Chen, Xiang
2013-09-01
A benzamide molecule is used as a "reader" molecule to form hydrogen bonds with five single DNA bases, i.e., four normal single DNA bases A,T,C,G and one for 5methylC. The whole molecule is then attached to the gold surface so that a meta-molecule junction is formed. We calculate the transmission function and conductance for the five metal-molecule systems, with the implementation of density functional theory-based non-equilibrium Green function method. Our results show that each DNA base exhibits a unique conductance and most of them are on the pS level. The distinguishable conductance of each DNA base provides a way for the fast sequencing of DNA. We also investigate the dependence of conductivity of such a metal-molecule system on the hydrogen bond length between the "reader" molecule and DNA base, which shows that conductance follows an exponential decay as the hydrogen bond length increases, i.e., the conductivity is highly sensitive to the change in hydrogen bond length.
Improved DNA hybridization parameters by Twisted Intercalating Nucleic Acid (TINA).
Schneider, Uffe Vest
2012-01-01
This thesis establishes oligonucleotide design rules and applications of a novel group of DNA stabilizing molecules collectively called Twisted Intercalating Nucleic Acid - TINA. Three peer-reviewed publications form the basis for the thesis. One publication describes an improved and rapid method for determination of DNA melting points and two publications describe the effects of positioning TINA molecules in parallel triplex helix and antiparallel duplex helix forming DNA structures. The third publication establishes that TINA molecules containing oligonucleotides improve an antiparallel duplex hybridization based capture assay's analytical sensitivity compared to conventionel DNA oligonucleotides. Clinical microbiology is traditionally based on pathogenic microorganisms' culture and serological tests. The introduction of DNA target amplification methods like PCR has improved the analytical sensitivity and total turn around time involved in clinical diagnostics of infections. Due to the relatively weak hybridization between the two strands of double stranded DNA, a number of nucleic acid stabilizing molecules have been developed to improve the sensitivity of DNA based diagnostics through superior binding properties. A short introduction is given to Watson-Crick and Hoogsteen based DNA binding and the derived DNA structures. A number of other nucleic acid stabilizing molecules are described. The stabilizing effect of TINA molecules on different DNA structures is discussed and considered in relation to other nucleic acid stabilizing molecules and in relation to future use of TINA containing oligonucleotides in clinical diagnostics and therapy. In conclusion, design of TINA modified oligonucleotides for antiparallel duplex helixes and parallel triplex helixes follows simple purpose dependent rules. TINA molecules are well suited for improving multiplex PCR assays and can be used as part of novel technologies. Future research should test whether combinations of TINA molecules and other nucleic acid stabilizing molecules can increase analytical sensitivity whilst maintaining nucleobase mismatch discrimination in triplex helix based diagnostic assays.
An evolution based biosensor receptor DNA sequence generation algorithm.
Kim, Eungyeong; Lee, Malrey; Gatton, Thomas M; Lee, Jaewan; Zang, Yupeng
2010-01-01
A biosensor is composed of a bioreceptor, an associated recognition molecule, and a signal transducer that can selectively detect target substances for analysis. DNA based biosensors utilize receptor molecules that allow hybridization with the target analyte. However, most DNA biosensor research uses oligonucleotides as the target analytes and does not address the potential problems of real samples. The identification of recognition molecules suitable for real target analyte samples is an important step towards further development of DNA biosensors. This study examines the characteristics of DNA used as bioreceptors and proposes a hybrid evolution-based DNA sequence generating algorithm, based on DNA computing, to identify suitable DNA bioreceptor recognition molecules for stable hybridization with real target substances. The Traveling Salesman Problem (TSP) approach is applied in the proposed algorithm to evaluate the safety and fitness of the generated DNA sequences. This approach improves efficiency and stability for enhanced and variable-length DNA sequence generation and allows extension to generation of variable-length DNA sequences with diverse receptor recognition requirements.
NASA Astrophysics Data System (ADS)
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark
2003-01-01
Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251
Bui, Phuc Tan; Nishino, Tomoaki; Shiigi, Hiroshi; Nagaoka, Tsutomu
2015-01-31
A DNA molecule was utilized as a probe tip to achieve single-molecule genetic diagnoses. Hybridization of the probe and target DNAs resulted in electron tunneling along the emergent double-stranded DNA. Simple stationary monitoring of the tunneling current leads to single-molecule DNA detection and discovery of base mismatches and methylation.
Olsen, Chris M; Shikiya, Ronald; Ganugula, Rajkumar; Reiling-Steffensmeier, Calliste; Khutsishvili, Irine; Johnson, Sarah E; Marky, Luis A
2016-05-01
The overall stability of DNA molecules globally depends on base-pair stacking, base-pairing, polyelectrolyte effect and hydration contributions. In order to understand how they carry out their biological roles, it is essential to have a complete physical description of how the folding of nucleic acids takes place, including their ion and water binding. To investigate the role of ions, water and protons in the stability and melting behavior of DNA structures, we report here an experimental approach i.e., mainly differential scanning calorimetry (DSC), to determine linking numbers: the differential binding of ions (Δnion), water (ΔnW) and protons (ΔnH(+)) in the helix-coil transition of DNA molecules. We use DSC and temperature-dependent UV spectroscopic techniques to measure the differential binding of ions, water, and protons for the unfolding of a variety of DNA molecules: salmon testes DNA (ST-DNA), one dodecamer, one undecamer and one decamer duplexes, nine hairpin loops, and two triplexes. These methods can be applied to any conformational transition of a biomolecule. We determined complete thermodynamic profiles, including all three linking numbers, for the unfolding of each molecule. The favorable folding of a DNA helix results from a favorable enthalpy-unfavorable entropy compensation. DSC thermograms and UV melts as a function of salt, osmolyte and proton concentrations yielded releases of ions and water. Therefore, the favorable folding of each DNA molecule results from the formation of base-pair stacks and uptake of both counterions and water molecules. In addition, the triplex with C(+)GC base triplets yielded an uptake of protons. Furthermore, the folding of a DNA duplex is accompanied by a lower uptake of ions and a similar uptake of four water molecules as the DNA helix gets shorter. In addition, the oligomer duplexes and hairpin thermodynamic data suggest ion and water binding depends on the DNA sequence rather than DNA composition. Copyright © 2015. Published by Elsevier B.V.
DNA-Based Single-Molecule Electronics: From Concept to Function.
Wang, Kun
2018-01-17
Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.
DNA-Based Single-Molecule Electronics: From Concept to Function
2018-01-01
Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091
Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A
2007-09-15
We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.
Scheible, Max B; Pardatscher, Günther; Kuzyk, Anton; Simmel, Friedrich C
2014-03-12
The combination of molecular self-assembly based on the DNA origami technique with lithographic patterning enables the creation of hierarchically ordered nanosystems, in which single molecules are positioned at precise locations on multiple length scales. Based on a hybrid assembly protocol utilizing DNA self-assembly and electron-beam lithography on transparent glass substrates, we here demonstrate a DNA origami microarray, which is compatible with the requirements of single molecule fluorescence and super-resolution microscopy. The spatial arrangement allows for a simple and reliable identification of single molecule events and facilitates automated read-out and data analysis. As a specific application, we utilize the microarray to characterize the performance of DNA strand displacement reactions localized on the DNA origami structures. We find considerable variability within the array, which results both from structural variations and stochastic reaction dynamics prevalent at the single molecule level.
NASA Astrophysics Data System (ADS)
Azuma, Naoki; Itoh, Shintaro; Fukuzawa, Kenji; Zhang, Hedong
2018-02-01
Through electrophoresis driven by a pulsed electric field, we succeeded in separating large DNA molecules with an electrophoretic microchip based on size exclusion chromatography (SEC), which was proposed in our previous study. The conditions of the pulsed electric field required to achieve the separation were determined by numerical analyses using our originally proposed separation model. From the numerical results, we succeeded in separating large DNA molecules (λ DNA and T4 DNA) within 1600 s, which was approximately half of that achieved under a direct electric field in our previous study. Our SEC-based electrophoresis microchip will be one of the effective tools to meet the growing demand of faster and more convenient separation of large DNA molecules, especially in the field of epidemiological research of infectious diseases.
Methods of DNA methylation detection
NASA Technical Reports Server (NTRS)
Maki, Wusi Chen (Inventor); Filanoski, Brian John (Inventor); Mishra, Nirankar (Inventor); Rastogi, Shiva (Inventor)
2010-01-01
The present invention provides for methods of DNA methylation detection. The present invention provides for methods of generating and detecting specific electronic signals that report the methylation status of targeted DNA molecules in biological samples.Two methods are described, direct and indirect detection of methylated DNA molecules in a nano transistor based device. In the direct detection, methylated target DNA molecules are captured on the sensing surface resulting in changes in the electrical properties of a nano transistor. These changes generate detectable electronic signals. In the indirect detection, antibody-DNA conjugates are used to identify methylated DNA molecules. RNA signal molecules are generated through an in vitro transcription process. These RNA molecules are captured on the sensing surface change the electrical properties of nano transistor thereby generating detectable electronic signals.
Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore
NASA Technical Reports Server (NTRS)
Vercoutere, Wenonah; DeGuzman, Veronica
2003-01-01
The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.
End-to-end distance and contour length distribution functions of DNA helices
NASA Astrophysics Data System (ADS)
Zoli, Marco
2018-06-01
I present a computational method to evaluate the end-to-end and the contour length distribution functions of short DNA molecules described by a mesoscopic Hamiltonian. The method generates a large statistical ensemble of possible configurations for each dimer in the sequence, selects the global equilibrium twist conformation for the molecule, and determines the average base pair distances along the molecule backbone. Integrating over the base pair radial and angular fluctuations, I derive the room temperature distribution functions as a function of the sequence length. The obtained values for the most probable end-to-end distance and contour length distance, providing a measure of the global molecule size, are used to examine the DNA flexibility at short length scales. It is found that, also in molecules with less than ˜60 base pairs, coiled configurations maintain a large statistical weight and, consistently, the persistence lengths may be much smaller than in kilo-base DNA.
DNA nanotechnology-enabled biosensors.
Chao, Jie; Zhu, Dan; Zhang, Yinan; Wang, Lianhui; Fan, Chunhai
2016-02-15
Biosensors employ biological molecules to recognize the target and utilize output elements which can translate the biorecognition event into electrical, optical or mass-sensitive signals to determine the quantities of the target. DNA-based biosensors, as a sub-field to biosensor, utilize DNA strands with short oligonucleotides as probes for target recognition. Although DNA-based biosensors have offered a promising alternative for fast, simple and cheap detection of target molecules, there still exist key challenges including poor stability and reproducibility that hinder their competition with the current gold standard for DNA assays. By exploiting the self-recognition properties of DNA molecules, researchers have dedicated to make versatile DNA nanostructures in a highly rigid, controllable and functionalized manner, which offers unprecedented opportunities for developing DNA-based biosensors. In this review, we will briefly introduce the recent advances on design and fabrication of static and dynamic DNA nanostructures, and summarize their applications for fabrication and functionalization of DNA-based biosensors. Copyright © 2015 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Reiß, Edda; Hölzel, Ralph; von Nickisch-Rosenegk, Markus; Bier, Frank F.
2006-09-01
In this article the usefulness of the enzyme phi29 DNA polymerase and the principle of rolling circle amplification (RCA) for creating single-stranded DNA (ssDNA) nanostructures is described. Currently we are working on the spatial orientation of a growing ssDNA molecule during its RCA-based synthesis by the application of a hydrodynamic force. Starting at an immobilized primer at single molecule level, the aim is to construct a nanostructure of known location and orientation, providing multiple repeating binding sites that can be addressed via complementary base-pairing. Proof-of-principle experiments demonstrate the potential of the enzymatic reaction. ssDNA molecules of more than 20 μm length were created at an immobilized primer and detected by means of fluorescence microscopy.
Definition of the persistence length in the coarse-grained models of DNA elasticity.
Fathizadeh, A; Eslami-Mossallam, B; Ejtehadi, M R
2012-11-01
By considering the detailed structure of DNA in the base pair level, two possible definitions of the persistence length are compared. One definition is related to the orientation of the terminal base pairs, and the other is based on the vectors which connect two adjacent base pairs at each end of the molecule. It is shown that although these definitions approach each other for long DNA molecules, they are dramatically different on short length scales. We show analytically that the difference mostly comes from the shear flexibility of the molecule and can be used to measure the shear modulus of DNA.
Single-Molecule Electrical Random Resequencing of DNA and RNA
NASA Astrophysics Data System (ADS)
Ohshiro, Takahito; Matsubara, Kazuki; Tsutsui, Makusu; Furuhashi, Masayuki; Taniguchi, Masateru; Kawai, Tomoji
2012-07-01
Two paradigm shifts in DNA sequencing technologies--from bulk to single molecules and from optical to electrical detection--are expected to realize label-free, low-cost DNA sequencing that does not require PCR amplification. It will lead to development of high-throughput third-generation sequencing technologies for personalized medicine. Although nanopore devices have been proposed as third-generation DNA-sequencing devices, a significant milestone in these technologies has been attained by demonstrating a novel technique for resequencing DNA using electrical signals. Here we report single-molecule electrical resequencing of DNA and RNA using a hybrid method of identifying single-base molecules via tunneling currents and random sequencing. Our method reads sequences of nine types of DNA oligomers. The complete sequence of 5'-UGAGGUA-3' from the let-7 microRNA family was also identified by creating a composite of overlapping fragment sequences, which was randomly determined using tunneling current conducted by single-base molecules as they passed between a pair of nanoelectrodes.
NASA Astrophysics Data System (ADS)
Zhang, Yuning; Reisner, Walter
2013-03-01
Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with embedded pore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a pore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We demonstrate that we can optically detect successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule. Furthermore, electrical measurements through the nanopore are performed, indicating that DNA sensing is feasible using the nanochannel-nanopore device.
Single-Molecule Denaturation Mapping of Genomic DNA in Nanofluidic Channels
NASA Astrophysics Data System (ADS)
Reisner, Walter; Larsen, Niels; Kristensen, Anders; Tegenfeldt, Jonas O.; Flyvbjerg, Henrik
2009-03-01
We have developed a new DNA barcoding technique based on the partial denaturation of extended fluorescently labeled DNA molecules. We partially melt DNA extended in nanofluidic channels via a combination of local heating and added chemical denaturants. The melted molecules, imaged via a standard fluorescence videomicroscopy setup, exhibit a nonuniform fluorescence profile corresponding to a series of local dips and peaks in the intensity trace along the stretched molecule. We show that this barcode is consistent with the presence of locally melted regions and can be explained by calculations of sequence-dependent melting probability. We believe this melting mapping technology is the first optically based single molecule technique sensitive to genome wide sequence variation that does not require an additional enzymatic labeling or restriction scheme.
NASA Astrophysics Data System (ADS)
Zhang, Yuning; Reisner, Walter
2012-02-01
Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with nanpore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a nanopore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We will discuss our recent progress on device fabrication and characterization. In particular, we demonstrate that we can detect - using fluorescent microscopy - successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the embedded pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule.
Antibody-Mediated Small Molecule Detection Using Programmable DNA-Switches.
Rossetti, Marianna; Ippodrino, Rudy; Marini, Bruna; Palleschi, Giuseppe; Porchetta, Alessandro
2018-06-13
The development of rapid, cost-effective, and single-step methods for the detection of small molecules is crucial for improving the quality and efficiency of many applications ranging from life science to environmental analysis. Unfortunately, current methodologies still require multiple complex, time-consuming washing and incubation steps, which limit their applicability. In this work we present a competitive DNA-based platform that makes use of both programmable DNA-switches and antibodies to detect small target molecules. The strategy exploits both the advantages of proximity-based methods and structure-switching DNA-probes. The platform is modular and versatile and it can potentially be applied for the detection of any small target molecule that can be conjugated to a nucleic acid sequence. Here the rational design of programmable DNA-switches is discussed, and the sensitive, rapid, and single-step detection of different environmentally relevant small target molecules is demonstrated.
Internal twisting motion dependent conductance of an aperiodic DNA molecule
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta
The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less
Distinguishing Individual DNA Bases in a Network by Non-Resonant Tip-Enhanced Raman Scattering.
Zhang, Rui; Zhang, Xianbiao; Wang, Huifang; Zhang, Yao; Jiang, Song; Hu, Chunrui; Zhang, Yang; Luo, Yi; Dong, Zhenchao
2017-05-08
The importance of identifying DNA bases at the single-molecule level is well recognized for many biological applications. Although such identification can be achieved by electrical measurements using special setups, it is still not possible to identify single bases in real space by optical means owing to the diffraction limit. Herein, we demonstrate the outstanding ability of scanning tunneling microscope (STM)-controlled non-resonant tip-enhanced Raman scattering (TERS) to unambiguously distinguish two individual complementary DNA bases (adenine and thymine) with a spatial resolution down to 0.9 nm. The distinct Raman fingerprints identified for the two molecules allow to differentiate in real space individual DNA bases in coupled base pairs. The demonstrated ability of non-resonant Raman scattering with super-high spatial resolution will significantly extend the applicability of TERS, opening up new routes for single-molecule DNA sequencing. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Lee, James W.; Thundat, Thomas G.
2005-06-14
An apparatus and method for performing nucleic acid (DNA and/or RNA) sequencing on a single molecule. The genetic sequence information is obtained by probing through a DNA or RNA molecule base by base at nanometer scale as though looking through a strip of movie film. This DNA sequencing nanotechnology has the theoretical capability of performing DNA sequencing at a maximal rate of about 1,000,000 bases per second. This enhanced performance is made possible by a series of innovations including: novel applications of a fine-tuned nanometer gap for passage of a single DNA or RNA molecule; thin layer microfluidics for sample loading and delivery; and programmable electric fields for precise control of DNA or RNA movement. Detection methods include nanoelectrode-gated tunneling current measurements, dielectric molecular characterization, and atomic force microscopy/electrostatic force microscopy (AFM/EFM) probing for nanoscale reading of the nucleic acid sequences.
Functional helicoidal model of DNA molecule with elastic nonlinearity
NASA Astrophysics Data System (ADS)
Tseytlin, Y. M.
2013-06-01
We constructed a functional DNA molecule model on the basis of a flexible helicoidal sensor, specifically, a pretwisted hollow nano-strip. We study in this article the helicoidal nano- sensor model with a pretwisted strip axial extension corresponding to the overstretching transition of DNA from dsDNA to ssDNA. Our model and the DNA molecule have similar geometrical and nonlinear mechanical features unlike models based on an elastic rod, accordion bellows, or an imaginary combination of "multiple soft and hard linear springs", presented in some recent publications.
Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases
Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef
2012-01-01
Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110
[Synthesis of Circular DNA Templates with T4 RNA Ligase for Rolling Circle Amplification].
Sakhabutdinova, A R; Maksimova, M A; Garafutdinov, R R
2017-01-01
Currently, isothermal methods of nucleic acid amplification have been well established; in particular, rolling circle amplification is of great interest. In this approach, circular ssDNA molecules have been used as a target that can be obtained by the intramolecular template-dependent ligation of an oligonucleotide C-probe. Here, a new method of synthesizing small circular DNA molecules via the cyclization of ssDNA based on T4 RNA ligase has been proposed. Circular ssDNA is further used as the template for the rolling circle amplification. The maximum yield of the cyclization products was observed in the presence of 5-10% polyethylene glycol 4000, and the optimum DNA length for the cyclization constituted 50 nucleotides. This highly sensitive method was shown to detect less than 10^(2) circular DNA molecules. The method reliability was proved based on artificially destroyed dsDNA, which suggests its implementation for analyzing any significantly fragmented dsDNA.
Seeman, Nadrian C.
2012-01-01
The combination of synthetic stable branched DNA and sticky ended cohesion has led to the development of structural DNA nanotechnology over the past 30 years. The basis of this enterprise is that it is possible to construct novel DNA-based materials by combining these features in a self-assembly protocol. Thus, simple branched molecules lead directly to the construction of polyhedra whose edges consist of double helical DNA, and whose vertices correspond to the branch points. Stiffer branched motifs can be used to produce self-assembled two-dimensional and three-dimensional periodic lattices of DNA (crystals). DNA has also been used to make a variety of nanomechanical devices, including molecules that change their shapes, and molecules that can walk along a DNA sidewalk. Devices have been incorporated into two-dimensional DNA arrangements; sequence-dependent devices are driven by increases in nucleotide pairing at each step in their machine cycles. PMID:20222824
Hori, Yuichiro; Otomura, Norimichi; Nishida, Ayuko; Nishiura, Miyako; Umeno, Maho; Suetake, Isao; Kikuchi, Kazuya
2018-02-07
Hybrid probes consisting of synthetic molecules and proteins are powerful tools for detecting biological molecules and signals in living cells. To date, most targets of the hybrid probes have been limited to pH and small analytes. Although biomacromolecules are essential to the physiological function of cells, the hybrid-probe-based approach has been scarcely employed for live-cell detection of biomacromolecules. Here, we developed a hybrid probe with a chemical switch for live-cell imaging of methylated DNA, an important macromolecule in the repression of gene expression. Using a protein labeling technique, we created a hybrid probe containing a DNA-binding fluorogen and a methylated-DNA-binding domain. The hybrid probe enhanced fluorescence intensity upon binding to methylated DNA and successfully monitored methylated DNA during mitosis. The hybrid probe offers notable advantages absent from probes based on small molecules or fluorescent proteins and is useful for live-cell analyses of epigenetic phenomena and diseases related to DNA methylation.
Torsional mechanics of DNA are regulated by small-molecule intercalation.
Celedon, Alfredo; Wirtz, Denis; Sun, Sean
2010-12-23
Whether the bend and twist mechanics of DNA molecules are coupled is unclear. Here, we report the direct measurement of the resistive torque of single DNA molecules to study the effect of ethidium bromide (EtBr) intercalation and pulling force on DNA twist mechanics. DNA molecules were overwound and unwound using recently developed magnetic tweezers where the molecular resistive torque was obtained from Brownian angular fluctuations. The effect of EtBr intercalation on the twist stiffness was found to be significantly different from the effect on the bend persistence length. The twist stiffness of DNA was dramatically reduced at low intercalator concentration (<10 nM); however, it did not decrease further when the intercalator concentration was increased by 3 orders of magnitude. We also determined the dependence of EtBr intercalation on the torque applied to DNA. We propose a model for the elasticity of DNA base pairs with intercalated EtBr molecules to explain the abrupt decrease of twist stiffness at low EtBr concentration. These results indicate that the bend and twist stiffnesses of DNA are independent and can be differently affected by small-molecule binding.
Method for performing site-specific affinity fractionation for use in DNA sequencing
Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.
1999-01-01
A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.
Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.
2000-01-01
A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.
Method for performing site-specific affinity fractionation for use in DNA sequencing
Mirzabekov, A.D.; Lysov, Y.P.; Dubley, S.A.
1999-05-18
A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between the cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting the extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to the extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from the array. 14 figs.
High-throughput DNA separation in nanofilter arrays.
Choi, Sungup; Kim, Ju Min; Ahn, Kyung Hyun; Lee, Seung Jong
2014-08-01
We numerically investigated the dynamics of short double-stranded DNA molecules moving through a deep-shallow alternating nanofilter, by utilizing Brownian dynamics simulation. We propose a novel mechanism for high-throughput DNA separation with a high electric field, which was originally predicted by Laachi et al. [Phys. Rev. Lett. 2007, 98, 098106]. In this work, we show that DNA molecules deterministically move along different electrophoretic streamlines according to their length, owing to geometric constraint at the exit of the shallow region. Consequently, it is more probable that long DNA molecules pass over a deep well region without significant lateral migration toward the bottom of the deep well, which is in contrast to the long dwelling time for short DNA molecules. We investigated the dynamics of DNA passage through a nanofilter facilitating electrophoretic field kinematics. The statistical distribution of the DNA molecules according to their size clearly corroborates our assumption. On the other hand, it was also found that the tapering angle between the shallow and deep regions significantly affects the DNA separation performance. The current results show that the nonuniform field effect combined with geometric constraint plays a key role in nanofilter-based DNA separation. We expect that our results will be helpful in designing and operating nanofluidics-based DNA separation devices and in understanding the polymer dynamics in confined geometries. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Yu, Guihua; Kushwaha, Amit; Lee, Jungkyu K; Shaqfeh, Eric S G; Bao, Zhenan
2011-01-25
DNA has been recently explored as a powerful tool for developing molecular scaffolds for making reproducible and reliable metal contacts to single organic semiconducting molecules. A critical step in the process of exploiting DNA-organic molecule-DNA (DOD) array structures is the controlled tethering and stretching of DNA molecules. Here we report the development of reproducible surface chemistry for tethering DNA molecules at tunable density and demonstrate shear flow processing as a rationally controlled approach for stretching/aligning DNA molecules of various lengths. Through enzymatic cleavage of λ-phage DNA to yield a series of DNA chains of various lengths from 17.3 μm down to 4.2 μm, we have investigated the flow/extension behavior of these tethered DNA molecules under different flow strengths in the flow-gradient plane. We compared Brownian dynamic simulations for the flow dynamics of tethered λ-DNA in shear, and found our flow-gradient plane experimental results matched well with our bead-spring simulations. The shear flow processing demonstrated in our studies represents a controllable approach for tethering and stretching DNA molecules of various lengths. Together with further metallization of DNA chains within DOD structures, this bottom-up approach can potentially enable efficient and reliable fabrication of large-scale nanoelectronic devices based on single organic molecules, therefore opening opportunities in both fundamental understanding of charge transport at the single molecular level and many exciting applications for ever-shrinking molecular circuits.
DNA origami as biocompatible surface to match single-molecule and ensemble experiments
Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip
2012-01-01
Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements. PMID:22523083
Gonzalez, E; Lino, J; Deriabina, A; Herrera, J N F; Poltev, V I
2013-01-01
To elucidate details of the DNA-water interactions we performed the calculations and systemaitic search for minima of interaction energy of the systems consisting of one of DNA bases and one or two water molecules. The results of calculations using two force fields of molecular mechanics (MM) and correlated ab initio method MP2/6-31G(d, p) of quantum mechanics (QM) have been compared with one another and with experimental data. The calculations demonstrated a qualitative agreement between geometry characteristics of the most of local energy minima obtained via different methods. The deepest minima revealed by MM and QM methods correspond to water molecule position between two neighbor hydrophilic centers of the base and to the formation by water molecule of hydrogen bonds with them. Nevertheless, the relative depth of some minima and peculiarities of mutual water-base positions in' these minima depend on the method used. The analysis revealed insignificance of some differences in the results of calculations performed via different methods and the importance of other ones for the description of DNA hydration. The calculations via MM methods enable us to reproduce quantitatively all the experimental data on the enthalpies of complex formation of single water molecule with the set of mono-, di-, and trimethylated bases, as well as on water molecule locations near base hydrophilic atoms in the crystals of DNA duplex fragments, while some of these data cannot be rationalized by QM calculations.
Gating electrical transport through DNA molecules that bridge between silicon nanogaps.
Takagi, Shogo; Takada, Tadao; Matsuo, Naoto; Yokoyama, Shin; Nakamura, Mitsunobu; Yamana, Kazushige
2012-03-21
DNA electronic devices were prepared on silicon-based three-terminal electrodes. Both ends of DNA molecules (400 bp long, mixed sequences) were bridged via chemical bonds between the source-drain nanogap (120 nm) electrodes. S-Shaped I-V curves were obtained and the electric current can be modulated by the gate voltage. The DNA molecules act as semiconducting p-type nanowires in the three-terminal device. This journal is © The Royal Society of Chemistry 2012
Characterization of the tunneling conductance across DNA bases
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zikic, Radomir; Krstic, Predrag S; Zhang, Xiaoguang
2006-01-01
Characterization of the electrical properties of the DNA bases, Adenine, Cytosine, Guanine and Thymine, besides building the basic knowledge on these fundamental constituents of a DNA, is a crucial step in developing a DNA sequencing technology. We present a first-principles study of the current-voltage characteristics of nucleotide-like molecules of the DNA bases, placed in a 1.5 nm gap formed between gold nanoelectrodes. The quantum transport calculations in the tunneling regime are shown to vary strongly with the electrode-molecule geometry and the choice of the DFT exchangecorrelation functionals. Analysis of the results in the zero-bias limit indicates that distinguishable current-voltage characteristicsmore » of different DNA bases are dominated by the geometrical conformations of the bases and nanoelectrodes.« less
Characterization of the tunneling conductance across DNA bases.
Zikic, Radomir; Krstić, Predrag S; Zhang, X-G; Fuentes-Cabrera, Miguel; Wells, Jack; Zhao, Xiongce
2006-07-01
Characterization of the electrical properties of the DNA bases (adenine, cytosine, guanine, and thymine), in addition to building the basic knowledge on these fundamental constituents of a DNA, is a crucial step in developing a DNA sequencing technology. We present a first-principles study of the current-voltage characteristics of nucleotidelike molecules of the DNA bases, placed in a 1.5 nm gap formed between gold nanoelectrodes. The quantum transport calculations in the tunneling regime are shown to vary strongly with the electrode-molecule geometry and the choice of the density-functional theory exchange-correlation functionals. Analysis of the results in the zero-bias limit indicates that distinguishable current-voltage characteristics of different DNA bases are dominated by the geometrical conformations of the bases and nanoelectrodes.
Single-Molecule Denaturation Mapping of DNA in Nanofluidic Channels
NASA Astrophysics Data System (ADS)
Reisner, Walter; Larsen, Niels; Silahtaroglu, Asli; Kristensen, Anders; Tommerup, Niels; Tegenfeldt, Jonas O.; Flyvbjerg, Henrik
2010-03-01
Nanochannel based DNA stretching can serve as a platform for a new optical mapping technique based on measuring the pattern of partial melting along the extended molecules. We partially melt DNA extended in nanofluidic channels via a combination of local heating and added chemical denaturants. The melted molecules, imaged via a standard fluorescence videomicroscopy setup, exhibit a nonuniform fluorescence profile corresponding to a series of local dips and peaks in the intensity trace along the stretched molecule. We show that this barcode is consistent with the presence of locally melted regions along the molecule and can be explained by calculations of sequence-dependent melting probability. Specifically, we obtain experimental melting profiles for T4, T7, lambda-phage and bacterial artificial chromosome DNA (from human chromosome 12) and compare these profiles to theory. In addition, we demonstrate that the BAC melting profile can be used to align the BAC to its correct position on chromosome 12.
Identifying DNA methylation in a nanochannel
NASA Astrophysics Data System (ADS)
Sun, Xiaoyin; Yasui, Takao; Yanagida, Takeshi; Kaji, Noritada; Rahong, Sakon; Kanai, Masaki; Nagashima, Kazuki; Kawai, Tomoji; Baba, Yoshinobu
2016-01-01
DNA methylation is a stable epigenetic modification, which is well known to be involved in gene expression regulation. In general, however, analyzing DNA methylation requires rather time consuming processes (24-96 h) via DNA replication and protein modification. Here we demonstrate a methodology to analyze DNA methylation at a single DNA molecule level without any protein modifications by measuring the contracted length and relaxation time of DNA within a nanochannel. Our methodology is based on the fact that methylation makes DNA molecules stiffer, resulting in a longer contracted length and a longer relaxation time (a slower contraction rate). The present methodology offers a promising way to identify DNA methylation without any protein modification at a single DNA molecule level within 2 h.
Small Molecule Protection of Bone Marrow Hematopoietic Stem Cells
2015-10-01
several recently identified small molecules can protect hematopoietic stem cells (HSCs) from damage or killing by endogenous aldehydes . Proof-of-concept...anemia bone marrow failure CD34+ hematopoietic stem cells aldehydes formaldehyde DNA damage DNA base adduct DNA-protein crosslink mass...below. Revised Specific Aim 1: Small molecule protection of human cells from aldehyde - induced killing (in vitro studies - no mice or human subjects
[Single-molecule detection and characterization of DNA replication based on DNA origami].
Wang, Qi; Fan, Youjie; Li, Bin
2014-08-01
To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.
Charlot, B.; Bardin, F.; Sanchez, N.; Roux, P.; Teixeira, S.; Schwob, E.
2014-01-01
Ordered deposition of elongated DNA molecules was achieved by the forced dewetting of a DNA solution droplet over a microstructured substrate. This technique allows trapping, uncoiling, and deposition of DNA fragments without the need of a physicochemical anchoring of the molecule and results in the combing of double stranded DNA from the edge of microwells on a polydimethylsiloxane (PDMS) substrate. The technique involves scanning a droplet of DNA solution caught between a movable blade and a PDMS substrate containing an array of microwells. The deposition and elongation appears when the receding meniscus dewets microwells, the latter acting here as a perturbation in the dewetting line forcing the water film to break locally. Thus, DNA molecules can be deposited in an ordered manner and elongated conformation based solely on a physical phenomenon, allowing uncoiled DNA molecules to be observed in all their length. However, the exact mechanism that governs the deposition of DNA strands is not well understood. This paper is an analysis of the physical phenomenon occurring in the deposition process and is based on observations made with the use of high frame/second rate video microscopy. PMID:24753724
DNA-Based Applications in Nanobiotechnology
Abu-Salah, Khalid M.; Ansari, Anees A.; Alrokayan, Salman A.
2010-01-01
Biological molecules such as deoxyribonucleic acid (DNA) have shown great potential in fabrication and construction of nanostructures and devices. The very properties that make DNA so effective as genetic material also make it a very suitable molecule for programmed self-assembly. The use of DNA to assemble metals or semiconducting particles has been extended to construct metallic nanowires and functionalized nanotubes. This paper highlights some important aspects of conjugating the unique physical properties of dots or wires with the remarkable recognition capabilities of DNA which could lead to miniaturizing biological electronics and optical devices, including biosensors and probes. Attempts to use DNA-based nanocarriers for gene delivery are discussed. In addition, the ecological advantages and risks of nanotechnology including DNA-based nanobiotechnology are evaluated. PMID:20652049
DNA-based applications in nanobiotechnology.
Abu-Salah, Khalid M; Ansari, Anees A; Alrokayan, Salman A
2010-01-01
Biological molecules such as deoxyribonucleic acid (DNA) have shown great potential in fabrication and construction of nanostructures and devices. The very properties that make DNA so effective as genetic material also make it a very suitable molecule for programmed self-assembly. The use of DNA to assemble metals or semiconducting particles has been extended to construct metallic nanowires and functionalized nanotubes. This paper highlights some important aspects of conjugating the unique physical properties of dots or wires with the remarkable recognition capabilities of DNA which could lead to miniaturizing biological electronics and optical devices, including biosensors and probes. Attempts to use DNA-based nanocarriers for gene delivery are discussed. In addition, the ecological advantages and risks of nanotechnology including DNA-based nanobiotechnology are evaluated.
Single Molecule Nano-Metronome
Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip
2008-01-01
We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule sensor of minute sequence differences of a target DNA. PMID:16522050
Identification of DNA primase inhibitors via a combined fragment-based and virtual screening
NASA Astrophysics Data System (ADS)
Ilic, Stefan; Akabayov, Sabine R.; Arthanari, Haribabu; Wagner, Gerhard; Richardson, Charles C.; Akabayov, Barak
2016-11-01
The structural differences between bacterial and human primases render the former an excellent target for drug design. Here we describe a technique for selecting small molecule inhibitors of the activity of T7 DNA primase, an ideal model for bacterial primases due to their common structural and functional features. Using NMR screening, fragment molecules that bind T7 primase were identified and then exploited in virtual filtration to select larger molecules from the ZINC database. The molecules were docked to the primase active site using the available primase crystal structure and ranked based on their predicted binding energies to identify the best candidates for functional and structural investigations. Biochemical assays revealed that some of the molecules inhibit T7 primase-dependent DNA replication. The binding mechanism was delineated via NMR spectroscopy. Our approach, which combines fragment based and virtual screening, is rapid and cost effective and can be applied to other targets.
Molecule counting with alkanethiol and DNA immobilized on gold microplates for extended gate FET.
Cao, Zhong; Xiao, Zhong-Liang; Zhang, Ling; Luo, Dong-Mei; Kamahori, Masao; Shimoda, Maki
2013-04-01
Several molecule counting methods based on electrochemical characterization of alkanethiol and thiolated single-stranded oligonucleotide (HS-ssDNA) immobilized on gold microplates, which were used as extended gates of field effect transistors (FETs), have been investigated in this paper. The surface density of alkanethiol and DNA monolayers on gold microplates were quantitatively evaluated from the reductive desorption charge by using cyclic voltammetry (CV) and fast CV (FCV) methods in strong alkali solution. Typically, the surface density of 6-hydroxy-1-hexanethiol (6-HHT) was evaluated to be 4.639 molecules/nm(2), and the 28 base-pair dsDNA about 1.226-4.849 molecules/100 nm(2) on Au microplates after post-treatment with 6-HHT. The behaviors on surface potential and capacitance of different aminoalkanethiols on Au microplates were measured in 0.1 mol/L Na2SO4 and 10 mmol/L Tris-HCl (pH=7.4) solutions, indicating that the surface potential increases and the double-layer capacitance decreases with the length of carbon chain increased for the thiol monolayers, which obey a physics relationship for a capacitor. Comparably, a simple sensing method based on the electronic signals of biochemical reaction events on DNA immobilization and hybridization at the Au surface of the extended gate FET (EGFET) was developed, with which the surface density of the hybridized dsDNA on the gold surface of the EGFET was evaluated to be 1.36 molecules per 100 nm(2), showing that the EGFET is a promising sensing biochip for DNA molecule counting. Copyright © 2012 Elsevier B.V. All rights reserved.
Biophysics of protein-DNA interactions and chromosome organization
Marko, John F.
2014-01-01
The function of DNA in cells depends on its interactions with protein molecules, which recognize and act on base sequence patterns along the double helix. These notes aim to introduce basic polymer physics of DNA molecules, biophysics of protein-DNA interactions and their study in single-DNA experiments, and some aspects of large-scale chromosome structure. Mechanisms for control of chromosome topology will also be discussed. PMID:25419039
Visualizing the Search for Radiation-damaged DNA Bases in Real Time.
Lee, Andrea J; Wallace, Susan S
2016-11-01
The Base Excision Repair (BER) pathway removes the vast majority of damages produced by ionizing radiation, including the plethora of radiation-damaged purines and pyrimidines. The first enzymes in the BER pathway are DNA glycosylases, which are responsible for finding and removing the damaged base. Although much is known about the biochemistry of DNA glycosylases, how these enzymes locate their specific damage substrates among an excess of undamaged bases has long remained a mystery. Here we describe the use of single molecule fluorescence to observe the bacterial DNA glycosylases, Nth, Fpg and Nei, scanning along undamaged and damaged DNA. We show that all three enzymes randomly diffuse on the DNA molecule and employ a wedge residue to search for and locate damage. The search behavior of the Escherichia coli DNA glycosylases likely provides a paradigm for their homologous mammalian counterparts.
Visualizing the search for radiation-damaged DNA bases in real time
NASA Astrophysics Data System (ADS)
Lee, Andrea J.; Wallace, Susan S.
2016-11-01
The Base Excision Repair (BER) pathway removes the vast majority of damages produced by ionizing radiation, including the plethora of radiation-damaged purines and pyrimidines. The first enzymes in the BER pathway are DNA glycosylases, which are responsible for finding and removing the damaged base. Although much is known about the biochemistry of DNA glycosylases, how these enzymes locate their specific damage substrates among an excess of undamaged bases has long remained a mystery. Here we describe the use of single molecule fluorescence to observe the bacterial DNA glycosylases, Nth, Fpg and Nei, scanning along undamaged and damaged DNA. We show that all three enzymes randomly diffuse on the DNA molecule and employ a wedge residue to search for and locate damage. The search behavior of the Escherichia coli DNA glycosylases likely provides a paradigm for their homologous mammalian counterparts.
Live-Cell Imaging of DNA Methylation Based on Synthetic-Molecule/Protein Hybrid Probe.
Kumar, Naresh; Hori, Yuichiro; Kikuchi, Kazuya
2018-06-04
The epigenetic modification of DNA involves the conversion of cytosine to 5-methylcytosine, also known as DNA methylation. DNA methylation is important in modulating gene expression and thus, regulating genome and cellular functions. Recent studies have shown that aberrations in DNA methylation are associated with various epigenetic disorders or diseases including cancer. This stimulates great interest in the development of methods that can detect and visualize DNA methylation. For instance, fluorescent proteins (FPs) in conjugation with methyl-CpG-binding domain (MBD) have been employed for live-cell imaging of DNA methylation. However, the FP-based approach showed fluorescence signals for both the DNA-bound and -unbound states and thus differentiation between these states is difficult. Synthetic-molecule/protein hybrid probes can provide an alternative to overcome this restriction. In this article, we discuss the synthetic-molecule/protein hybrid probe that we developed recently for live-cell imaging of DNA methylation, which exhibited fluorescence enhancement only after binding to methylated DNA. © 2018 The Chemical Society of Japan & Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
The Kinetic Mechanism for DNA Unwinding by Multiple Molecules of Dda Helicase Aligned on DNA†
Eoff, Robert L.; Raney, Kevin D.
2010-01-01
Helicases catalyze the separation of double-stranded nucleic acids to form single-stranded intermediates. Using transient state kinetic methods we have determined the kinetic properties of DNA unwinding under conditions that favor a monomeric form of the Dda helicase as well as conditions that allow multiple molecules to function on the same substrate. Multiple helicase molecules can align like a train on the DNA track. The number of base pairs unwound in a single binding event for Dda is increased from ~19 bp for the monomeric form to ~64 bp when as many as four Dda molecules are aligned on the same substrate, while the kinetic step-size (3.2 ± 0.7 bp) and unwinding rate (242 ± 25 bp s−1) appear to be independent of the number of Dda molecules present on a given substrate. The data support a model in which the helicase molecules bound to the same substrate move along the DNA track independently during DNA unwinding. The observed increase in processivity arises from the increased probability that at least one of the helicases will completely unwind the DNA prior to dissociation. These results are in contrast to previous reports in which multiple Dda molecules on the same track greatly enhanced the rate and amplitude for displacement of protein blocks on the track. Therefore, only when the progress of the lead molecule in the train is impeded by some type of block, such as a protein bound to DNA, do the trailing molecules interact with the lead molecule in order to overcome the block. The fact that trailing helicase molecules have little impact on the lead molecule in the train during routine DNA unwinding suggests that the trailing molecules are moving at similar rates as the lead molecule. This result implicates a step in the translocation mechanism as contributing greatly to the overall rate-limiting step for unwinding of duplex DNA. PMID:20408588
Wu, Zining; Graybill, Todd L; Zeng, Xin; Platchek, Michael; Zhang, Jean; Bodmer, Vera Q; Wisnoski, David D; Deng, Jianghe; Coppo, Frank T; Yao, Gang; Tamburino, Alex; Scavello, Genaro; Franklin, G Joseph; Mataruse, Sibongile; Bedard, Katie L; Ding, Yun; Chai, Jing; Summerfield, Jennifer; Centrella, Paolo A; Messer, Jeffrey A; Pope, Andrew J; Israel, David I
2015-12-14
DNA-encoded small-molecule library technology has recently emerged as a new paradigm for identifying ligands against drug targets. To date, this technology has been used with soluble protein targets that are produced and used in a purified state. Here, we describe a cell-based method for identifying small-molecule ligands from DNA-encoded libraries against integral membrane protein targets. We use this method to identify novel, potent, and specific inhibitors of NK3, a member of the tachykinin family of G-protein coupled receptors (GPCRs). The method is simple and broadly applicable to other GPCRs and integral membrane proteins. We have extended the application of DNA-encoded library technology to membrane-associated targets and demonstrate the feasibility of selecting DNA-tagged, small-molecule ligands from complex combinatorial libraries against targets in a heterogeneous milieu, such as the surface of a cell.
Measurement of inelastic cross sections for low-energy electron scattering from DNA bases.
Michaud, Marc; Bazin, Marc; Sanche, Léon
2012-01-01
To determine experimentally the absolute cross sections (CS) to deposit various amount of energies into DNA bases by low-energy electron (LEE) impact. Electron energy loss (EEL) spectra of DNA bases were recorded for different LEE impact energies on the molecules deposited at very low coverage on an inert argon (Ar) substrate. Following their normalisation to the effective incident electron current and molecular surface number density, the EEL spectra were then fitted with multiple Gaussian functions in order to delimit the various excitation energy regions. The CS to excite a molecule into its various excitation modes were finally obtained from computing the area under the corresponding Gaussians. The EEL spectra and absolute CS for the electronic excitations of pyrimidine and the DNA bases thymine, adenine, and cytosine by electron impacts below 18 eV were reported for the molecules deposited at about monolayer coverage on a solid Ar substrate. The CS for electronic excitations of DNA bases by LEE impact were found to lie within the 10(216) to 10(218) cm(2) range. The large value of the total ionisation CS indicated that ionisation of DNA bases by LEE is an important dissipative process via which ionising radiation degrades and is absorbed in DNA.
Measurement of inelastic cross sections for low-energy electron scattering from DNA bases
Michaud, Marc; Bazin, Marc.; Sanche, Léon
2013-01-01
Purpose Determine experimentally the absolute cross sections (CS) to deposit various amount of energies into DNA bases by low-energy electron (LEE) impact. Materials and methods Electron energy loss (EEL) spectra of DNA bases are recorded for different LEE impact energies on the molecules deposited at very low coverage on an inert argon (Ar) substrate. Following their normalisation to the effective incident electron current and molecular surface number density, the EEL spectra are then fitted with multiple Gaussian functions in order to delimit the various excitation energy regions. The CS to excite a molecule into its various excitation modes are finally obtained from computing the area under the corresponding Gaussians. Results The EEL spectra and absolute CS for the electronic excitations of pyrimidine and the DNA bases thymine, adenine, and cytosine by electron impacts below 18 eV are reported for the molecules deposited at about monolayer coverage on a solid Ar substrate. Conclusions The CS for electronic excitations of DNA bases by LEE impact are found to lie within the 10−16 – 10−18 cm2 range. The large value of the total ionisation CS indicates that ionisation of DNA bases by LEE is an important dissipative process via which ionising radiation degrades and is absorbed in DNA. PMID:21615242
Petersen, Philippe A D; Silva, Andreia S; Gonçalves, Marcos B; Lapolli, André L; Ferreira, Ana Maria C; Carbonari, Artur W; Petrilli, Helena M
2014-06-03
In this work, perturbed angular correlation (PAC) spectroscopy is used to study differences in the nuclear quadrupole interactions of Cd probes in DNA molecules of mice infected with the Y-strain of Trypanosoma cruzi. The possibility of investigating the local genetic alterations in DNA, which occur along generations of mice infected with T. cruzi, using hyperfine interactions obtained from PAC measurements and density functional theory (DFT) calculations in DNA bases is discussed. A comparison of DFT calculations with PAC measurements could determine the type of Cd coordination in the studied molecules. To the best of our knowledge, this is the first attempt to use DFT calculations and PAC measurements to investigate the local environment of Cd ions bound to DNA bases in mice infected with Chagas disease. The obtained results also allowed the detection of local changes occurring in the DNA molecules of different generations of mice infected with T. cruzi, opening the possibility of using this technique as a complementary tool in the characterization of complicated biological systems.
An optical deoxyribonucleic acid-based half-subtractor.
Yang, Chia-Ning; Chen, Yi-Li; Lin, Hung-Yin; Hsu, Chun-Yu
2013-10-09
This study introduces an optical DNA-based logic circuit that mimics a half-subtractor. The system contains an Au-surface immobilized molecular-beacon molecule that serves as a dual-gate molecule and outputs two series of fluorescence signals following Boolean INH and XOR patterns after interacting with one or two single-stranded DNA molecules as input. To the best of our knowledge, the system reported herein is rather concise compared to other molecular logic gate systems.
Sun, Zhongyue; Liao, Tangbin; Zhang, Yulin; Shu, Jing; Zhang, Hong; Zhang, Guo-Jun
2016-12-15
A very simple sensing device based on biomimetic nanochannels has been developed for label-free, ultrasensitive and highly sequence-specific detection of DNA. Probe DNA was modified on the inner wall of the nanochannel surface by layer-by-layer (LBL) assembly. After probe DNA immobilization, DNA detection was realized by monitoring the rectified ion current when hybridization occurred. Due to three dimensional (3D) nanoscale environment of the nanochannel, this special geometry dramatically increased the surface area of the nanochannel for immobilization of probe molecules on the inner-surface and enlarged contact area between probes and target-molecules. Thus, the unique sensor reached a reliable detection limit of 10 fM for target DNA. In addition, this DNA sensor could discriminate complementary DNA (c-DNA) from non-complementary DNA (nc-DNA), two-base mismatched DNA (2bm-DNA) and one-base mismatched DNA (1bm-DNA) with high specificity. Moreover, the nanochannel-based biosensor was also able to detect target DNA even in an interfering environment and serum samples. This approach will provide a novel biosensing platform for detection and discrimination of disease-related molecular targets and unknown sequence DNA. Copyright © 2016 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Kikuchi, Hayato; Nose, Keiji; Yoshikawa, Yuko; Yoshikawa, Kenichi
2018-06-01
It is becoming increasingly apparent that changes in the higher-order structure of genome-sized DNA molecules of more than several tens kbp play important roles in the self-control of genome activity in living cells. Unfortunately, it has been rather difficult to prepare genome-sized DNA molecules without damage or fragmentation. Here, we evaluated the degree of double-strand breaks (DSBs) caused by mechanical mixing by single-molecule observation with fluorescence microscopy. The results show that DNA breaks are most significant for the first second after the initiation of mechanical agitation. Based on such observation, we propose a novel mixing procedure to significantly decrease DSBs.
Current-voltage characteristics of double stranded versus single stranded DNA molecules
NASA Astrophysics Data System (ADS)
Hartzell, B.; Chen, Hong; Heremans, J. J.; McCord, B.; Soghomonian, V.
2004-03-01
Investigation of DNA conductivity has focused on the native, duplex structure, with controversial results. Here, we present the influence of the double-helical structure on charge transport through lambda DNA molecules. The current-voltage (I-V) characteristics of both disulfide-labeled double stranded DNA (dsDNA) and disulfide-labeled single stranded DNA (ssDNA) were measured. The ssDNA was formed from the dsDNA using two different methods for comparison purposes: a thermal/chemical denaturation and enzymatic digestion utilizing lambda exonuclease. Resulting I-V characteristics of both the double stranded and single stranded samples were close-to-linear when measured at room temperature. However, the ssDNA samples consistently gave conductivity values about two orders of magnitude smaller in amplitude. Our results suggest an integral relationship between the native structure of DNA with its stacked base pairs and the molecule's ability to support charge transport.(NSF NIRT 0103034)
Gül, O. Tolga; Pugliese, Kaitlin M.; Choi, Yongki; Sims, Patrick C.; Pan, Deng; Rajapakse, Arith J.; Weiss, Gregory A.; Collins, Philip G.
2016-01-01
As biosensing devices shrink smaller and smaller, they approach a scale in which single molecule electronic sensing becomes possible. Here, we review the operation of single-enzyme transistors made using single-walled carbon nanotubes. These novel hybrid devices transduce the motions and catalytic activity of a single protein into an electronic signal for real-time monitoring of the protein’s activity. Analysis of these electronic signals reveals new insights into enzyme function and proves the electronic technique to be complementary to other single-molecule methods based on fluorescence. As one example of the nanocircuit technique, we have studied the Klenow Fragment (KF) of DNA polymerase I as it catalytically processes single-stranded DNA templates. The fidelity of DNA polymerases makes them a key component in many DNA sequencing techniques, and here we demonstrate that KF nanocircuits readily resolve DNA polymerization with single-base sensitivity. Consequently, template lengths can be directly counted from electronic recordings of KF’s base-by-base activity. After measuring as few as 20 copies, the template length can be determined with <1 base pair resolution, and different template lengths can be identified and enumerated in solutions containing template mixtures. PMID:27348011
Gül, O Tolga; Pugliese, Kaitlin M; Choi, Yongki; Sims, Patrick C; Pan, Deng; Rajapakse, Arith J; Weiss, Gregory A; Collins, Philip G
2016-06-24
As biosensing devices shrink smaller and smaller, they approach a scale in which single molecule electronic sensing becomes possible. Here, we review the operation of single-enzyme transistors made using single-walled carbon nanotubes. These novel hybrid devices transduce the motions and catalytic activity of a single protein into an electronic signal for real-time monitoring of the protein's activity. Analysis of these electronic signals reveals new insights into enzyme function and proves the electronic technique to be complementary to other single-molecule methods based on fluorescence. As one example of the nanocircuit technique, we have studied the Klenow Fragment (KF) of DNA polymerase I as it catalytically processes single-stranded DNA templates. The fidelity of DNA polymerases makes them a key component in many DNA sequencing techniques, and here we demonstrate that KF nanocircuits readily resolve DNA polymerization with single-base sensitivity. Consequently, template lengths can be directly counted from electronic recordings of KF's base-by-base activity. After measuring as few as 20 copies, the template length can be determined with <1 base pair resolution, and different template lengths can be identified and enumerated in solutions containing template mixtures.
Liang, Feng; Lindsay, Stuart; Zhang, Peiming
2012-11-21
With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.
Liang, Feng; Lindsay, Stuart; Zhang, Peiming
2013-01-01
With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read the DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A:T and G:C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs. PMID:23038027
Detecting the Length of Double-stranded DNA with Solid State Nanopores
NASA Astrophysics Data System (ADS)
Li, Jiali; Gershow, Marc; Stein, Derek; Qun, Cai; Brandin, Eric; Wang, Hui; Huang, Albert; Branton, Dan; Golovchenko, Jene
2003-03-01
We report on the use of nanometer scale diameter, solid-state nanopores as single molecule detectors of double stranded DNA molecules. These solid-state nanopores are fabricated in thin membranes of silicon nitride, by ion beam sculpting 1. They produce discrete electronic signals: current blockages, when an electrically biased nanopore is exposed to DNA molecules in aqueous salt solutions. We demonstrate examples of such electronic signals for 3k base pairs (bp) and 10k bp double stranded DNA molecules, which suggest that these molecules are individually translocating through the nanopore during the detection process. The translocating time for the 10k bp double stranded DNA is about 3 times longer than the 3k bp, demonstrating that a solid-state nanopore device can be used to detect the lengths of double stranded DNA molecules. Similarities and differences with signals obtained from single stranded DNA in a biological nanopores are discussed 2. 1. Li, J., Stein, D., McMullan, C., Branton, D. Aziz, M. J. and Golovchenko, J. Ion Beam Sculpting at nanometer length scales. Nature 412, 166-169 (2001). 2. Meller, A., L. Nivon, E. Brandin, Golovchenko, J. & Branton, D. Proc. Natl. Acad. Sci. USA 97, 1079-1084 (2000).
Basic quantitative polymerase chain reaction using real-time fluorescence measurements.
Ares, Manuel
2014-10-01
This protocol uses quantitative polymerase chain reaction (qPCR) to measure the number of DNA molecules containing a specific contiguous sequence in a sample of interest (e.g., genomic DNA or cDNA generated by reverse transcription). The sample is subjected to fluorescence-based PCR amplification and, theoretically, during each cycle, two new duplex DNA molecules are produced for each duplex DNA molecule present in the sample. The progress of the reaction during PCR is evaluated by measuring the fluorescence of dsDNA-dye complexes in real time. In the early cycles, DNA duplication is not detected because inadequate amounts of DNA are made. At a certain threshold cycle, DNA-dye complexes double each cycle for 8-10 cycles, until the DNA concentration becomes so high and the primer concentration so low that the reassociation of the product strands blocks efficient synthesis of new DNA and the reaction plateaus. There are two types of measurements: (1) the relative change of the target sequence compared to a reference sequence and (2) the determination of molecule number in the starting sample. The first requires a reference sequence, and the second requires a sample of the target sequence with known numbers of the molecules of sequence to generate a standard curve. By identifying the threshold cycle at which a sample first begins to accumulate DNA-dye complexes exponentially, an estimation of the numbers of starting molecules in the sample can be extrapolated. © 2014 Cold Spring Harbor Laboratory Press.
Single-molecule study of thymidine glycol and i-motif through the alpha-hemolysin ion channel
NASA Astrophysics Data System (ADS)
He, Lidong
Nanopore-based devices have emerged as a single-molecule detection and analysis tool for a wide range of applications. Through electrophoretically driving DNA molecules across a nanosized pore, a lot of information can be received, including unfolding kinetics and DNA-protein interactions. This single-molecule method has the potential to sequence kilobase length DNA polymers without amplification or labeling, approaching "the third generation" genome sequencing for around $1000 within 24 hours. alpha-Hemolysin biological nanopores have the advantages of excellent stability, low-noise level, and precise site-directed mutagenesis for engineering this protein nanopore. The first work presented in this thesis established the current signal of the thymidine glycol lesion in DNA oligomers through an immobilization experiment. The thymidine glycol enantiomers were differentiated from each other by different current blockage levels. Also, the effect of bulky hydrophobic adducts to the current blockage was investigated. Secondly, the alpha-hemolysin nanopore was used to study the human telomere i-motif and RET oncogene i-motif at a single-molecule level. In Chapter 3, it was demonstrated that the alpha-hemolysin nanopore can differentiate an i-motif form and single-strand DNA form at different pH values based on the same sequence. In addition, it shows potential to differentiate the folding topologies generated from the same DNA sequence.
Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki
2015-01-01
In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600
A novel single-stranded DNA detection method based on organic semiconductor heterojunction
NASA Astrophysics Data System (ADS)
Gu, Wen; Liu, Hongbo; Zhang, Xia; Zhang, Hao; Chen, Xiong; Wang, Jun
2016-12-01
We demonstrate a novel DNA detection method with low-cost and disposable advantages by utilizing F16CuPc/CuPc planar organic heterojunction device. Single-stranded DNA (ssDNA) molecules have been well immobilized on the surface of CuPc film observed by atomic force microscopy, producing an obvious electrical response of the device. The conductivity of the organic heterojunction film was significantly increased by ssDNA immobilization because ssDNA molecules brought additional positive charges at heterojunction interface. Furthermore, the thickness dependence of CuPc upper layer on the electrical response was studied to optimize the sensitivity. This study will be helpful for the development of organic heterojunction based biosensors.
DNA sequence analysis with droplet-based microfluidics
Abate, Adam R.; Hung, Tony; Sperling, Ralph A.; Mary, Pascaline; Rotem, Assaf; Agresti, Jeremy J.; Weiner, Michael A.; Weitz, David A.
2014-01-01
Droplet-based microfluidic techniques can form and process micrometer scale droplets at thousands per second. Each droplet can house an individual biochemical reaction, allowing millions of reactions to be performed in minutes with small amounts of total reagent. This versatile approach has been used for engineering enzymes, quantifying concentrations of DNA in solution, and screening protein crystallization conditions. Here, we use it to read the sequences of DNA molecules with a FRET-based assay. Using probes of different sequences, we interrogate a target DNA molecule for polymorphisms. With a larger probe set, additional polymorphisms can be interrogated as well as targets of arbitrary sequence. PMID:24185402
Biosensing via light scattering from plasmonic core-shell nanospheres coated with DNA molecules
NASA Astrophysics Data System (ADS)
Xie, Huai-Yi; Chen, Minfeng; Chang, Yia-Chung; Moirangthem, Rakesh Singh
2017-05-01
We present both experimental and theoretical studies for investigating DNA molecules attached on metallic nanospheres. We have developed an efficient and accurate numerical method to investigate light scattering from plasmonic nanospheres on a substrate covered by a shell, based on the Green's function approach with suitable spherical harmonic basis. Next, we use this method to study optical scattering from DNA molecules attached to metallic nanoparticles placed on a substrate and compare with experimental results. We obtain fairly good agreement between theoretical predictions and the measured ellipsometric spectra. The metallic nanoparticles were used to detect the binding with DNA molecules in a microfluidic setup via spectroscopic ellipsometry (SE), and a detectable change in ellipsometric spectra was found when DNA molecules are captured on Au nanoparticles. Our theoretical simulation indicates that the coverage of Au nanosphere by a submonolayer of DNA molecules, which is modeled by a thin layer of dielectric material (which may absorb light), can lead to a small but detectable spectroscopic shift in both the Ψ and Δ spectra with more significant change in Δ spectra in agreement with experimental results. Our studies demonstrated the ultrasensitive capability of SE for sensing submonolayer coverage of DNA molecules on Au nanospheres. Hence the spectroscopic ellipsometric measurements coupled with theoretical analysis via an efficient computation method can be an effective tool for detecting DNA molecules attached on Au nanoparticles, thus achieving label-free, non-destructive, and high-sensitivity biosensing with nanoscale resolution.
