Sample records for dna mobility shift

  1. Using Electrophoretic Mobility Shift Assays to Measure Equilibrium Dissociation Constants: GAL4-p53 Binding DNA as a Model System

    ERIC Educational Resources Information Center

    Heffler, Michael A.; Walters, Ryan D.; Kugel, Jennifer F.

    2012-01-01

    An undergraduate biochemistry laboratory experiment is described that will teach students the practical and theoretical considerations for measuring the equilibrium dissociation constant (K[subscript D]) for a protein/DNA interaction using electrophoretic mobility shift assays (EMSAs). An EMSA monitors the migration of DNA through a native gel;…

  2. UV damage-specific DNA-binding protein in xeroderma pigmentosum complementation group E

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kataoka, H.; Fujiwara, Y.

    1991-03-29

    The gel mobility shift assay method revealed a specifically ultraviolet (UV) damage recognizing, DNA-binding protein in nuclear extracts of normal human cells. The resulted DNA/protein complexes caused the two retarded mobility shifts. Four xeroderma pigmentosum complementation group E (XPE) fibroblast strains derived from unrelated Japanese families were not deficient in such a DNA damage recognition/binding protein because of the normal complex formation and gel mobility shifts, although we confirmed the reported lack of the protein in the European XPE (XP2RO and XP3RO) cells. Thus, the absence of this binding protein is not always commonly observed in all the XPE strains,more » and the partially repair-deficient and intermediately UV-hypersensitive phenotype of XPE cells are much similar whether or not they lack the protein.« less

  3. Demonstrating Interactions of Transcription Factors with DNA by Electrophoretic Mobility Shift Assay.

    PubMed

    Yousaf, Nasim; Gould, David

    2017-01-01

    Confirming the binding of a transcription factor with a particular DNA sequence may be important in characterizing interactions with a synthetic promoter. Electrophoretic mobility shift assay is a powerful approach to demonstrate the specific DNA sequence that is bound by a transcription factor and also to confirm the specific transcription factor involved in the interaction. In this chapter we describe a method we have successfully used to demonstrate interactions of endogenous transcription factors with sequences derived from endogenous and synthetic promoters.

  4. Electrophoretic mobility shift scanning using an automated infrared DNA sequencer.

    PubMed

    Sano, M; Ohyama, A; Takase, K; Yamamoto, M; Machida, M

    2001-11-01

    Electrophoretic mobility shift assay (EMSA) is widely used in the study of sequence-specific DNA-binding proteins, including transcription factors and mismatch binding proteins. We have established a non-radioisotope-based protocol for EMSA that features an automated DNA sequencer with an infrared fluorescent dye (IRDye) detection unit. Our modification of the elec- trophoresis unit, which includes cooling the gel plates with a reduced well-to-read length, has made it possible to detect shifted bands within 1 h. Further, we have developed a rapid ligation-based method for generating IRDye-labeled probes with an approximately 60% cost reduction. This method has the advantages of real-time scanning, stability of labeled probes, and better safety associated with nonradioactive methods of detection. Analysis of a promoter from an industrially important filamentous fungus, Aspergillus oryzae, in a prototype experiment revealed that the method we describe has potential for use in systematic scanning and identification of the functionally important elements to which cellular factors bind in a sequence-specific manner.

  5. Rapid and Simple Detection of Hot Spot Point Mutations of Epidermal Growth Factor Receptor, BRAF, and NRAS in Cancers Using the Loop-Hybrid Mobility Shift Assay

    PubMed Central

    Matsukuma, Shoichi; Yoshihara, Mitsuyo; Kasai, Fumio; Kato, Akinori; Yoshida, Akira; Akaike, Makoto; Kobayashi, Osamu; Nakayama, Haruhiko; Sakuma, Yuji; Yoshida, Tsutomu; Kameda, Yoichi; Tsuchiya, Eiju; Miyagi, Yohei

    2006-01-01

    A simple and rapid method to detect the epidermal growth factor receptor hot spot mutation L858R in lung adenocarcinoma was developed based on principles similar to the universal heteroduplex generator technology. A single-stranded oligonucleotide with an internal deletion was used to generate heteroduplexes (loop-hybrids) bearing a loop in the complementary strand derived from the polymerase chain reaction product of the normal or mutant allele. By placing deletion in the oligonucleotide adjacent to the mutational site, difference in electrophoretic mobility between loop-hybrids with normal and mutated DNA was distinguishable in a native polyacrylamide gel. The method was also modified to detect in-frame deletion mutations of epidermal growth factor receptor in lung adenocarcinomas. In addition, the method was adapted to detect hot spot mutations in the B-type Raf kinase (BRAF) at V600 and in a Ras-oncogene (NRAS) at Q61, the mutations commonly found in thyroid carcinomas. Our mutation detection system, designated the loop-hybrid mobility shift assay was sensitive enough to detect mutant DNA comprising 7.5% of the total DNA. As a simple and straightforward mutation detection technique, loop-hybrid mobility shift assay may be useful for the molecular diagnosis of certain types of clinical cancers. Other applications are also discussed. PMID:16931592

  6. An Optimized Protocol for Electrophoretic Mobility Shift Assay Using Infrared Fluorescent Dye-labeled Oligonucleotides.

    PubMed

    Hsieh, Yi-Wen; Alqadah, Amel; Chuang, Chiou-Fen

    2016-11-29

    Electrophoretic Mobility Shift Assays (EMSA) are an instrumental tool to characterize the interactions between proteins and their target DNA sequences. Radioactivity has been the predominant method of DNA labeling in EMSAs. However, recent advances in fluorescent dyes and scanning methods have prompted the use of fluorescent tagging of DNA as an alternative to radioactivity for the advantages of easy handling, saving time, reducing cost, and improving safety. We have recently used fluorescent EMSA (fEMSA) to successfully address an important biological question. Our fEMSA analysis provides mechanistic insight into the effect of a missense mutation, G73E, in the highly conserved HMG transcription factor SOX-2 on olfactory neuron type diversification. We found that mutant SOX-2 G73E protein alters specific DNA binding activity, thereby causing olfactory neuron identity transformation. Here, we present an optimized and cost-effective step-by-step protocol for fEMSA using infrared fluorescent dye-labeled oligonucleotides containing the LIM-4/SOX-2 adjacent target sites and purified SOX-2 proteins (WT and mutant SOX-2 G73E proteins) as a biological example.

  7. Gel shift analysis of the empA promoter region in Vibrio anguillarum.

    PubMed

    Denkin, Steven M; Sekaric, Pedja; Nelson, David R

    2004-10-29

    The induction of metalloprotease encoded by empA in Vibrio anguillarum occurs at high cell density in salmon intestinal mucus. Previously we have shown that there are significant differences in empA expression in two strains of V. anguillarum, M93Sm and NB10. It is hypothesized that differences in empA regulation are due to differences in binding of regulatory elements. Two strains of V. anguillarum, M93Sm and NB10, were examined and compared for the presence of DNA regulatory proteins that bind to and control the empA promoter region. Gel mobility shift assays, using a digoxigenin (DIG)-labeled oligomer containing a lux box-like element and the promoter for empA, were done to demonstrate the presence of a DNA-binding protein. Protein extracts from NB10 cells incubated in Luria Bertani broth + 2% NaCl (LB20), nine salts solution + 200 microg/ml mucus (NSSM), 3M (marine minimal medium), or NSS resulted in a gel mobility shift. No gel mobility shift was seen when protein extracts from either LB20- or NSSM-grown M93Sm cells were mixed with the DIG-labeled empA oligomer. The azocasein assay detected protease activity in all incubation conditions for NB10 culture supernatants. In contrast, protease activity was detected in M93Sm culture supernatants only when incubated in NSSM. Since the luxR homologue in V. anguillarum, vanT, has been cloned, sequenced, and shown to be required for protease activity, we wanted to determine if vanT mutants of NB10 exhibit the same gel shift observed in the wild-type. Site-directed mutagenesis was used to create vanT mutants in V. anguillarum M93Sm and NB10 to test whether VanT is involved with the gel mobility shift. Both vanT mutants, M02 and NB02, did not produce protease activity in any conditions. However, protein extracts from NB02 incubated in each condition still exhibited a gel shift when mixed with the DIG-labeled empA oligomer. The data demonstrate that protein extracts of V. anguillarum NB10 cells contain a protein that binds to a 50 bp oligomer containing the empA promoter-lux box-like region. NB10 cells express empA during stationary phase in all growth conditions. The DNA binding protein is not present in M93Sm extracts. M93Sm cells express protease activity only when incubated at high cell density in fish gastrointestinal mucus. The gel shift observed with NB10 cells is not due to VanT binding. The data also suggest that the DNA binding protein is responsible for the less restrictive expression of empA in NB10 compared to M93Sm.

  8. Electrophoretic mobility shift assay reveals a novel recognition sequence for Setaria italica NAC protein.

    PubMed

    Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S; Prasad, Manoj

    2011-10-01

    The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncations of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T][T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein.

  9. Electrophoretic mobility shift assay reveals a novel recognition sequence for Setaria italica NAC protein

    PubMed Central

    Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S

    2011-01-01

    The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncation of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T] [T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein. PMID:21918373

  10. Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

    PubMed Central

    Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

    2012-01-01

    DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

  11. Gel shift analysis of the empA promoter region in Vibrio anguillarum

    PubMed Central

    Denkin, Steven M; Sekaric, Pedja; Nelson, David R

    2004-01-01

    Background The induction of metalloprotease encoded by empA in Vibrio anguillarum occurs at high cell density in salmon intestinal mucus. Previously we have shown that there are significant differences in empA expression in two strains of V. anguillarum, M93Sm and NB10. It is hypothesized that differences in empA regulation are due to differences in binding of regulatory elements. Results Two strains of V. anguillarum, M93Sm and NB10, were examined and compared for the presence of DNA regulatory proteins that bind to and control the empA promoter region. Gel mobility shift assays, using a digoxigenin (DIG)-labeled oligomer containing a lux box-like element and the promoter for empA, were done to demonstrate the presence of a DNA-binding protein. Protein extracts from NB10 cells incubated in Luria Bertani broth + 2% NaCl (LB20), nine salts solution + 200 μg/ml mucus (NSSM), 3M (marine minimal medium), or NSS resulted in a gel mobility shift. No gel mobility shift was seen when protein extracts from either LB20- or NSSM-grown M93Sm cells were mixed with the DIG-labeled empA oligomer. The azocasein assay detected protease activity in all incubation conditions for NB10 culture supernatants. In contrast, protease activity was detected in M93Sm culture supernatants only when incubated in NSSM. Since the luxR homologue in V. anguillarum, vanT, has been cloned, sequenced, and shown to be required for protease activity, we wanted to determine if vanT mutants of NB10 exhibit the same gel shift observed in the wild-type. Site-directed mutagenesis was used to create vanT mutants in V. anguillarum M93Sm and NB10 to test whether VanT is involved with the gel mobility shift. Both vanT mutants, M02 and NB02, did not produce protease activity in any conditions. However, protein extracts from NB02 incubated in each condition still exhibited a gel shift when mixed with the DIG-labeled empA oligomer. Conclusions The data demonstrate that protein extracts of V. anguillarum NB10 cells contain a protein that binds to a 50 bp oligomer containing the empA promoter-lux box-like region. NB10 cells express empA during stationary phase in all growth conditions. The DNA binding protein is not present in M93Sm extracts. M93Sm cells express protease activity only when incubated at high cell density in fish gastrointestinal mucus. The gel shift observed with NB10 cells is not due to VanT binding. The data also suggest that the DNA binding protein is responsible for the less restrictive expression of empA in NB10 compared to M93Sm. PMID:15516264

  12. DNA-HMGB1 interaction: The nuclear aggregates of polyamine mediation.

    PubMed

    Iacomino, Giuseppe; Picariello, Gianluca; Sbrana, Francesca; Raiteri, Roberto; D'Agostino, Luciano

    2016-10-01

    Nuclear aggregates of polyamines (NAPs) are supramolecular compounds generated by the self-assembly of protonated nuclear polyamines (spermine, spermidine and putrescine) and phosphate ions. In the presence of genomic DNA, the hierarchical process of self-structuring ultimately produces nanotube-like polymers that envelop the double helix. Because of their modular nature and their aggregation-disaggregation dynamics, NAPs confer plasticity and flexibility to DNA. Through the disposition of charges, NAPs also enable a bidirectional stream of information between the genome and interacting moieties. High mobility group (HMG) B1 is a non-histone chromosomal protein that binds to DNA and that influences multiple nuclear processes. Because genomic DNA binds to either NAPs or HMGB1 protein, we explored the ability of in vitro self-assembled NAPs (ivNAPs) to mediate the DNA-HMGB1 interaction. To this end, we structured DNA-NAPs-HMGB1 and DNA-HMGB1-NAPs ternary complexes in vitro through opportune sequential incubations. Mobility shift electrophoresis and atomic force microscopy showed that the DNA-ivNAPs-HGMB1 complex had conformational assets supposedly more suitable those of the DNA-HGMB1-ivNAPs to comply with the physiological and functional requirements of DNA. Our findings indicated that ivNAPs act as mediators of the DNA-HMGB1 interaction. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. The Staphylococcus aureus group II biotin protein ligase BirA is an effective regulator of biotin operon transcription and requires the DNA binding domain for full enzymatic activity.

    PubMed

    Henke, Sarah K; Cronan, John E

    2016-11-01

    Group II biotin protein ligases (BPLs) are characterized by the presence of an N-terminal DNA binding domain that functions in transcriptional regulation of the genes of biotin biosynthesis and transport. The Staphylococcus aureus Group II BPL which is called BirA has been reported to bind an imperfect inverted repeat located upstream of the biotin synthesis operon. DNA binding by other Group II BPLs requires dimerization of the protein which is triggered by synthesis of biotinoyl-AMP (biotinoyl-adenylate), the intermediate in the ligation of biotin to its cognate target proteins. However, the S. aureus BirA was reported to dimerize and bind DNA in the absence of biotin or biotinoyl-AMP (Soares da Costa et al. (2014) Mol Microbiol 91: 110-120). These in vitro results argued that the protein would be unable to respond to the levels of biotin or acceptor proteins and thus would lack the regulatory properties of the other characterized BirA proteins. We tested the regulatory function of the protein using an in vivo model system and examined its DNA binding properties in vitro using electrophoretic mobility shift and fluorescence anisotropy analyses. We report that the S. aureus BirA is an effective regulator of biotin operon transcription and that the prior data can be attributed to artifacts of mobility shift analyses. We also report that deletion of the DNA binding domain of the S. aureus BirA results in loss of virtually all of its ligation activity. © 2016 John Wiley & Sons Ltd.

  14. Manufacturing of a novel double-function ssDNA aptamer for sensitive diagnosis and efficient neutralization of SEA.

    PubMed

    Sedighian, Hamid; Halabian, Raheleh; Amani, Jafar; Heiat, Mohammad; Taheri, Ramezan Ali; Imani Fooladi, Abbas Ali

    2018-05-01

    Staphylococcal enterotoxin A (SEA) is an enterotoxin produced mainly by Staphylococcus aureus. In recent years, it has become the most prevalent compound for staphylococcal food poisoning (SFP) around the world. In this study, we isolate new dual-function single-stranded DNA (ssDNA) aptamers by using some new methods, such as the Taguchi method, by focusing on the detection and neutralization of SEA enterotoxin in food and clinical samples. For the asymmetric polymerase chain reaction (PCR) optimization of each round of systematic evolution of ligands by exponential enrichment (SELEX), we use Taguchi L9 orthogonal arrays, and the aptamer mobility shift assay (AMSA) is used for initial evaluation of the protein-DNA interactions on the last SELEX round. In our investigation the dissociation constant (K D ) value and the limit of detection (LOD) of the candidate aptamer were found to be 8.5 ± 0.91 of nM and 5 ng/ml using surface plasmon resonance (SPR). In the current study, the Taguchi and mobility shift assay methods were innovatively harnessed to improve the selection process and evaluate the protein-aptamer interactions. To the best of our knowledge, this is the first report on employing these two methods in aptamer technology especially against bacterial toxin. Copyright © 2018 Elsevier Inc. All rights reserved.

  15. Understanding gas phase modifier interactions in rapid analysis by Differential Mobility-Tandem Mass Spectrometry

    PubMed Central

    Kafle, Amol; Coy, Stephen L.; Wong, Bryan M.; Fornace, Albert J.; Glick, James J.; Vouros, Paul

    2014-01-01

    A systematic study involving the use and optimization of gas phase modifiers in quantitative differential mobility- mass spectrometry (DMS-MS) analysis is presented using mucleoside-adduct biomarkers of DNA damage as an important reference point for analysis in complex matrices. Commonly used polar protic and polar aprotic modifiers have been screened for use against two deoxyguanosine adducts of DNA: N-(deoxyguanosin-8-yl)-4-aminobiphenyl (dG-C8-4-ABP) and N-(deoxyguanosin-8-y1)-2-amino-l-methyl-6-phenylimidazo[4,5-b]pyridine (dG-C8-PhIP). Particular attention was paid to compensation voltage (CoV) shifts, peak shapes and product ion signal intensities while optimizing the DMS-MS conditions. The optimized parameters were then applied to rapid quantitation of the DNA adducts in calf thymus DNA. After a protein precipitation step, adduct levels corresponding to less than one modification in 106 normal DNA bases were detected using the DMS-MS platform. Based on DMS fundamentals and ab-initio thermochemical results we interpret the complexity of DMS modifier responses in terms of thermal activation and the development of solvent shells. At very high bulk gas temperature, modifier dipole moment may be the most important factor in cluster formation and cluster geometry in mobility differences, but at lower temperatures multi-neutral clusters are important and less predictable. This work provides a useful protocol for targeted DNA adduct quantitation and a basis for future work on DMS modifier effects. PMID:24452298

  16. Correlation of MFOLD-predicted DNA secondary structures with separation patterns obtained by capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis.

    PubMed

    Glavac, Damjan; Potocnik, Uros; Podpecnik, Darja; Zizek, Teofil; Smerkolj, Sava; Ravnik-Glavac, Metka

    2002-04-01

    We have studied 57 different mutations within three beta-globin gene promoter fragments with sizes 52 bp, 77 bp, and 193 bp by fluorescent capillary electrophoresis CE-SSCP analysis. For each mutation and wild type, energetically most-favorable predicted secondary structures were calculated for sense and antisense strands using the MFOLD DNA-folding algorithm in order to investigate if any correlation exists between predicted DNA structures and actual CE migration time shifts. The overall CE-SSCP detection rate was 100% for all mutations in three studied DNA fragments. For shorter 52 bp and 77 bp DNA fragments we obtained a positive correlation between the migration time shifts and difference in free energy values of predicted secondary structures at all temperatures. For longer 193 bp beta-globin gene fragments with 46 mutations MFOLD predicted different secondary structures for 89% of mutated strands at 25 degrees C and 40 degrees C. However, the magnitude of the mobility shifts did not necessarily correlate with their secondary structures and free energy values except for the sense strand at 40 degrees C where this correlation was statistically significant (r = 0.312, p = 0.033). Results of this study provided more direct insight into the mechanism of CE-SSCP and showed that MFOLD prediction could be helpful in making decisions about the running temperatures and in prediction of CE-SSCP data patterns, especially for shorter (50-100 bp) DNA fragments. Copyright 2002 Wiley-Liss, Inc.

  17. Heat shock of Escherichia coli increases binding of dnaK (the hsp70 homolog) to polypeptides by promoting its phosphorylation.

    PubMed Central

    Sherman, M Y; Goldberg, A L

    1993-01-01

    The "molecular chaperone", dnaK, is induced in Escherichia coli upon heat shock and promotes ATP-dependent refolding or degradation of damaged proteins. When cells were grown at 25 degrees C and disrupted, a small fraction of the dnaK bound to affinity columns containing unfolded polypeptides (e.g., a fusion protein named CRAG or casein) and could be dissociated by ATP-Mg2+. After shifting cells to 42 degrees C for 30 min, up to 5-fold more dnaK bound to these columns than after growth at 25 degrees C. This enhanced binding capacity was reversed after shifting cells back to 25 degrees C. It resulted from a covalent modification, which decreases dnaK's electrophoretic mobility and isoelectric point. This modification appears to be phosphorylation; after treatment with phosphatases, the ATP-eluted dnaK resembled the predominant form in electrophoretic and binding properties. In addition, after incubating cells with [32P]orthophosphate at 42 degrees C, the 32P-labeled dnaK bound quantitatively to the CRAG column, unlike the nonlabeled protein. Thus, the phosphorylated dnaK is a special form of the chaperone with enhanced affinity for unfolded proteins. Its accumulation at high temperatures may account for dnaK's function as the "cellular thermometer." Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 Fig. 7 PMID:8378342

  18. The region of CQQQKPQRRP of PGC-1{alpha} interacts with the DNA-binding complex of FXR/RXR{alpha}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kanaya, Eiko; Jingami, Hisato

    2006-04-14

    PGC-1{alpha} co-activates transcription by several nuclear receptors. To study the interaction among PGC-1{alpha}, RXR{alpha}/FXR, and DNA, we performed electrophoresis mobility shift assays. The RXR{alpha}/FXR proteins specifically bound to DNA containing the IR-1 sequence in the absence of ligand. When the fusion protein of GST-PGC-1{alpha} was added to the mixture of RXR{alpha}/FXR/DNA, the ligand-influenced retardation of the mobility was observed. The ligand for RXR{alpha} (9-cis-retinoic acid) was necessary for this retardation, whereas, the ligand for FXR, chenodeoxycholic acid, barely had an effect. The results obtained using truncated PGC-1{alpha} proteins suggested that two regions are necessary for PGC-1{alpha} to interact with themore » DNA-binding complex of RXR{alpha}/FXR. One is the region of the second leucine-rich motif, and the other is that of the amino acid sequence CQQQKPQRRP, present between the second and third leucine-rich motifs. The results obtained with the SPQSS mutation for KPQRR suggested that the basic amino acids are important for the interaction.« less

  19. EMSA Analysis of DNA Binding By Rgg Proteins

    PubMed Central

    LaSarre, Breah; Federle, Michael J.

    2016-01-01

    In bacteria, interaction of various proteins with DNA is essential for the regulation of specific target gene expression. Electrophoretic mobility shift assay (EMSA) is an in vitro approach allowing for the visualization of these protein-DNA interactions. Rgg proteins comprise a family of transcriptional regulators widespread among the Firmicutes. Some of these proteins function independently to regulate target gene expression, while others have now been demonstrated to function as effectors of cell-to-cell communication, having regulatory activities that are modulated via direct interaction with small signaling peptides. EMSA analysis can be used to assess DNA binding of either type of Rgg protein. EMSA analysis of Rgg protein activity has facilitated in vitro confirmation of regulatory targets, identification of precise DNA binding sites via DNA probe mutagenesis, and characterization of the mechanism by which some cognate signaling peptides modulate Rgg protein function (e.g. interruption of DNA-binding in some cases). PMID:27430004

  20. EMSA Analysis of DNA Binding By Rgg Proteins.

    PubMed

    LaSarre, Breah; Federle, Michael J

    2013-08-20

    In bacteria, interaction of various proteins with DNA is essential for the regulation of specific target gene expression. Electrophoretic mobility shift assay (EMSA) is an in vitro approach allowing for the visualization of these protein-DNA interactions. Rgg proteins comprise a family of transcriptional regulators widespread among the Firmicutes. Some of these proteins function independently to regulate target gene expression, while others have now been demonstrated to function as effectors of cell-to-cell communication, having regulatory activities that are modulated via direct interaction with small signaling peptides. EMSA analysis can be used to assess DNA binding of either type of Rgg protein. EMSA analysis of Rgg protein activity has facilitated in vitro confirmation of regulatory targets, identification of precise DNA binding sites via DNA probe mutagenesis, and characterization of the mechanism by which some cognate signaling peptides modulate Rgg protein function ( e.g. interruption of DNA-binding in some cases).

  1. Cytotoxicity, genotoxicity and oxidative stress of malachite green on the kidney and gill cell lines of freshwater air breathing fish Channa striata.

    PubMed

    Majeed, S Abdul; Nambi, K S N; Taju, G; Vimal, S; Venkatesan, C; Hameed, A S Sahul

    2014-12-01

    The cytotoxicity, genotoxicity and oxidative stress of malachite green (MG) was investigated using the fish Channa striata kidney (CSK) and Channa striata gill (CSG) cell lines. Five concentrations ranging from 0.001 to 10 μg mL(-1) were tested in three independent experiments. Cytotoxicity was assessed by 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, Rhodamine 123 and Alamar Blue. The mitochondrial changes and apoptosis of MG-exposed cells were observed by Rhodamine 123 and acridine orange/ethidium bromide (AO/EB) staining, respectively. In vitro potential DNA damaging effect of MG was tested using comet assay. Mitochondrial damage, apoptosis and DNA fragmentation increased in a concentration-dependent manner. Additionally, DNA electrophoretic mobility experiments were carried out to study the binding effect of MG to double-stranded DNA (dsDNA) of cells. DNA shift mobility experiments showed that MG is capable of strongly binding to linear dsDNA causing its degradation. Biochemical parameters such as lipid peroxidation (MDA), catalase (CAT) activity and reduced glutathione (GSH) levels were evaluated after exposure to MG. In CSK and CSG cell lines exposed to MG for 48 h, a significant increase in lipid peroxidation, which might be associated with decreased levels of reduced glutathione and catalase activity in these cell lines (p < 0.001), was observed.

  2. Fis protein induced λF-DNA bending observed by single-pair fluorescence resonance energy transfer

    NASA Astrophysics Data System (ADS)

    Chi-Cheng, Fu; Wunshain, Fann; Yuan Hanna, S.

    2006-03-01

    Fis, a site-specific DNA binding protein, regulates many biological processes including recombination, transcription, and replication in E.coli. Fis induced DNA bending plays an important role in regulating these functions and bending angle range from ˜50 to 95 dependent on the DNA sequence. For instance, the average bending angle of λF-DNA (26 bp, 8.8nm long, contained λF binding site on the center) measured by gel mobility shift assays was ˜ 94 . But the traditional method cannot provide information about the dynamics and the angle distribution. In this study, λF-DNA was labeled with donor (Alexa Fluor 546) and acceptor (Alexa Fluor 647) dyes on its two 5' ends and the donor-acceptor distances were measured using single-pair fluorescence resonance energy transfer (sp-FRET) with and without the present of Fis protein. Combing with structure information of Fis-DNA complex, the sp-FRET results are used to estimate the protein induced DNA bending angle distribution and dynamics.

  3. The crystal structure of the Sox4 HMG domain-DNA complex suggests a mechanism for positional interdependence in DNA recognition.

    PubMed

    Jauch, Ralf; Ng, Calista K L; Narasimhan, Kamesh; Kolatkar, Prasanna R

    2012-04-01

    It has recently been proposed that the sequence preferences of DNA-binding TFs (transcription factors) can be well described by models that include the positional interdependence of the nucleotides of the target sites. Such binding models allow for multiple motifs to be invoked, such as principal and secondary motifs differing at two or more nucleotide positions. However, the structural mechanisms underlying the accommodation of such variant motifs by TFs remain elusive. In the present study we examine the crystal structure of the HMG (high-mobility group) domain of Sox4 [Sry (sex-determining region on the Y chromosome)-related HMG box 4] bound to DNA. By comparing this structure with previously solved structures of Sox17 and Sox2, we observed subtle conformational differences at the DNA-binding interface. Furthermore, using quantitative electrophoretic mobility-shift assays we validated the positional interdependence of two nucleotides and the presence of a secondary Sox motif in the affinity landscape of Sox4. These results suggest that a concerted rearrangement of two interface amino acids enables Sox4 to accommodate primary and secondary motifs. The structural adaptations lead to altered dinucleotide preferences that mutually reinforce each other. These analyses underline the complexity of the DNA recognition by TFs and provide an experimental validation for the conceptual framework of positional interdependence and secondary binding motifs.

  4. Differential Targeting of Unpaired Bases within Duplex DNA by the Natural Compound Clerocidin: A Valuable Tool to Dissect DNA Secondary Structure

    PubMed Central

    Nadai, Matteo; Palù, Giorgio; Palumbo, Manlio; Richter, Sara N.

    2012-01-01

    Non-canonical DNA structures have been postulated to mediate protein-nucleic acid interactions and to function as intermediates in the generation of frame-shift mutations when errors in DNA replication occur, which result in a variety of diseases and cancers. Compounds capable of binding to non-canonical DNA conformations may thus have significant diagnostic and therapeutic potential. Clerocidin is a natural diterpenoid which has been shown to selectively react with single-stranded bases without targeting the double helix. Here we performed a comprehensive analysis on several non-canonical DNA secondary structures, namely mismatches, nicks, bulges, hairpins, with sequence variations in both the single-stranded region and the double-stranded flanking segment. By analysis of clerocidin reactivity, we were able to identify the exposed reactive residues which provided information on both the secondary structure and the accessibility of the non-paired sites. Mismatches longer than 1 base were necessary to be reached by clerocidin reactive groups, while 1-base nicks were promptly targeted by clerocidin; in hairpins, clerocidin reactivity increased with the length of the hairpin loop, while, interestingly, reactivity towards bulges reached a maximum in 3-base-long bulges and declined in longer bulges. Electrophoretic mobility shift analysis demonstrated that bulges longer than 3 bases (i.e. 5- and 7-bases) folded or stacked on the duplex region therefore being less accessible by the compound. Clerocidin thus represents a new valuable diagnostic tool to dissect DNA secondary structures. PMID:23285245

  5. Differential targeting of unpaired bases within duplex DNA by the natural compound clerocidin: a valuable tool to dissect DNA secondary structure.

    PubMed

    Nadai, Matteo; Palù, Giorgio; Palumbo, Manlio; Richter, Sara N

    2012-01-01

    Non-canonical DNA structures have been postulated to mediate protein-nucleic acid interactions and to function as intermediates in the generation of frame-shift mutations when errors in DNA replication occur, which result in a variety of diseases and cancers. Compounds capable of binding to non-canonical DNA conformations may thus have significant diagnostic and therapeutic potential. Clerocidin is a natural diterpenoid which has been shown to selectively react with single-stranded bases without targeting the double helix. Here we performed a comprehensive analysis on several non-canonical DNA secondary structures, namely mismatches, nicks, bulges, hairpins, with sequence variations in both the single-stranded region and the double-stranded flanking segment. By analysis of clerocidin reactivity, we were able to identify the exposed reactive residues which provided information on both the secondary structure and the accessibility of the non-paired sites. Mismatches longer than 1 base were necessary to be reached by clerocidin reactive groups, while 1-base nicks were promptly targeted by clerocidin; in hairpins, clerocidin reactivity increased with the length of the hairpin loop, while, interestingly, reactivity towards bulges reached a maximum in 3-base-long bulges and declined in longer bulges. Electrophoretic mobility shift analysis demonstrated that bulges longer than 3 bases (i.e. 5- and 7-bases) folded or stacked on the duplex region therefore being less accessible by the compound. Clerocidin thus represents a new valuable diagnostic tool to dissect DNA secondary structures.

  6. A plasmid containing the human metallothionein II gene can function as an antibody-assisted electrophoretic biosensor for heavy metals.

    PubMed

    Wooten, Dennis C; Starr, Clarise R; Lyon, Wanda J

    2016-01-01

    Different forms of heavy metals affect biochemical systems in characteristic ways that cannot be detected with typical metal analysis methods like atomic absorption spectrometry. Further, using living systems to analyze interaction of heavy metals with biochemical systems can be laborious and unreliable. To generate a reliable easy-to-use biologically-based biosensor system, the entire human metallothionein-II (MT-II) gene was incorporated into a plasmid (pUC57-MT) easily replicated in Escherichia coli. In this system, a commercial polyclonal antibody raised against human metal-responsive transcription factor-1 protein (MTF-1 protein) could modify the electrophoretic migration patterns (i.e. cause specific decreases in agarose gel electrophoretic mobility) of the plasmid in the presence or absence of heavy metals other than zinc (Zn). In the study here, heavy metals, MTF-1 protein, and polyclonal anti-MTF-1 antibody were used to assess pUC57-MT plasmid antibody-assisted electrophoretic mobility. Anti-MTF-1 antibody bound both MTF-1 protein and pUC57-MT plasmid in a non-competitive fashion such that it could be used to differentiate specific heavy metal binding. The results showed that antibody-inhibited plasmid migration was heavy metal level-dependent. Zinc caused a unique mobility shift pattern opposite to that of other metals tested, i.e. Zn blocked the antibody ability to inhibit plasmid migration, despite a greatly increased affinity for DNA by the antibody when Zn was present. The Zn effect was reversed/modified by adding MTF-1 protein. Additionally, antibody inhibition of plasmid mobility was resistant to heat pre-treatment and trypsinization, indicating absence of residual DNA extraction-resistant bacterial DNA binding proteins. DNA binding by anti-DNA antibodies may be commonly enhanced by xenobiotic heavy metals and elevated levels of Zn, thus making them potentially effective tools for assessment of heavy metal bioavailability in aqueous solutions and fluid obtained from metal implant sites.

  7. Genomic Instability and Breast Cancer

    DTIC Science & Technology

    2011-06-01

    Survival Assay—Atotal of 1 103 cells were seeded onto a 60-mm dish in triplicate. Twenty-four hours after seeding, cells were irradiated by using a JL...ShepherdMark I-68A 137Cs- irradiator at indicated doses and incubated for 14 days. Result- ing colonies were fixed and stainedwithCoomassie Blue. Num...antibodies, cell culture, transfection and siRNAs, DNA substrates protein purification in insect cells, electrophoretic mobility shift assay and the ATPase

  8. The monomeric form of Neisseria DNA mimic protein DMP19 prevents DNA from binding to the histone-like HU protein

    PubMed Central

    Ko, Tzu-Ping; Liao, Yi-Ting; Hsu, Kai-Cheng

    2017-01-01

    DNA mimicry is a direct and effective strategy by which the mimic competes with DNA for the DNA binding sites on other proteins. Until now, only about a dozen proteins have been shown to function via this strategy, including the DNA mimic protein DMP19 from Neisseria meningitides. We have shown previously that DMP19 dimer prevents the operator DNA from binding to the transcription factor NHTF. Here, we provide new evidence that DMP19 monomer can also interact with the Neisseria nucleoid-associated protein HU. Using BS3 crosslinking, gel filtration and isothermal titration calorimetry assays, we found that DMP19 uses its monomeric form to interact with the Neisseria HU dimer. Crosslinking conjugated mass spectrometry was used to investigate the binding mode of DMP19 monomer and HU dimer. Finally, an electrophoretic mobility shift assay (EMSA) confirmed that the DNA binding affinity of HU is affected by DMP19. These results showed that DMP19 is bifunctional in the gene regulation of Neisseria through its variable oligomeric forms. PMID:29220372

  9. Mismatch repair factor MSH2-MSH3 binds and alters the conformation of branched DNA structures predicted to form during genetic recombination.

    PubMed

    Surtees, Jennifer A; Alani, Eric

    2006-07-14

    Genetic studies in Saccharomyces cerevisiae predict that the mismatch repair (MMR) factor MSH2-MSH3 binds and stabilizes branched recombination intermediates that form during single strand annealing and gene conversion. To test this model, we constructed a series of DNA substrates that are predicted to form during these recombination events. We show in an electrophoretic mobility shift assay that S. cerevisiae MSH2-MSH3 specifically binds branched DNA substrates containing 3' single-stranded DNA and that ATP stimulates its release from these substrates. Chemical footprinting analyses indicate that MSH2-MSH3 specifically binds at the double-strand/single-strand junction of branched substrates, alters its conformation and opens up the junction. Therefore, MSH2-MSH3 binding to its substrates creates a unique nucleoprotein structure that may signal downstream steps in repair that include interactions with MMR and nucleotide excision repair factors.

  10. Understanding Gas Phase Modifier Interactions in Rapid Analysis by Differential Mobility-Tandem Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Kafle, Amol; Coy, Stephen L.; Wong, Bryan M.; Fornace, Albert J.; Glick, James J.; Vouros, Paul

    2014-07-01

    A systematic study involving the use and optimization of gas-phase modifiers in quantitative differential mobility-mass spectrometry (DMS-MS) analysis is presented using nucleoside-adduct biomarkers of DNA damage as an important reference point for analysis in complex matrices. Commonly used polar protic and polar aprotic modifiers have been screened for use against two deoxyguanosine adducts of DNA: N-(deoxyguanosin-8-yl)-4-aminobiphenyl (dG-C8-4-ABP) and N-(deoxyguanosin-8-y1)-2-amino-l-methyl-6-phenylimidazo[4,5-b]pyridine (dG-C8-PhIP). Particular attention was paid to compensation voltage (CoV) shifts, peak shapes, and product ion signal intensities while optimizing the DMS-MS conditions. The optimized parameters were then applied to rapid quantitation of the DNA adducts in calf thymus DNA. After a protein precipitation step, adduct levels corresponding to less than one modification in 106 normal DNA bases were detected using the DMS-MS platform. Based on DMS fundamentals and ab initio thermochemical results, we interpret the complexity of DMS modifier responses in terms of thermal activation and the development of solvent shells. At very high bulk gas temperature, modifier dipole moment may be the most important factor in cluster formation and cluster geometry, but at lower temperatures, multi-neutral clusters are important and less predictable. This work provides a useful protocol for targeted DNA adduct quantitation and a basis for future work on DMS modifier effects.

  11. RPA and XPA interaction with DNA structures mimicking intermediates of the late stages in nucleotide excision repair

    PubMed Central

    Maltseva, Ekaterina A.

    2018-01-01

    Replication protein A (RPA) and the xeroderma pigmentosum group A (XPA) protein are indispensable for both pathways of nucleotide excision repair (NER). Here we analyze the interaction of RPA and XPA with DNA containing a flap and different size gaps that imitate intermediates of the late NER stages. Using gel mobility shift assays, we found that RPA affinity for DNA decreased when DNA contained both extended gap and similar sized flap in comparison with gapped-DNA structure. Moreover, crosslinking experiments with the flap-gap DNA revealed that RPA interacts mainly with the ssDNA platform within the long gap and contacts flap in DNA with a short gap. XPA exhibits higher affinity for bubble-DNA structures than to flap-gap-containing DNA. Protein titration analysis showed that formation of the RPA-XPA-DNA ternary complex depends on the protein concentration ratio and these proteins can function as independent players or in tandem. Using fluorescently-labelled RPA, direct interaction of this protein with XPA was detected and characterized quantitatively. The data obtained allow us to suggest that XPA can be involved in the post-incision NER stages via its interaction with RPA. PMID:29320546

  12. RPA and XPA interaction with DNA structures mimicking intermediates of the late stages in nucleotide excision repair.

    PubMed

    Krasikova, Yuliya S; Rechkunova, Nadejda I; Maltseva, Ekaterina A; Lavrik, Olga I

    2018-01-01

    Replication protein A (RPA) and the xeroderma pigmentosum group A (XPA) protein are indispensable for both pathways of nucleotide excision repair (NER). Here we analyze the interaction of RPA and XPA with DNA containing a flap and different size gaps that imitate intermediates of the late NER stages. Using gel mobility shift assays, we found that RPA affinity for DNA decreased when DNA contained both extended gap and similar sized flap in comparison with gapped-DNA structure. Moreover, crosslinking experiments with the flap-gap DNA revealed that RPA interacts mainly with the ssDNA platform within the long gap and contacts flap in DNA with a short gap. XPA exhibits higher affinity for bubble-DNA structures than to flap-gap-containing DNA. Protein titration analysis showed that formation of the RPA-XPA-DNA ternary complex depends on the protein concentration ratio and these proteins can function as independent players or in tandem. Using fluorescently-labelled RPA, direct interaction of this protein with XPA was detected and characterized quantitatively. The data obtained allow us to suggest that XPA can be involved in the post-incision NER stages via its interaction with RPA.

  13. New insight into multifunctional role of peroxiredoxin family protein: Determination of DNA protection properties of bacterioferritin comigratory protein under hyperthermal and oxidative stresses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Sangmin, E-mail: taeinlee2011@kangwon.ac.kr; Chung, Jeong Min; Yun, Hyung Joong

    Bacterioferritin comigratory protein (BCP) is a monomeric conformer acting as a putative thiol-dependent bacterial peroxidase, however molecular basis of DNA-protection via DNA-binding has not been clearly understood. In this study, we characterized the DNA binding properties of BCP using various lengths and differently shaped architectures of DNA. An electrophoretic mobility shift assay and electron microscopy analysis showed that recombinant TkBCP bound to DNA of a circular shape (double-stranded DNA and single-stranded DNA) and a linear shape (16–1000 bp) as well as various architectures of DNA. In addition, DNA protection experiments indicated that TkBCP can protect DNA against hyperthermal and oxidative stressmore » by removing highly reactive oxygen species (ROS) or by protecting DNA from thermal degradation. Based on these results, we suggest that TkBCP is a multi-functional DNA-binding protein which has DNA chaperon and antioxidant functions. - Highlights: • Bacterioferritin comigratory protein (BCP) protects DNA from oxidative stress by reducing ROS. • TkBCP does not only scavenge ROS, but also protect DNA from hyperthermal stress. • BCP potentially adopts the multi-functional role in DNA binding activities and anti-oxidant functions.« less

  14. Affinity of yeast nucleotide excision repair factor 2, consisting of the Rad4 and Rad23 proteins, for ultraviolet damaged DNA.

    PubMed

    Guzder, S N; Sung, P; Prakash, L; Prakash, S

    1998-11-20

    Saccharomyces cerevisiae Rad4 and Rad23 proteins are required for the nucleotide excision repair of UV light-damaged DNA. Previous studies have indicated that these two DNA repair proteins are associated in a tight complex, which we refer to as nucleotide excision repair factor 2 (NEF2). In a reconstituted nucleotide excision repair reaction, incision of UV-damaged DNA is dependent on NEF2, indicating a role of NEF2 in an early step of the repair process. NEF2 does not, however, possess an enzymatic activity, and its function in the damage-specific incision reaction has not yet been defined. Here we use a DNA mobility shift assay to demonstrate that NEF2 binds specifically to UV-damaged DNA. Elimination of cyclobutane pyrimidine dimers from the UV-damaged DNA by enzymatic photoreactivation has little effect on the affinity of NEF2 for the DNA, suggesting that NEF2 recognizes the 6-(1, 2)-dihydro-2-oxo-4-pyrimidinyl)-5-methyl-2,4-(1H,3H)-pyrimidinedione photoproducts in the damaged DNA. These results highlight the intricacy of the DNA damage-demarcation reaction during nucleotide excision repair in eukaryotes.

  15. G-Quadruplex Induction by the Hairpin Pyrrole-Imidazole Polyamide Dimer.

    PubMed

    Obata, Shunsuke; Asamitsu, Sefan; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

    2018-02-06

    The G-quadruplex (G4) is one type of higher-order structure of nucleic acids and is thought to play important roles in various biological events such as regulation of transcription and inhibition of DNA replication. Pyrrole-imidazole polyamides (PIPs) are programmable small molecules that can sequence-specifically bind with high affinity to the minor groove of double-stranded DNA (dsDNA). Herein, we designed head-to-head hairpin PIP dimers and their target dsDNA in a model G4-forming sequence. Using an electrophoresis mobility shift assay and transcription arrest assay, we found that PIP dimers could induce the structural change to G4 DNA from dsDNA through the recognition by one PIP dimer molecule of two duplex-binding sites flanking both ends of the G4-forming sequence. This induction ability was dependent on linker length. This is the first study to induce G4 formation using PIPs, which are known to be dsDNA binders. The results reported here suggest that selective G4 induction in native sequences may be achieved with PIP dimers by applying the same design strategy.

  16. Triple helix-forming oligonucleotide corresponding to the polypyrimidine sequence in the rat alpha 1(I) collagen promoter specifically inhibits factor binding and transcription.

    PubMed

    Kovacs, A; Kandala, J C; Weber, K T; Guntaka, R V

    1996-01-19

    Type I and III fibrillar collagens are the major structural proteins of the extracellular matrix found in various organs including the myocardium. Abnormal and progressive accumulation of fibrillar type I collagen in the interstitial spaces compromises organ function and therefore, the study of transcriptional regulation of this gene and specific targeting of its expression is of major interest. Transient transfection of adult cardiac fibroblasts indicate that the polypurine-polypyrimidine sequence of alpha 1(I) collagen promoter between nucleotides - 200 and -140 represents an overall positive regulatory element. DNase I footprinting and electrophoretic mobility shift assays suggest that multiple factors bind to different elements of this promoter region. We further demonstrate that the unique polypyrimidine sequence between -172 and -138 of the promoter represents a suitable target for a single-stranded polypurine oligonucleotide (TFO) to form a triple helix DNA structure. Modified electrophoretic mobility shift assays show that this TFO specifically inhibits the protein-DNA interaction within the target region. In vitro transcription assays and transient transfection experiments demonstrate that the transcriptional activity of the promoter is inhibited by this oligonucleotide. We propose that TFOs represent a therapeutic potential to specifically influence the expression of alpha 1(I) collagen gene in various disease states where abnormal type I collagen accumulation is known to occur.

  17. Holes influence the mutation spectrum of human mitochondrial DNA

    NASA Astrophysics Data System (ADS)

    Villagran, Martha; Miller, John

    Mutations drive evolution and disease, showing highly non-random patterns of variant frequency vs. nucleotide position. We use computational DNA hole spectroscopy [M.Y. Suarez-Villagran & J.H. Miller, Sci. Rep. 5, 13571 (2015)] to reveal sites of enhanced hole probability in selected regions of human mitochondrial DNA. A hole is a mobile site of positive charge created when an electron is removed, for example by radiation or contact with a mutagenic agent. The hole spectra are quantum mechanically computed using a two-stranded tight binding model of DNA. We observe significant correlation between spectra of hole probabilities and of genetic variation frequencies from the MITOMAP database. These results suggest that hole-enhanced mutation mechanisms exert a substantial, perhaps dominant, influence on mutation patterns in DNA. One example is where a trapped hole induces a hydrogen bond shift, known as tautomerization, which then triggers a base-pair mismatch during replication. Our results deepen overall understanding of sequence specific mutation rates, encompassing both hotspots and cold spots, which drive molecular evolution.

  18. Insertion and deletion mutations in the dinucleotide repeat region of the Norrie disease gene in patients with advanced retinopathy of prematurity.

    PubMed

    Hiraoka, M; Berinstein, D M; Trese, M T; Shastry, B S

    2001-01-01

    Retinopathy of prematurity (ROP) is a leading cause of blindness in premature children. It is a multifactorial disorder which causes fibrovascular tissue changes that affect the retina in low birth-weight and short gestational age infants. To determine the prevalence of Norrie disease (ND) gene mutations, clinical examination and molecular genetic analyses were performed in 100 pre-term babies of different ethnic backgrounds who developed advanced ROP. The leukocyte DNA was extracted, amplified by the polymerase chain reaction (PCR), and analyzed by single-strand conformation polymorphism (SSCP), G/T and C/A scanning, and by DNA sequencing. All three exons, including splice sites and the 3'-untranslated region, were screened. Of the 100 patients analyzed, 2 patients with advanced ROP showed a mobility shift in the DNA. In 1 patient, this mobility shift was caused by the insertion of an additional 12-bp CT repeat in exon 1, and in the second patient, there was a 14-bp deletion in the same exon of the ND gene, as evidenced by direct sequencing of the amplified products. Similar analyses of exons 2 and 3 and the 3'-untranslated region failed to detect additional mutations in the gene. None of the 130 normal, unrelated controls revealed similar changes. Taking into account the above results, as well as those of other studies, it appears that the ND gene mutations can account for 3% of cases of advanced ROP. Although the ND gene is not frequently involved in advanced ROP, the present large-scale study further supports the hypothesis that genetic influences may play an important role in the development of severe ROP in some premature infants.

  19. Crystal Structure of the GRAS Domain of SCARECROW-LIKE7 in Oryza sativa

    PubMed Central

    Li, Shengping; Zhao, Yanhe; Zhao, Zheng; Wu, Xiuling; Sun, Lifang; Liu, Qingsong; Wu, Yunkun

    2016-01-01

    GRAS proteins belong to a plant-specific protein family with many members and play essential roles in plant growth and development, functioning primarily in transcriptional regulation. Proteins in the family are minimally defined as containing the conserved GRAS domain. Here, we determined the structure of the GRAS domain of Os-SCL7 from rice (Oryza sativa) to 1.82 Å. The structure includes cap and core subdomains and elucidates the features of the conserved GRAS LRI, VHIID, LRII, PFYRE, and SAW motifs. The structure is a dimer, with a clear groove to accommodate double-stranded DNA. Docking a DNA segment into the groove to generate an Os-SCL7/DNA complex provides insight into the DNA binding mechanism of GRAS proteins. Furthermore, the in vitro DNA binding property of Os-SCL7 and model-defined recognition residues are assessed by electrophoretic mobility shift analysis and mutagenesis assays. These studies reveal the structure and preliminary DNA interaction mechanisms of GRAS proteins and open the door to in-depth investigation and understanding of the individual pathways in which they play important roles. PMID:27081181

  20. Role of Human DNA Polymerase and its Accessory Proteins in Breast Cancer.

    DTIC Science & Technology

    1999-09-01

    by W estern blotting. Total mRNA was isolated from the Ac.in mRNA cells using RNA-STAT 60 (Tel- Test .t .... Inc) and subjected to Northern blotting...p53 expression on the activity of the POLDI promoter were tested using the 1.8 kb-luciferase POLD1 promoter construct in SAOS-2 cells which do not...activity. In preliminary studies using gel mobility shift assays we tested ds oligonucleotides corresponding to all five sites (P1-P5). The results

  1. Hypoxia Inducible Factor 1 (HIF1) Activation in U87 Glioma Cells Involves a Decrease in Reactive Oxygen Species Production and Protein Kinase C Activity

    DTIC Science & Technology

    1998-06-29

    Curcumin DFX Desferrioxamine DNA Deoxyribonucleic Acid DPI Diphenyliodinium DPPD Diphenylphenylenediamine DTH Dithionite EMSA Electrophoretic mobility shift... neuroprotective effects (Fern et al., 1996, Morishita et al., 1 1997). The identification of a hypoxia inducible transcription factor known as HIF-1 (Semenza...derived EPO in the eNS neuroprotective response to hypoxia. Cloning of the human and murine EPO gene, the availability of a convenient EPa producing

  2. Identification of transactivation-responsive DNA-binding protein 43 (TARDBP43; TDP-43) as a novel factor for TNF-α expression upon lipopolysaccharide stimulation in human monocytes.

    PubMed

    Murata, H; Hattori, T; Maeda, H; Takashiba, S; Takigawa, M; Kido, J; Nagata, T

    2015-08-01

    Tumor necrosis factor alpha (TNF-α) is a major cytokine implicated in various inflammatory diseases. The nature of the nuclear factors associated with human TNF-α gene regulation is not well elucidated. We previously identified a novel region located from -550 to -487 in human TNF-α promoter that did not contain the reported binding sites for nuclear factor kappa B (NF-κB) but showed lipopolysaccharide (LPS)-induced transcriptional activity. The purpose of this study is to identify novel factors that bind to the promoter region and regulate TNF-α expression. To identify DNA-binding proteins that bound to the target region of TNF-α promoter, a cDNA library from LPS-stimulated human monocytic cell line THP-1 was screened using a yeast one-hybrid system. Cellular localizations of the DNA-binding protein in the cells were examined by subcellular immunocytochemistry. Nuclear amounts of the protein in LPS-stimulated THP-1 cells were identified by western blot analysis. Expression of mRNA of the protein in the cells was quantified by real-time polymerase chain reaction. Electrophoretic mobility shift assays were performed to confirm the DNA-binding profile. Overexpression of the protein and knockdown of the gene were also performed to investigate the role for TNF-α expression. Several candidates were identified from the cDNA library and transactivation-responsive DNA-binding protein 43 (TARDBP43; TDP-43) was focused on. Western blot analysis revealed that nuclear TDP-43 protein was increased in the LPS-stimulated THP-1 cells. Expression of TDP-43 mRNA was already enhanced before TNF-α induction by LPS. Electrophoretic mobility shift assay analysis showed that nuclear extracts obtained by overexpressing FLAG-tagged TDP-43 bound to the -550 to -487 TNF-α promoter fragments. Overexpression of TDP-43 in THP-1 cells resulted in an increase of TNF-α expression. Knockdown of TDP-43 in THP-1 cells downregulated TNF-α expression. We identified TDP-43 as one of the novel TNF-α factors and found that it bound to the LPS-responsive element in the TNF-α promoter to increase TNF-α expression. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  3. Ku counteracts mobilization of PARP1 and MRN in chromatin damaged with DNA double-strand breaks

    PubMed Central

    Cheng, Qiao; Barboule, Nadia; Frit, Philippe; Gomez, Dennis; Bombarde, Oriane; Couderc, Bettina; Ren, Guo-Sheng; Salles, Bernard; Calsou, Patrick

    2011-01-01

    In mammalian cells, the main pathway for DNA double-strand breaks (DSBs) repair is classical non-homologous end joining (C-NHEJ). An alternative or back-up NHEJ (B-NHEJ) pathway has emerged which operates preferentially under C-NHEJ defective conditions. Although B-NHEJ appears particularly relevant to genomic instability associated with cancer, its components and regulation are still largely unknown. To get insights into this pathway, we have knocked-down Ku, the main contributor to C-NHEJ. Thus, models of human cell lines have been engineered in which the expression of Ku70/80 heterodimer can be significantly lowered by the conditional induction of a shRNA against Ku70. On Ku reduction in cells, resulting NHEJ competent protein extracts showed a shift from C- to B-NHEJ that could be reversed by addition of purified Ku protein. Using a cellular fractionation protocol after treatment with a strong DSBs inducer followed by western blotting or immunostaining, we established that, among C-NHEJ factors, Ku is the main counteracting factor against mobilization of PARP1 and the MRN complex to damaged chromatin. In addition, Ku limits PAR synthesis and single-stranded DNA production in response to DSBs. These data support the involvement of PARP1 and the MRN proteins in the B-NHEJ route for the repair of DNA DSBs. PMID:21880593

  4. High mobility group box (HMGB) proteins of Plasmodium falciparum: DNA binding proteins with pro-inflammatory activity.

    PubMed

    Kumar, Krishan; Singal, Ankita; Rizvi, M Moshahid A; Chauhan, Virander S

    2008-06-01

    High mobility group box chromosomal protein 1 (HMGB1), known as an abundant, non-histone architectural chromosomal protein, is highly conserved across different species. Homologues of HMGB1 were identified and cloned from malaria parasite, Plasmodium falciparum. Sequence analyses showed that the P. falciparum HMGB1 (PfHMGB1) exhibits 45, 23 and 18%, while PfHMGB2 shares 42, 21 and 17% homology with Saccharomyces cerevisiae, human and mouse HMG box proteins respectively. Parasite PfHMGB1and PfHMGB2 proteins contain one HMG Box domain similar to B-Box of mammalian HMGB1. Electrophoretic Mobility Shift Assay (EMSA) showed that recombinant PfHMGB1 and PfHMGB2 bind to DNA. Immunofluorescence Assay using specific antibodies revealed that these proteins are expressed abundantly in the ring stage nuclei. Significant levels of PfHMGB1 and PfHMGB2 were also present in the parasite cytosol at trophozoite and schizont stages. Both, PfHMGB1 and PfHMGB2 were found to be potent inducers of pro-inflammatory cytokines such as TNFalpha from mouse peritoneal macrophages as analyzed by both reverse transcription PCR and by ELISA. These results suggest that secreted PfHMGB1 and PfHMGB2 may be responsible for eliciting/ triggering host inflammatory immune responses associated with malaria infection.

  5. Determination of DNA Binding Behavior of FoxA1 Constructs Using a Gold Nanoparticle-Based High Throughput Assay

    NASA Astrophysics Data System (ADS)

    Aung, Khin Moh Moh; Lim, Michelle Gek Liang; Hong, Shuzhen; Cheung, Edwin; Su, Xiaodi

    Forkhead box protein 1 (FoxA1) is a member of the forkhead family of winged-helix transcription factors. It plays crucial roles in the development and differentiation of multiple organs and in the regulation of estrogen-stimulated genes. In this study, in order to determine the regions of FoxA1 necessary for efficient Deoxyribonucleic Acid (DNA) binding, we cloned, expressed and purified a series of FoxA1 constructs that contain either the DNA Binding Domain (DBD), the Transcription Activation Domain (TAD), or both. We determined the DNA binding behavior of these constructs using traditional electrophoretic mobility shift assay (EMSA) and a recently developed gold nanoparticles (AuNPs)-based fast screening method. We conclude that just the DBD region alone is not sufficient for protein-DNA binding activity. Amino acids flanking the upstream of the DBD region are required for maximal DNA binding activity. Through this study, we have also further validated the AuNPs assay for its generality and expanded the existing protocol for comparing the DNA binding behavior of multiple proteins of different charge properties and molecular weights.

  6. Kinetics of interaction of Cotton Leaf Curl Kokhran Virus-Dabawali (CLCuKV-Dab) coat protein and its mutants with ssDNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Priyadarshini, C.G. Poornima; Savithri, H.S., E-mail: bchss@biochem.iisc.ernet.i

    Gemini viral assembly and transport of viral DNA into nucleus for replication, essentially involve DNA-coat protein interactions. The kinetics of interaction of Cotton Leaf Curl Kokhran Virus-Dabawali recombinant coat protein (rCP) with DNA was studied by electrophoretic mobility shift assay (EMSA) and surface plasmon resonance (SPR). The rCP interacted with ssDNA with a K{sub A}, of 2.6 +- 0.29 x 10{sup 8} M{sup -1} in a sequence non-specific manner. The CP has a conserved C2H2 type zinc finger motif composed of residues C68, C72, H81 and H85. Mutation of these residues to alanine resulted in reduced binding to DNA probes.more » The H85A mutant rCP showed the least binding with approximately 756 fold loss in the association rate and a three order magnitude decrease in the binding affinity as compared to rCP. The CP-DNA interactions via the zinc finger motif could play a crucial role in virus assembly and in nuclear transport.« less

  7. The orphan receptor hepatic nuclear factor 4 functions as a transcriptional activator for tissue-specific and hypoxia-specific erythropoietin gene expression and is antagonized by EAR3/COUP-TF1.

    PubMed

    Galson, D L; Tsuchiya, T; Tendler, D S; Huang, L E; Ren, Y; Ogura, T; Bunn, H F

    1995-04-01

    The erythropoietin (Epo) gene is regulated by hypoxia-inducible cis-acting elements in the promoter and in a 3' enhancer, both of which contain consensus hexanucleotide hormone receptor response elements which are important for function. A group of 11 orphan nuclear receptors, transcribed and translated in vitro, were screened by the electrophoretic mobility shift assay. Of these, hepatic nuclear factor 4 (HNF-4), TR2-11, ROR alpha 1, and EAR3/COUP-TF1 bound specifically to the response elements in the Epo promoter and enhancer and, except for ROR alpha 1, formed DNA-protein complexes that had mobilities similar to those observed in nuclear extracts of the Epo-producing cell line Hep3B. Moreover, both anti-HNF-4 and anti-COUP antibodies were able to supershift complexes in Hep3B nuclear extracts. Like Epo, HNF-4 is expressed in kidney, liver, and Hep3B cells but not in HeLa cells. Transfection of a plasmid expressing HNF-4 into HeLa cells enabled an eightfold increase in the hypoxic induction of a luciferase reporter construct which contains the minimal Epo enhancer and Epo promoter, provided that the nuclear hormone receptor consensus DNA elements in both the promoter and the enhancer were intact. The augmentation by HNF-4 in HeLa cells could be abrogated by cotransfection with HNF-4 delta C, which retains the DNA binding domain of HNF-4 but lacks the C-terminal activation domain. Moreover, the hypoxia-induced expression of the endogenous Epo gene was significantly inhibited in Hep3B cells stably transfected with HNF-4 delta C. On the other hand, cotransfection of EAR3/COUP-TF1 and the Epo reporter either with HNF-4 into HeLa cells or alone into Hep3B cells suppressed the hypoxia induction of the Epo reporter. These electrophoretic mobility shift assay and functional experiments indicate that HNF-4 plays a critical positive role in the tissue-specific and hypoxia-inducible expression of the Epo gene, whereas the COUP family has a negative modulatory role.

  8. The T4 Phage DNA Mimic Protein Arn Inhibits the DNA Binding Activity of the Bacterial Histone-like Protein H-NS*

    PubMed Central

    Ho, Chun-Han; Wang, Hao-Ching; Ko, Tzu-Ping; Chang, Yuan-Chih; Wang, Andrew H.-J.

    2014-01-01

    The T4 phage protein Arn (Anti restriction nuclease) was identified as an inhibitor of the restriction enzyme McrBC. However, until now its molecular mechanism remained unclear. In the present study we used structural approaches to investigate biological properties of Arn. A structural analysis of Arn revealed that its shape and negative charge distribution are similar to dsDNA, suggesting that this protein could act as a DNA mimic. In a subsequent proteomic analysis, we found that the bacterial histone-like protein H-NS interacts with Arn, implying a new function. An electrophoretic mobility shift assay showed that Arn prevents H-NS from binding to the Escherichia coli hns and T4 p8.1 promoters. In vitro gene expression and electron microscopy analyses also indicated that Arn counteracts the gene-silencing effect of H-NS on a reporter gene. Because McrBC and H-NS both participate in the host defense system, our findings suggest that T4 Arn might knock down these mechanisms using its DNA mimicking properties. PMID:25118281

  9. Fanconi Anemia Complementation Group A (FANCA) Protein Has Intrinsic Affinity for Nucleic Acids with Preference for Single-stranded Forms*

    PubMed Central

    Yuan, Fenghua; Qian, Liangyue; Zhao, Xinliang; Liu, Jesse Y.; Song, Limin; D'Urso, Gennaro; Jain, Chaitanya; Zhang, Yanbin

    2012-01-01

    The Fanconi anemia complementation group A (FANCA) gene is one of 15 disease-causing genes and has been found to be mutated in ∼60% of Fanconi anemia patients. Using purified protein, we report that human FANCA has intrinsic affinity for nucleic acids. FANCA binds to both single-stranded (ssDNA) and double-stranded (dsDNA) DNAs; however, its affinity for ssDNA is significantly higher than for dsDNA in an electrophoretic mobility shift assay. FANCA also binds to RNA with an intriguingly higher affinity than its DNA counterpart. FANCA requires a certain length of nucleic acids for optimal binding. Using DNA and RNA ladders, we determined that the minimum number of nucleotides required for FANCA recognition is ∼30 for both DNA and RNA. By testing the affinity between FANCA and a variety of DNA structures, we found that a 5′-flap or 5′-tail on DNA facilitates its interaction with FANCA. A patient-derived FANCA truncation mutant (Q772X) has diminished affinity for both DNA and RNA. In contrast, the complementing C-terminal fragment of Q772X, C772–1455, retains the differentiated nucleic acid-binding activity (RNA > ssDNA > dsDNA), indicating that the nucleic acid-binding domain of FANCA is located primarily at its C terminus, where most disease-causing mutations are found. PMID:22194614

  10. Fanconi anemia complementation group A (FANCA) protein has intrinsic affinity for nucleic acids with preference for single-stranded forms.

    PubMed

    Yuan, Fenghua; Qian, Liangyue; Zhao, Xinliang; Liu, Jesse Y; Song, Limin; D'Urso, Gennaro; Jain, Chaitanya; Zhang, Yanbin

    2012-02-10

    The Fanconi anemia complementation group A (FANCA) gene is one of 15 disease-causing genes and has been found to be mutated in ∼60% of Fanconi anemia patients. Using purified protein, we report that human FANCA has intrinsic affinity for nucleic acids. FANCA binds to both single-stranded (ssDNA) and double-stranded (dsDNA) DNAs; however, its affinity for ssDNA is significantly higher than for dsDNA in an electrophoretic mobility shift assay. FANCA also binds to RNA with an intriguingly higher affinity than its DNA counterpart. FANCA requires a certain length of nucleic acids for optimal binding. Using DNA and RNA ladders, we determined that the minimum number of nucleotides required for FANCA recognition is ∼30 for both DNA and RNA. By testing the affinity between FANCA and a variety of DNA structures, we found that a 5'-flap or 5'-tail on DNA facilitates its interaction with FANCA. A patient-derived FANCA truncation mutant (Q772X) has diminished affinity for both DNA and RNA. In contrast, the complementing C-terminal fragment of Q772X, C772-1455, retains the differentiated nucleic acid-binding activity (RNA > ssDNA > dsDNA), indicating that the nucleic acid-binding domain of FANCA is located primarily at its C terminus, where most disease-causing mutations are found.

  11. Functions of the high mobility group protein, Abf2p, in mitochondrial DNA segregation, recombination and copy number in Saccharomyces cerevisiae.

    PubMed

    Zelenaya-Troitskaya, O; Newman, S M; Okamoto, K; Perlman, P S; Butow, R A

    1998-04-01

    Previous studies have established that the mitochondrial high mobility group (HMG) protein, Abf2p, of Saccharomyces cerevisiae influences the stability of wild-type (rho+) mitochondrial DNA (mtDNA) and plays an important role in mtDNA organization. Here we report new functions for Abf2p in mtDNA transactions. We find that in homozygous deltaabf2 crosses, the pattern of sorting of mtDNA and mitochondrial matrix protein is altered, and mtDNA recombination is suppressed relative to homozygous ABF2 crosses. Although Abf2p is known to be required for the maintenance of mtDNA in rho+ cells growing on rich dextrose medium, we find that it is not required for the maintenance of mtDNA in p cells grown on the same medium. The content of both rho+ and rho- mtDNAs is increased in cells by 50-150% by moderate (two- to threefold) increases in the ABF2 copy number, suggesting that Abf2p plays a role in mtDNA copy control. Overproduction of Abf2p by > or = 10-fold from an ABF2 gene placed under control of the GAL1 promoter, however, leads to a rapid loss of rho+ mtDNA and a quantitative conversion of rho+ cells to petites within two to four generations after a shift of the culture from glucose to galactose medium. Overexpression of Abf2p in rho- cells also leads to a loss of mtDNA, but at a slower rate than was observed for rho+ cells. The mtDNA instability phenotype is related to the DNA-binding properties of Abf2p because a mutant Abf2p that contains mutations in residues of both HMG box domains known to affect DNA binding in vitro, and that binds poorly to mtDNA in vivo, complements deltaabf2 cells only weakly and greatly lessens the effect of overproduction on mtDNA instability. In vivo binding was assessed by colocalization to mtDNA of fusions between mutant or wild-type Abf2p and green fluorescent protein. These findings are discussed in the context of a model relating mtDNA copy number control and stability to mtDNA recombination.

  12. Synthesis of the human insulin gene. Part II. Further improvements in the modified phosphotriester method and the synthesis of seventeen deoxyribooligonucleotide fragments constituting human insulin chains B and mini-CDNA.

    PubMed Central

    Sung, W L; Hsiung, H M; Brousseau, R; Michniewicz, J; Wu, R; Narang, S A

    1979-01-01

    The purification of protected deoxyribooligonucleotides containing phosphotriester internucleotidic linkages has been improved by developing a deactivated silica gel chromatographic technique. The efficiency of this technique as applied in the modified phosphotriester approach has been demonstrated in the rapid synthesis of seventeen pure fragments constituting the sequence of human insulin B and mini-C DNA. The sequence of each oligomer was confirmed by the two-dimensional mobility shift method of fingerprinting. Images PMID:230464

  13. Characterization of monomeric DNA-binding protein Histone H1 in Leishmania braziliensis.

    PubMed

    Carmelo, Emma; González, Gloria; Cruz, Teresa; Osuna, Antonio; Hernández, Mariano; Valladares, Basilio

    2011-08-01

    Histone H1 in Leishmania presents relevant differences compared to higher eukaryote counterparts, such as the lack of a DNA-binding central globular domain. Despite that, it is apparently fully functional since its differential expression levels have been related to changes in chromatin condensation and infectivity, among other features. The localization and the aggregation state of L. braziliensis H1 has been determined by immunolocalization, mass spectrometry, cross-linking and electrophoretic mobility shift assays. Analysis of H1 sequences from the Leishmania Genome Database revealed that our protein is included in a very divergent group of histones H1 that is present only in L. braziliensis. An antibody raised against recombinant L. braziliensis H1 recognized specifically that protein by immunoblot in L. braziliensis extracts, but not in other Leishmania species, a consequence of the sequence divergences observed among Leishmania species. Mass spectrometry analysis and in vitro DNA-binding experiments have also proven that L. braziliensis H1 is monomeric in solution, but oligomerizes upon binding to DNA. Finally, despite the lack of a globular domain, L. braziliensis H1 is able to form complexes with DNA in vitro, with higher affinity for supercoiled compared to linear DNA.

  14. The Drosophila telomere-capping protein Verrocchio binds single-stranded DNA and protects telomeres from DNA damage response

    PubMed Central

    Cicconi, Alessandro; Micheli, Emanuela; Vernì, Fiammetta; Jackson, Alison; Gradilla, Ana Citlali; Cipressa, Francesca; Raimondo, Domenico; Bosso, Giuseppe; Wakefield, James G.; Ciapponi, Laura; Cenci, Giovanni; Gatti, Maurizio

    2017-01-01

    Abstract Drosophila telomeres are sequence-independent structures maintained by transposition to chromosome ends of three specialized retroelements rather than by telomerase activity. Fly telomeres are protected by the terminin complex that includes the HOAP, HipHop, Moi and Ver proteins. These are fast evolving, non-conserved proteins that localize and function exclusively at telomeres, protecting them from fusion events. We have previously suggested that terminin is the functional analogue of shelterin, the multi-protein complex that protects human telomeres. Here, we use electrophoretic mobility shift assay (EMSA) and atomic force microscopy (AFM) to show that Ver preferentially binds single-stranded DNA (ssDNA) with no sequence specificity. We also show that Moi and Ver form a complex in vivo. Although these two proteins are mutually dependent for their localization at telomeres, Moi neither binds ssDNA nor facilitates Ver binding to ssDNA. Consistent with these results, we found that Ver-depleted telomeres form RPA and γH2AX foci, like the human telomeres lacking the ssDNA-binding POT1 protein. Collectively, our findings suggest that Drosophila telomeres possess a ssDNA overhang like the other eukaryotes, and that the terminin complex is architecturally and functionally similar to shelterin. PMID:27940556

  15. Isolation and characterization of target sequences of the chicken CdxA homeobox gene.

    PubMed Central

    Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A

    1993-01-01

    The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943

  16. Exploring the read-write genome: mobile DNA and mammalian adaptation.

    PubMed

    Shapiro, James A

    2017-02-01

    The read-write genome idea predicts that mobile DNA elements will act in evolution to generate adaptive changes in organismal DNA. This prediction was examined in the context of mammalian adaptations involving regulatory non-coding RNAs, viviparous reproduction, early embryonic and stem cell development, the nervous system, and innate immunity. The evidence shows that mobile elements have played specific and sometimes major roles in mammalian adaptive evolution by generating regulatory sites in the DNA and providing interaction motifs in non-coding RNA. Endogenous retroviruses and retrotransposons have been the predominant mobile elements in mammalian adaptive evolution, with the notable exception of bats, where DNA transposons are the major agents of RW genome inscriptions. A few examples of independent but convergent exaptation of mobile DNA elements for similar regulatory rewiring functions are noted.

  17. Exposure to non-ionizing electromagnetic fields emitted from mobile phones induced DNA damage in human ear canal hair follicle cells.

    PubMed

    Akdag, Mehmet; Dasdag, Suleyman; Canturk, Fazile; Akdag, Mehmet Zulkuf

    2018-01-01

    The aim of this study was to investigate effect of radiofrequency radiation (RFR) emitted from mobile phones on DNA damage in follicle cells of hair in the ear canal. The study was carried out on 56 men (age range: 30-60 years old)in four treatment groups with n = 14 in each group. The groups were defined as follows: people who did not use a mobile phone (Control), people use mobile phones for 0-30 min/day (second group), people use mobile phones for 30-60 min/day (third group) and people use mobile phones for more than 60 min/day (fourth group). Ear canal hair follicle cells taken from the subjects were analyzed by the Comet Assay to determine DNA damages. The Comet Assay parameters measured were head length, tail length, comet length, percentage of head DNA, tail DNA percentage, tail moment, and Olive tail moment. Results of the study showed that DNA damage indicators were higher in the RFR exposure groups than in the control subjects. In addition, DNA damage increased with the daily duration of exposure. In conclusion, RFR emitted from mobile phones has a potential to produce DNA damage in follicle cells of hair in the ear canal. Therefore, mobile phone users have to pay more attention when using wireless phones.

  18. Characterization of a DNA damage-recognition protein mammalian cells that binds specifically to intrastrand d(GpG) and d(ApG) DNA adducts of the anticancer drug cisplatin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Donahue, B.A.; Augot, M.; Bellon, S.F.

    1990-06-19

    A factor has been identified in extracts from human HeLa and hamster V79 cells that retards the electrophoretic mobility of several DNA restriction fragments modified with the antitumor drug cis-diamminedichloroplatinum(II) (cisplatin). Binding of the factor to cisplatin-modified DNA was sensitive to pretreatment with proteinase K, establishing that the factor is a protein. Gel mobility shifts were observed with probes containing as few as seven Pt atoms per kilobase of duplex DNA. By competition experiments the dissociation constant, K{sub d}, of the protein from cisplatin-modified DNA was estimated to be (1-20) {times} 10{sup {minus}10} M. Protein binding is selective for DNAmore » modified with cisplatin, (Pt(en)Cl{sub 2}) (en, ethylenediamine), and (Pt(dach)Cl{sub 2}) (dach, 1,2-diaminocyclohexane) but not with chemotherapeutically inactive trans-diamminedichloroplatinum(II) or monofunctionally coordinating (Pt(dien)Cl)Cl (dien, diethylenetriamine) complexes. The protein binds specifically to 1,2-intrastrand d(GpG) and d(ApG) cross-links formed by cisplatin. The apparent molecular weight of the protein is 91,000, as determined by sucrose gradient centrifugation of a preparation partially purified by ammonium sulfate fractionation. Binding of the protein to platinum-modified DNA does not require cofactors but is sensitive to treatment with 5 mM MnCl{sub 2}, CdCl{sub 2}, CoCl{sub 2}, or ZnCl{sub 2} and with 1 mM HgCl{sub 2}. This protein, alone or in conjunction with other cellular constituents, could be of general importance in the initial stages of processing of mammalian DNA damaged by cisplatin or other genotoxic agents and may belong to a wider class of such cellular damage-recognition proteins (DRPs).« less

  19. Analysis of LexA binding sites and transcriptomics in response to genotoxic stress in Leptospira interrogans.

    PubMed

    Schons-Fonseca, Luciane; da Silva, Josefa B; Milanez, Juliana S; Domingos, Renan H; Smith, Janet L; Nakaya, Helder I; Grossman, Alan D; Ho, Paulo L; da Costa, Renata M A

    2016-02-18

    We determined the effects of DNA damage caused by ultraviolet radiation on gene expression in Leptospira interrogans using DNA microarrays. These data were integrated with DNA binding in vivo of LexA1, a regulator of the DNA damage response, assessed by chromatin immunoprecipitation and massively parallel DNA sequencing (ChIP-seq). In response to DNA damage, Leptospira induced expression of genes involved in DNA metabolism, in mobile genetic elements and defective prophages. The DNA repair genes involved in removal of photo-damage (e.g. nucleotide excision repair uvrABC, recombinases recBCD and resolvases ruvABC) were not induced. Genes involved in various metabolic pathways were down regulated, including genes involved in cell growth, RNA metabolism and the tricarboxylic acid cycle. From ChIP-seq data, we observed 24 LexA1 binding sites located throughout chromosome 1 and one binding site in chromosome 2. Expression of many, but not all, genes near those sites was increased following DNA damage. Binding sites were found as far as 550 bp upstream from the start codon, or 1 kb into the coding sequence. Our findings indicate that there is a shift in gene expression following DNA damage that represses genes involved in cell growth and virulence, and induces genes involved in mutagenesis and recombination. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. B-DNA to Z-DNA structural transitions in the SV40 enhancer: stabilization of Z-DNA in negatively supercoiled DNA minicircles

    NASA Technical Reports Server (NTRS)

    Gruskin, E. A.; Rich, A.

    1993-01-01

    During replication and transcription, the SV40 control region is subjected to significant levels of DNA unwinding. There are three, alternating purine-pyrimidine tracts within this region that can adopt the Z-DNA conformation in response to negative superhelix density: a single copy of ACACACAT and two copies of ATGCATGC. Since the control region is essential for both efficient transcription and replication, B-DNA to Z-DNA transitions in these vital sequence tracts may have significant biological consequences. We have synthesized DNA minicircles to detect B-DNA to Z-DNA transitions in the SV40 enhancer, and to determine the negative superhelix density required to stabilize the Z-DNA. A variety of DNA sequences, including the entire SV40 enhancer and the two segments of the enhancer with alternating purine-pyrimidine tracts, were incorporated into topologically relaxed minicircles. Negative supercoils were generated, and the resulting topoisomers were resolved by electrophoresis. Using an anti-Z-DNA Fab and an electrophoretic mobility shift assay, Z-DNA was detected in the enhancer-containing minicircles at a superhelix density of -0.05. Fab saturation binding experiments demonstrated that three, independent Z-DNA tracts were stabilized in the supercoiled minicircles. Two other minicircles, each with one of the two alternating purine-pyrimidine tracts, also contained single Z-DNA sites. These results confirm the identities of the Z-DNA-forming sequences within the control region. Moreover, the B-DNA to Z-DNA transitions were detected at superhelix densities observed during normal replication and transcription processes in the SV40 life cycle.

  1. Functional Role of Extranucleosomal DNA and the Entry Site of the Nucleosome in Chromatin Remodeling by ISW2

    PubMed Central

    Zofall, Martin; Persinger, Jim; Bartholomew, Blaine

    2004-01-01

    A minimal amount of extranucleosomal DNA was required for nucleosome mobilization by ISW2 as shown by using a photochemical histone mapping approach to analyze nucleosome movement on a set of nucleosomes with varied lengths of extranucleosomal DNA. ISW2 was ineffective in repositioning or mobilizing nucleosomes with ≤20 bp of extranucleosomal DNA. In addition, ISW2 was able to slide nucleosomes to within only 10 to 13 bp of the edge of DNA fragments. The nucleosome mobilization was promoted by extranucleosomal single-stranded DNA with modest strand preference. Gaps (10 bp) just inside the nucleosome and in the extranucleosomal DNA showed that the transfer of torsional strain (twist) into the nucleosomal DNA region was not required for mobilizing nucleosomes. However, indications are that the extranucleosomal DNA immediately adjacent to the nucleosome has an important role in the initial stage of nucleosome movement by ISW2. PMID:15509805

  2. [Blocking 1800 MHz mobile phone radiation-induced reactive oxygen species production and DNA damage in lens epithelial cells by noise magnetic fields].

    PubMed

    Wu, Wei; Yao, Ke; Wang, Kai-jun; Lu, De-qiang; He, Ji-liang; Xu, Li-hong; Sun, Wen-jun

    2008-01-01

    To investigate whether the exposure to the electromagnetic noise can block reactive oxygen species (ROS) production and DNA damage of lens epithelial cells induced by 1800 MHz mobile phone radiation. The DCFH-DA method and comet assay were used respectively to detect the intracellular ROS and DNA damage of cultured human lens epithelial cells induced by 4 W/kg 1800 MHz mobile phone radiation or/and 2 muT electromagnetic noise for 24 h intermittently. 1800 MHz mobile phone radiation at 4 W/kg for 24 h increased intracellular ROS and DNA damage significantly (P<0.05). However, the ROS level and DNA damage of mobile phone radiation plus noise group were not significant enhanced (P>0.05) as compared to sham exposure group. Electromagnetic noise can block intracellular ROS production and DNA damage of human lens epithelial cells induced by 1800 MHz mobile phone radiation.

  3. DNA cross-linking by dehydromonocrotaline lacks apparent base sequence preference.

    PubMed

    Rieben, W Kurt; Coulombe, Roger A

    2004-12-01

    Pyrrolizidine alkaloids (PAs) are ubiquitous plant toxins, many of which, upon oxidation by hepatic mixed-function oxidases, become reactive bifunctional pyrrolic electrophiles that form DNA-DNA and DNA-protein cross-links. The anti-mitotic, toxic, and carcinogenic action of PAs is thought to be caused, at least in part, by these cross-links. We wished to determine whether the activated PA pyrrole dehydromonocrotaline (DHMO) exhibits base sequence preferences when cross-linked to a set of model duplex poly A-T 14-mer oligonucleotides with varying internal and/or end 5'-d(CG), 5'-d(GC), 5'-d(TA), 5'-d(CGCG), or 5'-d(GCGC) sequences. DHMO-DNA cross-links were assessed by electrophoretic mobility shift assay (EMSA) of 32P endlabeled oligonucleotides and by HPLC analysis of cross-linked DNAs enzymatically digested to their constituent deoxynucleosides. The degree of DNA cross-links depended upon the concentration of the pyrrole, but not on the base sequence of the oligonucleotide target. Likewise, HPLC chromatograms of cross-linked and digested DNAs showed no discernible sequence preference for any nucleotide. Added glutathione, tyrosine, cysteine, and aspartic acid, but not phenylalanine, threonine, serine, lysine, or methionine competed with DNA as alternate nucleophiles for cross-linking by DHMO. From these data it appears that DHMO exhibits no strong base preference when forming cross-links with DNA, and that some cellular nucleophiles can inhibit DNA cross-link formation.

