Sample records for dna isolation methods

  1. The DNA isolation method has effect on allele drop-out and on the results of fluorescent PCR and DNA fragment analysis.

    PubMed

    Nagy, Bálint; Bán, Zoltán; Papp, Zoltán

    2005-10-01

    The quality and the quantity of isolated DNA have an effect on PCR amplifications. The authors studied three DNA isolation protocols (resin binding method using fresh and frozen amniotic fluid samples, and silica adsorption method using fresh samples) on the quantity and on the quality of the isolated DNA. Amniotic fluid samples were obtained from 20 pregnant women. The isolated DNA concentrations were determined by real-time fluorimeter using SYBRGreen I method. Each sample was studied for the presence of 8 STR markers. The authors compared the number of the detected alleles, electrophoretograms and peak areas. There was a significant difference between the concentration of the obtained DNA and in the peak areas between the three isolation protocols. The numbers of detected alleles were different, we observed the most allele drop outs in the resin type DNA isolation protocol from the fresh sample (detected allele numbers 182), followed by resin binding protocol from the frozen samples (detected allele number 243) and by the silica adsorption method (detected allele number 264). The authors demonstrated that the DNA isolation method has an effect on the quantity and quality of the isolated DNA, and on further PCR amplifications.

  2. Co-precipitation of protein and polyester as a method to isolate high molecular weight DNA.

    PubMed

    Dixson, Jamie D

    2005-02-01

    DNA isolation is often the limiting step in genetic analysis using PCR and automated fragment analysis due to low quality or purity of DNA, the need to determine and adjust DNA concentrations after isolation etc. Several protocols have been developed which are either safe and provide good quality DNA or hazardous and provide excellent quality DNA. In this brief communication I describe a new and rapid method of DNA isolation which employs the co-precipitation of protein and polyester, in the presence of acetone, to remove contaminating proteins from a lysed-tissue sample, thus leaving high quality pure DNA. The advantages of this method are increased safety over the phenol:chloroform and the chaotrophic salt methods and increased purity over the salting-out method. Since the concentrations of DNA isolated using this method are relatively consistent regardless of the amount of starting tissue (within limits), adjustments of the DNA concentrations before use as templates in PCR's are not necessary.

  3. Rapid and effective processing of blood specimens for diagnostic PCR using filter paper and Chelex-100.

    PubMed Central

    Polski, J M; Kimzey, S; Percival, R W; Grosso, L E

    1998-01-01

    AIM: To provide a more efficient method for isolating DNA from peripheral blood for use in diagnostic DNA mutation analysis. METHODS: The use of blood impregnated filter paper and Chelex-100 in DNA isolation was evaluated and compared with standard DNA isolation techniques. RESULTS: In polymerase chain reaction (PCR) based assays of five point mutations, identical results were obtained with DNA isolated routinely from peripheral blood and isolated using the filter paper and Chelex-100 method. CONCLUSION: In the clinical setting, this method provides a useful alternative to conventional DNA isolation. It is easily implemented and inexpensive, and provides sufficient, stable DNA for multiple assays. The potential for specimen contamination is reduced because most of the steps are performed in a single microcentrifuge tube. In addition, this method provides for easy storage and transport of samples from the point of acquisition. PMID:9893748

  4. Rapid and effective processing of blood specimens for diagnostic PCR using filter paper and Chelex-100.

    PubMed

    Polski, J M; Kimzey, S; Percival, R W; Grosso, L E

    1998-08-01

    To provide a more efficient method for isolating DNA from peripheral blood for use in diagnostic DNA mutation analysis. The use of blood impregnated filter paper and Chelex-100 in DNA isolation was evaluated and compared with standard DNA isolation techniques. In polymerase chain reaction (PCR) based assays of five point mutations, identical results were obtained with DNA isolated routinely from peripheral blood and isolated using the filter paper and Chelex-100 method. In the clinical setting, this method provides a useful alternative to conventional DNA isolation. It is easily implemented and inexpensive, and provides sufficient, stable DNA for multiple assays. The potential for specimen contamination is reduced because most of the steps are performed in a single microcentrifuge tube. In addition, this method provides for easy storage and transport of samples from the point of acquisition.

  5. Utility of 16S rDNA Sequencing for Identification of Rare Pathogenic Bacteria.

    PubMed

    Loong, Shih Keng; Khor, Chee Sieng; Jafar, Faizatul Lela; AbuBakar, Sazaly

    2016-11-01

    Phenotypic identification systems are established methods for laboratory identification of bacteria causing human infections. Here, the utility of phenotypic identification systems was compared against 16S rDNA identification method on clinical isolates obtained during a 5-year study period, with special emphasis on isolates that gave unsatisfactory identification. One hundred and eighty-seven clinical bacteria isolates were tested with commercial phenotypic identification systems and 16S rDNA sequencing. Isolate identities determined using phenotypic identification systems and 16S rDNA sequencing were compared for similarity at genus and species level, with 16S rDNA sequencing as the reference method. Phenotypic identification systems identified ~46% (86/187) of the isolates with identity similar to that identified using 16S rDNA sequencing. Approximately 39% (73/187) and ~15% (28/187) of the isolates showed different genus identity and could not be identified using the phenotypic identification systems, respectively. Both methods succeeded in determining the species identities of 55 isolates; however, only ~69% (38/55) of the isolates matched at species level. 16S rDNA sequencing could not determine the species of ~20% (37/187) of the isolates. The 16S rDNA sequencing is a useful method over the phenotypic identification systems for the identification of rare and difficult to identify bacteria species. The 16S rDNA sequencing method, however, does have limitation for species-level identification of some bacteria highlighting the need for better bacterial pathogen identification tools. © 2016 Wiley Periodicals, Inc.

  6. Detection of processed genetically modified food using CIM monolithic columns for DNA isolation.

    PubMed

    Jerman, Sergej; Podgornik, Ales; Cankar, Katarina; Cadet, Neza; Skrt, Mihaela; Zel, Jana; Raspor, Peter

    2005-02-11

    The availability of sufficient quantities of DNA of adequate quality is crucial in polymerase chain reaction (PCR)-based methods for genetically modified food detection. In this work, the suitability of anion-exchange CIM (Convective Interaction Media; BIA Separations, Ljubljana, Slovenia) monolithic columns for isolation of DNA from food was studied. Maize and its derivates corn meal and thermally pretreated corn meal were chosen as model food. Two commercially available CIM disk columns were tested: DEAE (diethylaminoethyl) and QA (quaternary amine). Preliminary separations were performed with standard solution of salmon DNA at different pH values and different NaCl concentrations in mobile phase. DEAE groups and pH 8 were chosen for further isolations of DNA from a complex matrix-food extract. The quality and quantity of isolated DNA were tested on agarose gel electrophoresis, with UV-scanning spectrophotometry, and by amplification with real-time PCR. DNA isolated in this way was of suitable quality for further PCR analyses. The described method is also applicable for DNA isolation from processed foods with decreased DNA content. Furthermore, it is more effective and less time-consuming in comparison with the existing proposed methods for isolation of DNA from plant-derived foods.

  7. DNA ISOLATION FROM SMALL TISSUE SAMPLES USING SALT AND SPERMINE

    EPA Science Inventory

    Common DNA isolation methods rely upon protein denaturation by organic solvents such as phenol and chloroform. hese solvents pose some risk to the user and require special disposal procedures. e have previously reported a method for isolating DNA from peripheral blood lymphocytes...

  8. Isolation from genomic DNA of sequences binding specific regulatory proteins by the acceleration of protein electrophoretic mobility upon DNA binding.

    PubMed

    Subrahmanyam, S; Cronan, J E

    1999-01-21

    We report an efficient and flexible in vitro method for the isolation of genomic DNA sequences that are the binding targets of a given DNA binding protein. This method takes advantage of the fact that binding of a protein to a DNA molecule generally increases the rate of migration of the protein in nondenaturing gel electrophoresis. By the use of a radioactively labeled DNA-binding protein and nonradioactive DNA coupled with PCR amplification from gel slices, we show that specific binding sites can be isolated from Escherichia coli genomic DNA. We have applied this method to isolate a binding site for FadR, a global regulator of fatty acid metabolism in E. coli. We have also isolated a second binding site for BirA, the biotin operon repressor/biotin ligase, from the E. coli genome that has a very low binding efficiency compared with the bio operator region.

  9. Rapid Electrokinetic Isolation of Cancer-Related Circulating Cell-Free DNA Directly from Blood

    PubMed Central

    Sonnenberg, Avery; Marciniak, Jennifer Y.; Rassenti, Laura; Ghia, Emanuela M.; Skowronski, Elaine A.; Manouchehri, Sareh; McCanna, James; Widhopf, George F.; Kipps, Thomas J.; Heller, Michael J.

    2014-01-01

    BACKGROUND Circulating cell-free DNA (ccf-DNA) is becoming an important biomarker for cancer diagnostics and therapy monitoring. The isolation of ccf-DNA from plasma as a “liquid biopsy” may begin to replace more invasive tissue biopsies for the detection and analysis of cancer-related mutations. Conventional methods for the isolation of ccf-DNA from plasma are costly, time-consuming, and complex, preventing the use of ccf-DNA biomarkers for point-of-care diagnostics and limiting other biomedical research applications. METHODS We used an AC electrokinetic device to rapidly isolate ccf-DNA from 25 μL unprocessed blood. ccf-DNA from 15 chronic lymphocytic leukemia (CLL) patients and 3 healthy individuals was separated into dielectrophoretic (DEP) high-field regions, after which other blood components were removed by a fluidic wash. Concentrated ccf-DNA was detected by fluorescence and eluted for quantification,PCR,and DNA sequencing. The complete process, blood to PCR, required <10 min. ccf-DNA was amplified by PCR with immunoglobulin heavy chain variable region (IGHV)-specific primers to identify the unique IGHV gene expressed by the leukemic B-cell clone, and then sequenced. RESULTS PCR and DNA sequencing results obtained by DEP from 25 μL CLL blood matched results obtained by use of conventional methods for ccf-DNA isolation from 1 mL plasma and for genomic DNA isolation from CLL patient leukemic B cells isolated from 15–20 mL blood. CONCLUSIONS Rapid isolation of ccf-DNA directly from a drop of blood will advance disease-related biomarker research, accelerate the transition from tissue to liquid biopsies, and enable point-of-care diagnostic systems for patient monitoring. PMID:24270796

  10. Methods to alter levels of a DNA repair protein

    DOEpatents

    Petrini, John H.; Morgan, William Francis; Maser, Richard Scott; Carney, James Patrick

    2006-10-17

    An isolated and purified DNA molecule encoding a DNA repair protein, p95, is provided, as is isolated and purified p95. Also provided are methods of detecting p95 and DNA encoding p95. The invention further provides p95 knock-out mice.

  11. Comparison of methods for the extraction of DNA from formalin-fixed, paraffin-embedded archival tissues.

    PubMed

    Sengüven, Burcu; Baris, Emre; Oygur, Tulin; Berktas, Mehmet

    2014-01-01

    Discussing a protocol involving xylene-ethanol deparaffinization on slides followed by a kit-based extraction that allows for the extraction of high quality DNA from FFPE tissues. DNA was extracted from the FFPE tissues of 16 randomly selected blocks. Methods involving deparaffinization on slides or tubes, enzyme digestion overnight or for 72 hours and isolation using phenol chloroform method or a silica-based commercial kit were compared in terms of yields, concentrations and the amplifiability. The highest yield of DNA was produced from the samples that were deparaffinized on slides, digested for 72 hours and isolated with a commercial kit. Samples isolated with the phenol-chloroform method produced DNA of lower purity than the samples that were purified with kit. The samples isolated with the commercial kit resulted in better PCR amplification. Silica-based commercial kits and deparaffinized on slides should be considered for DNA extraction from FFPE.

  12. A rapid and easy method for the DNA extraction from Cryptococcus neoformans

    PubMed Central

    2011-01-01

    DNA isolation from C. neoformans is difficult due to a thick and resistant capsule. We have optimized a new and rapid DNA isolation method for Cryptococcus using a short urea treatment followed by a rapid method using a chelex resin suspension. This procedure is simpler than previously reported methods. PMID:21777412

  13. An improved method for the isolation of rat alveolar type II lung cells: Use in the Comet assay to determine DNA damage induced by cigarette smoke.

    PubMed

    Dalrymple, Annette; Ordoñez, Patricia; Thorne, David; Dillon, Debbie; Meredith, Clive

    2015-06-01

    Smoking is a cause of serious diseases, including lung cancer, emphysema, chronic bronchitis and heart disease. DNA damage is thought to be one of the mechanisms by which cigarette smoke (CS) initiates disease in the lung. Indeed, CS induced DNA damage can be measured in vitro and in vivo. The potential of the Comet assay to measure DNA damage in isolated rat lung alveolar type II epithelial cells (AEC II) was explored as a means to include a genotoxicity end-point in rodent sub-chronic inhalation studies. In this study, published AEC II isolation methods were improved to yield viable cells suitable for use in the Comet assay. The improved method reduced the level of basal DNA damage and DNA repair in isolated AEC II. CS induced DNA damage could also be quantified in isolated cells following a single or 5 days CS exposure. In conclusion, the Comet assay has the potential to determine CS or other aerosol induced DNA damage in AEC II isolated from rodents used in sub-chronic inhalation studies. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  14. Comparison of Methods for the Extraction of DNA from Formalin-Fixed, Paraffin-Embedded Archival Tissues

    PubMed Central

    Sengüven, Burcu; Baris, Emre; Oygur, Tulin; Berktas, Mehmet

    2014-01-01

    Aim: Discussing a protocol involving xylene-ethanol deparaffinization on slides followed by a kit-based extraction that allows for the extraction of high quality DNA from FFPE tissues. Methods: DNA was extracted from the FFPE tissues of 16 randomly selected blocks. Methods involving deparaffinization on slides or tubes, enzyme digestion overnight or for 72 hours and isolation using phenol chloroform method or a silica-based commercial kit were compared in terms of yields, concentrations and the amplifiability. Results: The highest yield of DNA was produced from the samples that were deparaffinized on slides, digested for 72 hours and isolated with a commercial kit. Samples isolated with the phenol-chloroform method produced DNA of lower purity than the samples that were purified with kit. The samples isolated with the commercial kit resulted in better PCR amplification. Conclusion: Silica-based commercial kits and deparaffinized on slides should be considered for DNA extraction from FFPE. PMID:24688314

  15. A silica sands-based method for faithful analysis of microbial communities and DNA isolation from a wide range of species.

    PubMed

    Liu, Xia; Xu, Yongdong; Li, Zhi; Jiang, Shengwei; Yao, Shuo; Wu, Rina; An, Yingfeng

    2018-04-21

    A silica sands-based method has been developed to isolate high quality genomic DNAs from cells of animals, plants and microorganisms, such as Hemisalanx prognathus, Spinacia oleracea, Pichia pastoris, Bacillus licheniformis and Escherichia coli. To the best of our knowledge, no DNA isolation method has so wide application until now. In addition, this method and a commercially available kit were compared in analysis of microbial communities using high-throughput 16s rDNA sequencing. As a result, the silica sands-based method was found to be even more efficient in isolating genomic DNA from gram-positive bacteria than the kit, indicating that it would become a very valuable choice to faithfully reflect the composition of microbial communities.

  16. Silicon Dioxide Thin Film Mediated Single Cell Nucleic Acid Isolation

    PubMed Central

    Bogdanov, Evgeny; Dominova, Irina; Shusharina, Natalia; Botman, Stepan; Kasymov, Vitaliy; Patrushev, Maksim

    2013-01-01

    A limited amount of DNA extracted from single cells, and the development of single cell diagnostics make it necessary to create a new highly effective method for the single cells nucleic acids isolation. In this paper, we propose the DNA isolation method from biomaterials with limited DNA quantity in sample, and from samples with degradable DNA based on the use of solid-phase adsorbent silicon dioxide nanofilm deposited on the inner surface of PCR tube. PMID:23874571

  17. A simple, fast, and inexpensive CTAB-PVP-silica based method for genomic DNA isolation from single, small insect larvae and pupae.

    PubMed

    Huanca-Mamani, W; Rivera-Cabello, D; Maita-Maita, J

    2015-07-17

    In this study, we report a modified CTAB-PVP method combined with silicon dioxide (silica) treatment for the extraction of high quality genomic DNA from a single larva or pupa. This method efficiently obtains DNA from small specimens, which is difficult and challenging because of the small amount of starting tissue. Maceration with liquid nitrogen, phenol treatment, and the ethanol precipitation step are eliminated using this methodology. The A260/A280 absorbance ratios of the isolated DNA were approximately 1.8, suggesting that the DNA is pure and can be used for further molecular analysis. The quality of the isolated DNA permits molecular applications and represents a fast, cheap, and effective alternative method for laboratories with low budgets.

  18. Evaluation of DNA extraction methods for PCR-based detection of Listeria monocytogenes from vegetables.

    PubMed

    Vojkovska, H; Kubikova, I; Kralik, P

    2015-03-01

    Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014 The Society for Applied Microbiology.

  19. DNA encoding a DNA repair protein

    DOEpatents

    Petrini, John H.; Morgan, William Francis; Maser, Richard Scott; Carney, James Patrick

    2006-08-15

    An isolated and purified DNA molecule encoding a DNA repair protein, p95, is provided, as is isolated and purified p95. Also provided are methods of detecting p95 and DNA encoding p95. The invention further provides p95 knock-out mice.

  20. A simple method of DNA isolation from jute (Corchorus olitorius) seed suitable for PCR-based detection of the pathogen Macrophomina phaseolina (Tassi) Goid.

    PubMed

    Biswas, C; Dey, P; Satpathy, S; Sarkar, S K; Bera, A; Mahapatra, B S

    2013-02-01

    A simple method was developed for isolating DNA from jute seed, which contains high amounts of mucilage and secondary metabolites, and a PCR protocol was standardized for detecting the seedborne pathogen Macrophomina phaseolina. The cetyl trimethyl ammonium bromide method was modified with increased salt concentration and a simple sodium acetate treatment to extract genomic as well as fungal DNA directly from infected jute seed. The Miniprep was evaluated along with five other methods of DNA isolation in terms of yield and quality of DNA and number of PCR positive samples. The Miniprep consistently recovered high amounts of DNA with good spectral qualities at A260/A280. The DNA isolated from jute seed was found suitable for PCR amplification. Macrophomina phaseolina could be detected by PCR from artificially inoculated as well as naturally infected jute seeds. The limit of PCR-based detection of M. phaseolina in jute seed was determined to be 0·62 × 10(-7) CFU g(-1) seed. © 2012 The Society for Applied Microbiology.

  1. Rapid electrokinetic isolation of cancer-related circulating cell-free DNA directly from blood.

    PubMed

    Sonnenberg, Avery; Marciniak, Jennifer Y; Rassenti, Laura; Ghia, Emanuela M; Skowronski, Elaine A; Manouchehri, Sareh; McCanna, James; Widhopf, George F; Kipps, Thomas J; Heller, Michael J

    2014-03-01

    Circulating cell-free DNA (ccf-DNA) is becoming an important biomarker for cancer diagnostics and therapy monitoring. The isolation of ccf-DNA from plasma as a "liquid biopsy" may begin to replace more invasive tissue biopsies for the detection and analysis of cancer-related mutations. Conventional methods for the isolation of ccf-DNA from plasma are costly, time-consuming, and complex, preventing the use of ccf-DNA biomarkers for point-of-care diagnostics and limiting other biomedical research applications. We used an AC electrokinetic device to rapidly isolate ccf-DNA from 25 μL unprocessed blood. ccf-DNA from 15 chronic lymphocytic leukemia (CLL) patients and 3 healthy individuals was separated into dielectrophoretic (DEP) high-field regions, after which other blood components were removed by a fluidic wash. Concentrated ccf-DNA was detected by fluorescence and eluted for quantification, PCR, and DNA sequencing. The complete process, blood to PCR, required <10 min. ccf-DNA was amplified by PCR with immunoglobulin heavy chain variable region (IGHV)-specific primers to identify the unique IGHV gene expressed by the leukemic B-cell clone, and then sequenced. PCR and DNA sequencing results obtained by DEP from 25 μL CLL blood matched results obtained by use of conventional methods for ccf-DNA isolation from 1 mL plasma and for genomic DNA isolation from CLL patient leukemic B cells isolated from 15-20 mL blood. Rapid isolation of ccf-DNA directly from a drop of blood will advance disease-related biomarker research, accelerate the transition from tissue to liquid biopsies, and enable point-of-care diagnostic systems for patient monitoring.

  2. Comparison of different methods for isolation of bacterial DNA from retail oyster tissues

    USDA-ARS?s Scientific Manuscript database

    Oysters are filter-feeders that bio-accumulate bacteria in water while feeding. To evaluate the bacterial genomic DNA extracted from retail oyster tissues, including the gills and digestive glands, four isolation methods were used. Genomic DNA extraction was performed using the Allmag™ Blood Genomic...

  3. Nucleic acid isolation

    DOEpatents

    Longmire, J.L.; Lewis, A.K.; Hildebrand, C.E.

    1988-01-21

    A method is provided for isolating DNA from eukaryotic cell and flow sorted chromosomes. When DNA is removed from chromosome and cell structure, detergent and proteolytic digestion products remain with the DNA. These products can be removed with organic extraction, but the process steps associated with organic extraction reduces the size of DNA fragments available for experimental use. The present process removes the waste products by dialyzing a solution containing the DNA against a solution containing polyethylene glycol (PEG). The waste products dialyze into the PEG leaving isolated DNA. The remaining DNA has been prepared with fragments containing more than 160 kb. The isolated DNA has been used in conventional protocols without effect on the protocol.

  4. Immobilization of microalgae cells in alginate facilitates isolation of DNA and RNA.

    PubMed

    Lopez, Blanca R; Hernandez, Juan-Pablo; Bashan, Yoav; de-Bashan, Luz E

    2017-04-01

    Isolation of nucleic acids from Chlorella is difficult, given the chemically complex nature of their cell walls and variable production of metabolites. Immobilization of microalgae in polymers adds additional difficulty. Here, we modified, amended, and standardized methods for isolation of nucleic acids and compared the yield of DNA and RNA from free-living and encapsulated microalgae C. sorokiniana. Isolation of nucleic acids from immobilized cells required two steps in dissolving the alginate matrix, releasing the cells, and mechanical disruption with glass beads. For DNA extraction, we used modified versions of a commercial kit along with the hexadecyltrimethylammonium bromide (CTAB) method. For RNA extraction, we used the commercial TRI reagent procedure and the CTAB-dithiotreitol method. Quantity and quality of nucleic acids in extracts varied with growth conditions, isolation procedures, and time of incubation of the original culture. There were consistently higher amounts of DNA and RNA in extracts from immobilized cells. Quantitatively, the modified procedure with the commercial Promega kit was the most reliable procedure for isolating DNA and a modified commercial TRI reagent procedure was the choice for isolating RNA. All four procedures eliminated proteins efficiently and had low levels of contamination from residual polysaccharides from the matrices and/or metabolites naturally produced by the microalgae. All DNA extracts under both growth conditions, time of incubation, and two isolation methods successfully amplified the 18S ribosomal RNA by PCR and quantitative reverse transcription (RT-qPCR). Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Methods for transforming and expression screening of filamentous fungal cells with a DNA library

    DOEpatents

    Teter, Sarah; Lamsa, Michael; Cherry, Joel; Ward, Connie

    2015-06-02

    The present invention relates to methods for expression screening of filamentous fungal transformants, comprising: (a) isolating single colony transformants of a DNA library introduced into E. coli; (b) preparing DNA from each of the single colony E. coli transformants; (c) introducing a sample of each of the DNA preparations of step (b) into separate suspensions of protoplasts of a filamentous fungus to obtain transformants thereof, wherein each transformant contains one or more copies of an individual polynucleotide from the DNA library; (d) growing the individual filamentous fungal transformants of step (c) on selective growth medium, thereby permitting growth of the filamentous fungal transformants, while suppressing growth of untransformed filamentous fungi; and (e) measuring activity or a property of each polypeptide encoded by the individual polynucleotides. The present invention also relates to isolated polynucleotides encoding polypeptides of interest obtained by such methods, to nucleic acid constructs, expression vectors, and recombinant host cells comprising the isolated polynucleotides, and to methods of producing the polypeptides encoded by the isolated polynucleotides.

  6. Antibody specific for a DNA repair protein

    DOEpatents

    Petrini, John H.; Morgan, William Francis; Maser, Richard Scott; Carney, James Patrick

    2006-07-11

    An isolated and purified DNA molecule encoding a DNA repair protein, p95, is provided, as is isolated and purified p95. Also provided are methods of detecting p95 and DNA encoding p95. The invention further provides p95 knock-out mice.

  7. Identification of Aspergillus fumigatus and Related Species by Nested PCR Targeting Ribosomal DNA Internal Transcribed Spacer Regions

    PubMed Central

    Zhao, Jun; Kong, Fanrong; Li, Ruoyu; Wang, Xiaohong; Wan, Zhe; Wang, Duanli

    2001-01-01

    Aspergillus fumigatus is the most common species that causes invasive aspergillosis. In order to identify A. fumigatus, partial ribosomal DNA (rDNA) from two to six strains of five different Aspergillus species was sequenced. By comparing sequence data from GenBank, we designed specific primer pairs targeting rDNA internal transcribed spacer (ITS) regions of A. fumigatus. A nested PCR method for identification of other A. fumigatus-related species was established by using the primers. To evaluate the specificities and sensitivities of those primers, 24 isolates of A. fumigatus and variants, 8 isolates of Aspergillus nidulans, 7 isolates of Aspergillus flavus and variants, 8 isolates of Aspergillus terreus, 9 isolates of Aspergillus niger, 1 isolate each of Aspergillus parasiticus, Aspergillus penicilloides, Aspergillus versicolor, Aspergillus wangduanlii, Aspergillus qizutongii, Aspergillus beijingensis, and Exophiala dermatitidis, 4 isolates of Candida, 4 isolates of bacteria, and human DNA were used. The nested PCR method specifically identified the A. fumigatus isolates and closely related species and showed a high degree of sensitivity. Additionally, four A. fumigatus strains that were recently isolated from our clinic were correctly identified by this method. Our results demonstrate that these primers are useful for the identification of A. fumigatus and closely related species in culture and suggest further studies for the identification of Aspergillus fumigatus species in clinical specimens. PMID:11376067

  8. Nucleic acid isolation process

    DOEpatents

    Longmire, Jonathan L.; Lewis, Annette K.; Hildebrand, Carl E.

    1990-01-01

    A method is provided for isolating DNA from eukaryotic cell and flow sorted chromosomes. When DNA is removed from chromosome and cell structure, detergent and proteolytic digestion products remain with the DNA. These products can be removed with organic extraction, but the process steps associated with organic extraction reduce the size of DNA fragments available for experimental use. The present process removes the waste products by dialyzing a solution containing the DNA against a solution containing polyethylene glycol (PEG). The waste products dialyze into the PEG leaving isolated DNA. The remaining DNA has been prepared with fragments containing more than 160 kb. The isolated DNA has been used in conventional protocols without affect on the protocol.

  9. A fully automatable enzymatic method for DNA extraction from plant tissues

    PubMed Central

    Manen, Jean-François; Sinitsyna, Olga; Aeschbach, Lorène; Markov, Alexander V; Sinitsyn, Arkady

    2005-01-01

    Background DNA extraction from plant tissues, unlike DNA isolation from mammalian tissues, remains difficult due to the presence of a rigid cell wall around the plant cells. Currently used methods inevitably require a laborious mechanical grinding step, necessary to disrupt the cell wall for the release of DNA. Results Using a cocktail of different carbohydrases, a method was developed that enables a complete digestion of the plant cell walls and subsequent DNA release. Optimized conditions for the digestion reaction minimize DNA shearing and digestion, and maximize DNA release from the plant cell. The method gave good results in 125 of the 156 tested species. Conclusion In combination with conventional DNA isolation techniques, the new enzymatic method allows to obtain high-yield, high-molecular weight DNA, which can be used for many applications, including genome characterization by AFLP, RAPD and SSR. Automation of the protocol (from leaf disks to DNA) is possible with existing workstations. PMID:16269076

  10. An optimized high quality male DNA extraction from spermatophores in open thelycum shrimp species.

    PubMed

    Planella, Laia; Heras, Sandra; Vera, Manuel; García-Marín, José-Luis; Roldán, María Inés

    2017-09-01

    The crucial step of most of the current genetic studies is the extraction of DNA of sufficient quantity and quality. Several genomic DNA isolation methods have been described to successfully obtain male DNA from shrimp species. However, all current protocols require invasive handling methods with males for DNA isolation. Using Aristeus antennatus as a model we tested a reliable non-invasive differential DNA extraction method to male DNA isolation from spermatophores attached to female thelycum. The present protocol provides high quality and quantity DNA for polymerase chain reaction amplification and male genotyping. This new approach could be useful to experimental shrimp culture to select sires with relevant genetic patterns for selective breeding programs. More importantly, it can be applied to identify the mating pairs and male structure in wild populations of species as A. antennatus, where males are often difficult to capture. Our method could be also valuable for biological studies on other spermatophore-using species, such as myriapods, arachnids and insects. © 2016 International Society of Zoological Sciences, Institute of Zoology/Chinese Academy of Sciences and John Wiley & Sons Australia, Ltd.

  11. Comparison of Haemophilus parasuis reference strains and field isolates by using random amplified polymorphic DNA and protein profiles

    PubMed Central

    2012-01-01

    Background Haemophilus parasuis is the causative agent of Glässer’s disease and is a pathogen of swine in high-health status herds. Reports on serotyping of field strains from outbreaks describe that approximately 30% of them are nontypeable and therefore cannot be traced. Molecular typing methods have been used as alternatives to serotyping. This study was done to compare random amplified polymorphic DNA (RAPD) profiles and whole cell protein (WCP) lysate profiles as methods for distinguishing H. parasuis reference strains and field isolates. Results The DNA and WCP lysate profiles of 15 reference strains and 31 field isolates of H. parasuis were analyzed using the Dice and neighbor joining algorithms. The results revealed unique and reproducible DNA and protein profiles among the reference strains and field isolates studied. Simpson’s index of diversity showed significant discrimination between isolates when three 10mer primers were combined for the RAPD method and also when both the RAPD and WCP lysate typing methods were combined. Conclusions The RAPD profiles seen among the reference strains and field isolates did not appear to change over time which may reflect a lack of DNA mutations in the genes of the samples. The recent field isolates had different WCP lysate profiles than the reference strains, possibly because the number of passages of the type strains may affect their protein expression. PMID:22703293

  12. An optimized method for high quality DNA extraction from microalga Prototheca wickerhamii for genome sequencing.

    PubMed

    Jagielski, Tomasz; Gawor, Jan; Bakuła, Zofia; Zuchniewicz, Karolina; Żak, Iwona; Gromadka, Robert

    2017-01-01

    The complex cell wall structure of algae often precludes efficient extraction of their genetic material. The purpose of this study was to design a next-generation sequencing-suitable DNA isolation method for unicellular, achlorophyllous, yeast-like microalgae of the genus Prototheca , the only known plant pathogens of both humans and animals. The effectiveness of the newly proposed scheme was compared with five other, previously described methods, commonly used for DNA isolation from plants and/or yeasts, available either as laboratory-developed, in-house assays, based on liquid nitrogen grinding or different enzymatic digestion, or as commercially manufactured kits. All five, previously described, isolation assays yielded DNA concentrations lower than those obtained with the new method, averaging 16.15 ± 25.39 vs 74.2 ± 0.56 ng/µL, respectively. The new method was also superior in terms of DNA purity, as measured by A260/A280 (-0.41 ± 4.26 vs 2.02 ± 0.03), and A260/A230 (1.20 ± 1.12 vs 1.97 ± 0.07) ratios. Only the liquid nitrogen-based method yielded DNA of comparable quantity (60.96 ± 0.16 ng/µL) and quality (A260/A280 = 2.08 ± 0.02; A260/A230 = 2.23 ± 0.26). Still, the new method showed higher integrity, which was best illustrated upon electrophoretic analysis. Genomic DNA of Prototheca wickerhamii POL-1 strain isolated with the protocol herein proposed was successfully sequenced on the Illumina MiSeq platform. A new method for DNA isolation from Prototheca algae is described. The method, whose protocol involves glass beads pulverization and cesium chloride (CsCl) density gradient centrifugation, was demonstrated superior over the other common assays in terms of DNA quantity and quality. The method is also the first to offer the possibility of preparation of DNA template suitable for whole genome sequencing of Prototheca spp.

  13. Novel Technology for Enrichment of Biomolecules from Cell-Free Body Fluids and Subsequent DNA Sizing.

    PubMed

    Patel, Vipulkumar; Celec, Peter; Grunt, Magdalena; Schwarzenbach, Heidi; Jenneckens, Ingo; Hillebrand, Timo

    2016-01-01

    Circulating cell-free DNA (ccfDNA) is a promising diagnostic tool and its size fractionation is of interest. However, kits for isolation of ccfDNA available on the market are designed for small volumes hence processing large sample volumes is laborious. We have tested a new method that enables enrichment of ccfDNA from large volumes of plasma and subsequently allows size-fractionation of isolated ccfDNA into two fractions with individually established cut-off levels of ccfDNA length. This method allows isolation of low-abundant DNA as well as separation of long and short DNA molecules. This procedure may be important e.g., in prenatal diagnostics and cancer research that have been already confirmed by our primary experiments. Here, we report the results of selective separation of 200- and 500-bp long synthetic DNA fragments spiked in plasma samples. Furthermore, we size-fractionated ccfDNA from the plasma of pregnant women and verified the prevalence of fetal ccfDNA in all fractions.

  14. DNA-based identification of spices: DNA isolation, whole genome amplification, and polymerase chain reaction.

    PubMed

    Focke, Felix; Haase, Ilka; Fischer, Markus

    2011-01-26

    Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.

  15. TECHNICAL BRIEF: Isolation of total DNA from postmortem human eye tissues and quality comparison between iris and retina

    PubMed Central

    Wang, Jay Ching Chieh; Wang, Aikun; Gao, Jiangyuan; Cao, Sijia; Samad, Idris; Zhang, Dean; Ritland, Carol; Cui, Jing Z.

    2012-01-01

    Background Recent genomic technologies have propelled our understanding of the mechanisms underlying complex eye diseases such as age-related macular degeneration (AMD). Genotyping postmortem eye tissues for known single nucleotide polymorphisms (SNPs) associated with AMD may prove valuable, especially when combined with information obtained through other methods such as immunohistochemistry, western blot, enzyme-linked immunosorbent assay (ELISA), and proteomics. Initially intending to genotype postmortem eye tissues for AMD-related SNPs, our group became interested in isolating and comparing the quality of DNA from the iris and retina of postmortem donor eyes. Since there is no previously published protocol in the literature on this topic, we present a protocol suitable for isolating high-quality DNA from postmortem eye tissues for genomic studies. Methods DNA from 33 retinal samples and 35 iris samples was extracted using the phenol-chloroform-isoamyl method from postmortem donor eye tissues. The quantity of DNA was measured with a spectrophotometer while the quality was checked using gel electrophoresis. The DNA samples were then amplified with PCR for the complement factor H (CFH) gene. The purified amplified products were then genotyped for the SNPs in the CFH gene. Results Regarding concentration, the retina yielded 936 ng/μl of DNA, while the iris yielded 78 ng/μl of DNA. Retinal DNA was also purer than iris DNA (260/280=1.78 vs. 1.46, respectively), and produced superior PCR results. Retinal tissue yielded significantly more DNA than the iris tissue per mg of sample (21.7 ng/μl/mg vs. 7.42 ng/μl/mg). Retinal DNA can be readily amplified with PCR, while iris DNA can also be amplified by adding bovine serum albumin. Overall, retinal tissues yielded DNA of superior quality, quantity, and suitability for genotyping and genomic studies. Conclusions The protocol presented here provides a clear and reliable method for isolating total DNA from postmortem eye tissues. Retinal tissue provides DNA of excellent quantity and quality for genotyping and downstream genomic studies. However, DNA isolated from iris tissues, and treated with bovine serum albumin, may also be a valuable source of DNA for genotyping and genomic studies. PMID:23288996

  16. Compendium of the FY1988 and FY1989 Research Reviews for the Research Methods Branch

    DTIC Science & Technology

    1993-02-01

    14, contained a very aggressive cholangiocarcinoma . DNA from these tissues was examined by primary transfection assay. DNA isolated from the MAM-Ac...exposed animals appeared to correlate with the degree of malignancy observed in the liver. DNA isolated from the cholangiocarcinoma lesion in MD6-14 was...transfection. DNA isolated from the cholangiocarcinoma lesion of MD6-14 very rapidly transformed NIH 3T3 cells as determined by standard focus assay

  17. A simple non-enzymatic method for the preparation of white spot syndrome virus (WSSV) DNA from the haemolymph of Marsupenaeus japonicus using FTA matrix cards.

    PubMed

    Sudhakaran, R; Mekata, T; Kono, T; Supamattaya, K; Linh, N T H; Suzuki, Y; Sakai, M; Itami, T

    2009-07-01

    White spot syndrome virus (WSSV) is an important shrimp pathogen responsible for large economic losses for the shrimp culture industry worldwide. The nucleic acids of the virus must be adequately preserved and transported from the field to the laboratory before molecular diagnostic analysis is performed. Here, we developed a new method to isolate WSSV-DNA using Flinders Technology Associates filter paper (FTA matrix card; Whatman) without centrifugation or hazardous steps involved. FTA technology is a new method allowing the simple collection, shipment and archiving of nucleic acids from haemolymph samples providing DNA protection against nucleases, oxidation, UV damage, microbial and fungal attack. DNA samples prepared from 10-fold dilutions of moribund shrimp haemolymph using FTA matrix cards were analysed using semi-quantitative and quantitative polymerase chain reaction (PCR) and were compared with two commercially available DNA isolation methods, the blood GenomicPrep Mini Spin Kit (GE Healthcare) and the DNAzol (Invitrogen). Sequence analysis was performed for the DNA samples prepared using the various isolation procedures and no differences in the sequence among these methods were identified. Results based on the initial copy number of DNA prepared from the GenomicPrep Mini Spin Kit are a little more sensitive than the DNA prepared from FTA matrix cards, whereas the DNAzol method is not suitable for blood samples. Our data shows the efficiency of retention capacity of WSSV-DNA samples from impregnated FTA matrix cards. Matrix cards were easy to store and ship for long periods of time. They provide ease of handling and are a reliable alternative for sample collection and for molecular detection and characterization of WSSV isolates.

  18. Comparison of strategies for the isolation of PCR-compatible, genomic DNA from a municipal biogas plants.

    PubMed

    Weiss, Agnes; Jérôme, Valérie; Freitag, Ruth

    2007-06-15

    The goal of the project was the extraction of PCR-compatible genomic DNA representative of the entire microbial community from municipal biogas plant samples (mash, bioreactor content, process water, liquid fertilizer). For the initial isolation of representative DNA from the respective lysates, methods were used that employed adsorption, extraction, or precipitation to specifically enrich the DNA. Since no dedicated method for biogas plant samples was available, preference was given to kits/methods suited to samples that resembled either the bioreactor feed, e.g. foodstuffs, or those intended for environmental samples including wastewater. None of the methods succeeded in preparing DNA that was directly PCR-compatible. Instead the DNA was found to still contain considerable amounts of difficult-to-remove enzyme inhibitors (presumably humic acids) that hindered the PCR reaction. Based on the isolation method that gave the highest yield/purity for all sample types, subsequent purification was attempted by agarose gel electrophoresis followed by electroelution, spermine precipitation, or dialysis through nitrocellulose membrane. A combination of phenol/chloroform extraction followed by purification via dialysis constituted the most efficient sample treatment. When such DNA preparations were diluted 1:100 they did no longer inhibit PCR reactions, while they still contained sufficient genomic DNA to allow specific amplification of specific target sequences.

  19. Does Extracellular DNA Production Vary in Staphylococcal Biofilms Isolated From Infected Implants versus Controls?

    PubMed

    Zatorska, Beata; Groger, Marion; Moser, Doris; Diab-Elschahawi, Magda; Lusignani, Luigi Segagni; Presterl, Elisabeth

    2017-08-01

    Prosthetic implant infections caused by Staphylococcus aureus and epidermidis are major challenges for early diagnosis and treatment owing to biofilm formation on the implant surface. Extracellular DNA (eDNA) is actively excreted from bacterial cells in biofilms, contributing to biofilm stability, and may offer promise in the detection or treatment of such infections. (1) Does DNA structure change during biofilm formation? (2) Are there time-dependent differences in eDNA production during biofilm formation? (3) Is there differential eDNA production between clinical and control Staphylococcal isolates? (4) Is eDNA production correlated to biofilm thickness? We investigated eDNA presence during biofilm formation in 60 clinical and 30 control isolates of S aureus and S epidermidis. The clinical isolates were isolated from patients with infections of orthopaedic prostheses and implants: 30 from infected hip prostheses and 30 from infected knee prostheses. The control isolates were taken from healthy volunteers who had not been exposed to antibiotics and a hospital environment during the previous 3 and 12 months, respectively. Control S epidermidis was isolated from the skin of the antecubital fossa, and control S aureus was isolated from the nares. For the biofilm experiments the following methods were used to detect eDNA: (1) fluorescent staining with 4',6-diamidino-2-phenylindole (DAPI), (2) eDNA extraction using a commercial kit, and (3) confocal laser scanning microscopy for 24-hour biofilm observation using propidium iodide and concanavalin-A staining; TOTO ® -1 and SYTO ® 60 staining were used for observation and quantification of eDNA after 6 and 24 hours of biofilm formation. Additionally antibiotic resistance was described. eDNA production as observed by confocal laser scanning microscopy was greater in clinical isolates than controls (clinical isolates mean ± SD: 1.84% ± 1.31%; control mean ± SD: 1.17% ± 1.37%; p < 0.005) after 6 hours of biofilm formation. After 24 hours, the amount of eDNA was greater in biofilms of S epidermidis than in biofilms of S aureus (S aureus mean ± SD: 1.35% ± 2.0%; S epidermidis mean ± SD: 6.42% ± 10.6%; p < 0.05). Clinical isolates of S aureus and S epidermidis produced more eDNA than control isolates at 6 hours of biofilm formation. The extraction method also showed that clinical isolates produced substantially greater amounts of eDNA than controls. S aureus and S epidermidis exhibit a differential production of DNA with time. Clinical isolates associated with implant infections produce greater amounts of eDNA than controls. Future research might focus on the diagnostic value of eDNA as a surrogate laboratory marker for biofilm formation in implant infections. eDNA should be considered as a potential future diagnostic tool or even a possible target to modify biofilms for successful treatment of biofilm-associated infections.

  20. DNA isolation protocol effects on nuclear DNA analysis by microarrays, droplet digital PCR, and whole genome sequencing, and on mitochondrial DNA copy number estimation.

    PubMed

    Nacheva, Elizabeth; Mokretar, Katya; Soenmez, Aynur; Pittman, Alan M; Grace, Colin; Valli, Roberto; Ejaz, Ayesha; Vattathil, Selina; Maserati, Emanuela; Houlden, Henry; Taanman, Jan-Willem; Schapira, Anthony H; Proukakis, Christos

    2017-01-01

    Potential bias introduced during DNA isolation is inadequately explored, although it could have significant impact on downstream analysis. To investigate this in human brain, we isolated DNA from cerebellum and frontal cortex using spin columns under different conditions, and salting-out. We first analysed DNA using array CGH, which revealed a striking wave pattern suggesting primarily GC-rich cerebellar losses, even against matched frontal cortex DNA, with a similar pattern on a SNP array. The aCGH changes varied with the isolation protocol. Droplet digital PCR of two genes also showed protocol-dependent losses. Whole genome sequencing showed GC-dependent variation in coverage with spin column isolation from cerebellum. We also extracted and sequenced DNA from substantia nigra using salting-out and phenol / chloroform. The mtDNA copy number, assessed by reads mapping to the mitochondrial genome, was higher in substantia nigra when using phenol / chloroform. We thus provide evidence for significant method-dependent bias in DNA isolation from human brain, as reported in rat tissues. This may contribute to array "waves", and could affect copy number determination, particularly if mosaicism is being sought, and sequencing coverage. Variations in isolation protocol may also affect apparent mtDNA abundance.

  1. DNA isolation protocol effects on nuclear DNA analysis by microarrays, droplet digital PCR, and whole genome sequencing, and on mitochondrial DNA copy number estimation

    PubMed Central

    Nacheva, Elizabeth; Mokretar, Katya; Soenmez, Aynur; Pittman, Alan M.; Grace, Colin; Valli, Roberto; Ejaz, Ayesha; Vattathil, Selina; Maserati, Emanuela; Houlden, Henry; Taanman, Jan-Willem; Schapira, Anthony H.

    2017-01-01

    Potential bias introduced during DNA isolation is inadequately explored, although it could have significant impact on downstream analysis. To investigate this in human brain, we isolated DNA from cerebellum and frontal cortex using spin columns under different conditions, and salting-out. We first analysed DNA using array CGH, which revealed a striking wave pattern suggesting primarily GC-rich cerebellar losses, even against matched frontal cortex DNA, with a similar pattern on a SNP array. The aCGH changes varied with the isolation protocol. Droplet digital PCR of two genes also showed protocol-dependent losses. Whole genome sequencing showed GC-dependent variation in coverage with spin column isolation from cerebellum. We also extracted and sequenced DNA from substantia nigra using salting-out and phenol / chloroform. The mtDNA copy number, assessed by reads mapping to the mitochondrial genome, was higher in substantia nigra when using phenol / chloroform. We thus provide evidence for significant method-dependent bias in DNA isolation from human brain, as reported in rat tissues. This may contribute to array “waves”, and could affect copy number determination, particularly if mosaicism is being sought, and sequencing coverage. Variations in isolation protocol may also affect apparent mtDNA abundance. PMID:28683077

  2. Shake and stew: a non-destructive PCR-ready DNA isolation method from a single preserved fish larva.

    PubMed

    Alvarado Bremer, J R; Smith, B L; Moulton, D L; Lu, C-P; Cornic, M

    2014-01-01

    A rapid non-destructive alternative to isolate DNA from an individual fish larva is presented, based on the suspension of epithelial cells through vortex forces, and the release of DNA in a heated alkaline solution. DNA from >6056 fish larvae isolated using this protocol has yielded a high PCR amplification success rate (>93%), suggesting its applicability to other taxonomic groups or sources when tissue amount is the limiting factor. © 2014 The Fisheries Society of the British Isles.

  3. Surveyor nuclease detection of mutations and polymorphisms of mtDNA in children.

    PubMed

    Pilch, Jacek; Asman, Marek; Jamroz, Ewa; Kajor, Maciej; Kotrys-Puchalska, Elżbieta; Goss, Małgorzata; Krzak, Maria; Witecka, Joanna; Gmiński, Jan; Sieroń, Aleksander L

    2010-11-01

    Mitochondrial encephalomyopathies are complex disorders with wide range of clinical manifestations. Particularly time-consuming is the identification of mutations in mitochondrial DNA. A group of 20 children with clinical manifestations of mitochondrial encephalomyopathies was selected for molecular studies. The aims were (a) to identify mutations in mtDNA isolated from muscle and (b) to verify detected mutations in DNA isolated from blood, in order to assess the utility of a Surveyor nuclease assay kit for patient screening. The most common changes found were polymorphisms, including a few missense mutations altering the amino acid sequence of mitochondrial proteins. In two boys with MELAS (i.e., mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes), a mutation A→G3243 was detected in the tRNALeu gene of mtDNA isolated from muscle and blood. In one boy, the carrier status of his mother was confirmed, based on molecular analysis of DNA isolated from blood. A method using Surveyor nuclease allows systematic screening for small mutations in mtDNA, using as its source blood of the patients and asymptomatic carriers. The method still requires confirmation studying a larger group. In some patients, the use of this method should precede and might limit indications for traumatic muscle and skin biopsy. Copyright © 2010 Elsevier Inc. All rights reserved.

  4. Absolute quantification of olive oil DNA by droplet digital-PCR (ddPCR): Comparison of isolation and amplification methodologies.

    PubMed

    Scollo, Francesco; Egea, Leticia A; Gentile, Alessandra; La Malfa, Stefano; Dorado, Gabriel; Hernandez, Pilar

    2016-12-15

    Olive oil is considered a premium product for its nutritional value and health benefits, and the ability to define its origin and varietal composition is a key step towards ensuring the traceability of the product. However, isolating the DNA from such a matrix is a difficult task. In this study, the quality and quantity of olive oil DNA, isolated using four different DNA isolation protocols, was evaluated using the qRT-PCR and ddPCR techniques. The results indicate that CTAB-based extraction methods were the best for unfiltered oil, while Nucleo Spin-based extraction protocols showed greater overall reproducibility. The use of both qRT-PCR and ddPCR led to the absolute quantification of the DNA copy number. The results clearly demonstrate the importance of the choice of DNA-isolation protocol, which should take into consideration the qualitative aspects of DNA and the evaluation of the amplified DNA copy number. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Evaluating the Impact of DNA Extraction Method on the Representation of Human Oral Bacterial and Fungal Communities

    PubMed Central

    Biswas, Kristi; Taylor, Michael W.; Gear, Kim

    2017-01-01

    The application of high-throughput, next-generation sequencing technologies has greatly improved our understanding of the human oral microbiome. While deciphering this diverse microbial community using such approaches is more accurate than traditional culture-based methods, experimental bias introduced during critical steps such as DNA extraction may compromise the results obtained. Here, we systematically evaluate four commonly used microbial DNA extraction methods (MoBio PowerSoil® DNA Isolation Kit, QIAamp® DNA Mini Kit, Zymo Bacterial/Fungal DNA Mini PrepTM, phenol:chloroform-based DNA isolation) based on the following criteria: DNA quality and yield, and microbial community structure based on Illumina amplicon sequencing of the V3–V4 region of the 16S rRNA gene of bacteria and the internal transcribed spacer (ITS) 1 region of fungi. Our results indicate that DNA quality and yield varied significantly with DNA extraction method. Representation of bacterial genera in plaque and saliva samples did not significantly differ across DNA extraction methods and DNA extraction method showed no effect on the recovery of fungal genera from plaque. By contrast, fungal diversity from saliva was affected by DNA extraction method, suggesting that not all protocols are suitable to study the salivary mycobiome. PMID:28099455

  6. A simple and rapid method for isolation of high quality genomic DNA from fruit trees and conifers using PVP.

    PubMed

    Kim, C S; Lee, C H; Shin, J S; Chung, Y S; Hyung, N I

    1997-03-01

    Because DNA degradation is mediated by secondary plant products such as phenolic terpenoids, the isolation of high quality DNA from plants containing a high content of polyphenolics has been a difficult problem. We demonstrate an easy extraction process by modifying several existing ones. Using this process we have found it possible to isolate DNAs from four fruit trees, grape (Vitis spp.), apple (Malus spp.), pear (Pyrus spp.) and persimmon (Diospyros spp.) and four species of conifer, Pinus densiflora, Pinus koraiensis,Taxus cuspidata and Juniperus chinensis within a few hours. Compared with the existing method, we have isolated high quality intact DNAs (260/280 = 1.8-2.0) routinely yielding 250-500 ng/microl (total 7.5-15 microg DNA from four to five tissue discs).

  7. A simple and rapid method for isolation of high quality genomic DNA from fruit trees and conifers using PVP.

    PubMed Central

    Kim, C S; Lee, C H; Shin, J S; Chung, Y S; Hyung, N I

    1997-01-01

    Because DNA degradation is mediated by secondary plant products such as phenolic terpenoids, the isolation of high quality DNA from plants containing a high content of polyphenolics has been a difficult problem. We demonstrate an easy extraction process by modifying several existing ones. Using this process we have found it possible to isolate DNAs from four fruit trees, grape (Vitis spp.), apple (Malus spp.), pear (Pyrus spp.) and persimmon (Diospyros spp.) and four species of conifer, Pinus densiflora, Pinus koraiensis,Taxus cuspidata and Juniperus chinensis within a few hours. Compared with the existing method, we have isolated high quality intact DNAs (260/280 = 1.8-2.0) routinely yielding 250-500 ng/microl (total 7.5-15 microg DNA from four to five tissue discs). PMID:9023124

  8. Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction.

    PubMed

    Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid

    2017-01-01

    Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA ® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. The CTAB method showed more positive results at 1:10-1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.

  9. An Efficient Method for Genomic DNA Extraction from Different Molluscs Species

    PubMed Central

    Pereira, Jorge C.; Chaves, Raquel; Bastos, Estela; Leitão, Alexandra; Guedes-Pinto, Henrique

    2011-01-01

    The selection of a DNA extraction method is a critical step when subsequent analysis depends on the DNA quality and quantity. Unlike mammals, for which several capable DNA extraction methods have been developed, for molluscs the availability of optimized genomic DNA extraction protocols is clearly insufficient. Several aspects such as animal physiology, the type (e.g., adductor muscle or gills) or quantity of tissue, can explain the lack of efficiency (quality and yield) in molluscs genomic DNA extraction procedure. In an attempt to overcome these aspects, this work describes an efficient method for molluscs genomic DNA extraction that was tested in several species from different orders: Veneridae, Ostreidae, Anomiidae, Cardiidae (Bivalvia) and Muricidae (Gastropoda), with different weight sample tissues. The isolated DNA was of high molecular weight with high yield and purity, even with reduced quantities of tissue. Moreover, the genomic DNA isolated, demonstrated to be suitable for several downstream molecular techniques, such as PCR sequencing among others. PMID:22174651

  10. DNA and bone structure preservation in medieval human skeletons.

    PubMed

    Coulson-Thomas, Yvette M; Norton, Andrew L; Coulson-Thomas, Vivien J; Florencio-Silva, Rinaldo; Ali, Nadir; Elmrghni, Samir; Gil, Cristiane D; Sasso, Gisela R S; Dixon, Ronald A; Nader, Helena B

    2015-06-01

    Morphological and ultrastructural data from archaeological human bones are scarce, particularly data that have been correlated with information on the preservation of molecules such as DNA. Here we examine the bone structure of macroscopically well-preserved medieval human skeletons by transmission electron microscopy and immunohistochemistry, and the quantity and quality of DNA extracted from these skeletons. DNA technology has been increasingly used for analyzing physical evidence in archaeological forensics; however, the isolation of ancient DNA is difficult since it is highly degraded, extraction yields are low and the co-extraction of PCR inhibitors is a problem. We adapted and optimised a method that is frequently used for isolating DNA from modern samples, Chelex(®) 100 (Bio-Rad) extraction, for isolating DNA from archaeological human bones and teeth. The isolated DNA was analysed by real-time PCR using primers targeting the sex determining region on the Y chromosome (SRY) and STR typing using the AmpFlSTR(®) Identifiler PCR Amplification kit. Our results clearly show the preservation of bone matrix in medieval bones and the presence of intact osteocytes with well preserved encapsulated nuclei. In addition, we show how effective Chelex(®) 100 is for isolating ancient DNA from archaeological bones and teeth. This optimised method is suitable for STR typing using kits aimed specifically at degraded and difficult DNA templates since amplicons of up to 250bp were successfully amplified. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  11. Isolation of genomic DNA using magnetic cobalt ferrite and silica particles.

    PubMed

    Prodelalová, Jana; Rittich, Bohuslav; Spanová, Alena; Petrová, Katerina; Benes, Milan J

    2004-11-12

    Adsorption separation techniques as an alternative to laborious traditional methods (e.g., based on phenol extraction procedure) have been applied for DNA purification. In this work we used two types of particles: silica and cobalt ferrite (unmodified or modified with a reagent containing weakly basic aminoethyl groups, aminophenyl groups, or alginic acid). DNA from chicken erythrocytes and DNA isolated from bacteria Lactococcus lactis were used for testing of adsorption/desorption properties of particles. The cobalt ferrite particles modified with different reagents were used for isolation of PCR-ready bacterial DNA from different dairy products.

  12. Comparison of DNA extraction methods for meat analysis.

    PubMed

    Yalçınkaya, Burhanettin; Yumbul, Eylem; Mozioğlu, Erkan; Akgoz, Muslum

    2017-04-15

    Preventing adulteration of meat and meat products with less desirable or objectionable meat species is important not only for economical, religious and health reasons, but also, it is important for fair trade practices, therefore, several methods for identification of meat and meat products have been developed. In the present study, ten different DNA extraction methods, including Tris-EDTA Method, a modified Cetyltrimethylammonium Bromide (CTAB) Method, Alkaline Method, Urea Method, Salt Method, Guanidinium Isothiocyanate (GuSCN) Method, Wizard Method, Qiagen Method, Zymogen Method and Genespin Method were examined to determine their relative effectiveness for extracting DNA from meat samples. The results show that the salt method is easy to perform, inexpensive and environmentally friendly. Additionally, it has the highest yield among all the isolation methods tested. We suggest this method as an alternative method for DNA isolation from meat and meat products. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens.

    PubMed

    Saeidi, Saman; McKain, Michael R; Kellogg, Elizabeth A

    2018-03-08

    Herbaria are an invaluable source of plant material that can be used in a variety of biological studies. The use of herbarium specimens is associated with a number of challenges including sample preservation quality, degraded DNA, and destructive sampling of rare specimens. In order to more effectively use herbarium material in large sequencing projects, a dependable and scalable method of DNA isolation and library preparation is needed. This paper demonstrates a robust, beginning-to-end protocol for DNA isolation and high-throughput library construction from herbarium specimens that does not require modification for individual samples. This protocol is tailored for low quality dried plant material and takes advantage of existing methods by optimizing tissue grinding, modifying library size selection, and introducing an optional reamplification step for low yield libraries. Reamplification of low yield DNA libraries can rescue samples derived from irreplaceable and potentially valuable herbarium specimens, negating the need for additional destructive sampling and without introducing discernible sequencing bias for common phylogenetic applications. The protocol has been tested on hundreds of grass species, but is expected to be adaptable for use in other plant lineages after verification. This protocol can be limited by extremely degraded DNA, where fragments do not exist in the desired size range, and by secondary metabolites present in some plant material that inhibit clean DNA isolation. Overall, this protocol introduces a fast and comprehensive method that allows for DNA isolation and library preparation of 24 samples in less than 13 h, with only 8 h of active hands-on time with minimal modifications.

  14. NET formation induced by Pseudomonas aeruginosa cystic fibrosis isolates measured as release of myeloperoxidase-DNA and neutrophil elastase-DNA complexes.

    PubMed

    Yoo, Dae-goon; Floyd, Madison; Winn, Matthew; Moskowitz, Samuel M; Rada, Balázs

    2014-08-01

    Cystic fibrosis (CF) airway disease is characterized by Pseudomonas aeruginosa infection and recruitment of neutrophil granulocytes. Neutrophil granule components (myeloperoxidase (MPO), human neutrophil elastase (HNE)), extracellular DNA and P. aeruginosa can all be found in the CF respiratory tract and have all been associated with worsening CF lung function. Pseudomonas-induced formation of neutrophil extracellular traps (NETs) offers a likely mechanism for release of MPO, HNE and DNA from neutrophils. NETs are composed of a DNA backbone decorated with granule proteins like MPO and HNE. Here we sought to examine whether CF clinical isolates of Pseudomonas are capable of inducing NET release from human neutrophil granulocytes. We used two methods to quantify NETs. We modified a previously employed ELISA that detects MPO-DNA complexes and established a new HNE-DNA ELISA. We show that these methods reliably quantify MPO-DNA and HNE-DNA complexes, measures of NET formation. We have found that CF isolates of P. aeruginosa stimulate robust respiratory burst and NET release in human neutrophils. By comparing paired "early" and "late" bacterial isolates obtained from the same CF patient we have found that early isolates induced significantly more NET release than late isolates. Our data support that Pseudomonas-induced NET release represents an important mechanism for release of neutrophil-derived CF inflammatory mediators, and confirm that decreased induction of NET formation is required for long-term adaptation of P. aeruginosa to CF airways. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. DNA purification by triplex-affinity capture and affinity capture electrophoresis

    DOEpatents

    Cantor, Charles R.; Ito, Takashi; Smith, Cassandra L.

    1996-01-01

    The invention provides a method for purifying or isolating double stranded DNA intact using triple helix formation. The method includes the steps of complexing an oligonucleotide and double stranded DNA to generate a triple helix and immobilization of the triple helix on a solid phase by means of a molecular recognition system such as avidin/biotin. The purified DNA is then recovered intact by treating the solid phase with a reagent that breaks the bonds between the oligonucleotide and the intact double stranded DNA while not affecting the Watson-Crick base pairs of the double helix. The present invention also provides a method for purifying or isolating double stranded DNA intact by complexing the double stranded DNA with a specific binding partner and recovering the complex during electrophoresis by immobilizing it on a solid phase trap imbedded in an electrophoretic gel.

  16. Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction

    PubMed Central

    Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid

    2017-01-01

    Background: Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. Materials and Methods: The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. Results: The CTAB method showed more positive results at 1:10–1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. Conclusions: According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor. PMID:29279831

  17. Isolation and characterization of 21 novel expressed DNA sequences from the distal region of human chromosome 4p

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ishida, Yoshikazu; Hadano, Shinji; Nagayama, Tomiko

    1994-07-15

    The authors have established an approach to the isolation of expressed DNA sequences from a defined region of the human chromosome. The method relies on the direct screening of cDNA libraries using pooled single-copy microclones generated by a laser chromosome microdissection in conjunction with a single unique primer polymerase chain reaction (SUP-PCR) procedure. They applied this method to the distal region of human chromosome 4p (4p15-4pter), which contains the Huntington disease (HD) and the Wolf-Hirschhorn syndrome (WHS) loci. Twenty-one nonoverlapping and region-specific cDNA clones encoding novel genes were isolated in this manner. Ten of 21 clones were subregionally assigned tomore » 4p16.1-4pter, and the remainder mapped to the region proximal to 4p16.1. Northern blot and reverse transcription followed by the PCR (RT-PCR) analysis revealed that 16 of these 21 clones detected transcripts in total RNA from human tissues. The method is applicable to other chromosomal regions and is a powerful approach to the isolation of region-specific cDNA clones. 44 refs., 3 figs., 3 tabs.« less

  18. DNA purification by triplex-affinity capture and affinity capture electrophoresis

    DOEpatents

    Cantor, C.R.; Ito, Takashi; Smith, C.L.

    1996-01-09

    The invention provides a method for purifying or isolating double stranded DNA intact using triple helix formation. The method includes the steps of complexing an oligonucleotide and double stranded DNA to generate a triple helix and immobilization of the triple helix on a solid phase by means of a molecular recognition system such as avidin/biotin. The purified DNA is then recovered intact by treating the solid phase with a reagent that breaks the bonds between the oligonucleotide and the intact double stranded DNA while not affecting the Watson-Crick base pairs of the double helix. The present invention also provides a method for purifying or isolating double stranded DNA intact by complexing the double stranded DNA with a specific binding partner and recovering the complex during electrophoresis by immobilizing it on a solid phase trap imbedded in an electrophoretic gel. 6 figs.

  19. DNA extraction from benthic Cyanobacteria: comparative assessment and optimization.

    PubMed

    Gaget, V; Keulen, A; Lau, M; Monis, P; Brookes, J D

    2017-01-01

    Benthic Cyanobacteria produce toxic and odorous compounds similar to their planktonic counterparts, challenging the quality of drinking water supplies. The biofilm that benthic algae and other micro-organisms produce is a complex and protective matrix. Monitoring to determine the abundance and identification of Cyanobacteria, therefore, relies on molecular techniques, with the choice of DNA isolation technique critical. This study investigated which DNA extraction method is optimal for DNA recovery in order to guarantee the best DNA yield for PCR-based analysis of benthic Cyanobacteria. The conventional phenol-chloroform extraction method was compared with five commercial kits, with the addition of chemical and physical cell-lysis steps also trialled. The efficacy of the various methods was evaluated by measuring the quantity and quality of DNA by UV spectrophotometry and by quantitative PCR (qPCR) using Cyanobacteria-specific primers. The yield and quality of DNA retrieved with the commercial kits was significantly higher than that of DNA obtained with the phenol-chloroform protocol. Kits including a physical cell-lysis step, such as the MO BIO Power Soil and Biofilm kits, were the most efficient for DNA isolation from benthic Cyanobacteria. These commercial kits allow greater recovery and the elimination of dangerous chemicals for DNA extraction, making them the method of choice for the isolation of DNA from benthic mats. They also facilitate the extraction of DNA from benthic Cyanobacteria, which can help to improve the characterization of Cyanobacteria in environmental studies using qPCRs or population composition analysis using next-generation sequencing. © 2016 The Society for Applied Microbiology.

  20. Investigation of interaction between magnetic silica particles and lambda phage DNA fragment.

    PubMed

    Smerkova, Kristyna; Dostalova, Simona; Vaculovicova, Marketa; Kynicky, Jindrich; Trnkova, Libuse; Kralik, Miroslav; Adam, Vojtech; Hubalek, Jaromir; Provaznik, Ivo; Kizek, Rene

    2013-12-01

    Nucleic acids belong to the most important molecules and therefore the understanding of their properties, function and behavior is crucial. Even though a range of analytical and biochemical methods have been developed for this purpose, one common step is essential for all of them - isolation of the nucleic acid from the from complex sample matrix. The use of magnetic particles for the separation of nucleic acids has many advantages over other isolation methods. In this study, an isolation procedure for extraction of DNA was optimized. Each step of the isolation process including washing, immobilization and elution was optimized and therefore the efficiency was increased from 1.7% to 28.7% and the total time was shortened from 75 to 30min comparing to the previously described method. Quantification of the particular parameter influence was performed by square-wave voltammetry using hanging drop mercury electrode. Further, we compared the optimized method with standard chloroform extraction and applied on isolation of DNA from Staphylococcus aureus and Escherichia coli. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Serotypes and DNA fingerprint profiles of Pasteurella multocida isolated from raptors

    USGS Publications Warehouse

    Wilson, M.A.; Duncan, R.M.; Nordholm, G.E.; Berlowski, B.M.

    1995-01-01

    Pasteurella multocida isolates from 21 raptors were examined by DNA fingerprint profile and serotyping methods. Isolates were obtained from noncaptive birds of prey found in 11 states from November 28, 1979, through February 10, 1993. Nine isolates were from bald eagles, and the remaining isolates were from hawks, falcons, and owls. Seven isolates were members of capsule group A, and 14 were nonencapsulated. One isolate was identified as somatic type 3, and another was type 3,4,7; both had unique HhaI DNA fingerprint profiles. Nineteen isolates expressed somatic type 1 antigen; HhaI profiles of all type 1 isolates were identical to each other and to the HhaI profile of the reference somatic type 1, strain X-73. The 19 type 1 isolates were differentiated by sequential digestion of DNA with HpaII; four HpaII fingerprint profiles were obtained. The HpaII profile of one isolate was identical to the HpaII profile of strain X-73. Incidence of P. multocida somatic type 1 in raptors suggests that this type may be prevalent in other wildlife or wildlife environments.

  2. Comparison of two DNA extraction protocols from leave samples of Cotinus coggygria, Citrus sinensis and Genus juglans.

    PubMed

    Fallah, F; Minaei Chenar, H; Amiri, H; Omodipour, S; Shirbande Ghods, F; Kahrizi, D; Sohrabi, M; Ghorbani, T; Kazemi, E

    2017-02-28

    High quality DNA is essential for molecular research. Secondary metabolites can affect the quantity and quality DNA. In current research two DNA isolation methods including CTAB and Delaporta (protocols 1 & 2 respectively) were applied in three leave samples from Cotinus coggygria, Citrus sinensis and Genus juglans that their leaves are rich of secondary metabolites. We successfully isolated DNA from C. coggygria, C. sinensis and Genus Juglans using the two protocols described above. Good quality DNA was isolated from C. coggygria, C. sinensis and Genus Juglans using protocol 1, while protocol 2 failed to produce usable DNA from these sources. The highest amount of DNA (1.3-1.6) was obtained from them using protocol 1. As we discovered, procedure 1 may work better for plants with secondary metabolites.

  3. Sample size, library composition, and genotypic diversity among natural populations of Escherichia coli from different animals influence accuracy of determining sources of fecal pollution.

    PubMed

    Johnson, LeeAnn K; Brown, Mary B; Carruthers, Ethan A; Ferguson, John A; Dombek, Priscilla E; Sadowsky, Michael J

    2004-08-01

    A horizontal, fluorophore-enhanced, repetitive extragenic palindromic-PCR (rep-PCR) DNA fingerprinting technique (HFERP) was developed and evaluated as a means to differentiate human from animal sources of Escherichia coli. Box A1R primers and PCR were used to generate 2,466 rep-PCR and 1,531 HFERP DNA fingerprints from E. coli strains isolated from fecal material from known human and 12 animal sources: dogs, cats, horses, deer, geese, ducks, chickens, turkeys, cows, pigs, goats, and sheep. HFERP DNA fingerprinting reduced within-gel grouping of DNA fingerprints and improved alignment of DNA fingerprints between gels, relative to that achieved using rep-PCR DNA fingerprinting. Jackknife analysis of the complete rep-PCR DNA fingerprint library, done using Pearson's product-moment correlation coefficient, indicated that animal and human isolates were assigned to the correct source groups with an 82.2% average rate of correct classification. However, when only unique isolates were examined, isolates from a single animal having a unique DNA fingerprint, Jackknife analysis showed that isolates were assigned to the correct source groups with a 60.5% average rate of correct classification. The percentages of correctly classified isolates were about 15 and 17% greater for rep-PCR and HFERP, respectively, when analyses were done using the curve-based Pearson's product-moment correlation coefficient, rather than the band-based Jaccard algorithm. Rarefaction analysis indicated that, despite the relatively large size of the known-source database, genetic diversity in E. coli was very great and is most likely accounting for our inability to correctly classify many environmental E. coli isolates. Our data indicate that removal of duplicate genotypes within DNA fingerprint libraries, increased database size, proper methods of statistical analysis, and correct alignment of band data within and between gels improve the accuracy of microbial source tracking methods.

  4. Fingerprinting of Cyanobacteria Based on PCR with Primers Derived from Short and Long Tandemly Repeated Repetitive Sequences

    PubMed Central

    Rasmussen, Ulla; Svenning, Mette M.

    1998-01-01

    The presence of repeated DNA (short tandemly repeated repetitive [STRR] and long tandemly repeated repetitive [LTRR]) sequences in the genome of cyanobacteria was used to generate a fingerprint method for symbiotic and free-living isolates. Primers corresponding to the STRR and LTRR sequences were used in the PCR, resulting in a method which generate specific fingerprints for individual isolates. The method was useful both with purified DNA and with intact cyanobacterial filaments or cells as templates for the PCR. Twenty-three Nostoc isolates from a total of 35 were symbiotic isolates from the angiosperm Gunnera species, including isolates from the same Gunnera species as well as from different species. The results show a genetic similarity among isolates from different Gunnera species as well as a genetic heterogeneity among isolates from the same Gunnera species. Isolates which have been postulated to be closely related or identical revealed similar results by the PCR method, indicating that the technique is useful for clustering of even closely related strains. The method was applied to nonheterocystus cyanobacteria from which a fingerprint pattern was obtained. PMID:16349487

  5. Response of bacteriophage T7 biological dosimeter to dehydration and extraterrestrial solar UV radiation

    NASA Astrophysics Data System (ADS)

    Hegedüs, M.; Fekete, A.; Módos, K.; Kovács, G.; Rontó, Gy.; Lammer, H.; Panitz, C.

    2007-02-01

    The experiment "Phage and uracil response" (PUR) will be accommodated in the EXPOSE facility of the ISS. Bacteriophage T7/isolated T7 DNA will be exposed to different subsets of extreme environmental parameters in space, in order to study the Responses of Organisms to the Space Environment (ROSE). Launch into orbit is preceded by EXPOSE Experiment Verification Tests (EVT) to optimize the methods and the evaluation. Bacteriophage T7/isolated T7 DNA thin layers were exposed to vacuum ( 10-6Pa), to monochromatic (254 nm) and polychromatic (200-400 nm) UV radiation in air as well as in simulated space vacuum. Using neutral density (ND) filters dose-effect curves were performed in order to define the maximum doses tolerated. The effect of temperature fluctuation in vacuum was also studied. The structural/chemical effects on bacteriophage T7/isolated T7 DNA were analyzed by spectroscopic and microscopical methods. Characteristic changes in the absorption spectrum and in the electrophoretic pattern of phage/DNA have been detected indicating the damage of isolated and intraphage DNA. DNA damage was also determined by quantitative PCR (QPCR) using 555 and 3826 bp fragments of T7 DNA. We obtained substantial evidence that DNA lesions (e.g. strand breaks, DNA-protein cross-links, cyclobutane pirimidine dimers (CPDs) etc.) accumulate throughout exposure. Preliminary results suggest a synergistic action of space vacuum and UV radiation with DNA being the critical target.

  6. Genomic fragmentation and extrachromosomal telomeric repeats impact assessment of telomere length in human spermatozoa: quantitative experiments and systematic review.

    PubMed

    Kurjanowicz, P; Moskovtsev, S; Librach, C

    2017-11-01

    Can differences in DNA isolation alter assessment of sperm telomere length (spTL) and do they account for conflicting results in the literature on spTL and male fertility? DNA isolation methods preferentially include or exclude short, extrachromosomal (EC) telomere-specific sequences that alter spTL measurements, and are responsible for a proportion of the disparity observed between investigations. The relationship between spTL and male fertility has become an active area of research. The results across investigations, however, have been discordant, generating a need to critically evaluate the existing body of knowledge to guide future investigations. Quantitative experiments determined the effect of DNA isolation on the integrity of sperm DNA and measures of spTL, while a systematic analysis of the current literature evaluated the effect of DNA isolation and study design on experimental outcomes. Two DNA isolation methods were compared: Genomic Tips which isolate 'High Molecular Weight' (HMW) DNA exclusively, and QIAamp® DNA Mini which isolates 'Total' genomic DNA irrespective of size. DNA quality was assessed via field inversion gel electrophoresis (FIGE) and spTL was measured via terminal restriction fragment analysis. In addition, major databases in medicine, health and the life sciences were subject to a targeted search, and results were independently screened according to defined exclusion/inclusion criterion. Findings from primary articles were analyzed for concordance and study designs were compared across six moderator variables (sample size, participant age, fertility status, semen fraction, telomere population and type of analysis). HMW DNA spTL was significantly longer than spTL measured from total DNA (P < 0.01), indicating that Total DNA contained short, EC telomeric repeats that shifted downstream assessment towards shorter spTL. HMW DNA spTL reflected the length of intact, chromosomal telomeres. Major findings on spTL showed the greatest concordance amongst studies that implemented HMW DNA isolation prior to spTL assessment. Studies that utilized Total DNA varied in concordance, but outcomes were similar if (i) a comparative analysis was applied or (ii) a sample size threshold of 81 was achieved for correlative analysis. Chromosomal and EC telomeric DNA were distinguished based on outcomes of HMW DNA isolation and size. Further experiments are required to determine the nature and function of these two types of telomeric sequences. This study reveals a dramatic impact of upstream DNA processing and study design on measurements of spTL, which accounts for conflicting results in the literature. Future assessments of spTL should incorporate independent detection of chromosomal and EC telomeric DNA and specific experimental planning. This study was funded by CReATe Fertility Centre, Toronto, Ontario, Canada. The authors have declared no conflict of interest. N/A. © The Author 2017. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  7. Modified salting-out method: high-yield, high-quality genomic DNA extraction from whole blood using laundry detergent.

    PubMed

    Nasiri, H; Forouzandeh, M; Rasaee, M J; Rahbarizadeh, F

    2005-01-01

    Different approaches have been used to extract DNA from whole blood. In most of these methods enzymes (such as proteinase K and RNAse A) or toxic organic solvents (such as phenol or guanidine isothiocyanate) are used. Since these enzymes are expensive, and most of the materials that are used routinely are toxic, it is desirable to apply an efficient DNA extraction procedure that does not require the use of such materials. In this study, genomic DNA was extracted by the salting-out method, but instead of using an analytical-grade enzyme and chemical detergents, as normally used for DNA isolation, a common laundry powder was used. Different concentrations of the powder were tested, and proteins were precipitated by NaCl-saturated distilled water. Finally, DNA precipitation was performed with the use of 96% ethanol. From the results, we conclude that the optimum concentration of laundry powder for the highest yield and purity of isolated DNA is 30 mg/mL. The procedure was optimized, and a final protocol is suggested. Following the same protocol, DNA was extracted from 100 blood samples, and their amounts were found to be >50 microg/mL of whole blood. The integrity of the DNA fragments was confirmed by agarose gel electrophoresis. Furthermore, the extracted DNA was used as a template for PCR reaction. The results obtained from PCR showed that the final solutions of extracted DNA did not contain any inhibitory material for the enzyme used in the PCR reaction, and indicated that the isolated DNA was of good quality. These results show that this method is simple, fast, safe, and cost-effective, and can be used in medical laboratories and research centers. Copyright 2005 Wiley-Liss, Inc.

  8. Application of IS1311 locus 2 PCR-REA assay for the specific detection of 'Bison type' Mycobacterium avium subspecies paratuberculosis isolates of Indian origin.

    PubMed

    Singh, Ajay Vir; Chauhan, Devendra Singh; Singh, Abhinendra; Singh, Pravin Kumar; Sohal, Jagdip Singh; Singh, Shoor Vir

    2015-01-01

    Of the three major genotypes of Mycobacterium avium subspecies paratuberculosis (MAP), 'Bison type' is most prevalent genotype in the domestic livestock species of the country, and has also been recovered from patients suffering from Crohn's disease. Recently, a new assay based on IS1311 locus 2 PCR- restriction endonuclease analysis (REA) was designed to distinguish between 'Indian Bison type' and non-Indian genotypes. The present study investigated discriminatory potential of this new assay while screening of a panel of MAP isolates of diverse genotypes and from different geographical regions. A total of 53 mycobacterial isolates (41 MAP and 12 mycobacterium other than MAP), three MAP genomic DNA and 36 MAP positive faecal DNA samples from different livestock species (cattle, buffaloes, goat, sheep and bison) and geographical regions (India, Canada, USA, Spain and Portugal) were included in the study. The extracted DNA samples (n=92) were analyzed for the presence of MAP specific sequences (IS900, ISMav 2 and HspX) using PCR. DNA samples were further subjected to genotype differentiation using IS1311 PCR-REA and IS1311 L2 PCR-REA methods. All the DNA samples (except DNA from non-MAP mycobacterial isolates) were positive for all the three MAP specific sequences based PCRs. IS1311 PCR-REA showed that MAP DNA samples of Indian origin belonged to 'Bison type'. Whereas, of the total 19 non-Indian MAP DNA samples, 2, 15 and 2 were genotyped as 'Bison type', 'Cattle type' and 'Sheep type', respectively. IS1311 L2 PCR-REA method showed different restriction profiles of 'Bison type' genotype as compared to non-Indian DNA samples. IS1311 L2 PCR-REA method successfully discriminated 'Indian Bison type' from other non-Indian genotypes and showed potential to be future epidemiological tool and for genotyping of MAP isolates.

  9. Detecting an elusive invasive species: a diagnostic PCR to detect Burmese python in Florida waters and an assessment of persistence of environmental DNA.

    PubMed

    Piaggio, Antoinette J; Engeman, Richard M; Hopken, Matthew W; Humphrey, John S; Keacher, Kandy L; Bruce, William E; Avery, Michael L

    2014-03-01

    Recent studies have demonstrated that detection of environmental DNA (eDNA) from aquatic vertebrates in water bodies is possible. The Burmese python, Python bivittatus, is a semi-aquatic, invasive species in Florida where its elusive nature and cryptic coloration make its detection difficult. Our goal was to develop a diagnostic PCR to detect P. bivittatus from water-borne eDNA, which could assist managers in monitoring this invasive species. First, we used captive P. bivittatus to determine whether reptilian DNA could be isolated and amplified from water samples. We also evaluated the efficacy of two DNA isolation methods and two DNA extraction kits commonly used in eDNA preparation. A fragment of the mitochondrial cytochrome b gene from P. bivittatus was detected in all water samples isolated with the sodium acetate precipitate and the QIAamp DNA Micro Kit. Next, we designed P. bivittatus-specific primers and assessed the degradation rate of eDNA in water. Our primers did not amplify DNA from closely related species, and we found that P. bivittatus DNA was consistently detectable up to 96 h. Finally, we sampled water from six field sites in south Florida. Samples from five sites, where P. bivittatus has been observed, tested positive for eDNA. The final site was negative and had no prior documented evidence of P. bivittatus. This study shows P. bivittatus eDNA can be isolated from water samples; thus, this method is a new and promising technique for the management of invasive reptiles. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.