Light-Triggered Release of DNA from Plasmon-Resonant Nanoparticles
NASA Astrophysics Data System (ADS)
Huschka, Ryan
Plasmon-resonant nanoparticle complexes show promising potential for lighttriggered, controllable delivery of deoxyribonucleic acids (DNA) for research and therapeutic purposes. For example, the approach of RNA interference (RNAi) . using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein . is very useful in dissecting genetic function and holds promise as a molecular therapeutic. Herein, we investigate the mechanism and probe the in vitro therapeutic potential of DNA light-triggered release from plasmonic nanoparticles. First, we investigate the mechanism of light-triggered release by dehybridizing double-stranded (dsDNA) via laser illumination from two types of nanoparticle substrates: gold (Au) nanoshells and Au nanorods. Both light-triggered and thermally induced releases are distinctly observable from nanoshell-based complexes. Surprisingly, no analogous measurable light-triggered release was observable from nanorod-based complexes below the DNA melting temperature. These results suggest that a nonthermal mechanism may play a role in light-triggered DNA release. Second, we demonstrate the in vitro light-triggered release of molecules noncovalently attached within dsDNA bound to the Au nanoshell surface. DAPI (4',6- diamidino-2-phenylindole), a bright blue fluorescent molecule that binds reversibly to double-stranded DNA, was chosen to visualize this intracellular light-induced release process. Illumination through the cell membrane of the nanoshell-dsDNA-DAPI complexes dehybridizes the DNA and releases the DAPI molecules within living cells. The DAPI molecules diffuse to the nucleus and associate with the cell's endogenous DNA. This work could have future applications towards drug delivery of molecules that associate with dsDNA. Finally, we demonstrate an engineered Au nanoshell (AuNS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on demand upon illumination with a near-infrared (NIR) laser. A poly(L)lysine peptide (PLL) epilayer coated onto the AuNS surface (AuNS-PLL) is used to capture intact, single-stranded antisense DNA oligonucleotide, or alternatively, double-stranded short-interfering RNA (siRNA) molecules. A green fluorescent protein (GFP)-expressing human lung cancer H1299 cell line was used to determine cellular uptake and GFP gene silencing mediated by AuNS-PLL delivery vector. The light-triggered release of oligonucleotides could have broad applications in the study of cellular processes and in the development of intracellular targeted therapies.
How to read and write mechanical information in DNA molecules
NASA Astrophysics Data System (ADS)
Schiessel, Helmut
In this talk I will show that DNA molecules contain another layer of information on top of the classical genetic information. This different type of information is of mechanical nature and guides the folding of DNA molecules inside cells. With the help of a new Monte Carlo technique, the Mutation Monte Carlo method, we demonstrate that the two layers of information can be multiplexed (as one can have two phone conversations on the same wire). For instance, we can guide on top of genes with single base-pair precision the packaging of DNA into nucleosomes. Finally, we study the mechanical properties of DNA molecules belonging to organisms all across the tree of life. From this we learn that in multicellular organisms the stiffness of DNA around transcription start sites differs dramatically from that of unicellular life. The reason for this difference is surprising.
Walder, Robert; Van Patten, William J; Adhikari, Ayush; Perkins, Thomas T
2018-01-23
Single-molecule force spectroscopy (SMFS) is a powerful technique to characterize the energy landscape of individual proteins, the mechanical properties of nucleic acids, and the strength of receptor-ligand interactions. Atomic force microscopy (AFM)-based SMFS benefits from ongoing progress in improving the precision and stability of cantilevers and the AFM itself. Underappreciated is that the accuracy of such AFM studies remains hindered by inadvertently stretching molecules at an angle while measuring only the vertical component of the force and extension, degrading both measurements. This inaccuracy is particularly problematic in AFM studies using double-stranded DNA and RNA due to their large persistence length (p ≈ 50 nm), often limiting such studies to other SMFS platforms (e.g., custom-built optical and magnetic tweezers). Here, we developed an automated algorithm that aligns the AFM tip above the DNA's attachment point to a coverslip. Importantly, this algorithm was performed at low force (10-20 pN) and relatively fast (15-25 s), preserving the connection between the tip and the target molecule. Our data revealed large uncorrected lateral offsets for 100 and 650 nm DNA molecules [24 ± 18 nm (mean ± standard deviation) and 180 ± 110 nm, respectively]. Correcting this offset yielded a 3-fold improvement in accuracy and precision when characterizing DNA's overstretching transition. We also demonstrated high throughput by acquiring 88 geometrically corrected force-extension curves of a single individual 100 nm DNA molecule in ∼40 min and versatility by aligning polyprotein- and PEG-based protein-ligand assays. Importantly, our software-based algorithm was implemented on a commercial AFM, so it can be broadly adopted. More generally, this work illustrates how to enhance AFM-based SMFS by developing more sophisticated data-acquisition protocols.
NASA Astrophysics Data System (ADS)
Chen, Shuo-Bin; Liu, Guo-Cai; Gu, Lian-Quan; Huang, Zhi-Shu; Tan, Jia-Heng
2018-02-01
Design of small molecules targeted at human telomeric G-quadruplex DNA is an extremely active research area. Interestingly, the telomeric G-quadruplex is a highly polymorphic structure. Changes in its conformation upon small molecule binding may be a powerful method to achieve a desired biological effect. However, the rational development of small molecules capable of regulating conformational change of telomeric G-quadruplex structures is still challenging. In this study, we developed a reliable ligand-based pharmacophore model based on isaindigotone derivatives with conformational change activity toward telomeric G-quadruplex DNA. Furthermore, virtual screening of database was conducted using this pharmacophore model and benzopyranopyrimidine derivatives in the database were identified as a strong inducer of the telomeric G-quadruplex DNA conformation, transforming it from hybrid-type structure to parallel structure.
Synthesis and DNA interaction of a mixed proflavine-phenanthroline Tröger base.
Baldeyrou, Brigitte; Tardy, Christelle; Bailly, Christian; Colson, Pierre; Houssier, Claude; Charmantray, Franck; Demeunynck, Martine
2002-04-01
We report the synthesis of an asymmetric Tröger base containing the two well characterised DNA binding chromophores, proflavine and phenanthroline. The mode of interaction of the hybrid molecule was investigated by circular and linear dichroism experiments and a biochemical assay using DNA topoisomerase I. The data are compatible with a model in which the proflavine moiety intercalates between DNA base pairs and the phenanthroline ring occupies the DNA groove. DNase I cleavage experiments were carried out to investigate the sequence preference of the hybrid ligand and a well resolved footprint was detected at a site encompassing two adjacent 5'-GTC.5-GAC triplets. The sequence preference of the asymmetric molecule is compared to that of the symmetric analogues.
Topological events in single molecules of E. coli DNA confined in nanochannels
Reifenberger, Jeffrey G.; Dorfman, Kevin D.; Cao, Han
2015-01-01
We present experimental data concerning potential topological events such as folds, internal backfolds, and/or knots within long molecules of double-stranded DNA when they are stretched by confinement in a nanochannel. Genomic DNA from E. coli was labeled near the ‘GCTCTTC’ sequence with a fluorescently labeled dUTP analog and stained with the DNA intercalator YOYO. Individual long molecules of DNA were then linearized and imaged using methods based on the NanoChannel Array technology (Irys® System) available from BioNano Genomics. Data were collected on 189,153 molecules of length greater than 50 kilobases. A custom code was developed to search for abnormal intensity spikes in the YOYO backbone profile along the length of individual molecules. By correlating the YOYO intensity spikes with the aligned barcode pattern to the reference, we were able to correlate the bright intensity regions of YOYO with abnormal stretching in the molecule, which suggests these events were either a knot or a region of internal backfolding within the DNA. We interpret the results of our experiments involving molecules exceeding 50 kilobases in the context of existing simulation data for relatively short DNA, typically several kilobases. The frequency of these events is lower than the predictions from simulations, while the size of the events is larger than simulation predictions and often exceeds the molecular weight of the simulated molecules. We also identified DNA molecules that exhibit large, single folds as they enter the nanochannels. Overall, topological events occur at a low frequency (~7% of all molecules) and pose an easily surmountable obstacle for the practice of genome mapping in nanochannels. PMID:25991508
Fu, Hua-Hua; Gu, Lei; Wu, Dan-Dan; Zhang, Zu-Quan
2015-04-28
We report a theoretical study highlighting the thermoelectric properties of biological and synthetic DNA molecules. Based on an effective tight-binding model of duplex DNA and by using the nonequilibrium Green's function technique, the thermal conductance, electrical conductance, Seebeck coefficient and thermoelectric figure of merit in the system are numerically calculated by varying the asymmetries of energies and electronic hoppings in the backbone sites to simulate the environmental complications and fluctuations. We find that due to the multiple transport paths in the DNA molecule, the Fano antiresonance occurs, and enhances the Seebeck coefficient and the figure of merit. When the energy difference is produced in every opposite backbone site, the Dicke effect appears. This effect gives rise to a semiconducting-metallic transition, and enhances the thermoelectric efficiency of the DNA molecule remarkably. Moreover, as the Fano antiresonance point is close to the Dicke resonance one, a giant enhancement in the thermoelectric figure of merit in the DNA molecule has been found. These results provide a scenario to obtain effective routes to enhance the thermoelectric efficiency in the DNA molecules, and suggest perspectives for future experiments intending to control the thermoelectric transport in DNA-like nanodevices.
Izanloo, Cobra
2017-09-02
An understanding of the mechanism of DNA interactions with gold nanoparticles is useful in today medicine applications. We have performed a molecular dynamics simulation on a B-DNA duplex (CCTCAGGCCTCC) in the vicinity of a gold nanoparticle with a truncated octahedron structure composed of 201 gold atoms (diameter ∼1.8 nm) to investigate gold nanoparticle (GNP) effects on the stability of DNA. During simulation, the nanoparticle is closed to DNA and phosphate groups direct the particles into the major grooves of the DNA molecule. Because of peeling and untwisting states that are occur at end of DNA, the nucleotide base lies flat on the surface of GNP. The configuration entropy is estimated using the covariance matrix of atom-positional fluctuations for different bases. The results show that when a gold nanoparticle has interaction with DNA, entropy increases. The results of conformational energy and the hydrogen bond numbers for DNA indicated that DNA becomes unstable in the vicinity of a gold nanoparticle. The radial distribution function was calculated for water hydrogen-phosphate oxygen pairs. Almost for all nucleotide, the presence of a nanoparticle around DNA caused water molecules to be released from the DNA duplex and cations were close to the DNA.
Microarray Detection of Duplex and Triplex DNA Binders with DNA-Modified Gold Nanoparticles
Lytton-Jean, Abigail K. R.; Han, Min Su; Mirkin, Chad A.
2008-01-01
We have designed a chip-based assay, using microarray technology, for determining the relative binding affinities of duplex and triplex DNA binders. This assay combines the high discrimination capabilities afforded by DNA-modified Au nanoparticles with the high-throughput capabilities of DNA microarrays. The detection and screening of duplex DNA binders are important because these molecules, in many cases, are potential anticancer agents as well as toxins. Triplex DNA binders are also promising drug candidates. These molecules, in conjunction with triplex forming oligonucleotides, could potentially be used to achieve control of gene expression by interfering with transcription factors that bind to DNA. Therefore, the ability to screen for these molecules in a high-throughput fashion could dramatically improve the drug screening process. The assay reported here provides excellent discrimination between strong, intermediate, and weak duplex and triplex DNA binders in a high-throughput fashion. PMID:17614366
Diffusion modulation of DNA by toehold exchange
NASA Astrophysics Data System (ADS)
Rodjanapanyakul, Thanapop; Takabatake, Fumi; Abe, Keita; Kawamata, Ibuki; Nomura, Shinichiro M.; Murata, Satoshi
2018-05-01
We propose a method to control the diffusion speed of DNA molecules with a target sequence in a polymer solution. The interaction between solute DNA and diffusion-suppressing DNA that has been anchored to a polymer matrix is modulated by the concentration of the third DNA molecule called the competitor by a mechanism called toehold exchange. Experimental results show that the sequence-specific modulation of the diffusion coefficient is successfully achieved. The diffusion coefficient can be modulated up to sixfold by changing the concentration of the competitor. The specificity of the modulation is also verified under the coexistence of a set of DNA with noninteracting base sequences. With this mechanism, we are able to control the diffusion coefficient of individual DNA species by the concentration of another DNA species. This methodology introduces a programmability to a DNA-based reaction-diffusion system.
Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)
NASA Astrophysics Data System (ADS)
Risqi, A. M.; Yudiarsah, E.
2017-07-01
Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.
Base-unpaired regions in supercoiled replicative form DNA of coliphage M13
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dasgupta, S.; Allison, D.P.; Snyder, C.E.
Superhelical covalently closed circular replicative form DNA (RF I) of coliphage M13 appears as a relaxed molecule that has a base-unpaired region in the form of a bubble (100 to 200 base pairs long) seen in electron micrographs when spread in the presence of formaldehyde and formamide or after pretreatment with glyoxal. S1 endonuclease, specific for single-stranded DNA, converts superhelical M13 RF I DNA, but not nonsuperhelical M13 RF I to a significant extent, into unit-length linear molecules by sequential nicking of two strands. The locations of S1 nuclease-susceptible sites and glyoxal-fixed base-unpaired regions were both related to the fivemore » A-T-rich regions in M13 RF DNA. While S1 nuclease does not show preference for any of these sites, glyoxal-fixed bubbles occur predominantly at the major A-T-rich region in M13 RF DNA.« less
Development of a reference material of a single DNA molecule for the quality control of PCR testing.
Mano, Junichi; Hatano, Shuko; Futo, Satoshi; Yoshii, Junji; Nakae, Hiroki; Naito, Shigehiro; Takabatake, Reona; Kitta, Kazumi
2014-09-02
We developed a reference material of a single DNA molecule with a specific nucleotide sequence. The double-strand linear DNA which has PCR target sequences at the both ends was prepared as a reference DNA molecule, and we named the PCR targets on each side as confirmation sequence and standard sequence. The highly diluted solution of the reference molecule was dispensed into 96 wells of a plastic PCR plate to make the average number of molecules in a well below one. Subsequently, the presence or absence of the reference molecule in each well was checked by real-time PCR targeting for the confirmation sequence. After an enzymatic treatment of the reaction mixture in the positive wells for the digestion of PCR products, the resultant solution was used as the reference material of a single DNA molecule with the standard sequence. PCR analyses revealed that the prepared samples included only one reference molecule with high probability. The single-molecule reference material developed in this study will be useful for the absolute evaluation of a detection limit of PCR-based testing methods, the quality control of PCR analyses, performance evaluations of PCR reagents and instruments, and the preparation of an accurate calibration curve for real-time PCR quantitation.
Structural Transitions in Supercoiled Stretched DNA
NASA Astrophysics Data System (ADS)
v, Croquette
1998-03-01
Using magnetic micromanipulation techniques [Strick 96]( uc(T.R.) Strick, J.-F. Allemand, D. Bensimon, A. Bensimon) and uc(V.) Croquette, "The elasticity of a single supercoiled DNA molecule", Science, 271, 1835 (1996)., we have studied the mechanical properties (force versus extension) of single DNA molecules under a wide range of torsional stresses (supercoiling). We show that unwinding the DNA double helix leads to a phase separation between regular B-DNA and denaturation bubbles. The fraction of denatured molecule increases linearly with the degree of unwinding, beginning at a value of 1% unwinding. We have confirmed this denatured state by hybridization of homologous single-stranded DNA probes and by a chemical attack of the exposed bases. Surprisingly, when we overwind the molecule, the elasticity curves we obtain may also be interpreted by the coexistence of two phases, B-DNA and a new phase which we note P-DNA. The fraction of this new phase increases smoothly with overwinding, beginning at 3 % and continuing up to 300 %. Our results indicate that this new phase is four times more twisted that the standard B-DNA and is 1.75 times longer. Although the structure of this phase is not yet known, such a high twisting can only be attained if the sugar-phosphate backbones of the two strands are twisted closely while the bases are expelled outside of the molecule's core, in a structure reminiscent of the one proposed by Pauling. Indeed we have shown that this new phase is sensitive to chemical attack whereas the B-DNA is not. This new phase begins to appear on a molecule overwound by 3 % and stretched by a force of 5 pN, conditions typically encountered in vivo during gene transcription. This new phase may thus play a biological role (for more details).
NASA Astrophysics Data System (ADS)
Kingsland, Addie
DNA is an amazing molecule which is the basic template for all genetics. It is the primary molecule for storing biological information, and has many applications in nanotechnology. Double-stranded DNA may contain mismatched base pairs beyond the Watson-Crick pairs guanine-cytosine and adenine-thymine. To date, no one has found a physical property of base pair mismatches which describes the behavior of naturally occurring mismatch repair enzymes. Many materials properties of DNA are also unknown, for instance, when pulling DNA in different configurations, different energy differences are observed with no obvious reason why. DNA mismatches also affect their local environment, for instance changing the quantum yield of nearby azobenzene moieties. We utilize molecular dynamics computer simulations to study the structure and dynamics for both matched and mismatched base pairs, within both biological and materials contexts, and in both equilibrium and biased dynamics. We show that mismatched pairs shift further in the plane normal to the DNA strand and are more likely to exhibit non-canonical structures, including the e-motif. Base pair mismatches alter their local environment, affecting the trans- to cis- photoisomerization quantum yield of azobenzene, as well as increasing the likelihood of observing the e-motif. We also show that by using simulated data, we can give new insights on theoretical models to calculate the energetics of pulling DNA strands apart. These results, all relatively inexpensive on modern computer hardware, can help guide the design of DNA-based nanotechnologies, as well as give new insights into the functioning of mismatch repair systems in cancer prevention.
Ahmed, Towfiq; Haraldsen, Jason T; Rehr, John J; Di Ventra, Massimiliano; Schuller, Ivan; Balatsky, Alexander V
2014-03-28
Nanopore-based sequencing has demonstrated a significant potential for the development of fast, accurate, and cost-efficient fingerprinting techniques for next generation molecular detection and sequencing. We propose a specific multilayered graphene-based nanopore device architecture for the recognition of single biomolecules. Molecular detection and analysis can be accomplished through the detection of transverse currents as the molecule or DNA base translocates through the nanopore. To increase the overall signal-to-noise ratio and the accuracy, we implement a new 'multi-point cross-correlation' technique for identification of DNA bases or other molecules on the single molecular level. We demonstrate that the cross-correlations between each nanopore will greatly enhance the transverse current signal for each molecule. We implement first-principles transport calculations for DNA bases surveyed across a multilayered graphene nanopore system to illustrate the advantages of the proposed geometry. A time-series analysis of the cross-correlation functions illustrates the potential of this method for enhancing the signal-to-noise ratio. This work constitutes a significant step forward in facilitating fingerprinting of single biomolecules using solid state technology.
DNA origami-based shape IDs for single-molecule nanomechanical genotyping
NASA Astrophysics Data System (ADS)
Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai
2017-04-01
Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.
DNA origami-based shape IDs for single-molecule nanomechanical genotyping
Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai
2017-01-01
Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ∼10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level. PMID:28382928
Logical NAND and NOR Operations Using Algorithmic Self-assembly of DNA Molecules
NASA Astrophysics Data System (ADS)
Wang, Yanfeng; Cui, Guangzhao; Zhang, Xuncai; Zheng, Yan
DNA self-assembly is the most advanced and versatile system that has been experimentally demonstrated for programmable construction of patterned systems on the molecular scale. It has been demonstrated that the simple binary arithmetic and logical operations can be computed by the process of self assembly of DNA tiles. Here we report a one-dimensional algorithmic self-assembly of DNA triple-crossover molecules that can be used to execute five steps of a logical NAND and NOR operations on a string of binary bits. To achieve this, abstract tiles were translated into DNA tiles based on triple-crossover motifs. Serving as input for the computation, long single stranded DNA molecules were used to nucleate growth of tiles into algorithmic crystals. Our method shows that engineered DNA self-assembly can be treated as a bottom-up design techniques, and can be capable of designing DNA computer organization and architecture.
Jaworska, Aleksandra; Jablonska, Anna; Wilanowski, Tomasz; Palys, Barbara; Sek, Slawomir; Kudelski, Andrzej
2018-05-24
Adsorption of molecules of DNA (deoxyribonucleic acid) or modified DNA on gold surfaces is often the first step in construction of many various biosensors, including biosensors for detection of DNA with a particular sequence. In this work we study the influence of amine and thiol modifications at the 3' ends of single stranded DNA (ssDNA) molecules on their adsorption on the surface of gold substrates and on the efficiency of hybridization of immobilized DNA with the complementary single stranded DNA. The characterization of formed layers has been carried out using infrared spectroscopy and atomic force microscopy. As model single stranded DNA we used DNA containing 20 adenine bases, whereas the complementary DNA contained 20 thymine bases. We found that the bands in polarization modulation-infrared reflection-adsorption spectroscopy (PM-IRRAS) spectra of layers formed from thiol-modified DNA are significantly narrower and sharper, indicating their higher regularity in the orientation of DNA on gold surface when using thiol linker. Also, hybridization of the layer of thiol-modified DNA containing 20 adenine bases with the respective DNA containing thymine bases leads to formation of much more organized structures than in the case of unmodified DNA or DNA with the amine linker. We conclude that the thiol-modified ssDNA is more promising for the preparation of biosensors, in comparison with the amine-modified or unmodified ssDNA. We have also found that the above-mentioned modifications at the 3' end of ssDNA significantly influence the IR spectrum (and hence the structure) of polycrystalline films formed from such compounds, even though adsorbed fragments contain less than 5% of the DNA chain. This effect should be taken into account when comparing IR spectra of various polycrystalline films formed from modified and unmodified DNA. Copyright © 2018. Published by Elsevier B.V.
Schneider, Uffe V.; Géci, Imrich; Jøhnk, Nina; Mikkelsen, Nikolaj D.; Pedersen, Erik B.; Lisby, Gorm
2011-01-01
The sensitivity and specificity of clinical diagnostic assays using DNA hybridization techniques are limited by the dissociation of double-stranded DNA (dsDNA) antiparallel duplex helices. This situation can be improved by addition of DNA stabilizing molecules such as nucleic acid intercalators. Here, we report the synthesis of a novel ortho-Twisted Intercalating Nucleic Acid (TINA) amidite utilizing the phosphoramidite approach, and examine the stabilizing effect of ortho- and para-TINA molecules in antiparallel DNA duplex formation. In a thermal stability assay, ortho- and para-TINA molecules increased the melting point (Tm) of Watson-Crick based antiparallel DNA duplexes. The increase in Tm was greatest when the intercalators were placed at the 5′ and 3′ termini (preferable) or, if placed internally, for each half or whole helix turn. Terminally positioned TINA molecules improved analytical sensitivity in a DNA hybridization capture assay targeting the Escherichia coli rrs gene. The corresponding sequence from the Pseudomonas aeruginosa rrs gene was used as cross-reactivity control. At 150 mM ionic strength, analytical sensitivity was improved 27-fold by addition of ortho-TINA molecules and 7-fold by addition of para-TINA molecules (versus the unmodified DNA oligonucleotide), with a 4-fold increase retained at 1 M ionic strength. Both intercalators sustained the discrimination of mismatches in the dsDNA (indicated by ΔTm), unless placed directly adjacent to the mismatch – in which case they partly concealed ΔTm (most pronounced for para-TINA molecules). We anticipate that the presented rules for placement of TINA molecules will be broadly applicable in hybridization capture assays and target amplification systems. PMID:21673988
Nanofluidic Device with Embedded Nanopore
NASA Astrophysics Data System (ADS)
Zhang, Yuning; Reisner, Walter
2014-03-01
Nanofluidic based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with nanpore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a nanopore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We demonstrate that we can detect - using fluorescent microscopy - successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. We also show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore until a certain voltage bias is added.
Li, Chen-Chen; Zhang, Yan; Tang, Bo; Zhang, Chun-Yang
2018-06-05
We combine single-molecule detection with magnetic separation for simultaneous measurement of human 8-oxoG DNA glycosylase 1 (hOGG1) and uracil DNA glycosylase (UDG) based on excision repair-initiated endonuclease IV (Endo IV)-assisted signal amplification. This method can sensitively detect multiple DNA glycosylases, and it can be further applied for the simultaneous measurement of enzyme kinetic parameters and screening of both hOGG1 and UDG inhibitors.
Spontaneous Transport of Single-Stranded DNA through Graphene-MoS2 Heterostructure Nanopores.
Luan, Binquan; Zhou, Ruhong
2018-04-24
The effective transport of a single-stranded DNA (ssDNA) molecule through a solid-state nanopore is essential to the future success of high-throughput and low-cost DNA sequencing. Compatible with current electric sensing technologies, here, we propose and demonstrate by molecular dynamics simulations the ssDNA transport through a quasi-two-dimensional nanopore in a heterostructure stacked together with different 2D materials, such as graphene and molybdenum disulfide (MoS 2 ). Due to different chemical potentials, U, of DNA bases on different 2D materials, it is energetically favorable for a ssDNA molecule to move from the low- U MoS 2 surface to the high- U graphene surface through a nanopore. With the proper attraction between the negatively charged phosphate group in each nucleotide and the positively charged Mo atoms exposed on the pore surface, the ssDNA molecule can be temporarily seized and released thereafter through a thermal activation, that is, a slow and possible nucleotide-by-nucleotide transport. A theoretical formulation is then developed for the free energy of the ssDNA transiting a heterostructure nanopore to properly characterize the non-equilibrium stick-slip-like motion of a ssDNA molecule.
Heterologous mitochondrial DNA recombination in human cells.
D'Aurelio, Marilena; Gajewski, Carl D; Lin, Michael T; Mauck, William M; Shao, Leon Z; Lenaz, Giorgio; Moraes, Carlos T; Manfredi, Giovanni
2004-12-15
Inter-molecular heterologous mitochondrial DNA (mtDNA) recombination is known to occur in yeast and plants. Nevertheless, its occurrence in human cells is still controversial. To address this issue we have fused two human cytoplasmic hybrid cell lines, each containing a distinct pathogenic mtDNA mutation and specific sets of genetic markers. In this hybrid model, we found direct evidence of recombination between these two mtDNA haplotypes. Recombinant mtDNA molecules in the hybrid cells were identified using three independent experimental approaches. First, recombinant molecules containing genetic markers from both parental alleles were demonstrated with restriction fragment length polymorphism of polymerase chain reaction products, by measuring the relative frequencies of each marker. Second, fragments of recombinant mtDNA were cloned and sequenced to identify the regions involved in the recombination events. Finally, recombinant molecules were demonstrated directly by Southern blot using appropriate combinations of polymorphic restriction sites and probes. This combined approach confirmed the existence of heterogeneous species of recombinant mtDNA molecules in the hybrid cells. These findings have important implications for mtDNA-related diseases, the interpretation of human evolution and population genetics and forensic analyses based on mtDNA genotyping.
Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-Ichi; Sugimoto, Naoki
2015-12-02
In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water-water interactions, (ii) ethylene glycol more effectively disrupted water-water interactions around Watson-Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson-Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Branchpoint expansion in a fully complementary three-way DNA junction.
Sabir, Tara; Toulmin, Anita; Ma, Long; Jones, Anita C; McGlynn, Peter; Schröder, Gunnar F; Magennis, Steven W
2012-04-11
Branched nucleic acid molecules serve as key intermediates in DNA replication, recombination, and repair; architectural elements in RNA; and building blocks and functional components for nanoscience applications. Using a combination of high-resolution single-molecule FRET, time-resolved spectroscopy, and molecular modeling, we have probed the local and global structure of a DNA three-way junction (3WJ) in solution. We found that it adopts a Y-shaped, pyramidal structure, in which the bases adjacent to the branchpoint are unpaired, despite the full Watson-Crick complementarity of the molecule. The unpairing allows a nanoscale cavity to form at the junction center. Our structure accounts for earlier observations made of the structure, flexibility, and reactivity of 3WJs. We anticipate that these results will guide the development of new DNA-based supramolecular receptors and nanosystems. © 2012 American Chemical Society
Voltage dependency of transmission probability of aperiodic DNA molecule
NASA Astrophysics Data System (ADS)
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
DNABIT Compress - Genome compression algorithm.
Rajarajeswari, Pothuraju; Apparao, Allam
2011-01-22
Data compression is concerned with how information is organized in data. Efficient storage means removal of redundancy from the data being stored in the DNA molecule. Data compression algorithms remove redundancy and are used to understand biologically important molecules. We present a compression algorithm, "DNABIT Compress" for DNA sequences based on a novel algorithm of assigning binary bits for smaller segments of DNA bases to compress both repetitive and non repetitive DNA sequence. Our proposed algorithm achieves the best compression ratio for DNA sequences for larger genome. Significantly better compression results show that "DNABIT Compress" algorithm is the best among the remaining compression algorithms. While achieving the best compression ratios for DNA sequences (Genomes),our new DNABIT Compress algorithm significantly improves the running time of all previous DNA compression programs. Assigning binary bits (Unique BIT CODE) for (Exact Repeats, Reverse Repeats) fragments of DNA sequence is also a unique concept introduced in this algorithm for the first time in DNA compression. This proposed new algorithm could achieve the best compression ratio as much as 1.58 bits/bases where the existing best methods could not achieve a ratio less than 1.72 bits/bases.
Wang, Guihong; Li, Chaoqun; Wang, Yan; Chen, Guangju
2013-01-01
Background Smads, the homologs of Sma and MAD proteins, play a key role in gene expression regulation in the transforming growth factor-β (TGF-β) signaling pathway. Recent experimental studies have revealed that Smad4/R-Smad heterodimers bound on DNA are energetically more favorable than homodimeric R-Smad/R-Smad complexes bound on DNA, which indicates that Smad4 might act as binding vehicle to cooperatively assemble with activated R-Smads on DNA in the nucleus. However, the details of interaction mechanism for cooperative recruitment of Smad4 protein to R-Smad proteins on DNA, and allosteric communication between the Smad4-DNA and R-Smad-DNA interfaces via DNA mediating are not yet clear so far. Methodology In the present work, we have constructed a series of Smadn+DNA+Smadn (n = 1, 3, 4) models and carried out molecular dynamics simulations, free energy calculations and DNA dynamics analysis for them to study the interaction properties of Smadn (n = 1, 3, 4) with DNA molecule. Results The results revealed that the binding of Smad4 protein to DNA molecule facilitates energetically the formation of the heteromeric Smad4+DNA+Smad1/3 complex by increasing the affinity of Smad1/3 with DNA molecule. Further investigations through the residue/base motion correlation and DNA dynamics analyses predicted that the binding of Smad4 protein to DNA molecule in the heteromeric Smad4+DNA+Smad1/3 model induces an allosteric communication from the Smad4-DNA interface to Smad1/Smad3-DNA interface via DNA base-pair helical motions, surface conformation changes and new hydrogen bond formations. The present work theoretically explains the mechanism of cooperative recruitment of Smad4 protein to Smad1/3 protein via DNA-mediated indirect readout mode in the nucleus. PMID:23326519
Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.
Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant
2017-11-28
Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.
Payne, Andrew C; Andregg, Michael; Kemmish, Kent; Hamalainen, Mark; Bowell, Charlotte; Bleloch, Andrew; Klejwa, Nathan; Lehrach, Wolfgang; Schatz, Ken; Stark, Heather; Marblestone, Adam; Church, George; Own, Christopher S; Andregg, William
2013-01-01
We present "molecular threading", a surface independent tip-based method for stretching and depositing single and double-stranded DNA molecules. DNA is stretched into air at a liquid-air interface, and can be subsequently deposited onto a dry substrate isolated from solution. The design of an apparatus used for molecular threading is presented, and fluorescence and electron microscopies are used to characterize the angular distribution, straightness, and reproducibility of stretched DNA deposited in arrays onto elastomeric surfaces and thin membranes. Molecular threading demonstrates high straightness and uniformity over length scales from nanometers to micrometers, and represents an alternative to existing DNA deposition and linearization methods. These results point towards scalable and high-throughput precision manipulation of single-molecule polymers.
Lactose-modified DNA tile nanostructures as drug carriers.
Akkus Sut, Pinar; Tunc, Cansu Umran; Culha, Mustafa
2016-09-01
DNA hybridization allows the preparation of nanoscale DNA structures with desired shape and size. DNA structures using simple base pairing can be used for the delivery of drug molecules into the cells. Since DNA carries multiple negative charges, their cellular uptake efficiency is low. Thus, the modification of the DNA structures with molecules that may enhance the cellular internalization may be an option. The objective of this study is to construct DNA-based nanocarrier system and to investigate the cellular uptake of DNA tile with/without lactose modification. Doxorubicin was intercalated to DNA tile and cellular uptake of drug-loaded DNA-based carrier with/without lactose modification was investigated in vitro. HeLa, BT-474, and MDA-MB-231 cancer cells were used for cellular uptake studies and cytotoxicity assays. Using fluorescence spectroscopy, flow cytometry, and confocal microscopy, cellular uptake behavior of DNA tile was investigated. The cytotoxicity of DNA tile structures was determined with WST-1 assay. The results show that modification with lactose effectively increases the intracellular uptake of doxorubicin loaded DNA tile structure by cancer cells compared with the unmodified DNA tile. The findings of this study suggest that DNA-based nanostructures modified with carbohydrates can be used as suitable multifunctional nanocarriers with simple chemical modifications.
Imaging and sizing of single DNA molecules on a mobile phone.
Wei, Qingshan; Luo, Wei; Chiang, Samuel; Kappel, Tara; Mejia, Crystal; Tseng, Derek; Chan, Raymond Yan Lok; Yan, Eddie; Qi, Hangfei; Shabbir, Faizan; Ozkan, Haydar; Feng, Steve; Ozcan, Aydogan
2014-12-23
DNA imaging techniques using optical microscopy have found numerous applications in biology, chemistry and physics and are based on relatively expensive, bulky and complicated set-ups that limit their use to advanced laboratory settings. Here we demonstrate imaging and length quantification of single molecule DNA strands using a compact, lightweight and cost-effective fluorescence microscope installed on a mobile phone. In addition to an optomechanical attachment that creates a high contrast dark-field imaging setup using an external lens, thin-film interference filters, a miniature dovetail stage and a laser-diode for oblique-angle excitation, we also created a computational framework and a mobile phone application connected to a server back-end for measurement of the lengths of individual DNA molecules that are labeled and stretched using disposable chips. Using this mobile phone platform, we imaged single DNA molecules of various lengths to demonstrate a sizing accuracy of <1 kilobase-pairs (kbp) for 10 kbp and longer DNA samples imaged over a field-of-view of ∼2 mm2.
Chandra, Madhavaiah; Keller, Sascha; Gloeckner, Christian; Bornemann, Benjamin; Marx, Andreas
2007-01-01
The Watson-Crick base pairing of DNA is an advantageous phenomenon that can be exploited when using DNA as a scaffold for directed self-organization of nanometer-sized objects. Several reports have appeared in the literature that describe the generation of branched DNA (bDNA) with variable numbers of arms that self-assembles into predesigned architectures. These bDNA units are generated by using cleverly designed rigid crossover DNA molecules. Alternatively, bDNA can be generated by using synthetic branch points derived from either nucleoside or non-nucleoside building blocks. Branched DNA has scarcely been explored for use in nanotechnology or from self-assembling perspectives. Herein, we wish to report our results for the synthesis, characterization, and assembling properties of asymmetrical bDNA molecules that are able to generate linear and circular bDNA constructs. Our strategy for the generation of bDNA is based on a branching point that makes use of a novel protecting-group strategy. The bDNA units were generated by means of automated DNA synthesis methods and were used to generate novel objects by employing chemical and biological techniques. The entities generated might be useful building blocks for DNA-based nanobiotechnology.
Multiplexed Sequence Encoding: A Framework for DNA Communication.
Zakeri, Bijan; Carr, Peter A; Lu, Timothy K
2016-01-01
Synthetic DNA has great propensity for efficiently and stably storing non-biological information. With DNA writing and reading technologies rapidly advancing, new applications for synthetic DNA are emerging in data storage and communication. Traditionally, DNA communication has focused on the encoding and transfer of complete sets of information. Here, we explore the use of DNA for the communication of short messages that are fragmented across multiple distinct DNA molecules. We identified three pivotal points in a communication-data encoding, data transfer & data extraction-and developed novel tools to enable communication via molecules of DNA. To address data encoding, we designed DNA-based individualized keyboards (iKeys) to convert plaintext into DNA, while reducing the occurrence of DNA homopolymers to improve synthesis and sequencing processes. To address data transfer, we implemented a secret-sharing system-Multiplexed Sequence Encoding (MuSE)-that conceals messages between multiple distinct DNA molecules, requiring a combination key to reveal messages. To address data extraction, we achieved the first instance of chromatogram patterning through multiplexed sequencing, thereby enabling a new method for data extraction. We envision these approaches will enable more widespread communication of information via DNA.
Banerjee, T; Banerjee, S; Sett, S; Ghosh, S; Rakshit, T; Mukhopadhyay, R
2016-01-01
DNA threading intercalators are a unique class of intercalating agents, albeit little biophysical information is available on their intercalative actions. Herein, the intercalative effects of nogalamycin, which is a naturally-occurring DNA threading intercalator, have been investigated by high-resolution atomic force microscopy (AFM) and spectroscopy (AFS). The results have been compared with those of the well-known chemotherapeutic drug daunomycin, which is a non-threading classical intercalator bearing structural similarity to nogalamycin. A comparative AFM assessment revealed a greater increase in DNA contour length over the entire incubation period of 48 h for nogalamycin treatment, whereas the contour length increase manifested faster in case of daunomycin. The elastic response of single DNA molecules to an externally applied force was investigated by the single molecule AFS approach. Characteristic mechanical fingerprints in the overstretching behaviour clearly distinguished the nogalamycin/daunomycin-treated dsDNA from untreated dsDNA-the former appearing less elastic than the latter, and the nogalamycin-treated DNA distinguished from the daunomycin-treated DNA-the classically intercalated dsDNA appearing the least elastic. A single molecule AFS-based discrimination of threading intercalation from the classical type is being reported for the first time.
Rapid screening for plasmid DNA.
Hughes, C; Meynell, G G
1977-03-07
A procedure is described for demonstrating plasmid DNA and its molecular weight, based on rate zonal centrifugation of unlabelled DNA in neutral sucrose gradients containing a low concentration of ethidium bromide. Each DNA species is then visualized as a discrete fluorescent band when the centrifuge tube is illuminated with ultra-violet light. Plasmids exist as closed circular and as relaxed circular molecules, which sediment separately, but during preparation of lysates, closed circular molecules are nicked so that each plasmid forms only a single band of relaxed circles within the gradient.
Mechanisms of small molecule–DNA interactions probed by single-molecule force spectroscopy
Almaqwashi, Ali A.; Paramanathan, Thayaparan; Rouzina, Ioulia; Williams, Mark C.
2016-01-01
There is a wide range of applications for non-covalent DNA binding ligands, and optimization of such interactions requires detailed understanding of the binding mechanisms. One important class of these ligands is that of intercalators, which bind DNA by inserting aromatic moieties between adjacent DNA base pairs. Characterizing the dynamic and equilibrium aspects of DNA-intercalator complex assembly may allow optimization of DNA binding for specific functions. Single-molecule force spectroscopy studies have recently revealed new details about the molecular mechanisms governing DNA intercalation. These studies can provide the binding kinetics and affinity as well as determining the magnitude of the double helix structural deformations during the dynamic assembly of DNA–ligand complexes. These results may in turn guide the rational design of intercalators synthesized for DNA-targeted drugs, optical probes, or integrated biological self-assembly processes. Herein, we survey the progress in experimental methods as well as the corresponding analysis framework for understanding single molecule DNA binding mechanisms. We discuss briefly minor and major groove binding ligands, and then focus on intercalators, which have been probed extensively with these methods. Conventional mono-intercalators and bis-intercalators are discussed, followed by unconventional DNA intercalation. We then consider the prospects for using these methods in optimizing conventional and unconventional DNA-intercalating small molecules. PMID:27085806
McAndrew, Christopher P.; Tyson, Christopher; Zischkau, Joseph; Mehl, Patrick; Tuma, Pamela L.; Pegg, Ian L.; Sarkar, Abhijit
2016-01-01
We report the development of a simple-to-implement magnetic force transducer that can apply a wide range of piconewton (pN) scale forces on single DNA molecules and DNA–protein complexes in the horizontal plane. The resulting low-noise force-extension data enable very high-resolution detection of changes in the DNA tether’s extension: ~0.05 pN in force and <10 nm change in extension. We have also verified that we can manipulate DNA in near equilibrium conditions through the wide range of forces by ramping the force from low to high and back again, and observing minimal hysteresis in the molecule’s force response. Using a calibration technique based on Stokes’ drag law, we have confirmed our force measurements from DNA force-extension experiments obtained using the fluctuation-dissipation theorem applied to transverse fluctuations of the magnetic microsphere. We present data on the force-distance characteristics of a DNA molecule complexed with histones. The results illustrate how the tweezers can be used to study DNA binding proteins at the single molecule level. PMID:26757808
Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions
Gardner, Shea N [San Leandro, CA; Mariella, Jr., Raymond P.; Christian, Allen T [Tracy, CA; Young, Jennifer A [Berkeley, CA; Clague, David S [Livermore, CA
2011-01-18
A method of fabricating a DNA molecule of user-defined sequence. The method comprises the steps of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an even or odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths. In one embodiment starting sequence fragments are of different lengths, n, n+1, n+2, etc.
Characterization of individual polynucleotide molecules using a membrane channel
NASA Technical Reports Server (NTRS)
Kasianowicz, J. J.; Brandin, E.; Branton, D.; Deamer, D. W.
1996-01-01
We show that an electric field can drive single-stranded RNA and DNA molecules through a 2.6-nm diameter ion channel in a lipid bilayer membrane. Because the channel diameter can accommodate only a single strand of RNA or DNA, each polymer traverses the membrane as an extended chain that partially blocks the channel. The passage of each molecule is detected as a transient decrease of ionic current whose duration is proportional to polymer length. Channel blockades can therefore be used to measure polynucleotide length. With further improvements, the method could in principle provide direct, high-speed detection of the sequence of bases in single molecules of DNA or RNA.
DNA melting profiles from a matrix method.
Poland, Douglas
2004-02-05
In this article we give a new method for the calculation of DNA melting profiles. Based on the matrix formulation of the DNA partition function, the method relies for its efficiency on the fact that the required matrices are very sparse, essentially reducing matrix multiplication to vector multiplication and thus making the computer time required to treat a DNA molecule containing N base pairs proportional to N(2). A key ingredient in the method is the result that multiplication by the inverse matrix can also be reduced to vector multiplication. The task of calculating the melting profile for the entire genome is further reduced by treating regions of the molecule between helix-plateaus, thus breaking the molecule up into independent parts that can each be treated individually. The method is easily modified to incorporate changes in the assignment of statistical weights to the different structural features of DNA. We illustrate the method using the genome of Haemophilus influenzae. Copyright 2003 Wiley Periodicals, Inc.
2013-01-01
Background To explore novel platinum-based anticancer agents that are distinct from the structure and interaction mode of the traditional cisplatin by forming the bifunctional intrastrand 1,2 GpG adduct, the monofunctional platinum + DNA adducts with extensive non-covalent interactions had been studied. It was reported that the monofunctional testosterone-based platinum(II) agents present the high anticancer activity. Moreover, it was also found that the testosterone-based platinum agents could cause the DNA helix to undergo significant unwinding and bending over the non-testosterone-based platinum agents. However, the interaction mechanisms of these platinum agents with DNA at the atomic level are not yet clear so far. Results In the present work, we used molecular dynamics (MD) simulations and DNA conformational dynamics calculations to study the DNA distortion properties of the testosterone-based platinum + DNA, the improved testosterone-based platinum + DNA and the non-testosterone-based platinum + DNA adducts. The results show that the intercalative interaction of the improved flexible testosterone-based platinum agent with DNA molecule could cause larger DNA conformational distortion than the groove-face interaction of the rigid testosterone-based platinum agent with DNA molecule. Further investigations for the non-testosterone-based platinum agent reveal the occurrence of insignificant change of DNA conformation due to the absence of testosterone ligand in such agent. Based on the DNA dynamics analysis, the DNA base motions relating to DNA groove parameter changes and hydrogen bond destruction of DNA base pairs were also discussed in this work. Conclusions The flexible linker in the improved testosterone-based platinum agent causes an intercalative interaction with DNA in the improved testosterone-based platinum + DNA adduct, which is different from the groove-face interaction caused by a rigid linker in the testosterone-based platinum agent. The present investigations provide useful information of DNA conformation affected by a testosterone-based platinum complex at the atomic level. PMID:23517640
Sub-Ensemble Monitoring of DNA Strand Displacement Using Multiparameter Single-Molecule FRET.
Baltierra-Jasso, Laura E; Morten, Michael J; Magennis, Steven W
2018-03-05
Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here, we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constant of 10 m -1 s -1 . We also followed the displacement from a DNA three-way junction (3WJ) by ssDNA. The presence of three internal mismatched bases in the middle of the invading strand did not prevent displacement from the 3WJ, but reduced the second-order rate constant by about 50 %. We attribute strand exchange in the dsDNA and 3WJ to a zero-toehold pathway from the blunt-ended duplex arms. The single-molecule approach demonstrated here will be useful for studying complex DNA networks. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Lesion search and recognition by thymine DNA glycosylase revealed by single molecule imaging
Buechner, Claudia N.; Maiti, Atanu; Drohat, Alexander C.; Tessmer, Ingrid
2015-01-01
The ability of DNA glycosylases to rapidly and efficiently detect lesions among a vast excess of nondamaged DNA bases is vitally important in base excision repair (BER). Here, we use single molecule imaging by atomic force microscopy (AFM) supported by a 2-aminopurine fluorescence base flipping assay to study damage search by human thymine DNA glycosylase (hTDG), which initiates BER of mutagenic and cytotoxic G:T and G:U mispairs in DNA. Our data reveal an equilibrium between two conformational states of hTDG–DNA complexes, assigned as search complex (SC) and interrogation complex (IC), both at target lesions and undamaged DNA sites. Notably, for both hTDG and a second glycosylase, hOGG1, which recognizes structurally different 8-oxoguanine lesions, the conformation of the DNA in the SC mirrors innate structural properties of their respective target sites. In the IC, the DNA is sharply bent, as seen in crystal structures of hTDG lesion recognition complexes, which likely supports the base flipping required for lesion identification. Our results support a potentially general concept of sculpting of glycosylases to their targets, allowing them to exploit the energetic cost of DNA bending for initial lesion sensing, coupled with continuous (extrahelical) base interrogation during lesion search by DNA glycosylases. PMID:25712093
Sequence Dependencies of DNA Deformability and Hydration in the Minor Groove
Yonetani, Yoshiteru; Kono, Hidetoshi
2009-01-01
Abstract DNA deformability and hydration are both sequence-dependent and are essential in specific DNA sequence recognition by proteins. However, the relationship between the two is not well understood. Here, systematic molecular dynamics simulations of 136 DNA sequences that differ from each other in their central tetramer revealed that sequence dependence of hydration is clearly correlated with that of deformability. We show that this correlation can be illustrated by four typical cases. Most rigid basepair steps are highly likely to form an ordered hydration pattern composed of one water molecule forming a bridge between the bases of distinct strands, but a few exceptions favor another ordered hydration composed of two water molecules forming such a bridge. Steps with medium deformability can display both of these hydration patterns with frequent transition. Highly flexible steps do not have any stable hydration pattern. A detailed picture of this correlation demonstrates that motions of hydration water molecules and DNA bases are tightly coupled with each other at the atomic level. These results contribute to our understanding of the entropic contribution from water molecules in protein or drug binding and could be applied for the purpose of predicting binding sites. PMID:19686662
NASA Astrophysics Data System (ADS)
Sen, Suman
DNA, RNA and Protein are three pivotal biomolecules in human and other organisms, playing decisive roles in functionality, appearance, diseases development and other physiological phenomena. Hence, sequencing of these biomolecules acquires the prime interest in the scientific community. Single molecular identification of their building blocks can be done by a technique called Recognition Tunneling (RT) based on Scanning Tunneling Microscope (STM). A single layer of specially designed recognition molecule is attached to the STM electrodes, which trap the targeted molecules (DNA nucleoside monophosphates, RNA nucleoside monophosphates or amino acids) inside the STM nanogap. Depending on their different binding interactions with the recognition molecules, the analyte molecules generate stochastic signal trains accommodating their "electronic fingerprints". Signal features are used to detect the molecules using a machine learning algorithm and different molecules can be identified with significantly high accuracy. This, in turn, paves the way for rapid, economical nanopore sequencing platform, overcoming the drawbacks of Next Generation Sequencing (NGS) techniques. To read DNA nucleotides with high accuracy in an STM tunnel junction a series of nitrogen-based heterocycles were designed and examined to check their capabilities to interact with naturally occurring DNA nucleotides by hydrogen bonding in the tunnel junction. These recognition molecules are Benzimidazole, Imidazole, Triazole and Pyrrole. Benzimidazole proved to be best among them showing DNA nucleotide classification accuracy close to 99%. Also, Imidazole reader can read an abasic monophosphate (AP), a product from depurination or depyrimidination that occurs 10,000 times per human cell per day. In another study, I have investigated a new universal reader, 1-(2-mercaptoethyl)pyrene (Pyrene reader) based on stacking interactions, which should be more specific to the canonical DNA nucleosides. In addition, Pyrene reader showed higher DNA base-calling accuracy compare to Imidazole reader, the workhorse in our previous projects. In my other projects, various amino acids and RNA nucleoside monophosphates were also classified with significantly high accuracy using RT. Twenty naturally occurring amino acids and various RNA nucleosides (four canonical and two modified) were successfully identified. Thus, we envision nanopore sequencing biomolecules using Recognition Tunneling (RT) that should provide comprehensive betterment over current technologies in terms of time, chemical and instrumental cost and capability of de novo sequencing.
Biswas, Sovan; Sen, Suman; Im, JongOne; Biswas, Sudipta; Krstic, Predrag; Ashcroft, Brian; Borges, Chad; Zhao, Yanan; Lindsay, Stuart; Zhang, Peiming
2016-12-27
A reader molecule, which recognizes all the naturally occurring nucleobases in an electron tunnel junction, is required for sequencing DNA by a recognition tunneling (RT) technique, referred to as a universal reader. In the present study, we have designed a series of heterocyclic carboxamides based on hydrogen bonding and a large-sized pyrene ring based on a π-π stacking interaction as universal reader candidates. Each of these compounds was synthesized to bear a thiolated linker for attachment to metal electrodes and examined for their interactions with naturally occurring DNA nucleosides and nucleotides by 1 H NMR, ESI-MS, computational calculations, and surface plasmon resonance. RT measurements were carried out in a scanning tunnel microscope. All of these molecules generated electrical signals with DNA nucleotides in tunneling junctions under physiological conditions (phosphate buffered aqueous solution, pH 7.4). Using a support vector machine as a tool for data analysis, we found that these candidates distinguished among naturally occurring DNA nucleotides with the accuracy of pyrene (by π-π stacking interactions) > azole carboxamides (by hydrogen-bonding interactions). In addition, the pyrene reader operated efficiently in a larger tunnel junction. However, the azole carboxamide could read abasic (AP) monophosphate, a product from spontaneous base hydrolysis or an intermediate of base excision repair. Thus, we envision that sequencing DNA using both π-π stacking and hydrogen-bonding-based universal readers in parallel should generate more comprehensive genome sequences than sequencing based on either reader molecule alone.
Shao, Zhiyong; Graf, Shannon; Chaga, Oleg Y; Lavrov, Dennis V
2006-10-15
The 16,937-nuceotide sequence of the linear mitochondrial DNA (mt-DNA) molecule of the moon jelly Aurelia aurita (Cnidaria, Scyphozoa) - the first mtDNA sequence from the class Scypozoa and the first sequence of a linear mtDNA from Metazoa - has been determined. This sequence contains genes for 13 energy pathway proteins, small and large subunit rRNAs, and methionine and tryptophan tRNAs. In addition, two open reading frames of 324 and 969 base pairs in length have been found. The deduced amino-acid sequence of one of them, ORF969, displays extensive sequence similarity with the polymerase [but not the exonuclease] domain of family B DNA polymerases, and this ORF has been tentatively identified as dnab. This is the first report of dnab in animal mtDNA. The genes in A. aurita mtDNA are arranged in two clusters with opposite transcriptional polarities; transcription proceeding toward the ends of the molecule. The determined sequences at the ends of the molecule are nearly identical but inverted and lack any obvious potential secondary structures or telomere-like repeat elements. The acquisition of mitochondrial genomic data for the second class of Cnidaria allows us to reconstruct characteristic features of mitochondrial evolution in this animal phylum.
Yagura, Teiti; Schuch, André Passaglia; Garcia, Camila Carrião Machado; Rocha, Clarissa Ribeiro Reily; Moreno, Natália Cestari; Angeli, José Pedro Friedmann; Mendes, Davi; Severino, Divinomar; Bianchini Sanchez, Angelica; Di Mascio, Paolo; de Medeiros, Marisa Helena Gennari; Menck, Carlos Frederico Martins
2017-07-01
UVA light is hardly absorbed by the DNA molecule, but recent works point to a direct mechanism of DNA lesion by these wavelengths. UVA light also excite endogenous chromophores, which causes DNA damage through ROS. In this study, DNA samples were irradiated with UVA light in different conditions to investigate possible mechanisms involved in the induction of DNA damage. The different types of DNA lesions formed after irradiation were determined through the use of endonucleases, which recognize and cleave sites containing oxidized bases and cyclobutane pyrimidine dimers (CPDs), as well as through antibody recognition. The formation of 8-oxo-7,8-dihydro-2'-deoxyguanine (8-oxodG) was also studied in more detail using electrochemical detection. The results show that high NaCl concentration and concentrated DNA are capable of reducing the induction of CPDs. Moreover, concerning damage caused by oxidative stress, the presence of sodium azide and metal chelators reduce their induction, while deuterated water increases the amounts of oxidized bases, confirming the involvement of singlet oxygen in the generation of these lesions. Curiously, however, high concentrations of DNA also enhanced the formation of oxidized bases, in a reaction that paralleled the increase in the formation of singlet oxygen in the solution. This was interpreted as being due to an intrinsic photosensitization mechanism, depending directly on the DNA molecule to absorb UVA and generate singlet oxygen. Therefore, the DNA molecule itself may act as a chromophore for UVA light, locally producing a damaging agent, which may lead to even greater concerns about the deleterious impact of sunlight. Copyright © 2017 Elsevier Inc. All rights reserved.
Modeling DNA bubble formation at the atomic scale
DOE Office of Scientific and Technical Information (OSTI.GOV)
Beleva, V; Rasmussen, K. O.; Garcia, A. E.
We describe the fluctuations of double stranded DNA molecules using a minimalist Go model over a wide range of temperatures. Minimalist models allow us to describe, at the atomic level, the opening and formation of bubbles in DNA double helices. This model includes all the geometrical constraints in helix melting imposed by the 3D structure of the molecule. The DNA forms melted bubbles within double helices. These bubbles form and break as a function of time. The equilibrium average number of broken base pairs shows a sharp change as a function of T. We observe a temperature profile of sequencemore » dependent bubble formation similar to those measured by Zeng et al. Long nuclei acid molecules melt partially through the formations of bubbles. It is known that CG rich sequences melt at higher temperatures than AT rich sequences. The melting temperature, however, is not solely determined by the CG content, but by the sequence through base stacking and solvent interactions. Recently, models that incorporate the sequence and nonlinear dynamics of DNA double strands have shown that DNA exhibits a very rich dynamics. Recent extensions of the Bishop-Peyrard model show that fluctuations in the DNA structure lead to opening in localized regions, and that these regions in the DNA are associated with transcription initiation sites. 1D and 2D models of DNA may contain enough information about stacking and base pairing interactions, but lack the coupling between twisting, bending and base pair opening imposed by the double helical structure of DNA that all atom models easily describe. However, the complexity of the energy function used in all atom simulations (including solvent, ions, etc) does not allow for the description of DNA folding/unfolding events that occur in the microsecond time scale.« less
Nakano, Shu-ichi; Uotani, Yuuki; Sato, Yuichi; Oka, Hirohito; Fujii, Masayuki; Sugimoto, Naoki
2013-01-01
DNA lesions produced by aromatic isocyanates have an extra bulky group on the nucleotide bases, with the capability of forming stacking interaction within a DNA helix. In this work, we investigated the conformation of the 2′-deoxyadenosine and 2′-deoxycytidine derivatives tethering a phenyl or naphthyl group, introduced in a DNA duplex. The chemical modification experiments using KMnO4 and 1-cyclohexyl-3 -(2-morpholinoethyl) carbodiimide metho-p-toluenesulfonate have shown that the 2′-deoxycytidine lesions form the base pair with guanine while the 2′-deoxyadenosine lesions have less ability of forming the base pair with thymine in solution. Nevertheless, the kinetic analysis shows that these DNA lesions are compatible with DNA ligase and DNA polymerase reactions, as much as natural DNA bases. We suggest that the adduct lesions have a capability of adopting dual conformations, depending on the difference in their interaction energies between stacking of the attached aromatic group and base pairing through hydrogen bonds. It is also presented that the attached aromatic groups change their orientation by interacting with the minor groove binding netropsin, distamycin and synthetic polyamide. The nucleotide derivatives would be useful for enhancing the phenotypic diversity of DNA molecules and for exploring new non-natural nucleotides. PMID:23873956
NASA Astrophysics Data System (ADS)
Stasiak, Andrzej
2016-09-01
Being a geek of DNA topology, I remember very well the stir caused by 1997 Science paper showing that DNA topoisomerases have the ability to simplify DNA topology below the topological equilibrium values [1]. In their seminal experiments Rybenkov et al. [1] started with linear double-stranded DNA molecules with cohesive ends. The mutual cohesiveness of DNA ends was due to mutual complementarity of single-stranded extensions at both ends of linear double-stranded DNA molecules. When such DNA molecules were heated up and then slowly cooled down the single-stranded ends eventually annealed with each other causing DNA circularization. This experimental protocol permitted the authors to establish topological/thermodynamic equilibrium within samples of circularized DNA molecules. Among simple unknotted circles one also observed knotted and catenated DNA molecules. The fraction of knotted molecules in DNA samples at topological equilibrium was increasing with the length of DNA molecules undergoing slow circularization. The fraction of catenated molecules was increasing with the length and the concentration of the molecules undergoing slow circularization. Rybenkov et al. incubated then such equilibrated DNA samples with type II DNA topoisomerases, which pass DNA duplex regions through each other, and observed that as the result of it the fraction of knotted and catenated DNA molecules was dramatically decreased (up to 80-fold). This elegant experiment indicated for the first time that type II DNA topoisomerases acting on knotted or catenated DNA molecules have the ability to select among many potential sites of DNA-DNA passages these that result in DNA unknotting or decatenation. Without such a selection topoisomerases could only maintain the original topological equilibrium obtained during the slow cyclization. The big question was how DNA topoisomerases can be directed to do DNA-DNA passages that preferentially result in DNA unknotting and decatenation.
Drug-DNA interactions at single molecule level: A view with optical tweezers
NASA Astrophysics Data System (ADS)
Paramanathan, Thayaparan
Studies of small molecule--DNA interactions are essential for developing new drugs for challenging diseases like cancer and HIV. The main idea behind developing these molecules is to target and inhibit the reproduction of the tumor cells and infected cells. We mechanically manipulate single DNA molecule using optical tweezers to investigate two molecules that have complex and multiple binding modes. Mononuclear ruthenium complexes have been extensively studied as a test for rational drug design. Potential drug candidates should have high affinity to DNA and slow dissociation kinetics. To achieve this, motifs of the ruthenium complexes are altered. Our collaborators designed a dumb-bell shaped binuclear ruthenium complex that can only intercalate DNA by threading through its bases. Studying the binding properties of this complex in bulk studies took hours. By mechanically manipulating a single DNA molecule held with optical tweezers, we lower the barrier to thread and make it fast compared to the bulk experiments. Stretching single DNA molecules with different concentration of drug molecules and holding it at a constant force allows the binding to reach equilibrium. By this we can obtain the equilibrium fractional ligand binding and length of DNA at saturated binding. Fitting these results yields quantitative measurements of the binding thermodynamics and kinetics of this complex process. The second complex discussed in this study is Actinomycin D (ActD), a well studied anti-cancer agent that is used as a prototype for developing new generations of drugs. However, the biophysical basis of its activity is still unclear. Because ActD is known to intercalate double stranded DNA (dsDNA), it was assumed to block replication by stabilizing dsDNA in front of the replication fork. However, recent studies have shown that ActD binds with even higher affinity to imperfect duplexes and some sequences of single stranded DNA (ssDNA). We directly measure the on and off rates by stretching the DNA molecule to a certain force and holding it at constant force while adding the drug and then while washing off the drug. Our finding resolves the long lasting controversy of ActD binding modes, clearly showing that both the dsDNA binding and ssDNA binding converge to the same single mode. The result supports the hypothesis that the primary characteristic of ActD that contributes to its biological activity is its ability to inhibit cellular replication by binding to transcription bubbles and causing cell death.
Recent phylogenetic studies have used DNA as the target molecule for the development of environmental 16S rDNA clone libraries. As DNA may persist in the environment, DNA-based libraries cannot be used to identify metabolically active bacteria in water systems. In this study, a...