  4. Probing the interaction of the phytochemical 6-gingerol from the spice ginger with DNA.

    PubMed

    Haris, Poovvathingal; Mary, Varughese; Sudarsanakumar, Chellappanpillai

    2018-07-01

    6-Gingerol [5-hydroxy-1-(4-hydroxy-3-methoxyphenyl) decan-3-one], the bio-active ingredient of the popular Indian spice ginger (Zingiber officinale Roscoe), is well-known for its pharmacological and physiological actions. The potent antioxidant, antiemetic, antiulcer, antimicrobial, analgesic, hypoglycemic, antihypertensive, antihyperlipidemic, immunostimulant, anti-inflammatory, cardiotonic, and cancer prevention activities of 6-Gingerol has been investigated and explored. 6-Gingerol is a good candidate for the treatment of various cancers including prostrate, pancreatic, breast, skin, gastrointestinal, pulmonary, and renal cancer. In this study we report for the first time the molecular recognition of 6-Gingerol with calf thymus DNA (ctDNA) through experimental and molecular modeling techniques confirming a minor groove binding mode of 6-Gingerol with ctDNA. Fluorescence and UV-vis spectroscopic studies confirm the complex formation of 6-gingerol with ctDNA. The energetics and thermodynamics of the interaction of 6-Gingerol with ctDNA was explored by Isothermal Titration Calorimetry (ITC) and Differential Scanning Calorimetry (DSC). The ctDNA helix melting upon 6-Gingerol binding was examined by melting temperature T m analysis. Further the electrophoretic mobility shift assay confirms a possible groove binding of 6-Gingerol with ctDNA. Molecular docking and Molecular dynamics (MD) studies provide a detailed understanding on the interaction of 6-Gingerol binding in the minor groove of DNA which supports experimental results. Copyright © 2018. Published by Elsevier B.V.

  5. A detailed protocol for chromatin immunoprecipitation in the yeast Saccharomyces cerevisiae.

    PubMed

    Grably, Melanie; Engelberg, David

    2010-01-01

    Critical cellular processes such as DNA replication, DNA damage repair, and transcription are mediated and regulated by DNA-binding proteins. Many efforts have been invested therefore in developing methods that monitor the dynamics of protein-DNA association. As older techniques such as DNA footprinting, and electrophoretic mobility shift assays (EMSA) could be applied mostly in vitro, the development of the chromatin immunoprecipitation (ChIP) method, which allows quantitative measurement of protein-bound DNA most accurately in vivo, revolutionized our capabilities of understanding the mechanisms underlying the aforementioned processes. Furthermore, this powerful tool could be applied at the genomic-scale providing a global picture of the protein-DNA complexes at the entire genome.The procedure is conceptually simple; involves rapid crosslinking of proteins to DNA by the addition of formaldehyde to the culture, shearing the DNA and immunoprecipitating the protein of interest while covalently bound to its DNA targets. Following decrosslinking, DNA that was coimmunoprecipitated could be amplified by PCR or could serve as a probe of a genomic microarray to identify all DNA fragments that were bound to the protein.Although simple in principle, the method is not trivial to implement and the results might be misleading if proper controls are not included in the experiment. In this chapter, we provide therefore a highly detailed protocol of ChIP assay as is applied successfully in our laboratory. We pay special attention to describe every small detail, in order that any investigator could readily and successfully apply this important and powerful technology.

  6. Replication origins oriGNAI3 and oriB of the mammalian AMPD2 locus nested in a region of straight DNA flanked by intrinsically bent DNA sites.

    PubMed

    Balani, Valério Américo; de Lima Neto, Quirino Alves; Takeda, Karen Izumi; Gimenes, Fabrícia; Fiorini, Adriana; Debatisse, Michelle; Fernandez, Maria Aparecida

    2010-11-01

    The aim of this work was to determine whether intrinsically bent DNA sites are present at, or close to, the mammalian replication origins oriGNAI3 and oriB in the Chinese hamster AMPD2 locus. Using an electrophoretic mobility shift assay and in silico analysis, we located four intrinsically bent DNA sites (b1 to b4) in a fragment that contains the oriGNAI3 and one site (b5) proximal to oriB. The helical parameters show that each bent DNA site is curved in a left-handed superhelical writhe. A 2D projection of 3D fragment trajectories revealed that oriGNAI3 is located in a relatively straight segment flanked by bent sites b1 and b2, which map in previously identified Scaffold/Matrix Attachment Region. Sites b3 and b4 are located approximately 2 kb downstream and force the fragment into a strong closed loop structure. The b5 site is also located in an S/MAR that is found just downstream of oriB.

  7. Yeast one-hybrid system used to identify the binding proteins for rat glutathione S-transferase P enhancer I.

    PubMed

    Liao, Ming-Xiang; Liu, Dong-Yuan; Zuo, Jin; Fang, Fu-De

    2002-03-01

    To detect the trans-factors specifically binding to the strong enhancer element (GPEI) in the upstream of rat glutathione S-transferase P (GST-P) gene. Yeast one-hybrid system was used to screen rat lung MATCHMAKER cDNA library to identify potential trans-factors that can interact with core sequence of GPEI(cGPEI). Electrophoresis mobility shift assay (EMSA) was used to analyze the binding of transfactors to cGPEI. cDNA fragments coding for the C-terminal part of the transcription factor c-Jun and rat adenine nucleotide translocator (ANT) were isolated. The binding of c-Jun and ANT to GPEI core sequence were confirmed. Rat c-jun transcriptional factor and ANT may interact with cGPEI. They could play an important role in the induced expression of GST-P gene.

  8. Genetic variations in the DNA replication origins of human papillomavirus family correlate with their oncogenic potential.

    PubMed

    Yilmaz, Gulden; Biswas-Fiss, Esther E; Biswas, Subhasis B

    2018-04-01

    Human papillomaviruses (HPVs) encompass a large family of viruses that range from benign to highly carcinogenic. The crucial differences between benign and carcinogenic types of HPV remain unknown, except that the two HPV types differ in the frequency of DNA replication. We have systematically analyzed the mechanism of HPV DNA replication initiation in low-risk and high-risk HPVs. Our results demonstrate that HPV-encoded E2 initiator protein and its four binding sites in the replication origin play pivotal roles in determining the destiny of the HPV-infected cell. We have identified strain-specific single nucleotide variations in E2 binding sites found only in the high-risk HPVs. We have demonstrated that these variations result in attenuated formation of the E2-DNA complex. E2 binding to these sites is linked to the activation of the DNA replication origin as well as initiation of DNA replication. Both electrophoretic mobility shift assay and atomic force microscopy studies demonstrated that binding of E2 from either low- or high-risk HPVs with variant binding sequences lacked multimeric E2-DNA complex formation in vitro. These results provided a molecular basis of differential DNA replication in the two types of HPVs and pointed to a correlation with the development of cancer. Copyright © 2017. Published by Elsevier B.V.

  9. Loop L1 governs the DNA-binding specificity and order for RecA-catalyzed reactions in homologous recombination and DNA repair

    PubMed Central

    Shinohara, Takeshi; Ikawa, Shukuko; Iwasaki, Wakana; Hiraki, Toshiki; Hikima, Takaaki; Mikawa, Tsutomu; Arai, Naoto; Kamiya, Nobuo; Shibata, Takehiko

    2015-01-01

    In all organisms, RecA-family recombinases catalyze homologous joint formation in homologous genetic recombination, which is essential for genome stability and diversification. In homologous joint formation, ATP-bound RecA/Rad51-recombinases first bind single-stranded DNA at its primary site and then interact with double-stranded DNA at another site. The underlying reason and the regulatory mechanism for this conserved binding order remain unknown. A comparison of the loop L1 structures in a DNA-free RecA crystal that we originally determined and in the reported DNA-bound active RecA crystals suggested that the aspartate at position 161 in loop L1 in DNA-free RecA prevented double-stranded, but not single-stranded, DNA-binding to the primary site. This was confirmed by the effects of the Ala-replacement of Asp-161 (D161A), analyzed directly by gel-mobility shift assays and indirectly by DNA-dependent ATPase activity and SOS repressor cleavage. When RecA/Rad51-recombinases interact with double-stranded DNA before single-stranded DNA, homologous joint-formation is suppressed, likely by forming a dead-end product. We found that the D161A-replacement reduced this suppression, probably by allowing double-stranded DNA to bind preferentially and reversibly to the primary site. Thus, Asp-161 in the flexible loop L1 of wild-type RecA determines the preference for single-stranded DNA-binding to the primary site and regulates the DNA-binding order in RecA-catalyzed recombinase reactions. PMID:25561575

  10. Mutation detection by mismatch binding protein, MutS, in amplified DNA: Application to the cystic fibrosis gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lishanski, A.; Ostrander, E.A.; Rine, J.

    1994-03-29

    An experimental strategy for detecting heterozygosity in genomic DNA has been developed based on preferential binding of Escherichia coli MutS protein to DNA molecules containing mismatched bases. The binding was detected by a gel mobility-shift assay. This approach was tested by using as a model the most commonly occurring mutations within the cystic fibrosis (CFTR) gene. Genomic DNA samples were amplified with 5{prime}-end-labeled primers that bracket the site of the {Delta}F508 3-bp deletion in exon 10 of the CFTR gene. The renatured PCR products from homozygotes produced homoduplexes; the PCR products from heterozygotes produced heteroduplexes and homoduplexes (1:1). MutS proteinmore » bound more strongly to heteroduplexes that correspond to heterozygous carriers of {Delta}F508 and contain a CTT or a GAA loop in one of the strands than to homoduplexes corresponding to homozygotes. The ability of MutS protein to detect heteroduplexes in PCR-amplified DNA extended to fragments {approximately} 500 bp long. The method was also able to detect carriers of the point mutations in exon 11 of the CFTR gene by a preferential binding of MutS to single-base mismatches in PCR-amplified DNA.« less

  11. Interaction of the host protein NbDnaJ with Potato virus X minus-strand stem-loop 1 RNA and capsid protein affects viral replication and movement.

    PubMed

    Cho, Sang-Yun; Cho, Won Kyong; Sohn, Seong-Han; Kim, Kook-Hyung

    2012-01-06

    Plant viruses must interact with host cellular components to replicate and move from cell to cell. In the case of Potato virus X (PVX), it carries stem-loop 1 (SL1) RNA essential for viral replication and movement. Using two-dimensional electrophoresis northwestern blot analysis, we previously identified several host proteins that bind to SL1 RNA. Of those, we further characterized a DnaJ-like protein from Nicotiana benthamiana named NbDnaJ. An electrophoretic mobility shift assay confirmed that NbDnaJ binds only to SL1 minus-strand RNA, and bimolecular fluorescence complementation (BiFC) indicated that NbDnaJ interacts with PVX capsid protein (CP). Using a series of deletion mutants, the C-terminal region of NbDnaJ was found to be essential for the interaction with PVX CP. The expression of NbDnaJ significantly changed upon infection with different plant viruses such as PVX, Tobacco mosaic virus, and Cucumber mosaic virus, but varied depending on the viral species. In transient experiments, both PVX replication and movement were inhibited in plants that over-expressed NbDnaJ but accelerated in plants in which NbDnaJ was silenced. In summary, we suggest that the newly identified NbDnaJ plays a role in PVX replication and movement by interacting with SL1(-) RNA and PVX CP. Copyright © 2011 Elsevier Inc. All rights reserved.

  12. A Novel DNA Binding Mechanism for maf Basic Region-Leucine Zipper Factors Inferred from a MafA-DNA Complex Structure and Binding Specificities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lu, Xun; Guanga, Gerald P; Wan, Cheng

    2012-11-13

    MafA is a proto-oncoprotein and is critical for insulin gene expression in pancreatic β-cells. Maf proteins belong to the AP1 superfamily of basic region-leucine zipper (bZIP) transcription factors. Residues in the basic helix and an ancillary N-terminal domain, the Extended Homology Region (EHR), endow maf proteins with unique DNA binding properties: binding a 13 bp consensus site consisting of a core AP1 site (TGACTCA) flanked by TGC sequences and binding DNA stably as monomers. To further characterize maf DNA binding, we determined the structure of a MafA–DNA complex. MafA forms base-specific hydrogen bonds with the flanking G –5C –4 andmore » central C 0/G 0 bases, but not with the core-TGA bases. However, in vitro binding studies utilizing a pulse–chase electrophoretic mobility shift assay protocol revealed that mutating either the core-TGA or flanking-TGC bases dramatically increases the binding off rate. Comparing the known maf structures, we propose that DNA binding specificity results from positioning the basic helix through unique phosphate contacts. The EHR does not contact DNA directly but stabilizes DNA binding by contacting the basic helix. Collectively, these results suggest a novel multistep DNA binding process involving a conformational change from contacting the core-TGA to contacting the flanking-TGC bases.« less

  13. Inhibition mechanisms of hemoglobin, immunoglobulin G, and whole blood in digital and real-time PCR.

    PubMed

    Sidstedt, Maja; Hedman, Johannes; Romsos, Erica L; Waitara, Leticia; Wadsö, Lars; Steffen, Carolyn R; Vallone, Peter M; Rådström, Peter

    2018-04-01

    Blood samples are widely used for PCR-based DNA analysis in fields such as diagnosis of infectious diseases, cancer diagnostics, and forensic genetics. In this study, the mechanisms behind blood-induced PCR inhibition were evaluated by use of whole blood as well as known PCR-inhibitory molecules in both digital PCR and real-time PCR. Also, electrophoretic mobility shift assay was applied to investigate interactions between inhibitory proteins and DNA, and isothermal titration calorimetry was used to directly measure effects on DNA polymerase activity. Whole blood caused a decrease in the number of positive digital PCR reactions, lowered amplification efficiency, and caused severe quenching of the fluorescence of the passive reference dye 6-carboxy-X-rhodamine as well as the double-stranded DNA binding dye EvaGreen. Immunoglobulin G was found to bind to single-stranded genomic DNA, leading to increased quantification cycle values. Hemoglobin affected the DNA polymerase activity and thus lowered the amplification efficiency. Hemoglobin and hematin were shown to be the molecules in blood responsible for the fluorescence quenching. In conclusion, hemoglobin and immunoglobulin G are the two major PCR inhibitors in blood, where the first affects amplification through a direct effect on the DNA polymerase activity and quenches the fluorescence of free dye molecules, and the latter binds to single-stranded genomic DNA, hindering DNA polymerization in the first few PCR cycles. Graphical abstract PCR inhibition mechanisms of hemoglobin and immunoglobulin G (IgG). Cq quantification cycle, dsDNA double-stranded DNA, ssDNA single-stranded DNA.

  14. Inhibition of nuclear factor kappaB proteins-platinated DNA interactions correlates with cytotoxic effectiveness of the platinum complexes

    PubMed Central

    Brabec, Viktor; Kasparkova, Jana; Kostrhunova, Hana; Farrell, Nicholas P.

    2016-01-01

    Nuclear DNA is the target responsible for anticancer activity of platinum anticancer drugs. Their activity is mediated by altered signals related to programmed cell death and the activation of various signaling pathways. An example is activation of nuclear factor kappaB (NF-κB). Binding of NF-κB proteins to their consensus sequences in DNA (κB sites) is the key biochemical activity responsible for the biological functions of NF-κB. Using gel-mobility-shift assays and surface plasmon resonance spectroscopy we examined the interactions of NF-κB proteins with oligodeoxyribonucleotide duplexes containing κB site damaged by DNA adducts of three platinum complexes. These complexes markedly differed in their toxic effects in tumor cells and comprised highly cytotoxic trinuclear platinum(II) complex BBR3464, less cytotoxic conventional cisplatin and ineffective transplatin. The results indicate that structurally different DNA adducts of these platinum complexes exhibit a different efficiency to affect the affinity of the platinated DNA (κB sites) to NF-κB proteins. Our results support the hypothesis that structural perturbations induced in DNA by platinum(II) complexes correlate with their higher efficiency to inhibit binding of NF-κB proteins to their κB sites and cytotoxicity as well. However, the full generalization of this hypothesis will require to evaluate a larger series of platinum(II) complexes. PMID:27574114

  15. Inhibition of nuclear factor kappaB proteins-platinated DNA interactions correlates with cytotoxic effectiveness of the platinum complexes.

    PubMed

    Brabec, Viktor; Kasparkova, Jana; Kostrhunova, Hana; Farrell, Nicholas P

    2016-08-30

    Nuclear DNA is the target responsible for anticancer activity of platinum anticancer drugs. Their activity is mediated by altered signals related to programmed cell death and the activation of various signaling pathways. An example is activation of nuclear factor kappaB (NF-κB). Binding of NF-κB proteins to their consensus sequences in DNA (κB sites) is the key biochemical activity responsible for the biological functions of NF-κB. Using gel-mobility-shift assays and surface plasmon resonance spectroscopy we examined the interactions of NF-κB proteins with oligodeoxyribonucleotide duplexes containing κB site damaged by DNA adducts of three platinum complexes. These complexes markedly differed in their toxic effects in tumor cells and comprised highly cytotoxic trinuclear platinum(II) complex BBR3464, less cytotoxic conventional cisplatin and ineffective transplatin. The results indicate that structurally different DNA adducts of these platinum complexes exhibit a different efficiency to affect the affinity of the platinated DNA (κB sites) to NF-κB proteins. Our results support the hypothesis that structural perturbations induced in DNA by platinum(II) complexes correlate with their higher efficiency to inhibit binding of NF-κB proteins to their κB sites and cytotoxicity as well. However, the full generalization of this hypothesis will require to evaluate a larger series of platinum(II) complexes.

  16. Identification of small molecule inhibitors of ERCC1-XPF that inhibit DNA repair and potentiate cisplatin efficacy in cancer cells

    PubMed Central

    Arora, Sanjeevani; Heyza, Joshua; Zhang, Hao; Kalman-Maltese, Vivian; Tillison, Kristin; Floyd, Ashley M.; Chalfin, Elaine M.; Bepler, Gerold; Patrick, Steve M.

    2016-01-01

    ERCC1-XPF heterodimer is a 5′-3′ structure-specific endonuclease which is essential in multiple DNA repair pathways in mammalian cells. ERCC1-XPF (ERCC1-ERCC4) repairs cisplatin-DNA intrastrand adducts and interstrand crosslinks and its specific inhibition has been shown to enhance cisplatin cytotoxicity in cancer cells. In this study, we describe a high throughput screen (HTS) used to identify small molecules that inhibit the endonuclease activity of ERCC1-XPF. Primary screens identified two compounds that inhibit ERCC1-XPF activity in the nanomolar range. These compounds were validated in secondary screens against two other non-related endonucleases to ensure specificity. Results from these screens were validated using an in vitro gel-based nuclease assay. Electrophoretic mobility shift assays (EMSAs) further show that these compounds do not inhibit the binding of purified ERCC1-XPF to DNA. Next, in lung cancer cells these compounds potentiated cisplatin cytotoxicity and inhibited DNA repair. Structure activity relationship (SAR) studies identified related compounds for one of the original Hits, which also potentiated cisplatin cytotoxicity in cancer cells. Excitingly, dosing with NSC16168 compound potentiated cisplatin antitumor activity in a lung cancer xenograft model. Further development of ERCC1-XPF DNA repair inhibitors is expected to sensitize cancer cells to DNA damage-based chemotherapy. PMID:27650543

  17. A Key Evolutionary Mutation Enhances DNA Binding of the FOXP2 Forkhead Domain.

    PubMed

    Morris, Gavin; Fanucchi, Sylvia

    2016-04-05

    Forkhead box (FOX) transcription factors share a conserved forkhead DNA binding domain (FHD) and are key role players in the development of many eukaryotic species. Their involvement in various congenital disorders and cancers makes them clinically relevant targets for novel therapeutic strategies. Among them, the FOXP subfamily of multidomain transcriptional repressors is unique in its ability to form DNA binding homo and heterodimers. The truncated FOXP2 FHD, in the absence of the leucine zipper, exists in equilibrium between monomeric and domain-swapped dimeric states in vitro. As a consequence, determining the DNA binding properties of the FOXP2 FHD becomes inherently difficult. In this work, two FOXP2 FHD hinge loop mutants have been generated to successfully prevent both the formation (A539P) and the dissociation (F541C) of the homodimers. This allows for the separation of the two species for downstream DNA binding studies. Comparison of DNA binding of the different species using electrophoretic mobility shift assay, fluorescence anisotropy and isothermal titration calorimetry indicates that the wild-type FOXP2 FHD binds DNA as a monomer. However, comparison of the DNA-binding energetics of the monomer and wild-type FHD, reveals that there is a difference in the mechanism of binding between the two species. We conclude that the naturally occurring reverse mutation (P539A) seen in the FOXP subfamily increases DNA binding affinity and may increase the potential for nonspecific binding compared to other FOX family members.

  18. Structural dynamics of the lac repressor-DNA complex revealed by a multiscale simulation.

    PubMed

    Villa, Elizabeth; Balaeff, Alexander; Schulten, Klaus

    2005-05-10

    A multiscale simulation of a complex between the lac repressor protein (LacI) and a 107-bp-long DNA segment is reported. The complex between the repressor and two operator DNA segments is described by all-atom molecular dynamics; the size of the simulated system comprises either 226,000 or 314,000 atoms. The DNA loop connecting the operators is modeled as a continuous elastic ribbon, described mathematically by the nonlinear Kirchhoff differential equations with boundary conditions obtained from the coordinates of the terminal base pairs of each operator. The forces stemming from the looped DNA are included in the molecular dynamics simulations; the loop structure and the forces are continuously recomputed because the protein motions during the simulations shift the operators and the presumed termini of the loop. The simulations reveal the structural dynamics of the LacI-DNA complex in unprecedented detail. The multiple domains of LacI exhibit remarkable structural stability during the simulation, moving much like rigid bodies. LacI is shown to absorb the strain from the looped DNA mainly through its mobile DNA-binding head groups. Even with large fluctuating forces applied, the head groups tilt strongly and keep their grip on the operator DNA, while the remainder of the protein retains its V-shaped structure. A simulated opening of the cleft of LacI by 500-pN forces revealed the interactions responsible for locking LacI in the V-conformation.

  19. Expression of the leukemia-associated CBF{beta}/SMMHC chimeric gene causes transformation of 3T3 cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hajra, A.; Liu, P.; Collins, E.S.

    1994-09-01

    A pericentric inversion of chromosome 16 (inv(16)(p13;q22)) is consistently seen in acute myeloid leukemia of the M4Eo subtype. This inversion fuses almost the entire coding region of the gene encoding of the {beta} subunit of the heterodimeric transcription factor CBF/PEBP2 to the region of the MYH11 gene encoding the rod domain for the smooth muscle myosin heavy chain (SMMHC). To investigate the biological properties of the CBF{beta}/SMMHC fusion protein, we have generated 3T3 cell lines that stably express the CBF{beta}/SMMHC chimeric cDNA or the normal, nonchimeric CBF{beta} and SMMHC cDNAs. 3T3 cells expressing CBF{beta}/SMMHC acquire a transformed phenotype, as indicatedmore » by altered cell morphology, formation of foci, and growth in soft agar. Cells constitutively overexpressing the normal CBF{beta} cDNA or the rod region of SMMHC remain nontransformed. Western blot analysis using antibodies to CBF{beta} and the SMMHC rod demonstrates that stably transfected cells express the appropriate chimeric or normal protein. Electrophoretic mobility shift assays reveal that cells transformed by the chimeric cDNA do not have a CBF-DNA complex of the expected mobility, but instead contain a large complex with CBF DNA-binding activity that fails to migrate out of the gel wells. In order to define the regions of CBF{beta}/SMMHC necessary for 3T3 transformation, we have stably transfected cells with mutant CBF{beta}/SMMHC cDNAs containing various deletions of the coding region. Analysis of these cell lines indicates that the transformation property of CBF{beta}/SMMHC requires regions of CBF{beta} known to be necessary for association with the DNA-binding CBF{alpha} subunit, and also requires an intact SMMHC carboxyl terminus, which is necessary for formation of the coiled coil domain of the myosin rod.« less

  20. Transforming growth factor-beta 1 (TGF-beta1) promotes IL-2 mRNA expression through the up-regulation of NF-kappaB, AP-1 and NF-AT in EL4 cells.

    PubMed

    Han, S H; Yea, S S; Jeon, Y J; Yang, K H; Kaminski, N E

    1998-12-01

    Transforming growth factor beta1 (TGF-beta1) has been previously shown to modulate interleukin 2 (IL-2) secretion by activated T-cells. In the present studies, we determined that TGF-beta1 induced IL-2 mRNA expression in the murine T-cell line EL4, in the absence of other stimuli. IL-2 mRNA expression was significantly induced by TGF-beta1 (0.1-1 ng/ml) over a relatively narrow concentration range, which led to the induction of IL-2 secretion. Under identical condition, we examined the effect of TGF-beta1 on the activity of nuclear factor AT (NF-AT), nuclear factor kappaB (NF-kappaB), activator protein-1 (AP-1) and octamer, all of which contribute to the regulation of IL-2 gene expression. Electrophoretic mobility shift assays showed that TGF-beta1 markedly increased NF-AT, NF-kappaB and AP-1 binding to their respective cognate DNA binding sites, whereas octamer binding remained constant, as compared with untreated cells. Employing a reporter gene expression system with p(NF-kappaB)3-CAT, p(NF-AT)3-CAT and p(AP-1)3-CAT, TGF-beta1 treatment of transfected EL4 cells induced a dose-related increase in chloramphenicol acetyltransferase activity that correlated well with the DNA binding profile found in the electrophoretic mobility shift assay studies. These results show that TGF-beta1, in the absence of any additional stimuli, up-regulates the activity of key transcription factors involved in IL-2 gene expression, including NF-AT, NF-kappaB and AP-1, to help promote IL-2 mRNA expression by EL4 cells.

  1. Synthesis of linear polyethylenimine derivatives for DNA transfection.

    PubMed

    Brissault, Blandine; Kichler, Antoine; Guis, Christine; Leborgne, Christian; Danos, Olivier; Cheradame, Hervé

    2003-01-01

    A series of linear polymers containing varying amounts of ethylenimine or N-propylethylenimine units were synthesized by hydrolysis and/or reduction of polyethyloxazolines. The pK(a)s of the polyamines were determined potentiometrically. Gel mobility shift assay showed that the efficiency of DNA complexation was related to the fraction of amino groups that are protonated at neutral pH. The effects of cationic charge density and molar weight of the polymers on the transfection efficiency were evaluated on HepG2 cells. The results obtained with different copolymers show that the transfection efficiency primarily depends on the fraction of ethylenimine units included in the polymer albeit the molar weight is also of importance. On the basis of the results obtained with poly(N-propylethylenimines), we also demonstrate that the high transfection efficiency of polyethylenimines does not solely rely on their capacity to capture protons which are transferred into the endo-lysosomes during acidification.

  2. Supramolecular polymer formation by cyclic dinucleotides and intercalators affects dinucleotide enzymatic processing

    PubMed Central

    Nakayama, Shizuka; Zhou, Jie; Zheng, Yue; Szmacinski, Henryk; Sintim, Herman O

    2016-01-01

    Background: Cyclic dinucleotides form supramolecular aggregates with intercalators, and this property could be utilized in nanotechnology and medicine. Methods & results: Atomic force microscopy and electrophoretic mobility shift assays were used to show that cyclic diguanylic acid (c-di-GMP) forms G-wires in the presence of intercalators. The average fluorescence lifetime of thiazole orange, when bound to c-di-GMP was greater than when bound to DNA G-quadruplexes or dsDNA. The stability of c-di-GMP supramolecular polymers is dependent on both the nature of the cation present and the intercalator. C-di-GMP or cyclic diadenylic acid/intercalator complexes are more resistant to cleavage by YybT, a phosphodiesterase, than the uncomplexed nucleotides. Conclusion: Cleavage of bacterial cyclic dinucleotides could be slowed down via complexation with small molecules and that this could be utilized for diverse applications in nanotechnology and medicine. PMID:28031943

  3. Schooling Mobile Phones: Assumptions about Proximal Benefits, the Challenges of Shifting Meanings, and the Politics of Teaching

    ERIC Educational Resources Information Center

    Philip, Thomas M.; Garcia, Antero

    2015-01-01

    Mobile devices are increasingly upheld as powerful tools for learning and school reform. In this article, we prioritize youth voices to critically examine assumptions about student interest in mobile devices that often drive the incorporation of new technologies into schools. By demonstrating how the very meaning of mobile phones shift as they are…

  4. Mobile phone radiation induces mode-dependent DNA damage in a mouse spermatocyte-derived cell line: a protective role of melatonin.

    PubMed

    Liu, Chuan; Gao, Peng; Xu, Shang-Cheng; Wang, Yuan; Chen, Chun-Hai; He, Min-Di; Yu, Zheng-Ping; Zhang, Lei; Zhou, Zhou

    2013-11-01

    To evaluate whether exposure to mobile phone radiation (MPR) can induce DNA damage in male germ cells. A mouse spermatocyte-derived GC-2 cell line was exposed to a commercial mobile phone handset once every 20 min in standby, listen, dialed or dialing modes for 24 h. DNA damage was determined using an alkaline comet assay. The levels of DNA damage were significantly increased following exposure to MPR in the listen, dialed and dialing modes. Moreover, there were significantly higher increases in the dialed and dialing modes than in the listen mode. Interestingly, these results were consistent with the radiation intensities of these modes. However, the DNA damage effects of MPR in the dialing mode were efficiently attenuated by melatonin pretreatment. These results regarding mode-dependent DNA damage have important implications for the safety of inappropriate mobile phone use by males of reproductive age and also suggest a simple preventive measure: Keeping mobile phones as far away from our body as possible, not only during conversations but during 'dialed' and 'dialing' operation modes. Since the 'dialed' mode is actually part of the standby mode, mobile phones should be kept at a safe distance from our body even during standby operation. Furthermore, the protective role of melatonin suggests that it may be a promising pharmacological candidate for preventing mobile phone use-related reproductive impairments.

  5. High affinity γPNA sandwich hybridization assay for rapid detection of short nucleic acid targets with single mismatch discrimination.

    PubMed

    Goldman, Johnathan M; Zhang, Li Ang; Manna, Arunava; Armitage, Bruce A; Ly, Danith H; Schneider, James W

    2013-07-08

    Hybridization analysis of short DNA and RNA targets presents many challenges for detection. The commonly employed sandwich hybridization approach cannot be implemented for these short targets due to insufficient probe-target binding strengths for unmodified DNA probes. Here, we present a method capable of rapid and stable sandwich hybridization detection for 22 nucleotide DNA and RNA targets. Stable hybridization is achieved using an n-alkylated, polyethylene glycol γ-carbon modified peptide nucleic acid (γPNA) amphiphile. The γPNA's exceptionally high affinity enables stable hybridization of a second DNA-based probe to the remaining bases of the short target. Upon hybridization of both probes, an electrophoretic mobility shift is measured via interaction of the n-alkane modification on the γPNA with capillary electrophoresis running buffer containing nonionic surfactant micelles. We find that sandwich hybridization of both probes is stable under multiple binding configurations and demonstrate single base mismatch discrimination. The binding strength of both probes is also stabilized via coaxial stacking on adjacent hybridization to targets. We conclude with a discussion on the implementation of the proposed sandwich hybridization assay as a high-throughput microRNA detection method.

  6. The interaction of E. coli integration host factor and lambda cos DNA: multiple complex formation and protein-induced bending.

    PubMed Central

    Kosturko, L D; Daub, E; Murialdo, H

    1989-01-01

    The interaction of E. coli's integration Host Factor (IHF) with fragments of lambda DNA containing the cos site has been studied by gel-mobility retardation and electron microscopy. The cos fragment used in the mobility assays is 398 bp and spans a region from 48,298 to 194 on the lambda chromosome. Several different complexes of IHF with this fragment can be distinguished by their differential mobility on polyacrylamide gels. Relative band intensities indicate that the formation of a complex between IHF and this DNA fragment has an equilibrium binding constant of the same magnitude as DNA fragments containing lambda's attP site. Gel-mobility retardation and electron microscopy have been employed to show that IHF sharply bends DNA near cos and to map the bending site. The protein-induced bend is near an intrinsic bend due to DNA sequence. The position of the bend suggests that IHF's role in lambda DNA packaging may be the enhancement of terminase binding/cos cutting by manipulating DNA structure. Images PMID:2521383

  7. Crowding Induces Complex Ergodic Diffusion and Dynamic Elongation of Large DNA Molecules

    PubMed Central

    Chapman, Cole D.; Gorczyca, Stephanie; Robertson-Anderson, Rae M.

    2015-01-01

    Despite the ubiquity of molecular crowding in living cells, the effects of crowding on the dynamics of genome-sized DNA are poorly understood. Here, we track single, fluorescent-labeled large DNA molecules (11, 115 kbp) diffusing in dextran solutions that mimic intracellular crowding conditions (0–40%), and determine the effects of crowding on both DNA mobility and conformation. Both DNAs exhibit ergodic Brownian motion and comparable mobility reduction in all conditions; however, crowder size (10 vs. 500 kDa) plays a critical role in the underlying diffusive mechanisms and dependence on crowder concentration. Surprisingly, in 10-kDa dextran, crowder influence saturates at ∼20% with an ∼5× drop in DNA diffusion, in stark contrast to exponentially retarded mobility, coupled to weak anomalous subdiffusion, with increasing concentration of 500-kDa dextran. Both DNAs elongate into lower-entropy states (compared to random coil conformations) when crowded, with elongation states that are gamma distributed and fluctuate in time. However, the broadness of the distribution of states and the time-dependence and length scale of elongation length fluctuations depend on both DNA and crowder size with concentration having surprisingly little impact. Results collectively show that mobility reduction and coil elongation of large crowded DNAs are due to a complex interplay between entropic effects and crowder mobility. Although elongation and initial mobility retardation are driven by depletion interactions, subdiffusive dynamics, and the drastic exponential slowing of DNA, up to ∼300×, arise from the reduced mobility of larger crowders. Our results elucidate the highly important and widely debated effects of cellular crowding on genome-sized DNA. PMID:25762333

  8. Physician satisfaction with a multi-platform digital scheduling system

    PubMed Central

    Rocha, Leonardo Lima; Lima, Alex Heitor; Santiago, Caroline Reis Maia; Terra, Jose Cláudio Cyrineu; Dagan, Alon; Celi, Leo Anthony

    2017-01-01

    Objective Physician shift schedules are regularly created manually, using paper or a shared online spreadsheet. Mistakes are not unusual, leading to last minute scrambles to cover a shift. We developed a web-based shift scheduling system and a mobile application tool to facilitate both the monthly scheduling and shift exchanges between physicians. The primary objective was to compare physician satisfaction before and after the mobile application implementation. Methods Over a 9-month period, three surveys, using the 4-point Likert type scale were performed to assess the physician satisfaction. The first survey was conducted three months prior mobile application release, a second survey three months after implementation and the last survey six months after. Results 51 (77%) of the physicians answered the baseline survey. Of those, 32 (63%) were males with a mean age of 37.8 ± 5.5 years. Prior to the mobile application implementation, 36 (70%) of the responders were using more than one method to carry out shift exchanges and only 20 (40%) were using the official department report sheet to document shift exchanges. The second and third survey were answered by 48 (73%) physicians. Forty-eight (98%) of them found the mobile application easy or very easy to install and 47 (96%) did not want to go back to the previous method. Regarding physician satisfaction, at baseline 37% of the physicians were unsatisfied or very unsatisfied with shift scheduling. After the mobile application was implementation, only 4% reported being unsatisfied (OR = 0.11, p < 0.001). The satisfaction level improved from 63% to 96% between the first and the last survey. Satisfaction levels significantly increased between the three time points (OR = 13.33, p < 0.001). Conclusion Our web and mobile phone-based scheduling system resulted in better physician satisfaction. PMID:28328958

  9. Physician satisfaction with a multi-platform digital scheduling system.

    PubMed

    Deliberato, Rodrigo Octávio; Rocha, Leonardo Lima; Lima, Alex Heitor; Santiago, Caroline Reis Maia; Terra, Jose Cláudio Cyrineu; Dagan, Alon; Celi, Leo Anthony

    2017-01-01

    Physician shift schedules are regularly created manually, using paper or a shared online spreadsheet. Mistakes are not unusual, leading to last minute scrambles to cover a shift. We developed a web-based shift scheduling system and a mobile application tool to facilitate both the monthly scheduling and shift exchanges between physicians. The primary objective was to compare physician satisfaction before and after the mobile application implementation. Over a 9-month period, three surveys, using the 4-point Likert type scale were performed to assess the physician satisfaction. The first survey was conducted three months prior mobile application release, a second survey three months after implementation and the last survey six months after. 51 (77%) of the physicians answered the baseline survey. Of those, 32 (63%) were males with a mean age of 37.8 ± 5.5 years. Prior to the mobile application implementation, 36 (70%) of the responders were using more than one method to carry out shift exchanges and only 20 (40%) were using the official department report sheet to document shift exchanges. The second and third survey were answered by 48 (73%) physicians. Forty-eight (98%) of them found the mobile application easy or very easy to install and 47 (96%) did not want to go back to the previous method. Regarding physician satisfaction, at baseline 37% of the physicians were unsatisfied or very unsatisfied with shift scheduling. After the mobile application was implementation, only 4% reported being unsatisfied (OR = 0.11, p < 0.001). The satisfaction level improved from 63% to 96% between the first and the last survey. Satisfaction levels significantly increased between the three time points (OR = 13.33, p < 0.001). Our web and mobile phone-based scheduling system resulted in better physician satisfaction.

  10. In vivo estradiol-dependent dephosphorylation of the repressor MDBP-2-H1 correlates with the loss of in vitro preferential binding to methylated DNA.

    PubMed Central

    Bruhat, A; Jost, J P

    1995-01-01

    We have previously shown that estradiol treatment of roosters resulted in a rapid loss of binding activity of the repressor MDBP-2-H1 (a member of the histone H1 family) to methylated DNA that was not due to a decrease in MDBP-2-H1 concentration. Here we demonstrate that MDBP-2-H1 from rooster liver nuclear extracts is a phosphoprotein. Phosphoamino acid analysis reveals that the phosphorylation occurs exclusively on serine residues. Two-dimensional gel electrophoresis and tryptic phosphopeptide analysis show that MDBP-2-H1 is phosphorylated at several sites. Treatment of roosters with estradiol triggers a dephosphorylation of at least two sites in the protein. Phosphatase treatment of purified rooster MDBP-2-H1 combined with gel mobility shift assay indicates that phosphorylation of MDBP-2-H1 is essential for the binding to methylated DNA and that the dephosphorylation can occur on the protein bound to methylated DNA causing its release from DNA. Thus, these results suggest that in vivo modification of the phosphorylation status of MDBP-2-H1 caused by estradiol treatment may be a key step for the down regulation of its binding to methylated DNA. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:7731964

  11. Using a Smart City IoT to Incentivise and Target Shifts in Mobility Behaviour—Is It a Piece of Pie?

    PubMed Central

    Poslad, Stefan; Ma, Athen; Wang, Zhenchen; Mei, Haibo

    2015-01-01

    Whilst there is an increasing capability to instrument smart cities using fixed and mobile sensors to produce the big data to better understand and manage transportation use, there still exists a wide gap between the sustainability goals of smart cities, e.g., to promote less private car use at peak times, with respect to their ability to more dynamically support individualised shifts in multi-modal transportation use to help achieve such goals. We describe the development of the tripzoom system developed as part of the SUNSET—SUstainable social Network SErvices for Transport—project to research and develop a mobile and fixed traffic sensor system to help facilitate individual mobility shifts. Its main novelty was its ability to use mobile sensors to classify common multiple urban transportation modes, to generate information-rich individual and group mobility profiles and to couple this with the use of a targeted incentivised marketplace to gamify travel. This helps to promote mobility shifts towards achieving sustainability goals. This system was trialled in three European country cities operated as Living Labs over six months. Our main findings were that we were able to accomplish a level of behavioural shifts in travel behaviour. Hence, we have provided a proof-of-concept system that uses positive incentives to change individual travel behaviour. PMID:26053752

  12. Using a Smart City IoT to Incentivise and Target Shifts in Mobility Behaviour--Is It a Piece of Pie?

    PubMed

    Poslad, Stefan; Ma, Athen; Wang, Zhenchen; Mei, Haibo

    2015-06-04

    Whilst there is an increasing capability to instrument smart cities using fixed and mobile sensors to produce the big data to better understand and manage transportation use, there still exists a wide gap between the sustainability goals of smart cities, e.g., to promote less private car use at peak times, with respect to their ability to more dynamically support individualised shifts in multi-modal transportation use to help achieve such goals. We describe the development of the tripzoom system developed as part of the SUNSET-SUstainable social Network SErvices for Transport-project to research and develop a mobile and fixed traffic sensor system to help facilitate individual mobility shifts. Its main novelty was its ability to use mobile sensors to classify common multiple urban transportation modes, to generate information-rich individual and group mobility profiles and to couple this with the use of a targeted incentivised marketplace to gamify travel. This helps to promote mobility shifts towards achieving sustainability goals. This system was trialled in three European country cities operated as Living Labs over six months. Our main findings were that we were able to accomplish a level of behavioural shifts in travel behaviour. Hence, we have provided a proof-of-concept system that uses positive incentives to change individual travel behaviour.

  13. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  14. Mobile small RNAs regulate genome-wide DNA methylation.

    PubMed

    Lewsey, Mathew G; Hardcastle, Thomas J; Melnyk, Charles W; Molnar, Attila; Valli, Adrián; Urich, Mark A; Nery, Joseph R; Baulcombe, David C; Ecker, Joseph R

    2016-02-09

    RNA silencing at the transcriptional and posttranscriptional levels regulates endogenous gene expression, controls invading transposable elements (TEs), and protects the cell against viruses. Key components of the mechanism are small RNAs (sRNAs) of 21-24 nt that guide the silencing machinery to their nucleic acid targets in a nucleotide sequence-specific manner. Transcriptional gene silencing is associated with 24-nt sRNAs and RNA-directed DNA methylation (RdDM) at cytosine residues in three DNA sequence contexts (CG, CHG, and CHH). We previously demonstrated that 24-nt sRNAs are mobile from shoot to root in Arabidopsis thaliana and confirmed that they mediate DNA methylation at three sites in recipient cells. In this study, we extend this finding by demonstrating that RdDM of thousands of loci in root tissues is dependent upon mobile sRNAs from the shoot and that mobile sRNA-dependent DNA methylation occurs predominantly in non-CG contexts. Mobile sRNA-dependent non-CG methylation is largely dependent on the DOMAINS REARRANGED METHYLTRANSFERASES 1/2 (DRM1/DRM2) RdDM pathway but is independent of the CHROMOMETHYLASE (CMT)2/3 DNA methyltransferases. Specific superfamilies of TEs, including those typically found in gene-rich euchromatic regions, lose DNA methylation in a mutant lacking 22- to 24-nt sRNAs (dicer-like 2, 3, 4 triple mutant). Transcriptome analyses identified a small number of genes whose expression in roots is associated with mobile sRNAs and connected to DNA methylation directly or indirectly. Finally, we demonstrate that sRNAs from shoots of one accession move across a graft union and target DNA methylation de novo at normally unmethylated sites in the genomes of root cells from a different accession.

  15. Imaging and sizing of single DNA molecules on a mobile phone.

    PubMed

    Wei, Qingshan; Luo, Wei; Chiang, Samuel; Kappel, Tara; Mejia, Crystal; Tseng, Derek; Chan, Raymond Yan Lok; Yan, Eddie; Qi, Hangfei; Shabbir, Faizan; Ozkan, Haydar; Feng, Steve; Ozcan, Aydogan

    2014-12-23

    DNA imaging techniques using optical microscopy have found numerous applications in biology, chemistry and physics and are based on relatively expensive, bulky and complicated set-ups that limit their use to advanced laboratory settings. Here we demonstrate imaging and length quantification of single molecule DNA strands using a compact, lightweight and cost-effective fluorescence microscope installed on a mobile phone. In addition to an optomechanical attachment that creates a high contrast dark-field imaging setup using an external lens, thin-film interference filters, a miniature dovetail stage and a laser-diode for oblique-angle excitation, we also created a computational framework and a mobile phone application connected to a server back-end for measurement of the lengths of individual DNA molecules that are labeled and stretched using disposable chips. Using this mobile phone platform, we imaged single DNA molecules of various lengths to demonstrate a sizing accuracy of <1 kilobase-pairs (kbp) for 10 kbp and longer DNA samples imaged over a field-of-view of ∼2 mm2.

  16. Identification of the cAMP response element that controls transcriptional activation of the insulin-like growth factor-I gene by prostaglandin E2 in osteoblasts

    NASA Technical Reports Server (NTRS)

    Thomas, M. J.; Umayahara, Y.; Shu, H.; Centrella, M.; Rotwein, P.; McCarthy, T. L.

    1996-01-01

    Insulin-like growth factor-I (IGF-I), a multifunctional growth factor, plays a key role in skeletal growth and can enhance bone cell replication and differentiation. We previously showed that prostaglandin E2 (PGE2) and other agents that increase cAMP activated IGF-I gene transcription in primary rat osteoblast cultures through promoter 1 (P1), the major IGF-I promoter, and found that transcriptional induction was mediated by protein kinase A. We now have identified a short segment of P1 that is essential for full hormonal regulation and have characterized inducible DNA-protein interactions involving this site. Transient transfections of IGF-I P1 reporter genes into primary rat osteoblasts showed that the 328-base pair untranslated region of exon 1 was required for a full 5.3-fold response to PGE2; mutation in a previously footprinted site, HS3D (base pairs +193 to +215), reduced induction by 65%. PGE2 stimulated nuclear protein binding to HS3D. Binding, as determined by gel mobility shift assay, was not seen in nuclear extracts from untreated osteoblast cultures, was detected within 2 h of PGE2 treatment, and was maximal by 4 h. This DNA-protein interaction was not observed in cytoplasmic extracts from PGE2-treated cultures, indicating nuclear localization of the protein kinase A-activated factor(s). Activation of this factor was not blocked by cycloheximide (Chx), and Chx did not impair stimulation of IGF-I gene expression by PGE2. In contrast, binding to a consensus cAMP response element (CRE; 5'-TGACGTCA-3') from the rat somatostatin gene was not modulated by PGE2 or Chx. Competition gel mobility shift analysis using mutated DNA probes identified 5'-CGCAATCG-3' as the minimal sequence needed for inducible binding. All modified IGF-I P1 promoterreporter genes with mutations within this CRE sequence also showed a diminished functional response to PGE2. These results identify the CRE within the 5'-untranslated region of IGF-I exon 1 that is required for hormonal activation of IGF-I gene transcription by cAMP in osteoblasts.

  17. Impact of molecular weight and degree of conjugation on the thermodynamics of DNA complexation and stability of polyethylenimine-graft-poly(ethylene glycol) copolymers.

    PubMed

    Smith, Ryan J; Beck, Rachel W; Prevette, Lisa E

    2015-01-01

    Poly(ethylene glycol) (PEG) is often conjugated to polyethylenimine (PEI) to provide colloidal stability to PEI-DNA polyplexes and shield charge leading to toxicity. Here, a library of nine cationic copolymers was synthesized by grafting three molecular weights (750, 2000, 5000Da) of PEG to linear PEI at three conjugation ratios. Using isothermal titration calorimetry, we have quantified the thermodynamics of the associations between the copolymers and DNA and determined the extent to which binding is hindered as a function of PEG molecular weight and conjugation ratio. Low conjugation ratios of 750Da PEG to PEI resulted in little decrease in DNA affinity, but a significant decrease-up to two orders of magnitude-was found for the other copolymers. We identified limitations in determination of affinity using indirect assays (electrophoretic mobility shift and ethidium bromide exclusion) commonly used in the field. Dynamic light scattering of the DNA complexes at physiological ionic strength showed that PEI modifications that did not reduce DNA affinity also did not confer significant colloidal stability, a finding that was supported by calorimetric data on the aggregation process. These results quantify the DNA interaction thermodynamics of PEGylated polycations for the first time and indicate that there is an optimum PEG chain length and degree of substitution in the design of agents that have desirable properties for effective in vivo gene delivery. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Lipophilic oligonucleotides spontaneously insert into lipid membranes, bind complementary DNA strands, and sequester into lipid-disordered domains.

    PubMed

    Bunge, Andreas; Kurz, Anke; Windeck, Anne-Kathrin; Korte, Thomas; Flasche, Wolfgang; Liebscher, Jürgen; Herrmann, Andreas; Huster, Daniel

    2007-04-10

    For the development of surface functionalized bilayers, we have synthesized lipophilic oligonucleotides to combine the molecular recognition mechanism of nucleic acids and the self-assembly characteristics of lipids in planar membranes. A lipophilic oligonucleotide consisting of 21 thymidine units and two lipophilic nucleotides with an alpha-tocopherol moiety as a lipophilic anchor was synthesized using solid-phase methods with a phosphoramadite strategy. The interaction of the water soluble lipophilic oligonucleotide with vesicular lipid membranes and its capability to bind complementary DNA strands was studied using complementary methods such as NMR, EPR, DSC, fluorescence spectroscopy, and fluorescence microscopy. This oligonucleotide inserted stably into preformed membranes from the aqueous phase. Thereby, no significant perturbation of the lipid bilayer and its stability was observed. However, the non-lipidated end of the oligonucleotide is exposed to the aqueous environment, is relatively mobile, and is free to interact with complementary DNA strands. Binding of the complementary single-stranded DNA molecules is fast and accomplished by the formation of Watson-Crick base pairs, which was confirmed by 1H NMR chemical shift analysis and fluorescence resonance energy transfer. The molecular structure of the membrane bound DNA double helix is very similar to the free double-stranded DNA. Further, the membrane bound DNA double strands also undergo regular melting. Finally, in raft-like membrane mixtures, the lipophilic oligonucleotide was shown to preferentially sequester into liquid-disordered membrane domains.

  19. Bacteroides fragilis mobilizable transposon Tn5520 requires a 71 base pair origin of transfer sequence and a single mobilization protein for relaxosome formation during conjugation.

    PubMed

    Vedantam, Gayatri; Knopf, Sarah; Hecht, David W

    2006-01-01

    Tn5520 is the smallest known bacterial mobilizable transposon and was isolated from an antibiotic resistant Bacteroides fragilis clinical isolate. When a conjugation apparatus is provided in trans, Tn5520 is mobilized (transferred) efficiently within, and from, both Bacteroides spp. and Escherichia coli. Only two genes are present on Tn5520; one encodes an integrase, and the other a multifunctional mobilization (Mob) protein BmpH. BmpH is essential for Tn5520 mobility. The focus of this study was to identify the Tn5520 origin of conjugative transfer (oriT) and to study BmpH-oriT binding. We delimited the functional Tn5520 oriT to a 71 bp sequence upstream of the bmpH gene. A plasmid vector harbouring this minimal 71 bp oriT was mobilized at the same frequency as that of intact Tn5520. The minimal oriT contains one 17 bp inverted repeat (IR) sequence. We constructed and tested multiple IR mutants and showed that the IR was essential in its entirety for mobilization. A nick site sequence (5'-GCTAC-3') was also identified within the minimal oriT; this sequence resembled nick sites found in plasmids of Gram positive origin. We further showed that mutation of a highly conserved GC dinucleotide in the nick site sequence completely abolished mobilization. We also purified BmpH and showed that it specifically bound a Tn5520 oriT fragment in electrophoretic mobility shift assays. We also identified non-nick site sequences within the minimal oriT that were essential for mobilization. We hypothesize that transposon-based single Mob protein systems may contribute to efficient gene dissemination from Bacteroides spp., because fewer DNA processing proteins are required for relaxosome formation.

  20. Surface salt bridges modulate DNA wrapping by the type II DNA-binding protein TF1.

    PubMed

    Grove, Anne

    2003-07-29

    The histone-like protein HU is involved in compaction of the bacterial genome. Up to 37 bp of DNA may be wrapped about some HU homologues in a process that has been proposed to depend on a linked disruption of surface salt bridges that liberates cationic side chains for interaction with the DNA. Despite significant sequence conservation between HU homologues, binding sites from 9 to 37 bp have been reported. TF1, an HU homologue that is encoded by Bacillus subtilis bacteriophage SPO1, has nM affinity for 37 bp preferred sites in DNA with 5-hydroxymethyluracil (hmU) in place of thymine. On the basis of electrophoretic mobility shift assays, we show that TF1-DNA complex formation is associated with a net release of only approximately 0.5 cations. The structure of TF1 suggests that Asp13 can form a dehydrated surface salt bridge with Lys23; substitution of Asp13 with Ala increases the net release of cations to approximately 1. These data are consistent with complex formation linked to disruption of surface salt bridges. Substitution of Glu90 with Ala, which would expose Lys87 predicted to contact DNA immediately distal to a proline-mediated DNA kink, causes an increase in affinity and an abrogation of the preference for hmU-containing DNA. We propose that hmU preference is due to finely tuned interactions at the sites of kinking that expose a differential flexibility of hmU- and T-containing DNA. Our data further suggest that the difference in binding site size for HU homologues is based on a differential ability to stabilize the DNA kinks.

  1. Datasets depicting mobility retardation of NCS proteins observed upon incubation with calcium, but not with magnesium, barium or strontium.

    PubMed

    Viviano, Jeffrey; Krishnan, Anuradha; Scully, Jenna; Wu, Hao; Venkataraman, Venkat

    2016-06-01

    In this data article we show the specificity of the Ca(2+)-induced mobility shift in three proteins that belong to the neuronal calcium sensor (NCS) protein family: Hippocalcin, GCAP1 and GCAP2. These proteins did not display a shift in mobility in native gels when incubated with divalent cations other than Ca(2+) - such as Mg(2+), Ba(2+), and Sr(2+), even at 10× concentrations. The data is similar to that obtained with another NCS protein, neurocalcin delta (Viviano et al., 2016, "Electrophoretic Mobility Shift in Native Gels Indicates Calcium-dependent Structural Changes of Neuronal Calcium Sensor Proteins", [1]).

  2. Friends-enemies: endogenous retroviruses are major transcriptional regulators of human DNA

    NASA Astrophysics Data System (ADS)

    Buzdin, Anton A.; Prassolov, Vladimir; Garazha, Andrew V.

    2017-06-01

    Endogenous retroviruses are mobile genetic elements hardly distinguishable from infectious, or “exogenous”, retroviruses at the time of insertion in the host DNA. Human endogenous retroviruses (HERVs) are not rare. They gave rise to multiple families of closely related mobile elements that occupy 8% of the human genome. Together, they shape genomic regulatory landscape by providing at least 320,000 human transcription factor binding sites (TFBS) located on 110,000 individual HERV elements. The HERVs host as many as 155,000 mapped DNaseI hypersensitivity sites, which denote loci active in the regulation of gene expression or chromatin structure. The contemporary view of the HERVs evolutionary dynamics suggests that at the early stages after insertion, the HERV is treated by the host cells as a foreign genetic element, and is likely to be suppressed by the targeted methylation and mutations. However, at the later stages, when significant number of mutations has been already accumulated and when the retroviral genes are broken, the regulatory potential of a HERV may be released and recruited to modify the genomic balance of transcription factor binding sites. This process goes together with further accumulation and selection of mutations, which reshape the regulatory landscape of the human DNA. However, developmental reprogramming, stress or pathological conditions like cancer, inflammation and infectious diseases, can remove the blocks limiting expression and HERV-mediated host gene regulation. This, in turn, can dramatically alter the gene expression equilibrium and shift it to a newer state, thus further amplifying instability and exacerbating the stressful situation.

  3. Bacillus subtilis glutamine synthetase regulates its own synthesis by acting as a chaperone to stabilize GlnR-DNA complexes.

    PubMed

    Fisher, Susan H; Wray, Lewis V

    2008-01-22

    The Bacillus subtilis GlnR repressor controls gene expression in response to nitrogen availability. Because all GlnR-regulated genes are expressed constitutively in mutants lacking glutamine synthetase (GS), GS is required for repression by GlnR. Feedback-inhibited GS (FBI-GS) was shown to activate GlnR DNA binding with an in vitro electophoretic mobility shift assay (EMSA). The activation of GlnR DNA binding by GS in these experiments depended on the feedback inhibitor glutamine and did not occur with mutant GS proteins defective in regulating GlnR activity in vivo. Although stable GS-GlnR-DNA ternary complexes were not observed in the EMSA experiments, cross-linking experiments showed that a protein-protein interaction occurs between GlnR and FBI-GS. This interaction was reduced in the absence of the feedback inhibitor glutamine and with mutant GS proteins. Because FBI-GS significantly reduced the dissociation rate of the GlnR-DNA complexes, the stability of these complexes is enhanced by FBI-GS. These results argue that FBI-GS acts as a chaperone that activates GlnR DNA binding through a transient protein-protein interaction that stabilizes GlnR-DNA complexes. GS was shown to control the activity of the B. subtilis nitrogen transcription factor TnrA by forming a stable complex between FBI-GS and TnrA that inhibits TnrA DNA binding. Thus, B. subtilis GS is an enzyme with dual catalytic and regulatory functions that uses distinct mechanisms to control the activity of two different transcription factors.

  4. Plant polyphenols mobilize nuclear copper in human peripheral lymphocytes leading to oxidatively generated DNA breakage: implications for an anticancer mechanism.

    PubMed

    Shamim, Uzma; Hanif, Sarmad; Ullah, M F; Azmi, Asfar S; Bhat, Showket H; Hadi, S M

    2008-08-01

    It was earlier proposed that an important anti-cancer mechanism of plant polyphenols may involve mobilization of endogenous copper ions, possibly chromatin-bound copper and the consequent pro-oxidant action. This paper shows that plant polyphenols are able to mobilize nuclear copper in human lymphocytes, leading to degradation of cellular DNA. A cellular system of lymphocytes isolated from human peripheral blood and comet assay was used for this purpose. Incubation of lymphocytes with neocuproine (a cell membrane permeable copper chelator) inhibited DNA degradation in intact lymphocytes. Bathocuproine, which is unable to permeate through the cell membrane, did not cause such inhibition. This study has further shown that polyphenols are able to degrade DNA in cell nuclei and that such DNA degradation is inhibited by neocuproine as well as bathocuproine (both of which are able to permeate the nuclear pore complex), suggesting that nuclear copper is mobilized in this reaction. Pre-incubation of lymphocyte nuclei with polyphenols indicates that it is capable of traversing the nuclear membrane. This study has also shown that polyphenols generate oxidative stress in lymphocyte nuclei which is inhibited by scavengers of reactive oxygen species (ROS) and neocuproine. These results indicate that the generation of ROS occurs through mobilization of nuclear copper resulting in oxidatively generated DNA breakage.

  5. The study of DNA adduct 8-hydroxy-2‧deoxyguanosine (8-OHdG) formation of butylated hydroxyanisole (BHA) and its metabolite ter-butyl hydroquinone (TBHQ) through in vitro reaction with Calf Thymus DNA and 2‧deoxyguanosine

    NASA Astrophysics Data System (ADS)

    Budiawan; Purwaningsih, S. S.; Cahaya, D. I.

    2017-04-01

    Butylated Hydroxyanisole (BHA) and its metabolite Tert-Butyl Hydroquinone (TBHQ) are synthetic antioxidants, commonly used as food and beverage preservatives. Although WHO declared their safety, the use of these preservatives are still controversial because some studies showed that BHA induced proliferative effects in animal testing and TBHQ is considered as carcinogenic and causes DNA cleavage. This study is aimed to analyze the interaction between Calf Thymus DNA with BHA and TBHQ which are mediated with Copper (II) Chloride. The result of the study in spectrophotometric showed there was bathochromic shift as much as 2-3 nm in DNA treated with TBHQ. The next analysis used HPLC method in stationary phase of ODS, mobile phase of 10mM Natrium Hydrogen Phosphate Buffer and Methanol (85 : 15) for DNA adduct formation, 8-Hydroxy-2-Deoxyguanosine (8-OHDG) as biomarker of risk cancer. The resultof the study showed the formation of DNA adduct 8-OHDG in the interaction between DNA and 20-500 ppm of TBHQ. The 8-OHdG formation was greatly increased by the higher concentration of TBHQ. The relative amount of 8 OHDG which formed was reached 946/105 deoxyguanosine in DNA bases. Confirmation test by LCMS/MS was characterized with the detection of mother ion peak (m/z 284); fragment ion peaks at m/z 167.9, and 139.9; at retention time 3.52 min. Meanwhile the interaction between DNA and 50-250 ppm BHA did not induce 8-OHDG.

  6. Binding to the minor groove of the double-strand, tau protein prevents DNA from damage by peroxidation.

    PubMed

    Wei, Yan; Qu, Mei-Hua; Wang, Xing-Sheng; Chen, Lan; Wang, Dong-Liang; Liu, Ying; Hua, Qian; He, Rong-Qiao

    2008-07-02

    Tau, an important microtubule associated protein, has been found to bind to DNA, and to be localized in the nuclei of both neurons and some non-neuronal cells. Here, using electrophoretic mobility shifting assay (EMSA) in the presence of DNA with different chain-lengths, we observed that tau protein favored binding to a 13 bp or a longer polynucleotide. The results from atomic force microscopy also showed that tau protein preferred a 13 bp polynucleotide to a 12 bp or shorter polynucleotide. In a competitive assay, a minor groove binder distamycin A was able to replace the bound tau from the DNA double helix, indicating that tau protein binds to the minor groove. Tau protein was able to protect the double-strand from digestion in the presence of DNase I that was bound to the minor groove. On the other hand, a major groove binder methyl green as a negative competitor exhibited little effect on the retardation of tau-DNA complex in EMSA. This further indicates the DNA minor groove as the binding site for tau protein. EMSA with truncated tau proteins showed that both the proline-rich domain (PRD) and the microtubule-binding domain (MTBD) contributed to the interaction with DNA; that is to say, both PRD and MTBD bound to the minor groove of DNA and bent the double-strand, as observed by electron microscopy. To investigate whether tau protein is able to prevent DNA from the impairment by hydroxyl free radical, the chemiluminescence emitted by the phen-Cu/H(2)O(2)/ascorbate was measured. The emission intensity of the luminescence was markedly decreased when tau protein was present, suggesting a significant protection of DNA from the damage in the presence of hydroxyl free radical.

  7. DNA binding specificity of the basic-helix-loop-helix protein MASH-1.

    PubMed

    Meierhan, D; el-Ariss, C; Neuenschwander, M; Sieber, M; Stackhouse, J F; Allemann, R K

    1995-09-05

    Despite the high degree of sequence similarity in their basic-helix-loop-helix (BHLH) domains, MASH-1 and MyoD are involved in different biological processes. In order to define possible differences between the DNA binding specificities of these two proteins, we investigated the DNA binding properties of MASH-1 by circular dichroism spectroscopy and by electrophoretic mobility shift assays (EMSA). Upon binding to DNA, the BHLH domain of MASH-1 underwent a conformational change from a mainly unfolded to a largely alpha-helical form, and surprisingly, this change was independent of the specific DNA sequence. The same conformational transition could be induced by the addition of 20% 2,2,2-trifluoroethanol. The apparent dissociation constants (KD) of the complexes of full-length MASH-1 with various oligonucleotides were determined from half-saturation points in EMSAs. MASH-1 bound as a dimer to DNA sequences containing an E-box with high affinity KD = 1.4-4.1 x 10(-14) M2). However, the specificity of DNA binding was low. The dissociation constant for the complex between MASH-1 and the highest affinity E-box sequence (KD = 1.4 x 10(-14) M2) was only a factor of 10 smaller than for completely unrelated DNA sequences (KD = approximately 1 x 10(-13) M2). The DNA binding specificity of MASH-1 was not significantly increased by the formation of an heterodimer with the ubiquitous E12 protein. MASH-1 and MyoD displayed similar binding site preferences, suggesting that their different target gene specificities cannot be explained solely by differential DNA binding. An explanation for these findings is provided on the basis of the known crystal structure of the BHLH domain of MyoD.

  8. Development of 19F-NMR chemical shift detection of DNA B-Z equilibrium using 19F-NMR.

    PubMed

    Nakamura, S; Yang, H; Hirata, C; Kersaudy, F; Fujimoto, K

    2017-06-28

    Various DNA conformational changes are in correlation with biological events. In particular, DNA B-Z equilibrium showed a high correlation with translation and transcription. In this study, we developed a DNA probe containing 5-trifluoromethylcytidine or 5-trifluoromethylthymidine to detect DNA B-Z equilibrium using 19 F-NMR. Its probe enabled the quantitative detection of B-, Z-, and ss-DNA based on 19 F-NMR chemical shift change.

  9. E2F mediates induction of the Sp1-controlled promoter of the human DNA polymerase ɛ B-subunit gene POLE2

    PubMed Central

    Huang, Deqi; Jokela, Maarit; Tuusa, Jussi; Skog, Sven; Poikonen, Kari; Syväoja, Juhani E.

    2001-01-01

    The B-subunits of replicative DNA polymerases from Archaea to humans belong to the same protein family, suggesting that they share a common fundamental function. We report here the gene structure for the B-subunit of human DNA polymerase ɛ (POLE2), whose expression and transcriptional regulation is typical for replication proteins with some unique features. The 75 bp core promoter region, located within exon 1, contains an Sp1 element that is a critical determinant of promoter activity as shown by the luciferase reporter, electrophoretic mobility shift and DNase I footprinting assays. Two overlapping E2F elements adjacent to the Sp1 element are essential for full promoter activity and serum response. Binding sites for E2F1 and NF-1 reside immediately downstream from the core promoter region. Our results suggest that human POLE2 is regulated by two E2F–pocket protein complexes, one associated with Sp1 and the other with NF-1. So far, only one replicative DNA polymerase B-subunit gene promoter, POLA2 encoding the B-subunit of DNA polymerase α, has been characterized. Mitogenic activation of the POLE2 promoter by an E2F-mediated mechanism resembles that of POLA2, but the regulation of basal promoter activity is different between these two genes. PMID:11433027

  10. Analysis of the regulation of viral transcription.

    PubMed

    Gloss, Bernd; Kalantari, Mina; Bernard, Hans-Ulrich

    2005-01-01

    Despite the small genomes and number of genes of papillomaviruses, regulation of their transcription is very complex and governed by numerous transcription factors, cis-responsive elements, and epigenetic phenomena. This chapter describes the strategies of how one can approach a systematic analysis of these factors, elements, and mechanisms. From the numerous different techniques useful for studying transcription, we describe in detail three selected protocols of approaches that have been relevant in shaping our knowledge of human papillomavirus transcription. These are DNAse I protection ("footprinting") for location of transcription-factor binding sites, electrophoretic mobility shifts ("gelshifts") for analysis of bound transcription factors, and bisulfite sequencing for analysis of DNA methylation as a prerequisite for epigenetic transcriptional regulation.

  11. Bacillus subtilis 168 Contains Two Differentially Regulated Genes Encoding l-Asparaginase

    PubMed Central

    Fisher, Susan H.; Wray, Lewis V.

    2002-01-01

    Expression of the two Bacillus subtilis genes encoding l-asparaginase is controlled by independent regulatory factors. The ansZ gene (formerly yccC) was shown by mutational analysis to encode a functional l-asparaginase, the expression of which is activated during nitrogen-limited growth by the TnrA transcription factor. Gel mobility shift and DNase I footprinting experiments indicate that TnrA regulates ansZ expression by binding to a DNA site located upstream of the ansZ promoter. The expression of the ansA gene, which encodes the second l-asparaginase, was found to be induced by asparagine. The ansA repressor, AnsR, was shown to negatively regulate its own expression. PMID:11914346

  12. Bacillus subtilis 168 contains two differentially regulated genes encoding L-asparaginase.

    PubMed

    Fisher, Susan H; Wray, Lewis V

    2002-04-01

    Expression of the two Bacillus subtilis genes encoding L-asparaginase is controlled by independent regulatory factors. The ansZ gene (formerly yccC) was shown by mutational analysis to encode a functional L-asparaginase, the expression of which is activated during nitrogen-limited growth by the TnrA transcription factor. Gel mobility shift and DNase I footprinting experiments indicate that TnrA regulates ansZ expression by binding to a DNA site located upstream of the ansZ promoter. The expression of the ansA gene, which encodes the second L-asparaginase, was found to be induced by asparagine. The ansA repressor, AnsR, was shown to negatively regulate its own expression.

  13. Structural and biophysical properties of h-FANCI ARM repeat protein.

    PubMed

    Siddiqui, Mohd Quadir; Choudhary, Rajan Kumar; Thapa, Pankaj; Kulkarni, Neha; Rajpurohit, Yogendra S; Misra, Hari S; Gadewal, Nikhil; Kumar, Satish; Hasan, Syed K; Varma, Ashok K

    2017-11-01

    Fanconi anemia complementation groups - I (FANCI) protein facilitates DNA ICL (Inter-Cross-link) repair and plays a crucial role in genomic integrity. FANCI is a 1328 amino acids protein which contains armadillo (ARM) repeats and EDGE motif at the C-terminus. ARM repeats are functionally diverse and evolutionarily conserved domain that plays a pivotal role in protein-protein and protein-DNA interactions. Considering the importance of ARM repeats, we have explored comprehensive in silico and in vitro approach to examine folding pattern. Size exclusion chromatography, dynamic light scattering (DLS) and glutaraldehyde crosslinking studies suggest that FANCI ARM repeat exist as monomer as well as in oligomeric forms. Circular dichroism (CD) and fluorescence spectroscopy results demonstrate that protein has predominantly α- helices and well-folded tertiary structure. DNA binding was analysed using electrophoretic mobility shift assay by autoradiography. Temperature-dependent CD, Fluorescence spectroscopy and DLS studies concluded that protein unfolds and start forming oligomer from 30°C. The existence of stable portion within FANCI ARM repeat was examined using limited proteolysis and mass spectrometry. The normal mode analysis, molecular dynamics and principal component analysis demonstrated that helix-turn-helix (HTH) motif present in ARM repeat is highly dynamic and has anti-correlated motion. Furthermore, FANCI ARM repeat has HTH structural motif which binds to double-stranded DNA.

  14. Quantitative analysis of TALE-DNA interactions suggests polarity effects.

    PubMed

    Meckler, Joshua F; Bhakta, Mital S; Kim, Moon-Soo; Ovadia, Robert; Habrian, Chris H; Zykovich, Artem; Yu, Abigail; Lockwood, Sarah H; Morbitzer, Robert; Elsäesser, Janett; Lahaye, Thomas; Segal, David J; Baldwin, Enoch P

    2013-04-01

    Transcription activator-like effectors (TALEs) have revolutionized the field of genome engineering. We present here a systematic assessment of TALE DNA recognition, using quantitative electrophoretic mobility shift assays and reporter gene activation assays. Within TALE proteins, tandem 34-amino acid repeats recognize one base pair each and direct sequence-specific DNA binding through repeat variable di-residues (RVDs). We found that RVD choice can affect affinity by four orders of magnitude, with the relative RVD contribution in the order NG > HD ≈ NN > NI > NK. The NN repeat preferred the base G over A, whereas the NK repeat bound G with 10(3)-fold lower affinity. We compared AvrBs3, a naturally occurring TALE that recognizes its target using some atypical RVD-base combinations, with a designed TALE that precisely matches 'standard' RVDs with the target bases. This comparison revealed unexpected differences in sensitivity to substitutions of the invariant 5'-T. Another surprising observation was that base mismatches at the 5' end of the target site had more disruptive effects on affinity than those at the 3' end, particularly in designed TALEs. These results provide evidence that TALE-DNA recognition exhibits a hitherto un-described polarity effect, in which the N-terminal repeats contribute more to affinity than C-terminal ones.

  15. The clpB gene of Bifidobacterium breve UCC 2003: transcriptional analysis and first insights into stress induction.

    PubMed

    Ventura, Marco; Kenny, John G; Zhang, Ziding; Fitzgerald, Gerald F; van Sinderen, Douwe

    2005-09-01

    The so-called clp genes, which encode components of the Clp proteolytic complex, are widespread among bacteria. The Bifidobacterium breve UCC 2003 genome contains a clpB gene with significant homology to predicted clpB genes from other members of the Actinobacteridae group. The heat- and osmotic-inducibility of the B. breve UCC 2003 clpB homologue was verified by slot-blot analysis, while Northern blot and primer extension analyses showed that the clpB gene is transcribed as a monocistronic unit with a single promoter. The role of a hspR homologue, known to control the regulation of clpB and dnaK gene expression in other high G+C content bacteria was investigated by gel mobility shift assays. Moreover the predicted 3D structure of HspR provides further insight into the binding mode of this protein to the clpB promoter region, and highlights the key amino acid residues believed to be involved in the protein-DNA interaction.

  16. High mobility organic field-effect transistor based on water-soluble deoxyribonucleic acid via spray coating

    NASA Astrophysics Data System (ADS)

    Shi, Wei; Han, Shijiao; Huang, Wei; Yu, Junsheng

    2015-01-01

    High mobility organic field-effect transistors (OFETs) by inserting water-soluble deoxyribonucleic acid (DNA) buffer layer between electrodes and pentacene film through spray coating process were fabricated. Compared with the OFETs incorporated with DNA in the conventional organic solvents of ethanol and methanol: water mixture, the water-soluble DNA based OFET exhibited an over four folds enhancement of field-effect mobility from 0.035 to 0.153 cm2/Vs. By characterizing the surface morphology and the crystalline structure of pentacene active layer through atomic force microscope and X-ray diffraction, it was found that the adoption of water solvent in DNA solution, which played a key role in enhancing the field-effect mobility, was ascribed to both the elimination of the irreversible organic solvent-induced bulk-like phase transition of pentacene film and the diminution of a majority of charge trapping at interfaces in OFETs.

  17. Oxazine dye-conjugated dna oligonucleotides: Förster resonance energy transfer in view of molecular dye-DNA interactions.

    PubMed

    Kupstat, Annette; Ritschel, Thomas; Kumke, Michael U

    2011-12-21

    In this work, the photophysical properties of two oxazine dyes (ATTO 610 and ATTO 680) covalently attached via a C6-amino linker to the 5'-end of short single-stranded as well as double-stranded DNA (ssDNA and dsDNA, respectively) of different lengths were investigated. The two oxazine dyes were chosen because of the excellent spectral overlap, the high extinction coefficients, and the high fluorescence quantum yield of ATTO 610, making them an attractive Förster resonance energy transfer (FRET) pair for bioanalytical applications in the far-red spectral range. To identify possible molecular dye-DNA interactions that cause photophysical alterations, we performed a detailed spectroscopic study, including time-resolved fluorescence anisotropy and fluorescence correlation spectroscopy measurements. As an effect of the DNA conjugation, the absorption and fluorescence maxima of both dyes were bathochromically shifted and the fluorescence decay times were increased. Moreover, the absorption of conjugated ATTO 610 was spectrally broadened, and a dual fluorescence emission was observed. Steric interactions with ssDNA as well as dsDNA were found for both dyes. The dye-DNA interactions were strengthened from ssDNA to dsDNA conjugates, pointing toward interactions with specific dsDNA domains (such as the top of the double helix). Although these interactions partially blocked the dye-linker rotation, a free (unhindered) rotational mobility of at least one dye facilitated the appropriate alignment of the transition dipole moments in doubly labeled ATTO 610/ATTO 680-dsDNA conjugates for the performance of successful FRET. Considering the high linker flexibility for the determination of the donor-acceptor distances, good accordance between theoretical and experimental FRET parameters was obtained. The considerably large Förster distance of ~7 nm recommends the application of this FRET pair not only for the detection of binding reactions between nucleic acids in living cells but also for monitoring interactions of larger biomolecules such as proteins.

  18. Gel electrophoresis of linear and star-branched DNA

    NASA Astrophysics Data System (ADS)

    Lau, Henry W.; Archer, Lynden A.

    2011-12-01

    The electrophoretic mobility of double-stranded DNA in polyacrylamide gel is investigated using an activated hopping model for the transport of a charged object within a heterogeneous medium. The model is premised upon a representation of the DNA path through the gel matrix as a series of traps with alternating large and small cross sections. Calculations of the trap dimensions from gel data show that the path imposes varying degrees of confinement upon migrating analytes, which retard their forward motion in a size-dependent manner. An expression derived for DNA mobility is shown to provide accurate predictions for the dynamics of linear DNA (67-622 bp) in gels of multiple concentrations. For star-branched DNA, the incorporation within the model of a length scale previously proposed to account for analyte architecture [Yuan , Anal. Chem.ANCHAM0003-270010.1021/ac060414w 78, 6179 (2006)] leads to mobility predictions that compare well with experimental results for a wide range of DNA shapes and molecular weights.

  19. High-mobility group (HMG) protein HMG-1 and TATA-binding protein-associated factor TAF(II)30 affect estrogen receptor-mediated transcriptional activation.

    PubMed

    Verrier, C S; Roodi, N; Yee, C J; Bailey, L R; Jensen, R A; Bustin, M; Parl, F F

    1997-07-01

    The estrogen receptor (ER) belongs to a family of ligand-inducible nuclear receptors that exert their effects by binding to cis-acting DNA elements in the regulatory region of target genes. The detailed mechanisms by which ER interacts with the estrogen response element (ERE) and affects transcription still remain to be elucidated. To study the ER-ERE interaction and transcription initiation, we employed purified recombinant ER expressed in both the baculovirus-Sf9 and his-tagged bacterial systems. The effect of high-mobility group (HMG) protein HMG-1 and purified recombinant TATA-binding protein-associated factor TAF(II)30 on ER-ERE binding and transcription initiation were assessed by electrophoretic mobility shift assay and in vitro transcription from an ERE-containing template (pERE2LovTATA), respectively. We find that purified, recombinant ER fails to bind to ERE in spite of high ligand-binding activity and electrophoretic and immunological properties identical to ER in MCF-7 breast cancer cells. HMG-1 interacts with ER and promotes ER-ERE binding in a concentration- and time-dependent manner. The effectiveness of HMG-1 to stimulate ER-ERE binding in the electrophoretic mobility shift assay depends on the sequence flanking the ERE consensus as well as the position of the latter in the oligonucleotide. We find that TAF(II)30 has no effect on ER-ERE binding either alone or in combination with ER and HMG-1. Although HMG-1 promotes ER-ERE binding, it fails to stimulate transcription initiation either in the presence or absence of hormone. In contrast, TAF(II)30, while not affecting ER-ERE binding, stimulates transcription initiation 20-fold in the presence of HMG-1. These results indicate that HMG-1 and TAF(II)30 act in sequence, the former acting to promote ER-ERE binding followed by the latter to stimulate transcription initiation.

  20. Targeting of Arabidopsis KNL2 to Centromeres Depends on the Conserved CENPC-k Motif in Its C Terminus.

    PubMed

    Sandmann, Michael; Talbert, Paul; Demidov, Dmitri; Kuhlmann, Markus; Rutten, Twan; Conrad, Udo; Lermontova, Inna

    2017-01-01

    KINETOCHORE NULL2 (KNL2) is involved in recognition of centromeres and in centromeric localization of the centromere-specific histone cenH3. Our study revealed a cenH3 nucleosome binding CENPC-k motif at the C terminus of Arabidopsis thaliana KNL2, which is conserved among a wide spectrum of eukaryotes. Centromeric localization of KNL2 is abolished by deletion of the CENPC-k motif and by mutating single conserved amino acids, but can be restored by insertion of the corresponding motif of Arabidopsis CENP-C. We showed by electrophoretic mobility shift assay that the C terminus of KNL2 binds DNA sequence-independently and interacts with the centromeric transcripts in vitro. Chromatin immunoprecipitation with anti-KNL2 antibodies indicated that in vivo KNL2 is preferentially associated with the centromeric repeat pAL1 Complete deletion of the CENPC-k motif did not influence its ability to interact with DNA in vitro. Therefore, we suggest that KNL2 recognizes centromeric nucleosomes, similar to CENP-C, via the CENPC-k motif and binds adjoining DNA. © 2017 American Society of Plant Biologists. All rights reserved.

  1. Increased expression of Aspergillus parasiticus aflR, encoding a sequence-specific DNA-binding protein, relieves nitrate inhibition of aflatoxin biosynthesis.