  10. Comparative analysis of Campylobacter isolates from wild birds and chickens using MALDI-TOF MS, biochemical testing, and DNA sequencing.

    PubMed

    Lawton, Samantha J; Weis, Allison M; Byrne, Barbara A; Fritz, Heather; Taff, Conor C; Townsend, Andrea K; Weimer, Bart C; Mete, Aslı; Wheeler, Sarah; Boyce, Walter M

    2018-05-01

    Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) was compared to conventional biochemical testing methods and nucleic acid analyses (16S rDNA sequencing, hippurate hydrolysis gene testing, whole genome sequencing [WGS]) for species identification of Campylobacter isolates obtained from chickens ( Gallus gallus domesticus, n = 8), American crows ( Corvus brachyrhynchos, n = 17), a mallard duck ( Anas platyrhynchos, n = 1), and a western scrub-jay ( Aphelocoma californica, n = 1). The test results for all 27 isolates were in 100% agreement between MALDI-TOF MS, the combined results of 16S rDNA sequencing, and the hippurate hydrolysis gene PCR ( p = 0.0027, kappa = 1). Likewise, the identifications derived from WGS from a subset of 14 isolates were in 100% agreement with the MALDI-TOF MS identification. In contrast, biochemical testing misclassified 5 isolates of C. jejuni as C. coli, and 16S rDNA sequencing alone was not able to differentiate between C. coli and C. jejuni for 11 sequences ( p = 0.1573, kappa = 0.0857) when compared to MALDI-TOF MS and WGS. No agreement was observed between MALDI-TOF MS dendrograms and the phylogenetic relationships revealed by rDNA sequencing or WGS. Our results confirm that MALDI-TOF MS is a fast and reliable method for identifying Campylobacter isolates to the species level from wild birds and chickens, but not for elucidating phylogenetic relationships among Campylobacter isolates.

  11. Comparison of RNA Isolation Methods From Insect Larvae

    PubMed Central

    Ridgeway, J. A.; Timm, A. E.

    2014-01-01

    Abstract Isolating RNA from insects is becoming increasingly important in molecular entomology. Four methods including three commercial kits RNeasy Mini Kit (Qiagen), SV Total RNA isolation system (Promega), TRIzol reagent (Invitrogen), and a cetyl trimethylammonium bromide (CTAB)-based method were compared regarding their ability to isolate RNA from whole-body larvae of Thaumatotibia leucotreta (Meyrick), Thanatophilus micans (F.), Plutella xylostella (L.), and Tenebrio molitor (L.). A difference was observed among the four methods regarding RNA quality but not quantity. However, RNA quality and quantity obtained was not dependent on the insect species. The CTAB-based method produced low-quality RNA and the Trizol reagent produced partially degraded RNA, whereas the RNeasy Mini Kit and SV Total RNA isolation system produced RNA of consistently high quality. However, after reverse transcription to cDNA, RNA produced using all four extraction methods could be used to successfully amplify a 708 bp fragment of the cytochrome oxidase I gene. Of the four methods, the SV Total RNA isolation system showed the least amount of DNA contamination with the highest RNA integrity number and is thus recommended for stringent applications where high-quality RNA is required. This is the first comparison of RNA isolation methods among different insect species and the first to compare RNA isolation methods in insects in the last 20 years. PMID:25527580

  12. Characterization of Aspergillus flavus strains from Brazilian Brazil nuts and cashew by RAPD and ribosomal DNA analysis.

    PubMed

    Midorikawa, G E O; Pinheiro, M R R; Vidigal, B S; Arruda, M C; Costa, F F; Pappas, G J; Ribeiro, S G; Freire, F; Miller, R N G

    2008-07-01

    The aim of this study was to determine the genetic variability in Aspergillus flavus populations from Brazil nut and cashew and develop a polymerase chain reaction (PCR) detection method. Chomatography analysis of 48 isolates identified 36 as aflatoxigenic (75%). One hundred and forty-one DNA bands were generated with 11 random amplified polymorphic DNA (RAPD) primers and analysed via unweighted pair group analysis, using arithmetic means (UPGMA). Isolates grouped according to host, with differentiation of those from A. occidentale also according to geographical origin. Aspergillus flavus-specific PCR primers ASPITSF2 and ASPITSR3 were designed from ribosomal DNA internal transcribed spacers (ITS 1 and 2), and an internal amplification control was developed, to prevent false negative results. Specificity to only A. flavus was confirmed against DNA from additional aspergilli and other fungi. RAPD-based characterization differentiated isolates according to plant host. The PCR primer pair developed showed specificity to A. flavus, with a detection limit of 10 fg. Genetic variability observed in A. flavus isolates from two Brazilian agroecosystems suggested reproductive isolation. The PCR detection method developed for A. flavus represents progress towards multiplex PCR detection of aflatoxigenic and nonaflatoxigenic strains in Hazard Analysis Critical Control Point systems.

  13. Isolation and bioinformatics analysis of differentially methylated genomic fragments in human gastric cancer

    PubMed Central

    Liao, Ai-Jun; Su, Qi; Wang, Xun; Zeng, Bin; Shi, Wei

    2008-01-01

    AIM: To isolate and analyze the DNA sequences which are methylated differentially between gastric cancer and normal gastric mucosa. METHODS: The differentially methylated DNA sequences between gastric cancer and normal gastric mucosa were isolated by methylation-sensitive representational difference analysis (MS-RDA). Similarities between the separated fragments and the human genomic DNA were analyzed with Basic Local Alignment Search Tool (BLAST). RESULTS: Three differentially methylated DNA sequences were obtained, two of which have been accepted by GenBank. The accession numbers are AY887106 and AY887107. AY887107 was highly similar to the 11th exon of LOC440683 (98%), 3’ end of LOC440887 (99%), and promoter and exon regions of DRD5 (94%). AY887106 was consistent (98%) with a CpG island in ribosomal RNA isolated from colorectal cancer by Minoru Toyota in 1999. CONCLUSION: The methylation degree is different between gastric cancer and normal gastric mucosa. The differentially methylated DNA sequences can be isolated effectively by MS-RDA. PMID:18322944

  14. Isolation of genomic DNA from defatted oil seed residue of rapeseed (Brassica napus).

    PubMed

    Sadia, M; Rabbani, M A; Hameed, S; Pearce, S R; Malik, S A

    2011-02-08

    A simple protocol for obtaining pure, restrictable and amplifiable megabase genomic DNA from oil-free seed residue of Brassica napus, an important oil seed plant, has been developed. Oil from the dry seeds was completely recovered in an organic solvent and quantified gravimetrically followed by processing of the residual biomass (defatted seed residue) for genomic DNA isolation. The isolated DNA can be cut by a range of restriction enzymes. The method enables simultaneous isolation and recovery of lipids and genomic DNA from the same test sample, thus allowing two independent analyses from a single sample. Multiple micro-scale oil extraction from the commercial seeds gave approximately 39% oil, which is close to the usual oil recovery from standard oil seed. Most of the amplified fragments were scored in the range of 2.5 to 0.5 kb, best suited for scoring as molecular diagnostics.

  15. Simple method of DNA stretching on glass substrate for fluorescence image and spectroscopy

    NASA Astrophysics Data System (ADS)

    Neupane, Guru P.; Dhakal, Krishna P.; Lee, Hyunsoo; Guthold, Martin; Joseph, Vincent S.; Hong, Jong-Dal; Kim, Jeongyong

    2013-05-01

    Study of biological molecule DNA has contributed to developing many breaking thoughts and wide applications in multidisciplinary fields, such as genomic, medical, sensing and forensic fields. Stretching of DNA molecules is an important supportive tool for AFM or spectroscopic studies of DNA in a single molecular level. In this article, we established a simple method of DNA stretching (to its full length) that occurred on a rotating negatively-charged surface of glass substrate. The isolation of a single DNA molecule was attained by the two competitive forces on DNA molecules, that is, the electrostatic attraction developed between the positively charged YOYO-1 stained DNA and the negatively charged substrate, and the centrifugal force of the rotating substrate, which separates the DNA aggregates into the single molecule. Density of stretched DNA molecules was controlled by selecting the specific parameters such as spinning time and rates, loading volume of DNA-dye complex solution etc. The atomic force microscopy image exhibited a single DNA molecule on the negatively-charged substrate in an isolated state. Further, the photoluminescence spectra of a single DNA molecule stained with YOYO-1 were achieved using the method developed in the present study, which is strongly believed to effectively support the spectroscopic analysis of DNA in a single molecular level.

  16. Isolation of entomopathogenic fungi from soils and Ixodes scapularis (Acari: Ixodidae) ticks: prevalence and methods.

    PubMed

    Tuininga, Amy R; Miller, Jessica L; Morath, Shannon U; Daniels, Thomas J; Falco, Richard C; Marchese, Michael; Sahabi, Sadia; Rosa, Dieshia; Stafford, Kirby C

    2009-05-01

    Entomopathogenic fungi are commonly found in forested soils that provide tick habitat, and many species are pathogenic to Ixodes scapularis Say, the blacklegged tick. As a first step to developing effective biocontrol strategies, the objective of this study was to determine the best methods to isolate entomopathogenic fungal species from field-collected samples of soils and ticks from an Eastern deciduous forest where I. scapularis is common. Several methods were assessed: (1) soils, leaf litter, and ticks were plated on two types of media; (2) soils were assayed for entomopathogenic fungi using the Galleria bait method; (3) DNA from internal transcribed spacer (ITS) regions of the nuclear ribosomal repeat was extracted from pure cultures obtained from soils, Galleria, and ticks and was amplified and sequenced; and (4) DNA was extracted directly from ticks, amplified, and sequenced. We conclude that (1) ticks encounter potentially entomopathogenic fungi more often in soil than in leaf litter, (2) many species of potentially entomopathogenic fungi found in the soil can readily be cultured, (3) the Galleria bait method is a sufficiently efficient method for isolation of these fungi from soils, and (4) although DNA extraction from ticks was not possible in this study because of small sample size, DNA extraction from fungi isolated from soils and from ticks was successful and provided clean sequences in 100 and 73% of samples, respectively. A combination of the above methods is clearly necessary for optimal characterization of entomopathogenic fungi associated with ticks in the environment.

  17. Evaluating variation in human gut microbiota profiles due to DNA extraction method and inter-subject differences.

    PubMed

    Wagner Mackenzie, Brett; Waite, David W; Taylor, Michael W

    2015-01-01

    The human gut contains dense and diverse microbial communities which have profound influences on human health. Gaining meaningful insights into these communities requires provision of high quality microbial nucleic acids from human fecal samples, as well as an understanding of the sources of variation and their impacts on the experimental model. We present here a systematic analysis of commonly used microbial DNA extraction methods, and identify significant sources of variation. Five extraction methods (Human Microbiome Project protocol, MoBio PowerSoil DNA Isolation Kit, QIAamp DNA Stool Mini Kit, ZR Fecal DNA MiniPrep, phenol:chloroform-based DNA isolation) were evaluated based on the following criteria: DNA yield, quality and integrity, and microbial community structure based on Illumina amplicon sequencing of the V4 region of bacterial and archaeal 16S rRNA genes. Our results indicate that the largest portion of variation within the model was attributed to differences between subjects (biological variation), with a smaller proportion of variation associated with DNA extraction method (technical variation) and intra-subject variation. A comprehensive understanding of the potential impact of technical variation on the human gut microbiota will help limit preventable bias, enabling more accurate diversity estimates.

  18. Review of the clinical applications and technological advances of circulating tumor DNA in cancer monitoring.

    PubMed

    Chang, Yi; Tolani, Bhairavi; Nie, Xiuhong; Zhi, Xiuyi; Hu, Mu; He, Biao

    2017-01-01

    Circulating cell-free DNA (cfDNA) released by tumor cells, termed ctDNA, closely reflects the heterogeneity of primary cancers and their metastases. As a noninvasive, real-time monitoring biomarker, ctDNA is a promising tool for detecting driver gene mutations, assessing tumor burden and acquired resistance, and early diagnosis. However, isolation and enrichment of cfDNA is a big challenge due to the high degree of DNA fragmentation and its relatively low abundance in the bloodstream. This review aims to provide insights into the recent technological advances in acquisition of optimal quality cfDNA, the use of preservatives, isolation methods, processing timelines, and detection techniques. It also describes clinical applications of ctDNA in cancer patient management.

  19. Molecular Epidemiological Study of Aspergillus fumigatus in a Bone Marrow Transplantation Unit by PCR Amplification of Ribosomal Intergenic Spacer Sequences

    PubMed Central

    Radford, Sarah A.; Johnson, Elizabeth M.; Leeming, John P.; Millar, Michael R.; Cornish, Jacqueline M.; Foot, Annabel B. M.; Warnock, David W.

    1998-01-01

    We have developed a PCR-based method for the subspecific discrimination of Aspergillus fumigatus types by using two primers designed to amplify the intergenic spacer regions between ribosomal DNA transcription units. The method permitted the reproducible discrimination of 11 distinct DNA types among a total of 119 isolates of A. fumigatus collected from patients and from the environment of a bone marrow transplantation (BMT) unit over a three-year period. Ten DNA types of A. fumigatus were isolated from patients in the BMT unit; eight of these types were also found in the hospital environment, and six of these were present in the unit itself. Thirteen BMT patients developed infection with one of three DNA types some months after these had first been found in the environment of the unit. In other instances, the same DNA types of A. fumigatus were isolated from BMT patients that were later recovered from the environment of the unit. Several DNA types of A. fumigatus were found in the hospital environment over an 18-month period. Molecular typing of multiple isolates of A. fumigatus, obtained from postmortem tissue samples, showed that one patient was infected with a single DNA type, but two others had up to three different DNA types. Our findings suggest that A. fumigatus infection in BMT recipients may be nosocomial in origin and underline the need for careful environmental monitoring of units in which high-risk patients are housed. PMID:9574694

  20. Filtration Isolation of Nucleic Acids: A Simple and Rapid DNA Extraction Method.

    PubMed

    McFall, Sally M; Neto, Mário F; Reed, Jennifer L; Wagner, Robin L

    2016-08-06

    FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 µl whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

  1. Ability of Polyphosphate and Nucleic Acids to Trigger Blood Clotting: Some Observations and Caveats

    PubMed Central

    Smith, Stephanie A.; Gajsiewicz, Joshua M.; Morrissey, James H.

    2018-01-01

    Polyphosphate plays several roles in coagulation and inflammation, while extracellular DNA and RNA are implicated in thrombosis and as disease biomarkers. We sought to compare the procoagulant activities of polyphosphate versus DNA or RNA isolated from mammalian cells. In a recent study, we found that much of the procoagulant activity of DNA isolated from mammalian cells using Qiagen kits resisted digestion with nuclease or polyphosphatase, and even resisted boiling in acid. These kits employ spin columns packed with silica, which is highly procoagulant. Indeed, much of the apparent procoagulant activity of cellular DNA isolated with such kits was attributable to silica particles shed by the spin columns. Therefore, silica-based methods for isolating nucleic acids or polyphosphate from mammalian cells are not suitable for studying their procoagulant activities. We now report that polyphosphate readily co-purified with DNA and RNA using several popular isolation methods, including phenol/chloroform extraction. Thus, cell-derived nucleic acids are also subject to contamination with traces of cellular polyphosphate, which can be eliminated by alkaline phosphatase digestion. We further report that long-chain polyphosphate was orders of magnitude more potent than cell-derived DNA (purified via phenol/chloroform extraction) or RNA at triggering clotting. Additional experiments using RNA homopolymers found that polyG and polyI have procoagulant activity similar to polyphosphate, while polyA and polyC are not procoagulant. Thus, the procoagulant activity of RNA is rather highly dependent on base composition. PMID:29719836

  2. Comparison of six simple methods for extracting ribosomal and mitochondrial DNA from Toxocara and Toxascaris nematodes.

    PubMed

    Mikaeili, F; Kia, E B; Sharbatkhori, M; Sharifdini, M; Jalalizand, N; Heidari, Z; Zarei, Z; Stensvold, C R; Mirhendi, H

    2013-06-01

    Six simple methods for extraction of ribosomal and mitochondrial DNA from Toxocara canis, Toxocara cati and Toxascaris leonina were compared by evaluating the presence, appearance and intensity of PCR products visualized on agarose gels and amplified from DNA extracted by each of the methods. For each species, two isolates were obtained from the intestines of their respective hosts: T. canis and T. leonina from dogs, and T. cati from cats. For all isolates, total DNA was extracted using six different methods, including grinding, boiling, crushing, beating, freeze-thawing and the use of a commercial kit. To evaluate the efficacy of each method, the internal transcribed spacer (ITS) region and the cytochrome c oxidase subunit 1 (cox1) gene were chosen as representative markers for ribosomal and mitochondrial DNA, respectively. Among the six DNA extraction methods, the beating method was the most cost effective for all three species, followed by the commercial kit. Both methods produced high intensity bands on agarose gels and were characterized by no or minimal smear formation, depending on gene target; however, beating was less expensive. We therefore recommend the beating method for studies where costs need to be kept at low levels. Copyright © 2013 Elsevier Inc. All rights reserved.

  3. Dielectrophoretic isolation and detection of cancer-related circulating cell-free DNA biomarkers from blood and plasma

    PubMed Central

    Sonnenberg, Avery; Marciniak, Jennifer Y.; Skowronski, Elaine A.; Manouchehri, Sareh; Rassenti, Laura; Ghia, Emanuela M.; Widhopf, George F.; Kipps, Thomas J.; Heller, Michael J.

    2014-01-01

    Conventional methods for the isolation of cancer-related circulating cell-free (ccf) DNA from patient blood (plasma) are time consuming and laborious. A DEP approach utilizing a microarray device now allows rapid isolation of ccf-DNA directly from a small volume of unprocessed blood. In this study, the DEP device is used to compare the ccf-DNA isolated directly from whole blood and plasma from 11 chronic lymphocytic leukemia (CLL) patients and one normal individual. Ccf-DNA from both blood and plasma samples was separated into DEP high-field regions, after which cells (blood), proteins, and other biomolecules were removed by a fluidic wash. The concentrated ccf-DNA was detected on-chip by fluorescence, and then eluted for PCR and DNA sequencing. The complete process from blood to PCR required less than 10 min; an additional 15 min was required to obtain plasma from whole blood. Ccf-DNA from the equivalent of 5 µL of CLL blood and 5 µL of plasma was amplified by PCR using Ig heavy-chain variable (IGHV) specific primers to identify the unique IGHV gene expressed by the leukemic B-cell clone. The PCR and DNA sequencing results obtained by DEP from all 11 CLL blood samples and from 8 of the 11 CLL plasma samples were exactly comparable to the DNA sequencing results obtained from genomic DNA isolated from CLL patient leukemic B cells (gold standard). PMID:24723219

  4. Dielectrophoretic isolation and detection of cancer-related circulating cell-free DNA biomarkers from blood and plasma.

    PubMed

    Sonnenberg, Avery; Marciniak, Jennifer Y; Skowronski, Elaine A; Manouchehri, Sareh; Rassenti, Laura; Ghia, Emanuela M; Widhopf, George F; Kipps, Thomas J; Heller, Michael J

    2014-07-01

    Conventional methods for the isolation of cancer-related circulating cell-free (ccf) DNA from patient blood (plasma) are time consuming and laborious. A DEP approach utilizing a microarray device now allows rapid isolation of ccf-DNA directly from a small volume of unprocessed blood. In this study, the DEP device is used to compare the ccf-DNA isolated directly from whole blood and plasma from 11 chronic lymphocytic leukemia (CLL) patients and one normal individual. Ccf-DNA from both blood and plasma samples was separated into DEP high-field regions, after which cells (blood), proteins, and other biomolecules were removed by a fluidic wash. The concentrated ccf-DNA was detected on-chip by fluorescence, and then eluted for PCR and DNA sequencing. The complete process from blood to PCR required less than 10 min; an additional 15 min was required to obtain plasma from whole blood. Ccf-DNA from the equivalent of 5 μL of CLL blood and 5 μL of plasma was amplified by PCR using Ig heavy-chain variable (IGHV) specific primers to identify the unique IGHV gene expressed by the leukemic B-cell clone. The PCR and DNA sequencing results obtained by DEP from all 11 CLL blood samples and from 8 of the 11 CLL plasma samples were exactly comparable to the DNA sequencing results obtained from genomic DNA isolated from CLL patient leukemic B cells (gold standard). © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Liquid biopsy - Performance of the PAXgene® Blood ccfDNA Tubes for the isolation and characterization of cell-free plasma DNA from tumor patients.

    PubMed

    Schmidt, Bernd; Reinicke, Dana; Reindl, Iris; Bork, Ines; Wollschläger, Bettina; Lambrecht, Nina; Fleischhacker, Michael

    2017-06-01

    In most research laboratories the use of EDTA tubes for the isolation of plasma DNA from tumor patients is standard. Unfortunately these tubes do not allow for an extended storage of samples before processing and prevent EDTA tubes from being shipped at ambient temperature. The aim of our study was to compare the quantity and quality of plasma DNA isolated from EDTA and PAXgene® Blood ccfDNA Tubes in different downstream applications. We enrolled 29 patients in our study. Blood samples were drawn into EDTA and PAXgene® Blood ccfDNA Tubes and were processed on day 0 and day 7 after storage at ambient temperature. The plasma DNA from 10 patients was isolated manually. For the DNA isolation from the plasma of 19 additional patients we used the automated QIAsymphony system. The total amount DNA from all samples was measured with a quantitative real-time PCR assay. In addition the amount of methylated mSHOX2 plasma DNA was determined. While the 7day storage lead to an increased amount of total DNA in almost all EDTA tubes, this effect was only seen in very few PAXgene® Blood ccfDNA Tubes. The stabilization solution which prevents the lysis of blood cells had no effect on the method for quantification of methylated sequences in these samples. The quantity and quality of plasma DNA from both types of blood draw tubes are comparable. DNA from PAXgene® Blood ccfDNA was successfully used for PCR-based quantification of total amount of cell-free DNA and for methylation analysis as well. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Fluorometric determination of the DNA concentration in municipal drinking water.

    PubMed Central

    McCoy, W F; Olson, B H

    1985-01-01

    DNA concentrations in municipal drinking water samples were measured by fluorometry, using Hoechst 33258 fluorochrome. The concentration, extraction, and detection methods used were adapted from existing techniques. The method is reproducible, fast, accurate, and simple. The amounts of DNA per cell for five different bacterial isolates obtained from drinking water samples were determined by measuring DNA concentration and total cell concentration (acridine orange epifluorescence direct cell counting) in stationary pure cultures. The relationship between DNA concentration and epifluorescence total direct cell concentration in 11 different drinking water samples was linear and positive; the amounts of DNA per cell in these samples did not differ significantly from the amounts in pure culture isolates. We found significant linear correlations between DNA concentration and colony-forming unit concentration, as well as between epifluorescence direct cell counts and colony-forming unit concentration. DNA concentration measurements of municipal drinking water samples appear to monitor changes in bacteriological quality at least as well as total heterotrophic plate counting and epifluorescence direct cell counting. PMID:3890737

  7. Isolation of active regulatory elements from eukaryotic chromatin using FAIRE (Formaldehyde Assisted Isolation of Regulatory Elements)

    PubMed Central

    Giresi, Paul G.; Lieb, Jason D.

    2009-01-01

    The binding of sequence-specific regulatory factors and the recruitment of chromatin remodeling activities cause nucleosomes to be evicted from chromatin in eukaryotic cells. Traditionally, these active sites have been identified experimentally through their sensitivity to nucleases. Here we describe the details of a simple procedure for the genome-wide isolation of nucleosome-depleted DNA from human chromatin, termed FAIRE (Formaldehyde Assisted Isolation of Regulatory Elements). We also provide protocols for different methods of detecting FAIRE-enriched DNA, including use of PCR, DNA microarrays, and next-generation sequencing. FAIRE works on all eukaryotic chromatin tested to date. To perform FAIRE, chromatin is crosslinked with formaldehyde, sheared by sonication, and phenol-chloroform extracted. Most genomic DNA is crosslinked to nucleosomes and is sequestered to the interphase, whereas DNA recovered in the aqueous phase corresponds to nucleosome-depleted regions of the genome. The isolated regions are largely coincident with the location of DNaseI hypersensitive sites, transcriptional start sites, enhancers, insulators, and active promoters. Given its speed and simplicity, FAIRE has utility in establishing chromatin profiles of diverse cell types in health and disease, isolating DNA regulatory elements en masse for further characterization, and as a screening assay for the effects of small molecules on chromatin organization. PMID:19303047

  8. The use of (GTG)5 oligonucleotide as an RAPD primer to type Campylobacter concisus.

    PubMed

    Matsheka, M I; Lastovica, A J; Zappe, H; Elisha, B G

    2006-06-01

    DNA fingerprinting using (GTG)(5) oligonucleotide as a primer in a random amplified polymorphic DNA (RAPD) assay was assessed by typing isolates of Campylobacter concisus strains, collected over a period of 8 years. RAPD analysis using the (GTG)(5) oligonucleotide as a primer was used to type 100 isolates of C. concisus comprising mostly isolates from children with diarrhoea. Using this method, 86% of the isolates were found to be genotypically diverse. Of these heterogeneous isolates, 25 of the strains were also shown to be genetically distinct in a previous study using pulsed field gel electrophoresis. The remaining isolates (14) could be classified into five profile groups based on the DNA fingerprinting patterns. The assay successfully identified epidemiologically linked strains from the unrelated genetically diverse pool of strains. Laboratory RADP typing using the (GTG)(5) primer proved to be useful in distinguishing related strains of C. concisus from a large pool of unrelated strains of this organism. RAPD typing using (GTG)(5) is a simple method that could be used to investigate the epidemiology of C. concisus. The results suggest that homologous lineages of C. concisus may exist within an otherwise heterogeneous species complex. However, these data need to be confirmed using a more robust typing method.

  9. DNA cards: determinants of DNA yield and quality in collecting genetic samples for pharmacogenetic studies.

    PubMed

    Mas, Sergi; Crescenti, Anna; Gassó, Patricia; Vidal-Taboada, Jose M; Lafuente, Amalia

    2007-08-01

    As pharmacogenetic studies frequently require establishment of DNA banks containing large cohorts with multi-centric designs, inexpensive methods for collecting and storing high-quality DNA are needed. The aims of this study were two-fold: to compare the amount and quality of DNA obtained from two different DNA cards (IsoCode Cards or FTA Classic Cards, Whatman plc, Brentford, Middlesex, UK); and to evaluate the effects of time and storage temperature, as well as the influence of anticoagulant ethylenediaminetetraacetic acid on the DNA elution procedure. The samples were genotyped by several methods typically used in pharmacogenetic studies: multiplex PCR, PCR-restriction fragment length polymorphism, single nucleotide primer extension, and allelic discrimination assay. In addition, they were amplified by whole genome amplification to increase genomic DNA mass. Time, storage temperature and ethylenediaminetetraacetic acid had no significant effects on either DNA card. This study reveals the importance of drying blood spots prior to isolation to avoid haemoglobin interference. Moreover, our results demonstrate that re-isolation protocols could be applied to increase the amount of DNA recovered. The samples analysed were accurately genotyped with all the methods examined herein. In conclusion, our study shows that both DNA cards, IsoCode Cards and FTA Classic Cards, facilitate genetic and pharmacogenetic testing for routine clinical practice.

  10. Isolation of Entomopathogenic Fungi From Soils and Ixodes scapularis (Acari: Ixodidae) Ticks: Prevalence and Methods

    PubMed Central

    Tuininga, Amy R.; Miller, Jessica L.; Morath, Shannon U.; Daniels, Thomas J.; Falco, Richard C.; Marchese, Michael; Sahabi, Sadia; Rosa, Dieshia; Stafford, Kirby C.

    2009-01-01

    Entomopathogenic fungi are commonly found in forested soils that provide tick habitat, and many species are pathogenic to Ixodes scapularis Say, the blacklegged tick. As a first step to developing effective biocontrol strategies, the objective of this study was to determine the best methods to isolate entomopathogenic fungal species from field-collected samples of soils and ticks from an Eastern deciduous forest where I. scapularis is common. Several methods were assessed: (1) soils, leaf litter, and ticks were plated on two types of media; (2) soils were assayed for entomopathogenic fungi using the Galleria bait method; (3) DNA from internal transcribed spacer (ITS) regions of the nuclear ribosomal repeat was extracted from pure cultures obtained from soils, Galleria, and ticks and was amplified and sequenced; and (4) DNA was extracted directly from ticks, amplified, and sequenced. We conclude that (1) ticks encounter potentially entomopathogenic fungi more often in soil than in leaf litter, (2) many species of potentially entomopathogenic fungi found in the soil can readily be cultured, (3) the Galleria bait method is a sufficiently efficient method for isolation of these fungi from soils, and (4) although DNA extraction from ticks was not possible in this study because of small sample size, DNA extraction from fungi isolated from soils and from ticks was successful and provided clean sequences in 100 and 73% of samples, respectively. A combination of the above methods is clearly necessary for optimal characterization of entomopathogenic fungi associated with ticks in the environment. PMID:19496427

  11. A Polymerase Chain Reaction-Based Method for Isolating Clones from a Complimentary DNA Library in Sheep

    PubMed Central

    Friis, Thor Einar; Stephenson, Sally; Xiao, Yin; Whitehead, Jon

    2014-01-01

    The sheep (Ovis aries) is favored by many musculoskeletal tissue engineering groups as a large animal model because of its docile temperament and ease of husbandry. The size and weight of sheep are comparable to humans, which allows for the use of implants and fixation devices used in human clinical practice. The construction of a complimentary DNA (cDNA) library can capture the expression of genes in both a tissue- and time-specific manner. cDNA libraries have been a consistent source of gene discovery ever since the technology became commonplace more than three decades ago. Here, we describe the construction of a cDNA library using cells derived from sheep bones based on the pBluescript cDNA kit. Thirty clones were picked at random and sequenced. This led to the identification of a novel gene, C12orf29, which our initial experiments indicate is involved in skeletal biology. We also describe a polymerase chain reaction-based cDNA clone isolation method that allows the isolation of genes of interest from a cDNA library pool. The techniques outlined here can be applied in-house by smaller tissue engineering groups to generate tools for biomolecular research for large preclinical animal studies and highlights the power of standard cDNA library protocols to uncover novel genes. PMID:24447069

  12. Susceptibility Testing by Polymerase Chain Reaction DNA Quantitation: A Method to Measure Drug Resistance of Human Immunodeficiency Virus Type 1 Isolates

    NASA Astrophysics Data System (ADS)

    Eron, Joseph J.; Gorczyca, Paul; Kaplan, Joan C.; D'Aquila, Richard T.

    1992-04-01

    Polymerase chain reaction (PCR) DNA quantitation (PDQ) susceptibility testing rapidly and directly measures nucleoside sensitivity of human immunodeficiency virus type 1 (HIV-1) isolates. PCR is used to quantitate the amount of HIV-1 DNA synthesized after in vitro infection of peripheral blood mononuclear cells. The relative amounts of HIV-1 DNA in cell lysates from cultures maintained at different drug concentrations reflect drug inhibition of virus replication. The results of PDQ susceptibility testing of 2- or 3-day cultures are supported by assays measuring HIV-1 p24 antigen production in supernatants of 7- or 10-day cultures. DNA sequence analyses to identify mutations in the reverse transcriptase gene that cause resistance to 3'-azido-3'-deoxythymidine also support the PDQ results. With the PDQ method, both infectivity titration and susceptibility testing can be performed on supernatants from primary cultures of peripheral blood mononuclear cells. PDQ susceptibility testing should facilitate epidemiologic studies of the clinical significance of drug-resistant HIV-1 isolates.

  13. Glutathione-S-conjugate transport in plants

    DOEpatents

    Rea, Philip A.; Lu, Yu-Ping; Li, Ze-Sheng

    2000-01-01

    The invention includes an isolated DNA encoding a plant GS-X pump polypeptide and an isolated preparation of a plant GS-X pump polypeptide. Also included is an isolated preparation of a nucleic acid which is antisense in orientation to a portion or all of a plant GS-X pump gene. The invention also includes a cells, vectors and transgenic plants having an isolated DNA encoding a plant GS-X pump and methods of use thereof. In addition, the invention relates to plant GS-X pump promoter sequences and the uses thereof.

  14. Efficient isolation method for high-quality genomic DNA from cicada exuviae.

    PubMed

    Nguyen, Hoa Quynh; Kim, Ye Inn; Borzée, Amaël; Jang, Yikweon

    2017-10-01

    In recent years, animal ethics issues have led researchers to explore nondestructive methods to access materials for genetic studies. Cicada exuviae are among those materials because they are cast skins that individuals left after molt and are easily collected. In this study, we aim to identify the most efficient extraction method to obtain high quantity and quality of DNA from cicada exuviae. We compared relative DNA yield and purity of six extraction protocols, including both manual protocols and available commercial kits, extracting from four different exoskeleton parts. Furthermore, amplification and sequencing of genomic DNA were evaluated in terms of availability of sequencing sequence at the expected genomic size. Both the choice of protocol and exuvia part significantly affected DNA yield and purity. Only samples that were extracted using the PowerSoil DNA Isolation kit generated gel bands of expected size as well as successful sequencing results. The failed attempts to extract DNA using other protocols could be partially explained by a low DNA yield from cicada exuviae and partly by contamination with humic acids that exist in the soil where cicada nymphs reside before emergence, as shown by spectroscopic measurements. Genomic DNA extracted from cicada exuviae could provide valuable information for species identification, allowing the investigation of genetic diversity across consecutive broods, or spatiotemporal variation among various populations. Consequently, we hope to provide a simple method to acquire pure genomic DNA applicable for multiple research purposes.

  15. Rapid isolation of novel FK506 binding proteins from multiple organisms using gDNA and cDNA T7 phage display.

    PubMed

    Piggott, Andrew M; Kriegel, Alison M; Willows, Robert D; Karuso, Peter

    2009-10-01

    Reverse chemical proteomics using T7 phage display is a powerful technique for identifying cellular receptors of biologically active small molecules. However, to date this method has generally been limited to cDNA libraries constructed from mRNA isolated from eukaryotes. In this paper, we describe the construction of the first prokaryotic T7 phage display libraries from randomly digested Pseudomonas stutzeri and Vibrio fischeri gDNA, as well as a plant cDNA library from Arabidopsis thaliana. We also describe the use of T7 phage display to identify novel proteins from environmental DNA samples using biotinylated FK506 as a model affinity probe.

  16. Genotyping of Giardia lamblia isolates from humans in China and Korea using ribosomal DNA Sequences.

    PubMed

    Yong, T S; Park, S J; Hwang, U W; Yang, H W; Lee, K W; Min, D Y; Rim, H J; Wang, Y; Zheng, F

    2000-08-01

    Genetic characterization of a total of 15 Giardia lamblia isolates, 8 from Anhui Province, China (all from purified cysts) and 7 from Seoul, Korea (2 from axenic cultures and 5 from purified cysts), was performed by polymerase chain reaction amplification and sequencing of a 295-bp region near the 5' end of the small subunit ribosomal DNA (eukaryotic 16S rDNA). Phylogenetic analyses were subsequently conducted using sequence data obtained in this study, as well as sequences published from other Giardia isolates. The maximum parsimony method revealed that G. lamblia isolates from humans in China and Korea are divided into 2 major lineages, assemblages A and B. All 7 Korean isolates were grouped into assemblage A, whereas 4 Chinese isolates were grouped into assemblage A and 4 into assemblage B. Two Giardia microti isolates and 2 dog-derived Giardia isolates also grouped into assemblage B, whereas Giardia ardeae and Giardia muris were unique.

  17. Transposon-containing DNA cloning vector and uses thereof

    DOEpatents

    Berg, C.M.; Berg, D.E.; Wang, G.

    1997-07-08

    The present invention discloses a rapid method of restriction mapping, sequencing or localizing genetic features in a segment of deoxyribonucleic acid (DNA) that is up to 42 kb in size. The method in part comprises cloning of the DNA segment in a specialized cloning vector and then isolating nested deletions in either direction in vivo by intramolecular transposition into the cloned DNA. A plasmid has been prepared and disclosed. 4 figs.

  18. Transposon-containing DNA cloning vector and uses thereof

    DOEpatents

    Berg, Claire M.; Berg, Douglas E.; Wang, Gan

    1997-01-01

    The present invention discloses a rapid method of restriction mapping, sequencing or localizing genetic features in a segment of deoxyribonucleic acid (DNA) that is up to 42 kb in size. The method in part comprises cloning of the DNA segment in a specialized cloning vector and then isolating nested deletions in either direction in vivo by intramolecular transposition into the cloned DNA. A plasmid has been prepared and disclosed.

  19. Isolation of centromeric-tandem repetitive DNA sequences by chromatin affinity purification using a HaloTag7-fused centromere-specific histone H3 in tobacco.

    PubMed

    Nagaki, Kiyotaka; Shibata, Fukashi; Kanatani, Asaka; Kashihara, Kazunari; Murata, Minoru

    2012-04-01

    The centromere is a multi-functional complex comprising centromeric DNA and a number of proteins. To isolate unidentified centromeric DNA sequences, centromere-specific histone H3 variants (CENH3) and chromatin immunoprecipitation (ChIP) have been utilized in some plant species. However, anti-CENH3 antibody for ChIP must be raised in each species because of its species specificity. Production of the antibodies is time-consuming and costly, and it is not easy to produce ChIP-grade antibodies. In this study, we applied a HaloTag7-based chromatin affinity purification system to isolate centromeric DNA sequences in tobacco. This system required no specific antibody, and made it possible to apply a highly stringent wash to remove contaminated DNA. As a result, we succeeded in isolating five tandem repetitive DNA sequences in addition to the centromeric retrotransposons that were previously identified by ChIP. Three of the tandem repeats were centromere-specific sequences located on different chromosomes. These results confirm the validity of the HaloTag7-based chromatin affinity purification system as an alternative method to ChIP for isolating unknown centromeric DNA sequences. The discovery of more than two chromosome-specific centromeric DNA sequences indicates the mosaic structure of tobacco centromeres. © Springer-Verlag 2011

  20. Preparation of Double-Stranded (Replicative Form) Bacteriophage M13 DNA.

    PubMed

    Green, Michael R; Sambrook, Joseph

    2017-11-01

    The double-stranded, closed-circular, replicative form (RF) of M13 DNA is present in high copy numbers in infected cells, and its physical characteristics are essentially identical to those of closed-circular plasmid DNAs. Any of the methods commonly used to purify plasmid DNA can therefore be used to isolate M13 RF DNA. This protocol describes the isolation of M13 RF DNA by alkaline lysis from small volumes (1-2 mL) of infected bacterial cultures. The yield of DNA (1-4 mg, depending on the size of the M13 clone) is more than enough for most purposes in molecular cloning. However, should more DNA be needed, the procedure can easily be scaled up. © 2017 Cold Spring Harbor Laboratory Press.

  1. Method for in vitro recombination

    DOEpatents

    Gibson, Daniel Glenn; Smith, Hamilton O

    2013-05-07

    The present invention relates to an in vitro method, using isolated protein reagents, for joining two double-stranded (ds) DNA molecules of interest, wherein the distal region of the first DNA molecule and the proximal region of the second DNA molecule share a region of sequence identity. The method allows the joining of a number of DNA fragments, in a predetermined order and orientation, without the use of restriction enzymes. It can be used, e.g., to join synthetically produced sub-fragments of a gene or genome of interest.

  2. Geranyl diphosphate synthase large subunit, and methods of use

    DOEpatents

    Croteau, Rodney B.; Burke, Charles C.; Wildung, Mark R.

    2001-10-16

    A cDNA encoding geranyl diphosphate synthase large subunit from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase large subunit). In another aspect, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase large subunit. In yet another aspect, the present invention provides isolated, recombinant geranyl diphosphate synthase protein comprising an isolated, recombinant geranyl diphosphate synthase large subunit protein and an isolated, recombinant geranyl diphosphate synthase small subunit protein. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase.

  3. A method suitable for DNA extraction from humus-rich soil.

    PubMed

    Miao, Tianjin; Gao, Song; Jiang, Shengwei; Kan, Guoshi; Liu, Pengju; Wu, Xianming; An, Yingfeng; Yao, Shuo

    2014-11-01

    A rapid and convenient method for extracting DNA from soil is presented. Soil DNA is extracted by direct cell lysis in the presence of EDTA, SDS, phenol, chloroform and isoamyl alcohol (3-methyl-1-butanol) followed by precipitation with 2-propanol. The extracted DNA is purified by modified DNA purification kit and DNA gel extraction kit. With this method, DNA extracted from humus-rich dark brown forest soil was free from humic substances and, therefore, could be used for efficient PCR amplification and restriction digestion. In contrast, DNA sample extracted with the traditional CTAB-based method had lower yield and purity, and no DNA could be extracted from the same soil sample with a commonly-used commercial soil DNA isolation kit. In addition, this method is time-saving and convenient, providing an efficient choice especially for DNA extraction from humus-rich soils.

  4. Validation of the (GTG)(5)-rep-PCR fingerprinting technique for rapid classification and identification of acetic acid bacteria, with a focus on isolates from Ghanaian fermented cocoa beans.

    PubMed

    De Vuyst, Luc; Camu, Nicholas; De Winter, Tom; Vandemeulebroecke, Katrien; Van de Perre, Vincent; Vancanneyt, Marc; De Vos, Paul; Cleenwerck, Ilse

    2008-06-30

    Amplification of repetitive bacterial DNA elements through the polymerase chain reaction (rep-PCR fingerprinting) using the (GTG)(5) primer, referred to as (GTG)(5)-PCR fingerprinting, was found a promising genotypic tool for rapid and reliable speciation of acetic acid bacteria (AAB). The method was evaluated with 64 AAB reference strains, including 31 type strains, and 132 isolates from Ghanaian, fermented cocoa beans, and was validated with DNA:DNA hybridization data. Most reference strains, except for example all Acetobacter indonesiensis strains and Gluconacetobacter liquefaciens LMG 1509, grouped according to their species designation, indicating the usefulness of this technique for identification to the species level. Moreover, exclusive patterns were obtained for most strains, suggesting that the technique can also be used for characterization below species level or typing of AAB strains. The (GTG)(5)-PCR fingerprinting allowed us to differentiate four major clusters among the fermented cocoa bean isolates, namely A. pasteurianus (cluster I, 100 isolates), A. syzygii- or A. lovaniensis-like (cluster II, 23 isolates), and A. tropicalis-like (clusters III and IV containing 4 and 5 isolates, respectively). A. syzygii-like and A. tropicalis-like strains from cocoa bean fermentations were reported for the first time. Validation of the method and indications for reclassifications of AAB species and existence of new Acetobacter species were obtained through 16S rRNA sequencing analyses and DNA:DNA hybridizations. Reclassifications refer to A. aceti LMG 1531, Ga. xylinus LMG 1518, and Ga. xylinus subsp. sucrofermentans LMG 18788(T).

  5. Isolation of High-Molecular-Weight DNA from Mammalian Tissues Using Proteinase K and Phenol.

    PubMed

    Green, Michael R; Sambrook, Joseph

    2017-03-01

    This procedure is the method of choice for purification of genomic DNA from mammalian tissues when large amounts of DNA are required, for example, for Southern blotting. © 2017 Cold Spring Harbor Laboratory Press.

  6. A rapid and efficient assay for extracting DNA from fungi

    USGS Publications Warehouse

    Griffin, Dale W.; Kellogg, C.A.; Peak, K.K.; Shinn, E.A.

    2002-01-01

    Aims: A method for the rapid extraction of fungal DNA from small quantities of tissue in a batch-processing format was investigated. Methods and Results: Tissue (< 3.0 mg) was scraped from freshly-grown fungal isolates. The tissue was suspended in buffer AP1 and subjected to seven rounds of freeze/thaw using a crushed dry ice/ethanol bath and a boiling water bath. After a 30 min boiling step, the tissue was quickly ground against the wall of the microfuge tube using a sterile pipette tip. The Qiagen DNeasy Plant Tissue Kit protocol was then used to purify the DNA for PCR/ sequencing applications. Conclusions: The method allowed batch DNA extraction from multiple fungal isolates using a simple yet rapid and reliable assay. Significance and Impact of the Study: Use of this assay will allow researchers to obtain DNA from fungi quickly for use in molecular assays that previously required specialized instrumentation, was time-consuming or was not conducive to batch processing.

  7. Efficacy of the detection of Legionella in hot and cold water samples by culture and PCR. I. Standardization of methods.

    PubMed

    Wójcik-Fatla, Angelina; Stojek, Nimfa Maria; Dutkiewicz, Jacek

    2012-01-01

    The aim of the present study was: - to compare methods for concentration and isolation of Legionella DNA from water; - to examine the efficacy of various modifications of PCR test (PCR, semi-nested PCR, and real-time PCR) for the detection of known numbers of Legionella pneumophila in water samples artificially contaminated with the strain of this bacterium and in randomly selected samples of environmental water, in parallel with examination by culture. It was found that filtration is much more effective than centrifugation for the concentration of DNA in water samples, and that the Qiamp DNA Mini-Kit is the most efficient for isolation of Legionella DNA from water. The semi-nested PCR and real-time PCR proved to be the most sensitive methods for detection of Legionella DNA in water samples. Both PCR modifications showed a high correlation with recovery of Legionella by culture (p<0.01), while no correlation occurred between the results of one-stage PCR and culture (p>0.1).

  8. Lactobacillus hammesii sp. nov., isolated from French sourdough.

    PubMed

    Valcheva, Rosica; Korakli, Maher; Onno, Bernard; Prévost, Hervé; Ivanova, Iskra; Ehrmann, Matthias A; Dousset, Xavier; Gänzle, Michael G; Vogel, Rudi F

    2005-03-01

    Twenty morphologically different strains were chosen from French wheat sourdough isolates. Cells were Gram-positive, non-spore-forming, non-motile rods. The isolates were identified using amplified-fragment length polymorphism, randomly amplified polymorphic DNA and 16S rRNA gene sequence analysis. All isolates were members of the genus Lactobacillus. They were identified as representing Lactobacillus plantarum, Lactobacillus paralimentarius, Lactobacillus sanfranciscensis, Lactobacillus spicheri and Lactobacillus sakei. However, two isolates (LP38(T) and LP39) could be clearly discriminated from recognized Lactobacillus species on the basis of genotyping methods. 16S rRNA gene sequence similarity and DNA-DNA relatedness data indicate that the two strains belong to a novel Lactobacillus species, for which the name Lactobacillus hammesii is proposed. The type strain is LP38(T) (=DSM 16381(T)=CIP 108387(T)=TMW 1.1236(T)).

  9. Isolating Sperm from Cell Mixtures Using Magnetic Beads Coupled with an Anti-PH-20 Antibody for Forensic DNA Analysis.

    PubMed

    Zhao, Xing-Chun; Wang, Le; Sun, Jing; Jiang, Bo-Wei; Zhang, Er-Li; Ye, Jian

    2016-01-01

    Vaginal swabs taken in rape cases usually contain epithelial cells from the victim and sperm from the assailant and forensic DNA analysis requires separation of sperm from these cell mixtures. PH-20, which is a glycosylphosphatidylinositol-anchored hyaluronidase located on the head of sperm, has important functions in fertilization. Here we describe a newly developed method for sperm isolation using anti-PH-20 antibody-coupled immunomagnetic beads (anti-PH-20 IMBs). Optical microscopy and scanning electron microscopy showed the IMBs recognized the head of sperm specifically and exhibited a great capacity to capture sperm cells. However, we found it necessary to incubate the IMB-sperm complex with DNase I before sperm lysis in order to remove any female DNA completely. We compared the sensitivity of anti-PH-20 IMBs in sperm and epithelial cell discrimination to those coated with a different anti-sperm antibody (anti-SP-10, anti-ADAM2 or anti-JLP). Only the anti-PH-20 IMBs succeeded in isolating sperm from cell mixtures at a sperm/epithelial cell ratio of 103:105. Further, our method exhibited greater power and better stability for sperm isolation compared to the traditional differential lysis strategy. Taken together, the anti-PH-20 IMB method described here could be effective for the isolation of sperm needed to obtain a single-sourced DNA profile as an aid to identifying the perpetrator in sexual assault cases.

  10. Isolating Sperm from Cell Mixtures Using Magnetic Beads Coupled with an Anti-PH-20 Antibody for Forensic DNA Analysis

    PubMed Central

    Zhao, Xing-Chun; Wang, Le; Sun, Jing; Jiang, Bo-Wei; Zhang, Er-Li; Ye, Jian

    2016-01-01

    Vaginal swabs taken in rape cases usually contain epithelial cells from the victim and sperm from the assailant and forensic DNA analysis requires separation of sperm from these cell mixtures. PH-20, which is a glycosylphosphatidylinositol-anchored hyaluronidase located on the head of sperm, has important functions in fertilization. Here we describe a newly developed method for sperm isolation using anti-PH-20 antibody-coupled immunomagnetic beads (anti-PH-20 IMBs). Optical microscopy and scanning electron microscopy showed the IMBs recognized the head of sperm specifically and exhibited a great capacity to capture sperm cells. However, we found it necessary to incubate the IMB–sperm complex with DNase I before sperm lysis in order to remove any female DNA completely. We compared the sensitivity of anti-PH-20 IMBs in sperm and epithelial cell discrimination to those coated with a different anti-sperm antibody (anti-SP-10, anti-ADAM2 or anti-JLP). Only the anti-PH-20 IMBs succeeded in isolating sperm from cell mixtures at a sperm/epithelial cell ratio of 103:105. Further, our method exhibited greater power and better stability for sperm isolation compared to the traditional differential lysis strategy. Taken together, the anti-PH-20 IMB method described here could be effective for the isolation of sperm needed to obtain a single-sourced DNA profile as an aid to identifying the perpetrator in sexual assault cases. PMID:27442128

  11. Structural Organization and Strain Variation in the Genome of Varicella Zoster Virus

    DTIC Science & Technology

    1984-10-23

    Zoster 6 Growth of VZV in tissue culture 9 Structure and proteins of VZV 15 Structure of HSV DNA 20 Classification of herpesviruses based on DNA...structure 28 Strain variation in herpesvirus DNA 31 VZV DNA 33 Specific aims 36 II. MATERIALS AND METHODS 38 Cells and viruses 38 Isolation of virus...endonuclease fragments by colony hybridization 106 21. Selected methods of restriction endonuclease mapping .... 109 22. Identification of

  12. Loop-mediated isothermal amplification (LAMP) assay-A rapid detection tool for identifying red fox (Vulpes vulpes) DNA in the carcasses of harbour porpoises (Phocoena phocoena).

    PubMed

    Heers, Teresa; van Neer, Abbo; Becker, André; Grilo, Miguel Luca; Siebert, Ursula; Abdulmawjood, Amir

    2017-01-01

    Carcasses of wild animals are often visited by different scavengers. However, determining which scavenger caused certain types of bite marks is particularly difficult and knowledge thereof is lacking. Therefore, a loop-mediated isothermal amplification (LAMP) assay (target sequence cytochrome b) was developed to detect red fox DNA in carcasses of harbour porpoises. The MSwab™ method for direct testing without prior DNA isolation was validated. As a detection device, the portable real-time fluorometer Genie® II was used, which yields rapid results and can be used in field studies without huge laboratory equipment. In addition to in vitro evaluation and validation, a stranded and scavenged harbour porpoise carcass was successfully examined for red fox DNA residues. The developed LAMP method is a valuable diagnostic tool for confirming presumable red fox bite wounds in harbour porpoises without further DNA isolation steps.

  13. Development of RFLP-PCR method for the identification of medically important Aspergillus species using single restriction enzyme MwoI.

    PubMed

    Diba, K; Mirhendi, H; Kordbacheh, P; Rezaie, S

    2014-01-01

    In this study we attempted to modify the PCR-RFLP method using restriction enzyme MwoI for the identification of medically important Aspergillus species. Our subjects included nine standard Aspergillus species and 205 Aspergillus isolates of approved hospital acquired infections and hospital indoor sources. First of all, Aspergillus isolates were identified in the level of species by using morphologic method. A twenty four hours culture was performed for each isolates to harvest Aspergillus mycelia and then genomic DNA was extracted using Phenol-Chloroform method. PCR-RFLP using single restriction enzyme MwoI was performed in ITS regions of rDNA gene. The electrophoresis data were analyzed and compared with those of morphologic identifications. Total of 205 Aspergillus isolates included 153 (75%) environmental and 52 (25%) clinical isolates. A. flavus was the most frequently isolate in our study (55%), followed by A. niger 65(31.7%), A. fumigatus 18(8.7%), A. nidulans and A. parasiticus 2(1% each). MwoI enabled us to discriminate eight medically important Aspergillus species including A. fumigatus, A. niger, A. flavus as the most common isolated species. PCR-RFLP method using the restriction enzyme MwoI is a rapid and reliable test for identification of at least the most medically important Aspergillus species.

  14. Development of RFLP-PCR method for the identification of medically important Aspergillus species using single restriction enzyme MwoI

    PubMed Central

    Diba, K.; Mirhendi, H.; Kordbacheh, P.; Rezaie, S.

    2014-01-01

    In this study we attempted to modify the PCR-RFLP method using restriction enzyme MwoI for the identification of medically important Aspergillus species. Our subjects included nine standard Aspergillus species and 205 Aspergillus isolates of approved hospital acquired infections and hospital indoor sources. First of all, Aspergillus isolates were identified in the level of species by using morphologic method. A twenty four hours culture was performed for each isolates to harvest Aspergillus mycelia and then genomic DNA was extracted using Phenol-Chloroform method. PCR-RFLP using single restriction enzyme MwoI was performed in ITS regions of rDNA gene. The electrophoresis data were analyzed and compared with those of morphologic identifications. Total of 205 Aspergillus isolates included 153 (75%) environmental and 52 (25%) clinical isolates. A. flavus was the most frequently isolate in our study (55%), followed by A. niger 65(31.7%), A. fumigatus 18(8.7%), A. nidulans and A. parasiticus 2(1% each). MwoI enabled us to discriminate eight medically important Aspergillus species including A. fumigatus, A. niger, A. flavus as the most common isolated species. PCR-RFLP method using the restriction enzyme MwoI is a rapid and reliable test for identification of at least the most medically important Aspergillus species. PMID:25242934

  15. Pasteurella multocida isolated from wild birds of North America: a serotype and DNA fingerprint study of isolates from 1978 to 1993

    USGS Publications Warehouse

    Wilson, M.A.; Duncan, R.M.; Nordholm, G.E.; Berlowski, B.M.

    1995-01-01

    Serotype and DNA fingerprint methods were used to study Pasteurella multocida isolated from 320 wild birds of North America. Isolates were collected during 1978-93. The HhaI profiles of 314 isolates matched the HhaI profile of somatic reference type 1, strain X-73; somatic type 1 antigen was expressed by 310 isolates, and the serotype of four isolates was undetected. Differentiation of the 314 isolates was observed by digestion of DNA with HpaII. None of the HpaII profiles matched the HpaII profile of X-73 (designated HhaI 001/HpaII 001). Three HpaII profiles were recognized among the somatic type 1 isolates: HpaII 002 (n = 18), HpaII 003 (n = 122), and HpaII 004 (n = 174). Profile HpaII 002 was found among isolates collected during 1979-83. Profile HpaII 003 was identified from isolates collected during 1979-89, with the exception of two isolates in 1992. The HpaII 004 profile was identified from isolates collected during 1983-93. Of the six remaining isolates, four expressed somatic type 4 and had HhaI profiles identical to the somatic type 4 reference strain P-1662 profile (designated HhaI 004); these isolates were differentiated by digestion of DNA with HpaII. One isolate was identified as serotype F:11, and another was serotype A:3,4. In the present study, 314 of 316 (99.4%) isolates from wild birds in the Central, Mississippi, and Pacific flyways during 1978-93, were P. multocida somatic type 1.

  16. Influence of amino acids Shiff bases on irradiated DNA stability in vivo.

    PubMed

    Karapetyan, N H; Malakyan, M H; Bajinyan, S A; Torosyan, A L; Grigoryan, I E; Haroutiunian, S G

    2013-01-01

    To reveal protective role of the new Mn(II) complexes with Nicotinyl-L-Tyrosinate and Nicotinyl-L-Tryptophanate Schiff Bases against ionizing radiation. The DNA of the rats liver was isolated on 7, 14, and 30 days after X-ray irradiation. The differences between the DNA of irradiated rats and rats pre-treated with Mn(II) complexes were studied using the melting, microcalorimetry, and electrophoresis methods. The melting parameters and the melting enthalpy of rats livers DNA were changed after the X-ray irradiation: melting temperature and melting enthalpy were decreased and melting interval was increased. These results can be explained by destruction of DNA molecules. It was shown that pre-treatment of rats with Mn(II) complexes approximates the melting parameters to norm. Agarose gel electrophoresis data confirmed the results of melting studies. The separate DNA fragments were revealed in DNA samples isolated from irradiated animals. The DNA isolated from animals pre-treated with the Mn(II) chelates had better electrophoretic characteristics, which correspond to healthy DNA. Pre-treatment of the irradiated rats with Mn(II)(Nicotinil-L-Tyrosinate) and Mn(II)(Nicotinil-L-Tryptophanate)2 improves the DNA characteristics.

  17. FACTORS INFLUENCING THE ABILITY OF ISOLATED CELL NUCLEI TO FORM GELS IN DILUTE ALKALI

    PubMed Central

    Dounce, Alexander L.; Monty, Kenneth J.

    1955-01-01

    1. Known methods for isolating cell nuclei are divided into two classes, depending on whether or not the nuclei are capable of forming gels in dilute alkali or strong saline solutions. Methods which produce nuclei that can form gels apparently prevent the action of an intramitochondrial enzyme capable of destroying the gel-forming capacity of the nuclei. Methods in the other class are believed to permit this enzyme to act on the nuclei during the isolation procedure, causing detachment of DNA from some nuclear constituent (probably protein). 2. It is shown that heating in alkaline solution and x-irradiation can destroy nuclear gels. Heating in acid or neutral solutions can destroy the capacity of isolated nuclei to form gels. 3. Chemical and biological evidence is summarized in favor of the hypothesis that DNA is normally bound firmly to some nuclear component by non-ionic linkages. PMID:14381437

  18. Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods.

    PubMed

    Kaneko, Ikuko; Miyamoto, Kazuaki; Mimura, Kanako; Yumine, Natsuko; Utsunomiya, Hirotoshi; Akimoto, Shigeru; McClane, Bruce A

    2011-11-01

    To prevent food-borne bacterial diseases and to trace bacterial contamination events to foods, microbial source tracking (MST) methods provide important epidemiological information. To apply molecular methods to MST, it is necessary not only to amplify bacterial cells to detection limit levels but also to prepare DNA with reduced inhibitory compounds and contamination. Isolates carrying the Clostridium perfringens enterotoxin gene (cpe) on the chromosome or a plasmid rank among the most important food-borne pathogens. Previous surveys indicated that cpe-positive C. perfringens isolates are present in only ∼5% of nonoutbreak food samples and then only at low numbers, usually less than 3 cells/g. In this study, four molecular assays for the detection of cpe-positive C. perfringens isolates, i.e., ordinary PCR, nested PCR, real-time PCR, and loop-mediated isothermal amplification (LAMP), were developed and evaluated for their reliability using purified DNA. For use in the artificial contamination of meat samples, DNA templates were prepared by three different commercial DNA preparation kits. The four molecular assays always detected cpe when >10³ cells/g of cpe-positive C. perfringens were present, using any kit. Of three tested commercial DNA preparation kits, the InstaGene matrix kit appeared to be most suitable for the testing of a large number of samples. By using the InstaGene matrix kit, the four molecular assays efficiently detected cpe using DNA prepared from enrichment culture specimens of meat samples contaminated with low numbers of cpe-positive C. perfringens vegetative cells or spores. Overall, the current study developed molecular assay protocols for MST to detect the contamination of foods with low numbers of cells, and at a low frequency, of cpe-positive C. perfringens isolates.

  19. Optimizing techniques to capture and extract environmental DNA for detection and quantification of fish.

    PubMed

    Eichmiller, Jessica J; Miller, Loren M; Sorensen, Peter W

    2016-01-01

    Few studies have examined capture and extraction methods for environmental DNA (eDNA) to identify techniques optimal for detection and quantification. In this study, precipitation, centrifugation and filtration eDNA capture methods and six commercially available DNA extraction kits were evaluated for their ability to detect and quantify common carp (Cyprinus carpio) mitochondrial DNA using quantitative PCR in a series of laboratory experiments. Filtration methods yielded the most carp eDNA, and a glass fibre (GF) filter performed better than a similar pore size polycarbonate (PC) filter. Smaller pore sized filters had higher regression slopes of biomass to eDNA, indicating that they were potentially more sensitive to changes in biomass. Comparison of DNA extraction kits showed that the MP Biomedicals FastDNA SPIN Kit yielded the most carp eDNA and was the most sensitive for detection purposes, despite minor inhibition. The MoBio PowerSoil DNA Isolation Kit had the lowest coefficient of variation in extraction efficiency between lake and well water and had no detectable inhibition, making it most suitable for comparisons across aquatic environments. Of the methods tested, we recommend using a 1.5 μm GF filter, followed by extraction with the MP Biomedicals FastDNA SPIN Kit for detection. For quantification of eDNA, filtration through a 0.2-0.6 μm pore size PC filter, followed by extraction with MoBio PowerSoil DNA Isolation Kit was optimal. These results are broadly applicable for laboratory studies on carps and potentially other cyprinids. The recommendations can also be used to inform choice of methodology for field studies. © 2015 John Wiley & Sons Ltd.

  20. Evaluation of DNA extraction methods for the analysis of microbial community in biological activated carbon.

    PubMed

    Zheng, Lu; Gao, Naiyun; Deng, Yang

    2012-01-01

    It is difficult to isolate DNA from biological activated carbon (BAC) samples used in water treatment plants, owing to the scarcity of microorganisms in BAC samples. The aim of this study was to identify DNA extraction methods suitable for a long-term, comprehensive ecological analysis of BAC microbial communities. To identify a procedure that can produce high molecular weight DNA, maximizes detectable diversity and is relatively free from contaminants, the microwave extraction method, the cetyltrimethylammonium bromide (CTAB) extraction method, a commercial DNA extraction kit, and the ultrasonic extraction method were used for the extraction of DNA from BAC samples. Spectrophotometry, agarose gel electrophoresis and polymerase chain reaction (PCR)-restriction fragment length polymorphisms (RFLP) analysis were conducted to compare the yield and quality of DNA obtained using these methods. The results showed that the CTAB method produce the highest yield and genetic diversity of DNA from BAC samples, but DNA purity was slightly less than that obtained with the DNA extraction-kit method. This study provides a theoretical basis for establishing and selecting DNA extraction methods for BAC samples.

  1. Enterohemorrhagic Escherichia coli O157 in milk and dairy products from Libya: Isolation and molecular identification by partial sequencing of 16S rDNA

    PubMed Central

    Garbaj, Aboubaker M.; Awad, Enas M.; Azwai, Salah M.; Abolghait, Said K.; Naas, Hesham T.; Moawad, Ashraf A.; Gammoudi, Fatim T.; Barbieri, Ilaria; Eldaghayes, Ibrahim M.

    2016-01-01

    Aim: The aim of this work was to isolate and molecularly identify enterohemorrhagic Escherichia coli (EHEC) O157 in milk and dairy products in Libya, in addition; to clear the accuracy of cultural and biochemical identification as compared with molecular identification by partial sequencing of 16S rDNA for the existing isolates. Materials and Methods: A total of 108 samples of raw milk (cow, she-camel, and goat) and locally made dairy products (fermented cow’s milk, Maasora, Ricotta and ice cream) were collected from some regions (Janzour, Tripoli, Kremiya, Tajoura and Tobruk) in Libya. Samples were subjected to microbiological analysis for isolation of E. coli that was detected by conventional cultural and molecular method using polymerase chain reaction and partial sequencing of 16S rDNA. Results: Out of 108 samples, only 27 isolates were found to be EHEC O157 based on their cultural characteristics (Tellurite-Cefixime-Sorbitol MacConkey) that include 3 isolates from cow’s milk (11%), 3 isolates from she-camel’s milk (11%), two isolates from goat’s milk (7.4%) and 7 isolates from fermented raw milk samples (26%), isolates from fresh locally made soft cheeses (Maasora and Ricotta) were 9 (33%) and 3 (11%), respectively, while none of the ice cream samples revealed any growth. However, out of these 27 isolates, only 11 were confirmed to be E. coli by partial sequencing of 16S rDNA and E. coli O157 Latex agglutination test. Phylogenetic analysis revealed that majority of local E. coli isolates were related to E. coli O157:H7 FRIK944 strain. Conclusion: These results can be used for further studies on EHEC O157 as an emerging foodborne pathogen and its role in human infection in Libya. PMID:27956766

  2. Effect of DNA extraction and sample preservation method on rumen bacterial population.

    PubMed

    Fliegerova, Katerina; Tapio, Ilma; Bonin, Aurelie; Mrazek, Jakub; Callegari, Maria Luisa; Bani, Paolo; Bayat, Alireza; Vilkki, Johanna; Kopečný, Jan; Shingfield, Kevin J; Boyer, Frederic; Coissac, Eric; Taberlet, Pierre; Wallace, R John

    2014-10-01

    The comparison of the bacterial profile of intracellular (iDNA) and extracellular DNA (eDNA) isolated from cow rumen content stored under different conditions was conducted. The influence of rumen fluid treatment (cheesecloth squeezed, centrifuged, filtered), storage temperature (RT, -80 °C) and cryoprotectants (PBS-glycerol, ethanol) on quality and quantity parameters of extracted DNA was evaluated by bacterial DGGE analysis, real-time PCR quantification and metabarcoding approach using high-throughput sequencing. Samples clustered according to the type of extracted DNA due to considerable differences between iDNA and eDNA bacterial profiles, while storage temperature and cryoprotectants additives had little effect on sample clustering. The numbers of Firmicutes and Bacteroidetes were lower (P < 0.01) in eDNA samples. The qPCR indicated significantly higher amount of Firmicutes in iDNA sample frozen with glycerol (P < 0.01). Deep sequencing analysis of iDNA samples revealed the prevalence of Bacteroidetes and similarity of samples frozen with and without cryoprotectants, which differed from sample stored with ethanol at room temperature. Centrifugation and consequent filtration of rumen fluid subjected to the eDNA isolation procedure considerably changed the ratio of molecular operational taxonomic units (MOTUs) of Bacteroidetes and Firmicutes. Intracellular DNA extraction using bead-beating method from cheesecloth sieved rumen content mixed with PBS-glycerol and stored at -80 °C was found as the optimal method to study ruminal bacterial profile. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. A rapid method for the identification and differentiation of Helicoverpa nucleopolyhedroviruses (NPV Baculoviridae) isolated from the environment.

    PubMed

    Christian, P D; Gibb, N; Kasprzak, A B; Richards, A

    2001-07-01

    A diagnostic method is described for the identification and differentiation of nucleopolyhedrovirus (NPV) pathogens of Helicoverpa species (Lepidoptera: Noctuidae) isolated from the environment. The method is based on the polymerase chain reaction (PCR) used in conjunction with restriction fragment length polymorphism (RFLP) analysis and comprises three parts. The first part describes procedures for obtaining PCR quality viral DNA from individual diseased H. armigera cadavers recovered during bioassay analyses of soil and other types of environmental sample. These procedures were modified from standard techniques used for the routine purification and dissolution of NPV polyhedra and provided an overall PCR success rate of 95% (n=60). The second part describes the design of several sets of PCR primers for generating DNA amplification products from closely and distantly related NPVs. These PCR primers were designed from published DNA sequence data and from randomly cloned genomic DNA fragments isolated from a reference H. armigera SNPV (HaSNPV) isolate. The final part of the method describes how specific PCR products when digested with specific restriction endonuclease enzymes, can be used to generate diagnostic DNA profiles (haplotypes) that can be used both to identify heterologous NPVs e.g. Autographa californica MNPV and related viruses, and to differentiate genotypic variants of Helicoverpa SNPV. In the latter case, only two PCR products and four restriction digests were required to differentiate a reference set of 10 Helicoverpa SNPV isolates known to differ 0.1--3.5% at the nucleotide level. The diagnostic method described below marks the second part of a two-phase quantitative-diagnostic protocol that is now being applied to a variety of ecological investigations. In particular, its application should lead to a significant improvement in our understanding of the distribution and population genetics of Helicoverpa SNPVs in the Australian environment, as well as providing a sound basis for the design of pre- and post-release monitoring systems for genetically enhanced bioinsecticides. It is also likely that this method can be adapted readily to the study of other insect pathogen associations important economically.

  4. Detection of DNA–protein crosslinks (DPCs) by novel direct fluorescence labeling methods: distinct stabilities of aldehyde and radiation-induced DPCs

    PubMed Central

    Shoulkamy, Mahmoud I.; Nakano, Toshiaki; Ohshima, Makiko; Hirayama, Ryoichi; Uzawa, Akiko; Furusawa, Yoshiya; Ide, Hiroshi

    2012-01-01

    Proteins are covalently trapped on DNA to form DNA–protein crosslinks (DPCs) when cells are exposed to DNA-damaging agents. DPCs interfere with many aspects of DNA transactions. The current DPC detection methods indirectly measure crosslinked proteins (CLPs) through DNA tethered to proteins. However, a major drawback of such methods is the non-linear relationship between the amounts of DNA and CLPs, which makes quantitative data interpretation difficult. Here we developed novel methods of DPC detection based on direct CLP measurement, whereby CLPs in DNA isolated from cells are labeled with fluorescein isothiocyanate (FITC) and quantified by fluorometry or western blotting using anti-FITC antibodies. Both formats successfully monitored the induction and elimination of DPCs in cultured cells exposed to aldehydes and mouse tumors exposed to ionizing radiation (carbon-ion beams). The fluorometric and western blotting formats require 30 and 0.3 μg of DNA, respectively. Analyses of the isolated genomic DPCs revealed that both aldehydes and ionizing radiation produce two types of DPC with distinct stabilities. The stable components of aldehyde-induced DPCs have half-lives of up to days. Interestingly, that of radiation-induced DPCs has an infinite half-life, suggesting that the stable DPC component exerts a profound effect on DNA transactions over many cell cycles. PMID:22730301

  5. Rapid Amplification of Plasmid and Phage DNA Using Phi29 DNA Polymerase and Multiply-Primed Rolling Circle Amplification

    PubMed Central

    Dean, Frank B.; Nelson, John R.; Giesler, Theresa L.; Lasken, Roger S.

    2001-01-01

    We describe a simple method of using rolling circle amplification to amplify vector DNA such as M13 or plasmid DNA from single colonies or plaques. Using random primers and φ29 DNA polymerase, circular DNA templates can be amplified 10,000-fold in a few hours. This procedure removes the need for lengthy growth periods and traditional DNA isolation methods. Reaction products can be used directly for DNA sequencing after phosphatase treatment to inactivate unincorporated nucleotides. Amplified products can also be used for in vitro cloning, library construction, and other molecular biology applications. PMID:11381035

  6. Phylogenetic and physiological diversity of microorganisms isolated from a deep greenland glacier ice core

    NASA Technical Reports Server (NTRS)

    Miteva, V. I.; Sheridan, P. P.; Brenchley, J. E.

    2004-01-01

    We studied a sample from the GISP 2 (Greenland Ice Sheet Project) ice core to determine the diversity and survival of microorganisms trapped in the ice at least 120,000 years ago. Previously, we examined the phylogenetic relationships among 16S ribosomal DNA (rDNA) sequences in a clone library obtained by PCR amplification from genomic DNA extracted from anaerobic enrichments. Here we report the isolation of nearly 800 aerobic organisms that were grouped by morphology and amplified rDNA restriction analysis patterns to select isolates for further study. The phylogenetic analyses of 56 representative rDNA sequences showed that the isolates belonged to four major phylogenetic groups: the high-G+C gram-positives, low-G+C gram-positives, Proteobacteria, and the Cytophaga-Flavobacterium-Bacteroides group. The most abundant and diverse isolates were within the high-G+C gram-positive cluster that had not been represented in the clone library. The Jukes-Cantor evolutionary distance matrix results suggested that at least 7 isolates represent new species within characterized genera and that 49 are different strains of known species. The isolates were further categorized based on the isolation conditions, temperature range for growth, enzyme activity, antibiotic resistance, presence of plasmids, and strain-specific genomic variations. A significant observation with implications for the development of novel and more effective cultivation methods was that preliminary incubation in anaerobic and aerobic liquid prior to plating on agar media greatly increased the recovery of CFU from the ice core sample.

  7. Isolation of PCR quality microbial community DNA from heavily contaminated environments.

    PubMed

    Gunawardana, Manjula; Chang, Simon; Jimenez, Abraham; Holland-Moritz, Daniel; Holland-Moritz, Hannah; La Val, Taylor P; Lund, Craig; Mullen, Madeline; Olsen, John; Sztain, Terra A; Yoo, Jennifer; Moss, John A; Baum, Marc M

    2014-07-01

    Asphalts, biochemically degraded oil, contain persistent, water-soluble compounds that pose a significant challenge to the isolation of PCR quality DNA. The adaptation of existing DNA purification protocols and commercial kits proved unsuccessful at overcoming this hurdle. Treatment of aqueous asphalt extracts with a polyamide resin afforded genomic microbial DNA templates that could readily be amplified by PCR. Physicochemically distinct asphalt samples from five natural oil seeps successfully generated the expected 291 bp amplicons targeting a region of the 16S rRNA gene, illustrating the robustness of the method. DNA recovery yields were in the 50-80% range depending on how the asphalt sample was seeded with exogenous DNA. The scope of the new method was expanded to include soil with high humic acid content. DNA from soil samples spiked with a range of humic acid concentrations was extracted with a commercial kit followed by treatment with the polyamide resin. The additional step significantly improved the purity of the DNA templates, especially at high humic acid concentrations, based on qPCR analysis of the bacterial 16S rRNA genes. The new method has the advantages of being inexpensive, simple, and rapid and should provide a valuable addition to protocols in the field of petroleum and soil microbiology. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Short communication: Identification of coagulase-negative staphylococcus species from goat milk with the API Staph identification test and with transfer RNA-intergenic spacer PCR combined with capillary electrophoresis.

    PubMed

    Koop, G; De Visscher, A; Collar, C A; Bacon, D A C; Maga, E A; Murray, J D; Supré, K; De Vliegher, S; Haesebrouck, F; Rowe, J D; Nielen, M; van Werven, T

    2012-12-01

    Coagulase-negative staphylococci (CNS) are the most commonly isolated bacteria from goat milk, but they have often been identified with phenotypic methods, which may have resulted in misclassification. The aims of this paper were to assess the amount of misclassification of a phenotypic test for identifying CNS species from goat milk compared with transfer RNA intergenic spacer PCR (tDNA-PCR) followed by capillary electrophoresis, and to apply the tDNA-PCR technique on different capillary electrophoresis equipment. Milk samples were collected from 416 does in 5 Californian dairy goat herds on 3 occasions during lactation. In total, 219 CNS isolates were identified at the species level with tDNA-PCR and subjected to the API 20 Staph identification test kit (API Staph; bioMérieux, Durham, NC). If the same species was isolated multiple times from the same udder gland, only the first isolate was used for further analyses, resulting in 115 unique CNS isolates. According to the tDNA-PCR test, the most prevalent CNS species were Staphylococcus epidermidis, Staphylococcus caprae, and Staphylococcus simulans. Typeability with API staph was low (72%). Although the API Staph test was capable of identifying the majority of Staph. epidermidis and Staph. caprae isolates, sensitivity for identification of Staph. simulans was low. The true positive fraction was high for the 3 most prevalent species. It was concluded that the overall performance of API Staph in differentiating CNS species from goat milk was moderate to low, mainly because of the low typeability, and that genotypic methods such as tDNA-PCR are preferred. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  9. Identification of Medically Important Yeasts Using PCR-Based Detection of DNA Sequence Polymorphisms in the Internal Transcribed Spacer 2 Region of the rRNA Genes

    PubMed Central

    Chen, Y. C.; Eisner, J. D.; Kattar, M. M.; Rassoulian-Barrett, S. L.; LaFe, K.; Yarfitz, S. L.; Limaye, A. P.; Cookson, B. T.

    2000-01-01

    Identification of medically relevant yeasts can be time-consuming and inaccurate with current methods. We evaluated PCR-based detection of sequence polymorphisms in the internal transcribed spacer 2 (ITS2) region of the rRNA genes as a means of fungal identification. Clinical isolates (401), reference strains (6), and type strains (27), representing 34 species of yeasts were examined. The length of PCR-amplified ITS2 region DNA was determined with single-base precision in less than 30 min by using automated capillary electrophoresis. Unique, species-specific PCR products ranging from 237 to 429 bp were obtained from 92% of the clinical isolates. The remaining 8%, divided into groups with ITS2 regions which differed by ≤2 bp in mean length, all contained species-specific DNA sequences easily distinguishable by restriction enzyme analysis. These data, and the specificity of length polymorphisms for identifying yeasts, were confirmed by DNA sequence analysis of the ITS2 region from 93 isolates. Phenotypic and ITS2-based identification was concordant for 427 of 434 yeast isolates examined using sequence identity of ≥99%. Seven clinical isolates contained ITS2 sequences that did not agree with their phenotypic identification, and ITS2-based phylogenetic analyses indicate the possibility of new or clinically unusual species in the Rhodotorula and Candida genera. This work establishes an initial database, validated with over 400 clinical isolates, of ITS2 length and sequence polymorphisms for 34 species of yeasts. We conclude that size and restriction analysis of PCR-amplified ITS2 region DNA is a rapid and reliable method to identify clinically significant yeasts, including potentially new or emerging pathogenic species. PMID:10834993

  10. Gene Patents and Personalized Cancer Care: Impact of the Myriad Case on Clinical Oncology

    PubMed Central

    Offit, Kenneth; Bradbury, Angela; Storm, Courtney; Merz, Jon F.; Noonan, Kevin E.; Spence, Rebecca

    2013-01-01

    Genomic discoveries have transformed the practice of oncology and cancer prevention. Diagnostic and therapeutic advances based on cancer genomics developed during a time when it was possible to patent genes. A case before the Supreme Court, Association for Molecular Pathology v Myriad Genetics, Inc seeks to overturn patents on isolated genes. Although the outcomes are uncertain, it is suggested here that the Supreme Court decision will have few immediate effects on oncology practice or research but may have more significant long-term impact. The Federal Circuit court has already rejected Myriad's broad diagnostic methods claims, and this is not affected by the Supreme Court decision. Isolated DNA patents were already becoming obsolete on scientific grounds, in an era when human DNA sequence is public knowledge and because modern methods of next-generation sequencing need not involve isolated DNA. The Association for Molecular Pathology v Myriad Supreme Court decision will have limited impact on new drug development, as new drug patents usually involve cellular methods. A nuanced Supreme Court decision acknowledging the scientific distinction between synthetic cDNA and genomic DNA will further mitigate any adverse impact. A Supreme Court decision to include or exclude all types of DNA from patent eligibility could impact future incentives for genomic discovery as well as the future delivery of medical care. Whatever the outcome of this important case, it is important that judicial and legislative actions in this area maximize genomic discovery while also ensuring patients' access to personalized cancer care. PMID:23766521

  11. A two-step electrodialysis method for DNA purification from polluted metallic environmental samples.

    PubMed

    Rodríguez-Mejía, José Luis; Martínez-Anaya, Claudia; Folch-Mallol, Jorge Luis; Dantán-González, Edgar

    2008-08-01

    Extracting DNA from samples of polluted environments using standard methods often results in low yields of poor-quality material unsuited to subsequent manipulation and analysis by molecular biological techniques. Here, we report a novel two-step electrodialysis-based method for the extraction of DNA from environmental samples. This technique permits the rapid and efficient isolation of high-quality DNA based on its acidic nature, and without the requirement for phenol-chloroform-isoamyl alcohol cleanup and ethanol precipitation steps. Subsequent PCR, endonuclease restriction, and cloning reactions were successfully performed utilizing DNA obtained by electrodialysis, whereas some or all of these techniques failed using DNA extracted with two alternative methods. We also show that his technique is applicable to purify DNA from a range of polluted and nonpolluted samples.

  12. ISOLATION AND PROPERTIES OF LIVER CELL NUCLEOLI

    PubMed Central

    Monty, K. J.; Litt, M.; Kay, E. R. M.; Dounce, A. L.

