be identified with certainty. Multigene phylogenetic analysis and phenotype profiling of four strains with an ITS1 and 2 phylotype similar to Trichoderma strigosum revealed a new sister species of the latter that is described here as Trichoderma strigosellum sp. nov. Sequence similarity searches revealed that this species also occurs in soils of Malaysia and Cameroon, suggesting a pantropical distribution.

Distribution patterns of haplotypes for symbionts from Umbilicaria esculenta and U. muehlenbergii reflect the importance of reproductive strategy in shaping population genetic structure.

PubMed

Cao, Shunan; Zhang, Fang; Liu, Chuanpeng; Hao, Zhihua; Tian, Yuan; Zhu, Lingxiang; Zhou, Qiming

2015-10-15

The diversity of lichen fungal components and their photosynthetic partners reflects both ecological and evolutionary factors. In present study, molecular investigations of the internal transcribed spacer of the nuclear ribosomal DNA (ITS nrDNA) region were conducted to analyze the genetic diversity of Umbilicaria esculenta and U. muehlenbergii together with their associated green algae. It was here demonstrated that the reproductive strategy is a principal reason for fungal selectivity to algae. U. muehlenbergii, which disperses via sexual spores, exhibits lower selectivity to its photosynthetic partners than U. esculenta, which has a vegetative reproductive strategy. The difference of genotypic diversity (both fungal and algal) between these two Umbilicaria species is low, although their nucleotide diversity can vary greatly. The present study illustrates that lichen-forming fungi with sexual reproductive strategies are less selective with respect to their photobionts; and reveals that both sexual and vegetative reproduction allow lichens to generate similar amounts of diversity to adapt to the environments. The current study will be helpful for elucidating how lichens with different reproductive strategies adapt to changing environments.

Usefulness of circulating free DNA for monitoring epidermal growth factor receptor mutations in advanced non-small cell lung cancer patients: a case report

PubMed Central

Gonzalez-Cao, Maria; Ramirez, Santiago Viteri; Ariza, Nuria Jordana; Balada, Ariadna; Garzón, Mónica; Teixidó, Cristina; Karachaliou, Niki; Morales-Espinosa, Daniela; Molina-Vila, Miguel Ángel; Rosell, Rafael

2016-01-01

Genomic analysis of circulating tumor DNA (ctDNA) released from cancer cells into the bloodstream has been proposed as a useful method to capture dynamic changes during the course of the disease. In particular, the ability to monitor epidermal growth factor receptor (EGFR) mutation status in cell-free circulating DNA (cfDNA) isolated from advanced non-small cell lung cancer (NSCLC) patients EGFR can help to the correct management of the disease and overcome the challenges associated with tumor heterogeneity and insufficient biopsied material to perform key molecular diagnosis. Here, we report a case of long term monitorization of EGFR mutation status in cfDNA from peripheral blood in an NSCLC patient in, with excellent correlation with clinical evolution. PMID:27826535

Biochemical and Structural Characterisation of DNA Ligases from Bacteria and Archaea.

PubMed

Pergolizzi, Giulia; Wagner, Gerd K; Bowater, Richard Peter

2016-08-31

DNA ligases are enzymes that seal breaks in the backbones of DNA, leading to them being essential for the survival of all organisms. DNA ligases have been studied from many different types of cells and organisms and shown to have diverse sizes and sequences, with well conserved specific sequences that are required for enzymatic activity. A significant number of DNA ligases have been isolated or prepared in recombinant forms and, here, we review their biochemical and structural characterisation. All DNA ligases contain an essential lysine that transfers an adenylate group from a co-factor to the 5'-phosphate of the DNA end that will ultimately be joined to the 3'-hydroxyl of the neighbouring DNA strand. The essential DNA ligases in bacteria use nicotinamide adenine dinucleotide ( β -NAD + ) as their co-factor whereas those that are essential in other cells use adenosine-5'-triphosphate (ATP) as their co-factor. This observation suggests that the essential bacterial enzyme could be targeted by novel antibiotics and the complex molecular structure of β -NAD + affords multiple opportunities for chemical modification. Several recent studies have synthesised novel derivatives and their biological activity against a range of DNA ligases has been evaluated as inhibitors for drug discovery and/or non-natural substrates for biochemical applications. Here, we review the recent advances that herald new opportunities to alter the biochemical activities of these important enzymes. The recent development of modified derivatives of nucleotides highlights that the continued combination of structural, biochemical and biophysical techniques will be useful in targeting these essential cellular enzymes. ©2016 The Author(s).

Molecular characterization of the host defense activity of the barrier to autointegration factor against vaccinia virus.

PubMed

Ibrahim, Nouhou; Wicklund, April; Wiebe, Matthew S

2011-11-01

The barrier to autointegration factor (BAF) is an essential cellular protein with functions in mitotic nuclear reassembly, retroviral preintegration complex stability, and transcriptional regulation. Molecular properties of BAF include the ability to bind double-stranded DNA in a sequence-independent manner, homodimerize, and bind proteins containing a LEM domain. These capabilities allow BAF to compact DNA and assemble higher-order nucleoprotein complexes, the nature of which is poorly understood. Recently, it was revealed that BAF also acts as a potent host defense against poxviral DNA replication in the cytoplasm. Here, we extend these observations by examining the molecular mechanism through which BAF acts as a host defense against vaccinia virus replication and cytoplasmic DNA in general. Interestingly, BAF rapidly relocalizes to transfected DNA from a variety of sources, demonstrating that BAF's activity as a host defense factor is not limited to poxviral infection. BAF's relocalization to cytoplasmic foreign DNA is highly dependent upon its DNA binding and dimerization properties but does not appear to require its LEM domain binding activity. However, the LEM domain protein emerin is recruited to cytoplasmic DNA in a BAF-dependent manner during both transfection and vaccinia virus infection. Finally, we demonstrate that the DNA binding and dimerization capabilities of BAF are essential for its function as an antipoxviral effector, while the presence of emerin is not required. Together, these data provide further mechanistic insight into which of BAF's molecular properties are employed by cells to impair the replication of poxviruses or respond to foreign DNA in general.

Unique helicase determinants in the essential conjugative TraI factor from Salmonella enterica serovar Typhimurium plasmid pCU1.

PubMed

McLaughlin, Krystle J; Nash, Rebekah P; Redinbo, Mathew R

2014-09-01

The widespread development of multidrug-resistant bacteria is a major health emergency. Conjugative DNA plasmids, which harbor a wide range of antibiotic resistance genes, also encode the protein factors necessary to orchestrate the propagation of plasmid DNA between bacterial cells through conjugative transfer. Successful conjugative DNA transfer depends on key catalytic components to nick one strand of the duplex DNA plasmid and separate the DNA strands while cell-to-cell transfer occurs. The TraI protein from the conjugative Salmonella plasmid pCU1 fulfills these key catalytic roles, as it contains both single-stranded DNA-nicking relaxase and ATP-dependent helicase domains within a single, 1,078-residue polypeptide. In this work, we unraveled the helicase determinants of Salmonella pCU1 TraI through DNA binding, ATPase, and DNA strand separation assays. TraI binds DNA substrates with high affinity in a manner influenced by nucleic acid length and the presence of a DNA hairpin structure adjacent to the nick site. TraI selectively hydrolyzes ATP, and mutations in conserved helicase motifs eliminate ATPase activity. Surprisingly, the absence of a relatively short (144-residue) domain at the extreme C terminus of the protein severely diminishes ATP-dependent strand separation. Collectively, these data define the helicase motifs of the conjugative factor TraI from Salmonella pCU1 and reveal a previously uncharacterized C-terminal functional domain that uncouples ATP hydrolysis from strand separation activity. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

International consensus for neuroblastoma molecular diagnostics: report from the International Neuroblastoma Risk Group (INRG) Biology Committee

PubMed Central

Ambros, P F; Ambros, I M; Brodeur, G M; Haber, M; Khan, J; Nakagawara, A; Schleiermacher, G; Speleman, F; Spitz, R; London, W B; Cohn, S L; Pearson, A D J; Maris, J M

2009-01-01

Neuroblastoma serves as a paradigm for utilising tumour genomic data for determining patient prognosis and treatment allocation. However, before the establishment of the International Neuroblastoma Risk Group (INRG) Task Force in 2004, international consensus on markers, methodology, and data interpretation did not exist, compromising the reliability of decisive genetic markers and inhibiting translational research efforts. The objectives of the INRG Biology Committee were to identify highly prognostic genetic aberrations to be included in the new INRG risk classification schema and to develop precise definitions, decisive biomarkers, and technique standardisation. The review of the INRG database (n=8800 patients) by the INRG Task Force finally enabled the identification of the most significant neuroblastoma biomarkers. In addition, the Biology Committee compared the standard operating procedures of different cooperative groups to arrive at international consensus for methodology, nomenclature, and future directions. Consensus was reached to include MYCN status, 11q23 allelic status, and ploidy in the INRG classification system on the basis of an evidence-based review of the INRG database. Standardised operating procedures for analysing these genetic factors were adopted, and criteria for proper nomenclature were developed. Neuroblastoma treatment planning is highly dependant on tumour cell genomic features, and it is likely that a comprehensive panel of DNA-based biomarkers will be used in future risk assignment algorithms applying genome-wide techniques. Consensus on methodology and interpretation is essential for uniform INRG classification and will greatly facilitate international and cooperative clinical and translational research studies. PMID:19401703