    PubMed Central

    Chang, P K; Ehrlich, K C; Yu, J; Bhatnagar, D; Cleveland, T E

    1995-01-01

    The aflR gene from Aspergillus parasiticus and Aspergillus flavus may be involved in the regulation of aflatoxin biosynthesis. The aflR gene product, AFLR, possesses a GAL4-type binuclear zinc finger DNA-binding domain. A transformant, SU1-N3 (pHSP), containing an additional copy of aflR, showed increased transcription of aflR and the aflatoxin pathway structural genes, nor-1, ver-1, and omt-1, when cells were grown in nitrate medium, which normally suppresses aflatoxin production. Electrophoretic mobility shift assays showed that the recombinant protein containing the DNA-binding domain, AFLR1, bound specifically to the palindromic sequence, TTAGGCCTAA, 120 bp upstream of the AFLR translation start site. Expression of aflR thus appears to be autoregulated. Increased expression of aflatoxin biosynthetic genes in the transformant might result from an elevated basal level of AFLR, allowing it to overcome nitrate inhibition and to bind to the aflR promotor region, thereby initiating aflatoxin biosynthesis. Results further suggest that aflR is involved in the regulation of multiple parts of the aflatoxin biosynthetic pathway. PMID:7793958

  2. Transcriptional regulation of the Borrelia burgdorferi antigenically variable VlsE surface protein.

    PubMed

    Bykowski, Tomasz; Babb, Kelly; von Lackum, Kate; Riley, Sean P; Norris, Steven J; Stevenson, Brian

    2006-07-01

    The Lyme disease agent Borrelia burgdorferi can persistently infect humans and other animals despite host active immune responses. This is facilitated, in part, by the vls locus, a complex system consisting of the vlsE expression site and an adjacent set of 11 to 15 silent vls cassettes. Segments of nonexpressed cassettes recombine with the vlsE region during infection of mammalian hosts, resulting in combinatorial antigenic variation of the VlsE outer surface protein. We now demonstrate that synthesis of VlsE is regulated during the natural mammal-tick infectious cycle, being activated in mammals but repressed during tick colonization. Examination of cultured B. burgdorferi cells indicated that the spirochete controls vlsE transcription levels in response to environmental cues. Analysis of PvlsE::gfp fusions in B. burgdorferi indicated that VlsE production is controlled at the level of transcriptional initiation, and regions of 5' DNA involved in the regulation were identified. Electrophoretic mobility shift assays detected qualitative and quantitative changes in patterns of protein-DNA complexes formed between the vlsE promoter and cytoplasmic proteins, suggesting the involvement of DNA-binding proteins in the regulation of vlsE, with at least one protein acting as a transcriptional activator.

  3. Recognition of the CDEI motif GTCACATG by mouse nuclear proteins and interference with the early development of the mouse embryo.

    PubMed Central

    Blangy, A; Léopold, P; Vidal, F; Rassoulzadegan, M; Cuzin, F

    1991-01-01

    We have reported previously (1) two unexpected consequences of the microinjection into fertilized mouse eggs of a recombinant plasmid designated p12B1, carrying a 343 bp insert of non-repetitive mouse DNA. Injected at very low concentrations, this plasmid could be established as an extrachromosomal genetic element. When injected in greater concentration, an early arrest of embryonic development resulted. In the present work, we have studied this toxic effect in more detail by microinjecting short synthetic oligonucleotides with sequences from the mouse insert. Lethality was associated with the nucleotide sequence GTCACATG, identical with the CDEl element of yeast centromeres. Development of injected embryos was arrested between the one-cell and the early morula stages, with abnormal structures and DNA contents. Electrophoretic mobility shift and DNAse foot-printing assays demonstrated the binding of mouse nuclear protein(s) to the CDEl-like box. Base changes within the CDEl sequence prevented both the toxic effects in embryos and the formation of protein complex in vitro, suggesting that protein binding at such sites in chromosomal DNA plays an important role in early development. Images PMID:1766880

  4. Electrophoresis of DNA in agarose gels, polyacrylamide gels and in free solution

    PubMed Central

    Stellwagen, Nancy C.

    2009-01-01

    This review describes the electrophoresis of curved and normal DNA molecules in agarose gels, polyacrylamide gels and in free solution. These studies were undertaken to clarify why curved DNA molecules migrate anomalously slowly in polyacrylamide gels but not in agarose gels. Two milestone papers are cited, in which Ferguson plots were used to estimate the effective pore size of agarose and polyacrylamide gels. Subsequent studies on the effect of the electric field on agarose and polyacrylamide gel matrices, DNA interactions with the two gel matrices, and the effect of curvature on the free solution mobility of DNA are also described. The combined results suggest that the anomalously slow mobilities observed for curved DNA molecules in polyacrylamide gels are due primarily to preferential interactions of curved DNAs with the polyacrylamide gel matrix; the restrictive pore size of the matrix is of lesser importance. In free solution, DNA mobilities increase with increasing molecular mass until leveling off at a plateau value of (3.17 ± 0.01) × 10-4 cm2/Vs in 40 mM Tris-acetate-EDTA buffer at 20°C. Curved DNA molecules migrate anomalously slowly in free solution as well as in polyacrylamide gels, explaining why the Ferguson plots of curved and normal DNAs containing the same number of base pairs extrapolate to different mobilities at zero gel concentration. PMID:19517510

  5. Opaque-2 is a transcriptional activator that recognizes a specific target site in 22-kD zein genes.

    PubMed Central

    Schmidt, R J; Ketudat, M; Aukerman, M J; Hoschek, G

    1992-01-01

    opaque-2 (o2) is a regulatory locus in maize that plays an essential role in controlling the expression of genes encoding the 22-kD zein proteins. Through DNase I footprinting and DNA binding analyses, we have identified the binding site for the O2 protein (O2) in the promoter of 22-kD zein genes. The sequence in the 22-kD zein gene promoter that is recognized by O2 is similar to the target site recognized by other "basic/leucine zipper" (bZIP) proteins in that it contains an ACGT core that is necessary for DNA binding. The site is located in the -300 region relative to the translation start and lies about 20 bp downstream of the highly conserved zein gene sequence motif known as the "prolamin box." Employing gel mobility shift assays, we used O2 antibodies and nuclear extracts from an o2 null mutant to demonstrate that the O2 protein in maize endosperm nuclei recognizes the target site in the zein gene promoter. Mobility shift assays using nuclear proteins from an o2 null mutant indicated that other endosperm proteins in addition to O2 can bind the O2 target site and that O2 may be associated with one of these proteins. We also demonstrated that in yeast cells the O2 protein can activate expression of a lacZ gene containing a multimer of the O2 target sequence as part of its promoter, thus confirming its role as a transcriptional activator. A computer-assisted search indicated that the O2 target site is not present in the promoters of zein genes other than those of the 22-kD class. These data suggest a likely explanation at the molecular level for the differential effect of o2 mutations on expression of certain members of the zein gene family. PMID:1392590

  6. Regulatory motifs for CREB-binding protein and Nfe2l2 transcription factors in the upstream enhancer of the mitochondrial uncoupling protein 1 gene.

    PubMed

    Rim, Jong S; Kozak, Leslie P

    2002-09-13

    Thermogenesis against cold exposure in mammals occurs in brown adipose tissue (BAT) through mitochondrial uncoupling protein (UCP1). Expression of the Ucp1 gene is unique in brown adipocytes and is regulated tightly. The 5'-flanking region of the mouse Ucp1 gene contains cis-acting elements including PPRE, TRE, and four half-site cAMP-responsive elements (CRE) with BAT-specific enhancer elements. In the course of analyzing how these half-site CREs are involved in Ucp1 expression, we found that a DNA regulatory element for NF-E2 overlaps CRE2. Electrophoretic mobility shift assay and competition assays with the CRE2 element indicates that nuclear proteins from BAT, inguinal fat, and retroperitoneal fat tissue interact with the CRE2 motif (CGTCA) in a specific manner. A supershift assay using an antibody against the CRE-binding protein (CREB) shows specific affinity to the complex from CRE2 and nuclear extract of BAT. Additionally, Western blot analysis for phospho-CREB/ATF1 shows an increase in phosphorylation of CREB/ATF1 in HIB-1B cells after norepinephrine treatment. Transient transfection assay using luciferase reporter constructs also indicates that the two half-site CREs are involved in transcriptional regulation of Ucp1 in response to norepinephrine and cAMP. We also show that a second DNA regulatory element for NF-E2 is located upstream of the CRE2 region. This element, which is found in a similar location in the 5'-flanking region of the human and rodent Ucp1 genes, shows specific binding to rat and human NF-E2 by electrophoretic mobility shift assay with nuclear extracts from brown fat. Co-transfections with an Nfe2l2 expression vector and a luciferase reporter construct of the Ucp1 enhancer region provide additional evidence that Nfe2l2 is involved in the regulation of Ucp1 by cAMP-mediated signaling.

  7. Carrier recovery techniques on satellite mobile channels

    NASA Technical Reports Server (NTRS)

    Vucetic, B.; Du, J.

    1990-01-01

    An analytical method and a stored channel model were used to evaluate error performance of uncoded quadrature phase shift keying (QPSK) and M-ary phase shift keying (MPSK) trellis coded modulation (TCM) over shadowed satellite mobile channels in the presence of phase jitter for various carrier recovery techniques.

  8. A novel class of plant-specific zinc-dependent DNA-binding protein that binds to A/T-rich DNA sequences

    PubMed Central

    Nagano, Yukio; Furuhashi, Hirofumi; Inaba, Takehito; Sasaki, Yukiko

    2001-01-01

    Complementary DNA encoding a DNA-binding protein, designated PLATZ1 (plant AT-rich sequence- and zinc-binding protein 1), was isolated from peas. The amino acid sequence of the protein is similar to those of other uncharacterized proteins predicted from the genome sequences of higher plants. However, no paralogous sequences have been found outside the plant kingdom. Multiple alignments among these paralogous proteins show that several cysteine and histidine residues are invariant, suggesting that these proteins are a novel class of zinc-dependent DNA-binding proteins with two distantly located regions, C-x2-H-x11-C-x2-C-x(4–5)-C-x2-C-x(3–7)-H-x2-H and C-x2-C-x(10–11)-C-x3-C. In an electrophoretic mobility shift assay, the zinc chelator 1,10-o-phenanthroline inhibited DNA binding, and two distant zinc-binding regions were required for DNA binding. A protein blot with 65ZnCl2 showed that both regions are required for zinc-binding activity. The PLATZ1 protein non-specifically binds to A/T-rich sequences, including the upstream region of the pea GTPase pra2 and plastocyanin petE genes. Expression of the PLATZ1 repressed those of the reporter constructs containing the coding sequence of luciferase gene driven by the cauliflower mosaic virus (CaMV) 35S90 promoter fused to the tandem repeat of the A/T-rich sequences. These results indicate that PLATZ1 is a novel class of plant-specific zinc-dependent DNA-binding protein responsible for A/T-rich sequence-mediated transcriptional repression. PMID:11600698

  9. Oxidation of a critical methionine modulates DNA binding of the Drosophila melanogaster high mobility group protein, HMG-D.

    PubMed

    Dow, L K; Changela, A; Hefner, H E; Churchill, M E

    1997-09-15

    HMG-D is a major high mobility group chromosomal protein present during early embryogenesis in Drosophila melanogaster. During overexpression and purification of HMG-D from E. coli, a key DNA binding residue, methionine 13, undergoes oxidation to methionine sulfoxide. Oxidation of this critical residue decreases the affinity of HMG-D for DNA by three-fold, altering the structure of the HMG-D-DNA complex without affecting the structure of the free protein. This work shows that minor modification of DNA intercalating residues may be used to fine tune the DNA binding affinity of HMG domain proteins.

  10. Analytical methods to determine the comparative DNA binding studies of curcumin-Cu(II) complexes

    NASA Astrophysics Data System (ADS)

    Rajesh, Jegathalaprathaban; Rajasekaran, Marichamy; Rajagopal, Gurusamy; Athappan, Periakaruppan

    2012-11-01

    DNA interaction studies of two mononuclear [1:1(1); 1:2(2)] copper(II) complexes of curcumin have been studied. The interaction of these complexes with CT-DNA has been explored by physical methods to propose modes of DNA binding of the complexes. Absorption spectral titrations of complex 1 with CT-DNA shows a red-shift of 3 nm with the DNA binding affinity of Kb, 5.21 × 104 M-1 that are higher than that obtained for 2 (red-shift, 2 nm; Kb, 1.73 × 104 M-1) reveal that the binding occurs in grooves as a result of the interaction is via exterior phosphates. The CD spectra of these Cu(II) complexes show a red shift of 3-10 nm in the positive band with increase in intensities. This spectral change of induced CD due to the hydrophobic interaction of copper complexes with DNA is the characteristic of B to A conformational change. The EB displacement assay also reveals the same trend as observed in UV-Vis spectral titration. The addition of complexes 1 and 2 to the DNA bound ethidium bromide (EB) solutions causes an obvious reduction in emission intensities indicating that these complexes competitively bind to DNA with EB. The positive shift of both the Epc and E0' accompanied by reduction of peak currents in differential pulse voltammogram (DPV), upon adding different concentrations of DNA to the metal complexes, are obviously in favor of strong binding to DNA. The super coiled plasmid pUC18 DNA cleavage ability of Cu(II) complexes in the presence of reducing agent reveals the single strand DNA cleavage (ssDNA) is observed. The hydroxyl radical (HOrad ) and the singlet oxygen are believed to be the reactive species responsible for the cleavage.

  11. Single DNA imaging and length quantification through a mobile phone microscope

    NASA Astrophysics Data System (ADS)

    Wei, Qingshan; Luo, Wei; Chiang, Samuel; Kappel, Tara; Mejia, Crystal; Tseng, Derek; Chan, Raymond Yan L.; Yan, Eddie; Qi, Hangfei; Shabbir, Faizan; Ozkan, Haydar; Feng, Steve; Ozcan, Aydogan

    2016-03-01

    The development of sensitive optical microscopy methods for the detection of single DNA molecules has become an active research area which cultivates various promising applications including point-of-care (POC) genetic testing and diagnostics. Direct visualization of individual DNA molecules usually relies on sophisticated optical microscopes that are mostly available in well-equipped laboratories. For POC DNA testing/detection, there is an increasing need for the development of new single DNA imaging and sensing methods that are field-portable, cost-effective, and accessible for diagnostic applications in resource-limited or field-settings. For this aim, we developed a mobile-phone integrated fluorescence microscopy platform that allows imaging and sizing of single DNA molecules that are stretched on a chip. This handheld device contains an opto-mechanical attachment integrated onto a smartphone camera module, which creates a high signal-to-noise ratio dark-field imaging condition by using an oblique illumination/excitation configuration. Using this device, we demonstrated imaging of individual linearly stretched λ DNA molecules (48 kilobase-pair, kbp) over 2 mm2 field-of-view. We further developed a robust computational algorithm and a smartphone app that allowed the users to quickly quantify the length of each DNA fragment imaged using this mobile interface. The cellphone based device was tested by five different DNA samples (5, 10, 20, 40, and 48 kbp), and a sizing accuracy of <1 kbp was demonstrated for DNA strands longer than 10 kbp. This mobile DNA imaging and sizing platform can be very useful for various diagnostic applications including the detection of disease-specific genes and quantification of copy-number-variations at POC settings.

  12. Mangiferin activates the Nrf2-ARE pathway and reduces etoposide-induced DNA damage in human umbilical cord mononuclear blood cells.

    PubMed

    Zhang, Benping; Zhao, Jie; Li, Shanshan; Zeng, Linglan; Chen, Yan; Fang, Jun

    2015-04-01

    Mangiferin (2-C-β-d-gluco-pyranosyl-1,3,6,7-tetrahydroxyxanthone) is a well-known natural antioxidant distributed in various plants of the Anacardiaceae and Gentianaceae families. Mangiferin can inhibit carcinogen-induced lung or colon tumor formation in experimental animals. However, the molecular mechanisms of its chemopreventive activity remain unexplored. This study aimed to investigate the effects of mangiferin on chemical carcinogen-induced DNA damage and Nrf2-ARE signaling in hematopoietic cells. Mononuclear cells (MNCs) were isolated from human umbilical cord blood (hUCB). DNA damage was evaluated by comet and micronucleus assays. The expression of Nrf2 and NQO1 was examined by immunofluorescence and western blotting. An electrophoretic mobility shift assay (EMSA) was used to detect the binding activity of Nrf2 with NQO1-ARE sequences. We found that mangiferin treatment significantly reduced DNA damage in etoposide-treated MNCs, which was verified by decreased olive tail moment (OTM) and micronucleus (MN) frequency. Mangiferin treatment significantly promoted Nrf2 translocation into the nucleus and increased nuclear Nrf2 expression. Moreover, NQO1, an Nrf2 signaling target, was significantly upregulated by mangiferin treatment, and the binding activity of Nrf2 with NQO1-ARE sequences was elevated after mangiferin treatment. Mangiferin activated Nrf2 signaling, upregulated NQO1 expression, and significantly reduced etoposide-induced DNA damage. Thus, mangiferin is a potential cytoprotective agent for hematopoietic cells.

  13. DNA Binding Mode Transitions of Escherichia coli HUαβ: Evidence for Formation of a Bent DNA – Protein Complex on Intact, Linear Duplex DNA

    PubMed Central

    Koh, Junseock; Saecker, Ruth M.; Record, M. Thomas

    2008-01-01

    Escherichia coli HUαβ, a major nucleoid associated protein (NAP), organizes the DNA chromosome and facilitates numerous DNA transactions. Using isothermal titration calorimetry (ITC), fluorescence resonance energy transfer (FRET) and a series of DNA lengths (8, 15, 34, 38 and 160 base pairs) we establish that HUαβ interacts with duplex DNA using three different nonspecific binding modes. Both the HU to DNA mole ratio ([HU]/[DNA]) and DNA length dictate the dominant HU binding mode. On sufficiently long DNA (≥ 34 base pairs), at low [HU]/[DNA], HU populates a noncooperative 34 bp binding mode with a binding constant of 2.1 (± 0.4) × 106 M−1, and a binding enthalpy of +7.7 (± 0.6) kcal/mol at 15 °C and 0.15 M Na+. With increasing [HU]/[DNA], HU bound in the noncooperative 34 bp mode progressively converts to two cooperative (ω ~ 20) modes with site sizes of 10 bp and 6 bp. These latter modes exhibit smaller binding constants (1.1 (± 0.2) × 105 M−1 for the 10 bp mode, 3.5 (± 1.4) × 104 M−1 for the 6 bp mode) and binding enthalpies (4.2 (± 0.3) kcal/mol for the 10 bp mode, −1.6 (±0.3) kcal/mol for the 6 bp mode). As DNA length increases to 34 bp or more at low [HU]/[DNA], the small modes are replaced by the 34 bp binding mode. FRET data demonstrate that the 34 bp mode bends DNA by 143 ± 6° whereas the 6 and 10 bp modes do not. The model proposed in this study provides a novel quantitative and comprehensive framework for reconciling previous structural and solution studies of HU, including single molecule (force extension measurement, AFM), fluorescence, and electrophoretic gel mobility shift assays. In particular, it explains how HU condenses or extends DNA depending on the relative concentrations of HU and DNA. PMID:18657548

  14. Mobile phone radiofrequency exposure has no effect on DNA double strand breaks (DSB) in human lymphocytes.

    PubMed

    Danese, Elisa; Lippi, Giuseppe; Buonocore, Ruggero; Benati, Marco; Bovo, Chiara; Bonaguri, Chiara; Salvagno, Gian Luca; Brocco, Giorgio; Roggenbuck, Dirk; Montagnana, Martina

    2017-07-01

    The use of mobile phones has been associated with an increased risk of developing certain type of cancer, especially in long term users. Therefore, this study was aimed to investigate the potential genotoxic effect of mobile phone radiofrequency exposure on human peripheral blood mononuclear cells in vitro. The study population consisted in 14 healthy volunteers. After collection of two whole blood samples, the former was placed in a plastic rack, 1 cm from the chassis of a commercial mobile phone (900 MHz carrier frequency), which was activated by a 30-min call. The second blood sample was instead maintained far from mobile phones or other RF sources. The influence of mobile phone RF on DNA integrity was assessed by analyzing γ-H2AX foci in lymphocytes using immunofluorescence staining kit on AKLIDES. No measure of γ-H2AX foci was significantly influenced by mobile phone RF exposure, nor mobile phone exposure was associated with significant risk of genetic damages in vitro (odds ratio comprised between 0.27 and 1.00). The results of this experimental study demonstrate that exposure of human lymphocytes to a conventional 900 MHz RF emitted by a commercial mobile phone for 30 min does not significantly impact DNA integrity.

  15. High mobility organic field-effect transistor based on water-soluble deoxyribonucleic acid via spray coating

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shi, Wei; Han, Shijiao; Huang, Wei

    High mobility organic field-effect transistors (OFETs) by inserting water-soluble deoxyribonucleic acid (DNA) buffer layer between electrodes and pentacene film through spray coating process were fabricated. Compared with the OFETs incorporated with DNA in the conventional organic solvents of ethanol and methanol: water mixture, the water-soluble DNA based OFET exhibited an over four folds enhancement of field-effect mobility from 0.035 to 0.153 cm{sup 2}/Vs. By characterizing the surface morphology and the crystalline structure of pentacene active layer through atomic force microscope and X-ray diffraction, it was found that the adoption of water solvent in DNA solution, which played a key role inmore » enhancing the field-effect mobility, was ascribed to both the elimination of the irreversible organic solvent-induced bulk-like phase transition of pentacene film and the diminution of a majority of charge trapping at interfaces in OFETs.« less

  16. A DNA-Inspired Encryption Methodology for Secure, Mobile Ad Hoc Networks

    NASA Technical Reports Server (NTRS)

    Shaw, Harry

    2012-01-01

    Users are pushing for greater physical mobility with their network and Internet access. Mobile ad hoc networks (MANET) can provide an efficient mobile network architecture, but security is a key concern. A figure summarizes differences in the state of network security for MANET and fixed networks. MANETs require the ability to distinguish trusted peers, and tolerate the ingress/egress of nodes on an unscheduled basis. Because the networks by their very nature are mobile and self-organizing, use of a Public Key Infra structure (PKI), X.509 certificates, RSA, and nonce ex changes becomes problematic if the ideal of MANET is to be achieved. Molecular biology models such as DNA evolution can provide a basis for a proprietary security architecture that achieves high degrees of diffusion and confusion, and resistance to cryptanalysis. A proprietary encryption mechanism was developed that uses the principles of DNA replication and steganography (hidden word cryptography) for confidentiality and authentication. The foundation of the approach includes organization of coded words and messages using base pairs organized into genes, an expandable genome consisting of DNA-based chromosome keys, and a DNA-based message encoding, replication, and evolution and fitness. In evolutionary computing, a fitness algorithm determines whether candidate solutions, in this case encrypted messages, are sufficiently encrypted to be transmitted. The technology provides a mechanism for confidential electronic traffic over a MANET without a PKI for authenticating users.

  17. Micrometer-sized TPM emulsion droplets with surface-mobile binding groups

    NASA Astrophysics Data System (ADS)

    van der Wel, Casper; van de Stolpe, Guido L.; Verweij, Ruben W.; Kraft, Daniela J.

    2018-03-01

    Colloids coated with lipid membranes have been widely employed for fundamental studies of lipid membrane processes, biotechnological applications such as drug delivery and biosensing, and more recently, for self-assembly. The latter has been made possible by inserting DNA oligomers with covalently linked hydrophobic anchors into the membrane. The lateral mobility of the DNA linkers on micrometer-sized droplets and solid particles has opened the door to creating structures with unprecedented structural flexibility. Here, we investigate micro-emulsions of TPM (3-(trimethoxysilyl)propyl methacrylate) as a platform for lipid monolayers and further functionalization with proteins and DNA oligonucleotides. TPM droplets can be produced with a narrow size distribution and are polymerizable, thus providing supports for model lipid membranes with controlled size and curvature. With fluorescence recovery after photobleaching, we observed that droplet-attached lipids, NeutrAvidin proteins, as well as DNA oligonucleotides all show mobility on the surface. We explored the assembly of micron-sized particles on TPM-droplets by exploiting either avidin-biotin interactions or double-stranded DNA with complementary single-stranded end groups. While the single molecules are mobile, the particles that are attached to them are not. We propose that this is caused by the heterogeneous nature of emulsified TPM, which forms an oligomer network that limits the collective motion of linkers, but allows the surface mobility of individual molecules.

  18. DNA Methylation in the Neuropeptide S Receptor 1 (NPSR1) Promoter in Relation to Asthma and Environmental Factors

    PubMed Central

    Reinius, Lovisa E.; Gref, Anna; Sääf, Annika; Acevedo, Nathalie; Joerink, Maaike; Kupczyk, Maciej; D'Amato, Mauro; Bergström, Anna; Melén, Erik; Scheynius, Annika; Dahlén, Sven-Erik; Pershagen, Göran; Söderhäll, Cilla; Kere, Juha

    2013-01-01

    Asthma and allergy are complex disorders influenced by both inheritance and environment, a relationship that might be further clarified by epigenetics. Neuropeptide S Receptor 1 (NPSR1) has been associated with asthma and allergy and a study suggested modulation of the genetic risk by environmental factors. We aimed to study DNA methylation in the promoter region of NPSR1 in relation to asthma and environmental exposures. Electrophoretic Mobility Shift Assay (EMSA) was used to investigate potential functional roles of both genotypes and methylation status in the NPSR1 promoter. DNA methylation was analysed using EpiTYPER in blood samples from two well-characterized cohorts; the BIOAIR study of severe asthma in adults and the Swedish birth cohort BAMSE. We observed that DNA methylation and genetic variants in the promoter influenced the binding of nuclear proteins to DNA, suggesting functional relevance. Significant, although small, differences in methylation were related to both adult severe asthma (p = 0.0001) and childhood allergic asthma (p = 0.01). Furthermore, DNA methylation was associated with exposures such as current smoking in adults for two CpG sites (p = 0.005 and 0.04), parental smoking during infancy in the children (p = 0.02) and in which month the sample was taken (p = 0.01). In summary, DNA methylation levels in the promoter of NPSR1 showed small but significant associations with asthma, both in adults and in children, and to related traits such as allergy and certain environmental exposures. Both genetic variation and the methylated state of CpG sites seem to have an effect on the binding of nuclear proteins in the regulatory region of NPSR1 suggesting complex regulation of this gene in asthma and allergy. PMID:23372674

  19. DNA electrophoresis in agarose gels: effects of field and gel concentration on the exponential dependence of reciprocal mobility on DNA length.

    PubMed

    Rill, Randolph L; Beheshti, Afshin; Van Winkle, David H

    2002-08-01

    Electrophoretic mobilities of DNA molecules ranging in length from 200 to 48 502 base pairs (bp) were measured in agarose gels with concentrations T = 0.5% to 1.3% at electric fields from E = 0.71 to 5.0 V/cm. This broad data set determines a range of conditions over which the new interpolation equation nu(L) = (beta+alpha(1+exp(-L/gamma))(-1) can be used to relate mobility to length with high accuracy. Mobility data were fit with chi(2) > 0.999 for all gel concentrations and fields ranging from 2.5 to 5 V/cm, and for lower fields at low gel concentrations. Analyses using so-called reptation plots (Rousseau, J., Drouin, G., Slater, G. W., Phys. Rev. Lett. 1997, 79, 1945-1948) indicate that this simple exponential relation is obeyed well when there is a smooth transition from the Ogston sieving regime to the reptation regime with increasing DNA length. Deviations from this equation occur when DNA migration is hindered, apparently by entropic-trapping, which is favored at low fields and high gel concentrations in the ranges examined.

  20. Theory of nucleosome corkscrew sliding in the presence of synthetic DNA ligands.

    PubMed

    Mohammad-Rafiee, Farshid; Kulić, Igor M; Schiessel, Helmut

    2004-11-12

    Histone octamers show a heat-induced mobility along DNA. Recent theoretical studies have established two mechanisms that are qualitatively and quantitatively compatible with in vitro experiments on nucleosome sliding: octamer repositioning through one-base-pair twist defects and through ten-base-pair bulge defects. A recent experiment demonstrated that the repositioning is strongly suppressed in the presence of minor-groove binding DNA ligands. In the present study, we give a quantitative theory for nucleosome repositioning in the presence of such ligands. We show that the experimentally observed octamer mobilities are consistent with the picture of bound ligands blocking the passage of twist defects through the nucleosome. This strongly supports the model of twist defects inducing a corkscrew motion of the nucleosome as the underlying mechanism of nucleosome sliding. We provide a theoretical estimate of the nucleosomal mobility without adjustable parameters, as a function of ligand concentration, binding affinity, binding site orientation, temperature and DNA anisotropy. Having this mobility in hand, we speculate on the interaction between a nucleosome and a transcribing RNA polymerase, and suggest a novel mechanism that might account for polymerase-induced nucleosome repositioning on short DNA templates.

  1. Airport Analyses Informing New Mobility Shifts: Opportunities to Adapt Energy-Efficient Mobility Services and Infrastructure: Preprint

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Henao, Alejandro; Sperling, Joshua; Young, Stanley E

    An airport is one of the most important assets for a region's economic development and connectivity with the rest of the nation and world. Key aspects for investigation of energy efficient mobility at airports is ground transportation including factors ranging from the infrastructure, mobility services, and associated revenues. Data is critical to understand the maturity of new mobility services that can inform both cities and airports on how to respond, approach, manage, and adapt to the challenges, opportunities, and uncertainties associated with shifts in new mobility that influence human behavior, energy-efficiency and sustainability strategies. One key question identified in thismore » article is how quickly we are adapting to new mobility options - such as app-based ride-hailing and 'pooling' services - that may provide an opportunity to influence energy efficiency of ground transportation to and from airports. By starting with airports in the regions of four smart city finalists in the U.S. DOT Smart City Challenge, this paper focuses on key observability aspects of new modes and the rate of shifts in mobility patterns across San Francisco, Portland, Denver, and Kansas City. With the emerging megatrend of rising urbanization and rising air travel demand (a predicted doubling in demand by 2035), airports are expected to increasingly be on the front lines of adaptation to new transportation technology and services in terms of infrastructure investments, policies, and revenues. As airports have demonstrated the most potential and capability of any public institution to implement fees for new ride-hailing services, they are also a prime resource for collecting important data to help understand smart mobility transitions. Results focused on the shifts in revenues for ground transportation at airports offer one vantage point into the pace of transitions and adaptations in the new emerging mobility landscape, and present an opportunity to analyze how future adaptations could support more energy-efficient scenarios.« less

  2. Effect of passage number on electrophoretic mobility distributions of cultured human embryonic kidney cells

    NASA Technical Reports Server (NTRS)

    Kunze, M. E.

    1985-01-01

    A systematic investigation was undertaken to characterize population shifts that occur in cultured human embryonic kidney cells as a function of passage number in vitro after original explantation. This approach to cell population shift analysis follows the suggestion of Mehreshi, Klein and Revesz that perturbed cell populations can be characterized by electrophoretic mobility distributions if they contain subpopulations with different electrophoretic mobilities. It was shown that this is the case with early passage cultured human embryo cells.

  3. Transcriptional regulation of the cytosolic chaperonin theta subunit gene, Cctq, by Ets domain transcription factors Elk-1, Sap-1a, and Net in the absence of serum response factor.

    PubMed

    Yamazaki, Yuji; Kubota, Hiroshi; Nozaki, Masami; Nagata, Kazuhiro

    2003-08-15

    The chaperonin-containing t-complex polypeptide 1 (CCT) is a molecular chaperone that facilitates protein folding in eukaryotic cytosol, and the expression of CCT is highly dependent on cell growth. We show here that transcription of the gene encoding the theta subunit of mouse CCT, Cctq, is regulated by the ternary complex factors (TCFs), Elk-1, Sap-1a, and Net (Sap-2). Reporter gene assay using HeLa cells indicated that the Cctq gene promoter contains a cis-acting element of the CCGGAAGT sequence (CQE1) at -36 bp. The major CQE1-binding proteins in HeLa cell nuclear extract was recognized by anti-Elk-1 or anti-Sap-1a antibodies in electrophoretic mobility shift assay, and recombinant Elk-1, Sap-1a, or Net specifically recognized CQE1. The CQE1-dependent transcriptional activity in HeLa cells was virtually abolished by overexpression of the DNA binding domains of TCFs. Overexpression of full-length TCFs with Ras indicated that exogenous TCFs can regulate the CQE1-dependent transcription in a Ras-dependent manner. PD98059, an inhibitor of MAPK, significantly repressed the CQE1-dependent transcription. However, no serum response factor was detected by electrophoretic mobility shift assay using the CQE1 element. These results indicate that transcription of the Cctq gene is regulated by TCFs under the control of the Ras/MAPK pathway, probably independently of serum response factor.

  4. Genomics Education in Practice: Evaluation of a Mobile Lab Design

    ERIC Educational Resources Information Center

    Van Mil, Marc H. W.; Boerwinkel, Dirk Jan; Buizer-Voskamp, Jacobine E.; Speksnijder, Annelies; Waarlo, Arend Jan

    2010-01-01

    Dutch genomics research centers have developed the "DNA labs on the road" to bridge the gap between modern genomics research practice and secondary-school curriculum in the Netherlands. These mobile DNA labs offer upper-secondary students the opportunity to experience genomics research through experiments with laboratory equipment that…

  5. Solid-to-fluid – like DNA transition in viruses facilitates infection

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Ting; Sae-Ueng, Udom; Li, Dong

    2014-10-14

    Releasing the packaged viral DNA into the host cell is an essential process to initiate viral infection. In many double-stranded DNA bacterial viruses and herpesviruses, the tightly packaged genome is hexagonally ordered and stressed in the protein shell, called the capsid. DNA condensed in this state inside viral capsids has been shown to be trapped in a glassy state, with restricted molecular motion in vitro. This limited intracapsid DNA mobility is caused by the sliding friction between closely packaged DNA strands, as a result of the repulsive interactions between the negative charges on the DNA helices. It had been unclearmore » how this rigid crystalline structure of the viral genome rapidly ejects from the capsid, reaching rates of 60,000 bp/s. Through a combination of single- molecule and bulk techniques, we determined how the structure and energy of the encapsidated DNA in phage λ regulates the mobility required for its ejection. Our data show that packaged λ -DNA undergoes a solid-to-fluid – like disordering transition as a function of temperature, resultin g locally in less densely packed DNA, reducing DNA – DNA repulsions. This p rocess leads to a sig- nificant increase in genome mobility or fluidity, which facilitates genome release at temperatures close to that of viral infection (37 °C), suggesting a remarkab le physical adaptation of bac- terial viruses to the environment of Escherichia coli cells in a human host.« less

  6. Targeted DNA sequencing and in situ mutation analysis using mobile phone microscopy

    NASA Astrophysics Data System (ADS)

    Kühnemund, Malte; Wei, Qingshan; Darai, Evangelia; Wang, Yingjie; Hernández-Neuta, Iván; Yang, Zhao; Tseng, Derek; Ahlford, Annika; Mathot, Lucy; Sjöblom, Tobias; Ozcan, Aydogan; Nilsson, Mats

    2017-01-01

    Molecular diagnostics is typically outsourced to well-equipped centralized laboratories, often far from the patient. We developed molecular assays and portable optical imaging designs that permit on-site diagnostics with a cost-effective mobile-phone-based multimodal microscope. We demonstrate that targeted next-generation DNA sequencing reactions and in situ point mutation detection assays in preserved tumour samples can be imaged and analysed using mobile phone microscopy, achieving a new milestone for tele-medicine technologies.

  7. Detection of DNA damage in workers exposed to JP-8 jet fuel.

    PubMed

    Krieg, Edward F; Mathias, Patricia I; Toennis, Christine A; Clark, John C; Marlow, Kate L; B'hymer, Clayton; Singh, Narendra P; Gibson, Roger L; Butler, Mary Ann

    2012-09-18

    The genotoxicity of jet propulsion fuel 8 (JP-8) was assessed in the leukocytes of archived blood specimens from U.S. Air Force personnel using the comet assay. No differences in mean comet assay measurements were found between low, moderate, and high exposure groups before or after a 4h work shift. Before the work shift, mean tail DNA and mean tail (Olive) moment increased as the concentration of benzene measured in end-exhaled breath increased, indicating that prior environmental or work-related exposures to benzene produced DNA damage. The number of cells with highly damaged DNA decreased as the pre-shift benzene concentration in breath increased. It is not clear why the decrease is occurring. Mean tail DNA and mean tail (Olive) moment decreased as the concentrations of benzene and naphthalene measured in breath immediately after the work shift increased. These inverse relationships may reflect a slower rate of absorption or a faster rate of expiration of benzene in the lung. The number of cells with highly damaged DNA increased as the concentration of urinary (2-methoxyethoxy)acetic acid (MEAA) increased. This relationship was not seen in urinary MEAA adjusted for creatinine. MEAA is a metabolite of the deicing agent 2-(2-methoxyethoxy)ethanol contained in JP-8. MEAA or a component of JP-8 correlated with MEAA may have a toxic effect on DNA. Published by Elsevier B.V.

  8. POZ domain transcription factor, FBI-1, represses transcription of ADH5/FDH by interacting with the zinc finger and interfering with DNA binding activity of Sp1.

    PubMed

    Lee, Dong-Kee; Suh, Dongchul; Edenberg, Howard J; Hur, Man-Wook

    2002-07-26

    The POZ domain is a protein-protein interaction motif that is found in many transcription factors, which are important for development, oncogenesis, apoptosis, and transcription repression. We cloned the POZ domain transcription factor, FBI-1, that recognizes the cis-element (bp -38 to -22) located just upstream of the core Sp1 binding sites (bp -22 to +22) of the ADH5/FDH minimal promoter (bp -38 to +61) in vitro and in vivo, as revealed by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. The ADH5/FDH minimal promoter is potently repressed by the FBI-1. Glutathione S-transferase fusion protein pull-down showed that the POZ domains of FBI-1, Plzf, and Bcl-6 directly interact with the zinc finger DNA binding domain of Sp1. DNase I footprinting assays showed that the interaction prevents binding of Sp1 to the GC boxes of the ADH5/FDH promoter. Gal4-POZ domain fusions targeted proximal to the GC boxes repress transcription of the Gal4 upstream activator sequence-Sp1-adenovirus major late promoter. Our data suggest that POZ domain represses transcription by interacting with Sp1 zinc fingers and by interfering with the DNA binding activity of Sp1.

  9. The COUP-TFs compose a family of functionally related transcription factors

    PubMed Central

    Wang, Lee-Ho; Ing, Nancy H.; Tsai, Sophia Y.; O’Malley, Bert W.; Tsai, Ming-Jer

    1991-01-01

    The chicken ovalbumin upstream promoter transcription factors (COUP-TFs) are members of the steroid/thyroid hormone receptor superfamily and function in transcriptional regulation of a wide variety of genes. The COUP-TFs purified from HeLa nuclear extract by COUP-affinity chromatography are composed of multiple Mr forms. The Low Mr COUP-TFs (43,000, 44,000, 46,000, and 47,000 Mr) produce a relatively fast migrating complex (Cl) with DNA in electrophoresis mobility shift assays, while the high Mr forms (66,000, 68,000, 72,000, and 74,000 Mr) produce a slower migrating (C2) complex. The high Mr COUP-TFs were purified by gel filtration chromatography and independently formed the C2 DNA complex, probably acting as dimers. The high Mr forms are indistinguishable from the low Mr COUP-TFs in DNA binding and in enhancement of in vitro transcription from the ovalbumin promoter. The finding of multiple COUP-TF forms led us to clone a second low Mr COUP-TF, “COUP-TF2.” The COUP-TF2 sequence has very strong homology with COUP-TF1. The N-termini of COUP-TF1 and COUP-TF2 are least similar, but both contain glutamine-rich and proline-rich motifs, putative activation domains. PMID:1820218

  10. cDNA cloning and characterization of mouse DTEF-1 and ETF, members of the TEA/ATTS family of transcription factors.

    PubMed

    Yockey, C E; Shimizu, N

    1998-02-01

    Members of the TEA/ATTS family of transcription factors have been found in most representative eukaryotic organisms. In vertebrates, the TEA family contains at least four members, which share overlapping DNA-binding specificity and have similar transcriptional activation properties. In this article, we describe the cDNA cloning and characterization of the murine TEA proteins DTEF-1 (mDTEF-1) and ETF. Using in situ hybridization analysis of mouse embryos, we found that mDTEF-1 and ETF transcript distributions substantially overlap. ETF is expressed throughout the embryo except in the myocardium early in development, whereas late in development, it is enriched in lung and neuroectoderm. Mouse DTEF-1 is expressed at a much lower level throughout development and is substantially enriched in ectoderm and skin, as well as in the developing pituitary at midgestation. Northern blot analysis of adult mouse tissue total RNA showed that both ETF and mDTEF-1 are abundant in uterus and lung relative to other tissues. Using gel mobility shift assays and GAL4-fusion protein analysis, we demonstrated that the full coding sequences of ETF and mDTEF-1 encode M-CAT/GT-IIC-binding proteins containing activation domains.

  11. Determination of the DNA-binding kinetics of three related but heteroimmune bacteriophage repressors using EMSA and SPR analysis

    PubMed Central

    Henriksson-Peltola, Petri; Sehlén, Wilhelmina; Haggård-Ljungquist, Elisabeth

    2007-01-01

    Bacteriophages P2, P2 Hy dis and WΦ are very similar but heteroimmune Escherichia coli phages. The structural genes show over 96% identity, but the repressors show between 43 and 63% identities. Furthermore, the operators, which contain two directly repeated sequences, vary in sequence, length, location relative to the promoter and spacing between the direct repeats. We have compared the in vivo effects of the wild type and mutated operators on gene expression with the complexes formed between the repressors and their wild type or mutated operators using electrophoretic mobility shift assay (EMSA), and real-time kinetics of the protein–DNA interactions using surface plasmon resonance (SPR) analysis. Using EMSA, the repressors formed different protein–DNA complexes, and only WΦ was significantly affected by point mutations. However, SPR analysis showed a reduced association rate constant and an increased dissociation rate constant for P2 and WΦ operator mutants. The association rate constants of P2 Hy dis was too fast to be determined. The P2 Hy dis dissociation response curves were shown to be triphasic, while both P2 and WΦ C were biphasic. Thus, the kinetics of complex formation and the nature of the complexes formed differ extensively between these very closely related phages. PMID:17412705

  12. Carrier mobility in double-helix DNA and RNA: A quantum chemistry study with Marcus-Hush theory.

    PubMed

    Wu, Tao; Sun, Lei; Shi, Qi; Deng, Kaiming; Deng, Weiqiao; Lu, Ruifeng

    2016-12-21

    Charge mobilities of six DNAs and RNAs have been computed using quantum chemistry calculation combined with the Marcus-Hush theory. Based on this simulation model, we obtained quite reasonable results when compared with the experiment, and the obtained charge mobility strongly depends on the molecular reorganization and electronic coupling. Besides, we find that hole mobilities are larger than electron mobilities no matter in DNAs or in RNAs, and the hole mobility of 2L8I can reach 1.09 × 10 -1 cm 2 V -1 s -1 which can be applied in the molecular wire. The findings also show that our theoretical model can be regarded as a promising candidate for screening DNA- and RNA-based molecular electronic devices.

  13. Carrier mobility in double-helix DNA and RNA: A quantum chemistry study with Marcus-Hush theory

    NASA Astrophysics Data System (ADS)

    Wu, Tao; Sun, Lei; Shi, Qi; Deng, Kaiming; Deng, Weiqiao; Lu, Ruifeng

    2016-12-01

    Charge mobilities of six DNAs and RNAs have been computed using quantum chemistry calculation combined with the Marcus-Hush theory. Based on this simulation model, we obtained quite reasonable results when compared with the experiment, and the obtained charge mobility strongly depends on the molecular reorganization and electronic coupling. Besides, we find that hole mobilities are larger than electron mobilities no matter in DNAs or in RNAs, and the hole mobility of 2L8I can reach 1.09 × 10-1 cm2 V-1 s-1 which can be applied in the molecular wire. The findings also show that our theoretical model can be regarded as a promising candidate for screening DNA- and RNA-based molecular electronic devices.

  14. Targeted DNA sequencing and in situ mutation analysis using mobile phone microscopy

    PubMed Central

    Kühnemund, Malte; Wei, Qingshan; Darai, Evangelia; Wang, Yingjie; Hernández-Neuta, Iván; Yang, Zhao; Tseng, Derek; Ahlford, Annika; Mathot, Lucy; Sjöblom, Tobias; Ozcan, Aydogan; Nilsson, Mats

    2017-01-01

    Molecular diagnostics is typically outsourced to well-equipped centralized laboratories, often far from the patient. We developed molecular assays and portable optical imaging designs that permit on-site diagnostics with a cost-effective mobile-phone-based multimodal microscope. We demonstrate that targeted next-generation DNA sequencing reactions and in situ point mutation detection assays in preserved tumour samples can be imaged and analysed using mobile phone microscopy, achieving a new milestone for tele-medicine technologies. PMID:28094784

  15. Analysis of E2F factors during epidermal differentiation.

    PubMed

    Chang, Wing Y; Dagnino, Lina

    2005-01-01

    The multigene E2F family of transcription factors is central in the control of cell cycle progression. The expression and activity of E2F proteins is tightly regulated transcriptionally and posttranslationally as a function of the proliferation and differentiation status of the cell. In this chapter, we review protocols designed to determine E2F mRNA abundance in tissues by in situ hybridization techniques. The ability to culture primary epidermal keratinocytes and maintain them as either undifferentiated or terminally differentiated cells allows the biochemical and molecular characterization of changes in E2F expression and activity. Thus, we also discuss in detail methods to analyze E2F protein abundance by immunoblot and their ability to bind DNA in cultured cells using electrophoretic mobility shift assays.

  16. The influence of direct mobile phone radiation on sperm quality.

    PubMed

    Gorpinchenko, Igor; Nikitin, Oleg; Banyra, Oleg; Shulyak, Alexander

    2014-01-01

    It is impossible to imagine a modern socially-active man who does not use mobile devices and/or computers with Wi-Fi function. The effect of mobile phone radiation on male fertility is the subject of recent interest and investigations. The aim of this study was to investigate the direct in vitro influence of mobile phone radiation on sperm DNA fragmentation and motility parameters in healthy subjects with normozoospermia. 32 healthy men with normal semen parameters were selected for the study. Each sperm sample was divided into two equal portions (A and B). Portions A of all involved men were placed for 5 hours in a thermostat, and portions B were placed into a second thermostat for the same period of time, where a mobile phone in standby/talk mode was placed. After 5 hours of incubation the sperm samples from both thermostats were re-evaluated regarding basic motility parameters. The presence of DNA fragmentation in both A and B portions of each sample was determined each hour using a standard sperm chromatin dispersion test. The number of spermatozoa with progressive movement in the group, influenced by electromagnetic radiation, is statistically lower than the number of spermatozoa with progressive movement in the group under no effect of the mobile phone. The number of non-progressive movement spermatozoa was significantly higher in the group, which was influenced by cell phone radiation. The DNA fragmentation was also significantly higher in this group. A correlation exists between mobile phone radiation exposure, DNA-fragmentation level and decreased sperm motility.

  17. Fructosylation induced structural changes in mammalian DNA examined by biophysical techniques

    NASA Astrophysics Data System (ADS)

    Zaman, Asif; Arif, Zarina; Alam, Khursheed

    2017-03-01

    Glycosylation of DNA, proteins, lipids, etc. by reducing sugars, can lead to the formation of advanced glycation end products (AGEs). These products may accumulate and involve in the pathogenesis of a number of diseases, contributing to tissue injury via several mechanisms. In this study, fructosylation of calf thymus dsDNA was carried out with varying concentrations of fructose. The neo-structure of fructosylated-DNA was studied by various biophysical techniques and morphological characterization. Fructosylated-DNA showed hyperchromicity, increase in fluorescence intensity and decrease in melting temperature. The CD signal of modified-DNA shifted in the direction of higher wavelength indicative of structural changes in DNA. FTIR results indicated shift in specific band positions in fructosylated-DNA. Morphological characterization of fructosylated-DNA exhibited strand breakage and aggregation. The results suggest that the structure and conformation of DNA may be altered under high concentrations of fructose.

  18. Coarse-grained model of conformation-dependent electrophoretic mobility and its influence on DNA dynamics

    NASA Astrophysics Data System (ADS)

    Pandey, Harsh; Underhill, Patrick T.

    2015-11-01

    The electrophoretic mobility of molecules such as λ -DNA depends on the conformation of the molecule. It has been shown that electrohydrodynamic interactions between parts of the molecule lead to a mobility that depends on conformation and can explain some experimental observations. We have developed a new coarse-grained model that incorporates these changes of mobility into a bead-spring chain model. Brownian dynamics simulations have been performed using this model. The model reproduces the cross-stream migration that occurs in capillary electrophoresis when pressure-driven flow is applied parallel or antiparallel to the electric field. The model also reproduces the change of mobility when the molecule is stretched significantly in an extensional field. We find that the conformation-dependent mobility can lead to a new type of unraveling of the molecule in strong fields. This occurs when different parts of the molecule have different mobilities and the electric field is large.

  19. Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy

    NASA Astrophysics Data System (ADS)

    Chao, J.; Zhang, P.; Wang, Q.; Wu, N.; Zhang, F.; Hu, J.; Fan, C. H.; Li, B.

    2016-03-01

    We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06544e

  20. Molecular interactions of orthologues of floral homeotic proteins from the gymnosperm Gnetum gnemon provide a clue to the evolutionary origin of 'floral quartets'.

    PubMed

    Wang, Yong-Qiang; Melzer, Rainer; Theissen, Günter

    2010-10-01

    Several lines of evidence suggest that the identity of floral organs in angiosperms is specified by multimeric transcription factor complexes composed of MADS-domain proteins. These bind to specific cis-regulatory elements ('CArG-boxes') of their target genes involving DNA-loop formation, thus constituting 'floral quartets'. Gymnosperms, angiosperms' closest relatives, contain orthologues of floral homeotic genes, but when and how the interactions constituting floral quartets were established during evolution has remained unknown. We have comprehensively studied the dimerization and DNA-binding of several classes of MADS-domain proteins from the gymnosperm Gnetum gnemon. Determination of protein-protein and protein-DNA interactions by yeast two-hybrid, in vitro pull-down and electrophoretic mobility shift assays revealed complex patterns of homo- and heterodimerization among orthologues of floral homeotic class B, class C and class E proteins and B(sister) proteins. Using DNase I footprint assays we demonstrate that both orthologues of class B with C proteins, and orthologues of class C proteins alone, but not orthologues of class B proteins alone can loop DNA in floral quartet-like complexes. This is in contrast to class B and class C proteins from angiosperms, which require other factors such as class E floral homeotic proteins to 'glue' them together in multimeric complexes. Our findings suggest that the evolutionary origin of floral quartet formation is based on the interaction of different DNA-bound homodimers, does not depend on class E proteins, and predates the origin of angiosperms. © 2010 The Authors. Journal compilation © 2010 Blackwell Publishing Ltd.

  1. In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax.

    PubMed

    Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z

    1994-01-01

    The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.

  2. Modems for emerging digital cellular-mobile radio system

    NASA Technical Reports Server (NTRS)

    Feher, Kamilo

    1991-01-01

    Digital modem techniques for emerging digital cellular telecommunications-mobile radio system applications are described and analyzed. In particular, theoretical performance, experimental results, principles of operation, and various architectures of pi/4-QPSK (pi/4-shifted coherent or differential QPSK) modems for second-generation US digital cellular radio system applications are presented. The spectral/power efficiency and performance of the pi/4-QPSK modems (American and Japanese digital cellular emerging standards) are studied and briefly compared to GMSK (Gaussian minimum-shift keying) modems (proposed for European DECT and GSM cellular standards). Improved filtering strategies and digital pilot-aided (digital channel sounding) techniques are also considered for pi/4-QPSK and other digital modems. These techniques could significantly improve the performance of digital cellular and other digital land mobile and satellite mobile radio systems. More spectrally efficient modem trends for future cellular/mobile (land mobile) and satellite communication systems applications are also highlighted.

  3. Shifting Patterns of Student Mobility in Asia

    ERIC Educational Resources Information Center

    Chan, Sheng-Ju

    2012-01-01

    During the past decade, Asia--traditionally one of the largest exporters of mobile students--has experienced major changes in student mobility within higher education. As the worldwide competition for international students has escalated, many Asian countries have adopted a wide range of mechanisms and strategies in facilitating student mobility.…

  4. Development of an optical biosensor based on surface-enhanced Raman scattering for DNA analysis

    NASA Astrophysics Data System (ADS)

    Yigit, Tugce; Akdogan, Ebru; Karagoz, Isık. Didem; Kahraman, Mehmet

    2016-03-01

    Rapid, accurate and sensitive DNA analysis is critically important for the diagnostic of genetic diseases. The most common method preferred in practice is fluorescence based microarrays to analyze the DNA. However, there exist some disadvantages related to the above-mentioned method such as the overlapping of the fluorescence emission wavelengths that can diminish in the performance of multiplexing, needed to obtain fluorescence spectra from each dye and photo degradation. In this study, a novel SERS based DNA analysis approach, which is Raman active dye-free and independent of SERS substrate properties, is developed. First, the single strand DNA probe is attached to the SERS substrate and half of the complimentary DNA is attached to gold nanoparticles, as well. We hypothesize that in the presence of target DNA, the complimentary DNA coupled colloids will bind to the SERS substrate surface via hybridization of single strand target DNA. To test this hypothesis, we used UV/Vis spectroscopy, atomic for microscopy (AFM) and dynamic light scattering (DLS). DNA analysis is demonstrated by a peak shift of the certain peak of the small molecules attached to the SERS substrate surface instead of SERS spectrum obtained in the presence of target DNA from the Raman reporter molecules. The degree of peak shifting will be used for the quantification of the target DNA in the sample. Plasmonic properties of SERS substrates and reproducibility issues will not be considerable due to the use of peak shifting instead of peak intensity for the qualitative analysis.

  5. Effects of nucleoside analog incorporation on DNA binding to the DNA binding domain of the GATA-1 erythroid transcription factor.

    PubMed

    Foti, M; Omichinski, J G; Stahl, S; Maloney, D; West, J; Schweitzer, B I

    1999-02-05

    We investigate here the effects of the incorporation of the nucleoside analogs araC (1-beta-D-arabinofuranosylcytosine) and ganciclovir (9-[(1,3-dihydroxy-2-propoxy)methyl] guanine) into the DNA binding recognition sequence for the GATA-1 erythroid transcription factor. A 10-fold decrease in binding affinity was observed for the ganciclovir-substituted DNA complex in comparison to an unmodified DNA of the same sequence composition. AraC substitution did not result in any changes in binding affinity. 1H-15N HSQC and NOESY NMR experiments revealed a number of chemical shift changes in both DNA and protein in the ganciclovir-modified DNA-protein complex when compared to the unmodified DNA-protein complex. These changes in chemical shift and binding affinity suggest a change in the binding mode of the complex when ganciclovir is incorporated into the GATA DNA binding site.

  6. Long Chain DNA Separation in a Sparse Nanopost Array

    NASA Astrophysics Data System (ADS)

    Ou, Jia; Joswiak, Mark; Dorfman, Kevin

    2010-11-01

    Long chain DNA separation is a challenge for gel lectrophoresis. Our previous DNA separation experiments and simulations demonstrated that a sparse micro post array can separate large DNA. However, the smaller DNA are not well resolved. We hypothesized that smaller posts will increase the collision frequency of the smaller DNA and thus the resolution. We successfully fabricated a hexagonal array of 350 nm diameter posts with a 3 μm spacing using an oxygen plasma etching method. Under an electric field of 10 V/cm, the mobilities of different species ranging from 10-48.5 kilobasepair (kbp) were normalized by the mobility of λ DNA (48.5 kbp), which was included in all experiments as a standard to correct for day-to-day variations in electroosmotic flow. The resolution of these DNA is markedly improved when compared with a 1 μm diameter micropost array. We demonstrate the robustness of the device by using the calibration curve to identify the peaks in a separation of the λ DNA-Mono Cut mix.

  7. LexA Binds to Transcription Regulatory Site of Cell Division Gene ftsZ in Toxic Cyanobacterium Microcystis aeruginosa.

    PubMed

    Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi

    2018-05-17

    Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.

  8. Estrogen receptor accessory proteins augment receptor-DNA interaction and DNA bending.

    PubMed

    Landel, C C; Potthoff, S J; Nardulli, A M; Kushner, P J; Greene, G L

    1997-01-01

    Increasing evidence suggests that accessory proteins play an important role in the ability of the estrogen receptor (ER) and other nuclear hormone receptors to modulate transcription when bound to cis-acting hormone response elements in target genes. We have previously shown that four proteins, hsp70, protein disulfide isomerase (PDI) and two unknown proteins (p48 and p45), copurify with ER that has been isolated by site-specific DNA chromatography (BERE) and influence the interaction of ER with DNA in vitro. To better define the nature of these effects, we used filter binding and electrophoretic mobility shift assays to study the ability of these proteins to alter the kinetics of ER-DNA interaction and to influence the ability of ER to bend DNA when bound to an estrogen response element (ERE). The results of both assays indicate that ERE-purified ER, with its four associated proteins (hsp70, PDI, p48, p45), has a greater ability to bind to the vitellogenin A2 ERE than ER purified by estradiol-Sepharose chromatography in the absence (ESeph) or presence (EATP) of ATP, in which p48, p45 (ESeph) and hsp70 (EATP) are removed. Surprisingly, the rates of association and dissociation of ER and ERE were essentially the same for all three mixtures, suggesting that one or more ER-associated proteins, especially p45 and p48, may be required for ER to attain maximum DNA binding activity. In addition, circular permutation and phasing analyses demonstrated that the same ER-associated proteins produced higher order ER-DNA complexes that significantly increased the magnitude of DNA distortion, but did not alter the direction of the ER-induced bend of ERE-containing DNA fragments, which was toward the major groove of the DNA helix. These results suggest that p45 and/or p48 and possibly hsp70, play an important role both in the specific DNA binding and bending activities of ER and thus contribute to the overall stimulation of transcription in target genes that contain cis-acting EREs.

  9. Structure determination of uracil-DNA N-glycosylase from Deinococcus radiodurans in complex with DNA.

    PubMed

    Pedersen, Hege Lynum; Johnson, Kenneth A; McVey, Colin E; Leiros, Ingar; Moe, Elin

    2015-10-01

    Uracil-DNA N-glycosylase (UNG) is a DNA-repair enzyme in the base-excision repair (BER) pathway which removes uracil from DNA. Here, the crystal structure of UNG from the extremophilic bacterium Deinococcus radiodurans (DrUNG) in complex with DNA is reported at a resolution of 1.35 Å. Prior to the crystallization experiments, the affinity between DrUNG and different DNA oligonucleotides was tested by electrophoretic mobility shift assays (EMSAs). As a result of this analysis, two 16 nt double-stranded DNAs were chosen for the co-crystallization experiments, one of which (16 nt AU) resulted in well diffracting crystals. The DNA in the co-crystal structure contained an abasic site (substrate product) flipped into the active site of the enzyme, with no uracil in the active-site pocket. Despite the high resolution, it was not possible to fit all of the terminal nucleotides of the DNA complex into electron density owing to disorder caused by a lack of stabilizing interactions. However, the DNA which was in contact with the enzyme, close to the active site, was well ordered and allowed detailed analysis of the enzyme-DNA interaction. The complex revealed that the interaction between DrUNG and DNA is similar to that in the previously determined crystal structure of human UNG (hUNG) in complex with DNA [Slupphaug et al. (1996). Nature (London), 384, 87-92]. Substitutions in a (here defined) variable part of the leucine loop result in a shorter loop (eight residues instead of nine) in DrUNG compared with hUNG; regardless of this, it seems to fulfil its role and generate a stabilizing force with the minor groove upon flipping out of the damaged base into the active site. The structure also provides a rationale for the previously observed high catalytic efficiency of DrUNG caused by high substrate affinity by demonstrating an increased number of long-range electrostatic interactions between the enzyme and the DNA. Interestingly, specific interactions between residues in the N-terminus of a symmetry-related molecule and the complementary DNA strand facing away from the active site were also observed which seem to stabilize the enzyme-DNA complex. However, the significance of this observation remains to be investigated. The results provide new insights into the current knowledge about DNA damage recognition and repair by uracil-DNA glycosylases.

  10. Nucleosome mobilization by ISW2 requires the concerted action of the ATPase and SLIDE domains

    PubMed Central

    Hota, Swetansu K.; Bhardwaj, Saurabh K.; Deindl, Sebastian; Lin, Yuan-chi; Zhuang, Xiaowei; Bartholomew, Blaine

    2013-01-01

    The ISWI family of ATP-dependent chromatin remodelers represses transcription by changing nucleosome positioning. The interactions with extranucleosomal DNA and the requirement of a minimal length of extranucleosomal DNA by ISWI mediate the spacing of nucleosomes. ISW2 from Saccharomyces cerevisiae, a member of the ISWI family, has a conserved domain called SLIDE (SANT-like ISWI domain), whose binding to extranucleosomal DNA ~19 bp from the edge of nucleosomes is required for efficiently pushing DNA into nucleosomes and maintaining the unidirectional movement of nucleosomes, as reported here. Loss of SLIDE binding does not perturb ATPase domain binding to the SHL2 site of nucleosomes or its initial movement of DNA inside of nucleosomes. ISW2 has therefore two distinct roles in mobilizing nucleosomes, with the ATPase domain translocating and moving DNA inside nucleosomes, and the SLIDE domain facilitating the entry of linker DNA into nucleosomes. PMID:23334290

  11. A new family of polymerases related to superfamily A DNA polymerases and T7-like DNA-dependent RNA polymerases.

    PubMed

    Iyer, Lakshminarayan M; Abhiman, Saraswathi; Aravind, L

    2008-10-04

    Using sequence profile methods and structural comparisons we characterize a previously unknown family of nucleic acid polymerases in a group of mobile elements from genomes of diverse bacteria, an algal plastid and certain DNA viruses, including the recently reported Sputnik virus. Using contextual information from domain architectures and gene-neighborhoods we present evidence that they are likely to possess both primase and DNA polymerase activity, comparable to the previously reported prim-pol proteins. These newly identified polymerases help in defining the minimal functional core of superfamily A DNA polymerases and related RNA polymerases. Thus, they provide a framework to understand the emergence of both DNA and RNA polymerization activity in this class of enzymes. They also provide evidence that enigmatic DNA viruses, such as Sputnik, might have emerged from mobile elements coding these polymerases.

  12. A new family of polymerases related to superfamily A DNA polymerases and T7-like DNA-dependent RNA polymerases

    PubMed Central

    Iyer, Lakshminarayan M; Abhiman, Saraswathi; Aravind, L

    2008-01-01

    Using sequence profile methods and structural comparisons we characterize a previously unknown family of nucleic acid polymerases in a group of mobile elements from genomes of diverse bacteria, an algal plastid and certain DNA viruses, including the recently reported Sputnik virus. Using contextual information from domain architectures and gene-neighborhoods we present evidence that they are likely to possess both primase and DNA polymerase activity, comparable to the previously reported prim-pol proteins. These newly identified polymerases help in defining the minimal functional core of superfamily A DNA polymerases and related RNA polymerases. Thus, they provide a framework to understand the emergence of both DNA and RNA polymerization activity in this class of enzymes. They also provide evidence that enigmatic DNA viruses, such as Sputnik, might have emerged from mobile elements coding these polymerases. This article was reviewed by Eugene Koonin and Mark Ragan. PMID:18834537

  13. Time-Restricted Feeding Shifts the Skin Circadian Clock and Alters UVB-Induced DNA Damage.

    PubMed

    Wang, Hong; van Spyk, Elyse; Liu, Qiang; Geyfman, Mikhail; Salmans, Michael L; Kumar, Vivek; Ihler, Alexander; Li, Ning; Takahashi, Joseph S; Andersen, Bogi

    2017-08-01

    The epidermis is a highly regenerative barrier protecting organisms from environmental insults, including UV radiation, the main cause of skin cancer and skin aging. Here, we show that time-restricted feeding (RF) shifts the phase and alters the amplitude of the skin circadian clock and affects the expression of approximately 10% of the skin transcriptome. Furthermore, a large number of skin-expressed genes are acutely regulated by food intake. Although the circadian clock is required for daily rhythms in DNA synthesis in epidermal progenitor cells, RF-induced shifts in clock phase do not alter the phase of DNA synthesis. However, RF alters both diurnal sensitivity to UVB-induced DNA damage and expression of the key DNA repair gene, Xpa. Together, our findings indicate regulation of skin function by time of feeding and emphasize a link between circadian rhythm, food intake, and skin health. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  14. RRR-alpha-tocopheryl succinate inhibits EL4 thymic lymphoma cell growth by inducing apoptosis and DNA synthesis arrest.

    PubMed

    Yu, W; Sanders, B G; Kline, K

    1997-01-01

    RRR-alpha-tocopheryl succinate (vitamin E succinate, VES) treatment of murine EL4 T lymphoma cells induced the cells to undergo apoptosis. After 48 hours of VES treatment at 20 micrograms/ml, 95% of cells were apoptotic. Evidence for the induction of apoptosis by VES treatments is based on staining of DNA for detection of chromatin condensation/fragmentation, two-color flow-cytometric analyses of DNA content, and end-labeled DNA and electrophoretic analyses for detection of DNA ladder formation. VES-treated EL4 cells were blocked in the G1 cell cycle phase; however, apoptotic cells came from all cell cycle phases. Analyses of mRNA expression of genes involved in apoptosis revealed decreased c-myc and increased bcl-2, c-fos, and c-jun mRNAs within three to six hours after treatment. Western analyses showed increased c-Jun, c-Fos, and Bcl-2 protein levels. Electrophoretic mobility shift assays showed increased AP-1 binding at 6, 12, and 24 hours after treatment and decreased c-Myc binding after 12 and 24 hours of VES treatment. Treatments of EL4 cells with VES+RRR-alpha-to-copherol reduced apoptosis without effecting DNA synthesis arrest. Treatments of EL4 cells with VES+rac-6-hydroxyl-2, 5,7,8-tetramethyl-chroman-2-carboxylic acid, butylated hydroxytoluene, or butylated hydroxyanisole had no effect on apoptosis or DNA synthesis arrest caused by VES treatments. Analyses of bcl-2, c-myc, c-jun, and c-fos mRNA levels in cells receiving VES + RRR-alpha-tocopherol treatments showed no change from cells receiving VES treatments alone, implying that these changes are correlated with VES treatments but are not causal for apoptosis. However, treatments with VES + RRR-alpha-tocopherol decreased AP-1 binding to consensus DNA oligomer, suggesting AP-1 involvement in apoptosis induced by VES treatments.

  15. Solution structure of telomere binding domain of AtTRB2 derived from Arabidopsis thaliana

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yun, Ji-Hye; Lee, Won Kyung; Kim, Heeyoun

    Highlights: • We have determined solution structure of Myb domain of AtTRB2. • The Myb domain of AtTRB2 is located in the N-terminal region. • The Myb domain of AtTRB2 binds to plant telomeric DNA without fourth helix. • Helix 2 and 3 of the Myb domain of AtTRB2 are involved in DNA recognition. • AtTRB2 is a novel protein distinguished from other known plant TBP. - Abstract: Telomere homeostasis is regulated by telomere-associated proteins, and the Myb domain is well conserved for telomere binding. AtTRB2 is a member of the SMH (Single-Myb-Histone)-like family in Arabidopsis thaliana, having an N-terminalmore » Myb domain, which is responsible for DNA binding. The Myb domain of AtTRB2 contains three α-helices and loops for DNA binding, which is unusual given that other plant telomere-binding proteins have an additional fourth helix that is essential for DNA binding. To understand the structural role for telomeric DNA binding of AtTRB2, we determined the solution structure of the Myb domain of AtTRB2 (AtTRB2{sub 1–64}) using nuclear magnetic resonance (NMR) spectroscopy. In addition, the inter-molecular interaction between AtTRB2{sub 1–64} and telomeric DNA has been characterized by the electrophoretic mobility shift assay (EMSA) and NMR titration analyses for both plant (TTTAGGG)n and human (TTAGGG)n telomere sequences. Data revealed that Trp28, Arg29, and Val47 residues located in Helix 2 and Helix 3 are crucial for DNA binding, which are well conserved among other plant telomere binding proteins. We concluded that although AtTRB2 is devoid of the additional fourth helix in the Myb-extension domain, it is able to bind to plant telomeric repeat sequences as well as human telomeric repeat sequences.« less

  16. SU-F-J-188: Clinical Implementation of in Room Mobile CT for Image Guided Proton Therapy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, H; Wu, R; Poenisch, F

    Purpose: To implement soft-tissue image-guided proton therapy using inroom mobile CT. Methods: Anthropomorphic phantom was first used to determine the setup accuracy using in- room mobile CT. Laser and bbs were used for the initial setup (marked isocenter). CT data was then acquired with in-room mobile CT (daily CT). The shift between the marked isocenter and the planned isocenter (final isocenter) was determined from the daily CT using in-house Computer Assisted Targeting (CAT) software. Orthogonal DRRs of the day was also generated from the daily CT. The phantom was then transferred on the treatment couch top to the treatment machinemore » using a transportation system, and again aligned to the marked isocenter. Couch shifts were made to align the phantom to the final isocenter using the shifts as determined using the CAT software, and verified using orthogonal X-ray images with the daily DRRs. Results: Phantom data suggests that following the setup procedure as described above, targeting accuracy could be within 1 mm. Patient data are being acquired and analyzed. Conclusion: In-room mobile CT is capable of providing soft-tissue image-guided proton therapy.« less

  17. Using advertisement light-panel and CMOS image sensor with frequency-shift-keying for visible light communication.

    PubMed

    Chow, Chi-Wai; Shiu, Ruei-Jie; Liu, Yen-Chun; Liao, Xin-Lan; Lin, Kun-Hsien; Wang, Yi-Chang; Chen, Yi-Yuan

    2018-05-14

    A frequency-shift-keying (FSK) visible light communication (VLC) system is proposed and demonstrated using advertisement light-panel as transmitter and mobile-phone image sensor as receiver. The developed application program (APP) in mobile-phone can retrieve the rolling shutter effect (RSE) pattern produced by the FSK VLC signal effectively. Here, we also define noise-ratio value (NRV) to evaluate the contrast of different advertisements displayed on the light-panel. Both mobile-phones under test can achieve success rate > 96% even when the transmission distance is up to 200 cm and the NRVs are low.

  18. Localisation Microscopy of Breast Epithelial ErbB-2 Receptors and Gap Junctions: Trafficking after γ-Irradiation, Neuregulin-1β, and Trastuzumab Application

    PubMed Central

    Pilarczyk, Götz; Nesnidal, Ines; Gunkel, Manuel; Bach, Margund; Bestvater, Felix; Hausmann, Michael

    2017-01-01

    In cancer, vulnerable breast epithelium malignance tendency correlates with number and activation of ErbB receptor tyrosine kinases. In the presented work, we observe ErbB receptors activated by irradiation-induced DNA injury or neuregulin-1β application, or alternatively, attenuated by a therapeutic antibody using high resolution fluorescence localization microscopy. The gap junction turnover coinciding with ErbB receptor activation and co-transport is simultaneously recorded. DNA injury caused by 4 Gray of 6 MeV photon γ-irradiation or alternatively neuregulin-1β application mobilized ErbB receptors in a nucleograde fashion—a process attenuated by trastuzumab antibody application. This was accompanied by increased receptor density, indicating packing into transport units. Factors mobilizing ErbB receptors also mobilized plasma membrane resident gap junction channels. The time course of ErbB receptor activation and gap junction mobilization recapitulates the time course of non-homologous end-joining DNA repair. We explain our findings under terms of DNA injury-induced membrane receptor tyrosine kinase activation and retrograde trafficking. In addition, we interpret the phenomenon of retrograde co-trafficking of gap junction connexons stimulated by ErbB receptor activation. PMID:28208769

  19. A Critical Review of 13 Years of Mobile Game-Based Learning

    ERIC Educational Resources Information Center

    Giannakas, Filippos; Kambourakis, Georgios; Papasalouros, Andreas; Gritzalis, Stefanos

    2018-01-01

    With the increasing popularity of smartphones and tablets, game-based learning (GBL) is undergoing a rapid shift to mobile platforms. This transformation is driven by mobility, wireless interfaces, and built-in sensors that these smart devices offer in order to enable blended and context-sensitive mobile learning (m-Learning) activities. Thus,…

  20. An Introduction to Current Trends and Benefits of Mobile Wireless Technology Use in Higher Education

    ERIC Educational Resources Information Center

    Kim, Sang Hyun; Mims, Clif; Holmes, Kerry P.

    2006-01-01

    The development of mobile wireless technologies has generated a considerable amount of excitement among practitioners and academics because it results in shifting the academic environment from traditional settings to mobile learning (m-learning) settings. Increasing numbers of institutions of higher education offer courses using mobile wireless…

  1. Regulation of the aceI multidrug efflux pump gene in Acinetobacter baumannii.

    PubMed

    Liu, Qi; Hassan, Karl A; Ashwood, Heather E; Gamage, Hasinika K A H; Li, Liping; Mabbutt, Bridget C; Paulsen, Ian T

    2018-06-01

    To investigate the function of AceR, a putative transcriptional regulator of the chlorhexidine efflux pump gene aceI in Acinetobacter baumannii. Chlorhexidine susceptibility and chlorhexidine induction of aceI gene expression were determined by MIC and quantitative real-time PCR, respectively, in A. baumannii WT and ΔaceR mutant strains. Recombinant AceR was prepared as both a full-length protein and as a truncated protein, AceR (86-299), i.e. AceRt, which has the DNA-binding domain deleted. The binding interaction of the purified AceR protein and its putative operator region was investigated by electrophoretic mobility shift assays and DNase I footprinting assays. The binding of AceRt with its putative ligand chlorhexidine was examined using surface plasmon resonance and tryptophan fluorescence quenching assays. MIC determination assays indicated that the ΔaceI and ΔaceR mutant strains both showed lower resistance to chlorhexidine than the parental strain. Chlorhexidine-induced expression of aceI was abolished in a ΔaceR background. Electrophoretic mobility shift assays and DNase I footprinting assays demonstrated chlorhexidine-stimulated binding of AceR with two sites upstream of the putative aceI promoter. Surface plasmon resonance and tryptophan fluorescence quenching assays suggested that the purified ligand-binding domain of the AceR protein was able to bind with chlorhexidine with high affinity. This study provides strong evidence that AceR is an activator of aceI gene expression when challenged with chlorhexidine. This study is the first characterization, to our knowledge, of a regulator controlling expression of a PACE family multidrug efflux pump.

  2. Impact of cadmium, cobalt and nickel on sequence-specific DNA binding of p63 and p73 in vitro and in cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Adámik, Matej; Bažantová, Pavla; Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava

    Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt,more » which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed.« less

  3. A Locus Encoding Variable Defense Systems against Invading DNA Identified in Streptococcus suis

    PubMed Central

    Okura, Masatoshi; Nozawa, Takashi; Watanabe, Takayasu; Murase, Kazunori; Nakagawa, Ichiro; Takamatsu, Daisuke; Osaki, Makoto; Sekizaki, Tsutomu; Gottschalk, Marcelo; Hamada, Shigeyuki

    2017-01-01

    Streptococcus suis, an important zoonotic pathogen, is known to have an open pan-genome and to develop a competent state. In S. suis, limited genetic lineages are suggested to be associated with zoonosis. However, little is known about the evolution of diversified lineages and their respective phenotypic or ecological characteristics. In this study, we performed comparative genome analyses of S. suis, with a focus on the competence genes, mobile genetic elements, and genetic elements related to various defense systems against exogenous DNAs (defense elements) that are associated with gene gain/loss/exchange mediated by horizontal DNA movements and their restrictions. Our genome analyses revealed a conserved competence-inducing peptide type (pherotype) of the competence system and large-scale genome rearrangements in certain clusters based on the genome phylogeny of 58 S. suis strains. Moreover, the profiles of the defense elements were similar or identical to each other among the strains belonging to the same genomic clusters. Our findings suggest that these genetic characteristics of each cluster might exert specific effects on the phenotypic or ecological differences between the clusters. We also found certain loci that shift several types of defense elements in S. suis. Of note, one of these loci is a previously unrecognized variable region in bacteria, at which strains of distinct clusters code for different and various defense elements. This locus might represent a novel defense mechanism that has evolved through an arms race between bacteria and invading DNAs, mediated by mobile genetic elements and genetic competence. PMID:28379509

  4. Pax6 localizes to chromatin-rich territories and displays a slow nuclear mobility altered by disease mutations.

    PubMed

    Elvenes, Julianne; Sjøttem, Eva; Holm, Turid; Bjørkøy, Geir; Johansen, Terje

    2010-12-01

    The transcription factor Pax6 is crucial for the embryogenesis of multiple organs, including the eyes, parts of the brain and the pancreas. Mutations in one allele of PAX6 lead to eye diseases including Peter's anomaly and aniridia. Here, we use fluorescence recovery after photobleaching to show that Pax6 and also other Pax family proteins display a strikingly low nuclear mobility compared to other transcriptional regulators. For Pax6, the slow mobility is largely due to the presence of two DNA-binding domains, but protein-protein interactions also contribute. Consistently, the subnuclear localization of Pax6 suggests that it interacts preferentially with chromatin-rich territories. Some aniridia-causing missense mutations in Pax6 have impaired DNA-binding affinity. Interestingly, when these mutants were analyzed by FRAP, they displayed a pronounced increased mobility compared to wild-type Pax6. Hence, our results support the conclusion that disease mutations result in proteins with impaired function because of altered DNA- and protein-interaction capabilities.

  5. Explosive diversification following a benthic to pelagic shift in freshwater fishes.

    PubMed

    Hollingsworth, Phillip R; Simons, Andrew M; Fordyce, James A; Hulsey, C Darrin

    2013-12-17

    Interspecific divergence along a benthic to pelagic habitat axis is ubiquitous in freshwater fishes inhabiting lentic environments. In this study, we examined the influence of this habitat axis on the macroevolution of a diverse, lotic radiation using mtDNA and nDNA phylogenies for eastern North America's most species-rich freshwater fish clade, the open posterior myodome (OPM) cyprinids. We used ancestral state reconstruction to identify the earliest benthic to pelagic transition in this group and generated fossil-calibrated estimates of when this shift occurred. This transition could have represented evolution into a novel adaptive zone, and therefore, we tested for a period of accelerated lineage accumulation after this historical habitat shift. Ancestral state reconstructions inferred a similar and concordant region of our mtDNA and nDNA based gene trees as representing the shift from benthic to pelagic habitats in the OPM clade. Two independent tests conducted on each gene tree suggested an increased diversification rate after this inferred habitat transition. Furthermore, lineage through time analyses indicated rapid early cladogenesis in the clade arising after the benthic to pelagic shift. A burst of diversification followed the earliest benthic to pelagic transition during the radiation of OPM cyprinids in eastern North America. As such, the benthic/pelagic habitat axis has likely influenced the generation of biodiversity across disparate freshwater ecosystems.

  6. Chromatic shifts in the fluorescence emitted by murine thymocytes stained with Hoechst 33342.

    PubMed

    Petersen, Timothy W; Ibrahim, Sherrif F; Diercks, Alan H; van den Engh, Ger

    2004-08-01

    Many methods in flow cytometry rely on staining DNA with a fluorescent dye to gauge DNA content. From the relative intensity of the fluorescence signature, one can then infer position in cell cycle, amount of DNA (i.e., for sperm selection), or, as in the case of flow karyotyping, to distinguish individual chromosomes. This work examines the staining of murine thymocytes with a common DNA dye, Hoechst 33342, to investigate nonlinearities in the florescence intensity as well as chromatic shifts. Murine thymocytes were stained with Hoechst 33342 and measured in a flow cytometer at two fluorescence emission bands. In other measurements, cells were stained at different dye concentrations, and then centrifuged. The supernatant was then used for a second round of staining to test the amount of dye uptake. Finally, to test for resonant energy transfer, we measured fluorescence anisotropy at two different wavelengths. The fluorescence of cells stained with Hoechst 33342 is a nonlinear process that shows an overall decrease in intensity with increased dye uptake, and spectral shift to the red. Along with the spectral shift of the fluorescence to the longer wavelengths, we document decreases in the fluorescence anisotropy that may indicate resonant energy transfer. At low concentrations, Hoechst 33342 binds to the minor groove of DNA and shows an increase in fluorescence and a blue shift upon binding. At higher concentrations, at which the dye molecules can no longer bind without overlapping, the blue fluorescence decreases and the red fluorescence increases until there is approximately one dye molecule per DNA base pair. The ratio of the blue fluorescence to the red fluorescence is an accurate indicator of the cellular dye concentration.

  7. Effect of GSTM1 and GSTT1 Polymorphisms on Genetic Damage in Humans Populations Exposed to Radiation From Mobile Towers.