Energy barriers and rates of tautomeric transitions in DNA bases: ab initio quantum chemical study.
Basu, Soumalee; Majumdar, Rabi; Das, Gourab K; Bhattacharyya, Dhananjay
2005-12-01
Tautomeric transitions of DNA bases are proton transfer reactions, which are important in biology. These reactions are involved in spontaneous point mutations of the genetic material. In the present study, intrinsic reaction coordinates (IRC) analyses through ab initio quantum chemical calculations have been carried out for the individual DNA bases A, T, G, C and also A:T and G:C base pairs to estimate the kinetic and thermodynamic barriers using MP2/6-31G** method for tautomeric transitions. Relatively higher values of kinetic barriers (about 50-60 kcal/mol) have been observed for the single bases, indicating that tautomeric alterations of isolated single bases are quite unlikely. On the other hand, relatively lower values of the kinetic barriers (about 20-25 kcal/mol) for the DNA base pairs A:T and G:C clearly suggest that the tautomeric shifts are much more favorable in DNA base pairs than in isolated single bases. The unusual base pairing A':C, T':G, C':A or G':T in the daughter DNA molecule, resulting from a parent DNA molecule with tautomeric shifts, is found to be stable enough to result in a mutation. The transition rate constants for the single DNA bases in addition to the base pairs are also calculated by computing the free energy differences between the transition states and the reactants.
Triple Helix Formation in a Topologically Controlled DNA Nanosystem.
Yamagata, Yutaro; Emura, Tomoko; Hidaka, Kumi; Sugiyama, Hiroshi; Endo, Masayuki
2016-04-11
In the present study, we demonstrate single-molecule imaging of triple helix formation in DNA nanostructures. The binding of the single-molecule third strand to double-stranded DNA in a DNA origami frame was examined using two different types of triplet base pairs. The target DNA strand and the third strand were incorporated into the DNA frame, and the binding of the third strand was controlled by the formation of Watson-Crick base pairing. Triple helix formation was monitored by observing the structural changes in the incorporated DNA strands. It was also examined using a photocaged third strand wherein the binding of the third strand was directly observed using high-speed atomic force microscopy during photoirradiation. We found that the binding of the third strand could be controlled by regulating duplex formation and the uncaging of the photocaged strands in the designed nanospace. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Control of DNA hybridization by photoswitchable molecular glue.
Dohno, Chikara; Nakatani, Kazuhiko
2011-12-01
Hybridization of DNA is one of the most intriguing events in molecular recognition and is essential for living matter to inherit life beyond generations. In addition to the function of DNA as genetic material, DNA hybridization is a key to control the function of DNA-based materials in nanoscience. Since the hybridization of two single stranded DNAs is a thermodynamically favorable process, dissociation of the once formed DNA duplex is normally unattainable under isothermal conditions. As the progress of DNA-based nanoscience, methodology to control the DNA hybridization process has become increasingly important. Besides many reports using the chemically modified DNA for the regulation of hybridization, we focused our attention on the use of a small ligand as the molecular glue for the DNA. In 2001, we reported the first designed molecule that strongly and specifically bound to the mismatched base pairs in double stranded DNA. Further studies on the mismatch binding molecules provided us a key discovery of a novel mode of the binding of a mismatch binding ligand that induced the base flipping. With these findings we proposed the concept of molecular glue for DNA for the unidirectional control of DNA hybridization and, eventually photoswitchable molecular glue for DNA, which enabled the bidirectional control of hybridization under photoirradiation. In this tutorial review, we describe in detail how we integrated the mismatch binding ligand into photoswitchable molecular glue for DNA, and the application and perspective in DNA-based nanoscience.
DNABIT Compress – Genome compression algorithm
Rajarajeswari, Pothuraju; Apparao, Allam
2011-01-01
Data compression is concerned with how information is organized in data. Efficient storage means removal of redundancy from the data being stored in the DNA molecule. Data compression algorithms remove redundancy and are used to understand biologically important molecules. We present a compression algorithm, “DNABIT Compress” for DNA sequences based on a novel algorithm of assigning binary bits for smaller segments of DNA bases to compress both repetitive and non repetitive DNA sequence. Our proposed algorithm achieves the best compression ratio for DNA sequences for larger genome. Significantly better compression results show that “DNABIT Compress” algorithm is the best among the remaining compression algorithms. While achieving the best compression ratios for DNA sequences (Genomes),our new DNABIT Compress algorithm significantly improves the running time of all previous DNA compression programs. Assigning binary bits (Unique BIT CODE) for (Exact Repeats, Reverse Repeats) fragments of DNA sequence is also a unique concept introduced in this algorithm for the first time in DNA compression. This proposed new algorithm could achieve the best compression ratio as much as 1.58 bits/bases where the existing best methods could not achieve a ratio less than 1.72 bits/bases. PMID:21383923
Structural DNA Nanotechnology: Artificial Nanostructures for Biomedical Research.
Ke, Yonggang; Castro, Carlos; Choi, Jong Hyun
2018-06-04
Structural DNA nanotechnology utilizes synthetic or biologic DNA as designer molecules for the self-assembly of artificial nanostructures. The field is founded upon the specific interactions between DNA molecules, known as Watson-Crick base pairing. After decades of active pursuit, DNA has demonstrated unprecedented versatility in constructing artificial nanostructures with significant complexity and programmability. The nanostructures could be either static, with well-controlled physicochemical properties, or dynamic, with the ability to reconfigure upon external stimuli. Researchers have devoted considerable effort to exploring the usability of DNA nanostructures in biomedical research. We review the basic design methods for fabricating both static and dynamic DNA nanostructures, along with their biomedical applications in fields such as biosensing, bioimaging, and drug delivery.
Analysis of DNA interactions using single-molecule force spectroscopy.
Ritzefeld, Markus; Walhorn, Volker; Anselmetti, Dario; Sewald, Norbert
2013-06-01
Protein-DNA interactions are involved in many biochemical pathways and determine the fate of the corresponding cell. Qualitative and quantitative investigations on these recognition and binding processes are of key importance for an improved understanding of biochemical processes and also for systems biology. This review article focusses on atomic force microscopy (AFM)-based single-molecule force spectroscopy and its application to the quantification of forces and binding mechanisms that lead to the formation of protein-DNA complexes. AFM and dynamic force spectroscopy are exciting tools that allow for quantitative analysis of biomolecular interactions. Besides an overview on the method and the most important immobilization approaches, the physical basics of the data evaluation is described. Recent applications of AFM-based force spectroscopy to investigate DNA intercalation, complexes involving DNA aptamers and peptide- and protein-DNA interactions are given.
NASA Astrophysics Data System (ADS)
Åkerman, Björn
1997-04-01
DNA orientation measurements by linear dichroism (LD) spectroscopy and single molecule imaging by fluorescence microscopy are used to investigate the effect of DNA size (71-740 kilo base pairs) and field strength E (1-5.9 V/cm) on the conformation dynamics during the field-driven threading of DNA molecules through a set of parallel pores in agarose gels, with average pore radii between 380 Å and 1400 Å. Locally relaxed but globally oriented DNA molecules are subjected to a perpendicular field, and the observed LD time profile is compared with a recent theory for the threading [D. Long and J.-L. Viovy, Phys. Rev. E 53, 803 (1996)] which assumes the same initial state. As predicted the DNA is driven by the ends into a U-form, leading to an overshoot in the LD. The overshoot-time scales as E-(1.2-1.4) as predicted, but grows more slowly with DNA size than the predicted linear dependence. For long molecules loops form initially in the threading process but are finally consumed by the ends, and the process of transfer of DNA segments, from the loops to the arms of the U, leads to a shoulder in the LD as predicted. The critical size below which loops do not form (as indicated by the LD shoulder being absent) is between 71 and 105 kbp (0.5% agarose, 5.9 V/cm), and considerably larger than predicted because in the initial state the DNA molecules are housed in gel cavities with effective pore sizes about four times larger than the average pore size. From the data, the separation of DNA by exploiting the threading dynamics in pulsed fields [D. Long et al., CR Acad. Sci. Paris, Ser. IIb 321, 239 (1995)] is shown to be feasible in principle in an agarose-based system.
SINGLE STRAND-CONTAINING REPLICATING MOLECULES OF CIRCULAR MITOCHONDRIAL DNA
Wolstenholme, David R.; Koike, Katsuro; Cochran-Fouts, Patricia
1973-01-01
Mitochondrial DNAs (mtDNAs) from Chang rat solid hepatomas and Novikoff rat ascites hepatomas were examined in the electron microscope after preparation by the aqueous and by the formamide protein monolayer techniques. MtDNAs from both tumors were found to include double-forked circular molecules with a form and size suggesting they were replicative intermediates. These molecules were of two classes. In molecules of one class, all three segments were apparently totally double stranded. Molecules of the second class were distinguished by the fact that one of the segments spanning the region between the forks in which replication had occurred (the daughter segments) was either totally single stranded, or contained a single-stranded region associated with one of the forks. Daughter segments of both totally double-stranded and single strand-containing replicating molecules varied in length from about 3 to about 80% of the circular contour length of the molecule. Similar classes of replicating molecules were found in mtDNA from regenerating rat liver and chick embryos, indicating them to be normal intermediates in the replication of mtDNA All of the mtDNAs examined included partially single-stranded simple (nonforked) circular molecules. A possible scheme for the replication of mtDNA is presented, based on the different molecular forms observed PMID:4345165
Static and Dynamic Properties of DNA Confined in Nanochannels
NASA Astrophysics Data System (ADS)
Gupta, Damini
Next-generation sequencing (NGS) techniques have considerably reduced the cost of high-throughput DNA sequencing. However, it is challenging to detect large-scale genomic variations by NGS due to short read lengths. Genome mapping can easily detect large-scale structural variations because it operates on extremely large intact molecules of DNA with adequate resolution. One of the promising methods of genome mapping is based on confining large DNA molecules inside a nanochannel whose cross-sectional dimensions are approximately 50 nm. Even though this genome mapping technology has been commercialized, the current understanding of the polymer physics of DNA in nanochannel confinement is based on theories and lacks much needed experimental support. The results of this dissertation are aimed at providing a detailed experimental understanding of equilibrium properties of nanochannel-confined DNA molecules. The results are divided into three parts. In first part, we evaluate the role of channel shape on thermodynamic properties of channel confined DNA molecules using a combination of fluorescence microscopy and simulations. Specifically, we show that high aspect ratio of rectangular channels significantly alters the chain statistics as compared to an equivalent square channel with same cross-sectional area. In the second part, we present experimental evidence that weak excluded volume effects arise in DNA nanochannel confinement, which form the physical basis for the extended de Gennes regime. We also show how confinement spectroscopy and simulations can be combined to reduce molecular weight dispersity effects arising from shearing, photo-cleavage, and nonuniform staining of DNA. Finally, the third part of the thesis concerns the dynamic properties of nanochannel confined DNA. We directly measure the center-of-mass diffusivity of single DNA molecules in confinement and show that that it is necessary to modify the classical results of de Gennes to account for local chain stiffness of DNA in order to explain the experimental results. In the end, we believe that our findings from the experimental test of the phase diagram for channel-confined DNA, with careful control over molecular weight dispersity, channel geometry, and electrostatic interactions, will provide a firm foundation for the emerging genome mapping technology.
Multiplexed Sequence Encoding: A Framework for DNA Communication
Zakeri, Bijan; Carr, Peter A.; Lu, Timothy K.
2016-01-01
Synthetic DNA has great propensity for efficiently and stably storing non-biological information. With DNA writing and reading technologies rapidly advancing, new applications for synthetic DNA are emerging in data storage and communication. Traditionally, DNA communication has focused on the encoding and transfer of complete sets of information. Here, we explore the use of DNA for the communication of short messages that are fragmented across multiple distinct DNA molecules. We identified three pivotal points in a communication—data encoding, data transfer & data extraction—and developed novel tools to enable communication via molecules of DNA. To address data encoding, we designed DNA-based individualized keyboards (iKeys) to convert plaintext into DNA, while reducing the occurrence of DNA homopolymers to improve synthesis and sequencing processes. To address data transfer, we implemented a secret-sharing system—Multiplexed Sequence Encoding (MuSE)—that conceals messages between multiple distinct DNA molecules, requiring a combination key to reveal messages. To address data extraction, we achieved the first instance of chromatogram patterning through multiplexed sequencing, thereby enabling a new method for data extraction. We envision these approaches will enable more widespread communication of information via DNA. PMID:27050646
Secondary structure prediction and structure-specific sequence analysis of single-stranded DNA.
Dong, F; Allawi, H T; Anderson, T; Neri, B P; Lyamichev, V I
2001-08-01
DNA sequence analysis by oligonucleotide binding is often affected by interference with the secondary structure of the target DNA. Here we describe an approach that improves DNA secondary structure prediction by combining enzymatic probing of DNA by structure-specific 5'-nucleases with an energy minimization algorithm that utilizes the 5'-nuclease cleavage sites as constraints. The method can identify structural differences between two DNA molecules caused by minor sequence variations such as a single nucleotide mutation. It also demonstrates the existence of long-range interactions between DNA regions separated by >300 nt and the formation of multiple alternative structures by a 244 nt DNA molecule. The differences in the secondary structure of DNA molecules revealed by 5'-nuclease probing were used to design structure-specific probes for mutation discrimination that target the regions of structural, rather than sequence, differences. We also demonstrate the performance of structure-specific 'bridge' probes complementary to non-contiguous regions of the target molecule. The structure-specific probes do not require the high stringency binding conditions necessary for methods based on mismatch formation and permit mutation detection at temperatures from 4 to 37 degrees C. Structure-specific sequence analysis is applied for mutation detection in the Mycobacterium tuberculosis katG gene and for genotyping of the hepatitis C virus.
Kong, Muwen; Beckwitt, Emily C; Springall, Luke; Kad, Neil M; Van Houten, Bennett
2017-01-01
Single-molecule approaches to solving biophysical problems are powerful tools that allow static and dynamic real-time observations of specific molecular interactions of interest in the absence of ensemble-averaging effects. Here, we provide detailed protocols for building an experimental system that employs atomic force microscopy and a single-molecule DNA tightrope assay based on oblique angle illumination fluorescence microscopy. Together with approaches for engineering site-specific lesions into DNA substrates, these complementary biophysical techniques are well suited for investigating protein-DNA interactions that involve target-specific DNA-binding proteins, such as those engaged in a variety of DNA repair pathways. In this chapter, we demonstrate the utility of the platform by applying these techniques in the studies of proteins participating in nucleotide excision repair. © 2017 Elsevier Inc. All rights reserved.
Borovok, Natalia; Iram, Natalie; Zikich, Dragoslav; Ghabboun, Jamal; Livshits, Gideon I; Porath, Danny; Kotlyar, Alexander B
2008-09-01
We describe a method for the preparation of novel long (hundreds of nanometers), uniform, inter-molecular G4-DNA molecules composed of four parallel G-strands. The only long continuous G4-DNA reported so far are intra-molecular structures made of a single G-strand. To enable a tetra-molecular assembly of the G-strands we developed a novel approach based on avidin-biotin biological recognition. The steps of the G4-DNA production include: (i) Enzymatic synthesis of long poly(dG)-poly(dC) molecules with biotinylated poly(dG)-strand; (ii) Formation of a complex between avidin-tetramer and four biotinylated poly(dG)-poly(dC) molecules; (iii) Separation of the poly(dC) strands from the poly(dG)-strands, which are connected to the avidin; (iv) Assembly of the four G-strands attached to the avidin into tetra-molecular G4-DNA. The average contour length of the formed structures, as measured by AFM, is equal to that of the initial poly(dG)-poly(dC) molecules, suggesting a tetra-molecular mechanism of the G-strands assembly. The height of tetra-molecular G4-nanostructures is larger than that of mono-molecular G4-DNA molecules having similar contour length. The CD spectra of the tetra- and mono-molecular G4-DNA are markedly different, suggesting different structural organization of these two types of molecules. The tetra-molecular G4-DNA nanostructures showed clear electrical polarizability. This suggests that they may be useful for molecular electronics.
Sett, S.; Ghosh, S.; Rakshit, T.; Mukhopadhyay, R.
2016-01-01
DNA threading intercalators are a unique class of intercalating agents, albeit little biophysical information is available on their intercalative actions. Herein, the intercalative effects of nogalamycin, which is a naturally-occurring DNA threading intercalator, have been investigated by high-resolution atomic force microscopy (AFM) and spectroscopy (AFS). The results have been compared with those of the well-known chemotherapeutic drug daunomycin, which is a non-threading classical intercalator bearing structural similarity to nogalamycin. A comparative AFM assessment revealed a greater increase in DNA contour length over the entire incubation period of 48 h for nogalamycin treatment, whereas the contour length increase manifested faster in case of daunomycin. The elastic response of single DNA molecules to an externally applied force was investigated by the single molecule AFS approach. Characteristic mechanical fingerprints in the overstretching behaviour clearly distinguished the nogalamycin/daunomycin-treated dsDNA from untreated dsDNA—the former appearing less elastic than the latter, and the nogalamycin-treated DNA distinguished from the daunomycin-treated DNA—the classically intercalated dsDNA appearing the least elastic. A single molecule AFS-based discrimination of threading intercalation from the classical type is being reported for the first time. PMID:27183010
Model Checking Temporal Logic Formulas Using Sticker Automata
Feng, Changwei; Wu, Huanmei
2017-01-01
As an important complex problem, the temporal logic model checking problem is still far from being fully resolved under the circumstance of DNA computing, especially Computation Tree Logic (CTL), Interval Temporal Logic (ITL), and Projection Temporal Logic (PTL), because there is still a lack of approaches for DNA model checking. To address this challenge, a model checking method is proposed for checking the basic formulas in the above three temporal logic types with DNA molecules. First, one-type single-stranded DNA molecules are employed to encode the Finite State Automaton (FSA) model of the given basic formula so that a sticker automaton is obtained. On the other hand, other single-stranded DNA molecules are employed to encode the given system model so that the input strings of the sticker automaton are obtained. Next, a series of biochemical reactions are conducted between the above two types of single-stranded DNA molecules. It can then be decided whether the system satisfies the formula or not. As a result, we have developed a DNA-based approach for checking all the basic formulas of CTL, ITL, and PTL. The simulated results demonstrate the effectiveness of the new method. PMID:29119114
Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas
2018-06-27
DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.
Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease
NASA Astrophysics Data System (ADS)
Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.
2018-04-01
We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.
An optical conveyor for molecules.
Weinert, Franz M; Braun, Dieter
2009-12-01
Trapping single ions under vacuum allows for precise spectroscopy in atomic physics. The confinement of biological molecules in bulk water is hindered by the lack of comparably strong forces. Molecules have been immobilized to surfaces, however often with detrimental effects on their function. Here, we optically trap molecules by creating the microscale analogue of a conveyor belt: a bidirectional flow is combined with a perpendicular thermophoretic molecule drift. Arranged in a toroidal geometry, the conveyor accumulates a hundredfold excess of 5-base DNA within seconds. The concentrations of the trapped DNA scale exponentially with length, reaching trapping potential depths of 14 kT for 50 bases. The mechanism does not require microfluidics, electrodes, or surface modifications. As a result, the trap can be dynamically relocated. The optical conveyor can be used to enhance diffusion-limited surface reactions, redirect cellular signaling, observe individual biomolecules over a prolonged time, or approach single-molecule chemistry in bulk water.
Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue
2016-01-01
DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962
Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E
2010-06-01
A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.
Kai, Takeshi; Higuchi, Mariko; Fujii, Kentaro; Watanabe, Ritsuko; Yokoya, Akinari
2012-12-01
To develop a method for simulating the dynamics of the photoelectrons and Auger electrons ejected from DNA molecules irradiated with pulsed monochromatic X-rays. A 30-base-pair (bp) DNA molecule was used as the target model, and the X-rays were assumed to have a Gaussian-shaped time distribution. Photoionization and Auger decay were considered as the atomic processes. The atoms from which the photoelectrons or Auger electrons were emitted were specified in the DNA molecule (or DNA ion) using the Monte Carlo method, and the trajectory of each electron in the electric field formed around the positively charged DNA molecule was calculated with a Newtonian equation. The kinetics of the electrons produced by irradiation with X-rays at an intensity ranging from 1 × 10(12) to 1 × 10(16) photons/mm(2) and energies of 380 eV (below the carbon K-edge), 435 eV (above the nitrogen K-edge), and 560 eV (above the oxygen K-edge) were evaluated. It was found that at an X-ray intensity of 1 × 10(14) photons/mm(2) or less, all the produced electrons escaped from the target. However, above an X-ray intensity of 1 × 10(15) photons/mm(2) and an energy of 560 eV, some photoelectrons that were ejected from the oxygen atoms were trapped near the target DNA. A simulation method for studying the trajectories of electrons ejected from a 30-bp DNA molecule irradiated with pulsed monochromatic X-rays has been developed. The present results show that electron dynamics are strongly dependent on the charged density induced in DNA by pulsed X-ray irradiation.
Kaji, Takahiro; Ito, Syoji; Iwai, Shigenori; Miyasaka, Hiroshi
2009-10-22
Single-molecule and ensemble time-resolved fluorescence measurements were applied for the investigation of the conformational dynamics of single-stranded DNA, ssDNA, connected with a fluorescein dye by a C6 linker, where the motions both of DNA and the C6 linker affect the geometry of the system. From the ensemble measurement of the fluorescence quenching via photoinduced electron transfer with a guanine base in the DNA sequence, three main conformations were found in aqueous solution: a conformation unaffected by the guanine base in the excited state lifetime of fluorescein, a conformation in which the fluorescence is dynamically quenched in the excited-state lifetime, and a conformation leading to rapid quenching via nonfluorescent complex. The analysis by using the parameters acquired from the ensemble measurements for interphoton time distribution histograms and FCS autocorrelations by the single-molecule measurement revealed that interconversion in these three conformations took place with two characteristic time constants of several hundreds of nanoseconds and tens of microseconds. The advantage of the combination use of the ensemble measurements with the single-molecule detections for rather complex dynamic motions is discussed by integrating the experimental results with those obtained by molecular dynamics simulation.
Single-Molecule Counting of Point Mutations by Transient DNA Binding
NASA Astrophysics Data System (ADS)
Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan
2017-03-01
High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.
Single-molecule DNA detection with an engineered MspA protein nanopore
Butler, Tom Z.; Pavlenok, Mikhail; Derrington, Ian M.; Niederweis, Michael; Gundlach, Jens H.
2008-01-01
Nanopores hold great promise as single-molecule analytical devices and biophysical model systems because the ionic current blockades they produce contain information about the identity, concentration, structure, and dynamics of target molecules. The porin MspA of Mycobacterium smegmatis has remarkable stability against environmental stresses and can be rationally modified based on its crystal structure. Further, MspA has a short and narrow channel constriction that is promising for DNA sequencing because it may enable improved characterization of short segments of a ssDNA molecule that is threaded through the pore. By eliminating the negative charge in the channel constriction, we designed and constructed an MspA mutant capable of electronically detecting and characterizing single molecules of ssDNA as they are electrophoretically driven through the pore. A second mutant with additional exchanges of negatively-charged residues for positively-charged residues in the vestibule region exhibited a factor of ≈20 higher interaction rates, required only half as much voltage to observe interaction, and allowed ssDNA to reside in the vestibule ≈100 times longer than the first mutant. Our results introduce MspA as a nanopore for nucleic acid analysis and highlight its potential as an engineerable platform for single-molecule detection and characterization applications. PMID:19098105
Digital DNA detection based on a compact optofluidic laser with ultra-low sample consumption.
Lee, Wonsuk; Chen, Qiushu; Fan, Xudong; Yoon, Dong Ki
2016-11-29
DNA lasers self-amplify optical signals from a DNA analyte as well as thermodynamic differences between sequences, allowing quasi-digital DNA detection. However, these systems have drawbacks, such as relatively large sample consumption and complicated dye labelling. Moreover, although the lasing signal can detect the target DNA, it is superimposed on an unintended fluorescence background, which persists for non-target DNA samples as well. From an optical point of view, it is thus not truly digital detection and requires spectral analysis to identify the target. In this work, we propose and demonstrate an optofluidic laser that has a single layer of DNA molecules as the gain material. A target DNA produces intensive laser emission comparable to existing DNA lasers, while any unnecessary fluorescence background is successfully suppressed. As a result, the target DNA can be detected with a single laser pulse, in a truly digital manner. Since the DNA molecules cover only a single layer on the surface of the laser microcavity, the DNA sample consumption is a few orders of magnitude lower than that of existing DNA lasers. Furthermore, the DNA molecules are stained by simply immersing the microcavity in the intercalating dye solution, and thus the proposed DNA laser is free of any complex dye-labelling process prior to analysis.
Molecular modelling study of changes induced by netropsin binding to nucleosome core particles.
Pérez, J J; Portugal, J
1990-01-01
It is well known that certain sequence-dependent modulators in structure appear to determine the rotational positioning of DNA on the nucleosome core particle. That preference is rather weak and could be modified by some ligands as netropsin, a minor-groove binding antibiotic. We have undertaken a molecular modelling approach to calculate the relative energy of interaction between a DNA molecule and the protein core particle. The histones particle is considered as a distribution of positive charges on the protein surface that interacts with the DNA molecule. The molecular electrostatic potentials for the DNA, simulated as a discontinuous cylinder, were calculated using the values for all the base pairs. Computing these parameters, we calculated the relative energy of interaction and the more stable rotational setting of DNA. The binding of four molecules of netropsin to this model showed that a new minimum of energy is obtained when the DNA turns toward the protein surface by about 180 degrees, so a new energetically favoured structure appears where netropsin binding sites are located facing toward the histones surface. The effect of netropsin could be explained in terms of an induced change in the phasing of DNA on the core particle. The induced rotation is considered to optimize non-bonded contacts between the netropsin molecules and the DNA backbone. PMID:2165249
Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions
Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S
2013-06-25
A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.
A single molecule study of G-quadruplex and short duplex DNA structures
NASA Astrophysics Data System (ADS)
Roy, William A., Jr.
Given that certain conditions are met, a single stranded DNA/RNA (ssDNA/RNA) structure called G-quadruplex (GQ) can form in regions throughout the genome, including at the telomeres and internal regions of the chromosomes. These structures serve various functions depending on the region in which they form which include protecting the chromosome ends, interfering with telomere elongation in cancer cells, and regulating transcription and translation level gene expression. Due to their high stability, various cellular mechanisms, such as GQ destabilizing proteins, are employed to unfold these structures during DNA replication or repair. Yet, their distinct layered structure has made GQs an attractive drug target in cancer treatment as GQ stabilizing molecules could inhibit telomerase dependent telomere elongation, a mechanism occurring in the majority of cancer cells to avoid senescence and apoptosis. However, proteins or small molecules interact with GQ that is under the influence of various cellular tension mechanisms, including the tension applied by other nearby molecules or the tension due to DNA structure within the chromatin context. Therefore, it is important to characterize the stability of various GQs and their response to interacting molecules when subjected to a tensile force. We employed a novel DNA-based nano tension generator that utilizes the elastic properties of circularized short double-stranded DNA (dsDNA) oligonucleotides to apply tension on the GQ. Since this is a completely new approach, the majority of this thesis was dedicated to proof-of-principle studies that demonstrated the feasibility and functionality of the method.
Construction of Biologically Functional Bacterial Plasmids In Vitro
Cohen, Stanley N.; Chang, Annie C. Y.; Boyer, Herbert W.; Helling, Robert B.
1973-01-01
The construction of new plasmid DNA species by in vitro joining of restriction endonuclease-generated fragments of separate plasmids is described. Newly constructed plasmids that are inserted into Escherichia coli by transformation are shown to be biologically functional replicons that possess genetic properties and nucleotide base sequences from both of the parent DNA molecules. Functional plasmids can be obtained by reassociation of endonuclease-generated fragments of larger replicons, as well as by joining of plasmid DNA molecules of entirely different origins. Images PMID:4594039
Lin, C H; Patel, D J
1997-11-01
Structural studies by nuclear magnetic resonance (NMR) of RNA and DNA aptamer complexes identified through in vitro selection and amplification have provided a wealth of information on RNA and DNA tertiary structure and molecular recognition in solution. The RNA and DNA aptamers that target ATP (and AMP) with micromolar affinity exhibit distinct binding site sequences and secondary structures. We report below on the tertiary structure of the AMP-DNA aptamer complex in solution and compare it with the previously reported tertiary structure of the AMP-RNA aptamer complex in solution. The solution structure of the AMP-DNA aptamer complex shows, surprisingly, that two AMP molecules are intercalated at adjacent sites within a rectangular widened minor groove. Complex formation involves adaptive binding where the asymmetric internal bubble of the free DNA aptamer zippers up through formation of a continuous six-base mismatch segment which includes a pair of adjacent three-base platforms. The AMP molecules pair through their Watson-Crick edges with the minor groove edges of guanine residues. These recognition G.A mismatches are flanked by sheared G.A and reversed Hoogsteen G.G mismatch pairs. The AMP-DNA aptamer and AMP-RNA aptamer complexes have distinct tertiary structures and binding stoichiometries. Nevertheless, both complexes have similar structural features and recognition alignments in their binding pockets. Specifically, AMP targets both DNA and RNA aptamers by intercalating between purine bases and through identical G.A mismatch formation. The recognition G.A mismatch stacks with a reversed Hoogsteen G.G mismatch in one direction and with an adenine base in the other direction in both complexes. It is striking that DNA and RNA aptamers selected independently from libraries of 10(14) molecules in each case utilize identical mismatch alignments for molecular recognition with micromolar affinity within binding-site pockets containing common structural elements.
Srinivasan, Ajay; Gold, Barry
2013-01-01
A major challenge in the future development of cancer therapeutics is the identification of biological targets and pathways, and the subsequent design of molecules to combat the drug-resistant cells hiding in virtually all cancers. This therapeutic approach is justified based upon the limited advances in cancer cures over the past 30 years, despite the development of many novel chemotherapies and earlier detection, which often fail due to drug resistance. Among the various targets to overcome tumor resistance are the DNA repair systems that can reverse the cytotoxicity of many clinically used DNA-damaging agents. Some progress has already been made but much remains to be done. We explore some components of the DNA-repair process, which are involved in repair of alkylation damage of DNA, as targets for the development of novel and effective molecules designed to improve the efficacy of existing anticancer drugs. PMID:22709253
NASA Astrophysics Data System (ADS)
Turan, Muhammed K.; Sehirli, Eftal; Elen, Abdullah; Karas, Ismail R.
2015-07-01
Gel electrophoresis (GE) is one of the most used method to separate DNA, RNA, protein molecules according to size, weight and quantity parameters in many areas such as genetics, molecular biology, biochemistry, microbiology. The main way to separate each molecule is to find borders of each molecule fragment. This paper presents a software application that show columns edges of DNA fragments in 3 steps. In the first step the application obtains lane histograms of agarose gel electrophoresis images by doing projection based on x-axis. In the second step, it utilizes k-means clustering algorithm to classify point values of lane histogram such as left side values, right side values and undesired values. In the third step, column edges of DNA fragments is shown by using mean algorithm and mathematical processes to separate DNA fragments from the background in a fully automated way. In addition to this, the application presents locations of DNA fragments and how many DNA fragments exist on images captured by a scientific camera.
Hochlaf, Majdi; Pan, Yi; Lau, Kai-Chung; Majdi, Youssef; Poisson, Lionel; Garcia, Gustavo A; Nahon, Laurent; Al Mogren, Muneerah Mogren; Schwell, Martin
2015-02-19
For fully understanding the light-molecule interaction dynamics at short time scales, recent theoretical and experimental studies proved the importance of accurate characterizations not only of the ground (D0) but also of the electronic excited states (e.g., D1) of molecules. While ground state investigations are currently straightforward, those of electronic excited states are not. Here, we characterized the à electronic state of ionic thymine (T(+)) DNA base using explicitly correlated coupled cluster ab initio methods and state-of-the-art synchrotron-based electron/ion coincidence techniques. The experimental spectrum is composed of rich and long vibrational progressions corresponding to the population of the low frequency modes of T(+)(Ã). This work challenges previous numerous works carried out on DNA bases using common synchrotron and VUV-based photoelectron spectroscopies. We provide hence a powerful theoretical and experimental framework to study the electronic structure of ionized DNA bases that could be generalized to other medium-sized biologically relevant systems.
Nayab, Pattan Sirajuddin; Akrema; Ansari, Istikhar A; Shahid, Mohammad; Rahisuddin
2017-08-01
Herein, we investigated new phthalimide-based Schiff base molecules as promising DNA-binding and free radical scavenging agents. Physicochemical properties of these molecules were demonstrated on the basis of elemental analysis, ultraviolet-visible (UV-Vis), infra-red (IR), 1 H and 13 C nuclear magnetic resonance (NMR) spectroscopy. All spectral data are agreed well with the proposed Schiff base framework. The DNA-binding potential of synthesized compounds were investigated by means of UV-visible, fluorescence, iodide quenching, circular dichroism, viscosity and thermal denaturation studies. The intrinsic binding constants (K b ) were calculated from absorption studies were found to be 1.1 × 10 4 and 1.0 × 10 4 M -1 for compounds 2a and 2b suggesting that compound 2a binding abilities with DNA were stronger than the compound 2b. Our studies showed that the presented compounds interact with DNA through groove binding. Molecular docking studies were carried out to predict the binding between Ct-DNA and test compounds. Interestingly, in silico predictions were corroborated with in vitro DNA-binding conclusions. Furthermore, the title compounds displayed remarkable antioxidant activity compared with reference standard. Copyright © 2016 John Wiley & Sons, Ltd.
Unraveling DNA dynamics using atomic force microscopy.
Suzuki, Yuki; Yoshikawa, Yuko; Yoshimura, Shige H; Yoshikawa, Kenichi; Takeyasu, Kunio
2011-01-01
The elucidation of structure-function relationships of biological samples has become important issue in post-genomic researches. In order to unveil the molecular mechanisms controlling gene regulations, it is essential to understand the interplay between fundamental DNA properties and the dynamics of the entire molecule. The wide range of applicability of atomic force microscopy (AFM) has allowed us to extract physicochemical properties of DNA and DNA-protein complexes, as well as to determine their topographical information. Here, we review how AFM techniques have been utilized to study DNA and DNA-protein complexes and what types of analyses have accelerated the understanding of the DNA dynamics. We begin by illustrating the application of AFM to investigate the fundamental feature of DNA molecules; topological transition of DNA, length dependent properties of DNA molecules, flexibility of double-stranded DNA, and capability of the formation of non-Watson-Crick base pairing. These properties of DNA are critical for the DNA folding and enzymatic reactions. The technical advancement in the time-resolution of AFM and sample preparation methods enabled visual analysis of DNA-protein interactions at sub-second time region. DNA tension-dependent enzymatic reaction and DNA looping dynamics by restriction enzymes were examined at a nanoscale in physiological environments. Contribution of physical properties of DNA to dynamics of nucleosomes and transition of the higher-order structure of reconstituted chromatin are also reviewed. Copyright © 2011 John Wiley & Sons, Inc.
ERIC Educational Resources Information Center
Robertson, Carol
2016-01-01
Deoxyribonucleic acid (DNA) is life's most amazing molecule. It carries the genetic instructions that almost every organism needs to develop and reproduce. In the human genome alone, there are some three billion DNA base pairs. The most difficult part of teaching DNA structure, however, may be getting students to visualize something as small as a…
Quantification of differential gene expression by multiplexed targeted resequencing of cDNA
Arts, Peer; van der Raadt, Jori; van Gestel, Sebastianus H.C.; Steehouwer, Marloes; Shendure, Jay; Hoischen, Alexander; Albers, Cornelis A.
2017-01-01
Whole-transcriptome or RNA sequencing (RNA-Seq) is a powerful and versatile tool for functional analysis of different types of RNA molecules, but sample reagent and sequencing cost can be prohibitive for hypothesis-driven studies where the aim is to quantify differential expression of a limited number of genes. Here we present an approach for quantification of differential mRNA expression by targeted resequencing of complementary DNA using single-molecule molecular inversion probes (cDNA-smMIPs) that enable highly multiplexed resequencing of cDNA target regions of ∼100 nucleotides and counting of individual molecules. We show that accurate estimates of differential expression can be obtained from molecule counts for hundreds of smMIPs per reaction and that smMIPs are also suitable for quantification of relative gene expression and allele-specific expression. Compared with low-coverage RNA-Seq and a hybridization-based targeted RNA-Seq method, cDNA-smMIPs are a cost-effective high-throughput tool for hypothesis-driven expression analysis in large numbers of genes (10 to 500) and samples (hundreds to thousands). PMID:28474677
Ultralocalized thermal reactions in subnanoliter droplets-in-air.
Salm, Eric; Guevara, Carlos Duarte; Dak, Piyush; Dorvel, Brian Ross; Reddy, Bobby; Alam, Muhammad Ashraf; Bashir, Rashid
2013-02-26
Miniaturized laboratory-on-chip systems promise rapid, sensitive, and multiplexed detection of biological samples for medical diagnostics, drug discovery, and high-throughput screening. Within miniaturized laboratory-on-chips, static and dynamic droplets of fluids in different immiscible media have been used as individual vessels to perform biochemical reactions and confine the products. Approaches to perform localized heating of these individual subnanoliter droplets can allow for new applications that require parallel, time-, and space-multiplex reactions on a single integrated circuit. Our method positions droplets on an array of individual silicon microwave heaters on chip to precisely control the temperature of droplets-in-air, allowing us to perform biochemical reactions, including DNA melting and detection of single base mismatches. We also demonstrate that ssDNA probe molecules can be placed on heaters in solution, dried, and then rehydrated by ssDNA target molecules in droplets for hybridization and detection. This platform enables many applications in droplets including hybridization of low copy number DNA molecules, lysing of single cells, interrogation of ligand-receptor interactions, and rapid temperature cycling for amplification of DNA molecules.
Model of biological quantum logic in DNA.
Mihelic, F Matthew
2013-08-02
The DNA molecule has properties that allow it to act as a quantum logic processor. It has been demonstrated that there is coherent conduction of electrons longitudinally along the DNA molecule through pi stacking interactions of the aromatic nucleotide bases, and it has also been demonstrated that electrons moving longitudinally along the DNA molecule are subject to a very efficient electron spin filtering effect as the helicity of the DNA molecule interacts with the spin of the electron. This means that, in DNA, electrons are coherently conducted along a very efficient spin filter. Coherent electron spin is held in a logically and thermodynamically reversible chiral symmetry between the C2-endo and C3-endo enantiomers of the deoxyribose moiety in each nucleotide, which enables each nucleotide to function as a quantum gate. The symmetry break that provides for quantum decision in the system is determined by the spin direction of an electron that has an orbital angular momentum that is sufficient to overcome the energy barrier of the double well potential separating the C2-endo and C3-endo enantiomers, and that enantiomeric energy barrier is appropriate to the Landauer limit of the energy necessary to randomize one bit of information.
Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A
2018-03-26
DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Simple method of DNA stretching on glass substrate for fluorescence image and spectroscopy
NASA Astrophysics Data System (ADS)
Neupane, Guru P.; Dhakal, Krishna P.; Lee, Hyunsoo; Guthold, Martin; Joseph, Vincent S.; Hong, Jong-Dal; Kim, Jeongyong
2013-05-01
Study of biological molecule DNA has contributed to developing many breaking thoughts and wide applications in multidisciplinary fields, such as genomic, medical, sensing and forensic fields. Stretching of DNA molecules is an important supportive tool for AFM or spectroscopic studies of DNA in a single molecular level. In this article, we established a simple method of DNA stretching (to its full length) that occurred on a rotating negatively-charged surface of glass substrate. The isolation of a single DNA molecule was attained by the two competitive forces on DNA molecules, that is, the electrostatic attraction developed between the positively charged YOYO-1 stained DNA and the negatively charged substrate, and the centrifugal force of the rotating substrate, which separates the DNA aggregates into the single molecule. Density of stretched DNA molecules was controlled by selecting the specific parameters such as spinning time and rates, loading volume of DNA-dye complex solution etc. The atomic force microscopy image exhibited a single DNA molecule on the negatively-charged substrate in an isolated state. Further, the photoluminescence spectra of a single DNA molecule stained with YOYO-1 were achieved using the method developed in the present study, which is strongly believed to effectively support the spectroscopic analysis of DNA in a single molecular level.
Twisting short dsDNA with applied tension
NASA Astrophysics Data System (ADS)
Zoli, Marco
2018-02-01
The twisting deformation of mechanically stretched DNA molecules is studied by a coarse grained Hamiltonian model incorporating the fundamental interactions that stabilize the double helix and accounting for the radial and angular base pair fluctuations. The latter are all the more important at short length scales in which DNA fragments maintain an intrinsic flexibility. The presented computational method simulates a broad ensemble of possible molecule conformations characterized by a specific average twist and determines the energetically most convenient helical twist by free energy minimization. As this is done for any external load, the method yields the characteristic twist-stretch profile of the molecule and also computes the changes in the macroscopic helix parameters i.e. average diameter and rise distance. It is predicted that short molecules under stretching should first over-twist and then untwist by increasing the external load. Moreover, applying a constant load and simulating a torsional strain which over-twists the helix, it is found that the average helix diameter shrinks while the molecule elongates, in agreement with the experimental trend observed in kilo-base long sequences. The quantitative relation between percent relative elongation and superhelical density at fixed load is derived. The proposed theoretical model and computational method offer a general approach to characterize specific DNA fragments and predict their macroscopic elastic response as a function of the effective potential parameters of the mesoscopic Hamiltonian.
Electrophoresis of DNA in agarose gels, polyacrylamide gels and in free solution
Stellwagen, Nancy C.
2009-01-01
This review describes the electrophoresis of curved and normal DNA molecules in agarose gels, polyacrylamide gels and in free solution. These studies were undertaken to clarify why curved DNA molecules migrate anomalously slowly in polyacrylamide gels but not in agarose gels. Two milestone papers are cited, in which Ferguson plots were used to estimate the effective pore size of agarose and polyacrylamide gels. Subsequent studies on the effect of the electric field on agarose and polyacrylamide gel matrices, DNA interactions with the two gel matrices, and the effect of curvature on the free solution mobility of DNA are also described. The combined results suggest that the anomalously slow mobilities observed for curved DNA molecules in polyacrylamide gels are due primarily to preferential interactions of curved DNAs with the polyacrylamide gel matrix; the restrictive pore size of the matrix is of lesser importance. In free solution, DNA mobilities increase with increasing molecular mass until leveling off at a plateau value of (3.17 ± 0.01) × 10-4 cm2/Vs in 40 mM Tris-acetate-EDTA buffer at 20°C. Curved DNA molecules migrate anomalously slowly in free solution as well as in polyacrylamide gels, explaining why the Ferguson plots of curved and normal DNAs containing the same number of base pairs extrapolate to different mobilities at zero gel concentration. PMID:19517510
Bio-recognitive photonics of a DNA-guided organic semiconductor.
Back, Seung Hyuk; Park, Jin Hyuk; Cui, Chunzhi; Ahn, Dong June
2016-01-04
Incorporation of duplex DNA with higher molecular weights has attracted attention for a new opportunity towards a better organic light-emitting diode (OLED) capability. However, biological recognition by OLED materials is yet to be addressed. In this study, specific oligomeric DNA-DNA recognition is successfully achieved by tri (8-hydroxyquinoline) aluminium (Alq3), an organic semiconductor. Alq3 rods crystallized with guidance from single-strand DNA molecules show, strikingly, a unique distribution of the DNA molecules with a shape of an 'inverted' hourglass. The crystal's luminescent intensity is enhanced by 1.6-fold upon recognition of the perfect-matched target DNA sequence, but not in the case of a single-base mismatched one. The DNA-DNA recognition forming double-helix structure is identified to occur only in the rod's outer periphery. This study opens up new opportunities of Alq3, one of the most widely used OLED materials, enabling biological recognition.
Bio-recognitive photonics of a DNA-guided organic semiconductor
NASA Astrophysics Data System (ADS)
Back, Seung Hyuk; Park, Jin Hyuk; Cui, Chunzhi; Ahn, Dong June
2016-01-01
Incorporation of duplex DNA with higher molecular weights has attracted attention for a new opportunity towards a better organic light-emitting diode (OLED) capability. However, biological recognition by OLED materials is yet to be addressed. In this study, specific oligomeric DNA-DNA recognition is successfully achieved by tri (8-hydroxyquinoline) aluminium (Alq3), an organic semiconductor. Alq3 rods crystallized with guidance from single-strand DNA molecules show, strikingly, a unique distribution of the DNA molecules with a shape of an `inverted' hourglass. The crystal's luminescent intensity is enhanced by 1.6-fold upon recognition of the perfect-matched target DNA sequence, but not in the case of a single-base mismatched one. The DNA-DNA recognition forming double-helix structure is identified to occur only in the rod's outer periphery. This study opens up new opportunities of Alq3, one of the most widely used OLED materials, enabling biological recognition.
Recent technological advances have driven rapid development of DNA-based methods designed to facilitate detection and monitoring of invasive species in aquatic environments. These tools promise to significantly alleviate difficulties associated with traditional monitoring approac...
Method for rapid base sequencing in DNA and RNA with two base labeling
Jett, J.H.; Keller, R.A.; Martin, J.C.; Posner, R.G.; Marrone, B.L.; Hammond, M.L.; Simpson, D.J.
1995-04-11
A method is described for rapid-base sequencing in DNA and RNA with two-base labeling and employing fluorescent detection of single molecules at two wavelengths. Bases modified to accept fluorescent labels are used to replicate a single DNA or RNA strand to be sequenced. The bases are then sequentially cleaved from the replicated strand, excited with a chosen spectrum of electromagnetic radiation, and the fluorescence from individual, tagged bases detected in the order of cleavage from the strand. 4 figures.
Method for rapid base sequencing in DNA and RNA with two base labeling
Jett, James H.; Keller, Richard A.; Martin, John C.; Posner, Richard G.; Marrone, Babetta L.; Hammond, Mark L.; Simpson, Daniel J.
1995-01-01
Method for rapid-base sequencing in DNA and RNA with two-base labeling and employing fluorescent detection of single molecules at two wavelengths. Bases modified to accept fluorescent labels are used to replicate a single DNA or RNA strand to be sequenced. The bases are then sequentially cleaved from the replicated strand, excited with a chosen spectrum of electromagnetic radiation, and the fluorescence from individual, tagged bases detected in the order of cleavage from the strand.
Size-based molecular diagnostics using plasma DNA for noninvasive prenatal testing.
Yu, Stephanie C Y; Chan, K C Allen; Zheng, Yama W L; Jiang, Peiyong; Liao, Gary J W; Sun, Hao; Akolekar, Ranjit; Leung, Tak Y; Go, Attie T J I; van Vugt, John M G; Minekawa, Ryoko; Oudejans, Cees B M; Nicolaides, Kypros H; Chiu, Rossa W K; Lo, Y M Dennis
2014-06-10
Noninvasive prenatal testing using fetal DNA in maternal plasma is an actively researched area. The current generation of tests using massively parallel sequencing is based on counting plasma DNA sequences originating from different genomic regions. In this study, we explored a different approach that is based on the use of DNA fragment size as a diagnostic parameter. This approach is dependent on the fact that circulating fetal DNA molecules are generally shorter than the corresponding maternal DNA molecules. First, we performed plasma DNA size analysis using paired-end massively parallel sequencing and microchip-based capillary electrophoresis. We demonstrated that the fetal DNA fraction in maternal plasma could be deduced from the overall size distribution of maternal plasma DNA. The fetal DNA fraction is a critical parameter affecting the accuracy of noninvasive prenatal testing using maternal plasma DNA. Second, we showed that fetal chromosomal aneuploidy could be detected by observing an aberrant proportion of short fragments from an aneuploid chromosome in the paired-end sequencing data. Using this approach, we detected fetal trisomy 21 and trisomy 18 with 100% sensitivity (T21: 36/36; T18: 27/27) and 100% specificity (non-T21: 88/88; non-T18: 97/97). For trisomy 13, the sensitivity and specificity were 95.2% (20/21) and 99% (102/103), respectively. For monosomy X, the sensitivity and specificity were both 100% (10/10 and 8/8). Thus, this study establishes the principle of size-based molecular diagnostics using plasma DNA. This approach has potential applications beyond noninvasive prenatal testing to areas such as oncology and transplantation monitoring.
Size-based molecular diagnostics using plasma DNA for noninvasive prenatal testing
Yu, Stephanie C. Y.; Chan, K. C. Allen; Zheng, Yama W. L.; Jiang, Peiyong; Liao, Gary J. W.; Sun, Hao; Akolekar, Ranjit; Leung, Tak Y.; Go, Attie T. J. I.; van Vugt, John M. G.; Minekawa, Ryoko; Oudejans, Cees B. M.; Nicolaides, Kypros H.; Chiu, Rossa W. K.; Lo, Y. M. Dennis
2014-01-01
Noninvasive prenatal testing using fetal DNA in maternal plasma is an actively researched area. The current generation of tests using massively parallel sequencing is based on counting plasma DNA sequences originating from different genomic regions. In this study, we explored a different approach that is based on the use of DNA fragment size as a diagnostic parameter. This approach is dependent on the fact that circulating fetal DNA molecules are generally shorter than the corresponding maternal DNA molecules. First, we performed plasma DNA size analysis using paired-end massively parallel sequencing and microchip-based capillary electrophoresis. We demonstrated that the fetal DNA fraction in maternal plasma could be deduced from the overall size distribution of maternal plasma DNA. The fetal DNA fraction is a critical parameter affecting the accuracy of noninvasive prenatal testing using maternal plasma DNA. Second, we showed that fetal chromosomal aneuploidy could be detected by observing an aberrant proportion of short fragments from an aneuploid chromosome in the paired-end sequencing data. Using this approach, we detected fetal trisomy 21 and trisomy 18 with 100% sensitivity (T21: 36/36; T18: 27/27) and 100% specificity (non-T21: 88/88; non-T18: 97/97). For trisomy 13, the sensitivity and specificity were 95.2% (20/21) and 99% (102/103), respectively. For monosomy X, the sensitivity and specificity were both 100% (10/10 and 8/8). Thus, this study establishes the principle of size-based molecular diagnostics using plasma DNA. This approach has potential applications beyond noninvasive prenatal testing to areas such as oncology and transplantation monitoring. PMID:24843150
Zhang, Hui; Guo, Peixuan
2014-05-15
Direct counting of biomolecules within biological complexes or nanomachines is demanding. Single molecule counting using optical microscopy is challenging due to the diffraction limit. The single molecule photobleaching (SMPB) technology for direct counting developed by our team (Shu et al., 2007 [18]; Zhang et al., 2007 [19]) offers a simple and straightforward method to determine the stoichiometry of molecules or subunits within biocomplexes or nanomachines at nanometer scales. Stoichiometry is determined by real-time observation of the number of descending steps resulted from the photobleaching of individual fluorophore. This technology has now been used extensively for single molecule counting of protein, RNA, and other macromolecules in a variety of complexes or nanostructures. Here, we elucidate the SMPB technology, using the counting of RNA molecules within a bacteriophage phi29 DNA-packaging biomotor as an example. The method described here can be applied to the single molecule counting of other molecules in other systems. The construction of a concise, simple and economical single molecule total internal reflection fluorescence (TIRF) microscope combining prism-type and objective-type TIRF is described. The imaging system contains a deep-cooled sensitive EMCCD camera with single fluorophore detection sensitivity, a laser combiner for simultaneous dual-color excitation, and a Dual-View™ imager to split the multiple outcome signals to different detector channels based on their wavelengths. Methodology of the single molecule photobleaching assay used to elucidate the stoichiometry of RNA on phi29 DNA packaging motor and the mechanism of protein/RNA interaction are described. Different methods for single fluorophore labeling of RNA molecules are reviewed. The process of statistical modeling to reveal the true copy number of the biomolecules based on binomial distribution is also described. Copyright © 2014 Elsevier Inc. All rights reserved.
Deformation of DNA molecules by hydrodynamic focusing
NASA Astrophysics Data System (ADS)
Wong, Pak Kin; Lee, Yi-Kuen; Ho, Chih-Ming
2003-12-01
The motion of a DNA molecule in a solvent flow reflects the deformation of a nano/microscale flexible mass spring structure by the forces exerted by the fluid molecules. The dynamics of individual molecules can reveal both fundamental properties of the DNA and basic understanding of the complex rheological properties of long-chain molecules. In this study, we report the dynamics of isolated DNA molecules under homogeneous extensional flow. Hydrodynamic focusing generates homogeneous extensional flow with uniform velocity in the transverse direction. The deformation of individual DNA molecules in the flow was visualized with video fluorescence microscopy. A coil stretch transition was observed when the Deborah number (De) is larger than 0.8. With a sudden stopping of the flow, the DNA molecule relaxes and recoils. The longest relaxation time of T2 DNA was determined to be 0.63 s when scaling viscosity to 0.9 cP.
Lin, Chung Hsun; Guan, Jingjiao; Chau, Shiu Wu; Chen, Shia Chung; Lee, L James
2010-08-04
DNA molecules in a solution can be immobilized and stretched into a highly ordered array on a solid surface containing micropillars by molecular combing technique. However, the mechanism of this process is not well understood. In this study, we demonstrated the generation of DNA nanostrand array with linear, zigzag, and fork-zigzag patterns and the microfluidic processes are modeled based on a deforming body-fitted grid approach. The simulation results provide insights for explaining the stretching, immobilizing, and patterning of DNA molecules observed in the experiments.
DNA Molecules Adsorbed on Rippled Supported Cationic Lipid Membranes -- A new way to stretch DNAs
NASA Astrophysics Data System (ADS)
Golubovic, Leonardo
2005-03-01
We discuss a novel approach to control to shapes of DNA molecules. We elucidate the recent experimental work of M. Hochrein, L. Golubovic and J. Raedler, on the conformational behavior of DNA molecules adsorbed on lipid membranes that are supported on grooved micro-structured surfaces. We explain the striking ability of the edges formed on these supported membranes to adsorb and completely orient (stretch) very long DNA molecules. Here we explain the experimentally observed DNA stretching effect in terms of the surface curvature dependent electrostatic potential seen by the adsorbed DNA molecules. On the curved, rippled membrane, we show that the DNA molecules undergo localization transitions causing them to stretch by binding to the ripple edges of the supported membrane. In the future, this stretching will allow to directly image, by the common fluorescence microscopy, fundamental biological processes of the interactions between DNA and single protein molecules.
Crystal structure of a four-stranded intercalated DNA: d(C4)
NASA Technical Reports Server (NTRS)
Chen, L.; Cai, L.; Zhang, X.; Rich, A.
1994-01-01
The crystal structure of d(C4) solved at 2.3-A resolution reveals a four-stranded molecule composed of two interdigitated or intercalated duplexes. The duplexes are held together by hemiprotonated cytosine-cytosine base pairs and are parallel stranded, but the two duplexes point in opposite directions. The molecule has a slow right-handed twist of 12.4 degrees between covalently linked cytosine base pairs, and the base stacking distance is 3.1 A. This is in general agreement with the NMR studies. A biological role for DNA in this conformation is suggested.
Modification-dependent restriction endonuclease, MspJI, flips 5-methylcytosine out of the DNA helix
Horton, J. R.; Wang, H.; Mabuchi, M. Y.; ...
2014-09-27
MspJI belongs to a family of restriction enzymes that cleave DNA containing 5-methylcytosine (5mC) or 5-hydroxymethylcytosine (5hmC). MspJI is specific for the sequence 5(h)mC-N-N-G or A and cleaves with some variability 9/13 nucleotides downstream. Earlier, we reported the crystal structure of MspJI without DNA and proposed how it might recognize this sequence and catalyze cleavage. Here we report its co-crystal structure with a 27-base pair oligonucleotide containing 5mC. This structure confirms that MspJI acts as a homotetramer and that the modified cytosine is flipped from the DNA helix into an SRA-like-binding pocket. We expected the structure to reveal two DNAmore » molecules bound specifically to the tetramer and engaged with the enzyme's two DNA-cleavage sites. A coincidence of crystal packing precluded this organization, however. We found that each DNA molecule interacted with two adjacent tetramers, binding one specifically and the other non-specifically. The latter interaction, which prevented cleavage-site engagement, also involved base flipping and might represent the sequence-interrogation phase that precedes specific recognition. MspJI is unusual in that DNA molecules are recognized and cleaved by different subunits. Such interchange of function might explain how other complex multimeric restriction enzymes act.« less
Biophysics: Breaking the Nanometer Barrier
DOE Office of Scientific and Technical Information (OSTI.GOV)
Block, Steven
2006-03-20
A new field of scientific exploration – single molecule biophysics – is currently reshaping and redefining our understanding of the mechanochemistry of life. The development of laser-based optical traps, or ‘optical tweezers,’ has allowed for physiological assessments of such precision that bio-molecules can now be measured and studied one at a time. In this colloquium, Professor Block will present findings based on his group’s construction of optical trapping instrumentation that has broken the nanometer barrier, allowing researchers to study single-molecule displacements on the Angstrom level. Focusing on RNA polymerase, the motor enzyme responsible for transcribing the genetic code contained inmore » DNA, Block’s group has been able to measure, in real time, the motion of a single molecule of RNA polymerase as it moves from base to base along the DNA template. A remarkable opportunity to gain insight into one of the most fundamental biological processes of life, this colloquium can not be missed!« less
Enhanced post wash retention of combed DNA molecules by varying multiple combing parameters.
Yadav, Hemendra; Sharma, Pulkit
2017-11-01
Recent advances in genomics have created a need for efficient techniques for deciphering information hidden in various genomes. Single molecule analysis is one such technique to understand molecular processes at single molecule level. Fiber- FISH performed with the help of DNA combing can help us in understanding genetic rearrangements and changes in genome at single DNA molecule level. For performing Fiber-FISH we need high retention of combed DNA molecules post wash as Fiber-FISH requires profuse washing. We optimized combing process involving combing solution, method of DNA mounting on glass slides and coating of glass slides to enhance post-wash retention of DNA molecules. It was found that average number of DNA molecules observed post-wash per field of view was maximum with our optimized combing solution. APTES coated glass slides showed lesser retention than PEI surface but fluorescent intensity was higher in case of APTES coated surface. Capillary method used to mount DNA on glass slides also showed lesser retention but straight DNA molecules were observed as compared to force flow method. Copyright © 2017 Elsevier Inc. All rights reserved.
Extending the spectrum of DNA sequences retrieved from ancient bones and teeth
Glocke, Isabelle; Meyer, Matthias
2017-01-01
The number of DNA fragments surviving in ancient bones and teeth is known to decrease with fragment length. Recent genetic analyses of Middle Pleistocene remains have shown that the recovery of extremely short fragments can prove critical for successful retrieval of sequence information from particularly degraded ancient biological material. Current sample preparation techniques, however, are not optimized to recover DNA sequences from fragments shorter than ∼35 base pairs (bp). Here, we show that much shorter DNA fragments are present in ancient skeletal remains but lost during DNA extraction. We present a refined silica-based DNA extraction method that not only enables efficient recovery of molecules as short as 25 bp but also doubles the yield of sequences from longer fragments due to improved recovery of molecules with single-strand breaks. Furthermore, we present strategies for monitoring inefficiencies in library preparation that may result from co-extraction of inhibitory substances during DNA extraction. The combination of DNA extraction and library preparation techniques described here substantially increases the yield of DNA sequences from ancient remains and provides access to a yet unexploited source of highly degraded DNA fragments. Our work may thus open the door for genetic analyses on even older material. PMID:28408382
Tunable graphene quantum point contact transistor for DNA detection and characterization
Girdhar, Anuj; Sathe, Chaitanya; Schulten, Klaus; Leburton, Jean-Pierre
2015-01-01
A graphene membrane conductor containing a nanopore in a quantum point contact (QPC) geometry is a promising candidate to sense, and potentially sequence, DNA molecules translocating through the nanopore. Within this geometry, the shape, size, and position of the nanopore as well as the edge configuration influences the membrane conductance caused by the electrostatic interaction between the DNA nucleotides and the nanopore edge. It is shown that the graphene conductance variations resulting from DNA translocation can be enhanced by choosing a particular geometry as well as by modulating the graphene Fermi energy, which demonstrates the ability to detect conformational transformations of a double-stranded DNA, as well as the passage of individual base pairs of a single-stranded DNA molecule through the nanopore. PMID:25765702
DNA condensation and size effects of DNA condensation agent
NASA Astrophysics Data System (ADS)
Liu, Yan-Hui; Jiang, Chong-Ming; Guo, Xin-Miao; Tang, Yan-Lin; Hu, Lin
2013-08-01
Based on the model of the strong correlation of counterions condensed on DNA molecule, by tailoring interaction potential, interduplex spacing and correlation spacing between condensed counterions on DNA molecule and interduplex spacing fluctuation strength, toroidal configuration, rod-like configuration and two-hole configurations are possible. The size effects of counterion structure on the toroidal structure can be detected by this model. The autocorrelation function of the tangent vectors is found as an effective way to detect the structure of toroidal conformations and the generic pathway of the process of DNA condensation. The generic pathway of all of the configurations involves an initial nucleation loop, and the next part of the DNA chain is folded on the top of the initial nucleation loop with different manners, in agreement with the recent experimental results.