    1956-01-01

    1. The significance of the term nucleolus has been discussed. 2. A detailed method for the isolation of nucleoli from already isolated rat or cat liver nuclei has been presented. 3. The presence of DNA in isolated liver cell nucleoli has been indicated by histochemical methods. 4. The percentages of DNA and RNA in the isolated nucleoli have been determined by chemical analysis. 5. The specific activities of aldolase, arginase, and catalase have been determined for two subnuclear fractions and for the isolated nucleoli of rat and cat liver, and the relative amounts of these enzymes in the same subnuclear fractions and nucleoli of rat liver have been measured. 6. The significance of the above findings has been discussed and consideration has been given to what types of isolated nuclei might best serve as starting material for the isolation of nucleoli. 7. A new hypothesis has been presented that nucleoli of the liver cell type may function primarily in furnishing (directly or indirectly) templates for the synthesis of the particular enzymes that must govern the chemistry of mitosis. PMID:13319377

  13. Identifying the bacterial community on the surface of Intralox belting in a meat boning room by culture-dependent and culture-independent 16S rDNA sequence analysis.

    PubMed

    Brightwell, Gale; Boerema, Jackie; Mills, John; Mowat, Eilidh; Pulford, David

    2006-05-25

    We examined the bacterial community present on an Intralox conveyor belt system in an operating lamb boning room by sequencing the 16S ribosomal DNA (rDNA) of bacteria extracted in the presence or absence of cultivation. RFLP patterns for 16S rDNA clone library and cultures were generated using HaeIII and MspI restriction endonucleases. 16S rDNA amplicons produced 8 distinct RFLP pattern groups. RFLP groups I-IV were represented in the clone library and RFLP groups I and V-VIII were represented amongst the cultured isolates. Partial DNA sequences from each RFLP group revealed that all group I, II and VIII representatives were Pseudomonas spp., group III were Sphingomonas spp., group IV clones were most similar to an uncultured alpha proteobacterium, group V was similar to a Serratia spp., group VI with an Alcaligenes spp., and group VII with Microbacterium spp. Sphingomonads were numerically dominant in the culture-independent clone library and along with the group IV alpha proteobacterium were not represented amongst the cultured isolates. Serratia, Alcaligenes and Microbacterium spp. were only represented with cultured isolates. Pseudomonads were detected by both culture-dependent (84% of isolates) and culture-independent (12.5% of clones) methods and their presence at high frequency does pose the risk of product spoilage if transferred onto meat stored under aerobic conditions. The detection of sphingomonads in large numbers by the culture-independent method demands further analysis because sphingomonads may represent a new source of meat spoilage that has not been previously recognised in the meat processing environment. The 16S rDNA collections generated by both methods were important at representing the diversity of the bacterial population associated with an Intralox conveyor belt system.

  14. Evaluation of a PCR melting profile method for intraspecies differentiation of Trichophyton rubrum and Trichophyton interdigitale.

    PubMed

    Leibner-Ciszak, Justyna; Dobrowolska, Anita; Krawczyk, Beata; Kaszuba, Aleksandra; Staczek, Paweł

    2010-02-01

    In order to identify the source of infections caused by dermatophytes, as well as the pathogen transmission pathway, there is a need to determine methods that allow detailed genetic differentiation of the strains within the dermatophyte genera. In this work, a PCR melting profile (PCR-MP) technique based on the ligation of adaptors and the difference in melting temperatures of DNA restriction fragments was used for the first time for intraspecies genotyping of dermatophytes. Clinical isolates and reference strains of dermatophytes isolated from skin, scalp, toenails and fingernails were used for this study. PCR-MP and random amplification of polymorphic DNA (RAPD) were used to type 11 isolates of Trichophyton rubrum, 40 isolates of Trichophyton interdigitale and 14 isolates of Microsporum canis. The results distinguished five types (containing one subtype) characteristic for T. rubrum and seven types characteristic for T. interdigitale using the PCR-MP technique. Analysis conducted using RAPD revealed five types for T. rubrum and four types for T. interdigitale isolates. No differentiation was observed for the M. canis isolates with either method. These results demonstrate that PCR-MP is a reliable method for the differentiation of T. rubrum and T. interdigitale strains and yields a discriminatory power that is at least equal to that of RAPD.

  15. Characterization of Lactobacillus from Algerian Goat’S Milk Based on Phenotypic, 16S rDNA Sequencing and their Technological Properties

    PubMed Central

    Marroki, Ahmed; Zúñiga, Manuel; Kihal, Mabrouk; Pérez- Martínez, Gaspar

    2011-01-01

    Nineteen strains of Lactobacillus isolated from goat’s milk from farms in north-west of Algeria were characterized. Isolates were identified by phenotypic, physiological and genotypic methods and some of their important technological properties were studied. Phenotypic characterization was carried out by studying physiological, morphological characteristics and carbohydrate fermentation patterns using API 50 CHL system. Isolates were also characterized by partial 16S rDNA sequencing. Results obtained with phenotypic methods were correlated with the genotypic characterization and 13 isolates were identified as L. plantarum, two isolates as L. rhamnosus and one isolate as L. fermentum. Three isolates identified as L. plantarum by phenotypic characterization were found to be L. pentosus by the genotypic method. A large diversity in technological properties (acid production in skim milk, exopolysaccharide production, aminopeptidase activity, antibacterial activity and antibiotic susceptibility) was observed. Based on these results, two strains of L. plantarum (LbMS16 and LbMS21) and one strain of L. rhamnosus (LbMF25) have been tentatively selected for use as starter cultures in the manufacture of artisanal fermented dairy products in Algeria. PMID:24031617

  16. Improving the yield and quality of DNA isolated from white-rot fungi.

    PubMed

    Kuhad, R C; Kapoor, R K; Lal, R

    2004-01-01

    A new simple method used to eliminate polysaccharides that cause problems during DNA isolation was established for 6 different white-rot fungi using 1% hexadecyltrimethylammonium bromide (CTAB) as wash buffer and followed by centrifugation. Variation in the DNA yield and quality was ascertained using precipitating agents, detergents and cell-wall-hydrolyzing chitinase. Considerable amount of exopolysaccharides from fungal biomass was removed with the use of 1% CTAB wash buffer followed by centrifugation. The DNA varied in terms of yield and quality. For the DNA extraction use of 2% SDS in extraction buffer worked best for Pycnoporus cinnabarinus, Cyathus bulleri, Cyathus striatus and Cyathus stercoreus, while 2% CTAB worked best for Phanerochaete chrysosporium and Pleurotus ostreatus. Elimination of phenol and use of absolute ethanol for precipitating DNA resulted in good yield and quality of DNA. This DNA was amenable to restriction endonuclease digestion.

  17. Colony-PCR Is a Rapid Method for DNA Amplification of Hyphomycetes

    PubMed Central

    Walch, Georg; Knapp, Maria; Rainer, Georg; Peintner, Ursula

    2016-01-01

    Fungal pure cultures identified with both classical morphological methods and through barcoding sequences are a basic requirement for reliable reference sequences in public databases. Improved techniques for an accelerated DNA barcode reference library construction will result in considerably improved sequence databases covering a wider taxonomic range. Fast, cheap, and reliable methods for obtaining DNA sequences from fungal isolates are, therefore, a valuable tool for the scientific community. Direct colony PCR was already successfully established for yeasts, but has not been evaluated for a wide range of anamorphic soil fungi up to now, and a direct amplification protocol for hyphomycetes without tissue pre-treatment has not been published so far. Here, we present a colony PCR technique directly from fungal hyphae without previous DNA extraction or other prior manipulation. Seven hundred eighty-eight fungal strains from 48 genera were tested with a success rate of 86%. PCR success varied considerably: DNA of fungi belonging to the genera Cladosporium, Geomyces, Fusarium, and Mortierella could be amplified with high success. DNA of soil-borne yeasts was always successfully amplified. Absidia, Mucor, Trichoderma, and Penicillium isolates had noticeably lower PCR success. PMID:29376929

  18. Genome-Wide Cell Type-Specific Mapping of In Vivo Chromatin Protein Binding Using an FLP-Inducible DamID System in Drosophila.

    PubMed

    Pindyurin, Alexey V

    2017-01-01

    A thorough study of the genome-wide binding patterns of chromatin proteins is essential for understanding the regulatory mechanisms of genomic processes in eukaryotic nuclei, including DNA replication, transcription, and repair. The DNA adenine methyltransferase identification (DamID) method is a powerful tool to identify genomic binding sites of chromatin proteins. This method does not require fixation of cells and the use of specific antibodies, and has been used to generate genome-wide binding maps of more than a hundred different proteins in Drosophila tissue culture cells. Recent versions of inducible DamID allow performing cell type-specific profiling of chromatin proteins even in small samples of Drosophila tissues that contain heterogeneous cell types. Importantly, with these methods sorting of cells of interest or their nuclei is not necessary as genomic DNA isolated from the whole tissue can be used as an input. Here, I describe in detail an FLP-inducible DamID method, namely generation of suitable transgenic flies, activation of the Dam transgenes by the FLP recombinase, isolation of DNA from small amounts of dissected tissues, and subsequent identification of the DNA binding sites of the chromatin proteins.

  19. Techniques for investigation of an apparent outbreak of infections with Candida glabrata.

    PubMed Central

    Arif, S; Barkham, T; Power, E G; Howell, S A

    1996-01-01

    A cluster of Candida glabrata isolates recovered from seven patients in an intensive care unit over a 10-week period were compared with a collection of isolates from six epidemiologically distinct outpatients and a reference strain by several DNA typing methods. Restriction enzyme analysis with HinII distinguished 13 strains from the 14 sources and was the method of choice. Pulsed-field gel electrophoresis and random amplification of polymorphic DNA both detected nine types from the 14 sources; however, the results of these two methods did not always correlate. These methods demonstrated that five of the seven patients had distinguishable strains and that cross-infection was unlikely. PMID:8862586

  20. Sequential cloning of chromosomes

    DOEpatents

    Lacks, Sanford A.

    1995-07-18

    A method for sequential cloning of chromosomal DNA of a target organism is disclosed. A first DNA segment homologous to the chromosomal DNA to be sequentially cloned is isolated. The first segment has a first restriction enzyme site on either side. A first vector product is formed by ligating the homologous segment into a suitably designed vector. The first vector product is circularly integrated into the target organism's chromosomal DNA. The resulting integrated chromosomal DNA segment includes the homologous DNA segment at either end of the integrated vector segment. The integrated chromosomal DNA is cleaved with a second restriction enzyme and ligated to form a vector-containing plasmid, which is replicated in a host organism. The replicated plasmid is then cleaved with the first restriction enzyme. Next, a DNA segment containing the vector and a segment of DNA homologous to a distal portion of the previously isolated DNA segment is isolated. This segment is then ligated to form a plasmid which is replicated within a suitable host. This plasmid is then circularly integrated into the target chromosomal DNA. The chromosomal DNA containing the circularly integrated vector is treated with a third, retrorestriction (class IIS) enzyme. The cleaved DNA is ligated to give a plasmid that is used to transform a host permissive for replication of its vector. The sequential cloning process continues by repeated cycles of circular integration and excision. The excision is carried out alternately with the second and third enzymes.

  1. Method for identifying mutagenic agents which induce large, multilocus deletions in DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bradley, W.E.C.; Belouchi, A.; Dewyse, P.

    1993-07-13

    A method of identifying a mutagenic agent is described which includes a large, multilocus deletions in DNA in mammalian cells comprising: (i) exposing a class III heterozygous CHO cell line to a potential mutagenic agent under investigation, and allowing any mutation of the cell line to proceed, said cell line being characterized in that a restriction fragment length variation exists in on mutation it becomes resistant to 2,6-diaminopurine and in that the DNA sequence adjacent to the two alleles of the APRT gene such that the DNA sequence adjacent to one of the two alleles can be digested with themore » enzyme BclI but the DNA sequence variation adjacent to the other of the two alleles cannot be digested with BclI, (ii) isolating induced mutations of the cell line deficient in APRT function, (iii) isolating DNA from the induced mutants, (iv) digesting the isolated DNA with BclI enzyme to produce digested fragments including a 19 kb fragment and any 2 kb fragment, which fragments hybridize with the labeled probe derived from DNA fragment PDI, (v) separating any digested fragments, (vi) transferring the separated fragments of (v) to a solid support, (vii) hybridizing the supported separated fragments with a labeled probe derived from the clone DNA fragment PD 1, (viii) determining fragments having undergone loss of the 2 kb band identified by the probe, as an identification of parent mutants in which the loss occurred, and (ix) evaluating the mutating ability of the potential mutagenic agent.« less

  2. Genotyping of Single Nucleotide Polymorphisms in DNA Isolated from Serum Using Sequenom MassARRAY Technology.

    PubMed

    Clendenen, Tess V; Rendleman, Justin; Ge, Wenzhen; Koenig, Karen L; Wirgin, Isaac; Currie, Diane; Shore, Roy E; Kirchhoff, Tomas; Zeleniuch-Jacquotte, Anne

    2015-01-01

    Large epidemiologic studies have the potential to make valuable contributions to the assessment of gene-environment interactions because they prospectively collected detailed exposure data. Some of these studies, however, have only serum or plasma samples as a low quantity source of DNA. We examined whether DNA isolated from serum can be used to reliably and accurately genotype single nucleotide polymorphisms (SNPs) using Sequenom multiplex SNP genotyping technology. We genotyped 81 SNPs using samples from 158 participants in the NYU Women's Health Study. Each participant had DNA from serum and at least one paired DNA sample isolated from a high quality source of DNA, i.e. clots and/or cell precipitates, for comparison. We observed that 60 of the 81 SNPs (74%) had high call frequencies (≥95%) using DNA from serum, only slightly lower than the 85% of SNPs with high call frequencies in DNA from clots or cell precipitates. Of the 57 SNPs with high call frequencies for serum, clot, and cell precipitate DNA, 54 (95%) had highly concordant (>98%) genotype calls across all three sample types. High purity was not a critical factor to successful genotyping. Our results suggest that this multiplex SNP genotyping method can be used reliably on DNA from serum in large-scale epidemiologic studies.

  3. A Simple Method for the Extraction, PCR-amplification, Cloning, and Sequencing of Pasteuria 16S rDNA from Small Numbers of Endospores.

    PubMed

    Atibalentja, N; Noel, G R; Ciancio, A

    2004-03-01

    For many years the taxonomy of the genus Pasteuria has been marred with confusion because the bacterium could not be cultured in vitro and, therefore, descriptions were based solely on morphological, developmental, and pathological characteristics. The current study sought to devise a simple method for PCR-amplification, cloning, and sequencing of Pasteuria 16S rDNA from small numbers of endospores, with no need for prior DNA purification. Results show that DNA extracts from plain glass bead-beating of crude suspensions containing 10,000 endospores at 0.2 x 10 endospores ml(-1) were sufficient for PCR-amplification of Pasteuria 16S rDNA, when used in conjunction with specific primers. These results imply that for P. penetrans and P. nishizawae only one parasitized female of Meloidogyne spp. and Heterodera glycines, respectively, should be sufficient, and as few as eight cadavers of Belonolaimus longicaudatus with an average number of 1,250 endospores of "Candidatus Pasteuria usgae" are needed for PCR-amplification of Pasteuria 16S rDNA. The method described in this paper should facilitate the sequencing of the 16S rDNA of the many Pasteuria isolates that have been reported on nematodes and, consequently, expedite the classification of those isolates through comparative sequence analysis.

  4. Diversity, molecular phylogeny and fingerprint profiles of airborne Aspergillus species using random amplified polymorphic DNA.

    PubMed

    Kermani, Firoozeh; Shams-Ghahfarokhi, Masoomeh; Gholami-Shabani, Mohammadhassan; Razzaghi-Abyaneh, Mehdi

    2016-06-01

    In the present study, diversity and phylogenetic relationship of Aspergillus species isolated from Tehran air was studied using random amplified polymorphic DNA (RAPD)-polymerase chain reaction (RAPD-PCR). Thirty-eight Aspergillus isolates belonging to 12 species i.e. A. niger (28.94 %, 11 isolates), A. flavus (18.42 %, 7 isolates), A. tubingensis (13.15 %, 5 isolates), A. japonicus (10.52 %, 4 isolates), A. ochraceus (10.52 %, 4 isolates), and 2.63 %, 1 isolate from each A. nidulans, A. amstelodami, A. oryzae, A. terreus, A. versicolor, A. flavipes and A. fumigatus were obtained by settle plate method which they were distributed in 18 out of 22 sampling sites examined. Fungal DNA was extracted from cultured mycelia of all Aspergillus isolates on Sabouraud Dextrose Agar and used for amplification of gene fragments in RAPD-PCR using 11 primers. RAPD-PCR data was analyzed using UPGMA software. Resulting dendrogram of combined selected primers including PM1, OPW-04, OPW-05, P160, P54, P10 and OPA14 indicated the distribution of 12 Aspergillus species in 8 major clusters. The similarity coefficient of all 38 Aspergillus isolates ranged from 0.02 to 0.40 indicating a wide degree of similarities and differences within and between species. Taken together, our results showed that various Aspergillus species including some important human pathogenic ones exist in the outdoor air of Tehran by different extents in distribution and diversity and suggested inter- and intra-species genetic diversity among Aspergillus species by RAPD-PCR as a rapid, sensitive and reproducible method.

  5. Combined subtraction hybridization and polymerase chain reaction amplification procedure for isolation of strain-specific Rhizobium DNA sequences.

    PubMed Central

    Bjourson, A J; Stone, C E; Cooper, J E

    1992-01-01

    A novel subtraction hybridization procedure, incorporating a combination of four separation strategies, was developed to isolate unique DNA sequences from a strain of Rhizobium leguminosarum bv. trifolii. Sau3A-digested DNA from this strain, i.e., the probe strain, was ligated to a linker and hybridized in solution with an excess of pooled subtracter DNA from seven other strains of the same biovar which had been restricted, ligated to a different, biotinylated, subtracter-specific linker, and amplified by polymerase chain reaction to incorporate dUTP. Subtracter DNA and subtracter-probe hybrids were removed by phenol-chloroform extraction of a streptavidin-biotin-DNA complex. NENSORB chromatography of the sequences remaining in the aqueous layer captured biotinylated subtracter DNA which may have escaped removal by phenol-chloroform treatment. Any traces of contaminating subtracter DNA were removed by digestion with uracil DNA glycosylase. Finally, remaining sequences were amplified by polymerase chain reaction with a probe strain-specific primer, labelled with 32P, and tested for specificity in dot blot hybridizations against total genomic target DNA from each strain in the subtracter pool. Two rounds of subtraction-amplification were sufficient to remove cross-hybridizing sequences and to give a probe which hybridized only with homologous target DNA. The method is applicable to the isolation of DNA and RNA sequences from both procaryotic and eucaryotic cells. Images PMID:1637166

  6. Luciferase genes cloned from the unculturable luminous bacteroid symbiont of the Caribbean flashlight fish, Kryptophanaron alfredi.

    PubMed

    Haygood, M G; Cohn, D H

    1986-01-01

    Light organs of anomalopid (flashlight) fish contain luminous bacteroids that have never been cultured and, consequently, have been difficult to study. We have characterized the luciferase (lux) region of DNA extracted from light organs of the Caribbean flashlight fish Kryptophanaron alfredi by hybridization of cloned Vibrio harveyi lux genes to restriction-endonuclease-digested, light organ DNA. Comparison of the hybridization pattern of light organ DNA with that of DNA of a putative symbiotic isolate provides a method for identifying the authentic luminous symbiont regardless of its luminescence, and was used to reject one such isolate. Light organ DNA was further used to construct a cosmid clone bank and the luciferase genes were isolated. Unlike other bacterial luciferase genes, the genes were not expressed in Escherichia coli. When placed under the control of the E. coli trp promoter, the genes were transcribed but no luciferase was detected, suggesting a posttranscriptional block to expression.

  7. Method for isolating chromosomal DNA in preparation for hybridization in suspension

    DOEpatents

    Lucas, Joe N.

    2000-01-01

    A method is provided for detecting nucleic acid sequence aberrations using two immobilization steps. According to the method, a nucleic acid sequence aberration is detected by detecting nucleic acid sequences having both a first nucleic acid sequence type (e.g., from a first chromosome) and a second nucleic acid sequence type (e.g., from a second chromosome), the presence of the first and the second nucleic acid sequence type on the same nucleic acid sequence indicating the presence of a nucleic acid sequence aberration. In the method, immobilization of a first hybridization probe is used to isolate a first set of nucleic acids in the sample which contain the first nucleic acid sequence type. Immobilization of a second hybridization probe is then used to isolate a second set of nucleic acids from within the first set of nucleic acids which contain the second nucleic acid sequence type. The second set of nucleic acids are then detected, their presence indicating the presence of a nucleic acid sequence aberration. Chromosomal DNA in a sample containing cell debris is prepared for hybridization in suspension by treating the mixture with RNase. The treated DNA can also be fixed prior to hybridization.

  8. RAPD- and ERIC-Based Typing of Clinical and Environmental Pseudomonas aeruginosa Isolates.

    PubMed

    Auda, Ibtesam Ghadban; Al-Kadmy, Israa M S; Kareem, Sawsan Mohammed; Lafta, Aliaa Khyuon; A'Affus, Mustafa Hussein Obeid; Khit, Ibrahim Abd Aloahd; Al Kheraif, Abdulaziz Abdullah; Divakar, Darshan Devang; Ramakrishnaiah, Ravikumar

    2017-03-01

    Pseudomonas aeruginosa is a major cause of nosocomial infection in children and adults, resulting in significant morbidity and mortality due to its ability to acquire drug resistance. The ability of P. aeruginosa in the environment to cause infection in individuals has been reported previously; henceforth, surveillance of the emergence and transmission of P. aeruginosa strains among patients is important for infection control in a clinical setup. Various gene-typing methods have been used for epidemiological typing of P. aeruginosa isolates for the purpose of surveillance. In this work, the suitability and comparability of two typing methods, enterobacterial repetitive intergenic consensus (ERIC)-PCR and random amplification of polymorphic DNA (RAPD)-PCR fingerprinting, were studied to characterize P. aeruginosa strains isolated from clinical and environmental sources. Forty-four clinical and environmental bacterial isolates of P. aeruginosa were collected between October 2015 and January 2016. DNA extraction, ERIC-PCR and RAPD-PCR, agarose gel electrophoresis, and phylogenetic analyses were carried using the unweighted pair-group method with mean. RAPD typing revealed less clonality among clinical isolates, whereas the ERIC method showed greater similarity in comparison with RAPD. Environmental isolates, however, showed greater similarity using RAPD compared with ERIC typing. With only a few exceptions, most clinical isolates were distinct from environmental isolates, irrespective of the typing method. In conclusion, both the RAPD and ERIC typing methods proved to be good tools in understanding clonal diversity. The results also suggest that there is no relationship between clinical and environmental isolates. The absence of clonality among the clinical isolates may indicate that most P. aeruginosa infection cases could be endemic and not epidemic and that endemic infections may be due to nonclonal strains of P. aeruginosa.

  9. New evidence that a large proportion of human blood plasma cell-free DNA is localized in exosomes

    PubMed Central

    Jiang, Chao; Krzyzanowski, Gary D.; Ryan, Wayne L.

    2017-01-01

    Cell-free DNA (cfDNA) in blood is used as a source of genetic material for noninvasive prenatal and cancer diagnostic assays in clinical practice. Recently we have started a project for new biomarker discovery with a view to developing new noninvasive diagnostic assays. While reviewing literature, it was found that exosomes may be a rich source of biomarkers, because exosomes play an important role in human health and disease. While characterizing exosomes found in human blood plasma, we observed the presence of cfDNA in plasma exosomes. Plasma was obtained from blood drawn into K3EDTA tubes. Exosomes were isolated from cell-free plasma using a commercially available kit. Sizing and enumeration of exosomes were done using electron microscopy and NanoSight particle counter. NanoSight and confocal microscopy was used to demonstrate the association between dsDNA and exosomes. DNA extracted from plasma and exosomes was measured by a fluorometric method and a droplet digital PCR (ddPCR) method. Size of extracellular vesicles isolated from plasma was heterogeneous and showed a mean value of 92.6 nm and a mode 39.7 nm. A large proportion of extracellular vesicles isolated from plasma were identified as exosomes using a fluorescence probe specific for exosomes and three protein markers, Hsp70, CD9 and CD63, that are commonly used to identify exosome fraction. Fluorescence dye that stain dsDNA showed the association between exosomes and dsDNA. Plasma cfDNA concentration analysis showed more than 93% of amplifiable cfDNA in plasma is located in plasma exosomes. Storage of a blood sample showed significant increases in exosome count and exosome DNA concentration. This study provide evidence that a large proportion of plasma cfDNA is localized in exosomes. Exosome release from cells is a metabolic energy dependent process, thus suggesting active release of cfDNA from cells as a source of cfDNA in plasma. PMID:28850588

  10. New evidence that a large proportion of human blood plasma cell-free DNA is localized in exosomes.

    PubMed

    Fernando, M Rohan; Jiang, Chao; Krzyzanowski, Gary D; Ryan, Wayne L

    2017-01-01

    Cell-free DNA (cfDNA) in blood is used as a source of genetic material for noninvasive prenatal and cancer diagnostic assays in clinical practice. Recently we have started a project for new biomarker discovery with a view to developing new noninvasive diagnostic assays. While reviewing literature, it was found that exosomes may be a rich source of biomarkers, because exosomes play an important role in human health and disease. While characterizing exosomes found in human blood plasma, we observed the presence of cfDNA in plasma exosomes. Plasma was obtained from blood drawn into K3EDTA tubes. Exosomes were isolated from cell-free plasma using a commercially available kit. Sizing and enumeration of exosomes were done using electron microscopy and NanoSight particle counter. NanoSight and confocal microscopy was used to demonstrate the association between dsDNA and exosomes. DNA extracted from plasma and exosomes was measured by a fluorometric method and a droplet digital PCR (ddPCR) method. Size of extracellular vesicles isolated from plasma was heterogeneous and showed a mean value of 92.6 nm and a mode 39.7 nm. A large proportion of extracellular vesicles isolated from plasma were identified as exosomes using a fluorescence probe specific for exosomes and three protein markers, Hsp70, CD9 and CD63, that are commonly used to identify exosome fraction. Fluorescence dye that stain dsDNA showed the association between exosomes and dsDNA. Plasma cfDNA concentration analysis showed more than 93% of amplifiable cfDNA in plasma is located in plasma exosomes. Storage of a blood sample showed significant increases in exosome count and exosome DNA concentration. This study provide evidence that a large proportion of plasma cfDNA is localized in exosomes. Exosome release from cells is a metabolic energy dependent process, thus suggesting active release of cfDNA from cells as a source of cfDNA in plasma.

  11. Isolation And Partial Characterization Of Bacteria Activity Associated With Gorgonian Euplexaura sp. Against Methicillin-Resistant Staphylococcus aureus (MRSA)

    NASA Astrophysics Data System (ADS)

    Kristiana, R.; Ayuningrum, D.; Asagabaldan, M. A.; Nuryadi, H.; Sabdono, A.; Radjasa, O. K.; Trianto, A.

    2017-02-01

    Methicillin-resistant Staphylococcus aureus (MRSA) infection has emerged in around the world and has been resistance to ciprofloxacin, erythromycin, clindamycin. The aims of this study were to isolate, to investigate and to characterize bacterial symbionts gorgonian having activity against MRSA. Euplexaura sp. was collected from Panjang Island, Jepara, Indonesia by snorkling 2-5 m in depth. Bacterias were isolated by using spesific media with dilution method. Bacterias were conducted by using the streak method. Antibacterial activity was investigated by overlay method. The potent bacteria was identified by using molecular identification (DNA extraction, electrophoresis, PCR and phylogenetic analysis using 16S rDNA genes with actinobacteria-spesific primers) and bio-chemical test (among 5 isolated bacteria from gorgonian showed activity against MRSA). The strain PG-344 was the best candidat that has an inhibition zone against MRSA. The result of sequencing bacteria is 100% closely related with Virgibacillus salarius. This becomes a potential new bioactive compounds to against MRSA that can be a new drug discovery.

  12. A Versatile Nanowire Platform for Highly Efficient Isolation and Direct PCR-free Colorimetric Detection of Human Papillomavirus DNA from Unprocessed Urine

    PubMed Central

    Lee, HyungJae; Choi, Mihye; Hwang, Sang-Hyun; Cho, Youngnam

    2018-01-01

    Purpose: As human papillomavirus (HPV) is primarily responsible for the development of cervical cancer, significant efforts have been devoted to develop novel strategies for detecting and identifying HPV DNA in urine. The analysis of target DNA sequences in urine offers a potential alternative to conventional methods as a non-invasive clinical screening and diagnostic assessment tool for the detection of HPV. However, the lack of efficient approaches to isolate and directly detect HPV DNA in urine has restricted its potential clinical use. In this study, we demonstrated a novel approach of using polyethylenimine-conjugated magnetic polypyrrole nanowires (PEI-mPpy NWs) for the extraction, identification, and PCR-free colorimetric detection of high-risk strains of HPV DNA sequences, particularly HPV-16 and HPV-18, in urine specimens of cervical cancer patients. Materials and Methods: We fabricated and characterized polyethylenimine-conjugated magnetic nanowires (PEI/mPpy NWs). PEI/mPpy NWs-based HPV DNA isolation and detection strategy appears to be a cost-effective and practical technology with greater sensitivity and accuracy than other urine-based methods. Results: The analytical and clinical performance of PEI-mPpy NWs was evaluated and compared with those of cervical swabs, demonstrating a superior type-specific concordance rate of 100% between urine and cervical swabs, even when using a small volume of urine (300 µL). Conclusion: We envision that PEI-mPpy NWs provide substantive evidence for clinical diagnosis and management of HPV-associated disease with their excellent performance in the recovery and detection of HPV DNA from minimal amounts of urine samples. PMID:29290816

  13. The usefulness of DNA sequencing after extraction by Whatman FTA filter matrix technology and phenotypic tests for differentiation of Candida albicans and Candida dubliniensis.

    PubMed

    Kiraz, Nuri; Oz, Yasemin; Aslan, Huseyin; Muslumanoglu, Hamza

    2014-02-01

    Since C. dubliniensis is similar to C. albicans phenotypically, it can be misidentified as C. albicans. We aimed to investigate the prevalence of C. dubliniensis among isolates previously identified as C. albicans in our stocks and to compare the phenotypic methods and DNA sequencing of D1/D2 region on the ribosomal large subunit (rLSU) gene. A total of 850 isolates included in this study. Phenotypic identification was performed based on germ tube formation, chlamydospore production, colony colors on chromogenic agar, inability of growth at 45 °C and growth on hypertonic Sabouraud dextrose agar. Eighty isolates compatible with C. dubliniensis by at least one phenotypic test were included in the sequence analysis. Nested PCR amplification of D1/D2 region of the rLSU gene was performed after the fungal DNA extraction by Whatman FTA filter paper technology. The sequencing analysis of PCR products carried out by an automated capillary gel electrophoresis device. The rate of C. dubliniensis was 2.35 % (n = 20) among isolates previously described as C. albicans. Consequently, none of the phenotypic tests provided satisfactory performance alone in our study, and molecular methods required special equipment and high cost. Thus, at least two phenotypic methods can be used for identification of C. dubliniensis, and molecular methods can be used for confirmation.

  14. [Validation of Differential Extraction Kit in forensic sexual assault cases].

    PubMed

    Wu, Dan; Cao, Yu; Xu, Yan; He, Bai-Fang; Bi, Gang; Zhou, Huai-Gu

    2009-12-01

    To evaluate the validity of Differential Extraction Kit in isolating spermatozoa and epithelial cell DNA from mixture samples. Selective lysis of spermatid and epithelial cells combined with paramagnetic particle method were applied to extract the DNA from the mock samples under controlled conditions and forensic case samples, and template DNA were analyzed by STR genotype method. This Differential Extraction Kit is efficient to obtain high quality spermatid and epithelial cell DNA from the mixture samples with different proportion of sperm to epithelial cell. The Differential Extraction Kit can be applied in DNA extraction for mixed stain from forensic sexual assault samples.

  15. Comparison of dkgB-linked intergenic sequence ribotyping to DNA microarray hybridization for assigning serotype to Salmonella enterica

    PubMed Central

    Guard, Jean; Sanchez-Ingunza, Roxana; Morales, Cesar; Stewart, Tod; Liljebjelke, Karen; Kessel, JoAnn; Ingram, Kim; Jones, Deana; Jackson, Charlene; Fedorka-Cray, Paula; Frye, Jonathan; Gast, Richard; Hinton, Arthur

    2012-01-01

    Two DNA-based methods were compared for the ability to assign serotype to 139 isolates of Salmonella enterica ssp. I. Intergenic sequence ribotyping (ISR) evaluated single nucleotide polymorphisms occurring in a 5S ribosomal gene region and flanking sequences bordering the gene dkgB. A DNA microarray hybridization method that assessed the presence and the absence of sets of genes was the second method. Serotype was assigned for 128 (92.1%) of submissions by the two DNA methods. ISR detected mixtures of serotypes within single colonies and it cost substantially less than Kauffmann–White serotyping and DNA microarray hybridization. Decreasing the cost of serotyping S. enterica while maintaining reliability may encourage routine testing and research. PMID:22998607

  16. Robust and effective methodologies for cryopreservation and DNA extraction from anaerobic gut fungi.

    PubMed

    Solomon, Kevin V; Henske, John K; Theodorou, Michael K; O'Malley, Michelle A

    2016-04-01

    Cell storage and DNA isolation are essential to developing an expanded suite of microorganisms for biotechnology. However, many features of non-model microbes, such as an anaerobic lifestyle and rigid cell wall, present formidable challenges to creating strain repositories and extracting high quality genomic DNA. Here, we establish accessible, high efficiency, and robust techniques to store lignocellulolytic anaerobic gut fungi long term without specialized equipment. Using glycerol as a cryoprotectant, gut fungal isolates were preserved for a minimum of 23 months at -80 °C. Unlike previously reported approaches, this improved protocol is non-toxic and rapid, with samples surviving twice as long with negligible growth impact. Genomic DNA extraction for these isolates was optimized to yield samples compatible with next generation sequencing platforms (e.g. Illumina, PacBio). Popular DNA isolation kits and precipitation protocols yielded preps that were unsuitable for sequencing due to carbohydrate contaminants from the chitin-rich cell wall and extensive energy reserves of gut fungi. To address this, we identified a proprietary method optimized for hardy plant samples that rapidly yielded DNA fragments in excess of 10 kb with minimal RNA, protein or carbohydrate contamination. Collectively, these techniques serve as fundamental tools to manipulate powerful biomass-degrading gut fungi and improve their accessibility among researchers. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Comparison of pulsed-field gel electrophoresis and enterobacterial repetitive intergenic consensus PCR and biochemical tests to characterize Lactococcus garvieae.

    PubMed

    Ture, M; Altinok, I; Capkin, E

    2015-01-01

    Biochemical test, pulsed-field gel electrophoresis (PFGE) and enterobacterial repetitive intergenic consensus sequence PCR (ERIC-PCR) were used to compare 42 strains of Lactococcus garvieae isolated from different regions of Turkey, Italy, France and Spain. Twenty biotypes of L. garvieae were formed based on 54 biochemical tests. ERIC-PCR of genomic DNA from different L. garvieae strains resulted in amplification of multiple fragments of DNA in sizes ranging between 200 and 5000 bp with various band intensities. After cutting DNA with ApaI restriction enzyme and running on the PFGE, 11–22 resolvable bands ranging from 2 to 194 kb were observed. Turkish isolates were grouped into two clusters, and only A58 (Italy) strain was connected with Turkish isolates. Similarities between Turkish, Spanish, Italian and French isolates were <50% except 216-6 Rize strain. In Turkey, first lactococcosis occurred in Mugla, and then, it has been spread all over the country. Based on ERIC-PCR, Spanish and Italian strains of L. garvieae were related to Mugla strains. Therefore, after comparing PFGE profiles, ERIC-PCR profiles and phenotypic characteristics of 42 strains of L. garvieae, there were no relationships found between these three typing methods. PFGE method was more discriminative than the other methods. © 2014 John Wiley & Sons Ltd.

  18. Where is DNA preserved in soil organic matter?

    NASA Astrophysics Data System (ADS)

    Zaccone, Claudio; Beneduce, Luciano; Plaza, César

    2015-04-01

    Deoxyribonucleic acid (DNA) consists of long chains of alternating sugar and phosphate residues twisted in the form of a helix. Upon decomposition of plant and animal debris, this nucleic acid is released into the soil, where its fate is still not completely understood. In fact, although DNA is one of the organic compounds from living cells that is apparently broken down rapidly in soils, it is also potentially capable of being incorporated in (or interact with) the precursors of humic molecules. In order to track DNA occurrence in soil organic matter (SOM) fractions, an experiment was set up as a randomized complete block design with two factors, namely biochar addition and organic amendment. In particular, biochar (BC), applied at a rate of 20 t/ha, was combined with municipal solid waste compost (BC+MC) at a rate equivalent to 75 kg/ha of potentially available N, and with sewage sludge (BC+SS) at a rate equivalent to 75 kg/ha of potentially available N. Using a physical fractionation method, free SOM located between aggregates (unprotected C pool; FR), SOM occluded within macroaggregates (C pool weakly protected by physical mechanisms; MA), SOM occluded within microaggregates (C pool strongly protected by physical mechanisms; MI), and SOM associated with the mineral fractions (chemically-protected C pool; MIN) were separated from soil samples. DNA was then isolated from each fraction of the two series, as well as from the unamended soil (C) and from the bulk soils (WS), using Powersoil DNA isolation kit (MoBio, CA, USA) with a modified protocol. Data clearly show that the DNA survived the SOM fractionation, thus suggesting that physical fractionation methods create less artifacts compared to the chemical ones. Moreover, in both BC+MC and BC+SS series, most of the isolated DNA was present in the FR fraction, followed by the MA and the MI fractions. No DNA was recovered from the MIN fraction. This finding supports the idea that most of the DNA occurring in the SOM is unprotected or physically protected, with a short-to-medium mean residence time. Finally, the DNA isolated showed, in all cases, an acceptable level of degradation that makes it suitable for further analyses by PCR.

  19. Comparative genotyping of Clostridium thermocellum strains isolated from biogas plants: genetic markers and characterization of cellulolytic potential.

    PubMed

    Koeck, Daniela E; Zverlov, Vladimir V; Liebl, Wolfgang; Schwarz, Wolfgang H

    2014-07-01

    Clostridium thermocellum is among the most prevalent of known anaerobic cellulolytic bacteria. In this study, genetic and phenotypic variations among C. thermocellum strains isolated from different biogas plants were determined and different genotyping methods were evaluated on these isolates. At least two C. thermocellum strains were isolated independently from each of nine different biogas plants via enrichment on cellulose. Various DNA-based genotyping methods such as ribotyping, RAPD (Random Amplified Polymorphic DNA) and VNTR (Variable Number of Tandem Repeats) were applied to these isolates. One novel approach - the amplification of unknown target sequences between copies of a previously discovered Random Inserted Mobile Element (RIME) - was also tested. The genotyping method with the highest discriminatory power was found to be the amplification of the sequences between the insertion elements, where isolates from each biogas plant yielded a different band pattern. Cellulolytic potentials, optimal growth conditions and substrate spectra of all isolates were characterized to help identify phenotypic variations. Irrespective of the genotyping method used, the isolates from each individual biogas plant always exhibited identical patterns. This is suggestive of a single C. thermocellum strain exhibiting dominance in each biogas plant. The genotypic groups reflect the results of the physiological characterization of the isolates like substrate diversity and cellulase activity. Conversely, strains isolated across a range of biogas plants differed in their genotyping results and physiological properties. Both strains isolated from one biogas plant had the best specific cellulose-degrading properties and might therefore achieve superior substrate utilization yields in biogas fermenters. Copyright © 2014 Elsevier GmbH. All rights reserved.

  20. Molecular Identification and Databases in Fusarium

    USDA-ARS?s Scientific Manuscript database

    DNA sequence-based methods for identifying pathogenic and mycotoxigenic Fusarium isolates have become the gold standard worldwide. Moreover, fusarial DNA sequence data are increasing rapidly in several web-accessible databases for comparative purposes. Unfortunately, the use of Basic Alignment Sea...

  1. Microchip method for the enrichment of specific DNA sequences

    DOEpatents

    Mirzabekov, A.D.; Lysov, Y.P.; Shick, V.V.; Dubiley, S.A.

    1998-12-22

    A method for enriching specific genetic material sequences is provided, whereby oligonucleotide molecules complementary to the desired genetic material is first used to isolate the genetic material from a first source of genomic material. Then the genetic material is used as a label to isolate similar genetic sequences from other sources. 4 figs.

  2. Microchip method for the enrichment of specific DNA sequences

    DOEpatents

    Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Shick, Valentine Vladimirovich; Dubiley, Svetlana Alekseevna

    1998-01-01

    A method for enriching specific genetic material sequences is provided, whereby oligonucleotide molecules complementary to the desired genetic material is first used to isolate the genetic material from a first source of genomic material. Then the genetic material is used as a label to isolate similar genetic sequences from other sources.

  3. Systematic cloning of human minisatellites from ordered array charomid libraries.

    PubMed

    Armour, J A; Povey, S; Jeremiah, S; Jeffreys, A J

    1990-11-01

    We present a rapid and efficient method for the isolation of minisatellite loci from human DNA. The method combines cloning a size-selected fraction of human MboI DNA fragments in a charomid vector with hybridization screening of the library in ordered array. Size-selection of large MboI fragments enriches for the longer, more variable minisatellites and reduces the size of the library required. The library was screened with a series of multi-locus probes known to detect a large number of hypervariable loci in human DNA. The gridded library allowed both the rapid processing of positive clones and the comparative evaluation of the different multi-locus probes used, in terms of both the relative success in detecting hypervariable loci and the degree of overlap between the sets of loci detected. We report 23 new human minisatellite loci isolated by this method, which map to 14 autosomes and the sex chromosomes.

  4. Isolation and characterization of 5S rDNA sequences in catfishes genome (Heptapteridae and Pseudopimelodidae): perspectives for rDNA studies in fish by C0t method.

    PubMed

    Gouveia, Juceli Gonzalez; Wolf, Ivan Rodrigo; de Moraes-Manécolo, Vivian Patrícia Oliveira; Bardella, Vanessa Belline; Ferracin, Lara Munique; Giuliano-Caetano, Lucia; da Rosa, Renata; Dias, Ana Lúcia

    2016-12-01

    Sequences of 5S ribosomal RNA (rRNA) are extensively used in fish cytogenomic studies, once they have a flexible organization at the chromosomal level, showing inter- and intra-specific variation in number and position in karyotypes. Sequences from the genome of Imparfinis schubarti (Heptapteridae) were isolated, aiming to understand the organization of 5S rDNA families in the fish genome. The isolation of 5S rDNA from the genome of I. schubarti was carried out by reassociation kinetics (C 0 t) and PCR amplification. The obtained sequences were cloned for the construction of a micro-library. The obtained clones were sequenced and hybridized in I. schubarti and Microglanis cottoides (Pseudopimelodidae) for chromosome mapping. An analysis of the sequence alignments with other fish groups was accomplished. Both methods were effective when using 5S rDNA for hybridization in I. schubarti genome. However, the C 0 t method enabled the use of a complete 5S rRNA gene, which was also successful in the hybridization of M. cottoides. Nevertheless, this gene was obtained only partially by PCR. The hybridization results and sequence analyses showed that intact 5S regions are more appropriate for the probe operation, due to conserved structure and motifs. This study contributes to a better understanding of the organization of multigene families in catfish's genomes.

  5. Isolation of bioactive and other oxoaporphine alkaloids from two annonaceous plants, Xylopia aethiopica and Miliusa cf. banacea.

    PubMed

    Harrigan, G G; Gunatilaka, A A; Kingston, D G; Chan, G W; Johnson, R K

    1994-01-01

    The oxoaporphine alkaloids oxophoebine [1] and liriodenine [2] have been isolated from Xylopia aethiopica (Annonaceae). Both showed selective toxicity against DNA repair and recombination deficient mutants of the yeast Saccharomyces cerevisae. Three related but inactive compounds, oxoglaucine [3], O-methylmoschatoline [4], and lysicamine [5], were also isolated from this plant. Selective toxicity was also observed for 10-methoxyliriodenine (lauterine) [6] and 10-hydroxyliriodenine [7], two oxoaporphine alkaloids isolated from Miliusa cf. banacea (Annonaceae). The structure of 10-hydroxyliriodenine [7], a novel oxoaporphine, was determined by spectroscopic methods and chemical conversion to compound 6. The role of the bioactive oxoaporphine alkaloids as DNA topoisomerase inhibitors is discussed.

  6. Sequential cloning of chromosomes

    DOEpatents

    Lacks, S.A.

    1995-07-18

    A method for sequential cloning of chromosomal DNA of a target organism is disclosed. A first DNA segment homologous to the chromosomal DNA to be sequentially cloned is isolated. The first segment has a first restriction enzyme site on either side. A first vector product is formed by ligating the homologous segment into a suitably designed vector. The first vector product is circularly integrated into the target organism`s chromosomal DNA. The resulting integrated chromosomal DNA segment includes the homologous DNA segment at either end of the integrated vector segment. The integrated chromosomal DNA is cleaved with a second restriction enzyme and ligated to form a vector-containing plasmid, which is replicated in a host organism. The replicated plasmid is then cleaved with the first restriction enzyme. Next, a DNA segment containing the vector and a segment of DNA homologous to a distal portion of the previously isolated DNA segment is isolated. This segment is then ligated to form a plasmid which is replicated within a suitable host. This plasmid is then circularly integrated into the target chromosomal DNA. The chromosomal DNA containing the circularly integrated vector is treated with a third, retrorestriction (class IIS) enzyme. The cleaved DNA is ligated to give a plasmid that is used to transform a host permissive for replication of its vector. The sequential cloning process continues by repeated cycles of circular integration and excision. The excision is carried out alternately with the second and third enzymes. 9 figs.

  7. Candida Species From Eye Infections: Drug Susceptibility, Virulence Factors, and Molecular Characterization.

    PubMed

    Ranjith, Konduri; Sontam, Bhavani; Sharma, Savitri; Joseph, Joveeta; Chathoth, Kanchana N; Sama, Kalyana C; Murthy, Somasheila I; Shivaji, Sisinthy

    2017-08-01

    To determine the type of Candida species in ocular infections and to investigate the relationship of antifungal susceptibility profile to virulence factors. Fifty isolates of yeast-like fungi from patients with keratitis, endophthalmitis, and orbital cellulitis were identified by Vitek-2 compact system and DNA sequencing of ITS1-5.8S-ITS2 regions of the rRNA gene, followed by phylogenetic analysis for phenotypic and genotypic identification, respectively. Minimum inhibitory concentration of six antifungal drugs was determined by E test/microbroth dilution methods. Phenotypic and genotypic methods were used to determine the virulence factors. Phylogenetic analysis showed the clustering of all isolates into eight distinct groups with a major cluster formed Candida parapsilosis (n = 21), which was the most common species by both Vitek 2 and DNA sequencing. Using χ2 test no significant difference was noted between the techniques except that Vitek 2 did not identify C. viswanathii, C. orthopsilosis, and two non-Candida genera. Of 43 tested Candida isolates high susceptibility to amphotericin B (39/43, 90.6%) and natamycin (43/43, 100%) was noted. While none of the isolates produced coagulase, all produced esterase and catalase. The potential to form biofilm was detected in 23/43 (53.4%) isolates. Distribution of virulence factors by heat map analysis showed difference in metabolic activity of biofilm producers from nonbiofilm producers. Identified by Vitek 2 and DNA sequencing methods C. parapsilosis was the most common species associated with eye infections. Irrespective of the virulence factors elaborated, the Candida isolates were susceptible to commonly used antifungal drugs such as amphotericin B and natamycin.

  8. Isolation and purification of recombinant proteins, antibodies and plasmid DNA with hydroxyapatite chromatography.

    PubMed

    Hilbrig, Frank; Freitag, Ruth

    2012-01-01

    Hydroxyapatite and related stationary phases increasingly play a role in the downstream processing of high-value biological materials, such as recombinant proteins, therapeutic antibodies and pharmaceutical-grade plasmid DNA. Chromatographic hydroxyapatite is an inorganic, ceramic material identical in composition, if not in structure, to calcium phosphate found in human bones and teeth. The interaction of hydroxyapatite with biomacromolecules is complex and highly dynamic, which can make predicting performance difficult, but also allows the design of very selective isolation processes. This review discusses the currently commercially available chromatographic materials, different retention mechanisms supported by these materials and differential exploitation for the design of highly specific isolation procedures. The state of the art of antibody purification by hydroxy- and fluoroapatite is reviewed together with tested routines for method development and implementation. Finally, the isolation of plasmid DNA is discussed, since the purification of DNA therapeutics at a sufficiently large scale is an emerging need in bioprocess development and perhaps the area in bioseparation where apatite chromatography can make its most important contribution to date. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Methods and Devices for Micro-Isolation, Extraction, and/or Analysis of Microscale Components

    NASA Technical Reports Server (NTRS)

    Wade, Lawrence A. (Inventor); Kartalov, Emil P. (Inventor); Taylor, Clive (Inventor); Shibata, Darryl (Inventor)

    2014-01-01

    Provided herein are devices and methods for the micro-isolation of biological cellular material. A micro-isolation apparatus described can comprise a photomask that protects regions of interest against DNA-destroying illumination. The micro-isolation apparatus can further comprise photosensitive material defining access wells following illumination and subsequent developing of the photosensitive material. The micro-isolation apparatus can further comprise a chambered microfluidic device comprising channels providing access to wells defined in photosensitive material. The micro-isolation apparatus can comprise a chambered microfluidic device without access wells defined in photosensitive material where valves control the flow of gases or liquids through the channels of the microfluidic device. Also included are methods for selectively isolating cellular material using the apparatuses described herein, as are methods for biochemical analysis of individual regions of interest of cellular material using the devices described herein. Further included are methods of making masking arrays useful for the methods described herein.

  10. Detection of Pseudomonas savastanoi pv. savastanoi in olive plants by enrichment and PCR.

    PubMed

    Penyalver, R; García, A; Ferrer, A; Bertolini, E; López, M M

    2000-06-01

    The sequence of the gene iaaL of Pseudomonas savastanoi EW2009 was used to design primers for PCR amplification. The iaaL-derived primers directed the amplification of a 454-bp fragment from genomic DNA isolated from 70 strains of P. savastanoi, whereas genomic DNA from 93 non-P. savastanoi isolates did not yield this amplified product. A previous bacterial enrichment in the semiselective liquid medium PVF-1 improved the PCR sensitivity level, allowing detection of 10 to 100 CFU/ml of plant extract. P. savastanoi was detected by the developed enrichment-PCR method in knots from different varieties of inoculated and naturally infected olive trees. Moreover, P. savastanoi was detected in symptomless stem tissues from naturally infected olive plants. This enrichment-PCR method is more sensitive and less cumbersome than the conventional isolation methods for detection of P. savastanoi.

  11. An improved extraction method to increase DNA yield from molted feathers

    Treesearch

    Shelley Bayard De Volo; Richard T. Reynolds; Marlis R. Douglas; Michael F. Antolin

    2008-01-01

    To assess the value of molted feathers as a noninvasive source of DNA for genetic studies of Northern Goshawks (Accipiter gentilis), we isolated and quantified DNA from molted feathers and compared yields across five feather types. We also compared PCR success across the same five feather types using five microsatellite genetic markers of varying...

  12. Molecular architecture of classical cytological landmarks: Centromeres and telomeres

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meyne, J.

    1994-11-01

    Both the human telomere repeat and the pericentromeric repeat sequence (GGAAT)n were isolated based on evolutionary conservation. Their isolation was based on the premise that chromosomal features as structurally and functionally important as telomeres and centromeres should be highly conserved. Both sequences were isolated by high stringency screening of a human repetitive DNA library with rodent repetitive DNA. The pHuR library (plasmid Human Repeat) used for this project was enriched for repetitive DNA by using a modification of the standard DNA library preparation method. Usually DNA for a library is cut with restriction enzymes, packaged, infected, and the library ismore » screened. A problem with this approach is that many tandem repeats don`t have any (or many) common restriction sites. Therefore, many of the repeat sequences will not be represented in the library because they are not restricted to a viable length for the vector used. To prepare the pHuR library, human DNA was mechanically sheared to a small size. These relatively short DNA fragments were denatured and then renatured to C{sub o}t 50. Theoretically only repetitive DNA sequences should renature under C{sub o}t 50 conditions. The single-stranded regions were digested using S1 nuclease, leaving the double-stranded, renatured repeat sequences.« less

  13. Separating endogenous ancient DNA from modern day contamination in a Siberian Neandertal

    PubMed Central

    Skoglund, Pontus; Northoff, Bernd H.; Shunkov, Michael V.; Derevianko, Anatoli P.; Pääbo, Svante; Krause, Johannes; Jakobsson, Mattias

    2014-01-01

    One of the main impediments for obtaining DNA sequences from ancient human skeletons is the presence of contaminating modern human DNA molecules in many fossil samples and laboratory reagents. However, DNA fragments isolated from ancient specimens show a characteristic DNA damage pattern caused by miscoding lesions that differs from present day DNA sequences. Here, we develop a framework for evaluating the likelihood of a sequence originating from a model with postmortem degradation—summarized in a postmortem degradation score—which allows the identification of DNA fragments that are unlikely to originate from present day sources. We apply this approach to a contaminated Neandertal specimen from Okladnikov Cave in Siberia to isolate its endogenous DNA from modern human contaminants and show that the reconstructed mitochondrial genome sequence is more closely related to the variation of Western Neandertals than what was discernible from previous analyses. Our method opens up the potential for genomic analysis of contaminated fossil material. PMID:24469802

  14. A non-invasive technique for rapid extraction of DNA from fish scales.

    PubMed

    Kumar, Ravindra; Singh, Poonam Jayant; Nagpure, N S; Kushwaha, Basdeo; Srivastava, S K; Lakra, W S

    2007-11-01

    DNA markers are being increasingly used in studies related to population genetics and conservation biology of endangered species. DNA isolation for such studies requires a source of biological material that is easy to collect, non-bulky and reliable. Further, the sampling strategies based on non-invasive procedures are desirable, especially for the endangered fish species. In view of above, a rapid DNA extraction method from fish scales has been developed with the use of a modified lysis buffer that require about 2 hr duration. This methodology is non-invasive, less expensive and reproducible with high efficiency of DNA recovery. The DNA extracted by this technique, have been found suitable for performing restriction enzyme digestion and PCR amplification. Therefore, the present DNA extraction procedure can be used as an alternative technique in population genetic studies pertaining to endangered fish species. The technique was also found equally effective for DNA isolation from fresh, dried and ethanol preserved scales.

  15. Elimination of bioweapons agents from forensic samples during extraction of human DNA.

    PubMed

    Timbers, Jason; Wilkinson, Della; Hause, Christine C; Smith, Myron L; Zaidi, Mohsin A; Laframboise, Denis; Wright, Kathryn E

    2014-11-01

    Collection of DNA for genetic profiling is a powerful means for the identification of individuals responsible for crimes and terrorist acts. Biologic hazards, such as bacteria, endospores, toxins, and viruses, could contaminate sites of terrorist activities and thus could be present in samples collected for profiling. The fate of these hazards during DNA isolation has not been thoroughly examined. Our goals were to determine whether the DNA extraction process used by the Royal Canadian Mounted Police eliminates or neutralizes these agents and if not, to establish methods that render samples safe without compromising the human DNA. Our results show that bacteria, viruses, and toxins were reduced to undetectable levels during DNA extraction, but endospores remained viable. Filtration of samples after DNA isolation eliminated viable spores from the samples but left DNA intact. We also demonstrated that contamination of samples with some bacteria, endospores, and toxins for longer than 1 h compromised the ability to complete genetic profiling. © 2014 American Academy of Forensic Sciences.

  16. Molecular Characterization and Analysis of 16S Ribosomal DNA in Some Isolates of Demodex folicullorum

    PubMed Central

    DANESHPARVAR, Afrooz; MOWLAVI, Gholamreza; MIRJALALI, Hamed; HAJJARAN, Homa; MOBEDI, Iraj; NADDAF, Saeed Reza; SHIDFAR, Mohammadreza; SADAT MAKKI, Mahsa

    2017-01-01

    Background: Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct and transmits through close contact with an infested host. Methods: This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, already obtained from four different patients and identified morphologically though clearing with 10% Potassium hydroxide (KOH) and microscopical examination. Amplified fragments from the isolates were compared with GeneBank database and phylogenetic analysis was carried out using MEGA6 software. Results: A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs) in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Conclusion: Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites. PMID:28761482

  17. Quantification of Plasmid Copy Number with Single Colour Droplet Digital PCR.

    PubMed

    Plotka, Magdalena; Wozniak, Mateusz; Kaczorowski, Tadeusz

    2017-01-01

    Bacteria can be considered as biological nanofactories that manufacture a cornucopia of bioproducts most notably recombinant proteins. As such, they must perfectly match with appropriate plasmid vectors to ensure successful overexpression of target genes. Among many parameters that correlate positively with protein productivity plasmid copy number plays pivotal role. Therefore, development of new and more accurate methods to assess this critical parameter will result in optimization of expression of plasmid-encoded genes. In this study, we present a simple and highly accurate method for quantifying plasmid copy number utilizing an EvaGreen single colour, droplet digital PCR. We demonstrate the effectiveness of this method by examining the copy number of the pBR322 vector within Escherichia coli DH5α cells. The obtained results were successfully validated by real-time PCR. However, we observed a strong dependency of the plasmid copy number on the method chosen for isolation of the total DNA. We found that application of silica-membrane-based columns for DNA purification or DNA isolation with use of bead-beating, a mechanical cell disruption lead to determination of an average of 20.5 or 7.3 plasmid copies per chromosome, respectively. We found that recovery of the chromosomal DNA from purification columns was less efficient than plasmid DNA (46.5 ± 1.9% and 87.4 ± 5.5%, respectively) which may lead to observed differences in plasmid copy number. Besides, the plasmid copy number variations dependent on DNA template isolation method, we found that droplet digital PCR is a very convenient method for measuring bacterial plasmid content. Careful determination of plasmid copy number is essential for better understanding and optimization of recombinant proteins production process. Droplet digital PCR is a very precise method that allows performing thousands of individual PCR reactions in a single tube. The ddPCR does not depend on running standard curves and is a straightforward and reliable method to quantify the plasmid copy number. Therefore we believe that the ddPCR designed in this study will be widely used for any plasmid copy number calculation in the future.

  18. Quantification of Plasmid Copy Number with Single Colour Droplet Digital PCR

    PubMed Central

    Plotka, Magdalena; Wozniak, Mateusz; Kaczorowski, Tadeusz

    2017-01-01

    Bacteria can be considered as biological nanofactories that manufacture a cornucopia of bioproducts most notably recombinant proteins. As such, they must perfectly match with appropriate plasmid vectors to ensure successful overexpression of target genes. Among many parameters that correlate positively with protein productivity plasmid copy number plays pivotal role. Therefore, development of new and more accurate methods to assess this critical parameter will result in optimization of expression of plasmid-encoded genes. In this study, we present a simple and highly accurate method for quantifying plasmid copy number utilizing an EvaGreen single colour, droplet digital PCR. We demonstrate the effectiveness of this method by examining the copy number of the pBR322 vector within Escherichia coli DH5α cells. The obtained results were successfully validated by real-time PCR. However, we observed a strong dependency of the plasmid copy number on the method chosen for isolation of the total DNA. We found that application of silica-membrane-based columns for DNA purification or DNA isolation with use of bead-beating, a mechanical cell disruption lead to determination of an average of 20.5 or 7.3 plasmid copies per chromosome, respectively. We found that recovery of the chromosomal DNA from purification columns was less efficient than plasmid DNA (46.5 ± 1.9% and 87.4 ± 5.5%, respectively) which may lead to observed differences in plasmid copy number. Besides, the plasmid copy number variations dependent on DNA template isolation method, we found that droplet digital PCR is a very convenient method for measuring bacterial plasmid content. Careful determination of plasmid copy number is essential for better understanding and optimization of recombinant proteins production process. Droplet digital PCR is a very precise method that allows performing thousands of individual PCR reactions in a single tube. The ddPCR does not depend on running standard curves and is a straightforward and reliable method to quantify the plasmid copy number. Therefore we believe that the ddPCR designed in this study will be widely used for any plasmid copy number calculation in the future. PMID:28085908

  19. DNA-magnetic Particle Binding Analysis by Dynamic and Electrophoretic Light Scattering.

    PubMed

    Haddad, Yazan; Dostalova, Simona; Kudr, Jiri; Zitka, Ondrej; Heger, Zbynek; Adam, Vojtech

    2017-11-09

    Isolation of DNA using magnetic particles is a field of high importance in biotechnology and molecular biology research. This protocol describes the evaluation of DNA-magnetic particles binding via dynamic light scattering (DLS) and electrophoretic light scattering (ELS). Analysis by DLS provides valuable information on the physicochemical properties of particles including particle size, polydispersity, and zeta potential. The latter describes the surface charge of the particle which plays major role in electrostatic binding of materials such as DNA. Here, a comparative analysis exploits three chemical modifications of nanoparticles and microparticles and their effects on DNA binding and elution. Chemical modifications by branched polyethylenimine, tetraethyl orthosilicate and (3-aminopropyl)triethoxysilane are investigated. Since DNA exhibits a negative charge, it is expected that zeta potential of particle surface will decrease upon binding of DNA. Forming of clusters should also affect particle size. In order to investigate the efficiency of these particles in isolation and elution of DNA, the particles are mixed with DNA in low pH (~6), high ionic strength and dehydration environment. Particles are washed on magnet and then DNA is eluted by Tris-HCl buffer (pH = 8). DNA copy number is estimated using quantitative polymerase chain reaction (PCR). Zeta potential, particle size, polydispersity and quantitative PCR data are evaluated and compared. DLS is an insightful and supporting method of analysis that adds a new perspective to the process of screening of particles for DNA isolation.

  20. Study of the effect of simulated space environment on nucleoprotein and DNA thin films

    NASA Astrophysics Data System (ADS)

    Fekete, A.; Módos, K.; Hegedüs, M.; Rontó, Gy.; Kovács, G.; Bérces, A.; Kargl, G.; Kömle, N. I.; Lammer, H.

    2002-11-01

    The main goal of PUR experiment (phage and uracil response) is to examine and quantify the effect of specific space conditions on nucleic acid models. To achieve this an improved method was elaborated for the preparation of DNA and bacteriophage thin films. The homogeneity of the films was controlled by UV spectroscopy and microscopy. To provide experimental evidence for the hypothesis that interplanetary transfer of life is possible, phage T7 and isolated T7 DNA thin films have been exposed to selected space conditions: intense UVC radiation (λ = 254 nm) and high vacuum (10-5 mbar). The effects of DNA hydration, conformation and packing on UV radiation damage were examined. Characteristic changes in the absorption spectrum, in the electrophoretic pattern of DNA and the decrease of the amount of PCR products have been detected indicating the photodamage of isolated and intraphage DNA.

  1. Simulation experiments of the effect of space environment on bacteriophage and DNA thin films

    NASA Astrophysics Data System (ADS)

    Fekete, A.; Rontó, Gy.; Hegedüs, M.; Módos, K.; Bérces, A.; Kovács, G.; Lammer, H.; Panitz, C.

    2004-01-01

    The main goal of PUR experiment (phage and uracil response) is to examine and quantify the effect of specific space conditions on nucleic acid models. To achieve this an improved method was elaborated for the preparation of DNA and bacteriophage thin films. The homogeneity of the films was controlled by UV spectroscopy and microscopy. To provide experimental evidence for the hypothesis that interplanetary transfer of the genetic material is possible, phage T7 and isolated T7 DNA thin films have been exposed to selected space conditions: intense UVC radiation ( λ=254 nm) and high vacuum (10 -4 Pa). The effects of DNA hydration, conformation and packing on UV radiation damage were examined. Characteristic changes in the absorption spectrum, in the electrophoretic pattern of DNA and the decrease of the amount of PCR products have been detected indicating the photodamage of isolated and intraphage DNA.

  2. Isolation of High-Molecular-Weight DNA from Monolayer Cultures of Mammalian Cells Using Proteinase K and Phenol.

    PubMed

    Green, Michael R; Sambrook, Joseph

    2017-07-05

    This procedure is the method of choice for purification of mammalian genomic DNA from monolayer cultures when large amounts of DNA are required, for example, for Southern blotting. Approximately 200 µg of mammalian DNA, 100-150 kb in length, is obtained from 5 × 10 7 cultured aneuploid cells (e.g., HeLa cells). © 2017 Cold Spring Harbor Laboratory Press.

  3. [Molecular combing method in the research of DNA replication parameters in isolated organs of Drosophyla melanogaster].

    PubMed

    Ivankin, A V; Kolesnikova, T D; Demakov, S A; Andreenkov, O V; Bil'danova, E R; Andreenkova, N G; Zhimulev, I F

    2011-01-01

    Methods of physical DNA mapping and direct visualization of replication and transcription in specific regions of genome play crucial role in the researches of structural and functional organization of eukaryotic genomes. Since DNA strands in the cells are organized into high-fold structure and present as highly compacted chromosomes, the majority of these methods have lower resolution at chromosomal level. One of the approaches to enhance the resolution and mapping accuracy is the method of molecular combing. The method is based on the process of stretching and alignment of DNA molecules that are covalently attached with one of the ends to the cover glass surface. In this article we describe the major methodological steps of molecular combing and their adaptation for researches of DNA replication parameters in polyploidy and diploid tissues of Drosophyla larvae.

  4. Photocleavable DNA barcode-antibody conjugates allow sensitive and multiplexed protein analysis in single cells.

    PubMed

    Agasti, Sarit S; Liong, Monty; Peterson, Vanessa M; Lee, Hakho; Weissleder, Ralph

    2012-11-14

    DNA barcoding is an attractive technology, as it allows sensitive and multiplexed target analysis. However, DNA barcoding of cellular proteins remains challenging, primarily because barcode amplification and readout techniques are often incompatible with the cellular microenvironment. Here we describe the development and validation of a photocleavable DNA barcode-antibody conjugate method for rapid, quantitative, and multiplexed detection of proteins in single live cells. Following target binding, this method allows DNA barcodes to be photoreleased in solution, enabling easy isolation, amplification, and readout. As a proof of principle, we demonstrate sensitive and multiplexed detection of protein biomarkers in a variety of cancer cells.

  5. Age-related decline in mitochondrial DNA copy number in isolated human pancreatic islets.

    PubMed

    Cree, L M; Patel, S K; Pyle, A; Lynn, S; Turnbull, D M; Chinnery, P F; Walker, M

    2008-08-01

    Pancreatic beta cell function has been shown to decline with age in man. Depletion of mitochondrial DNA (mtDNA) copy number is associated with impaired insulin secretion in pancreatic beta cell lines, and decreased mtDNA copy number has been observed with age in skeletal muscle in man. We investigated whether mtDNA copy number decreases with age in human pancreatic beta cells, which might in turn contribute to the age-related decline in insulin secretory capacity. We quantified mtDNA copy number in isolated human islet preparations from 15 pancreas donors aged between 17 and 75 years. Islets (n = 20) were individually hand-picked and pooled from each donor isolate for the quantification of mtDNA copy number and deleted mtDNA (%), which were determined using real-time PCR methods. There was a significant negative correlation between mtDNA copy number and islet donor age (r = -0.53, p = 0.044). mtDNA copy number was significantly decreased in islet preparations from donors aged > or =50 years (n = 8) compared with those aged <50 years (n = 7) (median [interquartile range]: 418 [236-503] vs 596 [554-729] mtDNA copy number/diploid genome; p = 0.032). None of the islet preparations harboured high levels of deleted mtDNA affecting the major arc. Given the correlation between mtDNA content and respiratory chain activity, the age-related decrease in mtDNA copy number that we observed in human pancreatic islet preparations may contribute to the age-dependent decline in pancreatic beta cell insulin secretory capacity.

  6. Simple and Inexpensive but Highly Discriminating Method for Computer-Assisted DNA Fingerprinting of Pseudomonas aeruginosa

    PubMed Central

    Al-Samarrai, Taha H.; Zhang, Ningxin; Lamont, Iain L.; Martin, Lois; Kolbe, John; Wilsher, Margaret; Morris, Arthur J.; Schmid, Jan

    2000-01-01

    We describe here a method for computer-assisted fingerprinting of Pseudomonas aeruginosa. In this method, DNA is digested with SalI, and bands with molecular sizes of ≥9.7 kb are visually scored after electrophoresis on agarose gels. Pattern scores are entered into a Microsoft Excel database. In scoring, the number of bands within each of a set of molecular size ranges is scored, rather than the absolute molecular size of each band, substantially enhancing the speed and reproducibility of the method, while eliminating the need for using expensive gel scanning equipment and software. Pattern scores are used to generate matrices of genetic distance values, which can be visualized in neighbor-joining trees. The method reliably distinguishes two epidemiologically unrelated isolates in 99.3% of all comparisons. The genetic relationships between isolates observed with the method were consistent with those obtained by analysis of two P. aeruginosa genes, indicating that it provides valid estimates of genetic divergence between isolates. Using the method, respiratory tract isolates from cystic fibrosis patients in Green Lane Hospital in Auckland, New Zealand, were shown to be genetically less diverse than epidemiologically unrelated isolates from other patients. This finding was not due to the existence of clusters of related strains specialized toward colonization of the respiratory tract and thus was indicative of transmission between patients. Analysis of multiple isolates from individual cystic fibrosis patients suggested that up to five separate clusters of genetically related strains may simultaneously be present in a patient. The method described should significantly enhance our ability to investigate the epidemiology of P. aeruginosa. PMID:11101578

  7. Isolating DNA from sexual assault cases: a comparison of standard methods with a nuclease-based approach

    PubMed Central

    2012-01-01

    Background Profiling sperm DNA present on vaginal swabs taken from rape victims often contributes to identifying and incarcerating rapists. Large amounts of the victim’s epithelial cells contaminate the sperm present on swabs, however, and complicate this process. The standard method for obtaining relatively pure sperm DNA from a vaginal swab is to digest the epithelial cells with Proteinase K in order to solubilize the victim’s DNA, and to then physically separate the soluble DNA from the intact sperm by pelleting the sperm, removing the victim’s fraction, and repeatedly washing the sperm pellet. An alternative approach that does not require washing steps is to digest with Proteinase K, pellet the sperm, remove the victim’s fraction, and then digest the residual victim’s DNA with a nuclease. Methods The nuclease approach has been commercialized in a product, the Erase Sperm Isolation Kit (PTC Labs, Columbia, MO, USA), and five crime laboratories have tested it on semen-spiked female buccal swabs in a direct comparison with their standard methods. Comparisons have also been performed on timed post-coital vaginal swabs and evidence collected from sexual assault cases. Results For the semen-spiked buccal swabs, Erase outperformed the standard methods in all five laboratories and in most cases was able to provide a clean male profile from buccal swabs spiked with only 1,500 sperm. The vaginal swabs taken after consensual sex and the evidence collected from rape victims showed a similar pattern of Erase providing superior profiles. Conclusions In all samples tested, STR profiles of the male DNA fractions obtained with Erase were as good as or better than those obtained using the standard methods. PMID:23211019

  8. [On the use of FTA technology for collection, archieving, and molecular analysis of microsporidia dna from clinical stool samples].

    PubMed

    Sokolova, O I; Dem'ianov, A V; Bovers, L S; Did'e, E S; Sokolova, Iu Ia

    2011-01-01

    The FTA technology was applied for sampling, archiving, and molecular analysis of the DNA isolated from stool samples to diagnose and identify microsporidia, the intracellular opportunistic parasites which induce malabsortion syndrome in immunosuppressed humans, particularly in patients with AIDS. Microsporidia DNA was successfully amplified in 6 of 50 stool samples of HIV-positive patients of the S. P. Botkin Memorial Infectious Disease Hospital (St. Petersburg) applied to FTA cards (FTA-Cars, Whatman Inc. Florham Park, NJ, USA). Amplicons (the fragments of rDNA) were directly sequenced, and microsporidia species--Encephalitozoon intestinalis, E. cuniculi, E. hellem, and Enterocytozoon bieneusi--were identified in Genbank by NCBI BLAST program. The FTA method of DNA immobilization is especially promising for epidemiological and field population studies which involve genotyping of microsporidia species and isolates.

  9. Time- and Cost-Efficient Identification of T-DNA Insertion Sites through Targeted Genomic Sequencing

    PubMed Central

    Lepage, Étienne; Zampini, Éric; Boyle, Brian; Brisson, Normand

    2013-01-01

    Forward genetic screens enable the unbiased identification of genes involved in biological processes. In Arabidopsis, several mutant collections are publicly available, which greatly facilitates such practice. Most of these collections were generated by agrotransformation of a T-DNA at random sites in the plant genome. However, precise mapping of T-DNA insertion sites in mutants isolated from such screens is a laborious and time-consuming task. Here we report a simple, low-cost and time efficient approach to precisely map T-DNA insertions simultaneously in many different mutants. By combining sequence capture, next-generation sequencing and 2D-PCR pooling, we developed a new method that allowed the rapid localization of T-DNA insertion sites in 55 out of 64 mutant plants isolated in a screen for gyrase inhibition hypersensitivity. PMID:23951038

  10. In vivo conformation of mitochondrial DNA revealed by pulsed-field gel electrophoresis in the true slime mold, Physarum polycephalum.

    PubMed

    Sakurai, R; Sasaki, N; Takano, H; Abe, T; Kawano, S

    2000-04-28

    Pulsed-field gel electrophoresis (PFGE) was used to examine the in vivo and in vitro conformations of Physarum polycephalum mitochondrial DNA (mtDNA). We used plugs containing isolated mitochondria, isolated mitochondrial nucleoids (mt-nuclei), and isolated mtDNA, in addition to whole cells. The mtDNA contained in the myxamoebae, plasmodia, isolated mitochondria, and isolated mt-nuclei was circular, but most of the isolated mtDNA had been site-specifically fragmented and linearized during DNA preparation and storage under low ionic strength conditions. Restriction mapping of Physarum mtDNA by the direct digestion of the isolated mt-nuclei from two different strains, DP89 x AI16 and KM88 x AI16, resulted in the circular form. A linear mitochondrial plasmid, mF, is known to promote mitochondrial fusion and integration of itself into the mtDNA in Physarum. Linearization of mtDNA by the integration of the mF plasmid was demonstrated when we used PFGE to analyze isolated mitochondria from the plasmodial strain DP89 x NG7 carrying the mF plasmid (mF+). The PFGE system can be used not only to determine whether the form of mtDNA is linear or circular but also to analyze the dynamic conformational changes of mtDNA.

  11. Recombinant pinoresinol/lariciresinol reductase, recombinant dirigent protein, and methods of use

    DOEpatents

    Lewis, Norman G.; Davin, Laurence B.; Dinkova-Kostova, Albena T.; Fujita, Masayuki; Gang, David R.; Sarkanen, Simo; Ford, Joshua D.

    2001-04-03

    Dirigent proteins and pinoresinol/lariciresinol reductases have been isolated, together with cDNAs encoding dirigent proteins and pinoresinol/lariciresinol reductases. Accordingly, isolated DNA sequences are provided which code for the expression of dirigent proteins and pinoresinol/lariciresinol reductases. In other aspects, replicable recombinant cloning vehicles are provided which code for dirigent proteins or pinoresinol/lariciresinol reductases or for a base sequence sufficiently complementary to at least a portion of dirigent protein or pinoresinol/lariciresinol reductase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding dirigent protein or pinoresinol/lariciresinol reductase. Thus, systems and methods are provided for the recombinant expression of dirigent proteins and/or pinoresinol/lariciresinol reductases.

  12. Identification of Candida lusitaniae as an opportunistic yeast in humans.

    PubMed

    Holzschu, D L; Presley, H L; Miranda, M; Phaff, H J

    1979-08-01

    Four yeast strains, causally associated with infection in a patient with acute myelogenous leukemia, were identified by standard methods currently used in yeast taxonomy as representatives of Candida lusitania van Uden et do Carmo-Sousa. Because this species has not been recognized previously as an opportunistic yeast in humans, molecular taxonomic methods were applied to confirm its identity. The nuclear deoxyribonucleic acid (DNA) base composition of two clinical isolates was shown to be 45.1 mol% guanine plus cytosine as compared to 44.7 mol% guanine plus cytosine for the type strain of this species. DNA/DNA reassociation experiments revealed more than 95% complementarity between the DNAs from the clinical isolates and that of the type strain of C. lusitaniae, thus confirming their classification by conventional taxonomy. A key is provided to differentiate C. lusitaniae from two phenotypically similar Candida species.

  13. Probiotic Candidates from Fish Pond Water in Central Java Indonesia

    NASA Astrophysics Data System (ADS)

    Harjuno Condro Haditomo, Alfabetian; Desrina; Sarjito; Budi Prayitno, S.

    2018-02-01

    Aeromonas hydrophilla is a major bacterial pathogen of intensive fresh water fish culture in Indonesia. An alternative method to control the pathogen is using probiotics. Probiotics is usually consist of live microorganisms which when administered in adequate amounts confer a health benefits on host. The aim of this research was to determine the probiotic candidates against A. hydrophilla which identified based on the 16S rDNA gene sequences. This research was started with field survey to obtained the probiotic candidate and continue with laboratory experiment. Probiotic candidates were isolated from fish pond water located in Boyolali, and Banjarnegara Regency, Central Java, Indonesia. A total of 133 isolates bacteria were isolated and cultured on to TSA, TSB and GSP medium. Out of 133 isolates only 30 isolates showed inhibition to A.hydrophilla activity. Three promising isolates were identified with PCR using primer for 16S rDNA. Based on 16S rDNA sequence analysis, all three isolates were belong to Bacillus genus. Isolate CKlA21, CKlA28, and CBA14 respectively were closely related to Bacillus sp. 13843 (GenBank accession no. JN874760.1 -100% homology), Bacillus subtilis strain H13 (GenBank accession no.KT907045.1 -- 99% homology), and Bacillus sp. strain 22-4 (GenBank accession no. KX816417.1 -- 97% homology).

  14. Restriction/modification polypeptides, polynucleotides, and methods

    DOEpatents

    Westpheling, Janet; Chung, DaeHwan; Huddleston, Jennifer; Farkas, Joel A

    2015-02-24

    The present invention relates to the discovery of a novel restriction/modification system in Caldicellulosiruptor bescii. The discovered restriction enzyme is a HaeIII-like restriction enzyme that possesses a thermophilic activity profile. The restriction/modification system also includes a methyltransferase, M.CbeI, that methylates at least one cytosine residue in the CbeI recognition sequence to m.sup.4C. Thus, the invention provides, in various aspects, isolated CbeI or M.CbeI polypeptides, or biologically active fragments thereof; isolated polynucleotides that encode the CbeI or M.CbeI polypeptides or biologically active fragments thereof, including expression vectors that include such polynucleotide sequences; methods of digesting DNA using a CbeI polypeptide; methods of treating a DNA molecule using a M.CbeI polypeptide; and methods of transforming a Caldicellulosiruptor cell.

  15. Detection of genetically modified organisms in foods by DNA amplification techniques.

    PubMed

    García-Cañas, Virginia; Cifuentes, Alejandro; González, Ramón

    2004-01-01

    In this article, the different DNA amplification techniques that are being used for detecting genetically modified organisms (GMOs) in foods are examined. This study intends to provide an updated overview (including works published till June 2002) on the principal applications of such techniques together with their main advantages and drawbacks in GMO detection in foods. Some relevant facts on sampling, DNA isolation, and DNA amplification methods are discussed. Moreover; these analytical protocols are discuissed from a quantitative point of view, including the newest investigations on multiplex detection of GMOs in foods and validation of methods.

  16. Identification of ochratoxin A producing Aspergillus carbonarius and A. niger clade isolated from grapes using the loop-mediated isothermal amplification (LAMP) reaction.

    PubMed

    Storari, M; von Rohr, R; Pertot, I; Gessler, C; Broggini, G A L

    2013-04-01

    To develop two assays based on the loop-mediated isothermal amplification (LAMP) of DNA for the quick and specific identification of Aspergillus carbonarius and ochratoxigenic strains of the Aspergillus niger clade isolated from grapes. Two sets of primers were designed based on the polyketide synthase genes involved or putatively involved in ochratoxin A (OTA) biosynthesis in A. carbonarius and A. niger clade. Hydroxynaphthol blue was used as indirect method to indicate DNA amplification. The limit of detection of both assays was comparable to that of a PCR reaction. Specificities of the reactions were tested using DNA from different black aspergilli isolated from grapes. The two LAMP assays were then used to identify A. carbonarius and ochratoxigenic A. niger and A. awamori grown in pure cultures without a prior DNA extraction. The two LAMP assays permitted to quickly and specifically identify DNA from OTA-producing black aspergilli, as well as isolates grown in pure culture. Monitoring vineyards for the presence of OTA-producing strains is part of the measures to minimize the occurrence of OTA in grape products. The two LAMP assays developed here could be potentially used to speed the screening process of vineyards for the presence of OTA-producing black aspergilli. © 2013 The Society for Applied Microbiology.