    PubMed

    Gulati, Sachin; Yadav, Anita; Kumar, Neeraj; Kanupriya; Aggarwal, Neeraj K; Kumar, Rajesh; Gupta, Ranjan

    2016-04-01

    All over the world, people have been debating about associated health risks due to radiation from mobile phones and mobile towers. The carcinogenicity of this nonionizing radiation has been the greatest health concern associated with mobile towers exposure until recently. The objective of our study was to evaluate the genetic damage caused by radiation from mobile towers and to find an association between genetic polymorphism of GSTM1 and GSTT1 genes and DNA damage. In our study, 116 persons exposed to radiation from mobile towers and 106 control subjects were genotyped for polymorphisms in the GSTM1 and GSTT1 genes by multiplex polymerase chain reaction method. DNA damage in peripheral blood lymphocytes was determined using alkaline comet assay in terms of tail moment (TM) value and micronucleus assay in buccal cells (BMN). There was a significant increase in BMN frequency and TM value in exposed subjects (3.65 ± 2.44 and 6.63 ± 2.32) compared with control subjects (1.23 ± 0.97 and 0.26 ± 0.27). However, there was no association of GSTM1 and GSTT1 polymorphisms with the level of DNA damage in both exposed and control groups.

  8. A novel hsp110-related gene, apg-1, that is abundantly expressed in the testis responds to a low temperature heat shock rather than the traditional elevated temperatures.

    PubMed

    Kaneko, Y; Nishiyama, H; Nonoguchi, K; Higashitsuji, H; Kishishita, M; Fujita, J

    1997-01-31

    We isolated a novel hsp110-related gene, apg-1, from a testis cDNA library. The apg-1 transcripts were constitutively expressed in the testicular germ cells and, in some degree, most tissues examined. In a mouse TAMA26 Sertoli cell line, apg-1 transcripts were induced in 2 h by a temperature shift from 32 to 39 degrees C, but not by a shift from 37 to 42 degrees C, the traditional heat stress, or a shift from 32 to 42 degrees C. The heat response pattern of hsp110 expression was similar to that of apg-1. Although induction of a hsp70 transcript was observed in 2 h by a shift from 32 to 39 degrees C, the induction was more apparent by a shift from 37 to 42 degrees C or from 32 to 42 degrees C. Essentially similar differential response patterns were observed among these genes in NIH/3T3 fibroblasts as well. The nuclear run-on assay and the native gel mobility shift assay demonstrated that, by the 32 to 39 degrees C temperature shift, the apg-1 gene was transcriptionally activated, and heat shock factor 1 bound to the heat shock elements in the 5'-flanking region of the apg-1 gene. These results demonstrated that expressions of apg-1, hsp110, and hsp70 could be heat-induced at a temperature lower than the traditional elevated temperatures in somatic cells of both testis and nontestis origin and suggest that the mechanisms regulating the transcript levels of apg-1 and hsp110 are different from those of hsp70. Furthermore, the constitutive expression in germ cells suggests that APG-1 plays a specific role in spermatogenesis as well as in stress response.

  9. Interactions of trans-acting factor(s) with the estradiol response element and nuclear factor 1 of the vitellogenin II gene of Japanese quail.

    PubMed

    Gupta, S; Upadhayay, R; Kanungo, M S

    1996-08-01

    This study was directed at achieving an understanding of the mechanisms by which steroid hormones control the synthesis of vitellogenin (VTG) protein in the liver of the Japanese quail. Northern hybridization shows that administration of estradiol alone or with progesterone stimulates the synthesis of VTG mRNA. Gel mobility shift assay of DNA fragments containing the ERE and NF 1 shows that estradiol alone or with progesterone increases the levels of nuclear proteins that bind to these cis-acting elements of the promoter of the VTG gene. The cooperative effect of the two hormones seen at the level of expression of the VTG gene may be due to protein-protein interactions of trans-acting factors that bind to ERE and NF 1.

  10. SSB as an organizer/mobilizer of genome maintenance complexes

    PubMed Central

    Shereda, Robert D.; Kozlov, Alexander G.; Lohman, Timothy M.; Cox, Michael M.; Keck, James L.

    2008-01-01

    When duplex DNA is altered in almost any way (replicated, recombined, or repaired), single strands of DNA are usually intermediates, and single-stranded DNA binding (SSB) proteins are present. These proteins have often been described as inert, protective DNA coatings. Continuing research is demonstrating a far more complex role of SSB that includes the organization and/or mobilization of all aspects of DNA metabolism. Escherichia coli SSB is now known to interact with at least 14 other proteins that include key components of the elaborate systems involved in every aspect of DNA metabolism. Most, if not all, of these interactions are mediated by the amphipathic C-terminus of SSB. In this review, we summarize the extent of the eubacterial SSB interaction network, describe the energetics of interactions with SSB, and highlight the roles of SSB in the process of recombination. Similar themes to those highlighted in this review are evident in all biological systems. PMID:18937104

  11. Mating patterns and pollinator mobility are critical traits in forest fragmentation genetics

    PubMed Central

    Breed, M F; Ottewell, K M; Gardner, M G; Marklund, M H K; Dormontt, E E; Lowe, A J

    2015-01-01

    Most woody plants are animal-pollinated, but the global problem of habitat fragmentation is changing the pollination dynamics. Consequently, the genetic diversity and fitness of the progeny of animal-pollinated woody plants sired in fragmented landscapes tend to decline due to shifts in plant-mating patterns (for example, reduced outcrossing rate, pollen diversity). However, the magnitude of this mating-pattern shift should theoretically be a function of pollinator mobility. We first test this hypothesis by exploring the mating patterns of three ecologically divergent eucalypts sampled across a habitat fragmentation gradient in southern Australia. We demonstrate increased selfing and decreased pollen diversity with increased fragmentation for two small-insect-pollinated eucalypts, but no such relationship for the mobile-bird-pollinated eucalypt. In a meta-analysis, we then show that fragmentation generally does increase selfing rates and decrease pollen diversity, and that more mobile pollinators tended to dampen these mating-pattern shifts. Together, our findings support the premise that variation in pollinator form contributes to the diversity of mating-pattern responses to habitat fragmentation. PMID:24002239

  12. Mechanisms Used for Genomic Proliferation by Thermophilic Group II Introns

    PubMed Central

    Mohr, Georg; Ghanem, Eman; Lambowitz, Alan M.

    2010-01-01

    Mobile group II introns, which are found in bacterial and organellar genomes, are site-specific retroelments hypothesized to be evolutionary ancestors of spliceosomal introns and retrotransposons in higher organisms. Most bacteria, however, contain no more than one or a few group II introns, making it unclear how introns could have proliferated to higher copy numbers in eukaryotic genomes. An exception is the thermophilic cyanobacterium Thermosynechococcus elongatus, which contains 28 closely related copies of a group II intron, constituting ∼1.3% of the genome. Here, by using a combination of bioinformatics and mobility assays at different temperatures, we identified mechanisms that contribute to the proliferation of T. elongatus group II introns. These mechanisms include divergence of DNA target specificity to avoid target site saturation; adaptation of some intron-encoded reverse transcriptases to splice and mobilize multiple degenerate introns that do not encode reverse transcriptases, leading to a common splicing apparatus; and preferential insertion within other mobile introns or insertion elements, which provide new unoccupied sites in expanding non-essential DNA regions. Additionally, unlike mesophilic group II introns, the thermophilic T. elongatus introns rely on elevated temperatures to help promote DNA strand separation, enabling access to a larger number of DNA target sites by base pairing of the intron RNA, with minimal constraint from the reverse transcriptase. Our results provide insight into group II intron proliferation mechanisms and show that higher temperatures, which are thought to have prevailed on Earth during the emergence of eukaryotes, favor intron proliferation by increasing the accessibility of DNA target sites. We also identify actively mobile thermophilic introns, which may be useful for structural studies, gene targeting in thermophiles, and as a source of thermostable reverse transcriptases. PMID:20543989

  13. Orientation dependence in fluorescent energy transfer between Cy3 and Cy5 terminally attached to double-stranded nucleic acids

    PubMed Central

    Iqbal, Asif; Arslan, Sinan; Okumus, Burak; Wilson, Timothy J.; Giraud, Gerard; Norman, David G.; Ha, Taekjip; Lilley, David M. J.

    2008-01-01

    We have found that the efficiency of fluorescence resonance energy transfer between Cy3 and Cy5 terminally attached to the 5′ ends of a DNA duplex is significantly affected by the relative orientation of the two fluorophores. The cyanine fluorophores are predominantly stacked on the ends of the helix in the manner of an additional base pair, and thus their relative orientation depends on the length of the helix. Observed fluorescence resonance energy transfer (FRET) efficiency depends on the length of the helix, as well as its helical periodicity. By changing the helical geometry from B form double-stranded DNA to A form hybrid RNA/DNA, a marked phase shift occurs in the modulation of FRET efficiency with helix length. Both curves are well explained by the standard geometry of B and A form helices. The observed modulation for both polymers is less than that calculated for a fully rigid attachment of the fluorophores. However, a model involving lateral mobility of the fluorophores on the ends of the helix explains the observed experimental data. This has been further modified to take account of a minor fraction of unstacked fluorophore observed by fluorescent lifetime measurements. Our data unequivocally establish that Förster transfer obeys the orientation dependence as expected for a dipole–dipole interaction. PMID:18676615

  14. Inhibitory Effects of Bangladeshi Medicinal Plant Extracts on Interactions between Transcription Factors and Target DNA Sequences

    PubMed Central

    Lampronti, Ilaria; Khan, Mahmud T.H.; Borgatti, Monica; Bianchi, Nicoletta

    2008-01-01

    Several transcription factors (TFs) play crucial roles in governing the expression of different genes involved in the immune response, embryo or cell lineage development, cell apoptosis, cell cycle progression, oncogenesis, repair and fibrosis processes and inflammation. As far as inflammation, TFs playing pivotal roles are nuclear factor kappa B (NF-kB), activator protein (AP-1), signal transducer and activator of transcription (STATs), cAMP response element binding protein (CREB) and GATA-1 factors. All these TFs regulate the expression of pro-inflammatory cytokines and are involved in the pathogenesis of a number of human disorders, particularly those with an inflammatory component. Since several medicinal plants can be employed to produce extracts exhibiting biological effects and because alteration of gene transcription represents a very interesting approach to control the expression of selected genes, this study sought to verify the ability of several extracts derived from Bangladeshi medicinal plants in interfering with molecular interactions between different TFs and specific DNA sequences. We first analyzed the antiproliferative activity of 19 medicinal plants on different human cell lines, including erythroleukemia K562, B lymphoid Raji and T lymphoid Jurkat cell lines. Secondly, we employed the electrophoretic mobility shift assay as a suitable technique for a fast screening of plant extracts altering the binding between NF-kB, AP-1, GATA-1, STAT-3, CREB and the relative target DNA elements. PMID:18830455

  15. Specific DNA binding of a potential transcriptional regulator, inosine 5'-monophosphate dehydrogenase-related protein VII, to the promoter region of a methyl coenzyme m reductase I-encoding operon retrieved from Methanothermobacter thermautotrophicus strain DeltaH.

    PubMed

    Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi

    2008-10-01

    Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.

  16. Identification and characterization of TF1(phox), a DNA-binding protein that increases expression of gp91(phox) in PLB985 myeloid leukemia cells.

    PubMed

    Eklund, E A; Kakar, R

    1997-04-04

    The CYBB gene encodes gp91(phox), the heavy chain of the phagocyte-specific NADPH oxidase. CYBB is transcriptionally inactive until the promyelocyte stage of myelopoiesis, and in mature phagocytes, expression of gp91(phox) is further increased by interferon-gamma (IFN-gamma) and other inflammatory mediators. The CYBB promoter region contains several lineage-specific cis-elements involved in the IFN-gamma response. We screened a leukocyte cDNA expression library for proteins able to bind to one of these cis-elements (-214 to -262 base pairs) and identified TF1(phox), a protein with sequence-specific binding to the CYBB promoter. Electrophoretic mobility shift assay with nuclear proteins from a variety of cell lines demonstrated binding of a protein to the CYBB promoter that was cross-immunoreactive with TF1(phox). DNA binding of this protein was increased by IFN-gamma treatment in the myeloid cell line PLB985, but not in the non-myeloid cell line HeLa. Overexpression of recombinant TF1(phox) in PLB985 cells increased endogenous gp91(phox) message abundance, but did not lead to cellular differentiation. Overexpression of TF1(phox) in myeloid leukemia cell lines increased reporter gene expression from artificial promoter constructs containing CYBB promoter sequence. These data suggested that TF1(phox) increased expression of gp91(phox).

  17. The UL5 and UL52 subunits of the herpes simplex virus type 1 helicase-primase subcomplex exhibit a complex interdependence for DNA binding.

    PubMed

    Biswas, N; Weller, S K

    2001-05-18

    Herpes simplex virus type 1 encodes a heterotrimeric helicase-primase complex composed of the products of the UL5, UL52, and UL8 genes. The UL5 protein contains seven motifs found in all members of helicase Superfamily 1 (SF1), and the UL52 protein contains several conserved motifs found in primases; however, the contributions of each subunit to the biochemical activities of the subcomplex are not clear. In this work, the DNA binding properties of wild type and mutant subcomplexes were examined using single-stranded, duplex, and forked substrates. A gel mobility shift assay indicated that the UL5-UL52 subcomplex binds more efficiently to the forked substrate than to either single strand or duplex DNA. Although nucleotides are not absolutely required for DNA binding, ADP stimulated the binding of UL5-UL52 to single strand DNA whereas ATP, ADP, and adenosine 5'-O-(thiotriphosphate) stimulated the binding to a forked substrate. We have previously shown that both subunits contact single-stranded DNA in a photocross-linking assay (Biswas, N., and Weller, S. K. (1999) J. Biol. Chem. 274, 8068-8076). In this study, photocross-linking assays with forked substrates indicate that the UL5 and UL52 subunits contact the forked substrates at different positions, UL52 at the single-stranded DNA tail and UL5 near the junction between single-stranded and double-stranded DNA. Neither subunit was able to cross-link a forked substrate when 5-iododeoxyuridine was located within the duplex portion. Photocross-linking experiments with subcomplexes containing mutant versions of UL5 and wild type UL52 indicated that the integrity of the ATP binding region is important for DNA binding of both subunits. These results support our previous proposal that UL5 and UL52 exhibit a complex interdependence for DNA binding (Biswas, N., and Weller, S. K. (1999) J. Biol. Chem. 274, 8068-8076) and indicate that the UL52 subunit may play a more active role in helicase activity than had previously been thought.

  18. Dual DNA binding property of ABA insensitive 3 like factors targeted to promoters responsive to ABA and auxin.

    PubMed

    Nag, Ronita; Maity, Manas Kanti; Dasgupta, Maitrayee

    2005-11-01

    The ABA responsive ABI3 and the auxin responsive ARF family of transcription factors bind the CATGCATG (Sph) and TGTCTC core motifs in ABA and auxin response elements (ABRE and AuxRE), respectively. Several evidences indicate ABI3s to act downstream to auxin too. Because DNA binding domain of ABI3s shows significant overlap with ARFs we enquired whether auxin responsiveness through ABI3s could be mediated by their binding to canonical AuxREs. Investigations were undertaken through in vitro gel mobility shift assays (GMSA) using the DNA binding domain B3 of PvAlf (Phaseolus vulgaris ABI3 like factor) and upstream regions of auxin responsive gene GH3 (-267 to -141) and ABA responsive gene Em (-316 to -146) harboring AuxRE and ABRE, respectively. We demonstrate that B3 domain of PvAlf could bind AuxRE only when B3 was associated with its flanking domain B2 (B2B3). Such strict requirement of B2 domain was not observed with ABRE, where B3 could bind with or without being associated with B2. This dual specificity in DNA binding of ABI3s was also demonstrated with nuclear extracts of cultured cells of Arachis hypogea. Supershift analysis of ABRE and AuxRE bound nuclear proteins with antibodies raised against B2B3 domains of PvAlf revealed that ABI3 associated complexes were detectable in association with both cis elements. Competition GMSA confirmed the same complexes to bind ABRE and AuxRE. This dual specificity of ABI3 like factors in DNA binding targeted to natural promoters responsive to ABA and auxin suggests them to have a potential role in conferring crosstalk between these two phytohormones.

  19. The bZIP dimer localizes at DNA full-sites where each basic region can alternately translocate and bind to subsites at the half-site

    PubMed Central

    Chan, I-San; Al-Sarraj, Taufik; Shahravan, S. Hesam; Fedorova, Anna V.; Shin, Jumi A.

    2012-01-01

    Crystal structures of the GCN4 bZIP (basic region/leucine zipper) with the AP-1 or CRE site show how each GCN4 basic region binds to a 4-bp cognate half-site as a single DNA target; however, this may not always fully describe how bZIP proteins interact with their target sites. Previously, we showed that the GCN4 basic region interacts with all 5 bp in half-site TTGCG (termed 5H-LR), and that 5H-LR comprises two 4-bp subsites, TTGC and TGCG, which individually are also target sites of the basic region. In this work, we explored how the basic region interacts with 5H-LR when the bZIP dimer localizes to full-sites. Using AMBER molecular modeling, we simulated GCN4 bZIP complexes with full-sites containing 5H-LR to investigate in silico the interface between the basic region and 5H-LR. We also performed in vitro investigation of bZIP–DNA interactions at a number of full-sites that contain 5H-LR vs. either subsite: we analyzed results from DNase I footprinting and electrophoretic mobility shift assay (EMSA) and from EMSA titrations to quantify binding affinities. Our computational and experimental results together support a highly dynamic DNA-binding model: when a bZIP dimer localizes to its target full-site, the basic region can alternately recognize either subsite as a distinct target at 5H-LR and translocate between the subsites, potentially by sliding and hopping. This model provides added insights into how α-helical DNA-binding domains of transcription factors can localize to their gene regulatory sequences in vivo. PMID:22856882

  20. The bZIP dimer localizes at DNA full-sites where each basic region can alternately translocate and bind to subsites at the half-site.

    PubMed

    Chan, I-San; Al-Sarraj, Taufik; Shahravan, S Hesam; Fedorova, Anna V; Shin, Jumi A

    2012-08-21

    Crystal structures of the GCN4 bZIP (basic region/leucine zipper) with the AP-1 or CRE site show how each GCN4 basic region binds to a 4 bp cognate half-site as a single DNA target; however, this may not always fully describe how bZIP proteins interact with their target sites. Previously, we showed that the GCN4 basic region interacts with all 5 bp in half-site TTGCG (termed 5H-LR) and that 5H-LR comprises two 4 bp subsites, TTGC and TGCG, which individually are also target sites of the basic region. In this work, we explore how the basic region interacts with 5H-LR when the bZIP dimer localizes to full-sites. Using AMBER molecular modeling, we simulated GCN4 bZIP complexes with full-sites containing 5H-LR to investigate in silico the interface between the basic region and 5H-LR. We also performed in vitro investigation of bZIP-DNA interactions at a number of full-sites that contain 5H-LR versus either subsite: we analyzed results from DNase I footprinting and electrophoretic mobility shift assay (EMSA) and from EMSA titrations to quantify binding affinities. Our computational and experimental results together support a highly dynamic DNA-binding model: when a bZIP dimer localizes to its target full-site, the basic region can alternately recognize either subsite as a distinct target at 5H-LR and translocate between the subsites, potentially by sliding and hopping. This model provides added insights into how α-helical DNA-binding domains of transcription factors can localize to their gene regulatory sequences in vivo.

  1. Initial Characterization of the Pf-Int Recombinase from the Malaria Parasite Plasmodium falciparum

    PubMed Central

    Ghorbal, Mehdi; Scheidig-Benatar, Christine; Bouizem, Salma; Thomas, Christophe; Paisley, Genevieve; Faltermeier, Claire; Liu, Melanie; Scherf, Artur; Lopez-Rubio, Jose-Juan; Gopaul, Deshmukh N.

    2012-01-01

    Background Genetic variation is an essential means of evolution and adaptation in many organisms in response to environmental change. Certain DNA alterations can be carried out by site-specific recombinases (SSRs) that fall into two families: the serine and the tyrosine recombinases. SSRs are seldom found in eukaryotes. A gene homologous to a tyrosine site-specific recombinase has been identified in the genome of Plasmodium falciparum. The sequence is highly conserved among five other members of Plasmodia. Methodology/Principal Findings The predicted open reading frame encodes for a ∼57 kDa protein containing a C-terminal domain including the putative tyrosine recombinase conserved active site residues R-H-R-(H/W)-Y. The N-terminus has the typical alpha-helical bundle and potentially a mixed alpha-beta domain resembling that of λ-Int. Pf-Int mRNA is expressed differentially during the P. falciparum erythrocytic life stages, peaking in the schizont stage. Recombinant Pf-Int and affinity chromatography of DNA from genomic or synthetic origin were used to identify potential DNA targets after sequencing or micro-array hybridization. Interestingly, the sequences captured also included highly variable subtelomeric genes such as var, rif, and stevor sequences. Electrophoretic mobility shift assays with DNA were carried out to verify Pf-Int/DNA binding. Finally, Pf-Int knock-out parasites were created in order to investigate the biological role of Pf-Int. Conclusions/Significance Our data identify for the first time a malaria parasite gene with structural and functional features of recombinases. Pf-Int may bind to and alter DNA, either in a sequence specific or in a non-specific fashion, and may contribute to programmed or random DNA rearrangements. Pf-Int is the first molecular player identified with a potential role in genome plasticity in this pathogen. Finally, Pf-Int knock-out parasite is viable showing no detectable impact on blood stage development, which is compatible with such function. PMID:23056326

  2. An evaluation of transport mode shift policies on transport-related physical activity through simulations based on random forests.

    PubMed

    Brondeel, Ruben; Kestens, Yan; Chaix, Basile

    2017-10-23

    Physical inactivity is widely recognized as one of the leading causes of mortality, and transport accounts for a large part of people's daily physical activity. This study develops a simulation approach to evaluate the impact of the Ile-de-France Urban Mobility Plan (2010-2020) on physical activity, under the hypothesis that the intended transport mode shifts are realized. Based on the Global Transport Survey (2010, n = 21,332) and on the RECORD GPS Study (2012-2013, n = 229) from the French capital region of Paris (Ile-de-France), a simulation method was designed and tested. The simulation method used accelerometer data and random forest models to predict the impact of the transport mode shifts anticipated in the Mobility Plan on transport-related moderate-to-vigorous physical activity (T-MVPA). The transport mode shifts include less private motorized trips in favor of more public transport, walking, and biking trips. The simulation model indicated a mean predicted increase of 2 min per day of T-MVPA, in case the intended transport mode shifts in the Ile-de-France Urban Mobility Plan were realized. The positive effect of the transport mode shifts on T-MVPA would, however, be larger for people with a higher level of education. This heterogeneity in the positive effect would further increase the existing inequality in transport-related physical activity by educational level. The method presented in this paper showed a significant increase in transport-related physical activity in case the intended mode shifts in the Ile-de-France Urban Mobility Plan were realized. This simulation method could be applied on other important health outcomes, such as exposure to noise or air pollution, making it a useful tool to anticipate the health impact of transport interventions or policies.

  3. Mobile DNA and evolution in the 21st century

    PubMed Central

    2010-01-01

    Scientific history has had a profound effect on the theories of evolution. At the beginning of the 21st century, molecular cell biology has revealed a dense structure of information-processing networks that use the genome as an interactive read-write (RW) memory system rather than an organism blueprint. Genome sequencing has documented the importance of mobile DNA activities and major genome restructuring events at key junctures in evolution: exon shuffling, changes in cis-regulatory sites, horizontal transfer, cell fusions and whole genome doublings (WGDs). The natural genetic engineering functions that mediate genome restructuring are activated by multiple stimuli, in particular by events similar to those found in the DNA record: microbial infection and interspecific hybridization leading to the formation of allotetraploids. These molecular genetic discoveries, plus a consideration of how mobile DNA rearrangements increase the efficiency of generating functional genomic novelties, make it possible to formulate a 21st century view of interactive evolutionary processes. This view integrates contemporary knowledge of the molecular basis of genetic change, major genome events in evolution, and stimuli that activate DNA restructuring with classical cytogenetic understanding about the role of hybridization in species diversification. PMID:20226073

  4. MobB protein stimulates nicking at the R1162 origin of transfer by increasing the proportion of complexed plasmid DNA.

    PubMed Central

    Perwez, T; Meyer, R

    1996-01-01

    An essential early step in conjugal mobilization of R1162, nicking of the DNA strand that is subsequently transferred, is carried out in the relaxosome, a complex of two plasmid-encoded proteins and DNA at the origin of transfer (oriT). A third protein, MobB, is also required for efficient mobilization. We show that in the cell this protein increases the proportion of molecules specifically nicked at oriT, resulting in lower yields of covalently closed molecules after alkaline extraction. These nicked molecules largely remain supercoiled, with unwinding presumably constrained by the relaxosome. MobB enhances the sensitivity of the oriT DNA to oxidation by permanganate, indicating that the protein acts by increasing the fraction of complexed molecules. Mutations that significantly reduce the amount of complexed DNA in the cell were isolated. However, plasmids with these mutations were mobilized at nearly the normal frequency, were nicked at a commensurate level, and still required MobB. Our results indicate that the frequency of transfer is determined both by the amount of time each molecule is in the nicked form and by the proportion of complexed molecules in the total population. PMID:8824623

  5. Mobile Phone Radiation Induces Reactive Oxygen Species Production and DNA Damage in Human Spermatozoa In Vitro

    PubMed Central

    De Iuliis, Geoffry N.; Newey, Rhiannon J.; King, Bruce V.; Aitken, R. John

    2009-01-01

    Background In recent times there has been some controversy over the impact of electromagnetic radiation on human health. The significance of mobile phone radiation on male reproduction is a key element of this debate since several studies have suggested a relationship between mobile phone use and semen quality. The potential mechanisms involved have not been established, however, human spermatozoa are known to be particularly vulnerable to oxidative stress by virtue of the abundant availability of substrates for free radical attack and the lack of cytoplasmic space to accommodate antioxidant enzymes. Moreover, the induction of oxidative stress in these cells not only perturbs their capacity for fertilization but also contributes to sperm DNA damage. The latter has, in turn, been linked with poor fertility, an increased incidence of miscarriage and morbidity in the offspring, including childhood cancer. In light of these associations, we have analyzed the influence of RF-EMR on the cell biology of human spermatozoa in vitro. Principal Findings Purified human spermatozoa were exposed to radio-frequency electromagnetic radiation (RF-EMR) tuned to 1.8 GHz and covering a range of specific absorption rates (SAR) from 0.4 W/kg to 27.5 W/kg. In step with increasing SAR, motility and vitality were significantly reduced after RF-EMR exposure, while the mitochondrial generation of reactive oxygen species and DNA fragmentation were significantly elevated (P<0.001). Furthermore, we also observed highly significant relationships between SAR, the oxidative DNA damage bio-marker, 8-OH-dG, and DNA fragmentation after RF-EMR exposure. Conclusions RF-EMR in both the power density and frequency range of mobile phones enhances mitochondrial reactive oxygen species generation by human spermatozoa, decreasing the motility and vitality of these cells while stimulating DNA base adduct formation and, ultimately DNA fragmentation. These findings have clear implications for the safety of extensive mobile phone use by males of reproductive age, potentially affecting both their fertility and the health and wellbeing of their offspring. PMID:19649291

  6. Specific labeling of zinc finger proteins using noncanonical amino acids and copper-free click chemistry.

    PubMed

    Kim, Younghoon; Kim, Sung Hoon; Ferracane, Dean; Katzenellenbogen, John A; Schroeder, Charles M

    2012-09-19

    Zinc finger proteins (ZFPs) play a key role in transcriptional regulation and serve as invaluable tools for gene modification and genetic engineering. Development of efficient strategies for labeling metalloproteins such as ZFPs is essential for understanding and controlling biological processes. In this work, we engineered ZFPs containing cysteine-histidine (Cys2-His2) motifs by metabolic incorporation of the unnatural amino acid azidohomoalanine (AHA), followed by specific protein labeling via click chemistry. We show that cyclooctyne promoted [3 + 2] dipolar cycloaddition with azides, known as copper-free click chemistry, provides rapid and specific labeling of ZFPs at high yields as determined by mass spectrometry analysis. We observe that the DNA-binding activity of ZFPs labeled by conventional copper-mediated click chemistry was completely abolished, whereas ZFPs labeled by copper-free click chemistry retain their sequence-specific DNA-binding activity under native conditions, as determined by electrophoretic mobility shift assays, protein microarrays, and kinetic binding assays based on Förster resonance energy transfer (FRET). Our work provides a general framework to label metalloproteins such as ZFPs by metabolic incorporation of unnatural amino acids followed by copper-free click chemistry.

  7. Specific Labeling of Zinc Finger Proteins using Non-canonical Amino Acids and Copper-free Click Chemistry

    PubMed Central

    Kim, Younghoon; Kim, Sung Hoon; Ferracane, Dean; Katzenellenbogen, John A.

    2012-01-01

    Zinc finger proteins (ZFPs) play a key role in transcriptional regulation and serve as invaluable tools for gene modification and genetic engineering. Development of efficient strategies for labeling metalloproteins such as ZFPs is essential for understanding and controlling biological processes. In this work, we engineered ZFPs containing cysteine-histidine (Cys2-His2) motifs by metabolic incorporation of the unnatural amino acid azidohomoalanine (AHA), followed by specific protein labeling via click chemistry. We show that cyclooctyne promoted [3 + 2] dipolar cycloaddition with azides, known as copper-free click chemistry, provides rapid and specific labeling of ZFPs at high yields as determined by mass spectrometry analysis. We observe that the DNA-binding activity of ZFPs labeled by conventional copper-mediated click chemistry was completely abolished, whereas ZFPs labeled by copper-free click chemistry retain their sequence-specific DNA-binding activity under native conditions, as determined by electrophoretic mobility shift assays, protein microarrays and kinetic binding assays based on Förster resonance energy transfer (FRET). Our work provides a general framework to label metalloproteins such as ZFPs by metabolic incorporation of unnatural amino acids followed by copper-free click chemistry. PMID:22871171

  8. Leptin rapidly activates PPARs in C2C12 muscle cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bendinelli, Paola; Piccoletti, Roberta; Maroni, Paola

    2005-07-08

    Experimental evidence suggests that leptin operates on the tissues, including skeletal muscle, also by modulating gene expression. Using electrophoretic mobility shift assays, we have shown that physiological doses of leptin promptly increase the binding of C2C12 cell nuclear extracts to peroxisome proliferator-activated receptor (PPAR) response elements in oligonucleotide probes and that all three PPAR isoforms participate in DNA-binding complexes. We pre-treated C2C12 cells with AACOCF{sub 3}, a specific inhibitor of cytosolic phospholipase A{sub 2} (cPLA{sub 2}), an enzyme that supplies ligands to PPARs, and found that it abrogates leptin-induced PPAR DNA-binding activity. Leptin treatment significantly increased cPLA{sub 2} activity, evaluatedmore » as the release of [{sup 3}H]arachidonic acid from pre-labelled C2C12 cells, as well as phosphorylation. Further, using MEK1 inhibitor PD-98059 we showed that leptin activates cPLA{sub 2} through ERK induction. These results support a direct effect of leptin on skeletal muscle cells, and suggest that the hormone may modulate muscle transcription also by precocious activation of PPARs through ERK-cPLA{sub 2} pathway.« less

  9. A duplex DNA-gold nanoparticle probe composed as a colorimetric biosensor for sequence-specific DNA-binding proteins.

    PubMed

    Ahn, Junho; Choi, Yeonweon; Lee, Ae-Ree; Lee, Joon-Hwa; Jung, Jong Hwa

    2016-03-21

    Using duplex DNA-AuNP aggregates, a sequence-specific DNA-binding protein, SQUAMOSA Promoter-binding-Like protein 12 (SPL-12), was directly determined by SPL-12-duplex DNA interaction-based colorimetric actions of DNA-Au assemblies. In order to prepare duplex DNA-Au aggregates, thiol-modified DNA 1 and DNA 2 were attached onto the surface of AuNPs, respectively, by the salt-aging method and then the DNA-attached AuNPs were mixed. Duplex-DNA-Au aggregates having the average size of 160 nm diameter and the maximum absorption at 529 nm were able to recognize SPL-12 and reached the equivalent state by the addition of ∼30 equivalents of SPL-12 accompanying a color change from red to blue with a red shift of the maximum absorption at 570 nm. As a result, the aggregation size grew to about 247 nm. Also, at higher temperatures of the mixture of duplex-DNA-Au aggregate solution and SPL-12, the equivalent state was reached rapidly. On the contrary, in the control experiment using Bovine Serum Albumin (BSA), no absorption band shift of duplex-DNA-Au aggregates was observed.

  10. Explosive diversification following a benthic to pelagic shift in freshwater fishes

    PubMed Central

    2013-01-01

    Background Interspecific divergence along a benthic to pelagic habitat axis is ubiquitous in freshwater fishes inhabiting lentic environments. In this study, we examined the influence of this habitat axis on the macroevolution of a diverse, lotic radiation using mtDNA and nDNA phylogenies for eastern North America’s most species-rich freshwater fish clade, the open posterior myodome (OPM) cyprinids. We used ancestral state reconstruction to identify the earliest benthic to pelagic transition in this group and generated fossil-calibrated estimates of when this shift occurred. This transition could have represented evolution into a novel adaptive zone, and therefore, we tested for a period of accelerated lineage accumulation after this historical habitat shift. Results Ancestral state reconstructions inferred a similar and concordant region of our mtDNA and nDNA based gene trees as representing the shift from benthic to pelagic habitats in the OPM clade. Two independent tests conducted on each gene tree suggested an increased diversification rate after this inferred habitat transition. Furthermore, lineage through time analyses indicated rapid early cladogenesis in the clade arising after the benthic to pelagic shift. Conclusions A burst of diversification followed the earliest benthic to pelagic transition during the radiation of OPM cyprinids in eastern North America. As such, the benthic/pelagic habitat axis has likely influenced the generation of biodiversity across disparate freshwater ecosystems. PMID:24341464

  11. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    PubMed

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick base pair in SECIS element plays an important role in the selenocysteine expression by UGA codon.

  12. Ionic switch controls the DNA state in phage λ

    PubMed Central

    Li, Dong; Liu, Ting; Zuo, Xiaobing; Li, Tao; Qiu, Xiangyun; Evilevitch, Alex

    2015-01-01

    We have recently found that DNA packaged in phage λ undergoes a disordering transition triggered by temperature, which results in increased genome mobility. This solid-to-fluid like DNA transition markedly increases the number of infectious λ particles facilitating infection. However, the structural transition strongly depends on temperature and ionic conditions in the surrounding medium. Using titration microcalorimetry combined with solution X-ray scattering, we mapped both energetic and structural changes associated with transition of the encapsidated λ-DNA. Packaged DNA needs to reach a critical stress level in order for transition to occur. We varied the stress on DNA in the capsid by changing the temperature, packaged DNA length and ionic conditions. We found striking evidence that the intracapsid DNA transition is ‘switched on’ at the ionic conditions mimicking those in vivo and also at the physiologic temperature of infection at 37°C. This ion regulated on-off switch of packaged DNA mobility in turn affects viral replication. These results suggest a remarkable adaptation of phage λ to the environment of its host bacteria in the human gut. The metastable DNA state in the capsid provides a new paradigm for the physical evolution of viruses. PMID:26092697

  13. Primer-Independent DNA Synthesis by a Family B DNA Polymerase from Self-Replicating Mobile Genetic Elements.

    PubMed

    Redrejo-Rodríguez, Modesto; Ordóñez, Carlos D; Berjón-Otero, Mónica; Moreno-González, Juan; Aparicio-Maldonado, Cristian; Forterre, Patrick; Salas, Margarita; Krupovic, Mart

    2017-11-07

    Family B DNA polymerases (PolBs) play a central role during replication of viral and cellular chromosomes. Here, we report the discovery of a third major group of PolBs, which we denote primer-independent PolB (piPolB), that might be a link between the previously known protein-primed and RNA/DNA-primed PolBs. PiPolBs are encoded by highly diverse mobile genetic elements, pipolins, integrated in the genomes of diverse bacteria and also present as circular plasmids in mitochondria. Biochemical characterization showed that piPolB displays efficient DNA polymerization activity that can use undamaged and damaged templates and is endowed with proofreading and strand displacement capacities. Remarkably, the protein is also capable of template-dependent de novo DNA synthesis, i.e., DNA-priming activity, thereby breaking the long-standing dogma that replicative DNA polymerases require a pre-existing primer for DNA synthesis. We suggest that piPolBs are involved in self-replication of pipolins and may also contribute to bacterial DNA damage tolerance. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  14. Ionic switch controls the DNA state in phage λ

    DOE PAGES

    Li, Dong; Liu, Ting; Zuo, Xiaobing; ...

    2015-06-19

    We have recently found that DNA packaged in phage λ undergoes a disordering transition triggered by temperature, which results in increased genome mobility. This solid-to-fluid like DNA transition markedly increases the number of infectious λ particles facilitating infection. However, the structural transition strongly depends on temperature and ionic conditions in the surrounding medium. Using titration microcalorimetry combined with solution X-ray scattering, we mapped both energetic and structural changes associated with transition of the encapsidated λ-DNA. Packaged DNA needs to reach a critical stress level in order for transition to occur. We varied the stress on DNA in the capsid bymore » changing the temperature, packaged DNA length and ionic conditions. We found striking evidence that the intracapsid DNA transition is ‘switched on’ at the ionic conditions mimicking those in vivo and also at the physiologic temperature of infection at 37°C. This ion regulated on-off switch of packaged DNA mobility in turn affects viral replication. The results suggest a remarkable adaptation of phage λ to the environment of its host bacteria in the human gut. The metastable DNA state in the capsid provides a new paradigm for the physical evolution of viruses.« less

  15. Ionic switch controls the DNA state in phage λ

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Dong; Liu, Ting; Zuo, Xiaobing

    We have recently found that DNA packaged in phage λ undergoes a disordering transition triggered by temperature, which results in increased genome mobility. This solid-to-fluid like DNA transition markedly increases the number of infectious λ particles facilitating infection. However, the structural transition strongly depends on temperature and ionic conditions in the surrounding medium. Using titration microcalorimetry combined with solution X-ray scattering, we mapped both energetic and structural changes associated with transition of the encapsidated λ-DNA. Packaged DNA needs to reach a critical stress level in order for transition to occur. We varied the stress on DNA in the capsid bymore » changing the temperature, packaged DNA length and ionic conditions. We found striking evidence that the intracapsid DNA transition is ‘switched on’ at the ionic conditions mimicking those in vivo and also at the physiologic temperature of infection at 37°C. This ion regulated on-off switch of packaged DNA mobility in turn affects viral replication. The results suggest a remarkable adaptation of phage λ to the environment of its host bacteria in the human gut. The metastable DNA state in the capsid provides a new paradigm for the physical evolution of viruses.« less

  16. A Naturally Occurring Mutation K220T in the Pleiotropic Activator PrfA of Listeria Monocytogenes Results in a Loss of Virulence Due to Decreasing DNA-Binding Affinity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Velge,P.; Herler, M.; Johansson, J.

    2007-01-01

    The sequencing of prfA, encoding the transcriptional regulator of virulence genes, in 26 low-virulence field Listeria monocytogenes strains showed that eight strains exhibited the same single amino-acid substitution: PrfAK220T. These strains exhibited no expression of PrfA-regulated proteins and thus no virulence. This substitution inactivated PrfA, since expression of the PrfAK220T mutant gene in an EGD{Delta}prfA strain did not restore the haemolytic and phosphatidylcholine phospholipase C activities, in contrast to the wild-type prfA gene. The substitution of the lysine at position 220 occurred in the helix H. However, the data showed that the PrfAK220T protein is dimerized just as well asmore » its wild-type counterpart, but does not bind to PrfA-boxes. PrfAK220T did not form a PrfA-DNA complex in electrophoretic mobility shift assays, but low concentrations of CI complexes (PrfAK220T-RNA polymerase-DNA complex) were formed by adding RNA polymerase, suggesting that PrfA interacted with RNA polymerase in solution in the absence of DNA. Formation of some transcriptionally active complexes was confirmed by in vitro runoff transcription assays and quantitative RT-PCR. Crystallographic analyses described the structure of native PrfA and highlighted the key role of allosteric changes in the activity of PrfA and especially the role of the Lys220 in the conformation of the helix-turn-helix (HTH) motif.« less

  17. Sequence-specific DNA binding by MYC/MAX to low-affinity non-E-box motifs.

    PubMed

    Allevato, Michael; Bolotin, Eugene; Grossman, Mark; Mane-Padros, Daniel; Sladek, Frances M; Martinez, Ernest

    2017-01-01

    The MYC oncoprotein regulates transcription of a large fraction of the genome as an obligatory heterodimer with the transcription factor MAX. The MYC:MAX heterodimer and MAX:MAX homodimer (hereafter MYC/MAX) bind Enhancer box (E-box) DNA elements (CANNTG) and have the greatest affinity for the canonical MYC E-box (CME) CACGTG. However, MYC:MAX also recognizes E-box variants and was reported to bind DNA in a "non-specific" fashion in vitro and in vivo. Here, in order to identify potential additional non-canonical binding sites for MYC/MAX, we employed high throughput in vitro protein-binding microarrays, along with electrophoretic mobility-shift assays and bioinformatic analyses of MYC-bound genomic loci in vivo. We identified all hexameric motifs preferentially bound by MYC/MAX in vitro, which include the low-affinity non-E-box sequence AACGTT, and found that the vast majority (87%) of MYC-bound genomic sites in a human B cell line contain at least one of the top 21 motifs bound by MYC:MAX in vitro. We further show that high MYC/MAX concentrations are needed for specific binding to the low-affinity sequence AACGTT in vitro and that elevated MYC levels in vivo more markedly increase the occupancy of AACGTT sites relative to CME sites, especially at distal intergenic and intragenic loci. Hence, MYC binds diverse DNA motifs with a broad range of affinities in a sequence-specific and dose-dependent manner, suggesting that MYC overexpression has more selective effects on the tumor transcriptome than previously thought.

  18. Fructose 1-Phosphate Is the Preferred Effector of the Metabolic Regulator Cra of Pseudomonas putida*

    PubMed Central

    Chavarría, Max; Santiago, César; Platero, Raúl; Krell, Tino; Casasnovas, José M.; de Lorenzo, Víctor

    2011-01-01

    The catabolite repressor/activator (Cra) protein is a global sensor and regulator of carbon fluxes through the central metabolic pathways of Gram-negative bacteria. To examine the nature of the effector (or effectors) that signal such fluxes to the protein of Pseudomonas putida, the Cra factor of this soil microorganism has been purified and characterized and its three-dimensional structure determined. Analytical ultracentrifugation, gel filtration, and mobility shift assays showed that the effector-free Cra is a dimer that binds an operator DNA sequence in the promoter region of the fruBKA cluster. Furthermore, fructose 1-phosphate (F1P) was found to most efficiently dissociate the Cra-DNA complex. Thermodynamic parameters of the F1P-Cra-DNA interaction calculated by isothermal titration calorimetry revealed that the factor associates tightly to the DNA sequence 5′-TTAAACGTTTCA-3′ (KD = 26.3 ± 3.1 nm) and that F1P binds the protein with an apparent stoichiometry of 1.06 ± 0.06 molecules per Cra monomer and a KD of 209 ± 20 nm. Other possible effectors, like fructose 1,6-bisphosphate, did not display a significant affinity for the regulator under the assay conditions. Moreover, the structure of Cra and its co-crystal with F1P at a 2-Å resolution revealed that F1P fits optimally the geometry of the effector pocket. Our results thus single out F1P as the preferred metabolic effector of the Cra protein of P. putida. PMID:21239488

  19. Atomic Simulation of Complex DNA DSBs and the Interactions with the Ku70/80 Heterodimer

    NASA Technical Reports Server (NTRS)

    Hu, Shaowen; Cucinotta, Francis A.

    2011-01-01

    DNA double strand breaks (DSBs) induced by ionizing radiation (IR) usually contain modified bases such as 8-oxo-7,8-dihydroguanine (8-oxoG) and thymine glycol, apurinic/apyrimidinic (AP) sites, 2-deoxyribonolactone, or single-strand breaks (SSBs). The presence of such lesions in close proximity to the DSB terminus makes the DNA nicks more difficult to repair and rejoin than endogenously induced simple DSBs, and as such a major determinant of the biological effects of high linear energy transfer (LET) radiation as encountered in space travel. In this study we conducted molecular dynamics simulations on a series of DNA duplexes with various complex lesions of 8-oxoG and AP sites, in an effort to investigate the effects of such lesions to the structural integrity and stability of DNA after insulted by IR. We also simulated the interaction of such complex DSBs with the Ku70/80 heterodimer, the first protein in mammalian cells to embark the non-homologous end joining (NHEJ) DNA repair pathway. The results indicate, compared to DNA with simple DSBs, the complex lesions can enhance the hydrogen bonds opening rate at the DNA terminus, and increase the mobility of the whole duplex, thus they present more deleterious effects to the genome integrity if not captured and repaired promptly in cells. Simulations also demonstrate the binding of Ku drastically reduces structural disruption and flexibility caused by the complex lesions, and the interactions of Ku with complex DSBs have a different potential energy landscape from the bound structure with simple DSB. In all complex DSBs systems, the binding of DSB terminus with Ku70 is softened while the binding of the middle duplex with Ku80 is tightened. This energy shift may help the Ku protein to secure at the DSB terminus for a longer time, so that other end processing factors or repair pathways can proceed at the lesions before NHEJ repair process starts. These atomic simulations may provide valuable new insight into the selective action of repair proteins on damaged DNA.

  20. Methods for separating particles and/or nucleic acids using isotachophoresis

    DOEpatents

    Jung, Byoungsok; Ness, Kevin; Rose, Klint A.

    2016-03-15

    According to one embodiment, a method includes co-feeding fluids comprising a leading electrolyte, a trailing electrolyte, and at least one of DNA and RNA to a channel, and applying an electric field to the fluids in a direction perpendicular to an axis of the channel for inducing transverse isotachophoresis. In another embodiment, a method includes co-feeding fluids to a channel. The fluids include a leading electrolyte, a trailing electrolyte, biological objects, at least one of DNA and RNA, and a spacer electrolyte having an electrophoretic mobility that is between an electrophoretic mobility of at least some of the biological objects and an electrophoretic mobility of the at least one of the DNA and the RNA. The method also includes applying an electric field to the fluids in a direction perpendicular to an axis of the channel for inducing transverse isotachophoresis. Other methods of isotachophoresis are disclosed in addition to these.

  1. Meeting report for mobile DNA 2010.

    PubMed

    Chaconas, George; Craig, Nancy; Curcio, M Joan; Deininger, Prescott; Feschotte, Cedric; Levin, Henry; Rice, Phoebe A; Voytas, Daniel F

    2010-08-24

    An international conference on mobile DNA was held 24-28 April 2010 in Montreal, Canada. Sponsored by the American Society for Microbiology, the conference's goal was to bring together researchers from around the world who study transposition in diverse organisms using multiple experimental approaches. The meeting drew over 190 attendees and most contributed through poster presentations, invited talks and short talks selected from poster abstracts. The talks were organized into eight scientific sessions, which ranged in topic from the evolutionary dynamics of mobile genetic elements to transposition reaction mechanisms. Here we present highlights from the platform sessions with a focus on talks presented by the invited speakers.

  2. Role of 6-Mercaptopurine in the potential therapeutic targets DNA base pairs and G-quadruplex DNA: insights from quantum chemical and molecular dynamics simulations.

    PubMed

    Radhika, R; Shankar, R; Vijayakumar, S; Kolandaivel, P

    2018-05-01

    The theoretical studies on DNA with the anticancer drug 6-Mercaptopurine (6-MP) are investigated using theoretical methods to shed light on drug designing. Among the DNA base pairs considered, 6-MP is stacked with GC with the highest interaction energy of -46.19 kcal/mol. Structural parameters revealed that structure of the DNA base pairs is deviated from the planarity of the equilibrium position due to the formation of hydrogen bonds and stacking interactions with 6-MP. These deviations are verified through the systematic comparison between X-H bond contraction and elongation and the associated blue shift and red shift values by both NBO analysis and vibrational analysis. Bent's rule is verified for the C-H bond contraction in the 6-MP interacted base pairs. The AIM results disclose that the higher values of electron density (ρ) and Laplacian of electron density (∇ 2 ρ) indicate the increased overlap between the orbitals that represent the strong interaction and positive values of the total electron density show the closed-shell interaction. The relative sensitivity of the chemical shift values for the DNA base pairs with 6-MP is investigated to confirm the hydrogen bond strength. Molecular dynamics simulation studies of G-quadruplex DNA d(TGGGGT) 4 with 6-MP revealed that the incorporation of 6-MP appears to cause local distortions and destabilize the G-quadruplex DNA.

  3. Two high-mobility group box domains act together to underwind and kink DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sánchez-Giraldo, R.; Acosta-Reyes, F. J.; Malarkey, C. S.

    The crystal structure of HMGB1 box A bound to an unmodified AT-rich DNA fragment is reported at a resolution of 2 Å. A new mode of DNA recognition for HMG box proteins is found in which two box A domains bind in an unusual configuration generating a highly kinked DNA structure. High-mobility group protein 1 (HMGB1) is an essential and ubiquitous DNA architectural factor that influences a myriad of cellular processes. HMGB1 contains two DNA-binding domains, box A and box B, which have little sequence specificity but have remarkable abilities to underwind and bend DNA. Although HMGB1 box A ismore » thought to be responsible for the majority of HMGB1–DNA interactions with pre-bent or kinked DNA, little is known about how it recognizes unmodified DNA. Here, the crystal structure of HMGB1 box A bound to an AT-rich DNA fragment is reported at a resolution of 2 Å. Two box A domains of HMGB1 collaborate in an unusual configuration in which the Phe37 residues of both domains stack together and intercalate the same CG base pair, generating highly kinked DNA. This represents a novel mode of DNA recognition for HMGB proteins and reveals a mechanism by which structure-specific HMG boxes kink linear DNA.« less

  4. Interleukin 2 transcription factors as molecular targets of cAMP inhibition: delayed inhibition kinetics and combinatorial transcription roles

    PubMed Central

    1994-01-01

    Elevation of cAMP can cause gene-specific inhibition of interleukin 2 (IL-2) expression. To investigate the mechanism of this effect, we have combined electrophoretic mobility shift assays and in vivo genomic footprinting to assess both the availability of putative IL-2 transcription factors in forskolin-treated cells and the functional capacity of these factors to engage their sites in vivo. All observed effects of forskolin depended upon protein kinase A, for they were blocked by introduction of a dominant negative mutant subunit of protein kinase A. In the EL4.E1 cell line, we report specific inhibitory effects of cAMP elevation both on NF-kappa B/Rel family factors binding at -200 bp, and on a novel, biochemically distinct "TGGGC" factor binding at -225 bp with respect to the IL-2 transcriptional start site. Neither NF-AT nor AP-1 binding activities are detectably inhibited in gel mobility shift assays. Elevation of cAMP inhibits NF-kappa B activity with delayed kinetics in association with a delayed inhibition of IL-2 RNA accumulation. Activation of cells in the presence of forskolin prevents the maintenance of stable protein- DNA interactions in vivo, not only at the NF-kappa B and TGGGC sites of the IL-2 enhancer, but also at the NF-AT, AP-1, and other sites. This result, and similar results in cyclosporin A-treated cells, imply that individual IL-2 transcription factors cannot stably bind their target sequences in vivo without coengagement of all other distinct factors at neighboring sites. It is proposed that nonhierarchical, cooperative enhancement of binding is a structural basis of combinatorial transcription factor action at the IL-2 locus. PMID:8113685

  5. Shifts in Abundance and Diversity of Mobile Genetic Elements after the Introduction of Diverse Pesticides into an On-Farm Biopurification System over the Course of a Year

    PubMed Central

    Dealtry, Simone; Holmsgaard, Peter N.; Dunon, Vincent; Jechalke, Sven; Ding, Guo-Chun; Krögerrecklenfort, Ellen; Heuer, Holger; Hansen, Lars H.; Springael, Dirk; Zühlke, Sebastian; Sørensen, Søren J.

    2014-01-01

    Biopurification systems (BPS) are used on farms to control pollution by treating pesticide-contaminated water. It is assumed that mobile genetic elements (MGEs) carrying genes coding for enzymes involved in degradation might contribute to the degradation of pesticides. Therefore, the composition and shifts of MGEs, in particular, of IncP-1 plasmids carried by BPS bacterial communities exposed to various pesticides, were monitored over the course of an agricultural season. PCR amplification of total community DNA using primers targeting genes specific to different plasmid groups combined with Southern blot hybridization indicated a high abundance of plasmids belonging to IncP-1, IncP-7, IncP-9, IncQ, and IncW, while IncU and IncN plasmids were less abundant or not detected. Furthermore, the integrase genes of class 1 and 2 integrons (intI1, intI2) and genes encoding resistance to sulfonamides (sul1, sul2) and streptomycin (aadA) were detected and seasonality was revealed. Amplicon pyrosequencing of the IncP-1 trfA gene coding for the replication initiation protein revealed high IncP-1 plasmid diversity and an increase in the abundance of IncP-1β and a decrease in the abundance of IncP-1ε over time. The data of the chemical analysis showed increasing concentrations of various pesticides over the course of the agricultural season. As an increase in the relative abundances of bacteria carrying IncP-1β plasmids also occurred, this might point to a role of these plasmids in the degradation of many different pesticides. PMID:24771027

  6. Russian Snap Military Exercise in March of 2015; What Implications did this Exercise Have

    DTIC Science & Technology

    2017-06-09

    Russia can mobilize rapidly the nation for war, shift substantial forces in its interior to meet any threat, and that Russia is willing to use military...Further, it demonstrates to any observer that Russia can mobilize rapidly the nation for war, shift substantial forces in its interior to meet any...the steps of qualitative research method in a class on Advanced Research Methods, September 12, 2016. 65 Robert K. Yin, Case Study Research: Design

  7. Biomarkers of exposure to polycyclic aromatic hydrocarbons (PAHs) and DNA damage: a cross-sectional pilot study among roofers in South Florida

    PubMed Central

    Lee, David; Dou, Zihong

    2012-01-01

    Objective The main goal of this pilot study was to assess the technical and logistic feasibility of a future study. The research hypothesis is that occupational exposures to polycyclic aromatic hydrocarbons (PAHs) are associated with increased risk of DNA damage among roofers who work with hot asphalt. Design This is a cross-sectional pilot study. Setting The study included roofers from four different construction sites in Miami-Dade County, Florida. Participants 19 roofers were recruited (six Hispanics and 13 African–Americans, all male), all of whom were eligible (no history of cancer and no history of chronic diseases of kidneys or liver). All participants provided pre-shift samples and 18 provided post-shift samples. Samples of one participant were excluded from the final analyses as they were considered unreliable. Results Levels of urinary PAH metabolites increased during 6 h of work. Linear regression models of post-shift metabolites included their pre-shift levels, post-shift urinary creatinine levels (for models of 1-OHPyr and 9-OHPhe), and skin burn due to contact with hot asphalt (for models of 1-OHPyr and 1-OHNap). Pre-shift levels of urinary 8-OHdG were not associated with any of the variables considered. For post-shift levels of 8-OHdG, however, post-shift 1-OHPyr (95% CI 0.091 to 0.788) and use of protective gloves (95% CI −1.57 to −0.61) during work explained 86.8% of its variation. Overall, highest levels of urinary PAH metabolites and of 8-OHdG were observed among workers who reported having skin burn and who did not use gloves during work. Conclusions Urinary 1-OHPyr is a promising predictor of oxidative DNA damage among roofers. Work-related skin burn and use of protective gloves appear to influence PAH exposure and DNA damage levels in this group, suggesting the importance of dermal absorption. PMID:22815468

  8. The Research Imagination in a World on the Move

    ERIC Educational Resources Information Center

    Kenway, Jane; Fahey, Johannah

    2006-01-01

    This paper focuses on the shifting terrain of mobile researchers beginning with an overview of research and research policy on "brain mobility", and then discussing what we call their optical illusions/delusions. Subsequently, our main purpose is to elaborate on a line of inquiry that offers richer notions of researcher mobility, connectivity and…

  9. Experimental mapping of DNA duplex shape enabled by global lineshape analyses of a nucleotide-independent nitroxide probe

    PubMed Central

    Ding, Yuan; Zhang, Xiaojun; Tham, Kenneth W.; Qin, Peter Z.

    2014-01-01

    Sequence-dependent variation in structure and dynamics of a DNA duplex, collectively referred to as ‘DNA shape’, critically impacts interactions between DNA and proteins. Here, a method based on the technique of site-directed spin labeling was developed to experimentally map shapes of two DNA duplexes that contain response elements of the p53 tumor suppressor. An R5a nitroxide spin label, which was covalently attached at a specific phosphate group, was scanned consecutively through the DNA duplex. X-band continuous-wave electron paramagnetic resonance spectroscopy was used to monitor rotational motions of R5a, which report on DNA structure and dynamics at the labeling site. An approach based on Pearson's coefficient analysis was developed to collectively examine the degree of similarity among the ensemble of R5a spectra. The resulting Pearson's coefficients were used to generate maps representing variation of R5a mobility along the DNA duplex. The R5a mobility maps were found to correlate with maps of certain DNA helical parameters, and were capable of revealing similarity and deviation in the shape of the two closely related DNA duplexes. Collectively, the R5a probe and the Pearson's coefficient-based lineshape analysis scheme yielded a generalizable method for examining sequence-dependent DNA shapes. PMID:25092920

  10. A dimer of the lymphoid protein RAG1 recognizes the recombination signal sequence and the complex stably incorporates the high mobility group protein HMG2.

    PubMed

    Rodgers, K K; Villey, I J; Ptaszek, L; Corbett, E; Schatz, D G; Coleman, J E

    1999-07-15

    RAG1 and RAG2 are the two lymphoid-specific proteins required for the cleavage of DNA sequences known as the recombination signal sequences (RSSs) flanking V, D or J regions of the antigen-binding genes. Previous studies have shown that RAG1 alone is capable of binding to the RSS, whereas RAG2 only binds as a RAG1/RAG2 complex. We have expressed recombinant core RAG1 (amino acids 384-1008) in Escherichia coli and demonstrated catalytic activity when combined with RAG2. This protein was then used to determine its oligomeric forms and the dissociation constant of binding to the RSS. Electrophoretic mobility shift assays show that up to three oligomeric complexes of core RAG1 form with a single RSS. Core RAG1 was found to exist as a dimer both when free in solution and as the minimal species bound to the RSS. Competition assays show that RAG1 recognizes both the conserved nonamer and heptamer sequences of the RSS. Zinc analysis shows the core to contain two zinc ions. The purified RAG1 protein overexpressed in E.coli exhibited the expected cleavage activity when combined with RAG2 purified from transfected 293T cells. The high mobility group protein HMG2 is stably incorporated into the recombinant RAG1/RSS complex and can increase the affinity of RAG1 for the RSS in the absence of RAG2.

  11. Solid-to-fluid DNA transition inside HSV-1 capsid close to the temperature of infection

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sae-Ueng, Udom; Li, Dong; Zuo, Xiaobing

    2014-10-01

    DNA in the human Herpes simplex virus type 1 (HSV-1) capsid is packaged to a tight density. This leads to tens of atmospheres of internal pressure responsible for the delivery of the herpes genome into the cell nucleus. In this study we show that, despite its liquid crystalline state inside the capsid, the DNA is fluid-like, which facilitates its ejection into the cell nucleus during infection. We found that the sliding friction between closely packaged DNA strands, caused by interstrand repulsive interactions, is reduced by the ionic environment of epithelial cells and neurons susceptible to herpes infection. However, variations inmore » the ionic conditions corresponding to neuronal activity can restrict DNA mobility in the capsid, making it more solid-like. This can inhibit intranuclear DNA release and interfere with viral replication. In addition, the temperature of the human host (37 °C) induces a disordering transition of the encapsidated herpes genome, which reduces interstrand interactions and provides genome mobility required for infection.« less

  12. [The effect of hypoxia preconditioning no binding activity of HIF-1 on the HRE with EPO in the hippocampus of mice].

    PubMed

    Shao, Guo; Zhou, Wei-Hua; Gao, Cui-Ying; Zhang, Ran; Lu, Guo-Wei

    2007-02-01

    To observe change of binding activity of HIF-1 with erythropoietin (EPO) hypoxia response element (HRE) in the hippocampus of mice preconditioned to hypoxia and explore relationship between the changes and the preconditioning. The hippocampus was removed from mice exposed to hypoxia for 0 run (control group), 1 run (H1 group) and 4 runs(H4 group). Electrophoretic mobility shift assays (EMSA), chromatin immunoprecipitation (ChIP)and real time PCR were used to detect the change of activity of HIF-1 on HRE of EPO. Both in vitro and in vivo binding tests showed that the HIF-1 DNA-binding activities were increased in group H1 and markedly increased in group H4. The increase of HIF-1 and HRE of EPO binding activities is thought be involved in hypoxic preconditioning.

  13. Genetic isolation of a now extinct population of bottlenose dolphins (Tursiops truncatus)

    PubMed Central

    Nichols, Courtney; Herman, Jerry; Gaggiotti, Oscar E; Dobney, Keith M; Parsons, Kim; Hoelzel, A. Rus

    2007-01-01

    A number of dolphin species, though highly mobile, show genetic structure among parapatric and sometimes sympatric populations. However, little is known about the temporal patterns of population structure for these species. Here, we apply Bayesian inference and data from ancient DNA to assess the structure and dynamics of bottlenose dolphin (Tursiops truncatus) populations in the coastal waters of the UK. We show that regional population structure in UK waters is consistent with earlier studies suggesting local habitat dependence for this species in the Mediterranean Sea and North Atlantic. One genetically differentiated UK population went extinct at least 100 years ago and has not been replaced. The data indicate that this was a local extinction, and not a case of historical range shift or contraction. One possible interpretation is a declining metapopulation and conservation need for this species in the UK. PMID:17456457

  14. Impact of radiofrequency radiation on DNA damage and antioxidants in peripheral blood lymphocytes of humans residing in the vicinity of mobile phone base stations.

    PubMed

    Zothansiama; Zosangzuali, Mary; Lalramdinpuii, Miriam; Jagetia, Ganesh Chandra

    2017-01-01

    Radiofrequency radiations (RFRs) emitted by mobile phone base stations have raised concerns on its adverse impact on humans residing in the vicinity of mobile phone base stations. Therefore, the present study was envisaged to evaluate the effect of RFR on the DNA damage and antioxidant status in cultured human peripheral blood lymphocytes (HPBLs) of individuals residing in the vicinity of mobile phone base stations and comparing it with healthy controls. The study groups matched for various demographic data including age, gender, dietary pattern, smoking habit, alcohol consumption, duration of mobile phone use and average daily mobile phone use. The RF power density of the exposed individuals was significantly higher (p < 0.0001) when compared to the control group. The HPBLs were cultured and the DNA damage was assessed by cytokinesis blocked micronucleus (MN) assay in the binucleate lymphocytes. The analyses of data from the exposed group (n = 40), residing within a perimeter of 80 m of mobile base stations, showed significantly (p < 0.0001) higher frequency of micronuclei when compared to the control group, residing 300 m away from the mobile base station/s. The analysis of various antioxidants in the plasma of exposed individuals revealed a significant attrition in glutathione (GSH) concentration (p < 0.01), activities of catalase (CAT) (p < 0.001) and superoxide dismutase (SOD) (p < 0.001) and rise in lipid peroxidation (LOO) when compared to controls. Multiple linear regression analyses revealed a significant association among reduced GSH concentration (p < 0.05), CAT (p < 0.001) and SOD (p < 0.001) activities and elevated MN frequency (p < 0.001) and LOO (p < 0.001) with increasing RF power density.

  15. Assessing Mobile Health Capacity and Task Shifting Strategies to Improve Hypertension Among Ghanaian Stroke Survivors.

    PubMed

    Nichols, Michelle; Sarfo, Fred Stephen; Singh, Arti; Qanungo, Suparna; Treiber, Frank; Ovbiagele, Bruce; Saulson, Raelle; Patel, Sachin; Jenkins, Carolyn

    2017-12-01

    There has been a tremendous surge in stroke prevalence in sub-Saharan Africa. Hypertension (HTN), the most potent, modifiable risk factor for stroke, is a particular challenge in sub-Saharan Africa. Culturally sensitive, efficacious HTN control programs that are timely and sustainable are needed, especially among stroke survivors. Mobile health (mHealth) technology and task-shifting offer promising approaches to address this need. Using a concurrent triangulation design, we collected data from stroke survivors, caregivers, community leaders, clinicians and hospital personnel to explore the barriers, facilitators and perceptions toward mHealth related to HTN management among poststroke survivors in Ghana. Exploration included perceptions of a nurse-led navigational model to facilitate care delivery and willingness of stroke survivors and caregivers to use mHealth technology. Two hundred stroke survivors completed study surveys while focus groups (n = 4) were conducted with stroke survivors, caregivers and community leaders (n = 28). Key informant interviews were completed with clinicians and hospital personnel (n = 10). A total of 93% of survey respondents had HTN (60% uncontrolled). Findings support mHealth strategies for poststroke care delivery and HTN management and for task-shifting through a nurse-led model. Of survey and focus group participants, 76% and 78.6%, respectively, have access to mobile phones and 90% express comfort in using mobile phones and conveyed assurance that task-shifting through a nurse-led model could facilitate management of HTN. Findings also identified barriers to care delivery and medication adherence across all levels of the social ecological model. Participants strongly supported enhanced care delivery through mobile health and were receptive toward a nurse-led navigational model. Copyright © 2017 Southern Society for Clinical Investigation. Published by Elsevier Inc. All rights reserved.

  16. The influence of direct mobile phone radiation on sperm quality

    PubMed Central

    Gorpinchenko, Igor; Nikitin, Oleg; Shulyak, Alexander

    2014-01-01

    Introduction It is impossible to imagine a modern socially–active man who does not use mobile devices and/or computers with Wi–Fi function. The effect of mobile phone radiation on male fertility is the subject of recent interest and investigations. The aim of this study was to investigate the direct in vitro influence of mobile phone radiation on sperm DNA fragmentation and motility parameters in healthy subjects with normozoospermia. Material and methods 32 healthy men with normal semen parameters were selected for the study. Each sperm sample was divided into two equal portions (A and B). Portions A of all involved men were placed for 5 hours in a thermostat, and portions B were placed into a second thermostat for the same period of time, where a mobile phone in standby/talk mode was placed. After 5 hours of incubation the sperm samples from both thermostats were re–evaluated regarding basic motility parameters. The presence of DNA fragmentation in both A and B portions of each sample was determined each hour using a standard sperm chromatin dispersion test. Results The number of spermatozoa with progressive movement in the group, influenced by electromagnetic radiation, is statistically lower than the number of spermatozoa with progressive movement in the group under no effect of the mobile phone. The number of non–progressive movement spermatozoa was significantly higher in the group, which was influenced by cell phone radiation. The DNA fragmentation was also significantly higher in this group. Conclusions A correlation exists between mobile phone radiation exposure, DNA–fragmentation level and decreased sperm motility. PMID:24982785

  17. Agarose electrophoresis of DNA in discontinuous buffers, using a horizontal slab apparatus and a buffer system with improved properties.

    PubMed

    Zsolnai, A; Orbán, L; Chrambach, A

    1993-03-01

    Using a horizontal slab apparatus with a buffer in the reservoirs at the level of the gel ("sea-level electrophoresis"), the retrograde discontinuous buffer system reported by Wiltfang et al. for sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) of proteins was applied to DNA electrophoresis. This application yielded the advantages of an increased displacement rate of the moving boundary front and a decrease in the concentration of the counterion base in the resolving phase, which yielded reduced relative mobility values at equivalent gel concentrations and practicable low buffer concentrations. The change of relative mobilities (Rf) with a variation of field strength is decreased compared to that of the migration rate in the continuous Tris-boric-acid-EDTA (TBE) buffer and thus the robustness of the system is improved, as well as the efficiency of separation. The system of Wiltfang et al. has in common with previously described discontinuous DNA system, that it is able to stack DNA from dilute samples and is insensitive to sample components with lower net mobilities than DNA, such as acetate. However, the variance of Rf at constant current density in the discontinuous buffer system is not improved over that of the migration rate at constant field strength in the continuous TBE buffer.

  18. [Study on the aggregation behavior of cationic porphyrins and their interaction with ctDNA].

    PubMed

    Ma, Hong-Min; Chen, Xin; Sun, Shu-Ting; Zhang, Li-Na; Wu, Dan; Zhu, Pei-Hua; Li, Yan; Du, Bin; Wei, Qin

    2009-02-01

    Interest in the interaction between cationic porphyrins, particularly derivatives of meso-tetra(N-methylpyridinium-4-yl) porphyrin(TMPyP), and DNA abounds because they are versatile DNA-binding agents that could find application in photodynamic therapy, cancer detection, artificial nucleases, virus inhibition and so on. The interaction of two water-soluble cationic porphyrins, meso-tetrakis(4-N, N, N-trimethylanilinium) porphyrin (TMAP) and 5-phenyl-10,15,20-tris[4-(N-methyl) pyridinium]porphyrin (TriMPyP), with calf thymus DNA (ctDNA) was studied by UV-Vis absorption spectroscopy, fluorescence spectroscopy and resonance light scattering technique. TriMPyP forms aggregate in water due to the molecular asymmetry while TMAP exists as monomers. At lower concentrations of ctDNA (R > 1, R = c(TMAP)/c(DNA) base pair), the interaction of TMAP with DNA leads to significant hypochromicity and bathochromic shift of absorption spectra. And the fluorescence of TMAP was quenched while it showed enhanced resonance light scattering signals. But the extent of enhancement of resonance light scattering signals is very small, so the aggregate of TMAP is not very high. These observations indicate the self-stacking of TMAP along the DNA surface. At higher concentrations of ctDNA (R < 1), TMAP association with DNA is via outside binding which is accompanied with hyperchromic effect and fluorescence enhancement while the resonance light scattering signals is reduced. DNA addition decreases the fluorescence intensity of TriMPyP and it shifts the peak to the higher wavelengths (red shift). The interaction with DNA promotes the aggregation of TriMPyP and no simple outside binding is observed even at higher concentrations of ctDNA. The steric effect of molecular distortion constrains the intercalation or further binding to DNA. The effect of ionic strength on the interaction was investigated at two DNA concentrations, 1.2 and 24.0 micromol x L(-1), for TMAP. The Interactions of both porphyrins with DNA show high sensitivity to ionic strength. By addition of NaCl, electrostatic attraction is decreased, resulting in the change of binding mode.

  19. Genomic organization of the Neurospora crassa gsn gene: possible involvement of the STRE and HSE elements in the modulation of transcription during heat shock.

    PubMed

    Freitas, F Zanolli; Bertolini, M C

    2004-12-01

    Glycogen synthase, an enzyme involved in glycogen biosynthesis, is regulated by phosphorylation and by the allosteric ligand glucose-6-phosphate (G6P). In addition, enzyme levels can be regulated by changes in gene expression. We recently cloned a cDNA for glycogen synthase ( gsn) from Neurospora crassa, and showed that gsn transcription decreased when cells were exposed to heat shock (shifted from 30 degrees C to 45 degrees C). In order to understand the mechanisms that control gsn expression, we isolated the gene, including its 5' and 3' flanking regions, from the genome of N. crassa. An ORF of approximately 2.4 kb was identified, which is interrupted by four small introns (II-V). Intron I (482 bp) is located in the 5'UTR region. Three putative Transcription Initiation Sites (TISs) were mapped, one of which lies downstream of a canonical TATA-box sequence (5'-TGTATAAA-3'). Analysis of the 5'-flanking region revealed the presence of putative transcription factor-binding sites, including Heat Shock Elements (HSEs) and STress Responsive Elements (STREs). The possible involvement of these motifs in the negative regulation of gsn transcription was investigated using Electrophoretic Mobility Shift Assays (EMSA) with nuclear extracts of N. crassa mycelium obtained before and after heat shock, and DNA fragments encompassing HSE and STRE elements from the 5'-flanking region. While elements within the promoter region are involved in transcription under heat shock, elements in the 5'UTR intron may participate in transcription during vegetative growth. The results thus suggest that N. crassa possesses trans -acting elements that interact with the 5'-flanking region to regulate gsn transcription during heat shock and vegetative growth.

  20. Preparation and testing of quaternized chitosan nanoparticles as gene delivery vehicles.

    PubMed

    Li, Guang-Feng; Wang, Jing-Cheng; Feng, Xin-Min; Liu, Zhen-Dong; Jiang, Chao-Yong; Yang, Jian-Dong

    2015-04-01

    The aim of this study was to synthesize a chitosan (CS) derivative, a quaternary ammonium salt crystal called N-2-hydroxypropyl trimethyl ammonium chloride chitosan (HACC), and test a series of HACC and pEGFP-DNA complexes at different weight ratios for their efficiency of gene delivery into human cells. CS was modified with cationic etherifying agent to obtain the CS derivative. Fourier transform infrared spectra were recorded on KBr pellets with a spectrometer. (1)H nuclear magnetic resonance (NMR) spectra of HACC were obtained using a spectrometer. HACC was subsequently used to prepare HACC/DNA complexes at different weight ratios by coacervation method. The resulting particle size and surface charge were assessed by laser light scattering using a zeta potential analyzer. The HACC/DNA complex formation and DNA protection in the nanoparticle complex was investigated by gel mobility shift assay and DNase I protection assay, respectively. The cytotoxicity of HACC and HACC/DNA nanoparticles was evaluated by MTT assay using (mesenchymal stem cell) MSC lines. The nanoscale structure of the particles was obtained by transmission electron microscope (TEM). The FTIR spectrum of HACC showed the characteristic quaternary ammonium group absorption band at 1475 cm(-1), which indicated the presence of quaternary ammonium group. The successful synthesis of HACC was also confirmed by (1)H NMR spectrum. HACC showed good solubility in water and was electropositive. HACC efficiently packed and protected pEGFP-DNA at a weight ratio of 10. With increased weight ratios, the surface charge of the composite particle increased from negative to positive, the average particle size increased, and HACC nanoparticle had a higher carrying efficiency. The nanoparticles released DNA in two distinct phases, and 55 % was released within the first 20 h of solubilization. The nanoparticles under TEM showed circular or oval shapes. The particles exhibited no cytotoxicity against human cells. No significant difference in gene delivery efficiency was detected between HACC/pEGFP-GDNF and liposome/pEGFP-GDNF complexes (33.8 vs. 34 %, P = 0.363). In this study, HACC was successfully synthesized, and HACC/DNA complex assembled efficiently. HACC showed strong DNA binding affinity and high protection of DNA and was non-cytotoxic to human cells. The particles had appropriate nanostructure, mean diameter, and DNA release time. The results suggest that HACC nanoparticles are a novel tool for efficient and safe gene delivery.

  1. The high mobility group protein Abf2p influences the level of yeast mitochondrial DNA recombination intermediates in vivo.

    PubMed

    MacAlpine, D M; Perlman, P S; Butow, R A

    1998-06-09

    Abf2p is a high mobility group (HMG) protein found in yeast mitochondria that is required for the maintenance of wild-type (rho+) mtDNA in cells grown on fermentable carbon sources, and for efficient recombination of mtDNA markers in crosses. Here, we show by two-dimensional gel electrophoresis that Abf2p promotes or stabilizes Holliday recombination junction intermediates in rho+ mtDNA in vivo but does not influence the high levels of recombination intermediates readily detected in the mtDNA of petite mutants (rho-). mtDNA recombination junctions are not observed in rho+ mtDNA of wild-type cells but are elevated to detectable levels in cells with a null allele of the MGT1 gene (Deltamgt1), which codes for a mitochondrial cruciform-cutting endonuclease. The level of recombination intermediates in rho+ mtDNA of Deltamgt1 cells is decreased about 10-fold if those cells contain a null allele of the ABF2 gene. Overproduction of Abf2p by >/= 10-fold in wild-type rho+ cells, which leads to mtDNA instability, results in a dramatic increase in mtDNA recombination intermediates. Specific mutations in the two Abf2p HMG boxes required for DNA binding diminishes these responses. We conclude that Abf2p functions in the recombination of rho+ mtDNA.

  2. What Have We Learnt about Mobile LifeLong Learning (mLLL)?

    ERIC Educational Resources Information Center

    Seta, Luciano; Kukulska-Hulme, Agnes; Arrigo, Marco

    2014-01-01

    Mobile technologies are becoming ubiquitous in education, yet the wider implications of this phenomenon are not well understood. The paper discusses how mobile lifelong learning (mLLL) may be defined, and the challenges of forging a suitable definition in an ever-shifting technological and socio-economic landscape. mLLL appears as a ubiquitous…

  3. Mobile Devices and Mobile Learning: Shifting the Mindset of Teachers and Learners

    ERIC Educational Resources Information Center

    Smith, Philippa K.; Grant, Lynn; Conway, Clare; Narayan, Vickel

    2016-01-01

    Incorporating new media technologies that enable mobile learning to be part of educational practice poses challenges to those used to teaching in a traditional classroom environment. In this article three lecturers and a learning advisor from a New Zealand university reflect on their experiences in the progressive redesign of a Bachelor of Arts…

  4. The Replication Stress Response in Pancreatic Cancer

    DTIC Science & Technology

    2013-10-01

    network that recognizes challenges to DNA replication and mobilizes diverse activities to maintain genome integrity. The RSR is critical for the...pancreatic cancer cells. We further validated positive hits be deconvolution of individual siRNAs and began work on determining their activities in DNA replication and DNA damage responses.

  5. On the mechanism of Cr (VI)-induced carcinogenesis: dose dependence of uptake and cellular responses.

    PubMed

    Liu, K; Husler, J; Ye, J; Leonard, S S; Cutler, D; Chen, F; Wang, S; Zhang, Z; Ding, M; Wang, L; Shi, X

    2001-06-01

    Cr (VI) compounds are widely used industrial chemicals and are recognized human carcinogens. The mechanisms of carcinogenesis associated with these compounds remain to be investigated. The present study focused on dose-dependence of Cr (VI)-induced uptake and cellular responses. The results show that Cr (VI) is able to enter the cells (human lung epithelial cell line A549) at low concentration (< 10 microM) and that the Cr (VI) uptake appears to be a combination of saturable transport and passive diffusion. Electron spin resonance (ESR) trapping measurements showed that upon stimulation with Cr (VI), A549 cells were able to generate reactive oxygen species (ROS). The amount of ROS generated depended on the Cr (VI) concentration. ROS generation involved NADPH-dependent flavoenzymes. Cr (VI) affected the following cellular parameters in a dose-dependent manner, (a) activation of nuclear transcription factors NF-kappaB, and p53, (b) DNA damage, (c) induction of cell apoptosis, and (d) inhibition of cell proliferation. The activation of transcription factors was assessed by electrophoretic mobility shift assay and western blot analysis, DNA damage by single cell gel electrophoresis assay, cell apoptosis by DNA fragmentation assay, and cell proliferation by a non-radioactive ELISA kit. At the concentration range used in the present study, no thresholds were found in all of these cell responses to Cr (VI). The results may guide further research to better understand and evaluate the risk of Cr (VI)-induced carcinogenesis at low levels of exposure.

  6. A functional SNP in the promoter region of TCOF1 is associated with reduced gene expression and YY1 DNA-protein interaction.

    PubMed

    Masotti, Cibele; Armelin-Correa, Lucia M; Splendore, Alessandra; Lin, Chin J; Barbosa, Angela; Sogayar, Mari C; Passos-Bueno, Maria Rita

    2005-10-10

    Treacher Collins syndrome (TCS) is an autosomal dominant craniofacial malformation caused by null mutations in the TCOF1 gene. High inter and intra familial clinical variability, ranging from mild malar hypoplasia to perinatal death due to airway collapse is observed, but, to date, no genotype-phenotype correlation has been reported. Considering haploinsufficiency as the molecular mechanism underlying the disease, we have hypothesized that mutations in the promoter region of the gene, which has never been previously characterized, in trans with a pathogenic mutation, could modulate the phenotype. Therefore, the aims of the present study were to determine the TCOF1 gene's core promoter and to identify mutations in this region that could contribute to the phenotypic variation observed in this syndrome. We have delimitated the minimal promoter to a region of less than 150 bp, with 63% of identity among 5 different species. We screened 1.2 kbp of the TCOF1 5' flanking sequence in the DNA obtained from 21 patients and 51 controls and identified four new single nucleotide polymorphisms (SNPs), one of which (-346C>T), was proved to be functional, as it decreased the promoter activity by 38%. Electrophoretic mobility shift assay (EMSA) analysis demonstrated that the -346T allele impairs DNA-binding to the YY1 transcription factor. This promoter variant represents a candidate allele to explain the clinical variability in patients bearing TCS.

  7. Transcriptional activation of transforming growth factor alpha by estradiol: requirement for both a GC-rich site and an estrogen response element half-site.