Electrochemical sensing and biosensing platform based on chemically reduced graphene oxide.
Zhou, Ming; Zhai, Yueming; Dong, Shaojun
2009-07-15
In this paper, the characterization and application of a chemically reduced graphene oxide modified glassy carbon (CR-GO/GC) electrode, a novel electrode system, for the preparation of electrochemical sensing and biosensing platform are proposed. Different kinds of important inorganic and organic electroactive compounds (i.e., probe molecule (potassium ferricyanide), free bases of DNA (guanine (G), adenine (A), thymine (T), and cytosine (C)), oxidase/dehydrogenase-related molecules (hydrogen peroxide (H2O2)/beta-nicotinamide adenine dinucleotide (NADH)), neurotransmitters (dopamine (DA)), and other biological molecules (ascorbic acid (AA), uric acid (UA), and acetaminophen (APAP)) were employed to study their electrochemical responses at the CR-GO/GC electrode, which shows more favorable electron transfer kinetics than graphite modified glassy carbon (graphite/GC) and glassy carbon (GC) electrodes. The greatly enhanced electrochemical reactivity of the four free bases of DNA at the CR-GO/GC electrode compared with that at graphite/GC and GC electrodes makes the CR-GO/GC electrode a better choice for the electrochemical biosensing of four DNA bases in both the single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) at physiological pH without a prehydrolysis step. This allows us to detect a single-nucleotide polymorphism (SNP) site for short oligomers with a particular sequence at the CR-GO/GC electrode without any hybridization or labeling processes in this work, suggesting the potential applications of CR-GO in the label-free electrochemical detection of DNA hybridization or DNA damage for further research. Based on the greatly enhanced electrochemical reactivity of H2O2 and NADH at the CR-GO/GC electrode, CR-GO/GC electrode-based bioelectrodes (in connection with glucose oxidase (GOD) and alcohol dehydrogenase (ADH)) show a better analytical performance for the detection of glucose and ethanol compared with graphite/GC- or GC-based bioelectrodes. By comparing the electrochemical performance of CR-GO with that of the conventional graphite and GC, we reveal that CR-GO with the nature of a single sheet showing favorable electrochemical activity should be a kind of more robust and advanced carbon electrode material which may hold great promise for electrochemical sensors and biosensors design.
Compositions and methods for detecting single nucleotide polymorphisms
Yeh, Hsin-Chih; Werner, James; Martinez, Jennifer S.
2016-11-22
Described herein are nucleic acid based probes and methods for discriminating and detecting single nucleotide variants in nucleic acid molecules (e.g., DNA). The methods include use of a pair of probes can be used to detect and identify polymorphisms, for example single nucleotide polymorphism in DNA. The pair of probes emit a different fluorescent wavelength of light depending on the association and alignment of the probes when hybridized to a target nucleic acid molecule. Each pair of probes is capable of discriminating at least two different nucleic acid molecules that differ by at least a single nucleotide difference. The methods can probes can be used, for example, for detection of DNA polymorphisms that are indicative of a particular disease or condition.
Liu, Ningning; Bu, Tianjia; Song, Yu; Zhang, Wei; Li, Jinjing; Zhang, Wenke; Shen, Jiacong; Li, Hongbin
2010-06-15
Single-stranded DNA binding proteins (SSB) interact with single-stranded DNA (ssDNA) specifically. Taking advantage of this character, we have employed Bacillus subtilis SSB protein to investigate the nature of force-induced conformation transition of double-stranded DNA (dsDNA) by using AFM-based single molecule force spectroscopy (SMFS) technique. Our results show that, when a dsDNA is stretched beyond its contour length, the dsDNA is partially melted, producing some ssDNA segments which can be captured by SSB proteins. We have also systematically investigated the effects of stretching length, waiting time, and salt concentration on the conformation transition of dsDNA and SSB-ssDNA interactions, respectively. Furthermore, the effect of proflavine, a DNA intercalator, on the SSB-DNA interactions has been investigated, and the results indicate that the proflavine-saturated dsDNA can be stabilized to the extent that the dsDNA will no longer melt into ssDNA under the mechanical force even up to 150 pN, and no SSB-DNA interactions are detectable.
Mukhina, T M; Nikolaienko, T Yu
2015-01-01
Recent studies on Escherichia coli bacteria cultivation, in which DNA thymine was replaced with 5-chlorouracil have refreshed the problem of understanding the changes to physical properties of DNA monomers resultant from chemical modifications. These studies have shown that the replacement did not affect the normal activities and division of the bacteria, but has significantly reduced its life span. In this paper a comparative analysis was carried out by the methods of computational experiment of a set of 687 possible conformers of natural monomeric DNA unit (2'-deoxyribonucleotide thymidine monophosphate) and 660 conformers of 5-chloro-2'-deoxyuridine monophosphate - a similar molecules in which the natural nitrogenous base thymine is substituted with 5-chlorouracil. Structures of stable conformers of the modified deoxyribonucleotide have been obtained and physical factors, which determine their variation from the conformers of the unmodified molecule have been analyzed. A comparative analysis of the elastic properties of conformers of investigated molecules and non-covalent interactions present in them was conducted. The results can be usedfor planning experiments on synthesis of artficial DNA suitable for incorporation into living organisms.
NASA Astrophysics Data System (ADS)
Sepehri, Alireza
Recently, some authors have shown that a DNA molecule produces electromagnetic signals and communicates with other DNA molecules or other molecules. In fact, a DNA acts like a receiver or transmitter of radio waves. In this paper, we suggest a mathematical model for the DNA molecule and use of its communication to cure some diseases like cancer. In this model, first, by using concepts from string theory and M-theory, we calculate the energy of a DNA in terms of interactions between free electrons and bound electrons. We show that when a DNA is damaged, its energy changes and an extra current is produced. This extra current causes the electromagnetic signals of a damaged DNA molecule to be different when compared to the electromagnetic signals of a normal DNA molecule. The electromagnetic signals of a damaged DNA molecule induce an extra current in a normal DNA molecule and lead to its destruction. By sending crafted electromagnetic signals to normal DNA molecules and inducing an opposite current with respect to this extra current, we can prevent the destruction of normal DNA. Finally, we argue that the type of packing of DNA in chromosomes of men and women is different. This causes radiated waves from DNAs of men and women to have opposite signs and cancel the effect of each other in a pair. Using this property, we suggest another mechanism to cancel the effect of extra waves, which are produced by DNAs in cancer cells of a male or a female, by extra waves which are produced by DNAs in similar cells of a female or a male and prevent the progression of the disease.
Zhan, Fengping; Liao, Xiaolei; Gao, Feng; Qiu, Weiwei; Wang, Qingxiang
2017-06-15
A novel electrochemical DNA biosensor has been facilely constructed by in-situ assembly of electroactive 4'-aminobenzo-18-crown-6-copper(II) complex (AbC-Cu 2+ ) on the free terminal of the hairpin-structured molecule beacon. The 3'-SH modified molecule beacon probe was first immobilized on the gold electrode (AuE) surface through self-assembly chemistry of Au-S bond. Then the crow ester of AbC was covalently coupled with 5'-COOH on the molecule beacon, and served as a platform to attach the Cu 2+ by coordination with ether bond (-O-) of the crown cycle. Thus, an electroactive molecule beacon-based biosensing interface was constructed. In comparison with conventional methods for preparation of electroactive molecule beacon, the approach presented in this work is much simpler, reagent- and labor-saving. Selectivity study shows that the in-situ fabricated electroactive molecule beacon remains excellent recognition ability of pristine molecule beacon probe to well differentiate various DNA fragments. The target DNA can be quantatively determined over the range from 0.10pM to 0.50nM. The detection limit of 0.060pM was estimated based on signal-to-noise ratio of 3. When the biosensor was applied for the detection cauliflower mosaic virus 35s (CaMV 35s) in soybean extraction samples, satisfactory results are achieved. This work opens a new strategy for facilely fabricating electrochemical sensing interface, which also shows great potential in aptasensor and immurosensor fabrication. Copyright © 2016 Elsevier B.V. All rights reserved.
Pulsed IR Heating Studies of Single-Molecule DNA Duplex Dissociation Kinetics and Thermodynamics
Holmstrom, Erik D.; Dupuis, Nicholas F.; Nesbitt, David J.
2014-01-01
Single-molecule fluorescence spectroscopy is a powerful technique that makes it possible to observe the conformational dynamics associated with biomolecular processes. The addition of precise temperature control to these experiments can yield valuable thermodynamic information about equilibrium and kinetic rate constants. To accomplish this, we have developed a microscopy technique based on infrared laser overtone/combination band absorption to heat small (≈10−11 liter) volumes of water. Detailed experimental characterization of this technique reveals three major advantages over conventional stage heating methods: 1), a larger range of steady-state temperatures (20–100°C); 2), substantially superior spatial (≤20 μm) control; and 3), substantially superior temporal (≈1 ms) control. The flexibility and breadth of this spatial and temporally resolved laser-heating approach is demonstrated in single-molecule fluorescence assays designed to probe the dissociation of a 21 bp DNA duplex. These studies are used to support a kinetic model based on nucleic acid end fraying that describes dissociation for both short (<10 bp) and long (>10 bp) DNA duplexes. These measurements have been extended to explore temperature-dependent kinetics for the 21 bp construct, which permit determination of single-molecule activation enthalpies and entropies for DNA duplex dissociation. PMID:24411254
Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.
2016-01-01
Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524
DNA dynamics in aqueous solution: opening the double helix
NASA Technical Reports Server (NTRS)
Pohorille, A.; Ross, W. S.; Tinoco, I. Jr; MacElroy, R. D. (Principal Investigator)
1990-01-01
The opening of a DNA base pair is a simple reaction that is a prerequisite for replication, transcription, and other vital biological functions. Understanding the molecular mechanisms of biological reactions is crucial for predicting and, ultimately, controlling them. Realistic computer simulations of the reactions can provide the needed understanding. To model even the simplest reaction in aqueous solution requires hundreds of hours of supercomputing time. We have used molecular dynamics techniques to simulate fraying of the ends of a six base pair double strand of DNA, [TCGCGA]2, where the four bases of DNA are denoted by T (thymine), C (cytosine), G (guanine), and A (adenine), and to estimate the free energy barrier to this process. The calculations, in which the DNA was surrounded by 2,594 water molecules, required 50 hours of CRAY-2 CPU time for every simulated 100 picoseconds. A free energy barrier to fraying, which is mainly characterized by the movement of adenine away from thymine into aqueous environment, was estimated to be 4 kcal/mol. Another fraying pathway, which leads to stacking between terminal adenine and thymine, was also observed. These detailed pictures of the motions and energetics of DNA base pair opening in water are a first step toward understanding how DNA will interact with any molecule.
NASA Astrophysics Data System (ADS)
Blank, K.; Mai, T.; Gilbert, I.; Schiffmann, S.; Rankl, J.; Zivin, R.; Tackney, C.; Nicolaus, T.; Spinnler, K.; Oesterhelt, F.; Benoit, M.; Clausen-Schaumann, H.; Gaub, H. E.
2003-09-01
A parallel assay for the quantification of single-molecule binding forces was developed based on differential unbinding force measurements where ligand-receptor interactions are compared with the unzipping forces of DNA hybrids. Using the DNA zippers as molecular force sensors, the efficient discrimination between specific and nonspecific interactions was demonstrated for small molecules binding to specific receptors, as well as for protein-protein interactions on protein arrays. Finally, an antibody sandwich assay with different capture antibodies on one chip surface and with the detection antibodies linked to a congruent surface via the DNA zippers was used to capture and quantify a recombinant hepatitis C antigen from solution. In this case, the DNA zippers enable not only discrimination between specific and nonspecific binding, but also allow for the local application of detection antibodies, thereby eliminating false-positive results caused by cross-reactive antibodies and nonspecific binding.
Hsieh, Shou-Shing; Chen, Jyun-Hong; Tsai, Cheng-Fung
2013-02-18
A novel DNA molecule stretching technique is developed and tested herein. Through a heated converging-diverging microchannel, thermal convection and thermophoresis induced by regional heating are shown to significantly elongate single DNA molecules; they are visualized via a confocal laser scanning microscopy. In addition, electrophoretic stretching is also implemented to examine the hybrid effect on the conformation and dynamics of single DNA molecules. The physical properties of the DNA molecules are secured via experimental measurements.
Single Molecule Detection Using a Silicon Nanopore-Nanotransistor Integrated Circuit
2006-01-01
indicates the dipole moment of the DNA bases projected along the pore axis. During this simulation 14 bases translocated through the pore. The letters...recorded S tU signals are plotted versus time on the top figure. The bottom figure indicates C" the dipole moment of DNA bases 0 - projected along the
Solid-State and Biological Nanopore for Real-Time Sensing of Single Chemical and Sequencing of DNA.
Haque, Farzin; Li, Jinghong; Wu, Hai-Chen; Liang, Xing-Jie; Guo, Peixuan
2013-02-01
Sensitivity and specificity are two most important factors to take into account for molecule sensing, chemical detection and disease diagnosis. A perfect sensitivity is to reach the level where a single molecule can be detected. An ideal specificity is to reach the level where the substance can be detected in the presence of many contaminants. The rapidly progressing nanopore technology is approaching this threshold. A wide assortment of biomotors and cellular pores in living organisms perform diverse biological functions. The elegant design of these transportation machineries has inspired the development of single molecule detection based on modulations of the individual current blockage events. The dynamic growth of nanotechnology and nanobiotechnology has stimulated rapid advances in the study of nanopore based instrumentation over the last decade, and inspired great interest in sensing of single molecules including ions, nucleotides, enantiomers, drugs, and polymers such as PEG, RNA, DNA, and polypeptides. This sensing technology has been extended to medical diagnostics and third generation high throughput DNA sequencing. This review covers current nanopore detection platforms including both biological pores and solid state counterparts. Several biological nanopores have been studied over the years, but this review will focus on the three best characterized systems including α-hemolysin and MspA, both containing a smaller channel for the detection of single-strand DNA, as well as bacteriophage phi29 DNA packaging motor connector that contains a larger channel for the passing of double stranded DNA. The advantage and disadvantage of each system are compared; their current and potential applications in nanomedicine, biotechnology, and nanotechnology are discussed.
Solid-State and Biological Nanopore for Real-Time Sensing of Single Chemical and Sequencing of DNA
Haque, Farzin; Li, Jinghong; Wu, Hai-Chen; Liang, Xing-Jie; Guo, Peixuan
2013-01-01
Sensitivity and specificity are two most important factors to take into account for molecule sensing, chemical detection and disease diagnosis. A perfect sensitivity is to reach the level where a single molecule can be detected. An ideal specificity is to reach the level where the substance can be detected in the presence of many contaminants. The rapidly progressing nanopore technology is approaching this threshold. A wide assortment of biomotors and cellular pores in living organisms perform diverse biological functions. The elegant design of these transportation machineries has inspired the development of single molecule detection based on modulations of the individual current blockage events. The dynamic growth of nanotechnology and nanobiotechnology has stimulated rapid advances in the study of nanopore based instrumentation over the last decade, and inspired great interest in sensing of single molecules including ions, nucleotides, enantiomers, drugs, and polymers such as PEG, RNA, DNA, and polypeptides. This sensing technology has been extended to medical diagnostics and third generation high throughput DNA sequencing. This review covers current nanopore detection platforms including both biological pores and solid state counterparts. Several biological nanopores have been studied over the years, but this review will focus on the three best characterized systems including α-hemolysin and MspA, both containing a smaller channel for the detection of single-strand DNA, as well as bacteriophage phi29 DNA packaging motor connector that contains a larger channel for the passing of double stranded DNA. The advantage and disadvantage of each system are compared; their current and potential applications in nanomedicine, biotechnology, and nanotechnology are discussed. PMID:23504223
Direct Detection and Sequencing of Damaged DNA Bases
2011-01-01
Products of various forms of DNA damage have been implicated in a variety of important biological processes, such as aging, neurodegenerative diseases, and cancer. Therefore, there exists great interest to develop methods for interrogating damaged DNA in the context of sequencing. Here, we demonstrate that single-molecule, real-time (SMRT®) DNA sequencing can directly detect damaged DNA bases in the DNA template - as a by-product of the sequencing method - through an analysis of the DNA polymerase kinetics that are altered by the presence of a modified base. We demonstrate the sequencing of several DNA templates containing products of DNA damage, including 8-oxoguanine, 8-oxoadenine, O6-methylguanine, 1-methyladenine, O4-methylthymine, 5-hydroxycytosine, 5-hydroxyuracil, 5-hydroxymethyluracil, or thymine dimers, and show that these base modifications can be readily detected with single-modification resolution and DNA strand specificity. We characterize the distinct kinetic signatures generated by these DNA base modifications. PMID:22185597
Direct detection and sequencing of damaged DNA bases.
Clark, Tyson A; Spittle, Kristi E; Turner, Stephen W; Korlach, Jonas
2011-12-20
Products of various forms of DNA damage have been implicated in a variety of important biological processes, such as aging, neurodegenerative diseases, and cancer. Therefore, there exists great interest to develop methods for interrogating damaged DNA in the context of sequencing. Here, we demonstrate that single-molecule, real-time (SMRT®) DNA sequencing can directly detect damaged DNA bases in the DNA template - as a by-product of the sequencing method - through an analysis of the DNA polymerase kinetics that are altered by the presence of a modified base. We demonstrate the sequencing of several DNA templates containing products of DNA damage, including 8-oxoguanine, 8-oxoadenine, O6-methylguanine, 1-methyladenine, O4-methylthymine, 5-hydroxycytosine, 5-hydroxyuracil, 5-hydroxymethyluracil, or thymine dimers, and show that these base modifications can be readily detected with single-modification resolution and DNA strand specificity. We characterize the distinct kinetic signatures generated by these DNA base modifications.
Cortini, Ruggero; Cheng, Xiaolin; Smith, Jeremy C.
2017-01-16
Electrostatic interactions between DNA molecules have been extensively studied experimentally and theoretically, but several aspects (e.g. its role in determining the pitch of the cholesteric DNA phase) still remain unclear. Here, we performed large-scale all-atom molecular dynamics simulations in explicit water and 150 mM sodium chloride, to reconstruct the potential of mean force (PMF) of two DNA oligomers 24 base pairs long as a function of their interaxial angle and intermolecular distance. We find that the potential of mean force is dominated by total DNA charge, and not by the helical geometry of its charged groups. The theory of homogeneously charged cylinders fits well all our simulation data, and the fit yields the optimal value of the total compensated charge on DNA to ≈65% of its total fixed charge (arising from the phosphorous atoms), close to the value expected from Manning's theory of ion condensation. The PMF calculated from our simulations does not show a significant dependence on the handedness of the angle between the two DNA molecules, or its size is on the order ofmore » $$1{{k}_{\\text{B}}}T$$ . Thermal noise for molecules of the studied length seems to mask the effect of detailed helical charge patterns of DNA. The fact that in monovalent salt the effective interaction between two DNA molecules is independent on the handedness of the tilt may suggest that alternative mechanisms are required to understand the cholesteric phase of DNA.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cortini, Ruggero; Cheng, Xiaolin; Smith, Jeremy C.
Electrostatic interactions between DNA molecules have been extensively studied experimentally and theoretically, but several aspects (e.g. its role in determining the pitch of the cholesteric DNA phase) still remain unclear. Here, we performed large-scale all-atom molecular dynamics simulations in explicit water and 150 mM sodium chloride, to reconstruct the potential of mean force (PMF) of two DNA oligomers 24 base pairs long as a function of their interaxial angle and intermolecular distance. We find that the potential of mean force is dominated by total DNA charge, and not by the helical geometry of its charged groups. The theory of homogeneously charged cylinders fits well all our simulation data, and the fit yields the optimal value of the total compensated charge on DNA to ≈65% of its total fixed charge (arising from the phosphorous atoms), close to the value expected from Manning's theory of ion condensation. The PMF calculated from our simulations does not show a significant dependence on the handedness of the angle between the two DNA molecules, or its size is on the order ofmore » $$1{{k}_{\\text{B}}}T$$ . Thermal noise for molecules of the studied length seems to mask the effect of detailed helical charge patterns of DNA. The fact that in monovalent salt the effective interaction between two DNA molecules is independent on the handedness of the tilt may suggest that alternative mechanisms are required to understand the cholesteric phase of DNA.« less
Clark, Andrew G; Naufer, M Nabuan; Westerlund, Fredrik; Lincoln, Per; Rouzina, Ioulia; Paramanathan, Thayaparan; Williams, Mark C
2018-02-06
Molecules that bind DNA via threading intercalation show high binding affinity as well as slow dissociation kinetics, properties ideal for the development of anticancer drugs. To this end, it is critical to identify the specific molecular characteristics of threading intercalators that result in optimal DNA interactions. Using single-molecule techniques, we quantify the binding of a small metal-organic ruthenium threading intercalator (Δ,Δ-B) and compare its binding characteristics to a similar molecule with significantly larger threading moieties (Δ,Δ-P). The binding affinities of the two molecules are the same, while comparison of the binding kinetics reveals significantly faster kinetics for Δ,Δ-B. However, the kinetics is still much slower than that observed for conventional intercalators. Comparison of the two threading intercalators shows that the binding affinity is modulated independently by the intercalating section and the binding kinetics is modulated by the threading moiety. In order to thread DNA, Δ,Δ-P requires a "lock mechanism", in which a large length increase of the DNA duplex is required for both association and dissociation. In contrast, measurements of the force-dependent binding kinetics show that Δ,Δ-B requires a large DNA length increase for association but no length increase for dissociation from DNA. This contrasts strongly with conventional intercalators, for which almost no DNA length change is required for association but a large DNA length change must occur for dissociation. This result illustrates the fundamentally different mechanism of threading intercalation compared with conventional intercalation and will pave the way for the rational design of therapeutic drugs based on DNA threading intercalation.
Park, Suehyun; Joo, Heesun; Kim, Jun Soo
2018-01-31
Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.
Klobutcher, L A; Swanton, M T; Donini, P; Prescott, D M
1981-01-01
In hypotrichous ciliates, all of the macronuclear DNA is in the form of low molecular weight molecules with an average size of approximately 2200 base pairs. Total macronuclear DNA from four hypotrichs has been shown to have inverted terminal repeats by direct sequence analysis. In Oxytricha nova, Oxytricha sp., and Stylonychia pustulata, this terminal sequence may be written as 5'-C4A4C4A4C4 ... 3'-G4T4G4T4G4T4G4T4G4 ... In Euplotes aediculatus, the sequences is similar but differs in the lengths of the duplex region (28 base pairs) and of the putative 3' extension (14 base pairs). Also in Euplotes, a second common sequence of 5 base pairs (A-A-C-T-T-T-T-G-A-A) occurs internal to the terminal repeat and a 17-base-pair heterogeneous region: 5'-C4A4C4A4C4A4C4(X)17T-T-G-A-A ... 3'-G2T4G4T4G4T4G4T4G4T4G4(X)17A-A-C-T-T ... The length of the terminal repeat sequence for O. nova was confirmed in cloned macronuclear DNA molecules. Images PMID:6265931
A Sensitive DNA Capacitive Biosensor Using Interdigitated Electrodes
Wang, Lei; Veselinovic, Milena; Yang, Lang; Geiss, Brian J.; Dandy, David S.; Chen, Tom
2017-01-01
This paper presents a label-free affinity-based capacitive biosensor using interdigitated electrodes. Using an optimized process of DNA probe preparation to minimize the effect of contaminants in commercial thiolated DNA probe, the electrode surface was functionalized with the 24-nucleotide DNA probes based on the West Nile virus sequence (Kunjin strain). The biosensor has the ability to detect complementary DNA fragments with a detection limit down to 20 DNA target molecules (1.5 aM range), making it suitable for a practical point-of-care (POC) platform for low target count clinical applications without the need for amplification. The reproducibility of the biosensor detection was improved with efficient covalent immobilization of purified single-stranded DNA probe oligomers on cleaned gold microelectrodes. In addition to the low detection limit, the biosensor showed a dynamic range of detection from 1 μL−1 to 105 μL−1 target molecules (20 to 2 million targets), making it suitable for sample analysis in a typical clinical application environment. The binding results presented in this paper were validated using fluorescent oligomers. PMID:27619528
PCR-based detection of a rare linear DNA in cell culture.
Saveliev, Sergei V.
2002-11-11
The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 10(7) or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.
PCR-based detection of a rare linear DNA in cell culture
2002-01-01
The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 107 or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials. PMID:12734566
Nucleic Acid Nanostructures: Bottom-Up Control of Geometry on the Nanoscale
Seeman, Nadrian C.; Lukeman, Philip S.
2012-01-01
DNA may seem an unlikely molecule from which to build nanostructures, but this is not correct. The specificity of interaction that enables DNA to function so successfully as genetic material also enables its use as a smart molecule for construction on the nanoscale. The key to using DNA for this purpose is the design of stable branched molecules, which expand its ability to interact specifically with other nucleic acid molecules. The same interactions used by genetic engineers can be used to make cohesive interactions with other DNA molecules that lead to a variety of new species. Branched DNA molecules are easy to design, and the can assume a variety of structural motifs. These can be used for purposes both of specific construction, such as polyhedra, and for the assembly of topological targets. A variety of two-dimensional periodic arrays with specific patterns have been made. DNA nanomechanical devices have been built with a series of different triggers, small molecules, nucleic acid molecules and proteins. Recently, progress has been made in self-replication of DNA nano-constructs, and in the scaffolding of other species into DNA arrangements. PMID:25152542
Ahour, F; Shamsi, A
2017-09-01
Based on the strong interaction between single-stranded DNA (ss-DNA) and graphene material, we have constructed a novel label-free electrochemical biosensor for rapid and facile detection of short sequences ss-DNA molecules related to hepatitis C virus 1a using graphene oxide modified pencil graphite electrode. The sensing mechanism is based on the superior adsorption of single-stranded DNA to GO over double stranded DNA (ds-DNA). The intrinsic guanine oxidation signal measured by differential pulse voltammetry (DPV) has been used for duplex DNA formation detection. The probe ss-DNA adsorbs onto the surface of GO via the π- π* stacking interactions leading to a strong background guanine oxidation signal. In the presence of complementary target, formation of helix which has weak binding ability to GO induced ds-DNA to release from the electrode surface and significant variation in differential pulse voltammetric response of guanine bases. The results indicated that the oxidation peak current was proportional to the concentration of complementary strand in the range of 0.1 nM-0.5 μM with a detection limit of 4.3 × 10 -11 M. The simple fabricated electrochemical biosensor has high sensitivity, good selectivity, and could be applied as a new platform for a range of target molecules in future. Copyright © 2017 Elsevier Inc. All rights reserved.
Zhang, Hao; Li, Yan; Su, Xingguang
2013-11-15
In this paper, we establish a novel fluorescence-sensing system for the detection of biotin based on the interaction between DNA and graphene oxide and on protection of the terminal of the biotinylated single-stranded DNA fluorescent probe by streptavidin. In this system, streptavidin binds to the biotinylated DNA, which protects the DNA from hydrolysis by exonuclease I. The streptavidin-DNA conjugate is then adsorbed to the graphene oxide resulting in the fluorescence being quenched. Upon the addition of free biotin, it competes with the labeled biotin for the binding sites of streptavidin and then the exonuclease I digests the unbound DNA probe from the 3' to the 5' terminal, releasing the fluorophore from the DNA. Because of the weak affinity between the fluorophore and graphene oxide, the fluorescence is recovered. Under optimal conditions, the fluorescence intensity is proportional to the concentration of biotin in the concentration range of 0.5-20nmol/L. The detection limit for biotin is 0.44nmol/L. The proposed fluorescence-sensing system was applied to the determination of biotin in some real samples with satisfactory reproducibility and accuracy. This work could provide a common platform for detecting small biomolecules based on protein-small molecule ligand binding. Copyright © 2013 Elsevier Inc. All rights reserved.
Gel Electrophoresis of Gold-DNA Nanoconjugates
Pellegrino, T.; Sperling, R. A.; Alivisatos, A. P.; ...
2007-01-01
Gold-DNA conjugates were investigated in detail by a comprehensive gel electrophoresis study based on 1200 gels. A controlled number of single-stranded DNA of different length was attached specifically via thiol-Au bonds to phosphine-stabilized colloidal gold nanoparticles. Alternatively, the surface of the gold particles was saturated with single stranded DNA of different length either specifically via thiol-Au bonds or by nonspecific adsorption. From the experimentally determined electrophoretic mobilities, estimates for the effective diameters of the gold-DNA conjugates were derived by applying two different data treatment approaches. The first method is based on making a calibration curve for the relation between effectivemore » diameters and mobilities with gold nanoparticles of known diameter. The second method is based on Ferguson analysis which uses gold nanoparticles of known diameter as reference database. Our study shows that effective diameters derived from gel electrophoresis measurements are affected with a high error bar as the determined values strongly depend on the method of evaluation, though relative changes in size upon binding of molecules can be detected with high precision. Furthermore, in this study, the specific attachment of DNA via gold-thiol bonds to Au nanoparticles is compared to nonspecific adsorption of DNA. Also, the maximum number of DNA molecules that can be bound per particle was determined.« less
Rupture of DNA aptamer: New insights from simulations
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mishra, Rakesh Kumar; Nath, Shesh; Kumar, Sanjay
2015-10-28
Base-pockets (non-complementary base-pairs) in a double-stranded DNA play a crucial role in biological processes. Because of thermal fluctuations, it can lower the stability of DNA, whereas, in case of DNA aptamer, small molecules, e.g., adenosinemonophosphate and adenosinetriphosphate, form additional hydrogen bonds with base-pockets termed as “binding-pockets,” which enhance the stability. Using the Langevin dynamics simulations of coarse grained model of DNA followed by atomistic simulations, we investigated the influence of base-pocket and binding-pocket on the stability of DNA aptamer. Striking differences have been reported here for the separation induced by temperature and force, which require further investigation by single moleculemore » experiments.« less
NASA Astrophysics Data System (ADS)
Hughes, Cameron Richard
Analysis of DNA structure and behavior, up to and including full sequencing of a genome's bases, and of biological processes such as replication, transcription and translation, is essential for an understanding of genetic variation, heritable diseases and the effects of environmental factors. Recently, single-molecule techniques have been developed to study DNA properties in unprecedented detail. For a number of these techniques, controlled adsorption of linearly stretched DNA molecules on surfaces is necessary. In experiments where hybridization of adsorbed molecules to labeled probes is used to determine DNA structure, single-stranded DNA is needed. Conventionally, for long DNA's (up to Mbp), double-stranded DNA is deposited on a surface and denatured in-situ. While successful, this method has several disadvantages. This thesis reports efforts to directly adsorb long single-stranded DNA's out of solution as an alternative strategy. It consists of three parts: (1) Establishment of a simple method using Acridine Orange (AO) staining dye to determine whether DNA's are ss or ds on the surface. The method allows for the assessment of the degree of renaturation during deposition. Incubation of surface-adsorbed DNA in solutions of AO dye in the concentration range of 10--15uM were found to be effective for discriminating between ss DNA and ds DNA based on differences in the fluorescence emission spectra. (2) Deposition of ss DNA produced by heat denaturation on polymer-coated surfaces. Lambda DNA (48502bp) was adsorbed by drop evaporation or dipping/extraction of surface out of a buffered solution. The efficiency of deposition was optimized with respect to DNA concentration, buffer type and pH. (3) Separation of complementary single strands of Lambda, mono-cut digest and HindIII digest by gel electrophoresis. Using agarose gels in concentrations ranging from 0.4% to 1.4% (weight/volume), electric fields in the range 1--4V/cm in 1x Tris-Acetate-EDTA (TAE) buffer, good strand separation could be obtained. Both DC and pulsed electric fields were used and compared. Following separation, sense and anti-sense strands of lambda DNA were extracted from gels and deposited separately onto surfaces, and length distributions of the isolated molecules were measured by fluorescence microscopy.
An integrated optics microfluidic device for detecting single DNA molecules.
Krogmeier, Jeffrey R; Schaefer, Ian; Seward, George; Yantz, Gregory R; Larson, Jonathan W
2007-12-01
A fluorescence-based integrated optics microfluidic device is presented, capable of detecting single DNA molecules in a high throughput and reproducible manner. The device integrates microfluidics for DNA stretching with two optical elements for single molecule detection (SMD): a plano-aspheric refractive lens for fluorescence excitation (illuminator) and a solid parabolic reflective mirror for fluorescence collection (collector). Although miniaturized in size, both optical components were produced and assembled onto the microfluidic device by readily manufacturable fabrication techniques. The optical resolution of the device is determined by the small and relatively low numerical aperture (NA) illuminator lens (0.10 effective NA, 4.0 mm diameter) that delivers excitation light to a diffraction limited 2.0 microm diameter spot at full width half maximum within the microfluidic channel. The collector (0.82 annular NA, 15 mm diameter) reflects the fluorescence over a large collection angle, representing 71% of a hemisphere, toward a single photon counting module in an infinity-corrected scheme. As a proof-of-principle experiment for this simple integrated device, individual intercalated lambda-phage DNA molecules (48.5 kb) were stretched in a mixed elongational-shear microflow, detected, and sized with a fluorescence signal to noise ratio of 9.9 +/-1.0. We have demonstrated that SMD does not require traditional high numerical aperture objective lenses and sub-micron positioning systems conventionally used in many applications. Rather, standard manufacturing processes can be combined in a novel way that promises greater accessibility and affordability for microfluidic-based single molecule applications.
Two modes of longe-range orientation of DNA bases realized upon compaction.
Yevdokimov YuM; Salyanov, V I; Berg, H
1981-01-01
Formation of compact particles from linear DNA-anthracycline complexes is accompanied by appearance of intense bands in the CD spectra in the region of absorption of DNA bases (UV-region) and in the region of absorption of anthracycline chromophores (visible region). The intense (positive or negative) bands in the region of anthracycline absorption demonstrate an ordered helical location of anthracycline molecules on the DNA template. This fact, in its turn, is related to formation of the DNA superstructure in PEG-containing water-salt solutions with a long-range orientation of nitrogen bases. Possible types of DNA superstructures and the relation between the local- and the long-range order of bases in the DNA superstructure are discussed. PMID:6938929
Methods And Devices For Characterizing Duplex Nucleic Acid Molecules
Akeson, Mark; Vercoutere, Wenonah; Haussler, David; Winters-Hilt, Stephen
2005-08-30
Methods and devices are provided for characterizing a duplex nucleic acid, e.g., a duplex DNA molecule. In the subject methods, a fluid conducting medium that includes a duplex nucleic acid molecule is contacted with a nanopore under the influence of an applied electric field and the resulting changes in current through the nanopore caused by the duplex nucleic acid molecule are monitored. The observed changes in current through the nanopore are then employed as a set of data values to characterize the duplex nucleic acid, where the set of data values may be employed in raw form or manipulated, e.g., into a current blockade profile. Also provided are nanopore devices for practicing the subject methods, where the subject nanopore devices are characterized by the presence of an algorithm which directs a processing means to employ monitored changes in current through a nanopore to characterize a duplex nucleic acid molecule responsible for the current changes. The subject methods and devices find use in a variety of applications, including, among other applications, the identification of an analyte duplex DNA molecule in a sample, the specific base sequence at a single nulceotide polymorphism (SNP), and the sequencing of duplex DNA molecules.
Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy
NASA Astrophysics Data System (ADS)
Chao, J.; Zhang, P.; Wang, Q.; Wu, N.; Zhang, F.; Hu, J.; Fan, C. H.; Li, B.
2016-03-01
We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06544e
Studying DNA looping by single-molecule FRET.
Le, Tung T; Kim, Harold D
2014-06-28
Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.
Studying DNA Looping by Single-Molecule FRET
Le, Tung T.; Kim, Harold D.
2014-01-01
Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA. PMID:24998459
NASA Astrophysics Data System (ADS)
(O' Lee, Dominic J.
2018-02-01
At present, there have been suggested two types of physical mechanism that may facilitate preferential pairing between DNA molecules, with identical or similar base pair texts, without separation of base pairs. One mechanism solely relies on base pair specific patterns of helix distortion being the same on the two molecules, discussed extensively in the past. The other mechanism proposes that there are preferential interactions between base pairs of the same composition. We introduce a model, built on this second mechanism, where both thermal stretching and twisting fluctuations are included, as well as the base pair specific helix distortions. Firstly, we consider an approximation for weak pairing interactions, or short molecules. This yields a dependence of the energy on the square root of the molecular length, which could explain recent experimental data. However, analysis suggests that this approximation is no longer valid at large DNA lengths. In a second approximation, for long molecules, we define two adaptation lengths for twisting and stretching, over which the pairing interaction can limit the accumulation of helix disorder. When the pairing interaction is sufficiently strong, both adaptation lengths are finite; however, as we reduce pairing strength, the stretching adaptation length remains finite but the torsional one becomes infinite. This second state persists to arbitrarily weak values of the pairing strength; suggesting that, if the molecules are long enough, the pairing energy scales as length. To probe differences between the two pairing mechanisms, we also construct a model of similar form. However, now, pairing between identical sequences solely relies on the intrinsic helix distortion patterns. Between the two models, we see interesting qualitative differences. We discuss our findings, and suggest new work to distinguish between the two mechanisms.
Development of an optical biosensor based on surface-enhanced Raman scattering for DNA analysis
NASA Astrophysics Data System (ADS)
Yigit, Tugce; Akdogan, Ebru; Karagoz, Isık. Didem; Kahraman, Mehmet
2016-03-01
Rapid, accurate and sensitive DNA analysis is critically important for the diagnostic of genetic diseases. The most common method preferred in practice is fluorescence based microarrays to analyze the DNA. However, there exist some disadvantages related to the above-mentioned method such as the overlapping of the fluorescence emission wavelengths that can diminish in the performance of multiplexing, needed to obtain fluorescence spectra from each dye and photo degradation. In this study, a novel SERS based DNA analysis approach, which is Raman active dye-free and independent of SERS substrate properties, is developed. First, the single strand DNA probe is attached to the SERS substrate and half of the complimentary DNA is attached to gold nanoparticles, as well. We hypothesize that in the presence of target DNA, the complimentary DNA coupled colloids will bind to the SERS substrate surface via hybridization of single strand target DNA. To test this hypothesis, we used UV/Vis spectroscopy, atomic for microscopy (AFM) and dynamic light scattering (DLS). DNA analysis is demonstrated by a peak shift of the certain peak of the small molecules attached to the SERS substrate surface instead of SERS spectrum obtained in the presence of target DNA from the Raman reporter molecules. The degree of peak shifting will be used for the quantification of the target DNA in the sample. Plasmonic properties of SERS substrates and reproducibility issues will not be considerable due to the use of peak shifting instead of peak intensity for the qualitative analysis.
Nanopore-based fourth-generation DNA sequencing technology.
Feng, Yanxiao; Zhang, Yuechuan; Ying, Cuifeng; Wang, Deqiang; Du, Chunlei
2015-02-01
Nanopore-based sequencers, as the fourth-generation DNA sequencing technology, have the potential to quickly and reliably sequence the entire human genome for less than $1000, and possibly for even less than $100. The single-molecule techniques used by this technology allow us to further study the interaction between DNA and protein, as well as between protein and protein. Nanopore analysis opens a new door to molecular biology investigation at the single-molecule scale. In this article, we have reviewed academic achievements in nanopore technology from the past as well as the latest advances, including both biological and solid-state nanopores, and discussed their recent and potential applications. Copyright © 2015 The Authors. Production and hosting by Elsevier Ltd.. All rights reserved.
Horn, T; Chang, C A; Urdea, M S
1997-12-01
The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology.
Horn, T; Chang, C A; Urdea, M S
1997-01-01
The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology. PMID:9365266
No recombination of mtDNA after heteroplasmy for 50 generations in the mouse maternal germline
Hagström, Erik; Freyer, Christoph; Battersby, Brendan J.; Stewart, James B.; Larsson, Nils-Göran
2014-01-01
Variants of mitochondrial DNA (mtDNA) are commonly used as markers to track human evolution because of the high sequence divergence and exclusive maternal inheritance. It is assumed that the inheritance is clonal, i.e. that mtDNA is transmitted between generations without germline recombination. In contrast to this assumption, a number of studies have reported the presence of recombinant mtDNA molecules in cell lines and animal tissues, including humans. If germline recombination of mtDNA is frequent, it would strongly impact phylogenetic and population studies by altering estimates of coalescent time and branch lengths in phylogenetic trees. Unfortunately, this whole area is controversial and the experimental approaches have been widely criticized as they often depend on polymerase chain reaction (PCR) amplification of mtDNA and/or involve studies of transformed cell lines. In this study, we used an in vivo mouse model that has had germline heteroplasmy for a defined set of mtDNA mutations for more than 50 generations. To assess recombination, we adapted and validated a method based on cloning of single mtDNA molecules in the λ phage, without prior PCR amplification, followed by subsequent mutation analysis. We screened 2922 mtDNA molecules and found no germline recombination after transmission of mtDNA under genetically and evolutionary relevant conditions in mammals. PMID:24163253
DeRocco, Vanessa; Anderson, Trevor; Piehler, Jacob; Erie, Dorothy A; Weninger, Keith
2010-11-01
To enable studies of conformational changes within multimolecular complexes, we present a simultaneous, four-color single molecule fluorescence methodology implemented with total internal reflection illumination and camera-based, wide-field detection. We further demonstrate labeling histidine-tagged proteins noncovalently with Tris-nitrilotriacetic acid (Tris-NTA)-conjugated dyes to achieve single molecule detection. We combine these methods to colocalize the mismatch repair protein MutSα on DNA while monitoring MutSα-induced DNA bending using Förster resonance energy transfer (FRET) and to monitor assembly of membrane-tethered SNARE protein complexes.
DeRocco, Vanessa C.; Anderson, Trevor; Piehler, Jacob; Erie, Dorothy A.; Weninger, Keith
2010-01-01
To allow studies of conformational changes within multi-molecular complexes, we present a simultaneous, 4-color single molecule fluorescence methodology implemented with total internal reflection illumination and camera based, wide-field detection. We further demonstrate labeling histidine-tagged proteins non-covalently with tris-Nitrilotriacetic acid (tris-NTA) conjugated dyes to achieve single molecule detection. We combine these methods to co-localize the mismatch repair protein MutSα on DNA while monitoring MutSα-induced DNA bending using Förster resonance energy transfer (FRET) and to monitor assembly of membrane-tethered SNARE protein complexes. PMID:21091445
Single DNA imaging and length quantification through a mobile phone microscope
NASA Astrophysics Data System (ADS)
Wei, Qingshan; Luo, Wei; Chiang, Samuel; Kappel, Tara; Mejia, Crystal; Tseng, Derek; Chan, Raymond Yan L.; Yan, Eddie; Qi, Hangfei; Shabbir, Faizan; Ozkan, Haydar; Feng, Steve; Ozcan, Aydogan
2016-03-01
The development of sensitive optical microscopy methods for the detection of single DNA molecules has become an active research area which cultivates various promising applications including point-of-care (POC) genetic testing and diagnostics. Direct visualization of individual DNA molecules usually relies on sophisticated optical microscopes that are mostly available in well-equipped laboratories. For POC DNA testing/detection, there is an increasing need for the development of new single DNA imaging and sensing methods that are field-portable, cost-effective, and accessible for diagnostic applications in resource-limited or field-settings. For this aim, we developed a mobile-phone integrated fluorescence microscopy platform that allows imaging and sizing of single DNA molecules that are stretched on a chip. This handheld device contains an opto-mechanical attachment integrated onto a smartphone camera module, which creates a high signal-to-noise ratio dark-field imaging condition by using an oblique illumination/excitation configuration. Using this device, we demonstrated imaging of individual linearly stretched λ DNA molecules (48 kilobase-pair, kbp) over 2 mm2 field-of-view. We further developed a robust computational algorithm and a smartphone app that allowed the users to quickly quantify the length of each DNA fragment imaged using this mobile interface. The cellphone based device was tested by five different DNA samples (5, 10, 20, 40, and 48 kbp), and a sizing accuracy of <1 kbp was demonstrated for DNA strands longer than 10 kbp. This mobile DNA imaging and sizing platform can be very useful for various diagnostic applications including the detection of disease-specific genes and quantification of copy-number-variations at POC settings.
Zhu, Longjiao; Shao, Xiangli; Luo, Yunbo; Huang, Kunlung; Xu, Wentao
2017-05-19
A two-way colorimetric biosensor based on unmodified gold nanoparticles (GNPs) and a switchable double-stranded DNA (dsDNA) concatemer have been demonstrated. Two hairpin probes (H1 and H2) were first designed that provided the fuels to assemble the dsDNA concatemers via hybridization chain reaction (HCR). A functional hairpin (FH) was rationally designed to recognize the target sequences. All the hairpins contained a single-stranded DNA (ssDNA) loop and sticky end to prevent GNPs from salt-induced aggregation. In the presence of target sequence, the capture probe blocked in the FH recognizes the target to form a duplex DNA, which causes the release of the initiator probe by FH conformational change. This process then starts the alternate-opening of H1 and H2 through HCR, and dsDNA concatemers grow from the target sequence. As a result, unmodified GNPs undergo salt-induced aggregation because the formed dsDNA concatemers are stiffer and provide less stabilization. A light purple-to-blue color variation was observed in the bulk solution, termed the light-off sensing way. Furthermore, H1 ingeniously inserted an aptamer sequence to generate dsDNA concatemers with multiple small molecule binding sites. In the presence of small molecule targets, concatemers can be disassembled into mixtures with ssDNA sticky ends. A blue-to-purple reverse color variation was observed due to the regeneration of the ssDNA, termed the light-on way. The two-way biosensor can detect both nucleic acids and small molecule targets with one sensing device. This switchable sensing element is label-free, enzyme-free, and sophisticated-instrumentation-free. The detection limits of both targets were below nanomolar.
Synthesis and Properties of Size-expanded DNAs: Toward Designed, Functional Genetic Systems
Krueger, Andrew T.; Lu, Haige; Lee, Alex H. F.; Kool, Eric T.
2008-01-01
We describe the design, synthesis, and properties of DNA-like molecules in which the base pairs are expanded by benzo homologation. The resulting size-expanded genetic helices are called xDNA (“expanded DNA”) and yDNA (“wide DNA”). The large component bases are fluorescent, and they display high stacking affinity. When singly substituted into natural DNA, they are destabilizing because the benzo-expanded base pair size is too large for the natural helix. However, when all base pairs are expanded, xDNA and yDNA form highly stable, sequence-selective double helices. The size-expanded DNAs are candidates for components of new, functioning genetic systems. In addition, the fluorescence of expanded DNA bases makes them potentially useful in probing nucleic acids. PMID:17309194
Single-molecule comparison of DNA Pol I activity with native and analog nucleotides
NASA Astrophysics Data System (ADS)
Gul, Osman; Olsen, Tivoli; Choi, Yongki; Corso, Brad; Weiss, Gregory; Collins, Philip
2014-03-01
DNA polymerases are critical enzymes for DNA replication, and because of their complex catalytic cycle they are excellent targets for investigation by single-molecule experimental techniques. Recently, we studied the Klenow fragment (KF) of DNA polymerase I using a label-free, electronic technique involving single KF molecules attached to carbon nanotube transistors. The electronic technique allowed long-duration monitoring of a single KF molecule while processing thousands of template strands. Processivity of up to 42 nucleotide bases was directly observed, and statistical analysis of the recordings determined key kinetic parameters for the enzyme's open and closed conformations. Subsequently, we have used the same technique to compare the incorporation of canonical nucleotides like dATP to analogs like 1-thio-2'-dATP. The analog had almost no affect on duration of the closed conformation, during which the nucleotide is incorporated. On the other hand, the analog increased the rate-limiting duration of the open conformation by almost 40%. We propose that the thiolated analog interferes with KF's recognition and binding, two key steps that determine its ensemble turnover rate.
Bio-recognitive photonics of a DNA-guided organic semiconductor
Back, Seung Hyuk; Park, Jin Hyuk; Cui, Chunzhi; Ahn, Dong June
2016-01-01
Incorporation of duplex DNA with higher molecular weights has attracted attention for a new opportunity towards a better organic light-emitting diode (OLED) capability. However, biological recognition by OLED materials is yet to be addressed. In this study, specific oligomeric DNA–DNA recognition is successfully achieved by tri (8-hydroxyquinoline) aluminium (Alq3), an organic semiconductor. Alq3 rods crystallized with guidance from single-strand DNA molecules show, strikingly, a unique distribution of the DNA molecules with a shape of an ‘inverted' hourglass. The crystal's luminescent intensity is enhanced by 1.6-fold upon recognition of the perfect-matched target DNA sequence, but not in the case of a single-base mismatched one. The DNA–DNA recognition forming double-helix structure is identified to occur only in the rod's outer periphery. This study opens up new opportunities of Alq3, one of the most widely used OLED materials, enabling biological recognition. PMID:26725969
Ramakrishnan, Saminathan; Krainer, Georg; Grundmeier, Guido; Schlierf, Michael; Keller, Adrian
2017-11-01
The stability of DNA origami nanostructures under various environmental conditions constitutes an important issue in numerous applications, including drug delivery, molecular sensing, and single-molecule biophysics. Here, the effect of Na + and Mg 2+ concentrations on DNA origami stability is investigated in the presence of urea and guanidinium chloride (GdmCl), two strong denaturants commonly employed in protein folding studies. While increasing concentrations of both cations stabilize the DNA origami nanostructures against urea denaturation, they are found to promote DNA origami denaturation by GdmCl. These inverse behaviors are rationalized by a salting-out of Gdm + to the hydrophobic DNA base stack. The effect of cation-induced DNA origami denaturation by GdmCl deserves consideration in the design of single-molecule studies and may potentially be exploited in future applications such as selective denaturation for purification purposes. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Tetrahelical monomolecular architecture of DNA: a new building block for nanotechnology.
Kankia, Besik
2014-06-12
DNA nanotechnology typically relies on Watson-Crick base pairing as both a recognition and structural element. This limits structural versatility and introduces errors during self-assembly of DNA. Guanine (G) quartet motifs show promise as an alternative to DNA duplexes, but the synthesis of long, precisely defined molecules is a significant challenge. Here we demonstrate a continuous tetrahelical DNA architecture capable of programmed self-assembly. We report that the homopolymer consisting of (G3T)3G3 monomeric units has the capability to fold into a monomolecular DNA tetrahelix with unprecedented speed and stability. For instance, in the presence of 1 mM K(+) ions the dimer, (G3T)2, folds readily and melts above 100 °C. These findings have the potential to revolutionize DNA nanotechnology by introducing fast and error-free self-assembly of long and extraordinarily stable molecules.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tamrin, Mohd Izzuddin Mohd; Turaev, Sherzod; Sembok, Tengku Mohd Tengku
There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes andmore » fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.« less
Weighted Watson-Crick automata
NASA Astrophysics Data System (ADS)
Tamrin, Mohd Izzuddin Mohd; Turaev, Sherzod; Sembok, Tengku Mohd Tengku
2014-07-01
There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.
Exact method for numerically analyzing a model of local denaturation in superhelically stressed DNA
NASA Astrophysics Data System (ADS)
Fye, Richard M.; Benham, Craig J.
1999-03-01
Local denaturation, the separation at specific sites of the two strands comprising the DNA double helix, is one of the most fundamental processes in biology, required to allow the base sequence to be read both in DNA transcription and in replication. In living organisms this process can be mediated by enzymes which regulate the amount of superhelical stress imposed on the DNA. We present a numerically exact technique for analyzing a model of denaturation in superhelically stressed DNA. This approach is capable of predicting the locations and extents of transition in circular superhelical DNA molecules of kilobase lengths and specified base pair sequences. It can also be used for closed loops of DNA which are typically found in vivo to be kilobases long. The analytic method consists of an integration over the DNA twist degrees of freedom followed by the introduction of auxiliary variables to decouple the remaining degrees of freedom, which allows the use of the transfer matrix method. The algorithm implementing our technique requires O(N2) operations and O(N) memory to analyze a DNA domain containing N base pairs. However, to analyze kilobase length DNA molecules it must be implemented in high precision floating point arithmetic. An accelerated algorithm is constructed by imposing an upper bound M on the number of base pairs that can simultaneously denature in a state. This accelerated algorithm requires O(MN) operations, and has an analytically bounded error. Sample calculations show that it achieves high accuracy (greater than 15 decimal digits) with relatively small values of M (M<0.05N) for kilobase length molecules under physiologically relevant conditions. Calculations are performed on the superhelical pBR322 DNA sequence to test the accuracy of the method. With no free parameters in the model, the locations and extents of local denaturation predicted by this analysis are in quantitatively precise agreement with in vitro experimental measurements. Calculations performed on the fructose-1,6-bisphosphatase gene sequence from yeast show that this approach can also accurately treat in vivo denaturation.
DNA-psoralen interaction: a single molecule experiment.
Rocha, M S; Viana, N B; Mesquita, O N
2004-11-15
By attaching one end of a single lambda-DNA molecule to a microscope coverslip and the other end to a polystyrene microsphere trapped by an optical tweezers, we can study the entropic elasticity of the lambda-DNA by measuring force versus extension as we stretch the molecule. This powerful method permits single molecule studies. We are particularly interested in the effects of the photosensitive drug psoralen on the elasticity of the DNA molecule. We have illuminated the sample with different light sources, studying how the different wavelengths affect the psoralen-DNA linkage. To do this, we measure the persistence length of individual DNA-psoralen complexes.
DNA of a Human Hepatitis B Virus Candidate
Robinson, William S.; Clayton, David A.; Greenman, Richard L.
1974-01-01
Particles containing DNA polymerase (Dane particles) were purified from the plasma of chronic carriers of hepatitis B antigen. After a DNA polymerase reaction with purified Dane particle preparations treated with Nonidet P-40 detergent, Dane particle core structures containing radioactive DNA product were isolated by sedimentation in a sucrose density gradient. The radioactive DNA was extracted with sodium dodecyl sulfate and isolated by band sedimentation in a preformed CsCl gradient. Examination of the radioactive DNA band by electron microscopy revealed exclusively circular double-stranded DNA molecules approximately 0.78 μm in length. Identical circular molecules were observed when DNA was isolated by a similar procedure from particles that had not undergone a DNA polymerase reaction. The molecules were completely degraded by DNase 1. When Dane particle core structures were treated with DNase 1 before DNA extraction, only 0.78-μm circular DNA molecules were detected. Without DNase treatment of core structures, linear molecules with lengths between 0.5 and 12 μm, in addition to the 0.78-μm circles were found. These results suggest that the 0.78-μm circular molecules were in a protected position within Dane particle cores and the linear molecules were not within core structures. Length measurements on 225 circular molecules revealed a mean length of 0.78 ± 0.09 μm which would correspond to a molecular weight of around 1.6 × 106. The circular molecules probably serve as primer-template for the DNA polymerase reaction carried out by Dane particle cores. Thermal denaturation and buoyant density measurements on the Dane particle DNA polymerase reaction product revealed a guanosine plus cytosine content of 48 to 49%. Images PMID:4847328
Subangstrom Measurements of Enzyme Function Using a Biological Nanopore, SPRNT.
Laszlo, A H; Derrrington, I M; Gundlach, J H
2017-01-01
Nanopores are emerging as new single-molecule tools in the study of enzymes. Based on the progress in nanopore sequencing of DNA, a tool called Single-molecule Picometer Resolution Nanopore Tweezers (SPRNT) was developed to measure the movement of enzymes along DNA in real time. In this new method, an enzyme is loaded onto a DNA (or RNA) molecule. A single-stranded DNA end of this complex is drawn into a nanopore by an electrostatic potential that is applied across the pore. The single-stranded DNA passes through the pore's constriction until the enzyme comes into contact with the pore. Further progression of the DNA through the pore is then controlled by the enzyme. An ion current that flows through the pore's constriction is modulated by the DNA in the constriction. Analysis of ion current changes reveals the advance of the DNA with high spatiotemporal precision, thereby providing a real-time record of the enzyme's activity. Using an engineered version of the protein nanopore MspA, SPRNT has spatial resolution as small as 40pm at millisecond timescales, while simultaneously providing the DNA's sequence within the enzyme. In this chapter, SPRNT is introduced and its extraordinary potential is exemplified using the helicase Hel308. Two distinct substates are observed for each one-nucleotide advance; one of these about half-nucleotide long steps is ATP dependent and the other is ATP independent. The spatiotemporal resolution of this low-cost single-molecule technique lifts the study of enzymes to a new level of precision, enabling exploration of hitherto unobservable enzyme dynamics in real time. © 2017 Elsevier Inc. All rights reserved.
The Incorporation of Ribonucleotides Induces Structural and Conformational Changes in DNA.
Meroni, Alice; Mentegari, Elisa; Crespan, Emmanuele; Muzi-Falconi, Marco; Lazzaro, Federico; Podestà, Alessandro
2017-10-03
Ribonucleotide incorporation is the most common error occurring during DNA replication. Cells have hence developed mechanisms to remove ribonucleotides from the genome and restore its integrity. Indeed, the persistence of ribonucleotides into DNA leads to severe consequences, such as genome instability and replication stress. Thus, it becomes important to understand the effects of ribonucleotides incorporation, starting from their impact on DNA structure and conformation. Here we present a systematic study of the effects of ribonucleotide incorporation into DNA molecules. We have developed, to our knowledge, a new method to efficiently synthesize long DNA molecules (hundreds of basepairs) containing ribonucleotides, which is based on a modified protocol for the polymerase chain reaction. By means of atomic force microscopy, we could therefore investigate the changes, upon ribonucleotide incorporation, of the structural and conformational properties of numerous DNA populations at the single-molecule level. Specifically, we characterized the scaling of the contour length with the number of basepairs and the scaling of the end-to-end distance with the curvilinear distance, the bending angle distribution, and the persistence length. Our results revealed that ribonucleotides affect DNA structure and conformation on scales that go well beyond the typical dimension of the single ribonucleotide. In particular, the presence of ribonucleotides induces a systematic shortening of the molecules, together with a decrease of the persistence length. Such structural changes are also likely to occur in vivo, where they could directly affect the downstream DNA transactions, as well as interfere with protein binding and recognition. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Development of Single-Stranded DNA Aptamers for Specific Bisphenol A Detection
Jo, Minjoung; Ahn, Ji-Young; Lee, Joohyung; Lee, Seram; Hong, Sun Woo; Yoo, Jae-Wook; Kang, Jeehye; Dua, Pooja
2011-01-01
The development of reagents with high affinity and specificity to small molecules is crucial for the high-throughput detection of chemical compounds, such as toxicants or pollutants. Aptamers are short and single-stranded (ss) oligonucleotides able to recognize target molecules with high affinity. Here, we report the selection of ssDNA aptamers that bind to Bisphenol A (BPA), an environmental hormone. Using SELEX process, we isolated high affinity aptamers to BPA from a 1015 random library of 60 mer ssDNAs. The selected aptamers bound specifically to BPA, but not to structurally similar molecules, such as Bisphenol B with one methyl group difference, or 4,4′-Bisphenol with 2 methyl groups difference. Using these aptamers, we developed an aptamer-based sol–gel biochip and detected BPA dissolved in water. This novel BPA aptamer-based detection can be further applied to the universal and high-specificity detection of small molecules. PMID:21413891
A dynamic bead-based microarray for parallel DNA detection
NASA Astrophysics Data System (ADS)
Sochol, R. D.; Casavant, B. P.; Dueck, M. E.; Lee, L. P.; Lin, L.
2011-05-01
A microfluidic system has been designed and constructed by means of micromachining processes to integrate both microfluidic mixing of mobile microbeads and hydrodynamic microbead arraying capabilities on a single chip to simultaneously detect multiple bio-molecules. The prototype system has four parallel reaction chambers, which include microchannels of 18 × 50 µm2 cross-sectional area and a microfluidic mixing section of 22 cm length. Parallel detection of multiple DNA oligonucleotide sequences was achieved via molecular beacon probes immobilized on polystyrene microbeads of 16 µm diameter. Experimental results show quantitative detection of three distinct DNA oligonucleotide sequences from the Hepatitis C viral (HCV) genome with single base-pair mismatch specificity. Our dynamic bead-based microarray offers an effective microfluidic platform to increase parallelization of reactions and improve microbead handling for various biological applications, including bio-molecule detection, medical diagnostics and drug screening.
Developing DNA nanotechnology using single-molecule fluorescence.