  17. Preanalytical blood sample workup for cell-free DNA analysis using Droplet Digital PCR for future molecular cancer diagnostics.

    PubMed

    van Ginkel, Joost H; van den Broek, Daan A; van Kuik, Joyce; Linders, Dorothé; de Weger, Roel; Willems, Stefan M; Huibers, Manon M H

    2017-10-01

    In current molecular cancer diagnostics, using blood samples of cancer patients for the detection of genetic alterations in plasma (cell-free) circulating tumor DNA (ctDNA) is an emerging practice. Since ctDNA levels in blood are low, highly sensitive Droplet Digital PCR (ddPCR) can be used for detecting rare mutational targets. In order to perform ddPCR on blood samples, a standardized procedure for processing and analyzing blood samples is necessary to facilitate implementation into clinical practice. Therefore, we assessed the technical sample workup procedure for ddPCR on blood plasma samples. Blood samples from healthy individuals, as well as lung cancer patients were analyzed. We compared different methods and protocols for sample collection, storage, centrifugation, isolation, and quantification. Cell-free DNA (cfDNA) concentrations of several wild-type targets and BRAF and EGFR-mutant ctDNA concentrations quantified by ddPCR were primary outcome measurements. Highest cfDNA concentrations were measured in blood collected in serum tubes. No significant differences in cfDNA concentrations were detected between various time points of up to 24 h until centrifugation. Highest cfDNA concentrations were detected after DNA isolation with the Quick cfDNA Serum & Plasma Kit, while plasma isolation using the QIAamp Circulating Nucleic Acid Kit yielded the most consistent results. DdPCR results on cfDNA are highly dependent on multiple factors during preanalytical sample workup, which need to be addressed during the development of this diagnostic tool for cancer diagnostics in the future. © 2017 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  18. Do Circulating Tumor Cells, Exosomes, and Circulating Tumor Nucleic Acids Have Clinical Utility?

    PubMed Central

    Gold, Bert; Cankovic, Milena; Furtado, Larissa V.; Meier, Frederick; Gocke, Christopher D.

    2016-01-01

    Diagnosing and screening for tumors through noninvasive means represent an important paradigm shift in precision medicine. In contrast to tissue biopsy, detection of circulating tumor cells (CTCs) and circulating tumor nucleic acids provides a minimally invasive method for predictive and prognostic marker detection. This allows early and serial assessment of metastatic disease, including follow-up during remission, characterization of treatment effects, and clonal evolution. Isolation and characterization of CTCs and circulating tumor DNA (ctDNA) are likely to improve cancer diagnosis, treatment, and minimal residual disease monitoring. However, more trials are required to validate the clinical utility of precise molecular markers for a variety of tumor types. This review focuses on the clinical utility of CTCs and ctDNA testing in patients with solid tumors, including somatic and epigenetic alterations that can be detected. A comparison of methods used to isolate and detect CTCs and some of the intricacies of the characterization of the ctDNA are also provided. PMID:25908243

  19. Isolation of Inositol Hexaphosphate (IHP)-Degrading Bacteria from Arbuscular Mycorrhizal Fungal Hyphal Compartments Using a Modified Baiting Method Involving Alginate Beads Containing IHP

    PubMed Central

    Hara, Shintaro; Saito, Masanori

    2016-01-01

    Phytate (inositol hexaphosphate; IHP)-degrading microbes have been suggested to contribute to arbuscular mycorrhizal fungi (AMF)-mediated P transfer from IHP to plants; however, no IHP degrader involved in AMF-mediated P transfer has been isolated to date. We herein report the isolation of IHP-degrading bacteria using a modified baiting method. We applied alginate beads as carriers of IHP powder, and used them as recoverable IHP in the AM fungal compartment of plant cultivation experiments. P transfer from IHP in alginate beads via AMF was confirmed, and extracted DNA from alginate beads was analyzed by denaturing gradient gel electrophoresis targeting the 16S rRNA gene and a clone library method for the beta-propeller phytase (BPP) gene. The diversities of the 16S rRNA and BPP genes of microbes growing on IHP beads were simple and those of Sphingomonas spp. and Caulobacter spp. dominated. A total of 187 IHP-utilizing bacteria were isolated and identified, and they were consistent with the results of DNA analysis. Furthermore, some isolated Sphingomonas spp. and Caulobacter sp. showed IHP-degrading activity. Therefore, we successfully isolated dominant IHP-degrading bacteria from IHP in an AMF hyphal compartment. These strains may contribute to P transfer from IHP via AMF. PMID:27383681

  20. An alternative method for cDNA cloning from surrogate eukaryotic cells transfected with the corresponding genomic DNA.

    PubMed

    Hu, Lin-Yong; Cui, Chen-Chen; Song, Yu-Jie; Wang, Xiang-Guo; Jin, Ya-Ping; Wang, Ai-Hua; Zhang, Yong

    2012-07-01

    cDNA is widely used in gene function elucidation and/or transgenics research but often suitable tissues or cells from which to isolate mRNA for reverse transcription are unavailable. Here, an alternative method for cDNA cloning is described and tested by cloning the cDNA of human LALBA (human alpha-lactalbumin) from genomic DNA. First, genomic DNA containing all of the coding exons was cloned from human peripheral blood and inserted into a eukaryotic expression vector. Next, by delivering the plasmids into either 293T or fibroblast cells, surrogate cells were constructed. Finally, the total RNA was extracted from the surrogate cells and cDNA was obtained by RT-PCR. The human LALBA cDNA that was obtained was compared with the corresponding mRNA published in GenBank. The comparison showed that the two sequences were identical. The novel method for cDNA cloning from surrogate eukaryotic cells described here uses well-established techniques that are feasible and simple to use. We anticipate that this alternative method will have widespread applications.

  1. Ribosomal DNA sequence divergence and group I introns within the Leucostoma species L. cinctum, L. persoonii, and L. parapersoonii sp. nov., ascomycetes that cause Cytospora canker of fruit trees.

    PubMed

    Adams, Gerard C; Surve-Iyer, Rupa S; Iezzoni, Amy F

    2002-01-01

    Leucostoma species that are the causal agents of Cytospora canker of stone and pome fruit trees were studied in detail. DNA sequence of the internal transcribed spacer regions and the 5.8S of the nuclear ribosomal DNA operon (ITS rDNA) supplied sufficient characters to assess the phylogenetic relationships among species of Leucostoma, Valsa, Valsella, and related anamorphs in Cytospora. Parsimony analysis of the aligned sequence divided Cytospora isolates from fruit trees into clades that generally agreed with the morphological species concepts, and with some of the phenetic groupings (PG 1-6) identified previously by isozyme analysis and cultural characteristics. Phylogenetic analysis inferred that isolates of L. persoonii formed two well-resolved clades distinct from isolates of L. cinctum. Phylogenetic analysis of the ITS rDNA, isozyme analysis, and cultural characteristics supported the inference that L. persoonii groups PG 2 and PG 3 were populations of a new species apparently more genetically different from L. persoonii PG 1 than from isolates representative of L. massariana, L. niveum, L. translucens, and Valsella melastoma. The new species, L. parapersoonii, was described. A diverse collection of isolates of L. cinctum, L. persoonii, and L. parapersoonii were examined for genetic variation using restriction fragment length polymorphism (RFLP) analysis of the ITS rDNA and the five prime end of the large subunit of the rDNA (LSU rDNA). HinfI and HpaII endonucleases were each useful in dividing the Leucostoma isolates into RFLP profiles corresponding to the isozyme phenetic groups, PG 1-6. RFLP analysis was more effective than isozyme analysis in uncovering variation among isolates of L. persoonii PG 1, but less effective within L. cinctum populations. Isolates representative of seven of the L. persoonii formae speciales proposed by G. Défago in 1935 were found to be genetically diverse isolates of PG 1. Two large insertions, 415 and 309 nucleotides long, in the small subunit (SSU) of the nuclear rDNA of L. cinctum were identified as Group 1 introns; intron 1 at position 943 and intron 2 at position 1199. The two introns were found to be consistently present in isolates of L. cinctum PG 4 and PG 5 and absent from L. cinctum PG 6 isolates, despite the similarity of the ITS sequence and teleomorph morphology. Intron 1 was of subgroup 1C1 whereas intron 2 was of an unknown subgroup. RFLP patterns and presence/absence of introns were useful characters for expediting the identification of cultures of Leucostoma isolated from stone and pome fruit cankers. RFLP patterns from 13 endonucleases provided an effective method for selecting an array of diverse PG 1 isolates useful in screening plant germplasm for disease-resistance.

  2. Direct PCR Offers a Fast and Reliable Alternative to Conventional DNA Isolation Methods for Gut Microbiomes.

    PubMed

    Videvall, Elin; Strandh, Maria; Engelbrecht, Anel; Cloete, Schalk; Cornwallis, Charlie K

    2017-01-01

    The gut microbiome of animals is emerging as an important factor influencing ecological and evolutionary processes. A major bottleneck in obtaining microbiome data from large numbers of samples is the time-consuming laboratory procedures required, specifically the isolation of DNA and generation of amplicon libraries. Recently, direct PCR kits have been developed that circumvent conventional DNA extraction steps, thereby streamlining the laboratory process by reducing preparation time and costs. However, the reliability and efficacy of direct PCR for measuring host microbiomes have not yet been investigated other than in humans with 454 sequencing. Here, we conduct a comprehensive evaluation of the microbial communities obtained with direct PCR and the widely used Mo Bio PowerSoil DNA extraction kit in five distinct gut sample types (ileum, cecum, colon, feces, and cloaca) from 20 juvenile ostriches, using 16S rRNA Illumina MiSeq sequencing. We found that direct PCR was highly comparable over a range of measures to the DNA extraction method in cecal, colon, and fecal samples. However, the two methods significantly differed in samples with comparably low bacterial biomass: cloacal and especially ileal samples. We also sequenced 100 replicate sample pairs to evaluate repeatability during both extraction and PCR stages and found that both methods were highly consistent for cecal, colon, and fecal samples ( r s > 0.7) but had low repeatability for cloacal ( r s = 0.39) and ileal ( r s = -0.24) samples. This study indicates that direct PCR provides a fast, cheap, and reliable alternative to conventional DNA extraction methods for retrieving 16S rRNA data, which can aid future gut microbiome studies. IMPORTANCE The microbial communities of animals can have large impacts on their hosts, and the number of studies using high-throughput sequencing to measure gut microbiomes is rapidly increasing. However, the library preparation procedure in microbiome research is both costly and time-consuming, especially for large numbers of samples. We investigated a cheaper and faster direct PCR method designed to bypass the DNA isolation steps during 16S rRNA library preparation and compared it with a standard DNA extraction method. We used both techniques on five different gut sample types collected from 20 juvenile ostriches and sequenced samples with Illumina MiSeq. The methods were highly comparable and highly repeatable in three sample types with high microbial biomass (cecum, colon, and feces), but larger differences and low repeatability were found in the microbiomes obtained from the ileum and cloaca. These results will help microbiome researchers assess library preparation procedures and plan their studies accordingly.

  3. Assessment of environmental DNA for detecting presence of imperiled aquatic amphibian species in isolated wetlands

    USGS Publications Warehouse

    Mckee, Anna; Calhoun, Daniel L.; Barichivich, William J.; Spear, Stephen F.; Goldberg, Caren S.; Glenn, Travis C

    2015-01-01

    Environmental DNA (eDNA) is an emerging tool that allows low-impact sampling for aquatic species by isolating DNA from water samples and screening for DNA sequences specific to species of interest. However, researchers have not tested this method in naturally acidic wetlands that provide breeding habitat for a number of imperiled species, including the frosted salamander (Ambystoma cingulatum), reticulated flatwoods salamanders (Ambystoma bishopi), striped newt (Notophthalmus perstriatus), and gopher frog (Lithobates capito). Our objectives for this study were to develop and optimize eDNA survey protocols and assays to complement and enhance capture-based survey methods for these amphibian species. We collected three or more water samples, dipnetted or trapped larval and adult amphibians, and conducted visual encounter surveys for egg masses for target species at 40 sites on 12 different longleaf pine (Pinus palustris) tracts. We used quantitative PCRs to screen eDNA from each site for target species presence. We detected flatwoods salamanders at three sites with eDNA but did not detect them during physical surveys. Based on the sample location we assumed these eDNA detections to indicate the presence of frosted flatwoods salamanders. We did not detect reticulated flatwoods salamanders. We detected striped newts with physical and eDNA surveys at two wetlands. We detected gopher frogs at 12 sites total, three with eDNA alone, two with physical surveys alone, and seven with physical and eDNA surveys. We detected our target species with eDNA at 9 of 11 sites where they were present as indicated from traditional surveys and at six sites where they were not detected with traditional surveys. It was, however, critical to use at least three water samples per site for eDNA. Our results demonstrate eDNA surveys can be a useful complement to traditional survey methods for detecting imperiled pond-breeding amphibians. Environmental DNA may be particularly useful in situations where detection probability using traditional survey methods is low or access by trained personnel is limited.

  4. Comparison of hard tissues that are useful for DNA analysis in forensic autopsy.

    PubMed

    Kaneko, Yu; Ohira, Hiroshi; Tsuda, Yukio; Yamada, Yoshihiro

    2015-11-01

    Forensic analysis of DNA from hard tissues can be important when investigating a variety of cases resulting from mass disaster or criminal cases. This study was conducted to evaluate the most suitable tissues, method and sample size for processing of hard tissues prior to DNA isolation. We also evaluated the elapsed time after death in relation to the quantity of DNA extracted. Samples of hard tissues (37 teeth, 42 skull, 42 rib, and 39 nails) from 42 individuals aged between 50 and 83 years were used. The samples were taken from remains following forensic autopsy (from 2 days to 2 years after death). To evaluate the integrity of the nuclear DNA isolated, the percentage of allele calls for short tandem repeat profiles were compared between the hard tissues. DNA typing results indicated that until 1 month after death, any of the four hard tissue samples could be used as an alternative to teeth, allowing analysis of all of the loci. However, in terms of the sampling site, collection method and sample size adjustment, the rib appeared to be the best choice in view of the ease of specimen preparation. Our data suggest that the rib could be an alternative hard tissue sample for DNA analysis of human remains. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  5. Molecular characterization of banana bunchy top virus isolate from Sri Lanka and its genetic relationship with other isolates.

    PubMed

    Wickramaarachchi, W A R T; Shankarappa, K S; Rangaswamy, K T; Maruthi, M N; Rajapakse, R G A S; Ghosh, Saptarshi

    2016-06-01

    Bunchy top disease of banana caused by Banana bunchy top virus (BBTV, genus Babuvirus family Nanoviridae) is one of the most important constraints in production of banana in the different parts of the world. Six genomic DNA components of BBTV isolate from Kandy, Sri Lanka (BBTV-K) were amplified by polymerase chain reaction (PCR) with specific primers using total DNA extracted from banana tissues showing typical symptoms of bunchy top disease. The amplicons were of expected size of 1.0-1.1 kb, which were cloned and sequenced. Analysis of sequence data revealed the presence of six DNA components; DNA-R, DNA-U3, DNA-S, DNA-N, DNA-M and DNA-C for Sri Lanka isolate. Comparisons of sequence data of DNA components followed by the phylogenetic analysis, grouped Sri Lanka-(Kandy) isolate in the Pacific Indian Oceans (PIO) group. Sri Lanka-(Kandy) isolate of BBTV is classified a new member of PIO group based on analysis of six components of the virus.

  6. Mild-Vectolysis: A nondestructive DNA extraction method for vouchering sand flies and mosquitoes

    USDA-ARS?s Scientific Manuscript database

    Nondestructive techniques allow the isolation of genomic DNA, without damaging the morphological features of the specimens. Though such techniques are available for numerous insect groups, they have not been applied to any member of the medically important families of mosquitoes (Diptera: Culicidae)...

  7. DETECTION OF GIARDIA IN ENVIRONMENTAL WATERS BY IMMUNO-PCR AMPLIFICATION METHODS

    EPA Science Inventory

    Genomic DNA was extracted either directly from Giardia muris cysts seeded into environmental surface waters or from cysts isolated by immunomagnetic beads (IMB).A 0.171-kbp segment of the giardin gene was PCR-amplified following "direct extraction" of Giardia DNA from seeded Caha...

  8. DETECTION OF GIARDIA IN ENVIRONMENTAL WATERS BY IMMUNO-PCR AMPLIFICATION METHODS

    EPA Science Inventory

    Genomic DNA was extracted either directly from Giardia muris cysts seeded into environmental surface waters or from cysts isolated by immunomagnetic beads (IMB}. A 0.171-kbp segment of the giardin gene was PCR-amplified following "direct extraction" of Giardia DNA from seeded Cah...

  9. Isolation and Molecular Identification of Streptomyces spp. with Antibacterial Activity from Northwest of Iran

    PubMed Central

    Maleki, Hadi; Dehnad, Alireza; Hanifian, Shahram; Khani, Sajjad

    2013-01-01

    Introduction: Streptomyces are a group of prokaryotes that are usually found in all types of ecosystems including water and soil. This group of bacteria is noteworthy as antibiotic producers; so the isolation and characterization of new species seemed to be crucial in introduction of markedly favorable antibiotics. Therefore, in this study we aim to isolate and characterize novel strains of Streptomyces with high antibiotic production capability. Methods: To achieve this goal, from 140 isolates collected throughout northwest of Iran, 12 selected Streptomyces isolates which exhibited high antibacterial activity against pathogenic bacteria were subjected to PCR reaction for identification via 16S rDNA gene and random amplified polymorphic DNA (RAPD) pattern analysis. Results: Analysis of morphological and biochemical characteristics and the 16S rDNA gene sequence indicated that all 12 selected isolates belonged to the genus Streptomyces. Moreover, screening of the isolates with regard to their antimicrobial activity against indicator bacteria as well as their classification using RAPD analysis revealed that G614C1 and K36C5 isolates have considerable antimicrobial activity and high similarity to Streptomyces coelicolor and Sreptomyces albogriseolus, respectively. Conclusion: Since many isolates in this study showed inhibitory effects against pathogenic bacteria, soil of northwest of Iran could be used as a rich source to be explored for novel Streptomyces strains with high potency of antibiotic production. PMID:24163805

  10. Automated genomic DNA purification options in agricultural applications using MagneSil paramagnetic particles

    NASA Astrophysics Data System (ADS)

    Bitner, Rex M.; Koller, Susan C.

    2002-06-01

    The automated high throughput purification of genomic DNA form plant materials can be performed using MagneSil paramagnetic particles on the Beckman-Coulter FX, BioMek 2000, and the Tecan Genesis robot. Similar automated methods are available for DNA purifications from animal blood. These methods eliminate organic extractions, lengthy incubations and cumbersome filter plates. The DNA is suitable for applications such as PCR and RAPD analysis. Methods are described for processing traditionally difficult samples such as those containing large amounts of polyphenolics or oils, while still maintaining a high level of DNA purity. The robotic protocols have ben optimized for agricultural applications such as marker assisted breeding, seed-quality testing, and SNP discovery and scoring. In addition to high yield purification of DNA from plant samples or animal blood, the use of Promega's DNA-IQ purification system is also described. This method allows for the purification of a narrow range of DNA regardless of the amount of additional DNA that is present in the initial sample. This simultaneous Isolation and Quantification of DNA allows the DNA to be used directly in applications such as PCR, SNP analysis, and RAPD, without the need for separate quantitation of the DNA.

  11. An improved protocol for DNA extraction from alkaline soil and sediment samples for constructing metagenomic libraries.

    PubMed

    Verma, Digvijay; Satyanarayana, T

    2011-09-01

    An improved single-step protocol has been developed for extracting pure community humic substance-free DNA from alkaline soils and sediments. The method is based on direct cell lysis in the presence of powdered activated charcoal and polyvinylpolypyrrolidone followed by precipitation with polyethyleneglycol and isopropanol. The strategy allows simultaneous isolation and purification of DNA while minimizing the loss of DNA with respect to other available protocols for metagenomic DNA extraction. Moreover, the purity levels are significant, which are difficult to attain with any of the methods reported in the literature for DNA extraction from soils. The DNA thus extracted was free from humic substances and, therefore, could be processed for restriction digestion, PCR amplification as well as for the construction of metagenomic libraries.

  12. Nucleic acid molecules encoding isopentenyl monophosphate kinase, and methods of use

    DOEpatents

    Croteau, Rodney B.; Lange, Bernd M.

    2001-01-01

    A cDNA encoding isopentenyl monophosphate kinase (IPK) from peppermint (Mentha x piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of isopentenyl monophosphate kinase (SEQ ID NO:2), from peppermint (Mentha x piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for isopentenyl monophosphate kinase, or for a base sequence sufficiently complementary to at least a portion of isopentenyl monophosphate kinase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding isopentenyl monophosphate kinase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant isopentenyl monophosphate kinase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant isopentenyl monophosphate kinase may be used to obtain expression or enhanced expression of isopentenyl monophosphate kinase in plants in order to enhance the production of isopentenyl monophosphate kinase, or isoprenoids derived therefrom, or may be otherwise employed for the regulation or expression of isopentenyl monophosphate kinase, or the production of its products.

  13. Size-based separation methods of circulating tumor cells.

    PubMed

    Hao, Si-Jie; Wan, Yuan; Xia, Yi-Qiu; Zou, Xin; Zheng, Si-Yang

    2018-02-01

    Circulating tumor cells (CTCs) originate from the primary tumor mass and enter into the peripheral bloodstream. Compared to other "liquid biopsy" portfolios such as exosome, circulating tumor DNA/RNA (ctDNA/RNA), CTCs have incomparable advantages in analyses of transcriptomics, proteomics, and signal colocalization. Hence, CTCs hold the key to understanding the biology of metastasis and play a vital role in cancer diagnosis, treatment monitoring, and prognosis. Size-based enrichment features are prominent in CTC isolation. It is a label-free, simple and fast method. Enriched CTCs remain unmodified and viable for a wide range of subsequent analyses. In this review, we comprehensively summarize the differences of size and deformability between CTCs and blood cells, which would facilitate the development of technologies of size-based CTC isolation. Then we review representative size-/deformability-based technologies available for CTC isolation and highlight the recent achievements in molecular analysis of isolated CTCs. To wrap up, we discuss the substantial challenges facing the field, and elaborate on prospects. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. PCR-based study of conserved and variable DNA sequences of Tritrichomonas foetus isolates from Saskatchewan, Canada.

    PubMed Central

    Riley, D E; Wagner, B; Polley, L; Krieger, J N

    1995-01-01

    The protozoan parasite Tritrichomonas foetus causes infertility and spontaneous abortion in cattle. In Saskatchewan, Canada, the culture prevalence of trichomonads was 65 of 1,048 (6%) among 1,048 bulls tested within a 1-year period ending in April 1994. Saskatchewan was previously thought to be free of the parasite. To confirm the culture results, possible T. foetus DNA presence was determined by the PCR. All of the 16 culture-positive isolates tested were PCR positive by a single-band test, but one PCR product was weak. DNA fingerprinting by both T17 PCR and randomly amplified polymorphic DNA PCR revealed genetic variation or polymorphism among the T. foetus isolates. T17 PCR also revealed conserved loci that distinguished these T. foetus isolates from Trichomonas vaginalis, from a variety of other protozoa, and from prokaryotes. TCO-1 PCR, a PCR test designed to sample DNA sequence homologous to the 5' flank of a highly conserved cell division control gene, detected genetic polymorphism at low stringency and a conserved, single locus at higher stringency. These findings suggested that T. foetus isolates exhibit both conserved genetic loci and polymorphic loci detectable by independent PCR methods. Both conserved and polymorphic genetic loci may prove useful for improved clinical diagnosis of T. foetus. The polymorphic loci detected by PCR suggested either a long history of infection or multiple lines of T. foetus infection in Saskatchewan. Polymorphic loci detected by PCR may provide data for epidemiologic studies of T. foetus. PMID:7615746

  15. Isolation of Mitochondrial DNA from Single, Short Hairs without Roots Using Pressure Cycling Technology.

    PubMed

    Harper, Kathryn A; Meiklejohn, Kelly A; Merritt, Richard T; Walker, Jessica; Fisher, Constance L; Robertson, James M

    2018-02-01

    Hairs are commonly submitted as evidence to forensic laboratories, but standard nuclear DNA analysis is not always possible. Mitochondria (mt) provide another source of genetic material; however, manual isolation is laborious. In a proof-of-concept study, we assessed pressure cycling technology (PCT; an automated approach that subjects samples to varying cycles of high and low pressure) for extracting mtDNA from single, short hairs without roots. Using three microscopically similar donors, we determined the ideal PCT conditions and compared those yields to those obtained using the traditional manual micro-tissue grinder method. Higher yields were recovered from grinder extracts, but yields from PCT extracts exceeded the requirements for forensic analysis, with the DNA quality confirmed through sequencing. Automated extraction of mtDNA from hairs without roots using PCT could be useful for forensic laboratories processing numerous samples.

  16. Evaluating the efficacy of DNA differential extraction methods for sexual assault evidence.

    PubMed

    Klein, Sonja B; Buoncristiani, Martin R

    2017-07-01

    Analysis of sexual assault evidence, often a mixture of spermatozoa and victim epithelial cells, represents a significant portion of a forensic DNA laboratory's case load. Successful genotyping of sperm DNA from these mixed cell samples, particularly with low amounts of sperm, depends on maximizing sperm DNA recovery and minimizing non-sperm DNA carryover. For evaluating the efficacy of the differential extraction, we present a method which uses a Separation Potential Ratio (SPRED) to consider both sperm DNA recovery and non-sperm DNA removal as variables for determining separation efficiency. In addition, we describe how the ratio of male-to-female DNA in the sperm fraction may be estimated by using the SPRED of the differential extraction method in conjunction with the estimated ratio of male-to-female DNA initially present on the mixed swab. This approach may be useful for evaluating or modifying differential extraction methods, as we demonstrate by comparing experimental results obtained from the traditional differential extraction and the Erase Sperm Isolation Kit (PTC © ) procedures. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Ribosomal DNA intergenic spacer sequence in foxtail millet, Setaria italica (L.) P. Beauv. and its characterization and application to typing of foxtail millet landraces.

    PubMed

    Fukunaga, Kenji; Ichitani, Katsuyuki; Taura, Satoru; Sato, Muneharu; Kawase, Makoto

    2005-02-01

    We determined the sequence of ribosomal DNA (rDNA) intergenic spacer (IGS) of foxtail millet isolated in our previous study, and identified subrepeats in the polymorphic region. We also developed a PCR-based method for identifying rDNA types based on sequence information and assessed 153 accessions of foxtail millet. Results were congruent with our previous works. This study provides new findings regarding the geographical distribution of rDNA variants. This new method facilitates analyses of numerous foxtail millet accessions. It is helpful for typing of foxtail millet germplasms and elucidating the evolution of this millet.

  18. Preparations of Meiotic Pachytene Chromosomes and Extended DNA Fibers from Cotton Suitable for Fluorescence In Situ Hybridization

    PubMed Central

    Liu, Fang; Ling, Jian; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Wang, Kunbo

    2012-01-01

    Fluorescence in situ hybridization (FISH) has become one of the most important techniques applied in plant molecular cytogenetics. However, the application of this technique in cotton has lagged behind because of difficulties in chromosome preparation. The focus of this article was FISH performed not only on cotton pachytene chromosomes, but also on cotton extended DNA fibers. The cotton pollen mother cells (PMCs) instead of buds or anthers were directly digested in enzyme to completely breakdown the cell wall. Before the routine acetic acid treatment, PMCs were incubated in acetic acid and enzyme mixture to remove the cytoplasm and clear the background. The method of ice-cold Carnoy's solution spreading chromosome was adopted instead of nitrogen removed method to avoid chromosomes losing and fully stretch chromosome. With the above-improved steps, the high-quality well-differentiated pachytene chromosomes with clear background were obtained. FISH results demonstrated that a mature protocol of cotton pachytene chromosomes preparation was presented. Intact and no debris cotton nuclei were obtained by chopping from etiolation cotyledons instead of the conventional liquid nitrogen grinding method. After incubating the nuclei with nucleus lysis buffer on slide, the parallel and clear background DNA fibers were acquired along the slide. This method overcomes the twist, accumulation and fracture of DNA fibers compared with other methods. The entire process of DNA fibers preparation requires only 30 min, in contrast, it takes 3 h with routine nitrogen grinding method. The poisonous mercaptoethanol in nucleus lysis buffer is replaced by nonpoisonous dithiothreitol. PVP40 in nucleus isolation buffer is used to prevent oxidation. The probability of success in isolating nuclei for DNA fiber preparation is almost 100% tested with this method in cotton. So a rapid, safe, and efficient method for the preparation of cotton extended DNA fibers suitable for FISH was established. PMID:22442728

  19. Development of a Method to Implement Whole-Genome Bisulfite Sequencing of cfDNA from Cancer Patients and a Mouse Tumor Model.

    PubMed

    Maggi, Elaine C; Gravina, Silvia; Cheng, Haiying; Piperdi, Bilal; Yuan, Ziqiang; Dong, Xiao; Libutti, Steven K; Vijg, Jan; Montagna, Cristina

    2018-01-01

    The goal of this study was to develop a method for whole genome cell-free DNA (cfDNA) methylation analysis in humans and mice with the ultimate goal to facilitate the identification of tumor derived DNA methylation changes in the blood. Plasma or serum from patients with pancreatic neuroendocrine tumors or lung cancer, and plasma from a murine model of pancreatic adenocarcinoma was used to develop a protocol for cfDNA isolation, library preparation and whole-genome bisulfite sequencing of ultra low quantities of cfDNA, including tumor-specific DNA. The protocol developed produced high quality libraries consistently generating a conversion rate >98% that will be applicable for the analysis of human and mouse plasma or serum to detect tumor-derived changes in DNA methylation.

  20. DNA Probe for Lactobacillus delbrueckii

    PubMed Central

    Delley, Michèle; Mollet, Beat; Hottinger, Herbert

    1990-01-01

    From a genomic DNA library of Lactobacillus delbrueckii subsp. bulgaricus, a clone was isolated which complements a leucine auxotrophy of an Escherichia coli strain (GE891). Subsequent analysis of the clone indicated that it could serve as a specific DNA probe. Dot-blot hybridizations with over 40 different Lactobacillus strains showed that this clone specifically recognizes L. delbrueckii subsp. delbrueckii, bulgaricus, and lactis. The sensitivity of the method was tested by using an α-32P-labeled DNA probe. Images PMID:16348233

  1. Genetic relationships among strains of Xanthomonas fragariae based on random amplified polymorphic DNA PCR, repetitive extragenic palindromic PCR, and enterobacterial repetitive intergenic consensus PCR data and generation of multiplexed PCR primers useful for the identification of this phytopathogen.

    PubMed Central

    Pooler, M R; Ritchie, D F; Hartung, J S

    1996-01-01

    Genetic relationships among 25 isolates of Xanthomonas fragariae from diverse geographic regions were determined by three PCR methods that rely on different amplification priming strategies: random amplified polymorphic DNA (RAPD) PCR, repetitive extragenic palindromic (REP) PCR, and enterobacterial repetitive intergenic consensus (ERIC) PCR. The results of these assays are mutually consistent and indicate that pathogenic strains are very closely related to each other. RAPD, ERIC, and REP PCR assays identified nine, four, and two genotypes, respectively, within X. fragariae isolates. A single nonpathogenic isolate of X. fragariae was not distinguishable by these methods. The results of the PCR assays were also fully confirmed by physiological tests. There was no correlation between DNA amplification product patterns and geographic sites of isolation, suggesting that this bacterium has spread largely through exchange of infected plant germ plasm. Sequences identified through the RAPD assays were used to develop three primer pairs for standard PCR assays to identify X. fragariae. In addition, we developed a stringent multiplexed PCR assay to identify X. fragariae by simultaneously using the three independently derived sets of primers specific for pathogenic strains of the bacteria. PMID:8795198

  2. Genetic diversity of Bacillus sp producers of amylase isolated from the soil.

    PubMed

    Xavier, A R E O; Lima, E R; Oliveira, A M E; Cardoso, L; Santos, J; Cangussu, C H C; Leite, L N; Quirino, M C L; Júnior, I G C; Oliveira, D A; Xavier, M A S

    2017-09-27

    The microorganisms are the best source of extracellular enzymes since they allow an economical technology with low-resource consumption compared to animals and plants. The amylases are among the most important enzymes being the genus Bacillus one of the most investigated due to its ability to produce this enzyme. The objective of this study was to isolate and analyze the genetic diversity among bacteria of the genus Bacillus sp producer of amylase originated from the soil. To this end, soil samples were collected and submitted to the condition of extreme temperature. The serial dilution procedure followed by seeding on solid medium containing starch was used for isolation of strains that produce amylase. The microorganisms isolated were subjected to standard morphological methods for presumptive identification of the genus Bacillus. The PCR assay with the universal genetic marker 16S rDNA was used for confirmation of bacterial strain. All the 10 isolates presumptively identified as bacteria amplified a fragment of 370 bp corresponding to the 16S rDNA gene. The enzymatic activity was expressed as an enzymatic index (EI), after 24 h of incubation. All isolate producers of amylase exhibited EI ≥ 2.0. The determination of the genetic profile and the clonal relationship among the isolates were performed by the method of ERIC-PCR polymorphism. The isolates of Bacillus spp were divided into 2 groups (I and II). Through this method, the discriminatory capacity of this analysis of polymorphisms was verified in differing producer strains from those not producing amylase.

  3. DNA damage under simulated extraterrestrial conditions in bacteriophage T7

    NASA Astrophysics Data System (ADS)

    Fekete, A.; Kovács, G.; Hegedüs, M.; Módos, K.; Rontó, Gy.; Lammer, H.; Panitz, C.

    The experiment ``Phage and uracil response'' (PUR) will be accommodated in the EXPOSE facility of the ISS aiming to examine and quantify the effect of specific space conditions on bacteriophage T7 and isolated T7 DNA thin films. To achieve this new method was elaborated for the preparation of DNA and nucleoprotein thin films (1). During the EXPOSE Experiment Verification Tests (EVT) the samples were exposed to vacuum (10 -6 Pa), to monochromatic (254 nm) and polychromatic (200-400 nm) UV radiation in air as well in simulated space vacuum. Using neutral density (ND) filters dose-effect curves were performed in order to define the maximum doses tolerated, and we also studied the effect of temperature in vacuum as well as the influence of temperature fluctuations. We obtained substantial evidence that DNA lesions (e.g. strand breaks, DNA-protein cross-links, DNA-DNA cross-links) accumulate throughout exposure. DNA damage was determined by quantitative PCR using 555 bp and 3826 bp fragments of T7 DNA (2) and by neutral and alkaline agarose gel electrophoresis; the structural/chemical effects were analyzed by spectroscopic and microscopical methods. Characteristic changes in the absorption spectrum, in the electrophoretic pattern of DNA and the decrease of the amount of the PCR products have been detected indicating the damage of isolated and intraphage DNA. Preliminary results suggest a synergistic action of space vacuum and UV radiation with DNA being the critical target. Fekete et al. J. Luminescence 102-103, 469-475, 2003 Hegedüs et al. Photochem. Photobiol. 78, 213-219, 2003

  4. Genetic characterization of Streptococcus phocae strains isolated from Atlantic salmon, Salmo salar L., in Chile.

    PubMed

    Valdés, I; Jaureguiberry, B; Romalde, J L; Toranzo, A E; Magariños, B; Avendaño-Herrera, R

    2009-04-01

    Streptococcus phocae is a beta-haemolytic bacterium frequently involved in disease outbreaks in seals causing pneumonia or respiratory infection. Since 1999, this pathogen has been isolated from diseased Atlantic salmon, Salmo salar, causing serious economic losses in the salmon industry in Chile. In this study, we used different molecular typing methods, such as pulsed-field gel electrophoresis (PFGE), randomly amplified polymorphic DNA (RAPD), enterobacterial repetitive intergenic consensus sequence PCR (ERIC-PCR), repetitive extragenic palindromic PCR (REP-PCR) and restriction of 16S-23S rDNA intergenic spacer regions to evaluate the genetic diversity in S. phocae. Thirty-four strains isolated in different years were analysed. The S. phocae type strain ATCC 51973(T) was included for comparative purposes. The results demonstrated genetic homogeneity within the S. phocae strains isolated in Chile over several years, suggesting the existence of clonal relationships among S. phocae isolated from Atlantic salmon. The type strain ATCC 51973(T) presented a different genetic pattern with the PFGE, RAPD, ERIC-PCR and REP-PCR methods. However, the fingerprint patterns of two seal isolates were distinct from those of the type strain.

  5. Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography.

    PubMed

    Hedayati Ch, Mojtaba; Amani, Jafar; Sedighian, Hamid; Amin, Mohsen; Salimian, Jafar; Halabian, Raheleh; Imani Fooladi, Abbas Ali

    2016-09-01

    Staphylococcus aureus are potent human pathogens possessing arsenal of virulence factors. Staphylococcal food poisoning (SFP) and respiratory infections mediated by staphylococcal enterotoxin B (SEB) are common clinical manifestations. Many diagnostic techniques are based on serological detection and quantification of SEB in different food and clinical samples. Aptamers are known as new therapeutic and detection tools which are available in different ssDNA, dsDNA and protein structures. In this study, we used a new set of ssDNA aptamers against SEB. The methods used included preparation of a dsDNA library using standard SEB protein as the target analyte, affinity chromatography matrix in microfuge tubes, SELEX procedures to isolate specific ssDNA-aptamer as an affinity ligand, aptamer purification using ethanol precipitation method, affinity binding assay using ELISA, aptamer cloning and specificity test. Among 12 readable sequences, three of them were selected as the most appropriate aptamer because of their affinity and specificity to SEB. This study presents a new set of ssDNA aptamer with favorable selectivity to SEB through 12 rounds of SELEX. Selected aptamers were used to detect SEB in infected serum samples. Results showed that SEB c1 aptamer (2 µg SEB/100 nM aptamer) had favorable specificity to SEB (kd  = 2.3 × 10(-11) ). In conclusion, aptamers can be considered as useful tools for detecting and evaluating SEB. The results showed that affinity chromatography was an affordable assay with acceptable accuracy to isolate sensitive and selective novel aptamers. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  6. Isolation and identification of female DNA on postcoital penile swabs.

    PubMed

    Cina, S J; Collins, K A; Pettenati, M J; Fitts, M

    2000-06-01

    After sexual assault, cells originating from the assailant may be recovered from the victim. Through polymerase chain reaction (PCR)-based technology, positive scientific identification of the assailant may be made from these cells. Described is a prospective study describing a method for positively identifying cells from a female sex partner obtained from postcoital swabs of the penis of the male sex partner. Swabs were taken from the penis of a man at 1- to 24-hour intervals after coitus. DNA was isolated from each swab through standard organic extraction methods. The presence of female DNA was detected using the gender-specific amelogenin marker. Extracted DNA was amplified for eight different genetic loci using the Promega PowerPlex kit (Promega) and Amplitaq Gold (Perkin Elmer). Amplified samples were electrophoresed on precast sequencing gels (Hitachi) and were analyzed fluorescently using Hitachi's FMBIO 2 fluorescent scanner and software. Each sample obtained from a penile swab or condom was compared to male and female buccal controls. Female DNA was isolated from all postcoital penile swabs as determined by exclusive amplification of the X-chromosome specific 212 base pair amelogenin marker. In all cases, scientific identification of the female DNA from the swabs was determined by coamplification of eight STR loci (PowerPlex) and was compared to female and male control profiles. Cells shed from a female victim during sexual intercourse can be retrieved from the penis of a male offender after sexual intercourse during a 1- to 24-hour postcoital interval. DNA can be extracted from these cells and can be used to scientifically identify the female sexual participant through PCR-based technology. It is suggested that penile swabs be taken from alleged perpetrators of sexual assaults to associate them with a female victim.

  7. Comparison of commercially-available preservatives for maintaining the integrity of bacterial DNA in human milk.

    PubMed

    Lackey, Kimberly A; Williams, Janet E; Price, William J; Carrothers, Janae M; Brooker, Sarah L; Shafii, Bahman; McGuire, Mark A; McGuire, Michelle K

    2017-10-01

    Inhibiting changes to bacteria in human milk between sample collection and analysis is necessary for unbiased characterization of the milk microbiome. Although cold storage is considered optimal, alternative preservation is sometimes necessary. The objective of this study was to compare the effectiveness of several commercially-available preservatives with regard to maintaining bacterial DNA in human milk for delayed microbiome analysis. Specifically, we compared Life Technologies' RNAlater® stabilization solution, Biomatrica's DNAgard® Saliva, Advanced Instruments' Broad Spectrum Microtabs II™, and Norgen Biotek Corporation's Milk DNA Preservation and Isolation Kit. Aliquots of 8 pools of human milk were treated with each preservative. DNA was extracted immediately and at 1, 2, 4, and 6wk, during which time milk was held at 37°C. The V1-V3 region of the bacterial 16S rRNA gene was amplified and sequenced. Changes in bacterial community structure and diversity over time were evaluated. Comparable to other studies, the most abundant genera were Streptococcus (33.3%), Staphylococcus (14.0%), Dyella (6.3%), Pseudomonas (3.0%), Veillonella (2.5%), Hafnia (2.0%), Prevotella (1.7%), Rhodococcus (1.6%), and Granulicatella (1.4%). Overall, use of Norgen's Milk DNA Preservation and Isolation Kit best maintained the consistency of the bacterial community structure. Total DNA, diversity, and evenness metrics were also highest in samples preserved with this method. When collecting human milk for bacterial community analysis in field conditions where cold storage is not available, our results suggest that Norgen's Milk DNA Preservation and Isolation Kit may be a useful method, at least for a period of 2weeks. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Recominant Pinoresino-Lariciresinol Reductase, Recombinant Dirigent Protein And Methods Of Use

    DOEpatents

    Lewis, Norman G.; Davin, Laurence B.; Dinkova-Kostova, Albena T.; Fujita, Masayuki , Gang; David R. , Sarkanen; Simo , Ford; Joshua D.

    2003-10-21

    Dirigent proteins and pinoresinol/lariciresinol reductases have been isolated, together with cDNAs encoding dirigent proteins and pinoresinol/lariciresinol reductases. Accordingly, isolated DNA sequences are provided from source species Forsythia intermedia, Thuja plicata, Tsuga heterophylla, Eucommia ulmoides, Linum usitatissimum, and Schisandra chinensis, which code for the expression of dirigent proteins and pinoresinol/lariciresinol reductases. In other aspects, replicable recombinant cloning vehicles are provided which code for dirigent proteins or pinoresinol/lariciresinol reductases or for a base sequence sufficiently complementary to at least a portion of dirigent protein or pinoresinol/lariciresinol reductase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding dirigent protein or pinoresinol/lariciresinol reductase. Thus, systems and methods are provided for the recombinant expression of dirigent proteins and/or pinoresinol/lariciresinol reductases.

  9. Identification of Candida lusitaniae as an opportunistic yeast in humans.

    PubMed Central

    Holzschu, D L; Presley, H L; Miranda, M; Phaff, H J

    1979-01-01

    Four yeast strains, causally associated with infection in a patient with acute myelogenous leukemia, were identified by standard methods currently used in yeast taxonomy as representatives of Candida lusitania van Uden et do Carmo-Sousa. Because this species has not been recognized previously as an opportunistic yeast in humans, molecular taxonomic methods were applied to confirm its identity. The nuclear deoxyribonucleic acid (DNA) base composition of two clinical isolates was shown to be 45.1 mol% guanine plus cytosine as compared to 44.7 mol% guanine plus cytosine for the type strain of this species. DNA/DNA reassociation experiments revealed more than 95% complementarity between the DNAs from the clinical isolates and that of the type strain of C. lusitaniae, thus confirming their classification by conventional taxonomy. A key is provided to differentiate C. lusitaniae from two phenotypically similar Candida species. PMID:292646

  10. ISSR, ERIC and RAPD techniques to detect genetic diversity in the aphid pathogen Pandora neoaphidis.

    PubMed

    Tymon, Anna M; Pell, Judith K

    2005-03-01

    The entomopathogenic fungus Pandora neoaphidis is an important natural enemy of aphids. ISSR, ERIC (Enterobacterial Repetitive Intergenic Consensus) and RAPD PCR-based DNA fingerprint analyses were undertaken to study intra-specific variation amongst 30 isolates of P. neoaphidis worldwide, together with six closely related species of Entomophthorales. All methods yielded scorable binary characters, and distance matrices were constructed from both individual and combined data sets. Neighbour-joining was used to construct consensus phylogenetic trees which showed that although P. neoaphidis isolates were highly polymorphic they separated into a monophyletic group compared with the other Entomophthorales tested. Three distinct subclades were found, with UK isolates occupying two of these. No specific correlation with aphid host species was established for any of the isolates apart from those in one cluster which contained isolates obtained from nettle aphid, Microlophium carnosum. ERIC, ISSR and RAPD analysis allowed the rapid genetic characterisation and differentiation of isolates with the generation of potential isolate- and cluster specific-diagnostic DNA markers.

  11. Molecular identification of environmental bacteria in indoor air in the domestic home: description of a new species of Exiguobacterium.

    PubMed

    Yuan, Ivan; Xu, Jiru; Millar, B Cherie; Dooley, James S G; Rooney, Paul J; Alexander, H Denis; Moore, John E

    2007-02-01

    The quality of indoor air in terms of its bioaerosol composition with microorganisms is important due to its potential aetiological role in development of conditions such as Sick Building Syndrome. Hence, laboratory identification of bacteriological components in any bioaerosol from buildings may help elucidate the role of such organisms in disease states, particularly allergy-related conditions. A molecular method was developed employing universal or "broad-range" eubacterial PCR to help identify environmental culturable bacteria from domestic household air. In a "proof of concept" experiment, 16S rDNA PCR was performed on a collection of bacterial isolates originating from indoor air in the domestic home. 16S rDNA PCR was performed using a set of universal primers to successfully generate an amplicon of approximately 1400 bp, which was sequenced to obtain each isolate's identity. Sequence analysis was able to identify 12/13 of the isolates, whereby the majority were Gram-positive (12/13). Nine different genera were identified from the 13 isolates examined, of which, 12/13 were Gram-positive, with the exception being Moraxella osloensis, which was Gram-negative, as well as a novel species of Exiguobacterium. The closest phylogenetic neighbour of the wildtype isolate to a named species within this genus was E. aestuarii (1364/1384 bases; 98.4% homology), followed by E. marinum (97.5%) and with E. acetylicum being the most distantly related of all the described species. On account of this divergence within the 16S rDNA gene operon of the unknown Exiguobacterium isolate, we believe this isolate to represent a novel species of Exiguobacterium, which we have tentatively named Exiguobacterium belfastensis. Although from this study, these organisms are usually unlikely to be clinically significant to healthy individuals with a competent immune system, we recommend that molecular identification methods are used, if considered necessary, as an adjunct to first line phenotypic identification schemes, where a definitive identification is required. When the use of molecular identification methods is justified, employment of partial 16S rDNA PCR and sequencing provides a valuable and reliable method of identification of environmental bacteria in the home. This study demonstrates the usefulness of such methods and a full and comprehensive study is now required to examine the diversity of bacteria in indoor air in the home, with particular emphasis on the risk of such environmental organisms to immunosurpressed patients, such as those with haematological malignancies and who are neutropenic.

  12. Insights from computational analysis of full-length β-ketoacyl-[ACP] synthase-II cDNA isolated from American and African oil palms

    PubMed Central

    Bhore, Subhash J.; Cha, Thye S.; Amelia, Kassim; Shah, Farida H.

    2014-01-01

    Background: Palm oil derived from fruits (mesocarp) of African oil palm (Elaeis guineensis Jacq. Tenera) and American oil palm (E. oleifera) is important for food industry. Due to high yield, Elaeis guineensis (Tenera) is cultivated on commercial scale, though its oil contains high (~54%) level of saturated fatty acids. The rate-limiting activity of beta-ketoacyl-[ACP] synthase-II (KAS-II) is considered mainly responsible for the high (44%) level of palmitic acid (C16:0) in the oil obtained from E. guineensis. Objective: The objective of this study was to annotate KAS-II cDNA isolated from American and African oil palms. Materials and Methods: The full-length E. oleifera KAS-II (EoKAS-II) cDNA clone was isolated using random method of gene isolation. Whereas, the E. guineensis KAS-II (EgTKAS-II) cDNA was isolated using reverse transcriptase polymerase chain reaction (RT-PCR) technique; and missing ends were obtained by employing 5’and 3’ RACE technique. Results: The results show that EoKAS-II and EgTKAS-II open reading frames (ORFs) are of 1689 and 1721 bp in length, respectively. Further analysis of the both EoKAS-II and EgTKAS-II predicted protein illustrates that they contains conserved domains for ‘KAS-I and II’, ‘elongating’ condensing enzymes, ‘condensing enzymes super-family’, and ‘3-oxoacyl-[ACP] synthase II’. The predicted protein sequences shows 95% similarity with each other. Consecutively, the three active sites (Cys, His, and His) were identified in both proteins. However, difference in positions of two active Histidine (His) residues was noticed. Conclusion: These insights may serve as the foundation in understanding the variable activity of KAS-II in American and African oil palms; and cDNA clones could be useful in the genetic engineering of oil palms. PMID:24678202

  13. Taxonomic study of extreme halophilic archaea isolated from the "Salar de Atacama", Chile.

    PubMed

    Lizama, C; Monteoliva-Sánchez, M; Prado, B; Ramos-Cormenzana, A; Weckesser, J; Campos, V

    2001-11-01

    A large number of halophilic bacteria were isolated in 1984-1992 from the Atacama Saltern (North of Chile). For this study 82 strains of extreme halophilic archaea were selected. The characterization was performed by using the phenotypic characters including morphological, physiological, biochemical, nutritional and antimicrobial susceptibility test. The results, together with those from reference strains, were subjected to numerical analysis, using the Simple Matching (S(SM)) coefficient and clustered by the unweighted pair group method of association (UPGMA). Fifteen phena were obtained at an 70% similarity level. The results obtained reveal a high diversity among the halophilic archaea isolated. Representative strains from the phena were chosen to determine their DNA base composition and the percentage of DNA-DNA similarity compared to reference strains. The 16S rRNA studies showed that some of these strains constitutes a new taxa of extreme halophilic archaea.

  14. Lactobacillus nantensis sp. nov., isolated from French wheat sourdough.

    PubMed

    Valcheva, Rosica; Ferchichi, Mounir F; Korakli, Maher; Ivanova, Iskra; Gänzle, Michael G; Vogel, Rudi F; Prévost, Hervé; Onno, Bernard; Dousset, Xavier

    2006-03-01

    A polyphasic taxonomic study of the bacterial flora isolated from traditional French wheat sourdough, using phenotypic characterization and phylogenetic as well as genetic methods, revealed a consistent group of isolates that could not be assigned to any recognized species. These results were confirmed by randomly amplified polymorphic DNA and amplified fragment length polymorphism fingerprinting analyses. Cells were Gram-positive, homofermentative rods. Comparative 16S rRNA gene sequence analysis of the representative strain LP33T indicated that these strains belong to the genus Lactobacillus and that they formed a branch distinct from their closest relatives Lactobacillus farciminis, Lactobacillus alimentarius, Lactobacillus paralimentarius and Lactobacillus mindensis. DNA-DNA reassociation experiments with the three phylogenetically closest Lactobacillus species confirmed that LP33T (= DSM 16982T = CIP 108546T = TMW 1.1265T) represents the type strain of a novel species, for which the name Lactobacillus nantensis sp. nov. is proposed.

  15. [Molecular typing of 12 Brucella strains isolated in Guizhou province in 2010-2013].

    PubMed

    Wang, Yue; Chen, Hong; Liu, Ying; Zhou, Jingzhu; Li, Shijun; Hang, Yan; Tang, Guangpeng; Wang, Dingming; Chen, Guichun

    2015-09-01

    To identify and characterize the Brucella strains from Guizhou province in 2010-2013. A total of 12 strains of Brucella suspicious bacteria were isolated in Guizhou province from 2010 to 2013. Four strains (GZLL3, GZLL4, GZLL11 and SH2) were isolated from goat blood samples and eight strains (SH4, GZZY, GZSQ, GZZA, BR13001, BR13004, BR13005 and BR13006) were isolated from blood samples of patient 12 Brucella suspicious strains were identified and characterized using conventional methods. Brucella genus specific gene BCSP31-based PCR (BCSP31-PCR) was used to identify the genus of Brucella and IS711 insert sequence-based PCR (AMOS-PCR) was applied to identify the species of Brucella strains. Goats and patients originated Brucella strains were comparatively analysed using Pulse-field Gel Electrophoresis (PFGE). Both of conventional methods and PCR identified the 12 Brucella suspicious strains as B. melitensis biotype 3. BCSP31-PCR identification results showed that a specific DNA bands (223 bp) were detected in all the 12 strains and positive control samples with no DNA band in negative samples. AMOS-PCR amplified a 731 bp-DNA bands in all the 12 strains, with 731 bp, 498 bp and 275 bp in M5, S2 and A19 strains, respectively, and no DNA band was detected in the negative control samples. PFGE analysis showed that 12 Brucella isolates from patients and goats showed consistent PFGE patterns with the digestion of restriction enzyme Xba I. The epidemic species/type of Brucella in both human and animal in Guizhou province was B. melitensis biotype 3 and goat was the main animal source of infection of brucellosis in Guizhou province.

  16. Design and performance testing of a real-time PCR assay for sensitive and reliable direct quantification of Brettanomyces in wine.

    PubMed

    Tessonnière, H; Vidal, S; Barnavon, L; Alexandre, H; Remize, F

    2009-02-28

    Because the yeast Brettanomyces produces volatile phenols and acetic acid, it is responsible for wine spoilage. The uncontrolled accumulation of these molecules in wine leads to sensorial defects that compromise wine quality. The need for a rapid, specific, sensitive and reliable method to detect this spoilage yeast has increased over the last decade. All these requirements are met by real-time PCR. We here propose improvements of existing methods to enhance the robustness of the assay. Six different protocols to isolate DNA from a wine and three PCR mix compositions were tested, and the best method was selected. Insoluble PVPP addition during DNA extraction by a classical phenol:chloroform protocol succeeded in the relief of PCR inhibitors from wine. We developed an internal control which was efficient to avoid false negative results due to decreases in the efficiency of DNA isolation and/or amplification. The method was evaluated by an intra-laboratory study for its specificity, linearity, repeatability and reproducibility. A standard curve was established from 14 different wines artificially inoculated. The quantification limit was 31 cfu/mL.

  17. Simulation experiments of the effect of space environment on bacteriophage and DNA thin films

    NASA Technical Reports Server (NTRS)

    Fekete, A.; Ronto, Gy; Hegedus, M.; Modos, K.; Berces, A.; Kovacs, G.; Lammer, H.; Panitz, C.

    2004-01-01

    The main goal of PUR experiment (phage and uracil response) is to examine and quantify the effect of specific space conditions on nucleic acid models. To achieve this an improved method was elaborated for the preparation of DNA and bacteriophage thin films. The homogeneity of the films was controlled by UV spectroscopy and microscopy. To provide experimental evidence for the hypothesis that interplanetary transfer of the genetic material is possible, phage T7 and isolated T7 DNA thin films have been exposed to selected space conditions: intense UVC radiation (lambda=254 nm) and high vacuum (10(-4) Pa). The effects of DNA hydration, conformation and packing on UV radiation damage were examined. Characteristic changes in the absorption spectrum, in the electrophoretic pattern of DNA and the decrease of the amount of PCR products have been detected indicating the photodamage of isolated and intraphage DNA. c2004 COSPAR. Published by Elsevier Ltd. All rights reserved.

  18. Analysis of Cellular DNA Content by Flow Cytometry.

    PubMed

    Darzynkiewicz, Zbigniew; Huang, Xuan; Zhao, Hong

    2017-10-02

    Cellular DNA content can be measured by flow cytometry with the aim of : (1) revealing cell distribution within the major phases of the cell cycle, (2) estimating frequency of apoptotic cells with fractional DNA content, and/or (3) disclosing DNA ploidy of the measured cell population. In this unit, simple and universally applicable methods for staining fixed cells are presented, as are methods that utilize detergents and/or proteolytic treatment to permeabilize cells and make DNA accessible to fluorochrome. Additionally, supravital cell staining with Hoechst 33342, which is primarily used for sorting live cells based on DNA-content differences for their subsequent culturing, is described. Also presented are methods for staining cell nuclei isolated from paraffin-embedded tissues. Available algorithms are listed for deconvolution of DNA-content-frequency histograms to estimate percentage of cells in major phases of the cell cycle and frequency of apoptotic cells with fractional DNA content. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley and Sons, Inc.

  19. Analysis of Cellular DNA Content by Flow Cytometry.

    PubMed

    Darzynkiewicz, Zbigniew; Huang, Xuan; Zhao, Hong

    2017-11-01

    Cellular DNA content can be measured by flow cytometry with the aim of : (1) revealing cell distribution within the major phases of the cell cycle, (2) estimating frequency of apoptotic cells with fractional DNA content, and/or (3) disclosing DNA ploidy of the measured cell population. In this unit, simple and universally applicable methods for staining fixed cells are presented, as are methods that utilize detergents and/or proteolytic treatment to permeabilize cells and make DNA accessible to fluorochrome. Additionally, supravital cell staining with Hoechst 33342, which is primarily used for sorting live cells based on DNA-content differences for their subsequent culturing, is described. Also presented are methods for staining cell nuclei isolated from paraffin-embedded tissues. Available algorithms are listed for deconvolution of DNA-content-frequency histograms to estimate percentage of cells in major phases of the cell cycle and frequency of apoptotic cells with fractional DNA content. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley and Sons, Inc.

  20. Introduction of a novel 18S rDNA gene arrangement along with distinct ITS region in the saline water microalga Dunaliella

    PubMed Central

    2010-01-01

    Comparison of 18S rDNA gene sequences is a very promising method for identification and classification of living organisms. Molecular identification and discrimination of different Dunaliella species were carried out based on the size of 18S rDNA gene and, number and position of introns in the gene. Three types of 18S rDNA structure have already been reported: the gene with a size of ~1770 bp lacking any intron, with a size of ~2170 bp consisting one intron near 5' terminus, and with a size of ~2570 bp harbouring two introns near 5' and 3' termini. Hereby, we report a new 18S rDNA gene arrangement in terms of intron localization and nucleotide sequence in a Dunaliella isolated from Iranian salt lakes (ABRIINW-M1/2). PCR amplification with genus-specific primers resulted in production of a ~2170 bp DNA band, which is similar to that of D. salina 18S rDNA gene containing only one intron near 5' terminus. Whilst, sequence composition of the gene revealed the lack of any intron near 5' terminus in our isolate. Furthermore, another alteration was observed due to the presence of a 440 bp DNA fragment near 3' terminus. Accordingly, 18S rDNA gene of the isolate is clearly different from those of D. salina and any other Dunaliella species reported so far. Moreover, analysis of ITS region sequence showed the diversity of this region compared to the previously reported species. 18S rDNA and ITS sequences of our isolate were submitted with accesion numbers of EU678868 and EU927373 in NCBI database, respectively. The optimum growth rate of this isolate occured at the salinity level of 1 M NaCl. The maximum carotenoid content under stress condition of intense light (400 μmol photon m-2 s-1), high salinity (4 M NaCl) and deficiency of nitrate and phosphate nutritions reached to 240 ng/cell after 15 days. PMID:20377865

  1. Differentiation of BHV-1 isolates from vaccine virus by high-resolution melting analysis.

    PubMed

    Ostertag-Hill, Claire; Fang, Liang; Izume, Satoko; Lee, Megan; Reed, Aimee; Jin, Ling

    2015-02-16

    An efficacious bovine herpesvirus type-1 (BHV-1) vaccine has been used for many years. However, in the past few years, abortion and respiratory diseases have occurred after administration of the modified live vaccine. To investigate whether BHV-1 isolates from disease outbreaks are identical to those of the vaccines used, selected regions of the BHV-1 genome were investigated by high-resolution melting (HRM) analysis and PCR-DNA sequencing. When a target region within the thymidine kinase (TK) gene was examined by HRM analysis, 6 out of the 11 isolates from abortion cases and 22 out of the 25 isolates from bovine respiratory disease (BRD) cases had different melting curves compared to the vaccine virus. Surprisingly, when a conserved region within the US6 gene that encodes glycoprotein D (gD) was examined by HRM analysis, 5 out of the 11 abortion isolates and 18 out of the 23 BRD isolates had different melting curves from the vaccine virus. To determine whether SNPs within the coding regions of glycoprotein E (gE) and TK genes can be used to differentiate the isolates from the vaccine virus, PCR-DNA sequencing was used to examine these SNPs in all the isolates. This revealed that only 1 out of 11 of the abortion isolates and 4 out of 24 of the BRD isolates are different in the target region of gE from the vaccine virus, while 5 out of 11 abortion isolates and 4 out of 22 BRD isolates are different in the target region of TK from the vaccine virus. No DNA sequence differences were observed in glycoprotein G (gG) region between disease and vaccine isolates. Our study demonstrated that many disease isolates had genetic differences from the vaccine virus in regions examined by HRM and PCR-DNA sequencing analysis. In addition, many isolates contained more than one type of mutation and were composed of mixed variants. Our study suggests that a mixture of variants were present in isolates collected post-vaccination. HRM is a rapid diagnostic method that can be used for rapid differentiation of clinical isolates from vaccine strains. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Potential for biocontrol of melanized fungi by actinobacteria isolated from intertidal region of Ilha Do Mel, Paraná, Brazil.

    PubMed

    Dalitz, Camila de Araújo; Porsani, Mariana Vieira; Figel, Izabel Cristina; Pimentel, Ida C; Dalzoto, Patrícia R

    Actinobacteria occur in many environments and have the capacity to produce secondary metabolites with antibiotic potential. Identification and taxonomy of actinobacteria that produce antimicrobial substances is essential for the screening of new compounds, and sequencing of the 16S region of ribosomal DNA (rDNA), which is conserved and present in all bacteria, is an important method of identification. Melanized fungi are free-living organisms, which can also be pathogens of clinical importance. This work aimed to evaluate growth inhibition of melanized fungi by actinobacteria and to identify the latter to the species level. In this study, antimicrobial activity of 13 actinobacterial isolates from the genus Streptomyces was evaluated against seven melanized fungi of the genera Exophiala, Cladosporium, and Rhinocladiella. In all tests, all actinobacterial isolates showed inhibitory activity against all isolates of melanized fungi, and only one actinobacterial isolate had less efficient inhibitory activity. The 16S rDNA region of five previously unidentified actinobacterial isolates from Ilha do Mel, Paraná, Brazil, was sequenced; four of the isolates were identified as Streptomyces globisporus subsp. globisporus, and one isolate was identified as Streptomyces aureus. This work highlights the potential of actinobacteria with antifungal activity and their role in the pursuit of novel antimicrobial substances. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  3. In Situ Analysis of DNA Methylation in Plants.

    PubMed

    Kathiria, Palak; Kovalchuk, Igor

    2017-01-01

    Epigenetic regulation in the plant genome is associated with the determination of expression patterns of various genes. Methylation of DNA at cytosine residues is one of the mechanisms of epigenetic regulation and has been a subject of various studies. Various techniques have been developed to analyze DNA methylation, most of which involve isolation of chromatin from cells and further in vitro studies. Limited techniques are available for in situ study of DNA methylation in plants. Here, we present such an in situ method for DNA methylation analysis which has high sensitivity and good reproducibility.

  4. Isolation and Characterization of Burkholderia rinojensis sp. nov., a Non-Burkholderia cepacia Complex Soil Bacterium with Insecticidal and Miticidal Activities

    PubMed Central

    Fernandez, Lorena E.; Koivunen, Marja; Yang, April; Flor-Weiler, Lina; Marrone, Pamela G.

    2013-01-01

    Isolate A396, a bacterium isolated from a Japanese soil sample demonstrated strong insecticidal and miticidal activities in laboratory bioassays. The isolate was characterized through biochemical methods, fatty acid methyl ester (FAME) analysis, sequencing of 16S rRNA, multilocus sequence typing and analysis, and DNA-DNA hybridization. FAME analysis matched A396 to Burkholderia cenocepacia, but this result was not confirmed by 16S rRNA or DNA-DNA hybridization. 16S rRNA sequencing indicated closest matches with B. glumae and B. plantarii. DNA-DNA hybridization experiments with B. plantarii, B. glumae, B. multivorans, and B. cenocepacia confirmed the low genetic similarity (11.5 to 37.4%) with known members of the genus. PCR-based screening showed that A396 lacks markers associated with members of the B. cepacia complex. Bioassay results indicated two mechanisms of action: through ingestion and contact. The isolate effectively controlled beet armyworms (Spodoptera exigua; BAW) and two-spotted spider mites (Tetranychus urticae; TSSM). In diet overlay bioassays with BAW, 1% to 4% (vol/vol) dilution of the whole-cell broth caused 97% to 100% mortality 4 days postexposure, and leaf disc treatment bioassays attained 75% ± 22% mortality 3 days postexposure. Contact bioassays led to 50% larval mortality, as well as discoloration, stunting, and failure to molt. TSSM mortality reached 93% in treated leaf discs. Activity was maintained in cell-free supernatants and after heat treatment (60°C for 2 h), indicating that a secondary metabolite or excreted thermostable enzyme might be responsible for the activity. Based on these results, we describe the novel species Burkholderia rinojensis, a good candidate for the development of a biocontrol product against insect and mite pests. PMID:24096416

  5. Evaluation of DNA extraction methods for Bacillus anthracis spores isolated from spiked food samples.

    PubMed

    Thomas, M C; Shields, M J; Hahn, K R; Janzen, T W; Goji, N; Amoako, K K

    2013-07-01

    Nine commercial DNA extraction kits were evaluated for the isolation of DNA from 10-fold serial dilutions of Bacillus anthracis spores using quantitative real-time PCR (qPCR). The three kits determined by qPCR to yield the most sensitive and consistent detection (Epicenter MasterPure Gram Positive; MoBio PowerFood; ABI PrepSeq) were subsequently tested for their ability to isolate DNA from trace amounts of B. anthracis spores (approx. 6·5 × 10(1) and 1·3 × 10(2)  CFU in 25 ml or 50 g of food sample) spiked into complex food samples including apple juice, ham, whole milk and bagged salad and recovered with immunomagnetic separation (IMS). The MasterPure kit effectively and consistently isolated DNA from low amounts of B. anthracis spores captured from food samples. Detection was achieved from apple juice, ham, whole milk and bagged salad from as few as 65 ± 14, 68 ± 8, 66 ± 4 and 52 ± 16 CFU, respectively, and IMS samples were demonstrated to be free of PCR inhibitors. Detection of B. anthracis spores isolated from food by IMS differs substantially between commercial DNA extraction kits; however, sensitive results can be obtained with the MasterPure Gram Positive kit. The extraction protocol identified herein combined with IMS is novel for B. anthracis and allows detection of low levels of B. anthracis spores from contaminated food samples. © Her Majesty the Queen in Right of Canada [2013]. Reproduced with the permission of the Canadian Food Inspection Agency.

  6. Purification of Single-Stranded cDNA Based on RNA Degradation Treatment and Adsorption Chromatography.

    PubMed

    Trujillo-Esquivel, Elías; Franco, Bernardo; Flores-Martínez, Alberto; Ponce-Noyola, Patricia; Mora-Montes, Héctor M

    2016-08-02

    Analysis of gene expression is a common research tool to study networks controlling gene expression, the role of genes with unknown function, and environmentally induced responses of organisms. Most of the analytical tools used to analyze gene expression rely on accurate cDNA synthesis and quantification to obtain reproducible and quantifiable results. Thus far, most commercial kits for isolation and purification of cDNA target double-stranded molecules, which do not accurately represent the abundance of transcripts. In the present report, we provide a simple and fast method to purify single-stranded cDNA, exhibiting high purity and yield. This method is based on the treatment with RNase H and RNase A after cDNA synthesis, followed by separation in silica spin-columns and ethanol precipitation. In addition, our method avoids the use of DNase I to eliminate genomic DNA from RNA preparations, which improves cDNA yield. As a case report, our method proved to be useful in the purification of single-stranded cDNA from the pathogenic fungus Sporothrix schenckii.

  7. An assessment of the efficiency of fungal DNA extraction methods for maximizing the detection of medically important fungi using PCR.

    PubMed

    Karakousis, A; Tan, L; Ellis, D; Alexiou, H; Wormald, P J

    2006-04-01

    To date, no single reported DNA extraction method is suitable for the efficient extraction of DNA from all fungal species. The efficiency of extraction is of particular importance in PCR-based medical diagnostic applications where the quantity of fungus in a tissue biopsy may be limited. We subjected 16 medically relevant fungi to physical, chemical and enzymatic cell wall disruption methods which constitutes the first step in extracting DNA. Examination by light microscopy showed that grinding with mortar and pestle was the most efficient means of disrupting the rigid fungal cell walls of hyphae and conidia. We then trialled several published DNA isolation protocols to ascertain the most efficient method of extraction. Optimal extraction was achieved by incorporating a lyticase and proteinase K enzymatic digestion step and adapting a DNA extraction procedure from a commercial kit (MO BIO) to generate high yields of high quality DNA from all 16 species. DNA quality was confirmed by the successful PCR amplification of the conserved region of the fungal 18S small-subunit rRNA multicopy gene.

  8. Isolation and identification of local bacteria endophyte and screening of its antimicrobial property against pathogenic bacteria and fungi

    NASA Astrophysics Data System (ADS)

    Fikri, Ahmad Syairazie Ibrahim; Rahman, Irman Abdul; Nor, Norefrina Shafinaz Md; Hamzah, Ainon

    2018-04-01

    Endophytes are organisms, often fungi and bacteria that live in living plant cells. These organisms reside in the living tissues of the host plant in a variety of relationships, ranging from symbiotic to slightly pathogenic. The endophytes may produce a plethora of substances that have potential to be used in modern medicine, agriculture and industry. The aims of this study are to isolate, identify and screening antimicrobial activity of bacterial endophytes. The endophytes were isolated using nutrient agar, incubated at 37°C for 48 hours. Identification of the isolates were done based on morphological characteristics, biochemical tests and 16S rDNA molecular analysis. Disk diffusion method was used to screen for antimicrobial activity of metabolites from endophytes against pathogenic bacteria. Screening for antifungal activity of selected endophytes was done using dual culture method againts pathogenic fungi followed by Kirby-Bauer method. Results showed endophytes designated as B2c and B7b have positive antimicrobial activity. The metabolites from isolate B2c showed antimicrobial activity against pathogenic bacteria methicillin-resistant Staphylococcus aureus (MRSA), Staphylococcus aureus and Staphylococcus epidermis, while isolate B7b have positive activities againts MRSA, S. aureus and Pseudomonas aeruginosa. Isolates B2c displayed antifungal activity against Fusarium oxysporum, Fusarium solani, Phytophthora palmivora and Colletotrichum gloeosporioides. Identification using biochemical tests and 16S rDNA sequences identified isolate B2c as Pseudomonas resinovorans with 97% homology and isolate B7b as Bacillus subtilis with 98% homology.

  9. Isolation of human simple repeat loci by hybridization selection.

    PubMed

    Armour, J A; Neumann, R; Gobert, S; Jeffreys, A J

    1994-04-01

    We have isolated short tandem repeat arrays from the human genome, using a rapid method involving filter hybridization to enrich for tri- or tetranucleotide tandem repeats. About 30% of clones from the enriched library cross-hybridize with probes containing trimeric or tetrameric tandem arrays, facilitating the rapid isolation of large numbers of clones. In an initial analysis of 54 clones, 46 different tandem arrays were identified. Analysis of these tandem repeat loci by PCR showed that 24 were polymorphic in length; substantially higher levels of polymorphism were displayed by the tetrameric repeat loci isolated than by the trimeric repeats. Primary mapping of these loci by linkage analysis showed that they derive from 17 chromosomes, including the X chromosome. We anticipate the use of this strategy for the efficient isolation of tandem repeats from other sources of genomic DNA, including DNA from flow-sorted chromosomes, and from other species.

  10. Isolation and bacterial expression of a sesquiterpene synthase cDNA clone from peppermint (Mentha x piperita, L.) that produces the aphid alarm pheromone (E)-.beta.-farnesene

    DOEpatents

    Croteau, Rodney Bruce; Crock, John E.

    2005-01-25

    A cDNA encoding (E)-.beta.-farnesene synthase from peppermint (Mentha piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of (E)-.beta.-farnesene synthase (SEQ ID NO:2), from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for (E)-.beta.-farnesene synthase, or for a base sequence sufficiently complementary to at least a portion of (E)-.beta.-farnesene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (E)-.beta.-farnesene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant (E)-.beta.-famesene synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant (E)-.beta.-farnesene synthase may be used to obtain expression or enhanced expression of (E)-.beta.-famesene synthase in plants in order to enhance the production of (E)-.beta.-farnesene, or may be otherwise employed for the regulation or expression of (E)-.beta.-farnesene synthase, or the production of its product.

  11. The Ins and Outs of DNA Fingerprinting the Infectious Fungi

    PubMed Central

    Soll, David R.

    2000-01-01

    DNA fingerprinting methods have evolved as major tools in fungal epidemiology. However, no single method has emerged as the method of choice, and some methods perform better than others at different levels of resolution. In this review, requirements for an effective DNA fingerprinting method are proposed and procedures are described for testing the efficacy of a method. In light of the proposed requirements, the most common methods now being used to DNA fingerprint the infectious fungi are described and assessed. These methods include restriction fragment length polymorphisms (RFLP), RFLP with hybridization probes, randomly amplified polymorphic DNA and other PCR-based methods, electrophoretic karyotyping, and sequencing-based methods. Procedures for computing similarity coefficients, generating phylogenetic trees, and testing the stability of clusters are then described. To facilitate the analysis of DNA fingerprinting data, computer-assisted methods are described. Finally, the problems inherent in the collection of test and control isolates are considered, and DNA fingerprinting studies of strain maintenance during persistent or recurrent infections, microevolution in infecting strains, and the origin of nosocomial infections are assessed in light of the preceding discussion of the ins and outs of DNA fingerprinting. The intent of this review is to generate an awareness of the need to verify the efficacy of each DNA fingerprinting method for the level of genetic relatedness necessary to answer the epidemiological question posed, to use quantitative methods to analyze DNA fingerprint data, to use computer-assisted DNA fingerprint analysis systems to analyze data, and to file data in a form that can be used in the future for retrospective and comparative studies. PMID:10756003

  12. Host Specialization in the Charcoal Rot Fungus, Macrophomina phaseolina.

    PubMed

    Su, G; Suh, S O; Schneider, R W; Russin, J S

    2001-02-01

    ABSTRACT To investigate host specialization in Macrophomina phaseolina, the fungus was isolated from soybean, corn, sorghum, and cotton root tissue and soil from fields cropped continuously to these species for 15 years in St. Joseph, LA. Chlorate phenotype of each isolate was determined after growing on a minimal medium containing 120 mM potassium chlorate. Consistent differences in chlorate sensitivity were detected among isolates from different hosts and from soil versus root. To further explore genetic differentiation among fungal isolates from each host, these isolates were examined by restriction fragment length polymorphism and random amplified polymorphic DNA (RAPD) analysis. No variations were observed among isolates in restriction patterns of DNA fragments amplified by polymerase chain reaction covering the internal transcribed spacer region, 5.8S rRNA and part of 25S rRNA, suggesting that M. phaseolina constitutes a single species. Ten random primers were used to amplify the total DNA of 45 isolates, and banding patterns resulting from RAPD analysis were compared with the neighbor-joining method. Isolates from a given host were genetically similar to each other but distinctly different from those from other hosts. Chlorate-sensitive isolates were distinct from chlorate-resistant isolates within a given host. In greenhouse tests, soybean, sorghum, corn, and cotton were grown separately in soil infested with individual isolates of M. phaseolina that were chosen based on their host of origin and chlorate phenotype. Root colonization and plant weight were measured after harvesting. More colonization of corn roots occurred when corn was grown in soil containing corn isolates compared with isolates from other hosts. However, there was no host specialization in isolates from soybean, sorghum, or cotton. More root colonization in soybean occurred with chlorate-sensitive than with chlorate-resistant isolates.

  13. DNA fingerprinting of Shiga-toxin producing Escherichia coli O157 based on Multiple-Locus Variable-Number Tandem-Repeats Analysis (MLVA)

    PubMed Central

    Lindstedt, Bjørn-Arne; Heir, Even; Gjernes, Elisabet; Vardund, Traute; Kapperud, Georg

    2003-01-01

    Background The ability to react early to possible outbreaks of Escherichia coli O157:H7 and to trace possible sources relies on the availability of highly discriminatory and reliable techniques. The development of methods that are fast and has the potential for complete automation is needed for this important pathogen. Methods In all 73 isolates of shiga-toxin producing E. coli O157 (STEC) were used in this study. The two available fully sequenced STEC genomes were scanned for tandem repeated stretches of DNA, which were evaluated as polymorphic markers for isolate identification. Results The 73 E. coli isolates displayed 47 distinct patterns and the MLVA assay was capable of high discrimination between the E. coli O157 strains. The assay was fast and all the steps can be automated. Conclusion The findings demonstrate a novel high discriminatory molecular typing method for the important pathogen E. coli O157 that is fast, robust and offers many advantages compared to current methods. PMID:14664722

  14. Isolation of a single rice chromosome by optical micromanipulation

    NASA Astrophysics Data System (ADS)

    Wang, Haowei; Liu, Xiaohui; Li, Yinmei; Han, Bin; Lou, Liren; Wang, Kangjun

    2004-01-01

    A new method based on optical tweezers technology is reported for the isolation of a single chromosome. A rice cell suspended in liquid was first fragmented by laser pulses (optical scalpel). Then a single released chromosome from the cell was manipulated and pulled away from other cells and oddments by optical tweezers without any direct mechanical contact. Finally the isolated single chromosome was extracted individually into a glass capillary nearby. After molecular cloning of the isolated chromosome, we obtained some specific DNA segments from the single chromosome. All these segments can be used for rice genomic sequencing. Different methods of extracting a single chromosome are compared. The advantages of optical micromanipulation method are summarized.

  15. Is the extraction by Whatman FTA filter matrix technology and sequencing of large ribosomal subunit D1-D2 region sufficient for identification of clinical fungi?

    PubMed

    Kiraz, Nuri; Oz, Yasemin; Aslan, Huseyin; Erturan, Zayre; Ener, Beyza; Akdagli, Sevtap Arikan; Muslumanoglu, Hamza; Cetinkaya, Zafer

    2015-10-01

    Although conventional identification of pathogenic fungi is based on the combination of tests evaluating their morphological and biochemical characteristics, they can fail to identify the less common species or the differentiation of closely related species. In addition these tests are time consuming, labour-intensive and require experienced personnel. We evaluated the feasibility and sufficiency of DNA extraction by Whatman FTA filter matrix technology and DNA sequencing of D1-D2 region of the large ribosomal subunit gene for identification of clinical isolates of 21 yeast and 160 moulds in our clinical mycology laboratory. While the yeast isolates were identified at species level with 100% homology, 102 (63.75%) clinically important mould isolates were identified at species level, 56 (35%) isolates at genus level against fungal sequences existing in DNA databases and two (1.25%) isolates could not be identified. Consequently, Whatman FTA filter matrix technology was a useful method for extraction of fungal DNA; extremely rapid, practical and successful. Sequence analysis strategy of D1-D2 region of the large ribosomal subunit gene was found considerably sufficient in identification to genus level for the most clinical fungi. However, the identification to species level and especially discrimination of closely related species may require additional analysis. © 2015 Blackwell Verlag GmbH.

  16. Highly Effective DNA Extraction Method for Nuclear Short Tandem Repeat Testing of Skeletal Remains from Mass Graves

    PubMed Central

    Davoren, Jon; Vanek, Daniel; Konjhodzić, Rijad; Crews, John; Huffine, Edwin; Parsons, Thomas J.