    PubMed

    Vyhlidal, C; Samudio, I; Kladde, M P; Safe, S

    2000-06-01

    17beta-Estradiol (E2) induces transforming growth factor alpha (TGFalpha) gene expression in MCF-7 cells and previous studies have identified a 53 bp (-252 to -200) sequence containing two imperfect estrogen responsive elements (EREs) that contribute to E2 responsiveness. Deletion analysis of the TGFalpha gene promoter in this study identified a second upstream region of the promoter (-623 to -549) that is also E2 responsive. This sequence contains three GC-rich sites and an imperfect ERE half-site, and the specific cis-elements and trans-acting factors were determined by promoter analysis in transient transfection experiments, gel mobility shift assays and in vitro DNA footprinting. The results are consistent with an estrogen receptor alpha (ERalpha)/Sp1 complex interacting with an Sp1(N)(30) ERE half-site ((1/2)) motif in which both ERalpha and Sp1 bind promoter DNA. The ER/Sp1-DNA complex is formed using nuclear extracts from MCF-7 cells but not with recombinant human ERalpha or Sp1 proteins, suggesting that other nuclear factor(s) are required for complex stabilization. The E2-responsive Sp1(N)(x)ERE(1/2) motif identified in the TGFalpha gene promoter has also been characterized in the cathepsin D and heat shock protein 27 gene promoters; however, in the latter two promoters the numbers of intervening nucleotides are 23 and 10 respectively.

  8. Structural and Functional Assessment of APOBEC3G Macromolecular Complexes

    PubMed Central

    Polevoda, Bogdan; McDougall, William M.; Bennett, Ryan P.; Salter, Jason D.; Smith, Harold C.

    2016-01-01

    There are eleven members in the human APOBEC family of proteins that are evolutionarily related through their zinc-dependent cytidine deaminase domains. The human APOBEC gene clusters arose on chromosome 6 and 22 through gene duplication and divergence to where current day APOBEC proteins are functionally diverse and broadly expressed in tissues. APOBEC serve enzymatic and non enzymatic functions in cells. In both cases, formation of higher-order structures driven by APOBEC protein-protein interactions and binding to RNA and/or single stranded DNA are integral to their function. In some circumstances, these interactions are regulatory and modulate APOBEC activities. We are just beginning to understand how macromolecular interactions drive processes such as APOBEC subcellular compartmentalization, formation of holoenzyme complexes, gene targeting, foreign DNA restriction, anti-retroviral activity, formation of ribonucleoprotein particles and APOBEC degradation. Protein-protein and protein-nucleic acid cross-linking methods coupled with mass spectrometry, electrophoretic mobility shift assays, glycerol gradient sedimentation, fluorescence anisotropy and APOBEC deaminase assays are enabling mapping of interacting surfaces that are essential for these functions. The goal of this methods review is through example of our research on APOBEC3G, describe the application of cross-linking methods to characterize and quantify macromolecular interactions and their functional implications. Given the homology in structure and function, it is proposed that these methods will be generally applicable to the discovery process for other APOBEC and RNA and DNA editing and modifying proteins. PMID:26988126

  9. A multistep damage recognition mechanism for global genomic nucleotide excision repair

    PubMed Central

    Sugasawa, Kaoru; Okamoto, Tomoko; Shimizu, Yuichiro; Masutani, Chikahide; Iwai, Shigenori; Hanaoka, Fumio

    2001-01-01

    A mammalian nucleotide excision repair (NER) factor, the XPC–HR23B complex, can specifically bind to certain DNA lesions and initiate the cell-free repair reaction. Here we describe a detailed analysis of its binding specificity using various DNA substrates, each containing a single defined lesion. A highly sensitive gel mobility shift assay revealed that XPC–HR23B specifically binds a small bubble structure with or without damaged bases, whereas dual incision takes place only when damage is present in the bubble. This is evidence that damage recognition for NER is accomplished through at least two steps; XPC–HR23B first binds to a site that has a DNA helix distortion, and then the presence of injured bases is verified prior to dual incision. Cyclobutane pyrimidine dimers (CPDs) were hardly recognized by XPC–HR23B, suggesting that additional factors may be required for CPD recognition. Although the presence of mismatched bases opposite a CPD potentiated XPC–HR23B binding, probably due to enhancement of the helix distortion, cell-free excision of such compound lesions was much more efficient than expected from the observed affinity for XPC–HR23B. This also suggests that additional factors and steps are required for the recognition of some types of lesions. A multistep mechanism of this sort may provide a molecular basis for ensuring the high level of damage discrimination that is required for global genomic NER. PMID:11238373

  10. A multistep damage recognition mechanism for global genomic nucleotide excision repair.

    PubMed

    Sugasawa, K; Okamoto, T; Shimizu, Y; Masutani, C; Iwai, S; Hanaoka, F

    2001-03-01

    A mammalian nucleotide excision repair (NER) factor, the XPC-HR23B complex, can specifically bind to certain DNA lesions and initiate the cell-free repair reaction. Here we describe a detailed analysis of its binding specificity using various DNA substrates, each containing a single defined lesion. A highly sensitive gel mobility shift assay revealed that XPC-HR23B specifically binds a small bubble structure with or without damaged bases, whereas dual incision takes place only when damage is present in the bubble. This is evidence that damage recognition for NER is accomplished through at least two steps; XPC-HR23B first binds to a site that has a DNA helix distortion, and then the presence of injured bases is verified prior to dual incision. Cyclobutane pyrimidine dimers (CPDs) were hardly recognized by XPC-HR23B, suggesting that additional factors may be required for CPD recognition. Although the presence of mismatched bases opposite a CPD potentiated XPC-HR23B binding, probably due to enhancement of the helix distortion, cell-free excision of such compound lesions was much more efficient than expected from the observed affinity for XPC-HR23B. This also suggests that additional factors and steps are required for the recognition of some types of lesions. A multistep mechanism of this sort may provide a molecular basis for ensuring the high level of damage discrimination that is required for global genomic NER.

  11. Mitochondrial Debris as a Discriminator Between Inflammatory and Infectious Complications of Blast Injuries: The Enemy Within

    DTIC Science & Technology

    2012-01-01

    adult respiratory distress syndrome (ALI/ARDS) occur after fractures in a sporadic entity often termed ‘‘ fat embolism syndrome.’’ Fat embolism ...We then went on to evaluate the role of fracture injuries in mobilizing mtDNA from human tissue trauma. As proposed, we used discarded human samples...to show that long bone fractures (very common in combatants) and their repair by clinical reamed nailing operations mobilized huge amounts of mtDNA

  12. Differences in unwinding of supercoiled DNA induced by the two enantiomers of anti-benzo[a]pyrene diol epoxide.

    PubMed Central

    Xu, R; Birke, S; Carberry, S E; Geacintov, N E; Swenberg, C E; Harvey, R G

    1992-01-01

    The unwinding of supercoiled phi X174 RFI DNA induced by the tumorigenic (+) and non-tumorigenic (-) enantiomers of trans-7,8-dihydroxy-anti-9,10-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene (BPDE) has been investigated by agarose slab-gel and ethidium titration tube gel electrophoresis. The differences in adduct conformations were verified by flow linear dichroism techniques. Both enantiomers cause a reversible unwinding by the formation of noncovalent intercalative complexes. The effects of covalently bound BPDE residues on the electrophoretic mobilities of the RF I DNA form in agarose gels were investigated in detail in the range of binding ratios rb approximately 0.0-0.06 (covalently bound BPDE residues/nucleotide). In this range of rb values, there is a striking difference in the mobilities of (+)-BPDE- and (-)-BPDE-adducted phi X174 DNA in agarose slab-gels, the covalently bound (+)-BPDE residues causing a significantly greater retardation than (-)-BPDE residues. Increasing the level of covalent adducts beyond rb approximately 0.06 in the case of the (+)-BPDE enantiomer, leads to further unwinding and a minimum in the mobilities (corresponding to comigration of the nicked form and the covalently closed relaxed modified form) at rb 0.10 +/- 0.01; at still higher rb values, rewinding of the modified DNA in the opposite sense is observed. From the minimum in the mobility, a mean unwinding angle (per BPDE residue) of theta = 12 +/- 1.5 degrees is determined, which is in good agreement the value of theta = 11 +/- 1.8 degrees obtained by the tube gel titration method. Using this latter method, values of theta = 6.8 +/- 1.7 degrees for (-)-BPDE-phi X174 adducts are observed. It is concluded that agarose slab gel techniques are not suitable for determining unwinding angles for (-)-BPDE-modified phi X174 DNA because the alterations in the tertiary structures for rb < 0.06 are too small to cause sufficiently large changes in the electrophoretic mobilities. The major trans (+)-BPDE-N2-guanosine covalent adduct is situated at external binding sites and the mechanisms of unwinding are therefore different from those relevant to noncovalent intercalative BPDE-DNA complexes or to classical intercalating drug molecules; a flexible hinge joint and a widening of the minor groove at the site of the lesion may account for the observed unwinding effects. The more heterogeneous (-)-BPDE-nucleoside adducts (involving cis and trans N2-guanosine, and adenosine adducts) are less effective in causing unwinding of supercoiled DNA for reasons which remain to be elucidated. Images PMID:1475180

  13. A minimal murine Msx-1 gene promoter. Organization of its cis-regulatory motifs and their role in transcriptional activation in cells in culture and in transgenic mice.

    PubMed

    Takahashi, T; Guron, C; Shetty, S; Matsui, H; Raghow, R

    1997-09-05

    To dissect the cis-regulatory elements of the murine Msx-1 promoter, which lacks a conventional TATA element, a putative Msx-1 promoter DNA fragment (from -1282 to +106 base pairs (bp)) or its congeners containing site-specific alterations were fused to luciferase reporter and introduced into NIH3T3 and C2C12 cells, and the expression of luciferase was assessed in transient expression assays. The functional consequences of the sequential 5' deletions of the promotor revealed that multiple positive and negative regulatory elements participate in regulating transcription of the Msx-1 gene. Surprisingly, however, the optimal expression of Msx-1 promoter in either NIH3T3 or C2C12 cells required only 165 bp of the upstream sequence to warrant detailed examination of its structure. Therefore, the functional consequences of site-specific deletions and point mutations of the cis-acting elements of the minimal Msx-1 promoter were systematically examined. Concomitantly, potential transcriptional factor(s) interacting with the cis-acting elements of the minimal promoter were also studied by gel electrophoretic mobility shift assays and DNase I footprinting. Combined analyses of the minimal promoter by DNase I footprinting, electrophoretic mobility shift assays, and super shift assays with specific antibodies revealed that 5'-flanking regions from -161 to -154 and from -26 to -13 of the Msx-1 promoter contains an authentic E box (proximal E box), capable of binding a protein immunologically related to the upstream stimulating factor 1 (USF-1) and a GC-rich sequence motif which can bind to Sp1 (proximal Sp1), respectively. Additionally, we observed that the promoter activation was seriously hampered if the proximal E box was removed or mutated, and the promoter activity was eliminated completely if the proximal Sp1 site was similarly altered. Absolute dependence of the Msx-1 minimal promoter on Sp1 could be demonstrated by transient expression assays in the Sp1-deficient Drosophila cell line cotransfected with Msx-1-luciferase and an Sp1 expression vector pPacSp1. The transgenic mice embryos containing -165/106-bp Msx-1 promoter-LacZ DNA in their genomes abundantly expressed beta-galactosidase in maxillae and mandibles and in the cellular primordia involved in the formation of the meninges and the bones of the skull. Thus, the truncated murine Msx-1 promoter can target expression of a heterologous gene in the craniofacial tissues of transgenic embryos known for high level of expression of the endogenous Msx-1 gene and found to be severely defective in the Msx-1 knock-out mice.

  14. Continuous-Time Random Walk Models of DNA Electrophoresis in a Post Array: II. Mobility and Sources of Band Broadening

    PubMed Central

    Olson, Daniel W.; Dutta, Sarit; Laachi, Nabil; Tian, Mingwei; Dorfman, Kevin D.

    2011-01-01

    Using the two-state, continuous-time random walk model, we develop expressions for the mobility and the plate height during DNA electrophoresis in an ordered post array that delineate the contributions due to (i) the random distance between collisions and (ii) the random duration of a collision. These contributions are expressed in terms of the means and variances of the underlying stochastic processes, which we evaluate from a large ensemble of Brownian dynamics simulations performed using different electric fields and molecular weights in a hexagonal array of 1 μm posts with a 3 μm center-to-center distance. If we fix the molecular weight, we find that the collision frequency governs the mobility. In contrast, the average collision duration is the most important factor for predicting the mobility as a function of DNA size at constant Péclet number. The plate height is reasonably well-described by a single post rope-over-pulley model, provided that the extension of the molecule is small. Our results only account for dispersion inside the post array and thus represent a theoretical lower bound on the plate height in an actual device. PMID:21290387

  15. Rapid Mitochondrial Genome Evolution through Invasion of Mobile Elements in Two Closely Related Species of Arbuscular Mycorrhizal Fungi

    PubMed Central

    Beaudet, Denis; Nadimi, Maryam; Iffis, Bachir; Hijri, Mohamed

    2013-01-01

    Arbuscular mycorrhizal fungi (AMF) are common and important plant symbionts. They have coenocytic hyphae and form multinucleated spores. The nuclear genome of AMF is polymorphic and its organization is not well understood, which makes the development of reliable molecular markers challenging. In stark contrast, their mitochondrial genome (mtDNA) is homogeneous. To assess the intra- and inter-specific mitochondrial variability in closely related Glomus species, we performed 454 sequencing on total genomic DNA of Glomus sp. isolate DAOM-229456 and we compared its mtDNA with two G. irregulare isolates. We found that the mtDNA of Glomus sp. is homogeneous, identical in gene order and, with respect to the sequences of coding regions, almost identical to G. irregulare. However, certain genomic regions vary substantially, due to insertions/deletions of elements such as introns, mitochondrial plasmid-like DNA polymerase genes and mobile open reading frames. We found no evidence of mitochondrial or cytoplasmic plasmids in Glomus species, and mobile ORFs in Glomus are responsible for the formation of four gene hybrids in atp6, atp9, cox2, and nad3, which are most probably the result of horizontal gene transfer and are expressed at the mRNA level. We found evidence for substantial sequence variation in defined regions of mtDNA, even among closely related isolates with otherwise identical coding gene sequences. This variation makes it possible to design reliable intra- and inter-specific markers. PMID:23637766

  16. Rapid mitochondrial genome evolution through invasion of mobile elements in two closely related species of arbuscular mycorrhizal fungi.

    PubMed

    Beaudet, Denis; Nadimi, Maryam; Iffis, Bachir; Hijri, Mohamed

    2013-01-01

    Arbuscular mycorrhizal fungi (AMF) are common and important plant symbionts. They have coenocytic hyphae and form multinucleated spores. The nuclear genome of AMF is polymorphic and its organization is not well understood, which makes the development of reliable molecular markers challenging. In stark contrast, their mitochondrial genome (mtDNA) is homogeneous. To assess the intra- and inter-specific mitochondrial variability in closely related Glomus species, we performed 454 sequencing on total genomic DNA of Glomus sp. isolate DAOM-229456 and we compared its mtDNA with two G. irregulare isolates. We found that the mtDNA of Glomus sp. is homogeneous, identical in gene order and, with respect to the sequences of coding regions, almost identical to G. irregulare. However, certain genomic regions vary substantially, due to insertions/deletions of elements such as introns, mitochondrial plasmid-like DNA polymerase genes and mobile open reading frames. We found no evidence of mitochondrial or cytoplasmic plasmids in Glomus species, and mobile ORFs in Glomus are responsible for the formation of four gene hybrids in atp6, atp9, cox2, and nad3, which are most probably the result of horizontal gene transfer and are expressed at the mRNA level. We found evidence for substantial sequence variation in defined regions of mtDNA, even among closely related isolates with otherwise identical coding gene sequences. This variation makes it possible to design reliable intra- and inter-specific markers.

  17. Thermo-optic characteristic of DNA thin solid film and its application as a biocompatible optical fiber temperature sensor.

    PubMed

    Hong, Seongjin; Jung, Woohyun; Nazari, Tavakol; Song, Sanggwon; Kim, Taeoh; Quan, Chai; Oh, Kyunghwan

    2017-05-15

    We report unique thermo-optical characteristics of DNA-Cetyl tri-methyl ammonium (DNA-CTMA) thin solid film with a large negative thermo-optical coefficient of -3.4×10-4/°C in the temperature range from 20°C to 70°C without any observable thermal hysteresis. By combining this thermo-optic DNA film and fiber optic multimode interference (MMI) device, we experimentally demonstrated a highly sensitive compact temperature sensor with a large spectral shift of 0.15 nm/°C. The fiber optic MMI device was a concatenated structure with single-mode fiber (SMF)-coreless silica fiber (CSF)-single mode fiber (SMF) and the DNA-CTMA film was deposited on the CSF. The spectral shifts of the device in experiments were compared with the beam propagation method, which showed a good agreement.

  18. Rapid, Affordable, and Point-of-Care Water Monitoring Via a Microfluidic DNA Sensor and a Mobile Interface for Global Health

    PubMed Central

    Ghanbari, Sarah; Ravikumar, Anusha; Seubert, John; Figueira, Silvia

    2013-01-01

    Contaminated water is a serious concern in many developing countries with severe health consequences particularly for children. Current methods for monitoring waterborne pathogens are often time consuming, expensive, and labor intensive, making them not suitable for these regions. Electrochemical detection in a microfluidic platform offers many advantages such as portability, minimal use of instrumentation, and easy integration with electronics. In many parts of the world, however, the required equipment for pathogen detection through electrochemical sensors is either not available or insufficiently portable, and operators may not be trained to use these sensors and interpret results, ultimately preventing its wide adoption. Counterintuitively, these same regions often have an extensive mobile phone infrastructure, suggesting the possibility of integrating electrochemical detection of bacterial pathogens with a mobile platform. Toward a solution to water quality interventions, we demonstrate a microfluidic electrochemical sensor combined with a mobile interface that detects the sequences from bacterial pathogens, suitable for rapid, affordable, and point-of-care water monitoring. We employ the transduction of DNA hybridization into a readily detectable electric signal by means of a conformational change of DNA stem-loop structure. Using this platform, we successfully demonstrate the detection of as low as 100 nM E. coli sequences and the automatic interpretation and mapping of the detection results via a mobile application. PMID:27170858

  19. XPD Helicase: Shifting the Inchworm into Reverse

    ERIC Educational Resources Information Center

    Pugh, Robert A.

    2009-01-01

    Directional translocation by helicases results in duplex separation and displacement of bound proteins which allows for the DNA processing events associated with DNA repair, replication, recombination, and transcription. Unresolved questions regarding DNA helicases include: (1) how is directional translocation determined in SF2 helicases; (2) do…

  20. Expression and characterization of an N-truncated form of the NifA protein of Azospirillum brasilense.

    PubMed

    Nishikawa, C Y; Araújo, L M; Kadowaki, M A S; Monteiro, R A; Steffens, M B R; Pedrosa, F O; Souza, E M; Chubatsu, L S

    2012-02-01

    Azospirillum brasilense is a nitrogen-fixing bacterium associated with important agricultural crops such as rice, wheat and maize. The expression of genes responsible for nitrogen fixation (nif genes) in this bacterium is dependent on the transcriptional activator NifA. This protein contains three structural domains: the N-terminal domain is responsible for the negative control by fixed nitrogen; the central domain interacts with the RNA polymerase σ(54) co-factor and the C-terminal domain is involved in DNA binding. The central and C-terminal domains are linked by the interdomain linker (IDL). A conserved four-cysteine motif encompassing the end of the central domain and the IDL is probably involved in the oxygen-sensitivity of NifA. In the present study, we have expressed, purified and characterized an N-truncated form of A. brasilense NifA. The protein expression was carried out in Escherichia coli and the N-truncated NifA protein was purified by chromatography using an affinity metal-chelating resin followed by a heparin-bound resin. Protein homogeneity was determined by densitometric analysis. The N-truncated protein activated in vivo nifH::lacZ transcription regardless of fixed nitrogen concentration (absence or presence of 20 mM NH(4)Cl) but only under low oxygen levels. On the other hand, the aerobically purified N-truncated NifA protein bound to the nifB promoter, as demonstrated by an electrophoretic mobility shift assay, implying that DNA-binding activity is not strictly controlled by oxygen levels. Our data show that, while the N-truncated NifA is inactive in vivo under aerobic conditions, it still retains DNA-binding activity, suggesting that the oxidized form of NifA bound to DNA is not competent to activate transcription.

  1. Expression and characterization of an N-truncated form of the NifA protein of Azospirillum brasilense

    PubMed Central

    Nishikawa, C.Y.; Araújo, L.M.; Kadowaki, M.A.S.; Monteiro, R.A.; Steffens, M.B.R.; Pedrosa, F.O.; Souza, E.M.; Chubatsu, L.S.

    2012-01-01

    Azospirillum brasilense is a nitrogen-fixing bacterium associated with important agricultural crops such as rice, wheat and maize. The expression of genes responsible for nitrogen fixation (nif genes) in this bacterium is dependent on the transcriptional activator NifA. This protein contains three structural domains: the N-terminal domain is responsible for the negative control by fixed nitrogen; the central domain interacts with the RNA polymerase σ54 factor and the C-terminal domain is involved in DNA binding. The central and C-terminal domains are linked by the interdomain linker (IDL). A conserved four-cysteine motif encompassing the end of the central domain and the IDL is probably involved in the oxygen-sensitivity of NifA. In the present study, we have expressed, purified and characterized an N-truncated form of A. brasilense NifA. The protein expression was carried out in Escherichia coli and the N-truncated NifA protein was purified by chromatography using an affinity metal-chelating resin followed by a heparin-bound resin. Protein homogeneity was determined by densitometric analysis. The N-truncated protein activated in vivo nifH::lacZ transcription regardless of fixed nitrogen concentration (absence or presence of 20 mM NH4Cl) but only under low oxygen levels. On the other hand, the aerobically purified N-truncated NifA protein bound to the nifB promoter, as demonstrated by an electrophoretic mobility shift assay, implying that DNA-binding activity is not strictly controlled by oxygen levels. Our data show that, while the N-truncated NifA is inactive in vivo under aerobic conditions, it still retains DNA-binding activity, suggesting that the oxidized form of NifA bound to DNA is not competent to activate transcription. PMID:22267004

  2. Identification of the Quorum-Sensing Target DNA Sequence and N-Acyl Homoserine Lactone Responsiveness of the Brucella abortus virB promoter▿

    PubMed Central

    Arocena, Gastón M.; Sieira, Rodrigo; Comerci, Diego J.; Ugalde, Rodolfo A.

    2010-01-01

    VjbR is a LuxR-type quorum-sensing (QS) regulator that plays an essential role in the virulence of the intracellular facultative pathogen Brucella, the causative agent of brucellosis. It was previously described that VjbR regulates a diverse group of genes, including the virB operon. The latter codes for a type IV secretion system (T4SS) that is central for the pathogenesis of Brucella. Although the regulatory role of VjbR on the virB promoter (PvirB) was extensively studied by different groups, the VjbR-binding site had not been identified so far. Here, we identified the target DNA sequence of VjbR in PvirB by DNase I footprinting analyses. Surprisingly, we observed that VjbR specifically recognizes a sequence that is identical to a half-binding site of the QS-related regulator MrtR of Mesorhizobium tianshanense. As shown by DNase I footprinting and electrophoretic mobility shift assays, generation of a palindromic MrtR-like-binding site in PvirB increased both the affinity and the stability of the VjbR-DNA complex, which confirmed that the QS regulator of Brucella is highly related to that of M. tianshanense. The addition of N-dodecanoyl homoserine lactone dissociated VjbR from the promoter, which confirmed previous reports that indicated a negative effect of this signal on the VjbR-mediated activation of PvirB. Our results provide new molecular evidence for the structure of the virB promoter and reveal unusual features of the QS target DNA sequence of the main regulator of virulence in Brucella. PMID:20400542

  3. The effects of dexamethasone on rat brain cortical nuclear factor kappa B (NF-{kappa}B) in endotoxic shock

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang Zhi; Kang Jinsong; Li Yang

    2006-08-01

    To explore the molecular mechanism of brain tissue injury induced by lipopolysaccharide (LPS), we studied the effects of endotoxic shock on rat brain cortex NF-{kappa}B and the effects of dexamethasone on these changes. Rats were randomly divided into LPS, LPS + dexamethasone, and control groups. The DNA-binding activity of NF-{kappa}B was observed using electrophoretic mobility shift assay (EMSA). Protein expression in nuclear extracts was studied using Western blots, and nuclear translocation was observed using immunohistochemistry. These indices were assayed at 1 h and 4 h after intravenous injection of LPS (4 mg.kg{sup -1}). EMSA showed significantly increased NF-{kappa}B DNA-binding activitymore » in nuclear extracts from the LPS group at both 1 h and 4 h after LPS injection, compared with the control group (P < 0.01). For the LPS group, the NF-{kappa}B DNA-binding activity was greater at 1 h than at 4 h (P < 0.05). The expression of p65 and p50 protein in the nuclear extracts was also increased, as compared with the control group. However, the expression of p65 and p50 protein from cytosolic extracts did not show any significant change. Dexamethasone down-regulated not only NF-{kappa}B DNA-binding activity but also the expression of p65 protein in the nuclear extracts. From these data, we have concluded that NF-{kappa}B activation and nuclear translocation of NF-{kappa}B play a key role in the molecular mechanism of brain tissue injury in endotoxic shock. Dexamethasone may alleviate brain injury by inhibiting NF-{kappa}B activation.« less

  4. Selective Inhibition of the Human tie-1 Promoter with Triplex-Forming Oligonucleotides Targeted to Ets Binding Sites

    PubMed Central

    Hewett, Peter W; Daft, Emma L; Laughton, Charles A; Ahmad, Shakil; Ahmed, Asif; Murray, J Clifford

    2006-01-01

    The Tie receptors (Tie-1 and Tie-2/Tek) are essential for angiogenesis and vascular remodeling/integrity. Tie receptors are up-regulated in tumor-associated endothelium, and their inhibition disrupts angiogenesis and can prevent tumor growth as a consequence. To investigate the potential of anti-gene approaches to inhibit tie gene expression for anti-angiogenic therapy, we have examined triple-helical (triplex) DNA formation at 2 tandem Ets transcription factor binding motifs (designated E-1 and E-2) in the human tie-1 promoter. Various tie-1 promoter deletion/mutation luciferase reporter constructs were generated and transfected into endothelial cells to examine the relative activities of E-1 and E-2. The binding of antiparallel and parallel (control) purine motif oligonucleotides (21–22 bp) targeted to E-1 and E-2 was assessed by plasmid DNA fragment binding and electrophoretic mobility shift assays. Triplex-forming oligonucleotides were incubated with tie-1 reporter constructs and transfected into endothelial cells to determine their activity. The Ets binding motifs in the E-1 sequence were essential for human tie-1 promoter activity in endothelial cells, whereas the deletion of E-2 had no effect. Antiparallel purine motif oligonucleotides targeted at E-1 or E-2 selectively formed strong triplex DNA (Kd ~10−7 M) at 37 °C. Transfection of tie-1 reporter constructs with triplex DNA at E-1, but not E-2, specifically inhibited tie-1 promoter activity by up to 75% compared with control oligonucleotides in endothelial cells. As similar multiple Ets binding sites are important for the regulation of several endothelial-restricted genes, this approach may have broad therapeutic potential for cancer and other pathologies involving endothelial proliferation/dysfunction. PMID:16838069

  5. Selective inhibition of the human tie-1 promoter with triplex-forming oligonucleotides targeted to Ets binding sites.

    PubMed

    Hewett, Peter W; Daft, Emma L; Laughton, Charles A; Ahmad, Shakil; Ahmed, Asif; Murray, J Clifford

    2006-01-01

    The Tie receptors (Tie-1 and Tie-2/Tek) are essential for angiogenesis and vascular remodeling/integrity. Tie receptors are up-regulated in tumor-associated endothelium, and their inhibition disrupts angiogenesis and can prevent tumor growth as a consequence. To investigate the potential of anti-gene approaches to inhibit tie gene expression for anti-angiogenic therapy, we have examined triple-helical (triplex) DNA formation at 2 tandem Ets transcription factor binding motifs (designated E-1 and E-2) in the human tie-1 promoter. Various tie-1 promoter deletion/mutation luciferase reporter constructs were generated and transfected into endothelial cells to examine the relative activities of E-1 and E-2. The binding of antiparallel and parallel (control) purine motif oligonucleotides (21-22 bp) targeted to E-1 and E-2 was assessed by plasmid DNA fragment binding and electrophoretic mobility shift assays. Triplex-forming oligonucleotides were incubated with tie-1 reporter constructs and transfected into endothelial cells to determine their activity. The Ets binding motifs in the E-1 sequence were essential for human tie-1 promoter activity in endothelial cells, whereas the deletion of E-2 had no effect. Antiparallel purine motif oligonucleotides targeted at E-1 or E-2 selectively formed strong triplex DNA (K(d) approximately 10(-7) M) at 37 degrees C. Transfection of tie-1 reporter constructs with triplex DNA at E-1, but not E-2, specifically inhibited tie-1 promoter activity by up to 75% compared with control oligonucleotides in endothelial cells. As similar multiple Ets binding sites are important for the regulation of several endothelial-restricted genes, this approach may have broad therapeutic potential for cancer and other pathologies involving endothelial proliferation/dysfunction.

  6. To Move Forward, We Must Be Mobile: Practical Uses of Mobile Technology in Literacy Education Courses

    ERIC Educational Resources Information Center

    Husbye, Nicholas E.; Elsener, Anne A.

    2013-01-01

    Technology continues to shift the definition of what it means to be literate. As literacy educators in teacher preparation programs, we must consider how emerging and mobile technology may be used within coursework to not only create multiple ways to conceptualize teaching 21st century literacy, but also as a professional imperative. This article…

  7. Separation of a chemically modified DNA oligomer bound by the carcinogen 2-Amino-1-methy-6-phenylimidazo [4,5-{beta}]pyridine using capillary gel electrophoresis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nguyen, T.N.

    1994-05-06

    We have optimized the reaction conditions under which unactivated metabolite of the food borne carcinogen 2-amino-1-methyl-6-phenylimidazo [4,5-{beta}]pyridine (PhIP) is covalently bound to the oligodeoxynucleotide d(CCTACGCATCC). Capillary electrophoresis (CE) was used to separate and characterize this DNA oligomer bound by PhIP. We observed 2 major and several minor PhIP adduct species. The 2 major adducts had different absorbance maxima; the major adduct eluates with faster and slower mobilities had absorbance maxima of 360 and 340 nm, respectively. One of the two major PhIP adduct species was resolvable but the peak was broad. Using detection at 260 nm, the other major PhIPmore » adduct with fastest electrophoretic mobility was not resolvable, but coelute with the huge broad unmodified DNA oligomer peak. However, at higher wavelengths (>320 nm) where DNA does not absorb, electropherograms generated by detection at these higher wavelengths showed very heterogeneous binding by PhIP to the DNA oligomer with no interfering absorbance by the DNA.« less

  8. Towards the Batch Synthesis of Long DNA

    DTIC Science & Technology

    2002-10-01

    mishybridizations which arise because of frame-shifting (in the special case of pairs of batch ssDNAs [as opposed to semi-ligated “DNA Frankensteins ...of DNA in solution, despite the possible influences of steric constraints, applied electric potential, etc. 78 Although Howorka et al. do not

  9. A Streptococcus uberis transposon mutant screen reveals a negative role for LiaR homologue in biofilm formation.

    PubMed

    Salomäki, T; Karonen, T; Siljamäki, P; Savijoki, K; Nyman, T A; Varmanen, P; Iivanainen, A

    2015-01-01

    The environmental pathogen Streptococcus uberis causes intramammary infections in dairy cows. Because biofilm growth might contribute to Strep. uberis mastitis, we conducted a biological screen to identify genes potentially involved in the regulation of biofilm growth. By screening a transposon mutant library of Strep. uberis, we determined that the disruption of 13 genes (including hasA, coaC, clpP, miaA, nox and uidA) led to increased biofilm formation. One of the genes (SUB1382) encoded a homologue of the LiaR response regulator (RR) of the Bacillus subtilis two-component signalling system (TCS). Electrophoretic mobility shift assays revealed that DNA binding by LiaR was greatly enhanced by phosphorylation. Two-dimensional differential in-gel electrophoresis analyses of the liaR mutant and the parental Strep. uberis strain revealed five differentially produced proteins with at least a 1·5-fold change in relative abundance (P < 0·05). The DNA-binding protein LiaR is a potential regulator of biofilm formation by Strep. uberis. Several molecular primary and downstream targets involved in biofilm formation by Strep. uberis were identified. This provides a solid foundation for further studies on the regulation of biofilm formation in this important pathogen. © 2014 The Society for Applied Microbiology.

  10. COACTIVATOR ACTIVATOR (CoAA) PREVENTS THE TRANSCRIPTIONAL ACTIVITY OF RUNT DOMAIN TRANSCRIPTION FACTORS

    PubMed Central

    Li, Xiaodong; Hoeppner, Luke H.; Jensen, Eric D.; Gopalakrishnan, Rajaram; Westendorf, Jennifer J.

    2013-01-01

    Runx proteins are essential for a number of developmental processes and are aberrantly expressed in many human cancers. Runx factors bind DNA and co-factors to activate or repress genes crucial for bone formation, hematopoiesis, and neuronal development. Co-activator activator (CoAA) is a nuclear protein that regulates gene expression, RNA splicing and is overexpressed in many human tumors. In this study, we identified CoAA as a Runx2 binding protein. CoAA repressed Runx factor-dependent activation of reporter genes in a histone deacetylase-independent manner. CoAA also blocked Runx2-mediated repression of the Axin2 promoter, a novel Runx target gene. The carboxy-terminus of CoAA is essential for binding the Runt domains of Runx1 and Runx2. In electophoretic mobility shift assays, CoAA inhibited Runx2 interactions with DNA. These data indicate that CoAA is an inhibitor of Runx factors and can negate Runx factor regulation of gene expression. CoAA is expressed at high levels in human fetal osteoblasts and osteosarcoma cell lines. Suppression of CoAA expression by RNA interference reduced osteosarcoma cell viability in vitro, suggesting that it contributes to the proliferation and/or survival of osteoblast lineage cells. PMID:19585539

  11. Hypoxia inducible factor-1 mediates the expression of the immune checkpoint HLA-G in glioma cells through hypoxia response element located in exon 2.

    PubMed

    Yaghi, Layale; Poras, Isabelle; Simoes, Renata T; Donadi, Eduardo A; Tost, Jörg; Daunay, Antoine; de Almeida, Bibiana Sgorla; Carosella, Edgardo D; Moreau, Philippe

    2016-09-27

    HLA-G is an immune checkpoint molecule with specific relevance in cancer immunotherapy. It was first identified in cytotrophoblasts, protecting the fetus from maternal rejection. HLA-G tissue expression is very restricted but induced in numerous malignant tumors such as glioblastoma, contributing to their immune escape. Hypoxia occurs during placenta and tumor development and was shown to activate HLA-G. We aimed to elucidate the mechanisms of HLA-G activation under conditions combining hypoxia-mimicking treatment and 5-aza-2'deoxycytidine, a DNA demethylating agent used in anti-cancer therapy which also induces HLA-G. Both treatments enhanced the amount of HLA-G mRNA and protein in HLA-G negative U251MG glioma cells. Electrophoretic Mobility Shift Assays and luciferase reporter gene assays revealed that HLA-G upregulation depends on Hypoxia Inducible Factor-1 (HIF-1) and a hypoxia responsive element (HRE) located in exon 2. A polymorphic HRE at -966 bp in the 5'UT region may modulate the magnitude of the response mediated by the exon 2 HRE. We suggest that therapeutic strategies should take into account that HLA-G expression in response to hypoxic tumor environment is dependent on HLA-G gene polymorphism and DNA methylation state at the HLA-G locus.

  12. Organization of genes responsible for the stereospecific conversion of hydantoins to alpha-amino acids in Arthrobacter aurescens DSM 3747.

    PubMed

    Wiese, A; Syldatk, C; Mattes, R; Altenbuchner, J

    2001-09-01

    Arthrobacter aurescens DSM 3747 hydrolyzes stereospecifically 5'-monosubstituted hydantoins to alpha-amino acids. The genes involved in hydantoin utilization (hyu) were isolated on an 8.7-kb DNA fragment, and by DNA sequence analysis eight ORFs were identified. The hyu gene cluster includes four genes: hyuP encoding a putative transport protein, the hydantoin racemase gene hyuA, the hydantoinase gene hyuH, and the carbamoylase gene hyuC. The four genes are transcribed in the same direction. Upstream of hyuP and in opposite orientation to the hyu genes, three ORFs were found showing similarities to cytochrome P450 monooxygenase (ORF1, incomplete), to membrane proteins (ORF2), and to ferredoxin (ORF3). ORF8 was found downstream of hyuC and again in opposite orientation to the hyu genes. The gene product of ORF8 displayed similarities to the LacI/GalR family of transcriptional regulators. Reverse transcriptase PCR experiments and Northern blot analysis revealed that the genes hyuPAHC are coexpressed in A. aurescens after induction with 3-N-CH3-IMH. The expression of the hyu operon was not regulated by the putative regulator ORF8 as shown by gene disruption and mobility-shift experiments.

  13. Interactions between the promoter and first intron are involved in transcriptional control of alpha 1(I) collagen gene expression.

    PubMed Central

    Bornstein, P; McKay, J; Liska, D J; Apone, S; Devarayalu, S

    1988-01-01

    The first intron of the human collagen alpha 1(I) gene contains several positively and negatively acting elements. We have studied the transcription of collagen-human growth hormone fusion genes, containing deletions and rearrangements of collagen intronic sequences, by transient transfection of chick tendon fibroblasts and NIH 3T3 cells. In chick tendon fibroblasts, but not in 3T3 cells, inversion of intronic sequences containing a previously studied 274-base-pair segment, A274, resulted in markedly reduced human growth hormone mRNA levels as determined by an RNase protection assay. This inhibitory effect was largely alleviated when deletions were introduced in the collagen promoter of plasmids containing negatively oriented intronic sequences. Evidence for interaction of the promoter with the intronic segment, A274, was obtained by gel mobility shift assays. We suggest that promoter-intron interactions, mediated by DNA-binding proteins, regulate collagen gene transcription. Inversion of intronic segments containing critical interactive elements might then lead to an altered geometry and reduced activity of a transcriptional complex in those cells with sufficiently high levels of appropriate transcription factors. We further suggest that the deleted promoter segment plays a key role in directing DNA interactions involved in transcriptional control. Images PMID:3211130

  14. Qualitatively Monitoring Binding and Expression of the Transcription Factors Sp1 and NFI as a Useful Tool to Evaluate the Quality of Primary Cultured Epithelial Stem Cells in Tissue Reconstruction.

    PubMed

    Le-Bel, Gaëtan; Ghio, Sergio Cortez; Larouche, Danielle; Germain, Lucie; Guérin, Sylvain L

    2018-05-27

    Electrophoretic mobility shift assays and Western blots are simple, efficient, and rapid methods to study DNA-protein interactions and protein expression, respectively. Primary cultures and subcultures of epithelial cells are widely used for the production of tissue-engineered substitutes and are gaining popularity as a model for gene expression studies. The preservation of stem cells through the culture process is essential to produce high quality substitutes. However, the increase in the number of cell passages is associated with a decrease in their ability to proliferate until senescence is reached. This process is likely to be mediated by the altered expression of nuclear-located transcription factors such as Sp1 and NFI, whose expression has been documented to be required for cell adhesion, migration, and differentiation. In some of our recent studies, we observed a correlation between reconstructed tissues exhibiting poor histological and structural characteristics and a low expression of Sp1 in their constituting epithelial cells. Therefore, monitoring both the expression and DNA binding of these transcription factors in human skin and corneal epithelial cells is a useful tool for characterizing the quality of primary cultured epithelial cells.

  15. A Bromodomain-Containing Protein from Tomato Specifically Binds Potato Spindle Tuber Viroid RNA In Vitro and In Vivo

    PubMed Central

    Martínez de Alba, Angel Emilio; Sägesser, Rudolf; Tabler, Martin; Tsagris, Mina

    2003-01-01

    For the identification of RNA-binding proteins that specifically interact with potato spindle tuber viroid (PSTVd), we subjected a tomato cDNA expression library prepared from viroid-infected leaves to an RNA ligand screening procedure. We repeatedly identified cDNA clones that expressed a protein of 602 amino acids. The protein contains a bromodomain and was termed viroid RNA-binding protein 1 (VIRP1). The specificity of interaction of VIRP1 with viroid RNA was studied by different methodologies, which included Northwestern blotting, plaque lift, and electrophoretic mobility shift assays. VIRP1 interacted strongly and specifically with monomeric and oligomeric PSTVd positive-strand RNA transcripts. Other RNAs, for example, U1 RNA, did not bind to VIRP1. Further, we could immunoprecipitate complexes from infected tomato leaves that contained VIRP1 and viroid RNA in vivo. Analysis of the protein sequence revealed that VIRP1 is a member of a newly identified family of transcriptional regulators associated with chromatin remodeling. VIRP1 is the first member of this family of proteins, for which a specific RNA-binding activity is shown. A possible role of VIRP1 in viroid replication and in RNA mediated chromatin remodeling is discussed. PMID:12915580

  16. Staphylococcus aureus genomics and the impact of horizontal gene transfer.

    PubMed

    Lindsay, Jodi A

    2014-03-01

    Whole genome sequencing and microarrays have revealed the population structure of Staphylococcus aureus, and identified epidemiological shifts, transmission routes, and adaptation of major clones. S. aureus genomes are highly diverse. This is partly due to a population structure of conserved lineages, each with unique combinations of genes encoding surface proteins, regulators, immune evasion and virulence pathways. Even more variable are the mobile genetic elements (MGE), which encode key proteins for antibiotic resistance, virulence and host-adaptation. MGEs can transfer at high frequency between isolates of the same lineage by horizontal gene transfer (HGT). There is increasing evidence that HGT is key to bacterial adaptation and success. Recent studies have shed light on new mechanisms of DNA transfer such as transformation, the identification of receptors for transduction, on integration of DNA pathways, mechanisms blocking transfer including CRISPR and new restriction systems, strategies for evasion of restriction barriers, as well as factors influencing MGE selection and stability. These studies have also lead to new tools enabling construction of genetically modified clinical S. aureus isolates. This review will focus on HGT mechanisms and their importance in shaping the evolution of new clones adapted to antibiotic resistance, healthcare, communities and livestock. Copyright © 2013 Elsevier GmbH. All rights reserved.

  17. CMX-8933, a peptide fragment of the glycoprotein ependymin, promotes activation of AP-1 transcription factor in mouse neuroblastoma and rat cortical cell cultures.

    PubMed

    Shashoua, V E; Adams, D; Boyer-Boiteau, A

    2001-10-19

    An 8-amino acid peptide fragment (CMX-8933) of Ependymin, a glycoprotein component of the extracellular fluid and cerebrospinal fluid of goldfish brain, was synthesized and tested for its capacity to activate AP-1 transcription factor in cell cultures. Dose-response and time-course studies of AP-1's binding to DNA were carried out in neuroblastoma (NB2a/dl) and primary rat brain cortical cultures using an electrophoretic mobility shift assay (EMSA). A 13-14-fold increase in AP-1's DNA binding was obtained when NB2a cells were incubated for 4 h with 6-10 microg/ml CMX-8933. Primary rat brain cortical cultures were much more sensitive to the effects of CMX-8933 than transformed (NB2a) cultures; here a 26.7+/-5.2-fold increase in binding was observed following a 3-h treatment with as little as 10 ng/ml peptide. These findings are consistent with an activation of this transcription factor, a characteristic that has been previously correlated with functional aspects of full-sized neurotrophic factors (nerve growth factor and brain-derived nerve growth factor) in neuronal differentiation and regeneration. Such data suggest a role for Ependymin in transcriptional control.

  18. Acetyl Coenzyme A Stimulates RNA Polymerase II Transcription and Promoter Binding by Transcription Factor IID in the Absence of Histones

    PubMed Central

    Galasinski, Shelly K.; Lively, Tricia N.; Grebe de Barron, Alexandra; Goodrich, James A.

    2000-01-01

    Protein acetylation has emerged as a means of controlling levels of mRNA synthesis in eukaryotic cells. Here we report that acetyl coenzyme A (acetyl-CoA) stimulates RNA polymerase II transcription in vitro in the absence of histones. The effect of acetyl-CoA on basal and activated transcription was studied in a human RNA polymerase II transcription system reconstituted from recombinant and highly purified transcription factors. Both basal and activated transcription were stimulated by the addition of acetyl-CoA to transcription reaction mixtures. By varying the concentrations of general transcription factors in the reaction mixtures, we found that acetyl-CoA decreased the concentration of TFIID required to observe transcription. Electrophoretic mobility shift assays and DNase I footprinting revealed that acetyl-CoA increased the affinity of the general transcription factor TFIID for promoter DNA in a TBP-associated factor (TAF)-dependent manner. Interestingly, acetyl-CoA also caused a conformational change in the TFIID-TFIIA-promoter complex as assessed by DNase I footprinting. These results show that acetyl-CoA alters the DNA binding activity of TFIID and indicate that this biologically important cofactor functions at multiple levels to control gene expression. PMID:10688640

  19. Acetyl coenzyme A stimulates RNA polymerase II transcription and promoter binding by transcription factor IID in the absence of histones.

    PubMed

    Galasinski, S K; Lively, T N; Grebe De Barron, A; Goodrich, J A

    2000-03-01

    Protein acetylation has emerged as a means of controlling levels of mRNA synthesis in eukaryotic cells. Here we report that acetyl coenzyme A (acetyl-CoA) stimulates RNA polymerase II transcription in vitro in the absence of histones. The effect of acetyl-CoA on basal and activated transcription was studied in a human RNA polymerase II transcription system reconstituted from recombinant and highly purified transcription factors. Both basal and activated transcription were stimulated by the addition of acetyl-CoA to transcription reaction mixtures. By varying the concentrations of general transcription factors in the reaction mixtures, we found that acetyl-CoA decreased the concentration of TFIID required to observe transcription. Electrophoretic mobility shift assays and DNase I footprinting revealed that acetyl-CoA increased the affinity of the general transcription factor TFIID for promoter DNA in a TBP-associated factor (TAF)-dependent manner. Interestingly, acetyl-CoA also caused a conformational change in the TFIID-TFIIA-promoter complex as assessed by DNase I footprinting. These results show that acetyl-CoA alters the DNA binding activity of TFIID and indicate that this biologically important cofactor functions at multiple levels to control gene expression.

  20. Improved bioactivity of G-rich triplex-forming oligonucleotides containing modified guanine bases

    PubMed Central

    Rogers, Faye A; Lloyd, Janice A; Tiwari, Meetu Kaushik

    2014-01-01

    Triplex structures generated by sequence-specific triplex-forming oligonucleotides (TFOs) have proven to be promising tools for gene targeting strategies. In addition, triplex technology has been highly utilized to study the molecular mechanisms of DNA repair, recombination and mutagenesis. However, triplex formation utilizing guanine-rich oligonucleotides as third strands can be inhibited by potassium-induced self-association resulting in G-quadruplex formation. We report here that guanine-rich TFOs partially substituted with 8-aza-7-deaza-guanine (PPG) have improved target site binding in potassium compared with TFOs containing the natural guanine base. We designed PPG-substituted TFOs to bind to a polypurine sequence in the supFG1 reporter gene. The binding efficiency of PPG-substituted TFOs to the target sequence was analyzed using electrophoresis mobility gel shift assays. We have determined that in the presence of potassium, the non-substituted TFO, AG30 did not bind to its target sequence, however binding was observed with the PPG-substituted AG30 under conditions with up to 140 mM KCl. The PPG-TFOs were able to maintain their ability to induce genomic modifications as measured by an assay for gene-targeted mutagenesis. In addition, these compounds were capable of triplex-induced DNA double strand breaks, which resulted in activation of apoptosis. PMID:25483840

  1. [The Effects of Mobile Social Networking Service-Based Cognitive Behavior Therapy on Insomnia in Nurses].

    PubMed

    Kim, Ji Eun; Kim, Suk Sun

    2017-08-01

    This study aimed to examine the effects of cognitive behavior therapy for insomnia (CBT-I) based on the mobile social networking service (SNS) on dysfunctional beliefs and attitudes about sleep, sleep quality, daytime sleepiness, depression, and quality of life among rotating-shift nurses in a hospital in Korea. A nonequivalent control group pre-post test design was used. The participants included 55 nurses with rotating three-shift work (25 in the experimental group and 30 in the control group). For the experimental group, CBT-I using mobile SNS was provided once a week for 60 minutes over six weeks. Data were analyzed using descriptive statistics, χ²-test, independent samples t-test, and Mann-whitney U test with the SPSS 21.0 program. In the homogeneity test of the general characteristics and study variables, there were no significant differences between the two groups. Nurses in the experimental group had significantly lower scores on dysfunctional beliefs and attitudes regarding sleep and sleepiness than nurses in the control group. Nurses in the experimental group had significantly higher scores on sleep quality and quality of life than nurses in the control group. These findings indicate that using the mobile SNS-based CBT-I is feasible and has significant and positive treatment-related effects on rotating-shift nurses' irrational thoughts and beliefs in association with sleep, sleep quality, daytime sleepiness, and quality of life. These contribute to expanding our knowledge of rotating-shift nurses' sleep issues and their preferences for intervention. © 2017 Korean Society of Nursing Science

  2. Quantifying attention shifts in augmented reality image-guided neurosurgery

    PubMed Central

    Drouin, Simon; Collins, D. Louis; Popa, Tiberiu; Kersten-Oertel, Marta

    2017-01-01

    Image-guided surgery (IGS) has allowed for more minimally invasive procedures, leading to better patient outcomes, reduced risk of infection, less pain, shorter hospital stays and faster recoveries. One drawback that has emerged with IGS is that the surgeon must shift their attention from the patient to the monitor for guidance. Yet both cognitive and motor tasks are negatively affected with attention shifts. Augmented reality (AR), which merges the realworld surgical scene with preoperative virtual patient images and plans, has been proposed as a solution to this drawback. In this work, we studied the impact of two different types of AR IGS set-ups (mobile AR and desktop AR) and traditional navigation on attention shifts for the specific task of craniotomy planning. We found a significant difference in terms of the time taken to perform the task and attention shifts between traditional navigation, but no significant difference between the different AR set-ups. With mobile AR, however, users felt that the system was easier to use and that their performance was better. These results suggest that regardless of where the AR visualisation is shown to the surgeon, AR may reduce attention shifts, leading to more streamlined and focused procedures. PMID:29184663

  3. Quantifying attention shifts in augmented reality image-guided neurosurgery.

    PubMed

    Léger, Étienne; Drouin, Simon; Collins, D Louis; Popa, Tiberiu; Kersten-Oertel, Marta

    2017-10-01

    Image-guided surgery (IGS) has allowed for more minimally invasive procedures, leading to better patient outcomes, reduced risk of infection, less pain, shorter hospital stays and faster recoveries. One drawback that has emerged with IGS is that the surgeon must shift their attention from the patient to the monitor for guidance. Yet both cognitive and motor tasks are negatively affected with attention shifts. Augmented reality (AR), which merges the realworld surgical scene with preoperative virtual patient images and plans, has been proposed as a solution to this drawback. In this work, we studied the impact of two different types of AR IGS set-ups (mobile AR and desktop AR) and traditional navigation on attention shifts for the specific task of craniotomy planning. We found a significant difference in terms of the time taken to perform the task and attention shifts between traditional navigation, but no significant difference between the different AR set-ups. With mobile AR, however, users felt that the system was easier to use and that their performance was better. These results suggest that regardless of where the AR visualisation is shown to the surgeon, AR may reduce attention shifts, leading to more streamlined and focused procedures.

  4. Evidence for the role of Mycobacterium tuberculosis RecG helicase in DNA repair and recombination.

    PubMed

    Thakur, Roshan S; Basavaraju, Shivakumar; Somyajit, Kumar; Jain, Akshatha; Subramanya, Shreelakshmi; Muniyappa, Kalappa; Nagaraju, Ganesh

    2013-04-01

    In order to survive and replicate in a variety of stressful conditions during its life cycle, Mycobacterium tuberculosis must possess mechanisms to safeguard the integrity of the genome. Although DNA repair and recombination related genes are thought to play key roles in the repair of damaged DNA in all organisms, so far only a few of them have been functionally characterized in the tubercle bacillus. In this study, we show that M. tuberculosis RecG (MtRecG) expression was induced in response to different genotoxic agents. Strikingly, expression of MtRecG in Escherichia coli ∆recG mutant strain provided protection against mitomycin C, methyl methane sulfonate and UV induced cell death. Purified MtRecG exhibited higher binding affinity for the Holliday junction (HJ) compared with a number of canonical recombinational DNA repair intermediates. Notably, although MtRecG binds at the core of the mobile and immobile HJs, and with higher binding affinity for the immobile HJ, branch migration was evident only in the case of the mobile HJ. Furthermore, immobile HJs stimulate MtRecG ATPase activity less efficiently than mobile HJs. In addition to HJ substrates, MtRecG exhibited binding affinity for a variety of branched DNA structures including three-way junctions, replication forks, flap structures, forked duplex and a D-loop structure, but demonstrated strong unwinding activity on replication fork and flap DNA structures. Together, these results support that MtRecG plays an important role in processes related to DNA metabolism under normal as well as stress conditions. © 2013 The Authors Journal compilation © 2013 FEBS.

  5. A single thiazole orange molecule forms an exciplex in a DNA i-motif.

    PubMed

    Xu, Baochang; Wu, Xiangyang; Yeow, Edwin K L; Shao, Fangwei

    2014-06-18

    A fluorescent exciplex of thiazole orange (TO) is formed in a single-dye conjugated DNA i-motif. The exciplex fluorescence exhibits a large Stokes shift, high quantum yield, robust response to pH oscillation and little structural disturbance to the DNA quadruplex, which can be used to monitor the folding of high-order DNA structures.

  6. Biosensors for DNA sequence detection

    NASA Technical Reports Server (NTRS)

    Vercoutere, Wenonah; Akeson, Mark

    2002-01-01

    DNA biosensors are being developed as alternatives to conventional DNA microarrays. These devices couple signal transduction directly to sequence recognition. Some of the most sensitive and functional technologies use fibre optics or electrochemical sensors in combination with DNA hybridization. In a shift from sequence recognition by hybridization, two emerging single-molecule techniques read sequence composition using zero-mode waveguides or electrical impedance in nanoscale pores.

  7. 5-Hydroxymethylcytosine in E-box motifs ACAT|GTG and ACAC|GTG increases DNA-binding of the B-HLH transcription factor TCF4.

    PubMed

    Khund-Sayeed, Syed; He, Ximiao; Holzberg, Timothy; Wang, Jun; Rajagopal, Divya; Upadhyay, Shriyash; Durell, Stewart R; Mukherjee, Sanjit; Weirauch, Matthew T; Rose, Robert; Vinson, Charles

    2016-09-12

    We evaluated DNA binding of the B-HLH family members TCF4 and USF1 using protein binding microarrays (PBMs) containing double-stranded DNA probes with cytosine on both strands or 5-methylcytosine (5mC) or 5-hydroxymethylcytosine (5hmC) on one DNA strand and cytosine on the second strand. TCF4 preferentially bound the E-box motif (CAN|NTG) with strongest binding to the 8-mer CAG|GTGGT. 5mC uniformly decreases DNA binding of both TCF4 and USF1. The bulkier 5hmC also inhibited USF1 binding to DNA. In contrast, 5hmC dramatically enhanced TCF4 binding to E-box motifs ACAT|GTG and ACAC|GTG, being better bound than any 8-mer containing cytosine. Examination of X-ray structures of the closely related TCF3 and USF1 bound to DNA suggests TCF3 can undergo a conformational shift to preferentially bind to 5hmC while the USF1 basic region is bulkier and rigid precluding a conformation shift to bind 5hmC. These results greatly expand the regulatory DNA sequence landscape bound by TCF4.

  8. Motion of Knots in DNA Stretched by Elongational Fields

    NASA Astrophysics Data System (ADS)

    Klotz, Alexander R.; Soh, Beatrice W.; Doyle, Patrick S.

    2018-05-01

    Knots in DNA occur in biological systems, serve as a model system for polymer entanglement, and affect the efficacy of modern genomics technologies. We study the motion of complex knots in DNA by stretching molecules with a divergent electric field that provides an elongational force. We demonstrate that the motion of knots is nonisotropic and driven towards the closest end of the molecule. We show for the first time experimentally that knots can go from a mobile to a jammed state by varying an applied strain rate, and that this jamming is reversible. We measure the mobility of knots as a function of strain rate, demonstrating the conditions under which knots can be driven towards the ends of the molecule and untied.

  9. Gel Electrophoresis of Gold-DNA Nanoconjugates

    DOE PAGES

    Pellegrino, T.; Sperling, R. A.; Alivisatos, A. P.; ...

    2007-01-01

    Gold-DNA conjugates were investigated in detail by a comprehensive gel electrophoresis study based on 1200 gels. A controlled number of single-stranded DNA of different length was attached specifically via thiol-Au bonds to phosphine-stabilized colloidal gold nanoparticles. Alternatively, the surface of the gold particles was saturated with single stranded DNA of different length either specifically via thiol-Au bonds or by nonspecific adsorption. From the experimentally determined electrophoretic mobilities, estimates for the effective diameters of the gold-DNA conjugates were derived by applying two different data treatment approaches. The first method is based on making a calibration curve for the relation between effectivemore » diameters and mobilities with gold nanoparticles of known diameter. The second method is based on Ferguson analysis which uses gold nanoparticles of known diameter as reference database. Our study shows that effective diameters derived from gel electrophoresis measurements are affected with a high error bar as the determined values strongly depend on the method of evaluation, though relative changes in size upon binding of molecules can be detected with high precision. Furthermore, in this study, the specific attachment of DNA via gold-thiol bonds to Au nanoparticles is compared to nonspecific adsorption of DNA. Also, the maximum number of DNA molecules that can be bound per particle was determined.« less

  10. Mobile Communication and Civil Society: Linking Patterns and Places of Use to Engagement with Others in Public

    ERIC Educational Resources Information Center

    Campbell, Scott W.; Kwak, Nojin

    2011-01-01

    This study examined whether and how mobile communication influences the extent to which one engages with new people in public settings. Contrary to our expectation, general use of the technology in public did not detract from conversing with strangers. Shifting focus from "where" one uses the mobile phone to "how" it is used, we found that uses…

  11. Aconitase couples metabolic regulation to mitochondrial DNA maintenance.

    PubMed

    Chen, Xin Jie; Wang, Xiaowen; Kaufman, Brett A; Butow, Ronald A

    2005-02-04

    Mitochondrial DNA (mtDNA) is essential for cells to maintain respiratory competency and is inherited as a protein-DNA complex called the nucleoid. We have identified 22 mtDNA-associated proteins in yeast, among which is mitochondrial aconitase (Aco1p). We show that this Krebs-cycle enzyme is essential for mtDNA maintenance independent of its catalytic activity. Regulation of ACO1 expression by the HAP and retrograde metabolic signaling pathways directly affects mtDNA maintenance. When constitutively expressed, Aco1p can replace the mtDNA packaging function of the high-mobility-group protein Abf2p. Thus, Aco1p may integrate metabolic signals and mtDNA maintenance.

  12. Sensitive Leptospira DNA detection using tapered optical fiber sensor.

    PubMed

    Zainuddin, Nurul H; Chee, Hui Y; Ahmad, Muhammad Z; Mahdi, Mohd A; Abu Bakar, Muhammad H; Yaacob, Mohd H

    2018-03-23

    This paper presents the development of tapered optical fiber sensor to detect a specific Leptospira bacteria DNA. The bacteria causes Leptospirosis, a deadly disease but with common early flu-like symptoms. Optical single mode fiber (SMF) of 125 μm diameter is tapered to produce 12 μm waist diameter and 15 cm length. The novel DNA-based optical fiber sensor is functionalized by incubating the tapered region with sodium hydroxide (NaOH), (3-Aminopropyl) triethoxysilane and glutaraldehyde. Probe DNA is immobilized onto the tapered region and subsequently hybridized by its complementary DNA (cDNA). The transmission spectra of the DNA-based optical fiber sensor are measured in the 1500 to 1600 nm wavelength range. It is discovered that the shift of the wavelength in the SMF sensor is linearly proportional with the increase in the cDNA concentrations from 0.1 to 1.0 nM. The sensitivity of the sensor toward DNA is measured to be 1.2862 nm/nM and able to detect as low as 0.1 fM. The sensor indicates high specificity when only minimal shift is detected for non-cDNA testing. The developed sensor is able to distinguish between actual DNA of Leptospira serovars (Canicola and Copenhageni) against Clostridium difficile (control sample) at very low (femtomolar) target concentrations. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Ultraviolet electroluminescence from zinc oxide nanorods/deoxyribonucleic acid hybrid bio light-emitting diode

    NASA Astrophysics Data System (ADS)

    Gupta, Rohini Bhardwaj; Nagpal, Swati; Arora, Swati; Bhatnagar, Pramod Kumar; Mathur, Parmatma Chandra

    2011-01-01

    Ultraviolet (UV) light-emitting diode using salmon deoxyribonucleic acid (sDNA)-cetyltrimethylammonium complex as an electron blocking layer and zinc oxide (ZnO) nanorods as emissive material was fabricated. UV emission, which was blue shifted up to 335 nm with respect to the band edge emission of 390 nm, was observed. This blue shift was caused due to accumulation of electrons in the conduction band of ZnO because of a high potential barrier existing at the sDNA/ZnO interface.

  14. Changes in pH and NADPH regulate the DNA binding activity of neuronal PAS domain protein 2, a mammalian circadian transcription factor.

    PubMed

    Yoshii, Katsuhiro; Tajima, Fumihisa; Ishijima, Sumio; Sagami, Ikuko

    2015-01-20

    Neuronal PAS domain protein 2 (NPAS2) is a core clock transcription factor that forms a heterodimer with BMAL1 to bind the E-box in the promoter of clock genes and is regulated by various environmental stimuli such as heme, carbon monoxide, and NAD(P)H. In this study, we investigated the effects of pH and NADPH on the DNA binding activity of NPAS2. In an electrophoretic mobility shift (EMS) assay, the pH of the reaction mixture affected the DNA binding activity of the NPAS2/BMAL1 heterodimer but not that of the BMAL1/BMAL1 homodimer. A change in pH from 7.0 to 7.5 resulted in a 1.7-fold increase in activity in the absence of NADPH, and NADPH additively enhanced the activity up to 2.7-fold at pH 7.5. The experiments using truncated mutants revealed that N-terminal amino acids 1-61 of NPAS2 were sufficient to sense the change in both pH and NADPH. We further analyzed the kinetics of formation and DNA binding of the NPAS2/BMAL1 heterodimer at various pH values. In the absence of NADPH, a change in pH from 6.5 to 8.0 decreased the KD(app) value of the E-box from 125 to 22 nM, with an 8-fold increase in the maximal level of DNA binding for the NPAS2/BMAL1 heterodimer. The addition of NADPH resulted in a further decrease in KD(app) to 9 nM at pH 8.0. Furthermore, NPAS2-dependent transcriptional activity in a luciferase assay using NIH3T3 cells also increased with the pH of the culture medium. These results suggest that NPAS2 has a role as a pH and metabolite sensor in regulating circadian rhythms.

  15. Alignment of Gold Nanoparticle-Decorated DNA Origami Nanotubes: Substrate Prepatterning versus Molecular Combing.

    PubMed

    Teschome, Bezu; Facsko, Stefan; Gothelf, Kurt V; Keller, Adrian

    2015-11-24

    DNA origami has become an established technique for designing well-defined nanostructures with any desired shape and for the controlled arrangement of functional nanostructures with few nanometer resolution. These unique features make DNA origami nanostructures promising candidates for use as scaffolds in nanoelectronics and nanophotonics device fabrication. Consequently, a number of studies have shown the precise organization of metallic nanoparticles on various DNA origami shapes. In this work, we fabricated large arrays of aligned DNA origami decorated with a high density of gold nanoparticles (AuNPs). To this end, we first demonstrate the high-yield assembly of high-density AuNP arrangements on DNA origami adsorbed to Si surfaces with few unbound background nanoparticles by carefully controlling the concentrations of MgCl2 and AuNPs in the hybridization buffer and the hybridization time. Then, we evaluate two methods, i.e., hybridization to prealigned DNA origami and molecular combing in a receding meniscus, with respect to their potential to yield large arrays of aligned AuNP-decorated DNA origami nanotubes. Because of the comparatively low MgCl2 concentration required for the efficient immobilization of the AuNPs, the prealigned DNA origami become mobile and displaced from their original positions, thereby decreasing the alignment yield. This increased mobility, on the other hand, makes the adsorbed origami susceptible to molecular combing, and a total alignment yield of 86% is obtained in this way.

  16. Mutation-Induced Population Shift in the MexR Conformational Ensemble Disengages DNA Binding: A Novel Mechanism for MarR Family Derepression.

    PubMed

    Anandapadamanaban, Madhanagopal; Pilstål, Robert; Andresen, Cecilia; Trewhella, Jill; Moche, Martin; Wallner, Björn; Sunnerhagen, Maria

    2016-08-02

    MexR is a repressor of the MexAB-OprM multidrug efflux pump operon of Pseudomonas aeruginosa, where DNA-binding impairing mutations lead to multidrug resistance (MDR). Surprisingly, the crystal structure of an MDR-conferring MexR mutant R21W (2.19 Å) presented here is closely similar to wild-type MexR. However, our extended analysis, by molecular dynamics and small-angle X-ray scattering, reveals that the mutation stabilizes a ground state that is deficient of DNA binding and is shared by both mutant and wild-type MexR, whereas the DNA-binding state is only transiently reached by the more flexible wild-type MexR. This population shift in the conformational ensemble is effected by mutation-induced allosteric coupling of contact networks that are independent in the wild-type protein. We propose that the MexR-R21W mutant mimics derepression by small-molecule binding to MarR proteins, and that the described allosteric model based on population shifts may also apply to other MarR family members. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Changes in brain glioma incidence and laterality correlates with use of mobile phones--a nationwide population based study in Israel.

    PubMed

    Barchana, Micha; Margaliot, Menahem; Liphshitz, Irena

    2012-01-01

    Mobile phones are in extensive use worldwide and concerns regarding their role in tumor formation were raised. Over the years multiple studies were published in order to investigate this issue using several approaches. The current study looks at secular trends of brain gliomas (low and high grade) incidence and changes in tumor's laterality over 30 years in a population extensively using this technology with a possible correlation to the spread of use of mobile phones. All brain gliomas that were diagnosed from 1980-2009 were included and subdivided into two groups--low and high grade. Secular and periodic time trend analyses of incidence rates and changes in laterality were performed. Preferred side of head using mobile phones was assessed with a questionnaire in a sample of adult individuals. A decrease in incidence of low grade giomas (LGG) that correlated with introduction of mobile technology was found from 2.57, 2.34 and 2.79 for every 100,000 in the period 1980 to the end of 1994 to 1.72, 1.82 and 1.57, respectively, over the last three 5-years periods (1995-2009). High-grade glioma incidences increased significantly from 1980-2009 but in the period after mobile phones were introduced (1994-2009) a lower, non significant, rate of increase was observed in males and a lower one (significant) in females. A shift towards left sided tumor location for all adult gliomas combined and separately for LGG and HGG was noted from 1995 onward. The shift was more marked for those who were diagnosed in ages 20-49 (p=0.03). We found a statistically significant decrease in LGG's over 30-years period that correlates with introducing of mobile phones technology and a shift in laterality towards left-sided tumors, the latter occurred in both low and high-grade gliomas.

  18. Oxidative DNA damage during night shift work.

    PubMed

    Bhatti, Parveen; Mirick, Dana K; Randolph, Timothy W; Gong, Jicheng; Buchanan, Diana Taibi; Zhang, Junfeng Jim; Davis, Scott

    2017-09-01

    We previously reported that compared with night sleep, day sleep among shift workers was associated with reduced urinary excretion of 8-hydroxydeoxyguanosine (8-OH-dG), potentially reflecting a reduced ability to repair 8-OH-dG lesions in DNA. We identified the absence of melatonin during day sleep as the likely causative factor. We now investigate whether night work is also associated with reduced urinary excretion of 8-OH-dG. For this cross-sectional study, 50 shift workers with the largest negative differences in night work versus night sleep circulating melatonin levels (measured as 6-sulfatoxymelatonin in urine) were selected from among the 223 shift workers included in our previous study. 8-OH-dG concentrations were measured in stored urine samples using high performance liquid chromatography with electrochemical detection. Mixed effects models were used to compare night work versus night sleep 8-OH-dG levels. Circulating melatonin levels during night work (mean=17.1 ng/mg creatinine/mg creatinine) were much lower than during night sleep (mean=51.7 ng/mg creatinine). In adjusted analyses, average urinary 8-OH-dG levels during the night work period were only 20% of those observed during the night sleep period (95% CI 10% to 30%; p<0.001). This study suggests that night work, relative to night sleep, is associated with reduced repair of 8-OH-dG lesions in DNA and that the effect is likely driven by melatonin suppression occurring during night work relative to night sleep. If confirmed, future studies should evaluate melatonin supplementation as a means to restore oxidative DNA damage repair capacity among shift workers. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  19. Investigating the Use of Text Messages in Mobile Learning

    ERIC Educational Resources Information Center

    Geng, Gretchen

    2013-01-01

    Nowadays, teaching and learning have been shifted from traditional classrooms to technology-supported learning environment. By offering a convenient, efficient and financially affordable information technology learning environment, mobile learning is a topic that is of considerable interest for education audiences owing to the pervasive nature of…

  20. Differential detection of Gaussian MSK in a mobile radio environment

    NASA Technical Reports Server (NTRS)

    Simon, M. K.; Wang, C. C.

    1984-01-01

    Minimum shift keying with Gaussian shaped transmit pulses is a strong candidate for a modulation technique that satisfies the stringent out-of-band radiated power requirements of the mobil radio application. Numerous studies and field experiments have been conducted by the Japanese on urban and suburban mobile radio channels with systems employing Gaussian minimum-shift keying (GMSK) transmission and differentially coherent reception. A comprehensive analytical treatment is presented of the performance of such systems emphasizing the important trade-offs among the various system design parameters such as transmit and receiver filter bandwidths and detection threshold level. It is shown that two-bit differential detection of GMSK is capable of offering far superior performance to the more conventional one-bit detection method both in the presence of an additive Gaussian noise background and Rician fading.

  1. Differential detection of Gaussian MSK in a mobile radio environment

    NASA Astrophysics Data System (ADS)

    Simon, M. K.; Wang, C. C.

    1984-11-01

    Minimum shift keying with Gaussian shaped transmit pulses is a strong candidate for a modulation technique that satisfies the stringent out-of-band radiated power requirements of the mobil radio application. Numerous studies and field experiments have been conducted by the Japanese on urban and suburban mobile radio channels with systems employing Gaussian minimum-shift keying (GMSK) transmission and differentially coherent reception. A comprehensive analytical treatment is presented of the performance of such systems emphasizing the important trade-offs among the various system design parameters such as transmit and receiver filter bandwidths and detection threshold level. It is shown that two-bit differential detection of GMSK is capable of offering far superior performance to the more conventional one-bit detection method both in the presence of an additive Gaussian noise background and Rician fading.

  2. Successive DNA extractions improve characterization of soil microbial communities

    PubMed Central

    de Hollander, Mattias; Smidt, Hauke; van Veen, Johannes A.

    2017-01-01

    Currently, characterization of soil microbial communities relies heavily on the use of molecular approaches. Independently of the approach used, soil DNA extraction is a crucial step, and success of downstream procedures will depend on how well DNA extraction was performed. Often, studies describing and comparing soil microbial communities are based on a single DNA extraction, which may not lead to a representative recovery of DNA from all organisms present in the soil. The use of successive DNA extractions might improve soil microbial characterization, but the benefit of this approach has only been limitedly studied. To determine whether successive DNA extractions of the same soil sample would lead to different observations in terms of microbial abundance and community composition, we performed three successive extractions, with two widely used commercial kits, on a range of clay and sandy soils. Successive extractions increased DNA yield considerably (1–374%), as well as total bacterial and fungal abundances in most of the soil samples. Analysis of the 16S and 18S ribosomal RNA genes using 454-pyrosequencing, revealed that microbial community composition (taxonomic groups) observed in the successive DNA extractions were similar. However, successive DNA extractions did reveal several additional microbial groups. For some soil samples, shifts in microbial community composition were observed, mainly due to shifts in relative abundance of a number of microbial groups. Our results highlight that performing successive DNA extractions optimize DNA yield, and can lead to a better picture of overall community composition. PMID:28168105

  3. Mobilization of a plant transposon by expression of the transposon-encoded anti-silencing factor.

    PubMed

    Fu, Yu; Kawabe, Akira; Etcheverry, Mathilde; Ito, Tasuku; Toyoda, Atsushi; Fujiyama, Asao; Colot, Vincent; Tarutani, Yoshiaki; Kakutani, Tetsuji

    2013-08-28

    Transposable elements (TEs) have a major impact on genome evolution, but they are potentially deleterious, and most of them are silenced by epigenetic mechanisms, such as DNA methylation. Here, we report the characterization of a TE encoding an activity to counteract epigenetic silencing by the host. In Arabidopsis thaliana, we identified a mobile copy of the Mutator-like element (MULE) with degenerated terminal inverted repeats (TIRs). This TE, named Hiun (Hi), is silent in wild-type plants, but it transposes when DNA methylation is abolished. When a Hi transgene was introduced into the wild-type background, it induced excision of the endogenous Hi copy, suggesting that Hi is the autonomously mobile copy. In addition, the transgene induced loss of DNA methylation and transcriptional activation of the endogenous Hi. Most importantly, the trans-activation of Hi depends on a Hi-encoded protein different from the conserved transposase. Proteins related to this anti-silencing factor, which we named VANC, are widespread in the non-TIR MULEs and may have contributed to the recent success of these TEs in natural Arabidopsis populations.

  4. Stiff Filamentous Viruses Probe the Mobility of Counterions During Nanopore Translocations

    NASA Astrophysics Data System (ADS)

    McMullen, Angus; Tang, Jay; Stein, Derek

    2015-03-01

    We study the electrophoresis of two different filamentous viruses and double-stranded DNA through solid-state nanopores. The two viruses we examine, fd and M13, are both 880 nm in length, 6.6 nm in diameter, very stiff, and monodisperse. They only differ in their linear charge density, which is 30 % lower for M13 than for fd. Filamentous viruses are therefore ideal for testing transport models and for comparisons with DNA dynamics. We find that the mean translocation speed of fd virus is related to the nanopore diameter, D, and the virus diameter, d, as ln(D / d) - 1 , in agreement with the conventional electrokinetic model of translocations. In order to obtain quantitative agreement between that electrokinetic model and the measured translocation dynamics, however, one must conclude that the mobility of counterions within a few Angstroms of the polymer surface is strongly reduced from the bulk value. Similar reductions in counterion mobility near fd, M13, and dsDNA explain their dynamics over a wide range of ionic strengths. This work was supported by NSF Grant CBET0846505, NSF Grant PHYS1058375 and Oxford Nanopore Technologies.

  5. Human cytomegalovirus DNA polymerase catalytic subunit pUL54 possesses independently acting nuclear localization and ppUL44 binding motifs.

    PubMed

    Alvisi, Gualtiero; Ripalti, Alessandro; Ngankeu, Apollinaire; Giannandrea, Maila; Caraffi, Stefano G; Dias, Manisha M; Jans, David A

    2006-10-01

    The catalytic subunit of human cytomegalovirus (HCMV) DNA polymerase pUL54 is a 1242-amino-acid protein, whose function, stimulated by the processivity factor, phosphoprotein UL44 (ppUL44), is essential for viral replication. The C-terminal residues (amino acids 1220-1242) of pUL54 have been reported to be sufficient for ppUL44 binding in vitro. Although believed to be important for functioning in the nuclei of infected cells, no data are available on either the interaction of pUL54 with ppUL44 in living mammalian cells or the mechanism of pUL54 nuclear transport and its relationship with that of ppUL44. The present study examines for the first time the nuclear import pathway of pUL54 and its interaction with ppUL44 using dual color, quantitative confocal laser scanning microscopy on live transfected cells and quantitative gel mobility shift assays. We showed that of two nuclear localization signals (NLSs) located at amino acids 1153-1159 (NLSA) and 1222-1227 (NLSB), NLSA is sufficient to confer nuclear localization on green fluorescent protein (GFP) by mediating interaction with importin alpha/beta. We also showed that pUL54 residues 1213-1242 are sufficient to confer ppUL44 binding abilities on GFP and that pUL54 and ppUL44 can be transported to the nucleus as a complex. Our work thus identified distinct sites within the HCMV DNA polymerase, which represent potential therapeutic targets and establishes the molecular basis of UL54 nuclear import.

  6. Human cells contain a factor that facilitates the DNA glycosylase-mediated excision of oxidized bases from occluded sites in nucleosomes.

    PubMed

    Maher, R L; Marsden, C G; Averill, A M; Wallace, S S; Sweasy, J B; Pederson, D S

    2017-09-01

    Reactive oxygen species generate some 20,000 base lesions per human cell per day. The vast majority of these potentially mutagenic or cytotoxic lesions are subject to base excision repair (BER). Although chromatin remodelers have been shown to enhance the excision of oxidized bases from nucleosomes in vitro, it is not clear that they are recruited to and act at sites of BER in vivo. To test the hypothesis that cells possess factors that enhance BER in chromatin, we assessed the capacity of nuclear extracts from human cells to excise thymine glycol (Tg) lesions from exogenously added, model nucleosomes. The DNA glycosylase NTHL1 in these extracts was able to excise Tg from both naked DNA and sites in nucleosomes that earlier studies had shown to be sterically accessible. However, the same extracts were able to excise lesions from sterically-occluded sites in nucleosomes only after the addition of Mg 2+ /ATP. Gel mobility shift assays indicated that nucleosomes remain largely intact following the Mg 2+ /ATP -dependent excision reaction. Size exclusion chromatography indicated that the NTHL1-stimulating activity has a relatively low molecular weight, close to that of NTHL1 and other BER glycosylases; column fractions that contained the very large chromatin remodeling complexes did not exhibit this same stimulatory activity. These results indicate that cells possess a factor(s) that promotes the initiation of BER in chromatin, but differs from most known chromatin remodeling complexes. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. 30 CFR 56.14100 - Safety defects; examination, correction and records.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... MINES Machinery and Equipment Safety Devices and Maintenance Requirements § 56.14100 Safety defects; examination, correction and records. (a) Self-propelled mobile equipment to be used during a shift shall be... defective items including self-propelled mobile equipment shall be taken out of service and placed in a...

  8. Internationalizing Higher Education in Malaysia: Government Policies and University's Response

    ERIC Educational Resources Information Center

    Tham, Siew Yean

    2013-01-01

    The intensity of internationalization has increased with an escalation in internationalization activities, leading to increasing student, program, and institutional mobility. In Malaysia, the internationalization of higher education in terms of student mobility has changed tremendously in the last two decades as the country has shifted from a…

  9. Mobility and Hierarchy in the Age of Near-Universal Access

    ERIC Educational Resources Information Center

    Parry, Gareth

    2011-01-01

    With the shift toward near-universal access, the movement of students within and between systems of higher education has assumed a new importance, especially for policies aimed at widening participation and social equity. Globalization has given rise to increasing levels of student mobility across national boundaries, with participation in…

  10. Sleep pattern and decision-making in physicians from mobile emergency care service with 12-h work schedules.

    PubMed

    Castro, Eleni de Araújo Sales; de Almondes, Katie Moraes

    2018-06-01

    Shift work schedules are biological standpoint worse because compel the body to anticipate periods of wakefulness and sleep and thus eventually cause a disruption of biological rhythms. The objective of this study is to evaluate the sleep pattern and decision-making in physicians working in mobile units of emergency attention undergoing day shift and rotating shift. The study included 26 physicians. The instruments utilized were a sociodemographic questionnaire, the Pittsburgh Sleep Quality Index, the Sleep Habits Questionnaire, the Epworth Sleepiness Scale and Chronotype Identification Questionnaire of Horne-Ostberg, the Iowa Gambling Task (IGT) and hypothetical scenarios of decision-making created according to the Policy-Capturing Technique. For inclusion and exclusion criteria, the participants answered the Chalder Fatigue Scale, the Beck Anxiety Inventory, the Beck Depression Inventory and the Inventory of Stress Symptoms for adults of Lipp. It was found good sleep quality for physicians on day shift schedule and bad sleep quality for physicians on rotating shift schedule. The IGT measure showed no impairment in decision-making, but the hypothetical scenarios revealed impairment decision-making during the shift for both schedules. Good sleep quality was related to a better performance in decision-making. Good sleep quality seems to influence a better performance in decision-making.

  11. Exposure to 1800 MHz radiofrequency electromagnetic radiation induces oxidative DNA base damage in a mouse spermatocyte-derived cell line.