Topological events in single molecules of E. coli DNA confined in nanochannels

PubMed Central

Reifenberger, Jeffrey G.; Dorfman, Kevin D.; Cao, Han

2015-01-01

We present experimental data concerning potential topological events such as folds, internal backfolds, and/or knots within long molecules of double-stranded DNA when they are stretched by confinement in a nanochannel. Genomic DNA from E. coli was labeled near the ‘GCTCTTC’ sequence with a fluorescently labeled dUTP analog and stained with the DNA intercalator YOYO. Individual long molecules of DNA were then linearized and imaged using methods based on the NanoChannel Array technology (Irys® System) available from BioNano Genomics. Data were collected on 189,153 molecules of length greater than 50 kilobases. A custom code was developed to search for abnormal intensity spikes in the YOYO backbone profile along the length of individual molecules. By correlating the YOYO intensity spikes with the aligned barcode pattern to the reference, we were able to correlate the bright intensity regions of YOYO with abnormal stretching in the molecule, which suggests these events were either a knot or a region of internal backfolding within the DNA. We interpret the results of our experiments involving molecules exceeding 50 kilobases in the context of existing simulation data for relatively short DNA, typically several kilobases. The frequency of these events is lower than the predictions from simulations, while the size of the events is larger than simulation predictions and often exceeds the molecular weight of the simulated molecules. We also identified DNA molecules that exhibit large, single folds as they enter the nanochannels. Overall, topological events occur at a low frequency (~7% of all molecules) and pose an easily surmountable obstacle for the practice of genome mapping in nanochannels. PMID:25991508

Diagnostic values for the viral load in peripheral blood mononuclear cells of patients with chronic active Epstein-Barr virus disease.

PubMed

Ito, Yoshinori; Suzuki, Michio; Kawada, Jun-ichi; Kimura, Hiroshi

2016-04-01

Chronic active Epstein-Barr virus disease (CAEBV) is a distinct EBV-associated lymphoproliferative disease with a poor prognosis. Although the viral load in blood samples has been widely used for diagnosing CAEBV, well-defined viral load thresholds to guide clinicians are currently lacking. The aim of the present study was to determine standardized diagnostic values for EBV load in blood samples of CAEBV patients using the World Health Organization international standard for reporting. Levels of EBV DNA in 103 peripheral blood mononuclear cells (PBMCs) and 95 plasma/serum samples from 107 cases with CAEBV were quantified and expressed in international units. Receiver operating characteristic curves were analyzed to assess the most appropriate cut-off values for levels of EBV DNA to distinguish CAEBV from EBV-associated infectious mononucleosis (IM) and controls with past EBV infection. Levels of EBV DNA in PBMCs were significantly higher in the CAEBV group (median, 10(4.2) IU/μgDNA) compared to the IM (median, 10(2.1) IU/μgDNA) and control groups. An inconsistent qualitative result was seen in 13 of 86 CAEBV patients; in these, EBV-DNA was positive in PBMCs, but negative in plasma. Diagnostic cut-off values for viral load in PBMCs from CAEBV patients, as compared to those of healthy controls and IM patients, were 10(2.0) IU/μgDNA and 10(3.2) IU/μgDNA, respectively. For diagnostic purposes, the viral load of PBMCs was better than of plasma/serum. A diagnostic cut-off EBV load for CAEBV may be useful for the management of CAEBV patients. Copyright © 2015 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Mitochondrial DNA Depletion in Respiratory Chain-Deficient Parkinson Disease Neurons.

PubMed

Grünewald, Anne; Rygiel, Karolina A; Hepplewhite, Philippa D; Morris, Christopher M; Picard, Martin; Turnbull, Doug M

2016-03-01

To determine the extent of respiratory chain abnormalities and investigate the contribution of mtDNA to the loss of respiratory chain complexes (CI-IV) in the substantia nigra (SN) of idiopathic Parkinson disease (IPD) patients at the single-neuron level. Multiple-label immunofluorescence was applied to postmortem sections of 10 IPD patients and 10 controls to quantify the abundance of CI-IV subunits (NDUFB8 or NDUFA13, SDHA, UQCRC2, and COXI) and mitochondrial transcription factors (TFAM and TFB2M) relative to mitochondrial mass (porin and GRP75) in dopaminergic neurons. To assess the involvement of mtDNA in respiratory chain deficiency in IPD, SN neurons, isolated with laser-capture microdissection, were assayed for mtDNA deletions, copy number, and presence of transcription/replication-associated 7S DNA employing a triplex real-time polymerase chain reaction (PCR) assay. Whereas mitochondrial mass was unchanged in single SN neurons from IPD patients, we observed a significant reduction in the abundances of CI and II subunits. At the single-cell level, CI and II deficiencies were correlated in patients. The CI deficiency concomitantly occurred with low abundances of the mtDNA transcription factors TFAM and TFB2M, which also initiate transcription-primed mtDNA replication. Consistent with this, real-time PCR analysis revealed fewer transcription/replication-associated mtDNA molecules and an overall reduction in mtDNA copy number in patients. This effect was more pronounced in single IPD neurons with severe CI deficiency. Respiratory chain dysfunction in IPD neurons not only involves CI, but also extends to CII. These deficiencies are possibly a consequence of the interplay between nDNA and mtDNA-encoded factors mechanistically connected via TFAM. © 2016 The Authors. Annals of Neurology published by Wiley Periodicals, Inc. on behalf of American Neurological Association.

The Electronic Behavior of Zinc-Finger Protein Binding Sites in the Context of the DNA Extended Ladder Model

NASA Astrophysics Data System (ADS)

Oiwa, Nestor; Cordeiro, Claudette; Heermann, Dieter

2016-05-01

Instead of ATCG letter alignments, typically used in bioinformatics, we propose a new alignment method using the probability distribution function of the bottom of the occupied molecular orbital (BOMO), highest occupied molecular orbital (HOMO) and lowest unoccupied orbital (LUMO). We apply the technique to transcription factors with Cys2His2 zinc fingers. These transcription factors search for binding sites, probing for the electronic patterns at the minor and major DNA groves. The eukaryotic Cys2His2 zinc finger proteins bind to DNA ubiquitously at highly conserved domains. They are responsible for gene regulation and the spatial organization of DNA. To study and understand these zinc finger DNA-protein interactions, we use the extended ladder in the DNA model proposed by Zhu, Rasmussen, Balatsky & Bishop (2007) te{Zhu-2007}. Considering one single spinless electron in each nucleotide π-orbital along a double DNA chain (dDNA), we find a typical pattern for the bottom of BOMO, HOMO and LUMO along the binding sites. We specifically looked at two members of zinc finger protein family: specificity protein 1 (SP1) and early grown response 1 transcription factors (EGR1). When the valence band is filled, we find electrons in the purines along the nucleotide sequence, compatible with the electric charges of the binding amino acids in SP1 and EGR1 zinc finger.

RNA polymerase gate loop guides the nontemplate DNA strand in transcription complexes.

PubMed

NandyMazumdar, Monali; Nedialkov, Yuri; Svetlov, Dmitri; Sevostyanova, Anastasia; Belogurov, Georgiy A; Artsimovitch, Irina

2016-12-27

Upon RNA polymerase (RNAP) binding to a promoter, the σ factor initiates DNA strand separation and captures the melted nontemplate DNA, whereas the core enzyme establishes interactions with the duplex DNA in front of the active site that stabilize initiation complexes and persist throughout elongation. Among many core RNAP elements that participate in these interactions, the β' clamp domain plays the most prominent role. In this work, we investigate the role of the β gate loop, a conserved and essential structural element that lies across the DNA channel from the clamp, in transcription regulation. The gate loop was proposed to control DNA loading during initiation and to interact with NusG-like proteins to lock RNAP in a closed, processive state during elongation. We show that the removal of the gate loop has large effects on promoter complexes, trapping an unstable intermediate in which the RNAP contacts with the nontemplate strand discriminator region and the downstream duplex DNA are not yet fully established. We find that although RNAP lacking the gate loop displays moderate defects in pausing, transcript cleavage, and termination, it is fully responsive to the transcription elongation factor NusG. Together with the structural data, our results support a model in which the gate loop, acting in concert with initiation or elongation factors, guides the nontemplate DNA in transcription complexes, thereby modulating their regulatory properties.

A human transcription factor in search mode.

PubMed

Hauser, Kevin; Essuman, Bernard; He, Yiqing; Coutsias, Evangelos; Garcia-Diaz, Miguel; Simmerling, Carlos

2016-01-08

Transcription factors (TF) can change shape to bind and recognize DNA, shifting the energy landscape from a weak binding, rapid search mode to a higher affinity recognition mode. However, the mechanism(s) driving this conformational change remains unresolved and in most cases high-resolution structures of the non-specific complexes are unavailable. Here, we investigate the conformational switch of the human mitochondrial transcription termination factor MTERF1, which has a modular, superhelical topology complementary to DNA. Our goal was to characterize the details of the non-specific search mode to complement the crystal structure of the specific binding complex, providing a basis for understanding the recognition mechanism. In the specific complex, MTERF1 binds a significantly distorted and unwound DNA structure, exhibiting a protein conformation incompatible with binding to B-form DNA. In contrast, our simulations of apo MTERF1 revealed significant flexibility, sampling structures with superhelical pitch and radius complementary to the major groove of B-DNA. Docking these structures to B-DNA followed by unrestrained MD simulations led to a stable complex in which MTERF1 was observed to undergo spontaneous diffusion on the DNA. Overall, the data support an MTERF1-DNA binding and recognition mechanism driven by intrinsic dynamics of the MTERF1 superhelical topology. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Enhanced translocation of single DNA molecules through α-hemolysin nanopores by manipulation of internal charge

PubMed Central

Maglia, Giovanni; Restrepo, Marcela Rincon; Mikhailova, Ellina; Bayley, Hagan

2008-01-01

Both protein and solid-state nanopores are under intense investigation for the analysis of nucleic acids. A crucial advantage of protein nanopores is that site-directed mutagenesis permits precise tuning of their properties. Here, by augmenting the internal positive charge within the α-hemolysin pore and varying its distribution, we increase the frequency of translocation of a 92-nt single-stranded DNA through the pore at +120 mV by ≈10-fold over the wild-type protein and dramatically lower the voltage threshold at which translocation occurs, e.g., by 50 mV for 1 event·s−1·μM−1. Further, events in which DNA enters the pore, but is not immediately translocated, are almost eliminated. These experiments provide a basis for improved nucleic acid analysis with protein nanopores, which might be translated to solid-state nanopores by using chemical surface modification. PMID:19060213

Establishing a novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure for the direct detection of gene doping.