    2007-01-01

    Aim To quantitatively compare a silica extraction method with a commonly used phenol/chloroform extraction method for DNA analysis of specimens exhumed from mass graves. Methods DNA was extracted from twenty randomly chosen femur samples, using the International Commission on Missing Persons (ICMP) silica method, based on Qiagen Blood Maxi Kit, and compared with the DNA extracted by the standard phenol/chloroform-based method. The efficacy of extraction methods was compared by real time polymerase chain reaction (PCR) to measure DNA quantity and the presence of inhibitors and by amplification with the PowerPlex 16 (PP16) multiplex nuclear short tandem repeat (STR) kit. Results DNA quantification results showed that the silica-based method extracted on average 1.94 ng of DNA per gram of bone (range 0.25-9.58 ng/g), compared with only 0.68 ng/g by the organic method extracted (range 0.0016-4.4880 ng/g). Inhibition tests showed that there were on average significantly lower levels of PCR inhibitors in DNA isolated by the organic method. When amplified with PP16, all samples extracted by silica-based method produced 16 full loci profiles, while only 75% of the DNA extracts obtained by organic technique amplified 16 loci profiles. Conclusions The silica-based extraction method showed better results in nuclear STR typing from degraded bone samples than a commonly used phenol/chloroform method. PMID:17696302

  17. Molecular threading: mechanical extraction, stretching and placement of DNA molecules from a liquid-air interface.

    PubMed

    Payne, Andrew C; Andregg, Michael; Kemmish, Kent; Hamalainen, Mark; Bowell, Charlotte; Bleloch, Andrew; Klejwa, Nathan; Lehrach, Wolfgang; Schatz, Ken; Stark, Heather; Marblestone, Adam; Church, George; Own, Christopher S; Andregg, William

    2013-01-01

    We present "molecular threading", a surface independent tip-based method for stretching and depositing single and double-stranded DNA molecules. DNA is stretched into air at a liquid-air interface, and can be subsequently deposited onto a dry substrate isolated from solution. The design of an apparatus used for molecular threading is presented, and fluorescence and electron microscopies are used to characterize the angular distribution, straightness, and reproducibility of stretched DNA deposited in arrays onto elastomeric surfaces and thin membranes. Molecular threading demonstrates high straightness and uniformity over length scales from nanometers to micrometers, and represents an alternative to existing DNA deposition and linearization methods. These results point towards scalable and high-throughput precision manipulation of single-molecule polymers.

  18. Direct detection of Mycobacterium tuberculosis rifampin resistance in bio-safe stained sputum smears.

    PubMed

    Lavania, Surabhi; Anthwal, Divya; Bhalla, Manpreet; Singh, Nagendra; Haldar, Sagarika; Tyagi, Jaya Sivaswami

    2017-01-01

    Direct smear microscopy of sputum forms the mainstay of TB diagnosis in resource-limited settings. Stained sputum smear slides can serve as a ready-made resource to transport sputum for molecular drug susceptibility testing. However, bio-safety is a major concern during transport of sputum/stained slides and for laboratory workers engaged in processing Mycobacterium tuberculosis infected sputum specimens. In this study, a bio-safe USP (Universal Sample Processing) concentration-based sputum processing method (Bio-safe method) was assessed on 87 M. tuberculosis culture positive sputum samples. Samples were processed for Ziehl-Neelsen (ZN) smear, liquid culture and DNA isolation. DNA isolated directly from sputum was subjected to an IS6110 PCR assay. Both sputum DNA and DNA extracted from bio-safe ZN concentrated smear slides were subjected to rpoB PCR and simultaneously assessed by DNA sequencing for determining rifampin (RIF) resistance. All sputum samples were rendered sterile by Bio-safe method. Bio-safe smears exhibited a 5% increment in positivity over direct smear with a 14% increment in smear grade status. All samples were positive for IS6110 and rpoB PCR. Thirty four percent samples were RIF resistant by rpoB PCR product sequencing. A 100% concordance (κ value = 1) was obtained between sequencing results derived from bio-safe smear slides and bio-safe sputum. This study demonstrates that Bio-safe method can address safety issues associated with sputum processing, provide an efficient alternative to sample transport in the form of bio-safe stained concentrated smear slides and can also provide information on drug (RIF) resistance by direct DNA sequencing.

  19. Direct detection of Mycobacterium tuberculosis rifampin resistance in bio-safe stained sputum smears

    PubMed Central

    Lavania, Surabhi; Anthwal, Divya; Bhalla, Manpreet; Singh, Nagendra; Haldar, Sagarika; Tyagi, Jaya Sivaswami

    2017-01-01

    Direct smear microscopy of sputum forms the mainstay of TB diagnosis in resource-limited settings. Stained sputum smear slides can serve as a ready-made resource to transport sputum for molecular drug susceptibility testing. However, bio-safety is a major concern during transport of sputum/stained slides and for laboratory workers engaged in processing Mycobacterium tuberculosis infected sputum specimens. In this study, a bio-safe USP (Universal Sample Processing) concentration-based sputum processing method (Bio-safe method) was assessed on 87 M. tuberculosis culture positive sputum samples. Samples were processed for Ziehl-Neelsen (ZN) smear, liquid culture and DNA isolation. DNA isolated directly from sputum was subjected to an IS6110 PCR assay. Both sputum DNA and DNA extracted from bio-safe ZN concentrated smear slides were subjected to rpoB PCR and simultaneously assessed by DNA sequencing for determining rifampin (RIF) resistance. All sputum samples were rendered sterile by Bio-safe method. Bio-safe smears exhibited a 5% increment in positivity over direct smear with a 14% increment in smear grade status. All samples were positive for IS6110 and rpoB PCR. Thirty four percent samples were RIF resistant by rpoB PCR product sequencing. A 100% concordance (κ value = 1) was obtained between sequencing results derived from bio-safe smear slides and bio-safe sputum. This study demonstrates that Bio-safe method can address safety issues associated with sputum processing, provide an efficient alternative to sample transport in the form of bio-safe stained concentrated smear slides and can also provide information on drug (RIF) resistance by direct DNA sequencing. PMID:29216262

  20. Comparison of various RNA extraction methods, cDNA preparation and isolation of calmodulin gene from a highly melanized isolate of apple leaf blotch fungus Marssonina coronaria.

    PubMed

    Chauhan, Arjun; Sharma, J N; Modgil, Manju; Siddappa, Sundaresha

    2018-05-29

    Marssonina coronaria causes apple blotch disease resulting in severe premature defoliation, and is distributed in many leading apple-growing areas in the world. Effective, reliable and high-quality RNA extraction is an indispensable procedure in any molecular biology study. No method currently exists for RNA extraction from M. coronaria that produces a high quantity of melanin-free RNA. Therefore, we evaluated eight RNA extraction methods including manual and commercial kits, to yield a sufficient quantity of high-quality and melanin-free RNA. Manual methods used here resulted in low quality and black colored RNA pellets showing the presence of melanin, despite all the modifications employed to original procedures. However, these methods when coupled with clean up resulted in melanin-free RNA. On the other hand, all commercial kits used were able to yield high-quality melanin-free RNA having variable yields. TRIzol™ Reagent + RNA Clean & Concentrator™-5 and Ambion-PureLink® RNA Mini Kit were found to be the best methods as the RNA extracted with these methods from 15 day old fungal culture grown on solid medium were free of melanin with good yield. RNA extracted by this improved methodology was applied for RT-PCR, subsequent PCR amplification, and isolation of calmodulin gene sequences from M. coronaria and infected apple leaf pieces. These methods are more time effective than traditional methods and take only an hour to complete. To our knowledge, this is the first report on the method of isolation of high-quality RNA for cDNA synthesis as well as isolation of the calmodulin gene sequence from this fungus. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. STUDIES ON ISOLATED NUCLEI. I. ISOLATION AND CHEMICAL CHARACTERIZATION OF A NUCLEAR FRACTION FROM GUINEA PIG LIVER.

    PubMed

    MAGGIO, R; SIEKEVITZ, P; PALADE, G E

    1963-08-01

    This article describes a method for the isolation of nuclei from guinea pig liver. It involves the homogenization of the tissue in 0.88 M sucrose-1.5 mM CaCl(2) followed by centrifugation in a discontinuous density gradient in which the upper phase is the homogenate and the lower phase is 2.2 M sucrose-0.5 mM CaCl(2). Based on DNA recovery, the isolated fraction contains 25 to 30 per cent of the nuclei of the original homogenate. Electron microscopical observations showed that approximately 88 per cent of the isolated nuclei come from liver cells (the rest from von Kupffer cells and leucocytes) and that approximately 90 per cent of the nuclei appear intact, with well preserved nucleoli, nucleoplasm, nuclear envelope, and pores. Cytoplasmic contamination is minimal and consists primarily of the nuclear envelope and its attached ribosomes. The nuclear fraction consists of approximately 22.3 per cent DNA, approximately 4.7 per cent RNA, and approximately 73 per cent protein, the DNA/RNA ratio being 4.7. Data on RNA extractibility by phosphate and salt and on the base composition of total nuclear RNA are included.

  2. Acetobacter fabarum sp. nov., an acetic acid bacterium from a Ghanaian cocoa bean heap fermentation.

    PubMed

    Cleenwerck, Ilse; Gonzalez, Angel; Camu, Nicholas; Engelbeen, Katrien; De Vos, Paul; De Vuyst, Luc

    2008-09-01

    Six acetic acid bacterial isolates, obtained during a study of the microbial diversity of spontaneous fermentations of Ghanaian cocoa beans, were subjected to a polyphasic taxonomic study. (GTG)(5)-PCR fingerprinting grouped the isolates together, but they could not be identified using this method. Phylogenetic analysis based on 16S rRNA gene sequences allocated the isolates to the genus Acetobacter and revealed Acetobacter lovaniensis, Acetobacter ghanensis and Acetobacter syzygii to be nearest neighbours. DNA-DNA hybridizations demonstrated that the isolates belonged to a single novel genospecies that could be differentiated from its phylogenetically nearest neighbours by the following phenotypic characteristics: no production of 2-keto-D-gluconic acid from D-glucose; growth on methanol and D-xylose, but not on maltose, as sole carbon sources; no growth on yeast extract with 30% D-glucose; and weak growth at 37 degrees C. The DNA G+C contents of four selected strains were 56.8-58.0 mol%. The results obtained prove that the isolates should be classified as representatives of a novel Acetobacter species, for which the name Acetobacter fabarum sp. nov. is proposed. The type strain is strain 985(T) (=R-36330(T) =LMG 24244(T) =DSM 19596(T)).

  3. Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-Rich DNA, and nuclear DNA analyses

    USGS Publications Warehouse

    Freeman, S.; Pham, M.; Rodriguez, R.J.

    1993-01-01

    Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-rich DNA, and nuclear DNA analyses. Experimental Mycology 17, 309-322. Isolates of Colletotrichum were grouped into 10 separate species based on arbitrarily primed PCR (ap-PCR), A + T-rich DNA (AT-DNA) and nuclear DNA banding patterns. In general, the grouping of Colletotrichum isolates by these molecular approaches corresponded to that done by classical taxonomic identification, however, some exceptions were observed. PCR amplification of genomic DNA using four different primers allowed for reliable differentiation between isolates of the 10 species. HaeIII digestion patterns of AT-DNA also distinguished between species of Colletotrichum by generating species-specific band patterns. In addition, hybridization of the repetitive DNA element (GcpR1) to genomic DNA identified a unique set of Pst 1-digested nuclear DNA fragments in each of the 10 species of Colletotrichum tested. Multiple isolates of C. acutatum, C. coccodes, C. fragariae, C. lindemuthianum, C. magna, C. orbiculare, C. graminicola from maize, and C. graminicola from sorghum showed 86-100% intraspecies similarity based on ap-PCR and AT-DNA analyses. Interspecies similarity determined by ap-PCR and AT-DNA analyses varied between 0 and 33%. Three distinct banding patterns were detected in isolates of C. gloeosporioides from strawberry. Similarly, three different banding patterns were observed among isolates of C. musae from diseased banana.

  4. Screening of eye-position related genes with DD-RT-PCR and RDA in the hybrids between Japanese flounder Paralichthys olivaceus and stone flounder Kareius bicoloratus

    NASA Astrophysics Data System (ADS)

    Chen, Yanjie; Zhang, Quanqi; Qi, Jie; Sun, Yeying; Zhong, Qiwang; Wang, Xubo; Wang, Zhigang; Li, Shuo; Li, Chunmei

    2009-02-01

    Flatfish or flounder moves one eye to change body proportion into vertebral asymmetry during metamorphosis, during which some become sinistral while others dextral. However, the mechanism behinds the eye-position has not been well understood. In this research, hybrids between Japanese flounder(♀) and stone flounder (♂) show mixed eye-location in both dextral type and sinistral type, and thus become good samples for studying the eye-migration. mRNAs from pro-metamorphosis sinistral and dextral hybrids larvae were screened with classical differential display RT-PCR (DD-RT-PCR) and representational difference analysis of cDNA (cDNA-RDA); 30 and 47 putative fragments were isolated, respectively. The cDNA fragments of creatine kinase and trypsinogen 2 precursor genes isolated by cDNA-RDA exhibited eye-position expression patterns during metamorphosis. However, none of the fragments was proved to be related to flatfishes’ eye-position specifically. Therefore, further studies and more sensitive gene isolated methods are needed to solve the problems.

  5. Use of plasmid analysis and determination of aminoglycoside-modifying enzymes to characterize isolates from an outbreak of methicillin-resistant Staphylococcus aureus.

    PubMed Central

    Licitra, C M; Brooks, R G; Terry, P M; Shaw, K J; Hare, R S

    1989-01-01

    We compared disk susceptibility, plasmid analysis, aminoglycoside resistance patterns, and DNA hybridization for their usefulness in characterizing isolates from a hospital outbreak of methicillin-resistant Staphylococcus aureus. Fifteen isolates were susceptible (group 1) and 28 were resistant (group 2) to gentamicin. A total of 15 of 15 (100%) group 1 and 22 of 28 (79%) group 2 isolates carried a 21.5-megadalton plasmid. All group 2 isolates and none of the group 1 isolates possessed a 33-megadalton plasmid. Aminoglycoside resistance pattern determinations revealed the presence of the ANT(4')-I enzyme (aminoglycoside 4' adenyltransferase) in all group 1 isolates but was unable to demonstrate presence of this enzyme in group 2 organisms. The APH(2") + AAC(6')-II enzyme (aminoglycoside 2" phosphotransferase plus 6' acetyltransferase) was found in all of the group 2 isolates but in none of the group 1 isolates. Use of DNA hybridization revealed the presence of the ANT(4')-I enzyme in both groups (group 1, 14 of 15; group 2, 26 of 28). In this hospital outbreak, we found good correlation between disk susceptibility, plasmid profile, aminoglycoside resistance patterns, and DNA hybridization results. It was difficult to predict the presence of the ANT(4')-I enzyme in the presence of the bifunctional [APH(2") + AAC(6')-II] enzyme by the aminoglycoside resistance pattern method because of overlap of the substrate profile. Images PMID:2808676

  6. Isolation and functional identification of a novel cDNA for astaxanthin biosynthesis from Haematococcus pluvialis, and astaxanthin synthesis in Escherichia coli.

    PubMed

    Kajiwara, S; Kakizono, T; Saito, T; Kondo, K; Ohtani, T; Nishio, N; Nagai, S; Misawa, N

    1995-10-01

    We succeeded in isolating a novel cDNA involved in astaxanthin biosynthesis from the green alga Haematococcus pluvialis, by an expression cloning method using an Escherichia coli transformant as a host that synthesizes beta-carotene due to the Erwinia uredovora carotenoid biosynthesis genes. The cloned cDNA was shown to encode a novel enzyme, beta-carotene ketolase (beta-carotene oxygenase), which converted beta-carotene to canthaxanthin via echinenone, through chromatographic and spectroscopic analysis of the pigments accumulated in an E. coli transformant. This indicates that the encoded enzyme is responsible for the direct conversion of methylene to keto groups, a mechanism that usually requires two different enzymatic reactions proceeding via a hydroxy intermediate. Northern blot analysis showed that the mRNA was synthesized only in the cyst cells of H. pluvialis. E. coli carrying the H. pluvialis cDNA and the E. uredovora genes required for zeaxanthin biosynthesis was also found to synthesize astaxanthin (3S, 3'S), which was identified after purification by a variety of spectroscopic methods.

  7. Multicenter Comparative Evaluation of Five Commercial Methods for Toxoplasma DNA Extraction from Amniotic Fluid▿

    PubMed Central

    Yera, H.; Filisetti, D.; Bastien, P.; Ancelle, T.; Thulliez, P.; Delhaes, L.

    2009-01-01

    Over the past few years, a number of new nucleic acid extraction methods and extraction platforms using chemistry combined with magnetic or silica particles have been developed, in combination with instruments to facilitate the extraction procedure. The objective of the present study was to investigate the suitability of these automated methods for the isolation of Toxoplasma gondii DNA from amniotic fluid (AF). Therefore, three automated procedures were compared to two commercialized manual extraction methods. The MagNA Pure Compact (Roche), BioRobot EZ1 (Qiagen), and easyMAG (bioMérieux) automated procedures were compared to two manual DNA extraction kits, the QIAamp DNA minikit (Qiagen) and the High Pure PCR template preparation kit (Roche). Evaluation was carried out with two specific Toxoplasma PCRs (targeting the 529-bp repeat element), inhibitor search PCRs, and human beta-globin PCRs. The samples each consisted of 4 ml of AF with or without a calibrated Toxoplasma gondii RH strain suspension (0, 1, 2.5, 5, and 25 tachyzoites/ml). All PCR assays were laboratory-developed real-time PCR assays, using either TaqMan or fluorescent resonance energy transfer probes. A total of 1,178 PCRs were performed, including 978 Toxoplasma PCRs. The automated and manual methods were similar in sensitivity for DNA extraction from T. gondii at the highest concentration (25 Toxoplasma gondii cells/ml). However, our results showed that the DNA extraction procedures led to variable efficacy in isolating low concentrations of tachyzoites in AF samples (<5 Toxoplasma gondii cells/ml), a difference that might have repercussions since low parasite concentrations in AF exist and can lead to congenital toxoplasmosis. PMID:19846633

  8. Detection and differentiation of Fusarium oxysporum f. sp. lycopersici race 1 using loop-mediated isothermal amplification with three primer sets.

    PubMed

    Ayukawa, Y; Komatsu, K; Kashiwa, T; Akai, K; Yamada, M; Teraoka, T; Arie, T

    2016-09-01

    Fusarium oxysporum f. sp. lycopersici (Fol) causes tomato wilt. Based on the difference in pathogenicity towards tomato cultivars, Fol is classified into three races. In this study, a rapid method is developed for the detection and discrimination of Fol race 1 using a loop-mediated isothermal amplification (LAMP) assay with two primer sets targeting a region of the nucleotide sequence of the SIX4 gene specific for race 1 and a primer set targeting the SIX5 gene, conserved in all known Fol isolates. Upon LAMP reaction, amplification using all three primer sets was observed only when DNA of Fol race 1 was used as a template, and not when DNA of other Fol races or other fungal species was used. This method could detect 300 fg of Fol race 1 DNA, a 100-fold higher sensitivity than that obtained by conventional PCR. The method can also detect DNA extracted from soil artificially infested with Fol race 1. It is now possible to detect Fol race 1 in colonies and infected tomato stems without DNA isolation. This method is a rapid and simple tool for discrimination of Fol race 1. This study developed a loop-mediated isothermal amplification (LAMP) assay for detection and differentiation of Fusarium oxysporum f. sp. lycopersici (Fol) race 1 by using three primer sets targeting for the SIX4 and SIX5 genes. These genes are present together only in Fol race 1. This method can detect Fol race 1 in infected tomato stems without DNA extraction, affording an efficient diagnosis of Fusarium wilt on tomatoes in the field. © 2016 The Society for Applied Microbiology.

  9. Porphyromonas endodontalis: prevalence and distribution of restriction enzyme patterns in families.

    PubMed

    Petit, M D; van Winkelhoff, A J; van Steenbergen, T J; de Graaff, J

    1993-08-01

    In this study we determined the prevalence and distribution of Porphyromonas endodontalis in 26 families consisting of 107 subjects. P. endodontalis was present in 24% of the investigated subjects and was recovered most often from the dorsum of the tongue (50%). Isolation was also possible from the tonsils, the buccal mucosa, the saliva and the periodontal pocket. The usefulness of restriction endonuclease analysis as a typing method for this particular species was investigated by typing 19 isolates from unrelated individuals. All these isolates had unique restriction endonuclease patterns. The observed heterogeneity indicates that restriction endonuclease analysis is a sensitive measure of genetic dissimilarity between P. endodontalis isolates and is able to characterize individual isolates. Application of restriction endonuclease analysis to the obtained clinical isolates in this study shows the possibility of the presence of multiple clonal types within one subject. The DNA patterns of all P. endodontalis isolates from unrelated individuals were found to be distinct. In 3 families the DNA patterns of isolates from the mother and her child were indistinguishable. These data indicate the possibility of intrafamilial transmission of P. endodontalis.

  10. Molecular profiles of Venezuelan isolates of Trypanosoma sp. by random amplified polymorphic DNA method.

    PubMed

    Perrone, T M; Gonzatti, M I; Villamizar, G; Escalante, A; Aso, P M

    2009-05-12

    Nine Trypanosoma sp. Venezuelan isolates, initially presumed to be T. evansi, were collected from three different hosts, capybara (Apure state), horse (Apure state) and donkey (Guarico state) and compared by the random amplification polymorphic DNA technique (RAPD). Thirty-one to 46 reproducible fragments were obtained with 12 of the 40 primers that were used. Most of the primers detected molecular profiles with few polymorphisms between the seven horse, capybara and donkey isolates. Quantitative analyses of the RAPD profiles of these isolates revealed a high degree of genetic conservation with similarity coefficients between 85.7% and 98.5%. Ten of the primers generated polymorphic RAPD profiles with two of the three Trypanosoma sp. horse isolates, namely TeAp-N/D1 and TeGu-N/D1. The similarity coefficient between these two isolates and the rest, ranged from 57.9% to 68.4% and the corresponding dendrogram clustered TeAp-N/D1 and Te Gu-N/D1 in a genetically distinct group.

  11. Isolation of epidermal cells and cDNA cloning of TNF decoy receptor 3 of conger eel, Conger myriaster.

    PubMed

    Tsutsui, Shigeyuki; Yoshino, Yuko; Matsui, Saho; Nakamura, Osamu; Muramoto, Koji; Watanabe, Tasuku

    2008-03-01

    By using EDTA and a trypsin solution, we established a method for isolating the epidermal cells of the conger eel, Conger myriaster. We then identified TNF decoy receptor (DcR) cDNA in the species from a suppression subtractive hybridization library prepared from the epidermal cells stimulated with LPS. The full-length cDNA of conger TNF DcR (conDcR) consisted of 1479 base pairs, and the protein comprised 286 amino acid residues. Phylogenetic analysis indicated that conDcR was clustered into a DcR3 branch. ConDcR is likely to act as an important immune-regulating factor in inhibiting the apoptosis-inducing effect of TNF in the skin of conger eel.

  12. Method for performing site-specific affinity fractionation for use in DNA sequencing

    DOEpatents

    Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

    1999-01-01

    A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

  13. Miniaturized reaction vessel system, method for performing site-specific biochemical reactions and affinity fractionation for use in DNA sequencing

    DOEpatents

    Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

    2000-01-01

    A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

  14. Method for performing site-specific affinity fractionation for use in DNA sequencing

    DOEpatents

    Mirzabekov, A.D.; Lysov, Y.P.; Dubley, S.A.

    1999-05-18

    A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between the cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting the extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to the extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from the array. 14 figs.

  15. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  16. Ribotyping for differentiating Flavobacterium meningosepticum isolates from clinical and environmental sources.

    PubMed Central

    Colding, H; Bangsborg, J; Fiehn, N E; Bennekov, T; Bruun, B

    1994-01-01

    On the basis of DNA-DNA hybridization data, two main genomic relatedness groups (I and II) have been reported for a geographically varied collection of 52 strains of Flavobacterium meningosepticum. Herein, we have shown that genomic group II can be further divided into four subgroups (II:1 to II:4). To examine the taxonomic relevance of the ribosomal patterns of the 52 F. meningosepticum strains, the patterns were compared with existing DNA-DNA hybridization data with restriction enzymes PstI and HindIII. Ribotyping of the 52 F. meningosepticum strains showed banding patterns that could identify them correctly to one of the five genomic groups or subgroups. To assess the value of ribotyping for the interpretation of epidemiological data, the discriminatory power of the method was investigated for the 52 F. meningosepticum strains. With one to four restriction enzymes (PstI, HindIII, ClaI, EcoRI), a discriminatory index of 0.95 to 0.97 was found. The value of ribotyping in an epidemiological setting was assessed for three clinical isolates of F. meningosepticum from an outbreak of meningitis and bacteremia in the neonatal intensive care unit, Rigshospitalet, Copenhagen, Denmark. The three clinical isolates were shown to belong to the same ribotype, characteristic of genomic subgroup II:1. This ribotyping method will prove to be a useful tool for epidemiological studies concerning F. meningosepticum in the future. Images PMID:8150962

  17. An improved protocol for the preparation of total genomic DNA from isolates of yeast and mould using Whatman FTA filter papers.

    PubMed

    Borman, Andrew M; Fraser, Mark; Linton, Christopher J; Palmer, Michael D; Johnson, Elizabeth M

    2010-06-01

    Here, we present a significantly improved version of our previously published method for the extraction of fungal genomic DNA from pure cultures using Whatman FTA filter paper matrix technology. This modified protocol is extremely rapid, significantly more cost effective than our original method, and importantly, substantially reduces the problem of potential cross-contamination between sequential filters when employing FTA technology.

  18. Strain variation and geographic endemism in Streptococcus iniae.

    PubMed

    Kvitt, H; Colorni, A

    2004-10-21

    Twenty-six Israeli isolates of Streptococcus iniae from both marine and fresh/brackish water sources were compared with each other and with 9 foreign isolates. All the isolates were tentatively identified according to their biochemical profile. Direct sequencing of approximately 600 bp PCR products of the 16S rDNA confirmed their identification as S. iniae at the molecular level and revealed a new (one-nucleotide) variant among Israeli isolates, in addition to 2 variants that had been previously reported. Strain variation was further examined by subjecting the isolates to randomly amplified polymorphic DNA (RAPD) and amplified fragment length polymorphism (AFLP) analyses. The RAPD method allowed separation of the isolates into only 2 groups, one including 5 Israeli fresh/brackish water isolates and one including all the other isolates. The AFLP method grouped the Israeli marine isolates into one homogeneous cluster, although they had been obtained in different years (1995 to 2001) from different species of fish, and from wild (Red Sea) as well as cultured (both Mediterranean and Red Sea) sources. The Israeli fresh/brackish water isolates and foreign isolates separated into distinct entities that clustered at generally high degrees of similarity. The distance between the clusters of the Israeli marine and fresh/brackish water isolates indicates that the S. iniae streptococcosis that has been afflicting the aquaculture industries in the 2 environments in recent years was caused by distinct strains. AFLP showed superior discriminative properties over RAPD in detecting intraspecific variation and proved to be an important tool for the characterization of S. iniae. A correlation between strain variation and geographic endemism was established.

  19. Survey of resistance of Pseudomonas aeruginosa from UK patients with cystic fibrosis to six commonly prescribed antimicrobial agents

    PubMed Central

    Pitt, T; Sparrow, M; Warner, M; Stefanidou, M

    2003-01-01

    Methods: The susceptibility of 417 CF patient isolates of P aeruginosa from 17 hospitals to six commonly prescribed antibiotics were examined. Isolates were tested by an agar break point dilution method and E-tests according to British Society of Antimicrobial Chemotherapy guidelines. Genotyping of isolates was performed by XbaI DNA macrorestriction and pulsed field gel electrophoresis. Results: 38% of isolates were susceptible to all of the agents tested; almost half were resistant to gentamicin compared with ceftazidime (39%), piperacillin (32%), ciprofloxacin (30%), tobramycin (10%), and colistin (3%). Approximately 40% were resistant to two or more compounds with ceftazidime in combination with gentamicin, piperacillin or ciprofloxacin being the most common cross resistances. Resistance rates were generally similar to those reported recently from the USA and Germany. A selection of resistant isolates proved to be predominantly genotypically distinct by XbaI DNA macrorestriction but six pairs from three centres had similar genotypes. Conclusions: The level of resistance to front line antipseudomonal agents, with the exception of colistin, is disturbingly high. The prudent use of antimicrobial drugs and closer monitoring of accumulation of resistant strain populations should be actively considered. PMID:12947141

  20. Preparation of fosmid libraries and functional metagenomic analysis of microbial community DNA.

    PubMed

    Martínez, Asunción; Osburne, Marcia S

    2013-01-01

    One of the most important challenges in contemporary microbial ecology is to assign a functional role to the large number of novel genes discovered through large-scale sequencing of natural microbial communities that lack similarity to genes of known function. Functional screening of metagenomic libraries, that is, screening environmental DNA clones for the ability to confer an activity of interest to a heterologous bacterial host, is a promising approach for bridging the gap between metagenomic DNA sequencing and functional characterization. Here, we describe methods for isolating environmental DNA and constructing metagenomic fosmid libraries, as well as methods for designing and implementing successful functional screens of such libraries. © 2013 Elsevier Inc. All rights reserved.

  1. Enhancing DNA electro-transformation efficiency on a clinical Staphylococcus capitis isolate.

    PubMed

    Cui, Bintao; Smooker, Peter M; Rouch, Duncan A; Deighton, Margaret A

    2015-02-01

    Clinical staphylococcus isolates possess a stronger restriction-modification (RM) barrier than laboratory strains. Clinical isolates are therefore more resistant to acceptance of foreign genetic material than laboratory strains, as their restriction systems more readily recognize and destroy foreign DNA. This stronger barrier consequently restricts genetic studies to a small number of domestic strains that are capable of accepting foreign DNA. In this study, an isolate of Staphylococcus capitis, obtained from the blood of a very low birth-weight baby, was transformed with a shuttle vector, pBT2. Optimal conditions for electro-transformation were as follows: cells were harvested at mid-log phase, electro-competent cells were prepared; cells were pre-treated at 55°C for 1min; 3μg of plasmid DNA was mixed with 70-80μL of competent cells (3-4×10(10)cells/mL) at 20°C in 0.5M sucrose, 10% glycerol; and electroporation was conducted using 2.1kV/cm field strength with a 0.1cm gap. Compared to the conventional method, which involves DNA electroporation of Staphylococcus aureus RN4220 as an intermediate strain to overcome the restriction barrier, our proposed approach exhibits a higher level (3 log10 units) of transformation efficiency. Heat treatment was used to temporarily inactivate the recipient RM barrier. Other important parameters contributing to improved electro-transformation efficiency were growth stage for cell harvesting, the quantity of DNA, the transformation temperature and field strength. The approach described here may facilitate genetic manipulations of this opportunistic pathogen. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Methods to isolate extracellular vesicles for diagnosis

    NASA Astrophysics Data System (ADS)

    Kang, Hyejin; Kim, Jiyoon; Park, Jaesung

    2017-12-01

    Extracellular vesicles (EVs) are small membrane-bound bodies that are released into extracellular space by diverse cells, and are found in body fluids like blood, urine and saliva. EVs contain RNA, DNA and proteins, which can be biomarkers for diagnosis. EVs can be obtained by minimally-invasive biopsy, so they are useful in disease diagnosis. High yield and purity contribute to precise diagnosis of disease, but damaged EVs and impurities can cause confu sed results. However, EV isolation methods have different yields and purities. Furthermore, the isolation method that is most suitable to maximize EV recovery efficiency depends on the experimental conditions. This review focuses on merits and demerits of several types of EV isolation methods, and provides examples of how to diagnose disease by exploiting information obtained by analysis of EVs.

  3. Diversity of Hindgut Bacterial Population in Subterranean Termite, Reticulitermes flavipes

    Treesearch

    Olanrewaju Raji; Dragica Jeremic-Nikolic; Juliet D. Tang

    2017-01-01

    The termite hindgut contains a bacterial community that symbiotically aids in digestion of cellulosic materials. For this paper, a species survey of bacterial hindgut symbionts in termites collected from Saucier, Mississippi was examined. Two methods were tested for optimal genetic material isolation. Genomic DNA was isolated from the hindgut luminal contents of five...

  4. Comparison of six extraction techniques for isolation of DNA from filamentous fungi.

    PubMed

    van Burik, J A; Schreckhise, R W; White, T C; Bowden, R A; Myerson, D

    1998-10-01

    Filamentous fungi have a sturdy cell wall which is resistant to the usual DNA extraction procedures. We determined the DNA extraction procedure with the greatest yield of high quality fungal DNA and the least predilection for cross-contamination of equipment between specimens. Each of six extraction methods was performed using Aspergillus fumigatus hyphae. The six methods were: (1) glass bead pulverization with vortexing; (2) grinding with mortar and pestle followed by glass bead pulverization; (3) glass bead pulverization using 1% hydroxyacetyl trimethyl ammonium bromide (CTAB) buffer in a water bath sonicator; (4) water bath sonication in CTAB buffer; (5) grinding followed by incubation with CTAB; and (6) lyticase enzymatic cell lysis. Genomic DNA yields were measured by spectrophotometry and by visual reading of 2% agarose gels, with shearing assessed by the migration of the DNA on the gel. Genomic fungal DNA yields were highest for Method 1, followed by Methods 5 approximately = to 2 >3 approximately = to 4 approximately = to 6. Methods 2 and 5, both of which involved grinding with mortar and pestle, led to shearing of the genomic DNA in one of two trials each. We conclude that the use of glass beads with extended vortexing is optimal for extraction of microgramme amounts of DNA from filamentous fungal cultures.

  5. Bat white-nose syndrome: a real-time TaqMan polymerase chain reaction test targeting the intergenic spacer region of Geomyces destructanstructans.

    USGS Publications Warehouse

    Muller, Laura K.; Lorch, Jeffrey M.; Lindner, Daniel L.; O'Connor, Michael; Gargas, Andrea; Blehert, David S.

    2013-01-01

    The fungus Geomyces destructans is the causative agent of white-nose syndrome (WNS), a disease that has killed millions of North American hibernating bats. We describe a real-time TaqMan PCR test that detects DNA from G. destructans by targeting a portion of the multicopy intergenic spacer region of the rRNA gene complex. The test is highly sensitive, consistently detecting as little as 3.3 fg of genomic DNA from G. destructans. The real-time PCR test specifically amplified genomic DNA from G. destructans but did not amplify target sequence from 54 closely related fungal isolates (including 43 Geomyces spp. isolates) associated with bats. The test was further qualified by analyzing DNA extracted from 91 bat wing skin samples, and PCR results matched histopathology findings. These data indicate the real-time TaqMan PCR method described herein is a sensitive, specific, and rapid test to detect DNA from G. destructans and provides a valuable tool for WNS diagnostics and research.

  6. A highly efficient strategy to determine genotypes of genetically-engineered mice using genomic DNA purified from hair roots.

    PubMed

    Otaño-Rivera, Víctor; Boakye, Amma; Grobe, Nadja; Almutairi, Mohammed M; Kursan, Shams; Mattis, Lesan K; Castrop, Hayo; Gurley, Susan B; Elased, Khalid M; Boivin, Gregory P; Di Fulvio, Mauricio

    2017-04-01

    Genotyping of genetically-engineered mice is necessary for the effective design of breeding strategies and identification of mutant mice. This process relies on the identification of DNA markers introduced into genomic sequences of mice, a task usually performed using the polymerase chain reaction (PCR). Clearly, the limiting step in genotyping is isolating pure genomic DNA. Isolation of mouse DNA for genotyping typically involves painful procedures such as tail snip, digit removal, or ear punch. Although the harvesting of hair has previously been proposed as a source of genomic DNA, there has been a perceived complication and reluctance to use this non-painful technique because of low DNA yields and fear of contamination. In this study we developed a simple, economic, and efficient strategy using Chelex® resins to purify genomic DNA from hair roots of mice which are suitable for genotyping. Upon comparison with standard DNA purification methods using a commercially available kit, we demonstrate that Chelex® efficiently and consistently purifies high-quality DNA from hair roots, minimizing pain, shortening time and reducing costs associated with the determination of accurate genotypes. Therefore, the use of hair roots combined with Chelex® is a reliable and more humane alternative for DNA genotyping.

  7. Usefulness of detection of clarithromycin-resistant Helicobacter pylori from fecal specimens for young adults treated with eradication therapy.

    PubMed

    Osaki, Takako; Mabe, Katsuhiro; Zaman, Cynthia; Yonezawa, Hideo; Okuda, Masumi; Amagai, Kenji; Fujieda, Shinji; Goto, Mitsuhide; Shibata, Wataru; Kato, Mototsugu; Kamiya, Shigeru

    2017-10-01

    To prevent Helicobacter pylori infection in the younger generation, it is necessary to investigate the prevalence of antibiotic-resistant H. pylori. The aim of this study was to evaluate the method of PCR-based sequencing to detect clarithromycin (CAM) resistance-associated mutations using fecal samples as a noninvasive method. DNA extracted from fecal specimens and isolates from gastric biopsy specimens were collected from patients with H. pylori infection. Antibiotic resistance to CAM was analyzed by molecular and culture methods. The detection rates of CAM resistance-associated mutations (A2142C or A2143G) were compared before and after eradication therapy. With CAM resistance of H. pylori evaluated by antibiotic susceptibility test as a gold standard, the sensitivity and the specificity of gene mutation detection from fecal DNA were 80% and 84.8%, respectively. In contrast, using DNA of isolated strains, the sensitivity and the specificity were 80% and 100%. Of the seven cases in which eradication was unsuccessful by triple therapy including CAM, CAM-resistant H. pylori, and resistance-associated mutations were detected in three cases, CAM-resistant H. pylori without the mutation was detected in two patients, and resistance-associated mutation was only detected in one patient. PCR-based sequencing to detect CAM resistance-associated mutations using isolates or fecal samples was useful for finding antibiotic-resistant H. pylori infection. Although the specificity of the detection from fecal samples compared with antibiotic susceptibility testing was lower than that from isolates, this fecal detection method is suitable especially for asymptomatic subjects including children. Further improvement is needed before clinical application. © 2017 John Wiley & Sons Ltd.

  8. Identification of the major yeasts isolated from high moisture corn and corn silages in the United States using genetic and biochemical methods.

    PubMed

    Santos, M C; Golt, C; Joerger, R D; Mechor, G D; Mourão, Gerson B; Kung, L

    2017-02-01

    The objective of this study was to identify species of yeasts in samples of high moisture corn (HMC) and corn silage (CS) collected from farms throughout the United States. Samples were plated and colonies were isolated for identification using DNA analysis. Randomly selected colonies were also identified by fatty acid methyl esters (FAME) and by physiological substrate profiling (ID 32C). For CS, Candida ethanolica, Saccharomyces bulderi, Pichia anomala, Kazachstania unispora, and Saccharomyces cerevisiae were the predominant yeasts. Pichia anomala, Issatchenkia orientalis, S. cerevisiae, and Pichia fermentans were the prevalent species in HMC. The 3 identification methods were in agreement at the species level for 16.6% of the isolates and showed no agreement for 25.7%. Agreement in species identification between ID 32C and DNA analysis, FAME and ID 32C, and FAME and DNA analysis was 41.1, 14.4, and 2.2%, respectively. Pichia anomala and I. orientalis were able to grow on lactic acid, whereas S. cerevisiae metabolized sugars (galactose, sucrose, and glucose) but failed to use lactic acid. The yeast diversity in CS and HMC varied due to type of feed and location. Differences in species assignments were seen among methods, but identification using substrate profiling generally corresponded with that based on DNA analysis. These findings provide information about the species that may be expected in silages, and this knowledge may lead to interventions that control unwanted yeasts. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  9. Long-Term Stability of Human Genomic and Human Papillomavirus DNA Stored in BD SurePath and Hologic PreservCyt Liquid-Based Cytology Media

    PubMed Central

    Agreda, Patricia M.; Beitman, Gerard H.; Gutierrez, Erin C.; Harris, James M.; Koch, Kristopher R.; LaViers, William D.; Leitch, Sharon V.; Maus, Courtney E.; McMillian, Ray A.; Nussbaumer, William A.; Palmer, Marcus L. R.; Porter, Michael J.; Richart, Gregory A.; Schwab, Ryan J.

    2013-01-01

    We evaluated the effect of storage at 2 to 8°C on the stability of human genomic and human papillomavirus (HPV) DNA stored in BD SurePath and Hologic PreservCyt liquid-based cytology media. DNA retained the ability to be extracted and PCR amplified for more than 2.5 years in both medium types. Prior inability to detect DNA in archived specimens may have been due to failure of the extraction method to isolate DNA from fixed cells. PMID:23678069

  10. Rapid step-gradient purification of mitochondrial DNA.

    PubMed

    Welter, C; Meese, E; Blin, N

    1988-01-01

    A convenient modification of the step gradient (CsCl/ethidium bomide) procedure is described. This rapid method allows isolation of covalently closed circular DNA separated from contaminating proteins, RNA and chromosomal DNA in ca. 5 h. Large scale preparations can be performed for circular DNA from eukaryotic organelles (mitochondria). The protocol uses organelle pelleting/NaCl-sarcosyl incubation steps for mitochondria followed by a CsCl step gradient and exhibits yields equal to the conventional procedures. It results in DNA sufficiently pure to be used for restriction endonuclease analysis, subcloning, 5'-end labeling, gel retention assays, and various types of hybridization.

  11. Potency of Bacillus thuringiensis isolates from bareng Tenes-Malang City as a biological control agent for suppressing third instar of Aedes aegypti larvae

    NASA Astrophysics Data System (ADS)

    Lutfiana, Nihayatul; Gama, Zulfaidah Penata

    2017-11-01

    Dengue is a mosquito-borne viral disease that is transmitted by the female Aedes species. The number of dengue fever cases has increased in many geographic regions including Indonesia and one of them occurred in Bareng Tenes, Malang City, East Java Province. The objective of this research was to identify the potency of B. thuringeinsis isolates from Bareng Tenes, Malang, as the biological agent to control third instar Ae. aegypti larvae and to identify the potential B. thuringiensis isolates based on 16S rDNA sequence. B. thuringiensis was isolated from water and soil from 12 sites in the Bareng Tenes area. Bacterial isolation was performed using B. thuringiensis selective media. Several isolates had similar phenotypic characters with B. thuringiensis used to toxicity test against third instar Ae. aegypti larvae. The LC50-96h value was determined using probit regression. The most effective isolate was identified based on the 16S rDNA sequence, then aligned to the reference isolate using the BLAST program. A phylogeny tree was constructed using the Maximum Likelihood method. This study showed that among 22 isolates of B. thuringiensis, only BA02b, BS04a, and BA03a isolates have similar phenotypic characters with B. thuringiensis. Based on the toxicity test of B. thuringiensis against the third instar of Ae. aegypti larvae, it was indicated that BA02b and BA03a isolates were the potential agents to control Ae. aegypti larvae. BA02b isolate was the most effective B. thuringiensis (LC50-96h = 2,75 x 107 cell/mL). Based on 16S rDNA sequence, BA02b was identified as Bacillus thuringiensis var. Israelensis BGSC4Q2 (99 % similarities).

  12. Detection of a transient mitochondrial DNA heteroplasmy in the progeny of crossed genetically divergent isolates of arbuscular mycorrhizal fungi.

    PubMed

    de la Providencia, Ivan Enrique; Nadimi, Maryam; Beaudet, Denis; Morales, Gabriela Rodriguez; Hijri, Mohamed

    2013-10-01

    Nonself fusion and nuclear genetic exchange have been documented in arbuscular mycorrhizal fungi (AMF), particularly in Rhizophagus irregularis. However, mitochondrial transmission accompanying nonself fusion of genetically divergent isolates remains unknown. Here, we tested the hypothesis that mitochondrial DNA (mtDNA) heteroplasmy occurs in the progeny of spores, obtained by crossing genetically divergent mtDNAs in R. irregularis isolates. Three isolates of geographically distant locations were used to investigate nonself fusions and mtDNA transmission to the progeny. We sequenced two additional mtDNAs of two R. irregularis isolates and developed isolate-specific size-variable markers in intergenic regions of these isolates and those of DAOM-197198. We achieved three crossing combinations in pre-symbiotic and symbiotic phases. Progeny spores per crossing combination were genotyped using isolate-specific markers. We found evidence that nonself recognition occurs between isolates originating from different continents both in pre-symbiotic and symbiotic phases. Genotyping patterns of individual spores from the progeny clearly showed the presence of markers of the two parental mtDNA haplotypes. Our results demonstrate that mtDNA heteroplasmy occurs in the progeny of the crossed isolates. However, this heteroplasmy appears to be a transient stage because all the live progeny spores that were able to germinate showed only one mtDNA haplotype. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

  13. Monitoring of resistance genes in Listeria monocytogenes isolates and their presence in the extracellular DNA of biofilms: a case study from the Czech Republic.

    PubMed

    Boháčová, Martina; Zdeňková, Kamila; Tomáštíková, Zuzana; Fuchsová, Viviana; Demnerová, Kateřina; Karpíšková, Renáta; Pazlarová, Jarmila

    2018-04-21

    The alarming occurrence of antibiotic resistance genes in food production demands continuous monitoring worldwide. One reservoir of resistance genes is thought to be eDNA. There is currently little available information in Europe about either the extracellular DNA distribution of the bacterium or the spread of resistance genes in L. monocytogenes. Therefore, our aims were to give insight into the Listeria monocytogenes resistance situation in the Czech Republic and assess the presence of resistance genes in their extracellular DNA (eDNA). First, susceptibility tests were performed on 49 isolates of L. monocytogenes with selected antibiotics. Next, we tested DNA of suspected isolates for the presence of resistance genes in both planktonic cells and the eDNA of biofilms. Finally, fluorescent confocal microscopy was used to observe the eDNA pattern of selected isolates under conditions that mimicked the food processing environment and the human body. Susceptibility tests found isolates intermediate resistant to chloramphenicol, tetracycline, and ciprofloxacin as well as isolates resistant to ciprofloxacin. For all suspected isolates, PCR confirmed the presence of the gene lde encoding efflux pump in both types of DNA. When the biofilm was observed using confocal laser scanning microscope, the eDNA distribution patterns varied considerably according to the culture conditions. Furthermore, the food and clinical isolates varied in terms of the amount of eDNA detected. The presence of an efflux pump in both types of DNA suggests that the eDNA might serve as a reservoir of resistance genes. Surprising differences were observed in the eDNA pattern. Our results suggest that the current risk of the spread of L. monocytogenes resistance genes is low in the Czech Republic, but they also indicate the need for continuous long-term monitoring of the situation.

  14. Use of molecular markers to compare Fusarium verticillioides pathogenic strains isolated from plants and humans.

    PubMed

    Chang, S C; Macêdo, D P C; Souza-Motta, C M; Oliveira, N T

    2013-08-12

    Fusarium verticillioides is a pathogen of agriculturally important crops, especially maize. It is considered one of the most important pathogens responsible for fumonisin contamination of food products, which causes severe, chronic, and acute intoxication in humans and animals. Moreover, it is recognized as a cause of localized infections in immunocompetent patients and disseminated infections among severely immunosuppressed patients. Several molecular tools have been used to analyze the intraspecific variability of fungi. The objective of this study was to use molecular markers to compare pathogenic isolates of F. verticillioides and isolates of the same species obtained from clinical samples of patients with Fusarium mycoses. The molecular markers that we used were inter-simple sequence repeat markers (primers GTG5 and GACA4), intron splice site primer (primer EI1), random amplified polymorphic DNA marker (primer OPW-6), and restriction fragment length polymorphism-internal transcribed spacer (ITS) from rDNA. From the data obtained, clusters were generated based on the UPGMA clustering method. The amplification products obtained using primers ITS4 and ITS5 and loci ITS1-5.8-ITS2 of the rDNA yielded fragments of approximately 600 bp for all the isolates. Digestion of the ITS region fragment using restriction enzymes such as EcoRI, DraI, BshI, AluI, HaeIII, HinfI, MspI, and PstI did not permit differentiation among pathogenic and clinical isolates. The inter-simple sequence repeat, intron splice site primer, and random amplified polymorphic DNA markers presented high genetic homogeneity among clinical isolates in contrast to the high variability found among the phytopathogenic isolates of F. verticillioides.

  15. Isolation of the constitutive heterochromatin from mouse liver nuclei.

    PubMed

    Zatsepina, Olga V; Zharskaya, Oxana O; Prusov, Andrei N

    2008-01-01

    A method for isolation of constitutive heterochromatin (chromocenters) from nuclei of mouse liver cells is described. This method is based on the higher resistance of chromocenters to low ionic strength treatment as compared with that of nucleoli and euchromatin. The method allows separation of chromocenters that are essentially free of nucleoli and other nuclear contaminants. In contrast to nuclei and nucleoli, isolated chromocenters are characterized by a simpler protein composition and contain a smaller number of proteins (especially of high molecular weight proteins). They possess telomeric DNA and telomerase activity that suggests a tight association of chromocenters with the telomerase complex in mouse hepatocyte nuclei.

  16. Isolation of plasmid from the blue-green alga Spirulina platensis

    NASA Astrophysics Data System (ADS)

    Qin, Song; Tong, Shun; Zhang, Peijun; Tseng, C. K.

    1993-09-01

    CCC plasmid was isolated from an economically important blue-green alga — Spirulina platensis (1.7×106 dalton from the S6 strain and 1.2×106 dalton from the F3 strain) using a rapid method based on ultrasonic disruption of algal cells and alkaline removal of chromosomal DNA. The difference in the molecular weight of the CCC DNAs from the two strains differing in form suggests that plasmid may be related with the differentiation of algal form. This modified method, which does not use any lysozyme, is a quick and effective method of plasmid isolation, especially for filamentous blue-green algae.

  17. Methods for detection of methyl-CpG dinucleotides

    DOEpatents

    Dunn, John J

    2013-11-26

    The invention provides methods for enriching methyl-CpG sequences from a DNA sample. The method makes use of conversion of cytosine residues to uracil under conditions in which methyl-cytosine residues are preserved. Additional methods of the invention enable to preservation of the context of me-CpG dinucleotides. The invention also provides a recombinant, full length and substantially pure McrA protein (rMcrA) for binding and isolation of DNA fragments containing the sequence 5'-C.sup.MeCpGG-3'. Methods for making and using the rMcrA protein, and derivatives thereof are provided.

  18. Methods for detection of methyl-CpG dinucleotides

    DOEpatents

    Dunn, John J.

    2013-01-29

    The invention provides methods for enriching methyl-CpG sequences from a DNA sample. The method makes use of conversion of cytosine residues to uracil under conditions in which methyl-cytosine residues are preserved. Additional methods of the invention enable to preservation of the context of me-CpG dinucleotides. The invention also provides a recombinant, full length and substantially pure McrA protein (rMcrA) for binding and isolation of DNA fragments containing the sequence 5'-C.sup.MeCpGG-3'. Methods for making and using the rMcrA protein, and derivatives thereof are provided.

  19. Methods for detection of methyl-CpG dinucleotides

    DOEpatents

    Dunn, John J.

    2012-09-11

    The invention provides methods for enriching methyl-CpG sequences from a DNA sample. The method makes use of conversion of cytosine residues to uracil under conditions in which methyl-cytosine residues are preserved. Additional methods of the invention enable to preservation of the context of me-CpG dinucleotides. The invention also provides a recombinant, full length and substantially pure McrA protein (rMcrA) for binding and isolation of DNA fragments containing the sequence 5'-C.sup.MeCpGG-3'. Methods for making and using the rMcrA protein, and derivatives thereof are provided.

  20. Comparison of commercial DNA extraction kits for isolation and purification of bacterial and eukaryotic DNA from PAH-contaminated soils.

    PubMed

    Mahmoudi, Nagissa; Slater, Greg F; Fulthorpe, Roberta R

    2011-08-01

    Molecular characterization of the microbial populations of soils and sediments contaminated with polycyclic aromatic hydrocarbons (PAHs) is often a first step in assessing intrinsic biodegradation potential. However, soils are problematic for molecular analysis owing to the presence of organic matter, such as humic acids. Furthermore, the presence of contaminants, such as PAHs, can cause further challenges to DNA extraction, quantification, and amplification. The goal of our study was to compare the effectiveness of four commercial soil DNA extraction kits (UltraClean Soil DNA Isolation kit, PowerSoil DNA Isolation kit, PowerMax Soil DNA Isolation kit, and FastDNA SPIN kit) to extract pure, high-quality bacterial and eukaryotic DNA from PAH-contaminated soils. Six different contaminated soils were used to determine if there were any biases among the kits due to soil properties or level of contamination. Extracted DNA was used as a template for bacterial 16S rDNA and eukaryotic 18S rDNA amplifications, and PCR products were subsequently analyzed using denaturing gel gradient electrophoresis (DGGE). We found that the FastDNA SPIN kit provided significantly higher DNA yields for all soils; however, it also resulted in the highest levels of humic acid contamination. Soil texture and organic carbon content of the soil did not affect the DNA yield of any kit. Moreover, a liquid-liquid extraction of the DNA extracts found no residual PAHs, indicating that all kits were effective at removing contaminants in the extraction process. Although the PowerSoil DNA Isolation kit gave relatively low DNA yields, it provided the highest quality DNA based on successful amplification of both bacterial and eukaryotic DNA for all six soils. DGGE fingerprints among the kits were dramatically different for both bacterial and eukaryotic DNA. The PowerSoil DNA Isolation kit revealed multiple bands for each soil and provided the most consistent DGGE profiles among replicates for both bacterial and eukaryotic DNA.

  1. Archetypal analysis of diverse Pseudomonas aeruginosa transcriptomes reveals adaptation in cystic fibrosis airways

    PubMed Central

    2013-01-01

    Background Analysis of global gene expression by DNA microarrays is widely used in experimental molecular biology. However, the complexity of such high-dimensional data sets makes it difficult to fully understand the underlying biological features present in the data. The aim of this study is to introduce a method for DNA microarray analysis that provides an intuitive interpretation of data through dimension reduction and pattern recognition. We present the first “Archetypal Analysis” of global gene expression. The analysis is based on microarray data from five integrated studies of Pseudomonas aeruginosa isolated from the airways of cystic fibrosis patients. Results Our analysis clustered samples into distinct groups with comprehensible characteristics since the archetypes representing the individual groups are closely related to samples present in the data set. Significant changes in gene expression between different groups identified adaptive changes of the bacteria residing in the cystic fibrosis lung. The analysis suggests a similar gene expression pattern between isolates with a high mutation rate (hypermutators) despite accumulation of different mutations for these isolates. This suggests positive selection in the cystic fibrosis lung environment, and changes in gene expression for these isolates are therefore most likely related to adaptation of the bacteria. Conclusions Archetypal analysis succeeded in identifying adaptive changes of P. aeruginosa. The combination of clustering and matrix factorization made it possible to reveal minor similarities among different groups of data, which other analytical methods failed to identify. We suggest that this analysis could be used to supplement current methods used to analyze DNA microarray data. PMID:24059747

  2. Quantitative cytochemistry of nuclear and cytoplasmic proteins using the Naphthol Yellow S and dinitrofluorobenzene staining methods.

    PubMed

    Tas, J; James, J

    1981-09-01

    The 'total protein staining' of biological specimens with the electrostatically binding Naphthol Yellow S or the covalently binding dinitrofluorobenzene must be interpreted as methods which yield data on the specific amino acid pool of the proteins concerned. Both dyes bind to certain free amino-acid side-chains, giving different dye--protein ratios for various proteins. In the presence of DNA, dinitrofluorobenzene stains all proteins present in cell nuclei, whereas Naphthol Yellow S only stains the majority of the non-histone proteins. When protein staining methods are combined with the Feulgen--Pararosanile (SO2) procedure for DNA, decreased Feulgen--DNA contents were measured in dinitrofluorobenzene-stained isolated nuclei and lymphocytes.

  3. Investigation of irradiated rats DNA in the presence of Cu(II) chelates of amino acids Schiff bases.

    PubMed

    Karapetyan, N H; Torosyan, A L; Malakyan, M; Bajinyan, S A; Haroutiunian, S G

    2016-01-01

    The new synthesized Cu(II) chelates of amino acids Schiff bases were studied as a potential radioprotectors. Male albino rats of Wistar strain were exposed to X-ray whole-body irradiation at 4.8 Gy. This dose caused 30% mortality of the animals (LD30). The survival of animals exposed to radiation after preliminary administration of 10 mg/kg Cu(II)(Nicotinyl-L-Tyrosinate)2 or Cu(II)(Nicotinyl-L-Tryptophanate)2 prior to irradiation was registered about 80 and 100% correspondingly. Using spectrophotometric melting and agarose gel electrophoresis methods, the differences between the DNA isolated from irradiated rats and rats pretreated with Cu(II) chelates were studied. The fragments of DNA with different breaks were revealed in DNA samples isolated from irradiated animals. While, the repair of the DNA structure was observed for animals pretreated with the Cu(II) chelates. The results suggested that pretreatment of the irradiated rats with Cu(II)(Nicotinyl-L-Tyrosinate)2 and Cu(II)(Nicotinyl-L-Tryptophanate)2 compounds improves the liver DNA characteristics.

  4. Molecular transformation, gene cloning, and gene expression systems for filamentous fungi

    USGS Publications Warehouse

    Gold, Scott E.; Duick, John W.; Redman, Regina S.; Rodriguez, Rusty J.

    2001-01-01

    This chapter discusses the molecular transformation, gene cloning, and gene expression systems for filamentous fungi. Molecular transformation involves the movement of discrete amounts of DNA into cells, the expression of genes on the transported DNA, and the sustainable replication of the transforming DNA. The ability to transform fungi is dependent on the stable replication and expression of genes located on the transforming DNA. Three phenomena observed in bacteria, that is, competence, plasmids, and restriction enzymes to facilitate cloning, were responsible for the development of molecular transformation in fungi. Initial transformation success with filamentous fungi, involving the complementation of auxotrophic mutants by exposure to sheared genomic DNA or RNA from wt isolates, occurred with low transformation efficiencies. In addition, it was difficult to retrieve complementing DNA fragments and isolate genes of interest. This prompted the development of transformation vectors and methods to increase efficiencies. The physiological studies performed with fungi indicated that the cell wall could be removed to generate protoplasts. It was evident that protoplasts could be transformed with significantly greater efficiencies than walled cells.

  5. Novel Method Developed to Further the Understanding of DNA Palindromes | Poster

    Cancer.gov

    Editor's note: Platinum Highlight articles are noteworthy publications selected periodically by Dr. Craig Reynolds, associate director, National Cancer Institute, from among the most recently published Platinum Publications. When Alison Rattray and colleagues in the Gene Regulation and Chromosome Biology Laboratory (GRCBL) examined a mutant yeast cell they had isolated in a screen, they noticed something strange. The DNA exhibited a “very specific, but weird, rearrangement,” she explained. The arrangement turned out to be a DNA palindrome, “opening the door to studying these elusive DNA motifs,” she said.

  6. Development of goose- and duck-specific DNA markers to determine sources of Escherichia coli in waterways.

    PubMed

    Hamilton, Matthew J; Yan, Tao; Sadowsky, Michael J

    2006-06-01

    The contamination of waterways with fecal material is a persistent threat to public health. Identification of the sources of fecal contamination is a vital component for abatement strategies and for determination of total maximum daily loads. While phenotypic and genotypic techniques have been used to determine potential sources of fecal bacteria in surface waters, most methods require construction of large known-source libraries, and they often fail to adequately differentiate among environmental isolates originating from different animal sources. In this study, we used pooled genomic tester and driver DNAs in suppression subtractive hybridizations to enrich for host source-specific DNA markers for Escherichia coli originating from locally isolated geese. Seven markers were identified. When used as probes in colony hybridization studies, the combined marker DNAs identified 76% of the goose isolates tested and cross-hybridized, on average, with 5% of the human E. coli strains and with less than 10% of the strains obtained from other animal hosts. In addition, the combined probes identified 73% of the duck isolates examined, suggesting that they may be useful for determining the contribution of waterfowl to fecal contamination. However, the hybridization probes reacted mainly with E. coli isolates obtained from geese in the upper midwestern United States, indicating that there is regional specificity of the markers identified. Coupled with high-throughput, automated macro- and microarray screening, these markers may provide a quantitative, cost-effective, and accurate library-independent method for determining the sources of genetically diverse E. coli strains for use in source-tracking studies. However, future efforts to generate DNA markers specific for E. coli must include isolates obtained from geographically diverse animal hosts.

  7. Evaluation of partial 16S ribosomal DNA sequencing for identification of nocardia species by using the MicroSeq 500 system with an expanded database.

    PubMed

    Cloud, Joann L; Conville, Patricia S; Croft, Ann; Harmsen, Dag; Witebsky, Frank G; Carroll, Karen C

    2004-02-01

    Identification of clinically significant nocardiae to the species level is important in patient diagnosis and treatment. A study was performed to evaluate Nocardia species identification obtained by partial 16S ribosomal DNA (rDNA) sequencing by the MicroSeq 500 system with an expanded database. The expanded portion of the database was developed from partial 5' 16S rDNA sequences derived from 28 reference strains (from the American Type Culture Collection and the Japanese Collection of Microorganisms). The expanded MicroSeq 500 system was compared to (i). conventional identification obtained from a combination of growth characteristics with biochemical and drug susceptibility tests; (ii). molecular techniques involving restriction enzyme analysis (REA) of portions of the 16S rRNA and 65-kDa heat shock protein genes; and (iii). when necessary, sequencing of a 999-bp fragment of the 16S rRNA gene. An unknown isolate was identified as a particular species if the sequence obtained by partial 16S rDNA sequencing by the expanded MicroSeq 500 system was 99.0% similar to that of the reference strain. Ninety-four nocardiae representing 10 separate species were isolated from patient specimens and examined by using the three different methods. Sequencing of partial 16S rDNA by the expanded MicroSeq 500 system resulted in only 72% agreement with conventional methods for species identification and 90% agreement with the alternative molecular methods. Molecular methods for identification of Nocardia species provide more accurate and rapid results than the conventional methods using biochemical and susceptibility testing. With an expanded database, the MicroSeq 500 system for partial 16S rDNA was able to correctly identify the human pathogens N. brasiliensis, N. cyriacigeorgica, N. farcinica, N. nova, N. otitidiscaviarum, and N. veterana.

  8. Using Partial Genomic Fosmid Libraries for Sequencing CompleteOrganellar Genomes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McNeal, Joel R.; Leebens-Mack, James H.; Arumuganathan, K.

    2005-08-26

    Organellar genome sequences provide numerous phylogenetic markers and yield insight into organellar function and molecular evolution. These genomes are much smaller in size than their nuclear counterparts; thus, their complete sequencing is much less expensive than total nuclear genome sequencing, making broader phylogenetic sampling feasible. However, for some organisms it is challenging to isolate plastid DNA for sequencing using standard methods. To overcome these difficulties, we constructed partial genomic libraries from total DNA preparations of two heterotrophic and two autotrophic angiosperm species using fosmid vectors. We then used macroarray screening to isolate clones containing large fragments of plastid DNA. Amore » minimum tiling path of clones comprising the entire genome sequence of each plastid was selected, and these clones were shotgun-sequenced and assembled into complete genomes. Although this method worked well for both heterotrophic and autotrophic plants, nuclear genome size had a dramatic effect on the proportion of screened clones containing plastid DNA and, consequently, the overall number of clones that must be screened to ensure full plastid genome coverage. This technique makes it possible to determine complete plastid genome sequences for organisms that defy other available organellar genome sequencing methods, especially those for which limited amounts of tissue are available.« less

  9. Review and International Recommendation of Methods for Typing Neisseria gonorrhoeae Isolates and Their Implications for Improved Knowledge of Gonococcal Epidemiology, Treatment, and Biology

    PubMed Central

    Unemo, Magnus; Dillon, Jo-Anne R.

    2011-01-01

    Summary: Gonorrhea, which may become untreatable due to multiple resistance to available antibiotics, remains a public health problem worldwide. Precise methods for typing Neisseria gonorrhoeae, together with epidemiological information, are crucial for an enhanced understanding regarding issues involving epidemiology, test of cure and contact tracing, identifying core groups and risk behaviors, and recommending effective antimicrobial treatment, control, and preventive measures. This review evaluates methods for typing N. gonorrhoeae isolates and recommends various methods for different situations. Phenotypic typing methods, as well as some now-outdated DNA-based methods, have limited usefulness in differentiating between strains of N. gonorrhoeae. Genotypic methods based on DNA sequencing are preferred, and the selection of the appropriate genotypic method should be guided by its performance characteristics and whether short-term epidemiology (microepidemiology) or long-term and/or global epidemiology (macroepidemiology) matters are being investigated. Currently, for microepidemiological questions, the best methods for fast, objective, portable, highly discriminatory, reproducible, typeable, and high-throughput characterization are N. gonorrhoeae multiantigen sequence typing (NG-MAST) or full- or extended-length porB gene sequencing. However, pulsed-field gel electrophoresis (PFGE) and Opa typing can be valuable in specific situations, i.e., extreme microepidemiology, despite their limitations. For macroepidemiological studies and phylogenetic studies, DNA sequencing of chromosomal housekeeping genes, such as multilocus sequence typing (MLST), provides a more nuanced understanding. PMID:21734242

  10. Comparison of six methods for the recovery of PCR-compatible microbial DNA from an agricultural biogas plant.

    PubMed

    Stagnati, L; Soffritti, G; Lanubile, A; Busconi, M

    2017-05-01

    Six different commercial methods were compared to evaluate their efficiency in recovering high quantity/quality PCR compatible microbial DNA from an agricultural biogas plant. Within the last two decades, biogas plants have been developed to produce energy from organic wastes and from devoted biomass. The complex biotransformations are performed by a diverse consortium of microorganisms that is an important reserve of genes and enzymatic activities with a huge range of applications in various commercial fields. In this respect, the ability to isolate DNA from a complex matrix is of high importance. Important parameters of the recovered DNA are good yield, purity, and quality. The methods examined showed considerable differences about quantity and quality of the recovered DNA and, usually, it was observed that a higher amount was accompanied by more degradation. DNA purity was determined by its PCR amplificability. Only two methods were able to provide DNA pure enough to be directly amplified. For the rest of the methods, a few intermediate steps such as dilution and/or the addition of polyvinylpyrrolidone were necessary to remove the inhibitors present and to amplify the DNA. Real-time PCR analysis evidenced that, as expected, prokaryotic DNA was much more abundant than eukaryotic DNA, but some methods were more suited to recovering prokaryotic or eukaryotic DNA. The digestion analysis of ribosomal DNA amplicons confirmed the influence of the methods on the final output, allowing the recovery of only a fraction of the present species as determined by sequencing a small prokaryotic and eukaryotic ribosomal library.

  11. Two micro-scale protocols for the isolation of DNA from polysaccharide-rich plant tissue.

    PubMed

    Shepherd, Lara D; McLay, Todd G B

    2011-03-01

    The high polysaccharide content of some plant species hinders the successful isolation of their DNA. As an alternative to the macro-extraction methods previously published for polysaccharide-rich plants, we present two techniques (STE/CTAB and HEPES/CTAB), which are performed in microcentrifuge tubes. These protocols are suitable for small amounts of silica gel-preserved plant tissue such as are commonly available from endangered plants. The critical step to remove polysaccharides was performing initial washes in either STE (0.25 M sucrose, 0.03 M Tris, 0.05 M EDTA) or HEPES (2% β-mercaptoethanol, 0.2% PVP, 0.1 M HEPES, pH 8.0) buffer. Precipitating the DNA at room temperature with isopropanol also aided in decreasing polysaccharide co-precipitation. Of the two protocols we present the STE/CTAB method has the advantages of being more cost-effective and avoiding the use of the hazardous chemical β-mercaptoethanol.

  12. Using single nuclei for RNA-seq to capture the transcriptome of postmortem neurons

    PubMed Central

    Krishnaswami, Suguna Rani; Grindberg, Rashel V; Novotny, Mark; Venepally, Pratap; Lacar, Benjamin; Bhutani, Kunal; Linker, Sara B; Pham, Son; Erwin, Jennifer A; Miller, Jeremy A; Hodge, Rebecca; McCarthy, James K; Kelder, Martin; McCorrison, Jamison; Aevermann, Brian D; Fuertes, Francisco Diez; Scheuermann, Richard H; Lee, Jun; Lein, Ed S; Schork, Nicholas; McConnell, Michael J; Gage, Fred H; Lasken, Roger S

    2016-01-01

    A protocol is described for sequencing the transcriptome of a cell nucleus. Nuclei are isolated from specimens and sorted by FACS, cDNA libraries are constructed and RNA-seq is performed, followed by data analysis. Some steps follow published methods (Smart-seq2 for cDNA synthesis and Nextera XT barcoded library preparation) and are not described in detail here. Previous single-cell approaches for RNA-seq from tissues include cell dissociation using protease treatment at 30 °C, which is known to alter the transcriptome. We isolate nuclei at 4 °C from tissue homogenates, which cause minimal damage. Nuclear transcriptomes can be obtained from postmortem human brain tissue stored at −80 °C, making brain archives accessible for RNA-seq from individual neurons. The method also allows investigation of biological features unique to nuclei, such as enrichment of certain transcripts and precursors of some noncoding RNAs. By following this procedure, it takes about 4 d to construct cDNA libraries that are ready for sequencing. PMID:26890679

  13. DNA probe for lactobacillus delbrueckii

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Delley, M.; Mollet, B.; Hottinger, H.

    1990-06-01

    From a genomic DNA library of Lactobacillus delbrueckii subsp. bulgaricus, a clone was isolated which complements a leucine auxotrophy of an Escherichia coli strain (GE891). Subsequent analysis of the clone indicated that it could serve as a specific DNA probe. Dot-blot hybridizations with over 40 different Lactobacillus strains showed that this clone specifically recognized L. delbrueckii subsp. delbrueckii, bulgaricus, and lactis. The sensitivity of the method was tested by using an {alpha}-{sup 32}P-labeled probe.

  14. Phenotypic and genotypic detection of Candida albicans and Candida dubliniensis strains isolated from oral mucosa of AIDS pediatric patients

    PubMed Central

    Livério, Harisson Oliveira; Ruiz, Luciana da Silva; de Freitas, Roseli Santos; Nishikaku, Angela; de Souza, Ana Clara; Paula, Claudete Rodrigues; Domaneschi, Carina

    2017-01-01

    ABSTRACT The aim of this study was to assess a collection of yeasts to verify the presence of Candida dubliniensis among strains isolated from the oral mucosa of AIDS pediatric patients which were initially characterized as Candida albicans by the traditional phenotypic method, as well as to evaluate the main phenotypic methods used in the discrimination between the two species and confirm the identification through genotypic techniques, i.e., DNA sequencing. Twenty-nine samples of C. albicans isolated from this population and kept in a fungi collection were evaluated and re-characterized. In order to differentiate the two species, phenotypic tests (Thermotolerance tests, Chromogenic medium, Staib agar, Tobacco agar, Hypertonic medium) were performed and genotypic techniques using DNA sequencing were employed for confirmation of isolated species. Susceptibility and specificity were calculated for each test. No phenotypic test alone was sufficient to provide definitive identification of C. dubliniensis or C. albicans, as opposed to results of molecular tests. After amplification and sequencing of specific regions of the 29 studied strains, 93.1% of the isolates were identified as C. albicans and 6.9% as C. dubliniensis. The Staib agar assay showed a higher susceptibility (96.3%) in comparison with other phenotypic techniques. Therefore, genotypic methods are indispensable for the conclusive identification and differentiation between these species. PMID:28423089

  15. Phenotypic and genotypic detection of Candida albicans and Candida dubliniensis strains isolated from oral mucosa of AIDS pediatric patients.

    PubMed

    Livério, Harisson Oliveira; Ruiz, Luciana da Silva; Freitas, Roseli Santos de; Nishikaku, Angela; Souza, Ana Clara de; Paula, Claudete Rodrigues; Domaneschi, Carina

    2017-04-13

    The aim of this study was to assess a collection of yeasts to verify the presence of Candida dubliniensis among strains isolated from the oral mucosa of AIDS pediatric patients which were initially characterized as Candida albicans by the traditional phenotypic method, as well as to evaluate the main phenotypic methods used in the discrimination between the two species and confirm the identification through genotypic techniques, i.e., DNA sequencing. Twenty-nine samples of C. albicans isolated from this population and kept in a fungi collection were evaluated and re-characterized. In order to differentiate the two species, phenotypic tests (Thermotolerance tests, Chromogenic medium, Staib agar, Tobacco agar, Hypertonic medium) were performed and genotypic techniques using DNA sequencing were employed for confirmation of isolated species. Susceptibility and specificity were calculated for each test. No phenotypic test alone was sufficient to provide definitive identification of C. dubliniensis or C. albicans, as opposed to results of molecular tests. After amplification and sequencing of specific regions of the 29 studied strains, 93.1% of the isolates were identified as C. albicans and 6.9% as C. dubliniensis. The Staib agar assay showed a higher susceptibility (96.3%) in comparison with other phenotypic techniques. Therefore, genotypic methods are indispensable for the conclusive identification and differentiation between these species.

  16. Introduction to Pharmaceutical Biotechnology, Volume 1; Basic techniques and concepts

    NASA Astrophysics Data System (ADS)

    Bhatia, Saurabh; Goli, Divakar

    2018-05-01

    Animal biotechnology is a broad field including polarities of fundamental and applied research, as well as DNA science, covering key topics of DNA studies and its recent applications. In Introduction to Pharmaceutical Biotechnology, DNA isolation procedures followed by molecular markers and screening methods of the genomic library are explained. Interesting areas like isolation, sequencing and synthesis of genes, with the broader coverage on synthesis of genes, are also described. The book begins with an introduction to biotechnology and its main branches, explaining both the basic science and the applications of biotechnology-derived pharmaceuticals, with special emphasis on their clinical use. It then moves on to historical development and scope of biotechnology with an overall review of early applications that scientists employed long before the field was defined.

  17. Mammalian DNA enriched for replication origins is enriched for snap-back sequences.

    PubMed

    Zannis-Hadjopoulos, M; Kaufmann, G; Martin, R G

    1984-11-15

    Using the instability of replication loops as a method for the isolation of double-stranded nascent DNA, extruded DNA enriched for replication origins was obtained and denatured. Snap-back DNA, single-stranded DNA with inverted repeats (palindromic sequences), reassociates rapidly into stem-loop structures with zero-order kinetics when conditions are changed from denaturing to renaturing, and can be assayed by chromatography on hydroxyapatite. Origin-enriched nascent DNA strands from mouse, rat and monkey cells growing either synchronously or asynchronously were purified and assayed for the presence of snap-back sequences. The results show that origin-enriched DNA is also enriched for snap-back sequences, implying that some origins for mammalian DNA replication contain or lie near palindromic sequences.

  18. [The use of multilocus sequence typing (MLST) and randomly amplified polymorphic DNA (RAPD) for the differentiation between strains of Burkholderia mallei].

    PubMed

    Antonov, V A; Altukhova, V V; Savchenko, S S; Zamaraev, V S; Iliukhin, V I; Alekseev, V V

    2007-01-01

    Burkholderia mallei is highly pathogenic microorganism for both humans and animals. In this work, the possibility of the use of the genotyping method for differentiation between strains of B. mallei was studied. A collection of 14 isolates of B. mallei was characterized using randomly amplified polymorphic DNA (RAPD) and multilocus sequence typing (MLST). RAPD was the best method used for detecting strain differences of B. mallei. It was suggested that this method would be an increasingly useful molecular epidemiological tool.

  19. Comparison of (GTG)5-oligonucleotide and ribosomal intergenic transcribed spacer (ITS)-PCR for molecular typing of Klebsiella isolates.

    PubMed

    Ryberg, Anna; Olsson, Crister; Ahrné, Siv; Monstein, Hans-Jürg

    2011-02-01

    Molecular typing of Klebsiella species has become important for monitoring dissemination of β-lactamase-producers in hospital environments. The present study was designed to evaluate poly-trinucleotide (GTG)(5)- and rDNA intergenic transcribed spacer (ITS)-PCR fingerprint analysis for typing of Klebsiella pneumoniae and Klebsiella oxytoca isolates. Multiple displacement amplified DNA derived from 19 K. pneumoniae (some with an ESBL-phenotype), 35 K. oxytoca isolates, five K. pneumoniae, two K. oxytoca, three Raoultella, and one Enterobacter aerogenes type and reference strains underwent (GTG)(5) and ITS-PCR analysis. Dendrograms were constructed using cosine coefficient and the Neighbour joining method. (GTG)(5) and ITS-PCR analysis revealed that K. pneumoniae and K. oxytoca isolates, reference and type strains formed distinct cluster groups, and tentative subclusters could be established. We conclude that (GTG)(5) and ITS-PCR analysis combined with automated capillary electrophoresis provides promising tools for molecular typing of Klebsiella isolates. Copyright © 2010 Elsevier B.V. All rights reserved.

  20. Bacillus pumilus SAFR-032 isolate

    NASA Technical Reports Server (NTRS)

    Venkateswaran, Kasthuri J. (Inventor)

    2007-01-01

    The present invention relates to discovery and isolation of a biologically pure culture of a Bacillus pumilus SAFR-032 isolate with UV sterilization resistant properties. This novel strain has been characterized on the basis of phenotypic traits, 16S rDNA sequence analysis and DNA-DNA hybridization. According to the results of these analyses, this strain belongs to the genus Bacillus. The GenBank accession number for the 16S rDNA sequence of the Bacillus pumilus SAFR-032 isolate is AY167879.

  1. Diversity of Lactobacilli in the Oral Cavities of Young Women with Dental Caries

    PubMed Central

    Caufield, P.W.; Li, Y.; Dasanayake, A.; Saxena, D.

    2009-01-01

    For nearly a century, lactobacilli (LB) in the oral cavity have been generally associated with dental caries. Here, we characterized the LB isolated from the saliva of 6 women with active caries using genetic-based taxonomical identification methods. From each subject, 30 isolates growing on Rogosa medium and presumed to be LB were analyzed. Of the 180 isolates, 176 were further characterized by biotyping, DNA melting points, DNA chromosomal fingerprinting, genotyping, and phylogenetic cluster assessment. We found a total of 30 unique genotypes of LB in the saliva of caries-active women, with each woman harboring between 2 and 8 distinct genotypes. Although Lactobacillus vaginalis, Lactobacillus fermentum, and Lactobacillus salivarius were found in 4 of 6 of the subjects, results from other studies using comparable methods show an entirely different array of LB associated with caries. These collective observations lead us to surmise that LB associated with dental caries are likely exogenous and opportunistic colonizers, arising from food or other reservoirs outside the oral cavity. PMID:17167253

  2. Translation and Assembly of Radiolabeled Mitochondrial DNA-Encoded Protein Subunits from Cultured Cells and Isolated Mitochondria.

    PubMed

    Formosa, Luke E; Hofer, Annette; Tischner, Christin; Wenz, Tina; Ryan, Michael T

    2016-01-01

    In higher eukaryotes, the mitochondrial electron transport chain consists of five multi-subunit membrane complexes responsible for the generation of cellular ATP. Of these, four complexes are under dual genetic control as they contain subunits encoded by both the mitochondrial and nuclear genomes, thereby adding another layer of complexity to the puzzle of respiratory complex biogenesis. These subunits must be synthesized and assembled in a coordinated manner in order to ensure correct biogenesis of different respiratory complexes. Here, we describe techniques to (1) specifically radiolabel proteins encoded by mtDNA to monitor the rate of synthesis using pulse labeling methods, and (2) analyze the stability, assembly, and turnover of subunits using pulse-chase methods in cultured cells and isolated mitochondria.

  3. DNA Probes Show Genetic Variation in Cyanobacterial Symbionts of the Azolla Fern and a Closer Relationship to Free-Living Nostoc Strains than to Free-Living Anabaena Strains

    PubMed Central

    Plazinski, Jacek; Zheng, Qi; Taylor, Rona; Croft, Lynn; Rolfe, Barry G.; Gunning, Brian E. S.