    PubMed

    Liu, Chuan; Duan, Weixia; Xu, Shangcheng; Chen, Chunhai; He, Mindi; Zhang, Lei; Yu, Zhengping; Zhou, Zhou

    2013-03-27

    Whether exposure to radiofrequency electromagnetic radiation (RF-EMR) emitted from mobile phones can induce DNA damage in male germ cells remains unclear. In this study, we conducted a 24h intermittent exposure (5 min on and 10 min off) of a mouse spermatocyte-derived GC-2 cell line to 1800 MHz Global System for Mobile Communication (GSM) signals in GSM-Talk mode at specific absorption rates (SAR) of 1 W/kg, 2 W/kg or 4 W/kg. Subsequently, through the use of formamidopyrimidine DNA glycosylase (FPG) in a modified comet assay, we determined that the extent of DNA migration was significantly increased at a SAR of 4 W/kg. Flow cytometry analysis demonstrated that levels of the DNA adduct 8-oxoguanine (8-oxoG) were also increased at a SAR of 4 W/kg. These increases were concomitant with similar increases in the generation of reactive oxygen species (ROS); these phenomena were mitigated by co-treatment with the antioxidant α-tocopherol. However, no detectable DNA strand breakage was observed by the alkaline comet assay. Taking together, these findings may imply the novel possibility that RF-EMR with insufficient energy for the direct induction of DNA strand breaks may produce genotoxicity through oxidative DNA base damage in male germ cells. Crown Copyright © 2013. Published by Elsevier Ireland Ltd. All rights reserved.

  12. Unusually large Stokes shift for a near-infrared emitting DNA-stabilized silver nanocluster

    NASA Astrophysics Data System (ADS)

    Ammitzbøll Bogh, Sidsel; Carro-Temboury, Miguel R.; Cerretani, Cecilia; Swasey, Steven M.; Copp, Stacy M.; Gwinn, Elisabeth G.; Vosch, Tom

    2018-04-01

    In this paper we present a new near-IR emitting silver nanocluster (NIR-DNA-AgNC) with an unusually large Stokes shift between absorption and emission maximum (211 nm or 5600 cm-1). We studied the effect of viscosity and temperature on the steady state and time-resolved emission. The time-resolved results on NIR-DNA-AgNC show that the relaxation dynamics slow down significantly with increasing viscosity of the solvent. In high viscosity solution, the spectral relaxation stretches well into the nanosecond scale. As a result of this slow spectral relaxation in high viscosity solutions, a multi-exponential fluorescence decay time behavior is observed, in contrast to the more mono-exponential decay in low viscosity solution.

  13. Antibiotic Resistance Genes in the Bacteriophage DNA Fraction of Environmental Samples

    PubMed Central

    Colomer-Lluch, Marta; Jofre, Juan; Muniesa, Maite

    2011-01-01

    Antibiotic resistance is an increasing global problem resulting from the pressure of antibiotic usage, greater mobility of the population, and industrialization. Many antibiotic resistance genes are believed to have originated in microorganisms in the environment, and to have been transferred to other bacteria through mobile genetic elements. Among others, β-lactam antibiotics show clinical efficacy and low toxicity, and they are thus widely used as antimicrobials. Resistance to β-lactam antibiotics is conferred by β-lactamase genes and penicillin-binding proteins, which are chromosomal- or plasmid-encoded, although there is little information available on the contribution of other mobile genetic elements, such as phages. This study is focused on three genes that confer resistance to β-lactam antibiotics, namely two β-lactamase genes (blaTEM and blaCTX-M9) and one encoding a penicillin-binding protein (mecA) in bacteriophage DNA isolated from environmental water samples. The three genes were quantified in the DNA isolated from bacteriophages collected from 30 urban sewage and river water samples, using quantitative PCR amplification. All three genes were detected in the DNA of phages from all the samples tested, in some cases reaching 104 gene copies (GC) of blaTEM or 102 GC of blaCTX-M and mecA. These values are consistent with the amount of fecal pollution in the sample, except for mecA, which showed a higher number of copies in river water samples than in urban sewage. The bla genes from phage DNA were transferred by electroporation to sensitive host bacteria, which became resistant to ampicillin. blaTEM and blaCTX were detected in the DNA of the resistant clones after transfection. This study indicates that phages are reservoirs of resistance genes in the environment. PMID:21390233

  14. Dexamethasone potently enhances phorbol ester-induced IL-1beta gene expression and nuclear factor NF-kappaB activation.

    PubMed

    Wang, Y; Zhang, J J; Dai, W; Lei, K Y; Pike, J W

    1997-07-15

    The synthetic glucocorticoid dexamethasone, an immunosuppressive and anti-inflammatory agent, was investigated for its effect on PMA-mediated expression of the inflammatory cytokine IL-1beta in the human monocytic leukemic cell line THP-1. PMA alone induced the production of low levels of IL-1beta in THP-1 cells, whereas dexamethasone alone had no effect. However, dexamethasone potently enhanced PMA-mediated IL-1beta production. Using a selective and potent inhibitor of protein kinase C, we found that synergistic interaction between PMA and dexamethasone requires protein kinase C activation. PMA has been known to activate nuclear factor NF-kappaB in THP-1 cells. Using an oligonucleotide probe corresponding to an NF-kappaB DNA-binding motif of the IL-1beta gene promoter in gel electrophoresis mobility shift assays, we demonstrated that PMA-induced NF-kappaB activation was greatly potentiated by dexamethasone. Our results indicate that glucocorticoids can be positive regulators of inflammatory cytokine gene expression during monocytic cell differentiation.

  15. Four dimensional imaging of E. coli nucleoid organization and dynamics in living cells

    PubMed Central

    Fisher, J. K.; Bourniquel, A.; Witz, G.; Weiner, B.; Prentiss, M.; Kleckner, N.

    2013-01-01

    Visualization of living E. coli nucleoids, defined by HupA-mCherry, reveals a discrete, dynamic helical ellipsoid. Three basic features emerge. (i) Nucleoid density efficiently coalesces into longitudinal bundles, giving a stiff, low DNA density ellipsoid. (ii) This ellipsoid is radially confined within the cell cylinder. Radial confinement gives helical shape and drives and directs global nucleoid dynamics, including sister segregation. (iii) Longitudinal density waves flux back and forth along the nucleoid, with 5–10% of density shifting within 5s, enhancing internal nucleoid mobility. Furthermore, sisters separate end-to-end in sequential discontinuous pulses, each elongating the nucleoid by 5–15%. Pulses occur at 20min intervals, at defined cell cycle times. This progression is mediated by sequential installation and release of programmed tethers, implying cyclic accumulation and relief of intra-nucleoid mechanical stress. These effects could comprise a chromosome-based cell cycle engine. Overall, the presented results suggest a general conceptual framework for bacterial nucleoid morphogenesis and dynamics. PMID:23623305

  16. High level transactivation by a modified Bombyx ecdysone receptor in mammalian cells without exogenous retinoid X receptor

    PubMed Central

    Suhr, Steven T.; Gil, Elad B.; Senut, Marie-Claude; Gage, Fred H.

    1998-01-01

    Our studies of the Bombyx mori ecdysone receptor (BE) revealed that, unlike the Drosophila melanogaster ecdysone receptor (DE), treatment of BE with the ecdysone agonist tebufenozide stimulated high level transactivation in mammalian cells without adding an exogenous heterodimer partner. Gel mobility shift and transfection assays with both the ultraspiracle gene product (Usp) and retinoid X receptor heterodimer partners indicated that this property of BE stems from significantly augmented heterodimer complex formation and concomitant DNA binding. We have mapped this “gain of function” to determinants within the D and E domains of BE and demonstrated that, although the D domain determinant is sufficient for high affinity heterodimerization with Usp, both determinants are necessary for high affinity interaction with retinoid X receptor. Modified BE receptors alone used as replication-defective retroviruses potently stimulated separate “reporter” viruses in all cell types examined, suggesting that BE has potentially broad utility in the modulation of transgene expression in mammalian cells. PMID:9653129

  17. Changes in Expression of Signal Transduction Proteins in T Lymphocytes of Patients with Leprosy

    PubMed Central

    Zea, Arnold H.; Ochoa, Maria T.; Ghosh, Paritosh; Longo, Dan L.; Alvord, W. Gregory; Valderrama, Liliana; Falabella, Rafael; Harvey, Linda K.; Saravia, Nancy; Moreno, Luis H.; Ochoa, Augusto C.

    1998-01-01

    Advanced stages of mycobacterial diseases such as leprosy and tuberculosis are characterized by a loss of T-cell function. The basis of this T-cell dysfunction is not well understood. The present report demonstrates major alterations in the expression of signal transduction molecules in T cells of leprosy patients. These alterations were most frequently observed in lepromatous leprosy (LL) patients. Of 29 LL patients, 69% had decreased T-cell receptor ζ-chain expression, 48% had decreased p56lck tyrosine kinase, and 63% had a loss of nuclear transcription factor NF-κB p65. An electrophoretic mobility shift assay with the gamma interferon core promoter region revealed a loss of the Th1 DNA-binding pattern in LL patients. In contrast, tuberculoid leprosy patients had only minor signal transduction alterations. These novel findings might improve our understanding of the T-cell dysfunction observed in leprosy and other infectious diseases and consequently might lead to better immunologic evaluation of patients. PMID:9453602

  18. Sensitive optical bio-sensing of p-type WSe2 hybridized with fluorescent dye attached DNA by doping and de-doping effects

    NASA Astrophysics Data System (ADS)

    Han, Kyu Hyun; Kim, Jun Young; Jo, Seong Gi; Seo, Changwon; Kim, Jeongyong; Joo, Jinsoo

    2017-10-01

    Layered transition metal dichalcogenides, such as MoS2, WSe2 and WS2, are exciting two-dimensional (2D) materials because they possess tunable optical and electrical properties that depend on the number of layers. In this study, the nanoscale photoluminescence (PL) characteristics of the p-type WSe2 monolayer, and WSe2 layers hybridized with the fluorescent dye Cy3 attached to probe-DNA (Cy3/p-DNA), have been investigated as a function of the concentration of Cy3/DNA by using high-resolution laser confocal microscopy. With increasing concentration of Cy3/p-DNA, the measured PL intensity decreases and its peak is red-shifted, suggesting that the WSe2 layer has been p-type doped with Cy3/p-DNA. Then, the PL intensity of the WSe2/Cy3/p-DNA hybrid system increases and the peak is blue-shifted through hybridization with relatively small amounts of target-DNA (t-DNA) (50-100 nM). This effect originates from charge and energy transfer from the Cy3/DNA to the WSe2. For t-DNA detection, our systems using p-type WSe2 have the merit in terms of the increase of PL intensity. The p-type WSe2 monolayers can be a promising nanoscale 2D material for sensitive optical bio-sensing based on the doping and de-doping responses to biomaterials.

  19. Ku Protein Levels, Localization and Association to Replication Origins in Different Stages of Breast Tumor Progression

    PubMed Central

    Abdelbaqi, Khalil; Di Paola, Domenic; Rampakakis, Emmanouil; Zannis-Hadjopoulos, Maria

    2013-01-01

    Human origins of DNA replication are specific sequences within the genome whereby DNA replication is initiated. A select group of proteins, known as the pre-replication (pre-RC) complex, in whose formation the Ku protein (Ku70/Ku86) was shown to play a role, bind to replication origins to initiate DNA replication. In this study, we have examined the involvement of Ku in breast tumorigenesis and tumor progression and found that the Ku protein expression levels in human breast metastatic (MCF10AC1a) cells were higher in the chromatin fraction compared to hyperplastic (MCF10AT) and normal (MCF10A) human breast cells, but remained constant in both the nuclear and cytoplasmic fractions. In contrast, in human intestinal cells, the Ku expression level was relatively constant for all cell fractions. Nascent DNA abundance and chromatin association of Ku70/86 revealed that the c-myc origin activity in MCF10AC1a is 2.5 to 5-fold higher than in MCF10AT and MCF10A, respectively, and Ku was bound to the c-myc origin more abundantly in MCF10AC1a, by approximately 1.5 to 4.2-fold higher than in MCF10AT and MCF10A, respectively. In contrast, similar nascent DNA abundance and chromatin association was found for all cell lines for the lamin B2 origin, associated with the constitutively active housekeeping lamin B2 gene. Electrophoretic mobility shift assays (EMSAs) performed on the nuclear extracts (NEs) of the three cell types revealed the presence of protein-DNA replication complexes on both the c-myc and lamin B2 origins, but an increase in binding activity was observed from normal, to transformed, to cancer cells for the c-myc origin, whereas no such difference was seen for the lamin B2 origin. Overall, the results suggest that increased Ku chromatin association, beyond wild type levels, alters cellular processes, which have been implicated in tumorigenesis. PMID:23781282

  20. Photoactive platinum(II) complexes of nonsteroidal anti-inflammatory drug naproxen: Interaction with biological targets, antioxidant activity and cytotoxicity.

    PubMed

    Srivastava, Payal; Singh, Khushbu; Verma, Madhu; Sivakumar, Sri; Patra, Ashis K

    2018-01-20

    The effect on the therapeutic efficacy of Pt(II) complexes on combining non-steroidal anti-inflammatory drugs (NSAIDs) is an attractive strategy to circumvent chronic inflammation mediated by cancer and metastasis. Two square-planar platinum(II) complexes: [Pt(dach)(nap)Cl] (1) and [Pt(dach)(nap) 2 ] (2), where dach = (1R,2R)-dichloro(cyclohexane-1,2-diamine) and NSAID drug naproxen (nap), have been designed for studying their biological activity. The naproxen bound to the Pt(II) centre get released upon photoirradiation with low-power UV-A light as confirmed by the significant enhancement in emission intensities of the complexes. The compounds were evaluated for their photophysical properties, photostability, reactivity with 5'-guanosine monophophosphate (5'-GMP), interactions with CT-DNA and BSA, antioxidant activity and reactive oxygen species mediated photo-induced DNA damage properties. ESI-MS studies demonstrated the formation of bis-adduct with 5'-GMP and the formation of Pt II -DNA crosslinks by gel electrophoretic mobility shift assay and ITC studies. The interaction of the complexes 1 and 2 with the CT-DNA exhibits potential binding affinity (K b  ∼ 10 4  M -1 , K app ∼ 10 5  M -1 ), implying intercalation to CT-DNA through planar naphthyl ring of the complexes. Both the complexes also exhibit strong binding affinity towards BSA (K BSA ∼ 10 5  M -1 ). The complexes exhibit efficient DNA damage activity on irradiation at 365 nm via formation of singlet oxygen ( 1 O 2 ) and hydroxyl radical ( • OH) under physiological conditions. Both the complexes were cytotoxic in dark and exhibit significant enhancement of cytotoxicity upon photo-exposure against HeLa and HepG2 cancer cells giving IC 50 values ranging from 8 to 12 μM for 1 and 2. The cellular internalization data showed cytosolic and nuclear localization of the complexes in the HeLa cells. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  1. PCNA appears in two populations of slow and fast diffusion with a constant ratio throughout S-phase in replicating mammalian cells.

    PubMed

    Zessin, Patrick J M; Sporbert, Anje; Heilemann, Mike

    2016-01-13

    DNA replication is a fundamental cellular process that precedes cell division. Proliferating cell nuclear antigen (PCNA) is a central scaffold protein that orchestrates DNA replication by recruiting many factors essential for the replication machinery. We studied the mobility of PCNA in live mammalian cells using single-particle tracking in combination with photoactivated-localization microscopy (sptPALM) and found two populations. The first population which is only present in cells with active DNA replication, showed slow diffusion and was found to be located in replication foci. The second population showed fast diffusion, and represents the nucleoplasmic pool of unbound PCNA not involved in DNA replication. The ratio of these two populations remained constant throughout different stages of S-phase. A fraction of molecules in both populations showed spatially constrained mobility. We determined an exploration radius of ~100 nm for 13% of the slow-diffusing PCNA molecules, and of ~600 nm for 46% of the fast-diffusing PCNA molecules.

  2. Electrophoretic Mobility Shift Assay (EMSA) for Detecting Protein-Nucleic Acid Interactions

    PubMed Central

    Hellman, Lance M.; Fried, Michael G.

    2009-01-01

    The gel electrophoresis mobility shift assay (EMSA) is used to detect protein complexes with nucleic acids. It is the core technology underlying a wide range of qualitative and quantitative analyses for the characterization of interacting systems. In the classical assay, solutions of protein and nucleic acid are combined and the resulting mixtures are subjected to electrophoresis under native conditions through polyacrylamide or agarose gel. After electrophoresis, the distribution of species containing nucleic acid is determined, usually by autoradiography of 32P-labeled nucleic acid. In general, protein-nucleic acid complexes migrate more slowly than the corresponding free nucleic acid. In this article, we identify the most important factors that determine the stabilities and electrophoretic mobilities of complexes under assay conditions. A representative protocol is provided and commonly used variants are discussed. Expected outcomes are briefly described. References to extensions of the method and a troubleshooting guide are provided. PMID:17703195

  3. Electrokinetic transport of rigid macroions in the thin double layer limit: a boundary element approach.

    PubMed

    Allison, Stuart A; Xin, Yao

    2005-08-15

    A boundary element (BE) procedure is developed to numerically calculate the electrophoretic mobility of highly charged, rigid model macroions in the thin double layer regime based on the continuum primitive model. The procedure is based on that of O'Brien (R.W. O'Brien, J. Colloid Interface Sci. 92 (1983) 204). The advantage of the present procedure over existing BE methodologies that are applicable to rigid model macroions in general (S. Allison, Macromolecules 29 (1996) 7391) is that computationally time consuming integrations over a large number of volume elements that surround the model particle are completely avoided. The procedure is tested by comparing the mobilities derived from it with independent theory of the mobility of spheres of radius a in a salt solution with Debye-Huckel screening parameter, kappa. The procedure is shown to yield accurate mobilities provided (kappa)a exceeds approximately 50. The methodology is most relevant to model macroions of mean linear dimension, L, with 1000>(kappa)L>100 and reduced absolute zeta potential (q|zeta|/k(B)T) greater than 1.0. The procedure is then applied to the compact form of high molecular weight, duplex DNA that is formed in the presence of the trivalent counterion, spermidine, under low salt conditions. For T4 DNA (166,000 base pairs), the compact form is modeled as a sphere (diameter=600 nm) and as a toroid (largest linear dimension=600 nm). In order to reconcile experimental and model mobilities, approximately 95% of the DNA phosphates must be neutralized by bound counterions. This interpretation, based on electrokinetics, is consistent with independent studies.

  4. On the Adsorption of DNA Origami Nanostructures in Nanohole Arrays.

    PubMed

    Brassat, Katharina; Ramakrishnan, Saminathan; Bürger, Julius; Hanke, Marcel; Doostdar, Mahnaz; Lindner, Jörg K N; Grundmeier, Guido; Keller, Adrian

    2018-05-22

    DNA origami nanostructures are versatile substrates for the controlled arrangement of molecular capture sites with nanometer precision and thus have many promising applications in single-molecule bioanalysis. Here, we investigate the adsorption of DNA origami nanostructures in nanohole arrays which represent an important class of biosensors and may benefit from the incorporation of DNA origami-based molecular probes. Nanoholes with well-defined diameter that enable the adsorption of single DNA origami triangles are fabricated in Au films on Si wafers by nanosphere lithography. The efficiency of directed DNA origami adsorption on the exposed SiO 2 areas at the bottoms of the nanoholes is evaluated in dependence of various parameters, i.e., Mg 2+ and DNA origami concentrations, buffer strength, adsorption time, and nanohole diameter. We observe that the buffer strength has a surprisingly strong effect on DNA origami adsorption in the nanoholes and that multiple DNA origami triangles with 120 nm edge length can adsorb in nanoholes as small as 120 nm in diameter. We attribute the latter observation to the low lateral mobility of once adsorbed DNA origami on the SiO 2 surface, in combination with parasitic adsorption to the Au film. Although parasitic adsorption can be suppressed by modifying the Au film with a hydrophobic self-assembled monolayer, the limited surface mobility of the adsorbed DNA origami still leads to poor localization accuracy in the nanoholes and results in many DNA origami crossing the boundary to the Au film even under optimized conditions. We discuss possible ways to minimize this effect by varying the composition of the adsorption buffer, employing different fabrication conditions, or using other substrate materials for nanohole array fabrication.

  5. Structural changes induced by binding of the high-mobility group I protein to a mouse satellite DNA sequence.

    PubMed Central

    Slama-Schwok, A; Zakrzewska, K; Léger, G; Leroux, Y; Takahashi, M; Käs, E; Debey, P

    2000-01-01

    Using spectroscopic methods, we have studied the structural changes induced in both protein and DNA upon binding of the High-Mobility Group I (HMG-I) protein to a 21-bp sequence derived from mouse satellite DNA. We show that these structural changes depend on the stoichiometry of the protein/DNA complexes formed, as determined by Job plots derived from experiments using pyrene-labeled duplexes. Circular dichroism and melting temperature experiments extended in the far ultraviolet range show that while native HMG-I is mainly random coiled in solution, it adopts a beta-turn conformation upon forming a 1:1 complex in which the protein first binds to one of two dA.dT stretches present in the duplex. HMG-I structure in the 1:1 complex is dependent on the sequence of its DNA target. A 3:1 HMG-I/DNA complex can also form and is characterized by a small increase in the DNA natural bend and/or compaction coupled to a change in the protein conformation, as determined from fluorescence resonance energy transfer (FRET) experiments. In addition, a peptide corresponding to an extended DNA-binding domain of HMG-I induces an ordered condensation of DNA duplexes. Based on the constraints derived from pyrene excimer measurements, we present a model of these nucleated structures. Our results illustrate an extreme case of protein structure induced by DNA conformation that may bear on the evolutionary conservation of the DNA-binding motifs of HMG-I. We discuss the functional relevance of the structural flexibility of HMG-I associated with the nature of its DNA targets and the implications of the binding stoichiometry for several aspects of chromatin structure and gene regulation. PMID:10777751

  6. DMSK: A practical 2400-bps receiver for the mobile satellite service: An MSAT-X Report

    NASA Technical Reports Server (NTRS)

    Davarian, F.; Simon, M. K.; Sumida, J.

    1985-01-01

    The partical aspects of a 2400-bps differential detection minimum-shift-keying (DMSK) receiver are investigated. Fundamental issues relating to hardware precision, Doppler shift, fading, and frequency offset are examined, and it is concluded that the receiver's implementation at baseband is more advantageous both in cost and simplicity than its IF implementation. The DMSK receiver has been fabricated and tested under simulated mobile satellite environment conditions. The measured receiver performance in the presence of anomalies pertinent to the link is presented in this report. Furthermore, the receiver behavior in a band-limited channel (GMSK) is also investigated. The DMSK receiver performs substantially better than a coherent minimum-shift-keying (MSK) receiver in a heavily fading environment. The DMSK radio is simple and robust, and results in a lower error floor than its coherent counterpart. Moreover, this receiver is suitable for burst-type signals, and its recovery from deep fades is fast.

  7. Shifting Patterns of Transnational Academic Mobility: A Comparative and Historical Approach

    ERIC Educational Resources Information Center

    Kim, Terri

    2009-01-01

    This article is an initial attempt to illustrate how patterns of academic mobility in the history of universities have been framed by the international politics of particular time periods. The article briefly looks at "the medieval period" and then at the emergent colonial and nationalist periods, including the ways that institutions as…

  8. Systematising the Field of Mobile Assisted Language Learning

    ERIC Educational Resources Information Center

    Viberg, Olga; Grönlund, Åke

    2013-01-01

    This study provides a systematic review of mobile assisted language (MALL) research within the specific area of second language acquisition (SLA) during the period of 2005-2012 in terms of research approaches, theories and methods, technology, and the linguistic knowledge and skills' results. The findings show a shift from the prevailing SMS-based…

  9. Mobile medical computing driven by the complexity of neurologic diagnosis.

    PubMed

    Segal, Michael M

    2006-07-01

    Medical computing has been split between palm-sized computers optimized for mobility and desktop computers optimized for capability. This split was due to technology too immature to deliver both mobility and capability in the same computer and the lack of medical software that demanded both mobility and capability. Advances in hardware and software are ushering in an era in which fully capable computers will be available ubiquitously. As a result, medical practice, education and publishing will change. Medical practice will be improved by the use of software that not only assists with diagnosis but can do so at the bedside, where the doctor can act immediately upon suggestions such as useful findings to check. Medical education will shift away from a focus on details of unusual diseases and toward a focus on skills of physical examination and using computerized tools. Medical publishing, in contrast, will shift toward greater detail: it will be increasingly important to quantitate the frequency of findings in diseases and their time course since such information can have a major impact clinically when added to decision support software.

  10. MicroRNA156: A Potential Graft-Transmissible MicroRNA That Modulates Plant Architecture and Tuberization in Solanum tuberosum ssp. andigena1[C][W][OPEN

    PubMed Central

    Bhogale, Sneha; Mahajan, Ameya S.; Natarajan, Bhavani; Rajabhoj, Mohit; Thulasiram, Hirekodathakallu V.; Banerjee, Anjan K.

    2014-01-01

    MicroRNA156 (miR156) functions in maintaining the juvenile phase in plants. However, the mobility of this microRNA has not been demonstrated. So far, only three microRNAs, miR399, miR395, and miR172, have been shown to be mobile. We demonstrate here that miR156 is a potential graft-transmissible signal that affects plant architecture and tuberization in potato (Solanum tuberosum). Under tuber-noninductive (long-day) conditions, miR156 shows higher abundance in leaves and stems, whereas an increase in abundance of miR156 has been observed in stolons under tuber-inductive (short-day) conditions, indicative of a photoperiodic control. Detection of miR156 in phloem cells of wild-type plants and mobility assays in heterografts suggest that miR156 is a graft-transmissible signal. This movement was correlated with changes in leaf morphology and longer trichomes in leaves. Overexpression of miR156 in potato caused a drastic phenotype resulting in altered plant architecture and reduced tuber yield. miR156 overexpression plants also exhibited altered levels of cytokinin and strigolactone along with increased levels of LONELY GUY1 and StCyclin D3.1 transcripts as compared with wild-type plants. RNA ligase-mediated rapid amplification of complementary DNA ends analysis validated SQUAMOSA PROMOTER BINDING-LIKE3 (StSPL3), StSPL6, StSPL9, StSPL13, and StLIGULELESS1 as targets of miR156. Gel-shift assays indicate the regulation of miR172 by miR156 through StSPL9. miR156-resistant SPL9 overexpression lines exhibited increased miR172 levels under a short-day photoperiod, supporting miR172 regulation via the miR156-SPL9 module. Overall, our results strongly suggest that miR156 is a phloem-mobile signal regulating potato development. PMID:24351688

  11. Regulation of L1 expression and retrotransposition by melatonin and its receptor: implications for cancer risk associated with light exposure at night

    PubMed Central

    deHaro, Dawn; Kines, Kristine J.; Sokolowski, Mark; Dauchy, Robert T.; Streva, Vincent A.; Hill, Steven M.; Hanifin, John P.; Brainard, George C.; Blask, David E.; Belancio, Victoria P.

    2014-01-01

    Expression of long interspersed element-1 (L1) is upregulated in many human malignancies. L1 can introduce genomic instability via insertional mutagenesis and DNA double-strand breaks, both of which may promote cancer. Light exposure at night, a recently recognized carcinogen, is associated with an increased risk of cancer in shift workers. We report that melatonin receptor 1 inhibits mobilization of L1 in cultured cells through downregulation of L1 mRNA and ORF1 protein. The addition of melatonin receptor antagonists abolishes the MT1 effect on retrotransposition in a dose-dependent manner. Furthermore, melatonin-rich, but not melatonin-poor, human blood collected at different times during the circadian cycle suppresses endogenous L1 mRNA during in situ perfusion of tissue-isolated xenografts of human cancer. Supplementation of human blood with exogenous melatonin or melatonin receptor antagonist during the in situ perfusion establishes a receptor-mediated action of melatonin on L1 expression. Combined tissue culture and in vivo data support that environmental light exposure of the host regulates expression of L1 elements in tumors. Our data imply that light-induced suppression of melatonin production in shift workers may increase L1-induced genomic instability in their genomes and suggest a possible connection between L1 activity and increased incidence of cancer associated with circadian disruption. PMID:24914052

  12. Formation of a parallel-stranded DNA homoduplex by d(GGA) repeat oligonucleotides.

    PubMed Central

    Suda, T; Mishima, Y; Asakura, H; Kominami, R

    1995-01-01

    The GGA9-H molecules consisting of a double helical stretch followed by a single-stranded 3'-terminal overhang of nine GGA sequence repeats exhibited a gel mobility-shifted band in a concentration-dependent manner, suggestive of the intermolecular complex formation. The position of the shifted band in a gel was almost identical to that of the Y-shaped dimer marker of the same molecular weight that had the two double-helices at one side. This suggests that GGA9-H dimerizes in a parallel orientation without the formation of four-stranded hairpin structure. Since the GGA9-H homoduplex was stably formed at pH 4, 7 and 9, the formation does not require protonation or deprotonation of the N1 position of adenines. Neither does it require the N7 group of guanines responsible for Hoogsteen base pairing from the methylation interference and modification studies. Modification of the N7 group of guanines with dimethyl sulfate (DMS) did not inhibit the association and also the N7 group in the homoduplex was not protected from DMS. On the other hand, the GAA9-H having the G to A base substitution did not show such an association with either GGA9-H or GAA9-H. These results suggest that the homoduplex formation may be due to G.G base pairing through non-Hoogsteen hydrogen bonds. Images PMID:7479009

  13. Insights into the strategies used by related group II introns to adapt successfully for the colonisation of a bacterial genome

    PubMed Central

    Martínez-Rodríguez, Laura; García-Rodríguez, Fernando M; Molina-Sánchez, María Dolores; Toro, Nicolás; Martínez-Abarca, Francisco

    2014-01-01

    Group II introns are self-splicing RNAs and site-specific mobile retroelements found in bacterial and organellar genomes. The group II intron RmInt1 is present at high copy number in Sinorhizobium meliloti species, and has a multifunctional intron-encoded protein (IEP) with reverse transcriptase/maturase activities, but lacking the DNA-binding and endonuclease domains. We characterized two RmInt1-related group II introns RmInt2 from S. meliloti strain GR4 and Sr.md.I1 from S. medicae strain WSM419 in terms of splicing and mobility activities. We used both wild-type and engineered intron-donor constructs based on ribozyme ΔORF-coding sequence derivatives, and we determined the DNA target requirements for RmInt2, the element most distantly related to RmInt1. The excision and mobility patterns of intron-donor constructs expressing different combinations of IEP and intron RNA provided experimental evidence for the co-operation of IEPs and intron RNAs from related elements in intron splicing and, in some cases, in intron homing. We were also able to identify the DNA target regions recognized by these IEPs lacking the DNA endonuclease domain. Our results provide new insight into the versatility of related group II introns and the possible co-operation between these elements to facilitate the colonization of bacterial genomes. PMID:25482895

  14. Insights into the strategies used by related group II introns to adapt successfully for the colonisation of a bacterial genome.

    PubMed

    Martínez-Rodríguez, Laura; García-Rodríguez, Fernando M; Molina-Sánchez, María Dolores; Toro, Nicolás; Martínez-Abarca, Francisco

    2014-01-01

    Group II introns are self-splicing RNAs and site-specific mobile retroelements found in bacterial and organellar genomes. The group II intron RmInt1 is present at high copy number in Sinorhizobium meliloti species, and has a multifunctional intron-encoded protein (IEP) with reverse transcriptase/maturase activities, but lacking the DNA-binding and endonuclease domains. We characterized two RmInt1-related group II introns RmInt2 from S. meliloti strain GR4 and Sr.md.I1 from S. medicae strain WSM419 in terms of splicing and mobility activities. We used both wild-type and engineered intron-donor constructs based on ribozyme ΔORF-coding sequence derivatives, and we determined the DNA target requirements for RmInt2, the element most distantly related to RmInt1. The excision and mobility patterns of intron-donor constructs expressing different combinations of IEP and intron RNA provided experimental evidence for the co-operation of IEPs and intron RNAs from related elements in intron splicing and, in some cases, in intron homing. We were also able to identify the DNA target regions recognized by these IEPs lacking the DNA endonuclease domain. Our results provide new insight into the versatility of related group II introns and the possible co-operation between these elements to facilitate the colonization of bacterial genomes.

  15. Mobility Effect on Poroelastic Seismic Signatures in Partially Saturated Rocks With Applications in Time-Lapse Monitoring of a Heavy Oil Reservoir

    NASA Astrophysics Data System (ADS)

    Zhao, Luanxiao; Yuan, Hemin; Yang, Jingkang; Han, De-hua; Geng, Jianhua; Zhou, Rui; Li, Hui; Yao, Qiuliang

    2017-11-01

    Conventional seismic analysis in partially saturated rocks normally lays emphasis on estimating pore fluid content and saturation, typically ignoring the effect of mobility, which decides the ability of fluids moving in the porous rocks. Deformation resulting from a seismic wave in heterogeneous partially saturated media can cause pore fluid pressure relaxation at mesoscopic scale, thereby making the fluid mobility inherently associated with poroelastic reflectivity. For two typical gas-brine reservoir models, with the given rock and fluid properties, the numerical analysis suggests that variations of patchy fluid saturation, fluid compressibility contrast, and acoustic stiffness of rock frame collectively affect the seismic reflection dependence on mobility. In particular, the realistic compressibility contrast of fluid patches in shallow and deep reservoir environments plays an important role in determining the reflection sensitivity to mobility. We also use a time-lapse seismic data set from a Steam-Assisted Gravity Drainage producing heavy oil reservoir to demonstrate that mobility change coupled with patchy saturation possibly leads to seismic spectral energy shifting from the baseline to monitor line. Our workflow starts from performing seismic spectral analysis on the targeted reflectivity interface. Then, on the basis of mesoscopic fluid pressure diffusion between patches of steam and heavy oil, poroelastic reflectivity modeling is conducted to understand the shift of the central frequency toward low frequencies after the steam injection. The presented results open the possibility of monitoring mobility change of a partially saturated geological formation from dissipation-related seismic attributes.

  16. Fueling and Stabilizing a Biomolecular Motor-Powered Biosensor for Remote Detection Scenarios

    DTIC Science & Technology

    2007-10-01

    streptavidin, cyclodextrin host - guest 0 , malachite green - aptamer", DNA - DNA12, and antibody - antigen . Using functionalized microtubules gliding on...3), 646-648 (2005). 11 Hirabayashi, M. et al. Malachite green-conjugated microtubules as mobile bioprobes selective for malachite green aptamers with

  17. Effect of structure on sensing performance of a target induced signaling probe shifting DNA-based (TISPS-DNA) sensor.

    PubMed

    Yu, Xiang; Yu, Zhigang; Li, Fengqin; Xu, Yanmei; He, Xunjun; Xu, Lan; Shi, Wenbing; Zhang, Guiling; Yan, Hong

    2017-05-15

    A type of "signal on" displacement-based sensors named target induced signaling probe shifting DNA-based (TISPS-DNA) sensor were developed for a designated DNA detection. The signaling mechanism of the signaling probe (SP) shifting different from the classical conformation/flexibility change mode endows the sensor with high sensitivity. Through using thiolated or no thiolated capturing probe (CP), two 3-probe sensing structures, sensor-1 and sensor-2, were designed and constructed. The systematical comparing research results show that both sensors exhibit some similarities or big differences in sensing performance. On the one hand, the similarity in structures determines the similarity in some aspects of signaling mechanism, background signal, signal changing form, anti-fouling ability and versatility; on the other hand, the slight difference in structures also results in two opposite hybridization modes of gradual increasing resistance and gradual decreasing resistance which can affect the hybridization efficiency between the assistant probe (AP) and the SP, further producing some big differences in sensing performance, for example, apparently different signal enhancement (SE) change, point mutation discrimination ability and response speed. Under the optimized fabrication and detection conditions, both sensors feature high sensitivity for target DNAs with the detection limits of ∼10 fM for sensor-1 and ∼7 fM for sensor-2, respectively. Among many acquired sensing virtues, the sensor-1 shows a peculiar specificity adjustability which is also a highlight in this work. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. DNA complexes with dyes designed for energy transfer as fluorescent markers

    DOEpatents

    Glazer, Alexander M.; Benson, Scott C.

    1999-01-01

    Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated.

  19. DNA complexes with dyes designed for energy transfer as fluorescent markers

    DOEpatents

    Glazer, Alexander M.; Benson, Scott C.

    1998-01-01

    Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated.

  20. DNA complexes with dyes designed for energy transfer as fluorescent markers

    DOEpatents

    Glazer, Alexander N.; Benson, Scott C.

    1995-01-01

    Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated.

  1. DNA complexes with dyes designed for energy transfer as fluorescent markers

    DOEpatents

    Glazer, Alexander N.; Benson, Scott C.

    1997-01-01

    Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated.

  2. Activation of the Early B-Cell-Specific mb-1 (Ig-α) Gene by Pax-5 Is Dependent on an Unmethylated Ets Binding Site

    PubMed Central

    Maier, Holly; Colbert, Jeff; Fitzsimmons, Daniel; Clark, Dawn R.; Hagman, James

    2003-01-01

    Methylation of cytosine in CpG dinucleotides promotes transcriptional repression in mammals by blocking transcription factor binding and recruiting methyl-binding proteins that initiate chromatin remodeling. Here, we use a novel cell-based system to show that retrovirally expressed Pax-5 protein activates endogenous early B-cell-specific mb-1 genes in plasmacytoma cells, but only when the promoter is hypomethylated. CpG methylation does not directly affect binding of the promoter by Pax-5. Instead, methylation of an adjacent CpG interferes with assembly of ternary complexes comprising Pax-5 and Ets proteins. In electrophoretic mobility shift assays, recruitment of Ets-1 is blocked by methylation of the Ets site (5′CCGGAG) on the antisense strand. In transfection assays, selective methylation of a single CpG within the Pax-5-dependent Ets site greatly reduces mb-1 promoter activity. Prior demethylation of the endogenous mb-1 promoter is required for its activation by Pax-5 in transduced cells. Although B-lineage cells have only unmethylated mb-1 genes and do not modulate methylation of the mb-1 promoter during development, other tissues feature high percentages of methylated alleles. Together, these studies demonstrate a novel DNA methylation-dependent mechanism for regulating transcriptional activity through the inhibition of DNA-dependent protein-protein interactions. PMID:12612069

  3. Advanced purification strategy for CueR, a cysteine containing copper(I) and DNA binding protein.

    PubMed

    Balogh, Ria K; Gyurcsik, Béla; Hunyadi-Gulyás, Éva; Christensen, Hans E M; Jancsó, Attila

    2016-07-01

    Metal ion regulation is essential for living organisms. In prokaryotes metal ion dependent transcriptional factors, the so-called metalloregulatory proteins play a fundamental role in controlling the concentration of metal ions. These proteins recognize metal ions with an outstanding selectivity. A detailed understanding of their function may be exploited in potential health, environmental and analytical applications. Members of the MerR protein family sense a broad range of mostly late transition and heavy metal ions through their cysteine thiolates. The air sensitivity of latter groups makes the expression and purification of such proteins challenging. Here we describe a method for the purification of the copper-regulatory CueR protein under optimized conditions. In order to avoid protein precipitation and/or eventual aggregation and to get rid of the co-purifying Escherichia coli elongation factor, our procedure consisted of four steps supplemented by DNA digestion. Subsequent anion exchange on Sepharose FF Q 16/10, affinity chromatography on Heparin FF 16/10, second anion exchange on Source 30 Q 16/13 and gel filtration on Superdex 75 26/60 resulted in large amounts of pure CueR protein without any affinity tag. Structure and functionality tests performed with mass spectrometry, circular dichroism spectroscopy and electrophoretic gel mobility shift assays approved the success of the purification procedure. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Core-binding factor beta interacts with Runx2 and is required for skeletal development.

    PubMed

    Yoshida, Carolina A; Furuichi, Tatsuya; Fujita, Takashi; Fukuyama, Ryo; Kanatani, Naoko; Kobayashi, Shinji; Satake, Masanobu; Takada, Kenji; Komori, Toshihisa

    2002-12-01

    Core-binding factor beta (CBFbeta, also called polyomavirus enhancer binding protein 2beta (PEBP2B)) is associated with an inversion of chromosome 16 and is associated with acute myeloid leukemia in humans. CBFbeta forms a heterodimer with RUNX1 (runt-related transcription factor 1), which has a DNA binding domain homologous to the pair-rule protein runt in Drosophila melanogaster. Both RUNX1 and CBFbeta are essential for hematopoiesis. Haploinsufficiency of another runt-related protein, RUNX2 (also called CBFA1), causes cleidocranial dysplasia in humans and is essential in skeletal development by regulating osteoblast differentiation and chondrocyte maturation. Mice deficient in Cbfb (Cbfb(-/-)) die at midgestation, so the function of Cbfbeta in skeletal development has yet to be ascertained. To investigate this issue, we rescued hematopoiesis of Cbfb(-/-) mice by introducing Cbfb using the Gata1 promoter. The rescued Cbfb(-/-) mice recapitulated fetal liver hematopoiesis in erythroid and megakaryocytic lineages and survived until birth, but showed severely delayed bone formation. Although mesenchymal cells differentiated into immature osteoblasts, intramembranous bones were poorly formed. The maturation of chondrocytes into hypertrophic cells was markedly delayed, and no endochondral bones were formed. Electrophoretic mobility shift assays and reporter assays showed that Cbfbeta was necessary for the efficient DNA binding of Runx2 and for Runx2-dependent transcriptional activation. These findings indicate that Cbfbeta is required for the function of Runx2 in skeletal development.

  5. Role of nuclear factor of activated T-cells and activator protein-1 in the inhibition of interleukin-2 gene transcription by cannabinol in EL4 T-cells.

    PubMed

    Yea, S S; Yang, K H; Kaminski, N E

    2000-02-01

    We previously reported that immunosuppressive cannabinoids inhibited interleukin (IL)-2 steady-state mRNA expression and secretion by phorbol-12-myristate-13-acetate plus ionomycin-activated mouse splenocytes and EL4 murine T-cells. Here we show that inhibition of IL-2 production by cannabinol, a modest central nervous system-active cannabinoid, is mediated through the inhibition of IL-2 gene transcription. Moreover, electrophoretic mobility shift assays demonstrated that cannabinol markedly inhibited the DNA binding activity of nuclear factor of activated T-cells (NF-AT) and activator protein-1 (AP-1) in a time- and concentration-dependent manner in activated EL4 cells. The inhibitory effects produced by cannabinol on AP-1 DNA binding were quite transient, showing partial recovery by 240 min after cell activation and no effect on the activity of a reporter gene under the control of AP-1. Conversely, cannabinol-mediated inhibition of NF-AT was robust and sustained as demonstrated by an NF-AT-regulated reporter gene. Collectively, these results suggest that decreased IL-2 production by cannabinol in EL4 cells is due to the inhibition of transcriptional activation of the IL-2 gene and is mediated, at least in part, through a transient inhibition of AP-1 and a sustained inhibition of NF-AT.

  6. Profiles of embryonic nuclear protein binding to the proximal promoter region of the soybean β-conglycinin α subunit gene.

    PubMed

    Yoshino, M; Tsutsumi, K; Kanazawa, A

    2015-01-01

    β-Conglycinin, a major component of seed storage protein in soybean, comprises three subunits: α, α' and β. The expression of genes for these subunits is strictly controlled during embryogenesis. The proximal promoter region up to 245 bp upstream of the transcription start site of the α subunit gene sufficiently confers spatial and temporal control of transcription in embryos. Here, the binding profile of nuclear proteins in the proximal promoter region of the α subunit gene was analysed. DNase I footprinting analysis indicated binding of proteins to the RY element and DNA regions including box I, a region conserved in cognate gene promoters. An electrophoretic mobility shift assay (EMSA) using different portions of box I as a probe revealed that multiple portions of box I bind to nuclear proteins. In addition, an EMSA using nuclear proteins extracted from embryos at different developmental stages indicated that the levels of major DNA-protein complexes on box I increased during embryo maturation. These results are consistent with the notion that box I is important for the transcriptional control of seed storage protein genes. Furthermore, the present data suggest that nuclear proteins bind to novel motifs in box I including 5'-TCAATT-3' rather than to predicted cis-regulatory elements. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

  7. The CcpA regulon of Streptococcus suis reveals novel insights into the regulation of the streptococcal central carbon metabolism by binding of CcpA to two distinct binding motifs.

    PubMed

    Willenborg, Jörg; de Greeff, Astrid; Jarek, Michael; Valentin-Weigand, Peter; Goethe, Ralph

    2014-04-01

    Streptococcus suis (S. suis) is a neglected zoonotic streptococcus causing fatal diseases in humans and in pigs. The transcriptional regulator CcpA (catabolite control protein A) is involved in the metabolic adaptation to different carbohydrate sources and virulence of S. suis and other pathogenic streptococci. In this study, we determined the DNA binding characteristics of CcpA and identified the CcpA regulon during growth of S. suis. Electrophoretic mobility shift analyses showed promiscuous DNA binding of CcpA to cognate cre sites in vitro. In contrast, sequencing of immunoprecipitated chromatin revealed two specific consensus motifs, a pseudo-palindromic cre motif (WWGAAARCGYTTTCWW) and a novel cre2 motif (TTTTYHWDHHWWTTTY), within the regulatory elements of the genes directly controlled by CcpA. Via these elements CcpA regulates expression of genes involved in carbohydrate uptake and conversion, and in addition in important metabolic pathways of the central carbon metabolism, like glycolysis, mixed-acid fermentation, and the fragmentary TCA cycle. Furthermore, our analyses provide evidence that CcpA regulates the genes of the central carbon metabolism by binding either the pseudo-palindromic cre motif or the cre2 motif in a HPr(Ser)∼P independent conformation. © 2014 John Wiley & Sons Ltd.

  8. Ex vivo adenoviral gene transfer of constitutively activated STAT3 reduces post-transplant liver injury and promotes regeneration in a 20% rat partial liver transplant model.

    PubMed

    Huda, Kamrul A S M; Guo, Lei; Haga, Sanae; Murata, Hiroshi; Ogino, Tetsuya; Fukai, Moto; Yagi, Takahito; Iwagaki, Hiromi; Tanaka, Noriaki; Ozaki, Michitaka

    2006-05-01

    Signal transducer and activator of transcription-3 (STAT3) is one of the most important transcription factors for liver regeneration. This study was designed to examine the effects of constitutively activated STAT3 (STAT3-C) on post-transplant liver injury and regeneration in a rat 20% partial liver transplant (PLTx) model by ex vivo adenoviral gene transfer. Adenovirus encoding the STAT3-C gene was introduced intraportally into liver grafts and clamped for 30 min during cold preservation. After orthotopic PLTx, liver graft/body weights and serum biochemistry were monitored, and both a histological study and DNA binding assay were performed. STAT3-C protein expression and its binding to DNA in the liver graft were confirmed by Western blotting and electrophoretic mobility shift assay (EMSA), respectively. This treatment modality promoted post-Tx liver regeneration effectively and rapidly. The serum levels of alanine aminotransferase/aspartate aminotransferase (AST/ALT) and bilirubin decreased in rats with STAT3-C. However, albumin (a marker of liver function) did not. Ex vivo gene transfer of STAT3-C to liver grafts reduced post-Tx injury and promoted liver regeneration. Thus, the activation of STAT3 in the liver graft may be a potentially effective clinical strategy for improving the outcome of small-for-size liver transplantation.

  9. Gliotoxin is a potent NOTCH2 transactivation inhibitor and efficiently induces apoptosis in chronic lymphocytic leukaemia (CLL) cells.

    PubMed

    Hubmann, Rainer; Hilgarth, Martin; Schnabl, Susanne; Ponath, Elena; Reiter, Marlies; Demirtas, Dita; Sieghart, Wolfgang; Valent, Peter; Zielinski, Christoph; Jäger, Ulrich; Shehata, Medhat

    2013-03-01

    Chronic lymphocytic leukaemia (CLL) cells express constitutively activated NOTCH2 in a protein kinase C (PKC)- dependent manner. The transcriptional activity of NOTCH2 correlates not only with the expression of its target gene FCER2 (CD23) but is also functionally linked with CLL cell viability. In the majority of CLL cases, DNA-bound NOTCH2 complexes are less sensitive to the γ-secretase inhibitor (GSI) DAPT. Therefore, we searched for compounds that interfere with NOTCH2 signalling at the transcription factor level. Using electrophoretic mobility shift assays (EMSA), we identified the Aspergillum-derived secondary metabolite gliotoxin as a potent NOTCH2 transactivation inhibitor. Gliotoxin completely blocked the formation of DNA-bound NOTCH2 complexes in CLL cells independent of their sensitivity to DAPT. The inhibition of NOTCH2 signalling by gliotoxin was associated with down regulation of CD23 (FCER) expression and induction of apoptosis. Short time exposure of CLL cells indicated that the early apoptotic effect of gliotoxin is independent of proteasome regulated nuclear factor κB activity, and is associated with up regulation of NOTCH3 and NR4A1 expression. Gliotoxin could overcome the supportive effect of primary bone marrow stromal cells in an ex vivo CLL microenvironment model. In conclusion, we identified gliotoxin as a potent NOTCH2 inhibitor with a promising therapeutic potential in CLL. © 2012 Blackwell Publishing Ltd.

  10. Petroleum contamination and bioaugmentation in bacterial rhizosphere communities from Avicennia schaueriana.

    PubMed

    Dealtry, Simone; Ghizelini, Angela Michelato; Mendonça-Hagler, Leda C S; Chaloub, Ricardo Moreira; Reinert, Fernanda; Campos, Tácio M P de; Gomes, Newton C M; Smalla, Kornelia

    2018-06-01

    Anthropogenic activity, such as accidental oil spills, are typical sources of urban mangrove pollution that may affect mangrove bacterial communities as well as their mobile genetic elements. To evaluate remediation strategies, we followed over the time the effects of a petroleum hydrocarbon degrading consortium inoculated on mangrove tree Avicennia schaueriana against artificial petroleum contamination in a phytoremediation greenhouse experiment. Interestingly, despite plant protection due to the inoculation, denaturing gradient gel electrophoresis of the bacterial 16S rRNA gene fragments amplified from the total community DNA indicated that the different treatments did not significantly affect the bacterial community composition. However, while the bacterial community was rather stable, pronounced shifts were observed in the abundance of bacteria carrying plasmids. A PCR-Southern blot hybridization analysis indicated an increase in the abundance of IncP-9 catabolic plasmids. Denaturing gradient gel electrophoresis of naphthalene dioxygenase (ndo) genes amplified from cDNA (RNA) indicated the dominance of a specific ndo gene in the inoculated petroleum amendment treatment. The petroleum hydrocarbon degrading consortium characterization indicated the prevalence of bacteria assigned to Pseudomonas spp., Comamonas spp. and Ochrobactrum spp. IncP-9 plasmids were detected for the first time in Comamonas sp. and Ochrobactrum spp., which is a novelty of this study. Copyright © 2018 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  11. Hypoxia inducible factor-1 mediates the expression of the immune checkpoint HLA-G in glioma cells through hypoxia response element located in exon 2

    PubMed Central

    Yaghi, Layale; Poras, Isabelle; Simoes, Renata T.; Donadi, Eduardo A.; Tost, Jörg; Daunay, Antoine; de Almeida, Bibiana Sgorla; Carosella, Edgardo D.; Moreau, Philippe

    2016-01-01

    HLA-G is an immune checkpoint molecule with specific relevance in cancer immunotherapy. It was first identified in cytotrophoblasts, protecting the fetus from maternal rejection. HLA-G tissue expression is very restricted but induced in numerous malignant tumors such as glioblastoma, contributing to their immune escape. Hypoxia occurs during placenta and tumor development and was shown to activate HLA-G. We aimed to elucidate the mechanisms of HLA-G activation under conditions combining hypoxia-mimicking treatment and 5-aza-2′deoxycytidine, a DNA demethylating agent used in anti-cancer therapy which also induces HLA-G. Both treatments enhanced the amount of HLA-G mRNA and protein in HLA-G negative U251MG glioma cells. Electrophoretic Mobility Shift Assays and luciferase reporter gene assays revealed that HLA-G upregulation depends on Hypoxia Inducible Factor-1 (HIF-1) and a hypoxia responsive element (HRE) located in exon 2. A polymorphic HRE at −966 bp in the 5′UT region may modulate the magnitude of the response mediated by the exon 2 HRE. We suggest that therapeutic strategies should take into account that HLA-G expression in response to hypoxic tumor environment is dependent on HLA-G gene polymorphism and DNA methylation state at the HLA-G locus. PMID:27577073

  12. Sound Change and Mobility in Los Angeles

    ERIC Educational Resources Information Center

    Johnson, Lawrence

    1975-01-01

    Deals with the shift of the low-back vowel as in 'caught' to a low-central vowel as in 'cot' thereby merging such pairs as caught/cot, dawn/Don, and stalk/stock. The causes and the sociolinguistic implications of this shift are discussed. The majority of the informants were from West Los Angeles. (TL)

  13. Robust multiperson detection and tracking for mobile service and social robots.

    PubMed

    Li, Liyuan; Yan, Shuicheng; Yu, Xinguo; Tan, Yeow Kee; Li, Haizhou

    2012-10-01

    This paper proposes an efficient system which integrates multiple vision models for robust multiperson detection and tracking for mobile service and social robots in public environments. The core technique is a novel maximum likelihood (ML)-based algorithm which combines the multimodel detections in mean-shift tracking. First, a likelihood probability which integrates detections and similarity to local appearance is defined. Then, an expectation-maximization (EM)-like mean-shift algorithm is derived under the ML framework. In each iteration, the E-step estimates the associations to the detections, and the M-step locates the new position according to the ML criterion. To be robust to the complex crowded scenarios for multiperson tracking, an improved sequential strategy to perform the mean-shift tracking is proposed. Under this strategy, human objects are tracked sequentially according to their priority order. To balance the efficiency and robustness for real-time performance, at each stage, the first two objects from the list of the priority order are tested, and the one with the higher score is selected. The proposed method has been successfully implemented on real-world service and social robots. The vision system integrates stereo-based and histograms-of-oriented-gradients-based human detections, occlusion reasoning, and sequential mean-shift tracking. Various examples to show the advantages and robustness of the proposed system for multiperson tracking from mobile robots are presented. Quantitative evaluations on the performance of multiperson tracking are also performed. Experimental results indicate that significant improvements have been achieved by using the proposed method.

  14. Reconstructing the complex evolutionary history of mobile plasmids in red algal genomes

    PubMed Central

    Lee, JunMo; Kim, Kyeong Mi; Yang, Eun Chan; Miller, Kathy Ann; Boo, Sung Min; Bhattacharya, Debashish; Yoon, Hwan Su

    2016-01-01

    The integration of foreign DNA into algal and plant plastid genomes is a rare event, with only a few known examples of horizontal gene transfer (HGT). Plasmids, which are well-studied drivers of HGT in prokaryotes, have been reported previously in red algae (Rhodophyta). However, the distribution of these mobile DNA elements and their sites of integration into the plastid (ptDNA), mitochondrial (mtDNA), and nuclear genomes of Rhodophyta remain unknown. Here we reconstructed the complex evolutionary history of plasmid-derived DNAs in red algae. Comparative analysis of 21 rhodophyte ptDNAs, including new genome data for 5 species, turned up 22 plasmid-derived open reading frames (ORFs) that showed syntenic and copy number variation among species, but were conserved within different individuals in three lineages. Several plasmid-derived homologs were found not only in ptDNA but also in mtDNA and in the nuclear genome of green plants, stramenopiles, and rhizarians. Phylogenetic and plasmid-derived ORF analyses showed that the majority of plasmid DNAs originated within red algae, whereas others were derived from cyanobacteria, other bacteria, and viruses. Our results elucidate the evolution of plasmid DNAs in red algae and suggest that they spread as parasitic genetic elements. This hypothesis is consistent with their sporadic distribution within Rhodophyta. PMID:27030297

  15. Diepoxybutane Interstrand Cross-Links Induce DNA Bending

    PubMed Central

    Millard, Julie T.; McGowan, Erin E.; Bradley, Sharonda Q.

    2011-01-01

    The bifunctional alkylating agent 1,2,3,4-diepoxybutane (DEB) is thought to be a major contributor to the carcinogenicity of 1,3-butadiene, from which it is derived in vivo. DEB forms DNA interstrand cross-links primarily between distal deoxyguanosine residues at the duplex sequence 5’-GNC. In order for the short butanediol tether to span this distance, distortion of the DNA target has been postulated. We determined that the electrophoretic mobility of ligated DNA oligomers containing DEB cross-links was retarded in comparison with control, uncross-linked DNA. Our data are consistent with DNA bending of ~34° per lesion towards the major groove. PMID:21839139

  16. Policy 2.0 Platform for Mobile Sensing and Incentivized Targeted Shifts in Mobility Behavior

    PubMed Central

    Semanjski, Ivana; Lopez Aguirre, Angel Javier; De Mol, Johan; Gautama, Sidharta

    2016-01-01

    Sustainable mobility and smart mobility management play important roles in achieving smart cities’ goals. In this context we investigate the role of smartphones as mobility behavior sensors and evaluate the responsivity of different attitudinal profiles towards personalized route suggestion incentives delivered via mobile phones. The empirical results are based on mobile sensed data collected from more than 3400 people’s real life over a period of six months. The findings show which user profiles are most likely to accept such incentives and how likely they are to result in more sustainable mode choices. In addition we provide insights into tendencies towards accepting more sustainable route options for different trip purposes and illustrate smart city platform potential (for collection of mobility behavior data and delivery of incentives) as a tool for development of personalized mobility management campaigns and policies. PMID:27399700

  17. Energy band gap and optical transition of metal ion modified double crossover DNA lattices.

    PubMed

    Dugasani, Sreekantha Reddy; Ha, Taewoo; Gnapareddy, Bramaramba; Choi, Kyujin; Lee, Junwye; Kim, Byeonghoon; Kim, Jae Hoon; Park, Sung Ha

    2014-10-22

    We report on the energy band gap and optical transition of a series of divalent metal ion (Cu(2+), Ni(2+), Zn(2+), and Co(2+)) modified DNA (M-DNA) double crossover (DX) lattices fabricated on fused silica by the substrate-assisted growth (SAG) method. We demonstrate how the degree of coverage of the DX lattices is influenced by the DX monomer concentration and also analyze the band gaps of the M-DNA lattices. The energy band gap of the M-DNA, between the lowest unoccupied molecular orbital (LUMO) and the highest occupied molecular orbital (HOMO), ranges from 4.67 to 4.98 eV as judged by optical transitions. Relative to the band gap of a pristine DNA molecule (4.69 eV), the band gap of the M-DNA lattices increases with metal ion doping up to a critical concentration and then decreases with further doping. Interestingly, except for the case of Ni(2+), the onset of the second absorption band shifts to a lower energy until a critical concentration and then shifts to a higher energy with further increasing the metal ion concentration, which is consistent with the evolution of electrical transport characteristics. Our results show that controllable metal ion doping is an effective method to tune the band gap energy of DNA-based nanostructures.

  18. Energy barriers and rates of tautomeric transitions in DNA bases: ab initio quantum chemical study.

    PubMed

    Basu, Soumalee; Majumdar, Rabi; Das, Gourab K; Bhattacharyya, Dhananjay

    2005-12-01

    Tautomeric transitions of DNA bases are proton transfer reactions, which are important in biology. These reactions are involved in spontaneous point mutations of the genetic material. In the present study, intrinsic reaction coordinates (IRC) analyses through ab initio quantum chemical calculations have been carried out for the individual DNA bases A, T, G, C and also A:T and G:C base pairs to estimate the kinetic and thermodynamic barriers using MP2/6-31G** method for tautomeric transitions. Relatively higher values of kinetic barriers (about 50-60 kcal/mol) have been observed for the single bases, indicating that tautomeric alterations of isolated single bases are quite unlikely. On the other hand, relatively lower values of the kinetic barriers (about 20-25 kcal/mol) for the DNA base pairs A:T and G:C clearly suggest that the tautomeric shifts are much more favorable in DNA base pairs than in isolated single bases. The unusual base pairing A':C, T':G, C':A or G':T in the daughter DNA molecule, resulting from a parent DNA molecule with tautomeric shifts, is found to be stable enough to result in a mutation. The transition rate constants for the single DNA bases in addition to the base pairs are also calculated by computing the free energy differences between the transition states and the reactants.

  19. Controlling the surface‐mediated release of DNA using ‘mixed multilayers’

    PubMed Central

    Appadoo, Visham; Carter, Matthew C. D.

    2016-01-01

    Abstract We report the design of erodible ‘mixed multilayer’ coatings fabricated using plasmid DNA and combinations of both hydrolytically degradable and charge‐shifting cationic polymer building blocks. Films fabricated layer‐by‐layer using combinations of a model poly(β‐amino ester) (polymer 1) and a model charge‐shifting polymer (polymer 2) exhibited DNA release profiles that were substantially different than those assembled using DNA and either polymer 1 or polymer 2 alone. In addition, the order in which layers of these two cationic polymers were deposited during assembly had a profound impact on DNA release profiles when these materials were incubated in physiological buffer. Mixed multilayers ∼225 nm thick fabricated by depositing layers of polymer 1/DNA onto films composed of polymer 2/DNA released DNA into solution over ∼60 days, with multi‐phase release profiles intermediate to and exhibiting some general features of polymer 1/DNA or polymer 2/DNA films (e.g., a period of rapid release, followed by a more extended phase). In sharp contrast, ‘inverted’ mixed multilayers fabricated by depositing layers of polymer 2/DNA onto films composed of polymer 1/DNA exhibited release profiles that were almost completely linear over ∼60‐80 days. These and other results are consistent with substantial interdiffusion and commingling (or mixing) among the individual components of these compound materials. Our results reveal this mixing to lead to new, unanticipated, and useful release profiles and provide guidance for the design of polymer‐based coatings for the local, surface‐mediated delivery of DNA from the surfaces of topologically complex interventional devices, such as intravascular stents, with predictable long‐term release profiles. PMID:27981243

  20. NMR and enzymology of modified DNA/protein interactions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kennedy, M.A.

    1994-12-31

    We have found distinct DNA structure and base dynamics precisely at the TpA cleavage site in the TTTAAA AHA III endonuclease restriction sequence. Hence, the unusual base stacking and mobility found in this sequence may be important to the mechanism of enzymatic cleavage of the phophodiester bond.

  1. Voltammetric Behavior of o-Nitrophenol and Damage to DNA

    PubMed Central

    Zhang, Da-Peng; Wu, Wei-Li; Long, Hai-Yan; Liu, Yun-Chun; Yang, Zhou-Sheng

    2008-01-01

    The electrochemical behavior of o-nitrophenol was studied in detail with a glassy carbon electrode (GCE). The dependence of peak potential on pH indicated that equivalent electrons and protons were involved in the process of o-nitrophenol reduction. The interaction of o-nitrophenol with calf thymus DNA was investigated by adding DNA to the o-nitrophenol solution and by immobilizing DNA on GCE, respectively. The peak current decrement and peak potential shift in presence of DNA indicated that o-nitrophenol could interact with DNA. The result was demonstrated that the in situ DNA damage was detected by differential pulse voltammetry after the o-nitrophenol was electrochemically reduced. PMID:19325751

  2. Plasmid replication initiator RepB forms a hexamer reminiscent of ring helicases and has mobile nuclease domains

    PubMed Central

    Boer, D Roeland; Ruíz-Masó, José A; López-Blanco, José R; Blanco, Alexander G; Vives-Llàcer, Mireia; Chacón, Pablo; Usón, Isabel; Gomis-Rüth, F Xavier; Espinosa, Manuel; Llorca, Oscar; del Solar, Gloria; Coll, Miquel

    2009-01-01

    RepB initiates plasmid rolling-circle replication by binding to a triple 11-bp direct repeat (bind locus) and cleaving the DNA at a specific distant site located in a hairpin loop within the nic locus of the origin. The structure of native full-length RepB reveals a hexameric ring molecule, where each protomer has two domains. The origin-binding and catalytic domains show a three-layer α–β–α sandwich fold. The active site is positioned at one of the faces of the β-sheet and coordinates a Mn2+ ion at short distance from the essential nucleophilic Y99. The oligomerization domains (ODs), each consisting of four α-helices, together define a compact ring with a central channel, a feature found in ring helicases. The toroidal arrangement of RepB suggests that, similar to ring helicases, it encircles one of the DNA strands during replication to confer processivity to the replisome complex. The catalytic domains appear to be highly mobile with respect to ODs. This mobility may account for the adaptation of the protein to two distinct DNA recognition sites. PMID:19440202

  3. A differential mobility spectrometry/mass spectrometry platform for the rapid detection and quantitation of DNA adduct dG-ABP.

    PubMed

    Kafle, Amol; Klaene, Joshua; Hall, Adam B; Glick, James; Coy, Stephen L; Vouros, Paul

    2013-07-15

    There is continued interest in exploring new analytical technologies for the detection and quantitation of DNA adducts, biomarkers which provide direct evidence of exposure and genetic damage in cells. With the goal of reducing clean-up steps and improving sample throughput, a Differential Mobility Spectrometry/Mass Spectrometry (DMS/MS) platform has been introduced for adduct analysis. A DMS/MS platform has been utilized for the analysis of dG-ABP, the deoxyguanosine adduct of the bladder carcinogen 4-aminobiphenyl (4-ABP). After optimization of the DMS parameters, each sample was analyzed in just 30 s following a simple protein precipitation step of the digested DNA. A detection limit of one modification in 10^6 nucleosides has been achieved using only 2 µg of DNA. A brief comparison (quantitative and qualitative) with liquid chromatography/mass spectrometry is also presented highlighting the advantages of using the DMS/MS method as a high-throughput platform. The data presented demonstrate the successful application of a DMS/MS/MS platform for the rapid quantitation of DNA adducts using, as a model analyte, the deoxyguanosine adduct of the bladder carcinogen 4-aminobiphenyl. Copyright © 2013 John Wiley & Sons, Ltd.

  4. Using mobile sequencers in an academic classroom

    PubMed Central

    Zaaijer, Sophie; Erlich, Yaniv

    2016-01-01

    The advent of mobile DNA sequencers has made it possible to generate DNA sequencing data outside of laboratories and genome centers. Here, we report our experience of using the MinION, a mobile sequencer, in a 13-week academic course for undergraduate and graduate students. The course consisted of theoretical sessions that presented fundamental topics in genomics and several applied hackathon sessions. In these hackathons, the students used MinION sequencers to generate and analyze their own data and gain hands-on experience in the topics discussed in the theoretical classes. The manuscript describes the structure of our class, the educational material, and the lessons we learned in the process. We hope that the knowledge and material presented here will provide the community with useful tools to help educate future generations of genome scientists. DOI: http://dx.doi.org/10.7554/eLife.14258.001 PMID:27054412

  5. Analysis of the Genotoxic Effects of Mobile Phone Radiation using Buccal Micronucleus Assay: A Comparative Evaluation.

    PubMed

    Banerjee, Sumita; Singh, Narendra Nath; Sreedhar, Gadiputi; Mukherjee, Saikat

    2016-03-01

    Micronucleus (MN) is considered to be a reliable marker for genotoxic damage and it determines the presence and the extent of the chromosomal damage. The MN is formed due to DNA damage or chromosomal disarrangements. The MN has a close association with cancer incidences. In the new era, mobile phones are constantly gaining popularity specifically in the young generation, but this device uses radiofrequency radiation that may have a possible carcinogenic effect. The available reports related to the carcinogenic effect of mobile radiation on oral mucosa are contradictory. To explore the effects of mobile phone radiation on the MN frequency in oral mucosal cells. The subjects were divided into two major groups: low mobile phone users and high mobile phone users. Subjects who used their mobile phone since less than five years and less than three hours a week comprised of the first group and those who used their mobile since more than five years and more than 10 hours a week comprised of the second group. Net surfing and text messaging was not considered in this study. Exfoliated buccal mucosal cells were collected from both the groups and the cells were stained with DNA-specific stain acridine orange. Thousand exfoliated buccal mucosal cells were screened and the cells which were positive for micronuclei were counted. The micronucleus frequency was represented as mean±SD, and unpaired Student t-test was used for intergroup comparisons. The number of micronucleated cells/ 1000 exfoliated buccal mucosal cells was found to be significantly increased in high mobile phone users group than the low mobile phone users group. The use of mobile phone with the associated complaint of warmth around the ear showed a maximum increase in the number of micronucleated cells /1000 exfoliated buccal mucosal cells. Mobile phone radiation even in the permissible range when used for longer duration causes significant genotoxicity. The genotoxicity can be avoided to some extent by the regular use of headphones.

  6. A Seamless Learning Design for Mobile Assisted Language Learning: An Iranian Context

    ERIC Educational Resources Information Center

    Foomani, Elham Mohammadi; Hedayati, Mohsen

    2016-01-01

    Recent developments in information communication technology (ICT) have resulted in a paradigm shift in e-Learning and there is a growing interest in developing design-based research (DBR) focusing on learners and their involvement in knowledge sharing in a contextualized mode. The present study reports a mobile-assisted language learning (MALL)…

  7. DNA complexes with dyes designed for energy transfer as fluorescent markers

    DOEpatents

    Glazer, A.N.; Benson, S.C.

    1997-07-08

    Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated. 4 figs.

  8. DNA complexes with dyes designed for energy transfer as fluorescent markers

    DOEpatents

    Glazer, A.M.; Benson, S.C.

    1998-06-16

    Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated. 4 figs.

  9. DNA complexes with dyes designed for energy transfer as fluorescent markers

    DOEpatents

    Glazer, A.N.; Benson, S.C.

    1995-03-28

    Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated. 4 figures.

  10. From teaching to learning in a mobile, wireless world.

    PubMed

    Billings, Diane M

    2005-08-01

    What research evidence justifies this shift from teaching to learning in the mobile, wireless world? We do not need evidence to answer questions such as, "Will the mobile, wireless device technology support teaching and learning?" (we already know it will), or "Will distance learning with mobile, wireless devices be as effective as that in the classroom?" (abundant evidence indicates there will be no significant differences). However, we do need to know, "How can we use these learning technologies to improve student learning and the outcomes of our academic programs?" Answers to this question will ultimately help educators prepare students to deliver safe and competent patient care in the mobile, wireless world.

  11. Solution structure and interactions of the Escherichia coli cell division activator protein CedA.

    PubMed

    Chen, Ho An; Simpson, Peter; Huyton, Trevor; Roper, David; Matthews, Stephen

    2005-05-10

    CedA is a protein that is postulated to be involved in the regulation of cell division in Escherichia coli and related organisms; however, little biological data about its possible mode of action are available. Here we present a three-dimensional structure of this protein as determined by NMR spectroscopy. The protein is made up of four antiparallel beta-strands, an alpha-helix, and a large unstructured stretch of residues at the N-terminus. It shows structural similarity to a family of DNA-binding proteins which interact with dsDNA via a three-stranded beta-sheet, suggesting that CedA may be a DNA-binding protein. The putative binding surface of CedA is predominantly positively charged with a number of basic residues surrounding a groove largely dominated by aromatic residues. NMR chemical shift perturbations and gel-shift experiments performed with CedA confirm that the protein binds dsDNA, and its interaction is mediated primarily via the beta-sheet.

  12. Sequencing the extrachromosomal circular mobilome reveals retrotransposon activity in plants

    PubMed Central

    Llauro, Christel; Jobet, Edouard; Robakowska-Hyzorek, Dagmara; Lasserre, Eric; Ghesquière, Alain; Panaud, Olivier

    2017-01-01

    Retrotransposons are mobile genetic elements abundant in plant and animal genomes. While efficiently silenced by the epigenetic machinery, they can be reactivated upon stress or during development. Their level of transcription not reflecting their transposition ability, it is thus difficult to evaluate their contribution to the active mobilome. Here we applied a simple methodology based on the high throughput sequencing of extrachromosomal circular DNA (eccDNA) forms of active retrotransposons to characterize the repertoire of mobile retrotransposons in plants. This method successfully identified known active retrotransposons in both Arabidopsis and rice material where the epigenome is destabilized. When applying mobilome-seq to developmental stages in wild type rice, we identified PopRice as a highly active retrotransposon producing eccDNA forms in the wild type endosperm. The mobilome-seq strategy opens new routes for the characterization of a yet unexplored fraction of plant genomes. PMID:28212378

  13. Sequencing the extrachromosomal circular mobilome reveals retrotransposon activity in plants.

    PubMed

    Lanciano, Sophie; Carpentier, Marie-Christine; Llauro, Christel; Jobet, Edouard; Robakowska-Hyzorek, Dagmara; Lasserre, Eric; Ghesquière, Alain; Panaud, Olivier; Mirouze, Marie

    2017-02-01

    Retrotransposons are mobile genetic elements abundant in plant and animal genomes. While efficiently silenced by the epigenetic machinery, they can be reactivated upon stress or during development. Their level of transcription not reflecting their transposition ability, it is thus difficult to evaluate their contribution to the active mobilome. Here we applied a simple methodology based on the high throughput sequencing of extrachromosomal circular DNA (eccDNA) forms of active retrotransposons to characterize the repertoire of mobile retrotransposons in plants. This method successfully identified known active retrotransposons in both Arabidopsis and rice material where the epigenome is destabilized. When applying mobilome-seq to developmental stages in wild type rice, we identified PopRice as a highly active retrotransposon producing eccDNA forms in the wild type endosperm. The mobilome-seq strategy opens new routes for the characterization of a yet unexplored fraction of plant genomes.

  14. Implications of Shifting Technology in Education

    ERIC Educational Resources Information Center

    Holland, Janet; Holland, John

    2014-01-01

    This article examines the implications of shifting technology trends by looking at what we've lost or are losing, where we are, and where we need to go for making the needed transitions in knowledge and skills. Areas of growth within new media and the tech industry are good indicators of our growing interests in mobility, improved quality,…

  15. Elevational range shifts in four mountain ungulate species from the Swiss Alps

    Treesearch

    Ulf Büntgen; Lucie Greuter; Kurt Bollmann; Hannes Jenny; Andrew Liebhold; J. Diego Galván; Nils C. Stenseth; Carrie Andrew; Atle Mysterud

    2017-01-01

    Warming-induced range shifts along elevational and latitudinal gradients have been observed in several species from various taxa. The mobility and behavioral plasticity of large endothermic mammals, however, complicate the detection of climatic effects on their spatial distributions. Here, we analyzed 230,565 hunting locations of the four most abundant ungulate species...

  16. Preferential association of a functional variant in complement receptor 2 with antibodies to double-stranded DNA

    PubMed Central

    Zhao, Jian; Giles, Brendan M; Taylor, Rhonda L; Yette, Gabriel A; Lough, Kara M; Ng, Han Leng; Abraham, Lawrence J; Wu, Hui; Kelly, Jennifer A; Glenn, Stuart B; Adler, Adam J; Williams, Adrienne H; Comeau, Mary E; Ziegler, Julie T; Marion, Miranda; Alarcón-Riquelme, Marta E; Alarcón, Graciela S; Anaya, Juan-Manuel; Bae, Sang-Cheol; Kim, Dam; Lee, Hye-Soon; Criswell, Lindsey A; Freedman, Barry I; Gilkeson, Gary S; Guthridge, Joel M; Jacob, Chaim O; James, Judith A; Kamen, Diane L; Merrill, Joan T; Sivils, Kathy Moser; Niewold, Timothy B; Petri, Michelle A; Ramsey-Goldman, Rosalind; Reveille, John D; Scofield, R Hal; Stevens, Anne M; Vilá, Luis M; Vyse, Timothy J; Kaufman, Kenneth M; Harley, John B; Langefeld, Carl D; Gaffney, Patrick M; Brown, Elizabeth E; Edberg, Jeffrey C; Kimberly, Robert P; Ulgiati, Daniela; Tsao, Betty P; Boackle, Susan A

    2016-01-01

    Objectives Systemic lupus erythematosus (SLE; OMIM 152700) is characterised by the production of antibodies to nuclear antigens. We previously identified variants in complement receptor 2 (CR2/CD21) that were associated with decreased risk of SLE. This study aimed to identify the causal variant for this association. Methods Genotyped and imputed genetic variants spanning CR2 were assessed for association with SLE in 15 750 case-control subjects from four ancestral groups. Allele-specific functional effects of associated variants were determined using quantitative real-time PCR, quantitative flow cytometry, electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP)-PCR. Results The strongest association signal was detected at rs1876453 in intron 1 of CR2 (pmeta=4.2×10−4, OR 0.85), specifically when subjects were stratified based on the presence of dsDNA autoantibodies (case-control pmeta=7.6×10−7, OR 0.71; case-only pmeta=1.9×10−4, OR 0.75). Although allele-specific effects on B cell CR2 mRNA or protein levels were not identified, levels of complement receptor 1 (CR1/CD35) mRNA and protein were significantly higher on B cells of subjects harbouring the minor allele (p=0.0248 and p=0.0006, respectively). The minor allele altered the formation of several DNA protein complexes by EMSA, including one containing CCCTC-binding factor (CTCF), an effect that was confirmed by ChIP-PCR. Conclusions These data suggest that rs1876453 in CR2 has long-range effects on gene regulation that decrease susceptibility to lupus. Since the minor allele at rs1876453 is preferentially associated with reduced risk of the highly specific dsDNA autoantibodies that are present in preclinical, active and severe lupus, understanding its mechanisms will have important therapeutic implications. PMID:25180293

  17. The contribution of alu elements to mutagenic DNA double-strand break repair.

    PubMed

    Morales, Maria E; White, Travis B; Streva, Vincent A; DeFreece, Cecily B; Hedges, Dale J; Deininger, Prescott L

    2015-03-01

    Alu elements make up the largest family of human mobile elements, numbering 1.1 million copies and comprising 11% of the human genome. As a consequence of evolution and genetic drift, Alu elements of various sequence divergence exist throughout the human genome. Alu/Alu recombination has been shown to cause approximately 0.5% of new human genetic diseases and contribute to extensive genomic structural variation. To begin understanding the molecular mechanisms leading to these rearrangements in mammalian cells, we constructed Alu/Alu recombination reporter cell lines containing Alu elements ranging in sequence divergence from 0%-30% that allow detection of both Alu/Alu recombination and large non-homologous end joining (NHEJ) deletions that range from 1.0 to 1.9 kb in size. Introduction of as little as 0.7% sequence divergence between Alu elements resulted in a significant reduction in recombination, which indicates even small degrees of sequence divergence reduce the efficiency of homology-directed DNA double-strand break (DSB) repair. Further reduction in recombination was observed in a sequence divergence-dependent manner for diverged Alu/Alu recombination constructs with up to 10% sequence divergence. With greater levels of sequence divergence (15%-30%), we observed a significant increase in DSB repair due to a shift from Alu/Alu recombination to variable-length NHEJ which removes sequence between the two Alu elements. This increase in NHEJ deletions depends on the presence of Alu sequence homeology (similar but not identical sequences). Analysis of recombination products revealed that Alu/Alu recombination junctions occur more frequently in the first 100 bp of the Alu element within our reporter assay, just as they do in genomic Alu/Alu recombination events. This is the first extensive study characterizing the influence of Alu element sequence divergence on DNA repair, which will inform predictions regarding the effect of Alu element sequence divergence on both the rate and nature of DNA repair events.

  18. Interaction of the E. coli DNA G:T-mismatch endonuclease (vsr protein) with oligonucleotides containing its target sequence.

    PubMed

    Turner, D P; Connolly, B A

    2000-12-15

    The Escherichia coli vsr endonuclease recognises G:T base-pair mismatches in double-stranded DNA and initiates a repair pathway by hydrolysing the phosphate group 5' to the incorrectly paired T. The enzyme shows a preference for G:T mismatches within a particular sequence context, derived from the recognition site of the E. coli dcm DNA-methyltransferase (CC[A/T]GG). Thus, the preferred substrate for the vsr protein is (CT[A/T]GG), where the underlined T is opposed by a dG base. This paper provides quantitative data for the interaction of the vsr protein with a number of oligonucleotides containing G:T mismatches. Evaluation of specificity constant (k(st)/K(D); k(st)=rate constant for single turnover, K(D)=equilibrium dissociation constant) confirms vsr's preference for a G:T mismatch within a hemi-methylated dcm sequence, i.e. the best substrate is a duplex (both strands written in the 5'-3' orientation) composed of CT[A/T]GG and C(5Me)C[T/A]GG. Conversion of the mispaired T (underlined) to dU or the d(5Me)C to dC gave poorer substrates. No interaction was observed with oligonucleotides that lacked a G:T mismatch or did not possess a dcm sequence. An analysis of the fraction of active protein, by "reverse-titration" (i.e. adding increasing amounts of DNA to a fixed amount of protein followed by gel-mobility shift analysis) showed that less than 1% of the vsr endonuclease was able to bind to the substrate. This was confirmed using "competitive titrations" (where competitor oligonucleotides are used to displace a (32)P-labelled nucleic acid from the vsr protein) and burst kinetic analysis. This result is discussed in the light of previous in vitro and in vivo data which indicate that the MutL protein may be needed for full vsr activity. Copyright 2000 Academic Press.