PubMed

Beiter, Thomas; Zimmermann, Martina; Fragasso, Annunziata; Armeanu, Sorin; Lauer, Ulrich M; Bitzer, Michael; Su, Hua; Young, William L; Niess, Andreas M; Simon, Perikles

2008-01-01

So far, the abuse of gene transfer technology in sport, so-called gene doping, is undetectable. However, recent studies in somatic gene therapy indicate that long-term presence of transgenic DNA (tDNA) following various gene transfer protocols can be found in DNA isolated from whole blood using conventional PCR protocols. Application of these protocols for the direct detection of gene doping would require almost complete knowledge about the sequence of the genetic information that has been transferred. Here, we develop and describe the novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure that overcomes this difficulty. Apart from the interesting perspectives that this spiPCR procedure offers in the fight against gene doping, this technology could also be of interest in biodistribution and biosafety studies for gene therapeutic applications.

Sequence analysis of the 5.8S ribosomal DNA and internal transcribed spacers (ITS1 and ITS2) from five species of the Oxalis tuberosa alliance.

PubMed

Tosto, D S; Hopp, H E

1996-01-01

The internal transcribed spacer region (ITS1 and ITS2) of the 18S-25S nuclear ribosomal DNA sequence and the intervening 5.8S region from five species of the genus Oxalis was amplified by polymerase chain reaction and subjected to direct DNA sequencing. On the basis of cytogenetic studies some species of this genus were postulated to be related by the number of chromosomes. Sequence homologies in the ITS1, 5.8S and ITS2 among species are in good agreement with previous relationships established on the basis of chromosome numbers. We also identified a highly conserved sequence of six bp in the ITS1, reported to be present in a wide range of flowering plants, but not in the Oxalidaceae family to which the genus Oxalis belongs to.

Quantitative molecular diagnostic assays of grain washes for Claviceps purpurea are correlated with visual determinations of ergot contamination.

PubMed

Comte, Alexia; Gräfenhan, Tom; Links, Matthew G; Hemmingsen, Sean M; Dumonceaux, Tim J

2017-01-01

We examined the epiphytic microbiome of cereal grain using the universal barcode chaperonin-60 (cpn60). Microbial community profiling of seed washes containing DNA extracts prepared from field-grown cereal grain detected sequences from a fungus identified only to Class Sordariomycetes. To identify the fungal sequence and to improve the reference database, we determined cpn60 sequences from field-collected and reference strains of the ergot fungus, Claviceps purpurea. These data allowed us to identify this fungal sequence as deriving from C. purpurea, and suggested that C. purpurea DNA is readily detectable on agricultural commodities, including those for which ergot was not identified as a grading factor. To get a sense of the prevalence and level of C. purpurea DNA in cereal grains, we developed a quantitative PCR assay based on the fungal internal transcribed spacer (ITS) and applied it to 137 samples from the 2014 crop year. The amount of Claviceps DNA quantified correlated strongly with the proportion of ergot sclerotia identified in each grain lot, although there was evidence that non-target organisms were responsible for some false positives with the ITS-based assay. We therefore developed a cpn60-targeted loop-mediated isothermal amplification assay and applied it to the same grain wash samples. The time to positive displayed a significant, inverse correlation to ergot levels determined by visual ratings. These results indicate that both laboratory-based and field-adaptable molecular diagnostic assays can be used to detect and quantify pathogen load in bulk commodities using cereal grain washes.

Quantitative molecular diagnostic assays of grain washes for Claviceps purpurea are correlated with visual determinations of ergot contamination

PubMed Central

Comte, Alexia; Gräfenhan, Tom; Links, Matthew G.; Hemmingsen, Sean M.

2017-01-01

We examined the epiphytic microbiome of cereal grain using the universal barcode chaperonin-60 (cpn60). Microbial community profiling of seed washes containing DNA extracts prepared from field-grown cereal grain detected sequences from a fungus identified only to Class Sordariomycetes. To identify the fungal sequence and to improve the reference database, we determined cpn60 sequences from field-collected and reference strains of the ergot fungus, Claviceps purpurea. These data allowed us to identify this fungal sequence as deriving from C. purpurea, and suggested that C. purpurea DNA is readily detectable on agricultural commodities, including those for which ergot was not identified as a grading factor. To get a sense of the prevalence and level of C. purpurea DNA in cereal grains, we developed a quantitative PCR assay based on the fungal internal transcribed spacer (ITS) and applied it to 137 samples from the 2014 crop year. The amount of Claviceps DNA quantified correlated strongly with the proportion of ergot sclerotia identified in each grain lot, although there was evidence that non-target organisms were responsible for some false positives with the ITS-based assay. We therefore developed a cpn60-targeted loop-mediated isothermal amplification assay and applied it to the same grain wash samples. The time to positive displayed a significant, inverse correlation to ergot levels determined by visual ratings. These results indicate that both laboratory-based and field-adaptable molecular diagnostic assays can be used to detect and quantify pathogen load in bulk commodities using cereal grain washes. PMID:28257512

UV-B affects the immune system and promotes nuclear abnormalities in pigmented and non-pigmented bullfrog tadpoles.

PubMed

Franco-Belussi, Lilian; Fanali, Lara Zácari; De Oliveira, Classius

2018-03-01

Ultra-Violet (UV) radiation is a stressor of the immune system and causes DNA damage. Leukocytes can change in response to environmental changes in anurans, making them an important biomarker of stressful situations. The initial barrier against UV in ectothermic animals is melanin-containing cells in skin and in their internal organs. Here, we tested the effects of UV exposure on immune cells and DNA integrity in pigmented and non-pigmented tadpoles of Lithobates catesbeianus. We used an inflammation model with lipopolysaccharide (LPS) of Escherichia coli to test synergic effects of UV and LPS. We tested the following hypotheses: 1) DNA damage caused by UV will be more pronounced in non-pigmented than in pigmented animals; 2) LPS increases leukocytes in both pigmented and non-pigmented animals by systemic inflammation; 3) The combined LPS and UV exposure will decrease the number of leukocytes. We found that the frequency of immune cells differed between pigmented and non-pigmented tadpoles. UV exposure increased mast cells and DNA damage in erythrocytes in both pigmented and non-pigmented tadpoles, while leukocytes decreased after UV exposure. Non-pigmented tadpoles experienced DNA damage and a lower lymphocyte count earlier than pigmented tadpoles. UV altered immune cells likely as a consequence of local and systemic inflammation. These alterations were less severe in pigmented than in non-pigmented animals. UV and LPS increased internal melanin in pigmented tadpoles, which were correlated with DNA damage and leukocytes. Here, we described for the first time the effects of UV and LPS in immune cells of pigmented and non-pigmented tadpoles. In addition, we demonstrated that internal melanin in tadpoles help in these defenses, since leukocyte responses were faster in non-pigmented animals, supporting the hypothesis that melanin is involved in the initial innate immune response. Copyright © 2018 Elsevier B.V. All rights reserved.

The use of archived tags in retrospective genetic analysis of fish.

PubMed

Bonanomi, Sara; Therkildsen, Nina Overgaard; Hedeholm, Rasmus Berg; Hemmer-Hansen, Jakob; Nielsen, Einar E

2014-05-01

Collections of historical tissue samples from fish (e.g. scales and otoliths) stored in museums and fisheries institutions are precious sources of DNA for conducting retrospective genetic analysis. However, in some cases, only external tags used for documentation of spatial dynamics of fish populations have been preserved. Here, we test the usefulness of fish tags as a source of DNA for genetic analysis. We extract DNA from historical tags from cod collected in Greenlandic waters between 1950 and 1968. We show that the quantity and quality of DNA recovered from tags is comparable to DNA from archived otoliths from the same individuals. Surprisingly, levels of cross-contamination do not seem to be significantly higher in DNA from external (tag) than internal (otolith) sources. Our study therefore demonstrates that historical tags can be a highly valuable source of DNA for retrospective genetic analysis of fish. © 2013 John Wiley & Sons Ltd.

Understanding environmental DNA detection probabilities: A case study using a stream-dwelling char Salvelinus fontinalis

Treesearch

Taylor M. Wilcox; Kevin S. McKelvey; Michael K. Young; Adam J. Sepulveda; Bradley B. Shepard; Stephen F. Jane; Andrew R. Whiteley; Winsor H. Lowe; Michael K. Schwartz

2016-01-01

Environmental DNA sampling (eDNA) has emerged as a powerful tool for detecting aquatic animals. Previous research suggests that eDNA methods are substantially more sensitive than traditional sampling. However, the factors influencing eDNA detection and the resulting sampling costs are still not well understood. Here we use multiple experiments to derive...