    1990-01-01

    Twenty-two isolates of Anabaena azollae derived from seven Azolla species from various geographic and ecological sources were characterized by DNA-DNA hybridization. Cloned DNA fragments derived from the genomic sequences of three different A. azollae isolates were used to detect restriction fragment length polymorphism among all symbiotic anabaenas. DNA clones were radiolabeled and hybridized against southern blot transfers of genomic DNAs of different isolates of A. azollae digested with restriction endonucleases. Eight DNA probes were selected to identify the Anabaena strains tested. Two were strain specific and hybridized only to A. azollae strains isolated from Azolla microphylla or Azolla caroliniana. One DNA probe was section specific (hybridized only to anabaenas isolated from Azolla ferns representing the section Euazolla), and five other probes gave finer discrimination among anabaenas representing various ecotypes of Azolla species. These cloned genomic DNA probes identified 11 different genotypes of A. azollae isolates. These included three endosymbiotic genotypes within Azolla filiculoides species and two genotypes within both A. caroliniana and Azolla pinnata endosymbionts. Although we were not able to discriminate among anabaenas extracted from different ecotypes of Azolla nilotica, Azolla mexicina, Azolla rubra and Azolla microphylla species, each of the endosymbionts was easily identified as a unique genotype. When total DNA isolated from free-living Anabaena sp. strain PCC7120 was screened, none of the genomic DNA probes gave detectable positive hybridization. Total DNA of Nostoc cycas PCC7422 hybridized with six of eight genomic DNA fragments. These data imply that the dominant symbiotic organism in association with Azolla spp. is more closely related to Nostoc spp. than to free-living Anabaena spp. Images PMID:16348182

  4. Characterization of Metarhizium species and varieties based on molecular analysis, heat tolerance and cold activity

    USGS Publications Warehouse

    Fernandes, E.K.K.; Keyser, C.A.; Chong, J.P.; Rangel, D.E.N.; Miller, M.P.; Roberts, D.W.

    2010-01-01

    Aims: The genetic relationships and conidial tolerances to high and low temperatures were determined for isolates of several Metarhizium species and varieties. Methods and Results: Molecular-based techniques [AFLP and rDNA (ITS1, ITS2 and 5??8S) gene sequencing] were used to characterize morphologically identified Metarhizium spp. isolates from a wide range of sources. Conidial suspensions of isolates were exposed to wet heat (45 ?? 0??2??C) and plated on potato dextrose agar plus yeast extract (PDAY) medium. After 8-h exposure, the isolates divided clearly into two groups: (i) all isolates of Metarhizium anisopliae var. anisopliae (Ma-an) and Metarhizium from the flavoviride complex (Mf) had virtually zero conidial relative germination (RG), (ii) Metarhizium anisopliae var. acridum (Ma-ac) isolates demonstrated high heat tolerance (c. 70-100% RG). Conidial suspensions also were plated on PDAY and incubated at 5??C for 15 days, during which time RGs for Ma-an and Ma-ac isolates were virtually zero, whereas the two Mf were highly cold active (100% RG). Conclusions: Heat and cold exposures can be used as rapid tools to tentatively identify some important Metarhizium species and varieties. Significance and Impact of the Study: Identification of Metarhizium spp. currently relies primarily on DNA-based methods; we suggest a simple temperature-based screen to quickly obtain tentative identification of isolates as to species or species complexes. ?? 2009 The Society for Applied Microbiology.

  5. Molecular Microbial Analysis of Lactobacillus Strains Isolated from the Gut of Calves for Potential Probiotic Use

    PubMed Central

    Soto, Lorena P.; Frizzo, Laureano S.; Bertozzi, Ezequiel; Avataneo, Elizabeth; Sequeira, Gabriel J.; Rosmini, Marcelo R.

    2010-01-01

    The intestinal microbiota has an influence on the growth and health status of the hosts. This is of particular interest in animals reared using intensive farming practices. Hence, it is necessary to know more about complexity of the beneficial intestinal microbiota. The use of molecular methods has revolutionized microbial identification by improving its quality and effectiveness. The specific aim of the study was to analyze predominant species of Lactobacillus in intestinal microbial ecosystem of young calves. Forty-two lactic acid bacteria (LAB) isolated from intestinal tract of young calves were characterized by: Amplified Ribosomal DNA Restriction Analysis (ARDRA), by using Hae III, Msp I, and Hinf I restriction enzymes, and 16S rDNA gene sequencing. ARDRA screening revealed nine unique patterns among 42 isolates, with the same pattern for 29 of the isolates. Gene fragments of 16S rDNA of 19 strains representing different patterns were sequenced to confirm the identification of these species. These results confirmed that ARDRA is a good tool for identification and discrimination of bacterial species isolated from complex ecosystem and between closely related groups. This paper provides information about the LAB species predominant in intestinal tract of young calves that could provide beneficial effects when administered as probiotic. PMID:20445780

  6. Variation in Ribosomal DNA among Isolates of the Mycorrhizal Fungus Cenococcum Geophilum FR.

    NASA Astrophysics Data System (ADS)

    Lobuglio, Katherine Frances

    1990-01-01

    Cenococcum geophilum Fr., a cosmopolitan mycorrhizal fungus, is well-known for its extremely wide host and habitat range. The ecological diversity of C. geophilum sharply contrasts its present taxonomic status as a monotypic form -genus. Restriction fragment length polymorphisms (RFLPs) in nuclear ribosomal DNA (rDNA) was used to assess the degree of genetic variation among 72 isolates of C. geophilum. The probe used in this study was the rDNA repeat cloned from C. geophilum isolate A145 (pCG15). Length of the rDNA repeat was approximately 9 kb. The rDNA clone was mapped for 5 restriction endonucleases. Hybridization with cloned Saccharomyces cerevisiae rDNA (pSR118, and pSR125 containing the 18S, and 5.8-25S rRNA genes respectively), and alignment of restriction endonuclease sites conserved in the rDNA genes of other fungi, were used to position the corresponding rDNAs of C. geophilum. Southern hybridizations with EcoRI, HindIII, XhoI, and PstI digested DNAs indicated extensive variation among the C. geophilum isolates, greater than has been previously reported to occur within a fungal species. Most of the rDNA polymorphisms occurred in the IGS region. Restriction endonuclease site and length polymorphisms were also observed in the 5.8S-26S genic regions. Sixteen size categories of length mutations, 6 restriction endonuclease site additions, and 4 restriction endonuclease site deletions were determined using isolate A145 as a reference. The rDNA repeat length among the isolates varied from approximately 8.5 to 10.2 kb. RFLPs were also observed in the mitochondrial (mt) 24S rRNA gene and flanking regions of HindIII digested DNAs of C. geophilum isolates representing both geographically distinct and similar origins. Among the C. geophilum isolates analyzed there were fewer RFLPs in mt-DNA than in nuclear rDNA. EcoRI rDNA phenotypes between C. geophilum and Elaphomyces anthracinus, its proposed teleomorph or sexual state, did not correspond. In addition, the four Elaphomyces species examined had smaller rDNA repeat sizes (approximately 7.3 to 8.0 kb) than that observed among C. geophilum isolates. UPGMA cluster analysis grouped C. geophilum isolates, on the basis of shared nuclear rDNA phenotypes, into a broad range of clusters ranging from 100% to 44% similarity. Limited correlation was observed among nuclear rDNA phenotypes and culture morphology, mycorrhizal characteristics, or geographic origins of the isolates. The amount of genetic variation demonstrated in this study indicates that C. geophilum is either an extremely heterogenous species or it represents more than one species and possibly more than one genus.

  7. Practical selection methods for rat and mouse round spermatids without DNA staining by flow cytometric cell sorting.

    PubMed

    Hayama, Tomonari; Yamaguchi, Tomoyuki; Kato-Itoh, Megumi; Ishii, Yumiko; Mizuno, Naoaki; Umino, Ayumi; Sato, Hideyuki; Sanbo, Makoto; Hamanaka, Sanae; Masaki, Hideki; Hirabayashi, Masumi; Nakauchi, Hiromitsu

    2016-06-01

    Round spermatid injection (ROSI) into unfertilized oocytes enables a male with a severe spermatogenesis disorder to have children. One limitation of the application of this technique in the clinic is the identification and isolation of round spermatids from testis tissue. Here we developed an efficient and simple method to isolate rodent haploid round spermatids using flow cytometric cell sorting, based on DNA content (stained with Hoechst 33342 or Dye Cycle Violet) or by cell diameter and granularity (forward and side scatter). ROSI was performed with round spermatids selected by flow cytometry, and we obtained healthy offspring from unstained cells. This non-invasive method could therefore be an effective option for breeding domestic animals and human male infertility treatment. Mol. Reprod. Dev. 83: 488-496, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  8. Detection of Multidrug Resistance in Mycobacterium tuberculosis▿

    PubMed Central

    Sekiguchi, Jun-ichiro; Miyoshi-Akiyama, Tohru; Augustynowicz-Kopeć, Ewa; Zwolska, Zofia; Kirikae, Fumiko; Toyota, Emiko; Kobayashi, Intetsu; Morita, Koji; Kudo, Koichiro; Kato, Seiya; Kuratsuji, Tadatoshi; Mori, Toru; Kirikae, Teruo

    2007-01-01

    We developed a DNA sequencing-based method to detect mutations in the genome of drug-resistant Mycobacterium tuberculosis. Drug resistance in M. tuberculosis is caused by mutations in restricted regions of the genome. Eight genome regions associated with drug resistance, including rpoB for rifampin (RIF), katG and the mabA (fabG1)-inhA promoter for isoniazid (INH), embB for ethambutol (EMB), pncA for pyrazinamide (PZA), rpsL and rrs for streptomycin (STR), and gyrA for levofloxacin, were amplified simultaneously by PCR, and the DNA sequences were determined. It took 6.5 h to complete all procedures. Among the 138 clinical isolates tested, 55 were resistant to at least one drug. Thirty-four of 38 INH-resistant isolates (89.5%), 28 of 28 RIF-resistant isolates (100%), 15 of 18 EMB-resistant isolates (83.3%), 18 of 30 STR-resistant isolates (60%), and 17 of 17 PZA-resistant isolates (100%) had mutations related to specific drug resistance. Eighteen of these mutations had not been reported previously. These novel mutations include one in rpoB, eight in katG, one in the mabA-inhA regulatory region, two in embB, five in pncA, and one in rrs. Escherichia coli isolates expressing individually five of the eight katG mutations showed loss of catalase and INH oxidation activities, and isolates carrying any of the five pncA mutations showed no pyrazinamidase activity, indicating that these mutations are associated with INH and PZA resistance, respectively. Our sequencing-based method was also useful for testing sputa from tuberculosis patients and for screening of mutations in Mycobacterium bovis. In conclusion, our new method is useful for rapid detection of multiple-drug-resistant M. tuberculosis and for identifying novel mutations in drug-resistant M. tuberculosis. PMID:17108078

  9. Exploring DNA-binding Proteins with In Vivo Chemical Cross-linking and Mass Spectrometry

    PubMed Central

    Qiu, Haibo; Wang, Yinsheng

    2009-01-01

    DNA-binding proteins are very important constituents of proteomes of all species and play crucial roles in transcription, DNA replication, recombination, repair and other activities associated with DNA. Although a number of DNA-binding proteins have been identified, many proteins involved in gene regulation and DNA repair are likely still unknown because of their dynamic and/or weak interactions with DNA. In this report, we described an approach for the comprehensive identification of DNA-binding proteins with in vivo formaldehyde cross-linking and LC-MS/MS. DNA-binding proteins could be purified via the isolation of DNA-protein complexes and released from the complexes by reversing the cross-linking. By using this method, we were able to identify more than one hundred DNA-binding proteins, such as proteins involved in transcription, gene regulation, DNA replication and repair, and a large number of proteins which are potentially associated with DNA and DNA-binding proteins. This method should be generally applicable to the investigation of other nucleic acid-binding proteins, and hold great potential in the comprehensive study of gene regulation, DNA damage response and repair, as well as many other critical biological processes at proteomic level. PMID:19714816

  10. Non-Enzymatic Detection of Bacterial Genomic DNA Using the Bio-Barcode Assay

    PubMed Central

    Hill, Haley D.; Vega, Rafael A.; Mirkin, Chad A.

    2011-01-01

    The detection of bacterial genomic DNA through a non-enzymatic nanomaterials based amplification method, the bio-barcode assay, is reported. The assay utilizes oligonucleotide functionalized magnetic microparticles to capture the target of interest from the sample. A critical step in the new assay involves the use of blocking oligonucleotides during heat denaturation of the double stranded DNA. These blockers bind to specific regions of the target DNA upon cooling, and prevent the duplex DNA from re-hybridizing, which allows the particle probes to bind. Following target isolation using the magnetic particles, oligonucleotide functionalized gold nanoparticles act as target recognition agents. The oligonucleotides on the nanoparticle (barcodes) act as amplification surrogates. The barcodes are then detected using the Scanometric method. The limit of detection for this assay was determined to be 2.5 femtomolar, and this is the first demonstration of a barcode type assay for the detection of double stranded, genomic DNA. PMID:17927207

  11. SIDR: simultaneous isolation and parallel sequencing of genomic DNA and total RNA from single cells.

    PubMed

    Han, Kyung Yeon; Kim, Kyu-Tae; Joung, Je-Gun; Son, Dae-Soon; Kim, Yeon Jeong; Jo, Areum; Jeon, Hyo-Jeong; Moon, Hui-Sung; Yoo, Chang Eun; Chung, Woosung; Eum, Hye Hyeon; Kim, Sangmin; Kim, Hong Kwan; Lee, Jeong Eon; Ahn, Myung-Ju; Lee, Hae-Ock; Park, Donghyun; Park, Woong-Yang

    2018-01-01

    Simultaneous sequencing of the genome and transcriptome at the single-cell level is a powerful tool for characterizing genomic and transcriptomic variation and revealing correlative relationships. However, it remains technically challenging to analyze both the genome and transcriptome in the same cell. Here, we report a novel method for simultaneous isolation of genomic DNA and total RNA (SIDR) from single cells, achieving high recovery rates with minimal cross-contamination, as is crucial for accurate description and integration of the single-cell genome and transcriptome. For reliable and efficient separation of genomic DNA and total RNA from single cells, the method uses hypotonic lysis to preserve nuclear lamina integrity and subsequently captures the cell lysate using antibody-conjugated magnetic microbeads. Evaluating the performance of this method using real-time PCR demonstrated that it efficiently recovered genomic DNA and total RNA. Thorough data quality assessments showed that DNA and RNA simultaneously fractionated by the SIDR method were suitable for genome and transcriptome sequencing analysis at the single-cell level. The integration of single-cell genome and transcriptome sequencing by SIDR (SIDR-seq) showed that genetic alterations, such as copy-number and single-nucleotide variations, were more accurately captured by single-cell SIDR-seq compared with conventional single-cell RNA-seq, although copy-number variations positively correlated with the corresponding gene expression levels. These results suggest that SIDR-seq is potentially a powerful tool to reveal genetic heterogeneity and phenotypic information inferred from gene expression patterns at the single-cell level. © 2018 Han et al.; Published by Cold Spring Harbor Laboratory Press.

  12. SIDR: simultaneous isolation and parallel sequencing of genomic DNA and total RNA from single cells

    PubMed Central

    Han, Kyung Yeon; Kim, Kyu-Tae; Joung, Je-Gun; Son, Dae-Soon; Kim, Yeon Jeong; Jo, Areum; Jeon, Hyo-Jeong; Moon, Hui-Sung; Yoo, Chang Eun; Chung, Woosung; Eum, Hye Hyeon; Kim, Sangmin; Kim, Hong Kwan; Lee, Jeong Eon; Ahn, Myung-Ju; Lee, Hae-Ock; Park, Donghyun; Park, Woong-Yang

    2018-01-01

    Simultaneous sequencing of the genome and transcriptome at the single-cell level is a powerful tool for characterizing genomic and transcriptomic variation and revealing correlative relationships. However, it remains technically challenging to analyze both the genome and transcriptome in the same cell. Here, we report a novel method for simultaneous isolation of genomic DNA and total RNA (SIDR) from single cells, achieving high recovery rates with minimal cross-contamination, as is crucial for accurate description and integration of the single-cell genome and transcriptome. For reliable and efficient separation of genomic DNA and total RNA from single cells, the method uses hypotonic lysis to preserve nuclear lamina integrity and subsequently captures the cell lysate using antibody-conjugated magnetic microbeads. Evaluating the performance of this method using real-time PCR demonstrated that it efficiently recovered genomic DNA and total RNA. Thorough data quality assessments showed that DNA and RNA simultaneously fractionated by the SIDR method were suitable for genome and transcriptome sequencing analysis at the single-cell level. The integration of single-cell genome and transcriptome sequencing by SIDR (SIDR-seq) showed that genetic alterations, such as copy-number and single-nucleotide variations, were more accurately captured by single-cell SIDR-seq compared with conventional single-cell RNA-seq, although copy-number variations positively correlated with the corresponding gene expression levels. These results suggest that SIDR-seq is potentially a powerful tool to reveal genetic heterogeneity and phenotypic information inferred from gene expression patterns at the single-cell level. PMID:29208629

  13. Identification of Legionella Species by Random Amplified Polymorphic DNA Profiles

    PubMed Central

    Lo Presti, François; Riffard, Serge; Vandenesch, François; Etienne, Jerome

    1998-01-01

    Random amplified polymorphic DNA (RAPD) was used for the identification of Legionella species. Primer SK2 (5′-CGGCGGCGGCGG-3′) and standardized RAPD conditions gave the technique a reproducibility of 93 to 100%, depending on the species tested. Species-specific patterns corresponding to the 42 Legionella species were consequently defined by this method; the patterns were dependent on the recognition of a core of common bands for each species. This specificity was demonstrated by testing 65 type strains and 265 environmental and clinical isolates. No serogroup-specific profiles were obtained. A number of unidentified Legionella isolates potentially corresponding to new species were clustered in four groups. RAPD analysis appears to be a rapid and reproducible technique for identification of Legionella isolates to the species level without further restriction or hybridization. PMID:9774564

  14. Identification of Mucorales From Clinical Specimens: A 4-Year Experience in a Single Institution

    PubMed Central

    Yang, Mina; Lee, Jang Ho; Kim, Young-Kwon; Ki, Chang-Seok

    2016-01-01

    Mucormycosis, a fatal opportunistic infection in immunocompromised hosts, is caused by fungi belonging to the order Mucorales. Early diagnosis based on exact identification and multidisciplinary treatments is critical. However, identification of Mucorales fungi is difficult and often delayed, resulting in poor prognosis. This study aimed to compare the results of phenotypic and molecular identification of 12 Mucorales isolates collected from 4-yr-accumulated data. All isolates were identified on the basis of phenotypic characteristics such as growth rate, colony morphology, and reproductive structures. PCR and direct sequencing were performed to target internal transcribed spacer (ITS) and/or D1/D2 regions. Target DNA sequencing identified five Lichtheimia isolates, two Rhizopus microsporus isolates, two Rhizomucor pusillus isolates, one Cunninghamella bertholletiae isolate, one Mucor fragilis isolate, and one Syncephalastrum racemosum isolate. Five of the 12 (41.7%) isolates were incorrectly identified on the basis of phenotypic identification. DNA sequencing showed that of these five isolates, two were Lichtheimia isolates, one was Mucor isolate, one was Rhizomucor isolate, and one was Rhizopus microspores. All the isolates were identified at the species level by ITS and/or D1/D2 analyses. Phenotypic differentiation and identification of Mucorales is difficult because different Mucorales share similar morphology. Our results indicate that the molecular methods employed in this study are valuable for identifying Mucorales. PMID:26522761

  15. Identification of mucorales from clinical specimens: a 4-year experience in a single institution.

    PubMed

    Yang, Mina; Lee, Jang Ho; Kim, Young Kwon; Ki, Chang Seok; Huh, Hee Jae; Lee, Nam Yong

    2016-01-01

    Mucormycosis, a fatal opportunistic infection in immunocompromised hosts, is caused by fungi belonging to the order Mucorales. Early diagnosis based on exact identification and multidisciplinary treatments is critical. However, identification of Mucorales fungi is difficult and often delayed, resulting in poor prognosis. This study aimed to compare the results of phenotypic and molecular identification of 12 Mucorales isolates collected from 4-yr-accumulated data. All isolates were identified on the basis of phenotypic characteristics such as growth rate, colony morphology, and reproductive structures. PCR and direct sequencing were performed to target internal transcribed spacer (ITS) and/or D1/D2 regions. Target DNA sequencing identified five Lichtheimia isolates, two Rhizopus microsporus isolates, two Rhizomucor pusillus isolates, one Cunninghamella bertholletiae isolate, one Mucor fragilis isolate, and one Syncephalastrum racemosum isolate. Five of the 12 (41.7%) isolates were incorrectly identified on the basis of phenotypic identification. DNA sequencing showed that of these five isolates, two were Lichtheimia isolates, one was Mucor isolate, one was Rhizomucor isolate, and one was Rhizopus microspores. All the isolates were identified at the species level by ITS and/or D1/D2 analyses. Phenotypic differentiation and identification of Mucorales is difficult because different Mucorales share similar morphology. Our results indicate that the molecular methods employed in this study are valuable for identifying Mucorales.

  16. Presence of anti-HBc is associated to high rates of HBV resolved infection and low threshold for Occult HBV Infection in HIV patients with negative HBsAg in Chile.

    PubMed

    Vargas, Jose Ignacio; Jensen, Daniela; Sarmiento, Valeska; Peirano, Felipe; Acuña, Pedro; Fuster, Felipe; Soto, Sabrina; Ahumada, Rodrigo; Huilcaman, Marco; Bruna, Mario; Jensen, Werner; Fuster, Francisco

    2016-04-01

    HBV-HIV coinfection is prevalent. Frequently, anti-HBc is the only serological marker of HBV, which can be indicative of HBV resolved infection, when found together with anti-HBs reactivity; or present as "isolated anti-HBc," related to HBV occult infection with presence of detectable DNA HBV, more prevalent in HIV-positive individuals. Regional data about this condition are scarce. Anti-HBc rapid test has been used as screening, but its performance has not been described in HIV-positive patients. The aim of this study was determine prevalence of anti-HBc in HIV-positive patients, serological pattern of HBV resolved infection and isolated anti-HBc, evaluating presence of HBV occult infection. Assess anti-HBc rapid test compared to ECLIA. Methods included measurement of anti-HBc and anti-HBs in HIV-positive patients with negative HBsAg. Serum HBV DNA quantification and HBV booster vaccination to "isolated anti-HBc" individuals. Detection of anti-HBc by rapid test and ECLIA. In 192 patients, prevalence of anti-HBc was 42.7% (82/192); associated to male gender, drug use, men-sex-men, positive-VDRL, and longer time HIV diagnosis. 34.4% (66/192) had presence of anti-HBs, mean titers of 637 ui/ml. Isolated anti-HBc in 8.3% (16/192), associated to detectable HIV viral load and no-use of HAART; in them, HBV DNA was undetectable, and 60% responded to HBV vaccination booster. Anti-HBc rapid test showed low sensibility (32.9%) compared to ECLIA. These results show that prevalence of anti-HBc in HIV-positive individuals is high, in most cases accompanied with anti-HBs as HBV resolved infection. Low prevalence of "isolated anti-HBc," with undetectable HBV DNA, and most had anamnestic response to HBV vaccination; suggest low possibility of occult HBV infection. Anti-HBc rapid test cannot be recommended as screening method for anti-HBc. © 2015 Wiley Periodicals, Inc.

  17. Method of identifying hairpin DNA probes by partial fold analysis

    DOEpatents

    Miller, Benjamin L [Penfield, NY; Strohsahl, Christopher M [Saugerties, NY

    2009-10-06

    Method of identifying molecular beacons in which a secondary structure prediction algorithm is employed to identify oligonucleotide sequences within a target gene having the requisite hairpin structure. Isolated oligonucleotides, molecular beacons prepared from those oligonucleotides, and their use are also disclosed.

  18. Method of identifying hairpin DNA probes by partial fold analysis

    DOEpatents

    Miller, Benjamin L.; Strohsahl, Christopher M.

    2008-10-28

    Methods of identifying molecular beacons in which a secondary structure prediction algorithm is employed to identify oligonucleotide sequences within a target gene having the requisite hairpin structure. Isolated oligonucleotides, molecular beacons prepared from those oligonucleotides, and their use are also disclosed.

  19. Rapid isolation of mycoviral double-stranded RNA from Botrytis cinerea and Saccharomyces cerevisiae.

    PubMed

    Castillo, Antonio; Cottet, Luis; Castro, Miguel; Sepúlveda, Felipe

    2011-01-25

    In most of the infected fungi, the mycoviruses are latent or cryptic, the infected fungus does not show disease symptoms, and it is phenotypically identical to a non-infected strain of the same species. Because of these properties, the initial stage in the search for fungi infected with mycoviruses is the detection of their viral genome, which in most of the described cases corresponds to double-stranded RNA (dsRNA). So to analyze a large number of fungal isolates it is necessary to have a simple and rapid method to detect dsRNA. A rapid method to isolate dsRNA from a virus-infected filamentous fungus, Botrytis cinerea, and from a killer strain of Saccharomyces cerevisiae using commercial minicolumns packed with CF11 cellulose was developed. In addition to being a rapid method, it allows to use small quantities of yeasts or mycelium as starting material, being obtained sufficient dsRNA quantity that can later be analyzed by agarose gel electrophoresis, treated with enzymes for its partial characterization, amplified by RT-PCR and cloned in appropriate vectors for further sequencing. The method yields high quality dsRNA, free from DNA and ssRNA. The use of nucleases to degrade the DNA or the ssRNA is not required, and it can be used to isolate dsRNA from any type of fungi or any biological sample that contains dsRNA.

  20. Do circulating tumor cells, exosomes, and circulating tumor nucleic acids have clinical utility? A report of the association for molecular pathology.

    PubMed

    Gold, Bert; Cankovic, Milena; Furtado, Larissa V; Meier, Frederick; Gocke, Christopher D

    2015-05-01

    Diagnosing and screening for tumors through noninvasive means represent an important paradigm shift in precision medicine. In contrast to tissue biopsy, detection of circulating tumor cells (CTCs) and circulating tumor nucleic acids provides a minimally invasive method for predictive and prognostic marker detection. This allows early and serial assessment of metastatic disease, including follow-up during remission, characterization of treatment effects, and clonal evolution. Isolation and characterization of CTCs and circulating tumor DNA (ctDNA) are likely to improve cancer diagnosis, treatment, and minimal residual disease monitoring. However, more trials are required to validate the clinical utility of precise molecular markers for a variety of tumor types. This review focuses on the clinical utility of CTCs and ctDNA testing in patients with solid tumors, including somatic and epigenetic alterations that can be detected. A comparison of methods used to isolate and detect CTCs and some of the intricacies of the characterization of the ctDNA are also provided. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  1. Rapid screening for nuclear genes mutations in isolated respiratory chain complex I defects.

    PubMed

    Pagniez-Mammeri, Hélène; Lombes, Anne; Brivet, Michèle; Ogier-de Baulny, Hélène; Landrieu, Pierre; Legrand, Alain; Slama, Abdelhamid

    2009-04-01

    Complex I or reduced nicotinamide adenine dinucleotide (NADH): ubiquinone oxydoreductase deficiency is the most common cause of respiratory chain defects. Molecular bases of complex I deficiencies are rarely identified because of the dual genetic origin of this multi-enzymatic complex (nuclear DNA and mitochondrial DNA) and the lack of phenotype-genotype correlation. We used a rapid method to screen patients with isolated complex I deficiencies for nuclear genes mutations by Surveyor nuclease digestion of cDNAs. Eight complex I nuclear genes, among the most frequently mutated (NDUFS1, NDUFS2, NDUFS3, NDUFS4, NDUFS7, NDUFS8, NDUFV1 and NDUFV2), were studied in 22 cDNA fragments spanning their coding sequences in 8 patients with a biochemically proved complex I deficiency. Single nucleotide polymorphisms and missense mutations were detected in 18.7% of the cDNA fragments by Surveyor nuclease treatment. Molecular defects were detected in 3 patients. Surveyor nuclease screening is a reliable method for genotyping nuclear complex I deficiencies, easy to interpret, and limits the number of sequence reactions. Its use will enhance the possibility of prenatal diagnosis and help us for a better understanding of complex I molecular defects.

  2. A new method for simultaneous detection and discrimination of Bovine herpesvirus types 1 (BoHV-1) and 5 (BoHV-5) using real time PCR with high resolution melting (HRM) analysis.

    PubMed

    Marin, M S; Quintana, S; Leunda, M R; Recavarren, M; Pagnuco, I; Späth, E; Pérez, S; Odeón, A

    2016-01-01

    Bovine herpesvirus types 1 (BoHV-1) and 5 (BoHV-5) are antigenically and genetically similar. The aim of this study was to develop a simple and reliable one-step real time PCR assay with high resolution melting (HRM) analysis for the simultaneous detection and differentiation of BoHV-1 and BoHV-5. Optimization of assay conditions was performed with DNA from reference strains. Then, DNA from field isolates, clinical samples and tissue samples of experimentally infected animals were studied by real time PCR-HRM. An efficient amplification of real time PCR products was obtained, and a clear melting curve and appropriate melting peaks for both viruses were achieved in the HRM curve analysis for BoHV type identification. BoHV was identified in all of the isolates and clinical samples, and BoHV types were properly differentiated. Furthermore, viral DNA was detected in 12/18 and 7/18 samples from BoHV-1- and BoHV-5-infected calves, respectively. Real time PCR-HRM achieved a higher sensitivity compared with virus isolation or conventional PCR. In this study, HRM was used as a novel procedure. This method provides rapid, sensitive, specific and simultaneous detection of bovine alpha-herpesviruses DNA. Thus, this technique is an excellent tool for diagnosis, research and epidemiological studies of these viruses in cattle. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Isolation and bacterial expression of a sesquiterpene synthase CDNA clone from peppermint(mentha .chi. piperita, L.) that produces the aphid alarm pheromone (E)-.beta.-farnesene

    DOEpatents

    Croteau, Rodney Bruce; Wildung, Mark Raymond; Crock, John E.

    1999-01-01

    A cDNA encoding (E)-.beta.-farnesene synthase from peppermint (Mentha piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of (E)-.beta.-farnesene synthase (SEQ ID NO:2), from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for (E)-.beta.-farnesene synthase, or for a base sequence sufficiently complementary to at least a portion of (E)-.beta.-farnesene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (E)-.beta.-farnesene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant (E)-.beta.-farnesene synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant (E)-.beta.-farnesene synthase may be used to obtain expression or enhanced expression of (E)-.beta.-farnesene synthase in plants in order to enhance the production of (E)-.beta.-farnesene, or may be otherwise employed for the regulation or expression of (E)-.beta.-farnesene synthase, or the production of its product.

  4. Biodegradation of Para Amino Acetanilide by Halomonas sp. TBZ3

    PubMed Central

    Hajizadeh, Nader; Sefidi Heris, Youssof; Zununi Vahed, Sepideh; Vallipour, Javad; Hejazi, Mohammad Amin; Golabi, Sayyed Mahdi; Asadpour-Zeynali, Karim; Hejazi, Mohammad Saeid

    2015-01-01

    Background: Aromatic compounds are known as a group of highly persistent environmental pollutants. Halomonas sp. TBZ3 was isolated from the highly salty Urmia Lake of Iran. In this study, characterization of a new Halomonas isolate called Halomonas sp. TBZ3 and its employment for biodegradation of para-amino acetanilide (PAA), as an aromatic environmental pollutant, is described. Objectives: This study aimed to characterize the TBZ3 isolate and to elucidate its ability as a biodegradative agent that decomposes PAA. Materials and Methods: Primarily, DNA-DNA hybridization between TBZ3, Halomonas denitrificans DSM18045T and Halomonas saccharevitans LMG 23976T was carried out. Para-amino acetanilide biodegradation was assessed using spectrophotometry and confirmed by gas chromatography-mass spectroscopy (GC-MS). Parameters effective on biodegradation of PAA were optimized by the Response Surface Methodology (RSM). Results: The DNA-DNA hybridization experiments between isolate TBZ3, H. denitrificans and H. saccharevitans revealed relatedness levels of 57% and 65%, respectively. According to GC-MS results, TBZ3 degrades PAA to benzene, hexyl butanoate, 3-methyl-1-heptanol and hexyl hexanoate. Temperature 32.92°C, pH 6.76, and salinity 14% are the optimum conditions for biodegradation with a confidence level of 95% (at level α = 0.05). Conclusions: According to our results, Halomonas sp. TBZ3 could be considered as a biological agent for bioremediation of PAA and possibly other similar aromatic compounds. PMID:26495103

  5. Corynebacterium pilbarense sp. nov., a non-lipophilic corynebacterium isolated from a human ankle aspirate.

    PubMed

    Aravena-Roman, M; Spröer, C; Sträubler, B; Inglis, T; Yassin, A F

    2010-07-01

    A non-lipophilic coryneform bacterium isolated from an anaerobic Bactec bottle inoculated with an ankle aspirate from a male patient was characterized by phenotypic and molecular taxonomic methods. Chemotaxonomic investigations revealed the presence of short-chain mycolic acids in the cell wall of the bacterium, a feature consistent with members of the genus Corynebacterium. Comparative 16S rRNA gene sequence analysis demonstrated that the isolate displayed 92.0-99.0 % gene sequence similarity with members of the genus Corynebacterium, with Corynebacterium ureicelerivorans as the most closely related phylogenetic species (99.0 % gene sequence similarity). However, the isolate could be genomically separated from C. ureicelerivorans on the basis of DNA-DNA hybridization studies (39.5 % relatedness). Furthermore, the isolate could also be differentiated from C. ureicelerivorans and other species of the genus Corynebacterium on the basis of biochemical properties. Based on both phenotypic and phylogenetic evidence, it is proposed that this isolate be classified as representing a novel species, Corynebacterium pilbarense sp. nov. (type strain IMMIB WACC 658(T)=DSM 45350(T)=CCUG 57942(T)).

  6. Differential impact of ionic and coordinate covalent chromium (Cr)-DNA binding on DNA replication.

    PubMed

    Fornsaglio, Jamie L; O'Brien, Travis J; Patierno, Steven R

    2005-11-01

    The reactive species produced by the reduction of Cr(VI), particularly Cr(III), can form both ionic and coordinate covalent complexes with DNA. These Cr(III)-DNA interactions consist of Cr-DNA monoadducts, Cr-DNA ternary adducts, and Cr-DNA interstrand cross-links (Cr-ICLs), the latter of which are DNA polymerase arresting lesions (PALs). We sought to determine the impact of Cr-DNA interactions on the formation of replication blocking lesions in S. cerevisiae using a PCR-based method. We found that target sequence (TS) amplification using DNA isolated from Cr(VI)-treated yeast actually increased as a function of Cr(VI) concentration. Moreover, the enhanced TS amplification was reproduced in vitro using Cr(III)-treated DNA. In contrast, PCR amplification of TS from DNA isolated from yeast exposed to equitoxic doses of the inorganic DNA cross-linking agent cisplatin (CDDP), was decreased in a concentration-dependent manner. This paradox suggested that a specific Cr-DNA interaction, such as an ionic Cr-DNA complex, was responsible for the enhanced TS amplification, thereby masking the replication-blocking effect of certain ternary Cr-DNA adducts (i.e. interstrand cross-links). To test this possibility, we removed ionically associated Cr from the DNA using salt extraction prior to PCR analysis. This procedure obviated the increased amplification and revealed a dose-dependent decrease in TS amplification and an increase in Cr-PALs. These data from DNA analyzed ex vivo after treatment of intact cells indicate that ionic interactions of Cr with DNA result in increased DNA amplification whereas coordinate-covalent Cr-DNA complexes lead to formation of Cr-PALs. Thus, these results suggest that treatment of living cells with Cr(VI) leads to two modes of Cr-binding, which may have conflicting effects on DNA replication.

  7. Strand-Specific Analysis of DNA Synthesis and Proteins Association with DNA Replication Forks in Budding Yeast.

    PubMed

    Yu, Chuanhe; Gan, Haiyun; Zhang, Zhiguo

    2018-01-01

    DNA replication initiates at DNA replication origins after unwinding of double-strand DNA(dsDNA) by replicative helicase to generate single-stranded DNA (ssDNA) templates for the continuous synthesis of leading-strand and the discontinuous synthesis of lagging-strand. Therefore, methods capable of detecting strand-specific information will likely yield insight into the association of proteins at leading and lagging strand of DNA replication forks and the regulation of leading and lagging strand synthesis during DNA replication. The enrichment and Sequencing of Protein-Associated Nascent DNA (eSPAN), which measure the relative amounts of proteins at nascent leading and lagging strands of DNA replication forks, is a step-wise procedure involving the chromatin immunoprecipitation (ChIP) of a protein of interest followed by the enrichment of protein-associated nascent DNA through BrdU immunoprecipitation. The isolated ssDNA is then subjected to strand-specific sequencing. This method can detect whether a protein is enriched at leading or lagging strand of DNA replication forks. In addition to eSPAN, two other strand-specific methods, (ChIP-ssSeq), which detects potential protein-ssDNA binding and BrdU-IP-ssSeq, which can measure synthesis of both leading and lagging strand, were developed along the way. These methods can provide strand-specific and complementary information about the association of the target protein with DNA replication forks as well as synthesis of leading and lagging strands genome wide. Below, we describe the detailed eSPAN, ChIP-ssSeq, and BrdU-IP-ssSeq protocols.

  8. Evaluation of milk sample fractions for characterization of milk microbiota from healthy and clinical mastitis cows

    PubMed Central

    Lima, Svetlana Ferreira; Bicalho, Marcela Lucas de Souza

    2018-01-01

    Amplicon sequencing technique has been increasingly applied to the clinical setting as a sensitive diagnostic tool. Therefore, it is of great importance to develop a DNA extraction method that accurate isolates DNA from complex host-associated microbiota. Given the multifactorial etiology of clinical mastitis and the diversified lifestyle of bacterial species harboring in milk, here four distinct milk sample fractions: raw whole milk, milk fat, casein-pellet, and casein-pellet + fat from healthy cows and cows with clinical mastitis, were subjected to bead-beating DNA extraction, followed by high-throughput sequencing. We aimed to identify the best approach for characterization of the milk microbiota and detection of mastitis pathogens (Klebsiella spp., Streptococcus spp. and Escherichia coli). DNA from each milk fraction tested was extracted by two commercial kits, which include physical, mechanical and chemical lysis; in total 280 DNA samples from 35 cows were analyzed. Milk-health-status were categorized into four groups (healthy group; E. coli-mastitis group; Klebsiella spp.-mastitis group; and Streptococcus spp.–mastitis group). Bacterial phyla and families were described for each milk-health-status group across milk sample fractions and DNA extraction kits. For the mastitis groups the relative abundance of f__Enterobacteriaceae and f__Streptococcaceae were compared to determine the efficacy of procedures in detecting the mastitis pathogens. The four milk fractions used allowed efficiently and uniformly detection of the causative agent of mastitis. Only 27% of the families detected in healthy milk were shared among the samples extracted from all fractions of milk samples; followed by 3, 4, and 12% for the samples from E. coli-mastitis, Klebsiella spp.-mastitis and Streptococcus spp-mastitis, respectively. However, the shared families comprised a mean relative abundance greater than 85%, regardless of milk-health-status, milk fraction and DNA isolation method. Taxonomic data at the family level showed that sequences from mastitis milk samples cultured positive for E. coli and Klebsiella spp. were predominantly affiliated with f__Enterobacteriaceae, while for Streptococcus spp. were dominated by f__Streptococcacea, followed by f__Pseudomonadaceae and f__Enterococcaceae. Microbial community analysis revealed that most of the microbial community composition corresponded to milk bacterial species irrespective of the DNA isolation method and milk fraction evaluated. PMID:29561873

  9. 16S-ARDRA and MALDI-TOF mass spectrometry as tools for identification of Lactobacillus bacteria isolated from poultry.

    PubMed

    Dec, Marta; Puchalski, Andrzej; Urban-Chmiel, Renata; Wernicki, Andrzej

    2016-06-13

    The objective of our study is to evaluate the potential use of Amplified 16S Ribosomal DNA Restriction Analysis (16S-ARDRA) and MALDI-TOF mass spectrometry (MS) as methods for species identification of Lactobacillus strains in poultry. A total of 80 Lactobacillus strains isolated from the cloaca of chicken, geese and turkeys were identified to the species level by MALDI-TOF MS (on-plate extraction method) and 16S-ARDRA. The two techniques produced comparable classification results, some of which were additionally confirmed by sequencing of 16S rDNA. MALDI-TOF MS enabled rapid species identification but produced more than one reliable identification result for 16.25 % of examined strains (mainly of the species L. johnsonii). For 30 % of isolates intermediate log(scores) of 1.70-1.99 were obtained, indicating correct genus identification but only presumptive species identification. The 16S-ARDRA protocol was based on digestion of 16S rDNA with the restriction enzymes MseI, HinfI, MboI and AluI. This technique was able to distinguish 17 of the 19 Lactobacillus reference species tested and enabled identification of all 80 wild isolates. L. salivarius dominated among the 15 recognized species, followed by L. johnsonii and L. ingluviei. The MALDI-TOF MS and 16S-ARDRA assays are valuable tools for the identification of avian lactobacilli to the species level. MALDI-TOF MS is a fast, simple and cost-effective technique, and despite generating a high percentage of results with a log(score) <2.00, the on-plate extraction method is characterized by high-performance. For samples for which Biotyper produces more than one reliable result, MALDI-TOF MS must be used in combination with genotypic techniques to achieve unambiguous results. 16S-ARDRA is simple, repetitive method with high power of discrimination, whose sole limitation is its inability to discriminate between species with very high 16S rDNA sequence homology, such as L. casei and L. zeae. The assays can be used for discrimination of Lactobacillus bacteria from different habitats.

  10. Development of Amplified 16S Ribosomal DNA Restriction Analysis for Identification of Actinomyces Species and Comparison with Pyrolysis-Mass Spectrometry and Conventional Biochemical Tests

    PubMed Central

    Hall, Val; O’Neill, G. L.; Magee, J. T.; Duerden, B. I.

    1999-01-01

    Identification of Actinomyces spp. by conventional phenotypic methods is notoriously difficult and unreliable. Recently, the application of chemotaxonomic and molecular methods has clarified the taxonomy of the group and has led to the recognition of several new species. A practical and discriminatory identification method is now needed for routine identification of clinical isolates. Amplified 16S ribosomal DNA restriction analysis (ARDRA) was applied to reference strains (n = 27) and clinical isolates (n = 36) of Actinomyces spp. and other gram-positive rods. Clinical strains were identified initially to the species level by conventional biochemical tests. However, given the low degree of confidence in conventional methods, the findings obtained by ARDRA were also compared with those obtained by pyrolysis-mass spectrometry. The ARDRA profiles generated by the combination of HaeIII and HpaII endonuclease digestion differentiated all reference strains to the species or subspecies level. The profiles correlated well with the findings obtained by pyrolysis-mass spectrometry and by conventional tests and enabled the identification of 31 of 36 clinical isolates to the species level. ARDRA was shown to be a simple, rapid, cost-effective, and highly discriminatory method for routine identification of Actinomyces spp. of clinical origin. PMID:10364594

  11. [Utilization of nylon membranes for specific isolation and characterization of verotoxin-producing Escherichia coli using DNA probes].

    PubMed

    Gallien, P; Klie, H; Perlberg, K W; Protz, D

    1996-01-01

    A method for specific isolation of VT(+)-strains in raw milk is given. DNA-hybridization technique with DIG-labeled PCR-amplificates as probes are the basis. No background is seen by using "DIG Easy Hyb" solution and nylon membranes for colony- and plaque-hybridization (Boehringer Mannheim GmbH). Marked colonies are visible on the membranes after detection. So it is possible to select these colonies from a masterplate. The results are available within one day (without enrichment and membrane preparation). After stripping the membranes can be used for a new hybridisation to detect another factor of virulence.

  12. Isolation of a DNA Probe for Lactobacillus curvatus

    PubMed Central

    Petrick, Hendrik A. R.; Ambrosio, Riccardo E.; Holzapfel, Wilhelm H.

    1988-01-01

    A genomic library of Lactobacillus curvatus DSM 20019 was constructed in bacteriophage λ gt11. A 1.2-kilobase DNA probe specific for L. curvatus was isolated from this library. When this probe was hybridized to DNA from Lactobacillus isolates from different sources classified by conventional techniques, differing degrees of hybridization were obtained. This could imply that these isolates may have been incorrectly classified. Images PMID:16347554

  13. Isolation of high quality RNA from cereal seeds containing high levels of starch.

    PubMed

    Wang, Guifeng; Wang, Gang; Zhang, Xiaowei; Wang, Fang; Song, Rentao

    2012-01-01

    Cereals are an important source of food, feed and fuel with a rapidly increasing global demand. However, cereal seeds contain high levels of starch and polysaccharides, making the isolation of high quality RNA extremely difficult. To develop a novel method for extracting high quality total RNA from various starch- and polysaccharides-rich cereal seeds, such as maize, rice, sorghum and wheat. We developed a modified sodium dodecyl sulphate (SDS)/TRIzol method. The combined use of a Tris buffer (pH 9.0) and SDS before TRIzol extraction effectively resolved the problem of seed homogenate solidification in such a buffer. A high concentration of SDS was used separately, not only to promote cell lysis but also to effectively dissolve seed sample containing high levels of starch. Moreover, acid phenol saturated with 0.1  M citrate buffer (pH 4.3) was used to separate RNA from DNAs, proteins and high levels of starch. This rapid protocol was compared with other RNA isolation methods preferentially used for plants rich in polysaccharides and secondary metabolites. Gel electrophoresis analysis indicated that the extracted total RNA had good integrity without apparent DNA contamination. Furthermore, an A₂₆₀/₂₈₀ ratio of approximately 2.0, an A₂₆₀/₂₃₀ ratio of more than 2.0 and RIN values of more than 8.6 indicated that the isolated RNA was of high purity. The isolated RNA was suitable for subsequent molecular manipulations, such as reverse-transcription polymerase chain reaction (PCR), rapid amplification of cDNA ends (RACE) and real-time PCR. The study has described an easy, efficient and highly reproducible method for RNA isolation from various cereal seeds. Copyright © 2011 John Wiley & Sons, Ltd.

  14. DNA Barcoding Coupled with High Resolution Melting Analysis Enables Rapid and Accurate Distinction of Aspergillus species.

    PubMed

    Fidler, Gabor; Kocsube, Sandor; Leiter, Eva; Biro, Sandor; Paholcsek, Melinda

    2017-08-01

    We describe a high-resolution melting (HRM) analysis method that is rapid, reproducible, and able to identify reference strains and further 40 clinical isolates of Aspergillus fumigatus (14), A. lentulus (3), A. terreus (7), A. flavus (8), A. niger (2), A. welwitschiae (4), and A. tubingensis (2). Asp1 and Asp2 primer sets were designed to amplify partial sequences of the Aspergillus benA (beta-tubulin) genes in a closed-, single-tube system. Human placenta DNA, further Aspergillus (3), Candida (9), Fusarium (6), and Scedosporium (2) nucleic acids from type strains and clinical isolates were also included in this study to evaluate cross reactivity with other relevant pathogens causing invasive fungal infections. The barcoding capacity of this method proved to be 100% providing distinctive binomial scores; 14, 34, 36, 35, 25, 15, 26 when tested among species, while the within-species distinction capacity of the assay proved to be 0% based on the aligned thermodynamic profiles of the Asp1, Asp2 melting clusters allowing accurate species delimitation of all tested clinical isolates. The identification limit of this HRM assay was also estimated on Aspergillus reference gDNA panels where it proved to be 10-102 genomic equivalents (GE) except the A. fumigatus panel where it was 103 only. Furthermore, misidentification was not detected with human genomic DNA or with Candida, Fusarium, and Scedosporium strains. Our DNA barcoding assay introduced here provides results within a few hours, and it may possess further diagnostic utility when analyzing standard cultures supporting adequate therapeutic decisions. © The Author 2016. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. DNA capture elements for rapid detection and identification of biological agents

    NASA Astrophysics Data System (ADS)

    Kiel, Johnathan L.; Parker, Jill E.; Holwitt, Eric A.; Vivekananda, Jeeva

    2004-08-01

    DNA capture elements (DCEs; aptamers) are artificial DNA sequences, from a random pool of sequences, selected for their specific binding to potential biological warfare agents. These sequences were selected by an affinity method using filters to which the target agent was attached and the DNA isolated and amplified by polymerase chain reaction (PCR) in an iterative, increasingly stringent, process. Reporter molecules were attached to the finished sequences. To date, we have made DCEs to Bacillus anthracis spores, Shiga toxin, Venezuelan Equine Encephalitis (VEE) virus, and Francisella tularensis. These DCEs have demonstrated specificity and sensitivity equal to or better than antibody.

  16. Molecular identification of Armillaria gallica from the Niobrara Valley Preserve in Nebraska

    Treesearch

    Mee-Sook Kim; Ned B. Klopfenstein

    2011-01-01

    Armillaria isolates were collected from a unique forest ecosystem in the Niobrara Valley Preserve in Nebraska, USA, which comprises a glacial and early postglacial refugium in the central plains of North America. The isolates were collected from diverse forest trees representing a unique mixture of forest types. Combined methods of rDNA sequencing and flow cytometric...

  17. An efficient, reliable and inexpensive device for the rapid homogenization of multiple tissue samples by centrifugation.

    PubMed

    Ilyin, S E; Plata-Salamán, C R

    2000-02-15

    Homogenization of tissue samples is a common first step in the majority of current protocols for RNA, DNA, and protein isolation. This report describes a simple device for centrifugation-mediated homogenization of tissue samples. The method presented is applicable to RNA, DNA, and protein isolation, and we show examples where high quality total cell RNA, DNA, and protein were obtained from brain and other tissue samples. The advantages of the approach presented include: (1) a significant reduction in time investment relative to hand-driven or individual motorized-driven pestle homogenization; (2) easy construction of the device from inexpensive parts available in any laboratory; (3) high replicability in the processing; and (4) the capacity for the parallel processing of multiple tissue samples, thus allowing higher efficiency, reliability, and standardization.

  18. Genetic heterogeneity of the dnaK gene locus including transcription terminator region (TTR) in Campylobacter lari.

    PubMed

    Shitara, M; Tsuboi, Y; Sekizuka, T; Tazumi, A; Moorei, J E; Millar, B C; Taneike, I; Matsuda, M

    2008-01-01

    Nucleotide sequences of approximately 3.1 kbp consisting of the full-length open reading frame (ORF) for grpE, a non-coding (NC) region and a putative ORF for the full-length dnaK gene (1860 bp) were identified from a urease-positive thermophilic Campylobacter (UPTC) CF89-12 isolate. Then, following the construction of a new degenerate polymerase chain reaction (PCR) primer pair for amplification of the dnaK structural gene, including the transcription terminator region of C. lari isolates, the dnaK region was amplified successfully, TA-cloned and sequenced in nine C. lari isolates. The dnaK gene sequences commenced with an ATG and terminated with a TAA in all 10 isolates, including CF89-12. In addition, the putative ORFs for the dnaK gene locus from seven UPTC isolates consisted of 1860 bases, and the four urease-negative (UN) C. lari isolates included C. lari RM2100 reference strain 1866. Interestingly, different probable ribosome binding sites and hypothetically intrinsic p-independent terminator structures were identified between the seven UPTC and four UN C. lari isolates, respectively. Moreover, it is interesting to note that 20 out of a total of 28 polymorphic sites occurred among amino acid sequences of the dnaK ORF from 11 C. lari isolates, identified to be alternatively UPTC-specific or UN C. lari-specific. In the neighbour-joining tree based on the nucleotide sequence information of the dnaK gene, C. lari forms two major distinct clusters consisting of UPTC and UN C. lari isolates, respectively, with UN C. lari being more closely related to other thermophilic campylobacters than to UPTC.

  19. Detection of an enigmatic plethodontid Salamander using Environmental DNA

    USGS Publications Warehouse

    Pierson, Todd W.; Mckee, Anna; Spear, Stephen F.; Maerz, John C.; Camp, Carlos D.; Glenn, Travis C.

    2016-01-01

    The isolation and identification of environmental DNA (eDNA) offers a non-invasive and efficient method for the detection of rare and secretive aquatic wildlife, and it is being widely integrated into inventory and monitoring efforts. The Patch-Nosed Salamander (Urspelerpes brucei) is a tiny, recently discovered species of plethodontid salamander known only from headwater streams in a small region of Georgia and South Carolina. Here, we present results of a quantitative PCR-based eDNA assay capable of detecting Urspelerpes in more than 75% of 33 samples from five confirmed streams. We deployed the method at 31 additional streams and located three previously undocumented populations of Urspelerpes. We compare the results of our eDNA assay with our attempt to use aquatic leaf litterbags for the rapid detection of Urspelerpes and demonstrate the relative efficacy of the eDNA assay. We suggest that eDNA offers great potential for use in detecting other aquatic and semi-aquatic plethodontid salamanders.

  20. [Real-time PCR kits for the detection of the African Swine Fever virus].

    PubMed

    Latyshev, O E; Eliseeva, O V; Grebennikova, T V; Verkhovskiĭ, O A; Tsibezov, V V; Chernykh, O Iu; Dzhailidi, G A; Aliper, T I

    2014-01-01

    The results obtained using the diagnostic kit based on real-time polymerase chain reaction to detect the DNA of the African Swine Fever in the pathological material, as well as in the culture fluid, are presented. A high sensitivity and specificity for detection of the DNA in the organs and tissues of animals was shown to be useful for detection in the European Union referentiality reagent kits for DNA detection by real time PCR of ASFV. More rapid and effective method of DNA extraction using columns mini spin Quick gDNA(TM) MiniPrep was suggested and compared to the method of DNA isolation on the inorganic sorbent. High correlation of the results of the DNA detection of ASFV by real-time PCR and antigen detection results ASFV by competitive ELISA obtained with the ELISA SEROTEST/INGEZIM COMRAC PPA was demonstrated. The kit can be used in the veterinary services for effective monitoring of ASFV to contain, eliminate and prevent further spread of the disease.

  1. Whole genome amplification of Chelex-extracted DNA from a single mite: a method for studying genetics of the predatory mite Phytoseiulus persimilis.

    PubMed

    Konakandla, Bhanu; Park, Yoonseong; Margolies, David

    2006-01-01

    We developed and optimized a method using Chelex DNA extraction followed by whole genome amplification (WGA) to overcome problems conducting molecular genetic studies due to the limited amount of DNA obtainable from individual small organisms such as predatory mites. The DNA from a single mite, Phytoseiulus persimilis Athias-Henrot (Acari: Phytoseiidae), isolated in Chelex suspension was subjected to WGA. More than 1000-fold amplification of the DNA was achieved using as little as 0.03 ng genomic DNA template. The DNA obtained by the WGA was used for polymerase chain reaction followed by direct sequencing. From WGA DNA, nuclear DNA intergenic spacers ITS1 and ITS2 and a mitochondrial DNA 12S marker were tested in three different geographical populations of the predatory mite: California, the Netherlands, and Sicily. We found a total of four different alleles of the 12S in the Sicilian population, but no polymorphism was identified in the ITS marker. The combination of Chelex DNA extraction and WGA is thus shown to be a simple and robust technique for examining molecular markers for multiple loci by using individual mites. We conclude that the methods, Chelex extraction of DNA followed by WGA, provide a large quantity of DNA template that can be used for multiple PCR reactions useful for genetic studies requiring the genotypes of individual mites.

  2. Establishment of a simple and rapid identification method for Listeria spp. by using high-resolution melting analysis, and its application in food industry.

    PubMed

    Ohshima, Chihiro; Takahashi, Hajime; Phraephaisarn, Chirapiphat; Vesaratchavest, Mongkol; Keeratipibul, Suwimon; Kuda, Takashi; Kimura, Bon

    2014-01-01

    Listeria monocytogenes is the causative bacteria of listeriosis, which has a higher mortality rate than that of other causes of food poisoning. Listeria spp., of which L. monocytogenes is a member, have been isolated from food and manufacturing environments. Several methods have been published for identifying Listeria spp.; however, many of the methods cannot identify newly categorized Listeria spp. Additionally, they are often not suitable for the food industry, owing to their complexity, cost, or time consumption. Recently, high-resolution melting analysis (HRMA), which exploits DNA-sequence differences, has received attention as a simple and quick genomic typing method. In the present study, a new method for the simple, rapid, and low-cost identification of Listeria spp. has been presented using the genes rarA and ldh as targets for HRMA. DNA sequences of 9 Listeria species were first compared, and polymorphisms were identified for each species for primer design. Species specificity of each HRM curve pattern was estimated using type strains of all the species. Among the 9 species, 7 were identified by HRMA using rarA gene, including 3 new species. The remaining 2 species were identified by HRMA of ldh gene. The newly developed HRMA method was then used to assess Listeria isolates from the food industry, and the method efficiency was compared to that of identification by 16S rDNA sequence analysis. The 2 methods were in coherence for 92.6% of the samples, demonstrating the high accuracy of HRMA. The time required for identifying Listeria spp. was substantially low, and the process was considerably simplified, providing a useful and precise method for processing multiple samples per day. Our newly developed method for identifying Listeria spp. is highly valuable; its use is not limited to the food industry, and it can be used for the isolates from the natural environment.

  3. Establishment of a Simple and Rapid Identification Method for Listeria spp. by Using High-Resolution Melting Analysis, and Its Application in Food Industry

    PubMed Central

    Ohshima, Chihiro; Takahashi, Hajime; Phraephaisarn, Chirapiphat; Vesaratchavest, Mongkol; Keeratipibul, Suwimon; Kuda, Takashi; Kimura, Bon

    2014-01-01

    Listeria monocytogenes is the causative bacteria of listeriosis, which has a higher mortality rate than that of other causes of food poisoning. Listeria spp., of which L. monocytogenes is a member, have been isolated from food and manufacturing environments. Several methods have been published for identifying Listeria spp.; however, many of the methods cannot identify newly categorized Listeria spp. Additionally, they are often not suitable for the food industry, owing to their complexity, cost, or time consumption. Recently, high-resolution melting analysis (HRMA), which exploits DNA-sequence differences, has received attention as a simple and quick genomic typing method. In the present study, a new method for the simple, rapid, and low-cost identification of Listeria spp. has been presented using the genes rarA and ldh as targets for HRMA. DNA sequences of 9 Listeria species were first compared, and polymorphisms were identified for each species for primer design. Species specificity of each HRM curve pattern was estimated using type strains of all the species. Among the 9 species, 7 were identified by HRMA using rarA gene, including 3 new species. The remaining 2 species were identified by HRMA of ldh gene. The newly developed HRMA method was then used to assess Listeria isolates from the food industry, and the method efficiency was compared to that of identification by 16S rDNA sequence analysis. The 2 methods were in coherence for 92.6% of the samples, demonstrating the high accuracy of HRMA. The time required for identifying Listeria spp. was substantially low, and the process was considerably simplified, providing a useful and precise method for processing multiple samples per day. Our newly developed method for identifying Listeria spp. is highly valuable; its use is not limited to the food industry, and it can be used for the isolates from the natural environment. PMID:24918440

  4. Isolation, characterization and phylogenetic analysis of halophilic archaea from a salt mine in central Anatolia (Turkey).

    PubMed

    Yildiz, Evrim; Ozcan, Birgul; Caliskan, Mahmut

    2012-01-01

    The haloarchaeal diversity of a salt mine, a natural cave in central Anatolia, was investigated using convential microbiological and molecular biology methods. Eight halophilic archaeal isolates selected based on their colony morphology and whole cell protein profiles were taxonomically classified on the basis of their morphological, physiological, biochemical properties, polar lipid and protein profiles and 16S rDNA sequences. From the 16S rDNA sequences comparisons it was established that the isolates CH2, CH3 and CHC resembled Halorubrum saccharovorum by 98.8%, 98.9% and 99.5%, respectively. There was a 99.7% similarity between the isolate CH11 and Halobacterium noricense and 99.2% between the isolate CHA1 and Haloarcula argentinensis. The isolate CH8K and CH8B revealed a similarity rate of 99.8% and 99.3% to Halococcus dombrowskii, respectively. It was concluded that the isolates named CH2, CH3 and CHC were clustered in the genus Halorubrum and that CHA1 and CH7 in the genus Haloarcula, CH8K and CH8B in the genus Halococcus and CH11 in the genus Halobacterium.

  5. Identification of Vibrio splendidus as a Member of the Planktonic Luminous Bacteria from the Persian Gulf and Kuwait Region with luxA Probes

    PubMed Central

    Nealson, K. H.; Wimpee, B.; Wimpee, C.

    1993-01-01

    Hybridization probes specific for the luxA genes of four groups of luminous bacteria were used to screen luminous isolates obtained from the Persian Gulf, near Al Khiran, Kuwait Nine of these isolates were identified as Vibrio harveyi, a commonly encountered planktonic isolate, while three others showed no hybridization to any of the four probes (V. harveyi, Vibrio fischeri, Photobacterium phosphoreum, or Photobacterium leiognathi) under high-stringency conditions. Polymerase chain reaction amplification was used to prepare a luxA probe against one of these isolates, K-1, and this probe was screened under high-stringency conditions against a collection of DNAs from luminous bacteria; it was found to hybridize specifically to the DNA of the species Vibrio splendidus. A probe prepared against the type strain of V. splendidus (ATCC 33369) was tested against the collection of luminous bacterial DNA preparations and against the Kuwait isolates and was found to hybridize only against the type strain and the three unidentified Kuwait isolates. Extensive taxonomic analysis by standard methods confirmed the identification of the 13 isolates. Images PMID:16349023

  6. RT-PCR analysis of RNA extracted from Bouin-fixed and paraffin-embedded lymphoid tissues.

    PubMed

    Gloghini, Annunziata; Canal, Barbara; Klein, Ulf; Dal Maso, Luigino; Perin, Tiziana; Dalla-Favera, Riccardo; Carbone, Antonino

    2004-11-01

    In the present study, we have investigated whether RNA can be efficiently isolated from Bouin-fixed or formalin-fixed, paraffin-embedded lymphoid tissue specimens. To this aim, we applied a new and simple method that includes the combination of proteinase K digestion and column purification. By this method, we demonstrated that the amplification of long fragments could be accomplished after a pre-heating step before cDNA synthesis associated with the use of enzymes that work at high temperature. By means of PCR using different primers for two examined genes (glyceraldehyde-3-phosphate dehydrogenase [GAPDH]- and CD40), we amplified segments of cDNA obtained by reverse transcription of the isolated RNA extracted from Bouin-fixed or formalin-fixed paraffin-embedded tissues. Amplified fragments of the expected sizes were obtained for both genes tested indicating that this method is suitable for the isolation of high-quality RNA. To explore the possibility for giving accurate real time quantitative RT-PCR results, cDNA obtained from matched frozen, Bouin-fixed and formalin-fixed neoplastic samples (two diffuse large cell lymphomas, one plasmacytoma) was tested for the following target genes: CD40, Aquaporin-3, BLIMP1, IRF4, Syndecan-1. Delta threshold cycle (DeltaC(T)) values for Bouin-fixed and formalin-fixed paraffin-embedded tissues and their correlation with those for frozen samples showed an extremely high correlation (r > 0.90) for all of the tested genes. These results show that the method of RNA extraction we propose is suitable for giving accurate real time quantitative RT-PCR results.

  7. Development and application of loop-mediated isothermal amplification for detection of the F167Y mutation of carbendazim-resistant isolates in Fusarium graminearum

    PubMed Central

    Duan, Yabing; Zhang, Xiaoke; Ge, Changyan; Wang, Yong; Cao, Junhong; Jia, Xiaojing; Wang, Jianxin; Zhou, Mingguo

    2014-01-01

    Resistance of Fusarium graminearum to carbendazim is caused by point mutations in the β2-tubulin gene. The point mutation at codon 167 (TTT → TAT, F167Y) occurs in more than 90% of field resistant isolates in China. To establish a suitable method for rapid detection of the F167Y mutation in F. graminearum, an efficient and simple method with high specificity was developed based on loop-mediated isothermal amplification (LAMP). A set of four primers was designed and optimized to specially distinguish the F167Y mutation genotype. The LAMP reaction was optimal at 63°C for 60 min. When hydroxynaphthol blue dye (HNB) was added prior to amplification, samples with DNA of the F167Y mutation developed a characteristic sky blue color after the reaction but those without DNA or with different DNA did not. Results of HNB staining method were reconfirmed by gel electrophoresis. The developed LAMP had good specificity, stability and repeatability and was suitable for monitoring carbendazim-resistance populations of F. graminearum in agricultural production. PMID:25403277

  8. Morphological and molecular identification of filamentous Aspergillus flavus and Aspergillus parasiticus isolated from compound feeds in South Africa.

    PubMed

    Iheanacho, Henry E; Njobeh, Patrick B; Dutton, Francis M; Steenkamp, Paul A; Steenkamp, Lucia; Mthombeni, Julian Q; Daru, Barnabas H; Makun, Anthony H

    2014-12-01

    Isolation of filamentous species of two Aspergillum genera from compound feeds produced in South Africa, and subsequent extraction of their individual DNA in this study, presents a simple but rapid molecular procedure for high through-put analysis of the individual morphological forms. DNA was successfully isolated from the Aspergillus spp. from agar cultures by use of a commercial kit. Agarose gel electrophoresis fractionation of the fungi DNA, showed distinct bands. The DNA extracted by this procedure appears to be relatively pure with a ratio absorbance at 260 and 280 nm. However, the overall morphological and molecular data indicated that 67.5 and 51.1% of feed samples were found to be contaminated with Aspergillus flavus and Aspergillus parasiticus, respectively, with poultry feed having the highest contamination mean level of 5.7 × 105 CFU/g when compared to cattle (mean: 4.0 × 106 CFU/g), pig (mean: 2.7 × 104 CFU/g) and horse (1.0 × 102 CFU) feed. This technique presents a readily achievable, easy to use method in the extraction of filamentous fungal DNA and it's identification. Hence serves as an important tool towards molecular study of these organisms for routine analysis check in monitoring and improving compound feed quality against fungal contamination. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using

    DOEpatents

    Weier, H.U.G.; Gray, J.W.

    1995-06-27

    A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers and probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity. 18 figs.

  10. Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using

    DOEpatents

    Weier, Heinz-Ulrich G.; Gray, Joe W.

    1995-01-01

    A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers ard probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity.

  11. Technique for quantitative RT-PCR analysis directly from single muscle fibers.

    PubMed

    Wacker, Michael J; Tehel, Michelle M; Gallagher, Philip M

    2008-07-01

    The use of single-cell quantitative RT-PCR has greatly aided the study of gene expression in fields such as muscle physiology. For this study, we hypothesized that single muscle fibers from a biopsy can be placed directly into the reverse transcription buffer and that gene expression data can be obtained without having to first extract the RNA. To test this hypothesis, biopsies were taken from the vastus lateralis of five male subjects. Single muscle fibers were isolated and underwent RNA isolation (technique 1) or placed directly into reverse transcription buffer (technique 2). After cDNA conversion, individual fiber cDNA was pooled and quantitative PCR was performed using primer-probes for beta(2)-microglobulin, glyceraldehyde-3-phosphate dehydrogenase, insulin-like growth factor I receptor, and glucose transporter subtype 4. The no RNA extraction method provided similar quantitative PCR data as that of the RNA extraction method. A third technique was also tested in which we used one-quarter of an individual fiber's cDNA for PCR (not pooled) and the average coefficient of variation between fibers was <8% (cycle threshold value) for all genes studied. The no RNA extraction technique was tested on isolated muscle fibers using a gene known to increase after exercise (pyruvate dehydrogenase kinase 4). We observed a 13.9-fold change in expression after resistance exercise, which is consistent with what has been previously observed. These results demonstrate a successful method for gene expression analysis directly from single muscle fibers.

  12. [RHD variant in RhD/-/ mother with anti-D makes noninvasive fetal RHD genotyping impossible].

    PubMed

    Orzińska, Agnieszka; Engel, Karina; Łakomy, Magdalena; Smolarczyk-Wodzyńska, Justyna; Lipińska, Anna; Pelc-Kłopotowska, Monika; Brojer, Ewa

    2009-10-01

    Noninvasive fetal RHD genotyping from maternal plasma of RhD(/-) pregnant women of Caucasian race may be used for predicting the risk of hemolytic disease because the RHD gene is usually absent in such populations. If detected in plasma of such women, the RHD gene originates from the RhD(+) fetus. The number of fetal copies of the gene in maternal plasma is extremely small. In the presented case of the RhD(/-) pregnant woman with anti-D it was impossible to give a fetal RHD result due to mother's RHD(+) genotype. The fetal RHD was determined from amniocytes. to present the difficulties related to the interpretation of results of invasive and noninvasive procedures. whole blood, plasma and amniotic fluid of the RhD(-) woman with anti-D (14 week of pregnancy) as well as whole blood of the newborn. RHD and RHCE*c were genotyped by real-time PCR in DNA isolated from maternal plasma and amniocytes and the RHD and d-genotypes were tested by SSP methods in DNA isolated from whole blood and amniocytes. RHD and RHCE*c were detected in DNA isolated from plasma. The high level of RHD suggested its origin from the mother's DNA therefore it was impossible to determine the fetal RHD. The d-little test identified a RHD(IVS3+ 1G>A) variant in the mother's genome. A weak signal of real-time PCR for the RHD was obtained in amniocytes but the RHD was not detected by SSP. The RHCE*c was detected by both methods. Results were inconclusive; the fetal RHD status remained unknown. The child was RhD(-) with RHD in its DNA undetected by either method. 1/The RHD(IVS3+ 1G>A) variant in the RhD(-) mother precluded formal noninvasive fetal RHD genotyping. 2/Real-time PCR is too sensitive for amniocyte testing and may lead to false results as it detects trace maternal DNA in amniotic fluid. 3/The frequency of RHD(IVS3+1G>A) occurrence in Poland requires further studies.

  13. Marinospirillum insulare sp. nov., a novel halophilic helical bacterium isolated from kusaya gravy.

    PubMed

    Satomi, M; Kimura, B; Hayashi, M; Okuzumi, M; Fujii, T

    2004-01-01

    A novel species that belongs to the genus Marinospirillum is described on the basis of phenotypic characteristics, phylogenetic analysis of 16S rRNA and gyrB gene sequences and DNA-DNA hybridization. Four strains of helical, halophilic, Gram-negative, heterotrophic bacteria were isolated from kusaya gravy, which is fermented brine that is used for the production of traditional dried fish in the Izu Islands of Japan. All of the new isolates were motile by means of bipolar tuft flagella, of small cell size, coccoid-body-forming and aerophilic; it was concluded that they belong to the same bacterial species, based on DNA-DNA hybridization values (>70% DNA relatedness). DNA G+C contents of the new strains were 42-43 mol% and they had isoprenoid quinone Q-8 as the major component. Phylogenetic analysis of 16S rRNA gene sequences indicated that the new isolates were members of the genus Marinospirillum; sequence similarity of the new isolates to Marinospirillum minutulum, Marinospirillum megaterium and Marinospirillum alkaliphilum was 98.5, 98.2 and 95.2%, respectively. Phylogenetic analysis based on the gyrB gene indicated that the new isolates had enough phylogenetic distance from M. minutulum and M. megaterium to be regarded as different species, with 84.7 and 78.7% sequence similarity, respectively. DNA-DNA hybridization showed that the new isolates had <36% DNA relatedness to M. minutulum and M. megaterium, supporting the phylogenetic conclusion. Thus, a novel species is proposed: Marinospirillum insulare sp. nov. (type strain, KT=LMG 21802T=NBRC 100033T).

  14. [Isolation and characterization of siphovirus phages infecting bovine Streptococcus agalactiae].

    PubMed

    Bai, Qinqin; Yang, Yongchun; Lu, Chengping

    2016-02-04

    To isolate and identify Streptococcus agalactiae phages and screen candidate phages to control infection caused by bovine S. agalactiae. We used two methods for isolation of S. agalactiae phages, namely (1) isolation of phages from milk and environmental samples, and (2) isolation of phages via induction of lysogens with Mitomycin C. Double-layer agar culture method was used to purify phages. Then the newly obtained phages, with S. agalactiae phage JX01 isolated from mastitis milk, were comparatively analyzed in the following aspects: morphology of phages by transmission electron microscopy, host range of phages to 55 S. agalactiae strains and other Streptococcus strains, phages DNA using EcoR I, Xba I, Pst I and Sal I, the optical multiplicity of infection, absorption curve and one step growth curve, and the stability of phages at different storage conditions. The comparative analysis of the 3 novel phages LYGO9, HZ04 and pA11 (induced from S. agalctiae bovine clinical isolate HAJL2011070601) with JX01 showed that the 4 phages were classified as the member of Siphovirdae family. EcoR I, Sal I, Xba I and Pst I separately digested the 4 phages DNA provided 4, 3, 3 and 2 profiles, respectively. This suggested that they were different strains. All the 4 phages specifically infected bovine S. agalactiae isolates. LYGO9, pA11, JX01 and HZ04 could lyse 12, 13, 20 and 23 of 42 tested bovine S. agalctiae isolates, respectively. This clearly indicated that these 4 phages are closely related. The 3 new phages which specifically lyse bovine S. agalactiae isolates are siphovirus phages. Phage LYGO9 was shown having a short latent period and a larger burst size.

  15. Successful isolation and PCR amplification of DNA from National Institute of Standards and Technology herbal dietary supplement standard reference material powders and extracts.

    PubMed

    Cimino, Matthew T

    2010-03-01

    Twenty-four herbal dietary supplement powder and extract reference standards provided by the National Institute of Standards and Technology (NIST) were investigated using three different commercially available DNA extraction kits to evaluate DNA availability for downstream nucleotide-based applications. The material included samples of Camellia, Citrus, Ephedra, Ginkgo, Hypericum, Serenoa, And Vaccinium. Protocols from Qiagen, MoBio, and Phytopure were used to isolate and purify DNA from the NIST standards. The resulting DNA concentration was quantified using SYBR Green fluorometry. Each of the 24 samples yielded DNA, though the concentration of DNA from each approach was notably different. The Phytopure method consistently yielded more DNA. The average yield ratio was 22 : 3 : 1 (ng/microL; Phytopure : Qiagen : MoBio). Amplification of the internal transcribed spacer II region using PCR was ultimately successful in 22 of the 24 samples. Direct sequencing chromatograms of the amplified material suggested that most of the samples were comprised of mixtures. However, the sequencing chromatograms of 12 of the 24 samples were sufficient to confirm the identity of the target material. The successful extraction, amplification, and sequencing of DNA from these herbal dietary supplement extracts and powders supports a continued effort to explore nucleotide sequence-based tools for the authentication and identification of plants in dietary supplements. (c) Georg Thieme Verlag KG Stuttgart . New York.

  16. Isolated spinach ribulose-1,5-bisphosphate carboxylase/oxgenase large subunit .epsilon. n-methyltransferase and method of inactivating ribulose-1,5-bishosphatase .epsilon. n-methyltransferase activity

    DOEpatents

    Houtz, Robert L.

    2001-01-01

    The gene sequence for ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) large subunit (LS) .sup..epsilon. N-methyltansferase (protein methylase III or Rubisco LSMT) from a plant which has a des(methyl) lysyl residue in the LS is disclosed. In addition, the full-length cDNA clones for Rubisco LSMT are disclosed. Transgenic plants and methods of producing same which have the Rubisco LSMT gene inserted into the DNA are also provided. Further, methods of inactivating the enzymatic activity of Rubisco LSMT are also disclosed.

  17. Human umbilical cord derived matrix: A scaffold suitable for tissue engineering application.

    PubMed

    Dan, Pan; Velot, Émilie; Mesure, Benjamin; Groshenry, Guillaume; Bacharouche, Jalal; Decot, Véronique; Menu, Patrick

    2017-01-01

    Human tissue derived natural extracellular matrix (ECM) has great potential in tissue engineering. We sought to isolate extracellular matrix derived from human umbilical cord and test its potential in tissue engineering. An enzymatic method was applied to isolate and solubilized complete human umbilical cord derived matrix (hUCM). The obtained solution was analyzed for growth factors, collagen and residual DNA contents, then used to coat 2D and 3D surfaces for cell culture application. The hUCM was successfully isolated with trypsin digestion to acquire a solution containing various growth factors and collagen but no residual DNA. This hUCM solution can form a coating on 2D and 3D substrates suitable cell culture. We developed a new matrix derived from human source that can be further used in tissue engineering.

  18. High-resolution mapping and sequence analysis of 597 cDNA clones transcribed from the 1 Mb region in human chromosome 4q16.3 containing Huntington disease gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hadano, S.; Ishida, Y.; Tomiyasu, H.

    1994-09-01

    To complete a transcription map of the 1 Mb region in human chromosome 4p16.3 containing the Huntington disease (HD) gene, the isolation of cDNA clones are being performed throughout. Our method relies on a direct screening of the cDNA libraries probed with single copy microclones from 3 YAC clones spanning 1 Mbp of the HD gene region. AC-DNAs were isolated by a preparative pulsed-field gel electrophoresis, amplified by both a single unique primer (SUP)-PCR and a linker ligation PCR, and 6 microclone-DNA libraries were generated. Then, 8,640 microclones from these libraries were independently amplified by PCR, and arrayed onto themore » membranes. 800-900 microclones that were not cross-hybridized with total human and yeast genomic DNA, TAC vector DNA, and ribosomal cDNA on a dot hybridization (putatively carrying single copy sequences) were pooled to make 9 probe pools. A total of {approximately}1.8x10{sup 7} plaques from the human brain cDNA libraries was screened with 9 pool-probes, and then 672 positive cDNA clones were obtained. So far, 597 cDNA clones were defined and arrayed onto a map of the 1 Mbp of the HD gene region by hybridization with HD region-specific cosmid contigs and YAC clones. Further characterization including a DNA sequencing and Northern blot analysis is currently underway.« less

  19. Fluorescence resonance energy transfer-based real-time polymerase chain reaction method without DNA extraction for the genotyping of F5, F2, F12, MTHFR, and HFE.

    PubMed

    Martinez-Serra, Jordi; Robles, Juan; Nicolàs, Antoni; Gutierrez, Antonio; Ros, Teresa; Amat, Juan Carlos; Alemany, Regina; Vögler, Oliver; Abelló, Aina; Noguera, Aina; Besalduch, Joan

    2014-01-01

    Blood samples are extensively used for the molecular diagnosis of many hematological diseases. The daily practice in a clinical laboratory of molecular diagnosis in hematology involves using a variety of techniques, based on the amplification of nucleic acids. Current methods for polymerase chain reaction (PCR) use purified genomic DNA, mostly isolated from total peripheral blood cells or white blood cells (WBC). In this paper we describe a real-time fluorescence resonance energy transfer-based method for genotyping directly from blood cells. Our strategy is based on an initial isolation of the WBCs, allowing the removal of PCR inhibitors, such as the heme group, present in the erythrocytes. Once the erythrocytes have been lysed, in the LightCycler(®) 2.0 Instrument, we perform a real-time PCR followed by a melting curve analysis for different genes (Factors 2, 5, 12, MTHFR, and HFE). After testing 34 samples comparing the real-time crossing point (CP) values between WBC (5×10(6) WBC/mL) and purified DNA (20 ng/μL), the results for F5 Leiden were as follows: CP mean value for WBC was 29.26±0.566 versus purified DNA 24.79±0.56. Thus, when PCR was performed from WBC (5×10(6) WBC/mL) instead of DNA (20 ng/μL), we observed a delay of about 4 cycles. These small differences in CP values were similar for all genes tested and did not significantly affect the subsequent analysis by melting curves. In both cases the fluorescence values were high enough, allowing a robust genotyping of all these genes without a previous DNA purification/extraction.

  20. Simple and rapid enzymatic method for the synthesis of single-strand oligonucleotides containing trifluorothymidine.

    PubMed

    Suzuki, Norihiko; Fukushima, Masakazu

    2010-11-01

    To investigate the mechanism of trifluorothymidine (TFT)-induced DNA damage, we developed an enzymatic method for the synthesis of single-strand oligonucleotides containing TFT-monophosphate residues. Sixteen-mer oligonucleotides and 14-mer 5'-phosphorylated oligonucleotides were annealed to the template of 25-mer, so as to empty one nucleotide site. TFT-triphosphate was incorporated into the site by DNA polymerase and then ligated to 5'-phosphorylated oligonucleotides by DNA ligase. The synthesized 31-mer oligonucleotides containing TFT residues were isolated from the 25-mer complementary template by denaturing polyacrylamide electrophoresis. Using these single-strand oligonucleotides containing TFT residues, the cleavage of TFT residues from DNA, using mismatch uracil-DNA glycosylase (MUG) of E.coli origin, was compared with that of 5-fluorouracil (5FU) and 5-bromodeoxyuridine (BrdU). The TFT/A pair was not cleaved by MUG, while the other pairs, namely, 5FU/A, 5FU/G, BrdU/A, BrdU/G, and TFT/G, were easily cleaved from each synthesized DNA. Thus, this method is useful for obtaining some site-specifically modified oligonucleotides.