  19. Exercise leads to faster postural reflexes, improved balance and mobility, and fewer falls in older persons with chronic stroke.

    PubMed

    Marigold, Daniel S; Eng, Janice J; Dawson, Andrew S; Inglis, J Timothy; Harris, Jocelyn E; Gylfadóttir, Sif

    2005-03-01

    To determine the effect of two different community-based group exercise programs on functional balance, mobility, postural reflexes, and falls in older adults with chronic stroke. A randomized, clinical trial. Community center. Sixty-one community-dwelling older adults with chronic stroke. Participants were randomly assigned to an agility (n=30) or stretching/weight-shifting (n=31) exercise group. Both groups exercised three times a week for 10 weeks. Participants were assessed before, immediately after, and 1 month after the intervention for Berg Balance, Timed Up and Go, step reaction time, Activities-specific Balance Confidence, and Nottingham Health Profile. Testing of standing postural reflexes and induced falls evoked by a translating platform was also performed. In addition, falls in the community were tracked for 1 year from the start of the interventions. Although exercise led to improvements in all clinical outcome measures for both groups, the agility group demonstrated greater improvement in step reaction time and paretic rectus femoris postural reflex onset latency than the stretching/weight-shifting group. In addition, the agility group experienced fewer induced falls on the platform. Group exercise programs that include agility or stretching/weight shifting exercises improve postural reflexes, functional balance, and mobility and may lead to a reduction of falls in older adults with stroke.

  20. Isolation of a thyroid hormone-responsive gene by immunoprecipitation of thyroid hormone receptor-DNA complexes.

    PubMed Central

    Bigler, J; Eisenman, R N

    1994-01-01

    Thyroid hormone (T3) receptor (TR) is a ligand-dependent transcription factor that acts through specific binding sites in the promoter region of target genes. In order to identify new genes that are regulated by T3, we used anti-TR antiserum to immunoprecipitate TR-DNA complexes from GH4 cell nuclei that had previously been treated with a restriction enzyme. Screening of the immunopurified, cloned DNA for TR binding sites by electrophoretic mobility shift assay yielded 53 positive clones. A subset of these clones was specifically immunoprecipitated with anti-TR antiserum and may therefore represent biologically significant binding sites. One of these clones, clone 122, was characterized in detail. It includes sequences highly related to the NICER long terminal repeat-like element and contains three TR binding sites as determined by DNase I footprinting. Two of the clone 122 TR binding sites are located upstream of the TATA box, and one is located downstream. The TR binding site downstream from the promoter was necessary and sufficient to confer T3-dependent regulation in transient transfection experiments. Expression of a reporter construct under the control of the clone 122 promoter region was activated by TR in the absence of ligand and returned to basal levels after T3 addition. Clone 122 sequences hybridize to at least two different mRNAs of approximately 6 and 10 kb from GH4 cells. The levels of both of these mRNAs increased upon removal of T3. Our studies suggest that specific immunoprecipitation of chromatin allows identification of binding sites and target genes for transcription factors. Images PMID:7935476

  1. Shikonin reduces oedema induced by phorbol ester by interfering with IκBα degradation thus inhibiting translocation of NF-κB to the nucleus

    PubMed Central

    Andújar, I; Recio, MC; Bacelli, T; Giner, RM; Ríos, JL

    2010-01-01

    Background and purpose: In the present paper we studied the effect of shikonin on ear oedema induced by 12-O-tetradecanoylphorbol-13-acetate (TPA), and determined the mechanisms through which shikonin might exert its topical anti-inflammatory action. Experimental approach: Acute ear oedema was induced in mice by topical application of TPA. The in vitro assays used macrophages RAW 264.7 cells stimulated with lipopolysaccharide. Cyclooxygenase-2, inducible nitric oxide synthase, protein kinase Cα, extracellular signal-regulated protein kinase (ERK), phosphorylated ERK (pERK), c-Jun N-terminal kinase (JNK), pJNK, p38, p-p38, p65, p-p65, inhibitor protein of nuclear factor-κB (NF-κB) (IκBα) and pIκBα were measured by Western blotting, activation and binding of NF-κB to DNA was detected by reporter gene and electrophoretic mobility shift assay, respectively, and NF-κB p65 localization was detected by immunocytochemistry. Key results: Shikonin reduced the oedema (inhibitory dose 50 = 1.0 mg per ear), the expression of cyclooxygenase-2 (70%) and of inducible nitric oxide synthase (100%) in vivo. It significantly decreased TPA-induced translocation of protein kinase Cα, the phosphorylation and activation of ERK, the nuclear translocation of NF-κB and the TPA-induced NF-κB-DNA-binding activity in mouse skin. Moreover, in RAW 264.7 cells, shikonin significantly inhibited the binding of NF-κB to DNA in a dose-dependent manner and the nuclear translocation of p65. Conclusions and implications: Shikonin exerted its topical anti-inflammatory action by interfering with the degradation of IκBα, thus inhibiting the activation of NF-κB. PMID:20423347

  2. Mechanistic studies of DepR in regulating FK228 biosynthesis in Chromobacterium violaceum no. 968

    PubMed Central

    Xue, Jiao; Lin, Wenjing; Deng, Zixin; Cheng, Yi-Qiang

    2018-01-01

    DepR, a LysR-type transcriptional regulator encoded by the last gene of the putative min operon (orf21-20-19-depR) located at the downstream region of the anticancer agent FK228 biosynthetic gene cluster in Chromobacterium violaceum No. 968, positively regulates the biosynthesis of FK228. In this work, the mechanism underlining this positive regulation was probed by multiple approaches. Electrophoretic mobility shift assay (EMSA) and DNase I footprinting assay (DIFA) identified a conserved 35-nt DNA segment in the orf21-orf22 intergenic region where the purified recombinant DepR binds to. Quantitative reverse transcription PCR (RT-qPCR) and green fluorescent protein (GFP) promoter probe assays established that transcription of phasin gene orf22 increases in the depR deletion mutant of C. violaceum (CvΔdepR) compared to the wild-type strain. FK228 production in the orf22-overexpressed strain C. violaceum was reduced compared with the wild-type strain. DepR has two conserved cysteine residues C199 and C208 presumed to form a disulfide bridge upon sensing oxidative stress. C199X point mutations that locked DepR in a reduced conformation decreased the DNA-binding affinity of DepR; T232A or R278A mutation also had a negative impact on DNA binding of DepR. Complementation of CvΔdepR with any of those versions of depR carrying a single codon mutation was not able to restore FK228 production to the level of wild-type strain. All evidences collectively suggested that DepR positively regulates the biosynthesis of FK228 through indirect metabolic networking. PMID:29672625

  3. Mechanistic studies of DepR in regulating FK228 biosynthesis in Chromobacterium violaceum no. 968.

    PubMed

    Qiao, Yongjian; Tong, Tiantian; Xue, Jiao; Lin, Wenjing; Deng, Zixin; Cheng, Yi-Qiang; Zhu, Dongqing

    2018-01-01

    DepR, a LysR-type transcriptional regulator encoded by the last gene of the putative min operon (orf21-20-19-depR) located at the downstream region of the anticancer agent FK228 biosynthetic gene cluster in Chromobacterium violaceum No. 968, positively regulates the biosynthesis of FK228. In this work, the mechanism underlining this positive regulation was probed by multiple approaches. Electrophoretic mobility shift assay (EMSA) and DNase I footprinting assay (DIFA) identified a conserved 35-nt DNA segment in the orf21-orf22 intergenic region where the purified recombinant DepR binds to. Quantitative reverse transcription PCR (RT-qPCR) and green fluorescent protein (GFP) promoter probe assays established that transcription of phasin gene orf22 increases in the depR deletion mutant of C. violaceum (CvΔdepR) compared to the wild-type strain. FK228 production in the orf22-overexpressed strain C. violaceum was reduced compared with the wild-type strain. DepR has two conserved cysteine residues C199 and C208 presumed to form a disulfide bridge upon sensing oxidative stress. C199X point mutations that locked DepR in a reduced conformation decreased the DNA-binding affinity of DepR; T232A or R278A mutation also had a negative impact on DNA binding of DepR. Complementation of CvΔdepR with any of those versions of depR carrying a single codon mutation was not able to restore FK228 production to the level of wild-type strain. All evidences collectively suggested that DepR positively regulates the biosynthesis of FK228 through indirect metabolic networking.

  4. Molecular Control of Polyene Macrolide Biosynthesis

    PubMed Central

    Santos-Aberturas, Javier; Vicente, Cláudia M.; Guerra, Susana M.; Payero, Tamara D.; Martín, Juan F.; Aparicio, Jesús F.

    2011-01-01

    Control of polyene macrolide production in Streptomyces natalensis is mediated by the transcriptional activator PimM. This regulator, which combines an N-terminal PAS domain with a C-terminal helix-turn-helix motif, is highly conserved among polyene biosynthetic gene clusters. PimM, truncated forms of the protein without the PAS domain (PimMΔPAS), and forms containing just the DNA-binding domain (DBD) (PimMDBD) were overexpressed in Escherichia coli as GST-fused proteins. GST-PimM binds directly to eight promoters of the pimaricin cluster, as demonstrated by electrophoretic mobility shift assays. Assays with truncated forms of the protein revealed that the PAS domain does not mediate specificity or the distinct recognition of target genes, which rely on the DBD domain, but significantly reduces binding affinity up to 500-fold. Transcription start points were identified by 5′-rapid amplification of cDNA ends, and the binding regions of PimMDBD were investigated by DNase I protection studies. In all cases, binding took place covering the −35 hexamer box of each promoter, suggesting an interaction of PimM and RNA polymerase to cause transcription activation. Information content analysis of the 16 sequences protected in target promoters was used to deduce the structure of the PimM-binding site. This site displays dyad symmetry, spans 14 nucleotides, and adjusts to the consensus TVGGGAWWTCCCBA. Experimental validation of this binding site was performed by using synthetic DNA duplexes. Binding of PimM to the promoter region of one of the polyketide synthase genes from the Streptomyces nodosus amphotericin cluster containing the consensus binding site was also observed, thus proving the applicability of the findings reported here to other antifungal polyketides. PMID:21187288

  5. Characterization of a novel Y2K-type dehydrin VrDhn1 from Vigna radiata.

    PubMed

    Lin, Chia-Hui; Peng, Po-Hsin; Ko, Chia-Yun; Markhart, Albert H; Lin, Tsai-Yun

    2012-05-01

    A novel dehydrin gene (VrDhn1) was isolated from an embryo cDNA library of Vigna radiata (L.) Wilczek (mungbean) variety VC1973A. The intronless VrDhn1 gene encodes a protein belonging to the Y(2)K-type dehydrin family. VrDhn1 protein accumulated in embryos and cotyledons during seed maturation and disappeared 2 days after seed imbibition (DAI). The expression of VrDhn1 mRNA and accumulation of VrDhn1 protein were at high levels in mature seeds, but neither mRNA nor protein was detected in mungbean vegetative tissues under normal growth conditions. The VrDhn1 mRNA level was extremely high in mature seeds and decreased to ∼30% at 1 DAI, and was not detectable at ~7 DAI. Tissue dehydration, salinity and exogenous ABA markedly induced VrDhn1 transcripts in plants as measured by quantitative real-time reverse transcription-PCR (qRT-PCR). VrDhn1 protein was not detected using immunoblots in seedlings under stress treatments. In mature seeds or 1 DAI seedlings, VrDhn1 proteins were immunolocalized in the nucleus and cytoplasm. VrDhn1 exhibited low affinity for non-specific interaction with DNA using electrophoretic mobility shift assays (EMSAs), and the exogenous addition of Zn(2+) or Ni(2+) stimulated interaction. The His-tagged VrDhn1 (30.17 kDa) protein showed a molecular mass of 63.1 kDa on gel filtration, suggesting a dimer form. This is the first report showing that a Y(2)K-type VrDhn1 enters the nucleus and interacts with DNA during seed maturation.

  6. The putative Agrobacterium transcriptional activator-like virulence protein VirD5 may target T-complex to prevent the degradation of coat proteins in the plant cell nucleus.

    PubMed

    Wang, Yafei; Peng, Wei; Zhou, Xu; Huang, Fei; Shao, Lingyun; Luo, Meizhong

    2014-09-01

    Agrobacterium exports at least five virulence proteins (VirE2, VirE3, VirF, VirD2, VirD5) into host cells and hijacks some host plant factors to facilitate its transformation process. Random DNA binding selection assays (RDSAs), electrophoretic mobility shift assays (EMSAs) and yeast one-hybrid systems were used to identify protein-bound DNA elements. Bimolecular fluorescence complementation, glutathione S-transferase pull-down and yeast two-hybrid assays were used to detect protein interactions. Protoplast transformation, coprecipitation, competitive binding and cell-free degradation assays were used to analyze the relationships among proteins. We found that Agrobacterium VirD5 exhibits transcriptional activation activity in yeast, is located in the plant cell nucleus, and forms homodimers. A specific VirD5-bound DNA element designated D5RE (VirD5 response element) was identified. VirD5 interacted directly with Arabidopsis VirE2 Interacting Protein 1 (AtVIP1). However, the ternary complex of VirD5-AtVIP1-VirE2 could be detected, whereas that of VirD5-AtVIP1-VBF (AtVIP1 Binding F-box protein) could not. We demonstrated that VirD5 competes with VBF for binding to AtVIP1 and stabilizes AtVIP1 and VirE2 in the cell-free degradation system. Our results indicated that VirD5 may act as both a transcriptional activator-like effector to regulate host gene expression and a protector preventing the coat proteins of the T-complex from being quickly degraded by the host's ubiquitin proteasome system (UPS). © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

  7. Pattern of heat shock factor and heat shock protein expression in lymphocytes of bipolar patients: increased HSP70-glucocorticoid receptor heterocomplex.

    PubMed

    Bei, E S; Salpeas, V; Alevizos, B; Anagnostara, C; Pappa, D; Moutsatsou, P

    2013-11-01

    Bipolar disorder (BD), a stress-related disease, is characterized by altered glucocorticoid receptor (GR) signalling. Stress response includes activation of heat shock factor (HSF) and subsequent heat shock protein (HSP) synthesis which regulate GR folding and function. The objective of this study was to investigate the possible role of HSFs, HSPs and their interaction with GR in BD. We applied immunoprecipitation, SDS-PAGE/Western blot analysis and electrophoretic mobility shift assay (EMSA) in lymphocytes (whole cell or nuclear extracts) from BD patients and healthy subjects and determined the HSPs (HSP90 and HSP70), the heterocomplexes HSP90-GR and HSP70-GR, the HSFs (HSF1 and HSF4) as well as the HSF-DNA binding. The HSP70-GR heterocomplex was elevated (p < 0.05) in BD patients vs healthy subjects, and nuclear HSP70 was reduced (p ≤ 0.01) in bipolar manic patients. Protein levels of HSF1, HSF4, HSP90, HSP90-GR heterocomplex, and HSF-DNA binding remained unaltered in BD patients vs healthy subjects. The corresponding effect sizes (ES) indicated a large ES for HSP70-GR, HSP70, HSF-DNA binding and HSF4, and a medium ES for HSP90, HSF1 and HSP90-GR between healthy subjects and bipolar patients. Significant correlations among HSFs, HSPs, GR and HSP70-GR heterocomplex were observed in healthy subjects, which were abrogated in bipolar patients. The higher interaction between GR and HSP70 and the disturbances in the relations among heat shock response parameters and GR as observed in our BD patients may provide novel insights into the contribution of these factors in BD aetiopathogenesis. Copyright © 2013. Published by Elsevier Ltd.

  8. Mitochondrial DNA sequence characteristics modulate the size of the genetic bottleneck.

    PubMed

    Wilson, Ian J; Carling, Phillipa J; Alston, Charlotte L; Floros, Vasileios I; Pyle, Angela; Hudson, Gavin; Sallevelt, Suzanne C E H; Lamperti, Costanza; Carelli, Valerio; Bindoff, Laurence A; Samuels, David C; Wonnapinij, Passorn; Zeviani, Massimo; Taylor, Robert W; Smeets, Hubert J M; Horvath, Rita; Chinnery, Patrick F

    2016-03-01

    With a combined carrier frequency of 1:200, heteroplasmic mitochondrial DNA (mtDNA) mutations cause human disease in ∼1:5000 of the population. Rapid shifts in the level of heteroplasmy seen within a single generation contribute to the wide range in the severity of clinical phenotypes seen in families transmitting mtDNA disease, consistent with a genetic bottleneck during transmission. Although preliminary evidence from human pedigrees points towards a random drift process underlying the shifting heteroplasmy, some reports describe differences in segregation pattern between different mtDNA mutations. However, based on limited observations and with no direct comparisons, it is not clear whether these observations simply reflect pedigree ascertainment and publication bias. To address this issue, we studied 577 mother-child pairs transmitting the m.11778G>A, m.3460G>A, m.8344A>G, m.8993T>G/C and m.3243A>G mtDNA mutations. Our analysis controlled for inter-assay differences, inter-laboratory variation and ascertainment bias. We found no evidence of selection during transmission but show that different mtDNA mutations segregate at different rates in human pedigrees. m.8993T>G/C segregated significantly faster than m.11778G>A, m.8344A>G and m.3243A>G, consistent with a tighter mtDNA genetic bottleneck in m.8993T>G/C pedigrees. Our observations support the existence of different genetic bottlenecks primarily determined by the underlying mtDNA mutation, explaining the different inheritance patterns observed in human pedigrees transmitting pathogenic mtDNA mutations. © The Author 2016. Published by Oxford University Press.

  9. Non-enolisable Knoevenagel condensate appended Schiff bases-metal (II) complexes: Spectral characteristics, DNA-binding and nuclease activities

    NASA Astrophysics Data System (ADS)

    Gubendran, Ammavasi; Kesavan, Mookkandi Palsamy; Ayyanaar, Srinivasan; Mitu, Liviu; Athappan, Periyakaruppan; Rajesh, Jegathalaprathaban

    2017-06-01

    New Schiff base complexes [Cu(L1)Cl] (1), [Ni(L1)Cl] (2), [Zn(L1)Cl] (3), and [Fe(L2)H2OCl] (4) {L1 = (4E)-3-(2-hydroxybenzylidene)-4-(2-hydroxyphenylimino)pentan-2-one, L2 = 2,2‧-(1E,1‧E)-(3-(2-hydroxybenzylidene)-pentane-2,4-diylidene)bis(azan-1-yl-1 idene)diphenol} have been synthesized and characterized by elemental analysis, UV-Vis, IR, FAB-mass, EPR, spectral studies and electrochemical studies, the ligands L1 &L2 were characterized by 1H and 13C NMR spectra. Complex 1 show a visible spectral d-d band near 600 nm and display cyclic voltammetric quasireversible response for the Cu(II)/Cu(I) couple vs Ag/AgCl in DMSO. The EPR spectrum of 1 show g‖ > g⊥ suggesting a square planar geometry around copper with dx2 - y2 as the ground state. The mass spectral results have confirmed the proposed structure for complexes 1-4. DNA binding properties of these complexes 1-4 have been investigated by absorption titrations, cyclic voltammetric studies and circular dichroism studies. On titration with DNA, the complexes 1-4 show hypochromism at the MLCT band (13-31%) with a red shift of 1-8 nm in the electronic spectrum and positive shift of voltammetric E1/2 in the CV studies are in favour of intercalative binding. CD spectra of 1 showed an increase in molar ellipticity (θ278) of the positive band with a minor red shift indicating the transition of B-form of DNA to A like form. DNA cleavage studies of complexes 1 and 4 with pUC18 DNA were studied by gel electrophoresis and complex 4 cleaves supercoiled pUC18 DNA in an oxidative manner in the presence of H2O2 and on photo irradiation at 312 nm.

  10. Enzyme-free colorimetric detection systems based on the DNA strand displacement competition reaction

    NASA Astrophysics Data System (ADS)

    Zhang, Z.; Birkedal, V.; Gothelf, K. V.

    2016-05-01

    The strand displacement competition assay is based on the dynamic equilibrium of the competitive hybridization of two oligonucleotides (A and B) to a third oligonucleotide (S). In the presence of an analyte that binds to a specific affinity-moiety conjugated to strand B, the equilibrium shifts, which can be detected by a shift in the fluorescence resonance energy transfer signal between dyes attached to the DNA strands. In the present study we have integrated an ATP aptamer in the strand B and demonstrated the optical detection of ATP. Furthermore we explore a new readout method using a split G-quadruplex DNAzyme for colorimetric readout of the detection of streptavidin by the naked eye. Finally, we integrate the whole G-quadruplex DNAzyme system in a single DNA strand and show that it is applicable to colorimetric detection.

  11. Fitness cost implications of phiC31-mediated site-specific integrations in target-site strains of the Mexican fruit fly, Anastrepha ludens (Diptera: Tephritidae)

    USDA-ARS?s Scientific Manuscript database

    Site-specific recombination technologies are powerful new tools for the manipulation of genomic DNA in insects that can improve transgenesis strategies such as targeting transgene insertions, allowing transgene cassette exchange and DNA mobilization for transgene stabilization. However, understandin...

  12. Nuclear ARP2/3 drives DNA break clustering for homology-directed repair.

    PubMed

    Schrank, Benjamin R; Aparicio, Tomas; Li, Yinyin; Chang, Wakam; Chait, Brian T; Gundersen, Gregg G; Gottesman, Max E; Gautier, Jean

    2018-06-20

    DNA double-strand breaks repaired by non-homologous end joining display limited DNA end-processing and chromosomal mobility. By contrast, double-strand breaks undergoing homology-directed repair exhibit extensive processing and enhanced motion. The molecular basis of this movement is unknown. Here, using Xenopus laevis cell-free extracts and mammalian cells, we establish that nuclear actin, WASP, and the actin-nucleating ARP2/3 complex are recruited to damaged chromatin undergoing homology-directed repair. We demonstrate that nuclear actin polymerization is required for the migration of a subset of double-strand breaks into discrete sub-nuclear clusters. Actin-driven movements specifically affect double-strand breaks repaired by homology-directed repair in G2 cell cycle phase; inhibition of actin nucleation impairs DNA end-processing and homology-directed repair. By contrast, ARP2/3 is not enriched at double-strand breaks repaired by non-homologous end joining and does not regulate non-homologous end joining. Our findings establish that nuclear actin-based mobility shapes chromatin organization by generating repair domains that are essential for homology-directed repair in eukaryotic cells.

  13. Systematic prediction of control proteins and their DNA binding sites

    PubMed Central

    Sorokin, Valeriy; Severinov, Konstantin; Gelfand, Mikhail S.

    2009-01-01

    We present here the results of a systematic bioinformatics analysis of control (C) proteins, a class of DNA-binding regulators that control time-delayed transcription of their own genes as well as restriction endonuclease genes in many type II restriction-modification systems. More than 290 C protein homologs were identified and DNA-binding sites for ∼70% of new and previously known C proteins were predicted by a combination of phylogenetic footprinting and motif searches in DNA upstream of C protein genes. Additional analysis revealed that a large proportion of C protein genes are translated from leaderless RNA, which may contribute to time-delayed nature of genetic switches operated by these proteins. Analysis of genetic contexts of newly identified C protein genes revealed that they are not exclusively associated with restriction-modification genes; numerous instances of associations with genes originating from mobile genetic elements were observed. These instances might be vestiges of ancient horizontal transfers and indicate that during evolution ancestral restriction-modification system genes were the sites of mobile elements insertions. PMID:19056824

  14. A unique mitigator sequence determines the species specificity of the major late promoter in adenovirus type 12 DNA.

    PubMed Central

    Zock, C; Iselt, A; Doerfler, W

    1993-01-01

    Human adenovirus type 12 (Ad12) cannot replicate in hamster cells, whereas human cells are permissive for Ad12. Ad12 DNA replication and late-gene and virus-associated RNA expression are blocked in hamster cells. Early Ad12 genes are transcribed, and the viral DNA can be integrated into the host genome. Ad12 DNA replication and late-gene transcription can be complemented in hamster cells by E1 functions of Ad2 or Ad5, for which hamster cells are fully permissive (for a review, see W. Doerfler, Adv. Virus Res. 39:89-128, 1991). We have previously demonstrated that a 33-nucleotide mitigator sequence, which is located in the downstream region of the major late promoter (MLP) of Ad12 DNA, is responsible for the inactivity of the Ad12 MLP in hamster cells (C. Zock and W. Doerfler, EMBO J. 9:1615-1623, 1990). A similar negative regulator has not been found in the MLP of Ad2 DNA. We have now studied the mechanism of action of this mitigator element. The results of nuclear run-on experiments document the absence of MLP transcripts in the nuclei of Ad12-infected BHK21 hamster cells. Surprisingly, the mitigator element cannot elicit its function in in vitro transcription experiments with nuclear extracts from both hamster BHK21 and human HeLa cells. Intact nuclear topology and/or tightly bound nuclear elements that cannot be eluted in nuclear extracts are somehow required for recognition of the Ad12 mitigator. Electrophoretic mobility shift assays have not revealed significant differences in the binding of proteins from human HeLa or hamster BHK21 cells to the mitigator sequence in the MLP of Ad12 DNA or to the corresponding sequence in Ad2 DNA. We have converted the sequence of the mitigator in the MLP of Ad12 DNA to the equivalent sequence in the MLP of Ad2 DNA by site-directed mutagenesis. This construct was not active in hamster cells. When the Ad12 mitigator, on the other hand, was inserted into the Ad2 MLP, the latter's function in hamster cells was not compromised. Deletions in the 5' upstream region of the Ad12 MLP have provided evidence for the existence of additional sequences that codetermine the deficiency of the Ad12 MLP in hamster cells. The amphifunctional YY1 protein from HeLa cells can bind specifically to the mitigator and to upstream elements of the MLP of Ad12 DNA.(ABSTRACT TRUNCATED AT 400 WORDS) Images PMID:8419643

  15. Effect of magnesium ions on the structure of DNA thin films: an infrared spectroscopy study

    PubMed Central

    Serec, Kristina; Babić, Sanja Dolanski; Podgornik, Rudolf; Tomić, Silvia

    2016-01-01

    Utilizing Fourier transform infrared spectroscopy we have investigated the vibrational spectrum of thin dsDNA films in order to track the structural changes upon addition of magnesium ions. In the range of low magnesium concentration ([magnesium]/[phosphate] = [Mg]/[P] < 0.5), both the red shift and the intensity of asymmetric PO2 stretching band decrease, indicating an increase of magnesium-phosphate binding in the backbone region. Vibration characteristics of the A conformation of the dsDNA vanish, whereas those characterizing the B conformation become fully stabilized. In the crossover range with comparable Mg and intrinsic Na DNA ions ([Mg]/[P] ≈ 1) B conformation remains stable; vibrational spectra show moderate intensity changes and a prominent blue shift, indicating a reinforcement of the bonds and binding in both the phosphate and the base regions. The obtained results reflect the modified screening and local charge neutralization of the dsDNA backbone charge, thus consistently demonstrating that the added Mg ions interact with DNA via long-range electrostatic forces. At high Mg contents ([Mg]/[P] > 10), the vibrational spectra broaden and show a striking intensity rise, while the base stacking remains unaffected. We argue that at these extreme conditions, where a charge compensation by vicinal counterions reaches 92–94%, DNA may undergo a structural transition into a more compact form. PMID:27484473

  16. Chairs!: A Mobile Game for Organic Chemistry Students to Learn the Ring Flip of Cyclohexane

    ERIC Educational Resources Information Center

    Winter, Julia; Wentzel, Michael; Ahluwalia, Sonia

    2016-01-01

    The hallmark of game-based learning is that students discover concepts through trial and error as they play. With the digital landscape in higher education shifting to mobile-first, new tools for learning chemistry are both possible and needed. Interactive games for chemistry bring intuitive content directly to students through their devices. The…

  17. E-bike trials’ potential to promote sustained changes in car owners mobility habits

    NASA Astrophysics Data System (ADS)

    Moser, Corinne; Blumer, Yann; Lena Hille, Stefanie

    2018-04-01

    Modal shifts hold considerable potential to mitigate carbon emissions. Electric bikes (e-bikes) represent a promising energy- and carbon-efficient alternative to cars. However, as mobility behaviour is highly habitual, convincing people to switch from cars to e-bikes is challenging. One strategy to accomplish this is the disruption of existing habits—a key idea behind an annual e-bike promotion programme in Switzerland, in which car owners can try out an e-bike for free over a two-week period in exchange for their car keys. By means of a longitudinal survey, we measured the long-term effects of this trial on mobility-related habitual associations. After one year, participants’ habitual association with car use had weakened significantly. This finding was valid both for participants who bought an e-bike after the trial and those who did not. Our findings contrast the results of other studies who find that the effect of interventions to induce modal shifts wears off over time. We conclude that an e-bike trial has the potential to break mobility habits and motivate car owners to use more sustainable means of transport.

  18. Significance of the gate voltage-dependent mobility in the electrical characterization of organic field effect transistors

    NASA Astrophysics Data System (ADS)

    Kim, Jong Beom; Lee, Dong Ryeol

    2018-04-01

    We studied the effect of the addition of free hole- and electron-rich organic molecules to organic semiconductors (OSCs) in organic field effect transistors (OFETs) on the gate voltage-dependent mobility. The drain current versus gate voltage characteristics were quantitatively analyzed using an OFET mobility model of power law behavior based on hopping transport in an OSC. This analysis distinguished the threshold voltage shifts, depending on the materials and structures of the OFET device, and properly estimated the hopping transport of the charge carriers induced by the gate bias within the OSC from the power law exponent parameter. The addition of pentacene or C60 molecules to a one-monolayer pentacene-based OFET shifted the threshold voltages negatively or positively, respectively, due to the structural changes that occurred in the OFET device. On the other hand, the power law parameters revealed that the addition of charge carriers of the same or opposite polarity enhanced or hindered hopping transport, respectively. This study revealed the need for a quantitative analysis of the gate voltage-dependent mobility while distinguishing this effect from the threshold voltage effect in order to understand OSC hopping transport in OFETs.

  19. Scanning fluorescence correlation spectroscopy techniques to quantify the kinetics of DNA double strand break repair proteins after γ-irradiation and bleomycin treatment

    PubMed Central

    Abdisalaam, Salim; Davis, Anthony J.; Chen, David J.; Alexandrakis, George

    2014-01-01

    A common feature of DNA repair proteins is their mobilization in response to DNA damage. The ability to visualizing and quantifying the kinetics of proteins localizing/dissociating from DNA double strand breaks (DSBs) via immunofluorescence or live cell fluorescence microscopy have been powerful tools in allowing insight into the DNA damage response, but these tools have some limitations. For example, a number of well-established DSB repair factors, in particular those required for non-homologous end joining (NHEJ), do not form discrete foci in response to DSBs induced by ionizing radiation (IR) or radiomimetic drugs, including bleomycin, in living cells. In this report, we show that time-dependent kinetics of the NHEJ factors Ku80 and DNA-dependent protein kinase catalytic subunits (DNA–PKcs) in response to IR and bleomycin can be quantified by Number and Brightness analysis and Raster-scan Image Correlation Spectroscopy. Fluorescent-tagged Ku80 and DNA–PKcs quickly mobilized in response to IR and bleomycin treatments consistent with prior reports using laser-generated DSBs. The response was linearly dependent on IR dose, and blocking NHEJ enhanced immobilization of both Ku80 and DNA–PKcs after DNA damage. These findings support the idea of using Number and Brightness and Raster-scan Image Correlation Spectroscopy as methods to monitor kinetics of DSB repair proteins in living cells under conditions mimicking radiation and chemotherapy treatments. PMID:24137007

  20. Two CGTCA motifs and a GHF1/Pit1 binding site mediate cAMP-dependent protein kinase A regulation of human growth hormone gene expression in rat anterior pituitary GC cells.

    PubMed

    Shepard, A R; Zhang, W; Eberhardt, N L

    1994-01-21

    We established the cis-acting elements which mediate cAMP responsiveness of the human growth hormone (hGH) gene in transiently transfected rat anterior pituitary tumor GC cells. Analysis of the intact hGH gene or hGH 5'-flanking DNA (5'-FR) coupled to the hGh cDNA or chloramphenicol acetyltransferase or luciferase genes, indicated that cAMP primarily stimulated hGH promoter activity. Cotransfection of a protein kinase A inhibitory protein cDNA demonstrated that the cAMP response was mediated by protein kinase A. Mutational analysis of the hGH promoter identified two core cAMP response element motifs (CGTCA) located at nucleotides -187/-183 (distal cAMP response element; dCRE) and -99/-95 (proximal cAMP response element; pCRE) and a pituitary-specific transcription factor (GHF1/Pit1) binding site at nucleotides -123/-112 (dGHF1) which were required for cAMP responsiveness. GHF1 was not a limiting factor, since overexpression of GHF1 in cotransfections increased basal but not forskolin induction levels. Gel shift analyses indicated that similar, ubiquitous, thermostable protein(s) specifically bound the pCRE and dCRE motifs. The CGTCA motif-binding factors were cAMP response element binding protein (CREB)/activating transcription factor-1 (ATF-1)-related, since the DNA-protein complex was competed by unlabeled CREB consensus oligonucleotide, specifically supershifted by antisera to CREB and ATF-1 but not ATF-2, and was bound by purified CREB with the same relative binding affinity (pCRE < dCRE < CREB) and mobility as the GC nuclear extract. UV cross-linking and Southwestern blot analyses revealed multiple DNA-protein interactions of which approximately 100- and approximately 45-kDa proteins were predominant; the approximately 45-kDa protein may represent CREB. These results indicate that CREB/ATF-1-related factors act coordinately with the cell-specific factor GHF1 to mediate cAMP-dependent regulation of hGH-1 gene transcription in anterior pituitary somatotrophs.

  1. CCAAT/enhancer-binding protein delta is a critical regulator of insulin-like growth factor-I gene transcription in osteoblasts

    NASA Technical Reports Server (NTRS)

    Umayahara, Y.; Billiard, J.; Ji, C.; Centrella, M.; McCarthy, T. L.; Rotwein, P.

    1999-01-01

    Insulin-like growth factor-I (IGF-I) plays a major role in promoting skeletal growth by stimulating bone cell replication and differentiation. Prostaglandin E2 and other agents that induce cAMP production enhance IGF-I gene transcription in cultured rat osteoblasts through a DNA element termed HS3D, located in the proximal part of the major rat IGF-I promoter. We previously determined that CCAAT/enhancer-binding protein delta (C/EBPdelta) is the key cAMP-stimulated regulator of IGF-I transcription in these cells and showed that it transactivates the rat IGF-I promoter through the HS3D site. We now have defined the physical-chemical properties and functional consequences of the interactions between C/EBPdelta and HS3D. C/EBPdelta, expressed in COS-7 cells or purified as a recombinant protein from Escherichia coli, bound to HS3D with an affinity at least equivalent to that of the albumin D-site, a known high affinity C/EBP binding sequence, and both DNA elements competed equally for C/EBPdelta. C/EBPdelta bound to HS3D as a dimer, with protein-DNA contact points located on guanine residues on both DNA strands within and just adjacent to the core C/EBP half-site, GCAAT, as determined by methylation interference footprinting. C/EBPdelta also formed protein-protein dimers in the absence of interactions with its DNA binding site, as indicated by results of glutaraldehyde cross-linking studies. As established by competition gel-mobility shift experiments, the conserved HS3D sequence from rat, human, and chicken also bound C/EBPdelta with similar affinity. We also found that prostaglandin E2-induced expression of reporter genes containing human IGF-I promoter 1 or four tandem copies of the human HS3D element fused to a minimal promoter and show that these effects were enhanced by a co-transfected C/EBPdelta expression plasmid. Taken together, our results provide evidence that C/EBPdelta is a critical activator of IGF-I gene transcription in osteoblasts and potentially in other cell types and species.

  2. Programmable ion-sensitive transistor interfaces. II. Biomolecular sensing and manipulation.

    PubMed

    Jayant, Krishna; Auluck, Kshitij; Funke, Mary; Anwar, Sharlin; Phelps, Joshua B; Gordon, Philip H; Rajwade, Shantanu R; Kan, Edwin C

    2013-07-01

    The chemoreceptive neuron metal-oxide-semiconductor transistor described in the preceding paper is further used to monitor the adsorption and interaction of DNA molecules and subsequently manipulate the adsorbed biomolecules with injected static charge. Adsorption of DNA molecules onto poly-L-lysine-coated sensing gates (SGs) modulates the floating gate (FG) potential ψ(O), which is reflected as a threshold voltage shift measured from the control gate (CG) V(th_CG). The asymmetric capacitive coupling between the CG and SG to the FG results in V(th_CG) amplification. The electric field in the SG oxide E(SG_ox) is fundamentally different when we drive the current readout with V(CG) and V(ref) (i.e., the potential applied to the CG and reference electrode, respectively). The V(CG)-driven readout induces a larger E(SG_ox), leading to a larger V(th_CG) shift when DNA is present. Simulation studies indicate that the counterion screening within the DNA membrane is responsible for this effect. The DNA manipulation mechanism is enabled by tunneling electrons (program) or holes (erase) onto FGs to produce repulsive or attractive forces. Programming leads to repulsion and eventual desorption of DNA, while erasing reestablishes adsorption. We further show that injected holes or electrons prior to DNA addition either aids or disrupts the immobilization process, which can be used for addressable sensor interfaces. To further substantiate DNA manipulation, we used impedance spectroscopy with a split ac-dc technique to reveal the net interface impedance before and after charge injection.

  3. Structure and Function Study of Phi29 DNA packaging motor

    NASA Astrophysics Data System (ADS)

    Fang, Huaming

    A powerful nanomotor is employed by the tailed dsDNA virus to package the genome into a preformed protein shell during the process of replication. The bacteriophage phi29 is an excellent model for investigating the viral DNA packaging mechanism. The phi29 DNA packaging motor is composed of three ring structures: the dodecameric connector ring, the hexameric pRNA ring and the hexameric ATPase gp16 ring. The connector is the central hub for the DNA to enter and to exit. There are four positively charged lysine rings scattered inside the highly negatively charged connector channel. It is speculated that these positive charged lysine rings may play active roles during DNA packaging in many models. To test this prevalent view, the basic lysine residues were mutated to neutral alanines and the pH environment was altered. Amazingly, the results were beyond expectation. Neither the DNA translocation nor the one-way traffic property of the channel were measurably influenced by the alteration of the charge of lysine residues when the basic lysine residues mutated to neutral alanines or the pH environment changed to acid or basic. The ATPase or the terminase is the central part of the viral DNA packaging motor. The phi29 ATPase is highly hydrophobic and tends to aggregate in solution. A green fluorescent protein tag (eGFP) fused to the N-terminus of gp16 enhanced its solubility and stability. The eGFP-gp16 showed similar activity to wild type gp16 and was easily detected by fluorescent instruments. The interaction between eGFP-gp16 and DNA in the various conditions were investigated by electrophoretic mobility shift assay, FRET and sucrose gradient. gamma-S-ATP dramatically increased gp16 binding affinity to DNA and ATP, ADP, phosphate could release gp16 from gp16-DNA-gamma-S-ATP complex. The sliding of gp16 out of the gp16-DNA-gamma-S-ATP complex could be blocked by addition of Steptavidin to ends of dsDNA which is conjugated with biotins. Also, we found that six eGFP-gp16 molecules were required to bind to one short dsDNA molecule. The inhibitive curve of Walker B mutant gp16 analyzed by binomial distribution model showed that one inactive mutant gp16 in the gp16 ring could block the function of the motor and the stoichiometry of gp16 was six. These findings facilitate our understanding of the molecular mechanism of viral DNA packaging: a novel viral DNA packaging model "push through a one-way valve" was proposed. In this model, the connector functioned as a valve to allow DNA to enter but prevented it from sliding out during DNA packaging; the six subunits in the gp16 ring acted sequentially to push DNA into the connector channel. ATP binding of gp16 induced a conformation change with a high affinity for dsDNA. Then, the ATP was hydrolyzed which resulted in the movement of subdomains in this individual gp16 subunit and DNA was pushed forward, followed by the double helix of dsDNA being brought forward to the adjacent subunit in the gp16 ring. The elucidation of the viral DNA packaging mechanism holds great potential for developing artificial motors for delivering drugs and other molecular cargos.

  4. Justification of rapid prototyping in the development cycle of thermoplastic-based lab-on-a-chip.

    PubMed

    Preywisch, Regina; Ritzi-Lehnert, Marion; Drese, Klaus S; Röser, Tina

    2011-11-01

    During the developmental cycle of lab-on-a-chip devices, various microstructuring techniques are required. While in the designing and assay implementation phase direct structuring or so-called rapid-prototyping methods such as milling or laser ablation are applied, replication methods like hot embossing or injection moulding are favourable for large quantity manufacturing. This work investigated the applicability of rapid-prototyping techniques for thermoplastic chip development in general, and the reproducibility of performances in dependency of the structuring technique. A previously published chip for prenatal diagnosis that preconcentrates DNA via electrokinetic trapping and field-amplified-sample-stacking and afterwards separates it in CGE was chosen as a model. The impact of structuring, sealing, and the integration of membranes on the mobility of the EOF, DNA preconcentration, and DNA separation was studied. Structuring methods were found to significantly change the location where preconcentration of DNA occurs. However, effects on the mobility of the EOF and the separation quality of DNA were not observed. Exchange of the membrane has no effect on the chip performance, whereas the sealing method impairs the separation of DNA within the chip. The overall assay performance is not significantly influenced by different structuring methods; thus, the application of rapid-prototyping methods during a chip development cycle is well justified. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. DNA Extraction by Isotachophoresis in a Microfluidic Channel

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stephenson, S J

    Biological assays have many applications. For example, forensics personnel and medical professionals use these tests to diagnose diseases and track their progression or identify pathogens and the host response to them. One limitation of these tests, however, is that most of them target only one piece of the sample - such as bacterial DNA - and other components (e.g. host genomic DNA) get in the way, even though they may be useful for different tests. To address this problem, it would be useful to extract several different substances from a complex biological sample - such as blood - in anmore » inexpensive and efficient manner. This summer, I worked with Maxim Shusteff at Lawrence Livermore National Lab on the Rapid Automated Sample Prep project. The goal of the project is to solve the aforementioned problem by creating a system that uses a series of different extraction methods to extract cells, bacteria, and DNA from a complex biological sample. Biological assays can then be run on purified output samples. In this device, an operator could input a complex sample such as blood or saliva, and would receive separate outputs of cells, bacteria, viruses, and DNA. I had the opportunity to work this summer with isotachophoresis (ITP), a technique that can be used to extract nucleic acids from a sample. This technique is intended to be the last stage of the purification device. Isotachophoresis separates particles based on different electrophoretic mobilities. This technique is convenient for out application because free solution DNA mobility is approximately equal for DNA longer than 300 base pairs in length. The sample of interest - in our case DNA - is fed into the chip with streams of leading electrolyte (LE) and trailing electrolyte (TE). When an electric field is applied, the species migrate based on their electrophoretic mobilities. Because the ions in the leading electrolyte have a high electrophoretic mobility, they race ahead of the slower sample and trailing electrolyte ions. Conversely, the trailing electrolyte ions have a slow electrophoretic mobility, so they lag behind the sample, thus trapping the species of interest between the LE and TE streams. In a typical isotachophoresis configuration, the electric field is applied in a direction parallel to the direction of flow. The species then form bands that stretch across the width of the channel. A major limitation of that approach is that only a finite amount of sample can be processed at once, and the sample must be processed in batches. For our purposes, a form of free-flow isotachophoresis is more convenient, where the DNA forms a band parallel to the edges of the channel. To achieve this, in our chip, the electric field is applied transversely. This creates a force perpendicular to the direction of flow, which causes the different ions to migrate across the flow direction. Because the mobility of the DNA is between the mobility of the leading and the trailing electrolyte, the DNA is focused in a tight band near the center of the channel. The stream of DNA can then be directed to a different output to produce a highly concentrated outlet stream without batch processing. One hurdle that must be overcome for successful ITP is isolating the electrochemical reactions that result from the application of high voltage for the actual process of isotachophoresis. The electrochemical reactions that occur around metal electrodes produce bubbles and pH changes that are detrimental to successful ITP. The design of the chips we use incorporates polyacrylamide gels to serve as electrodes along the central channel. For our design, the metal electrodes are located away from the chip, and high conductivity buffer streams carry the potential to the chip, functioning as a 'liquid electrode.' The stream then runs alongside a gel barrier. The gel electrode permits ion transfer while simultaneously isolating the separation chamber from any contaminants in the outer, 'liquid electrode' streams. The difference in potential from one side of the chip to the other creates an electric field. This field traverses the inner, separation channel, containing the leading electrolyte, the trailing electrolyte, and the sample of interest (DNA). To increase the ease of use of the chips, a newer chip design has been fabricated. This design has wire electrodes integrated on the chip, rather than elsewhere. To keep the pH changes and bubbling isolated from the separation channel, the chip contains deeper wells near the electrodes so that the flowing buffer can wash away any gases that form around the electrode. This design is significantly more compact because it eliminates the cumbersome electrode boxes. Eliminating the electrode boxes also decreases the required voltage, making the experiments safer. This happens because when the 'liquid electrode' streams travel through small diameter tubing, they lose much of their voltage due to the electrical resistance of the fluid in the tubing.« less

  6. Investigation of Defect Distributions in SiO2/AlGaN/GaN High-Electron-Mobility Transistors by Using Capacitance-Voltage Measurement with Resonant Optical Excitation

    NASA Astrophysics Data System (ADS)

    Kim, Tae-Soo; Lim, Seung-Young; Park, Yong-Keun; Jung, Gunwoo; Song, Jung-Hoon; Cha, Ho-Young; Han, Sang-Woo

    2018-06-01

    We investigated the distributions and the energy levels of defects in SiO2/AlGaN/GaN highelectron-mobility transistors (HEMTs) by using frequency-dependent ( F- D) capacitance-voltage ( C- V) measurements with resonant optical excitation. A Schottky barrier (SB) and a metal-oxidesemiconductor (MOS) HEMT were prepared to compare the effects of defects in their respective layers. We also investigated the effects of those layers on the threshold voltage ( V th ). A drastic voltage shift in the C- V curve at higher frequencies was caused by the large number of defect levels in the SiO2/GaN interface. A significant shift in V th with additional light illumination was observed due to a charging of the defect states in the SiO2/GaN interface. The voltage shifts were attributed to the detrapping of defect states at the SiO2/GaN interface.

  7. Structure and stability of the consecutive stereoregulated chiral phosphorothioate DNA duplex.

    PubMed

    Kanaori, K; Tamura, Y; Wada, T; Nishi, M; Kanehara, H; Morii, T; Tajima, K; Makino, K

    1999-12-07

    The duplex structures of the stereoregulated phosphorothioate DNAs, [R(p),R(p)]- and [S(p),S(p)]-[d(GC(ps)T(ps)ACG)] (ps, phosphorothioate; PS-DNA), with their complementary RNA have been investigated by combined use of (1)H NMR and restrained molecular dynamics calculation. Compared to those obtained for the unmodified duplex structures (PO-DNA.RNA), the NOE cross-peak intensities are virtually identical for the PS-DNA.RNA hybrid duplexes. The structural analysis on the basis of the NOE restraints reveals that all of the three DNA.RNA duplexes take a A-form conformation and that there is no significant difference in the base stacking for the DNA.RNA hybrid duplexes. On the other hand, the NOE cross-peak intensities of the protons around the central T(ps)A step of the PS-DNA.DNA duplexes are apparently different from those of PO-DNA. DNA. The chemical shifts of H8/6 and H1' at the T(ps)A step are also largely different among PS-DNA.DNAs and PO-DNA.DNA, suggesting that the DNA.DNA structure is readily changed by the introduction of the phosphorothioate groups to the central T(p)A step. The structure calculations indicate that all of these DNA.DNA duplexes are B-form although there exist some small differences in helical parameters between the [R(p),R(p)]- and [S(p),S(p)]PS-DNA.DNA duplexes. The melting temperatures (T(m)) were determined for all of the duplexes by plotting the chemical shift change of isolated peaks as a function of temperature. For the PS-DNA.RNA hybrid duplexes, the [S(p),S(p)] isomer is less stable than the [R(p),R(p)] isomer while this trend is reversed for the PS-DNA.DNA duplexes. Consequently, although the PS-DNA.RNA duplexes take the similar A-form structure, the duplex stability is different between PS-DNA.RNA duplexes. The stability of the DNA.RNA duplexes may not be governed by the A-form structure itself but by some other factors such as the hydration around the phosphorothioate backbone, although the T(m) difference of the DNA.DNA duplexes could be explained by the structural factor.

  8. Nanoplasmonic biosensor: detection and amplification of dual bio-signatures of circulating tumor DNA.

    PubMed

    Nguyen, Anh H; Sim, Sang Jun

    2015-05-15

    Circulating tumor DNA (ctDNA) bearing tumor-specific mutation and methylation are promising biomarkers for noninvasive cancer assessment. However, existing methods for ctDNA detection are restricted to genetic mutations. Recently, nanoplasmonics has emerged as a platform for one-step dual detection with high sensitivity and specificity. Here we present a strategy for ultrasensitive detection of tumor-specific mutations (E542K and E545K) and methylation of ctDNA of PIK3CA gene based on localized surface plasmon resonance (LSPR) and the coupling plasmon mode of gold nanoparticles (AuNPs). Peptide nucleic acids (PNA) is used as a probe to capture and enrich the 69-bp PIK3CA ctDNA. The exposure of PNA-probed AuNPs to 200 fM ctDNA generates LSPR-peak shift of 4.3 nm, corresponding to the primary response. Immunogold colloids are exploited as methylation detectors and plasmon coupling based enhancement for secondary response. LSPR-peak shifted from 4.3 nm to 11.4 nm upon the immunogold colloids binding to two methylcytosines (mCpG), which is an approximately 107% increase, compared to that of the primary response. This enhancement leads to four times (~50 fM) improvement of sensitivity and because of two mCpG sites, ctDNA was detected. These results demonstrate that the sensor can simultaneously detect the hot-spot mutation and epigenetic changes on the ctDNA. Promisingly, other specific-tumor mutants and epigenetic changes can be detected at low concentration with this platform. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. The Dynamics of Entangled DNA Networks using Single-Molecule Methods

    NASA Astrophysics Data System (ADS)

    Chapman, Cole David

    Single molecule experiments were performed on DNA, a model polymer, and entangled DNA networks to explore diffusion within complex polymeric fluids and their linear and non-linear viscoelasticity. DNA molecules of varying length and topology were prepared using biological methods. An ensemble of individual molecules were then fluorescently labeled and tracked in blends of entangled linear and circular DNA to examine the dependence of diffusion on polymer length, topology, and blend ratio. Diffusion was revealed to possess a non-monotonic dependence on the blend ratio, which we believe to be due to a second-order effect where the threading of circular polymers by their linear counterparts greatly slows the mobility of the system. Similar methods were used to examine the diffusive and conformational behavior of DNA within highly crowded environments, comparable to that experienced within the cell. A previously unseen gamma distributed elongation of the DNA in the presence of crowders, proposed to be due to entropic effects and crowder mobility, was observed. Additionally, linear viscoelastic properties of entangled DNA networks were explored using active microrheology. Plateau moduli values verified for the first time the predicted independence from polymer length. However, a clear bead-size dependence was observed for bead radii less than ~3x the tube radius, a newly discovered limit, above which microrheology results are within the continuum limit and may access the bulk properties of the fluid. Furthermore, the viscoelastic properties of entangled DNA in the non-linear regime, where the driven beads actively deform the network, were also examined. By rapidly driving a bead through the network utilizing optical tweezers, then removing the trap and tracking the bead's subsequent motion we are able to model the system as an over-damped harmonic oscillator and find the elasticity to be dominated by stress-dependent entanglements.

  10. Persistent ecological shifts in marine molluscan assemblages across the end-Cretaceous mass extinction.

    PubMed

    Aberhan, Martin; Kiessling, Wolfgang

    2015-06-09

    Contemporary biodiversity loss and population declines threaten to push the biosphere toward a tipping point with irreversible effects on ecosystem composition and function. As a potential example of a global-scale regime shift in the geological past, we assessed ecological changes across the end-Cretaceous mass extinction based on molluscan assemblages at four well-studied sites. By contrasting preextinction and postextinction rank abundance and numerical abundance in 19 molluscan modes of life--each defined as a unique combination of mobility level, feeding mode, and position relative to the substrate--we find distinct shifts in ecospace utilization, which significantly exceed predictions from null models. The magnitude of change in functional traits relative to normal temporal fluctuations at far-flung sites indicates that molluscan assemblages shifted to differently structured systems and faunal response was global. The strengths of temporal ecological shifts, however, are mostly within the range of preextinction site-to-site variability, demonstrating that local ecological turnover was similar to geographic variation over a broad latitudinal range. In conjunction with varied site-specific temporal patterns of individual modes of life, these spatial and temporal heterogeneities argue against a concerted phase shift of molluscan assemblages from one well-defined regime to another. At a broader ecological level, by contrast, congruent tendencies emerge and suggest deterministic processes. These patterns comprise the well-known increase of deposit-feeding mollusks in postextinction assemblages and increases in predators and predator-resistant modes of life, i.e., those characterized by elevated mobility and infaunal life habits.

  11. ICE Afe 1, an actively excising genetic element from the biomining bacterium Acidithiobacillus ferrooxidans.

    PubMed

    Bustamante, Paula; Covarrubias, Paulo C; Levicán, Gloria; Katz, Assaf; Tapia, Pablo; Holmes, David; Quatrini, Raquel; Orellana, Omar

    2012-01-01

    Integrative conjugative elements (ICEs) are self-transferred mobile genetic elements that contribute to horizontal gene transfer. An ICE (ICEAfe1) was identified in the genome of Acidithiobacillus ferrooxidans ATCC 23270. Excision of the element and expression of relevant genes under normal and DNA-damaging growth conditions was analyzed. Bioinformatic tools and DNA amplification methods were used to identify and to assess the excision and expression of genes related to the mobility of the element. Both basal and mitomycin C-inducible excision as well as expression and induction of the genes for integration/excision are demonstrated, suggesting that ICEAfe1 is an actively excising SOS-regulated mobile genetic element. The presence of a complete set of genes encoding self-transfer functions that are induced in response to DNA damage caused by mitomycin C additionally suggests that this element is capable of conjugative transfer to suitable recipient strains. Transfer of ICEAfe1 may provide selective advantages to other acidophiles in this ecological niche through dissemination of gene clusters expressing transfer RNAs, CRISPRs, and exopolysaccharide biosynthesis enzymes, probably by modification of translation efficiency, resistance to bacteriophage infection and biofilm formation, respectively. These data open novel avenues of research on conjugative transformation of biotechnologically relevant microorganisms recalcitrant to genetic manipulation. Copyright © 2013 S. Karger AG, Basel.

  12. Transformation of personal computers and mobile phones into genetic diagnostic systems.

    PubMed

    Walker, Faye M; Ahmad, Kareem M; Eisenstein, Michael; Soh, H Tom

    2014-09-16

    Molecular diagnostics based on the polymerase chain reaction (PCR) offer rapid and sensitive means for detecting infectious disease, but prohibitive costs have impeded their use in resource-limited settings where such diseases are endemic. In this work, we report an innovative method for transforming a desktop computer and a mobile camera phone--devices that have become readily accessible in developing countries--into a highly sensitive DNA detection system. This transformation was achieved by converting a desktop computer into a de facto thermal cycler with software that controls the temperature of the central processing unit (CPU), allowing for highly efficient PCR. Next, we reconfigured the mobile phone into a fluorescence imager by adding a low-cost filter, which enabled us to quantitatively measure the resulting PCR amplicons. Our system is highly sensitive, achieving quantitative detection of as little as 9.6 attograms of target DNA, and we show that its performance is comparable to advanced laboratory instruments at approximately 1/500th of the cost. Finally, in order to demonstrate clinical utility, we have used our platform for the successful detection of genomic DNA from the parasite that causes Chagas disease, Trypanosoma cruzi, directly in whole, unprocessed human blood at concentrations 4-fold below the clinical titer of the parasite.

  13. Transformation of Personal Computers and Mobile Phones into Genetic Diagnostic Systems

    PubMed Central

    2014-01-01

    Molecular diagnostics based on the polymerase chain reaction (PCR) offer rapid and sensitive means for detecting infectious disease, but prohibitive costs have impeded their use in resource-limited settings where such diseases are endemic. In this work, we report an innovative method for transforming a desktop computer and a mobile camera phone—devices that have become readily accessible in developing countries—into a highly sensitive DNA detection system. This transformation was achieved by converting a desktop computer into a de facto thermal cycler with software that controls the temperature of the central processing unit (CPU), allowing for highly efficient PCR. Next, we reconfigured the mobile phone into a fluorescence imager by adding a low-cost filter, which enabled us to quantitatively measure the resulting PCR amplicons. Our system is highly sensitive, achieving quantitative detection of as little as 9.6 attograms of target DNA, and we show that its performance is comparable to advanced laboratory instruments at approximately 1/500th of the cost. Finally, in order to demonstrate clinical utility, we have used our platform for the successful detection of genomic DNA from the parasite that causes Chagas disease, Trypanosoma cruzi, directly in whole, unprocessed human blood at concentrations 4-fold below the clinical titer of the parasite. PMID:25223929

  14. Mobilization of Copper ions by Flavonoids in Human Peripheral Lymphocytes Leads to Oxidative DNA Breakage: A Structure Activity Study.

    PubMed

    Arif, Hussain; Rehmani, Nida; Farhan, Mohd; Ahmad, Aamir; Hadi, Sheikh Mumtaz

    2015-11-09

    Epidemiological studies have linked dietary consumption of plant polyphenols with lower incidence of various cancers. In particular, flavonoids (present in onion, tomato and other plant sources) induce apoptosis and cytotoxicity in cancer cells. These can therefore be used as lead compounds for the synthesis of novel anticancer drugs with greater bioavailability. In the present study, we examined the chemical basis of cytotoxicity of flavonoids by studying the structure-activity relationship of myricetin (MN), fisetin (FN), quercetin (QN), kaempferol (KL) and galangin (GN). Using single cell alkaline gel electrophoresis (comet assay), we established the relative efficiency of cellular DNA breakage as MN > FN > QN > KL > GN. Also, we determined that the cellular DNA breakage was the result of mobilization of chromatin-bound copper ions and the generation of reactive oxygen species. The relative DNA binding affinity order was further confirmed using molecular docking and thermodynamic studies through the interaction of flavonoids with calf thymus DNA. Our results suggest that novel anti-cancer molecules should have ortho-dihydroxy groups in B-ring and hydroxyl groups at positions 3 and 5 in the A-ring system. Additional hydroxyl groups at other positions further enhance the cellular cytotoxicity of the flavonoids.

  15. Alpha3, a transposable element that promotes host sexual reproduction.

    PubMed

    Barsoum, Emad; Martinez, Paula; Aström, Stefan U

    2010-01-01

    Theoretical models predict that selfish DNA elements require host sex to persist in a population. Therefore, a transposon that induces sex would strongly favor its own spread. We demonstrate that a protein homologous to transposases, called alpha3, was essential for mating type switch in Kluyveromyces lactis. Mutational analysis showed that amino acids conserved among transposases were essential for its function. During switching, sequences in the 5' and 3' flanking regions of the alpha3 gene were joined, forming a DNA circle, showing that alpha3 mobilized from the genome. The sequences encompassing the alpha3 gene circle junctions in the mating type alpha (MATalpha) locus were essential for switching from MATalpha to MATa, suggesting that alpha3 mobilization was a coupled event. Switching also required a DNA-binding protein, Mating type switch 1 (Mts1), whose binding sites in MATalpha were important. Expression of Mts1 was repressed in MATa/MATalpha diploids and by nutrients, limiting switching to haploids in low-nutrient conditions. A hairpin-capped DNA double-strand break (DSB) was observed in the MATa locus in mre11 mutant strains, indicating that mating type switch was induced by MAT-specific DSBs. This study provides empirical evidence for selfish DNA promoting host sexual reproduction by mediating mating type switch.

  16. Mobilization of Copper ions by Flavonoids in Human Peripheral Lymphocytes Leads to Oxidative DNA Breakage: A Structure Activity Study

    PubMed Central

    Arif, Hussain; Rehmani, Nida; Farhan, Mohd; Ahmad, Aamir; Hadi, Sheikh Mumtaz

    2015-01-01

    Epidemiological studies have linked dietary consumption of plant polyphenols with lower incidence of various cancers. In particular, flavonoids (present in onion, tomato and other plant sources) induce apoptosis and cytotoxicity in cancer cells. These can therefore be used as lead compounds for the synthesis of novel anticancer drugs with greater bioavailability. In the present study, we examined the chemical basis of cytotoxicity of flavonoids by studying the structure–activity relationship of myricetin (MN), fisetin (FN), quercetin (QN), kaempferol (KL) and galangin (GN). Using single cell alkaline gel electrophoresis (comet assay), we established the relative efficiency of cellular DNA breakage as MN > FN > QN > KL > GN. Also, we determined that the cellular DNA breakage was the result of mobilization of chromatin-bound copper ions and the generation of reactive oxygen species. The relative DNA binding affinity order was further confirmed using molecular docking and thermodynamic studies through the interaction of flavonoids with calf thymus DNA. Our results suggest that novel anti-cancer molecules should have ortho-dihydroxy groups in B-ring and hydroxyl groups at positions 3 and 5 in the A-ring system. Additional hydroxyl groups at other positions further enhance the cellular cytotoxicity of the flavonoids. PMID:26569217

  17. Living Organisms Author Their Read-Write Genomes in Evolution

    PubMed Central

    2017-01-01

    Evolutionary variations generating phenotypic adaptations and novel taxa resulted from complex cellular activities altering genome content and expression: (i) Symbiogenetic cell mergers producing the mitochondrion-bearing ancestor of eukaryotes and chloroplast-bearing ancestors of photosynthetic eukaryotes; (ii) interspecific hybridizations and genome doublings generating new species and adaptive radiations of higher plants and animals; and, (iii) interspecific horizontal DNA transfer encoding virtually all of the cellular functions between organisms and their viruses in all domains of life. Consequently, assuming that evolutionary processes occur in isolated genomes of individual species has become an unrealistic abstraction. Adaptive variations also involved natural genetic engineering of mobile DNA elements to rewire regulatory networks. In the most highly evolved organisms, biological complexity scales with “non-coding” DNA content more closely than with protein-coding capacity. Coincidentally, we have learned how so-called “non-coding” RNAs that are rich in repetitive mobile DNA sequences are key regulators of complex phenotypes. Both biotic and abiotic ecological challenges serve as triggers for episodes of elevated genome change. The intersections of cell activities, biosphere interactions, horizontal DNA transfers, and non-random Read-Write genome modifications by natural genetic engineering provide a rich molecular and biological foundation for understanding how ecological disruptions can stimulate productive, often abrupt, evolutionary transformations. PMID:29211049

  18. Living Organisms Author Their Read-Write Genomes in Evolution.

    PubMed

    Shapiro, James A

    2017-12-06

    Evolutionary variations generating phenotypic adaptations and novel taxa resulted from complex cellular activities altering genome content and expression: (i) Symbiogenetic cell mergers producing the mitochondrion-bearing ancestor of eukaryotes and chloroplast-bearing ancestors of photosynthetic eukaryotes; (ii) interspecific hybridizations and genome doublings generating new species and adaptive radiations of higher plants and animals; and, (iii) interspecific horizontal DNA transfer encoding virtually all of the cellular functions between organisms and their viruses in all domains of life. Consequently, assuming that evolutionary processes occur in isolated genomes of individual species has become an unrealistic abstraction. Adaptive variations also involved natural genetic engineering of mobile DNA elements to rewire regulatory networks. In the most highly evolved organisms, biological complexity scales with "non-coding" DNA content more closely than with protein-coding capacity. Coincidentally, we have learned how so-called "non-coding" RNAs that are rich in repetitive mobile DNA sequences are key regulators of complex phenotypes. Both biotic and abiotic ecological challenges serve as triggers for episodes of elevated genome change. The intersections of cell activities, biosphere interactions, horizontal DNA transfers, and non-random Read-Write genome modifications by natural genetic engineering provide a rich molecular and biological foundation for understanding how ecological disruptions can stimulate productive, often abrupt, evolutionary transformations.

  19. Novel Structure of Ty3 Reverse Transcriptase | Center for Cancer Research

    Cancer.gov

    Retrotransposons are mobile genetic elements that self amplify via a single-stranded RNA intermediate, which is converted to double-stranded DNA by an encoded reverse transcriptase (RT) with both DNA polymerase (pol) and ribonuclease H (RNase) activities. Categorized by whether they contain flanking long terminal repeat (LTR) sequences, retrotransposons play a critical role in

  20. Managing shifting species: Ancient DNA reveals conservation conundrums in a dynamic world.

    PubMed

    Waters, Jonathan M; Grosser, Stefanie

    2016-11-01

    The spread of exotic species represents a major driver of biological change across the planet. While dispersal and colonization are natural biological processes, we suggest that the failure to recognize increasing rates of human-facilitated self-introductions may represent a threat to native lineages. Notably, recent biogeographic analyses have revealed numerous cases of biological range shifts in response to anthropogenic impacts and climate change. In particular, ancient DNA analyses have revealed several cases in which lineages traditionally thought to be long-established "natives" are in fact recent colonizers. Such range expansion events have apparently occurred in response to human-mediated native biodiversity declines and ecosystem change, particularly in recently colonized, isolated ecosystems such as New Zealand. While such events can potentially boost local biodiversity, the spread of exotic lineages may also hasten the decline of indigenous species, so it is essential that conservation managers recognize these rapid biotic shifts.​. © 2016 WILEY Periodicals, Inc.

  1. Electrochemical, spectroscopic, and theoretical studies on the interaction between azathioprine and DNA.

    PubMed

    Jalali, Fahimeh; Rasaee, Gelareh

    2015-11-01

    Possible interaction between immunosuppressive drug, azathioprine, and calf thymus DNA was explored by cyclic voltammetry, spectrophotometry, competitive spectrofluorimetry, circular dichroism spectroscopy (CD), and viscosity measurements. Cyclic voltammetry showed negative shift in the reduction peak of azathioprine in the presence of DNA, and large decrease in peak current, referring to the predominance of electrostatic forces. The binding constant was calculated to be 1.22×10(3)M(-1). Absorption hyperchromism without shift in wavelength was observed when DNA was added to azathioprine solution. Competitive fluorescence experiments were conducted by using Hoechst 33258 and methylene blue as probes for minor groove and intercalation binding modes, respectively. The studies showed that azathioprine could release Hoechst 33258, while negligible effect was detected in the case of methylene blue. Stern-Volmer quenching constant (KSV) and complex formation constant (Kf) were obtained from the fluorescence measurements to be 7.6×10(3)M(-1) and 7.76×10(4)M(-1), respectively, at 298K. Enthalpy and entropy changes during the interaction between azathioprine and DNA were calculated from Van't Hoff plot (ΔH=-20.2kJmol(-1); ΔS=26.11Jmol(-1)K(-1) at 298K) which showed an exothermic spontaneous reaction, and involvement of electrostatic forces in the complex formation with DNA. Moreover, circular dichroism studies revealed that azathioprine induced detectable changes in the negative band of DNA spectrum. Viscosity of DNA solution decreased in the presence of azathioprine, showed a non-intercalative mode of interaction. Finally, molecular docking calculations showed that in the lowest energy level of drug-DNA complex, azathioprine approaches the minor grooves of DNA. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Structure and Environment Influence in DNA Conduction

    NASA Technical Reports Server (NTRS)

    Adessi, C.; Walch, S.; Anantram, M. P.; Biegel, Bryan A. (Technical Monitor)

    2002-01-01

    Results for transmission through a poly(G) DNA molecule are presented. We show that a modification of the rise of a B-DNA form can induce a shift of the conduction channel toward the valence one. We clearly prove that deformation of the backbone of the molecule has a significant influence on hole transport. Finally, we observe that the presence of ionic species, such Na, near the molecule can create new conduction channels.

  3. [Impact of mobile phone radiation on the quality and DNA methylation of human sperm in vitro].

    PubMed

    Wang, Dong; Li, Bo; Liu, Yuan; Ma, Ye-fei; Chen, Shu-qiang; Sun, Hui-jun; Dong, Jie; Ma, Xu-hui; Zhou, Jing; Wang, Xiao-hong

    2015-06-01

    To investigate the influences of mobile phone radiation on the quality and DNA methylation of human sperm in vitro. According to the fifth edition of the WHO Laboratory Manual for the Examination and Processing of Human Semen, we randomly selected 97 male volunteers with normal semen parameters and divided each semen sample from the subjects into two equal parts, one exposed to mobile phone radiation at 1950 M Hz, SAR3. 0 W/kg for 3 hours while the other left untreated as the control. We obtained routine semen parameters as well as the acrosomal reaction ability, apoptosis and DNA methylation of sperm, and compared them between the two groups. Compared with the control, the radiation group showed significantly decreased progressive sperm motility ([36.64 ± 16.93] vs [27.56 ± 16.92]%, P < 0.01) and sperm viability ([63.72 ± 16.35] vs [54.31 ± 17.35]%, P < 0.01) and increased sperm head defects ([69.92 ± 4.46] vs [71.17 ± 4.89]%, P < 0.05), but no significant differences in sperm acrosomal reaction ([66.20 ± 6.75] vs [64.50 ± 3.47]%, P > 0.05). The early apoptosis rate of sperm cells was remarkably higher in the radiation group ([6.89 ± 9.84]%) than in the control ([4.44 ± 5.89]%) (P < 0.05). However, no statistically significant differences were found between the control and radiation groups in the DNA methylation patterns of the paternal imprinting gene H19 ICR ([0.60 ± 0.02] vs [1.40 ± 0.03]%, P > 0.05) or the maternal imprinting gene KvDMR1 ([0.00 ± 0.00] vs [1.80 ± 0.031%, P > 0.05). Mobile phone radiation reduces the progressive motility and viability of human sperm and increases sperm head defects and early apoptosis of sperm cells.

  4. Atomistic Simulations of Complex DNA DSBs and the Interactions with Ku70/80 Heterodimer

    NASA Technical Reports Server (NTRS)

    Hu, Shaowen; Cucinotta, Francis A.

    2011-01-01

    Compared to DNA with simple DSBs, the complex lesions can enhance the hydrogen bonds opening rate at the DNA terminus, and increase the mobility of the whole duplex. Binding of Ku drastically reduces the structural disruption and flexibility caused by the complex lesions. In all complex DSBs systems, the binding of DSB terminus with Ku70 is softened while the binding of the middle duplex with Ku80 is tightened. Binding of Ku promotes the rigidity of DNA duplexes, due to the clamp structure of the inner surface of the rings of Ku70/80.

  5. Analysis of large-scale gene expression data.

    PubMed

    Sherlock, G

    2000-04-01

    The advent of cDNA and oligonucleotide microarray technologies has led to a paradigm shift in biological investigation, such that the bottleneck in research is shifting from data generation to data analysis. Hierarchical clustering, divisive clustering, self-organizing maps and k-means clustering have all been recently used to make sense of this mass of data.

  6. Gasoline from coal in the state of Illinois: feasibility study. Volume I. Design. [KBW gasification process, ICI low-pressure methanol process and Mobil M-gasoline process

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1980-01-01

    Volume 1 describes the proposed plant: KBW gasification process, ICI low-pressure methanol process and Mobil M-gasoline process, and also with ancillary processes, such as oxygen plant, shift process, RECTISOL purification process, sulfur recovery equipment and pollution control equipment. Numerous engineering diagrams are included. (LTN)

  7. Short-Term Study Tours as a Driver for Increasing Domestic Student Mobility in Order to Generate Global Work-Ready Students and Cultural Exchange in Asia Pacific

    ERIC Educational Resources Information Center

    Scharoun, Lisa

    2016-01-01

    Recent federal government programmes in Australia have seen a shift in focus from the international student towards increasing the possibilities for domestic mobility through short- and long-term exchange opportunities. The current New Colombo Plan funding scheme encourages Australian students, who have traditionally undertaken semester-long…

  8. A Multi-Case Study of Research Using Mobile Imaging, Sensing and Tracking Technologies to Objectively Measure Behavior: Ethical Issues and Insights to Guide Responsible Research Practice

    ERIC Educational Resources Information Center

    Nebeker, Camille; Linares-Orozco, Rubi; Crist, Katie

    2015-01-01

    Introduction: The increased availability of mobile sensing technologies is creating a paradigm shift for health research by creating new opportunities for measuring and monitoring behavior. For example, researchers can now collect objective information about a participant's daily activity using wearable devices that have: 1- Global Positioning…

  9. Regulation of L1 expression and retrotransposition by melatonin and its receptor: implications for cancer risk associated with light exposure at night.

    PubMed

    deHaro, Dawn; Kines, Kristine J; Sokolowski, Mark; Dauchy, Robert T; Streva, Vincent A; Hill, Steven M; Hanifin, John P; Brainard, George C; Blask, David E; Belancio, Victoria P

    2014-07-01

    Expression of long interspersed element-1 (L1) is upregulated in many human malignancies. L1 can introduce genomic instability via insertional mutagenesis and DNA double-strand breaks, both of which may promote cancer. Light exposure at night, a recently recognized carcinogen, is associated with an increased risk of cancer in shift workers. We report that melatonin receptor 1 inhibits mobilization of L1 in cultured cells through downregulation of L1 mRNA and ORF1 protein. The addition of melatonin receptor antagonists abolishes the MT1 effect on retrotransposition in a dose-dependent manner. Furthermore, melatonin-rich, but not melatonin-poor, human blood collected at different times during the circadian cycle suppresses endogenous L1 mRNA during in situ perfusion of tissue-isolated xenografts of human cancer. Supplementation of human blood with exogenous melatonin or melatonin receptor antagonist during the in situ perfusion establishes a receptor-mediated action of melatonin on L1 expression. Combined tissue culture and in vivo data support that environmental light exposure of the host regulates expression of L1 elements in tumors. Our data imply that light-induced suppression of melatonin production in shift workers may increase L1-induced genomic instability in their genomes and suggest a possible connection between L1 activity and increased incidence of cancer associated with circadian disruption. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Use of Mobile Clinical Decision Support Software by Junior Doctors at a UK Teaching Hospital: Identification and Evaluation of Barriers to Engagement.

    PubMed

    Patel, Rakesh; Green, William; Shahzad, Muhammad Waseem; Larkin, Chris

    2015-08-13

    Clinical decision support (CDS) tools improve clinical diagnostic decision making and patient safety. The availability of CDS to health care professionals has grown in line with the increased prevalence of apps and smart mobile devices. Despite these benefits, patients may have safety concerns about the use of mobile devices around medical equipment. This research explored the engagement of junior doctors (JDs) with CDS and the perceptions of patients about their use. There were three objectives for this research: (1) to measure the actual usage of CDS tools on mobile devices (mCDS) by JDs, (2) to explore the perceptions of JDs about the drivers and barriers to using mCDS, and (3) to explore the perceptions of patients about the use of mCDS. This study used a mixed-methods approach to study the engagement of JDs with CDS accessed through mobile devices. Usage data were collected on the number of interactions by JDs with mCDS. The perceived drivers and barriers for JDs to using CDS were then explored by interviews. Finally, these findings were contrasted with the perception of patients about the use of mCDS by JDs. Nine of the 16 JDs made a total of 142 recorded interactions with the mCDS over a 4-month period. Only 27 of the 114 interactions (24%) that could be categorized as on-shift or off-shift occurred on-shift. Eight individual, institutional, and cultural barriers to engagement emerged from interviews with the user group. In contrast to reported cautions and concerns about the impact of clinicians' use of mobile phone on patient health and safety, patients had positive perceptions about the use of mCDS. Patients reported positive perceptions toward mCDS. The usage of mCDS to support clinical decision making was considered to be positive as part of everyday clinical practice. The degree of engagement was found to be limited due to a number of individual, institutional, and cultural barriers. The majority of mCDS engagement occurred outside of the workplace. Further research is required to verify these findings and assess their implications for future policy and practice.

  11. Current strategies for mobilome research.

    PubMed

    Jørgensen, Tue S; Kiil, Anne S; Hansen, Martin A; Sørensen, Søren J; Hansen, Lars H

    2014-01-01

    Mobile genetic elements (MGEs) are pivotal for bacterial evolution and adaptation, allowing shuffling of genes even between distantly related bacterial species. The study of these elements is biologically interesting as the mode of genetic propagation is kaleidoscopic and important, as MGEs are the main vehicles of the increasing bacterial antibiotic resistance that causes thousands of human deaths each year. The study of MGEs has previously focused on plasmids from individual isolates, but the revolution in sequencing technology has allowed the study of mobile genomic elements of entire communities using metagenomic approaches. The problem in using metagenomic sequencing for the study of MGEs is that plasmids and other mobile elements only comprise a small fraction of the total genetic content that are difficult to separate from chromosomal DNA based on sequence alone. The distinction between plasmid and chromosome is important as the mobility and regulation of genes largely depend on their genetic context. Several different approaches have been proposed that specifically enrich plasmid DNA from community samples. Here, we review recent approaches used to study entire plasmid pools from complex environments, and point out possible future developments for and pitfalls of these approaches. Further, we discuss the use of the PacBio long-read sequencing technology for MGE discovery.

  12. Inhibition of RNA polymerase II allows controlled mobilisation of retrotransposons for plant breeding.

    PubMed

    Thieme, Michael; Lanciano, Sophie; Balzergue, Sandrine; Daccord, Nicolas; Mirouze, Marie; Bucher, Etienne

    2017-07-07

    Retrotransposons play a central role in plant evolution and could be a powerful endogenous source of genetic and epigenetic variability for crop breeding. To ensure genome integrity several silencing mechanisms have evolved to repress retrotransposon mobility. Even though retrotransposons fully depend on transcriptional activity of the host RNA polymerase II (Pol II) for their mobility, it was so far unclear whether Pol II is directly involved in repressing their activity. Here we show that plants defective in Pol II activity lose DNA methylation at repeat sequences and produce more extrachromosomal retrotransposon DNA upon stress in Arabidopsis and rice. We demonstrate that combined inhibition of both DNA methylation and Pol II activity leads to a strong stress-dependent mobilization of the heat responsive ONSEN retrotransposon in Arabidopsis seedlings. The progenies of these treated plants contain up to 75 new ONSEN insertions in their genome which are stably inherited over three generations of selfing. Repeated application of heat stress in progeny plants containing increased numbers of ONSEN copies does not result in increased activation of this transposon compared to control lines. Progenies with additional ONSEN copies show a broad panel of environment-dependent phenotypic diversity. We demonstrate that Pol II acts at the root of transposon silencing. This is important because it suggests that Pol II can regulate the speed of plant evolution by fine-tuning the amplitude of transposon mobility. Our findings show that it is now possible to study induced transposon bursts in plants and unlock their use to induce epigenetic and genetic diversity for crop breeding.

  13. MD simulations of papillomavirus DNA-E2 protein complexes hints at a protein structural code for DNA deformation.

    PubMed

    Falconi, M; Oteri, F; Eliseo, T; Cicero, D O; Desideri, A

    2008-08-01

    The structural dynamics of the DNA binding domains of the human papillomavirus strain 16 and the bovine papillomavirus strain 1, complexed with their DNA targets, has been investigated by modeling, molecular dynamics simulations, and nuclear magnetic resonance analysis. The simulations underline different dynamical features of the protein scaffolds and a different mechanical interaction of the two proteins with DNA. The two protein structures, although very similar, show differences in the relative mobility of secondary structure elements. Protein structural analyses, principal component analysis, and geometrical and energetic DNA analyses indicate that the two transcription factors utilize a different strategy in DNA recognition and deformation. Results show that the protein indirect DNA readout is not only addressable to the DNA molecule flexibility but it is finely tuned by the mechanical and dynamical properties of the protein scaffold involved in the interaction.

  14. Non-B-DNA structures on the interferon-beta promoter?

    PubMed

    Robbe, K; Bonnefoy, E

    1998-01-01

    The high mobility group (HMG) I protein intervenes as an essential factor during the virus induced expression of the interferon-beta (IFN-beta) gene. It is a non-histone chromatine associated protein that has the dual capacity of binding to a non-B-DNA structure such as cruciform-DNA as well as to AT rich B-DNA sequences. In this work we compare the binding affinity of HMGI for a synthetic cruciform-DNA to its binding affinity for the HMGI-binding-site present in the positive regulatory domain II (PRDII) of the IFN-beta promoter. Using gel retardation experiments, we show that HMGI protein binds with at least ten times more affinity to the synthetic cruciform-DNA structure than to the PRDII B-DNA sequence. DNA hairpin sequences are present in both the human and the murine PRDII-DNAs. We discuss in this work the presence of, yet putative, non-B-DNA structures in the IFN-beta promoter.