Evaluation of DNA Binding Drugs as Inhibitors of ESX, and ETS Domain Transcription Factor Associated With Breast Cancer: Effects of ESX/DNA Complex Disruption

DTIC Science & Technology

2000-08-01

4). Sequence recognition of all four DNA bases is achieved by positioning an N- methylimidazole opposite guanine or N-methylpyrrole opposite...unique sequences of DNA based upon selective binding motifs to all four DNA bases , although relatively little is known about the ability of these agents to

Affinity of yeast nucleotide excision repair factor 2, consisting of the Rad4 and Rad23 proteins, for ultraviolet damaged DNA.

PubMed

Guzder, S N; Sung, P; Prakash, L; Prakash, S

1998-11-20

Saccharomyces cerevisiae Rad4 and Rad23 proteins are required for the nucleotide excision repair of UV light-damaged DNA. Previous studies have indicated that these two DNA repair proteins are associated in a tight complex, which we refer to as nucleotide excision repair factor 2 (NEF2). In a reconstituted nucleotide excision repair reaction, incision of UV-damaged DNA is dependent on NEF2, indicating a role of NEF2 in an early step of the repair process. NEF2 does not, however, possess an enzymatic activity, and its function in the damage-specific incision reaction has not yet been defined. Here we use a DNA mobility shift assay to demonstrate that NEF2 binds specifically to UV-damaged DNA. Elimination of cyclobutane pyrimidine dimers from the UV-damaged DNA by enzymatic photoreactivation has little effect on the affinity of NEF2 for the DNA, suggesting that NEF2 recognizes the 6-(1, 2)-dihydro-2-oxo-4-pyrimidinyl)-5-methyl-2,4-(1H,3H)-pyrimidinedione photoproducts in the damaged DNA. These results highlight the intricacy of the DNA damage-demarcation reaction during nucleotide excision repair in eukaryotes.

International multi-center evaluation of a novel chemiluminescence assay for the detection of anti-dsDNA antibodies.

PubMed

Bentow, C; Lakos, G; Martis, P; Wahl, E; Garcia, M; Viñas, O; Espinosa, G; Cervera, R; Sjöwall, C; Carmona-Fernandes, D; Santos, M J; Hanly, J G; Mahler, M

2016-07-01

Anti-double stranded desoxyribonucleic acid (anti-dsDNA) antibodies are considered fairly specific for systemic lupus erythematosus (SLE) and their quantification is useful for the clinical management of SLE patients. We assessed the diagnostic performance of the QUANTA Flash dsDNA chemiluminescent immunoassay (CIA) in comparison to an ELISA, using patients from five participating countries. The main focus was to evaluate the correlation between anti-dsDNA antibody results from the CIA and global SLE disease activity, as measured by the SLE Disease Activity Index 2000 (SLEDAI-2K). A total of 1431 samples (SLE, n = 843; disease controls, n = 588) from five countries (Canada, USA, Portugal, Sweden and Spain) were tested with QUANTA Flash dsDNA (Inova Diagnostics, San Diego, CA, USA). Data obtained with the QUANTA Lite dsDNA SC ELISA (Inova Diagnostics) were available for samples from three sites (Canada, USA and Sweden, n = 566). The SLEDAI-2K scores were available for 805 SLE patients and a cut-off of > 4 was used to define active disease. QUANTA Flash dsDNA had a sensitivity of 54.3% for the diagnosis of SLE, combined with 89.8% specificity. Anti-dsDNA antibody levels were significantly higher (p < 0.0001) in active SLE (SLEDAI-2K > 4; n = 232; median value 83.0 IU/mL) versus the inactive patients (n = 573; median value 22.3 IU/mL), and the SLEDAI-2K scoring correlated with their dsDNA antibody levels (Spearman's rho = 0.44, p < 0.0001). Similar but less pronounced findings were also found for the ELISA, in relation to disease activity. The QUANTA Flash dsDNA assay showed good clinical performance in a large international multi-center study. Additionally, the strong correlation between anti-dsDNA antibody results and SLEDAI-2K scores supported the potential utility of QUANTA Flash dsDNA for monitoring disease activity. © The Author(s) 2016.

In vitro transfection of plasmid DNA by amine derivatives of gelatin accompanied with ultrasound irradiation.

PubMed

Hosseinkhani, Hossein; Aoyama, Ternyoshi; Yamamoto, Shingo; Ogawa, Osamu; Tabata, Yasuhiko

2002-10-01

The purpose of this study is to examine the ultrasound (US)-enhanced gene expression by the complexes of a plasmid DNA with gelatin derivatives of aminization. Gelatin derivatives with different introduced extents of ethylenediamine (Ed), spermidine (Sd), and spermine (Sm) were prepared with a water-soluble carbodiimide. The molecular size and zeta potential of the gelatin derivatives before and after complexation with the plasmid DNA were examined. After incubation with the complexes with or without US exposure, the DNA expression of rat gastric mucosal cells was measured to evaluate the effect of the type of gelatin derivatives on their gene expression. The cell uptake of the complexes, the cell viability, and the buffering effect of gelatin derivatives were examined. The apparent molecular size and zeta potential of gelatin derivatives became larger as their aminization extent increased although the Sm gelatin derivative of higher aminization showed a larger value than other corresponding derivatives. Irrespective of the type of gelatin derivatives, the apparent molecular size of plasmid DNA was reduced by increasing the gelatin-DNA mixing ratio to attain a saturated value of about 150 nm. The condensed gelatin-DNA complexes showed the zeta potential of 10-15 mV. The cells incubated with the complex exhibited significantly stronger luciferase activities than free plasmid DNA, and the activity was further enhanced by US irradiation. The enhancement was significant for the Sm derivative compared with the corresponding Ed and Sd derivatives. The amount of plasmid DNA internalized into the cells was significantly increased by the complexation with every gelatin derivative, whereas US irradiation did not significantly increase the DNA internalization. US irradiation had no effect on the viability of cells incubated with every gelatin derivative-plasmid DNA complex, although the viability was decreased by the complex incubation. The buffering capacity of Sm derivative was higher than that of Ed and Sd derivatives and comparable with that of polyethylene amine. Among amine derivatives of gelatin, the Sm derivative enabled the plasmid DNA to induce the US-enhanced gene expression of cells in vitro most effectively because of the superior buffering effect.

Characterization of Aspergillus flavus strains from Brazilian Brazil nuts and cashew by RAPD and ribosomal DNA analysis.

PubMed

Midorikawa, G E O; Pinheiro, M R R; Vidigal, B S; Arruda, M C; Costa, F F; Pappas, G J; Ribeiro, S G; Freire, F; Miller, R N G

2008-07-01

The aim of this study was to determine the genetic variability in Aspergillus flavus populations from Brazil nut and cashew and develop a polymerase chain reaction (PCR) detection method. Chomatography analysis of 48 isolates identified 36 as aflatoxigenic (75%). One hundred and forty-one DNA bands were generated with 11 random amplified polymorphic DNA (RAPD) primers and analysed via unweighted pair group analysis, using arithmetic means (UPGMA). Isolates grouped according to host, with differentiation of those from A. occidentale also according to geographical origin. Aspergillus flavus-specific PCR primers ASPITSF2 and ASPITSR3 were designed from ribosomal DNA internal transcribed spacers (ITS 1 and 2), and an internal amplification control was developed, to prevent false negative results. Specificity to only A. flavus was confirmed against DNA from additional aspergilli and other fungi. RAPD-based characterization differentiated isolates according to plant host. The PCR primer pair developed showed specificity to A. flavus, with a detection limit of 10 fg. Genetic variability observed in A. flavus isolates from two Brazilian agroecosystems suggested reproductive isolation. The PCR detection method developed for A. flavus represents progress towards multiplex PCR detection of aflatoxigenic and nonaflatoxigenic strains in Hazard Analysis Critical Control Point systems.

Conformational changes leading to T7 DNA delivery upon interaction with the bacterial receptor.

PubMed

González-García, Verónica A; Pulido-Cid, Mar; Garcia-Doval, Carmela; Bocanegra, Rebeca; van Raaij, Mark J; Martín-Benito, Jaime; Cuervo, Ana; Carrascosa, José L

2015-04-17

The majority of bacteriophages protect their genetic material by packaging the nucleic acid in concentric layers to an almost crystalline concentration inside protein shells (capsid). This highly condensed genome also has to be efficiently injected into the host bacterium in a process named ejection. Most phages use a specialized complex (often a tail) to deliver the genome without disrupting cell integrity. Bacteriophage T7 belongs to the Podoviridae family and has a short, non-contractile tail formed by a tubular structure surrounded by fibers. Here we characterize the kinetics and structure of bacteriophage T7 DNA delivery process. We show that T7 recognizes lipopolysaccharides (LPS) from Escherichia coli rough strains through the fibers. Rough LPS acts as the main phage receptor and drives DNA ejection in vitro. The structural characterization of the phage tail after ejection using cryo-electron microscopy (cryo-EM) and single particle reconstruction methods revealed the major conformational changes needed for DNA delivery at low resolution. Interaction with the receptor causes fiber tilting and opening of the internal tail channel by untwisting the nozzle domain, allowing release of DNA and probably of the internal head proteins. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

The transcription fidelity factor GreA impedes DNA break repair.