Tsukanov, Roman; Tomov, Toma E; Liber, Miran; Berger, Yaron; Nir, Eyal
2014-06-17
CONSPECTUS: An important effort in the DNA nanotechnology field is focused on the rational design and manufacture of molecular structures and dynamic devices made of DNA. As is the case for other technologies that deal with manipulation of matter, rational development requires high quality and informative feedback on the building blocks and final products. For DNA nanotechnology such feedback is typically provided by gel electrophoresis, atomic force microscopy (AFM), and transmission electron microscopy (TEM). These analytical tools provide excellent structural information; however, usually they do not provide high-resolution dynamic information. For the development of DNA-made dynamic devices such as machines, motors, robots, and computers this constitutes a major problem. Bulk-fluorescence techniques are capable of providing dynamic information, but because only ensemble averaged information is obtained, the technique may not adequately describe the dynamics in the context of complex DNA devices. The single-molecule fluorescence (SMF) technique offers a unique combination of capabilities that make it an excellent tool for guiding the development of DNA-made devices. The technique has been increasingly used in DNA nanotechnology, especially for the analysis of structure, dynamics, integrity, and operation of DNA-made devices; however, its capabilities are not yet sufficiently familiar to the community. The purpose of this Account is to demonstrate how different SMF tools can be utilized for the development of DNA devices and for structural dynamic investigation of biomolecules in general and DNA molecules in particular. Single-molecule diffusion-based Förster resonance energy transfer and alternating laser excitation (sm-FRET/ALEX) and immobilization-based total internal reflection fluorescence (TIRF) techniques are briefly described and demonstrated. To illustrate the many applications of SMF to DNA nanotechnology, examples of SMF studies of DNA hairpins and Holliday junctions and of the interactions of DNA strands with DNA origami and origami-related devices such as a DNA bipedal motor are provided. These examples demonstrate how SMF can be utilized for measurement of distances and conformational distributions and equilibrium and nonequilibrium kinetics, to monitor structural integrity and operation of DNA devices, and for isolation and investigation of minor subpopulations including malfunctioning and nonreactive devices. Utilization of a flow-cell to achieve measurements of dynamics with increased time resolution and for convenient and efficient operation of DNA devices is discussed briefly. We conclude by summarizing the various benefits provided by SMF for the development of DNA nanotechnology and suggest that the method can significantly assist in the design and manufacture and evaluation of operation of DNA devices.
Single-molecule optical genome mapping of a human HapMap and a colorectal cancer cell line.
Teo, Audrey S M; Verzotto, Davide; Yao, Fei; Nagarajan, Niranjan; Hillmer, Axel M
2015-01-01
Next-generation sequencing (NGS) technologies have changed our understanding of the variability of the human genome. However, the identification of genome structural variations based on NGS approaches with read lengths of 35-300 bases remains a challenge. Single-molecule optical mapping technologies allow the analysis of DNA molecules of up to 2 Mb and as such are suitable for the identification of large-scale genome structural variations, and for de novo genome assemblies when combined with short-read NGS data. Here we present optical mapping data for two human genomes: the HapMap cell line GM12878 and the colorectal cancer cell line HCT116. High molecular weight DNA was obtained by embedding GM12878 and HCT116 cells, respectively, in agarose plugs, followed by DNA extraction under mild conditions. Genomic DNA was digested with KpnI and 310,000 and 296,000 DNA molecules (≥ 150 kb and 10 restriction fragments), respectively, were analyzed per cell line using the Argus optical mapping system. Maps were aligned to the human reference by OPTIMA, a new glocal alignment method. Genome coverage of 6.8× and 5.7× was obtained, respectively; 2.9× and 1.7× more than the coverage obtained with previously available software. Optical mapping allows the resolution of large-scale structural variations of the genome, and the scaffold extension of NGS-based de novo assemblies. OPTIMA is an efficient new alignment method; our optical mapping data provide a resource for genome structure analyses of the human HapMap reference cell line GM12878, and the colorectal cancer cell line HCT116.
ERIC Educational Resources Information Center
Dimitrov, Valentin V.
2009-01-01
This work focuses on studying properties of DNA molecules and DNA-protein interactions using synthetic nanopores, and it examines the prospects of sequencing DNA using synthetic nanopores. We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. There exists…
Identifying single bases in a DNA oligomer with electron tunnelling.
Huang, Shuo; He, Jin; Chang, Shuai; Zhang, Peiming; Liang, Feng; Li, Shengqin; Tuchband, Michael; Fuhrmann, Alexander; Ros, Robert; Lindsay, Stuart
2010-12-01
It has been proposed that single molecules of DNA could be sequenced by measuring the physical properties of the bases as they pass through a nanopore. Theoretical calculations suggest that electron tunnelling can identify bases in single-stranded DNA without enzymatic processing, and it was recently experimentally shown that tunnelling can sense individual nucleotides and nucleosides. Here, we report that tunnelling electrodes functionalized with recognition reagents can identify a single base flanked by other bases in short DNA oligomers. The residence time of a single base in a recognition junction is on the order of a second, but pulling the DNA through the junction with a force of tens of piconewtons would yield reading speeds of tens of bases per second.
Hou, Sen; Sun, Lili; Wieczorek, Stefan A; Kalwarczyk, Tomasz; Kaminski, Tomasz S; Holyst, Robert
2014-01-15
Fluorescent double-stranded DNA (dsDNA) molecules labeled at both ends are commonly produced by annealing of complementary single-stranded DNA (ssDNA) molecules, labeled with fluorescent dyes at the same (3' or 5') end. Because the labeling efficiency of ssDNA is smaller than 100%, the resulting dsDNA have two, one or are without a dye. Existing methods are insufficient to measure the percentage of the doubly-labeled dsDNA component in the fluorescent DNA sample and it is even difficult to distinguish the doubly-labeled DNA component from the singly-labeled component. Accurate measurement of the percentage of such doubly labeled dsDNA component is a critical prerequisite for quantitative biochemical measurements, which has puzzled scientists for decades. We established a fluorescence correlation spectroscopy (FCS) system to measure the percentage of doubly labeled dsDNA (PDL) in the total fluorescent dsDNA pool. The method is based on comparative analysis of the given sample and a reference dsDNA sample prepared by adding certain amount of unlabeled ssDNA into the original ssDNA solution. From FCS autocorrelation functions, we obtain the number of fluorescent dsDNA molecules in the focal volume of the confocal microscope and PDL. We also calculate the labeling efficiency of ssDNA. The method requires minimal amount of material. The samples have the concentration of DNA in the nano-molar/L range and the volume of tens of microliters. We verify our method by using restriction enzyme Hind III to cleave the fluorescent dsDNA. The kinetics of the reaction depends strongly on PDL, a critical parameter for quantitative biochemical measurements. Copyright © 2013 Elsevier B.V. All rights reserved.
Probe DNA-Cisplatin Interaction with Solid-State Nanopores
NASA Astrophysics Data System (ADS)
Zhou, Zhi; Hu, Ying; Li, Wei; Xu, Zhi; Wang, Pengye; Bai, Xuedong; Shan, Xinyan; Lu, Xinghua; Nanopore Collaboration
2014-03-01
Understanding the mechanism of DNA-cisplatin interaction is essential for clinical application and novel drug design. As an emerging single-molecule technology, solid-state nanopore has been employed in biomolecule detection and probing DNA-molecule interactions. Herein, we reported a real-time monitoring of DNA-cisplatin interaction by employing solid-state SiN nanopores. The DNA-cisplatin interacting process is clearly classified into three stages by measuring the capture rate of DNA-cisplatin adducts. In the first stage, the negative charged DNA molecules were partially discharged due to the bonding of positive charged cisplatin and forming of mono-adducts. In the second stage, forming of DNA-cisplatin di-adducts with the adjacent bases results in DNA bending and softening. The capture rate increases since the softened bi-adducts experience a lower barrier to thread into the nanopores. In the third stage, complex structures, such as micro-loop, are formed and the DNA-cisplatin adducts are aggregated. The capture rate decreases to zero as the aggregated adduct grows to the size of the pore. The characteristic time of this stage was found to be linear with the diameter of the nanopore and this dynamic process can be described with a second-order reaction model. We are grateful to Laboratory of Microfabrication, Dr. Y. Yao, and Prof. R.C. Yu (Institute of Physics, Chinese Academy of Sciences) for technical assistance.
NASA Astrophysics Data System (ADS)
Li, Xiang; Ding, Xuelian; Li, Yongfang; Wang, Linsong; Fan, Jing
2016-05-01
Development of new strategies for the sensitive and selective detection of ultra-low concentrations of specific cancer markers is of great importance for assessing cancer therapeutics due to its crucial role in early clinical diagnoses and biomedical applications. In this work, we have developed two types of fluorescence polarization (FP) amplification assay strategies for the detection of biomolecules by using TiS2 as a FP enhancer and Zn2+-dependent self-hydrolyzing deoxyribozymes as catalysts to realize enzyme-catalyzed target-recycling signal amplification. One approach is based on the terminal protection of small-molecule-linked DNA, in which biomolecular binding to small molecules in DNA-small-molecule chimeras can protect the conjugated DNA from degradation by exonuclease I (Exo I); the other approach is based on the terminal protection of biomolecular bound aptamer DNA, in which biomolecules directly bound to the single strand aptamer DNA can protect the ssDNA from degradation by Exo I. We select folate receptor (FR) and thrombin (Tb) as model analytes to verify the current concept. It is shown that under optimized conditions, our strategies exhibit high sensitivity and selectivity for the quantification of FR and Tb with low detection limits (0.003 ng mL-1 and 0.01 pM, respectively). Additionally, this strategy is a simple ``mix and detect'' approach, and does not require any separation steps. This biosensor is also utilized in the analysis of real biological samples, the results agree well with those obtained by the enzyme-linked immunosorbent assay (ELISA).Development of new strategies for the sensitive and selective detection of ultra-low concentrations of specific cancer markers is of great importance for assessing cancer therapeutics due to its crucial role in early clinical diagnoses and biomedical applications. In this work, we have developed two types of fluorescence polarization (FP) amplification assay strategies for the detection of biomolecules by using TiS2 as a FP enhancer and Zn2+-dependent self-hydrolyzing deoxyribozymes as catalysts to realize enzyme-catalyzed target-recycling signal amplification. One approach is based on the terminal protection of small-molecule-linked DNA, in which biomolecular binding to small molecules in DNA-small-molecule chimeras can protect the conjugated DNA from degradation by exonuclease I (Exo I); the other approach is based on the terminal protection of biomolecular bound aptamer DNA, in which biomolecules directly bound to the single strand aptamer DNA can protect the ssDNA from degradation by Exo I. We select folate receptor (FR) and thrombin (Tb) as model analytes to verify the current concept. It is shown that under optimized conditions, our strategies exhibit high sensitivity and selectivity for the quantification of FR and Tb with low detection limits (0.003 ng mL-1 and 0.01 pM, respectively). Additionally, this strategy is a simple ``mix and detect'' approach, and does not require any separation steps. This biosensor is also utilized in the analysis of real biological samples, the results agree well with those obtained by the enzyme-linked immunosorbent assay (ELISA). Electronic supplementary information (ESI) available: Tables S1-S4, Scheme S1, Fig. S1-S10. See DOI: 10.1039/c6nr00946h
The unusual and dynamic character of PX-DNA
Niu, Dong; Jiang, Hualin; Sha, Ruojie; ...
2015-07-15
PX-DNA is a four-stranded DNA structure that has been implicated in the recognition of homology, either continuously, or in an every-other-half-turn fashion. Some of the structural features of the molecule have been noted previously, but the structure requires further characterization. Here, we report atomic force microscopic characterization of PX molecules that contain periodically placed biotin groups, enabling the molecule to be labeled by streptavidin molecules at these sites. In comparison with conventional double stranded DNA and with antiparallel DNA double crossover molecules, it is clear that PX-DNA is a more dynamic structure. Moreover, the spacing between the nucleotide pairs alongmore » the helix axis is shorter, suggesting a mixed B/A structure. Circular dichroism spectroscopy indicates unusual features in the PX molecule that are absent in both the molecules to which it is compared.« less
Optoelectronic studies on heterocyclic bases of deoxyribonucleic acid for DNA photonics.
El-Diasty, Fouad; Abdel-Wahab, Fathy
2015-10-01
The optoelectronics study of large molecules, particularly π-stacking molecules, such as DNA is really an extremely difficult task. We perform first electronic structure calculations on the heterocyclic bases of 2'-deoxyribonucleic acid based on Lorentz-Fresnel dispersion theory. In the UV-VIS range of spectrum, many of the optoelectronic parameters for DNA four bases namely adenine, guanine, cytosine and thymine are calculated and discussed. The results demonstrate that adenine has the highest hyperpolarizability, whereas thymine has the lowest hyperpolarizability. Cytosine has the lower average oscillator energy and the higher lattice energy. Thymine infers the most stable nucleic base with the lower phonon energy. Thymine also has the highest average oscillator energy and the lower lattice energy. Moreover, the four nucleic acid bases have large band gap energies less than 5 eV with a semiconducting behavior. Guanine shows the smallest band gap and the highest Fermi level energy, whereas adenine elucidates the highest band gap energy. Copyright © 2015. Published by Elsevier B.V.
The use of carrier RNA to enhance DNA extraction from microfluidic-based silica monoliths.
Shaw, Kirsty J; Thain, Lauren; Docker, Peter T; Dyer, Charlotte E; Greenman, John; Greenway, Gillian M; Haswell, Stephen J
2009-10-12
DNA extraction was carried out on silica-based monoliths within a microfluidic device. Solid-phase DNA extraction methodology was applied in which the DNA binds to silica in the presence of a chaotropic salt, such as guanidine hydrochloride, and is eluted in a low ionic strength solution, such as water. The addition of poly-A carrier RNA to the chaotropic salt solution resulted in a marked increase in the effective amount of DNA that could be recovered (25ng) compared to the absence of RNA (5ng) using the silica-based monolith. These findings confirm that techniques utilising nucleic acid carrier molecules can enhance DNA extraction methodologies in microfluidic applications.
Visualization of yeast chromosomal DNA
NASA Technical Reports Server (NTRS)
Lubega, Seth
1990-01-01
The DNA molecule is the most significant life molecule since it codes the blue print for other structural and functional molecules of all living organisms. Agarose gel electrophoresis is now being widely used to separate DNA of virus, bacteria, and lower eukaryotes. The task was undertaken of reviewing the existing methods of DNA fractionation and microscopic visualization of individual chromosonal DNA molecules by gel electrophoresis as a basis for a proposed study to investigate the feasibility of separating DNA molecules in free fluids as an alternative to gel electrophoresis. Various techniques were studied. On the molecular level, agarose gel electrophoresis is being widely used to separate chromosomal DNA according to molecular weight. Carl and Olson separate and characterized the entire karyotype of a lab strain of Saccharomyces cerevisiae. Smith et al. and Schwartz and Koval independently reported the visualization of individual DNA molecules migrating through agarose gel matrix during electrophoresis. The techniques used by these researchers are being reviewed in the lab as a basis for the proposed studies.
Carbon Nanotube Biosensors for Space Molecule Detection and Clinical Molecular Diagnostics
NASA Technical Reports Server (NTRS)
Han, Jie
2001-01-01
Both space molecule detection and clinical molecule diagnostics need to develop ultra sensitive biosensors for detection of less than attomole molecules such as amino acids for DNA. However all the electrode sensor systems including those fabricated from the existing carbon nanotubes, have a background level of nA (nanoAmp). This has limited DNA or other molecule detection to nA level or molecules whose concentration is, much higher than attomole level. A program has been created by NASA and NCI (National Cancer Institute) to exploit the possibility of carbon nanotube based biosensors to solve this problem for both's interest. In this talk, I will present our effort on the evaluation and novel design of carbon nanotubes as electrode biosensors with strategies to minimize background currents while maximizing signal intensity.The fabrication of nanotube electrode arrays, immobilization of molecular probes on nanotube electrodes and in vitro biosensor testing will also be discussed.
Single Molecule Enzymology via Nanoelectronic Circuits
NASA Astrophysics Data System (ADS)
Collins, Philip
Traditional single-molecule techniques rely on fluorescence or force transduction to monitor conformational changes and biochemical activity. Recent demonstrations of single-molecule monitoring with electronic transistors are poised to add to the single-molecule research toolkit. The transistor-based technique is sensitive to the motion of single charged side chain residues and can transduce those motions with microsecond resolution, opening the doors to single-molecule enzymology with unprecedented resolution. Furthermore, the solid-state platform provides opportunities for parallelization in arrays and long-duration monitoring of one molecule's activity or processivity, all without the limitations caused by photo-oxidation or mutagenic fluorophore incorporation. This presentation will review some of these advantages and their particular application to DNA polymerase I processing single-stranded DNA templates. This research was supported financially by the NIH NCI (R01 CA133592-01), the NIH NIGMS (1R01GM106957-01) and the NSF (DMR-1104629 and ECCS-1231910).
Simulation studies of DNA at the nanoscale: Interactions with proteins, polycations, and surfaces
NASA Astrophysics Data System (ADS)
Elder, Robert M.
Understanding the nanoscale interactions of DNA, a multifunctional biopolymer with sequence-dependent properties, with other biological and synthetic substrates and molecules is essential to advancing these technologies. This doctoral thesis research is aimed at understanding the thermodynamics and molecular-level structure when DNA interacts with proteins, polycations, and functionalized surfaces. First, we investigate the ability of a DNA damage recognition protein (HMGB1a) to bind to anti-cancer drug-induced DNA damage, seeking to explain how HMGB1a differentiates between the drugs in vivo. Using atomistic molecular dynamics simulations, we show that the structure of the drug-DNA molecule exhibits drug- and base sequence-dependence that explains some of the experimentally observed differential recognition of the drugs in various sequence contexts. Then, we show how steric hindrance from the drug decreases the deformability of the drug-DNA molecule, which decreases recognition by the protein, a concept that can be applied to rational drug design. Second, we study how polycation architecture and chemistry affect polycation-DNA binding so as to design optimal polycations for high efficiency gene (DNA) delivery. Using a multiscale computational approach involving atomistic and coarse-grained simulations, we examine how rearranging polylysine from a linear to a grafted architecture, and several aspects of the grafted architecture, affect polycation-DNA binding and the structure of polycation-DNA complexes. Next, going beyond lysine we examine how oligopeptide chemistry and sequence in the grafted architecture affects polycation-DNA binding and find that strategic placement of hydrophobic peptides might be used to tailor binding strength. Third, we study the adsorption and conformations of single-stranded DNA (an amphiphilic biopolymer) on model hydrophilic and hydrophobic surfaces. Short ssDNA oligomers adsorb to both surfaces with similar strength, with the strength of adsorption to the hydrophobic surface depending on the composition of the DNA strands, i.e. purine or pyrimidine bases. Additionally, DNA-surface and DNA-water interactions near the surfaces govern the adsorption. For longer ssDNA oligomers, the effects of surface chemistry and temperature on ssDNA conformations are rather small, but either the hydrophilic surface or increased temperature favor slightly more compact conformations due to energetic and entropic effects, respectively.
Transformation of Escherichia coli with large DNA molecules by electroporation.
Sheng, Y; Mancino, V; Birren, B
1995-01-01
We have examined bacterial electroporation with a specific interest in the transformation of large DNA, i.e. molecules > 100 kb. We have used DNA from bacterial artificial chromosomes (BACs) ranging from 7 to 240 kb, as well as BAC ligation mixes containing a range o different sized molecules. The efficiency of electroporation with large DNA is strongly dependent on the strain of Escherichia coli used; strains which offer comparable efficiencies for 7 kb molecules differ in their uptake of 240 kb DNA by as much as 30-fold. Even with a host strain that transforms relatively well with large DNA, transformation efficiency drops dramatically with increasing size of the DNA. Molecules of 240 kb transform approximately 30-fold less well, on a molar basis, than molecules of 80 kb. Maximum transformation of large DNA occurs with different voltage gradients and with different time constants than are optimal for smaller DNA. This provides the opportunity to increase the yield of transformants which have taken up large DNA relative to the number incorporating smaller molecules. We have demonstrated that conditions may be selected which increase the average size of BAC clones generated by electroporation and compare the overall efficiency of each of the conditions tested. Images PMID:7596828
The study of electrical conductivity of DNA molecules by scanning tunneling spectroscopy
NASA Astrophysics Data System (ADS)
Sharipov, T. I.; Bakhtizin, R. Z.
2017-10-01
An interest to the processes of charge transport in DNA molecules is very high, due to perspective of their using in nanoelectronics. The original sample preparation for studying electrical conductivity of DNA molecules by scanning tunneling spectroscopy has been proposed and tested. The DNA molecules immobilized on gold surface have been imaged clearly and their current-voltage curves have been measured.
A universal DNA-based protein detection system.
Tran, Thua N N; Cui, Jinhui; Hartman, Mark R; Peng, Songming; Funabashi, Hisakage; Duan, Faping; Yang, Dayong; March, John C; Lis, John T; Cui, Haixin; Luo, Dan
2013-09-25
Protein immune detection requires secondary antibodies which must be carefully selected in order to avoid interspecies cross-reactivity, and is therefore restricted by the limited availability of primary/secondary antibody pairs. Here we present a versatile DNA-based protein detection system using a universal adapter to interface between IgG antibodies and DNA-modified reporter molecules. As a demonstration of this capability, we successfully used DNA nano-barcodes, quantum dots, and horseradish peroxidase enzyme to detect multiple proteins using our DNA-based labeling system. Our system not only eliminates secondary antibodies but also serves as a novel method platform for protein detection with modularity, high capacity, and multiplexed capability.
A Universal DNA-Based Protein Detection System
Tran, Thua N. N.; Cui, Jinhui; Hartman, Mark R.; Peng, Songming; Funabashi, Hisakage; Duan, Faping; Yang, Dayong; March, John C.; Lis, John T.; Cui, Haixin; Luo, Dan
2014-01-01
Protein immune detection requires secondary antibodies which must be carefully selected in order to avoid interspecies cross-reactivity, and is therefore restricted by the limited availability of primary/secondary antibody pairs. Here we present a versatile DNA-based protein detection system using a universal adapter to interface between IgG antibodies and DNA-modified reporter molecules. As a demonstration of this capability, we successfully used DNA nano-barcodes, quantum dots, and horseradish peroxidase enzyme to detect multiple proteins using our DNA-based labeling system. Our system not only eliminates secondary antibodies but also serves as a novel method platform for protein detection with modularity, high capacity, and multiplexed capability. PMID:23978265
Another expert system rule inference based on DNA molecule logic gates
NASA Astrophysics Data System (ADS)
WÄ siewicz, Piotr
2013-10-01
With the help of silicon industry microfluidic processors were invented utilizing nano membrane valves, pumps and microreactors. These so called lab-on-a-chips combined together with molecular computing create molecular-systems-ona- chips. This work presents a new approach to implementation of molecular inference systems. It requires the unique representation of signals by DNA molecules. The main part of this work includes the concept of logic gates based on typical genetic engineering reactions. The presented method allows for constructing logic gates with many inputs and for executing them at the same quantity of elementary operations, regardless of a number of input signals. Every microreactor of the lab-on-a-chip performs one unique operation on input molecules and can be connected by dataflow output-input connections to other ones.
Zhang, Wei Yun; Zhang, Wenhua; Liu, Zhiyuan; Li, Cong; Zhu, Zhi; Yang, Chaoyong James
2012-01-03
We have developed a novel method for efficiently screening affinity ligands (aptamers) from a complex single-stranded DNA (ssDNA) library by employing single-molecule emulsion polymerase chain reaction (PCR) based on the agarose droplet microfluidic technology. In a typical systematic evolution of ligands by exponential enrichment (SELEX) process, the enriched library is sequenced first, and tens to hundreds of aptamer candidates are analyzed via a bioinformatic approach. Possible candidates are then chemically synthesized, and their binding affinities are measured individually. Such a process is time-consuming, labor-intensive, inefficient, and expensive. To address these problems, we have developed a highly efficient single-molecule approach for aptamer screening using our agarose droplet microfluidic technology. Statistically diluted ssDNA of the pre-enriched library evolved through conventional SELEX against cancer biomarker Shp2 protein was encapsulated into individual uniform agarose droplets for droplet PCR to generate clonal agarose beads. The binding capacity of amplified ssDNA from each clonal bead was then screened via high-throughput fluorescence cytometry. DNA clones with high binding capacity and low K(d) were chosen as the aptamer and can be directly used for downstream biomedical applications. We have identified an ssDNA aptamer that selectively recognizes Shp2 with a K(d) of 24.9 nM. Compared to a conventional sequencing-chemical synthesis-screening work flow, our approach avoids large-scale DNA sequencing and expensive, time-consuming DNA synthesis of large populations of DNA candidates. The agarose droplet microfluidic approach is thus highly efficient and cost-effective for molecular evolution approaches and will find wide application in molecular evolution technologies, including mRNA display, phage display, and so on. © 2011 American Chemical Society
How to measure separations and angles between intra-molecular fluorescent markers
NASA Astrophysics Data System (ADS)
Flyvbjerg, Henrik; Mortensen, Kim I.; Sung, Jongmin; Spudich, James A.
We demonstrate a novel, yet simple tool for the study of structure and function of biomolecules by extending two-colour co-localization microscopy to fluorescent molecules with fixed orientations and in intra-molecular proximity. From each color-separated microscope image in a time-lapse movie and using only simple means, we simultaneously determine both the relative (x,y)-separation of the fluorophores and their individual orientations in space with accuracy and precision. The positions and orientations of two domains of the same molecule are thus time-resolved. Using short double-stranded DNA molecules internally labelled with two fixed fluorophores, we demonstrate the accuracy and precision of our method using the known structure of double-stranded DNA as a benchmark, resolve 10-base-pair differences in fluorophore separations, and determine the unique 3D orientation of each DNA molecule, thereby establishing short, double-labelled DNA molecules as probes of 3D orientation of anything to which one can attach them firmly. This work was supported by a Lundbeck fellowship to K.I.M; a Stanford Bio-X fellowship to J.S. and Grants from the NIH (GM33289) to J.A.S. and the Human Frontier Science Program (GP0054/2009-C) to J.A.S. and H.F.
Single-Molecule Interactions of a Monoclonal Anti-DNA Antibody with DNA
Nevzorova, Tatiana A.; Zhao, Qingze; Lomakin, Yakov A.; Ponomareva, Anastasia A.; Mukhitov, Alexander R.; Purohit, Prashant K.; Weisel, John W.; Litvinov, Rustem I.
2017-01-01
Interactions of DNA with proteins are essential for key biological processes and have both a fundamental and practical significance. In particular, DNA binding to anti-DNA antibodies is a pathogenic mechanism in autoimmune pathology, such as systemic lupus erythematosus. Here we measured at the single-molecule level binding and forced unbinding of surface-attached DNA and a monoclonal anti-DNA antibody MRL4 from a lupus erythematosus mouse. In optical trap-based force spectroscopy, a microscopic antibodycoated latex bead is trapped by a focused laser beam and repeatedly brought into contact with a DNA-coated surface. After careful discrimination of non-specific interactions, we showed that the DNA-antibody rupture force spectra had two regimes, reflecting formation of weaker (20–40 pN) and stronger (>40 pN) immune complexes that implies the existence of at least two bound states with different mechanical stability. The two-dimensional force-free off-rate for the DNA-antibody complexes was ~2.2 × 10−3 s−1, the transition state distance was ~0.94 nm, the apparent on-rate was ~5.26 s−1, and the stiffness of the DNA-antibody complex was characterized by a spring constant of 0.0021 pN/nm, suggesting that the DNA-antibody complex is a relatively stable, but soft and deformable macromolecular structure. The stretching elasticity of the DNA molecules was characteristic of single-stranded DNA, suggesting preferential binding of the MRL4 antibody to one strand of DNA. Collectively, the results provide fundamental characteristics of formation and forced dissociation of DNA-antibody complexes that help to understand principles of DNA-protein interactions and shed light on the molecular basis of autoimmune diseases accompanied by formation of anti-DNA antibodies. PMID:29104846
Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias
2013-09-24
Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp.
Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias
2013-01-01
Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp. PMID:24019490
Conformation-dependent DNA attraction
NASA Astrophysics Data System (ADS)
Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang
2014-05-01
Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg2+ ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg2+ or Na+, benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg2+ bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg2+ ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg2+ or Na+, benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg2+ bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription. Electronic supplementary information (ESI) available. See DOI: 10.1039/c3nr03235c
Robinson, Clifford R.; Sligar, Stephen G.
1998-01-01
Restriction endonucleases such as EcoRI bind and cleave DNA with great specificity and represent a paradigm for protein–DNA interactions and molecular recognition. Using osmotic pressure to induce water release, we demonstrate the participation of bound waters in the sequence discrimination of substrate DNA by EcoRI. Changes in solvation can play a critical role in directing sequence-specific DNA binding by EcoRI and are also crucial in assisting site discrimination during catalysis. By measuring the volume change for complex formation, we show that at the cognate sequence (GAATTC) EcoRI binding releases about 70 fewer water molecules than binding at an alternate DNA sequence (TAATTC), which differs by a single base pair. EcoRI complexation with nonspecific DNA releases substantially less water than either of these specific complexes. In cognate substrates (GAATTC) kcat decreases as osmotic pressure is increased, indicating the binding of about 30 water molecules accompanies the cleavage reaction. For the alternate substrate (TAATTC), release of about 40 water molecules accompanies the reaction, indicated by a dramatic acceleration of the rate when osmotic pressure is raised. These large differences in solvation effects demonstrate that water molecules can be key players in the molecular recognition process during both association and catalytic phases of the EcoRI reaction, acting to change the specificity of the enzyme. For both the protein–DNA complex and the transition state, there may be substantial conformational differences between cognate and alternate sites, accompanied by significant alterations in hydration and solvent accessibility. PMID:9482860
Recent patents of nanopore DNA sequencing technology: progress and challenges.
Zhou, Jianfeng; Xu, Bingqian
2010-11-01
DNA sequencing techniques witnessed fast development in the last decades, primarily driven by the Human Genome Project. Among the proposed new techniques, Nanopore was considered as a suitable candidate for the single DNA sequencing with ultrahigh speed and very low cost. Several fabrication and modification techniques have been developed to produce robust and well-defined nanopore devices. Many efforts have also been done to apply nanopore to analyze the properties of DNA molecules. By comparing with traditional sequencing techniques, nanopore has demonstrated its distinctive superiorities in main practical issues, such as sample preparation, sequencing speed, cost-effective and read-length. Although challenges still remain, recent researches in improving the capabilities of nanopore have shed a light to achieve its ultimate goal: Sequence individual DNA strand at single nucleotide level. This patent review briefly highlights recent developments and technological achievements for DNA analysis and sequencing at single molecule level, focusing on nanopore based methods.
Schaffert, David H; Okholm, Anders H; Sørensen, Rasmus S; Nielsen, Jesper S; Tørring, Thomas; Rosen, Christian B; Kodal, Anne Louise B; Mortensen, Michael R; Gothelf, Kurt V; Kjems, Jørgen
2016-05-01
DNA origami provides rapid access to easily functionalized, nanometer-sized structures making it an intriguing platform for the development of defined drug delivery and sensor systems. Low cellular uptake of DNA nanostructures is a major obstacle in the development of DNA-based delivery platforms. Herein, significant strong increase in cellular uptake in an established cancer cell line by modifying a planar DNA origami structure with the iron transport protein transferrin (Tf) is demonstrated. A variable number of Tf molecules are coupled to the origami structure using a DNA-directed, site-selective labeling technique to retain ligand functionality. A combination of confocal fluorescence microscopy and quantitative (qPCR) techniques shows up to 22-fold increased cytoplasmic uptake compared to unmodified structures and with an efficiency that correlates to the number of transferrin molecules on the origami surface. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Samorì, Bruno; Zuccheri, Giampaolo
2005-02-11
The nanometer scale is a special place where all sciences meet and develop a particularly strong interdisciplinarity. While biology is a source of inspiration for nanoscientists, chemistry has a central role in turning inspirations and methods from biological systems to nanotechnological use. DNA is the biological molecule by which nanoscience and nanotechnology is mostly fascinated. Nature uses DNA not only as a repository of the genetic information, but also as a controller of the expression of the genes it contains. Thus, there are codes embedded in the DNA sequence that serve to control recognition processes on the atomic scale, such as the base pairing, and others that control processes taking place on the nanoscale. From the chemical point of view, DNA is the supramolecular building block with the highest informational content. Nanoscience has therefore the opportunity of using DNA molecules to increase the level of complexity and efficiency in self-assembling and self-directing processes.
DNA molecules on periodically microstructured lipid membranes: Localization and coil stretching
NASA Astrophysics Data System (ADS)
Hochrein, Marion B.; Leierseder, Judith A.; Golubović, Leonardo; Rädler, Joachim O.
2007-02-01
We explore large scale conformations of DNA molecules adsorbed on curved surfaces. For that purpose, we investigate the behavior of DNA adsorbed on periodically shaped cationic lipid membranes. These unique membrane morphologies are supported on grooved, one-dimensionally periodic microstructured surfaces. Strikingly, we find that these periodically structured membranes are capable to stretch DNA coils. We elucidate this phenomenon in terms of surface curvature dependent potential energy attained by the adsorbed DNA molecules. Due to it, DNA molecules undergo a localization transition causing them to stretch by binding to highly curved sections (edges) of the supported membranes. This effect provides a new venue for controlling conformations of semiflexible polymers such as DNA by employing their interactions with specially designed biocompatible surfaces. We report the first experimental observation of semiflexible polymers unbinding transition in which DNA molecules unbind from one-dimensional manifolds (edges) while remaining bound to two-dimensional manifolds (cationic membranes).
Observation of DNA Molecules Using Fluorescence Microscopy and Atomic Force Microscopy
ERIC Educational Resources Information Center
Ito, Takashi
2008-01-01
This article describes experiments for an undergraduate instrumental analysis laboratory that aim to observe individual double-stranded DNA (dsDNA) molecules using fluorescence microscopy and atomic force microscopy (AFM). dsDNA molecules are observed under several different conditions to discuss their chemical and physical properties. In…
Reaching the Ionic Current Detection Limit in Silicon-Based Nanopores
NASA Astrophysics Data System (ADS)
Puster, Matthew; Rodriguez-Manzo, Julio Alejandro; Nicolai, Adrien; Meunier, Vincent; Drndic, Marija
2015-03-01
Solid-state nanopores act as single-molecule sensors whereby passage of an individual molecule in aqueous electrolyte through a nanopore is registered as a change in ionic conductance (ΔG). Future nanopore applications such as DNA sequencing at high bandwidth require high ΔG for optimal signal-to-noise ratio. Reducing the nanopore diameter and thickness increase ΔG. Molecule size limits the diameter, thus efforts concentrate on minimizing the thickness by thinning oxide/nitride films or using 2D materials. Weighted by electrolyte conductivity the highest ΔG reported to date for DNA translocations were obtained with nanopores made in oxide/nitride films. We present a controlled electron irradiation technique to thin such films to the limit of their stability, producing nanopores tailored to molecule size in amorphous Si with thicknesses less than 2 nm. We compare ΔG values with results found in the literature for DNA translocation through these nanopores, where access resistance becomes comparable to the resistance through the nanopore itself.
Observing Holliday junction branch migration one step at a time
NASA Astrophysics Data System (ADS)
Ha, Taekjip
2004-03-01
During genetic recombination, two homologous DNA molecules undergo strand exchange to form a four-way DNA (Holliday) junction and the recognition and processing of this species by branch migration and junction resolving enzymes determine the outcome. We have used single molecule fluorescence techniques to study two intrinsic structural dynamics of the Holliday junction, stacking conformer transitions and spontaneous branch migration. Our studies show that the dynamics of branch migration, resolved with one base pair resolution, is determined by the stability of conformers which in turn depends on the local DNA sequences. Therefore, the energy landscape of Holliday junction branch migation is not uniform, but is rugged.
Dielectric dispersion for short double-strand DNA.
Omori, Shinji; Katsumoto, Yoichi; Yasuda, Akio; Asami, Koji
2006-05-01
A complex dielectric constant for double-strand DNA molecules with a length of not greater than 120 base pairs in an aqueous solution containing 30 mM NaCl was systematically measured as a function of chain length in such a way that experimental uncertainties associated with the molecular-weight distribution of specimens were virtually excluded. In contrast to the past experimental and theoretical studies for much longer DNA molecules, both the molar specific dielectric increment and the relaxation time are proportional to the chain length. These scaling rules cannot be accounted for by any theory so far proposed that gives analytical expressions for those two quantities in the long-chain limit.
The role of solitons on the tunneling magnetoresistance through a double-stranded DNA molecule
NASA Astrophysics Data System (ADS)
Ashhadi, M.
2018-07-01
We have studied the role of solitons on the spin-dependent transport properties of through a double-stranded DNA (dsDNA) molecule attached to two the semi-infinite ferromagnetic (FM) electrodes. The work is based on a tight-binding Hamiltonian model within the framework of a generalized Green's function technique and relies on the Landauer-Bütikker formalism as the basis for studying the current-voltage characteristic of this system. The conductance properties of the spin system are studied for a ladder model for poly (dG)-poly (dC) DNA molecule. Our calculations indicate that the presence of a homogeneous distribution of the solitons along the molecular, as a sublattice of the correlated solitons, gives rise to significant enhancement in the density of states within the bandgap and large enhancement in conductance and the current-voltage characteristic. It is also shown that tunnel magnetoresistance (TMR) decreases in compared with TMR obtained in the absence of solitons.
Domingues, William Borges; da Silveira, Tony Leandro Rezende; Komninou, Eliza Rossi; Monte, Leonardo Garcia; Remião, Mariana Härter; Dellagostin, Odir Antônio; Corcini, Carine Dahl; Varela Junior, Antônio Sergio; Seixas, Fabiana Kömmling; Collares, Tiago; Campos, Vinicius Farias
2017-08-01
Bovine sex-sorted sperm have been commercialized and successfully used for the production of transgenic embryos of the desired sex through the sperm-mediated gene transfer (SMGT) technique. However, sex-sorted sperm show a reduced ability to internalize exogenous DNA. The interaction between sperm cells and the exogenous DNA has been reported in other species to be a CD4-like molecule-dependent process. The flow cytometry-based sex-sorting process subjects the spermatozoa to different stresses causing changes in the cell membrane. The aim of this study was to elucidate the relationship between the redistribution of CD4-like molecules and binding of exogenous DNA to sex-sorted bovine sperm. In the first set of experiments, the membrane phospholipid disorder and the redistribution of the CD4 were evaluated. The second set of experiments was conducted to investigate the effect of CD4 redistribution on the mechanism of binding of exogenous DNA to sperm cells and the efficiency of lipofection in sex-sorted bovine sperm. Sex-sorting procedure increased the membrane phospholipid disorder and induced the redistribution of CD4-like molecules. Both X-sorted and Y-sorted sperm had decreased DNA bound to membrane in comparison with the unsorted sperm; however, the binding of the exogenous DNA was significantly increased with the addition of liposomes. Moreover, we demonstrated that the number of sperm-bound exogenous DNA was decreased when these cells were preincubated with anti-bovine CD4 monoclonal antibody, supporting our hypothesis that CD4-like molecules indeed play a crucial role in the process of exogenous DNA/bovine sperm cells interaction.
DNA interrogation by the CRISPR RNA-guided endonuclease Cas9.
Sternberg, Samuel H; Redding, Sy; Jinek, Martin; Greene, Eric C; Doudna, Jennifer A
2014-03-06
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.
DNA interrogation by the CRISPR RNA-guided endonuclease Cas9
NASA Astrophysics Data System (ADS)
Sternberg, Samuel H.; Redding, Sy; Jinek, Martin; Greene, Eric C.; Doudna, Jennifer A.
2014-03-01
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.
Sun, Tiedong; Mirzoev, Alexander; Korolev, Nikolay; Lyubartsev, Alexander P; Nordenskiöld, Lars
2017-08-24
It is well established that the presence of the trivalent cobalt(III)-hexammine cation (CoHex 3+ ) at submillimolar concentrations leads to bundling (condensation) of double-stranded DNA molecules, which is caused by DNA-DNA attraction induced by the multivalent counterions. However, the detailed mechanism of this process is still not fully understood. Furthermore, in all-atom molecular dynamics (MD) simulations, spontaneous aggregation of several DNA oligonucleotides in the presence of CoHex 3+ has previously not been demonstrated. In order to obtain a rigorous description of CoHex 3+ -nucleic acid interactions and CoHex 3+ -induced DNA condensation to be used in MD simulations, we have derived optimized force field parameters of the CoHex 3+ ion. They were obtained from Car-Parrinello molecular dynamics simulation of a single CoHex 3+ ion in the presence of 125 water molecules. The new set of force field parameters reproduces the experimentally known transition of DNA from B- to A-form, and qualitatively describes changes of DNA and RNA persistence lengths. We then carried out a 2 μs long atomistic simulation of four DNA oligomers each consisting of 36 base pairs in the presence of CoHex 3+ . We demonstrate that, in this system, DNA molecules display attractive interactions and aggregate into bundle-like structures. This behavior depends critically on the details of the CoHex 3+ interaction with DNA. A control simulation with a similar setup but in the presence of Mg 2+ does not induce DNA-DNA attraction, which is also in agreement with experiment.
Inhibition mechanisms of hemoglobin, immunoglobulin G, and whole blood in digital and real-time PCR.
Sidstedt, Maja; Hedman, Johannes; Romsos, Erica L; Waitara, Leticia; Wadsö, Lars; Steffen, Carolyn R; Vallone, Peter M; Rådström, Peter
2018-04-01
Blood samples are widely used for PCR-based DNA analysis in fields such as diagnosis of infectious diseases, cancer diagnostics, and forensic genetics. In this study, the mechanisms behind blood-induced PCR inhibition were evaluated by use of whole blood as well as known PCR-inhibitory molecules in both digital PCR and real-time PCR. Also, electrophoretic mobility shift assay was applied to investigate interactions between inhibitory proteins and DNA, and isothermal titration calorimetry was used to directly measure effects on DNA polymerase activity. Whole blood caused a decrease in the number of positive digital PCR reactions, lowered amplification efficiency, and caused severe quenching of the fluorescence of the passive reference dye 6-carboxy-X-rhodamine as well as the double-stranded DNA binding dye EvaGreen. Immunoglobulin G was found to bind to single-stranded genomic DNA, leading to increased quantification cycle values. Hemoglobin affected the DNA polymerase activity and thus lowered the amplification efficiency. Hemoglobin and hematin were shown to be the molecules in blood responsible for the fluorescence quenching. In conclusion, hemoglobin and immunoglobulin G are the two major PCR inhibitors in blood, where the first affects amplification through a direct effect on the DNA polymerase activity and quenches the fluorescence of free dye molecules, and the latter binds to single-stranded genomic DNA, hindering DNA polymerization in the first few PCR cycles. Graphical abstract PCR inhibition mechanisms of hemoglobin and immunoglobulin G (IgG). Cq quantification cycle, dsDNA double-stranded DNA, ssDNA single-stranded DNA.
USDA-ARS?s Scientific Manuscript database
DNA sequencing and other DNA-based methods, such as PCR, are now broadly used for detection and identification of bacterial foodborne pathogens. For the identification of foodborne bacterial pathogens, it is important to make taxonomic assignments to the species, or even subspecies level. Long-read ...
Sequencing of adenine in DNA by scanning tunneling microscopy
NASA Astrophysics Data System (ADS)
Tanaka, Hiroyuki; Taniguchi, Masateru
2017-08-01
The development of DNA sequencing technology utilizing the detection of a tunnel current is important for next-generation sequencer technologies based on single-molecule analysis technology. Using a scanning tunneling microscope, we previously reported that dI/dV measurements and dI/dV mapping revealed that the guanine base (purine base) of DNA adsorbed onto the Cu(111) surface has a characteristic peak at V s = -1.6 V. If, in addition to guanine, the other purine base of DNA, namely, adenine, can be distinguished, then by reading all the purine bases of each single strand of a DNA double helix, the entire base sequence of the original double helix can be determined due to the complementarity of the DNA base pair. Therefore, the ability to read adenine is important from the viewpoint of sequencing. Here, we report on the identification of adenine by STM topographic and spectroscopic measurements using a synthetic DNA oligomer and viral DNA.
DNA strand displacement reaction for programmable release of biomolecules.
Ramezani, Hamid; Jed Harrison, D
2015-05-14
Sample cleanup is a major processing step in many analytical assays. Here, we propose an approach to capture-and-release of analytes based on the DNA strand displacement reaction (SDR) and demonstrate its application to a fluoroimmunoassay on beads for a thyroid cancer biomarker, thyroglobulin. The SDR-based cleanup showed no interference from matrix molecules in serum.
A Single-Molecule Barcoding System using Nanoslits for DNA Analysis
NASA Astrophysics Data System (ADS)
Jo, Kyubong; Schramm, Timothy M.; Schwartz, David C.
Single DNA molecule approaches are playing an increasingly central role in the analytical genomic sciences because single molecule techniques intrinsically provide individualized measurements of selected molecules, free from the constraints of bulk techniques, which blindly average noise and mask the presence of minor analyte components. Accordingly, a principal challenge that must be addressed by all single molecule approaches aimed at genome analysis is how to immobilize and manipulate DNA molecules for measurements that foster construction of large, biologically relevant data sets. For meeting this challenge, this chapter discusses an integrated approach for microfabricated and nanofabricated devices for the manipulation of elongated DNA molecules within nanoscale geometries. Ideally, large DNA coils stretch via nanoconfinement when channel dimensions are within tens of nanometers. Importantly, stretched, often immobilized, DNA molecules spanning hundreds of kilobase pairs are required by all analytical platforms working with large genomic substrates because imaging techniques acquire sequence information from molecules that normally exist in free solution as unrevealing random coils resembling floppy balls of yarn. However, nanoscale devices fabricated with sufficiently small dimensions fostering molecular stretching make these devices impractical because of the requirement of exotic fabrication technologies, costly materials, and poor operational efficiencies. In this chapter, such problems are addressed by discussion of a new approach to DNA presentation and analysis that establishes scaleable nanoconfinement conditions through reduction of ionic strength; stiffening DNA molecules thus enabling their arraying for analysis using easily fabricated devices that can also be mass produced. This new approach to DNA nanoconfinement is complemented by the development of a novel labeling scheme for reliable marking of individual molecules with fluorochrome labels, creating molecular barcodes, which are efficiently read using fluorescence resonance energy transfer techniques for minimizing noise from unincorporated labels. As such, our integrative approach for the realization of genomic analysis through nanoconfinement, named nanocoding, was demonstrated through the barcoding and mapping of bacterial artificial chromosomal molecules, thereby providing the basis for a high-throughput platform competent for whole genome investigations.
Scala, Giovanni; Affinito, Ornella; Palumbo, Domenico; Florio, Ermanno; Monticelli, Antonella; Miele, Gennaro; Chiariotti, Lorenzo; Cocozza, Sergio
2016-11-25
CpG sites in an individual molecule may exist in a binary state (methylated or unmethylated) and each individual DNA molecule, containing a certain number of CpGs, is a combination of these states defining an epihaplotype. Classic quantification based approaches to study DNA methylation are intrinsically unable to fully represent the complexity of the underlying methylation substrate. Epihaplotype based approaches, on the other hand, allow methylation profiles of cell populations to be studied at the single molecule level. For such investigations, next-generation sequencing techniques can be used, both for quantitative and for epihaplotype analysis. Currently available tools for methylation analysis lack output formats that explicitly report CpG methylation profiles at the single molecule level and that have suited statistical tools for their interpretation. Here we present ampliMethProfiler, a python-based pipeline for the extraction and statistical epihaplotype analysis of amplicons from targeted deep bisulfite sequencing of multiple DNA regions. ampliMethProfiler tool provides an easy and user friendly way to extract and analyze the epihaplotype composition of reads from targeted bisulfite sequencing experiments. ampliMethProfiler is written in python language and requires a local installation of BLAST and (optionally) QIIME tools. It can be run on Linux and OS X platforms. The software is open source and freely available at http://amplimethprofiler.sourceforge.net .
Mohamadi, Maryam; Mostafavi, Ali; Torkzadeh-Mahani, Masoud
2017-11-01
The aim of this research was the determination of a microRNA (miRNA) using a DNA electrochemical aptasensor. In this biosensor, the complementary complementary DNA (cDNA) of miRNA-145 (a sense RNA transcript) was the target strand and the cDNA of miRNA-145 was the probe strand. Both cDNAs can be the product of the reverse transcriptase-polymerase chain reaction of miRNA. The proposed aptasensor's function was based on the hybridization of target strands with probes immobilized on the surface of a working electrode and the subsequent intercalation of doxorubicin (DOX) molecules functioning as the electroactive indicators of any double strands that formed. Electrochemical transduction was performed by measuring the cathodic current resulting from the electrochemical reduction of the intercalated molecules at the electrode surface. In the experiment, because many DOX molecules accumulated on each target strand on the electrode surface, amplification was inherently easy, without a need for enzymatic or complicated amplification strategies. The proposed aptasensor also had the excellent ability to regenerate as a result of the melting of the DNA duplex. Moreover, the use of DNA probe strands obviated the challenges of working with an RNA probe, such as sensitivity to RNase enzyme. In addition to the linear relationship between the electrochemical signal and the concentration of the target strands that ranged from 2.0 to 80.0 nM with an LOD of 0.27 nM, the proposed biosensor was clearly capable of distinguishing between complementary (target strand) and noncomplementary sequences. The presented biosensor was successfully applied for the quantification of DNA strands corresponding to miRNA-145 in human serum samples.
Szczurek, Aleksander; Klewes, Ludger; Xing, Jun; Gourram, Amine; Birk, Udo; Knecht, Hans; Dobrucki, Jurek W.; Mai, Sabine
2017-01-01
Abstract Advanced light microscopy is an important tool for nanostructure analysis of chromatin. In this report we present a general concept for Single Molecule localization Microscopy (SMLM) super-resolved imaging of DNA-binding dyes based on modifying the properties of DNA and the dye. By careful adjustment of the chemical environment leading to local, reversible DNA melting and hybridization control over the fluorescence signal of the DNA-binding dye molecules can be introduced. We postulate a transient binding as the basis for our variation of binding-activated localization microscopy (BALM). We demonstrate that several intercalating and minor-groove binding DNA dyes can be used to register (optically isolate) only a few DNA-binding dye signals at a time. To highlight this DNA structure fluctuation-assisted BALM (fBALM), we applied it to measure, for the first time, nanoscale differences in nuclear architecture in model ischemia with an anticipated structural resolution of approximately 50 nm. Our data suggest that this approach may open an avenue for the enhanced microscopic analysis of chromatin nano-architecture and hence the microscopic analysis of nuclear structure aberrations occurring in various pathological conditions. It may also become possible to analyse nuclear nanostructure differences in different cell types, stages of development or environmental stress conditions. PMID:28082388
Macroscopic modeling and simulations of supercoiled DNA with bound proteins
NASA Astrophysics Data System (ADS)
Huang, Jing; Schlick, Tamar
2002-11-01
General methods are presented for modeling and simulating DNA molecules with bound proteins on the macromolecular level. These new approaches are motivated by the need for accurate and affordable methods to simulate slow processes (on the millisecond time scale) in DNA/protein systems, such as the large-scale motions involved in the Hin-mediated inversion process. Our approaches, based on the wormlike chain model of long DNA molecules, introduce inhomogeneous potentials for DNA/protein complexes based on available atomic-level structures. Electrostatically, treat those DNA/protein complexes as sets of effective charges, optimized by our discrete surface charge optimization package, in which the charges are distributed on an excluded-volume surface that represents the macromolecular complex. We also introduce directional bending potentials as well as non-identical bead hydrodynamics algorithm to further mimic the inhomogeneous effects caused by protein binding. These models thus account for basic elements of protein binding effects on DNA local structure but remain computational tractable. To validate these models and methods, we reproduce various properties measured by both Monte Carlo methods and experiments. We then apply the developed models to study the Hin-mediated inversion system in long DNA. By simulating supercoiled, circular DNA with or without bound proteins, we observe significant effects of protein binding on global conformations and long-time dynamics of the DNA on the kilo basepair length.
NASA Astrophysics Data System (ADS)
Shibata, Takayuki; Iio, Naohiro; Furukawa, Hiromi; Nagai, Moeto
2017-02-01
We performed a fundamental study on the photocatalytic degradation of fluorescently labeled DNA molecules immobilized on titanium dioxide (TiO2) thin films under ultraviolet irradiation. The films were prepared by the electrochemical anodization of Ti thin films sputtered on silicon substrates. We also confirmed that the photocurrent arising from the photocatalytic oxidation of DNA molecules can be detected during this process. We then demonstrated an atomic force microscopy (AFM)-based nanofabrication technique by employing TiO2-coated AFM probes to penetrate living cell membranes under near-physiological conditions for minimally invasive intracellular delivery.
Capillary electrophoresis: Biotechnology for separation of DNA and chromosomes
NASA Technical Reports Server (NTRS)
Williams, George O., Jr.
1994-01-01
Electrophoresis has been used for the separation of particles, ions, and molecules for a number of years. The technology for separation and detection of the results has many applications in the life sciences. One of the major goals of the scientific community is to separate DNA molecules and intact chromosomes based upon their different lengths or number of base pairs. This may be achieved by using some of the commercially available and widely used methods, but these processes require a considerable amount of time. The challenge is to achieve separation of intact chromosomes in a short time, preferably in a matter of minutes.
Microwave-Induced Inactivation of DNA-Based Hybrid Catalyst in Asymmetric Catalysis
Zhao, Hua; Shen, Kai
2015-01-01
DNA-based hybrid catalysts have gained strong interests in asymmetric reactions. However, to maintain the high enantioselectivity, these reactions are usually conducted at relatively low temperatures (e.g. < 5 °C) for 2–3 days. Aiming to improve the reaction’s turnover rate, we evaluated microwave irradiation with simultaneous cooling as potential energy source since this method has been widely used to accelerate various chemical and enzymatic reactions. However, our data indicated that microwave irradiation induced an inactivation of DNA-based hybrid catalyst even at low temperatures (such as 5 °C). Circular dichroism (CD) spectra and gel electrophoresis of DNA suggest that microwave exposure degrades DNA molecules and disrupts DNA double-stranded structures, causing changes of DNA–metal ligand binding properties and thus poor DNA catalytic performance. PMID:26712696
Lee, Andrea J; Wallace, Susan S
2017-06-01
The first step of the base excision repair (BER) pathway responsible for removing oxidative DNA damage utilizes DNA glycosylases to find and remove the damaged DNA base. How glycosylases find the damaged base amidst a sea of undamaged bases has long been a question in the BER field. Single molecule total internal reflection fluorescence microscopy (SM TIRFM) experiments have allowed for an exciting look into this search mechanism and have found that DNA glycosylases scan along the DNA backbone in a bidirectional and random fashion. By comparing the search behavior of bacterial glycosylases from different structural families and with varying substrate specificities, it was found that glycosylases search for damage by periodically inserting a wedge residue into the DNA stack as they redundantly search tracks of DNA that are 450-600bp in length. These studies open up a wealth of possibilities for further study in real time of the interactions of DNA glycosylases and other BER enzymes with various DNA substrates. Copyright © 2016 Elsevier Inc. All rights reserved.
Sub-Terrahertz Spectroscopy of E.COLI Dna: Experiment, Statistical Model, and MD Simulations
NASA Astrophysics Data System (ADS)
Sizov, I.; Dorofeeva, T.; Khromova, T.; Gelmont, B.; Globus, T.
2012-06-01
We will present result of combined experimental and computational study of sub-THz absorption spectra from Escherichia coli (E.coli) DNA. Measurements were conducted using a Bruker FTIR spectrometer with a liquid helium cooled bolometer and a recently developed frequency domain sensor operating at room temperature, with spectral resolution of 0.25 cm-1 and 0.03 cm-1, correspondingly. We have earlier demonstrated that molecular dynamics (MD) simulation can be effectively applied for characterizing relatively small biological molecules, such as transfer RNA or small protein thioredoxin from E. coli , and help to understand and predict their absorption spectra. Large size of DNA macromolecules ( 5 million base pairs for E. coli DNA) prevents, however, direct application of MD simulation at the current level of computational capabilities. Therefore, by applying a second order Markov chain approach and Monte-Carlo technique, we have developed a new statistical model to construct DNA sequences from biological cells. These short representative sequences (20-60 base pairs) are built upon the most frequently repeated fragments (2-10 base pairs) in the original DNA. Using this new approach, we constructed DNA sequences for several non-pathogenic strains of E.coli, including a well-known strain BL21, uro-pathogenic strain, CFT073, and deadly EDL933 strain (O157:H7), and used MD simulations to calculate vibrational absorption spectra of these strains. Significant differences are clearly present in spectra of strains in averaged spectra and in all components for particular orientations. The mechanism of interaction of THz radiation with a biological molecule is studied by analyzing dynamics of atoms and correlation of local vibrations in the modeled molecule. Simulated THz vibrational spectra of DNA are compared with experimental results. With the spectral resolution of 0.1 cm-1 or better, which is now available in experiments, the very easy discrimination between different strains of the same bacteria becomes possible.
Single Molecule Sensing by Nanopores and Nanopore Devices
Gu, Li-Qun; Shim, Ji Wook
2010-01-01
Molecular-scale pore structures, called nanopores, can be assembled by protein ion channels through genetic engineering or be artificially fabricated on solid substrates using fashion nanotechnology. When target molecules interact with the functionalized lumen of a nanopore, they characteristically block the ion pathway. The resulting conductance changes allow for identification of single molecules and quantification of target species in the mixture. In this review, we first overview nanopore-based sensory techniques that have been created for the detection of myriad biomedical targets, from metal ions, drug compounds, and cellular second messengers to proteins and DNA. Then we introduce our recent discoveries in nanopore single molecule detection: (1) using the protein nanopore to study folding/unfolding of the G-quadruplex aptamer; (2) creating a portable and durable biochip that is integrated with a single-protein pore sensor (this chip is compared with recently developed protein pore sensors based on stabilized bilayers on glass nanopore membranes and droplet interface bilayer); and (3) creating a glass nanopore-terminated probe for single-molecule DNA detection, chiral enantiomer discrimination, and identification of the bioterrorist agent ricin with an aptamer-encoded nanopore. PMID:20174694
Manipulating and Visualizing Molecular Interactions in Customized Nanoscale Spaces
NASA Astrophysics Data System (ADS)
Stabile, Francis; Henkin, Gil; Berard, Daniel; Shayegan, Marjan; Leith, Jason; Leslie, Sabrina
We present a dynamically adjustable nanofluidic platform for formatting the conformations of and visualizing the interaction kinetics between biomolecules in solution, offering new time resolution and control of the reaction processes. This platform extends convex lens-induced confinement (CLiC), a technique for imaging molecules under confinement, by introducing a system for in situ modification of the chemical environment; this system uses a deep microchannel to diffusively exchange reagents within the nanoscale imaging region, whose height is fixed by a nanopost array. To illustrate, we visualize and manipulate salt-induced, surfactant-induced, and enzyme-induced reactions between small-molecule reagents and DNA molecules, where the conformations of the DNA molecules are formatted by the imposed nanoscale confinement. By using nanofabricated, nonabsorbing, low-background glass walls to confine biomolecules, our nanofluidic platform facilitates quantitative exploration of physiologically and biotechnologically relevant processes at the nanoscale. This device provides new kinetic information about dynamic chemical processes at the single-molecule level, using advancements in the CLiC design including a microchannel-based diffuser and postarray-based dialysis slit.
Huang, Xiaoxi; Tao, Zhimin; Praskavich, John C; Goswami, Anandarup; Al-Sharab, Jafar F; Minko, Tamara; Polshettiwar, Vivek; Asefa, Tewodros
2014-09-16
The pore size and pore structure of nanoporous materials can affect the materials' physical properties, as well as potential applications in different areas, including catalysis, drug delivery, and biomolecular therapeutics. KCC-1, one of the newest members of silica nanomaterials, possesses fibrous, large pore, dendritic pore networks with wide pore entrances, large pore size distribution, spacious pore volume and large surface area--structural features that are conducive for adsorption and release of large guest molecules and biomacromolecules (e.g., proteins and DNAs). Here, we report the results of our comparative studies of adsorption of salmon DNA in a series of KCC-1-based nanomaterials that are functionalized with different organoamine groups on different parts of their surfaces (channel walls, external surfaces or both). For comparison the results of our studies of adsorption of salmon DNA in similarly functionalized, MCM-41 mesoporous silica nanomaterials with cylindrical pores, some of the most studied silica nanomaterials for drug/gene delivery, are also included. Our results indicate that, despite their relatively lower specific surface area, the KCC-1-based nanomaterials show high adsorption capacity for DNA than the corresponding MCM-41-based nanomaterials, most likely because of KCC-1's large pores, wide pore mouths, fibrous pore network, and thereby more accessible and amenable structure for DNA molecules to diffuse through. Conversely, the MCM-41-based nanomaterials adsorb much less DNA, presumably because their outer surfaces/cylindrical channel pore entrances can get blocked by the DNA molecules, making the inner parts of the materials inaccessible. Moreover, experiments involving fluorescent dye-tagged DNAs suggest that the amine-grafted KCC-1 materials are better suited for delivering the DNAs adsorbed on their surfaces into cellular environments than their MCM-41 counterparts. Finally, cellular toxicity tests show that the KCC-1-based materials are biocompatible. On the basis of these results, the fibrous and porous KCC-1-based nanomaterials can be said to be more suitable to carry, transport, and deliver DNAs and genes than cylindrical porous nanomaterials such as MCM-41.