  1. Blastocystis phylogeny among various isolates from humans to insects.

    PubMed

    Yoshikawa, Hisao; Koyama, Yukiko; Tsuchiya, Erika; Takami, Kazutoshi

    2016-12-01

    Blastocystis is a common unicellular eukaryotic parasite found not only in humans, but also in various kinds of animal species worldwide. Since Blastocystis isolates are morphologically indistinguishable, many molecular biological approaches have been applied to classify these isolates. The complete or partial sequences of the small subunit rRNA gene (SSU rDNA) are mainly used for comparisons and phylogenetic analyses among Blastocystis isolates. However, various lengths of the partial SSU rDNA sequence have been used for phylogenetic inference among genetically different isolates. Based on the complete SSU rDNA sequences, consensus terminology of nine subtypes (STs) of Blastocystis sp. that were supported by phylogenetically monophyletic nine clades was proposed in 2007. Thereafter, eight additional kinds of STs comprising non-human mammalian Blastocystis isolates have been reported based on the phylogeny of SSU rDNA sequences, while STs 11 and 12 were only proposed on the base of partial sequences. Although many sequence data from mammalian and avian Blastocystis are registered in GenBank, only limited data on SSU rDNA are available for poikilotherm-derived Blastocystis isolates. Therefore, the phylogenetic positions of the reptilian/amphibian Blastocystis clades are unstable. The phylogenetic inference of various STs comprising mammalian and/or avian Blastocystis isolates was verified herein based on comparisons between partial and complete SSU rDNA sequences, and the phylogenetic positions of reptilian and amphibian Blastocystis isolates were also investigated using 14 new Blastocystis isolates from reptiles with all known isolates from other reptilians, amphibians, and insects registered in GenBank. Copyright © 2016. Published by Elsevier Ireland Ltd.

  2. A novel method of genomic DNA extraction for Cactaceae1

    PubMed Central

    Fehlberg, Shannon D.; Allen, Jessica M.; Church, Kathleen

    2013-01-01

    • Premise of the study: Genetic studies of Cactaceae can at times be impeded by difficult sampling logistics and/or high mucilage content in tissues. Simplifying sampling and DNA isolation through the use of cactus spines has not previously been investigated. • Methods and Results: Several protocols for extracting DNA from spines were tested and modified to maximize yield, amplification, and sequencing. Sampling of and extraction from spines resulted in a simplified protocol overall and complete avoidance of mucilage as compared to typical tissue extractions. Sequences from one nuclear and three plastid regions were obtained across eight genera and 20 species of cacti using DNA extracted from spines. • Conclusions: Genomic DNA useful for amplification and sequencing can be obtained from cactus spines. The protocols described here are valuable for any cactus species, but are particularly useful for investigators interested in sampling living collections, extensive field sampling, and/or conservation genetic studies. PMID:25202521

  3. The nucleotide sequence of the putative transcription initiation site of a cloned ribosomal RNA gene of the mouse.

    PubMed Central

    Urano, Y; Kominami, R; Mishima, Y; Muramatsu, M

    1980-01-01

    Approximately one kilobase pairs surrounding and upstream the transcription initiation site of a cloned ribosomal DNA (rDNA) of the mouse were sequenced. The putative transcription initiation site was determined by two independent methods: one nuclease S1 protection and the other reverse transcriptase elongation mapping using isolated 45S ribosomal RNA precursor (45S RNA) and appropriate restriction fragments of rDNA. Both methods gave an identical result; 45S RNA had a structure starting from ACTCTTAG---. Characteristically, mouse rDNA had many T clusters (greater than or equal to 5) upstream the initiation site, the longest being 21 consecutive T's. A pentadecanucleotide, TGCCTCCCGAGTGCA, appeared twice within 260 nucleotides upstream the putative initiation site. No such characteristic sequences were found downstream this site. Little similarity was found in the upstream of the transcription initiation site between the mouse, Xenopus laevis and Saccharomyces cerevisiae rDNA. Images PMID:6162156

  4. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maaloum, M.; Muller, P.; Beker, A-F.

    Almost two decades ago, measurements of force versus extension on isolated double-stranded DNA molecules revealed a force plateau. This unusual stretching phenomenon in DNA suggests that the long molecules may be extended from the usual B form into a new conformation. Different models have been proposed to describe the nature of DNA in its stretched form, S-DNA. Using atomic force microscopy combined with a molecular combing method, we identified the structure of {lambda}-phage DNA for different stretching values. We provide strong evidence for the existence of a first-order transition between B form and S form. Beyond a certain extension ofmore » the natural length, DNA molecules adopt a new double-helix conformation characterized by a diameter of 1.2 nm and a helical pitch of18 nm.« less

  5. Microsatellite DNA capture from enriched libraries.

    PubMed

    Gonzalez, Elena G; Zardoya, Rafael

    2013-01-01

    Microsatellites are DNA sequences of tandem repeats of one to six nucleotides, which are highly polymorphic, and thus the molecular markers of choice in many kinship, population genetic, and conservation studies. There have been significant technical improvements since the early methods for microsatellite isolation were developed, and today the most common procedures take advantage of the hybrid capture methods of enriched-targeted microsatellite DNA. Furthermore, recent advents in sequencing technologies (i.e., next-generation sequencing, NGS) have fostered the mining of microsatellite markers in non-model organisms, affording a cost-effective way of obtaining a large amount of sequence data potentially useful for loci characterization. The rapid improvements of NGS platforms together with the increase in available microsatellite information open new avenues to the understanding of the evolutionary forces that shape genetic structuring in wild populations. Here, we provide detailed methodological procedures for microsatellite isolation based on the screening of GT microsatellite-enriched libraries, either by cloning and Sanger sequencing of positive clones or by direct NGS. Guides for designing new species-specific primers and basic genotyping are also given.

  6. The first determination of Trichuris sp. from roe deer by amplification and sequenation of the ITS1-5.8S-ITS2 segment of ribosomal DNA.

    PubMed

    Salaba, O; Rylková, K; Vadlejch, J; Petrtýl, M; Scháňková, S; Brožová, A; Jankovská, I; Jebavý, L; Langrová, I

    2013-03-01

    Trichuris nematodes were isolated from roe deer (Capreolus capreolus). At first, nematodes were determined using morphological and biometrical methods. Subsequently genomic DNA was isolated and the ITS1-5.8S-ITS2 segment from ribosomal DNA (RNA) was amplified and sequenced using PCR techniques. With u sing morphological and biometrical methods, female nematodes were identified as Trichuris globulosa, and the only male was identified as Trichuris ovis. The females were classified into four morphotypes. However, analysis of the internal transcribed spacers (ITS1-5.8S-ITS2) of specimens did not confirm this classification. Moreover, the female individuals morphologically determined as T. globulosa were molecularly identified as Trichuris discolor. In the case of the only male molecular analysis match the result of the molecular identification. Furthermore, a comparative phylogenetic study was carried out with the ITS1 and ITS2 sequences of the Trichuris species from various hosts. A comparison of biometric information from T. discolor individuals from this study was also conducted.

  7. High-sensitivity stable-isotope probing by a quantitative terminal restriction fragment length polymorphism protocol.

    PubMed

    Andeer, Peter; Strand, Stuart E; Stahl, David A

    2012-01-01

    Stable-isotope probing (SIP) has proved a valuable cultivation-independent tool for linking specific microbial populations to selected functions in various natural and engineered systems. However, application of SIP to microbial populations with relatively minor buoyant density increases, such as populations that utilize compounds as a nitrogen source, results in reduced resolution of labeled populations. We therefore developed a tandem quantitative PCR (qPCR)-TRFLP (terminal restriction fragment length polymorphism) protocol that improves resolution of detection by quantifying specific taxonomic groups in gradient fractions. This method combines well-controlled amplification with TRFLP analysis to quantify relative taxon abundance in amplicon pools of FAM-labeled PCR products, using the intercalating dye EvaGreen to monitor amplification. Method accuracy was evaluated using mixtures of cloned 16S rRNA genes, DNA extracted from low- and high-G+C bacterial isolates (Escherichia coli, Rhodococcus, Variovorax, and Microbacterium), and DNA from soil microcosms amended with known amounts of genomic DNA from bacterial isolates. Improved resolution of minor shifts in buoyant density relative to TRFLP analysis alone was confirmed using well-controlled SIP analyses.

  8. Diversity of halophilic archaea from six hypersaline environments in Turkey.

    PubMed

    Ozcan, Birgul; Ozcengiz, Gulay; Coleri, Arzu; Cokmus, Cumhur

    2007-06-01

    The diversity of archaeal strains from six hypersaline environments in Turkey was analyzed by comparing their phenotypic characteristics and 16S rDNA sequences. Thirty-three isolates were characterized in terms of their phenotypic properties including morphological and biochemical characteristics, susceptibility to different antibiotics, and total lipid and plasmid contents, and finally compared by 16S rDNA gene sequences. The results showed that all isolates belong to the family Halobacteriaceae. Phylogenetic analyses using approximately 1,388 bp comparisions of 16S rDNA sequences demonstrated that all isolates clustered closely to species belonging to 9 genera, namely Halorubrum (8 isolates), Natrinema (5 isolates), Haloarcula (4 isolates), Natronococcus (4 isolates), Natrialba (4 isolates), Haloferax (3 isolates), Haloterrigena (3 isolates), Halalkalicoccus (1 isolate), and Halomicrobium (1 isolate). The results revealed a high diversity among the isolated halophilic strains and indicated that some of these strains constitute new taxa of extremely halophilic archaea.

  9. Isolation of Protein-Associated Circular DNA from Healthy Cattle Serum

    PubMed Central

    Funk, Mathis; Gunst, Karin; Lucansky, Vincent; Müller, Hermann; zur Hausen, Harald

    2014-01-01

    Three replication-competent single-stranded DNA molecules sharing nucleotide similarity to transmissible spongiform encephalopathy (TSE)-associated isolate Sphinx 2.36 were isolated from healthy bovine serum. PMID:25169856

  10. A primary assessment of the endophytic bacterial community in a xerophilous moss (Grimmia montana) using molecular method and cultivated isolates

    PubMed Central

    Liu, Xiao Lei; Liu, Su Lin; Liu, Min; Kong, Bi He; Liu, Lei; Li, Yan Hong

    2014-01-01

    Investigating the endophytic bacterial community in special moss species is fundamental to understanding the microbial-plant interactions and discovering the bacteria with stresses tolerance. Thus, the community structure of endophytic bacteria in the xerophilous moss Grimmia montana were estimated using a 16S rDNA library and traditional cultivation methods. In total, 212 sequences derived from the 16S rDNA library were used to assess the bacterial diversity. Sequence alignment showed that the endophytes were assigned to 54 genera in 4 phyla (Proteobacteria, Firmicutes, Actinobacteria and Cytophaga/Flexibacter/Bacteroids). Of them, the dominant phyla were Proteobacteria (45.9%) and Firmicutes (27.6%), the most abundant genera included Acinetobacter, Aeromonas, Enterobacter, Leclercia, Microvirga, Pseudomonas, Rhizobium, Planococcus, Paenisporosarcina and Planomicrobium. In addition, a total of 14 species belonging to 8 genera in 3 phyla (Proteobacteria, Firmicutes, Actinobacteria) were isolated, Curtobacterium, Massilia, Pseudomonas and Sphingomonas were the dominant genera. Although some of the genera isolated were inconsistent with those detected by molecular method, both of two methods proved that many different endophytic bacteria coexist in G. montana. According to the potential functional analyses of these bacteria, some species are known to have possible beneficial effects on hosts, but whether this is the case in G. montana needs to be confirmed. PMID:24948927

  11. Isolation of "Caenorhabditis elegans" Genomic DNA and Detection of Deletions in the "unc-93" Gene Using PCR

    ERIC Educational Resources Information Center

    Lissemore, James L.; Lackner, Laura L.; Fedoriw, George D.; De Stasio, Elizabeth A.

    2005-01-01

    PCR, genomic DNA isolation, and agarose gel electrophoresis are common molecular biology techniques with a wide range of applications. Therefore, we have developed a series of exercises employing these techniques for an intermediate level undergraduate molecular biology laboratory course. In these exercises, students isolate genomic DNA from the…

  12. Rapid and efficient cDNA library screening by self-ligation of inverse PCR products (SLIP).

    PubMed

    Hoskins, Roger A; Stapleton, Mark; George, Reed A; Yu, Charles; Wan, Kenneth H; Carlson, Joseph W; Celniker, Susan E

    2005-12-02

    cDNA cloning is a central technology in molecular biology. cDNA sequences are used to determine mRNA transcript structures, including splice junctions, open reading frames (ORFs) and 5'- and 3'-untranslated regions (UTRs). cDNA clones are valuable reagents for functional studies of genes and proteins. Expressed Sequence Tag (EST) sequencing is the method of choice for recovering cDNAs representing many of the transcripts encoded in a eukaryotic genome. However, EST sequencing samples a cDNA library at random, and it recovers transcripts with low expression levels inefficiently. We describe a PCR-based method for directed screening of plasmid cDNA libraries. We demonstrate its utility in a screen of libraries used in our Drosophila EST projects for 153 transcription factor genes that were not represented by full-length cDNA clones in our Drosophila Gene Collection. We recovered high-quality, full-length cDNAs for 72 genes and variously compromised clones for an additional 32 genes. The method can be used at any scale, from the isolation of cDNA clones for a particular gene of interest, to the improvement of large gene collections in model organisms and the human. Finally, we discuss the relative merits of directed cDNA library screening and RT-PCR approaches.

  13. Isolation and molecular identification of keratinophilic fungi from public parks soil in Shiraz, Iran.

    PubMed

    Pakshir, Keyvan; Ghiasi, Moosa Rahimi; Zomorodian, Kamiar; Gharavi, Ali Reza

    2013-01-01

    Keratinophilic fungi are an important group of fungi that live in soil. The aim of this study was to isolate and identify keratinophilic fungi from the soil of different parks in Shiraz. A total of 196 soil samples from 43 parks were collected. Isolation of the fungi was performed by hair bait technique. The isolated colonies were identified by morphologic feature of macro- and microconidia and molecular method, using DNA sequence analysis. ITS region of ribosomal DNA was amplified and the PCR products were sequenced. Results. 411 isolates from 22 genera were identified. Fusarium (23.8%), Chrysosporium (13.13%), Acremonium (12.65%), Penicillium (12.39%), Microsporum gypseum (1.94%), Bionectria ochroleuca (1.21%), Bipolaris spicifera (1.21%), Scedosporium apiospermum (0.82%), Phialophora reptans (0.82%), Cephalosporium curtipes (0.49%), Scedosporium dehoogii (0.24%), Ochroconis constricta (0.24%), Nectria mauritiicola (0.49%), Chaetomium (0.49%), Scopulariopsis (0.24%), Malbranchea (0.24%), and Tritirachium (0.24%) were the most important isolates. Most of the fungi were isolated from the soils with the PH range of 7 to 8. Our study results showed that many keratinophilic fungi isolated from the parks soil are important for public health and children are an important group at a high risk of being exposed to these fungi.

  14. Characterization of Vibrio parahaemolyticus causing acute hepatopancreatic necrosis disease in southern Thailand.

    PubMed

    Kongrueng, J; Yingkajorn, M; Bunpa, S; Sermwittayawong, N; Singkhamanan, K; Vuddhakul, V

    2015-11-01

    Vibrio parahaemolyticus was isolated from shrimp of five farms located in the Pattani and Songkhla provinces of southern Thailand. Using a PCR method targeted to the unique DNA sequences derived from the plasmid (AP2 primers) and the toxin gene (AP3 primers) of V. parahaemolyticus that caused acute hepatopancreatic necrosis disease (AHPND), a total of 33 of 108 isolates were positive. In contrast, all 63 and 66 isolates of clinical and environmental V. parahaemolyticus, respectively, obtained previously from 2008 to 2014 from the same area were negative. This implied that these strains were likely to be the cause of the outbreak of AHPND in this area. Intestinal samples proved to be a better source for the isolation of V. parahaemolyticus AHPND than the hepatopancreas. All isolates were investigated for haemolytic activity, virulence genes, serotypes, genotypes and antibiotic susceptibility. All the AHPND isolates had a unique O antigen, but small variations of the K antigens were detected from different farms. In addition, the DNA profiles of V. parahaemolyticus AHPND isolates were similar, but distinct from those clinical and environmental isolates. It is postulated that the causative agent of AHPND might have originated from one clone and then slightly different serotypes subsequently developed. © 2014 John Wiley & Sons Ltd.

  15. Phenol emulsion-enhanced DNA-driven subtractive cDNA cloning: isolation of low-abundance monkey cortex-specific mRNAs.

    PubMed Central

    Travis, G H; Sutcliffe, J G

    1988-01-01

    To isolate cDNA clones of low-abundance mRNAs expressed in monkey cerebral cortex but absent from cerebellum, we developed an improved subtractive cDNA cloning procedure that requires only modest quantities of mRNA. Plasmid DNA from a monkey cerebellum cDNA library was hybridized in large excess to radiolabeled monkey cortex cDNA in a phenol emulsion-enhanced reaction. The unhybridized cortex cDNA was isolated by chromatography on hydroxyapatite and used to probe colonies from a monkey cortex cDNA library. Of 60,000 colonies screened, 163 clones were isolated and confirmed by colony hybridization or RNA blotting to represent mRNAs, ranging from 0.001% to 0.1% abundance, specific to or highly enriched in cerebral cortex relative to cerebellum. Clones of one medium-abundance mRNA were recovered almost quantitatively. Two of the lower-abundance mRNAs were expressed at levels reduced by a factor of 10 in Alzheimer disease relative to normal human cortex. One of these was identified as the monkey preprosomatostatin I mRNA. Images PMID:2894033

  16. Rapid isolation of mycoviral double-stranded RNA from Botrytis cinerea and Saccharomyces cerevisiae

    PubMed Central

    2011-01-01

    Background In most of the infected fungi, the mycoviruses are latent or cryptic, the infected fungus does not show disease symptoms, and it is phenotypically identical to a non-infected strain of the same species. Because of these properties, the initial stage in the search for fungi infected with mycoviruses is the detection of their viral genome, which in most of the described cases corresponds to double-stranded RNA (dsRNA). So to analyze a large number of fungal isolates it is necessary to have a simple and rapid method to detect dsRNA. Results A rapid method to isolate dsRNA from a virus-infected filamentous fungus, Botrytis cinerea, and from a killer strain of Saccharomyces cerevisiae using commercial minicolumns packed with CF11 cellulose was developed. In addition to being a rapid method, it allows to use small quantities of yeasts or mycelium as starting material, being obtained sufficient dsRNA quantity that can later be analyzed by agarose gel electrophoresis, treated with enzymes for its partial characterization, amplified by RT-PCR and cloned in appropriate vectors for further sequencing. Conclusions The method yields high quality dsRNA, free from DNA and ssRNA. The use of nucleases to degrade the DNA or the ssRNA is not required, and it can be used to isolate dsRNA from any type of fungi or any biological sample that contains dsRNA. PMID:21262001

  17. Specific primers design based on the superoxide dismutase b gene for Trypanosoma cruzi as a screening tool: Validation method using strains from Colombia classified according to their discrete typing unit.

    PubMed

    Olmo, Francisco; Escobedo-Orteg, Javier; Palma, Patricia; Sánchez-Moreno, Manuel; Mejía-Jaramillo, Ana; Triana, Omar; Marín, Clotilde

    2014-11-01

    To classify 21 new isolates of Trypanosoma cruzi (T. cruzi) according to the Discrete Typing Unit (DTU) which they belong to, as well as tune up a new pair of primers designed to detect the parasite in biological samples. Strains were isolated, DNA extracted, and classified by using three Polymerase Chain Reactions (PCR). Subsequently this DNA was used along with other isolates of various biological samples, for a new PCR using primers designed. Finally, the amplified fragments were sequenced. It was observed the predominance of DTU I in Colombia, as well as the specificity of our primers for detection of T. cruzi, while no band was obtained when other species were used. This work reveals the genetic variability of 21 new isolates of T. cruzi in Colombia.Our primers confirmed their specificity for detecting the presence of T. cruzi. Copyright © 2014 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

  18. Repetitive sequences based on genotyping of Candida albicans isolates obtained from Iranian patients with human immunodeficiency virus

    PubMed Central

    Tamai, Iradj Ashrafi; Salehi, Taghi Zahraei; Sharifzadeh, Aghil; Shokri, Hojjatollah; Khosravi, Ali Reza

    2014-01-01

    Objective(s): Candidiasis infection caused by Candida albicans has been known as a major problem in patients with immune disorders. The objective of this study was to genotype the C. albicans isolates obtained from oral cavity of patients with positive human immunodeficiency virus (HIV+) with or/and without oropharyngeal candidiasis (OPC). Materials and Methods: A total of 100 C. albicans isolates from Iranian HIV+patients were genotyped using specific PCR primers of the 25S rDNA and RPS genes. Results: The frequencies of genotypes A, B and C which were achieved using 25S rDNA , were 66, 24 and 10 percent, respectively. In addition, genotypes D and E were not found in this study. Each C. albicans genotype was further classified into four subtypes (types 2, 3, 2/3 and 3/4) by PCR amplification targeting RPS sequence. Conclusion: In general, genotype A3 constituted the majority of understudy clinical isolates obtained from oral cavity of Iranian HIV+ patients. PMID:25691923

  19. Taxonomy of oxalotrophic Methylobacterium strains

    NASA Astrophysics Data System (ADS)

    Sahin, Nurettin; Kato, Yuko; Yilmaz, Ferah

    2008-10-01

    Most of the oxalotrophic bacteria are facultative methylotrophs and play important ecological roles in soil fertility and cycling of elements. This study gives a detailed picture of the taxonomy and diversity of these bacteria and provides new information about the taxonomical variability within the genus Methylobacterium. Twelve mesophilic, pink-pigmented, and facultatively methylotrophic oxalate-oxidizing strains were included in this work that had been previously isolated from the soil and some plant tissues by the potassium oxalate enrichment method. The isolates were characterized using biochemical tests, cellular lipid profiles, spectral characteristics of carotenoid pigments, G+C content of the DNA, and 16S rDNA sequencing. The taxonomic similarities among the strains were analyzed using the simple matching ( S SM) and Jaccard ( S J) coefficients, and the UPGMA clustering algorithm. The phylogenetic position of the strains was inferred by the neighbor-joining method on the basis of the 16S rDNA sequences. All isolates were Gram-negative, facultatively methylotrophic, oxidase and catalase positive, and required no growth factors. Based on the results of numerical taxonomy, the strains formed four closely related clusters sharing ≥85% similarity. Analysis of the 16S rDNA sequences demonstrated that oxalotrophic, pink-pigmented, and facultatively methylotrophic strains could be identified as members of the genus Methylobacterium. Except for M. variabile and M. aquaticum, all of the Methylobacterium type strains tested had the ability of oxalate utilization. Our results indicate that the capability of oxalate utilization seems to be an uncommon trait and could be used as a valuable taxonomic criterion for differentiation of Methylobacterium species.

  20. Taxonomy of oxalotrophic Methylobacterium strains.

    PubMed

    Sahin, Nurettin; Kato, Yuko; Yilmaz, Ferah

    2008-10-01

    Most of the oxalotrophic bacteria are facultative methylotrophs and play important ecological roles in soil fertility and cycling of elements. This study gives a detailed picture of the taxonomy and diversity of these bacteria and provides new information about the taxonomical variability within the genus Methylobacterium. Twelve mesophilic, pink-pigmented, and facultatively methylotrophic oxalate-oxidizing strains were included in this work that had been previously isolated from the soil and some plant tissues by the potassium oxalate enrichment method. The isolates were characterized using biochemical tests, cellular lipid profiles, spectral characteristics of carotenoid pigments, G+C content of the DNA, and 16S rDNA sequencing. The taxonomic similarities among the strains were analyzed using the simple matching (S (SM)) and Jaccard (S (J)) coefficients, and the UPGMA clustering algorithm. The phylogenetic position of the strains was inferred by the neighbor-joining method on the basis of the 16S rDNA sequences. All isolates were Gram-negative, facultatively methylotrophic, oxidase and catalase positive, and required no growth factors. Based on the results of numerical taxonomy, the strains formed four closely related clusters sharing > or =85% similarity. Analysis of the 16S rDNA sequences demonstrated that oxalotrophic, pink-pigmented, and facultatively methylotrophic strains could be identified as members of the genus Methylobacterium. Except for M. variabile and M. aquaticum, all of the Methylobacterium type strains tested had the ability of oxalate utilization. Our results indicate that the capability of oxalate utilization seems to be an uncommon trait and could be used as a valuable taxonomic criterion for differentiation of Methylobacterium species.

  1. Linkage of ciprofloxacin resistance with a single genotypic cluster of Klebsiella pneumoniae.

    PubMed

    Dashti, A A; Paton, R; Amyes, S G B

    2006-01-01

    The objective of this study was to examine the epidemiology of ciprofloxacin-resistant, extended-spectrum beta-lactamase (ESBL)-producing Klebsiella pneumoniae strains. Sixty-nine unique patient isolates of K. pneumoniae isolated from a variety of clinical specimens submitted to the clinical bacteriology laboratories of The Royal Infirmary of Edinburgh and associated General Practices were identified and susceptibility testing was performed with the Vitek system. Strains flagged as ESBL-positive by the Vitek system were subjected to isoelectric focusing. The results suggested that all 69 isolates harboured at least one ESBL, which was later confirmed by polymerase chain reaction (PCR) with bla(TEM) and/or bla(SHV) primers. The purified PCR product was subjected to automated sequencing and the results were compared with the BLAST online search engine. Of the 69 isolates, 32 (46.4%) were found to be resistant to ciprofloxacin, 11 (15.9%) were intermediate and 26 (37.7%) were sensitive. To investigate the epidemiological relationship between the ciprofloxacin-resistant ESBL-positive strains, pulsed-field gel electrophoresis (PFGE) was performed. Rapidest software was used to calculate the genetic distance by the Nei distance method. PFGE analysis indicated that the clinical isolates belonged to four distinct genotype clusters (Groups A, B, C and D); each group or cluster was homogeneous or compact with respect to certain characteristics. Group A consisted of 25 isolates, group B of 3 isolates and Groups C and D of 2 isolates each. These results indicate that the spread of resistance is largely as a result of the dissemination of a single clonal strain. PCR was used to amplify the gyrA and parC genes from genomic DNA of the ciprofloxacin-resistant isolates. The amplified product was sent for analysis by automated DNA sequencing and the resulting DNA sequences were compared with the gyrA gene of K. pneumoniae. The sequencing results demonstrated that alteration of the GyrA subunit of DNA gyrase at amino acid 83 and/or amino acid 87 plays a central role in conferring high-level quinolone resistance in K. pneumoniae possessing ESBLs.

  2. The Composition and Structure of Biofilms Developed by Propionibacterium acnes Isolated from Cardiac Pacemaker Devices.

    PubMed

    Okuda, Ken-Ichi; Nagahori, Ryuichi; Yamada, Satomi; Sugimoto, Shinya; Sato, Chikara; Sato, Mari; Iwase, Tadayuki; Hashimoto, Kazuhiro; Mizunoe, Yoshimitsu

    2018-01-01

    The present study aimed to understand the biofilm formation mechanism of Propionibacterium acnes by analyzing the components and structure of the biofilms. P. acnes strains were isolated from the surface of explanted cardiac pacemaker devices that exhibited no clinical signs of infection. Culture tests using a simple stamp culture method (pressing pacemakers against the surface of agar plates) revealed frequent P. acnes colonization on the surface of cardiac pacemaker devices. P . acnes was isolated from 7/31 devices, and the isolates were categorized by multilocus sequence typing into five different sequence types (STs): ST4 (JK18.2), ST53 (JK17.1), ST69 (JK12.2 and JK13.1), ST124 (JK5.3), ST125 (JK6.2), and unknown ST (JK19.3). An in vitro biofilm formation assay using microtiter plates demonstrated that 5/7 isolates formed biofilms. Inhibitory effects of DNase I and proteinase K on biofilm formation varied among isolates. In contrast, dispersin B showed no inhibitory activity against all isolates. Three-dimensional live/dead imaging of P. acnes biofilms with different biochemical properties using confocal laser microscopy demonstrated different distributions and proportions of living and dead cells. Additionally, it was suggested that extracellular DNA (eDNA) plays a role in the formation of biofilms containing living cells. Ultrastructural analysis of P. acnes biofilms using a transmission electron microscope and atmospheric scanning electron microscope revealed leakage of cytoplasmic components along with cell lysis and fibrous structures of eDNA connecting cells. In conclusion, the biochemical properties and structures of the biofilms differed among P. acnes isolates. These findings may provide clues for establishing countermeasures against biofilm-associated infection by P. acnes .

  3. The Composition and Structure of Biofilms Developed by Propionibacterium acnes Isolated from Cardiac Pacemaker Devices

    PubMed Central

    Okuda, Ken-ichi; Nagahori, Ryuichi; Yamada, Satomi; Sugimoto, Shinya; Sato, Chikara; Sato, Mari; Iwase, Tadayuki; Hashimoto, Kazuhiro; Mizunoe, Yoshimitsu

    2018-01-01

    The present study aimed to understand the biofilm formation mechanism of Propionibacterium acnes by analyzing the components and structure of the biofilms. P. acnes strains were isolated from the surface of explanted cardiac pacemaker devices that exhibited no clinical signs of infection. Culture tests using a simple stamp culture method (pressing pacemakers against the surface of agar plates) revealed frequent P. acnes colonization on the surface of cardiac pacemaker devices. P. acnes was isolated from 7/31 devices, and the isolates were categorized by multilocus sequence typing into five different sequence types (STs): ST4 (JK18.2), ST53 (JK17.1), ST69 (JK12.2 and JK13.1), ST124 (JK5.3), ST125 (JK6.2), and unknown ST (JK19.3). An in vitro biofilm formation assay using microtiter plates demonstrated that 5/7 isolates formed biofilms. Inhibitory effects of DNase I and proteinase K on biofilm formation varied among isolates. In contrast, dispersin B showed no inhibitory activity against all isolates. Three-dimensional live/dead imaging of P. acnes biofilms with different biochemical properties using confocal laser microscopy demonstrated different distributions and proportions of living and dead cells. Additionally, it was suggested that extracellular DNA (eDNA) plays a role in the formation of biofilms containing living cells. Ultrastructural analysis of P. acnes biofilms using a transmission electron microscope and atmospheric scanning electron microscope revealed leakage of cytoplasmic components along with cell lysis and fibrous structures of eDNA connecting cells. In conclusion, the biochemical properties and structures of the biofilms differed among P. acnes isolates. These findings may provide clues for establishing countermeasures against biofilm-associated infection by P. acnes. PMID:29491850

  4. Packaging DNA Origami into Viral Protein Cages.

    PubMed

    Linko, Veikko; Mikkilä, Joona; Kostiainen, Mauri A

    2018-01-01

    The DNA origami technique is a widely used method to create customized, complex, spatially well-defined two-dimensional (2D) and three-dimensional (3D) DNA nanostructures. These structures have huge potential to serve as smart drug-delivery vehicles and molecular devices in various nanomedical and biotechnological applications. However, so far only little is known about the behavior of these novel structures in living organisms or in cell culture/tissue models. Moreover, enhancing pharmacokinetic bioavailability and transfection properties of such structures still remains a challenge. One intriguing approach to overcome these issues is to coat DNA origami nanostructures with proteins or lipid membranes. Here, we show how cowpea chlorotic mottle virus (CCMV) capsid proteins (CPs) can be used for coating DNA origami nanostructures. We present a method for disassembling native CCMV particles and isolating the pure CP dimers, which can further bind and encapsulate a rectangular DNA origami shape. Owing to the highly programmable nature of DNA origami, packaging of DNA nanostructures into viral protein cages could find imminent uses in enhanced targeting and cellular delivery of various active nano-objects, such as enzymes and drug molecules.

  5. An accurate bacterial DNA quantification assay for HTS library preparation of human biological samples.

    PubMed

    Seashols-Williams, Sarah; Green, Raquel; Wohlfahrt, Denise; Brand, Angela; Tan-Torres, Antonio Limjuco; Nogales, Francy; Brooks, J Paul; Singh, Baneshwar

    2018-05-17

    Sequencing and classification of microbial taxa within forensically relevant biological fluids has the potential for applications in the forensic science and biomedical fields. The quantity of bacterial DNA from human samples is currently estimated based on quantity of total DNA isolated. This method can miscalculate bacterial DNA quantity due to the mixed nature of the sample, and consequently library preparation is often unreliable. We developed an assay that can accurately and specifically quantify bacterial DNA within a mixed sample for reliable 16S ribosomal DNA (16S rDNA) library preparation and high throughput sequencing (HTS). A qPCR method was optimized using universal 16S rDNA primers, and a commercially available bacterial community DNA standard was used to develop a precise standard curve. Following qPCR optimization, 16S rDNA libraries from saliva, vaginal and menstrual secretions, urine, and fecal matter were amplified and evaluated at various DNA concentrations; successful HTS data were generated with as low as 20 pg of bacterial DNA. Changes in bacterial DNA quantity did not impact observed relative abundances of major bacterial taxa, but relative abundance changes of minor taxa were observed. Accurate quantification of microbial DNA resulted in consistent, successful library preparations for HTS analysis. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Genetic diversity among brazilian isolates of beauveria bassiana: comparisons with non-brazilian isolates and other beauveria species

    USGS Publications Warehouse

    Fernandes, E.K.K.; Moraes, A.M.L.; Pacheco, R.S.; Rangel, D.E.N.; Miller, M.P.; Bittencourt, V.R.E.P.; Roberts, D.W.

    2009-01-01

    Aims: The genetic diversity of Beauveria bassiana was investigated by comparing isolates of this species to each other (49 from different geographical regions of Brazil and 4 from USA) and to other Beauveria spp. Methods and Results: The isolates were examined by multilocus enzyme electrophoresis (MLEE), amplified fragment length polymorphism (AFLP), and rDNA sequencing. MLEE and AFLP revealed considerable genetic variability among B. bassiana isolates. Several isolates from South and Southeast Brazil had high similarity coefficients, providing evidence of at least one population with clonal structure. There were clear genomic differences between most Brazilian and USA B. bassiana isolates. A Mantel test using data generated by AFLP provided evidence that greater geographical distances were associated with higher genetic distances. AFLP and rDNA sequencing demonstrated notable genotypic variation between B. bassiana and other Beauveria spp. Conclusion: Geographical distance between populations apparently is an important factor influencing genotypic variability among B. bassiana populations in Brazil. Significance and Impact of the Study: This study characterized many B. bassiana isolates. The results indicate that certain Brazilian isolates are considerably different from others and possibly should be regarded as separate species from B. bassiana sensu latu. The information on genetic variation among the Brazilian isolates, therefore, will be important to comprehending the population structure of B. bassiana in Brazil. ?? 2009 The Society for Applied Microbiology.

  7. Isolation, molecular cloning and in vitro expression of rhesus monkey (Macaca mulatta) prominin-1.s1 complementary DNA encoding a potential hematopoietic stem cell antigen.

    PubMed

    Husain, S M; Shou, Y; Sorrentino, B P; Handgretinger, R

    2006-10-01

    Human prominin-1 (CD133 or AC133) is an important cell surface marker used to isolate primitive hematopoietic stem cells. The commercially available antibody to human prominin-1 does not recognize rhesus prominin-1. Therefore, we isolated, cloned and characterized the complementary DNA (cDNA) of rhesus prominin-1 gene and determined its coding potential. Following the nomenclature of prominin family of genes, we named this cDNA as rhesus prominin-1.s1. The amino acid sequence data of the putative rhesus prominin-1.s1 could be used in designing antigenic peptides to raise antibodies for use in isolation of pure populations of rhesus prominin-1(+) hematopoietic cells. To the best of our knowledge, there has been no previously published report about the isolation of a prominin-1 cDNA from rhesus monkey (Macaca mulatta).

  8. Genetic mutation underlying orthostatic intolerance and diagnostic and therapeutic methods relating thereto

    NASA Technical Reports Server (NTRS)

    Blakely, Randy D. (Inventor); Robertson, David (Inventor)

    2006-01-01

    Isolated polynucleotide molecules and peptides encoded by these molecules are used in the analysis of human norepinephrine (NE) transporter variants, as well as in diagnostic and therapeutic applications, relating to a human NE transporter polymorphism. By analyzing genomic DNA or amplified genomic DNA, or amplified cDNA derived from mRNA, it is possible to type a human NE transporter with regard to the human NE transporter polymorphism, for example, in the context of diagnosing and treating NE transport impairments, and disorders associated with NE transport impairments, such as orthostatic intolerance.

  9. Rapid ABO genotyping by high-speed droplet allele-specific PCR using crude samples.

    PubMed

    Taira, Chiaki; Matsuda, Kazuyuki; Takeichi, Naoya; Furukawa, Satomi; Sugano, Mitsutoshi; Uehara, Takeshi; Okumura, Nobuo; Honda, Takayuki

    2018-01-01

    ABO genotyping has common tools for personal identification of forensic and transplantation field. We developed a new method based on a droplet allele-specific PCR (droplet-AS-PCR) that enabled rapid PCR amplification. We attempted rapid ABO genotyping using crude DNA isolated from dried blood and buccal cells. We designed allele-specific primers for three SNPs (at nucleotides 261, 526, and 803) in exons 6 and 7 of the ABO gene. We pretreated dried blood and buccal cells with proteinase K, and obtained crude DNAs without DNA purification. Droplet-AS-PCR allowed specific amplification of the SNPs at the three loci using crude DNA, with results similar to those for DNA extracted from fresh peripheral blood. The sensitivity of the methods was 5%-10%. The genotyping of extracted DNA and crude DNA were completed within 8 and 9 minutes, respectively. The genotypes determined by the droplet-AS-PCR method were always consistent with those obtained by direct sequencing. The droplet-AS-PCR method enabled rapid and specific amplification of three SNPs of the ABO gene from crude DNA treated with proteinase K. ABO genotyping by the droplet-AS-PCR has the potential to be applied to various fields including a forensic medicine and transplantation medical care. © 2017 Wiley Periodicals, Inc.

  10. A sensitive method to extract DNA from biological traces present on ammunition for the purpose of genetic profiling.

    PubMed

    Dieltjes, Patrick; Mieremet, René; Zuniga, Sofia; Kraaijenbrink, Thirsa; Pijpe, Jeroen; de Knijff, Peter

    2011-07-01

    Exploring technological limits is a common practice in forensic DNA research. Reliable genetic profiling based on only a few cells isolated from trace material retrieved from a crime scene is nowadays more and more the rule rather than the exception. On many crime scenes, cartridges, bullets, and casings (jointly abbreviated as CBCs) are regularly found, and even after firing, these potentially carry trace amounts of biological material. Since 2003, the Forensic Laboratory for DNA Research is routinely involved in the forensic investigation of CBCs in the Netherlands. Reliable DNA profiles were frequently obtained from CBCs and used to match suspects, victims, or other crime scene-related DNA traces. In this paper, we describe the sensitive method developed by us to extract DNA from CBCs. Using PCR-based genotyping of autosomal short tandem repeats, we were able to obtain reliable and reproducible DNA profiles in 163 out of 616 criminal cases (26.5%) and in 283 out of 4,085 individual CBC items (6.9%) during the period January 2003-December 2009. We discuss practical aspects of the method and the sometimes unexpected effects of using cell lysis buffer on the subsequent investigation of striation patterns on CBCs.

  11. Applying pollen DNA metabarcoding to the study of plant–pollinator interactions1

    PubMed Central

    Bell, Karen L.; Fowler, Julie; Burgess, Kevin S.; Dobbs, Emily K.; Gruenewald, David; Lawley, Brice; Morozumi, Connor; Brosi, Berry J.

    2017-01-01

    Premise of the study: To study pollination networks in a changing environment, we need accurate, high-throughput methods. Previous studies have shown that more highly resolved networks can be constructed by studying pollen loads taken from bees, relative to field observations. DNA metabarcoding potentially allows for faster and finer-scale taxonomic resolution of pollen compared to traditional approaches (e.g., light microscopy), but has not been applied to pollination networks. Methods: We sampled pollen from 38 bee species collected in Florida from sites differing in forest management. We isolated DNA from pollen mixtures and sequenced rbcL and ITS2 gene regions from all mixtures in a single run on the Illumina MiSeq platform. We identified species from sequence data using comprehensive rbcL and ITS2 databases. Results: We successfully built a proof-of-concept quantitative pollination network using pollen metabarcoding. Discussion: Our work underscores that pollen metabarcoding is not quantitative but that quantitative networks can be constructed based on the number of interacting individuals. Due to the frequency of contamination and false positive reads, isolation and PCR negative controls should be used in every reaction. DNA metabarcoding has advantages in efficiency and resolution over microscopic identification of pollen, and we expect that it will have broad utility for future studies of plant–pollinator interactions. PMID:28690929

  12. Revision of the species complex Amidostomum acutum (Lundahl, 1848) (Nematoda: Amidostomatidae) by use of molecular techniques.

    PubMed

    Kavetska, Katarzyna M; Polasik, Daniel; Dzierzba, Emil; Jędrzejczak, Małgorzata; Kalisińska, Elżbieta; Rząd, Izabella

    2015-01-01

    The aim of the work is to confirm the species differentiation of the nematodes of the Amidostomatidae family: Amidostomoides acutum (Lundahl, 1848) Lomakin, 1991; Amidostomoides monodon (Linstow, 1882) Lomakin, 1991, and Amidostomoides petrovi (Shakhtahtinskaya, 1956) Lomakin, 1991, which still are used in the parasitological literature as synonyms of Amidostomum acutum (Lundahl, 1848). The research material consisted of nematodes isolated from gizzards of dabbling ducks from the north-west of Poland. To confirm the species differentiation, DNA from the nematodes was isolated and approximately 630bp of the 28S rRNA gene were sequenced. The obtained DNA sequences were tabulated and then phylogenetic analysis were conducted using the UPGMA method. The results of the research distinctly diversify the nematodes of the genus Amidostomoides at the DNA level, which together with morphological and ecological differences among them (hosts from different systematic groups) enables to classify them into the separate species.

  13. A novel growth-promoting microbe, Methylobacterium funariae sp. nov., isolated from the leaf surface of a common moss.

    PubMed

    Schauer, S; Kutschera, U

    2011-04-01

    Land plants (embryophytes) evolved in the presence of prokaryotic microbes. As a result, numerous mutually beneficial associations (symbioses) developed that can be analyzed using a variety of methods. Here we describe the isolation and characterization of a new pink-pigmented facultatively methylotrophic symbiotic bacterium of the genus Methylobacterium (laboratory strain F3.2) that was isolated from the gametophytic phylloids of the common cord moss Funaria hygrometrica Hedw. Plantlets were collected in the field and analyzed in the laboratory. Colonies of methylobacteria were obtained by the agar-impression-method. Based on its unique phenotype (the bacterial cells are characterized by fimbriae-like appendages), a comparative 16S rRNA gene (DNA) sequence analysis, and an average DNA-DNA hybridization value of 8,4 %, compared with its most closely related sister taxon, this isolate is described as a new species, Methylobacterium funariae sp. nov. (type strain F3.2). This new epiphytic bacterium inhabits the leaf surface of "primitive" land plants such as mosses and interacts with its host organism via the secretion of phytohormones (cytokinines, auxins). These external signals are perceived by the plant cells that divide and grow more rapidly than in the absence of their prokaryotic phytosymbionts. We suggest that M. funariae sp. nov. uses methanol emitted from the stomatal pores as principal carbon source for cell metabolism. However, our novel data indicate that, in this unique symbiotic plant-microbe interaction, the uptake of amino acids leached from the surface of the epidermal cells of the green host organism may be of importance as microbial carbon- and nitrogen-source.

  14. Phenotypic and genotypic characteristics of drug resistance in Mycobacterium tuberculosis isolates from pediatric population of Chennai, India.

    PubMed

    Therese, K Lily; Gayathri, R; Balasubramanian, S; Natrajan, S; Madhavan, H N

    2012-01-01

    Multidrug-resistant TB (MDR-TB) has been reported in almost all parts of the world. Childhood TB is accorded low priority by national TB control programs. Probable reasons include diagnostic difficulties, limited resources, misplaced faith in BCG and lack of data on treatment. Good data on the burden of all forms of TB among children in India are not available. To study the drug sensitivity pattern of tuberculosis in children aged from 3 months to 18 years and the outcome of drug-resistant tuberculosis by BACTEC culture system and PCR-based DNA sequencing technique. This is a retrospective study. One hundred and fifty-nine clinical specimens were processed for Ziehl-Neelsen stain, Mycobacterial culture by BACTEC method, phenotypic DST for first-line drugs for Mycobacterium tuberculosis (M. tuberculosis) isolates and PCR-based DNA sequencing was performed for the M. tuberculosis isolates targeting rpoB, katG, inhA, oxyR-ahpC, rpsL, rrs and pncA. Out of the 159 Mycobacterial cultures performed during the study period, 17 clinical specimens (10.7%) were culture positive for M. tuberculosis. Among the 17 M. tuberculosis isolates, 2 were multidrug-resistant TB. PCR-based DNA sequencing revealed the presence of many novel mutations targeting katG, inhA, oxyR-ahpC and pncA and the most commonly reported mutation Ser531Leu in the rpoB gene. This study underlines the urgent need to take efforts to develop methods for rapid detection and drug susceptibility of tubercle bacilli in the pediatric population.

  15. 3' rapid amplification of cDNA ends (RACE) walking for rapid structural analysis of large transcripts.

    PubMed

    Ozawa, Tatsuhiko; Kondo, Masato; Isobe, Masaharu

    2004-01-01

    The 3' rapid amplification of cDNA ends (3' RACE) is widely used to isolate the cDNA of unknown 3' flanking sequences. However, the conventional 3' RACE often fails to amplify cDNA from a large transcript if there is a long distance between the 5' gene-specific primer and poly(A) stretch, since the conventional 3' RACE utilizes 3' oligo-dT-containing primer complementary to the poly(A) tail of mRNA at the first strand cDNA synthesis. To overcome this problem, we have developed an improved 3' RACE method suitable for the isolation of cDNA derived from very large transcripts. By using the oligonucleotide-containing random 9mer together with the GC-rich sequence for the suppression PCR technology at the first strand of cDNA synthesis, we have been able to amplify the cDNA from a very large transcript, such as the microtubule-actin crosslinking factor 1 (MACF1) gene, which codes a transcript of 20 kb in size. When there is no splicing variant, our highly specific amplification allows us to perform the direct sequencing of 3' RACE products without requiring cloning in bacterial hosts. Thus, this stepwise 3' RACE walking will help rapid characterization of the 3' structure of a gene, even when it encodes a very large transcript.

  16. Energy barriers and rates of tautomeric transitions in DNA bases: ab initio quantum chemical study.

    PubMed

    Basu, Soumalee; Majumdar, Rabi; Das, Gourab K; Bhattacharyya, Dhananjay

    2005-12-01

    Tautomeric transitions of DNA bases are proton transfer reactions, which are important in biology. These reactions are involved in spontaneous point mutations of the genetic material. In the present study, intrinsic reaction coordinates (IRC) analyses through ab initio quantum chemical calculations have been carried out for the individual DNA bases A, T, G, C and also A:T and G:C base pairs to estimate the kinetic and thermodynamic barriers using MP2/6-31G** method for tautomeric transitions. Relatively higher values of kinetic barriers (about 50-60 kcal/mol) have been observed for the single bases, indicating that tautomeric alterations of isolated single bases are quite unlikely. On the other hand, relatively lower values of the kinetic barriers (about 20-25 kcal/mol) for the DNA base pairs A:T and G:C clearly suggest that the tautomeric shifts are much more favorable in DNA base pairs than in isolated single bases. The unusual base pairing A':C, T':G, C':A or G':T in the daughter DNA molecule, resulting from a parent DNA molecule with tautomeric shifts, is found to be stable enough to result in a mutation. The transition rate constants for the single DNA bases in addition to the base pairs are also calculated by computing the free energy differences between the transition states and the reactants.

  17. Taxonomic analysis of extremely halophilic archaea isolated from 56-years-old dead sea brine samples.

    PubMed

    Arahal, D R; Gutiérrez, M C; Volcani, B E; Ventosa, A

    2000-10-01

    A taxonomic study comprising both phenotypic and genotypic characterization, has been carried out on a total of 158 extremely halophilic aerobic archaeal strains. These strains were isolated from enrichments prepared from Dead Sea water samples dating from 1936 that were collected by B. E. Volcani for the demonstration of microbial life in the Dead Sea. The isolates were examined for 126 morphological, physiological, biochemical and nutritional tests. Numerical analysis of the data, by using the S(J) coefficient and UPGMA clustering method, showed that the isolates clustered into six phenons. Twenty-two out of the 158 strains used in this study were characterized previously (ARAHAL et al., 1996) and were placed into five phenotypic groups. The genotypic study included both the determination of the guanineplus-cytosine content of the DNA and DNA-DNA hybridization studies. For this purpose, representative strains from the six phenons were chosen. These groups were found to represent some members of three different genera - Haloarcula (phenons A, B, and C), Haloferax (phenons D and E) and Halobacterium (phenon F) - of the family Halobacteriaceae, some of them never reported to occur in the Dead Sea, such as Haloarcula hispanica, while Haloferax volcanii (phenons D and E) was described in the Dead Sea by studies carried out several decades later than Volcani's work.

  18. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... for Mycoplasma gallisepticum and M. synoviae. (a) DNA isolation. Isolate DNA from 1 mL of eluate from... supernatant DNA to a nuclease-free tube. Estimate the DNA concentration and purity by spectrophotometric... primer (50 μM), 1 μl Forward primer (50 μM). (2) Perform DNA amplification in a Perkin-Elmer 9600...

  19. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... for Mycoplasma gallisepticum and M. synoviae. (a) DNA isolation. Isolate DNA from 1 mL of eluate from... supernatant DNA to a nuclease-free tube. Estimate the DNA concentration and purity by spectrophotometric... primer (50 μM), 1 μl Forward primer (50 μM). (2) Perform DNA amplification in a Perkin-Elmer 9600...

  20. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... for Mycoplasma gallisepticum and M. synoviae. (a) DNA isolation. Isolate DNA from 1 mL of eluate from... supernatant DNA to a nuclease-free tube. Estimate the DNA concentration and purity by spectrophotometric... primer (50 μM), 1 μl Forward primer (50 μM). (2) Perform DNA amplification in a Perkin-Elmer 9600...

  1. Chemically synthesized silver nanoparticles as cell lysis agent for bacterial genomic DNA isolation

    NASA Astrophysics Data System (ADS)

    Goswami, Gunajit; Boruah, Himangshu; Gautom, Trishnamoni; Jyoti Hazarika, Dibya; Barooah, Madhumita; Boro, Robin Chandra

    2017-12-01

    Silver nanoparticles (AgNPs) have seen a recent spurt of use in varied fields of science. In this paper, we showed a novel application of AgNP as a promising microbial cell-lysis agent for genomic DNA isolation. We utilized chemically synthesized AgNPs for lysing bacterial cells to isolate their genomic DNA. The AgNPs efficiently lysed bacterial cells to yield good quality DNA that could be subsequently used for several molecular biology works.

  2. The identification of genes specific to Prevotella intermedia and Prevotella nigrescens using genomic subtractive hybridization.

    PubMed

    Masakiyo, Yoshiaki; Yoshida, Akihiro; Shintani, Yasuyuki; Takahashi, Yusuke; Ansai, Toshihiro; Takehara, Tadamichi

    2010-06-01

    Prevotella intermedia and Prevotella nigrescens, which are often isolated from periodontal sites, were once considered two different genotypes of P. intermedia. Although the genomic sequence of P. intermedia was determined recently, little is known about the genetic differences between P. intermedia and P. nigrescens. The subtractive hybridization technique is a powerful method for generating a set of DNA fragments differing between two closely related bacterial strains or species. We used subtractive hybridization to identify the DNA regions specific to P. intermedia ATCC 25611 and P. nigrescens ATCC 25261. Using this method, four P. intermedia ATCC 25611-specific and three P. nigrescens ATCC 25261-specific regions were determined. From the species-specific regions, insertion sequence (IS) elements were isolated for P. intermedia. IS elements play an important role in the pathogenicity of bacteria. For the P. intermedia-specific regions, the genes adenine-specific DNA-methyltransferase and 8-amino-7-oxononanoate synthase were isolated. The P. nigrescens-specific region contained a Flavobacterium psychrophilum SprA homologue, a cell-surface protein involved in gliding motility, Prevotella melaninogenica ATCC 25845 glutathione peroxide, and Porphyromonas gingivalis ATCC 33277 leucyl-tRNA synthetase. The results demonstrate that the subtractive hybridization technique was useful for distinguishing between the two closely related species. Furthermore, this technique will contribute to our understanding of the virulence of these species. 2009 Elsevier Ltd. All rights reserved.

  3. Adenovirus type 2 DNA replication. I. Evidence for discontinuous DNA synthesis.

    PubMed Central

    Winnacker, E L

    1975-01-01

    Isolated nuclei from adenovirus type 2-infected HeLa cells catalyze the incorporation of all four deoxyribonucleoside triphosphates into viral DNA. The observed DNA synthesis occurs via a transient formation of DNA fragments with a sedimentation coefficient of 10S. The fragments are precursors to unit-length viral DNA, they are self-complementary to an extent of at least 70%, and they are distributed along most of the viral chromosome. In addition, accumulation of 10S DNA fragments is observed either in intact, virus-infected HeLa cells under conditions where viral DNA synthesis is inhibited by hydroxyurea or in isolated nuclei from virus-infected HeLa cells at low concentrations of deoxyribonucleotides. Under these suboptimal conditions for DNA synthesis in isolated nuclei, ribonucleoside triphosphates determine the size distribution of DNA intermediates. The evidence presented suggests that a ribonucleoside-dependent initiation step as well at two DNA polymerase catalyzed reactions are involved in the discontinuous replication of adenovirus type 2 DNA. PMID:1117487

  4. Evaluation and comparison of FTA card and CTAB DNA extraction methods for non-agricultural taxa.

    PubMed

    Siegel, Chloe S; Stevenson, Florence O; Zimmer, Elizabeth A

    2017-02-01

    An efficient, effective DNA extraction method is necessary for comprehensive analysis of plant genomes. This study analyzed the quality of DNA obtained using paper FTA cards prepared directly in the field when compared to the more traditional cetyltrimethylammonium bromide (CTAB)-based extraction methods from silica-dried samples. DNA was extracted using FTA cards according to the manufacturer's protocol. In parallel, CTAB-based extractions were done using the automated AutoGen DNA isolation system. DNA quality for both methods was determined for 15 non-agricultural species collected in situ, by gel separation, spectrophotometry, fluorometry, and successful amplification and sequencing of nuclear and chloroplast gene markers. The FTA card extraction method yielded less concentrated, but also less fragmented samples than the CTAB-based technique. The card-extracted samples provided DNA that could be successfully amplified and sequenced. The FTA cards are also useful because the collected samples do not require refrigeration, extensive laboratory expertise, or as many hazardous chemicals as extractions using the CTAB-based technique. The relative success of the FTA card method in our study suggested that this method could be a valuable tool for studies in plant population genetics and conservation biology that may involve screening of hundreds of individual plants. The FTA cards, like the silica gel samples, do not contain plant material capable of propagation, and therefore do not require permits from the U.S. Department of Agriculture (USDA) Animal and Plant Health Inspection Service (APHIS) for transportation.

  5. Two New Nuclear Isolation Buffers for Plant DNA Flow Cytometry: A Test with 37 Species

    PubMed Central

    Loureiro, João; Rodriguez, Eleazar; Doležel, Jaroslav; Santos, Conceição

    2007-01-01

    Background and Aims After the initial boom in the application of flow cytometry in plant sciences in the late 1980s and early 1990s, which was accompanied by development of many nuclear isolation buffers, only a few efforts were made to develop new buffer formulas. In this work, recent data on the performance of nuclear isolation buffers are utilized in order to develop new buffers, general purpose buffer (GPB) and woody plant buffer (WPB), for plant DNA flow cytometry. Methods GPB and WPB were used to prepare samples for flow cytometric analysis of nuclear DNA content in a set of 37 plant species that included herbaceous and woody taxa with leaf tissues differing in structure and chemical composition. The following parameters of isolated nuclei were assessed: forward and side light scatter, propidium iodide fluorescence, coefficient of variation of DNA peaks, quantity of debris background, and the number of particles released from sample tissue. The nuclear genome size of 30 selected species was also estimated using the buffer that performed better for a given species. Key Results In unproblematic species, the use of both buffers resulted in high quality samples. The analysis of samples obtained with GPB usually resulted in histograms of DNA content with higher or similar resolution than those prepared with the WPB. In more recalcitrant tissues, such as those from woody plants, WPB performed better and GPB failed to provide acceptable results in some cases. Improved resolution of DNA content histograms in comparison with previously published buffers was achieved in most of the species analysed. Conclusions WPB is a reliable buffer which is also suitable for the analysis of problematic tissues/species. Although GPB failed with some plant species, it provided high-quality DNA histograms in species from which nuclear suspensions are easy to prepare. The results indicate that even with a broad range of species, either GPB or WPB is suitable for preparation of high-quality suspensions of intact nuclei suitable for DNA flow cytometry. PMID:17684025

  6. Molecular characterisation and control of Acinetobacter baumannii isolates resistant to multi-drugs emerging in inter-intensive care units.

    PubMed

    Ertürk, Ayşe; Çiçek, Ayşegül Çopur; Gümüş, Aziz; Cüre, Erkan; Şen, Ahmet; Kurt, Aysel; Karagöz, Alper; Aydoğan, Nebahat; Sandallı, Cemal; Durmaz, Rıza

    2014-07-22

    A nosocomial outbreak of Acinetobacter baumannii (AB) infections occurred among intensive care units (ICU) (surgery, medical, cardiovascular surgery, coronary unit) of Recep Tayyip Erdogan University Medical School (Rize, Turkey) between January 2011 and May 2012. The identification of isolates and clonal relation among them were investigated by molecular techniques. A total of 109 AB isolates were obtained from 64 clinical materials from 54 ICU patients and 3 from the hands of healthcare workers (HCWs) of 42 environmental samples. The isolates were identified by 16S rDNA sequencing and OXA- specific PCR. The clonal relation between isolates was investigated by PFGE methods using ApaI restriction enzyme. All isolates were determined as AB by 16S rDNA sequencing and OXA-spesific PCR. While the blaOXA-51-like gene was amplified in all isolates, the blaOXA-23-like gene was amplified from 103 isolates. The PFGE pattern generated 9 pulsotypes and showed that the isolates from patients, HCWs, and the environment were genetically related. In 7 of these pulsotypes, there were 107 strains (98%) showing similar PFGE profiles that cannot be distinguished from each other, ranging from 2 to 53. The remaining 2 pulsotypes were comprised of strains closely associated with the main cluster. Two major groups were discovered with similarity coefficient of 85% and above. The first group consisted of 97 strains that are similar to each other at 92.7% rate, and the second group consisted of 12 strains that are 100% identical. The common utilization of the blood gas device among ICU was the reason for the contamination. AB strains can remain stable for a long period of time, although due to the disinfection procedures applied in hospitals, there is a small chance that the same clone might reappear and cause another epidemic. For that reason, the resistance profiles of the strains must be continuously followed with amplification-based methods, and these methods should be used to support the PFGE method in the short term.

  7. BAC sequencing using pooled methods.

    PubMed

    Saski, Christopher A; Feltus, F Alex; Parida, Laxmi; Haiminen, Niina

    2015-01-01

    Shotgun sequencing and assembly of a large, complex genome can be both expensive and challenging to accurately reconstruct the true genome sequence. Repetitive DNA arrays, paralogous sequences, polyploidy, and heterozygosity are main factors that plague de novo genome sequencing projects that typically result in highly fragmented assemblies and are difficult to extract biological meaning. Targeted, sub-genomic sequencing offers complexity reduction by removing distal segments of the genome and a systematic mechanism for exploring prioritized genomic content through BAC sequencing. If one isolates and sequences the genome fraction that encodes the relevant biological information, then it is possible to reduce overall sequencing costs and efforts that target a genomic segment. This chapter describes the sub-genome assembly protocol for an organism based upon a BAC tiling path derived from a genome-scale physical map or from fine mapping using BACs to target sub-genomic regions. Methods that are described include BAC isolation and mapping, DNA sequencing, and sequence assembly.

  8. Molecular identification of leishmania species using samples obtained from negative stained smears.

    PubMed

    Mohaghegh, Ma; Fata, A; Salehi, Gh; Berenji, F; Bazzaz, M Mousavi; Rafatpanah, H; Parian, M; Movahedi, A

    2013-04-01

    Cutaneous Leishmaniasis (CL) is a parasitic skin disease. Diagnosis primarily is based on clinical signs and microscopic observation of parasite on direct stained smears or tissue sections. Sensitivity of direct smear is not as high as molecular methods. The aim of this study was to identify and characterize Leishmania species among the negative direct smears obtained from skin ulcers suspected to CL by PCR method. Among 81 patients with suspicious skin lesions to CL referred to the Parasitology lab, negative Giemsa stained smears were collected. DNA extraction performed by scraping stained smears, then PCR was performed. Among the DNA extracted from smears, L. tropica was isolated from 9 (11.1%) of the smears and L.major was not isolated from any samples. Direct microscopy on stained smears for diagnosis of leishmaniasis is not enough accurate. PCR is recommended for clinically suspected lesions with negative result of direct smear.

  9. Isolation of a species-specific mitochondrial DNA sequence for identification of Tilletia indica, the Karnal bunt of wheat fungus.

    PubMed Central

    Ferreira, M A; Tooley, P W; Hatziloukas, E; Castro, C; Schaad, N W

    1996-01-01

    Mitochondrial DNA (mtDNA) from five isolates of Tilletia indica was isolated and digested with several restriction enzymes. A 2.3-kb EcoRI fragment was chosen, cloned, and shown to hybridize with total DNA restricted with EcoRI from T. indica and not from a morphologically similar smut fungus, Tilletia barclayana. The clone was partially sequenced, and primers were designed and tested under high-stringency conditions in PCR assays. The primer pair Ti1/Ti4 amplified a 2.3-kb fragment from total DNA of 17 T. indica isolates from India, Pakistan, and Mexico. DNA from 25 isolates of other smut fungi (T. barclayana, Tilletia foetida, Tilletia caries, Tilletia fusca, and Tilletia controversa) did not produce any bands, as detected by ethidium bromide-stained agarose gels and Southern hybridizations. The sensitivity of the assay was determined and increased by using a single nested primer in a second round of amplification, so that 1 pg of total mycelial DNA could be detected. The results indicated that the primers which originated from a cloned mtDNA sequence can be used to differentiate T. indica from other Tilletia species and have the potential to identify teliospores contaminating wheat seeds. PMID:8572716

  10. Comparison of DNA Microarray, Loop-Mediated Isothermal Amplification (LAMP) and Real-Time PCR with DNA Sequencing for Identification of Fusarium spp. Obtained from Patients with Hematologic Malignancies.

    PubMed

    de Souza, Marcela; Matsuzawa, Tetsuhiro; Sakai, Kanae; Muraosa, Yasunori; Lyra, Luzia; Busso-Lopes, Ariane Fidelis; Levin, Anna Sara Shafferman; Schreiber, Angélica Zaninelli; Mikami, Yuzuru; Gonoi, Tohoru; Kamei, Katsuhiko; Moretti, Maria Luiza; Trabasso, Plínio

    2017-08-01

    The performance of three molecular biology techniques, i.e., DNA microarray, loop-mediated isothermal amplification (LAMP), and real-time PCR were compared with DNA sequencing for properly identification of 20 isolates of Fusarium spp. obtained from blood stream as etiologic agent of invasive infections in patients with hematologic malignancies. DNA microarray, LAMP and real-time PCR identified 16 (80%) out of 20 samples as Fusarium solani species complex (FSSC) and four (20%) as Fusarium spp. The agreement among the techniques was 100%. LAMP exhibited 100% specificity, while DNA microarray, LAMP and real-time PCR showed 100% sensitivity. The three techniques had 100% agreement with DNA sequencing. Sixteen isolates were identified as FSSC by sequencing, being five Fusarium keratoplasticum, nine Fusarium petroliphilum and two Fusarium solani. On the other hand, sequencing identified four isolates as Fusarium non-solani species complex (FNSSC), being three isolates as Fusarium napiforme and one isolate as Fusarium oxysporum. Finally, LAMP proved to be faster and more accessible than DNA microarray and real-time PCR, since it does not require a thermocycler. Therefore, LAMP signalizes as emerging and promising methodology to be used in routine identification of Fusarium spp. among cases of invasive fungal infections.

  11. Isolation and characterization of target sequences of the chicken CdxA homeobox gene.

    PubMed Central

    Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A

    1993-01-01

    The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943

  12. Genomic relations among 31 species of Mammillaria haworth (Cactaceae) using random amplified polymorphic DNA.

    PubMed

    Mattagajasingh, Ilwola; Mukherjee, Arup Kumar; Das, Premananda

    2006-01-01

    Thirty-one species of Mammillaria were selected to study the molecular phylogeny using random amplified polymorphic DNA (RAPD) markers. High amount of mucilage (gelling polysaccharides) present in Mammillaria was a major obstacle in isolating good quality genomic DNA. The CTAB (cetyl trimethyl ammonium bromide) method was modified to obtain good quality genomic DNA. Twenty-two random decamer primers resulted in 621 bands, all of which were polymorphic. The similarity matrix value varied from 0.109 to 0.622 indicating wide variability among the studied species. The dendrogram obtained from the unweighted pair group method using arithmetic averages (UPGMA) analysis revealed that some of the species did not follow the conventional classification. The present work shows the usefulness of RAPD markers for genetic characterization to establish phylogenetic relations among Mammillaria species.

  13. DNA Fingerprinting of Lactic Acid Bacteria in Sauerkraut Fermentations▿ † ‡

    PubMed Central

    Plengvidhya, Vethachai; Breidt, Fredrick; Lu, Zhongjing; Fleming, Henry P.

    2007-01-01

    Previous studies using traditional biochemical identification methods to study the ecology of commercial sauerkraut fermentations revealed that four species of lactic acid bacteria, Leuconostoc mesenteroides, Lactobacillus plantarum, Pediococcus pentosaceus, and Lactobacillus brevis, were the primary microorganisms in these fermentations. In this study, 686 isolates were collected from four commercial fermentations and analyzed by DNA fingerprinting. The results indicate that the species of lactic acid bacteria present in sauerkraut fermentations are more diverse than previously reported and include Leuconostoc citreum, Leuconostoc argentinum, Lactobacillus paraplantarum, Lactobacillus coryniformis, and Weissella sp. The newly identified species Leuconostoc fallax was also found. Unexpectedly, only two isolates of P. pentosaceus and 15 isolates of L. brevis were recovered during this study. A better understanding of the microbiota may aid in the development of low-salt fermentations, which may have altered microflora and altered sensory characteristics. PMID:17921264

  14. Phenotypic and genotypic characterization of phenanthrene-degrading fluorescent Pseudomonas biovars.

    PubMed Central

    Johnsen, K; Andersen, S; Jacobsen, C S

    1996-01-01

    A total of 41 phenanthrene degraders were isolated from a former coal gasification site by using Pseudomonas-selective Gould's S1 medium. All isolates were found to belong to the fluorescent Pseudomonas group and were subjected to characterization by phenotypic methods, including classical taxonomic tests, API 20NE, and Biolog GN, and the strains were further characterized by the genotypic method repetitive extragenic palindromic PCR (REP-PCR). By using classical tests, the population was found to consist of 38 strains belonging to P. fluorescens, 2 P. putida strains, and 1 Pseudomonas sp. Bacteria in phenograms from Biolog GN and REP-PCR data were divided into groups, which were in good agreement with classical test and API 20NE results. We found a nonfluorescent group of 22 bacteria inconsistent with any Pseudomonas sp. in Bergey's Manual of Systematic Bacteriology. The group showed small differences in the genotypic test, indicating that all 22 isolates were not recent clones of the same isolate. Analyses of the nonfluorescent group indicated that it belonged to Pseudomonas, but the group could not be affiliated with P. fluorescens because of differences in DNA-DNA hybridization. Identifications using classical tests and API 20NE were found to correlate, but Biolog GN identifications after 24-h incubation resulted very often in the distantly related P. corrugata. The reproducibilities of individual tests of each phenotypic method were assessed, and low reproducibilities were mainly found to be associated with specific Biolog GN test wells. Classical tests and API 20NE proved to be the best for identification of isolates, whereas Biolog GN and REP-PCR were found to be the best tests for high resolution among these closely related isolates. PMID:8837438

  15. Characterization of multidrug-resistant Acinetobacter ssp. strains isolated from medical intensive care units in Cali - Colombia.

    PubMed Central

    Castillo, Andres; Chávez-Vivas, Mónica

    2017-01-01

    Abstract Introduction: The extensive use of antibiotics has led to the emergence of multi-resistant strains in some species of the genus Acinetobacter. Objective: To investigate the molecular characteristics of multidrug-resistant of Acinetobacter ssp. strains isolated from 52 patients collected between March 2009 and July 2010 in medical intensive care units in Cali - Colombia. Methods: The susceptibility to various classes of antibiotics was determined by disc diffusion method, and the determination of the genomic species was carried out using amplified ribosomal DNA restriction analysis (ARDRA) and by sequencing of the 16s rDNA gene. Also, the genes of beta-lactamases as well as, integrases IntI1 and IntI2 were analyzed by PCR method. Results: The phenotypic identification showed that the isolates belong mainly to A. calcoaceticus- A. baumannii complex. All of them were multi-resistant to almost the whole antibiotics except to tigecycline and sulperazon, and they were grouped into five (I to V) different antibiotypes, being the antibiotype I the most common (50.0%). The percent of beta-lactamases detected was: blaTEM (17.3%), blaCTX-M (9.6%), blaVIM (21.2%), blaIMP (7.7%), blaOXA-58 (21.2%), and blaOXA-51 (21.2%). The phylogenetic tree analysis showed that the isolates were clustering to A. baumannii (74.1%), A. nosocomialis (11.1%) and A. calcoaceticus (7.4 %). Besides, the integron class 1 and class 2 were detected in 23.1% and 17.3% respectively. Conclusion: The isolates were identified to species A. baumanii mainly, and they were multiresistant. The resistance to beta-lactams may be by for presence of beta-lactamases in the majority of the isolates. PMID:29662260

  16. Phylogenetic Analysis of Shewanella Strains by DNA Relatedness Derived from Whole Genome Microarray DNA-DNA Hybridization and Comparison with Other Methods

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Liyou; Yi, T. Y.; Van Nostrand, Joy

    Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site [Hanford Reach of the Columbia River (HRCR), 11 strains], Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the averagemore » nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.« less

  17. Hofmeister series salts enhance purification of plasmid DNA by non-ionic detergents

    PubMed Central

    Lezin, George; Kuehn, Michael R.; Brunelli, Luca

    2011-01-01

    Ion-exchange chromatography is the standard technique used for plasmid DNA purification, an essential molecular biology procedure. Non-ionic detergents (NIDs) have been used for plasmid DNA purification, but it is unclear whether Hofmeister series salts (HSS) change the solubility and phase separation properties of specific NIDs, enhancing plasmid DNA purification. After scaling-up NID-mediated plasmid DNA isolation, we established that NIDs in HSS solutions minimize plasmid DNA contamination with protein. In addition, large-scale NID/HSS solutions eliminated LPS contamination of plasmid DNA more effectively than Qiagen ion-exchange columns. Large-scale NID isolation/NID purification generated increased yields of high quality DNA compared to alkali isolation/column purification. This work characterizes how HSS enhance NID-mediated plasmid DNA purification, and demonstrates that NID phase transition is not necessary for LPS removal from plasmid DNA. Specific NIDs such as IGEPAL CA-520 can be utilized for rapid, inexpensive and efficient laboratory-based large-scale plasmid DNA purification, outperforming Qiagen-based column procedures. PMID:21351074

  18. Localization microscopy of DNA in situ using Vybrant(®) DyeCycle™ Violet fluorescent probe: A new approach to study nuclear nanostructure at single molecule resolution.

    PubMed

    Żurek-Biesiada, Dominika; Szczurek, Aleksander T; Prakash, Kirti; Mohana, Giriram K; Lee, Hyun-Keun; Roignant, Jean-Yves; Birk, Udo J; Dobrucki, Jurek W; Cremer, Christoph

    2016-05-01

    Higher order chromatin structure is not only required to compact and spatially arrange long chromatids within a nucleus, but have also important functional roles, including control of gene expression and DNA processing. However, studies of chromatin nanostructures cannot be performed using conventional widefield and confocal microscopy because of the limited optical resolution. Various methods of superresolution microscopy have been described to overcome this difficulty, like structured illumination and single molecule localization microscopy. We report here that the standard DNA dye Vybrant(®) DyeCycle™ Violet can be used to provide single molecule localization microscopy (SMLM) images of DNA in nuclei of fixed mammalian cells. This SMLM method enabled optical isolation and localization of large numbers of DNA-bound molecules, usually in excess of 10(6) signals in one cell nucleus. The technique yielded high-quality images of nuclear DNA density, revealing subdiffraction chromatin structures of the size in the order of 100nm; the interchromatin compartment was visualized at unprecedented optical resolution. The approach offers several advantages over previously described high resolution DNA imaging methods, including high specificity, an ability to record images using a single wavelength excitation, and a higher density of single molecule signals than reported in previous SMLM studies. The method is compatible with DNA/multicolor SMLM imaging which employs simple staining methods suited also for conventional optical microscopy. Copyright © 2016. Published by Elsevier Inc.

  19. Comparative evaluation of different extraction and quantification methods for forensic RNA analysis.

    PubMed

    Grabmüller, Melanie; Madea, Burkhard; Courts, Cornelius

    2015-05-01

    Since about 2005, there is increasing interest in forensic RNA analysis whose versatility may very favorably complement traditional DNA profiling in forensic casework. There is, however, no method available specifically dedicated for extraction of RNA from forensically relevant sample material. In this study we compared five commercially available and commonly used RNA extraction kits and methods (mirVana™ miRNA Isolation Kit Ambion; Trizol® Reagent, Invitrogen; NucleoSpin® miRNA Kit Macherey-Nagel; AllPrep DNA/RNA Mini Kit and RNeasy® Mini Kit both Qiagen) to assess their relative effectiveness of yielding RNA of good quality and their compatibility with co-extraction of DNA amenable to STR profiling. We set up samples of small amounts of dried blood, liquid saliva, semen and buccal mucosa that were aged for different time intervals for co-extraction of RNA and DNA. RNA quality was assessed by determination of 'RNA integrity number' (RIN) and quantitative PCR based expression analysis. DNA quality was assessed via monitoring STR typing success rates. By comparison, the different methods exhibited considerable differences between RNA and DNA yields, RNA quality values and expression levels, and STR profiling success, with the AllPrep DNA/RNA Mini Kit and the NucleoSpin® miRNA Kit excelling at DNA co-extraction and RNA results, respectively. Overall, there was no 'best' method to satisfy all demands of comprehensible co-analysis of RNA and DNA and it appears that each method has specific merits and flaws. We recommend to cautiously choose from available methods and align its characteristics with the needs of the experimental setting at hand. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  20. Geranyl diphosphate synthase from mint

    DOEpatents

    Croteau, Rodney Bruce; Wildung, Mark Raymond; Burke, Charles Cullen; Gershenzon, Jonathan

    1999-01-01

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate.

  1. Geranyl diphosphate synthase from mint

    DOEpatents

    Croteau, R.B.; Wildung, M.R.; Burke, C.C.; Gershenzon, J.

    1999-03-02

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate. 5 figs.

  2. Adaptation of red blood cell lysis represents a fundamental breakthrough that improves the sensitivity of Salmonella detection in blood

    PubMed Central

    Boyd, MA; Tennant, SM; Melendez, JH; Toema, D; Galen, JE; Geddes, CD; Levine, MM

    2015-01-01

    Aims Isolation of Salmonella Typhi from blood culture is the standard diagnostic for confirming typhoid fever but it is unavailable in many developing countries. We previously described a Microwave Accelerated Metal Enhanced Fluorescence (MAMEF)-based assay to detect Salmonella in medium. Attempts to detect Salmonella in blood were unsuccessful, presumably due to the interference of erythrocytes. The objective of this study was to evaluate various blood treatment methods that could be used prior to PCR, real-time PCR or MAMEF to increase sensitivity of detection of Salmonella. Methods and Results We tested ammonium chloride and erythrocyte lysis buffer, water, Lymphocyte Separation Medium, BD Vacutainer® CPT™ Tubes and dextran. Erythrocyte lysis buffer was the best isolation method as it is fast, inexpensive and works with either fresh or stored blood. The sensitivity of PCR- and real-time PCR detection of Salmonella in spiked blood was improved when whole blood was first lysed using erythrocyte lysis buffer prior to DNA extraction. Removal of erythrocytes and clotting factors also enabled reproducible lysis of Salmonella and fragmentation of DNA, which are necessary for MAMEF sensing. Conclusions Use of the erythrocyte lysis procedure prior to DNA extraction has enabled improved sensitivity of Salmonella detection by PCR and real-time PCR and has allowed lysis and fragmentation of Salmonella using microwave radiation (for future detection by MAMEF). Significance and Impact of the Study Adaptation of the blood lysis method represents a fundamental breakthrough that improves the sensitivity of DNA-based detection of Salmonella in blood. PMID:25630831

  3. Direct bisulfite sequencing for examination of DNA methylation with gene and nucleotide resolution from brain tissues.

    PubMed

    Parrish, R Ryley; Day, Jeremy J; Lubin, Farah D

    2012-07-01

    DNA methylation is an epigenetic modification that is essential for the development and mature function of the central nervous system. Due to the relevance of this modification to the transcriptional control of gene expression, it is often necessary to examine changes in DNA methylation patterns with both gene and single-nucleotide resolution. Here, we describe an in-depth basic protocol for direct bisulfite sequencing of DNA isolated from brain tissue, which will permit direct assessment of methylation status at individual genes as well as individual cytosine molecules/nucleotides within a genomic region. This method yields analysis of DNA methylation patterns that is robust, accurate, and reproducible, thereby allowing insights into the role of alterations in DNA methylation in brain tissue.

  4. Molecular Phylogenetics of Trichostrongylus Species (Nematoda: Trichostrongylidae) from Humans of Mazandaran Province, Iran.

    PubMed

    Sharifdini, Meysam; Heidari, Zahra; Hesari, Zahra; Vatandoost, Sajad; Kia, Eshrat Beigom

    2017-06-01

    The present study was performed to analyze molecularly the phylogenetic positions of human-infecting Trichostrongylus species in Mazandaran Province, Iran, which is an endemic area for trichostrongyliasis. DNA from 7 Trichostrongylus infected stool samples were extracted by using in-house (IH) method. PCR amplification of ITS2-rDNA region was performed, and products were sequenced. Phylogenetic analysis of the nucleotide sequence data was performed using MEGA 5.0 software. Six out of 7 isolates had high similarity with Trichostrongylus colubriformis , while the other one showed high homology with Trichostrongylus axei registered in GenBank reference sequences. Intra-specific variations within isolates of T. colubriformis and T. axei amounted to 0-1.8% and 0-0.6%, respectively. Trichostrongylus species obtained in the present study were in a cluster with the relevant reference sequences from previous studies. BLAST analysis indicated that there was 100% homology among all 6 ITS2 sequences of T. colubriformis in the present study and most previously registered sequences of T. colubriformis from human, sheep, and goat isolates from Iran and also human isolates from Laos, Thailand, and France. The ITS2 sequence of T. axei exhibited 99.4% homology with the human isolate of T. axei from Thailand, sheep isolates from New Zealand and Iran, and cattle isolate from USA.

  5. Isolated spinach ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit .sup..epsilon. N-methyltransferase and method of inactivating ribulose-1,5-bisphosphatase carboxylase/oxygenase large subunit .sup..epsilon. N-methyltransferase activity

    DOEpatents

    Houtz, Robert L.

    1999-01-01

    The gene sequence for ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) large subunit (LS) .sup..epsilon. N-methyltransferase (protein methylase III or Rubisco LSMT) from a plant which has a des(methyl) lysyl residue in the LS is disclosed. In addition, the full-length cDNA clones for Rubisco LSMT are disclosed. Transgenic plants and methods of producing same which have the Rubisco LSMT gene inserted into the DNA are also provided. Further, methods of inactivating the enzymatic activity of Rubisco LSMT are also disclosed.