PubMed

Sivaramakrishnan, Priya; Sepúlveda, Leonardo A; Halliday, Jennifer A; Liu, Jingjing; Núñez, María Angélica Bravo; Golding, Ido; Rosenberg, Susan M; Herman, Christophe

2017-10-12

Homologous recombination repairs DNA double-strand breaks and must function even on actively transcribed DNA. Because break repair prevents chromosome loss, the completion of repair is expected to outweigh the transcription of broken templates. However, the interplay between DNA break repair and transcription processivity is unclear. Here we show that the transcription factor GreA inhibits break repair in Escherichia coli. GreA restarts backtracked RNA polymerase and hence promotes transcription fidelity. We report that removal of GreA results in markedly enhanced break repair via the classic RecBCD-RecA pathway. Using a deep-sequencing method to measure chromosomal exonucleolytic degradation, we demonstrate that the absence of GreA limits RecBCD-mediated resection. Our findings suggest that increased RNA polymerase backtracking promotes break repair by instigating RecA loading by RecBCD, without the influence of canonical Chi signals. The idea that backtracked RNA polymerase can stimulate recombination presents a DNA transaction conundrum: a transcription fidelity factor that compromises genomic integrity.

The Pea light-independent photomorphogenesis1 Mutant Results from Partial Duplication of COP1 Generating an Internal Promoter and Producing Two Distinct Transcripts

PubMed Central

Sullivan, James A.; Gray, John C.

2000-01-01

The pea lip1 (light-independent photomorphogenesis1) mutant shows many of the characteristics of light-grown development when grown in continuous darkness. To investigate the identity of LIP1, cDNAs encoding the pea homolog of COP1, a repressor of photomorphogenesis identified in Arabidopsis, were isolated from wild-type and lip1 pea seedlings. lip1 seedlings contained a wild-type COP1 transcript as well as a larger COP1′ transcript that contained an internal in-frame duplication of 894 bp. The COP1′ transcript segregated with the lip1 phenotype in F2 seedlings and could be translated in vitro to produce a protein of ∼100 kD. The COP1 gene in lip1 peas contained a 7.5-kb duplication, consisting of exons 1 to 7 of the wild-type sequence, located 2.5 kb upstream of a region of genomic DNA identical to the wild-type COP1 DNA sequence. Transcription and splicing of the mutant COP1 gene was predicted to produce the COP1′ transcript, whereas transcription from an internal promoter in the 2.5-kb region of DNA located between the duplicated regions of COP1 would produce the wild-type COP1 transcript. The presence of small quantities of wild-type COP1 transcripts may reduce the severity of the phenotype produced by the mutated COP1′ protein. The genomic DNA sequences of the COP1 gene from wild-type and lip1 peas and the cDNA sequences of COP1 and COP1′ transcripts have been submitted to the EMBL database under the EMBL accession numbers AJ276591, AJ276592, AJ289773, and AJ289774, respectively. PMID:11041887

Catch the live show: Visualizing damaged DNA in vivo.

PubMed

Oshidari, Roxanne; Mekhail, Karim

2018-06-01

The health of an organism is intimately linked to its ability to repair damaged DNA. Importantly, DNA repair processes are highly dynamic. This highlights the necessity of characterizing DNA repair in live cells. Advanced genome editing and imaging approaches allow us to visualize damaged DNA and its associated factors in real time. Here, we summarize both established and recent methods that are used to induce DNA damage and visualize damaged DNA and its repair in live cells. Copyright © 2018 Elsevier Inc. All rights reserved.

Internal validation of STRmix™ for the interpretation of single source and mixed DNA profiles.

PubMed

Moretti, Tamyra R; Just, Rebecca S; Kehl, Susannah C; Willis, Leah E; Buckleton, John S; Bright, Jo-Anne; Taylor, Duncan A; Onorato, Anthony J

2017-07-01

The interpretation of DNA evidence can entail analysis of challenging STR typing results. Genotypes inferred from low quality or quantity specimens, or mixed DNA samples originating from multiple contributors, can result in weak or inconclusive match probabilities when a binary interpretation method and necessary thresholds (such as a stochastic threshold) are employed. Probabilistic genotyping approaches, such as fully continuous methods that incorporate empirically determined biological parameter models, enable usage of more of the profile information and reduce subjectivity in interpretation. As a result, software-based probabilistic analyses tend to produce more consistent and more informative results regarding potential contributors to DNA evidence. Studies to assess and internally validate the probabilistic genotyping software STRmix™ for casework usage at the Federal Bureau of Investigation Laboratory were conducted using lab-specific parameters and more than 300 single-source and mixed contributor profiles. Simulated forensic specimens, including constructed mixtures that included DNA from two to five donors across a broad range of template amounts and contributor proportions, were used to examine the sensitivity and specificity of the system via more than 60,000 tests comparing hundreds of known contributors and non-contributors to the specimens. Conditioned analyses, concurrent interpretation of amplification replicates, and application of an incorrect contributor number were also performed to further investigate software performance and probe the limitations of the system. In addition, the results from manual and probabilistic interpretation of both prepared and evidentiary mixtures were compared. The findings support that STRmix™ is sufficiently robust for implementation in forensic laboratories, offering numerous advantages over historical methods of DNA profile analysis and greater statistical power for the estimation of evidentiary weight, and can be used reliably in human identification testing. With few exceptions, likelihood ratio results reflected intuitively correct estimates of the weight of the genotype possibilities and known contributor genotypes. This comprehensive evaluation provides a model in accordance with SWGDAM recommendations for internal validation of a probabilistic genotyping system for DNA evidence interpretation. Copyright © 2017. Published by Elsevier B.V.

Droplet digital polymerase chain reaction (ddPCR) assays integrated with an internal control for quantification of bovine, porcine, chicken and turkey species in food and feed

PubMed Central

Shehata, Hanan R.; Li, Jiping; Redda, Helen; Cheng, Shumei; Tabujara, Nicole; Li, Honghong; Warriner, Keith; Hanner, Robert

2017-01-01

Food adulteration and feed contamination are significant issues in the food/feed industry, especially for meat products. Reliable techniques are needed to monitor these issues. Droplet Digital PCR (ddPCR) assays were developed and evaluated for detection and quantification of bovine, porcine, chicken and turkey DNA in food and feed samples. The ddPCR methods were designed based on mitochondrial DNA sequences and integrated with an artificial recombinant plasmid DNA to control variabilities in PCR procedures. The specificity of the ddPCR assays was confirmed by testing both target species and additional 18 non-target species. Linear regression established a detection range between 79 and 33200 copies of the target molecule from 0.26 to 176 pg of fresh animal tissue DNA with a coefficient of determination (R2) of 0.997–0.999. The quantification ranges of the methods for testing fortified heat-processed food and feed samples were 0.05–3.0% (wt/wt) for the bovine and turkey targets, and 0.01–1.0% (wt/wt) for pork and chicken targets. Our methods demonstrated acceptable repeatability and reproducibility for the analytical process for food and feed samples. Internal validation of the PCR process was monitored using a control chart for 74 consecutive ddPCR runs for quantifying bovine DNA. A matrix effect was observed while establishing calibration curves with the matrix type under testing, and the inclusion of an internal control in DNA extraction provides a useful means to overcome this effect. DNA degradation caused by heating, sonication or Taq I restriction enzyme digestion was found to reduce ddPCR readings by as much as 4.5 fold. The results illustrated the applicability of the methods to quantify meat species in food and feed samples without the need for a standard curve, and to potentially support enforcement activities for food authentication and feed control. Standard reference materials matching typical manufacturing processes are needed for future validation of ddPCR assays for absolute quantification of meat species. PMID:28796824

Droplet digital polymerase chain reaction (ddPCR) assays integrated with an internal control for quantification of bovine, porcine, chicken and turkey species in food and feed.

PubMed

Shehata, Hanan R; Li, Jiping; Chen, Shu; Redda, Helen; Cheng, Shumei; Tabujara, Nicole; Li, Honghong; Warriner, Keith; Hanner, Robert

2017-01-01

Food adulteration and feed contamination are significant issues in the food/feed industry, especially for meat products. Reliable techniques are needed to monitor these issues. Droplet Digital PCR (ddPCR) assays were developed and evaluated for detection and quantification of bovine, porcine, chicken and turkey DNA in food and feed samples. The ddPCR methods were designed based on mitochondrial DNA sequences and integrated with an artificial recombinant plasmid DNA to control variabilities in PCR procedures. The specificity of the ddPCR assays was confirmed by testing both target species and additional 18 non-target species. Linear regression established a detection range between 79 and 33200 copies of the target molecule from 0.26 to 176 pg of fresh animal tissue DNA with a coefficient of determination (R2) of 0.997-0.999. The quantification ranges of the methods for testing fortified heat-processed food and feed samples were 0.05-3.0% (wt/wt) for the bovine and turkey targets, and 0.01-1.0% (wt/wt) for pork and chicken targets. Our methods demonstrated acceptable repeatability and reproducibility for the analytical process for food and feed samples. Internal validation of the PCR process was monitored using a control chart for 74 consecutive ddPCR runs for quantifying bovine DNA. A matrix effect was observed while establishing calibration curves with the matrix type under testing, and the inclusion of an internal control in DNA extraction provides a useful means to overcome this effect. DNA degradation caused by heating, sonication or Taq I restriction enzyme digestion was found to reduce ddPCR readings by as much as 4.5 fold. The results illustrated the applicability of the methods to quantify meat species in food and feed samples without the need for a standard curve, and to potentially support enforcement activities for food authentication and feed control. Standard reference materials matching typical manufacturing processes are needed for future validation of ddPCR assays for absolute quantification of meat species.