Visualization of DNA molecules in time during electrophoresis
NASA Technical Reports Server (NTRS)
Lubega, Seth
1991-01-01
For several years individual DNA molecules have been observed and photographed during agarose gel electrophoresis. The DNA molecule is clearly the largest molecule known. Nevertheless, the largest molecule is still too small to be seen using a microscope. A technique developed by Morikawa and Yanagida has made it possible to visualize individual DNA molecules. When these long molecules are labeled with appropriate fluorescence dyes and observed under a fluorescence microscope, although it is not possible to directly visualize the local ultrastructure of the molecules, yet because they are long light emitting chains, their microscopic dynamical behavior can be observed. This visualization works in the same principle that enables one to observe a star through a telescope because it emits light against a dark background. The dynamics of individual DNA molecules migrating through agarose matrix during electrophoresis have been described by Smith et al. (1989), Schwartz and Koval (1989), and Bustamante et al. (1990). DNA molecules during agarose gel electrophoresis advance lengthwise thorough the gel in an extended configuration. They display an extension-contraction motion and tend to bunch up in their leading ends as the 'heads' find new pores through the gel. From time to time they get hooked on obstacles in the gel to form U-shaped configurations before they resume their linear configuration.
Use of continuous/contiguous stacking hybridization as a diagnostic tool
Mirzabekov, Andrei Darievich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Dubiley, Svetlana Alekseevna
2002-01-01
A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. A method is also provided for determining the length of a repeat sequence in DNA or RNA, and also for determining the base sequence of unknown DNA or RNA.
Use of continuous/contiguous stacking hybridization as a diagnostic tool
Mirzabekov, Andrei Darievich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Dubiley, Svetlana Alekseevna
2000-01-01
A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. A method is also provided for determining the length of a repeat sequence in DNA or RNA, and also for determining the base sequence of unknown DNA or RNA.
Feuillie, Cécile; Merheb, Maxime M.; Gillet, Benjamin; Montagnac, Gilles; Daniel, Isabelle; Hänni, Catherine
2014-01-01
The analysis of ancient or processed DNA samples is often a great challenge, because traditional Polymerase Chain Reaction – based amplification is impeded by DNA damage. Blocking lesions such as abasic sites are known to block the bypass of DNA polymerases, thus stopping primer elongation. In the present work, we applied the SERRS-hybridization assay, a fully non-enzymatic method, to the detection of DNA refractory to PCR amplification. This method combines specific hybridization with detection by Surface Enhanced Resonant Raman Scattering (SERRS). It allows the detection of a series of double-stranded DNA molecules containing a varying number of abasic sites on both strands, when PCR failed to detect the most degraded sequences. Our SERRS approach can quickly detect DNA molecules without any need for DNA repair. This assay could be applied as a pre-requisite analysis prior to enzymatic reparation or amplification. A whole new set of samples, both forensic and archaeological, could then deliver information that was not yet available due to a high degree of DNA damage. PMID:25502338
Feuillie, Cécile; Merheb, Maxime M; Gillet, Benjamin; Montagnac, Gilles; Daniel, Isabelle; Hänni, Catherine
2014-01-01
The analysis of ancient or processed DNA samples is often a great challenge, because traditional Polymerase Chain Reaction - based amplification is impeded by DNA damage. Blocking lesions such as abasic sites are known to block the bypass of DNA polymerases, thus stopping primer elongation. In the present work, we applied the SERRS-hybridization assay, a fully non-enzymatic method, to the detection of DNA refractory to PCR amplification. This method combines specific hybridization with detection by Surface Enhanced Resonant Raman Scattering (SERRS). It allows the detection of a series of double-stranded DNA molecules containing a varying number of abasic sites on both strands, when PCR failed to detect the most degraded sequences. Our SERRS approach can quickly detect DNA molecules without any need for DNA repair. This assay could be applied as a pre-requisite analysis prior to enzymatic reparation or amplification. A whole new set of samples, both forensic and archaeological, could then deliver information that was not yet available due to a high degree of DNA damage.
Single Molecule Visualization of Protein-DNA Complexes: Watching Machines at Work
NASA Astrophysics Data System (ADS)
Kowalczykowski, Stephen
2013-03-01
We can now watch individual proteins acting on single molecules of DNA. Such imaging provides unprecedented interrogation of fundamental biophysical processes. Visualization is achieved through the application of two complementary procedures. In one, single DNA molecules are attached to a polystyrene bead and are then captured by an optical trap. The DNA, a worm-like coil, is extended either by the force of solution flow in a micro-fabricated channel, or by capturing the opposite DNA end in a second optical trap. In the second procedure, DNA is attached by one end to a glass surface. The coiled DNA is elongated either by continuous solution flow or by subsequently tethering the opposite end to the surface. Protein action is visualized by fluorescent reporters: fluorescent dyes that bind double-stranded DNA (dsDNA), fluorescent biosensors for single-stranded DNA (ssDNA), or fluorescently-tagged proteins. Individual molecules are imaged using either epifluorescence microscopy or total internal reflection fluorescence (TIRF) microscopy. Using these approaches, we imaged the search for DNA sequence homology conducted by the RecA-ssDNA filament. The manner by which RecA protein finds a single homologous sequence in the genome had remained undefined for almost 30 years. Single-molecule imaging revealed that the search occurs through a mechanism termed ``intersegmental contact sampling,'' in which the randomly coiled structure of DNA is essential for reiterative sampling of DNA sequence identity: an example of parallel processing. In addition, the assembly of RecA filaments on single molecules of single-stranded DNA was visualized. Filament assembly requires nucleation of a protein dimer on DNA, and subsequent growth occurs via monomer addition. Furthermore, we discovered a class of proteins that catalyzed both nucleation and growth of filaments, revealing how the cell controls assembly of this protein-DNA complex.
Rock, Cassandra; Shamlou, Parviz Ayazi; Levy, M. Susana
2003-01-01
A method is described for high-throughput monitoring of DNA backbone integrity in plasmids and artificial chromosomes in solution. The method is based on the denaturation properties of double-stranded DNA in alkaline conditions and uses PicoGreen fluorochrome to monitor denaturation. In the present method, fluorescence enhancement of PicoGreen at pH 12.4 is normalised by its value at pH 8 to give a ratio that is proportional to the average backbone integrity of the DNA molecules in the sample. A good regression fit (r2 > 0.98) was obtained when results derived from the present method and those derived from agarose gel electrophoresis were compared. Spiking experiments indicated that the method is sensitive enough to detect a proportion of 6% (v/v) molecules with an average of less than two breaks per molecule. Under manual operation, validation parameters such as inter-assay and intra-assay variation gave values of <5% coefficient of variation. Automation of the method showed equivalence to the manual procedure with high reproducibility and low variability within wells. The method described requires as little as 0.5 ng of DNA per well and a 96-well microplate can be analysed in 12 min providing an attractive option for analysis of high molecular weight vectors. A preparation of a 116 kb bacterial artificial chromosome was subjected to chemical and shear degradation and DNA integrity was tested using the method. Good correlation was obtained between time of chemical degradation and shear rate with fluorescence response. Results obtained from pulsed- field electrophoresis of sheared samples were in agreement with those obtained using the microplate-based method. PMID:12771229
C-5 Propynyl Modifications Enhance the Mechanical Stability of DNA.
Aschenbrenner, Daniela; Baumann, Fabian; Milles, Lukas F; Pippig, Diana A; Gaub, Hermann E
2015-07-20
Increased thermal or mechanical stability of DNA duplexes is desired for many applications in nanotechnology or -medicine where DNA is used as a programmable building block. Modifications of pyrimidine bases are known to enhance thermal stability and have the advantage of standard base-pairing and easy integration during chemical DNA synthesis. Through single-molecule force spectroscopy experiments with atomic force microscopy and the molecular force assay we investigated the effect of pyrimidines harboring C-5 propynyl modifications on the mechanical stability of double-stranded DNA. Utilizing these complementary techniques, we show that propynyl bases significantly increase the mechanical stability if the DNA is annealed at high temperature. In contrast, modified DNA complexes formed at room temperature and short incubation times display the same stability as non-modified DNA duplexes. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Global structure of forked DNA in solution revealed by high-resolution single-molecule FRET.
Sabir, Tara; Schröder, Gunnar F; Toulmin, Anita; McGlynn, Peter; Magennis, Steven W
2011-02-09
Branched DNA structures play critical roles in DNA replication, repair, and recombination in addition to being key building blocks for DNA nanotechnology. Here we combine single-molecule multiparameter fluorescence detection and molecular dynamics simulations to give a general approach to global structure determination of branched DNA in solution. We reveal an open, planar structure of a forked DNA molecule with three duplex arms and demonstrate an ion-induced conformational change. This structure will serve as a benchmark for DNA-protein interaction studies.
Biomolecular computers with multiple restriction enzymes.
Sakowski, Sebastian; Krasinski, Tadeusz; Waldmajer, Jacek; Sarnik, Joanna; Blasiak, Janusz; Poplawski, Tomasz
2017-01-01
The development of conventional, silicon-based computers has several limitations, including some related to the Heisenberg uncertainty principle and the von Neumann "bottleneck". Biomolecular computers based on DNA and proteins are largely free of these disadvantages and, along with quantum computers, are reasonable alternatives to their conventional counterparts in some applications. The idea of a DNA computer proposed by Ehud Shapiro's group at the Weizmann Institute of Science was developed using one restriction enzyme as hardware and DNA fragments (the transition molecules) as software and input/output signals. This computer represented a two-state two-symbol finite automaton that was subsequently extended by using two restriction enzymes. In this paper, we propose the idea of a multistate biomolecular computer with multiple commercially available restriction enzymes as hardware. Additionally, an algorithmic method for the construction of transition molecules in the DNA computer based on the use of multiple restriction enzymes is presented. We use this method to construct multistate, biomolecular, nondeterministic finite automata with four commercially available restriction enzymes as hardware. We also describe an experimental applicaton of this theoretical model to a biomolecular finite automaton made of four endonucleases.
Double nanohole optical tweezers visualize protein p53 suppressing unzipping of single DNA-hairpins
Kotnala, Abhay; Gordon, Reuven
2014-01-01
Here we report on the use of double-nanohole (DNH) optical tweezers as a label-free and free-solution single-molecule probe for protein–DNA interactions. Using this approach, we demonstrate the unzipping of individual 10 base pair DNA-hairpins, and quantify how tumor suppressor p53 protein delays the unzipping. From the Arrhenius behavior, we find the energy barrier to unzipping introduced by p53 to be 2 × 10−20 J, whereas cys135ser mutant p53 does not show suppression of unzipping, which gives clues to its functional inability to suppress tumor growth. This transformative approach to single molecule analysis allows for ultra-sensitive detection and quantification of protein–DNA interactions to revolutionize the fight against genetic diseases. PMID:24940547
DNA nanomapping using CRISPR-Cas9 as a programmable nanoparticle.
Mikheikin, Andrey; Olsen, Anita; Leslie, Kevin; Russell-Pavier, Freddie; Yacoot, Andrew; Picco, Loren; Payton, Oliver; Toor, Amir; Chesney, Alden; Gimzewski, James K; Mishra, Bud; Reed, Jason
2017-11-21
Progress in whole-genome sequencing using short-read (e.g., <150 bp), next-generation sequencing technologies has reinvigorated interest in high-resolution physical mapping to fill technical gaps that are not well addressed by sequencing. Here, we report two technical advances in DNA nanotechnology and single-molecule genomics: (1) we describe a labeling technique (CRISPR-Cas9 nanoparticles) for high-speed AFM-based physical mapping of DNA and (2) the first successful demonstration of using DVD optics to image DNA molecules with high-speed AFM. As a proof of principle, we used this new "nanomapping" method to detect and map precisely BCL2-IGH translocations present in lymph node biopsies of follicular lymphoma patents. This HS-AFM "nanomapping" technique can be complementary to both sequencing and other physical mapping approaches.
Chronic Obstructive Pulmonary Disease: From Injury to Genomic Stability.
Sergio, Luiz Philippe da Silva; de Paoli, Flavia; Mencalha, Andre Luiz; da Fonseca, Adenilson de Souza
2017-08-01
Chronic obstructive pulmonary disease (COPD) is the fourth cause of death in the world and it is currently presenting a major global public health challenge, causing premature death from pathophysiological complications and rising economic and social burdens. COPD develops from a combination of factors following exposure to pollutants and cigarette smoke, presenting a combination of both emphysema and chronic obstructive bronchitis, which causes lung airflow limitations that are not fully reversible by bronchodilators. Oxidative stress plays a key role in the maintenance and amplification of inflammation in tissue injury, and also induces DNA damages. Once the DNA molecule is damaged, enzymatic mechanisms act in order to repair the DNA molecule. These mechanisms are specific to repair of oxidative damages, such as nitrogen base modifications, or larger DNA damages, such as double-strand breaks. In addition, there is an enzymatic mechanism for the control of telomere length. All these mechanisms contribute to cell viability and homeostasis. Thus, therapies based on modulation of DNA repair and genomic stability could be effective in improving repair and recovery of lung tissue in patients with COPD.
Selectively Sized Graphene-Based Nanopores for in Situ Single Molecule Sensing
2015-01-01
The use of nanopore biosensors is set to be extremely important in developing precise single molecule detectors and providing highly sensitive advanced analysis of biological molecules. The precise tailoring of nanopore size is a significant step toward achieving this, as it would allow for a nanopore to be tuned to a corresponding analyte. The work presented here details a methodology for selectively opening nanopores in real-time. The tunable nanopores on a quartz nanopipette platform are fabricated using the electroetching of a graphene-based membrane constructed from individual graphene nanoflakes (ø ∼30 nm). The device design allows for in situ opening of the graphene membrane, from fully closed to fully opened (ø ∼25 nm), a feature that has yet to be reported in the literature. The translocation of DNA is studied as the pore size is varied, allowing for subfeatures of DNA to be detected with slower DNA translocations at smaller pore sizes, and the ability to observe trends as the pore is opened. This approach opens the door to creating a device that can be target to detect specific analytes. PMID:26204996
Ryu, Kyoung-Seok; Tugarinov, Vitali; Clore, G Marius
2014-10-15
The kinetics of translocation of the homeodomain transcription factor HoxD9 between specific sites of the same or opposite polarities on the same DNA molecule have been studied by (15)Nz-exchange NMR spectroscopy. We show that exchange occurs by two facilitated diffusion mechanisms: a second-order intermolecular exchange reaction between specific sites located on different DNA molecules without the protein dissociating into free solution that predominates at high concentrations of free DNA, and a first-order intramolecular process involving direct transfer between specific sites located on the same DNA molecule. Control experiments using a mixture of two DNA molecules, each possessing only a single specific site, indicate that transfer between specific sites by full dissociation of HoxD9 into solution followed by reassociation is too slow to measure by z-exchange spectroscopy. Intramolecular transfer with comparable rate constants occurs between sites of the same and opposing polarity, indicating that both rotation-coupled sliding and hopping/flipping (analogous to geminate recombination) occur. The half-life for intramolecular transfer (0.5-1 s) is many orders of magnitude larger than the calculated transfer time (1-100 μs) by sliding, leading us to conclude that the intramolecular transfer rates measured by z-exchange spectroscopy represent the rate-limiting step for a one-base-pair shift from the specific site to the immediately adjacent nonspecific site. At zero concentration of added salt, the intramolecular transfer rate constants between sites of opposing polarity are smaller than those between sites of the same polarity, suggesting that hopping/flipping may become rate-limiting at very low salt concentrations.
Torsional stress in DNA limits collaboration among reverse gyrase molecules.
Ogawa, Taisaku; Sutoh, Kazuo; Kikuchi, Akihiko; Kinosita, Kazuhiko
2016-04-01
Reverse gyrase is an enzyme that can overwind (introduce positive supercoils into) DNA using the energy obtained from ATP hydrolysis. The enzyme is found in hyperthermophiles, and the overwinding reaction generally requires a temperature above 70 °C. In a previous study using microscopy, we have shown that 30 consecutive mismatched base pairs (a bubble) in DNA serve as a well-defined substrate site for reverse gyrase, warranting the processive overwinding activity down to 50 °C. Here, we inquire how multiple reverse gyrase molecules may collaborate with each other in overwinding one DNA molecule. We introduced one, two, or four bubbles in a linear DNA that tethered a magnetic bead to a coverslip surface. At 40-71 °C in the presence of reverse gyrase, the bead rotated clockwise as viewed from above, to relax the DNA twisted by reverse gyrase. Dependence on the enzyme concentration indicated that each bubble binds reverse gyrase tightly (dissociation constant < 0.1 nm) and that bound enzyme continuously overwinds DNA for > 5 min. Rotation with two bubbles was significantly faster compared with one bubble, indicating that overwinding actions are basically additive, but four bubbles did not show further acceleration except at 40 °C where the activity was very low. The apparent saturation is due to the hydrodynamic friction against the rotating bead, as confirmed by increasing the medium viscosity. When torsional stress in the DNA, determined by the friction, approaches ~ 7 pN·nm (at 71 °C), the overwinding activity of reverse gyrase drops sharply. Multiple molecules of reverse gyrase collaborate additively within this limit. © 2016 The Authors. The FEBS Journal published by John Wiley & Sons Ltd on behalf of Federation of European Biochemical Societies.
DNA/RNA transverse current sequencing: intrinsic structural noise from neighboring bases
Alvarez, Jose R.; Skachkov, Dmitry; Massey, Steven E.; Kalitsov, Alan; Velev, Julian P.
2015-01-01
Nanopore DNA sequencing via transverse current has emerged as a promising candidate for third-generation sequencing technology. It produces long read lengths which could alleviate problems with assembly errors inherent in current technologies. However, the high error rates of nanopore sequencing have to be addressed. A very important source of the error is the intrinsic noise in the current arising from carrier dispersion along the chain of the molecule, i.e., from the influence of neighboring bases. In this work we perform calculations of the transverse current within an effective multi-orbital tight-binding model derived from first-principles calculations of the DNA/RNA molecules, to study the effect of this structural noise on the error rates in DNA/RNA sequencing via transverse current in nanopores. We demonstrate that a statistical technique, utilizing not only the currents through the nucleotides but also the correlations in the currents, can in principle reduce the error rate below any desired precision. PMID:26150827
DNA Origami-Graphene Hybrid Nanopore for DNA Detection.
Barati Farimani, Amir; Dibaeinia, Payam; Aluru, Narayana R
2017-01-11
DNA origami nanostructures can be used to functionalize solid-state nanopores for single molecule studies. In this study, we characterized a nanopore in a DNA origami-graphene heterostructure for DNA detection. The DNA origami nanopore is functionalized with a specific nucleotide type at the edge of the pore. Using extensive molecular dynamics (MD) simulations, we computed and analyzed the ionic conductivity of nanopores in heterostructures carpeted with one or two layers of DNA origami on graphene. We demonstrate that a nanopore in DNA origami-graphene gives rise to distinguishable dwell times for the four DNA base types, whereas for a nanopore in bare graphene, the dwell time is almost the same for all types of bases. The specific interactions (hydrogen bonds) between DNA origami and the translocating DNA strand yield different residence times and ionic currents. We also conclude that the speed of DNA translocation decreases due to the friction between the dangling bases at the pore mouth and the sequencing DNA strands.
Stellwagen, Earle; Stellwagen, Nancy C
2015-09-01
Free solution capillary electrophoresis (CE) is a useful technique for measuring the translational diffusion coefficients of charged analytes. The measurements are relatively fast if the polarity of the electric field is reversed to drive the analyte back and forth past the detection window during each run. We have tested the validity of the resulting diffusion coefficients using double-stranded DNA molecules ranging in size from 20 to 960 base pairs as the model system. The diffusion coefficients of small DNAs are equal to values in the literature measured by other techniques. However, the diffusion coefficients of DNA molecules larger than ∼30 base pairs are anomalously high and deviate increasingly from the literature values with increasing DNA molar mass. The anomalously high diffusion coefficients are due to electrostatic coupling between the DNA and its counterions. As a result, the measured diffusion coefficients vary with the diffusion coefficient of the counterion, as well as with cation concentration and electric field strength. These effects can be reduced or eliminated by measuring apparent diffusion coefficients of the DNA at several different electric field strengths and extrapolating the results to zero electric field.
Jalili, Seifollah; Karami, Leila
2012-03-01
The proline-rich homeodomain (PRH)-DNA complex consists of a protein with 60 residues and a 13-base-pair DNA. The PRH protein is a transcription factor that plays a key role in the regulation of gene expression. PRH is a significant member of the Q50 class of homeodomain proteins. The homeodomain section of PRH is essential for binding to DNA and mediates sequence-specific DNA binding. Three 20-ns molecular dynamics (MD) simulations (free protein, free DNA and protein-DNA complex) in explicit solvent water were performed to elucidate the intermolecular contacts in the PRH-DNA complex and the role of dynamics of water molecules forming water-mediated contacts. The simulation provides a detailed explanation of the trajectory of hydration water molecules. The simulations show that some water molecules in the protein-DNA interface exchange with bulk waters. The simulation identifies that most of the contacts consisted of direct interactions between the protein and DNA including specific and non-specific contacts, but several water-mediated polar contacts were also observed. The specific interaction between Gln50 and C18 and water-mediated hydrogen bond between Gln50 and T7 were found to be present during almost the entire time of the simulation. These results show good consistency with experimental and previous computational studies. Structural properties such as root-mean-square deviations (RMSD), root-mean-square fluctuations (RMSF) and secondary structure were also analyzed as a function of time. Analyses of the trajectories showed that the dynamic fluctuations of both the protein and the DNA were lowered by the complex formation.
Etheridge, Thomas J.; Boulineau, Rémi L.; Herbert, Alex; Watson, Adam T.; Daigaku, Yasukazu; Tucker, Jem; George, Sophie; Jönsson, Peter; Palayret, Matthieu; Lando, David; Laue, Ernest; Osborne, Mark A.; Klenerman, David; Lee, Steven F.; Carr, Antony M.
2014-01-01
Development of single-molecule localization microscopy techniques has allowed nanometre scale localization accuracy inside cells, permitting the resolution of ultra-fine cell structure and the elucidation of crucial molecular mechanisms. Application of these methodologies to understanding processes underlying DNA replication and repair has been limited to defined in vitro biochemical analysis and prokaryotic cells. In order to expand these techniques to eukaryotic systems, we have further developed a photo-activated localization microscopy-based method to directly visualize DNA-associated proteins in unfixed eukaryotic cells. We demonstrate that motion blurring of fluorescence due to protein diffusivity can be used to selectively image the DNA-bound population of proteins. We designed and tested a simple methodology and show that it can be used to detect changes in DNA binding of a replicative helicase subunit, Mcm4, and the replication sliding clamp, PCNA, between different stages of the cell cycle and between distinct genetic backgrounds. PMID:25106872
Electrostatics of polymer translocation events in electrolyte solutions.
Buyukdagli, Sahin; Ala-Nissila, T
2016-07-07
We develop an analytical theory that accounts for the image and surface charge interactions between a charged dielectric membrane and a DNA molecule translocating through the membrane. Translocation events through neutral carbon-based membranes are driven by a competition between the repulsive DNA-image-charge interactions and the attractive coupling between the DNA segments on the trans and the cis sides of the membrane. The latter effect is induced by the reduction of the coupling by the dielectric membrane. In strong salt solutions where the repulsive image-charge effects dominate the attractive trans-cis coupling, the DNA molecule encounters a translocation barrier of ≈10 kBT. In dilute electrolytes, the trans-cis coupling takes over image-charge forces and the membrane becomes a metastable attraction point that can trap translocating polymers over long time intervals. This mechanism can be used in translocation experiments in order to control DNA motion by tuning the salt concentration of the solution.
Atomic-scale imaging of DNA using scanning tunnelling microscopy.
Driscoll, R J; Youngquist, M G; Baldeschwieler, J D
1990-07-19
The scanning tunnelling microscope (STM) has been used to visualize DNA under water, under oil and in air. Images of single-stranded DNA have shown that submolecular resolution is possible. Here we describe atomic-resolution imaging of duplex DNA. Topographic STM images of uncoated duplex DNA on a graphite substrate obtained in ultra-high vacuum are presented that show double-helical structure, base pairs, and atomic-scale substructure. Experimental STM profiles show excellent correlation with atomic contours of the van der Waals surface of A-form DNA derived from X-ray crystallography. A comparison of variations in the barrier to quantum mechanical tunnelling (barrier-height) with atomic-scale topography shows correlation over the phosphate-sugar backbone but anticorrelation over the base pairs. This relationship may be due to the different chemical characteristics of parts of the molecule. Further investigation of this phenomenon should lead to a better understanding of the physics of imaging adsorbates with the STM and may prove useful in sequencing DNA. The improved resolution compared with previously published STM images of DNA may be attributable to ultra-high vacuum, high data-pixel density, slow scan rate, a fortuitously clean and sharp tip and/or a relatively dilute and extremely clean sample solution. This work demonstrates the potential of the STM for characterization of large biomolecular structures, but additional development will be required to make such high resolution imaging of DNA and other large molecules routine.
Logic Gate Operation by DNA Translocation through Biological Nanopores.
Yasuga, Hiroki; Kawano, Ryuji; Takinoue, Masahiro; Tsuji, Yutaro; Osaki, Toshihisa; Kamiya, Koki; Miki, Norihisa; Takeuchi, Shoji
2016-01-01
Logical operations using biological molecules, such as DNA computing or programmable diagnosis using DNA, have recently received attention. Challenges remain with respect to the development of such systems, including label-free output detection and the rapidity of operation. Here, we propose integration of biological nanopores with DNA molecules for development of a logical operating system. We configured outputs "1" and "0" as single-stranded DNA (ssDNA) that is or is not translocated through a nanopore; unlabeled DNA was detected electrically. A negative-AND (NAND) operation was successfully conducted within approximately 10 min, which is rapid compared with previous studies using unlabeled DNA. In addition, this operation was executed in a four-droplet network. DNA molecules and associated information were transferred among droplets via biological nanopores. This system would facilitate linking of molecules and electronic interfaces. Thus, it could be applied to molecular robotics, genetic engineering, and even medical diagnosis and treatment.
Logic Gate Operation by DNA Translocation through Biological Nanopores
Takinoue, Masahiro; Tsuji, Yutaro; Osaki, Toshihisa; Kamiya, Koki; Miki, Norihisa; Takeuchi, Shoji
2016-01-01
Logical operations using biological molecules, such as DNA computing or programmable diagnosis using DNA, have recently received attention. Challenges remain with respect to the development of such systems, including label-free output detection and the rapidity of operation. Here, we propose integration of biological nanopores with DNA molecules for development of a logical operating system. We configured outputs “1” and “0” as single-stranded DNA (ssDNA) that is or is not translocated through a nanopore; unlabeled DNA was detected electrically. A negative-AND (NAND) operation was successfully conducted within approximately 10 min, which is rapid compared with previous studies using unlabeled DNA. In addition, this operation was executed in a four-droplet network. DNA molecules and associated information were transferred among droplets via biological nanopores. This system would facilitate linking of molecules and electronic interfaces. Thus, it could be applied to molecular robotics, genetic engineering, and even medical diagnosis and treatment. PMID:26890568
DNA Walkers as Transport Vehicles of Nanoparticles Along a Carbon Nanotube Track.
Pan, Jing; Cha, Tae-Gon; Chen, Haorong; Li, Feiran; Choi, Jong Hyun
2017-01-01
DNA-based molecular motors are synthetic analogs of naturally occurring protein motors. Typical DNA walkers are constructed from synthetic short DNA strands and are powered by various free energy changes during hybridization reactions. Due to the constraints set by their small physical dimension and slow kinetics, most DNA walkers are characterized by ensemble measurements that result in averaged kinetics data. Here we present a synthetic DNA walker system that exploits the extraordinary physicochemical properties of nanomaterials and the functionalities of DNA molecules, which enables real-time control and monitoring of single-DNA walkers over an extended period.
NASA Astrophysics Data System (ADS)
Fengyun, Yang; Kaige, Wang; Dan, Sun; Wei, Zhao; Hai-qing, Wang; Xin, He; Gui-ren, Wang; Jin-tao, Bai
2016-07-01
The electrodynamic characteristics of single DNA molecules moving within micro-/nano-fluidic channels are important in the design of biomedical chips and bimolecular sensors. In this study, the dynamic properties of λ-DNA molecules transferring along the microchannels driven by the external electrickinetic force were systemically investigated with the single molecule fluorescence imaging technique. The experimental results indicated that the velocity of DNA molecules was strictly dependent on the value of the applied electric field and the diameter of the channel. The larger the external electric field, the larger the velocity, and the more significant deformation of DNA molecules. More meaningfully, it was found that the moving directions of DNA molecules had two completely different directions: (i) along the direction of the external electric field, when the electric field intensity was smaller than a certain threshold value; (ii) opposite to the direction of the external electric field, when the electric field intensity was greater than the threshold electric field intensity. The reversal movement of DNA molecules was mainly determined by the competition between the electrophoresis force and the influence of electro-osmosis flow. These new findings will theoretically guide the practical application of fluidic channel sensors and lab-on-chips for precisely manipulating single DNA molecules. Project supported by the National Natural Science Foundation of China (Grant No. 61378083), the International Cooperation Foundation of the National Science and Technology Major Project of the Ministry of Science and Technology of China (Grant No. 2011DFA12220), the Major Research Plan of National Natural Science Foundation of China (Grant No. 91123030), and the Natural Science Foundation of Shaanxi Province of China (Grant Nos. 2010JS110 and 2013SZS03-Z01).
Nanopore detection of DNA molecules in crowded neutral polymer solutions
NASA Astrophysics Data System (ADS)
Sharma, Rajesh Kumar; Dai, Liang; Doyle, Patrick; Garaj, Slaven
Nanopore sensing is a precise technique for analysis of the structure and dynamics of individual biomolecules in different environments, and has even become a prominent technique for next-gen DNA sequencing. In the nanopore sensor, an individual DNA molecule is electrophoretically translocated through a single, nanometer-scaled pore in a solid-state membrane separating two chambers filled with electrolyte. The conformation of the molecule is deduced from modulations in the ionic current through the pore during the translocation event. Using nanopores, we investigated the dynamics of the DNA molecules in a crowded solution of neutral polymers of different sizes and concentrations. The translocation dynamics depends significantly on the size and concentration of the polymers, as different contributions to the electrophoretic and entropic forces on the DNA molecules come into play. This setup offers an excellent, tuneable model-system for probing biologically relevant questions regarding the behaviour of DNA molecules in highly confined and crowded environments. Singapore-MIT Alliance for Research and Technology.
Single molecule techniques in DNA repair: A primer
Hughes, Craig D.; Simons, Michelle; Mackenzie, Cassidy E.; Van Houten, Bennett; Kad, Neil M.
2016-01-01
A powerful new approach has become much more widespread and offers insights into aspects of DNA repair unattainable with billions of molecules. Single molecule techniques can be used to image, manipulate or characterize the action of a single repair protein on a single strand of DNA. This allows search mechanisms to be probed, and the effects of force to be understood. These physical aspects can dominate a biochemical reaction, where at the ensemble level their nuances are obscured. In this paper we discuss some of the many technical advances that permit study at the single molecule level. We focus on DNA repair to which these techniques are actively being applied. DNA repair is also a process that encompasses so much of what single molecule studies benefit – searching for targets, complex formation, sequential biochemical reactions and substrate hand-off to name just a few. We discuss how single molecule biophysics is poised to transform our understanding of biological systems, in particular DNA repair. PMID:24819596
The Evolution of DNA-Templated Synthesis as a Tool for Materials Discovery.
O'Reilly, Rachel K; Turberfield, Andrew J; Wilks, Thomas R
2017-10-17
Precise control over reactivity and molecular structure is a fundamental goal of the chemical sciences. Billions of years of evolution by natural selection have resulted in chemical systems capable of information storage, self-replication, catalysis, capture and production of light, and even cognition. In all these cases, control over molecular structure is required to achieve a particular function: without structural control, function may be impaired, unpredictable, or impossible. The search for molecules with a desired function is often achieved by synthesizing a combinatorial library, which contains many or all possible combinations of a set of chemical building blocks (BBs), and then screening this library to identify "successful" structures. The largest libraries made by conventional synthesis are currently of the order of 10 8 distinct molecules. To put this in context, there are 10 13 ways of arranging the 21 proteinogenic amino acids in chains up to 10 units long. Given that we know that a number of these compounds have potent biological activity, it would be highly desirable to be able to search them all to identify leads for new drug molecules. Large libraries of oligonucleotides can be synthesized combinatorially and translated into peptides using systems based on biological replication such as mRNA display, with selected molecules identified by DNA sequencing; but these methods are limited to BBs that are compatible with cellular machinery. In order to search the vast tracts of chemical space beyond nucleic acids and natural peptides, an alternative approach is required. DNA-templated synthesis (DTS) could enable us to meet this challenge. DTS controls chemical product formation by using the specificity of DNA hybridization to bring selected reactants into close proximity, and is capable of the programmed synthesis of many distinct products in the same reaction vessel. By making use of dynamic, programmable DNA processes, it is possible to engineer a system that can translate instructions coded as a sequence of DNA bases into a chemical structure-a process analogous to the action of the ribosome in living organisms but with the potential to create a much more chemically diverse set of products. It is also possible to ensure that each product molecule is tagged with its identifying DNA sequence. Compound libraries synthesized in this way can be exposed to selection against suitable targets, enriching successful molecules. The encoding DNA can then be amplified using the polymerase chain reaction and decoded by DNA sequencing. More importantly, the DNA instruction sequences can be mutated and reused during multiple rounds of amplification, translation, and selection. In other words, DTS could be used as the foundation for a system of synthetic molecular evolution, which could allow us to efficiently search a vast chemical space. This has huge potential to revolutionize materials discovery-imagine being able to evolve molecules for light harvesting, or catalysts for CO 2 fixation. The field of DTS has developed to the point where a wide variety of reactions can be performed on a DNA template. Complex architectures and autonomous "DNA robots" have been implemented for the controlled assembly of BBs, and these mechanisms have in turn enabled the one-pot synthesis of large combinatorial libraries. Indeed, DTS libraries are being exploited by pharmaceutical companies and have already found their way into drug lead discovery programs. This Account explores the processes involved in DTS and highlights the challenges that remain in creating a general system for molecular discovery by evolution.
The Evolution of DNA-Templated Synthesis as a Tool for Materials Discovery
2017-01-01
Conspectus Precise control over reactivity and molecular structure is a fundamental goal of the chemical sciences. Billions of years of evolution by natural selection have resulted in chemical systems capable of information storage, self-replication, catalysis, capture and production of light, and even cognition. In all these cases, control over molecular structure is required to achieve a particular function: without structural control, function may be impaired, unpredictable, or impossible. The search for molecules with a desired function is often achieved by synthesizing a combinatorial library, which contains many or all possible combinations of a set of chemical building blocks (BBs), and then screening this library to identify “successful” structures. The largest libraries made by conventional synthesis are currently of the order of 108 distinct molecules. To put this in context, there are 1013 ways of arranging the 21 proteinogenic amino acids in chains up to 10 units long. Given that we know that a number of these compounds have potent biological activity, it would be highly desirable to be able to search them all to identify leads for new drug molecules. Large libraries of oligonucleotides can be synthesized combinatorially and translated into peptides using systems based on biological replication such as mRNA display, with selected molecules identified by DNA sequencing; but these methods are limited to BBs that are compatible with cellular machinery. In order to search the vast tracts of chemical space beyond nucleic acids and natural peptides, an alternative approach is required. DNA-templated synthesis (DTS) could enable us to meet this challenge. DTS controls chemical product formation by using the specificity of DNA hybridization to bring selected reactants into close proximity, and is capable of the programmed synthesis of many distinct products in the same reaction vessel. By making use of dynamic, programmable DNA processes, it is possible to engineer a system that can translate instructions coded as a sequence of DNA bases into a chemical structure—a process analogous to the action of the ribosome in living organisms but with the potential to create a much more chemically diverse set of products. It is also possible to ensure that each product molecule is tagged with its identifying DNA sequence. Compound libraries synthesized in this way can be exposed to selection against suitable targets, enriching successful molecules. The encoding DNA can then be amplified using the polymerase chain reaction and decoded by DNA sequencing. More importantly, the DNA instruction sequences can be mutated and reused during multiple rounds of amplification, translation, and selection. In other words, DTS could be used as the foundation for a system of synthetic molecular evolution, which could allow us to efficiently search a vast chemical space. This has huge potential to revolutionize materials discovery—imagine being able to evolve molecules for light harvesting, or catalysts for CO2 fixation. The field of DTS has developed to the point where a wide variety of reactions can be performed on a DNA template. Complex architectures and autonomous “DNA robots” have been implemented for the controlled assembly of BBs, and these mechanisms have in turn enabled the one-pot synthesis of large combinatorial libraries. Indeed, DTS libraries are being exploited by pharmaceutical companies and have already found their way into drug lead discovery programs. This Account explores the processes involved in DTS and highlights the challenges that remain in creating a general system for molecular discovery by evolution. PMID:28915003
Constructing Smart Protocells with Built-In DNA Computational Core to Eliminate Exogenous Challenge.
Lyu, Yifan; Wu, Cuichen; Heinke, Charles; Han, Da; Cai, Ren; Teng, I-Ting; Liu, Yuan; Liu, Hui; Zhang, Xiaobing; Liu, Qiaoling; Tan, Weihong
2018-06-06
A DNA reaction network is like a biological algorithm that can respond to "molecular input signals", such as biological molecules, while the artificial cell is like a microrobot whose function is powered by the encapsulated DNA reaction network. In this work, we describe the feasibility of using a DNA reaction network as the computational core of a protocell, which will perform an artificial immune response in a concise way to eliminate a mimicked pathogenic challenge. Such a DNA reaction network (RN)-powered protocell can realize the connection of logical computation and biological recognition due to the natural programmability and biological properties of DNA. Thus, the biological input molecules can be easily involved in the molecular computation and the computation process can be spatially isolated and protected by artificial bilayer membrane. We believe the strategy proposed in the current paper, i.e., using DNA RN to power artificial cells, will lay the groundwork for understanding the basic design principles of DNA algorithm-based nanodevices which will, in turn, inspire the construction of artificial cells, or protocells, that will find a place in future biomedical research.
DNA-templated synthesis of Pt nanoparticles on single-walled carbon nanotubes.
Dong, Lifeng
2009-11-18
A series of electron microscopy characterizations demonstrate that single-stranded deoxyribonucleic acid (ssDNA) can bind to nanotube surfaces and disperse bundled single-walled carbon nanotubes (SWCNTs) into individual tubes. The ssDNA molecules on the nanotube surfaces demonstrate various morphologies, such as aggregated clusters and spiral wrapping around a nanotube with different pitches and spaces, indicating that the morphology of the SWCNT/DNA hybrids is not related solely to the base sequence of the ssDNA or the chirality or the diameter of the nanotubes. In addition to serving as a non-covalent dispersion agent, the ssDNA molecules bonded to the nanotube surface can provide addresses for localizing Pt(II) complexes along the nanotubes. The Pt nanoparticles obtained by a reduction of the Pt2+-DNA adducts are crystals with a size of < or =1-2 nm. These results expand our understanding of the interactions between ssDNA and SWCNTs and provide an efficient approach for positioning Pt and other metal particles, with uniform sizes and without aggregations, along the nanotube surfaces for applications in direct ethanol/methanol fuel cells and nanoscale electronics.
Single molecular biology: coming of age in DNA replication.
Liu, Xiao-Jing; Lou, Hui-Qiang
2017-09-20
DNA replication is an essential process of the living organisms. To achieve precise and reliable replication, DNA polymerases play a central role in DNA synthesis. Previous investigations have shown that the average rates of DNA synthesis on the leading and lagging strands in a replisome must be similar to avoid the formation of significant gaps in the nascent strands. The underlying mechanism has been assumed to be coordination between leading- and lagging-strand polymerases. However, Kowalczykowski's lab members recently performed single molecule techniques in E. coli and showed the real-time behavior of a replisome. The leading- and lagging-strand polymerases function stochastically and independently. Furthermore, when a DNA polymerase is paused, the helicase slows down in a self-regulating fail-safe mechanism, akin to a ''dead-man's switch''. Based on the real-time single-molecular observation, the authors propose that leading- and lagging-strand polymerases synthesize DNA stochastically within a Gaussian distribution. Along with the development and application of single-molecule techniques, we will witness a new age of DNA replication and other biological researches.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta
By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency.more » The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.« less
Trehalose facilitates DNA melting: a single-molecule optical tweezers study.
Bezrukavnikov, Sergey; Mashaghi, Alireza; van Wijk, Roeland J; Gu, Chan; Yang, Li Jiang; Gao, Yi Qin; Tans, Sander J
2014-10-07
Using optical tweezers, here we show that the overstretching transition force of double-stranded DNA (dsDNA) is lowered significantly by the addition of the disaccharide trehalose as well as certain polyol osmolytes. This effect is found to depend linearly on the logarithm of the trehalose concentration. We propose an entropic driving mechanism for the experimentally observed destabilization of dsDNA that is rooted in the higher affinity of the DNA bases for trehalose than for water, which promotes base exposure and DNA melting. Molecular dynamics simulation reveals the direct interaction of trehalose with nucleobases. Experiments with other osmolytes confirm that the extent of dsDNA destabilization is governed by the ratio between polar and apolar fractions of an osmolyte.
Identifying active foraminifera in the Sea of Japan using metatranscriptomic approach
NASA Astrophysics Data System (ADS)
Lejzerowicz, Franck; Voltsky, Ivan; Pawlowski, Jan
2013-02-01
Metagenetics represents an efficient and rapid tool to describe environmental diversity patterns of microbial eukaryotes based on ribosomal DNA sequences. However, the results of metagenetic studies are often biased by the presence of extracellular DNA molecules that are persistent in the environment, especially in deep-sea sediment. As an alternative, short-lived RNA molecules constitute a good proxy for the detection of active species. Here, we used a metatranscriptomic approach based on RNA-derived (cDNA) sequences to study the diversity of the deep-sea benthic foraminifera and compared it to the metagenetic approach. We analyzed 257 ribosomal DNA and cDNA sequences obtained from seven sediments samples collected in the Sea of Japan at depths ranging from 486 to 3665 m. The DNA and RNA-based approaches gave a similar view of the taxonomic composition of foraminiferal assemblage, but differed in some important points. First, the cDNA dataset was dominated by sequences of rotaliids and robertiniids, suggesting that these calcareous species, some of which have been observed in Rose Bengal stained samples, are the most active component of foraminiferal community. Second, the richness of monothalamous (single-chambered) foraminifera was particularly high in DNA extracts from the deepest samples, confirming that this group of foraminifera is abundant but not necessarily very active in the deep-sea sediments. Finally, the high divergence of undetermined sequences in cDNA dataset indicate the limits of our database and lack of knowledge about some active but possibly rare species. Our study demonstrates the capability of the metatranscriptomic approach to detect active foraminiferal species and prompt its use in future high-throughput sequencing-based environmental surveys.
Fluorescence Microscopy of Nanochannel-Confined DNA.
Westerlund, Fredrik; Persson, Fredrik; Fritzsche, Joachim; Beech, Jason P; Tegenfeldt, Jonas O
2018-01-01
Stretching of DNA in nanoscale confinement allows for several important studies. The genetic contents of the DNA can be visualized on the single DNA molecule level and both the polymer physics of confined DNA and also DNA/protein and other DNA/DNA-binding molecule interactions can be explored. This chapter describes the basic steps to fabricate the nanostructures, perform the experiments and analyze the data.
Matsumoto, Atsushi; Tobias, Irwin; Olson, Wilma K
2005-01-01
Fine structural and energetic details embedded in the DNA base sequence, such as intrinsic curvature, are important to the packaging and processing of the genetic material. Here we investigate the internal dynamics of a 200 bp closed circular molecule with natural curvature using a newly developed normal-mode treatment of DNA in terms of neighboring base-pair "step" parameters. The intrinsic curvature of the DNA is described by a 10 bp repeating pattern of bending distortions at successive base-pair steps. We vary the degree of intrinsic curvature and the superhelical stress on the molecule and consider the normal-mode fluctuations of both the circle and the stable figure-8 configuration under conditions where the energies of the two states are similar. To extract the properties due solely to curvature, we ignore other important features of the double helix, such as the extensibility of the chain, the anisotropy of local bending, and the coupling of step parameters. We compare the computed normal modes of the curved DNA model with the corresponding dynamical features of a covalently closed duplex of the same chain length constructed from naturally straight DNA and with the theoretically predicted dynamical properties of a naturally circular, inextensible elastic rod, i.e., an O-ring. The cyclic molecules with intrinsic curvature are found to be more deformable under superhelical stress than rings formed from naturally straight DNA. As superhelical stress is accumulated in the DNA, the frequency, i.e., energy, of the dominant bending mode decreases in value, and if the imposed stress is sufficiently large, a global configurational rearrangement of the circle to the figure-8 form takes place. We combine energy minimization with normal-mode calculations of the two states to decipher the configurational pathway between the two states. We also describe and make use of a general analytical treatment of the thermal fluctuations of an elastic rod to characterize the motions of the minicircle as a whole from knowledge of the full set of normal modes. The remarkable agreement between computed and theoretically predicted values of the average deviation and dispersion of the writhe of the circular configuration adds to the reliability in the computational approach. Application of the new formalism to the computed modes of the figure-8 provides insights into macromolecular motions which are beyond the scope of current theoretical treatments.
Genetics Home Reference: mitochondrial neurogastrointestinal encephalopathy disease
... modification) is used as a building block of DNA . Thymidine phosphorylase breaks down thymidine into smaller molecules, ... molecule is damaging to a particular kind of DNA known as mitochondrial DNA or mtDNA. Mitochondria are ...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in
2015-07-28
Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging themore » ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.« less
DNA recombination activity in soybean mitochondria.
Manchekar, Medha; Scissum-Gunn, Karyn; Song, Daqing; Khazi, Fayaz; McLean, Stephanie L; Nielsen, Brent L
2006-02-17
Mitochondrial genomes in higher plants are much larger and more complex as compared to animal mitochondrial genomes. There is growing evidence that plant mitochondrial genomes exist predominantly as a collection of linear and highly branched DNA molecules and replicate by a recombination-dependent mechanism. However, biochemical evidence of mitochondrial DNA (mtDNA) recombination activity in plants has previously been lacking. We provide the first report of strand-invasion activity in plant mitochondria. Similar to bacterial RecA, this activity from soybean is dependent on the presence of ATP and Mg(2+). Western blot analysis using an antibody against the Arabidopsis mitochondrial RecA protein shows cross-reaction with a soybean protein of about 44 kDa, indicating conservation of this protein in at least these two plant species. mtDNA structure was analyzed by electron microscopy of total soybean mtDNA and molecules recovered after field-inversion gel electrophoresis (FIGE). While most molecules were found to be linear, some molecules contained highly branched DNA structures and a small but reproducible proportion consisted of circular molecules (many with tails) similar to recombination intermediates. The presence of recombination intermediates in plant mitochondria preparations is further supported by analysis of mtDNA molecules by 2-D agarose gel electrophoresis, which indicated the presence of complex recombination structures along with a considerable amount of single-stranded DNA. These data collectively provide convincing evidence for the occurrence of homologous DNA recombination in plant mitochondria.
Recombinant DNA encoding a desulfurization biocatalyst
Rambosek, John; Piddington, Chris S.; Kovacevich, Brian R.; Young, Kevin D.; Denome, Sylvia A.
1994-01-01
This invention relates to a recombinant DNA molecule containing a gene or genes which encode a biocatalyst capable of desulfurizing a fossil fuel which contains organic sulfur molecules. For example, the present invention encompasses a recombinant DNA molecule containing a gene or genes of a strain of Rhodococcus rhodochrous.
Gene Transfer in Eukaryotic Cells Using Activated Dendrimers
NASA Astrophysics Data System (ADS)
Dennig, Jörg
Gene transfer into eukaryotic cells plays an important role in cell biology. Over the last 30 years a number of transfection methods have been developed to mediate gene transfer into eukaryotic cells. Classical methods include co-precipitation of DNA with calcium phosphate, charge-dependent precipitation of DNA with DEAE-dextran, electroporation of nucleic acids, and formation of transfection complexes between DNA and cationic liposomes. Gene transfer technologies based on activated PAMAM-dendrimers provide another class of transfection reagents. PAMAM-dendrimers are highly branched, spherical molecules. Activation of newly synthesized dendrimers involves hydrolytic removal of some of the branches, and results in a molecule with a higher degree of flexibility. Activated dendrimers assemble DNA into compact structures via charge interactions. Activated dendrimer - DNA complexes bind to the cell membrane of eukaryotic cells, and are transported into the cell by non-specific endocytosis. A structural model of the activated dendrimer - DNA complex and a potential mechanism for its uptake into cells will be discussed.
Effect of genome sequence on the force-induced unzipping of a DNA molecule.
Singh, N; Singh, Y
2006-02-01
We considered a dsDNA polymer in which distribution of bases are random at the base pair level but ordered at a length of 18 base pairs and calculated its force elongation behaviour in the constant extension ensemble. The unzipping force F(y) vs. extension y is found to have a series of maxima and minima. By changing base pairs at selected places in the molecule we calculated the change in F(y) curve and found that the change in the value of force is of the order of few pN and the range of the effect depending on the temperature, can spread over several base pairs. We have also discussed briefly how to calculate in the constant force ensemble a pause or a jump in the extension-time curve from the knowledge of F(y).
Wood, Bayden R
2016-04-07
Since Watson and Crick's historical papers on the structure and function of DNA based on Rosalind Franklin's and Maurice Wilkin's X-ray diffraction patterns tremendous scientific curiosity has been aroused by the unique and dynamic structure of the molecule of life. A-DNA and B-DNA represent different conformations of the DNA molecule, which is stabilised by hydrogen interactions between base pairs, stacking interactions between neighboring bases and long-range intra- and inter-backbone forces. This review highlights the contribution Fourier transform infrared (FTIR) spectroscopy has made to the understanding of DNA conformation in relation to hydration and its potential role in clinical diagnostics. The review will first begin by elucidating the main forms of DNA conformation found in nature and the general structures of the A, B and Z forms. This is followed by a detailed critique on infrared spectroscopy applied to DNA conformation highlighting pivotal studies on isolated DNA, polynucleotides, nucleoprotein and nucleohistone complexes. A discussion on the potential of diagnosing cancer using FTIR spectroscopy based on the detection of DNA bands in cells and tissues will ensue, highlighting the recent studies investigating the conformation of DNA in hydrated and dehydrated cells. The method of hydration as a way to facilitate DNA conformational band assignment will be discussed and the conformational change to the A-form upon dehydration will be used to explain the reason for the apparent lack of FTIR DNA signals observed in fixed or air-dried cells and tissues. The advantages of investigating B-DNA in the hydrated state, as opposed to A-DNA in the dehydrated state, are exemplified in a series of studies that show: (1) improved quantification of DNA in cells; (2) improved discrimination and reproducibility of FTIR spectra recorded of cells progressing through the cell cycle; (3) insights into the biological significance of A-DNA as evidenced by an interesting study on bacteria, which can survive desiccation and at the same time undergo the B-A-B transition. Finally, the importance of preserving the B-DNA conformation for the diagnosis of cancer is put forward as way to improve the sensitivity of this powerful technique.
Rapid purification of circular DNA by triplex-mediated affinity capture
Ji, Huamin; Smith, Lloyd M.
1997-01-01
A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support.
Zanchetta, Giuliano; Giavazzi, Fabio; Nakata, Michi; Buscaglia, Marco; Cerbino, Roberto; Clark, Noel A.; Bellini, Tommaso
2010-01-01
Concentrated solutions of duplex-forming DNA oligomers organize into various mesophases among which is the nematic (N∗), which exhibits a macroscopic chiral helical precession of molecular orientation because of the chirality of the DNA molecule. Using a quantitative analysis of the transmission spectra in polarized optical microscopy, we have determined the handedness and pitch of this chiral nematic helix for a large number of sequences ranging from 8 to 20 bases. The B-DNA molecule exhibits a right-handed molecular double-helix structure that, for long molecules, always yields N∗ phases with left-handed pitch in the μm range. We report here that ultrashort oligomeric duplexes show an extremely diverse behavior, with both left- and right-handed N∗ helices and pitches ranging from macroscopic down to 0.3 μm. The behavior depends on the length and the sequence of the oligomers, and on the nature of the end-to-end interactions between helices. In particular, the N∗ handedness strongly correlates with the oligomer length and concentration. Right-handed phases are found only for oligomers shorter than 14 base pairs, and for the sequences having the transition to the N∗ phase at concentration larger than 620 mg/mL. Our findings indicate that in short DNA, the intermolecular double-helical interactions switch the preferred liquid crystal handedness when the columns of stacked duplexes are forced at high concentrations to separations comparable to the DNA double-helix pitch, a regime still to be theoretically described. PMID:20876125
Liu, Meng; Song, Jinping; Shuang, Shaomin; Dong, Chuan; Brennan, John D; Li, Yingfu
2014-06-24
We report a versatile biosensing platform capable of achieving ultrasensitive detection of both small-molecule and macromolecular targets. The system features three components: reduced graphene oxide for its ability to adsorb single-stranded DNA molecules nonspecifically, DNA aptamers for their ability to bind reduced graphene oxide but undergo target-induced conformational changes that facilitate their release from the reduced graphene oxide surface, and rolling circle amplification (RCA) for its ability to amplify a primer-template recognition event into repetitive sequence units that can be easily detected. The key to the design is the tagging of a short primer to an aptamer sequence, which results in a small DNA probe that allows for both effective probe adsorption onto the reduced graphene oxide surface to mask the primer domain in the absence of the target, as well as efficient probe release in the presence of the target to make the primer available for template binding and RCA. We also made an observation that the circular template, which on its own does not cause a detectable level of probe release from the reduced graphene oxide, augments target-induced probe release. The synergistic release of DNA probes is interpreted to be a contributing factor for the high detection sensitivity. The broad utility of the platform is illustrated though engineering three different sensors that are capable of achieving ultrasensitive detection of a protein target, a DNA sequence and a small-molecule analyte. We envision that the approach described herein will find useful applications in the biological, medical, and environmental fields.
NASA Astrophysics Data System (ADS)
Hanasaki, Itsuo; Yukimoto, Naoya; Uehara, Satoshi; Shintaku, Hirofumi; Kawano, Satoyuki
2015-04-01
Because long DNA molecules usually exist in random coil states due to the entropic effect, linearisation is required for devices equipped with nanopores where electrical sequencing is necessary during single-file translocation. We present a novel technique for linearising DNA molecules in a micro-channel. In our device, electrodes are embedded in the bottom surface of the channel. The application of a voltage induces the trapping of λDNA molecules on the positive electrode. An instantaneous voltage drop is used to put the λDNA molecules in a partly released state and the hydrodynamic force of the solution induces linearisation. Phenomena were directly observed using an optical microscopy system equipped with a high-speed camera and the linearisation principle was explored in detail. Furthermore, we estimate the tensile characteristics produced by the flow of the solution through a numerical model of a tethered polymer subject to a Poiseuille flow. The mean tensile force is in the range of 0.1-1 pN. This is sufficiently smaller than the structural transition point of λDNA but counterbalances the entropic elasticity that causes the random coil shape of λDNA molecules in solution. We show the important role of thermal fluctuation in the manipulation of molecules in solution and clarify the tensile conditions required for DNA linearisation using a combination of solution flow and voltage variation in a microchannel.
Chikkaraddy, Rohit; Turek, V A; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F; Baumberg, Jeremy J
2018-01-10
Fabricating nanocavities in which optically active single quantum emitters are precisely positioned is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5 nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore and obtain enhancements of ≥4 × 10 3 with high quantum yield (≥50%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of ±1.5 nm. Our approach introduces a straightforward noninvasive way to measure and quantify confined optical modes on the nanoscale.
Knowledge-Based Elastic Potentials for Docking Drugs or Proteins with Nucleic Acids
Ge, Wei; Schneider, Bohdan; Olson, Wilma K.
2005-01-01
Elastic ellipsoidal functions defined by the observed hydration patterns around the DNA bases provide a new basis for measuring the recognition of ligands in the grooves of double-helical structures. Here a set of knowledge-based potentials suitable for quantitative description of such behavior is extracted from the observed positions of water molecules and amino acid atoms that form hydrogen bonds with the nitrogenous bases in high resolution crystal structures. Energies based on the displacement of hydrogen-bonding sites on drugs in DNA-crystal complexes relative to the preferred locations of water binding around the heterocyclic bases are low, pointing to the reliability of the potentials and the apparent displacement of water molecules by drug atoms in these structures. The validity of the energy functions has been further examined in a series of sequence substitution studies based on the structures of DNA bound to polyamides that have been designed to recognize the minor-groove edges of Watson-Crick basepairs. The higher energies of binding to incorrect sequences superimposed (without conformational adjustment or displacement of polyamide ligands) on observed high resolution structures confirm the hypothesis that the drug subunits associate with specific DNA bases. The knowledge-based functions also account satisfactorily for the measured free energies of DNA-polyamide association in solution and the observed sites of polyamide binding on nucleosomal DNA. The computations are generally consistent with mechanisms by which minor-groove binding ligands are thought to recognize DNA basepairs. The calculations suggest that the asymmetric distributions of hydrogen-bond-forming atoms on the minor-groove edge of the basepairs may underlie ligand discrimination of G·C from C·G pairs, in addition to the commonly believed role of steric hindrance. The analysis of polyamide-bound nucleosomal structures reveals other discrepancies in the expected chemical design, including unexpected contacts to DNA and modified basepair targets of some ligands. The ellipsoidal potentials thus appear promising as a mathematical tool for the study of drug- and protein-DNA interactions and for gaining new insights into DNA-binding mechanisms. PMID:15501936
Recombinant DNA encoding a desulfurization biocatalyst
Rambosek, J.; Piddington, C.S.; Kovacevich, B.R.; Young, K.D.; Denome, S.A.
1994-10-18
This invention relates to a recombinant DNA molecule containing a gene or genes which encode a biocatalyst capable of desulfurizing a fossil fuel which contains organic sulfur molecules. For example, the present invention encompasses a recombinant DNA molecule containing a gene or genes of a strain of Rhodococcus rhodochrous. 13 figs.
Osmylated DNA, a novel concept for sequencing DNA using nanopores
NASA Astrophysics Data System (ADS)
Kanavarioti, Anastassia
2015-03-01
Saenger sequencing has led the advances in molecular biology, while faster and cheaper next generation technologies are urgently needed. A newer approach exploits nanopores, natural or solid-state, set in an electrical field, and obtains base sequence information from current variations due to the passage of a ssDNA molecule through the pore. A hurdle in this approach is the fact that the four bases are chemically comparable to each other which leads to small differences in current obstruction. ‘Base calling’ becomes even more challenging because most nanopores sense a short sequence and not individual bases. Perhaps sequencing DNA via nanopores would be more manageable, if only the bases were two, and chemically very different from each other; a sequence of 1s and 0s comes to mind. Osmylated DNA comes close to such a sequence of 1s and 0s. Osmylation is the addition of osmium tetroxide bipyridine across the C5-C6 double bond of the pyrimidines. Osmylation adds almost 400% mass to the reactive base, creates a sterically and electronically notably different molecule, labeled 1, compared to the unreactive purines, labeled 0. If osmylated DNA were successfully sequenced, the result would be a sequence of osmylated pyrimidines (1), and purines (0), and not of the actual nucleobases. To solve this problem we studied the osmylation reaction with short oligos and with M13mp18, a long ssDNA, developed a UV-vis assay to measure extent of osmylation, and designed two protocols. Protocol A uses mild conditions and yields osmylated thymidines (1), while leaving the other three bases (0) practically intact. Protocol B uses harsher conditions and effectively osmylates both pyrimidines, but not the purines. Applying these two protocols also to the complementary of the target polynucleotide yields a total of four osmylated strands that collectively could define the actual base sequence of the target DNA.
NASA Astrophysics Data System (ADS)
Shafirovich, Vladimir; Singh, Carolyn; Geacintov, Nicholas E.