  15. A homeodomain transcription factor gene, PfMSX, activates expression of Pif gene in the pearl oyster Pinctada fucata.

    PubMed

    Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi

    2014-01-01

    We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5' flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster.

  16. A Homeodomain Transcription Factor Gene, PfMSX, Activates Expression of Pif Gene in the Pearl Oyster Pinctada fucata

    PubMed Central

    Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi

    2014-01-01

    We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5′ flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster. PMID:25099698

  17. Interactions of the Metalloregulatory Protein SloR from Streptococcus mutans with Its Metal Ion Effectors and DNA Binding Site

    PubMed Central

    Corbett, John; Cornacchione, Louis; Daly, William; Galan, Diego; Wysota, Michael; Tivnan, Patrick; Collins, Justin; Nye, Dillon; Levitz, Talya; Breyer, Wendy A.; Glasfeld, Arthur

    2015-01-01

    ABSTRACT Streptococcus mutans is the causative agent of dental caries, a significant concern for human health, and therefore an attractive target for therapeutics development. Previous work in our laboratory has identified a homodimeric, manganese-dependent repressor protein, SloR, as an important regulator of cariogenesis and has used site-directed mutagenesis to map functions to specific regions of the protein. Here we extend those studies to better understand the structural interaction between SloR and its operator and its effector metal ions. The results of DNase I assays indicate that SloR protects a 42-bp region of DNA that overlaps the sloABC promoter on the S. mutans UA159 chromosome, while electrophoretic mobility shift and solution binding assays indicate that each of two SloR dimers binds to this region. Real-time semiquantitative reverse transcriptase PCR (real-time semi-qRT-PCR) experiments were used to determine the individual base pairs that contribute to SloR-DNA binding specificity. Solution studies indicate that Mn2+ is better than Zn2+ at specifically activating SloR to bind DNA, and yet the 2.8-Å resolved crystal structure of SloR bound to Zn2+ provides insight into the means by which selective activation by Mn2+ may be achieved and into how SloR may form specific interactions with its operator. Taken together, these experimental observations are significant because they can inform rational drug design aimed at alleviating and/or preventing S. mutans-induced caries formation. IMPORTANCE This report focuses on investigating the SloR protein as a regulator of essential metal ion transport and virulence gene expression in the oral pathogen Streptococcus mutans and on revealing the details of SloR binding to its metal ion effectors and binding to DNA that together facilitate this expression. We used molecular and biochemical approaches to characterize the interaction of SloR with Mn2+ and with its SloR recognition element to gain a clearer picture of the regulatory networks that optimize SloR-mediated metal ion homeostasis and virulence gene expression in S. mutans. These experiments can have a significant impact on caries treatment and/or prevention by revealing the S. mutans SloR-DNA binding interface as an appropriate target for the development of novel therapeutic interventions. PMID:26350131

  18. Analysis of the Genotoxic Effects of Mobile Phone Radiation using Buccal Micronucleus Assay: A Comparative Evaluation

    PubMed Central

    Singh, Narendra Nath; Sreedhar, Gadiputi; Mukherjee, Saikat

    2016-01-01

    Introduction Micronucleus (MN) is considered to be a reliable marker for genotoxic damage and it determines the presence and the extent of the chromosomal damage. The MN is formed due to DNA damage or chromosomal disarrangements. The MN has a close association with cancer incidences. In the new era, mobile phones are constantly gaining popularity specifically in the young generation, but this device uses radiofrequency radiation that may have a possible carcinogenic effect. The available reports related to the carcinogenic effect of mobile radiation on oral mucosa are contradictory. Aim To explore the effects of mobile phone radiation on the MN frequency in oral mucosal cells. Materials and Methods The subjects were divided into two major groups: low mobile phone users and high mobile phone users. Subjects who used their mobile phone since less than five years and less than three hours a week comprised of the first group and those who used their mobile since more than five years and more than 10 hours a week comprised of the second group. Net surfing and text messaging was not considered in this study. Exfoliated buccal mucosal cells were collected from both the groups and the cells were stained with DNA-specific stain acridine orange. Thousand exfoliated buccal mucosal cells were screened and the cells which were positive for micronuclei were counted. The micronucleus frequency was represented as mean±SD, and unpaired Student t-test was used for intergroup comparisons. Results The number of micronucleated cells/ 1000 exfoliated buccal mucosal cells was found to be significantly increased in high mobile phone users group than the low mobile phone users group. The use of mobile phone with the associated complaint of warmth around the ear showed a maximum increase in the number of micronucleated cells /1000 exfoliated buccal mucosal cells. Conclusion Mobile phone radiation even in the permissible range when used for longer duration causes significant genotoxicity. The genotoxicity can be avoided to some extent by the regular use of headphones. PMID:27135009

  19. Induction of dystrophin Dp71 expression during neuronal differentiation: opposite roles of Sp1 and AP2alpha in Dp71 promoter activity.

    PubMed

    Morales-Lázaro, Sara Luz; González-Ramírez, Ricardo; Gómez, Pablo; Tapia-Ramírez, Victor; de León, Mario Bermúdez; Cisneros, Bulmaro

    2010-01-01

    In this study, we delineated the molecular mechanisms that modulate Dp71 expression during neuronal differentiation, using the N1E-115 cell line. We demonstrated that Dp71 expression is up-regulated in response to cAMP-mediated neuronal differentiation of these cells, and that this induction is controlled at promoter level. Functional deletion analysis of the Dp71 promoter revealed that a 5'-flanking 159-bp DNA fragment that contains Sp1 and AP2 binding sites is necessary and sufficient for basal expression of this TATA-less promoter, as well as for its induction during neuronal differentiation. Electrophoretic mobility shift and chromatin immunoprecipitation assays revealed that Sp1 and AP2alpha bind to their respective DNA elements within the Dp71 basal promoter. Overall, mutagenesis assays on the Sp1 and AP2 binding sites, over-expression of Sp1 and AP2alpha, as well as knock-down experiments on Sp1 and AP2alpha gene expression established that Dp71 basal expression is controlled by the combined action of Sp1 and AP2alpha, which act as activator and repressor, respectively. Furthermore, we demonstrated that induction of Dp71 expression in differentiated cells is the result of the maintenance of positive regulation exerted by Sp1, as well as of the loss of AP2alpha binding, which ultimately releases the promoter from repression.

  20. DNA Methylation Influences Chlorogenic Acid Biosynthesis in Lonicera japonica by Mediating LjbZIP8 to Regulate Phenylalanine Ammonia-Lyase 2 Expression.

    PubMed

    Zha, Liangping; Liu, Shuang; Liu, Juan; Jiang, Chao; Yu, Shulin; Yuan, Yuan; Yang, Jian; Wang, Yaolong; Huang, Luqi

    2017-01-01

    The content of active compounds differ in buds and flowers of Lonicera japonica (FLJ) and L. japonica var. chinensis (rFLJ). Chlorogenic acid (CGAs) were major active compounds of L. japonica and regarded as measurements for quality evaluation. However, little is known concerning the formation of active compounds at the molecular level. We quantified the major CGAs in FLJ and rFLJ, and found the concentrations of CGAs were higher in the buds of rFLJ than those of FLJ. Further analysis of CpG methylation of CGAs biosynthesis genes showed differences between FLJ and rFLJ in the 5'-UTR of phenylalanine ammonia-lyase 2 ( PAL2 ). We identified 11 LjbZIP proteins and 24 rLjbZIP proteins with conserved basic leucine zipper domains, subcellular localization, and electrophoretic mobility shift assay showed that the transcription factor LjbZIP8 is a nuclear-localized protein that specifically binds to the G-box element of the LjPAL2 5'-UTR. Additionally, a transactivation assay and LjbZIP8 overexpression in transgenic tobacco indicated that LjbZIP8 could function as a repressor of transcription. Finally, treatment with 5-azacytidine decreased the transcription level of LjPAL2 and CGAs content in FLJ leaves. These results raise the possibility that DNA methylation might influence the recruitment of LjbZIP8, regulating PAL2 expression level and CGAs content in L. japonica .

  1. DNA Methylation Influences Chlorogenic Acid Biosynthesis in Lonicera japonica by Mediating LjbZIP8 to Regulate Phenylalanine Ammonia-Lyase 2 Expression

    PubMed Central

    Zha, Liangping; Liu, Shuang; Liu, Juan; Jiang, Chao; Yu, Shulin; Yuan, Yuan; Yang, Jian; Wang, Yaolong; Huang, Luqi

    2017-01-01

    The content of active compounds differ in buds and flowers of Lonicera japonica (FLJ) and L. japonica var. chinensis (rFLJ). Chlorogenic acid (CGAs) were major active compounds of L. japonica and regarded as measurements for quality evaluation. However, little is known concerning the formation of active compounds at the molecular level. We quantified the major CGAs in FLJ and rFLJ, and found the concentrations of CGAs were higher in the buds of rFLJ than those of FLJ. Further analysis of CpG methylation of CGAs biosynthesis genes showed differences between FLJ and rFLJ in the 5′-UTR of phenylalanine ammonia-lyase 2 (PAL2). We identified 11 LjbZIP proteins and 24 rLjbZIP proteins with conserved basic leucine zipper domains, subcellular localization, and electrophoretic mobility shift assay showed that the transcription factor LjbZIP8 is a nuclear-localized protein that specifically binds to the G-box element of the LjPAL2 5′-UTR. Additionally, a transactivation assay and LjbZIP8 overexpression in transgenic tobacco indicated that LjbZIP8 could function as a repressor of transcription. Finally, treatment with 5-azacytidine decreased the transcription level of LjPAL2 and CGAs content in FLJ leaves. These results raise the possibility that DNA methylation might influence the recruitment of LjbZIP8, regulating PAL2 expression level and CGAs content in L. japonica. PMID:28740500

  2. Location analysis for the estrogen receptor-α reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements

    PubMed Central

    Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.

    2010-01-01

    Location analysis for estrogen receptor-α (ERα)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERα-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10–20% nucleotide deviation from the canonical ERE sequence. We demonstrate that ∼50% of all ERα-bound loci do not have a discernable ERE and show that most ERα-bound EREs are not perfect consensus EREs. Approximately one-third of all ERα-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERα-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERα binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers. PMID:20047966

  3. Location analysis for the estrogen receptor-alpha reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements.

    PubMed

    Mason, Christopher E; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M; Kallen, Roland G; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B

    2010-04-01

    Location analysis for estrogen receptor-alpha (ERalpha)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERalpha-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10-20% nucleotide deviation from the canonical ERE sequence. We demonstrate that approximately 50% of all ERalpha-bound loci do not have a discernable ERE and show that most ERalpha-bound EREs are not perfect consensus EREs. Approximately one-third of all ERalpha-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERalpha-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERalpha binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers.

  4. Mutations in the Promoter Region of the Aldolase B Gene that cause Hereditary Fructose Intolerance

    PubMed Central

    Coffee, Erin M.; Tolan, Dean R.

    2010-01-01

    SUMMARY Hereditary fructose intolerance (HFI) is a potentially fatal inherited metabolic disease caused by a deficiency of aldolase B activity in the liver and kidney. Over 40 disease-causing mutations are known in the protein-coding region of ALDOB. Mutations upstream of the protein-coding portion of ALDOB are reported here for the first time. DNA sequence analysis of 61 HFI patients revealed single base mutations in the promoter, intronic enhancer, and the first exon, which is entirely untranslated. One mutation, g.–132G>A, is located within the promoter at an evolutionarily conserved nucleotide within a transcription factor-binding site. A second mutation, IVS1+1G>C, is at the donor splice site of the first exon. In vitro electrophoretic mobility shift assays show a decrease in nuclear extract-protein binding at the g.–132G>A mutant site. The promoter mutation results in decreased transcription using luciferase reporter plasmids. Analysis of cDNA from cells transfected with plasmids harboring the IVS1+1G>C mutation results in aberrant splicing leading to complete retention of the first intron (~ 5 kb). The IVS1+1G>C splicing mutation results in loss of luciferase activity from a reporter plasmid. These novel mutations in ALDOB represent 2% of alleles in American HFI patients, with IVS1+1G>C representing a significantly higher allele frequency (6%) among HFI patients of Hispanic and African-American ethnicity. PMID:20882353

  5. Functional Characterization of the Mannitol Promoter of Pseudomonas fluorescens DSM 50106 and Its Application for a Mannitol-Inducible Expression System for Pseudomonas putida KT2440

    PubMed Central

    Hoffmann, Jana; Altenbuchner, Josef

    2015-01-01

    A new pBBR1MCS-2-derived vector containing the Pseudomonas fluorescens DSM10506 mannitol promoter PmtlE and mtlR encoding its AraC/XylS type transcriptional activator was constructed and optimized for low basal expression. Mannitol, arabitol, and glucitol-inducible gene expression was demonstrated with Pseudomonas putida and eGFP as reporter gene. The new vector was applied for functional characterization of PmtlE. Identification of the DNA binding site of MtlR was achieved by in vivo eGFP measurement with PmtlE wild type and mutants thereof. Moreover, purified MtlR was applied for detailed in vitro investigations using electrophoretic mobility shift assays and DNaseI footprinting experiments. The obtained data suggest that MtlR binds to PmtlE as a dimer. The proposed DNA binding site of MtlR is AGTGC-N5-AGTAT-N7-AGTGC-N5-AGGAT. The transcription activation mechanism includes two binding sites with different binding affinities, a strong upstream binding site and a weaker downstream binding site. The presence of the weak downstream binding site was shown to be necessary to sustain mannitol-inducibility of PmtlE. Two possible functions of mannitol are discussed; the effector might stabilize binding of the second monomer to the downstream half site or promote transcription activation by inducing a conformational change of the regulator that influences the contact to the RNA polymerase. PMID:26207762

  6. A microfluidics-based mobility shift assay to identify new inhibitors of β-secretase for Alzheimer's disease.

    PubMed

    Liu, Rongfeng; Liu, Yu-Chih; Meng, Junwei; Zhu, Haiyan; Zhang, Xuehong

    2017-11-01

    The β-secretase (BACE1) initiates the generation of toxic amyloid-β peptide (Aβ) from amyloid-β precursor protein (APP), which was widely considered to play a key role in the pathogenesis of Alzheimer's disease (AD). Here, a novel microfluidics-based mobility shift assay (MMSA) was developed, validated, and applied for the screening of BACE1 inhibitors for AD. First, the BACE1 activity assay was established with a new fluorescent peptide substrate (FAM-EVNLDAEF) derived from the Swedish mutant APP, and high-quality ratiometric data were generated in both endpoint and kinetic modes by electrophoretic separation of peptide substrate from the BACE1 cleaved product (FAM-EVNL) before fluorescence quantification. To validate the assay, the inhibition and kinetic parameter values of two known inhibitors (AZD3839 and AZD3293) were evaluated, and the results were in good agreement with those reported by other methods. Finally, the assay was applied to screen for new inhibitors from a 900-compound library in a 384-well format, and one novel hit (IC 50 = 26.5 ± 1.5 μM) was identified. Compared with the common fluorescence-based assays, the primary advantage of the direct MMSA was to discover novel BACE1 inhibitors with lower auto-fluorescence interference, and its superb capability for kinetic study. Graphical abstract Microfluidics-based mobility shift assay for BACE1.

  7. Modulation and coding for fast fading mobile satellite communication channels

    NASA Technical Reports Server (NTRS)

    Mclane, P. J.; Wittke, P. H.; Smith, W. S.; Lee, A.; Ho, P. K. M.; Loo, C.

    1988-01-01

    The performance of Gaussian baseband filtered minimum shift keying (GMSK) using differential detection in fast Rician fading, with a novel treatment of the inherent intersymbol interference (ISI) leading to an exact solution is discussed. Trellis-coded differentially coded phase shift keying (DPSK) with a convolutional interleaver is considered. The channel is the Rician Channel with the line-of-sight component subject to a lognormal transformation.

  8. Nonadiabatic tapered optical fiber sensor for measuring interaction nicotine with DNA

    NASA Astrophysics Data System (ADS)

    Zibaii, M. I.; Latifi, H.; Pourbeyram, H.; Gholami, M.; Taghipour, Z.; Saeedian, Z.; Hosseini, S. M.

    2011-05-01

    A nonadiabatic tapered optical fiber sensor was utilized for studying of bimolecular interactions including DNA-DNA and DNA-Drug interaction. This work presents a simple evanescent wave sensing system based on an interferometric approach, suitable to meet the requirements of lable-free sensor systems for detecting biomolecular interactions. We have demonstrated the measuring refractive index and the real time detection of interactions between biomolecules. Furthermore basic experiments were carried out, for detecting the hybridization of 25-mer DNA with an immobilized counterpart on the surface. The overall shift after the successful DNA hybridization was 9.5 nm. In this work, a new approach for studying DNA-drug interactions was successfully tested. Nicotine as a carcinogenic compound in cigarette smoke plays an important role in interaction with DNA. Different concentrations of nicotine were applied to observe the Longmuir interaction with DNA.

  9. Flavin Charge Transfer Transitions Assist DNA Photolyase Electron Transfer

    NASA Astrophysics Data System (ADS)

    Skourtis, Spiros S.; Prytkova, Tatiana; Beratan, David N.

    2007-12-01

    This contribution describes molecular dynamics, semi-empirical and ab-initio studies of the primary photo-induced electron transfer reaction in DNA photolyase. DNA photolyases are FADH--containing proteins that repair UV-damaged DNA by photo-induced electron transfer. A DNA photolyase recognizes and binds to cyclobutatne pyrimidine dimer lesions of DNA. The protein repairs a bound lesion by transferring an electron to the lesion from FADH-, upon photo-excitation of FADH- with 350-450 nm light. We compute the lowest singlet excited states of FADH- in DNA photolyase using INDO/S configuration interaction, time-dependent density-functional, and time-dependent Hartree-Fock methods. The calculations identify the lowest singlet excited state of FADH- that is populated after photo-excitation and that acts as the electron donor. For this donor state we compute conformationally-averaged tunneling matrix elements to empty electron-acceptor states of a thymine dimer bound to photolyase. The conformational averaging involves different FADH--thymine dimer confromations obtained from molecular dynamics simulations of the solvated protein with a thymine dimer docked in its active site. The tunneling matrix element computations use INDO/S-level Green's function, energy splitting, and Generalized Mulliken-Hush methods. These calculations indicate that photo-excitation of FADH- causes a π→π* charge-transfer transition that shifts electron density to the side of the flavin isoalloxazine ring that is adjacent to the docked thymine dimer. This shift in electron density enhances the FADH--to-dimer electronic coupling, thus inducing rapid electron transfer.

  10. A close relative of the nuclear, chromosomal high-mobility group protein HMG1 in yeast mitochondria.

    PubMed Central

    Diffley, J F; Stillman, B

    1991-01-01

    ABF2 (ARS-binding factor 2), a small, basic DNA-binding protein that binds specifically to the autonomously replicating sequence ARS1, is located primarily in the mitochondria of the yeast Saccharomyces cerevisiae. The abundance of ABF2 and the phenotype of abf2- null mutants argue that this protein plays a key role in the structure, maintenance, and expression of the yeast mitochondrial genome. The predicted amino acid sequence of ABF2 is closely related to the high-mobility group proteins HMG1 and HMG2 from vertebrate cell nuclei and to several other DNA-binding proteins. Additionally, ABF2 and the other HMG-related proteins are related to a globular domain from the heat shock protein hsp70 family. ABF2 interacts with DNA both nonspecifically and in a specific manner within regulatory regions, suggesting a mechanism whereby it may aid in compacting the mitochondrial genome without interfering with expression. Images PMID:1881919

  11. A panel study of occupational exposure to fine particulate matter and changes in DNA methylation over a single workday and years worked in boilermaker welders

    PubMed Central

    2013-01-01

    Background Exposure to pollutants including metals and particulate air pollution can alter DNA methylation. Yet little is known about intra-individual changes in DNA methylation over time in relationship to environmental exposures. Therefore, we evaluated the effects of acute- and chronic metal-rich PM2.5 exposures on DNA methylation. Methods Thirty-eight male boilermaker welders participated in a panel study for a total of 54 person days. Whole blood was collected prior to any welding activities (pre-shift) and immediately after the exposure period (post-shift). The percentage of methylated cytosines (%mC) in LINE-1, Alu, and inducible nitric oxide synthase gene (iNOS) were quantified using pyrosequencing. Personal PM2.5 (particulate matter with an aerodynamic diameter ≤ 2.5 μm) was measured over the work-shift. A questionnaire assessed job history and years worked as a boilermaker. Linear mixed models with repeated measures evaluated associations between DNA methylation, PM2.5 concentration (acute exposure), and years worked as a boilermaker (chronic exposure). Results PM2.5 exposure was associated with increased methylation in the promoter region of the iNOS gene (β = 0.25, SE: 0.11, p-value = 0.04). Additionally, the number of years worked as a boilermaker was associated with increased iNOS methylation (β = 0.03, SE: 0.01, p-value = 0.03). No associations were observed for Alu or LINE-1. Conclusions Acute and chronic exposure to PM2.5 generated from welding activities was associated with a modest change in DNA methylation of the iNOS gene. Future studies are needed to confirm this association and determine if the observed small increase in iNOS methylation are associated with changes in NO production or any adverse health effect. PMID:23758843

  12. Role of the Acidic Tail of High Mobility Group Protein B1 (HMGB1) in Protein Stability and DNA Bending

    PubMed Central

    Belgrano, Fabricio S.; de Abreu da Silva, Isabel C.; Bastos de Oliveira, Francisco M.; Fantappié, Marcelo R.; Mohana-Borges, Ronaldo

    2013-01-01

    High mobility group box (HMGB) proteins are abundant nonhistone proteins found in all eukaryotic nuclei and are capable of binding/bending DNA. The human HMGB1 is composed of two binding motifs, known as Boxes A and B, are L-shaped alpha-helix structures, followed by a random-coil acidic tail that consists of 30 Asp and Glu residues. This work aimed at evaluating the role of the acidic tail of human HMGB1 in protein stability and DNA interactions. For this purpose, we cloned, expressed and purified HMGB1 and its tailless form, HMGB1ΔC, in E. coli strain. Tryptophan fluorescence spectroscopy and circular dichroism (CD) experiments clearly showed an increase in protein stability promoted by the acidic tail under different conditions, such as the presence of the chemical denaturant guanidine hydrochloride (Gdn.HCl), high temperature and low pH. Folding intermediates found at low pH for both proteins were denatured only in the presence of chemical denaturant, thus showing a relatively high stability. The acidic tail did not alter the DNA-binding properties of the protein, although it enhanced the DNA bending capability from 76° (HMGB1ΔC) to 91° (HMGB1), as measured using the fluorescence resonance energy transfer technique. A model of DNA bending in vivo was proposed, which might help to explain the interaction of HMGB1 with DNA and other proteins, i.e., histones, and the role of that protein in chromatin remodeling. PMID:24255708

  13. Oral administration of copper to rats leads to increased lymphocyte cellular DNA degradation by dietary polyphenols: implications for a cancer preventive mechanism.

    PubMed

    Khan, Husain Y; Zubair, Haseeb; Ullah, Mohd F; Ahmad, Aamir; Hadi, Sheikh M

    2011-12-01

    To account for the observed anticancer properties of plant polyphenols, we have earlier proposed a mechanism which involves the mobilization of endogenous copper ions by polyphenols leading to the generation of reactive oxygen species (ROS) that serve as proximal DNA cleaving agents and lead to cell death. Over the last decade we have proceeded to validate our hypothesis with considerable success. As a further confirmation of our hypothesis, in this paper we first show that oral administration of copper to rats leads to elevated copper levels in lymphocytes. When such lymphocytes with a copper overload were isolated and treated with polyphenols EGCG, genistein and resveratrol, an increased level of DNA breakage was observed. Further, preincubation of lymphocytes having elevated copper levels with the membrane permeable copper chelator neocuproine, resulted in inhibition of polyphenol induced DNA degradation. However, membrane impermeable chelator of copper bathocuproine, as well as iron and zinc chelators were ineffective in causing such inhibition in DNA breakage, confirming the involvement of endogenous copper in polyphenol induced cellular DNA degradation. It is well established that serum and tissue concentrations of copper are greatly increased in various malignancies. In view of this fact, the present results further confirm our earlier findings and strengthen our hypothesis that an important anticancer mechanism of plant polyphenols could be the mobilization of intracellular copper leading to ROS-mediated cellular DNA breakage. In this context, it may be noted that cancer cells are under considerable oxidative stress and increasing such stress to cytotoxic levels could be a successful anticancer approach.

  14. The constant region affects antigen binding of antibodies to DNA by altering secondary structure.

    PubMed

    Xia, Yumin; Janda, Alena; Eryilmaz, Ertan; Casadevall, Arturo; Putterman, Chaim

    2013-11-01

    We previously demonstrated an important role of the constant region in the pathogenicity of anti-DNA antibodies. To determine the mechanisms by which the constant region affects autoantibody binding, a panel of isotype-switch variants (IgG1, IgG2a, IgG2b) was generated from the murine PL9-11 IgG3 autoantibody. The affinity of the PL9-11 antibody panel for histone was measured by surface plasmon resonance (SPR). Tryptophan fluorescence was used to determine wavelength shifts of the antibody panel upon binding to DNA and histone. Finally, circular dichroism spectroscopy was used to measure changes in secondary structure. SPR analysis revealed significant differences in histone binding affinity between members of the PL9-11 panel. The wavelength shifts of tryptophan fluorescence emission were found to be dependent on the antibody isotype, while circular dichroism analysis determined that changes in antibody secondary structure content differed between isotypes upon antigen binding. Thus, the antigen binding affinity is dependent on the particular constant region expressed. Moreover, the effects of antibody binding to antigen were also constant region dependent. Alteration of secondary structures influenced by constant regions may explain differences in fine specificity of anti-DNA antibodies between antibodies with similar variable regions, as well as cross-reactivity of anti-DNA antibodies with non-DNA antigens. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Ligand induced stabilization of the melting temperature of the HSV-1 single-strand DNA binding protein using the thermal shift assay.

    PubMed

    Rupesh, Kanchi Ravi; Smith, Aaron; Boehmer, Paul E

    2014-11-28

    We have adapted the thermal shift assay to measure the ligand binding properties of the herpes simplex virus-1 single-strand DNA binding protein, ICP8. By measuring SYPRO Orange fluorescence in microtiter plates using a fluorescence-enabled thermal cycler, we have quantified the effects of oligonucleotide ligands on the melting temperature of ICP8. We found that single-stranded oligomers raise the melting temperature of ICP8 in a length- and concentration-dependent manner, ranging from 1°C for (dT)5 to a maximum of 9°C with oligomers ⩾10 nucleotides, with an apparent Kd of <1μM for (dT)20. Specifically, the results indicate that ICP8 is capable of interacting with oligomers as short as 5 nucleotides. Moreover, the observed increases in melting temperature of up to 9°C, indicates that single-strand DNA binding significantly stabilizes the structure of ICP8. This assay may be applied to investigate the ligand binding proteins of other single-strand DNA binding proteins and used as a high-throughput screen to identify compounds with therapeutic potential that inhibit single-strand DNA binding. As proof of concept, the single-strand DNA binding agent ciprofloxacin reduces the ligand induced stabilization of the melting temperature of ICP8 in a dose-dependent manner. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. A method for modelling peak signal statistics on a mobile satellite transponder

    NASA Technical Reports Server (NTRS)

    Bilodeau, Andre; Lecours, Michel; Pelletier, Marcel; Delisle, Gilles Y.

    1990-01-01

    A simulation method is proposed. The simulation was developed to model the peak duration and energy content of signal peaks in a mobile communication satellite operating in a Frequency Division Multiple Access (FDMA) mode and presents an estimate of those power peaks for a system where the channels are modeled as band limited Gaussian noise, which is taken as a reasonable representation for Amplitude Commanded Single Sideband (ACSSB), Minimum Shift Keying (MSK), or Phase Shift Keying (PSK) modulated signals. The simulation results show that, under this hypothesis, the level of the signal power peaks for 10 percent, 1 percent, and 0.1 percent of the time are well described by a Rayleigh law and that their duration is extremely short and inversely proportional to the total FDM system bandwidth.

  17. The 2100MHz radiofrequency radiation of a 3G-mobile phone and the DNA oxidative damage in brain.

    PubMed

    Sahin, Duygu; Ozgur, Elcin; Guler, Goknur; Tomruk, Arın; Unlu, Ilhan; Sepici-Dinçel, Aylin; Seyhan, Nesrin

    2016-09-01

    We aimed to evaluate the effect of 2100MHz radiofrequency radiation emitted by a generator, simulating a 3G-mobile phone on the brain of rats during 10 and 40 days of exposure. The female rats were randomly divided into four groups. Group I; exposed to 3G modulated 2100MHz RFR signal for 6h/day, 5 consecutive days/wk for 2 weeks, group II; control 10 days, were kept in an inactive exposure set-up for 6h/day, 5 consecutive days/wk for 2 weeks, group III; exposed to 3G modulated 2100MHz RFR signal for 6h/day, 5 consecutive days/wk for 8 weeks and group IV; control 40 days, were kept in an inactive exposure set-up for 6h/day, 5 consecutive days/wk for 8 weeks. After the genomic DNA content of brain was extracted, oxidative DNA damage (8-hydroxy-2'deoxyguanosine, pg/mL) and malondialdehyde (MDA, nmoL/g tissue) levels were determined. Our main finding was the increased oxidative DNA damage to brain after 10 days of exposure with the decreased oxidative DNA damage following 40 days of exposure compared to their control groups. Besides decreased lipid peroxidation end product, MDA, was observed after 40 days of exposure. The measured decreased quantities of damage during the 40 days of exposure could be the means of adapted and increased DNA repair mechanisms. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Role of IKK-alpha in the EGFR Signaling Regulation

    DTIC Science & Technology

    2014-09-01

    Rho family GTPase (VAV2), and Phospholipase C (PLC) (4). These signaling activities regulate cell proliferation, mobility , and differentiation in...correlation coefficient r=0.63, pɘ.05) was found, suggesting that high IKK promotes EGFR phosphorylation in breast cancer cells (Fig. 3G ...phosphorylation (Figure 2E). Since protein phosphorylation sometimes results in a mobility shift in SDS-PAGE, we used a phospho-tag to capture phospho

  19. Federated Ground Station Network Model and Interface Specification

    DTIC Science & Technology

    2014-12-01

    interface definition language JSON JavaScript Object Notation LEO low Earth orbit LNA low-noise amplifier MC3 Mobile CubeSat Command and Control...Naval Research Laboratory OQPSK offset quadrature phase-shift keying xviii P2P peer-to-peer PKI public key infrastructure REST Representational...enhanced our work being performed on the Mobile CubeSat Command and Control (MC3) ground station network. You also provided crucial guidance from

  20. "MXing it up": how African adolescents may affect social change through mobile phone use.

    PubMed

    Napolitano, Christopher M

    2010-01-01

    This chapter outlines mobile phone use among African (particularly South African) adolescents. With an estimated 350 million active mobile phone subscriptions, improving network infrastructure, low-cost Internet-ready handsets, innovative programs and applications, mobiles in Africa, and their increasingly younger, increasingly poorer, and increasingly savvy users have the potential to act as conduits for local and regional socially just change. This broad-based connectedness not only provides access to information, but also, and crucially, connects individuals and their social, intellectual, and financial capital. It may represent a powerful, transformative shift in a region where access to similar technologies was historically limited to a privileged few. In order to best leverage these developments and opportunities to promote socially just change, I argue that future mobile-based programs or initiatives in the region should be based in both contemporary developmental systems theory as well as current, popular mobile applications and services.

  1. State of the cart.

    PubMed

    Bernstein, C; Weiss, S; Lorenzini, B

    1994-03-15

    Food on wheels: it's here, there and everywhere. But while some operations rev up cart expansion plans, others have shifted into low gear. Here's an update on that '90s phenomenon: mobile merchandising.

  2. Sensitivity of spiral ganglion neurons to damage caused by mobile phone electromagnetic radiation will increase in lipopolysaccharide-induced inflammation in vitro model.

    PubMed

    Zuo, Wen-Qi; Hu, Yu-Juan; Yang, Yang; Zhao, Xue-Yan; Zhang, Yuan-Yuan; Kong, Wen; Kong, Wei-Jia

    2015-05-29

    With the increasing popularity of mobile phones, the potential hazards of radiofrequency electromagnetic radiation (RF-EMR) on the auditory system remain unclear. Apart from RF-EMR, humans are also exposed to various physical and chemical factors. We established a lipopolysaccharide (LPS)-induced inflammation in vitro model to investigate whether the possible sensitivity of spiral ganglion neurons to damage caused by mobile phone electromagnetic radiation (at specific absorption rates: 2, 4 W/kg) will increase. Spiral ganglion neurons (SGN) were obtained from neonatal (1- to 3-day-old) Sprague Dawley® (SD) rats. After the SGN were treated with different concentrations (0, 20, 40, 50, 100, 200, and 400 μg/ml) of LPS, the Cell Counting Kit-8 (CCK-8) and alkaline comet assay were used to quantify cellular activity and DNA damage, respectively. The SGN were treated with the moderate LPS concentrations before RF-EMR exposure. After 24 h intermittent exposure at an absorption rate of 2 and 4 W/kg, DNA damage was examined by alkaline comet assay, ultrastructure changes were detected by transmission electron microscopy, and expression of the autophagy markers LC3-II and Beclin1 were examined by immunofluorescence and confocal laser scanning microscopy. Reactive oxygen species (ROS) production was quantified by the dichlorofluorescin-diacetate assay. LPS (100 μg/ml) induced DNA damage and suppressed cellular activity (P < 0.05). LPS (40 μg/ml) did not exhibit cellular activity changes or DNA damage (P > 0.05); therefore, 40 μg/ml was used to pretreat the concentration before exposure to RF-EMR. RF-EMR could not directly induce DNA damage. However, the 4 W/kg combined with LPS (40 μg/ml) group showed mitochondria vacuoles, karyopyknosis, presence of lysosomes and autophagosome, and increasing expression of LC3-II and Beclin1. The ROS values significantly increased in the 4 W/kg exposure, 4 W/kg combined with LPS (40 μg/ml) exposure, and H2O2 groups (P < 0.05, 0.01). Short-term exposure to radiofrequency electromagnetic radiation could not directly induce DNA damage in normal spiral ganglion neurons, but it could cause the changes of cellular ultrastructure at special SAR 4.0 W/kg when cells are in fragile or micro-damaged condition. It seems that the sensitivity of SGN to damage caused by mobile phone electromagnetic radiation will increase in a lipopolysaccharide-induced inflammation in vitro model.

  3. [A fluoride-sensor for kink structure in DNA condensation process].

    PubMed

    Liu, Yan-Hui; Zhang, Jing; Chen, Ying-Bing; Li, Yu-Pu; Hu, Lin

    2014-01-01

    Bloomfield has pointed out that the kink structure occurs for sharp bending during DNA condensation process, until now, which has not been proved by experiments. Using UV Spectrophotometer, the effects of fluoride and chlorine on the polyamine-DNA condensation system can be detected. Fluoride and chlorine both belong to the halogen family, but their effects on spermine-DNA condensation system are totally different. Fluoride ions make blue-shift and hyperchromicity appear in the spermine-DNA condensation system, but chlorine ions only make insignificant hyperchromicity happen in this system. Both fluoride ions and chlorine ions only make insignificant hyperchromicity happen in spermidine-DNA condensation system. Based on the distinguished character of fluoride, a fluoride-sensor for "kink" structure in DNA condensation was developed and the second kind of "kink" structure only appear in the spermine-DNA condensation system.

  4. Photographic measurement of head and cervical posture when viewing mobile phone: a pilot study.

    PubMed

    Guan, Xiaofei; Fan, Guoxin; Wu, Xinbo; Zeng, Ying; Su, Hang; Gu, Guangfei; Zhou, Qi; Gu, Xin; Zhang, Hailong; He, Shisheng

    2015-12-01

    With the dramatic growth of mobile phone usage, concerns have been raised with regard to the adverse health effects of mobile phone on spinal posture. The aim of this study was to determine the head and cervical postures by photogrammetry when viewing the mobile phone screen, compared with those in neutral standing posture. A total of 186 subjects (81 females and 105 males) aged from 17 to 31 years old participated in this study. Subjects were instructed to stand neutrally and using mobile phone as in daily life. Using a photographic method, the sagittal head and cervical postures were assessed by head tilt angle, neck tilt angle, forward head shift and gaze angle. The photographic method showed a high intra-rater and inter-rater reliability in measuring the sagittal posture of cervical spine and gaze angle (ICCs ranged from 0.80 to 0.99). When looking at mobile phone, the head tilt angle significantly increased (from 74.55° to 95.22°, p = 0.000) and the neck angle decreased (from 54.68° to 38.77°, p = 0.000). The forward head posture was also confirmed by the significantly increased head shift (from 10.90 to 13.85 cm, p = 0.000). The posture assumed in mobile phone use was significantly correlated with neutral posture (p < 0.05). Males displayed a more forward head posture than females (p < 0.05). The head tilt angle was positively correlated with the gaze angle (r = 0.616, p = 0.000), while the neck tilt angle was negatively correlated with the gaze angle (r = -0.628, p = 0.000). Photogrammetry is a reliable, quantitative method to evaluate the head and cervical posture during mobile phone use. Compared to neutral standing, subjects display a more forward head posture when viewing the mobile phone screen, which is correlated with neutral posture, gaze angle and gender. Future studies will be needed to investigate a dose-response relationship between mobile phone use and assumed posture.

  5. Dimeric fluorescent energy transfer dyes comprising asymmetric cyanine azole-indolenine chromophores

    DOEpatents

    Glazer, Alexander N.; Benson, Scott C.

    1996-01-01

    Novel fluorescent DNA-staining dyes are provided combining asymmetric cyanine azole-indolenine dyes, which provide for strong DNA affinity, large Stokes shifts and emission in the red region of the spectrum. The dyes find particular application in gel electrophoresis and for labels which may be bound to a variety of compositions in a variety of contexts.

  6. High Sensitivity Detection of CdSe/ZnS Quantum Dot-Labeled DNA Based on N-type Porous Silicon Microcavities

    PubMed Central

    Lv, Changwu; Jia, Zhenhong; Lv, Jie; Zhang, Hongyan; Li, Yanyu

    2017-01-01

    N-type macroporous silicon microcavity structures were prepared using electrochemical etching in an HF solution in the absence of light and oxidants. The CdSe/ZnS water-soluble quantum dot-labeled DNA target molecules were detected by monitoring the microcavity reflectance spectrum, which was characterized by the reflectance spectrum defect state position shift resulting from changes to the structures’ refractive index. Quantum dots with a high refractive index and DNA coupling can improve the detection sensitivity by amplifying the optical response signals of the target DNA. The experimental results show that DNA combined with a quantum dot can improve the sensitivity of DNA detection by more than five times. PMID:28045442

  7. High Sensitivity Detection of CdSe/ZnS Quantum Dot-Labeled DNA Based on N-type Porous Silicon Microcavities.

    PubMed

    Lv, Changwu; Jia, Zhenhong; Lv, Jie; Zhang, Hongyan; Li, Yanyu

    2017-01-01

    N-type macroporous silicon microcavity structures were prepared using electrochemical etching in an HF solution in the absence of light and oxidants. The CdSe/ZnS water-soluble quantum dot-labeled DNA target molecules were detected by monitoring the microcavity reflectance spectrum, which was characterized by the reflectance spectrum defect state position shift resulting from changes to the structures' refractive index. Quantum dots with a high refractive index and DNA coupling can improve the detection sensitivity by amplifying the optical response signals of the target DNA. The experimental results show that DNA combined with a quantum dot can improve the sensitivity of DNA detection by more than five times.

  8. Social Properties of Mobile Video

    NASA Astrophysics Data System (ADS)

    Mitchell, April Slayden; O'Hara, Kenton; Vorbau, Alex

    Mobile video is now an everyday possibility with a wide array of commercially available devices, services, and content. These new technologies have created dramatic shifts in the way video-based media can be produced, consumed, and delivered by people beyond the familiar behaviors associated with fixed TV and video technologies. Such technology revolutions change the way users behave and change their expectations in regards to their mobile video experiences. Building upon earlier studies of mobile video, this paper reports on a study using diary techniques and ethnographic interviews to better understand how people are using commercially available mobile video technologies in their everyday lives. Drawing on reported episodes of mobile video behavior, the study identifies the social motivations and values underpinning these behaviors that help characterize mobile video consumption beyond the simplistic notion of viewing video only to kill time. This paper also discusses the significance of user-generated content and the usage of video in social communities through the description of two mobile video technology services that allow users to create and share content. Implications for adoption and design of mobile video technologies and services are discussed as well.

  9. Using Eye Tracking to Explore Consumers' Visual Behavior According to Their Shopping Motivation in Mobile Environments.

    PubMed

    Hwang, Yoon Min; Lee, Kun Chang

    2017-07-01

    Despite a strong shift to mobile shopping trends, many in-depth questions about mobile shoppers' visual behaviors in mobile shopping environments remain unaddressed. This study aims to answer two challenging research questions (RQs): (a) how much does shopping motivation like goal orientation and recreation influence mobile shoppers' visual behavior toward displays of shopping information on a mobile shopping screen and (b) how much of mobile shoppers' visual behavior influences their purchase intention for the products displayed on a mobile shopping screen? An eye-tracking approach is adopted to answer the RQs empirically. The experimental results showed that goal-oriented shoppers paid closer attention to products' information areas to meet their shopping goals. Their purchase intention was positively influenced by their visual attention to the two areas of interest such as product information and consumer opinions. In contrast, recreational shoppers tended to visually fixate on the promotion area, which positively influences their purchase intention. The results contribute to understanding mobile shoppers' visual behaviors and shopping intentions from the perspective of mindset theory.

  10. From Multilingualism to Bilingualism: Changes in Language Use, Language Value, and Social Mobility among Engdewu Speakers in the Solomon Islands

    ERIC Educational Resources Information Center

    Emerine Hicks, Rachel

    2017-01-01

    On the island of Santa Cruz in the Solomon Islands, the Engdewu language is facing imminent language shift because of the increasing use of the lingua franca Solomon Islands Pijin in the community. In this article, I argue that this language shift is occurring because of changes to the social structure in Baemawz, one of the villages where Engdewu…

  11. Isolation of a 5-Kilodalton Actin-Sequestering Peptide from Human Blood Platelets

    NASA Astrophysics Data System (ADS)

    Safer, Daniel; Golla, Rajasree; Nachmias, Vivianne T.

    1990-04-01

    Resting human platelets contain ≈0.3 mM unpolymerized actin. When freshly drawn and washed platelets are treated with saponin, 85-90% of the unpolymerized actin diffuses out. Analysis by polyacrylamide gel electrophoresis under nondenaturing conditions shows that the bulk of this unpolymerized actin migrates with a higher mobility than does pure G-actin, profilactin, or actin-gelsolin complex. When muscle G-actin is added to fresh or boiled saponin extract, the added muscle actin is shifted to the high-mobility form. The saponin extract contains an acidic peptide having a molecular mass in the range of 5 kDa, which has been purified to homogeneity by reverse-phase HPLC. This peptide also shifts muscle actin to the high-mobility form. Addition of either boiled saponin extract or the purified peptide to muscle G-actin also strongly and stoichiometrically inhibits salt-induced polymerization, as assayed by falling-ball viscometry and by sedimentation. We conclude that this peptide binds to the bulk of the unpolymerized actin in platelets and prevents it from polymerizing.

  12. Rat L (long interspersed repeated DNA) elements contain guanine-rich homopurine sequences that induce unpairing of contiguous duplex DNA.

    PubMed Central

    Usdin, K; Furano, A V

    1988-01-01

    The L family (long interspersed repeated DNA) of mobile genetic elements is a persistent feature of the mammalian genome. In rats, this family contains approximately equal to 40,000 members and accounts for approximately equal to 10% of the haploid genome. We demonstrate here that the guanine-rich homopurine stretches located at the right end of L-DNA induce oligonucleotide uptake by contiguous duplex DNA. The uptake is dependent on negative supercoiling and the length of the homopurine stretch and occurs even when the L-DNA homopurine stretches are introduced into a different DNA environment. The bound oligomer primes DNA synthesis when DNA polymerase and deoxyribonucleoside triphosphates are added, resulting in a faithful copy of the template to which the oligonucleotide had bound. The implications of this property of the L-DNA guanine-rich homopurine stretches in the amplification, recombination, and dispersal of L elements is discussed. Images PMID:2837766

  13. Dose related shifts in the developmental progress of chick embryos exposed to mobile phone induced electromagnetic fields.

    PubMed

    Zareen, Nusrat; Khan, Muhammad Yunus; Minhas, Liaqat Ali

    2009-01-01

    The possible adverse effects of Electromagnetic Fields (EMFs) emitted from mobile phones present a major public concern today. Some studies indicate EMFs effects on genes, free radical production, immunological and carcinogenic effects. On the other hand there are studies which do not support the hypothesis of any biological impacts of EMFs. This study was designed to observe the effects of mobile phone induced EMFs on survival and general growth and development of chick embryo, investigating dose-response relationship if any. This was an experimental study in which developing chick embryos were exposed to different doses of mobile phone induced EMFs. For this purpose a mobile phone was placed in the incubator in the centre of fertilised eggs in silent ringing mode and was 'rung' upon from any other line or cell phone. After incubation for 10 or 15 days the eggs were opened and the developmental mile-stones of the surviving embryos were compared with the non exposed subgroup. EMFs exposure significantly decreased the survivability of the chick embryos. The lower doses of EMFs caused growth retardation. However, this effect of growth retardation reallocated to partial growth enhancement on increasing the dose of EMFs and shifted over to definite growth enhancement on further raising the dose. There is an adverse effect of EMFs exposure on embryo survivability. Chick embryos developmental process is influenced by EMFs. However, these effects are variable depending upon the dose of EMFs exposure.

  14. Annual time-series analysis of aqueous eDNA reveals ecologically relevant dynamics of lake ecosystem biodiversity

    PubMed Central

    Bista, Iliana; Carvalho, Gary R.; Walsh, Kerry; Seymour, Mathew; Hajibabaei, Mehrdad; Lallias, Delphine; Christmas, Martin; Creer, Simon

    2017-01-01

    The use of environmental DNA (eDNA) in biodiversity assessments offers a step-change in sensitivity, throughput and simultaneous measures of ecosystem diversity and function. There remains, however, a need to examine eDNA persistence in the wild through simultaneous temporal measures of eDNA and biota. Here, we use metabarcoding of two markers of different lengths, derived from an annual time series of aqueous lake eDNA to examine temporal shifts in ecosystem biodiversity and in an ecologically important group of macroinvertebrates (Diptera: Chironomidae). The analyses allow different levels of detection and validation of taxon richness and community composition (β-diversity) through time, with shorter eDNA fragments dominating the eDNA community. Comparisons between eDNA, community DNA, taxonomy and UK species abundance data further show significant relationships between diversity estimates derived across the disparate methodologies. Our results reveal the temporal dynamics of eDNA and validate the utility of eDNA metabarcoding for tracking seasonal diversity at the ecosystem scale. PMID:28098255

  15. Annual time-series analysis of aqueous eDNA reveals ecologically relevant dynamics of lake ecosystem biodiversity

    NASA Astrophysics Data System (ADS)

    Bista, Iliana; Carvalho, Gary R.; Walsh, Kerry; Seymour, Mathew; Hajibabaei, Mehrdad; Lallias, Delphine; Christmas, Martin; Creer, Simon

    2017-01-01

    The use of environmental DNA (eDNA) in biodiversity assessments offers a step-change in sensitivity, throughput and simultaneous measures of ecosystem diversity and function. There remains, however, a need to examine eDNA persistence in the wild through simultaneous temporal measures of eDNA and biota. Here, we use metabarcoding of two markers of different lengths, derived from an annual time series of aqueous lake eDNA to examine temporal shifts in ecosystem biodiversity and in an ecologically important group of macroinvertebrates (Diptera: Chironomidae). The analyses allow different levels of detection and validation of taxon richness and community composition (β-diversity) through time, with shorter eDNA fragments dominating the eDNA community. Comparisons between eDNA, community DNA, taxonomy and UK species abundance data further show significant relationships between diversity estimates derived across the disparate methodologies. Our results reveal the temporal dynamics of eDNA and validate the utility of eDNA metabarcoding for tracking seasonal diversity at the ecosystem scale.

  16. Backbone assignment of the little finger domain of a Y-family DNA polymerase.

    PubMed

    Ma, Dejian; Fowler, Jason D; Suo, Zucai

    2011-10-01

    Sulfolobus solfataricus DNA polymerase IV (Dpo4), a prototype Y-family DNA polymerase, contains a unique little finger domain besides a catalytic core. Here, we report the chemical shift assignments for the backbone nitrogens, α and β carbons, and amide protons of the little finger domain of Dpo4. This work and our published backbone assignment for the catalytic core provide the basis for investigating the conformational dynamics of Dpo4 during catalysis using solution NMR spectroscopy.

  17. Mobile phone specific electromagnetic fields induce transient DNA damage and nucleotide excision repair in serum-deprived human glioblastoma cells.

    PubMed

    Al-Serori, Halh; Ferk, Franziska; Kundi, Michael; Bileck, Andrea; Gerner, Christopher; Mišík, Miroslav; Nersesyan, Armen; Waldherr, Monika; Murbach, Manuel; Lah, Tamara T; Herold-Mende, Christel; Collins, Andrew R; Knasmüller, Siegfried

    2018-01-01

    Some epidemiological studies indicate that the use of mobile phones causes cancer in humans (in particular glioblastomas). It is known that DNA damage plays a key role in malignant transformation; therefore, we investigated the impact of the UMTS signal which is widely used in mobile telecommunications, on DNA stability in ten different human cell lines (six brain derived cell lines, lymphocytes, fibroblasts, liver and buccal tissue derived cells) under conditions relevant for users (SAR 0.25 to 1.00 W/kg). We found no evidence for induction of damage in single cell gel electrophoresis assays when the cells were cultivated with serum. However, clear positive effects were seen in a p53 proficient glioblastoma line (U87) when the cells were grown under serum free conditions, while no effects were found in p53 deficient glioblastoma cells (U251). Further experiments showed that the damage disappears rapidly in U87 and that exposure induced nucleotide excision repair (NER) and does not cause double strand breaks (DSBs). The observation of NER induction is supported by results of a proteome analysis indicating that several proteins involved in NER are up-regulated after exposure to UMTS; additionally, we found limited evidence for the activation of the γ-interferon pathway. The present findings show that the signal causes transient genetic instability in glioma derived cells and activates cellular defense systems.

  18. Analysis of energy states where electrons and holes coexist in pseudomorphically strained InAs high-electron-mobility transistors

    NASA Astrophysics Data System (ADS)

    Nishio, Yui; Sato, Takato; Hirayama, Naomi; Iida, Tsutomu; Takanashi, Yoshifumi

    2016-04-01

    In strained high-electron-mobility transistors (HEMTs) with InAs as the channel, excess electrons and holes are generated in the drain region by impact ionization. In the source region, electrons are injected to recombine with accumulated holes by the Auger process. This causes the shift of the gate potential, V GS,shift, for HEMTs. For a system where electrons and holes coexist, we established a theory taking into account the nonparabolicity of the conduction band in the InAs channel. This theory enables us to rigorously determine not only the energy states and the concentration profiles for both carriers but also the V GS,shift due to an accumulation of holes. We have derived the Auger recombination theory which takes into account the Fermi-Dirac statistics and is applicable to an arbitrary shape of potential energy. The Auger recombination lifetime τA for InAs-PHEMTs was estimated as a function of the sheet hole concentration, p s, and τA was on the order of psec for p s exceeding 1012 cm-2.

  19. Sub-diffusion and trapped dynamics of neutral and charged probes in DNA-protein coacervates

    NASA Astrophysics Data System (ADS)

    Arfin, Najmul; Yadav, Avinash Chand; Bohidar, H. B.

    2013-11-01

    The physical mechanism leading to the formation of large intermolecular DNA-protein complexes has been studied. Our study aims to explain the occurrence of fast coacervation dynamics at the charge neutralization point, followed by the appearance of smaller complexes and slower coacervation dynamics as the complex experiences overcharging. Furthermore, the electrostatic potential and probe mobility was investigated to mimic the transport of DNA / DNA-protein complex in a DNA-protein complex coacervate medium [N. Arfin and H. B. Bohidar, J. Phys. Chem. B 116, 13192 (2012)] by assigning neutral, negative, or positive charge to the probe particle. The mobility of the neutral probe was maximal at low matrix concentrations and showed random walk behavior, while its mobility ceased at the jamming concentration of c = 0.6, showing sub-diffusion and trapped dynamics. The positively charged probe showed sub-diffusive random walk followed by trapped dynamics, while the negatively charged probe showed trapping with occasional hopping dynamics at much lower concentrations. Sub-diffusion of the probe was observed in all cases under consideration, where the electrostatic interaction was used exclusively as the dominant force involved in the dynamics. For neutral and positive probes, the mean square displacement ⟨R2⟩ exhibits a scaling with time as ⟨R2⟩ ˜ tα, distinguishing random walk and trapped dynamics at α = 0.64 ± 0.04 at c = 0.12 and c = 0.6, respectively. In addition, the same scaling factors with the exponent β = 0.64 ± 0.04 can be used to distinguish random walk and trapped dynamics for the neutral and positive probes using the relation between the number of distinct sites visited by the probe, S(t), which follows the scaling, S(t) ˜ tβ/ln (t). Our results established the occurrence of a hierarchy of diffusion dynamics experienced by a probe in a dense medium that is either charged or neutral.

  20. Mapping protein-DNA and protein-protein interactions of ATP-dependent chromatin remodelers.

    PubMed

    Hota, Swetansu K; Dechassa, Mekonnen Lemma; Prasad, Punit; Bartholomew, Blaine

    2012-01-01

    Chromatin plays a key regulatory role in several DNA-dependent processes as it regulates DNA access to different protein factors. Several multisubunit protein complexes interact, modify, or mobilize nucleosomes: the basic unit of chromatin, from its original location in an ATP-dependent manner to facilitate processes, such as transcription, replication, repair, and recombination. Knowledge of the interactions of chromatin remodelers with nucleosomes is a crucial requirement to understand the mechanism of chromatin remodeling. Here, we describe several methods to analyze the interactions of multisubunit chromatin-remodeling enzymes with nucleosomes.

  1. Effect of 3G cell phone exposure with computer controlled 2-D stepper motor on non-thermal activation of the hsp27/p38MAPK stress pathway in rat brain.

    PubMed

    Kesari, Kavindra Kumar; Meena, Ramovatar; Nirala, Jayprakash; Kumar, Jitender; Verma, H N

    2014-03-01

    Cell phone radiation exposure and its biological interaction is the present concern of debate. Present study aimed to investigate the effect of 3G cell phone exposure with computer controlled 2-D stepper motor on 45-day-old male Wistar rat brain. Animals were exposed for 2 h a day for 60 days by using mobile phone with angular movement up to zero to 30°. The variation of the motor is restricted to 90° with respect to the horizontal plane, moving at a pre-determined rate of 2° per minute. Immediately after 60 days of exposure, animals were scarified and numbers of parameters (DNA double-strand break, micronuclei, caspase 3, apoptosis, DNA fragmentation, expression of stress-responsive genes) were performed. Result shows that microwave radiation emitted from 3G mobile phone significantly induced DNA strand breaks in brain. Meanwhile a significant increase in micronuclei, caspase 3 and apoptosis were also observed in exposed group (P < 0.05). Western blotting result shows that 3G mobile phone exposure causes a transient increase in phosphorylation of hsp27, hsp70, and p38 mitogen-activated protein kinase (p38MAPK), which leads to mitochondrial dysfunction-mediated cytochrome c release and subsequent activation of caspases, involved in the process of radiation-induced apoptotic cell death. Study shows that the oxidative stress is the main factor which activates a variety of cellular signal transduction pathways, among them the hsp27/p38MAPK is the pathway of principle stress response. Results conclude that 3G mobile phone radiations affect the brain function and cause several neurological disorders.

  2. Bioinformatics Approaches for Fetal DNA Fraction Estimation in Noninvasive Prenatal Testing

    PubMed Central

    Peng, Xianlu Laura; Jiang, Peiyong

    2017-01-01

    The discovery of cell-free fetal DNA molecules in plasma of pregnant women has created a paradigm shift in noninvasive prenatal testing (NIPT). Circulating cell-free DNA in maternal plasma has been increasingly recognized as an important proxy to detect fetal abnormalities in a noninvasive manner. A variety of approaches for NIPT using next-generation sequencing have been developed, which have been rapidly transforming clinical practices nowadays. In such approaches, the fetal DNA fraction is a pivotal parameter governing the overall performance and guaranteeing the proper clinical interpretation of testing results. In this review, we describe the current bioinformatics approaches developed for estimating the fetal DNA fraction and discuss their pros and cons. PMID:28230760

  3. Bioinformatics Approaches for Fetal DNA Fraction Estimation in Noninvasive Prenatal Testing.

    PubMed

    Peng, Xianlu Laura; Jiang, Peiyong

    2017-02-20

    The discovery of cell-free fetal DNA molecules in plasma of pregnant women has created a paradigm shift in noninvasive prenatal testing (NIPT). Circulating cell-free DNA in maternal plasma has been increasingly recognized as an important proxy to detect fetal abnormalities in a noninvasive manner. A variety of approaches for NIPT using next-generation sequencing have been developed, which have been rapidly transforming clinical practices nowadays. In such approaches, the fetal DNA fraction is a pivotal parameter governing the overall performance and guaranteeing the proper clinical interpretation of testing results. In this review, we describe the current bioinformatics approaches developed for estimating the fetal DNA fraction and discuss their pros and cons.

  4. Triplex DNA-binding proteins are associated with clinical outcomes revealed by proteomic measurements in patients with colorectal cancer

    PubMed Central

    2012-01-01

    Background Tri- and tetra-nucleotide repeats in mammalian genomes can induce formation of alternative non-B DNA structures such as triplexes and guanine (G)-quadruplexes. These structures can induce mutagenesis, chromosomal translocations and genomic instability. We wanted to determine if proteins that bind triplex DNA structures are quantitatively or qualitatively different between colorectal tumor and adjacent normal tissue and if this binding activity correlates with patient clinical characteristics. Methods Extracts from 63 human colorectal tumor and adjacent normal tissues were examined by gel shifts (EMSA) for triplex DNA-binding proteins, which were correlated with clinicopathological tumor characteristics using the Mann-Whitney U, Spearman’s rho, Kaplan-Meier and Mantel-Cox log-rank tests. Biotinylated triplex DNA and streptavidin agarose affinity binding were used to purify triplex-binding proteins in RKO cells. Western blotting and reverse-phase protein array were used to measure protein expression in tissue extracts. Results Increased triplex DNA-binding activity in tumor extracts correlated significantly with lymphatic disease, metastasis, and reduced overall survival. We identified three multifunctional splicing factors with biotinylated triplex DNA affinity: U2AF65 in cytoplasmic extracts, and PSF and p54nrb in nuclear extracts. Super-shift EMSA with anti-U2AF65 antibodies produced a shifted band of the major EMSA H3 complex, identifying U2AF65 as the protein present in the major EMSA band. U2AF65 expression correlated significantly with EMSA H3 values in all extracts and was higher in extracts from Stage III/IV vs. Stage I/II colon tumors (p = 0.024). EMSA H3 values and U2AF65 expression also correlated significantly with GSK3 beta, beta-catenin, and NF- B p65 expression, whereas p54nrb and PSF expression correlated with c-Myc, cyclin D1, and CDK4. EMSA values and expression of all three splicing factors correlated with ErbB1, mTOR, PTEN, and Stat5. Western blots confirmed that full-length and truncated beta-catenin expression correlated with U2AF65 expression in tumor extracts. Conclusions Increased triplex DNA-binding activity in vitro correlates with lymph node disease, metastasis, and reduced overall survival in colorectal cancer, and increased U2AF65 expression is associated with total and truncated beta-catenin expression in high-stage colorectal tumors. PMID:22682314

  5. Temperature-induced band shift in bulk γ-InSe by angle-resolved photoemission spectroscopy

    NASA Astrophysics Data System (ADS)

    Xu, Huanfeng; Wang, Wei; Zhao, Yafei; Zhang, Xiaoqian; Feng, Yue; Tu, Jian; Gu, Chenyi; Sun, Yizhe; Liu, Chang; Nie, Yuefeng; Edmond Turcu, Ion C.; Xu, Yongbing; He, Liang

    2018-05-01

    Indium selenide (InSe) has recently become popular research topics because of its unique layered crystal structure, direct band gap and high electron mobilities. In this work, we have acquired the electronic structure of bulk γ-InSe at various temperatures using angle-resolved photoemission spectroscopy (ARPES). We have also found that as the temperature decreases, the valence bands of γ-InSe exhibit a monotonic shift to lower binding energies. This band shift is attributed to the change of lattice parameters and has been validated by variable temperature X-ray diffraction measurements and theoretical calculations.

  6. DNA-Binding Interaction Studies of Microwave Assisted Synthesized Sulfonamide Substituted 8-Hydroxyquinoline Derivatives.

    PubMed

    Dixit, Ritu B; Patel, Tarosh S; Vanparia, Satish F; Kunjadiya, Anju P; Keharia, Harish R; Dixit, Bharat C

    2011-01-01

    Sulfonamide substituted 8-hydroxyquinoline derivatives were prepared using a microwave synthesizer. The interaction of sulfonamide substituted 8-hydroxyquinoline derivatives and their transition metal complexes with Plasmid (pUC 19) DNA and Calf Thymus DNA were investigated by UV spectroscopic studies and gel electrophoresis measurements. The interaction between ligand/metal complexes and DNA was carried out by increasing the concentration of DNA from 0 to 12 μl in UV spectroscopic study, while the concentration of DNA in gel electrophoresis remained constant at 10 μl. These studies supported the fact that, the complex binds to DNA by intercalation via ligand into the base pairs of DNA. The relative binding efficacy of the complexes to DNA was much higher than the binding efficacy of ligands, especially the complex of Cu-AHQMBSH had the highest binding ability to DNA. The mobility of the bands decreased as the concentration of the complex was increased, indicating that there was increase in the interaction between the metal ion and DNA. Complexes of AHQMBSH were excellent for DNA binding as compared to HQMABS.

  7. Female and Male Perspectives on the Neolithic Transition in Europe: Clues from Ancient and Modern Genetic Data

    PubMed Central

    Rasteiro, Rita; Chikhi, Lounès

    2013-01-01

    The arrival of agriculture into Europe during the Neolithic transition brought a significant shift in human lifestyle and subsistence. However, the conditions under which the spread of the new culture and technologies occurred are still debated. Similarly, the roles played by women and men during the Neolithic transition are not well understood, probably due to the fact that mitochondrial DNA (mtDNA) and Y chromosome (NRY) data are usually studied independently rather than within the same statistical framework. Here, we applied an integrative approach, using different model-based inferential techniques, to analyse published datasets from contemporary and ancient European populations. By integrating mtDNA and NRY data into the same admixture approach, we show that both males and females underwent the same admixture history and both support the demic diffusion model of Ammerman and Cavalli-Sforza. Similarly, the patterns of genetic diversity found in extant and ancient populations demonstrate that both modern and ancient mtDNA support the demic diffusion model. They also show that population structure and differential growth between farmers and hunter-gatherers are necessary to explain both types of data. However, we also found some differences between male and female markers, suggesting that the female effective population size was larger than that of the males, probably due to different demographic histories. We argue that these differences are most probably related to the various shifts in cultural practices and lifestyles that followed the Neolithic Transition, such as sedentism, the shift from polygyny to monogamy or the increase of patrilocality. PMID:23613761

  8. Female and male perspectives on the neolithic transition in Europe: clues from ancient and modern genetic data.

    PubMed

    Rasteiro, Rita; Chikhi, Lounès

    2013-01-01

    The arrival of agriculture into Europe during the Neolithic transition brought a significant shift in human lifestyle and subsistence. However, the conditions under which the spread of the new culture and technologies occurred are still debated. Similarly, the roles played by women and men during the Neolithic transition are not well understood, probably due to the fact that mitochondrial DNA (mtDNA) and Y chromosome (NRY) data are usually studied independently rather than within the same statistical framework. Here, we applied an integrative approach, using different model-based inferential techniques, to analyse published datasets from contemporary and ancient European populations. By integrating mtDNA and NRY data into the same admixture approach, we show that both males and females underwent the same admixture history and both support the demic diffusion model of Ammerman and Cavalli-Sforza. Similarly, the patterns of genetic diversity found in extant and ancient populations demonstrate that both modern and ancient mtDNA support the demic diffusion model. They also show that population structure and differential growth between farmers and hunter-gatherers are necessary to explain both types of data. However, we also found some differences between male and female markers, suggesting that the female effective population size was larger than that of the males, probably due to different demographic histories. We argue that these differences are most probably related to the various shifts in cultural practices and lifestyles that followed the Neolithic Transition, such as sedentism, the shift from polygyny to monogamy or the increase of patrilocality.

  9. Current strategies for mobilome research

    PubMed Central

    Jørgensen, Tue S.; Kiil, Anne S.; Hansen, Martin A.; Sørensen, Søren J.; Hansen, Lars H.

    2015-01-01

    Mobile genetic elements (MGEs) are pivotal for bacterial evolution and adaptation, allowing shuffling of genes even between distantly related bacterial species. The study of these elements is biologically interesting as the mode of genetic propagation is kaleidoscopic and important, as MGEs are the main vehicles of the increasing bacterial antibiotic resistance that causes thousands of human deaths each year. The study of MGEs has previously focused on plasmids from individual isolates, but the revolution in sequencing technology has allowed the study of mobile genomic elements of entire communities using metagenomic approaches. The problem in using metagenomic sequencing for the study of MGEs is that plasmids and other mobile elements only comprise a small fraction of the total genetic content that are difficult to separate from chromosomal DNA based on sequence alone. The distinction between plasmid and chromosome is important as the mobility and regulation of genes largely depend on their genetic context. Several different approaches have been proposed that specifically enrich plasmid DNA from community samples. Here, we review recent approaches used to study entire plasmid pools from complex environments, and point out possible future developments for and pitfalls of these approaches. Further, we discuss the use of the PacBio long-read sequencing technology for MGE discovery. PMID:25657641

  10. Spectroscopic insights into quadruplexes of five-repeat telomere DNA sequences upon G-block damage.

    PubMed

    Dvořáková, Zuzana; Vorlíčková, Michaela; Renčiuk, Daniel

    2017-11-01

    The DNA lesions, resulting from oxidative damage, were shown to destabilize human telomere four-repeat quadruplex and to alter its structure. Long telomere DNA, as a repetitive sequence, offers, however, other mechanisms of dealing with the lesion: extrusion of the damaged repeat into loop or shifting the quadruplex position by one repeat. Using circular dichroism and UV absorption spectroscopy and polyacrylamide electrophoresis, we studied consequences of lesions at different positions of the model five-repeat human telomere DNA sequences on the structure and stability of their quadruplexes in sodium and in potassium. The repeats affected by lesion are preferentially positioned as terminal overhangs of the core quadruplex structurally similar to the four-repeat one. Forced affecting of the inner repeats leads to presence of variety of more parallel folds in potassium. In sodium the designed models form mixture of two dominant antiparallel quadruplexes whose population varies with the position of the affected repeat. The shapes of quadruplex CD spectra, namely the height of dominant peaks, significantly correlate with melting temperatures. Lesion in one guanine tract of a more than four repeats long human telomere DNA sequence may cause re-positioning of its quadruplex arrangement associated with a shift of the structure to less common quadruplex conformations. The type of the quadruplex depends on the loop position and external conditions. The telomere DNA quadruplexes are quite resistant to the effect of point mutations due to the telomere DNA repetitive nature, although their structure and, consequently, function might be altered. Copyright © 2017. Published by Elsevier B.V.

  11. Infrared Sensor System for Mobile-Robot Positioning in Intelligent Spaces

    PubMed Central

    Gorostiza, Ernesto Martín; Galilea, José Luis Lázaro; Meca, Franciso Javier Meca; Monzú, David Salido; Zapata, Felipe Espinosa; Puerto, Luis Pallarés

    2011-01-01

    The aim of this work was to position a Mobile Robot in an Intelligent Space, and this paper presents a sensorial system for measuring differential phase-shifts in a sinusoidally modulated infrared signal transmitted from the robot. Differential distances were obtained from these phase-shifts, and the position of the robot was estimated by hyperbolic trilateration. Due to the extremely severe trade-off between SNR, angle (coverage) and real-time response, a very accurate design and device selection was required to achieve good precision with wide coverage and acceptable robot speed. An I/Q demodulator was used to measure phases with one-stage synchronous demodulation to DC. A complete set of results from real measurements, both for distance and position estimations, is provided to demonstrate the validity of the system proposed, comparing it with other similar indoor positioning systems. PMID:22163907

  12. The Chd1 Chromatin Remodeler Shifts Nucleosomal DNA Bidirectionally as a Monomer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Qiu, Yupeng; Levendosky, Robert F.; Chakravarthy, Srinivas

    Chromatin remodelers catalyze dynamic packaging of the genome by carrying out nucleosome assembly/disassembly, histone exchange, and nucleosome repositioning. Remodeling results in evenly spaced nucleosomes, which requires probing both sides of the nucleosome, yet the way remodelers organize sliding activity to achieve this task is not understood. Here, we show that the monomeric Chd1 remodeler shifts DNA back and forth by dynamically alternating between different segments of the nucleosome. During sliding, Chd1 generates unstable remodeling intermediates that spontaneously relax to a pre-remodeled position. We demonstrate that nucleosome sliding is tightly controlled by two regulatory domains: the DNA-binding domain, which interferes withmore » sliding when its range is limited by a truncated linking segment, and the chromodomains, which play a key role in substrate discrimination. We propose that active interplay of the ATPase motor with the regulatory domains may promote dynamic nucleosome structures uniquely suited for histone exchange and chromatin reorganization during transcription.« less

  13. Mitochondrial DNA polymorphism in a maternal lineage of Holstein cows.

    PubMed Central

    Hauswirth, W W; Laipis, P J

    1982-01-01

    Two mitochondrial genotypes are shown to exist within one Holstein cow maternal lineage. They were detected by the appearance of an extra Hae III recognition site in one genotype. The nucleotide sequence of this region has been determined and the genotypes are distinguished by an adenine/guanine base transition which creates the new Hae III site. This point mutation occurs within an open reading frame at the third position of a glycine codon and therefore does not alter the amino acid sequence. The present pattern of genotypes within the lineage demands that multiple shifts between genotypes must have occurred within the past 20 years with the most rapid shift taking place in no more than 4 years and indicates that mitochondrial DNA polymorphism can occur between maternally related mammals. The process that gave rise to different genotypes in one lineage is clearly of fundamental importance in understanding intraspecific mitochondrial polymorphism and evolution in mammals. Several potential mechanisms for rapid mitochondrial DNA variation are discussed in light of these results. Images PMID:6289312

  14. A DNA-scaffold platform enhances a multi-enzymatic cycling reaction.

    PubMed

    Mashimo, Yasumasa; Mie, Masayasu; Kobatake, Eiry

    2018-04-01

    We explored the co-localization of multiple enzymes on a DNA backbone via a DNA-binding protein, Gene-A* (A*-tag) to increase the efficiency of cascade enzymatic reactions. Firefly luciferase (FLuc) and pyruvate orthophosphate dikinase (PPDK) were genetically fused with A*-tag and modified with single-stranded (ss) DNA via A*-tag. The components were assembled on ssDNA by hybridization, thereby enhancing the efficiency of the cascading bioluminescent reaction producing light emission from pyrophosphate. The activity of A*-tag in each enzyme was investigated with dye-labeled DNA. Co-localization of the enzymes via hybridization was examined using a gel shift assay. The multi-enzyme complex showed significant improvement in the overall efficiency of the cascading reaction in comparison to a mixture of free enzymes. A*-tag is highly convenient for ssDNA modification of versatile enzymes, and it can be used for construction of functional DNA-enzyme complexes.

  15. Sequence-dependent DNA flexibility mediates DNase I cleavage.

    PubMed

    Heddi, Brahim; Abi-Ghanem, Josephine; Lavigne, Marc; Hartmann, Brigitte

    2010-01-08

    Understanding the preference of nonspecific proteins for certain DNA structural features requires an accurate description of the properties of free DNA, especially regarding their possible predisposition to adopt a conformation that favors the formation of a complex. Exploiting previous exhaustive NMR studies performed on free DNA oligomers, we investigated the molecular basis of DNase I sensitivity under conditions where DNase I binding limits the probability of cleavage. We showed that cleavage intensity was correlated with adjacent 3' phosphate linkage flexibility, monitored by (31)P chemical shifts. Examining NMR-refined DNA structures highlighted that sequence-dependent flexible phosphates were associated with large minor groove variations that may promote the affinity of DNase I, according to relevant DNA-protein complexes. In sum, this work demonstrates that specificity in DNA-DNase I interaction is mediated by DNA flexibility, which influences the induced-fit transitions required to form productive complexes.

  16. Cancer, viruses, and mass migration: Paul Berg's venture into eukaryotic biology and the advent of recombinant DNA research and technology, 1967-1980.

    PubMed

    Yi, Doogab

    2008-01-01

    The existing literature on the development of recombinant DNA technology and genetic engineering tends to focus on Stanley Cohen and Herbert Boyer's recombinant DNA cloning technology and its commercialization starting in the mid-1970s. Historians of science, however, have pointedly noted that experimental procedures for making recombinant DNA molecules were initially developed by Stanford biochemist Paul Berg and his colleagues, Peter Lobban and A. Dale Kaiser in the early 1970s. This paper, recognizing the uneasy disjuncture between scientific authorship and legal invention in the history of recombinant DNA technology, investigates the development of recombinant DNA technology in its full scientific context. I do so by focusing on Stanford biochemist Berg's research on the genetic regulation of higher organisms. As I hope to demonstrate, Berg's new venture reflected a mass migration of biomedical researchers as they shifted from studying prokaryotic organisms like bacteria to studying eukaryotic organisms like mammalian and human cells. It was out of this boundary crossing from prokaryotic to eukaryotic systems through virus model systems that recombinant DNA technology and other significant new research techniques and agendas emerged. Indeed, in their attempt to reconstitute 'life' as a research technology, Stanford biochemists' recombinant DNA research recast genes as a sequence that could be rewritten thorough biochemical operations. The last part of this paper shifts focus from recombinant DNA technology's academic origins to its transformation into a genetic engineering technology by examining the wide range of experimental hybridizations which occurred as techniques and knowledge circulated between Stanford biochemists and the Bay Area's experimentalists. Situating their interchange in a dense research network based at Stanford's biochemistry department, this paper helps to revise the canonized history of genetic engineering's origins that emerged during the patenting of Cohen-Boyer's recombinant DNA cloning procedures.

  17. Expression, purification, and DNA-binding activity of the Herbaspirillum seropedicae RecX protein.

    PubMed

    Galvão, Carolina W; Pedrosa, Fábio O; Souza, Emanuel M; Yates, M Geoffrey; Chubatsu, Leda S; Steffens, Maria Berenice R

    2004-06-01

    The Herbaspirillum seropedicae RecX protein participates in the SOS response: a process in which the RecA protein plays a central role. The RecX protein of the H. seropedicae, fused to a His-tag sequence (RecX His-tagged), was over-expressed in Escherichia coli and purified by metal-affinity chromatography to yield a highly purified and active protein. DNA band-shift assays showed that the RecX His-tagged protein bound to both circular and linear double-stranded DNA and also to circular single-stranded DNA. The apparent affinity of RecX for DNA decreased in the presence of Mg(2+) ions. The ability of RecX to bind DNA may be relevant to its function in the SOS response.

  18. Mobile DNA in cancer. Extensive transduction of nonrepetitive DNA mediated by L1 retrotransposition in cancer genomes.

    PubMed

    Tubio, Jose M C; Li, Yilong; Ju, Young Seok; Martincorena, Inigo; Cooke, Susanna L; Tojo, Marta; Gundem, Gunes; Pipinikas, Christodoulos P; Zamora, Jorge; Raine, Keiran; Menzies, Andrew; Roman-Garcia, Pablo; Fullam, Anthony; Gerstung, Moritz; Shlien, Adam; Tarpey, Patrick S; Papaemmanuil, Elli; Knappskog, Stian; Van Loo, Peter; Ramakrishna, Manasa; Davies, Helen R; Marshall, John; Wedge, David C; Teague, Jon W; Butler, Adam P; Nik-Zainal, Serena; Alexandrov, Ludmil; Behjati, Sam; Yates, Lucy R; Bolli, Niccolo; Mudie, Laura; Hardy, Claire; Martin, Sancha; McLaren, Stuart; O'Meara, Sarah; Anderson, Elizabeth; Maddison, Mark; Gamble, Stephen; Foster, Christopher; Warren, Anne Y; Whitaker, Hayley; Brewer, Daniel; Eeles, Rosalind; Cooper, Colin; Neal, David; Lynch, Andy G; Visakorpi, Tapio; Isaacs, William B; Veer, Laura Van't; Caldas, Carlos; Desmedt, Christine; Sotiriou, Christos; Aparicio, Sam; Foekens, John A; Eyfjörd, Jórunn Erla; Lakhani, Sunil R; Thomas, Gilles; Myklebost, Ola; Span, Paul N; Børresen-Dale, Anne-Lise; Richardson, Andrea L; Van de Vijver, Marc; Vincent-Salomon, Anne; Van den Eynden, Gert G; Flanagan, Adrienne M; Futreal, P Andrew; Janes, Sam M; Bova, G Steven; Stratton, Michael R; McDermott, Ultan; Campbell, Peter J

    2014-08-01

    Long interspersed nuclear element-1 (L1) retrotransposons are mobile repetitive elements that are abundant in the human genome. L1 elements propagate through RNA intermediates. In the germ line, neighboring, nonrepetitive sequences are occasionally mobilized by the L1 machinery, a process called 3' transduction. Because 3' transductions are potentially mutagenic, we explored the extent to which they occur somatically during tumorigenesis. Studying cancer genomes from 244 patients, we found that tumors from 53% of the patients had somatic retrotranspositions, of which 24% were 3' transductions. Fingerprinting of donor L1s revealed that a handful of source L1 elements in a tumor can spawn from tens to hundreds of 3' transductions, which can themselves seed further retrotranspositions. The activity of individual L1 elements fluctuated during tumor evolution and correlated with L1 promoter hypomethylation. The 3' transductions disseminated genes, exons, and regulatory elements to new locations, most often to heterochromatic regions of the genome. Copyright © 2014, American Association for the Advancement of Science.

  19. Schizosaccharomyces pombe Retrotransposon Tf2 Mobilizes Primarily through Homologous cDNA Recombination

    PubMed Central

    Hoff, Eleanor F.; Levin, Henry L.; Boeke, Jef D.

    1998-01-01

    The Tf2 retrotransposon, found in the fission yeast Schizosaccharomyces pombe, is nearly identical to its sister element, Tf1, in its reverse transcriptase-RNase H and integrase domains but is very divergent in the gag domain, the protease, the 5′ untranslated region, and the U3 domain of the long terminal repeats. It has now been demonstrated that a neo-marked copy of Tf2 overexpressed from a heterologous promoter can mobilize into the S. pombe genome and produce true transposition events. However, the Tf2-neo mobilization frequency is 10- to 20-fold lower than that of Tf1-neo, and 70% of the Tf2-neo events are homologous recombination events generated independently of a functional Tf2 integrase. Thus, the Tf2 element is primarily dependent on homologous recombination with preexisting copies of Tf2 for its propagation. Finally, production of Tf2-neo proteins and cDNA was also analyzed; surprisingly, Tf2 was found to produce its reverse transcriptase as a single species in which it is fused to protease, unlike all other retroviruses and retrotransposons. PMID:9774697

  20. Effect of C(60) fullerene on the duplex formation of i-motif DNA with complementary DNA in solution.

    PubMed

    Jin, Kyeong Sik; Shin, Su Ryon; Ahn, Byungcheol; Jin, Sangwoo; Rho, Yecheol; Kim, Heesoo; Kim, Seon Jeong; Ree, Moonhor

    2010-04-15

    The structural effects of fullerene on i-motif DNA were investigated by characterizing the structures of fullerene-free and fullerene-bound i-motif DNA, in the presence of cDNA and in solutions of varying pH, using circular dichroism and synchrotron small-angle X-ray scattering. To facilitate a direct structural comparison between the i-motif and duplex structures in response to pH stimulus, we developed atomic scale structural models for the duplex and i-motif DNA structures, and for the C(60)/i-motif DNA hybrid associated with the cDNA strand, assuming that the DNA strands are present in an ideal right-handed helical conformation. We found that fullerene shifted the pH-induced conformational transition between the i-motif and the duplex structure, possibly due to the hydrophobic interactions between the terminal fullerenes and between the terminal fullerenes and an internal TAA loop in the DNA strand. The hybrid structure showed a dramatic reduction in cyclic hysteresis.

Top