Dynamic maps of UV damage formation and repair for the human genome

PubMed Central

Hu, Jinchuan; Adebali, Ogun; Adar, Sheera; Sancar, Aziz

2017-01-01

Formation and repair of UV-induced DNA damage in human cells are affected by cellular context. To study factors influencing damage formation and repair genome-wide, we developed a highly sensitive single-nucleotide resolution damage mapping method [high-sensitivity damage sequencing (HS–Damage-seq)]. Damage maps of both cyclobutane pyrimidine dimers (CPDs) and pyrimidine-pyrimidone (6-4) photoproducts [(6-4)PPs] from UV-irradiated cellular and naked DNA revealed that the effect of transcription factor binding on bulky adducts formation varies, depending on the specific transcription factor, damage type, and strand. We also generated time-resolved UV damage maps of both CPDs and (6-4)PPs by HS–Damage-seq and compared them to the complementary repair maps of the human genome obtained by excision repair sequencing to gain insight into factors that affect UV-induced DNA damage and repair and ultimately UV carcinogenesis. The combination of the two methods revealed that, whereas UV-induced damage is virtually uniform throughout the genome, repair is affected by chromatin states, transcription, and transcription factor binding, in a manner that depends on the type of DNA damage. PMID:28607063

Dynamic maps of UV damage formation and repair for the human genome.

PubMed

Hu, Jinchuan; Adebali, Ogun; Adar, Sheera; Sancar, Aziz

2017-06-27

Formation and repair of UV-induced DNA damage in human cells are affected by cellular context. To study factors influencing damage formation and repair genome-wide, we developed a highly sensitive single-nucleotide resolution damage mapping method [high-sensitivity damage sequencing (HS-Damage-seq)]. Damage maps of both cyclobutane pyrimidine dimers (CPDs) and pyrimidine-pyrimidone (6-4) photoproducts [(6-4)PPs] from UV-irradiated cellular and naked DNA revealed that the effect of transcription factor binding on bulky adducts formation varies, depending on the specific transcription factor, damage type, and strand. We also generated time-resolved UV damage maps of both CPDs and (6-4)PPs by HS-Damage-seq and compared them to the complementary repair maps of the human genome obtained by excision repair sequencing to gain insight into factors that affect UV-induced DNA damage and repair and ultimately UV carcinogenesis. The combination of the two methods revealed that, whereas UV-induced damage is virtually uniform throughout the genome, repair is affected by chromatin states, transcription, and transcription factor binding, in a manner that depends on the type of DNA damage.

Molecular dynamics studies on the DNA-binding process of ERG.

PubMed

Beuerle, Matthias G; Dufton, Neil P; Randi, Anna M; Gould, Ian R

2016-11-15

The ETS family of transcription factors regulate gene targets by binding to a core GGAA DNA-sequence. The ETS factor ERG is required for homeostasis and lineage-specific functions in endothelial cells, some subset of haemopoietic cells and chondrocytes; its ectopic expression is linked to oncogenesis in multiple tissues. To date details of the DNA-binding process of ERG including DNA-sequence recognition outside the core GGAA-sequence are largely unknown. We combined available structural and experimental data to perform molecular dynamics simulations to study the DNA-binding process of ERG. In particular we were able to reproduce the ERG DNA-complex with a DNA-binding simulation starting in an unbound configuration with a final root-mean-square-deviation (RMSD) of 2.1 Å to the core ETS domain DNA-complex crystal structure. This allowed us to elucidate the relevance of amino acids involved in the formation of the ERG DNA-complex and to identify Arg385 as a novel key residue in the DNA-binding process. Moreover we were able to show that water-mediated hydrogen bonds are present between ERG and DNA in our simulations and that those interactions have the potential to achieve sequence recognition outside the GGAA core DNA-sequence. The methodology employed in this study shows the promising capabilities of modern molecular dynamics simulations in the field of protein DNA-interactions.

Normal breast tissue DNA methylation differences at regulatory elements are associated with the cancer risk factor age.

PubMed

Johnson, Kevin C; Houseman, E Andres; King, Jessica E; Christensen, Brock C

2017-07-10

The underlying biological mechanisms through which epidemiologically defined breast cancer risk factors contribute to disease risk remain poorly understood. Identification of the molecular changes associated with cancer risk factors in normal tissues may aid in determining the earliest events of carcinogenesis and informing cancer prevention strategies. Here we investigated the impact cancer risk factors have on the normal breast epigenome by analyzing DNA methylation genome-wide (Infinium 450 K array) in cancer-free women from the Susan G. Komen Tissue Bank (n = 100). We tested the relation of established breast cancer risk factors, age, body mass index, parity, and family history of disease, with DNA methylation adjusting for potential variation in cell-type proportions. We identified 787 cytosine-guanine dinucleotide (CpG) sites that demonstrated significant associations (Q value <0.01) with subject age. Notably, DNA methylation was not strongly associated with the other evaluated breast cancer risk factors. Age-related DNA methylation changes are primarily increases in methylation enriched at breast epithelial cell enhancer regions (P = 7.1E-20), and binding sites of chromatin remodelers (MYC and CTCF). We validated the age-related associations in two independent populations, using normal breast tissue samples (n = 18) and samples of normal tissue adjacent to tumor tissue (n = 97). The genomic regions classified as age-related were more likely to be regions altered in both pre-invasive (n = 40, P = 3.0E-03) and invasive breast tumors (n = 731, P = 1.1E-13). DNA methylation changes with age occur at regulatory regions, and are further exacerbated in cancer, suggesting that age influences breast cancer risk in part through its contribution to epigenetic dysregulation in normal breast tissue.

Genomic Approach to Understand the Association of DNA Repair with Longevity and Healthy Aging Using Genomic Databases of Oldest-Old Population

PubMed Central

Kim, Hyun Soo

2018-01-01

Aged population is increasing worldwide due to the aging process that is inevitable. Accordingly, longevity and healthy aging have been spotlighted to promote social contribution of aged population. Many studies in the past few decades have reported the process of aging and longevity, emphasizing the importance of maintaining genomic stability in exceptionally long-lived population. Underlying reason of longevity remains unclear due to its complexity involving multiple factors. With advances in sequencing technology and human genome-associated approaches, studies based on population-based genomic studies are increasing. In this review, we summarize recent longevity and healthy aging studies of human population focusing on DNA repair as a major factor in maintaining genome integrity. To keep pace with recent growth in genomic research, aging- and longevity-associated genomic databases are also briefly introduced. To suggest novel approaches to investigate longevity-associated genetic variants related to DNA repair using genomic databases, gene set analysis was conducted, focusing on DNA repair- and longevity-associated genes. Their biological networks were additionally analyzed to grasp major factors containing genetic variants of human longevity and healthy aging in DNA repair mechanisms. In summary, this review emphasizes DNA repair activity in human longevity and suggests approach to conduct DNA repair-associated genomic study on human healthy aging.

Single-molecule manipulation reveals supercoiling-dependent modulation of lac repressor-mediated DNA looping

PubMed Central

Normanno, Davide; Vanzi, Francesco; Pavone, Francesco Saverio

2008-01-01

Gene expression regulation is a fundamental biological process which deploys specific sets of genomic information depending on physiological or environmental conditions. Several transcription factors (including lac repressor, LacI) are present in the cell at very low copy number and increase their local concentration by binding to multiple sites on DNA and looping the intervening sequence. In this work, we employ single-molecule manipulation to experimentally address the role of DNA supercoiling in the dynamics and stability of LacI-mediated DNA looping. We performed measurements over a range of degrees of supercoiling between −0.026 and +0.026, in the absence of axial stretching forces. A supercoiling-dependent modulation of the lifetimes of both the looped and unlooped states was observed. Our experiments also provide evidence for multiple structural conformations of the LacI–DNA complex, depending on torsional constraints. The supercoiling-dependent modulation demonstrated here adds an important element to the model of the lac operon. In fact, the complex network of proteins acting on the DNA in a living cell constantly modifies its topological and mechanical properties: our observations demonstrate the possibility of establishing a signaling pathway from factors affecting DNA supercoiling to transcription factors responsible for the regulation of specific sets of genes. PMID:18310101

ATM-Dependent Phosphorylation of MEF2D Promotes Neuronal Survival after DNA Damage

PubMed Central

Chan, Shing Fai; Sances, Sam; Brill, Laurence M.; Okamoto, Shu-ichi; Zaidi, Rameez; McKercher, Scott R.; Akhtar, Mohd W.; Nakanishi, Nobuki

2014-01-01

Mutations in the ataxia telangiectasia mutated (ATM) gene, which encodes a kinase critical for the normal DNA damage response, cause the neurodegenerative disorder ataxia-telangiectasia (AT). The substrates of ATM in the brain are poorly understood. Here we demonstrate that ATM phosphorylates and activates the transcription factor myocyte enhancer factor 2D (MEF2D), which plays a critical role in promoting survival of cerebellar granule cells. ATM associates with MEF2D after DNA damage and phosphorylates the transcription factor at four ATM consensus sites. Knockdown of endogenous MEF2D with a short-hairpin RNA (shRNA) increases sensitivity to etoposide-induced DNA damage and neuronal cell death. Interestingly, substitution of endogenous MEF2D with an shRNA-resistant phosphomimetic MEF2D mutant protects cerebellar granule cells from cell death after DNA damage, whereas an shRNA-resistant nonphosphorylatable MEF2D mutant does not. In vivo, cerebella in Mef2d knock-out mice manifest increased susceptibility to DNA damage. Together, our results show that MEF2D is a substrate for phosphorylation by ATM, thus promoting survival in response to DNA damage. Moreover, dysregulation of the ATM–MEF2D pathway may contribute to neurodegeneration in AT. PMID:24672010