2003-11-01
Oxidative damage of DNA molecules associated with electron-transfer reactions is an important phenomenon in living cells, which can lead to mutations and contribute to carcinogenesis and the aging processes. This article describes the design of several simple experiments to explore DNA damage initiated by photoinduced electron-transfer reactions sensitized by the acridine derivative, proflavine (PF). A supercoiled DNA agarose gel nicking assay is employed as a sensitive probe of DNA strand cleavage. A low-cost experimental and computer-interfaced imaging apparatus is described allowing for the digital recording and analysis of the gel electrophoresis results. The first experiment describes the formation of direct strand breaks in double-stranded DNA induced by photoexcitation of the intercalated PF molecules. The second experiment demonstrates that the addition of the well-known electron acceptor, methylviologen, gives rise to a significant enhancement of the photochemical DNA strand cleavage effect. This occurs by an electron transfer step to methylviologen that renders the inital photoinduced charge separation between photoexcited PF and DNA irreversible. The third experiment demonstrates that the action spectrum of the DNA photocleavage matches the absorption spectrum of DNA-bound, intercalated PF molecules, which differs from that of free PF molecules. This result demonstrates that the photoinduced DNA strand cleavage is initiated by intercalated rather than free PF molecules.
CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules
NASA Astrophysics Data System (ADS)
Sarangi, S. N.; Sahu, S. N.; Nozaki, S.
2018-03-01
CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of <220>. Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.
Kieff, Elliott; Levine, Judith
1974-01-01
At least 90% of the sequences of purified, in vitro labeled, DNA from Epstein-Barr virus (prepared from HR-1, Burkitt's lymphoblastoid cells) are homologous to the DNA of the herpes virus contained in cell lines derived from patients with infectious mononucleosis. The thermal stability of the homologous and heterologous hybrid DNA molecules could not be differentiated, indicating at least 97% matching of base pairs between DNA of Epstein-Barr virus and the herpes viral DNA contained in the lymphoblasts from patients with infectious mononucleosis. PMID:4360941
Visnapuu, Mari-Liis; Fazio, Teresa; Wind, Shalom; Greene, Eric C.
2009-01-01
The analysis of individual molecules is evolving into an important tool for biological research, and presents conceptually new ways of approaching experimental design strategies. However, more robust methods are required if these technologies are to be made broadly available to the biological research community. To help achieve this goal we have combined nanofabrication techniques with single-molecule optical microscopy for assembling and visualizing curtains comprised of thousands of individual DNA molecules organized at engineered diffusion barriers on a lipid bilayer-coated surface. Here we present an important extension of this technology that implements geometric barrier patterns comprised of thousands of nanoscale wells that can be loaded with single molecules of DNA. We show that these geometric nanowells can be used to precisely control the lateral distribution of the individual DNA molecules within curtains assembled along the edges of the engineered barrier patterns. The individual molecules making up the DNA curtain can be separated from one another by a user-defined distance dictated by the dimensions of the nanowells. We demonstrate the broader utility of these patterned DNA curtains in a novel, real time restriction assay that we refer to as dynamic optical restriction mapping, which can be used to rapidly identify entire sets of cleavage sites within a large DNA molecule. PMID:18788761
Mapping Base Modifications in DNA by Transverse-Current Sequencing
NASA Astrophysics Data System (ADS)
Alvarez, Jose R.; Skachkov, Dmitry; Massey, Steven E.; Kalitsov, Alan; Velev, Julian P.
2018-02-01
Sequencing DNA modifications and lesions, such as methylation of cytosine and oxidation of guanine, is even more important and challenging than sequencing the genome itself. The traditional methods for detecting DNA modifications are either insensitive to these modifications or require additional processing steps to identify a particular type of modification. Transverse-current sequencing in nanopores can potentially identify the canonical bases and base modifications in the same run. In this work, we demonstrate that the most common DNA epigenetic modifications and lesions can be detected with any predefined accuracy based on their tunneling current signature. Our results are based on simulations of the nanopore tunneling current through DNA molecules, calculated using nonequilibrium electron-transport methodology within an effective multiorbital model derived from first-principles calculations, followed by a base-calling algorithm accounting for neighbor current-current correlations. This methodology can be integrated with existing experimental techniques to improve base-calling fidelity.
Conformation-dependent DNA attraction.
Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang
2014-06-21
Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg(2+) ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg(2+) or Na(+), benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg(2+) bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.
Seeing believes: Watching entangled sculpted branched DNA in real time
NASA Astrophysics Data System (ADS)
Jee, Ah-Young; Guan, Juan; Chen, Kejia; Granick, Steve
2015-03-01
The importance of branching in polymer physics is universally accepted but the details are disputed. We have sculpted DNA to various degrees of branching and used single-molecule tracking to image its diffusion in real time when entangled. By ligating three identical or varying length DNA segments, we construct symmetric and asymmetric ?Y? branches from elements of lambda-DNA with 16 um contour length, allowing for single-molecule visualization of equilibrium dynamics. Using home-written software, a full statistical distribution based on at least hundreds of trajectories is quantified with focus on discriminating arm-retraction from branch point motion. Some part of our observations is consistent with the anticipated ?relaxation through arm retraction? mechanism but other observations do not appear to be anticipated theoretically. Currently working as a researcher in Institute for Basic Science.
Karas, Vlad O; Sinnott-Armstrong, Nicholas A; Varghese, Vici; Shafer, Robert W; Greenleaf, William J; Sherlock, Gavin
2018-01-01
Abstract Much of the within species genetic variation is in the form of single nucleotide polymorphisms (SNPs), typically detected by whole genome sequencing (WGS) or microarray-based technologies. However, WGS produces mostly uninformative reads that perfectly match the reference, while microarrays require genome-specific reagents. We have developed Diff-seq, a sequencing-based mismatch detection assay for SNP discovery without the requirement for specialized nucleic-acid reagents. Diff-seq leverages the Surveyor endonuclease to cleave mismatched DNA molecules that are generated after cross-annealing of a complex pool of DNA fragments. Sequencing libraries enriched for Surveyor-cleaved molecules result in increased coverage at the variant sites. Diff-seq detected all mismatches present in an initial test substrate, with specific enrichment dependent on the identity and context of the variation. Application to viral sequences resulted in increased observation of variant alleles in a biologically relevant context. Diff-Seq has the potential to increase the sensitivity and efficiency of high-throughput sequencing in the detection of variation. PMID:29361139
Yang, Xiang; Yang, Ke; Zhao, Xiang; Lin, Zhongquan; Liu, Zhiyong; Luo, Sha; Zhang, Yang; Wang, Yunxia; Fu, Weiling
2017-12-04
The demand for rapid and sensitive bacterial detection is continuously increasing due to the significant requirements of various applications. In this study, a terahertz (THz) biosensor based on rolling circle amplification (RCA) was developed for the isothermal detection of bacterial DNA. The synthetic bacterium-specific sequence of 16S rDNA hybridized with a padlock probe (PLP) that contains a sequence fully complementary to the target sequence at the 5' and 3' ends. The linear PLP was circularized by ligation to form a circular PLP upon recognition of the target sequence; then the capture probe (CP) immobilized on magnetic beads (MBs) acted as a primer to initialize RCA. As DNA molecules are much less absorptive than water molecules in the THz range, the RCA products on the surface of the MBs cause a significant decrease in THz absorption, which can be sensitively probed by THz spectroscopy. Our results showed that 0.12 fmol of synthetic bacterial DNA and 0.05 ng μL -1 of genomic DNA could be effectively detected using this assay. In addition, the specificity of this strategy was demonstrated by its low signal response to interfering bacteria. The proposed strategy not only represents a new method for the isothermal detection of the target bacterial DNA but also provides a general methodology for sensitive and specific DNA biosensing using THz spectroscopy.
Wyhs, Nicolas; Walker, David; Giovinazzo, Hugh; Yegnasubramanian, Srinivasan; Nelson, William G
2014-08-01
Methylated DNA binding proteins such as Methyl-CpG Binding Domain Protein 2 (MBD2) can transduce DNA methylation alterations into a repressive signal by recruiting transcriptional co-repressor complexes. Interfering with MBD2 could lead to reactivation of tumor suppressor genes and therefore represents an attractive strategy for epigenetic therapy. We developed and compared fluorescence polarization (FP) and time-resolved fluorescence resonance energy transfer (TR-FRET)-based high-throughput screening (HTS) assays to identify small-molecule inhibitors of the interaction between the methyl binding domain of MBD2 (MBD2-MBD) and methylated DNA. Although both assays performed well in 96-well format, the TR-FRET assay (Z' factor = 0.58) emerged as a superior screening strategy compared with FP (Z' factor = 0.08) when evaluated in an HTS 384-well plate format. Using TR-FRET, we screened the Sigma LOPAC library for MBD2-MBD inhibitors and identified four compounds that also validated in a dose-response series. This included two known DNA intercalators (mitoxantrone and idarubicin) among two other inhibitory compounds (NF449 and aurintricarboxylic acid). All four compounds also inhibited the binding of SP-1, a transcription factor with a GC-rich binding sequence, to a methylated oligonucleotide, demonstrating that the activity was nonspecific. Our results provide proof of principle for using TR-FRET-based HTS to identify small-molecule inhibitors of MBD2 and other DNA-protein interactions. © 2014 Society for Laboratory Automation and Screening.
Noise reduction in single time frame optical DNA maps
Müller, Vilhelm; Westerlund, Fredrik
2017-01-01
In optical DNA mapping technologies sequence-specific intensity variations (DNA barcodes) along stretched and stained DNA molecules are produced. These “fingerprints” of the underlying DNA sequence have a resolution of the order one kilobasepairs and the stretching of the DNA molecules are performed by surface adsorption or nano-channel setups. A post-processing challenge for nano-channel based methods, due to local and global random movement of the DNA molecule during imaging, is how to align different time frames in order to produce reproducible time-averaged DNA barcodes. The current solutions to this challenge are computationally rather slow. With high-throughput applications in mind, we here introduce a parameter-free method for filtering a single time frame noisy barcode (snap-shot optical map), measured in a fraction of a second. By using only a single time frame barcode we circumvent the need for post-processing alignment. We demonstrate that our method is successful at providing filtered barcodes which are less noisy and more similar to time averaged barcodes. The method is based on the application of a low-pass filter on a single noisy barcode using the width of the Point Spread Function of the system as a unique, and known, filtering parameter. We find that after applying our method, the Pearson correlation coefficient (a real number in the range from -1 to 1) between the single time-frame barcode and the time average of the aligned kymograph increases significantly, roughly by 0.2 on average. By comparing to a database of more than 3000 theoretical plasmid barcodes we show that the capabilities to identify plasmids is improved by filtering single time-frame barcodes compared to the unfiltered analogues. Since snap-shot experiments and computational time using our method both are less than a second, this study opens up for high throughput optical DNA mapping with improved reproducibility. PMID:28640821
Stigter, Dirk
2004-07-01
Brewer et al. (Biophys. J. 85 (2003) 2519-2524) have studied the compaction of dsDNA in a double flow cell by observing the extension of stained DNA tethered in buffer solutions with or without Abf2p. They use a Langmuir adsorption model in which one Abf2p molecule adsorbs on one site on the DNA, and the binding constant, K, is given as the ratio of the experimental rates of adsorption and desorption. This paper presents an improved interpretation. Instead of Langmuir adsorption we use the more appropriate McGhee-von Hippel (J. Mol. Biol. 86 (1974) 469-489) theory for the adsorption of large ligands to a one-dimensional lattice. We assume that each adsorbed molecule shortens the effective contour length of DNA by the foot print of Abf2p of 27 base pairs. When Abf2p adsorbs to DNA stretched in the flowing buffer solution, we account for a tension effect that decreases the adsorption rate and the binding constant by a factor of 2 to 4. The data suggest that the accessibility to Abf2p decreases significantly with increasing compaction of DNA, resulting in a lower adsorption rate and a lower binding constant. The kinetics reported by Brewer et al. (Biophys. J. 85 (2003) 2519-2524) lead to a binding constant K=3.6 x 10(6) M(-1) at the beginning, and to K=5 x 10(5) M(-1) near the end of a compaction run, more than an order of magnitude lower than the value K=2.57 x 10(7) M(-1) calculated by Brewer et al. (Biophys. J. 85 (2003) 2519-2524).
Agarose gel electrophoresis for the separation of DNA fragments.
Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon
2012-04-20
Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate concentration for their needs Prepare an agarose gel for electrophoresis of DNA samples Set up the gel electrophoresis apparatus and power supply Select an appropriate voltage for the separation of DNA fragments Understand the mechanism by which ethidium bromide allows for the visualization of DNA bands Determine the sizes of separated DNA fragments.
Wang, Hui; Wang, Honghong; Duan, Xinrui; Liu, Chenghui; Li, Zhengping
2017-09-15
The ability to dissect cell-to-cell variations of microRNA (miRNA) expression with single-cell resolution has become a powerful tool to investigate the regulatory function of miRNAs in biological processes and the pathogenesis of miRNA-related diseases. Herein, we have developed a novel scheme for digital detection of miRNA in single cell by using the ligation-depended DNA polymerase colony (polony). Firstly, two simply designed target-specific DNA probes were ligated by using individual miRNA as the template. Then the ligated DNA probe acted as polony template that was amplified by PCR process in the thin polyacrylamide hydrogel. Due to the covalent attachment of a PCR primer on polyacrylamide matrix and the retarding effect of the polyacrylamide hydrogel matrix itself, as the polony reaction proceeds, the PCR products diffused radially near individual template molecule to form a bacteria colony-like spots of DNA molecules. The spots can be counted after staining the polyacrylamide gel with SYBR Green I and imaging with a microarray scanner. Our polony-based method is sensitive enough to detect 60 copies of miRNA molecules. Meanwhile, the new strategy has the capability of distinguishing singe-base difference. Due to its high sensitivity and specificity, the proposed method has been successfully applied to analysis of the expression profiling of miRNA in single cell. Copyright © 2017 Elsevier B.V. All rights reserved.
An effect of couterion in STM imaging process of DNA on Cu(111)
NASA Astrophysics Data System (ADS)
Furukawa, Masashi; Nishimura, Makoto; Tanaka, Hiroyuki; Kawai, Tomoji
2002-03-01
In order to elucidate electrical conduction mechanism of DNA, which is still under debate over the last decade, we have performed local electronic structure measurement of single- and double-stranded DNA molecules adsorbed onto Cu(111) surfaces using scanning tunneling microscope (STM). Bias-voltage-dependent STM images (from -5 V to +5 V) have shown that the molecular corrugation height in STM increases gradually at positive bias voltage region (empty state). Despite the theoretical assumption in which their 1st-LUMO states are localized at π plane of DNA bases, one cannot conclude its origin as the existence of their LUMO states, based on the results of relevant control measurements, DNA base molecules/Cu(111) [1] and NaCl/Cu(111). In fact, we found almost identical bias dependencies in the latter case (NaCl/Cu(111)), indicating that the feature of π* states of DNA bases should be buried in an additional channel that opens up by the onset of its unoccupied overlayer state in the tunneling process [2]. This study implies a potential difficulty in direct comparison of the obtained data with those characterized by XAS, in which π* states is located at ca. -1 eV relative to the Fermi level [3]. [1]M. Furukawa et al., submitted to Surf. Sci. [2] J. Kliewer et al., Surf. Sci. 477 (2001) 250.; A. Carlsson et al., Phys. Rev. B. 56 (1997) 1593. [3] M. Furukawa et al., submitted to Phys. Rev. B.
Molecular DNA-based detection of ionising radiation in meat.
Şakalar, Ergün
2017-05-01
Ionising radiation induces molecular alterations, such as formation of ions, free radicals, and new stable molecules, and cleavage of the chemical bonds of the molecules present in food. Irradiation-treated meat should be labelled to control the process and to ensure free consumer choice. Therefore, sensitive analytical methods are required to detect the irradiation dose. Meat samples were exposed to radiation doses of 0, 0.272, 0.497, 1.063, 3.64, 8.82 and 17.42 kGy in an industrial 60 Co gamma cell. Primers were designed to amplify 998, 498 and 250-base pair (bp) regions of the 18S rRNA gene of nuclear DNA from the irradiated samples. A new DNA-based method was developed to quantify the radiation exposed to the unstored meat and the meat stored at -20 °C for 3 and 6 months. The method was able to detect meat samples stored and unstored with dose limits of 1.063 and 3.64 kGy, respectively. The level of irradiation can be detected using primer pairs that target particularly different-sized sequences for DNA amplification by PCR. This method can be widely used for the analysis of not only meat samples, but also all biological materials containing DNA. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Gerhold, Joachim M; Sedman, Tiina; Visacka, Katarina; Slezakova, Judita; Tomaska, Lubomir; Nosek, Jozef; Sedman, Juhan
2014-08-15
Variation in the topology of mitochondrial DNA (mtDNA) in eukaryotes evokes the question if differently structured DNAs are replicated by a common mechanism. RNA-primed DNA synthesis has been established as a mechanism for replicating the circular animal/mammalian mtDNA. In yeasts, circular mtDNA molecules were assumed to be templates for rolling circle DNA-replication. We recently showed that in Candida albicans, which has circular mapping mtDNA, recombination driven replication is a major mechanism for replicating a complex branched mtDNA network. Careful analyses of C. albicans-mtDNA did not reveal detectable amounts of circular DNA molecules. In the present study we addressed the question of how the unit sized linear mtDNA of Candida parapsilosis terminating at both ends with arrays of tandem repeats (mitochondrial telomeres) is replicated. Originally, we expected to find replication intermediates diagnostic of canonical bi-directional replication initiation at the centrally located bi-directional promoter region. However, we found that the linear mtDNA of Candida parapsilosis also employs recombination for replication initiation. The most striking findings were that the mitochondrial telomeres appear to be hot spots for recombination driven replication, and that stable RNA:DNA hybrids, with a potential role in mtDNA replication, are also present in the mtDNA preparations. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Gerhold, Joachim M.; Sedman, Tiina; Visacka, Katarina; Slezakova, Judita; Tomaska, Lubomir; Nosek, Jozef; Sedman, Juhan
2014-01-01
Variation in the topology of mitochondrial DNA (mtDNA) in eukaryotes evokes the question if differently structured DNAs are replicated by a common mechanism. RNA-primed DNA synthesis has been established as a mechanism for replicating the circular animal/mammalian mtDNA. In yeasts, circular mtDNA molecules were assumed to be templates for rolling circle DNA-replication. We recently showed that in Candida albicans, which has circular mapping mtDNA, recombination driven replication is a major mechanism for replicating a complex branched mtDNA network. Careful analyses of C. albicans-mtDNA did not reveal detectable amounts of circular DNA molecules. In the present study we addressed the question of how the unit sized linear mtDNA of Candida parapsilosis terminating at both ends with arrays of tandem repeats (mitochondrial telomeres) is replicated. Originally, we expected to find replication intermediates diagnostic of canonical bi-directional replication initiation at the centrally located bi-directional promoter region. However, we found that the linear mtDNA of Candida parapsilosis also employs recombination for replication initiation. The most striking findings were that the mitochondrial telomeres appear to be hot spots for recombination driven replication, and that stable RNA:DNA hybrids, with a potential role in mtDNA replication, are also present in the mtDNA preparations. PMID:24951592
NASA Astrophysics Data System (ADS)
Zhang, Ce; Zhang, Fang; van Kan, Jeroen A.; van der Maarel, Johan R. C.
2008-06-01
Single T4-DNA molecules were confined in rectangular-shaped channels with a depth of 300 nm and a width in the range of 150-300 nm casted in a poly(dimethylsiloxane) nanofluidic chip. The extensions of the DNA molecules were measured with fluorescence microscopy as a function of the ionic strength and composition of the buffer as well as the DNA intercalation level by the YOYO-1 dye. The data were interpreted with the scaling theory for a wormlike polymer in good solvent, including the effects of confinement, charge, and self-avoidance. It was found that the elongation of the DNA molecules with decreasing ionic strength can be interpreted in terms of an increase of the persistence length. Self-avoidance effects on the extension are moderate, due to the small correlation length imposed by the channel cross-sectional diameter. Intercalation of the dye results in an increase of the DNA contour length and a partial neutralization of the DNA charge, but besides effects of electrostatic origin it has no significant effect on the bare bending rigidity. In the presence of divalent cations, the DNA molecules were observed to contract, but they do not collapse into a condensed structure. It is proposed that this contraction results from a divalent counterion mediated attractive force between the segments of the DNA molecule.
Nanofabricated Racks of Aligned and Anchored DNA Substrates for Single-Molecule Imaging
2009-01-01
Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This “double-tethered” DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein−DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA. PMID:19736980
Nanofabricated racks of aligned and anchored DNA substrates for single-molecule imaging.
Gorman, Jason; Fazio, Teresa; Wang, Feng; Wind, Shalom; Greene, Eric C
2010-01-19
Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This "double-tethered" DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein-DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA.
Surface-Enhanced Raman Scattering Based Nonfluorescent Probe for Multiplex DNA Detection
Sun, Lan; Yu, Chenxu; Irudayaraj, Joseph
2008-01-01
To provide rapid and accurate detection of DNA markers in a straightforward, inexpensive and multiplex format, an alternative surface enhanced Raman scattering (SERS) based probe was designed and fabricated to covalently attach both DNA probing sequence and non-fluorescent Raman tags to the surface of gold nanoparticles (DNA-AuP-RTag). The intensity of Raman signal of the probes could be controlled through the surface coverage of the non-fluorescent Raman tags (RTags). Detection sensitivity of these probes could be optimized by fine-tuning the amount of DNA molecules and RTags on the probes. Long-term stability of the DNA-AuP-RTag probes was found to be good (over 3 months). Excellent multiplexing capability of the DNA-AuP-RTag scheme was demonstrated by simultaneous identification of up to eight probes in a mixture. Detection of hybridization of single-stranded DNA (ssDNA) to its complementary targets was successfully accomplished with a long-term goal to use non-fluorescent RTags in a Raman-based DNA microarray platform. PMID:17465531
DNA sequence-dependent mechanics and protein-assisted bending in repressor-mediated loop formation
Boedicker, James Q.; Garcia, Hernan G.; Johnson, Stephanie; Phillips, Rob
2014-01-01
As the chief informational molecule of life, DNA is subject to extensive physical manipulations. The energy required to deform double-helical DNA depends on sequence, and this mechanical code of DNA influences gene regulation, such as through nucleosome positioning. Here we examine the sequence-dependent flexibility of DNA in bacterial transcription factor-mediated looping, a context for which the role of sequence remains poorly understood. Using a suite of synthetic constructs repressed by the Lac repressor and two well-known sequences that show large flexibility differences in vitro, we make precise statistical mechanical predictions as to how DNA sequence influences loop formation and test these predictions using in vivo transcription and in vitro single-molecule assays. Surprisingly, sequence-dependent flexibility does not affect in vivo gene regulation. By theoretically and experimentally quantifying the relative contributions of sequence and the DNA-bending protein HU to DNA mechanical properties, we reveal that bending by HU dominates DNA mechanics and masks intrinsic sequence-dependent flexibility. Such a quantitative understanding of how mechanical regulatory information is encoded in the genome will be a key step towards a predictive understanding of gene regulation at single-base pair resolution. PMID:24231252
Controlling the surface density of DNA on gold by electrically induced desorption.
Arinaga, Kenji; Rant, Ulrich; Knezević, Jelena; Pringsheim, Erika; Tornow, Marc; Fujita, Shozo; Abstreiter, Gerhard; Yokoyama, Naoki
2007-10-31
We report on a method to control the packing density of sulfur-bound oligonucleotide layers on metal electrodes by electrical means. In a first step, a dense nucleic acid layer is deposited by self-assembly from solution; in a second step, defined fractions of DNA molecules are released from the surface by applying a series of negative voltage cycles. Systematic investigations of the influence of the applied electrode potentials and oligonucleotide length allow us to identify a sharp desorption onset at -0.65 V versus Ag/AgCl, which is independent of the DNA length. Moreover, our results clearly show the pronounced influence of competitive adsorbents in solution on the desorption behavior, which can prevent the re-adsorption of released DNA molecules, thereby enhancing the desorption efficiency. The method is fully bio-compatible and can be employed to improve the functionality of DNA layers. This is demonstrated in hybridization experiments revealing almost perfect yields for electrically "diluted" DNA layers. The proposed control method is extremely beneficial to the field of DNA-based sensors.
Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores
NASA Astrophysics Data System (ADS)
Bell, Nicholas A. W.; Keyser, Ulrich F.
2016-07-01
The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.
Bell, Nicholas A W; Keyser, Ulrich F
2016-07-01
The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.
Wang, Ying; Schellenberg, Helene; Walhorn, Volker; Toensing, Katja; Anselmetti, Dario
2017-09-01
Fluorescent dyes are broadly used in many biotechnological applications to detect and visualize DNA molecules. However, their binding to DNA alters the structural and nanomechanical properties of DNA and, thus, interferes with associated biological processes. In this work we employed magnetic tweezers and fluorescence spectroscopy to investigate the binding of PicoGreen to DNA at room temperature in a concentration-dependent manner. PicoGreen is an ultrasensitive quinolinium nucleic acid stain exhibiting hardly any background signal from unbound dye molecules. By means of stretching and overwinding single, torsionally constrained, nick-free double-stranded DNA molecules, we acquired force-extension and supercoiling curves which allow quantifying DNA contour length, persistence length and other thermodynamical binding parameters, respectively. The results of our magnetic tweezers single-molecule binding study were well supported through analyzing the fluorescent spectra of stained DNA. On the basis of our work, we could identify a concentration-dependent bimodal binding behavior, where, apparently, PicoGreen associates to DNA as an intercalator and minor-groove binder simultaneously.
Hengel, Sarah R; Spies, M Ashley; Spies, Maria
2017-09-21
To maintain stable genomes and to avoid cancer and aging, cells need to repair a multitude of deleterious DNA lesions, which arise constantly in every cell. Processes that support genome integrity in normal cells, however, allow cancer cells to develop resistance to radiation and DNA-damaging chemotherapeutics. Chemical inhibition of the key DNA repair proteins and pharmacologically induced synthetic lethality have become instrumental in both dissecting the complex DNA repair networks and as promising anticancer agents. The difficulty in capitalizing on synthetically lethal interactions in cancer cells is that many potential targets do not possess well-defined small-molecule binding determinates. In this review, we discuss several successful campaigns to identify and leverage small-molecule inhibitors of the DNA repair proteins, from PARP1, a paradigm case for clinically successful small-molecule inhibitors, to coveted new targets, such as RAD51 recombinase, RAD52 DNA repair protein, MRE11 nuclease, and WRN DNA helicase. Copyright © 2017 Elsevier Ltd. All rights reserved.
Mun, Hyoyoung; Jo, Eun-Jung; Li, Taihua; Joung, Hyou-Arm; Hong, Dong-Gu; Shim, Won-Bo; Jung, Cheulhee; Kim, Min-Gon
2014-08-15
We have designed a single-stranded DNAzyme-aptamer sensor for homogeneous target molecular detection based on chemiluminescence resonance energy transfer (CRET). The structure of the engineered single-stranded DNA (ssDNA) includes the horseradish peroxidase (HRP)-like DNAzyme, optimum-length linker (10-mer-length DNA), and target-specific aptamer sequences. A quencher dye was modified at the 3' end of the aptamer sequence. The incorporation of hemin into the G-quadruplex structure of DNAzyme yields an active HRP-like activity that catalyzes luminol to generate a chemiluminescence (CL) signal. In the presence of target molecules, such as ochratoxin A (OTA), adenosine triphosphate (ATP), or thrombin, the aptamer sequence was folded due to the formation of the aptamer/analyte complex, which induced the quencher dye close to the DNAzyme structure. Consequently, the CRET occurred between a DNAzyme-catalyzed chemiluminescence reaction and the quencher dye. Our results showed that CRET-based DNAzyme-aptamer biosensing enabled specific OTA analysis with a limit of detection of 0.27ng/mL. The CRET platform needs no external light source and avoids autofluorescence and photobleaching, and target molecules can be detected specifically and sensitively in a homogeneous manner. Copyright © 2014 Elsevier B.V. All rights reserved.
Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules
NASA Astrophysics Data System (ADS)
Buyukdagli, Sahin
2017-02-01
We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test-charge theory [S. Buyukdagli et al., Phys. Rev. E 94, 042502 (2016), 10.1103/PhysRevE.94.042502] to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the experimental phase diagrams for polymer solutions. First, the addition of polyvalent cations to the electrolyte solution results in the attraction of the negatively charged polymer by the DNA molecule. The glue of the like-charge attraction is the enhanced shielding of the polymer charges by the dense counterion layer at the DNA surface. Second, through the shielding of the DNA-induced electrostatic potential, mono- and polyvalent cations of large concentration both suppress the like-charge attraction. Within the same formalism, we also predict a new opposite-charge repulsion effect between the DNA molecule and a positively charged polymer. In the presence of polyvalent anions such as sulfate or phosphate, their repulsion by the DNA charges leads to the charge screening deficiency of the region around the DNA molecule. This translates into a repulsive force that results in the decomplexation of the polymer from DNA. This opposite-charge repulsion phenomenon can be verified by current experiments and the underlying mechanism can be beneficial to gene therapeutic applications where the control over polymer-DNA interactions is the key factor.
Thermally driven spin-Seebeck transport in chiral dsDNA-based molecular devices
NASA Astrophysics Data System (ADS)
Nian, L. L.; Zhang, Rong; Tang, F. R.; Tang, Jun; Bai, Long
2018-03-01
By employing the nonequilibrium Green's function technique, we study the thermal-induced spin-Seebeck transport through a chiral double-stranded DNA (dsDNA) connected to a normal-metal and a ferromagnetic lead. How the main parameters of the dsDNA-based system influence the spin-Seebeck transport is analyzed at length, and the thermally created charge (spin-related) current displays the rectification effect and the negative differential thermal conductance feature. More importantly, the spin current exhibits the rectification behavior of the spin-Seebeck effect; even the perfect spin-Seebeck effect can be obtained with the null charge current. Thus, the chiral dsDNA-based system can act as a spin(charge)-Seebeck diode, spin(charge)-Seebeck switch, and spin(charge)-Seebeck transistor. Our results provide new ways to design spin caloritronic devices based on dsDNA or other organic molecules.
Shin, Min Jae; Tan, Lihan; Jeong, Min Ho; Kim, Ji-Heung; Choe, Woo-Seok
2011-08-05
Immobilized metal affinity monolith column as a new class of chromatographic support is shown to be superior to conventional particle-based column as plasmid DNA (pDNA) purification platform. By harnessing the affinity of endotoxin to copper ions in the solution, a majority of endotoxin (90%) was removed from the alkaline cell lysate using CuCl(2)-induced precipitation. RNA and remaining endotoxin were subsequently removed to below detection limit with minimal loss of pDNA using either monolith or particle-based column. Monolith column has the additional advantage of feed concentration and flowrate-independent dynamic binding capacity for RNA molecules, enabling purification process to be conducted at high feed RNA concentration and flowrate. The use of monolith column gives three fold increased productivity of pDNA as compared to particle-based column, providing a more rapid and economical platform for pDNA purification. Copyright © 2011 Elsevier B.V. All rights reserved.
Dressman, Devin; Yan, Hai; Traverso, Giovanni; Kinzler, Kenneth W.; Vogelstein, Bert
2003-01-01
Many areas of biomedical research depend on the analysis of uncommon variations in individual genes or transcripts. Here we describe a method that can quantify such variation at a scale and ease heretofore unattainable. Each DNA molecule in a collection of such molecules is converted into a single magnetic particle to which thousands of copies of DNA identical in sequence to the original are bound. This population of beads then corresponds to a one-to-one representation of the starting DNA molecules. Variation within the original population of DNA molecules can then be simply assessed by counting fluorescently labeled particles via flow cytometry. This approach is called BEAMing on the basis of four of its principal components (beads, emulsion, amplification, and magnetics). Millions of individual DNA molecules can be assessed in this fashion with standard laboratory equipment. Moreover, specific variants can be isolated by flow sorting and used for further experimentation. BEAMing can be used for the identification and quantification of rare mutations as well as to study variations in gene sequences or transcripts in specific populations or tissues. PMID:12857956
Sriram, K. K.; Chang, Chun-Ling; Rajesh Kumar, U.; Chou, Chia-Fu
2014-01-01
Molecular combing and flow-induced stretching are the most commonly used methods to immobilize and stretch DNA molecules. While both approaches require functionalization steps for the substrate surface and the molecules, conventionally the former does not take advantage of, as the latter, the versatility of microfluidics regarding robustness, buffer exchange capability, and molecule manipulation using external forces for single molecule studies. Here, we demonstrate a simple one-step combing process involving only low-pressure oxygen (O2) plasma modified polysilsesquioxane (PSQ) polymer layer to facilitate both room temperature microfluidic device bonding and immobilization of stretched single DNA molecules without molecular functionalization step. Atomic force microscopy and Kelvin probe force microscopy experiments revealed a significant increase in surface roughness and surface potential on low-pressure O2 plasma treated PSQ, in contrast to that with high-pressure O2 plasma treatment, which are proposed to be responsible for enabling effective DNA immobilization. We further demonstrate the use of our platform to observe DNA-RNA polymerase complexes and cancer drug cisplatin induced DNA condensation using wide-field fluorescence imaging. PMID:25332730
Single-molecule dilution and multiple displacement amplification for molecular haplotyping.
Paul, Philip; Apgar, Josh
2005-04-01
Separate haploid analysis is frequently required for heterozygous genotyping to resolve phase ambiguity or confirm allelic sequence. We demonstrate a technique of single-molecule dilution followed by multiple strand displacement amplification to haplotype polymorphic alleles. Dilution of DNA to haploid equivalency, or a single molecule, is a simple method for separating di-allelic DNA. Strand displacement amplification is a robust method for non-specific DNA expansion that employs random hexamers and phage polymerase Phi29 for double-stranded DNA displacement and primer extension, resulting in high processivity and exceptional product length. Single-molecule dilution was followed by strand displacement amplification to expand separated alleles to microgram quantities of DNA for more efficient haplotype analysis of heterozygous genes.
Ni, Jiancong; Wang, Qingxiang; Yang, Weiqiang; Zhao, Mengmeng; Zhang, Ying; Guo, Longhua; Qiu, Bin; Lin, Zhenyu; Yang, Huang-Hao
2016-12-15
The determination of folate receptor (FR) that over expressed in vast quantity of cancerous cells frequently is significant for the clinical diagnosis and treatment of cancers. Many DNA-based electrochemical biosensors have been developed for FR detection with high selectivity and sensitivity, but most of them need complicated immobilization of DNA on the electrode surface firstly, which is tedious and therefore results in the poor reproducibility. In this study, a simple, sensitive, and selective electrochemical FR biosensor in cancer cells has been proposed, which combines the advantages of the convenient immobilization-free homogeneous indium tin oxide (ITO)-based electrochemical detection strategy and the high selectivity of the terminal protection of small molecule linked DNA. The small molecule of folic acid (FA) and an electroactive molecule of ferrocence (Fc) were tethered to 3'- and 5'-end of an arbitrary single-stranded DNA (ssDNA), respectively, forming the FA-ssDNA-Fc complex. In the absence of the target FR, the FA-ssDNA-Fc was degraded by exonuclease I (Exo I) from 3'-end and produced a free Fc, diffusing freely to the ITO electrode surface and resulting in strong electrochemical signal. When the target FR was present, the FA-ssDNA-Fc was bound to FR through specific interaction with FA anchored at the 3'-end, effectively protecting the ssDNA strand from hydrolysis by Exo I. The FR-FA-ssDNA-Fc could not diffuse easily to the negatively charged ITO electrode surface due to the electrostatic repulsion between the DNA strand and the negatively charged ITO electrode, so electrochemical signal reduced. The decreased electrochemical signal has a linear relationship with the logarithm of FR concentration in range of 10fM to 10nM with a detection limit of 3.8fM (S/N=3). The proposed biosensor has been applied to detect FR in HeLa cancer cells, and the decreased electrochemical signal has a linear relationship with the logarithm of cell concentration ranging from 100-10000cell/mL. Compared with the traditional heterogeneous electrochemical FR biosensors, the proposed biosensor owns the merits of the simplicity and high specificity, presenting the great potential application in the area of early diagnosis of cancers. Copyright © 2016 Elsevier B.V. All rights reserved.
Rapid purification of circular DNA by triplex-mediated affinity capture
Ji, H.; Smith, L.M.
1997-01-07
A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support. 3 figs.
NASA Astrophysics Data System (ADS)
Vologodskii, Alexander
2016-09-01
The widespread circular form of DNA molecules inside cells creates very serious topological problems during replication. Due to the helical structure of the double helix the parental strands of circular DNA form a link of very high order, and yet they have to be unlinked before the cell division. DNA topoisomerases, the enzymes that catalyze passing of one DNA segment through another, solve this problem in principle. However, it is very difficult to remove all entanglements between the replicated DNA molecules due to huge length of DNA comparing to the cell size. One strategy that nature uses to overcome this problem is to create the topoisomerases that can dramatically reduce the fraction of linked circular DNA molecules relative to the corresponding fraction at thermodynamic equilibrium. This striking property of the enzymes means that the enzymes that interact with DNA only locally can access their topology, a global property of circular DNA molecules. This review considers the experimental studies of the phenomenon and analyzes the theoretical models that have been suggested in attempts to explain it. We describe here how various models of enzyme action can be investigated computationally. There is no doubt at the moment that we understand basic principles governing enzyme action. Still, there are essential quantitative discrepancies between the experimental data and the theoretical predictions. We consider how these discrepancies can be overcome.
Lipid-Based Passivation in Nanofluidics
2012-01-01
Stretching DNA in nanochannels is a useful tool for direct, visual studies of genomic DNA at the single molecule level. To facilitate the study of the interaction of linear DNA with proteins in nanochannels, we have implemented a highly effective passivation scheme based on lipid bilayers. We demonstrate virtually complete long-term passivation of nanochannel surfaces to a range of relevant reagents, including streptavidin-coated quantum dots, RecA proteins, and RecA–DNA complexes. We show that the performance of the lipid bilayer is significantly better than that of standard bovine serum albumin-based passivation. Finally, we show how the passivated devices allow us to monitor single DNA cleavage events during enzymatic degradation by DNase I. We expect that our approach will open up for detailed, systematic studies of a wide range of protein–DNA interactions with high spatial and temporal resolution. PMID:22432814
Single molecule fluorescence burst detection of DNA fragments separated by capillary electrophoresis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Haab, B.B.; Mathies, R.A.
A method has been developed for detecting DNA separated by capillary gel electrophoresis (CGE) using single molecule photon burst counting. A confocal fluorescence microscope was used to observe the fluorescence bursts from single molecules of DNA multiply labeled with the thiazole orange derivative TO6 as they passed through the nearly 2-{mu}m diameter focused laser beam. Amplified photo-electron pulses from the photomultiplier are grouped into bins of 360-450 {mu}s in duration, and the resulting histogram is stored in a computer for analysis. Solutions of M13 DNA were first flowed through the capillary at various concentrations, and the resulting data were usedmore » to optimize the parameters for digital filtering using a low-pass Fourier filter, selecting a discriminator level for peak detection, and applying a peak-calling algorithm. The optimized single molecule counting method was then applied to an electrophoretic separation of M13 DNA and to a separation of pBR 322 DNA from pRL 277 DNA. Clusters of discreet fluorescence bursts were observed at the expected appearance time of each DNA band. The auto-correlation function of these data indicated transit times that were consistent with the observed electrophoretic velocity. These separations were easily detected when only 50-100 molecules of DNA per band traveled through the detection region. This new detection technology should lead to the routine analysis of DNA in capillary columns with an on-column sensitivity of nearly 100 DNA molecules/band or better. 45 refs., 10 figs.« less
NASA Astrophysics Data System (ADS)
Brancolini, Giorgia; Di Felice, Rosa
2011-05-01
Novel DNA derivatives have been recently investigated in the pursuit of modified DNA duplexes to tune the electronic structure of DNA-based assemblies for nanotechnology applications. Size-expanded DNAs (e.g., xDNA) and metalated DNAs (M-DNA) may enhance stacking interactions and induce metallic conductivity, respectively. Here we explore possible ways of tailoring the DNA electronic structure by combining the aromatic size expansion with the metal-doping. We select the salient structures from our recent study on natural DNA pairs complexed with transition metal ions and consider the equivalent model configurations for xDNA pairs. We present the results of density functional theory electronic structure calculations of the metalated expanded base-pairs with various localized basis sets and exchange-correlation functionals. Implicit solvent and coordination water molecules are also included. Our results indicate that the effect of base expansion is largest in Ag-xGC complexes, while Cu-xGC complexes are the most promising candidates for nanowires with enhanced electron transfer and also for on-purpose modification of the DNA double-helix for signal detection.
Milton, James A.; Patole, Samson; Yin, Huabing; Xiao, Qiang; Brown, Tom; Melvin, Tracy
2013-01-01
Although strategies for the immobilization of DNA oligonucleotides onto surfaces for bioanalytical and top-down bio-inspired nanobiofabrication approaches are well developed, the effect of introducing spacer molecules between the surface and the DNA oligonucleotide for the hybridization of nanoparticle–DNA conjugates has not been previously assessed in a quantitative manner. The hybridization efficiency of DNA oligonucleotides end-labelled with gold nanoparticles (1.4 or 10 nm diameter) with DNA sequences conjugated to silicon surfaces via hexaethylene glycol phosphate diester oligomer spacers (0, 1, 2, 6 oligomers) was found to be independent of spacer length. To quantify both the density of DNA strands attached to the surfaces and hybridization with the surface-attached DNA, new methodologies have been developed. Firstly, a simple approach based on fluorescence has been developed for determination of the immobilization density of DNA oligonucleotides. Secondly, an approach using mass spectrometry has been created to establish (i) the mean number of DNA oligonucleotides attached to the gold nanoparticles and (ii) the hybridization density of nanoparticle–oligonucleotide conjugates with the silicon surface–attached complementary sequence. These methods and results will be useful for application with nanosensors, the self-assembly of nanoelectronic devices and the attachment of nanoparticles to biomolecules for single-molecule biophysical studies. PMID:23361467
Winding single-molecule double-stranded DNA on a nanometer-sized reel
You, Huijuan; Iino, Ryota; Watanabe, Rikiya; Noji, Hiroyuki
2012-01-01
A molecular system of a nanometer-sized reel was developed from F1–ATPase, a rotary motor protein. By combination with magnetic tweezers and optical tweezers, single-molecule double-stranded DNA (dsDNA) was wound around the molecular reel. The bending stiffness of dsDNA was determined from the winding tension (0.9–6.0 pN) and the diameter of the wound loop (21.4–8.5 nm). Our results were in good agreement with the conventional worm-like chain model and a persistence length of 54 ± 9 nm was estimated. This molecular reel system offers a new platform for single-molecule study of micromechanics of sharply bent DNA molecules and is expected to be applicable to the elucidation of the molecular mechanism of DNA-associating proteins on sharply bent DNA strands. PMID:22772992
Biomolecular computers with multiple restriction enzymes
Sakowski, Sebastian; Krasinski, Tadeusz; Waldmajer, Jacek; Sarnik, Joanna; Blasiak, Janusz; Poplawski, Tomasz
2017-01-01
Abstract The development of conventional, silicon-based computers has several limitations, including some related to the Heisenberg uncertainty principle and the von Neumann “bottleneck”. Biomolecular computers based on DNA and proteins are largely free of these disadvantages and, along with quantum computers, are reasonable alternatives to their conventional counterparts in some applications. The idea of a DNA computer proposed by Ehud Shapiro’s group at the Weizmann Institute of Science was developed using one restriction enzyme as hardware and DNA fragments (the transition molecules) as software and input/output signals. This computer represented a two-state two-symbol finite automaton that was subsequently extended by using two restriction enzymes. In this paper, we propose the idea of a multistate biomolecular computer with multiple commercially available restriction enzymes as hardware. Additionally, an algorithmic method for the construction of transition molecules in the DNA computer based on the use of multiple restriction enzymes is presented. We use this method to construct multistate, biomolecular, nondeterministic finite automata with four commercially available restriction enzymes as hardware. We also describe an experimental applicaton of this theoretical model to a biomolecular finite automaton made of four endonucleases. PMID:29064510
DNA intermediates and telomere addition during genome reorganization in Euplotes crassus.
Roth, M; Prescott, D M
1985-06-01
Three gene-sized molecules cloned intact from macronuclear DNA served as hybridization probes to study excision of these molecules from chromosomes and their processing during macronuclear development in the hypotrich Euplotes crassus. These molecules occur in integrated forms within polytene chromosomal DNA during macronuclear developmental. After transection of the polytene chromosomes, the three molecules occur in intermediate forms. One of the three molecules first appeared in a large intermediate that was subsequently replaced by a second intermediate, approximately 140 bp larger than the final molecule. The other two macronuclear molecules were detected only in intermediates approximately 140 bp larger than the mature form. These penultimate intermediates are larger by virtue of oversized telomeres, which are pared to yield the mature gene-sized molecules.
Design and Synthesis of Biaryl DNA-Encoded Libraries.
Ding, Yun; Franklin, G Joseph; DeLorey, Jennifer L; Centrella, Paolo A; Mataruse, Sibongile; Clark, Matthew A; Skinner, Steven R; Belyanskaya, Svetlana
2016-10-10
DNA-encoded library technology (ELT) is a powerful tool for the discovery of new small-molecule ligands to various protein targets. Here we report the design and synthesis of biaryl DNA-encoded libraries based on the scaffold of 5-formyl 3-iodobenzoic acid. Three reactions on DNA template, acylation, Suzuki-Miyaura coupling and reductive amination, were applied in the library synthesis. The three cycle library of 3.5 million diversity has delivered potent hits for phosphoinositide 3-kinase α (PI3Kα).
Development of novel small molecules for imaging and drug release
NASA Astrophysics Data System (ADS)
Cao, Yanting
Small organic molecules, including small molecule based fluorescent probes, small molecule based drugs or prodrugs, and smart multifunctional fluorescent drug delivery systems play important roles in biological research, drug discovery, and clinical practices. Despite the significant progress made in these fields, the development of novel and diverse small molecules is needed to meet various demands for research and clinical applications. My Ph.D study focuses on the development of novel functional molecules for recognition, imaging and drug release. In the first part, a turn-on fluorescent probe is developed for the detection of intracellular adenosine-5'-triphosphate (ATP) levels based on multiplexing recognitions. Considering the unique and complicated structure of ATP molecules, a fluorescent probe has been implemented with improved sensitivity and selectivity due to two synergistic binding recognitions by incorporating of 2, 2'-dipicolylamine (Dpa)-Zn(II) for targeting of phospho anions and phenylboronic acid group for cis-diol moiety. The novel probe is able to detect intracellular ATP levels in SH-SY5Y cells. Meanwhile, the advantages of multiplexing recognition design concept have been demonstrated using two control molecules. In the second part, a prodrug system is developed to deliver multiple drugs within one small molecule entity. The prodrug is designed by using 1-(2-nitrophenyl)ethyl (NPE) as phototrigger, and biphenol biquaternary ammonium as the prodrug. With controlled photo activation, both DNA cross-linking agents mechlorethamine and o-quinone methide are delivered and released at the preferred site, leading to efficient DNA cross-links formation and cell death. The prodrug shows negligible cytotoxicity towards normal skin cells (Hekn cells) with and without UV activation, but displays potent activity towards cancer cells (HeLa cells) upon UV activation. The multiple drug release system may hold a great potential for practical application. In the last part, a new photo-initiated fluorescent anticancer prodrug for DNA alkylating agent mechlorethamine releasing and monitoring has been developed. The theranostic prodrug consists a photolabile NPE group, an inactive form of mechlorethamine and a nonfluorescent coumarin in one small molecule. It is demonstrated that the prodrug shows negligible cytotoxicity towards normal skin cells (Hekn cells) with and without UV activation, while the original parent drug mechlorethamine can be photocontrol-released and induces effective DNA cross-linking activity. Importantly, the drug release progress can be conveniently monitored by the 'off-on' fluorescence enhancement in cells. Moreover, the selective prodrug is not only cell permeable but also nuclear permeable. Therefore, the prodrug serves as a promising drug delivery system for spatiotemporal control release and monitoring of an anticancer drug to obtain the optimal treatment efficacy.
DNA mechanics as a tool to probe helicase and translocase activity.
Lionnet, Timothée; Dawid, Alexandre; Bigot, Sarah; Barre, François-Xavier; Saleh, Omar A; Heslot, François; Allemand, Jean-François; Bensimon, David; Croquette, Vincent
2006-01-01
Helicases and translocases are proteins that use the energy derived from ATP hydrolysis to move along or pump nucleic acid substrates. Single molecule manipulation has proved to be a powerful tool to investigate the mechanochemistry of these motors. Here we first describe the basic mechanical properties of DNA unraveled by single molecule manipulation techniques. Then we demonstrate how the knowledge of these properties has been used to design single molecule assays to address the enzymatic mechanisms of different translocases. We report on four single molecule manipulation systems addressing the mechanism of different helicases using specifically designed DNA substrates: UvrD enzyme activity detection on a stretched nicked DNA molecule, HCV NS3 helicase unwinding of a RNA hairpin under tension, the observation of RecBCD helicase/nuclease forward and backward motion, and T7 gp4 helicase mediated opening of a synthetic DNA replication fork. We then discuss experiments on two dsDNA translocases: the RuvAB motor studied on its natural substrate, the Holliday junction, and the chromosome-segregation motor FtsK, showing its unusual coupling to DNA supercoiling.
NASA Astrophysics Data System (ADS)
Ploetz, Evelyn; Lerner, Eitan; Husada, Florence; Roelfs, Martin; Chung, Sangyoon; Hohlbein, Johannes; Weiss, Shimon; Cordes, Thorben
2016-09-01
Advanced microscopy methods allow obtaining information on (dynamic) conformational changes in biomolecules via measuring a single molecular distance in the structure. It is, however, extremely challenging to capture the full depth of a three-dimensional biochemical state, binding-related structural changes or conformational cross-talk in multi-protein complexes using one-dimensional assays. In this paper we address this fundamental problem by extending the standard molecular ruler based on Förster resonance energy transfer (FRET) into a two-dimensional assay via its combination with protein-induced fluorescence enhancement (PIFE). We show that donor brightness (via PIFE) and energy transfer efficiency (via FRET) can simultaneously report on e.g., the conformational state of double stranded DNA (dsDNA) following its interaction with unlabelled proteins (BamHI, EcoRV, and T7 DNA polymerase gp5/trx). The PIFE-FRET assay uses established labelling protocols and single molecule fluorescence detection schemes (alternating-laser excitation, ALEX). Besides quantitative studies of PIFE and FRET ruler characteristics, we outline possible applications of ALEX-based PIFE-FRET for single-molecule studies with diffusing and immobilized molecules. Finally, we study transcription initiation and scrunching of E. coli RNA-polymerase with PIFE-FRET and provide direct evidence for the physical presence and vicinity of the polymerase that causes structural changes and scrunching of the transcriptional DNA bubble.
Ploetz, Evelyn; Lerner, Eitan; Husada, Florence; Roelfs, Martin; Chung, SangYoon; Hohlbein, Johannes; Weiss, Shimon; Cordes, Thorben
2016-01-01
Advanced microscopy methods allow obtaining information on (dynamic) conformational changes in biomolecules via measuring a single molecular distance in the structure. It is, however, extremely challenging to capture the full depth of a three-dimensional biochemical state, binding-related structural changes or conformational cross-talk in multi-protein complexes using one-dimensional assays. In this paper we address this fundamental problem by extending the standard molecular ruler based on Förster resonance energy transfer (FRET) into a two-dimensional assay via its combination with protein-induced fluorescence enhancement (PIFE). We show that donor brightness (via PIFE) and energy transfer efficiency (via FRET) can simultaneously report on e.g., the conformational state of double stranded DNA (dsDNA) following its interaction with unlabelled proteins (BamHI, EcoRV, and T7 DNA polymerase gp5/trx). The PIFE-FRET assay uses established labelling protocols and single molecule fluorescence detection schemes (alternating-laser excitation, ALEX). Besides quantitative studies of PIFE and FRET ruler characteristics, we outline possible applications of ALEX-based PIFE-FRET for single-molecule studies with diffusing and immobilized molecules. Finally, we study transcription initiation and scrunching of E. coli RNA-polymerase with PIFE-FRET and provide direct evidence for the physical presence and vicinity of the polymerase that causes structural changes and scrunching of the transcriptional DNA bubble. PMID:27641327
DNA nanotechnology: a future perspective
2013-01-01
In addition to its genetic function, DNA is one of the most distinct and smart self-assembling nanomaterials. DNA nanotechnology exploits the predictable self-assembly of DNA oligonucleotides to design and assemble innovative and highly discrete nanostructures. Highly ordered DNA motifs are capable of providing an ultra-fine framework for the next generation of nanofabrications. The majority of these applications are based upon the complementarity of DNA base pairing: adenine with thymine, and guanine with cytosine. DNA provides an intelligent route for the creation of nanoarchitectures with programmable and predictable patterns. DNA strands twist along one helix for a number of bases before switching to the other helix by passing through a crossover junction. The association of two crossovers keeps the helices parallel and holds them tightly together, allowing the assembly of bigger structures. Because of the DNA molecule's unique and novel characteristics, it can easily be applied in a vast variety of multidisciplinary research areas like biomedicine, computer science, nano/optoelectronics, and bionanotechnology. PMID:23497147
Surface-enhanced Raman scattering based nonfluorescent probe for multiplex DNA detection.
Sun, Lan; Yu, Chenxu; Irudayaraj, Joseph
2007-06-01
To provide rapid and accurate detection of DNA markers in a straightforward, inexpensive, and multiplex format, an alternative surface-enhanced Raman scattering based probe was designed and fabricated to covalently attach both DNA probing sequence and nonfluorescent Raman tags to the surface of gold nanoparticles (DNA-AuP-RTag). The intensity of Raman signal of the probes could be controlled through the surface coverage of the nonfluorescent Raman tags (RTags). Detection sensitivity of these probes could be optimized by fine-tuning the amount of DNA molecules and RTags on the probes. Long-term stability of the DNA-AuP-RTag probes was found to be good (over 3 months). Excellent multiplexing capability of the DNA-AuP-RTag scheme was demonstrated by simultaneous identification of up to eight probes in a mixture. Detection of hybridization of single-stranded DNA to its complementary targets was successfully accomplished with a long-term goal to use nonfluorescent RTags in a Raman-based DNA microarray platform.
2017-01-01
Fabricating nanocavities in which optically active single quantum emitters are precisely positioned is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5 nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore and obtain enhancements of ≥4 × 103 with high quantum yield (≥50%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of ±1.5 nm. Our approach introduces a straightforward noninvasive way to measure and quantify confined optical modes on the nanoscale. PMID:29166033
NASA Astrophysics Data System (ADS)
Chikkaraddy, Rohit; Turek, V. A.; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F.; Baumberg, Jeremy J.
2018-01-01
Fabricating nanocavities in which optically-active single quantum emitters are precisely positioned, is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore, and obtain enhancements of $\\geq4\\times10^3$ with high quantum yield ($\\geq50$%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of $\\pm1.5$ nm. Our approach introduces a straightforward non-invasive way to measure and quantify confined optical modes on the nanoscale.
A mix-and-read drop-based in vitro two-hybrid method for screening high-affinity peptide binders
Cui, Naiwen; Zhang, Huidan; Schneider, Nils; Tao, Ye; Asahara, Haruichi; Sun, Zhiyi; Cai, Yamei; Koehler, Stephan A.; de Greef, Tom F. A.; Abbaspourrad, Alireza; Weitz, David A.; Chong, Shaorong
2016-01-01
Drop-based microfluidics have recently become a novel tool by providing a stable linkage between phenotype and genotype for high throughput screening. However, use of drop-based microfluidics for screening high-affinity peptide binders has not been demonstrated due to the lack of a sensitive functional assay that can detect single DNA molecules in drops. To address this sensitivity issue, we introduced in vitro two-hybrid system (IVT2H) into microfluidic drops and developed a streamlined mix-and-read drop-IVT2H method to screen a random DNA library. Drop-IVT2H was based on the correlation between the binding affinity of two interacting protein domains and transcriptional activation of a fluorescent reporter. A DNA library encoding potential peptide binders was encapsulated with IVT2H such that single DNA molecules were distributed in individual drops. We validated drop-IVT2H by screening a three-random-residue library derived from a high-affinity MDM2 inhibitor PMI. The current drop-IVT2H platform is ideally suited for affinity screening of small-to-medium-sized libraries (103–106). It can obtain hits within a single day while consuming minimal amounts of reagents. Drop-IVT2H simplifies and accelerates the drop-based microfluidics workflow for screening random DNA libraries, and represents a novel alternative method for protein engineering and in vitro directed protein evolution. PMID:26940078
Weerts, Marjolein J.A.; Sieuwerts, Anieta M.; Smid, Marcel; Look, Maxime P.; Foekens, John A.; Sleijfer, Stefan; Martens, John W.M.
2016-01-01
Reduced mitochondrial DNA (mtDNA) content in breast cancer cell lines has been associated with transition towards a mesenchymal phenotype, but its clinical consequences concerning breast cancer dissemination remain unidentified. Here, we aimed to clarify the link between mtDNA content and a mesenchymal phenotype and its relation to prognosis of breast cancer patients. We analyzed mtDNA content in 42 breast cancer cell lines and 207 primary breast tumor specimens using a combination of quantitative PCR and array-based copy number analysis. By associating mtDNA content with expression levels of genes involved in epithelial-to-mesenchymal transition (EMT) and with the intrinsic breast cancer subtypes, we could not identify a relation between low mtDNA content and mesenchymal properties in the breast cancer cell lines or in the primary breast tumors. In addition, we explored the relation between mtDNA content and prognosis in our cohort of primary breast tumor specimens that originated from patients with lymph node-negative disease who did not receive any (neo)adjuvant systemic therapy. When patients were divided based on the tumor quartile levels of mtDNA content, those in the lowest quarter (≤ 350 mtDNA molecules per cell) showed a poorer 10-year distant metastasis-free survival than patients with > 350 mtDNA molecules per cell (HR 0.50 [95% CI 0.29–0.87], P = 0.015). The poor prognosis was independent of established clinicopathological markers (HR 0.54 [95% CI 0.30–0.97], P = 0.038). We conclude that, despite a lack of evidence between mtDNA content and EMT, low mtDNA content might provide meaningful prognostic value for distant metastasis in breast cancer. PMID:27081694
Phelps, Carey; Israels, Brett; Marsh, Morgan C; von Hippel, Peter H; Marcus, Andrew H
2016-12-29
Recent advances in single-molecule fluorescence imaging have made it possible to perform measurements on microsecond time scales. Such experiments have the potential to reveal detailed information about the conformational changes in biological macromolecules, including the reaction pathways and dynamics of the rearrangements involved in processes, such as sequence-specific DNA "breathing" and the assembly of protein-nucleic acid complexes. Because microsecond-resolved single-molecule trajectories often involve "sparse" data, that is, they contain relatively few data points per unit time, they cannot be easily analyzed using the standard protocols that were developed for single-molecule experiments carried out with tens-of-millisecond time resolution and high "data density." Here, we describe a generalized approach, based on time-correlation functions, to obtain kinetic information from microsecond-resolved single-molecule fluorescence measurements. This approach can be used to identify short-lived intermediates that lie on reaction pathways connecting relatively long-lived reactant and product states. As a concrete illustration of the potential of this methodology for analyzing specific macromolecular systems, we accompany the theoretical presentation with the description of a specific biologically relevant example drawn from studies of reaction mechanisms of the assembly of the single-stranded DNA binding protein of the T4 bacteriophage replication complex onto a model DNA replication fork.
Single Nucleobase Identification Using Biophysical Signatures from Nanoelectronic Quantum Tunneling.
Korshoj, Lee E; Afsari, Sepideh; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant
2017-03-01
Nanoelectronic DNA sequencing can provide an important alternative to sequencing-by-synthesis by reducing sample preparation time, cost, and complexity as a high-throughput next-generation technique with accurate single-molecule identification. However, sample noise and signature overlap continue to prevent high-resolution and accurate sequencing results. Probing the molecular orbitals of chemically distinct DNA nucleobases offers a path for facile sequence identification, but molecular entropy (from nucleotide conformations) makes such identification difficult when relying only on the energies of lowest-unoccupied and highest-occupied molecular orbitals (LUMO and HOMO). Here, nine biophysical parameters are developed to better characterize molecular orbitals of individual nucleobases, intended for single-molecule DNA sequencing using quantum tunneling of charges. For this analysis, theoretical models for quantum tunneling are combined with transition voltage spectroscopy to obtain measurable parameters unique to the molecule within an electronic junction. Scanning tunneling spectroscopy is then used to measure these nine biophysical parameters for DNA nucleotides, and a modified machine learning algorithm identified nucleobases. The new parameters significantly improve base calling over merely using LUMO and HOMO frontier orbital energies. Furthermore, high accuracies for identifying DNA nucleobases were observed at different pH conditions. These results have significant implications for developing a robust and accurate high-throughput nanoelectronic DNA sequencing technique. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
New Catalytic DNA Biosensors for Radionuclides and Metal ion
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yi Lu
2008-03-01
We aim to develop new DNA biosensors for simultaneous detection and quantification of bioavailable radionuclides, such as uranium, technetium, and plutonium, and metal contaminants, such as lead, chromium, and mercury. The sensors will be highly sensitive and selective. They will be applied to on-site, real-time assessment of concentration, speciation, and stability of the individual contaminants before and during bioremediation, and for long-term monitoring of DOE contaminated sites. To achieve this goal, we have employed a combinatorial method called “in vitro selection” to search from a large DNA library (~ 1015 different molecules) for catalytic DNA molecules that are highly specificmore » for radionuclides or other metal ions through intricate 3-dimensional interactions as in metalloproteins. Comprehensive biochemical and biophysical studies have been performed on the selected DNA molecules. The findings from these studies have helped to elucidate fundamental principles for designing effective sensors for radionuclides and metal ions. Based on the study, the DNA have been converted to fluorescent or colorimetric sensors by attaching to it fluorescent donor/acceptor pairs or gold nanoparticles, with 11 part-per-trillion detection limit (for uranium) and over million fold selectivity (over other radionuclides and metal ions tested). Practical application of the biosensors for samples from the Environmental Remediation Sciences Program (ERSP) Field Research Center (FRC) at Oak Ridge has also been demonstrated.« less
A DNAzyme-mediated logic gate for programming molecular capture and release on DNA origami.