  6. Metagenomic approaches to identify and isolate bioactive natural products from microbiota of marine sponges.

    PubMed

    Gurgui, Cristian; Piel, Jörn

    2010-01-01

    Many marine sponges harbor massive consortia of symbiotic bacteria belonging to diverse phyla. Sponges are also an unusually rich source of biologically active natural products, and evidence is accumulating that these compounds might often be synthesized by the symbionts. Since the study of sponge-associated bacteria is generally hampered by very low cultivation rates, cultivation-independent, metagenomic methods have recently been applied to sponges. These methods allow for the isolation of biosynthetic gene clusters that can ultimately be exploited to develop sustainable natural product sources by heterologous expression. However, general challenges encountered in sponge metagenomic research are the poor quality of the isolated DNA with respect to size and yield, the difficulty to identify genes of interest among numerous homologs, insufficient clone numbers in metagenomic libraries, and time-consuming screening procedures to identify and isolate rare positive clones. Here, we give an overview of methods that address these problems and can be used to streamline isolation of biosynthetic and other genes of interest.

  7. Analysis of 4-hydroxy-1-(-3-pyridyl)-1-butanone (HPB)-releasing DNA adducts in human exfoliated oral mucosa cells by liquid chromatography-electrospray ionization-tandem mass spectrometry

    PubMed Central

    Stepanov, Irina; Muzic, John; Le, Chap T.; Sebero, Erin; Villalta, Peter; Ma, Bin; Jensen, Joni; Hatsukami, Dorothy; Hecht, Stephen S.

    2013-01-01

    Quantitation of DNA adducts could provide critical information on the relationship between exposure to tobacco smoke and cancer risk in smokers. In this study, we developed a robust and sensitive liquid chromatography-tandem mass spectrometry method for the analysis of 4-hydroxy-1-(3-pyridyl)-1-butanone (HPB1)-releasing DNA adducts in human oral cells, a non-invasive source of DNA for biomarker studies. Isolated DNA undergoes acid hydrolysis, after which samples are purified by solid-phase extraction and analyzed by LC-ESI-MS/MS. The developed method was applied for analysis of samples obtained via collection with a commercial mouthwash from 30 smokers and 15 nonsmokers. In smokers, the levels of HPB-releasing DNA adducts averaged 12.0 pmol HPB/mg DNA (detected in 20 out of 28 samples with quantifiable DNA yield) and in nonsmokers, the levels of adducts averaged 0.23 pmol/mg DNA (detected in 3 out of 15 samples). For the 30 smoking subjects, matching buccal brushings were also analyzed and HPB-releasing DNA adducts were detected in 24 out of 27 samples with quantifiable DNA yield, averaging 44.7 pmol HPB/mg DNA. The levels of adducts in buccal brushings correlated with those in mouthwash samples of smokers (R = 0.73, p < 0.0001). Potentially the method can be applied in studies of individual susceptibility to tobacco-induced cancers in humans. PMID:23252610

  8. HPV Genotyping of Modified General Primer-Amplicons Is More Analytically Sensitive and Specific by Sequencing than by Hybridization

    PubMed Central

    Meisal, Roger; Rounge, Trine Ballestad; Christiansen, Irene Kraus; Eieland, Alexander Kirkeby; Worren, Merete Molton; Molden, Tor Faksvaag; Kommedal, Øyvind; Hovig, Eivind; Leegaard, Truls Michael

    2017-01-01

    Sensitive and specific genotyping of human papillomaviruses (HPVs) is important for population-based surveillance of carcinogenic HPV types and for monitoring vaccine effectiveness. Here we compare HPV genotyping by Next Generation Sequencing (NGS) to an established DNA hybridization method. In DNA isolated from urine, the overall analytical sensitivity of NGS was found to be 22% higher than that of hybridization. NGS was also found to be the most specific method and expanded the detection repertoire beyond the 37 types of the DNA hybridization assay. Furthermore, NGS provided an increased resolution by identifying genetic variants of individual HPV types. The same Modified General Primers (MGP)-amplicon was used in both methods. The NGS method is described in detail to facilitate implementation in the clinical microbiology laboratory and includes suggestions for new standards for detection and calling of types and variants with improved resolution. PMID:28045981

  9. HPV Genotyping of Modified General Primer-Amplicons Is More Analytically Sensitive and Specific by Sequencing than by Hybridization.

    PubMed

    Meisal, Roger; Rounge, Trine Ballestad; Christiansen, Irene Kraus; Eieland, Alexander Kirkeby; Worren, Merete Molton; Molden, Tor Faksvaag; Kommedal, Øyvind; Hovig, Eivind; Leegaard, Truls Michael; Ambur, Ole Herman

    2017-01-01

    Sensitive and specific genotyping of human papillomaviruses (HPVs) is important for population-based surveillance of carcinogenic HPV types and for monitoring vaccine effectiveness. Here we compare HPV genotyping by Next Generation Sequencing (NGS) to an established DNA hybridization method. In DNA isolated from urine, the overall analytical sensitivity of NGS was found to be 22% higher than that of hybridization. NGS was also found to be the most specific method and expanded the detection repertoire beyond the 37 types of the DNA hybridization assay. Furthermore, NGS provided an increased resolution by identifying genetic variants of individual HPV types. The same Modified General Primers (MGP)-amplicon was used in both methods. The NGS method is described in detail to facilitate implementation in the clinical microbiology laboratory and includes suggestions for new standards for detection and calling of types and variants with improved resolution.

  10. Nucleic acids encoding human trithorax protein

    DOEpatents

    Evans, Glen A.; Djabali, Malek; Selleri, Licia; Parry, Pauline

    2001-01-01

    In accordance with the present invention, there is provided an isolated peptide having the characteristics of human trithorax protein (as well as DNA encoding same, antisense DNA derived therefrom and antagonists therefor). The invention peptide is characterized by having a DNA binding domain comprising multiple zinc fingers and at least 40% amino acid identity with respect to the DNA binding domain of Drosophila trithorax protein and at least 70% conserved sequence with respect to the DNA binding domain of Drosophila trithorax protein, and wherein said peptide is encoded by a gene located at chromosome 11 of the human genome at q23. Also provided are methods for the treatment of subject(s) suffering from immunodeficiency, developmental abnormality, inherited disease, or cancer by administering to said subject a therapeutically effective amount of one of the above-described agents (i.e., peptide, antagonist therefor, DNA encoding said peptide or antisense DNA derived therefrom). Also provided is a method for the diagnosis, in a subject, of immunodeficiency, developmental abnormality, inherited disease, or cancer associated with disruption of chromosome 11 at q23.

  11. Evaluation of vector-primed cDNA library production from microgram quantities of total RNA.

    PubMed

    Kuo, Jonathan; Inman, Jason; Brownstein, Michael; Usdin, Ted B

    2004-12-15

    cDNA sequences are important for defining the coding region of genes, and full-length cDNA clones have proven to be useful for investigation of the function of gene products. We produced cDNA libraries containing 3.5-5 x 10(5) primary transformants, starting with 5 mug of total RNA prepared from mouse pituitary, adrenal, thymus, and pineal tissue, using a vector-primed cDNA synthesis method. Of approximately 1000 clones sequenced, approximately 20% contained the full open reading frames (ORFs) of known transcripts, based on the presence of the initiating methionine residue codon. The libraries were complex, with 94, 91, 83 and 55% of the clones from the thymus, adrenal, pineal and pituitary libraries, respectively, represented only once. Twenty-five full-length clones, not yet represented in the Mammalian Gene Collection, were identified. Thus, we have produced useful cDNA libraries for the isolation of full-length cDNA clones that are not yet available in the public domain, and demonstrated the utility of a simple method for making high-quality libraries from small amounts of starting material.

  12. Ionizing Radiation-Induced DNA Damage and Its Repair in Human Cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dizdaroglu, Miral

    DNA damage in mammalian chromatin in vitro and in cultured mammalian cells including human cells was studied. In the first phase of these studies, a cell culture laboratory was established. Necessary equipment including an incubator, a sterile laminar flow hood and several centrifuges was purchased. We have successfully grown several cell lines such as murine hybridoma cells, V79 cells and human K562 leukemia cells. This was followed by the establishment of a methodology for the isolation of chromatin from cells. This was a very important step, because a routine and successful isolation of chromatin was a prerequisite for the successmore » of the further studies in this project, the aim of which was the measurement of DNA darnage in mammalian chromatin in vitro and in cultured cells. Chromatin isolation was accomplished using a slightly modified procedure of the one described by Mee & Adelstein (1981). For identification and quantitation of DNA damage in cells, analysis of chromatin was preferred over the analysis of "naked DNA" for the following reasons: i. DNA may not be extracted efficiently from nucleoprotein in exposed cells, due to formation of DNA-protein cross-links, ii. the extractability of DNA is well known to decrease with increasing doses of radiation, iii. portions of DNA may not be extracted due to fragmentation, iv. unextracted DNA may contain a significant portion of damaged DNA bases and DNA-protein cross-links. The technique of gas chromatography/mass spectrometry (GC/MS), which was used in the present project, permits the identification and quantitation of modified DNA bases in chromatin in the presence of proteins without the necessity of first isolating DNA from chromatin. This has been demonstrated previously by the results from our laboratory and by the results obtained during the course of the present project. The quality of isolated chromatin was tested by measurement of its content of DNA, proteins, and RNA, by analysis of its protein components using gel electrophoresis, and by absorption spectral analysis. GeneraUy, the RNA content was <5% of the amount of DNA, and the ratio of the amount of protein to that of DNA was =1. 8-2 (w/w). Having developed a suitable methodology for routine isolation of chromatin from mammalian cells, studies of DNA damage in chromatin in vitro and in cultured human cells were pursued.« less

  13. Localization microscopy of DNA in situ using Vybrant{sup ®} DyeCycle™ Violet fluorescent probe: A new approach to study nuclear nanostructure at single molecule resolution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Żurek-Biesiada, Dominika; Szczurek, Aleksander T.; Prakash, Kirti

    Higher order chromatin structure is not only required to compact and spatially arrange long chromatids within a nucleus, but have also important functional roles, including control of gene expression and DNA processing. However, studies of chromatin nanostructures cannot be performed using conventional widefield and confocal microscopy because of the limited optical resolution. Various methods of superresolution microscopy have been described to overcome this difficulty, like structured illumination and single molecule localization microscopy. We report here that the standard DNA dye Vybrant{sup ®} DyeCycle™ Violet can be used to provide single molecule localization microscopy (SMLM) images of DNA in nuclei ofmore » fixed mammalian cells. This SMLM method enabled optical isolation and localization of large numbers of DNA-bound molecules, usually in excess of 10{sup 6} signals in one cell nucleus. The technique yielded high-quality images of nuclear DNA density, revealing subdiffraction chromatin structures of the size in the order of 100 nm; the interchromatin compartment was visualized at unprecedented optical resolution. The approach offers several advantages over previously described high resolution DNA imaging methods, including high specificity, an ability to record images using a single wavelength excitation, and a higher density of single molecule signals than reported in previous SMLM studies. The method is compatible with DNA/multicolor SMLM imaging which employs simple staining methods suited also for conventional optical microscopy. - Highlights: • Super-resolution imaging of nuclear DNA with Vybrant Violet and blue excitation. • 90nm resolution images of DNA structures in optically thick eukaryotic nuclei. • Enhanced resolution confirms the existence of DNA-free regions inside the nucleus. • Optimized imaging conditions enable multicolor super-resolution imaging.« less

  14. DNA recovery from microhymenoptera using six non-destructive methodologies with considerations for subsequent preparation of museum slides.

    PubMed

    Guzmán-Larralde, Adriana J; Suaste-Dzul, Alba P; Gallou, Adrien; Peña-Carrillo, Kenzy I

    2017-01-01

    Because of the tiny size of microhymenoptera, successful morphological identification typically requires specific mounting protocols that require time, skills, and experience. Molecular taxonomic identification is an alternative, but many DNA extraction protocols call for maceration of the whole specimen, which is not compatible with preserving museum vouchers. Thus, non-destructive DNA isolation methods are attractive alternatives for obtaining DNA without damaging sample individuals. However, their performance needs to be assessed in microhymenopterans. We evaluated six non-destructive methods: (A) DNeasy® Blood & Tissue Kit; (B) DNeasy® Blood & Tissue Kit, modified; (C) Protocol with CaCl 2 buffer; (D) Protocol with CaCl 2 buffer, modified; (E) HotSHOT; and (F) Direct PCR. The performance of each DNA extraction method was tested across several microhymenopteran species by attempting to amplify the mitochondrial gene COI from insect specimens of varying ages: 1 day, 4 months, 3 years, 12 years, and 23 years. Methods B and D allowed COI amplification in all insects, while methods A, C, and E were successful in DNA amplification from insects up to 12 years old. Method F, the fastest, was useful in insects up to 4 months old. Finally, we adapted permanent slide preparation in Canada balsam for every technique. The results reported allow for combining morphological and molecular methodologies for taxonomic studies.

  15. Genetic diversity study of Chromobacterium violaceum isolated from Kolli Hills by amplified ribosomal DNA restriction analysis (ARDRA) and random amplified polymorphic DNA (RAPD).

    PubMed

    Ponnusamy, K; Jose, S; Savarimuthu, I; Michael, G P; Redenbach, M

    2011-09-01

    Chromobacterium are saprophytes that cause highly fatal opportunistic infections. Identification and strain differentiation were performed to identify the strain variability among the environmental samples. We have evaluated the suitability of individual and combined methods to detect the strain variations of the samples collected in different seasons. Amplified ribosomal DNA restriction analysis (ARDRA) and random amplified polymorphic DNA (RAPD) profiles were obtained using four different restriction enzyme digestions (AluI, HaeIII, MspI and RsaI) and five random primers. A matrix of dice similarity coefficients was calculated and used to compare these restriction patterns. ARDRA showed rapid differentiation of strains based on 16S rDNA, but the combined RAPD and ARDRA gave a more reliable differentiation than when either of them was analysed individually. A high level of genetic diversity was observed, which indicates that the Kolli Hills' C. violaceum isolates would fall into at least three new clusters. Results showed a noteworthy bacterial variation and genetic diversity of C. violaceum in the unexplored, virgin forest area. © 2011 The Authors. Letters in Applied Microbiology © 2011 The Society for Applied Microbiology.

  16. Bacterial population in traditional sourdough evaluated by molecular methods.

    PubMed

    Randazzo, C L; Heilig, H; Restuccia, C; Giudici, P; Caggia, C

    2005-01-01

    To study the microbial communities in artisanal sourdoughs, manufactured by traditional procedure in different areas of Sicily, and to evaluate the lactic acid bacteria (LAB) population by classical and culture-independent approaches. Forty-five LAB isolates were identified both by phenotypic and molecular methods. The restriction fragment length polymorphism and 16S ribosomal DNA gene sequencing gave evidence of a variety of species with the dominance of Lactobacillus sanfranciscensis and Lactobacillus pentosus, in all sourdoughs tested. Culture-independent method, such as denaturing gradient gel electrophoresis (DGGE) of the V6-V8 regions of the 16S rDNA, was applied for microbial community fingerprint. The DGGE profiles revealed the dominance of L. sanfranciscensis species. In addition, Lactobacillus-specific primers were used to amplify the V1-V3 regions of the 16S rDNA. DGGE profiles flourished the dominance of L. sanfranciscensis and Lactobacillus fermentum in the traditional sourdoughs, and revealed that the closely related species Lactobacillus kimchii and Lactobacillus alimentarius were not discriminated. Lactobacillus-specific PCR-DGGE analysis is a rapid tool for rapid detection of Lactobacillus species in artisanal sourdough. This study reports a characterization of Lactobacillus isolates from artisanal sourdoughs and highlights the value of DGGE approach to detect uncultivable Lactobacillus species.

  17. Protocol: a rapid and economical procedure for purification of plasmid or plant DNA with diverse applications in plant biology

    PubMed Central

    2010-01-01

    Research in plant molecular biology involves DNA purification on a daily basis. Although different commercial kits enable convenient extraction of high-quality DNA from E. coli cells, PCR and agarose gel samples as well as plant tissues, each kit is designed for a particular type of DNA extraction work, and the cost of purchasing these kits over a long run can be considerable. Furthermore, a simple method for the isolation of binary plasmid from Agrobacterium tumefaciens cells with satisfactory yield is lacking. Here we describe an easy protocol using homemade silicon dioxide matrix and seven simple solutions for DNA extraction from E. coli and A. tumefaciens cells, PCR and restriction digests, agarose gel slices, and plant tissues. Compared with the commercial kits, this protocol allows rapid DNA purification from diverse sources with comparable yield and purity at negligible cost. Following this protocol, we have demonstrated: (1) DNA fragments as small as a MYC-epitope tag coding sequence can be successfully recovered from an agarose gel slice; (2) Miniprep DNA from E. coli can be eluted with as little as 5 μl water, leading to high DNA concentrations (>1 μg/μl) for efficient biolistic bombardment of Arabidopsis seedlings, polyethylene glycol (PEG)-mediated Arabidopsis protoplast transfection and maize protoplast electroporation; (3) Binary plasmid DNA prepared from A. tumefaciens is suitable for verification by restriction analysis without the need for large scale propagation; (4) High-quality genomic DNA is readily isolated from several plant species including Arabidopsis, tobacco and maize. Thus, the silicon dioxide matrix-based DNA purification protocol offers an easy, efficient and economical way to extract DNA for various purposes in plant research. PMID:20180960

  18. Sequencing of the large dsDNA genome of Oryctes rhinoceros nudivirus using multiple displacement amplification of nanogram amounts of virus DNA.

    PubMed

    Wang, Yongjie; Kleespies, Regina G; Ramle, Moslim B; Jehle, Johannes A

    2008-09-01

    The genomic sequence analysis of many large dsDNA viruses is hampered by the lack of enough sample materials. Here, we report a whole genome amplification of the Oryctes rhinoceros nudivirus (OrNV) isolate Ma07 starting from as few as about 10 ng of purified viral DNA by application of phi29 DNA polymerase- and exonuclease-resistant random hexamer-based multiple displacement amplification (MDA) method. About 60 microg of high molecular weight DNA with fragment sizes of up to 25 kbp was amplified. A genomic DNA clone library was generated using the product DNA. After 8-fold sequencing coverage, the 127,615 bp of OrNV whole genome was sequenced successfully. The results demonstrate that the MDA-based whole genome amplification enables rapid access to genomic information from exiguous virus samples.

  19. Evaluation and comparison of FTA card and CTAB DNA extraction methods for non-agricultural taxa1

    PubMed Central

    Siegel, Chloe S.; Stevenson, Florence O.; Zimmer, Elizabeth A.

    2017-01-01

    Premise of the study: An efficient, effective DNA extraction method is necessary for comprehensive analysis of plant genomes. This study analyzed the quality of DNA obtained using paper FTA cards prepared directly in the field when compared to the more traditional cetyltrimethylammonium bromide (CTAB)–based extraction methods from silica-dried samples. Methods: DNA was extracted using FTA cards according to the manufacturer’s protocol. In parallel, CTAB-based extractions were done using the automated AutoGen DNA isolation system. DNA quality for both methods was determined for 15 non-agricultural species collected in situ, by gel separation, spectrophotometry, fluorometry, and successful amplification and sequencing of nuclear and chloroplast gene markers. Results: The FTA card extraction method yielded less concentrated, but also less fragmented samples than the CTAB-based technique. The card-extracted samples provided DNA that could be successfully amplified and sequenced. The FTA cards are also useful because the collected samples do not require refrigeration, extensive laboratory expertise, or as many hazardous chemicals as extractions using the CTAB-based technique. Discussion: The relative success of the FTA card method in our study suggested that this method could be a valuable tool for studies in plant population genetics and conservation biology that may involve screening of hundreds of individual plants. The FTA cards, like the silica gel samples, do not contain plant material capable of propagation, and therefore do not require permits from the U.S. Department of Agriculture (USDA) Animal and Plant Health Inspection Service (APHIS) for transportation. PMID:28224056

  20. DNA methylation profiling of genomic DNA isolated from urine in diabetic chronic kidney disease: A pilot study

    PubMed Central

    Sexton-Oates, Alexandra; Carmody, Jake; Ekinci, Elif I.; Dwyer, Karen M.; Saffery, Richard

    2018-01-01

    Aim To characterise the genomic DNA (gDNA) yield from urine and quality of derived methylation data generated from the widely used Illuminia Infinium MethylationEPIC (HM850K) platform and compare this with buffy coat samples. Background DNA methylation is the most widely studied epigenetic mark and variations in DNA methylation profile have been implicated in diabetes which affects approximately 415 million people worldwide. Methods QIAamp Viral RNA Mini Kit and QIAamp DNA micro kit were used to extract DNA from frozen and fresh urine samples as well as increasing volumes of fresh urine. Matched buffy coats to the frozen urine were also obtained and DNA was extracted from the buffy coats using the QIAamp DNA Mini Kit. Genomic DNA of greater concentration than 20μg/ml were used for methylation analysis using the HM850K array. Results Irrespective of extraction technique or the use of fresh versus frozen urine samples, limited genomic DNA was obtained using a starting sample volume of 5ml (0–0.86μg/mL). In order to optimize the yield, we increased starting volumes to 50ml fresh urine, which yielded only 0–9.66μg/mL A different kit, QIAamp DNA Micro Kit, was trialled in six fresh urine samples and ten frozen urine samples with inadequate DNA yields from 0–17.7μg/mL and 0–1.6μg/mL respectively. Sufficient genomic DNA was obtained from only 4 of the initial 41 frozen urine samples (10%) for DNA methylation profiling. In comparison, all four buffy coat samples (100%) provided sufficient genomic DNA. Conclusion High quality data can be obtained provided a sufficient yield of genomic DNA is isolated. Despite optimizing various extraction methodologies, the modest amount of genomic DNA derived from urine, may limit the generalisability of this approach for the identification of DNA methylation biomarkers of chronic diabetic kidney disease. PMID:29462136

  1. Trypanosomatidae: Phytomonas detection in plants and phytophagous insects by PCR amplification of a genus-specific sequence of the spliced leader gene.

    PubMed

    Serrano, M G; Nunes, L R; Campaner, M; Buck, G A; Camargo, E P; Teixeira, M M

    1999-03-01

    In this paper we describe a method for the detection of Phytomonas spp. from plants and phytophagous insects using the PCR technique by targeting a genus-specific sequence of the spliced leader (SL) gene. PCR amplification of DNA from 48 plant and insect isolates previously classified as Phytomonas by morphological, biochemical, and molecular criteria resulted in all cases in a 100-bp fragment that hybridized with the Phytomonas-specific spliced leader-derived probe SL3'. Moreover, this Phytomonas-specific PCR could also detect Phytomonas spp. in crude preparations of naturally infected plants and insects. This method shows no reaction with any other trypanosomatid genera or with plant and insect host DNA, revealing it to be able to detect Phytomonas spp. from fruit, latex, or phloem of various host plants as well as from salivary glands and digestive tubes of several species of insect hosts. Results demonstrated that SLPCR is a simple, fast, specific, and sensitive method that can be applied to the diagnosis of Phytomonas among cultured trypanosomatids and directly in plants and putative vector insects. Therefore, the method was shown to be a very specific and sensitive tool for diagnosis of Phytomonas without the need for isolation, culture, and DNA extraction of flagellates, a feature that is very convenient for practical and epidemiological purposes. Copyright 1999 Academic Press.

  2. Standardization of Spore Inactivation Method for PMA-PhyloChip Analysis

    NASA Technical Reports Server (NTRS)

    Schrader, Michael

    2011-01-01

    In compliance with the Committee on Space Research (COSPAR) planetary protection policy, National Aeronautics and Space Administration (NASA) monitors the total microbial burden of spacecraft as a means for minimizing the inadvertent transfer of viable contaminant microorganisms to extraterrestrial environments (forward contamination). NASA standard assay-based counts are used both as a proxy for relative surface cleanliness and to estimate overall microbial burden as well as to assess whether forward planetary protection risk criteria are met for a given mission, which vary by the planetary body to be explored and whether or not life detection missions are present. Despite efforts to reduce presence of microorganisms from spacecraft prior to launch, microbes have been isolated from spacecraft and associated surfaces within the extreme conditions of clean room facilities using state of the art molecular technologies. Development of a more sensitive method that will better enumerate all viable microorganisms from spacecraft and associated surfaces could support future life detection missions. Current culture-based (NASA standard spore assay) and nucleic-acid-based polymerase chain reaction (PCR) methods have significant shortcomings in this type of analysis. The overall goal of this project is to evaluate and validate a new molecular method based on the use of a deoxyribonucleic acid (DNA) intercalating agent propidium monoazide (PMA). This is used in combination with DNA microarray (PhyloChip) which has been shown to identify very low levels of organisms on spacecraft associated surfaces. PMA can only penetrate the membrane of dead cells. Once penetrated, it intercalates the DNA and, upon photolysis using visible light it produces stable DNA monoadducts. This allows DNA to be unavailable for further PCR analysis. The specific aim of this study is to standardize the spore inactivation method for PMA-PhyloChip analysis. We have used the bacterial spores Bacillus subtilis 168 (standard laboratory isolate) as a test organism.

  3. Comparison of the gentamicin resistance transposon Tn5281 with regions encoding gentamicin resistance in Enterococcus faecalis isolates from diverse geographic locations.

    PubMed Central

    Hodel-Christian, S L; Murray, B E

    1992-01-01

    The genetic determinant encoding gentamicin resistance (Gmr) on the beta-lactamase encoding plasmid pBEM10 of Enterococcus faecalis HH22 is carried on a transposon, termed Tn5281, that is highly related to the staphylococcal Gmr transposons Tn4001 found in Australian isolates of Staphylococcus aureus and Tn4031 found in United States isolates of Staphylococcus epidermidis. We have now studied plasmid DNA from Gmr strains of E. faecalis isolated from diverse geographical locations (Houston, Pennsylvania, Thailand, and Chile) by using restriction endonuclease analysis and DNA-DNA hybridization to determine whether other Gmr E. faecalis carry Tn5281 or a similar type of element. We also compared these enterococci to several United States isolates of Staphylococcus aureus with nonmobile Gmr determinants. Three E. faecalis isolates (from Houston and Chile) carried Tn5281-like elements, whereas two isolates (from Houston and Pennsylvania) had restriction endonuclease and DNA-DNA hybridization patterns more similar to those of the Tn4001-IS257 hybrid found in the nonmobile Gmr determinants in United States isolates of S. aureus. A strain from Thailand had a third pattern unrelated to either Tn5281 or the nonmobile Gmr determinants present in United States isolates of S. aureus. Our results demonstrate that there is both similarity and diversity between the Gmr determinant of strains of E. faecalis isolated in diverse geographic locations. Images PMID:1332593

  4. Molecular variability among isolates of Fusarium oxysporum associated with root rot disease of Agave tequilana.

    PubMed

    Vega-Ramos, Karla L; Uvalle-Bueno, J Xavier; Gómez-Leyva, Juan F

    2013-04-01

    In this study, 115 isolates of Fusarium oxysporum from roots of Agave tequilana Weber cv azul plants and soil in commercial plantations in western Mexico were characterized using morphological and molecular methods. Genetic analyses of monosporic isolates included restriction enzyme analysis of rDNA (ARDRA) using HaeIII and HinfI, and genetic diversity was determined using Box-PCR molecular markers. Box-PCR analysis generated 14 groups. The groups correlated highly with the geographic location of the isolate and sample type. These results demonstrate the usefulness of ARDRA and Box-PCR techniques in the molecular characterization of the Fusarium genus for the discrimination of pathogenic isolates.

  5. Identification of bacteria isolated from veterinary clinical specimens using MALDI-TOF MS.

    PubMed

    Pavlovic, Melanie; Wudy, Corinna; Zeller-Peronnet, Veronique; Maggipinto, Marzena; Zimmermann, Pia; Straubinger, Alix; Iwobi, Azuka; Märtlbauer, Erwin; Busch, Ulrich; Huber, Ingrid

    2015-01-01

    Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) has recently emerged as a rapid and accurate identification method for bacterial species. Although it has been successfully applied for the identification of human pathogens, it has so far not been well evaluated for routine identification of veterinary bacterial isolates. This study was performed to compare and evaluate the performance of MALDI-TOF MS based identification of veterinary bacterial isolates with commercially available conventional test systems. Discrepancies of both methods were resolved by sequencing 16S rDNA and, if necessary, the infB gene for Actinobacillus isolates. A total of 375 consecutively isolated veterinary samples were collected. Among the 357 isolates (95.2%) correctly identified at the genus level by MALDI-TOF MS, 338 of them (90.1% of the total isolates) were also correctly identified at the species level. Conventional methods offered correct species identification for 319 isolates (85.1%). MALDI-TOF identification therefore offered more accurate identification of veterinary bacterial isolates. An update of the in-house mass spectra database with additional reference spectra clearly improved the identification results. In conclusion, the presented data suggest that MALDI-TOF MS is an appropriate platform for classification and identification of veterinary bacterial isolates.

  6. First isolation of Actinobacillus genomospecies 2 in Japan.

    PubMed

    Murakami, Miyuki; Shimonishi, Yoshimasa; Hobo, Seiji; Niwa, Hidekazu; Ito, Hiroya

    2016-05-03

    We describe here the first isolation of Actinobacillus genomospecies 2 in Japan. The isolate was found in a septicemic foal and characterized by phenotypic and genetic analyses, with the latter consisting of 16S rDNA nucleotide sequence analysis plus multilocus sequence analysis using three housekeeping genes, recN, rpoA and thdF, that have been proposed for use as a genomic tool in place of DNA-DNA hybridization.

  7. Quantitative Field Testing Rotylenchulus reniformis DNA from Metagenomic Samples Isolated Directly from Soil

    PubMed Central

    Showmaker, Kurt; Lawrence, Gary W.; Lu, Shien; Balbalian, Clarissa; Klink, Vincent P.

    2011-01-01

    A quantitative PCR procedure targeting the β-tubulin gene determined the number of Rotylenchulus reniformis Linford & Oliveira 1940 in metagenomic DNA samples isolated from soil. Of note, this outcome was in the presence of other soil-dwelling plant parasitic nematodes including its sister genus Helicotylenchus Steiner, 1945. The methodology provides a framework for molecular diagnostics of nematodes from metagenomic DNA isolated directly from soil. PMID:22194958

  8. Genetic and Biochemical Diversity among Isolates of Paenibacillus alvei Cultured from Australian Honeybee (Apis mellifera) Colonies

    PubMed Central

    Djordjevic, Steven P.; Forbes, Wendy A.; Smith, Lisa A.; Hornitzky, Michael A.

    2000-01-01

    Twenty-five unique CfoI-generated whole-cell DNA profiles were identified in a study of 30 Paenibacillus alvei isolates cultured from honey and diseased larvae collected from honeybee (Apis mellifera) colonies in geographically diverse areas in Australia. The fingerprint patterns were highly variable and readily discernible from one another, which highlighted the potential of this method for tracing the movement of isolates in epidemiological studies. 16S rRNA gene fragments (length, 1,416 bp) for all 30 isolates were enzymatically amplified by PCR and subjected to restriction analysis with DraI, HinfI, CfoI, AluI, FokI, and RsaI. With each enzyme the restriction profiles of the 16S rRNA genes from all 30 isolates were identical (one restriction fragment length polymorphism [RFLP] was observed in the HinfI profile of the 16S rRNA gene from isolate 17), which confirmed that the isolates belonged to the same species. The restriction profiles generated by using DraI, FokI, and HinfI differentiated P. alvei from the phylogenetically closely related species Paenibacillus macerans and Paenibacillus macquariensis. Alveolysin gene fragments (length, 1,555 bp) were enzymatically amplified from some of the P. alvei isolates (19 of 30 isolates), and RFLP were detected by using the enzymes CfoI, Sau3AI, and RsaI. Extrachromosomal DNA ranging in size from 1 to 10 kb was detected in 17 of 30 (57%) P. alvei whole-cell DNA profiles. Extensive biochemical heterogeneity was observed among the 28 P. alvei isolates examined with the API 50CHB system. All of these isolates were catalase, oxidase, and Voges-Proskauer positive and nitrate negative, and all produced acid when glycerol, esculin, and maltose were added. The isolates produced variable results for 16 of the 49 biochemical tests; negative reactions were recorded in the remaining 30 assays. The genetic and biochemical heterogeneity in P. alvei isolates may be a reflection of adaptation to the special habitats in which they originated. PMID:10698777

  9. Genetic and biochemical diversity among isolates of Paenibacillus alvei cultured from Australian honeybee (Apis mellifera) colonies.

    PubMed

    Djordjevic, S P; Forbes, W A; Smith, L A; Hornitzky, M A

    2000-03-01

    Twenty-five unique CfoI-generated whole-cell DNA profiles were identified in a study of 30 Paenibacillus alvei isolates cultured from honey and diseased larvae collected from honeybee (Apis mellifera) colonies in geographically diverse areas in Australia. The fingerprint patterns were highly variable and readily discernible from one another, which highlighted the potential of this method for tracing the movement of isolates in epidemiological studies. 16S rRNA gene fragments (length, 1,416 bp) for all 30 isolates were enzymatically amplified by PCR and subjected to restriction analysis with DraI, HinfI, CfoI, AluI, FokI, and RsaI. With each enzyme the restriction profiles of the 16S rRNA genes from all 30 isolates were identical (one restriction fragment length polymorphism [RFLP] was observed in the HinfI profile of the 16S rRNA gene from isolate 17), which confirmed that the isolates belonged to the same species. The restriction profiles generated by using DraI, FokI, and HinfI differentiated P. alvei from the phylogenetically closely related species Paenibacillus macerans and Paenibacillus macquariensis. Alveolysin gene fragments (length, 1, 555 bp) were enzymatically amplified from some of the P. alvei isolates (19 of 30 isolates), and RFLP were detected by using the enzymes CfoI, Sau3AI, and RsaI. Extrachromosomal DNA ranging in size from 1 to 10 kb was detected in 17 of 30 (57%) P. alvei whole-cell DNA profiles. Extensive biochemical heterogeneity was observed among the 28 P. alvei isolates examined with the API 50CHB system. All of these isolates were catalase, oxidase, and Voges-Proskauer positive and nitrate negative, and all produced acid when glycerol, esculin, and maltose were added. The isolates produced variable results for 16 of the 49 biochemical tests; negative reactions were recorded in the remaining 30 assays. The genetic and biochemical heterogeneity in P. alvei isolates may be a reflection of adaptation to the special habitats in which they originated.

  10. [Identification of filamentous fungi isolated from clinical samples by two different methods and their susceptibility results].

    PubMed

    Direkel, Sahin; Otağ, Feza; Aslan, Gönül; Ulger, Mahmut; Emekdaş, Gürol

    2012-01-01

    Molds are widely distributed in nature. Aspergillus spp. represent the most frequently observed causative agents, however less frequent pathogens Fusarium, Scedosporium and Zygomycetes have also been considered the most important causes of morbidity and mortality in profoundly immunosuppressed hosts. The aims of this study were to identify filamentous fungi isolated from clinical specimens by conventional and molecular methods, and to detect their antifungal susceptibilities. A total of 6742 clinical specimens obtained from hospitalized patients at critical units of Mersin University Medical Faculty Hospital and sent to our laboratory between April 2008-January 2010 were included in the study. The isolates were identified by classical mycological methods and polymerase chain reaction-based DNA sequencing. Susceptibilities to fluconazole and voriconazole were tested by disk diffusion method and to fluconazole, voriconazole, amfoterisin B, caspofungin and posaconazole by E-test. Filamentous fungi were isolated from 71 (1.05%) samples (13 sputum, 4 wound, 4 peritoneal fluid, 3 extrenal ear discharge, 3 abscess and one of each cerebrospinal fluid, blood, tissue biopsy, nasal swab and conjunctival swab) which belonged to 32 patients (13 female, 19 male; age range 7 months-77 years, mean age: 46.6 years). Of the patients 62.3% presented one or more risk factors such as chronic renal failure (n= 8), chronic obstructive lung disease (n= 6), malignancy (n= 6), diabetes mellitus (n= 5) and peripheral vascular disease (n= 5). Of the isolates six were identified as Aspergillus niger, six as Aspergillus flavus, five as Aspergillus fumigatus, four as Aspergillus terreus, five as Fusarium spp., two as Bipolaris spp., and one of each as Acremonium spp., Aurebasidium spp., Mucor spp., and Scedosporium spp. By conventional methods. Three isolates exhibited different identities by DNA sequencing. All Aspergillus isolates were correctly identified at species level by both methods, Other fungi were identified at genus level by conventional methods and at species level by DNA sequencing. Fluconazole minimum inhibitory concentration (MIC) values were determined as > 256 mg/L in all strains, except Scedosporium; voriconazole MIC values were < 0.38 mg/L in all Aspergillus spp. Caspofungin MIC values were > 32 mg/L for Fusarium, Scedosporium, Rhizopus and Bipolaris strains and ≤ 0.006-0.125 mg/L in all Aspergillus isolates, In three strains (Fusarium equiseti, Cylindrocarpon lichenicola and Rhizopus oryzae) posaconazole minimum inhibitory concentration (MIC) values were > 32 mg/L, however it was < 1.5 mg/L, for the other strains. Amphotericin B MIC values were > 32 mg/L for Fusarium, Scedosporium, Rhizopus and all A.terreus strains and < 2 mg/L for the others. E-test and disk diffusion test results were compatible with each other for all the antifungal agents tested. In conclusion, the identification of filamentous fungi such as Aspergillus and Fusarium spp. is easily and reliably achieved by conventional methods. Since the rate of invasive fungal infections is increasing currently, filamentous molds should be searched especially in the clinical specimens of immunocompromised patients for accurate and prompt diagnosis of such infections and to decrease the related mortality risk.

  11. Chemoraces and Habitat Specialization of Claviceps purpurea Populations

    PubMed Central

    Pažoutová, Sylvie; Olšovská, Jana; Linka, Marek; Kolínská, Renata; Flieger, Miroslav

    2000-01-01

    We studied genetic variability of 100 isolates of Claviceps purpurea by using randomly amplified polymorphic DNA (RAPD), an EcoRI restriction site polymorphism in the 5.8S ribosomal DNA (rDNA), the alkaloids produced, and conidial morphology. We identified three groups: (i) group G1 from fields and open meadows (57 isolates), (ii) group G2 from shady or wet habitats (41 isolates), and (iii) group G3 from Spartina anglica from salt marshes (2 isolates). The sclerotia of G1 isolates contained ergotamines and ergotoxines; G2 isolates produced ergosine and ergocristine along with small amounts of ergocryptine; and G3 isolates produced ergocristine and ergocryptine. The conidia of G1 isolates were 5 to 8 μm long, the conidia of G2 isolates were 7 to 10 μm long, and the conidia of G3 isolates were 10 to 12 μm long. Sclerotia of the G2 and G3 isolates floated on water. In the 5.8S rDNA analysis, an EcoRI site was found in G1 and G3 isolates but not in G2 isolates. The host preferences of the groups were not absolute, and there were host genera that were common to both G1 and G2; the presence of members of different groups in the same locality was rare. Without the use of RAPD or rDNA polymorphism, it was not possible to distinguish the three groups solely on the basis of phenotype, host, or habitat. In general, populations of C. purpurea are not host specialized, as previously assumed, but they are habitat specialized, and collecting strategies and toxin risk assessments should be changed to reflect this paradigm shift. PMID:11097923

  12. Simple sequence repeat markers useful for sorghum downy mildew (Peronosclerospora sorghi) and related species

    PubMed Central

    Perumal, Ramasamy; Nimmakayala, Padmavathi; Erattaimuthu, Saradha R; No, Eun-Gyu; Reddy, Umesh K; Prom, Louis K; Odvody, Gary N; Luster, Douglas G; Magill, Clint W

    2008-01-01

    Background A recent outbreak of sorghum downy mildew in Texas has led to the discovery of both metalaxyl resistance and a new pathotype in the causal organism, Peronosclerospora sorghi. These observations and the difficulty in resolving among phylogenetically related downy mildew pathogens dramatically point out the need for simply scored markers in order to differentiate among isolates and species, and to study the population structure within these obligate oomycetes. Here we present the initial results from the use of a biotin capture method to discover, clone and develop PCR primers that permit the use of simple sequence repeats (microsatellites) to detect differences at the DNA level. Results Among the 55 primers pairs designed from clones from pathotype 3 of P. sorghi, 36 flanked microsatellite loci containing simple repeats, including 28 (55%) with dinucleotide repeats and 6 (11%) with trinucleotide repeats. A total of 22 microsatellites with CA/AC or GT/TG repeats were the most abundant (40%) and GA/AG or CT/TC types contribute 15% in our collection. When used to amplify DNA from 19 isolates from P. sorghi, as well as from 5 related species that cause downy mildew on other hosts, the number of different bands detected for each SSR primer pair using a LI-COR- DNA Analyzer ranged from two to eight. Successful cross-amplification for 12 primer pairs studied in detail using DNA from downy mildews that attack maize (P. maydis & P. philippinensis), sugar cane (P. sacchari), pearl millet (Sclerospora graminicola) and rose (Peronospora sparsa) indicate that the flanking regions are conserved in all these species. A total of 15 SSR amplicons unique to P. philippinensis (one of the potential threats to US maize production) were detected, and these have potential for development of diagnostic tests. A total of 260 alleles were obtained using 54 microsatellites primer combinations, with an average of 4.8 polymorphic markers per SSR across 34 Peronosclerospora, Peronospora and Sclerospora spp isolates studied. Cluster analysis by UPGMA as well as principal coordinate analysis (PCA) grouped the 34 isolates into three distinct groups (all 19 isolates of Peronosclerospora sorghi in cluster I, five isolates of P. maydis and three isolates of P. sacchari in cluster II and five isolates of Sclerospora graminicola in cluster III). Conclusion To our knowledge, this is the first attempt to extensively develop SSR markers from Peronosclerospora genomic DNA. The newly developed SSR markers can be readily used to distinguish isolates within several species of the oomycetes that cause downy mildew diseases. Also, microsatellite fragments likely include retrotransposon regions of DNA and these sequences can serve as useful genetic markers for strain identification, due to their degree of variability and their widespread occurrence among sorghum, maize, sugarcane, pearl millet and rose downy mildew isolates. PMID:19040756

  13. An Optimized Centrifugal Method for Separation of Semen from Superabsorbent Polymers for Forensic Analysis.

    PubMed

    Camarena, Lucy R; Glasscock, Bailey K; Daniels, Demi; Ackley, Nicolle; Sciarretta, Marybeth; Seashols-Williams, Sarah J

    2017-03-01

    Connection of a perpetrator to a sexual assault is best performed through the confirmed presence of semen, thereby proving sexual contact. Evidentiary items can include sanitary napkins or diapers containing superabsorbent polymers (SAPs), complicating spermatozoa visualization and DNA analysis. In this report, we evaluated the impact of SAPS on the current forensic DNA workflow, developing an efficient centrifugal protocol for separating spermatozoa from SAP material. The optimized filtration method was compared to common practices of excising the top layer only, resulting in significantly higher sperm yields when a core sample of the substrate was taken. Direct isolation of the SAP-containing materials without filtering resulted in 20% sample failure; additionally, SAP material was observed in the final eluted DNA samples, causing physical interference. Thus, use of the described centrifugal-filtering method is a simple preliminary step that improves spermatozoa visualization and enables more consistent DNA yields, while also avoiding SAP interference. © 2016 American Academy of Forensic Sciences.

  14. 1-deoxy-d-xylulose-5-phosphate reductoisomerases and method of use

    DOEpatents

    Croteau, Rodney B.; Lange, Bernd M.

    2001-01-01

    The present invention relates to isolated DNA sequences which code for the expression of plant 1-deoxy-D-xylulose-5-phosphate reductoisomerase protein, such as the sequence presented in SEQ ID NO:1 which encodes a 1-deoxy-D-xylulose-5-phosphate reductoisomerase protein from peppermint (Mentha x piperita). Additionally, the present invention relates to isolated plant 1-deoxy-D-xylulose-5-phosphate reductoisomerase protein. In other aspects, the present invention is directed to replicable recombinant cloning vehicles comprising a nucleic acid sequence which codes for a plant 1-deoxy-D-xylulose-5-phosphate reductoisomerase, to modified host cells transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence of the invention.

  15. 1-deoxy-D-xylulose-5-phosphate reductoisomerases, and methods of use

    DOEpatents

    Croteau, Rodney B.; Lange, Bernd M.

    2002-07-16

    The present invention relates to isolated DNA sequences which code for the expression of plant 1-deoxy-D-xylulose-5-phosphate reductoisomerase protein, such as the sequence presented in SEQ ID NO:1 which encodes a 1-deoxy-D-xylulose-5-phosphate reductoisomerase protein from peppermint (Mentha x piperita). Additionally, the present invention relates to isolated plant 1-deoxy-D-xylulose-5-phosphate reductoisomerase protein. In other aspects, the present invention is directed to replicable recombinant cloning vehicles comprising a nucleic acid sequence which codes for a plant 1-deoxy-D-xylulose-5-phosphate reductoisomerase, to modified host cells transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence of the invention.

  16. Isolation of Fungal Pathogens to an Edible Mushroom, Pleurotus eryngii, and Development of Specific ITS Primers

    PubMed Central

    Kim, Sang-Woo; Kim, Sinil; Lee, Hyun-Jun; Park, Ju-Wan

    2013-01-01

    Fungal pathogens have caused severe damage to the commercial production of Pleurotus eryngii, the king oyster mushroom, by reducing production yield, causing deterioration of commercial value, and shortening shelf-life. Four strains of pathogenic fungi, including Trichoderma koningiopsis DC3, Phomopsis sp. MP4, Mucor circinelloides MP5, and Cladosporium bruhnei MP6, were isolated from the bottle culture of diseased P. eryngii. A species-specific primer set was designed for each fungus from the ITS1-5.8S rDNA-ITS2 sequences. PCR using the ITS primer set yielded a unique DNA band for each fungus without any cross-reaction, proving the validity of our method in detection of mushroom fungal pathogens. PMID:24493949

  17. Comparative analysis of Edwardsiella isolates from fish in the eastern United States identifies two distinct genetic taxa amongst organisms phenotypically classified as E. tarda

    USGS Publications Warehouse

    Griffin, Matt J.; Quiniou, Sylvie M.; Cody, Theresa; Tabuchi, Maki; Ware, Cynthia; Cipriano, Rocco C.; Mauel, Michael J.; Soto, Esteban

    2013-01-01

    Edwardsiella tarda, a Gram-negative member of the family Enterobacteriaceae, has been implicated in significant losses in aquaculture facilities worldwide. Here, we assessed the intra-specific variability of E. tarda isolates from 4 different fish species in the eastern United States. Repetitive sequence mediated PCR (rep-PCR) using 4 different primer sets (ERIC I & II, ERIC II, BOX, and GTG5) and multi-locus sequence analysis of 16S SSU rDNA, groEl, gyrA, gyrB, pho, pgi, pgm, and rpoA gene fragments identified two distinct genotypes of E. tarda (DNA group I; DNA group II). Isolates that fell into DNA group II demonstrated more similarity to E. ictaluri than DNA group I, which contained the reference E. tarda strain (ATCC #15947). Conventional PCR analysis using published E. tarda-specific primer sets yielded variable results, with several primer sets producing no observable amplification of target DNA from some isolates. Fluorometric determination of G + C content demonstrated 56.4% G + C content for DNA group I, 60.2% for DNA group II, and 58.4% for E. ictaluri. Surprisingly, these isolates were indistinguishable using conventional biochemical techniques, with all isolates demonstrating phenotypic characteristics consistent with E. tarda. Analysis using two commercial test kits identified multiple phenotypes, although no single metabolic characteristic could reliably discriminate between genetic groups. Additionally, anti-microbial susceptibility and fatty acid profiles did not demonstrate remarkable differences between groups. The significant genetic variation (<90% similarity at gyrA, gyrB, pho, phi and pgm; <40% similarity by rep-PCR) between these groups suggests organisms from DNA group II may represent an unrecognized, genetically distinct taxa of Edwardsiella that is phenotypically indistinguishable from E. tarda.

  18. Microbiological study of lactic acid bacteria in kefir grains by culture-dependent and culture-independent methods.

    PubMed

    Chen, Hsi-Chia; Wang, Sheng-Yao; Chen, Ming-Ju

    2008-05-01

    Lactic acid bacteria (LAB) in different original kefir grains were first assessed using polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) by a culture-dependent way, and were further confirmed by DNA sequencing techniques. Results indicated that a combined method of cultivation with PCR-DGGE and subsequent DNA sequencing could successfully identify four LAB strains from three kefir grains from Taiwan (named Hsinchu, Mongolia and Ilan). Lactobacillus kefiri accounted, in the three kefir grains, for at least half of the isolated colonies while Lb. kefiranofaciens was the second most frequently isolated species. Leuconostoc mesenteroides was less frequently found but still in the three kefir grains conversely to Lactococcus lactis which based on culture-dependent isolation was only found in two of the kefir grains. It was interesting to find that all three kefir grains contain similar LAB species. Furthermore, the DGGE as a culture-independent method was also applied to detect the LAB strains. Results indicated that Lb. kefiranofaciens was found in all three kefir grains, whereas Lb. kefiri was only observed in Hsinchu kefir grain and Lc. lactis was found in both Mongolia and Ilan samples. Two additional strains, Pseudomonas spp. and E. coli, were also detected in kefir grains.

  19. Linkage map of the fragments of herpesvirus papio DNA.

    PubMed Central

    Lee, Y S; Tanaka, A; Lau, R Y; Nonoyama, M; Rabin, H

    1981-01-01

    Herpesvirus papio (HVP), an Epstein-Barr-like virus, causes lymphoblastoid disease in baboons. The physical map of HVP DNA was constructed for the fragments produced by cleavage of HVP DNA with restriction endonucleases EcoRI, HindIII, SalI, and PvuI, which produced 12, 12, 10, and 4 fragments, respectively. The total molecular size of HVP DNA was calculated as close to 110 megadaltons. The following methods were used for construction of the map; (i) fragments near the ends of HVP DNA were identified by treating viral DNA with lambda exonuclease before restriction enzyme digestion; (ii) fragments containing nucleotide sequences in common with fragments from the second enzyme digest of HVP DNA were examined by Southern blot hybridization; and (iii) the location of some fragments was determined by isolating individual fragments from agarose gels and redigesting the isolated fragments with a second restriction enzyme. Terminal heterogeneity and internal repeats were found to be unique features of HVP DNA molecule. One to five repeats of 0.8 megadaltons were found at both terminal ends. Although the repeats of both ends shared a certain degree of homology, it was not determined whether they were identical repeats. The internal repeat sequence of HVP DNA was found in the EcoRI-C region, which extended from 8.4 to 23 megadaltons from the left end of the molecule. The average number of the repeats was calculated to be seven, and the molecular size was determined to be 1.8 megadaltons. Similar unique features have been reported in EBV DNA (D. Given and E. Kieff, J. Virol. 28:524-542, 1978). Images PMID:6261015

  20. Identification of Stenotrophomonas maltophilia strains isolated from environmental and clinical samples: a rapid and efficient procedure.

    PubMed

    Pinot, C; Deredjian, A; Nazaret, S; Brothier, E; Cournoyer, B; Segonds, C; Favre-Bonté, S

    2011-11-01

    Aim of the study is to identify accurately Stenotrophomonas maltophilia isolates recovered from environmental and clinical samples. Recovery of Sten. maltophilia-like isolates from soil samples using the vancomycin, imipenem, amphotericin B (VIA) selective agar medium enabled distinction of various morphotype colonies. A set of soil and clinical isolates was tested for species identification using different methods. 16S rDNA analyses showed the dark green with a blue halo morphotype to be typical Sten. maltophilia strains. The API-20NE, Vitek-2 and Biolog phenotypic analyses typically used for the identification of clinical isolates did not perform well on these soil isolates. The species-specific PCR screening targeting Sten. maltophilia 23S rDNA and the multiplex smeD/ggpS PCR, differentiating Sten. maltophilia from Stenotrophomonas rhizophila, were tested for improvement of these identification schemes. The latter multiplex PCR identified all isolates tested in this study, whatever be their origin. Isolation on VIA medium and confirmation of Sten. maltophilia species membership by smeD PCR is proposed to identify environmental and clinical isolates of Sten. maltophilia. The proposed approach enables isolation and identification of Sten. maltophilia from different environments in an easy and rapid way. This approach will be useful to accurately manage studies on the abundance and distribution of Sten. maltophilia in hospital and nonhospital environments. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.

  1. Identification of tissue-specific cell death using methylation patterns of circulating DNA

    PubMed Central

    Lehmann-Werman, Roni; Neiman, Daniel; Zemmour, Hai; Moss, Joshua; Magenheim, Judith; Vaknin-Dembinsky, Adi; Rubertsson, Sten; Nellgård, Bengt; Blennow, Kaj; Zetterberg, Henrik; Spalding, Kirsty; Haller, Michael J.; Wasserfall, Clive H.; Schatz, Desmond A.; Greenbaum, Carla J.; Dorrell, Craig; Grompe, Markus; Zick, Aviad; Hubert, Ayala; Maoz, Myriam; Fendrich, Volker; Bartsch, Detlef K.; Golan, Talia; Ben Sasson, Shmuel A.; Zamir, Gideon; Razin, Aharon; Cedar, Howard; Shapiro, A. M. James; Glaser, Benjamin; Shemer, Ruth; Dor, Yuval

    2016-01-01

    Minimally invasive detection of cell death could prove an invaluable resource in many physiologic and pathologic situations. Cell-free circulating DNA (cfDNA) released from dying cells is emerging as a diagnostic tool for monitoring cancer dynamics and graft failure. However, existing methods rely on differences in DNA sequences in source tissues, so that cell death cannot be identified in tissues with a normal genome. We developed a method of detecting tissue-specific cell death in humans based on tissue-specific methylation patterns in cfDNA. We interrogated tissue-specific methylome databases to identify cell type-specific DNA methylation signatures and developed a method to detect these signatures in mixed DNA samples. We isolated cfDNA from plasma or serum of donors, treated the cfDNA with bisulfite, PCR-amplified the cfDNA, and sequenced it to quantify cfDNA carrying the methylation markers of the cell type of interest. Pancreatic β-cell DNA was identified in the circulation of patients with recently diagnosed type-1 diabetes and islet-graft recipients; oligodendrocyte DNA was identified in patients with relapsing multiple sclerosis; neuronal/glial DNA was identified in patients after traumatic brain injury or cardiac arrest; and exocrine pancreas DNA was identified in patients with pancreatic cancer or pancreatitis. This proof-of-concept study demonstrates that the tissue origins of cfDNA and thus the rate of death of specific cell types can be determined in humans. The approach can be adapted to identify cfDNA derived from any cell type in the body, offering a minimally invasive window for diagnosing and monitoring a broad spectrum of human pathologies as well as providing a better understanding of normal tissue dynamics. PMID:26976580

  2. Improved EGFR mutation detection using combined exosomal RNA and circulating tumor DNA in NSCLC patient plasma

    PubMed Central

    Krug, A K; Enderle, D; Karlovich, C; Priewasser, T; Bentink, S; Spiel, A; Brinkmann, K; Emenegger, J; Grimm, D G; Castellanos-Rizaldos, E; Goldman, J W; Sequist, L V; Soria, J -C; Camidge, D R; Gadgeel, S M; Wakelee, H A; Raponi, M; Noerholm, M; Skog, J

    2018-01-01

    Abstract Background A major limitation of circulating tumor DNA (ctDNA) for somatic mutation detection has been the low level of ctDNA found in a subset of cancer patients. We investigated whether using a combined isolation of exosomal RNA (exoRNA) and cell-free DNA (cfDNA) could improve blood-based liquid biopsy for EGFR mutation detection in non-small-cell lung cancer (NSCLC) patients. Patients and methods Matched pretreatment tumor and plasma were collected from 84 patients enrolled in TIGER-X (NCT01526928), a phase 1/2 study of rociletinib in mutant EGFR NSCLC patients. The combined isolated exoRNA and cfDNA (exoNA) was analyzed blinded for mutations using a targeted next-generation sequencing panel (EXO1000) and compared with existing data from the same samples using analysis of ctDNA by BEAMing. Results For exoNA, the sensitivity was 98% for detection of activating EGFR mutations and 90% for EGFR T790M. The corresponding sensitivities for ctDNA by BEAMing were 82% for activating mutations and 84% for T790M. In a subgroup of patients with intrathoracic metastatic disease (M0/M1a; n = 21), the sensitivity increased from 26% to 74% for activating mutations (P = 0.003) and from 19% to 31% for T790M (P = 0.5) when using exoNA for detection. Conclusions Combining exoRNA and ctDNA increased the sensitivity for EGFR mutation detection in plasma, with the largest improvement seen in the subgroup of M0/M1a disease patients known to have low levels of ctDNA and poses challenges for mutation detection on ctDNA alone. Clinical Trials NCT01526928 PMID:29216356

  3. Sequence analysis of ORF IV RTBV isolated from tungro infected Oryza sativa L. cv Ciherang

    NASA Astrophysics Data System (ADS)

    Hastilestari, Bernadetta Rina; Astuti, Dwi; Estiati, Amy; Nugroho, Satya

    2015-09-01

    The Effort to increase rice production is often constrained by pest and disease such as Tungro. The Tungro disease is caused by the joint infection with two dissimilar viruses; a bacil-form-DNA virus, the Rice tungro bacilliform virus(RTBV) and the spherical RNA virus, Rice tungro spherical virus (RTSV) and transmitted by Green leafhopper (Nephotettix virescens). The symptom of disease is caused by the presence of RTBV. The genome of RTBV consists of four Open reading frames (ORFs) which encode functional proteins. Of the four, ORF IV is unique because it exists only in RTBV. The most efficient method of generating disease resistance plants is to look for natural sources of resistance genes in wild or germplasm and then transfer the gene and the accompanying resistance in cultivated crop varieties. The aim of this study is, therefore, to isolate and analyze of 1170 bp gene of ORF 4 of Tungro virus isolated from an Indonesian rice cultivar, Ciherang (Oryza sativa L. cv Indica). DNA sequencing analysis using BLAST showed 94% similarity with the reference sequence gen bank Acc.M65026.1. The comparisons and mutation analysis of DNA sequences were discussed in this research.

  4. Effect of DNA Extraction Methods on the Apparent Structure of Yak Rumen Microbial Communities as Revealed by 16S rDNA Sequencing.

    PubMed

    Chen, Ya-Bing; Lan, Dao-Liang; Tang, Cheng; Yang, Xiao-Nong; Li, Jian

    2015-01-01

    To more efficiently identify the microbial community of the yak rumen, the standardization of DNA extraction is key to ensure fidelity while studying environmental microbial communities. In this study, we systematically compared the efficiency of several extraction methods based on DNA yield, purity, and 16S rDNA sequencing to determine the optimal DNA extraction methods whose DNA products reflect complete bacterial communities. The results indicate that method 6 (hexadecyltrimethylammomium bromide-lysozyme-physical lysis by bead beating) is recommended for the DNA isolation of the rumen microbial community due to its high yield, operational taxonomic unit, bacterial diversity, and excellent cell-breaking capability. The results also indicate that the bead-beating step is necessary to effectively break down the cell walls of all of the microbes, especially Gram-positive bacteria. Another aim of this study was to preliminarily analyze the bacterial community via 16S rDNA sequencing. The microbial community spanned approximately 21 phyla, 35 classes, 75 families, and 112 genera. A comparative analysis showed some variations in the microbial community between yaks and cattle that may be attributed to diet and environmental differences. Interestingly, numerous uncultured or unclassified bacteria were found in yak rumen, suggesting that further research is required to determine the specific functional and ecological roles of these bacteria in yak rumen. In summary, the investigation of the optimal DNA extraction methods and the preliminary evaluation of the bacterial community composition of yak rumen support further identification of the specificity of the rumen microbial community in yak and the discovery of distinct gene resources.

  5. Enhanced genetic analysis of single human bioparticles recovered by simplified micromanipulation from forensic 'touch DNA' evidence.

    PubMed

    Farash, Katherine; Hanson, Erin K; Ballantyne, Jack

    2015-03-09

    DNA profiles can be obtained from 'touch DNA' evidence, which comprises microscopic traces of human biological material. Current methods for the recovery of trace DNA employ cotton swabs or adhesive tape to sample an area of interest. However, such a 'blind-swabbing' approach will co-sample cellular material from the different individuals, even if the individuals' cells are located in geographically distinct locations on the item. Thus, some of the DNA mixtures encountered in touch DNA samples are artificially created by the swabbing itself. In some instances, a victim's DNA may be found in significant excess thus masking any potential perpetrator's DNA. In order to circumvent the challenges with standard recovery and analysis methods, we have developed a lower cost, 'smart analysis' method that results in enhanced genetic analysis of touch DNA evidence. We describe an optimized and efficient micromanipulation recovery strategy for the collection of bio-particles present in touch DNA samples, as well as an enhanced amplification strategy involving a one-step 5 µl microvolume lysis/STR amplification to permit the recovery of STR profiles from the bio-particle donor(s). The use of individual or few (i.e., "clumps") bioparticles results in the ability to obtain single source profiles. These procedures represent alternative enhanced techniques for the isolation and analysis of single bioparticles from forensic touch DNA evidence. While not necessary in every forensic investigation, the method could be highly beneficial for the recovery of a single source perpetrator DNA profile in cases involving physical assault (e.g., strangulation) that may not be possible using standard analysis techniques. Additionally, the strategies developed here offer an opportunity to obtain genetic information at the single cell level from a variety of other non-forensic trace biological material.

  6. Evaluating Protocols for Porcine Faecal Microbiome Recollection, Storage and DNA Extraction: from the Farm to the Lab.

    PubMed

    Muiños-Bühl, Anixa; González-Recio, Oscar; Muñoz, María; Óvilo, Cristina; García-Casco, Juan; Fernández, Ana I

    2018-06-01

    There is a growing interest in understanding the role of the gut microbiome on productive and meat quality-related traits in livestock species in order to develop new useful tools for improving pig production systems and industry. Faecal samples are analysed as a proxy of gut microbiota and here the selection of suitable protocols for faecal sampling and DNA isolation is a critical first step in order to obtain reliable results, even more to compare results obtained from different studies. The aim of the current study was to establish in a cost-effective way, using automated ribosomal intergenic spacer analysis technique, a protocol for porcine faecal sampling and storage at farm and slaughterhouse and to determine the most efficient microbiota DNA isolation kit among those most widely used. Operational Taxonomic Unit profiles were compared from Iberian pig faecal samples collected from rectum or ground, stored with liquid N 2 , room temperature or RNAlater, and processed with QIAamp DNA Stool (Qiagen), PowerFecal DNA Isolation (Mobio) or SpeedTools Tissue DNA extraction (Biotools) commercial kits. The results, focused on prokaryote sampling, based on DNA yield and quality, OTU number and Sørensen similarity Indexes, indicate that the recommended protocol for porcine faecal microbiome sampling at farm should include: the collection from porcine rectum to avoid contamination; the storage in liquid N 2 or even at room temperature, but not in RNAlater; and the isolation of microbiota DNA using PowerFecal DNA Isolation kit. These conditions provide more reliable DNA samples for further microbiome analysis.

  7. How-to-Do-It: A Simple DNA Isolation Technique Using Halophilic Bacteria.

    ERIC Educational Resources Information Center

    Guilfoile, Patrick

    1989-01-01

    Described is a simple technique for isolating DNA from halophilic bacteria. Materials, procedure, and additional experiments are outlined. It is stated that the DNA obtained will be somewhat contaminated with cellular proteins and RNA. Offers a procedure for greater purification. (RT)

  8. Evaluation of commercial DNA and RNA extraction methods for high-throughput sequencing of FFPE samples.

    PubMed

    Kresse, Stine H; Namløs, Heidi M; Lorenz, Susanne; Berner, Jeanne-Marie; Myklebost, Ola; Bjerkehagen, Bodil; Meza-Zepeda, Leonardo A

    2018-01-01

    Nucleic acid material of adequate quality is crucial for successful high-throughput sequencing (HTS) analysis. DNA and RNA isolated from archival FFPE material are frequently degraded and not readily amplifiable due to chemical damage introduced during fixation. To identify optimal nucleic acid extraction kits, DNA and RNA quantity, quality and performance in HTS applications were evaluated. DNA and RNA were isolated from five sarcoma archival FFPE blocks, using eight extraction protocols from seven kits from three different commercial vendors. For DNA extraction, the truXTRAC FFPE DNA kit from Covaris gave higher yields and better amplifiable DNA, but all protocols gave comparable HTS library yields using Agilent SureSelect XT and performed well in downstream variant calling. For RNA extraction, all protocols gave comparable yields and amplifiable RNA. However, for fusion gene detection using the Archer FusionPlex Sarcoma Assay, the truXTRAC FFPE RNA kit from Covaris and Agencourt FormaPure kit from Beckman Coulter showed the highest percentage of unique read-pairs, providing higher complexity of HTS data and more frequent detection of recurrent fusion genes. truXTRAC simultaneous DNA and RNA extraction gave similar outputs as individual protocols. These findings show that although successful HTS libraries could be generated in most cases, the different protocols gave variable quantity and quality for FFPE nucleic acid extraction. Selecting the optimal procedure is highly valuable and may generate results in borderline quality specimens.

  9. Mimosa caesalpiniifolia rhizobial isolates from different origins of the Brazilian Northeast.

    PubMed

    Martins, Paulo Geovani Silva; Junior, Mario Andrade Lira; Fracetto, Giselle Gomes Monteiro; da Silva, Maria Luiza Ribeiro Bastos; Vincentin, Rayssa Pereira; de Lyra, Maria do Carmo Catanho Pereira

    2015-04-01

    Biological nitrogen fixation from the legume-rhizobia symbiosis is one of the main sources of fixed nitrogen on land environments. Diazotrophic bacteria taxonomy has been substantially modified by the joint use of phenotypic, physiological and molecular aspects. Among these molecular tools, sequencing and genotyping of genomic regions such as 16S rDNA and repetitive conserved DNA regions have boosted the accuracy of species identification. This research is a phylogenetic study of diazotrophic bacteria from sabiá (Mimosa caesalpiniifolia Benth.), inoculated with soils from five municipalities of the Brazilian Northeast. After bacterial isolation and morphophysiological characterization, genotyping was performed using REP, ERIC and BOX oligonucleotides and 16S rDNA sequencing for genetic diversity identification. A 1.5b Kb fragment of the 16S rDNA was amplified from each isolate. Morphophysiological characterization of the 47 isolates created a dendrogram, where isolate PE-GR02 formed a monophyletic branch. The fingerprinting conducted with BOX, ERIC and REP shows distinct patterns, and their compilation created a dendrogram with diverse groups and, after blasting in GenBank, resulted in genetic identities ranging from 77 to 99 % with Burkholderia strains. The 16S rDNA phylogenetic tree constructed with these isolates and GenBank deposits of strains recommended for inoculant production confirm these isolates are distinct from the previously deposited strains, whereas isolates PE-CR02, PE-CR4, PE-CR07, PE-CR09 and PE-GE06 were the most distinct within the group. Morphophysiological characterization and BOX, ERIC and REP compilation enhanced the discrimination of the isolates, and the 16S rDNA sequences compared with GenBank confirmed the preference of Mimosa for Burkholderia diazotrophic bacteria.

  10. Nucleic and amino acid sequences relating to a novel transketolase, and methods for the expression thereof

    DOEpatents

    Croteau, Rodney Bruce; Wildung, Mark Raymond; Lange, Bernd Markus; McCaskill, David G.

    2001-01-01

    cDNAs encoding 1-deoxyxylulose-5-phosphate synthase from peppermint (Mentha piperita) have been isolated and sequenced, and the corresponding amino acid sequences have been determined. Accordingly, isolated DNA sequences (SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7) are provided which code for the expression of 1-deoxyxylulose-5-phosphate synthase from plants. In another aspect the present invention provides for isolated, recombinant DXPS proteins, such as the proteins having the sequences set forth in SEQ ID NO:4, SEQ ID NO:6 and SEQ ID NO:8. In other aspects, replicable recombinant cloning vehicles are provided which code for plant 1-deoxyxylulose-5-phosphate synthases, or for a base sequence sufficiently complementary to at least a portion of 1-deoxyxylulose-5-phosphate synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding a plant 1-deoxyxylulose-5-phosphate synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant 1-deoxyxylulose-5-phosphate synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant 1-deoxyxylulose-5-phosphate synthase may be used to obtain expression or enhanced expression of 1-deoxyxylulose-5-phosphate synthase in plants in order to enhance the production of 1-deoxyxylulose-5-phosphate, or its derivatives such as isopentenyl diphosphate (BP), or may be otherwise employed for the regulation or expression of 1-deoxyxylulose-5-phosphate synthase, or the production of its products.

  11. A novel growth-promoting microbe, Methylobacterium funariae sp. nov., isolated from the leaf surface of a common moss

    PubMed Central

    Schauer, S

    2011-01-01

    Land plants (embryophytes) evolved in the presence of prokaryotic microbes. As a result, numerous mutually beneficial associations (symbioses) developed that can be analyzed using a variety of methods. Here we describe the isolation and characterization of a new pink-pigmented facultatively methylotrophic symbiotic bacterium of the genus Methylobacterium (laboratory strain F3.2) that was isolated from the gametophytic phylloids of the common cord moss Funaria hygrometrica Hedw. Plantlets were collected in the field and analyzed in the laboratory. Colonies of methylobacteria were obtained by the agar-impression-method. Based on its unique phenotype (the bacterial cells are characterized by fimbriae-like appendages), a comparative 16S rRNA gene (DNA) sequence analysis and an average DNA-DNA hybridization value of 8.4%, compared with its most closely related sister taxon, this isolate is described as a new species, Methylobacterium funariae sp. nov. (type strain F3.2). This new epiphytic bacterium inhabits the leaf surface of “primitive” land plants such as mosses and interacts with its host organism via the secretion of phytohormones (cytokinines, auxins). These external signals are perceived by the plant cells that divide and grow more rapidly than in the absence of their prokaryotic phytosymbionts. We suggest that M. funariae sp. nov. uses methanol emitted from the stomatal pores as principal carbon source for cell metabolism. However, our novel data indicate that, in this unique symbiotic plant-microbe interaction, the uptake of amino acids leached from the surface of the epidermal cells of the green host organism may be of importance as microbial carbon- and nitrogen-source. PMID:21673511

  12. Rapid Isolation and Detection for RNA Biomarkers for TBI Diagnostics

    DTIC Science & Technology

    2016-10-01

    address the qualitative result of PCR by choosing the threshold crossover cycle (CT) as a surrogate measure of the RNA/DNA originally in the sample ...include developing DEP techniques for isolation of cell-free (cf) RNA from glioblastoma exosomes and TBI samples (IRB dependent); methods for on... Sample to Answer diagnostics. 15. SUBJECT TERMS 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF PAGES 19a. NAME OF

  13. [Assessment of two DNA extraction methods to amplify the pneumolysin gene (PLY) from blood culture samples of Streptococcus pneumoniae].

    PubMed

    Hernández, Carolina; Durán, Claudia; Ulloa, María Teresa; Prado, Valeria

    2004-05-01

    Streptococcus pneumoniae is a common etiologic agent of invasive respiratory infections among children under 5 years of age and older adults. Isolation rates of S. pneumoniae by traditional culture techniques are low. To study the sensitivity and specificity of two different DNA extraction methods to amplify the ply gene, applied to three different types of blood culture broths, experimentally inoculated with S. pneumoniae. DNA was extracted from the cultures using an organic method or a technique that consists in dilution, washing with NaOH and concentration of the sample. This was followed by PCR amplification of a 355 pb fragment of the pneumolysin gene (ply). The organic DNA extraction method inhibited the PCR reaction at all concentrations studied (0.6 to 10(6) colony forming units/mL). Using the NaOH extraction, ply gene amplification was positive in all three blood culture broths, but only at concentrations of 10(3) colony forming units/mL, or higher. Using the same DNA extraction method, PCR was negative when the broths were inoculated with seven other related bacterial species, which results in a 100% specificity. Detection of S. pneumoniae by amplification of ply gene from blood cultures using the protocol of NaOH for DNA extraction is specific and provides results in a short lapse. However, the diagnostic sensitivity is not optimal, which limits its clinical use.

  14. First isolation of Actinobacillus genomospecies 2 in Japan

    PubMed Central

    MURAKAMI, Miyuki; SHIMONISHI, Yoshimasa; HOBO, Seiji; NIWA, Hidekazu; ITO, Hiroya

    2015-01-01

    We describe here the first isolation of Actinobacillus genomospecies 2 in Japan. The isolate was found in a septicemic foal and characterized by phenotypic and genetic analyses, with the latter consisting of 16S rDNA nucleotide sequence analysis plus multilocus sequence analysis using three housekeeping genes, recN, rpoA and thdF, that have been proposed for use as a genomic tool in place of DNA-DNA hybridization. PMID:26668165

  15. DNA-A of a highly pathogenic Indian cassava mosaic virus isolated from Jatropha curcas causes symptoms in Nicotiana benthamiana.

    PubMed

    Wang, Gang; Sun, Yanwei; Xu, Ruirui; Qu, Jing; Tee, Chuansia; Jiang, Xiyuan; Ye, Jian

    2014-04-01

    Jatropha curcas mosaic disease (JcMD) is a newly emerging disease that has been reported in Africa and India. Here, we report the complete nucleotide sequence of a new Indian cassava mosaic virus isolate (ICMV-SG) from Singapore. Infection of ICMV-SG showed more severe JcMD in Jatropha curcas and Nicotiana benthamiana than the other ICMV isolates reported previously, though ICMV-SG shares high sequence identity with the other ICMV isolates. Agroinfectious DNA-A alone sufficiently induced systemic symptoms in N. benthamiana, but not in J. curcas. Results from agroinfection assays showed that systemic infection of ICMV-SG in J. curcas required both DNA-A and DNA-B components.

  16. Evaluation of the Biotyper MALDI-TOF MS system for identification of Staphylococcus species.

    PubMed

    Zhu, Wenming; Sieradzki, Krzysztof; Albrecht, Valerie; McAllister, Sigrid; Lin, Wen; Stuchlik, Olga; Limbago, Brandi; Pohl, Jan; Kamile Rasheed, J

    2015-10-01

    The Bruker Biotyper MALDI-TOF MS (Biotyper) system, with a modified 30 minute formic acid extraction method, was evaluated by its ability to identify 216 clinical Staphylococcus isolates from the CDC reference collection comprising 23 species previously identified by conventional biochemical tests. 16S rDNA sequence analysis was used to resolve discrepancies. Of these, 209 (96.8%) isolates were correctly identified: 177 (84.7%) isolates had scores ≥2.0, while 32 (15.3%) had scores between 1.70 and 1.99. The Biotyper identification was inconsistent with the biochemical identification for seven (3.2%) isolates, but the Biotyper identifications were confirmed by 16S rDNA analysis. The distribution of low scores was strongly species-dependent, e.g. only 5% of Staphylococcus epidermidis and 4.8% of Staphylococcus aureus isolates scored below 2.0, while 100% of Staphylococcus cohnii, 75% of Staphylococcus sciuri, and 60% of Staphylococcus caprae produced low but accurate Biotyper scores. Our results demonstrate that the Biotyper can reliably identify Staphylococcus species with greater accuracy than conventional biochemicals. Broadening of the reference database by inclusion of additional examples of under-represented species could further optimize Biotyper results. Published by Elsevier B.V.

  17. Differentiation of Trichophyton rubrum clinical isolates from Japanese and Chinese patients by randomly amplified polymorphic DNA and DNA sequence analysis of the non-transcribed spacer region of the rRNA gene.

    PubMed

    Yang, Xiumin; Sugita, Takashi; Takashima, Masako; Hiruma, Masataro; Li, Ruoyu; Sudo, Hajime; Ogawa, Hideoki; Ikeda, Shigaku

    2009-04-01

    Trichophyton rubrum is the most common pathogen causing dermatophytosis worldwide. Recent genetic investigations showed that the microorganism originated in Africa and then spread to Europe and North America via Asia. We investigated the intraspecific diversity of T. rubrum isolated from two closely located Asian countries, Japan and China. A total of 150 clinical isolates of T. rubrum obtained from Japanese and Chinese patients were analyzed by randomly amplified polymorphic DNA (RAPD) and DNA sequence analysis of the non-transcribed spacer (NTS) region in the rRNA gene. RAPD analysis divided the 150 strains into two major clusters, A and B. Of the Japanese isolates, 30% belonged to cluster A and 70% belonged to cluster B, whereas 91% of the Chinese isolates were in cluster A. The NTS region of the rRNA gene was divided into four major groups (I-IV) based on DNA sequencing. The majority of Japanese isolates were type IV (51%), and the majority of Chinese isolates were type III (75%). These results suggest that although Japan and China are neighboring countries, the origins of T. rubrum isolates from these countries may not be identical. These findings provide information useful for tracing the global transmission routes of T. rubrum.

  18. Dielectrophoretic Isolation and Detection of cfc-DNA Nanoparticulate Biomarkers and Virus from Blood

    PubMed Central

    Sonnenberg, Avery; Marciniak, Jennifer Y.; McCanna, James; Krishnan, Rajaram; Rassenti, Laura; Kipps, Thomas J.; Heller, Michael J.

    2015-01-01

    Dielectrophoretic (DEP) microarray devices allow important cellular nanoparticulate biomarkers and virus to be rapidly isolated, concentrated and detected directly from clinical and biological samples. A variety of sub-micron nanoparticulate entities including cell free circulating (cfc) DNA, mitochondria and virus can be isolated into DEP high-field areas on microelectrodes, while blood cells and other micron-size entities become isolated into DEP low-field areas between the microelectrodes. The nanoparticulate entities are held in the DEP high-field areas while cells are washed away along with proteins and other small molecules which are not affected by the DEP electric fields. DEP carried out on 20 µL of whole blood obtained from Chronic Lymphocytic Leukemia (CLL) patients showed a considerable amount of SYBR Green stained DNA fluorescent material concentrated in the DEP high-field regions. Whole blood obtained from healthy individuals showed little or no fluorescent DNA materials in the DEP high-field regions. Fluorescent T7 bacteriophage virus could be isolated directly from blood samples, and fluorescently stained mitochondria could be isolated from biological buffer samples. Using newer DEP microarray devices, high molecular weight (hmw) DNA could be isolated from serum and detected at levels as low as 8–16 ng/mL. PMID:23436471

  19. DNA fingerprinting of isolates of Streptococcus mutans by pulsed-field gel electrophoresis.

    PubMed

    Mineyama, R; Yoshino, S; Maeda, N

    2007-01-01

    Forty isolates and five standard laboratory strains, representing serotypes c, e and f of Streptococcus mutans were analyzed by pulsed-field gel electrophoresis (PFGE) after digestion of the genomic DNA with BssH II. The digestion patterns of standard laboratory strains were characteristic of serotypes c, e and f. Serotypes c and f generated diagnostic DNA fragments of approximately 145 kbp and of approximately 130-175 kbp in length, respectively. Serotype e generated a ladder of at least 14 fragments of 15-155 kbp in length. The digestion patterns of isolates were essentially similar to those of the standard laboratory strains. The patterns of almost all isolates obtained from a single individual were identical, but patterns of a few different types were also observed among isolates obtained from two individuals. Digestion with BssH II revealed differences among isolates obtained from different individuals. We used differences in banding patterns among isolates to construct a dendrogram. The dendrogram included two major clusters, one that consisted of isolates of serotypes c and f, and an other that consisted of isolates of serotype e. Our results indicate that BssH II is a useful enzyme for distinguishing among isolates of S. mutans and that digestion patterns obtained by PFGE can be used for chromosomal DNA fingerprinting.

  20. Isolation of Microarray-Grade Total RNA, MicroRNA, and DNA from a Single PAXgene Blood RNA Tube

    PubMed Central

    Kruhøffer, Mogens; Dyrskjøt, Lars; Voss, Thorsten; Lindberg, Raija L.P.; Wyrich, Ralf; Thykjaer, Thomas; Orntoft, Torben F.

    2007-01-01

    We have developed a procedure for isolation of microRNA and genomic DNA in addition to total RNA from whole blood stabilized in PAXgene Blood RNA tubes. The procedure is based on automatic extraction on a BioRobot MDx and includes isolation of DNA from a fraction of the stabilized blood and recovery of small RNA species that are otherwise lost. The procedure presented here is suitable for large-scale experiments and is amenable to further automation. Procured total RNA and DNA was tested using Affymetrix Expression and single-nucleotide polymorphism GeneChips, respectively, and isolated microRNA was tested using spotted locked nucleic acid-based microarrays. We conclude that the yield and quality of total RNA, microRNA, and DNA from a single PAXgene blood RNA tube is sufficient for downstream microarray analysis. PMID:17690207

Top