Quantifying the Effect of DNA Packaging on Gene Expression Level

NASA Astrophysics Data System (ADS)

Kim, Harold

2010-10-01

Gene expression, the process by which the genetic code comes alive in the form of proteins, is one of the most important biological processes in living cells, and begins when transcription factors bind to specific DNA sequences in the promoter region upstream of a gene. The relationship between gene expression output and transcription factor input which is termed the gene regulation function is specific to each promoter, and predicting this gene regulation function from the locations of transcription factor binding sites is one of the challenges in biology. In eukaryotic organisms (for example, animals, plants, fungi etc), DNA is highly compacted into nucleosomes, 147-bp segments of DNA tightly wrapped around histone protein core, and therefore, the accessibility of transcription factor binding sites depends on their locations with respect to nucleosomes - sites inside nucleosomes are less accessible than those outside nucleosomes. To understand how transcription factor binding sites contribute to gene expression in a quantitative manner, we obtain gene regulation functions of promoters with various configurations of transcription factor binding sites by using fluorescent protein reporters to measure transcription factor input and gene expression output in single yeast cells. In this talk, I will show that the affinity of a transcription factor binding site inside and outside the nucleosome controls different aspects of the gene regulation function, and explain this finding based on a mass-action kinetic model that includes competition between nucleosomes and transcription factors.

Role of p53 in Mammary Epithelial Cell Senescence

DTIC Science & Technology

2007-05-01

UTR similar to myosin XV GGCCATGGCT-38-GGCAGGAGT 4 8 Internal Homo sapiens chromosome 8, clone RP11-301G7 AGACACTCCT-8-AGACAGGGTC 5 6 Internal...Human DNA sequence from clone RP3-322A24. fibronectin type III domain containing 1 TTTCATGGCT-74-TGGTTTGCCT 6 12 Internal Homo sapiens 12 BAC RP11...513P18 TAACTTGTGT-x-TGAAATGCTT 7 5 Internal Homo sapiens chromosome 5 clone CTD-2210P15 AGGCAGGTTG-28-AGGCATCCTA 8 12 Internal Homo sapiens

Lactose-modified DNA tile nanostructures as drug carriers.

PubMed

Akkus Sut, Pinar; Tunc, Cansu Umran; Culha, Mustafa

2016-09-01

DNA hybridization allows the preparation of nanoscale DNA structures with desired shape and size. DNA structures using simple base pairing can be used for the delivery of drug molecules into the cells. Since DNA carries multiple negative charges, their cellular uptake efficiency is low. Thus, the modification of the DNA structures with molecules that may enhance the cellular internalization may be an option. The objective of this study is to construct DNA-based nanocarrier system and to investigate the cellular uptake of DNA tile with/without lactose modification. Doxorubicin was intercalated to DNA tile and cellular uptake of drug-loaded DNA-based carrier with/without lactose modification was investigated in vitro. HeLa, BT-474, and MDA-MB-231 cancer cells were used for cellular uptake studies and cytotoxicity assays. Using fluorescence spectroscopy, flow cytometry, and confocal microscopy, cellular uptake behavior of DNA tile was investigated. The cytotoxicity of DNA tile structures was determined with WST-1 assay. The results show that modification with lactose effectively increases the intracellular uptake of doxorubicin loaded DNA tile structure by cancer cells compared with the unmodified DNA tile. The findings of this study suggest that DNA-based nanostructures modified with carbohydrates can be used as suitable multifunctional nanocarriers with simple chemical modifications.

DNA binding triggers tetramerization of the glucocorticoid receptor in live cells

PubMed Central

Presman, Diego M.; Ganguly, Sourav; Schiltz, R. Louis; Johnson, Thomas A.; Karpova, Tatiana S.; Hager, Gordon L.

2016-01-01

Transcription factors dynamically bind to chromatin and are essential for the regulation of genes. Although a large percentage of these proteins appear to self-associate to form dimers or higher order oligomers, the stoichiometry of DNA-bound transcription factors has been poorly characterized in vivo. The glucocorticoid receptor (GR) is a ligand-regulated transcription factor widely believed to act as a dimer or a monomer. Using a unique set of imaging techniques coupled with a cell line containing an array of DNA binding elements, we show that GR is predominantly a tetramer when bound to its target DNA. We find that DNA binding triggers an interdomain allosteric regulation within the GR, leading to tetramerization. We therefore propose that dynamic changes in GR stoichiometry represent a previously unidentified level of regulation in steroid receptor activation. Quaternary structure analysis of other members of the steroid receptor family (estrogen, androgen, and progesterone receptors) reveals variation in oligomerization states among this family of transcription factors. Because GR’s oligomerization state has been implicated in therapy outcome, our findings open new doors to the rational design of novel GR ligands and redefine the quaternary structure of steroid receptors. PMID:27382178

Transcription factor FoxA (HNF3) on a nucleosome at an enhancer complex in liver chromatin.

PubMed

Chaya, D; Hayamizu, T; Bustin, M; Zaret, K S

2001-11-30

Nucleosome-like particles and acetylated histones occur near active promoters and enhancers, and certain transcription factors can recognize their target sites on the surface of a nucleosome in vitro; yet it has been unclear whether transcription factors can occupy target sites on nucleosomes in native chromatin. We developed a method for sequential chromatin immunoprecipitation of distinct nuclear proteins that are simultaneously cross-linked to nucleosome-sized genomic DNA segments. We find that core histone H2A co-occupies, along with the FoxA (hepatocyte nuclear factor-3) transcription factor, DNA for the albumin transcriptional enhancer in native liver chromatin, where the enhancer is active. Because histone H2A on nuclear DNA is only known to exist in nucleosomes, we conclude that transcription factors can form a stable complex on nucleosomes at an active enhancer element in vivo.

A novel mini-DNA barcoding assay to identify processed fins from internationally protected shark species.

PubMed

Fields, Andrew T; Abercrombie, Debra L; Eng, Rowena; Feldheim, Kevin; Chapman, Demian D

2015-01-01

There is a growing need to identify shark products in trade, in part due to the recent listing of five commercially important species on the Appendices of the Convention on International Trade in Endangered Species (CITES; porbeagle, Lamna nasus, oceanic whitetip, Carcharhinus longimanus scalloped hammerhead, Sphyrna lewini, smooth hammerhead, S. zygaena and great hammerhead S. mokarran) in addition to three species listed in the early part of this century (whale, Rhincodon typus, basking, Cetorhinus maximus, and white, Carcharodon carcharias). Shark fins are traded internationally to supply the Asian dried seafood market, in which they are used to make the luxury dish shark fin soup. Shark fins usually enter international trade with their skin still intact and can be identified using morphological characters or standard DNA-barcoding approaches. Once they reach Asia and are traded in this region the skin is removed and they are treated with chemicals that eliminate many key diagnostic characters and degrade their DNA ("processed fins"). Here, we present a validated mini-barcode assay based on partial sequences of the cytochrome oxidase I gene that can reliably identify the processed fins of seven of the eight CITES listed shark species. We also demonstrate that the assay can even frequently identify the species or genus of origin of shark fin soup (31 out of 50 samples).

A Novel Mini-DNA Barcoding Assay to Identify Processed Fins from Internationally Protected Shark Species

PubMed Central

Fields, Andrew T.; Abercrombie, Debra L.; Eng, Rowena; Feldheim, Kevin; Chapman, Demian D.

2015-01-01

There is a growing need to identify shark products in trade, in part due to the recent listing of five commercially important species on the Appendices of the Convention on International Trade in Endangered Species (CITES; porbeagle, Lamna nasus, oceanic whitetip, Carcharhinus longimanus scalloped hammerhead, Sphyrna lewini, smooth hammerhead, S. zygaena and great hammerhead S. mokarran) in addition to three species listed in the early part of this century (whale, Rhincodon typus, basking, Cetorhinus maximus, and white, Carcharodon carcharias). Shark fins are traded internationally to supply the Asian dried seafood market, in which they are used to make the luxury dish shark fin soup. Shark fins usually enter international trade with their skin still intact and can be identified using morphological characters or standard DNA-barcoding approaches. Once they reach Asia and are traded in this region the skin is removed and they are treated with chemicals that eliminate many key diagnostic characters and degrade their DNA (“processed fins”). Here, we present a validated mini-barcode assay based on partial sequences of the cytochrome oxidase I gene that can reliably identify the processed fins of seven of the eight CITES listed shark species. We also demonstrate that the assay can even frequently identify the species or genus of origin of shark fin soup (31 out of 50 samples). PMID:25646789

A Pre-mRNA-Splicing Factor Is Required for RNA-Directed DNA Methylation in Arabidopsis

PubMed Central

Huang, Chao-Feng; Miki, Daisuke; Tang, Kai; Zhou, Hao-Ran; Zheng, Zhimin; Chen, Wei; Ma, Ze-Yang; Yang, Lan; Zhang, Heng; Liu, Renyi; He, Xin-Jian; Zhu, Jian-Kang

2013-01-01

Cytosine DNA methylation is a stable epigenetic mark that is frequently associated with the silencing of genes and transposable elements (TEs). In Arabidopsis, the establishment of DNA methylation is through the RNA-directed DNA methylation (RdDM) pathway. Here, we report the identification and characterization of RDM16, a new factor in the RdDM pathway. Mutation of RDM16 reduced the DNA methylation levels and partially released the silencing of a reporter gene as well as some endogenous genomic loci in the DNA demethylase ros1-1 mutant background. The rdm16 mutant had morphological defects and was hypersensitive to salt stress and abscisic acid (ABA). Map-based cloning and complementation test led to the identification of RDM16, which encodes a pre-mRNA-splicing factor 3, a component of the U4/U6 snRNP. RNA-seq analysis showed that 308 intron retention events occurred in rdm16, confirming that RDM16 is involved in pre-mRNA splicing in planta. RNA-seq and mRNA expression analysis also revealed that the RDM16 mutation did not affect the pre-mRNA splicing of known RdDM genes, suggesting that RDM16 might be directly involved in RdDM. Small RNA expression analysis on loci showing RDM16-dependent DNA methylation suggested that unlike the previously reported putative splicing factor mutants, rdm16 did not affect small RNA levels; instead, the rdm16 mutation caused a decrease in the levels of Pol V transcripts. ChIP assays revealed that RDM16 was enriched at some Pol V target loci. Our results suggest that RDM16 regulates DNA methylation through influencing Pol V transcript levels. Finally, our genome-wide DNA methylation analysis indicated that RDM16 regulates the overall methylation of TEs and gene-surrounding regions, and preferentially targets Pol IV-dependent DNA methylation loci and the ROS1 target loci. Our work thus contributes to the understanding of RdDM and its interactions with active DNA demethylation. PMID:24068953

Internal friction and nonequilibrium unfolding of polymeric globules.

PubMed

Alexander-Katz, Alfredo; Wada, Hirofumi; Netz, Roland R

2009-07-10

The stretching response of a single collapsed homopolymer is studied using Brownian dynamic simulations. The irreversibly dissipated work is found to be dominated by internal friction effects below the collapse temperature, and the internal viscosity grows exponentially with the effective cohesive strength between monomers. These results explain friction effects of globular DNA and are relevant for dissipation at intermediate stages of protein folding.

Intelligent layered nanoflare: ``lab-on-a-nanoparticle'' for multiple DNA logic gate operations and efficient intracellular delivery

NASA Astrophysics Data System (ADS)

Yang, Bin; Zhang, Xiao-Bing; Kang, Li-Ping; Huang, Zhi-Mei; Shen, Guo-Li; Yu, Ru-Qin; Tan, Weihong

2014-07-01

DNA strand displacement cascades have been engineered to construct various fascinating DNA circuits. However, biological applications are limited by the insufficient cellular internalization of naked DNA structures, as well as the separated multicomponent feature. In this work, these problems are addressed by the development of a novel DNA nanodevice, termed intelligent layered nanoflare, which integrates DNA computing at the nanoscale, via the self-assembly of DNA flares on a single gold nanoparticle. As a ``lab-on-a-nanoparticle'', the intelligent layered nanoflare could be engineered to perform a variety of Boolean logic gate operations, including three basic logic gates, one three-input AND gate, and two complex logic operations, in a digital non-leaky way. In addition, the layered nanoflare can serve as a programmable strategy to sequentially tune the size of nanoparticles, as well as a new fingerprint spectrum technique for intelligent multiplex biosensing. More importantly, the nanoflare developed here can also act as a single entity for intracellular DNA logic gate delivery, without the need of commercial transfection agents or other auxiliary carriers. By incorporating DNA circuits on nanoparticles, the presented layered nanoflare will broaden the applications of DNA circuits in biological systems, and facilitate the development of DNA nanotechnology.DNA strand displacement cascades have been engineered to construct various fascinating DNA circuits. However, biological applications are limited by the insufficient cellular internalization of naked DNA structures, as well as the separated multicomponent feature. In this work, these problems are addressed by the development of a novel DNA nanodevice, termed intelligent layered nanoflare, which integrates DNA computing at the nanoscale, via the self-assembly of DNA flares on a single gold nanoparticle. As a ``lab-on-a-nanoparticle'', the intelligent layered nanoflare could be engineered to perform a variety of Boolean logic gate operations, including three basic logic gates, one three-input AND gate, and two complex logic operations, in a digital non-leaky way. In addition, the layered nanoflare can serve as a programmable strategy to sequentially tune the size of nanoparticles, as well as a new fingerprint spectrum technique for intelligent multiplex biosensing. More importantly, the nanoflare developed here can also act as a single entity for intracellular DNA logic gate delivery, without the need of commercial transfection agents or other auxiliary carriers. By incorporating DNA circuits on nanoparticles, the presented layered nanoflare will broaden the applications of DNA circuits in biological systems, and facilitate the development of DNA nanotechnology. Electronic supplementary information (ESI) available: Additional figures (Table S1, Fig. S1-S5). See DOI: 10.1039/c4nr01676a

Integrated in silico and biological validation of the blocking effect of Cot-1 DNA on Microarray-CGH.

PubMed

Kang, Seung-Hui; Park, Chan Hee; Jeung, Hei Cheul; Kim, Ki-Yeol; Rha, Sun Young; Chung, Hyun Cheol

2007-06-01

In array-CGH, various factors may act as variables influencing the result of experiments. Among them, Cot-1 DNA, which has been used as a repetitive sequence-blocking agent, may become an artifact-inducing factor in BAC array-CGH. To identify the effect of Cot-1 DNA on Microarray-CGH experiments, Cot-1 DNA was labeled directly and Microarray-CGH experiments were performed. The results confirmed that probes which hybridized more completely with Cot-1 DNA had a higher sequence similarity to the Alu element. Further, in the sex-mismatched Microarray-CGH experiments, the variation and intensity in the fluorescent signal were reduced in the high intensity probe group in which probes were better hybridized with Cot-1 DNA. Otherwise, those of the low intensity probe group showed no alterations regardless of Cot-1 DNA. These results confirmed by in silico methods that Cot-1 DNA could block repetitive sequences in gDNA and probes. In addition, it was confirmed biologically that the blocking effect of Cot-1 DNA could be presented via its repetitive sequences, especially Alu elements. Thus, in contrast to BAC-array CGH, the use of Cot-1 DNA is advantageous in controlling experimental variation in Microarray-CGH.

Lindnera (Pichia) fabianii blood infection after mesenteric ischemia.

PubMed

Gabriel, Frederic; Noel, Thierry; Accoceberry, Isabelle

2012-04-01

Lindnera (Pichia) fabianii (teleomorph of Candida fabianii) is a yeast species rarely involved in human infections. This report describes the first known human case of a Lindnera fabianii blood infection after mesenteric ischemia. The 53-year-old patient was hospitalized in the intensive care unit after a suicide attempt and was suffering from a mesenteric ischemia and acute renal failure. Lindnera fabianii was recovered from an oropharyngeal swab, then isolated from stool and urine samples before the diagnosis of the blood infection. Caspofungin intravenous treatment was associated with a successful outcome. Final unequivocal identification of the strain was done by sequencing the internal transcribed spacer (ITS) region, and regions of 18S rDNA gene and of the translation elongation factor-1α gene. Until our work, the genomic databases did not contain the complete ITS region of L. fabianii as a single nucleotide sequence (encompassing ITS1, the 5.8S rDNA and ITS2), and misidentification with other yeast species, e.g., Lindnera (Pichia) mississippiensis, could have occurred. Our work demonstrates that the usual DNA barcoding method based on sequencing of the ITS region may fail to provide the correct identification of some taxa, and that partial sequencing of the EF1α gene may be much more effective for the accurate delineation and molecular identification of new emerging opportunistic yeast pathogens.

Role of ataxia-telangiectasia mutated (ATM) in porcine oocyte in vitro maturation.

PubMed

Lin, Zi-Li; Kim, Nam-Hyung

2015-06-01

Ataxia-telangiectasia mutated (ATM) is critical for the DNA damage response, cell cycle checkpoints, and apoptosis. Significant effort has focused on elucidating the relationship between ATM and other nuclear signal transducers; however, little is known about the connection between ATM and oocyte meiotic maturation. We investigated the function of ATM in porcine oocytes. ATM was expressed at all stages of oocyte maturation and localized predominantly in the nucleus. Furthermore, the ATM-specific inhibitor KU-55933 blocked porcine oocyte maturation, reducing the percentages of oocytes that underwent germinal vesicle breakdown (GVBD) and first polar body extrusion. KU-55933 also decreased the expression of DNA damage-related genes (breast cancer 1, budding uninhibited by benzimidazoles 1, and P53) and reduced the mRNA and protein levels of AKT and other cell cycle-regulated genes that are predominantly expressed during G2/M phase, including bone morphogenetic protein 15, growth differentiation factor 9, cell division cycle protein 2, cyclinB1, and AKT. KU-55933 treatment decreased the developmental potential of blastocysts following parthenogenetic activation and increased the level of apoptosis. Together, these data suggested that ATM influenced the meiotic and cytoplasmic maturation of porcine oocytes, potentially by decreasing their sensitivity to DNA strand breaks, stimulating the AKT pathway, and/or altering the expression of other maternal genes. © 2015 International Federation for Cell Biology.