Li, Feiran; Chen, Haorong; Pan, Jing; Cha, Tae-Gon; Medintz, Igor L; Choi, Jong Hyun
2016-06-28
Here we design a DNA origami-based site-specific molecular capture and release platform operated by a DNAzyme-mediated logic gate process. We show the programmability and versatility of this platform with small molecules, proteins, and nanoparticles, which may also be controlled by external light signals.
Cell-targetable DNA nanocapsules for spatiotemporal release of caged bioactive small molecules
NASA Astrophysics Data System (ADS)
Veetil, Aneesh T.; Chakraborty, Kasturi; Xiao, Kangni; Minter, Myles R.; Sisodia, Sangram S.; Krishnan, Yamuna
2017-12-01
Achieving triggered release of small molecules with spatial and temporal precision at designated cells within an organism remains a challenge. By combining a cell-targetable, icosahedral DNA-nanocapsule loaded with photoresponsive polymers, we show cytosolic delivery of small molecules with the spatial resolution of single endosomes in specific cells in Caenorhabditis elegans. Our technology can report on the extent of small molecules released after photoactivation as well as pinpoint the location at which uncaging of the molecules occurred. We apply this technology to release dehydroepiandrosterone (DHEA), a neurosteroid that promotes neurogenesis and neuron survival, and determined the timescale of neuronal activation by DHEA, using light-induced release of DHEA from targeted DNA nanocapsules. Importantly, sequestration inside the DNA capsule prevents photocaged DHEA from activating neurons prematurely. Our methodology can in principle be generalized to diverse neurostimulatory molecules.
NASA Astrophysics Data System (ADS)
Li, Xiaoqing; Hu, Rui; Li, Ji; Tong, Xin; Diao, J. J.; Yu, Dapeng; Zhao, Qing
2016-10-01
Nanopore-based sensing technology is considered high-throughput and low-cost for single molecule detection, but solid-state nanopores have suffered from pore clogging issues. A simple Tween 20 coating method is applied to ensure long-term (several hours) non-sticky translocation of various types of bio-molecules through SiN nanopores in a wide pH range (4.0-13.0). We also emphasize the importance of choosing appropriate concentration of Tween 20 coating buffer for desired effect. By coating nanopores with a Tween 20 layer, we are able to differentiate between single-stranded DNA and double-stranded DNA, to identify drift-dominated domain for single-stranded DNA, to estimate BSA volume and to observe the shape of individual nucleosome translocation event without non-specific adsorption. The wide pH endurance from 4.0 to 13.0 and the broad types of detection analytes including nucleic acids, proteins, and biological complexes highlight the great application potential of Tween 20-coated solid-state nanopores.
Proposed Ancestors of Phage Nucleic Acid Packaging Motors (and Cells)
Serwer, Philip
2011-01-01
I present a hypothesis that begins with the proposal that abiotic ancestors of phage RNA and DNA packaging systems (and cells) include mobile shells with an internal, molecule-transporting cavity. The foundations of this hypothesis include the conjecture that current nucleic acid packaging systems have imprints from abiotic ancestors. The abiotic shells (1) initially imbibe and later also bind and transport organic molecules, thereby providing a means for producing molecular interactions that are links in the chain of events that produces ancestors to the first molecules that are both information carrying and enzymatically active, and (2) are subsequently scaffolds on which proteins assemble to form ancestors common to both shells of viral capsids and cell membranes. Emergence of cells occurs via aggregation and merger of shells and internal contents. The hypothesis continues by using proposed imprints of abiotic and biotic ancestors to deduce an ancestral thermal ratchet-based DNA packaging motor that subsequently evolves to integrate a DNA packaging ATPase that provides a power stroke. PMID:21994778
Design of stapled DNA-minor-groove-binding molecules with a mutable atom simulated annealing method
NASA Astrophysics Data System (ADS)
Walker, Wynn L.; Kopka, Mary L.; Dickerson, Richard E.; Goodsell, David S.
1997-11-01
We report the design of optimal linker geometries for the synthesis of stapledDNA-minor-groove-binding molecules. Netropsin, distamycin, and lexitropsinsbind side-by-side to mixed-sequence DNA and offer an opportunity for thedesign of sequence-reading molecules. Stapled molecules, with two moleculescovalently linked side-by-side, provide entropic gains and restrain theposition of one molecule relative to its neighbor. Using a free-atom simulatedannealing technique combined with a discrete mutable atom definition, optimallengths and atomic composition for covalent linkages are determined, and anovel hydrogen bond `zipper' is proposed to phase two molecules accuratelyside-by-side.
Mechanical design of DNA nanostructures
NASA Astrophysics Data System (ADS)
Castro, Carlos E.; Su, Hai-Jun; Marras, Alexander E.; Zhou, Lifeng; Johnson, Joshua
2015-03-01
Structural DNA nanotechnology is a rapidly emerging field that has demonstrated great potential for applications such as single molecule sensing, drug delivery, and templating molecular components. As the applications of DNA nanotechnology expand, a consideration of their mechanical behavior is becoming essential to understand how these structures will respond to physical interactions. This review considers three major avenues of recent progress in this area: (1) measuring and designing mechanical properties of DNA nanostructures, (2) designing complex nanostructures based on imposed mechanical stresses, and (3) designing and controlling structurally dynamic nanostructures. This work has laid the foundation for mechanically active nanomachines that can generate, transmit, and respond to physical cues in molecular systems.Structural DNA nanotechnology is a rapidly emerging field that has demonstrated great potential for applications such as single molecule sensing, drug delivery, and templating molecular components. As the applications of DNA nanotechnology expand, a consideration of their mechanical behavior is becoming essential to understand how these structures will respond to physical interactions. This review considers three major avenues of recent progress in this area: (1) measuring and designing mechanical properties of DNA nanostructures, (2) designing complex nanostructures based on imposed mechanical stresses, and (3) designing and controlling structurally dynamic nanostructures. This work has laid the foundation for mechanically active nanomachines that can generate, transmit, and respond to physical cues in molecular systems. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr07153k
Arora, Sanjeevani; Heyza, Joshua; Zhang, Hao; Kalman-Maltese, Vivian; Tillison, Kristin; Floyd, Ashley M.; Chalfin, Elaine M.; Bepler, Gerold; Patrick, Steve M.
2016-01-01
ERCC1-XPF heterodimer is a 5′-3′ structure-specific endonuclease which is essential in multiple DNA repair pathways in mammalian cells. ERCC1-XPF (ERCC1-ERCC4) repairs cisplatin-DNA intrastrand adducts and interstrand crosslinks and its specific inhibition has been shown to enhance cisplatin cytotoxicity in cancer cells. In this study, we describe a high throughput screen (HTS) used to identify small molecules that inhibit the endonuclease activity of ERCC1-XPF. Primary screens identified two compounds that inhibit ERCC1-XPF activity in the nanomolar range. These compounds were validated in secondary screens against two other non-related endonucleases to ensure specificity. Results from these screens were validated using an in vitro gel-based nuclease assay. Electrophoretic mobility shift assays (EMSAs) further show that these compounds do not inhibit the binding of purified ERCC1-XPF to DNA. Next, in lung cancer cells these compounds potentiated cisplatin cytotoxicity and inhibited DNA repair. Structure activity relationship (SAR) studies identified related compounds for one of the original Hits, which also potentiated cisplatin cytotoxicity in cancer cells. Excitingly, dosing with NSC16168 compound potentiated cisplatin antitumor activity in a lung cancer xenograft model. Further development of ERCC1-XPF DNA repair inhibitors is expected to sensitize cancer cells to DNA damage-based chemotherapy. PMID:27650543
DNA-DNA interaction beyond the ground state
NASA Astrophysics Data System (ADS)
Lee, D. J.; Wynveen, A.; Kornyshev, A. A.
2004-11-01
The electrostatic interaction potential between DNA duplexes in solution is a basis for the statistical mechanics of columnar DNA assemblies. It may also play an important role in recombination of homologous genes. We develop a theory of this interaction that includes thermal torsional fluctuations of DNA using field-theoretical methods and Monte Carlo simulations. The theory extends and rationalizes the earlier suggested variational approach which was developed in the context of a ground state theory of interaction of nonhomologous duplexes. It shows that the heuristic variational theory is equivalent to the Hartree self-consistent field approximation. By comparison of the Hartree approximation with an exact solution based on the QM analogy of path integrals, as well as Monte Carlo simulations, we show that this easily analytically-tractable approximation works very well in most cases. Thermal fluctuations do not remove the ability of DNA molecules to attract each other at favorable azimuthal conformations, neither do they wash out the possibility of electrostatic “snap-shot” recognition of homologous sequences, considered earlier on the basis of ground state calculations. At short distances DNA molecules undergo a “torsional alignment transition,” which is first order for nonhomologous DNA and weaker order for homologous sequences.
A silicon carbide nanowire field effect transistor for DNA detection
NASA Astrophysics Data System (ADS)
Fradetal, L.; Bano, E.; Attolini, G.; Rossi, F.; Stambouli, V.
2016-06-01
This work reports on the label-free electrical detection of DNA molecules for the first time, using silicon carbide (SiC) as a novel material for the realization of nanowire field effect transistors (NWFETs). SiC is a promising semiconductor for this application due to its specific characteristics such as chemical inertness and biocompatibility. Non-intentionally n-doped SiC NWs are first grown using a bottom-up vapor-liquid-solid (VLS) mechanism, leading to the NWs exhibiting needle-shaped morphology, with a length of approximately 2 μm and a diameter ranging from 25 to 60 nm. Then, the SiC NWFETs are fabricated and functionalized with DNA molecule probes via covalent coupling using an amino-terminated organosilane. The drain current versus drain voltage (I d-V d) characteristics obtained after the DNA grafting and hybridization are reported from the comparative and simultaneous measurements carried out on the SiC NWFETs, used either as sensors or references. As a representative result, the current of the sensor is lowered by 22% after probe DNA grafting and by 7% after target DNA hybridization, while the current of the reference does not vary by more than ±0.6%. The current decrease confirms the field effect induced by the negative charges of the DNA molecules. Moreover, the selectivity, reproducibility, reversibility and stability of the studied devices are emphasized by de-hybridization, non-complementary hybridization and re-hybridization experiments. This first proof of concept opens the way for future developments using SiC-NW-based sensors.
Zou, Hong; Zhang, Jin; Li, Wenxiang; Wu, Shangong; Wang, Guitang
2012-01-01
The 17,922 base pairs (bp) nucleotide sequence of the linear mitochondrial DNA (mtDNA) molecule of the freshwater jellyfish Craspedacusta sowerbyi (Hydrozoa, Trachylina, Limnomedusae) has been determined. This sequence exhibits surprisingly low A+T content (57.1%), containing genes for 13 energy pathway proteins, a small and a large subunit rRNAs, and methionine and tryptophan tRNAs. Mitochondrial ancestral medusozoan gene order (AMGO) was found in the C. sowerbyi, as those found in Cubaia aphrodite (Hydrozoa, Trachylina, Limnomedusae), discomedusan Scyphozoa and Staurozoa. The genes of C. sowerbyi mtDNA are arranged in two clusters with opposite transcriptional polarities, whereby transcription proceeds toward the ends of the DNA molecule. Identical inverted terminal repeats (ITRs) flank the ends of the mitochondrial DNA molecule, a characteristic typical of medusozoans. In addition, two open reading frames (ORFs) of 354 and 1611 bp in length were found downstream of the large subunit rRNA gene, similar to the two ORFs of ORF314 and polB discovered in the linear mtDNA of C. aphrodite, discomedusan Scyphozoa and Staurozoa. Phylogenetic analyses of C. sowerbyi and other cnidarians were carried out based on both nucleotide and inferred amino acid sequences of the 13 mitochondrial energy pathway genes. Our working hypothesis supports the monophyletic Medusozoa being a sister group to Octocorallia (Cnidaria, Anthozoa). Within Medusozoa, the phylogenetic analysis suggests that Staurozoa may be the earliest diverging class and the sister group of all other medusozoans. Cubozoa and coronate Scyphozoa form a clade that is the sister group of Hydrozoa plus discomedusan Scyphozoa. Hydrozoa is the sister group of discomedusan Scyphozoa. Semaeostomeae is a paraphyletic clade with Rhizostomeae, while Limnomedusae (Trachylina) is the sister group of hydroidolinans and may be the earliest diverging lineage among Hydrozoa.
Zou, Hong; Zhang, Jin; Li, Wenxiang; Wu, Shangong; Wang, Guitang
2012-01-01
The 17,922 base pairs (bp) nucleotide sequence of the linear mitochondrial DNA (mtDNA) molecule of the freshwater jellyfish Craspedacusta sowerbyi (Hydrozoa,Trachylina, Limnomedusae) has been determined. This sequence exhibits surprisingly low A+T content (57.1%), containing genes for 13 energy pathway proteins, a small and a large subunit rRNAs, and methionine and tryptophan tRNAs. Mitochondrial ancestral medusozoan gene order (AMGO) was found in the C. sowerbyi, as those found in Cubaia aphrodite (Hydrozoa, Trachylina, Limnomedusae), discomedusan Scyphozoa and Staurozoa. The genes of C. sowerbyi mtDNA are arranged in two clusters with opposite transcriptional polarities, whereby transcription proceeds toward the ends of the DNA molecule. Identical inverted terminal repeats (ITRs) flank the ends of the mitochondrial DNA molecule, a characteristic typical of medusozoans. In addition, two open reading frames (ORFs) of 354 and 1611 bp in length were found downstream of the large subunit rRNA gene, similar to the two ORFs of ORF314 and polB discovered in the linear mtDNA of C. aphrodite, discomedusan Scyphozoa and Staurozoa. Phylogenetic analyses of C. sowerbyi and other cnidarians were carried out based on both nucleotide and inferred amino acid sequences of the 13 mitochondrial energy pathway genes. Our working hypothesis supports the monophyletic Medusozoa being a sister group to Octocorallia (Cnidaria, Anthozoa). Within Medusozoa, the phylogenetic analysis suggests that Staurozoa may be the earliest diverging class and the sister group of all other medusozoans. Cubozoa and coronate Scyphozoa form a clade that is the sister group of Hydrozoa plus discomedusan Scyphozoa. Hydrozoa is the sister group of discomedusan Scyphozoa. Semaeostomeae is a paraphyletic clade with Rhizostomeae, while Limnomedusae (Trachylina) is the sister group of hydroidolinans and may be the earliest diverging lineage among Hydrozoa. PMID:23240028
Nayak, Alpana; Suresh, K A
2008-08-01
We have studied the electrical conductivity in monolayer films of an ionic disk-shaped liquid-crystal molecule, pyridinium tethered with hexaalkoxytriphenylene (PyTp), and its complex with DNA by current-sensing atomic force microscopy (CS-AFM). The pure PyTp and PyTp-DNA complex monolayer films were first formed at the air-water interface and then transferred onto conducting substrates by the Langmuir-Blodgett (LB) technique to study the nanoscale electron transport through these films. The conductive tip of CS-AFM, the LB film, and the metal substrate form a nanoscopic metal-LB film-metal (M-LB-M) junction. We have measured the current-voltage (I-V) characteristics for the M-LB-M junction using CS-AFM and have analyzed the data quantitatively. We find that the I-V curves fit well to the Fowler-Nordheim (FN) model, suggesting electron tunneling to be a possible mechanism for electron transport in our system. Further, analysis of the I-V curves based on the FN model yields the barrier heights of PyTp-DNA complex and pure PyTp films. Electron transport studies of films of ionic disk-shaped liquid-crystal molecules and their complex with DNA are important from the point of view of their applications in organic electronics.
NASA Astrophysics Data System (ADS)
Nayak, Alpana; Suresh, K. A.
2008-08-01
We have studied the electrical conductivity in monolayer films of an ionic disk-shaped liquid-crystal molecule, pyridinium tethered with hexaalkoxytriphenylene (PyTp), and its complex with DNA by current-sensing atomic force microscopy (CS-AFM). The pure PyTp and PyTp-DNA complex monolayer films were first formed at the air-water interface and then transferred onto conducting substrates by the Langmuir-Blodgett (LB) technique to study the nanoscale electron transport through these films. The conductive tip of CS-AFM, the LB film, and the metal substrate form a nanoscopic metal-LB film-metal (M-LB-M) junction. We have measured the current-voltage (I-V) characteristics for the M-LB-M junction using CS-AFM and have analyzed the data quantitatively. We find that the I-V curves fit well to the Fowler-Nordheim (FN) model, suggesting electron tunneling to be a possible mechanism for electron transport in our system. Further, analysis of the I-V curves based on the FN model yields the barrier heights of PyTp-DNA complex and pure PyTp films. Electron transport studies of films of ionic disk-shaped liquid-crystal molecules and their complex with DNA are important from the point of view of their applications in organic electronics.
Prinz, J.; Heck, C.; Ellerik, L.; Merk, V.
2016-01-01
DNA origami nanostructures are a versatile tool to arrange metal nanostructures and other chemical entities with nanometer precision. In this way gold nanoparticle dimers with defined distance can be constructed, which can be exploited as novel substrates for surface enhanced Raman scattering (SERS). We have optimized the size, composition and arrangement of Au/Ag nanoparticles to create intense SERS hot spots, with Raman enhancement up to 1010, which is sufficient to detect single molecules by Raman scattering. This is demonstrated using single dye molecules (TAMRA and Cy3) placed into the center of the nanoparticle dimers. In conjunction with the DNA origami nanostructures novel SERS substrates are created, which can in the future be applied to the SERS analysis of more complex biomolecular targets, whose position and conformation within the SERS hot spot can be precisely controlled. PMID:26892770
Plasmid DNA Delivery: Nanotopography Matters.
Song, Hao; Yu, Meihua; Lu, Yao; Gu, Zhengying; Yang, Yannan; Zhang, Min; Fu, Jianye; Yu, Chengzhong
2017-12-20
Plasmid DNA molecules with unique loop structures have widespread bioapplications, in many cases relying heavily on delivery vehicles to introduce them into cells and achieve their functions. Herein, we demonstrate that control over delicate nanotopography of silica nanoparticles as plasmid DNA vectors has significant impact on the transfection efficacy. For silica nanoparticles with rambutan-, raspberry-, and flower-like morphologies composed of spike-, hemisphere-, and bowl-type subunit nanotopographies, respectively, the rambutan-like nanoparticles with spiky surfaces demonstrate the highest plasmid DNA binding capability and transfection efficacy of 88%, higher than those reported for silica-based nanovectors. Moreover, it is shown that the surface spikes of rambutan nanoparticles provide a continuous open space to bind DNA chains via multivalent interactions and protect the gene molecules sheltered in the spiky layer against nuclease degradation, exhibiting no significant transfection decay. This unique protection feature is in great contrast to a commercial transfection agent with similar transfection performance but poor protection capability against enzymatic cleavage. Our study provides new understandings in the rational design of nonviral vectors for efficient gene delivery.
Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets.
Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard
2007-10-30
We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 x 10(8) bound targets per cm(2) sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format.
Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets
Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard
2007-01-01
We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 × 108 bound targets per cm2 sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format. PMID:17951434
Mapping DNA polymerase errors by single-molecule sequencing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, David F.; Lu, Jenny; Chang, Seungwoo
Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less
Mapping DNA polymerase errors by single-molecule sequencing
Lee, David F.; Lu, Jenny; Chang, Seungwoo; ...
2016-05-16
Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less
Binding regularities in complexes of transcription factors with operator DNA: homeodomain family.
Chirgadze, Yu N; Zheltukhin, E I; Polozov, R V; Sivozhelezov, V S; Ivanov, V V
2009-06-01
In order to disclose general regularities of binding in homeodomain-DNA complexes we considered five of them and extended the observed regularities over the entire homeodomain family. The five complexes have been selected by similarity of protein structures and patterns of contacting residues. Their long range interactions and interfaces were compared. The long-range stage of the recognition process was characterized by electrostatic potentials about 5 Angstrom away from molecular surfaces of protein or DNA. For proteins, clear positive potential is displayed only at the side contacting the DNA. The double-chained DNA molecule displays a rather strong negative potential, especially in their grooves. Thus, a functional role of electrostatics is a guiding of the protein into the DNA major groove, so the protein and DNA could form a loose non-specific complex. At the close-range stage, neutralization of the phosphate charges by positively charged residues is necessary for decreasing the strong electrostatic potential of DNA, allowing nucleotide bases to participate in the formation of protein-DNA atomic contacts in the interface. The recognizing alpha-helix of protein was shown to form both invariant and variable groups of contacts with DNA by means of certain specific side groups. The invariant contacts included highly specific protein-DNA hydrogen bonds between asparagine and adenine, nonpolar contacts of hydrophobic amino acids serving as a stereochemical barrier for fixing the protein factor on DNA, and an interface cluster of water molecules providing local conformational mobility necessary for the dissociation process. There is a unique water molecule within the interface that is conservative and located at the interface center. Invariant contacts of the proteins are mostly formed with the TAAT motif of the promoter DNA forward strand. While the invariant contacts specify the family of homeodomains, the variable contacts that are formed with the reverse strand of DNA provide specificity of individual complexes within the homeodomain family.
NASA Astrophysics Data System (ADS)
Nicasio-Collazo, Luz Adriana; Delgado-González, Alexandra; Hernández-Lemus, Enrique; Castañeda-Priego, Ramón
2017-04-01
The study of the effects associated with the electrostatic properties of DNA is of fundamental importance to understand both its molecular properties at the single molecule level, like the rigidity of the chain, and its interaction with other charged bio-molecules, including other DNA molecules; such interactions are crucial to maintain the thermodynamic stability of the intra-cellular medium. In the present work, we combine the Poisson-Boltzmann mean-field theory with an irreversible thermodynamic approximation to analyze the effects of counterion accumulation inside DNA on both the denaturation profile of the chain and the equation of state of the suspension. To this end, we model the DNA molecule as a porous charged cylinder immersed in an aqueous solution. These thermo-electrostatic effects are explicitly studied in the particular case of some genes for which damage in their sequence is associated with diffuse large B-cell lymphoma.
Cooper, Lauren A; Stringer, Anne M; Wade, Joseph T
2018-04-17
In clustered regularly interspaced short palindromic repeat (CRISPR)-Cas (CRISPR-associated) immunity systems, short CRISPR RNAs (crRNAs) are bound by Cas proteins, and these complexes target invading nucleic acid molecules for degradation in a process known as interference. In type I CRISPR-Cas systems, the Cas protein complex that binds DNA is known as Cascade. Association of Cascade with target DNA can also lead to acquisition of new immunity elements in a process known as primed adaptation. Here, we assess the specificity determinants for Cascade-DNA interaction, interference, and primed adaptation in vivo , for the type I-E system of Escherichia coli Remarkably, as few as 5 bp of crRNA-DNA are sufficient for association of Cascade with a DNA target. Consequently, a single crRNA promotes Cascade association with numerous off-target sites, and the endogenous E. coli crRNAs direct Cascade binding to >100 chromosomal sites. In contrast to the low specificity of Cascade-DNA interactions, >18 bp are required for both interference and primed adaptation. Hence, Cascade binding to suboptimal, off-target sites is inert. Our data support a model in which the initial Cascade association with DNA targets requires only limited sequence complementarity at the crRNA 5' end whereas recruitment and/or activation of the Cas3 nuclease, a prerequisite for interference and primed adaptation, requires extensive base pairing. IMPORTANCE Many bacterial and archaeal species encode CRISPR-Cas immunity systems that protect against invasion by foreign DNA. In the Escherichia coli CRISPR-Cas system, a protein complex, Cascade, binds 61-nucleotide (nt) CRISPR RNAs (crRNAs). The Cascade complex is directed to invading DNA molecules through base pairing between the crRNA and target DNA. This leads to recruitment of the Cas3 nuclease, which destroys the invading DNA molecule and promotes acquisition of new immunity elements. We made the first in vivo measurements of Cascade binding to DNA targets. Thus, we show that Cascade binding to DNA is highly promiscuous; endogenous E. coli crRNAs can direct Cascade binding to >100 chromosomal locations. In contrast, we show that targeted degradation and acquisition of new immunity elements require highly specific association of Cascade with DNA, limiting CRISPR-Cas function to the appropriate targets. Copyright © 2018 Cooper et al.
Wang, Yaru; Ma, Na; Wang, Yan; Chen, Guangju
2012-01-01
It has been extensively developed in recent years that cell-permeable small molecules, such as polyamide, can be programmed to disrupt transcription factor-DNA interfaces and can silence aberrant gene expression. For example, cyclic pyrrole-imidazole polyamide that competes with glucocorticoid receptor (GR) for binding to glucocorticoid response elements could be expected to affect the DNA dependent binding by interfering with the protein-DNA interface. However, how such small molecules affect the transcription factor-DNA interfaces and gene regulatory pathways through DNA structure distortion is not fully understood so far. In the present work, we have constructed some models, especially the ternary model of polyamides+DNA+GR DNA-binding domain (GRDBD) dimer, and carried out molecular dynamics simulations and free energy calculations for them to address how polyamide molecules disrupt the GRDBD and DNA interface when polyamide and protein bind at the same sites on opposite grooves of DNA. We found that the cyclic polyamide binding in minor groove of DNA can induce a large structural perturbation of DNA, i.e. a >4 Å widening of the DNA minor groove and a compression of the major groove by more than 4 Å as compared with the DNA molecule in the GRDBD dimer+DNA complex. Further investigations for the ternary system of polyamides+DNA+GRDBD dimer and the binary system of allosteric DNA+GRDBD dimer revealed that the compression of DNA major groove surface causes GRDBD to move away from the DNA major groove with the initial average distance of ∼4 Å to the final average distance of ∼10 Å during 40 ns simulation course. Therefore, this study straightforward explores how small molecule targeting specific sites in the DNA minor groove disrupts the transcription factor-DNA interface in DNA major groove, and consequently modulates gene expression.
Development of novel vaccines using DNA shuffling and screening strategies.
Locher, Christopher P; Soong, Nay Wei; Whalen, Robert G; Punnonen, Juha
2004-02-01
DNA shuffling and screening technologies recombine and evolve genes in vitro to rapidly obtain molecules with improved biological activity and fitness. In this way, genes from related strains are bred like plants or livestock and their successive progeny are selected. These technologies have also been called molecular breeding-directed molecular evolution. Recent developments in bioinformatics-assisted computer programs have facilitated the design, synthesis and analysis of DNA shuffled libraries of chimeric molecules. New applications in vaccine development are among the key features of DNA shuffling and screening technologies because genes from several strains or antigenic variants of pathogens can be recombined to create novel molecules capable of inducing immune responses that protect against infections by multiple strains of pathogens. In addition, molecules such as co-stimulatory molecules and cytokines have been evolved to have improved T-cell proliferation and cytokine production compared with the wild-type human molecules. These molecules can be used to immunomodulate vaccine responsiveness and have multiple applications in infectious diseases, cancer, allergy and autoimmunity. Moreover, DNA shuffling and screening technologies can facilitate process development of vaccine manufacturing through increased expression of recombinant polypeptides and viruses. Therefore, DNA shuffling and screening technologies can overcome some of the challenges that vaccine development currently faces.
Molecular structure of r/GCG/d/TATACGC/ - A DNA-RNA hybrid helix joined to double helical DNA
NASA Technical Reports Server (NTRS)
Wang, A. H.-J.; Fujii, S.; Rich, A.; Van Boom, J. H.; Van Der Marel, G. A.; Van Boeckel, S. A. A.
1982-01-01
The molecule r(GCG)d(TATACGC) is self-complementary and forms two DNA-RNA hybrid segments surrounding a central region of double helical DNA; its molecular structure has been solved by X-ray analysis. All three parts of the molecule adopt a conformation which is close to that seen in the 11-fold RNA double helix. The conformation of the ribonucleotides is partly determined by water molecules bridging between the ribose O2' hydroxyl group and cytosine O2. The hybrid-DNA duplex junction contains no structural discontinuities. However, the central DNA TATA sequence has some structural irregularities.
DNA confinement in nanochannels: physics and biological applications
NASA Astrophysics Data System (ADS)
Reisner, Walter; Pedersen, Jonas N.; Austin, Robert H.
2012-10-01
DNA is the central storage molecule of genetic information in the cell, and reading that information is a central problem in biology. While sequencing technology has made enormous advances over the past decade, there is growing interest in platforms that can readout genetic information directly from long single DNA molecules, with the ultimate goal of single-cell, single-genome analysis. Such a capability would obviate the need for ensemble averaging over heterogeneous cellular populations and eliminate uncertainties introduced by cloning and molecular amplification steps (thus enabling direct assessment of the genome in its native state). In this review, we will discuss how the information contained in genomic-length single DNA molecules can be accessed via physical confinement in nanochannels. Due to self-avoidance interactions, DNA molecules will stretch out when confined in nanochannels, creating a linear unscrolling of the genome along the channel for analysis. We will first review the fundamental physics of DNA nanochannel confinement—including the effect of varying ionic strength—and then discuss recent applications of these systems to genomic mapping. Apart from the intense biological interest in extracting linear sequence information from elongated DNA molecules, from a physics view these systems are fascinating as they enable probing of single-molecule conformation in environments with dimensions that intersect key physical length-scales in the 1 nm to 100 µm range.
DNA confinement in nanochannels: physics and biological applications.
Reisner, Walter; Pedersen, Jonas N; Austin, Robert H
2012-10-01
DNA is the central storage molecule of genetic information in the cell, and reading that information is a central problem in biology. While sequencing technology has made enormous advances over the past decade, there is growing interest in platforms that can readout genetic information directly from long single DNA molecules, with the ultimate goal of single-cell, single-genome analysis. Such a capability would obviate the need for ensemble averaging over heterogeneous cellular populations and eliminate uncertainties introduced by cloning and molecular amplification steps (thus enabling direct assessment of the genome in its native state). In this review, we will discuss how the information contained in genomic-length single DNA molecules can be accessed via physical confinement in nanochannels. Due to self-avoidance interactions, DNA molecules will stretch out when confined in nanochannels, creating a linear unscrolling of the genome along the channel for analysis. We will first review the fundamental physics of DNA nanochannel confinement--including the effect of varying ionic strength--and then discuss recent applications of these systems to genomic mapping. Apart from the intense biological interest in extracting linear sequence information from elongated DNA molecules, from a physics view these systems are fascinating as they enable probing of single-molecule conformation in environments with dimensions that intersect key physical length-scales in the 1 nm to 100 µm range.
Cartwright, Joseph F; Anderson, Karin; Longworth, Joseph; Lobb, Philip; James, David C
2018-06-01
High-fidelity replication of biologic-encoding recombinant DNA sequences by engineered mammalian cell cultures is an essential pre-requisite for the development of stable cell lines for the production of biotherapeutics. However, immortalized mammalian cells characteristically exhibit an increased point mutation frequency compared to mammalian cells in vivo, both across their genomes and at specific loci (hotspots). Thus unforeseen mutations in recombinant DNA sequences can arise and be maintained within producer cell populations. These may affect both the stability of recombinant gene expression and give rise to protein sequence variants with variable bioactivity and immunogenicity. Rigorous quantitative assessment of recombinant DNA integrity should therefore form part of the cell line development process and be an essential quality assurance metric for instances where synthetic/multi-component assemblies are utilized to engineer mammalian cells, such as the assessment of recombinant DNA fidelity or the mutability of single-site integration target loci. Based on Pacific Biosciences (Menlo Park, CA) single molecule real-time (SMRT™) circular consensus sequencing (CCS) technology we developed a rDNA sequence analysis tool to process the multi-parallel sequencing of ∼40,000 single recombinant DNA molecules. After statistical filtering of raw sequencing data, we show that this analytical method is capable of detecting single point mutations in rDNA to a minimum single mutation frequency of 0.0042% (<1/24,000 bases). Using a stable CHO transfectant pool harboring a randomly integrated 5 kB plasmid construct encoding GFP we found that 28% of recombinant plasmid copies contained at least one low frequency (<0.3%) point mutation. These mutations were predominantly found in GC base pairs (85%) and that there was no positional bias in mutation across the plasmid sequence. There was no discernable difference between the mutation frequencies of coding and non-coding DNA. The putative ratio of non-synonymous and synonymous changes within the open reading frames (ORFs) in the plasmid sequence indicates that natural selection does not impact upon the prevalence of these mutations. Here we have demonstrated the abundance of mutations that fall outside of the reported range of detection of next generation sequencing (NGS) and second generation sequencing (SGS) platforms, providing a methodology capable of being utilized in cell line development platforms to identify the fidelity of recombinant genes throughout the production process. © 2018 Wiley Periodicals, Inc.
Transportin mediates nuclear entry of DNA in vertebrate systems.
Lachish-Zalait, Aurelie; Lau, Corine K; Fichtman, Boris; Zimmerman, Ella; Harel, Amnon; Gaylord, Michelle R; Forbes, Douglass J; Elbaum, Michael
2009-10-01
Delivery of DNA to the cell nucleus is an essential step in many types of viral infection, transfection, gene transfer by the plant pathogen Agrobacterium tumefaciens and in strategies for gene therapy. Thus, the mechanism by which DNA crosses the nuclear pore complex (NPC) is of great interest. Using nuclei reconstituted in vitro in Xenopus egg extracts, we previously studied DNA passage through the nuclear pores using a single-molecule approach based on optical tweezers. Fluorescently labeled DNA molecules were also seen to accumulate within nuclei. Here we find that this import of DNA relies on a soluble protein receptor of the importin family. To identify this receptor, we used different pathway-specific cargoes in competition studies as well as pathway-specific dominant negative inhibitors derived from the nucleoporin Nup153. We found that inhibition of the receptor transportin suppresses DNA import. In contrast, inhibition of importin beta has little effect on the nuclear accumulation of DNA. The dependence on transportin was fully confirmed in assays using permeabilized HeLa cells and a mammalian cell extract. We conclude that the nuclear import of DNA observed in these different vertebrate systems is largely mediated by the receptor transportin. We further report that histones, a known cargo of transportin, can act as an adaptor for the binding of transportin to DNA.
Kim, Kyung-Il; Lee, Seonghyun; Jin, Xuelin; Kim, Su Ji; Jo, Kyubong; Lee, Jung Heon
2017-01-01
Synthesis of smooth and continuous DNA nanowires, preserving the original structure of native DNA, and allowing its analysis by scanning electron microscope (SEM), is demonstrated. Gold nanoparticles densely assembled on the DNA backbone via thiol-tagged DNA binding peptides work as seeds for metallization of DNA. This method allows whole analysis of DNA molecules with entangled 3D features. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Direct observation of single flexible polymers using single stranded DNA†
Brockman, Christopher; Kim, Sun Ju
2012-01-01
Over the last 15 years, double stranded DNA (dsDNA) has been used as a model polymeric system for nearly all single polymer dynamics studies. However, dsDNA is a semiflexible polymer with markedly different molecular properties compared to flexible chains, including synthetic organic polymers. In this work, we report a new system for single polymer studies of flexible chains based on single stranded DNA (ssDNA). We developed a method to synthesize ssDNA for fluorescence microscopy based on rolling circle replication, which generates long strands (>65 kb) of ssDNA containing “designer” sequences, thereby preventing intramolecular base pair interactions. Polymers are synthesized to contain amine-modified bases randomly distributed along the backbone, which enables uniform labelling of polymer chains with a fluorescent dye to facilitate fluorescence microscopy and imaging. Using this approach, we synthesized ssDNA chains with long contour lengths (>30 μm) and relatively low dye loading ratios (~1 dye per 100 bases). In addition, we used epifluorescence microscopy to image single ssDNA polymer molecules stretching in flow in a microfluidic device. Overall, we anticipate that ssDNA will serve as a useful model system to probe the dynamics of polymeric materials at the molecular level. PMID:22956981
KiranKumar, Hulihalli N; RohitKumar, Heggodu G; Advirao, Gopal M
2018-01-01
Two new derivatives of pyrimido[4',5';4,5]thieno(2,3-b)quinoline (PTQ), 9-hydroxy-4-(3-diethylaminopropylamino)pyrimido[4',5';4,5]thieno(2,3-b)quinoline (Hydroxy-DPTQ) and 8-methoxy-4-(3-diethylaminopropylamino)pyrimido[4',5';4,5]thieno(2,3-b)quinoline (Methoxy-DPTQ) were synthesized and their DNA binding ability was analyzed using spectroscopy (UV-visible, fluorescence and circular dichroism), ethidium bromide dye displacement assay, melting temperature (T m ) analysis and computational docking studies. The hypochromism in UV-visible spectrum and increased fluorescence emission of Hydroxy-DPTQ and Methoxy-DPTQ in the presence of DNA suggested the molecule-DNA interaction. The association constants calculated from UV-visible and spectral titrations were of the order 10 4 to 10 6 M -1 . Circular dichroism studies corroborated the induced conformational changes in DNA upon addition of molecules. The change in the ellipticity was observed both in negative and positive peak of DNA, thus, suggesting the intercalation of molecules. The observed displacement of ethidium bromide from the DNA and increased T m , upon addition of DNA confirmed the intercalative mode of binding. This was further validated by computational docking, which showed clear intercalation of molecules into the d(GpC)-d(CpG) site of the receptor DNA. Anticancer activities of these molecules are evaluated by using MTT assay. Both molecules showed antiproliferative activity against all the three cancer cells studied, with Hydroxy-DPTQ being more potential molecule among the two. IC 50 value of Hydroxy-DPTQ and Methoxy-DPTQ were in the range of 3-5μM and 130-250μM, respectively. Copyright © 2017 Elsevier B.V. All rights reserved.
Single-molecule analysis of DNA uncoiling by a type II topoisomerase
NASA Astrophysics Data System (ADS)
Strick, Terence R.; Croquette, Vincent; Bensimon, David
2000-04-01
Type II DNA topoisomerases are ubiquitous ATP-dependent enzymes capable of transporting a DNA through a transient double-strand break in a second DNA segment. This enables them to untangle DNA and relax the interwound supercoils (plectonemes) that arise in twisted DNA. In vivo, they are responsible for untangling replicated chromosomes and their absence at mitosis or meiosis ultimately causes cell death. Here we describe a micromanipulation experiment in which we follow in real time a single Drosophila melanogaster topoisomerase II acting on a linear DNA molecule which is mechanically stretched and supercoiled. By monitoring the DNA's extension in the presence of ATP, we directly observe the relaxation of two supercoils during a single catalytic turnover. By controlling the force pulling on the molecule, we determine the variation of the reaction rate with the applied stress. Finally, in the absence of ATP, we observe the clamping of a DNA crossover by a single topoisomerase on at least two different timescales (configurations). These results show that single molecule experiments are a powerful new tool for the study of topoisomerases.
van 't Hoff, Marcel; Reuter, Marcel; Dryden, David T F; Oheim, Martin
2009-09-21
Bacteriophage lambda-DNA molecules are frequently used as a scaffold to characterize the action of single proteins unwinding, translocating, digesting or repairing DNA. However, scaling up such single-DNA-molecule experiments under identical conditions to attain statistically relevant sample sizes remains challenging. Additionally the movies obtained are frequently noisy and difficult to analyse with any precision. We address these two problems here using, firstly, a novel variable-angle total internal reflection fluorescence (VA-TIRF) reflector composed of a minimal set of optical reflective elements, and secondly, using single value decomposition (SVD) to improve the signal-to-noise ratio prior to analysing time-lapse image stacks. As an example, we visualize under identical optical conditions hundreds of surface-tethered single lambda-DNA molecules, stained with the intercalating dye YOYO-1 iodide, and stretched out in a microcapillary flow. Another novelty of our approach is that we arrange on a mechanically driven stage several capillaries containing saline, calibration buffer and lambda-DNA, respectively, thus extending the approach to high-content, high-throughput screening of single molecules. Our length measurements of individual DNA molecules from noise-reduced kymograph images using SVD display a 6-fold enhanced precision compared to raw-data analysis, reaching approximately 1 kbp resolution. Combining these two methods, our approach provides a straightforward yet powerful way of collecting statistically relevant amounts of data in a semi-automated manner. We believe that our conceptually simple technique should be of interest for a broader range of single-molecule studies, well beyond the specific example of lambda-DNA shown here.
Single DNA molecule detection using nanopipettes and nanoparticles.
Karhanek, Miloslav; Kemp, Jennifer T; Pourmand, Nader; Davis, Ronald W; Webb, Chris D
2005-02-01
Single DNA molecules labeled with nanoparticles can be detected by blockades of ionic current as they are translocated through a nanopipette tip formed by a pulled glass capillary. The nanopipette detection technique can provide not only tools for detection and identification of single DNA and protein molecules but also deeper insight and understanding of stochastic interactions of various biomolecules with their environment.
Second-generation DNA-templated macrocycle libraries for the discovery of bioactive small molecules.
Usanov, Dmitry L; Chan, Alix I; Maianti, Juan Pablo; Liu, David R
2018-07-01
DNA-encoded libraries have emerged as a widely used resource for the discovery of bioactive small molecules, and offer substantial advantages compared with conventional small-molecule libraries. Here, we have developed and streamlined multiple fundamental aspects of DNA-encoded and DNA-templated library synthesis methodology, including computational identification and experimental validation of a 20 × 20 × 20 × 80 set of orthogonal codons, chemical and computational tools for enhancing the structural diversity and drug-likeness of library members, a highly efficient polymerase-mediated template library assembly strategy, and library isolation and purification methods. We have integrated these improved methods to produce a second-generation DNA-templated library of 256,000 small-molecule macrocycles with improved drug-like physical properties. In vitro selection of this library for insulin-degrading enzyme affinity resulted in novel insulin-degrading enzyme inhibitors, including one of unusual potency and novel macrocycle stereochemistry (IC 50 = 40 nM). Collectively, these developments enable DNA-templated small-molecule libraries to serve as more powerful, accessible, streamlined and cost-effective tools for bioactive small-molecule discovery.
DNA-Based Enzyme Reactors and Systems
Linko, Veikko; Nummelin, Sami; Aarnos, Laura; Tapio, Kosti; Toppari, J. Jussi; Kostiainen, Mauri A.
2016-01-01
During recent years, the possibility to create custom biocompatible nanoshapes using DNA as a building material has rapidly emerged. Further, these rationally designed DNA structures could be exploited in positioning pivotal molecules, such as enzymes, with nanometer-level precision. This feature could be used in the fabrication of artificial biochemical machinery that is able to mimic the complex reactions found in living cells. Currently, DNA-enzyme hybrids can be used to control (multi-enzyme) cascade reactions and to regulate the enzyme functions and the reaction pathways. Moreover, sophisticated DNA structures can be utilized in encapsulating active enzymes and delivering the molecular cargo into cells. In this review, we focus on the latest enzyme systems based on novel DNA nanostructures: enzyme reactors, regulatory devices and carriers that can find uses in various biotechnological and nanomedical applications. PMID:28335267
Method for in vitro recombination
Gibson, Daniel Glenn; Smith, Hamilton O
2013-05-07
The present invention relates to an in vitro method, using isolated protein reagents, for joining two double-stranded (ds) DNA molecules of interest, wherein the distal region of the first DNA molecule and the proximal region of the second DNA molecule share a region of sequence identity. The method allows the joining of a number of DNA fragments, in a predetermined order and orientation, without the use of restriction enzymes. It can be used, e.g., to join synthetically produced sub-fragments of a gene or genome of interest.
Induced Polarization Influences the Fundamental Forces in DNA Base Flipping
2015-01-01
Base flipping in DNA is an important process involved in genomic repair and epigenetic control of gene expression. The driving forces for these processes are not fully understood, especially in the context of the underlying dynamics of the DNA and solvent effects. We studied double-stranded DNA oligomers that have been previously characterized by imino proton exchange NMR using both additive and polarizable force fields. Our results highlight the importance of induced polarization on the base flipping process, yielding near-quantitative agreement with experimental measurements of the equilibrium between the base-paired and flipped states. Further, these simulations allow us to quantify for the first time the energetic implications of polarization on the flipping pathway. Free energy barriers to base flipping are reduced by changes in dipole moments of both the flipped bases that favor solvation of the bases in the open state and water molecules adjacent to the flipping base. PMID:24976900
Gao, Zhuangqiang; Qiu, Zhenli; Lu, Minghua; Shu, Jian; Tang, Dianping
2017-03-15
This work designs a new label-free aptasensor for the colorimetric determination of small molecules (adenosine 5'-triphosphate, ATP) by using visible gold nanoparticles as the signal-generation tags, based on target-triggered hybridization chain reaction (HCR) between two hairpin DNA probes. The assay is carried out referring to the change in the color/absorbance by salt-induced aggregation of gold nanoparticles after the interaction with hairpins, gold nanoparticles and ATP. To construct such an assay system, two hairpin DNA probes with a short single-stranded DNA at the sticky end are utilized for interaction with gold nanoparticles. In the absence of target ATP, the hairpin DNA probes can prevent gold nanoparticles from the salt-induced aggregation through the interaction of the single-stranded DNA at the sticky end with gold nanoparticles. Upon target ATP introduction, the aptamer-based hairpin probe is opened to expose a new sticky end for the strand-displacement reaction with another complementary hairpin, thus resulting in the decreasing single-stranded DNA because of the consumption of hairpins. In this case, gold nanoparticles are uncovered owing to the formation of double-stranded DNA, which causes their aggregation upon addition of the salt, thereby leading to the change in the red-to-blue color. Under the optimal conditions, the HCR-based colorimetric assay presents good visible color or absorbance responses for the determination of target ATP at a concentration as low as 1.0nM. Importantly, the methodology can be further extended to quantitatively or qualitatively monitor other small molecules or biotoxins by changing the sequence of the corresponding aptamer. Copyright © 2016 Elsevier B.V. All rights reserved.
Single cell and single molecule techniques for the analysis of the epigenome
NASA Astrophysics Data System (ADS)
Wallin, Christopher Benjamin
Epigenetic regulation is a critical biological process for the health and development of a cell. Epigenetic regulation is facilitated by covalent modifications to the underlying DNA and chromatin proteins. A fundamental understanding of these epigenetic modifications and their associated interactions at the molecular scale is necessary to explain phenomena including cellular identity, stem cell plasticity, and neoplastic transformation. It is widely known that abnormal epigenetic profiles have been linked to many diseases, most notably cancer. While the field of epigenetics has progressed rapidly with conventional techniques, significant advances remain to be made with respect to combinatoric analysis of epigenetic marks and single cell epigenetics. Therefore, in this dissertation, I will discuss our development of devices and methodologies to address these pertinent issues. First, we designed a preparatory polydimethylsiloxane (PDMS) microdevice for the extraction, purification, and stretching of human chromosomal DNA and chromatin from small cell populations down to a single cell. The valveless device captures cells by size exclusion within the micropillars, entraps the DNA or chromatin in the micropillars after cell lysis, purifies away the cellular debris, and fluorescently labels the DNA and/or chromatin all within a single reaction chamber. With the device, we achieve nearly 100% extraction efficiency of the DNA. The device is also used for in-channel immunostaining of chromatin followed by downstream single molecule chromatin analysis in nanochannels (SCAN). Second, using multi-color, time-correlated single molecule measurements in nanochannels, simultaneous coincidence detection of 2 epigenetic marks is demonstrated. Coincidence detection of 3 epigenetic marks is also established using a pulsed interleaved excitation scheme. With these two promising results, genome-wide quantification of epigenetic marks was pursued. Unfortunately, quantitative SCAN never materialized. Reasons for this, including poor signal to background, are explained in detail. Third, development of mobility-SCAN, an analytical technique for measuring and analyzing single molecules based on their fluorescent signature and their electrophoretic mobility in nanochannels is described. We use the technique to differentiate biomolecules from complex mixtures and derive parameters such as diffusion coefficients and effective charges. Finally, the device is used to detect binding interactions of various complexes similar to affinity capillary electrophoresis, but on a single molecule level. Fourth, we conclude by briefly discussing SCAN-sort, a technique to sort individual chromatin molecules based on their fluorescent emissions for further downstream analysis such as DNA sequencing. We demonstrate a 2-fold enrichment of chromatin from sorting and discuss possible system modifications for better performance in the future.
Cytotoxicity and Antineoplastic Activities of Alkylamines and Their Borane Derivatives
Tse, Elaine Y.; Muhammad, Rosallah A.
1996-01-01
The alkylamines and their related boron derivatives demonstrated potent cytotoxicity against the growth of murine and human tissue cultured cells. These agents did not necessarily require the boron atom to possess potent cytotoxic action in certain tumor lines. Their ability to suppress tumor cell growth was based on their inhibition of DNA and protein syntheses. DNA synthesis was reduced because purine synthesis was blocked at the enzyme site of IMP dehydrogenase by the agents. In addition ribonucleotide reductase and nucleoside kinase activities were reduced by the agents which would account for the reduced d[NTP] pools. The DNA template or molecule may be a target of the drugs with regard to binding of the drug to nucleoside bases or intercalaction of the drug between DNA base pairs. Only some Of the agents caused DNA fragmentation with reduced DNA viscosity. These effects would contribute to overall cell death afforded by the agents. PMID:18472803
Osica, V D; Pyatigorskaya, T L; Polyvtsev, O F; Dembo, A T; Kliya, M O; Vasilchenko, V N; Verkin, B I; Sukharevskya, B Y
1977-04-01
Double-stranded DNA molecules (molecular weight 2.5 X 10(5) - 5 X 10(5) daltons) have been crystallized from water-salt solutions as cetyltrimethylammonium salts (CTA-DNA). Variation of crystallization conditions results in a production of different types of CTA-DNA crystals: spherulits, dendrites, needle-shaped and faceted rhombic crystals, the latter beeing up to 0.3 mm on a side. X-ray diffraction data indicate that DNA molecules in the crystals form a hexagonal lattice which parameters vary slightly with the morphological type of the crystal. Comparison of the melting curves of the DNA preparation before and after crystallization suggests that DNA molecules are partially fractionated in the course of crystallization. Crystals of the CTA-DNA-proflavine complex have also been obtained.
Osica, V D; Pyatigorskaya, T L; Polyvtsev, O F; Dembo, A T; Kliya, M O; Vasilchenko, V N; Verkin, B I; Sukharevskya, B Y
1977-01-01
Double-stranded DNA molecules (molecular weight 2.5 X 10(5) - 5 X 10(5) daltons) have been crystallized from water-salt solutions as cetyltrimethylammonium salts (CTA-DNA). Variation of crystallization conditions results in a production of different types of CTA-DNA crystals: spherulits, dendrites, needle-shaped and faceted rhombic crystals, the latter beeing up to 0.3 mm on a side. X-ray diffraction data indicate that DNA molecules in the crystals form a hexagonal lattice which parameters vary slightly with the morphological type of the crystal. Comparison of the melting curves of the DNA preparation before and after crystallization suggests that DNA molecules are partially fractionated in the course of crystallization. Crystals of the CTA-DNA-proflavine complex have also been obtained. Images PMID:866188
Nanopore arrays in a silicon membrane for parallel single-molecule detection: DNA translocation
NASA Astrophysics Data System (ADS)
Zhang, Miao; Schmidt, Torsten; Jemt, Anders; Sahlén, Pelin; Sychugov, Ilya; Lundeberg, Joakim; Linnros, Jan
2015-08-01
Optical nanopore sensing offers great potential in single-molecule detection, genotyping, or DNA sequencing for high-throughput applications. However, one of the bottle-necks for fluorophore-based biomolecule sensing is the lack of an optically optimized membrane with a large array of nanopores, which has large pore-to-pore distance, small variation in pore size and low background photoluminescence (PL). Here, we demonstrate parallel detection of single-fluorophore-labeled DNA strands (450 bps) translocating through an array of silicon nanopores that fulfills the above-mentioned requirements for optical sensing. The nanopore array was fabricated using electron beam lithography and anisotropic etching followed by electrochemical etching resulting in pore diameters down to ∼7 nm. The DNA translocation measurements were performed in a conventional wide-field microscope tailored for effective background PL control. The individual nanopore diameter was found to have a substantial effect on the translocation velocity, where smaller openings slow the translocation enough for the event to be clearly detectable in the fluorescence. Our results demonstrate that a uniform silicon nanopore array combined with wide-field optical detection is a promising alternative with which to realize massively-parallel single-molecule detection.
Targeting Mycobacterium tuberculosis nucleoid-associated protein HU with structure-based inhibitors
NASA Astrophysics Data System (ADS)
Bhowmick, Tuhin; Ghosh, Soumitra; Dixit, Karuna; Ganesan, Varsha; Ramagopal, Udupi A.; Dey, Debayan; Sarma, Siddhartha P.; Ramakumar, Suryanarayanarao; Nagaraja, Valakunja
2014-06-01
The nucleoid-associated protein HU plays an important role in maintenance of chromosomal architecture and in global regulation of DNA transactions in bacteria. Although HU is essential for growth in Mycobacterium tuberculosis (Mtb), there have been no reported attempts to perturb HU function with small molecules. Here we report the crystal structure of the N-terminal domain of HU from Mtb. We identify a core region within the HU-DNA interface that can be targeted using stilbene derivatives. These small molecules specifically inhibit HU-DNA binding, disrupt nucleoid architecture and reduce Mtb growth. The stilbene inhibitors induce gene expression changes in Mtb that resemble those induced by HU deficiency. Our results indicate that HU is a potential target for the development of therapies against tuberculosis.
Kurata, Shinya; Kanagawa, Takahiro; Yamada, Kazutaka; Torimura, Masaki; Yokomaku, Toyokazu; Kamagata, Yoichi; Kurane, Ryuichiro
2001-01-01
We have developed a simple method for the quantitative detection of specific DNA or RNA molecules based on the finding that BODIPY® FL fluorescence was quenched by its interaction with a uniquely positioned guanine. This approach makes use of an oligonucleotide probe or primer containing a BODIPY® FL-modified cytosine at its 5′-end. When such a probe was hybridized with a target DNA, its fluorescence was quenched by the guanine in the target, complementary to the modified cytosine, and the quench rate was proportional to the amount of target DNA. This widely applicable technique will be used directly with larger samples or in conjunction with the polymerase chain reaction to quantify small DNA samples. PMID:11239011
In Touch with Molecules: Improving Student Learning with Innovative Molecular Models
ERIC Educational Resources Information Center
Davenport, Jodi; Silberglitt, Matt; Olson, Arthur
2013-01-01
How do viruses self-assemble? Why do DNA bases pair the way they do? What factors determine whether strands of proteins fold into sheets or helices? Why does handedness matter? A deep understanding of core issues in biology requires students to understand both complex spatial structures of molecules and the interactions involved in dynamic…
Theoretical Studies of Chemical Reactions following Electronic Excitation
NASA Technical Reports Server (NTRS)
Chaban, Galina M.
2003-01-01
The use of multi-configurational wave functions is demonstrated for several processes: tautomerization reactions in the ground and excited states of the DNA base adenine, dissociation of glycine molecule after electronic excitation, and decomposition/deformation of novel rare gas molecules HRgF. These processes involve bond brealung/formation and require multi-configurational approaches that include dynamic correlation.
Tang, Juan; Huang, Yapei; Liu, Huiqiong; Zhang, Cengceng; Tang, Dianping
2016-12-01
A new homogeneous electrochemical immunosensing platform was designed for sensitive detection of aflatoxin B 1 (AFB 1 ) in foodstuff. The system consisted of anti-AFB 1 antibody labeled DNA 1 (Ab-DNA 1 ), AFB 1 -bovine serum albumin (BSA)-conjugated DNA 2 (AFB 1 -DNA 2 ), and methylene blue functionalized hairpin DNA. Owing to a specific antigen-antibody reaction between anti-AFB 1 and AFB 1 -BSA, the immunocomplex formed assisted the proximity hybridization of DNA 1 with DNA 2 , thus resulting in the formation of an omega-like DNA junction. Thereafter, the junction opened the hairpin DNA to construct a new double-stranded DNA, which could be readily cleaved by exonuclease III to release the omega-like DNA junction and methylene blue. The dissociated DNA junction could repeatedly hybridize with residual hairpin DNA molecules with exonuclease III-based isothermal cycling amplification, thereby releasing numerous free methylene blue molecules into the detection solution. The as-produced free methylene blue molecules could be captured by a negatively charged indium tin oxide electrode, each of which could produce an electronic signal within the applied potentials. On introduction of target AFB 1 , the analyte competed with AFB 1 -DNA 2 for the conjugated anti-AFB 1 on the Ab-DNA 1 , subsequently decreasing the amount of omega-like DNA junctions formed, hence causing methylene blue labeled hairpin DNA to move far away from the electrode surface. Under optimal conditions the detectable electrochemical signal decreased with increasing amount of target AFB 1 in a dynamic working range of 0.01-30 ng mL -1 with a detection limit of 4.8 pg mL -1 . In addition, the precision and reproducibility of this system were acceptable. Finally, the method was further evaluated for analysis of naturally contaminated or AFB 1 -spiked peanut samples, giving results that matched well with those obtained with a commercial AFB 1 ELISA kit.
Single Molecule Study of Metalloregulatory Protein-DNA Interactions
NASA Astrophysics Data System (ADS)
Sarkar, Susanta; Benitez, Jaime; Huang, Zhengxi; Wang, Qi; Chen, Peng
2007-03-01
Control of metal concentrations is essential for living body. Metalloregulatory proteins respond to metal concentrations by regulating transcriptions of metal resistance genes via protein-DNA interactions. It is thus necessary to understand interactions of metalloregulatory proteins with DNA. Ensemble measurements provide average behavior of a vast number of biomolecules. In contrast, single molecule spectroscopy can track single molecules individually and elucidate dynamics of processes of short time scales and intermediate structures not revealed by ensemble measurements. Here we present single molecule study of interactions between PbrR691, a MerR-family metalloregulatory protein and DNA. We presume that the dynamics of protein/DNA conformational changes and interactions are important for the transcription regulation and kinetics of these dynamic processes can provide useful information about the mechanisms of these metalloregulatory proteins.
Cristóvão, Michele; Sisamakis, Evangelos; Hingorani, Manju M.; Marx, Andreas D.; Jung, Caroline P.; Rothwell, Paul J.; Seidel, Claus A. M.; Friedhoff, Peter
2012-01-01
Mismatch repair (MMR) corrects replication errors such as mismatched bases and loops in DNA. The evolutionarily conserved dimeric MMR protein MutS recognizes mismatches by stacking a phenylalanine of one subunit against one base of the mismatched pair. In all crystal structures of G:T mismatch-bound MutS, phenylalanine is stacked against thymine. To explore whether these structures reflect directional mismatch recognition by MutS, we monitored the orientation of Escherichia coli MutS binding to mismatches by FRET and anisotropy with steady state, pre-steady state and single-molecule multiparameter fluorescence measurements in a solution. The results confirm that specifically bound MutS bends DNA at the mismatch. We found additional MutS–mismatch complexes with distinct conformations that may have functional relevance in MMR. The analysis of individual binding events reveal significant bias in MutS orientation on asymmetric mismatches (G:T versus T:G, A:C versus C:A), but not on symmetric mismatches (G:G). When MutS is blocked from binding a mismatch in the preferred orientation by positioning asymmetric mismatches near the ends of linear DNA substrates, its ability to authorize subsequent steps of MMR, such as MutH endonuclease activation, is almost abolished. These findings shed light on prerequisites for MutS interactions with other MMR proteins for repairing the appropriate DNA strand. PMID:22367846
Nanopores and nucleic acids: prospects for ultrarapid sequencing
NASA Technical Reports Server (NTRS)
Deamer, D. W.; Akeson, M.
2000-01-01
DNA and RNA molecules can be detected as they are driven through a nanopore by an applied electric field at rates ranging from several hundred microseconds to a few milliseconds per molecule. The nanopore can rapidly discriminate between pyrimidine and purine segments along a single-stranded nucleic acid molecule. Nanopore detection and characterization of single molecules represents a new method for directly reading information encoded in linear polymers. If single-nucleotide resolution can be achieved, it is possible that nucleic acid sequences can be determined at rates exceeding a thousand bases per second.
He, Peng; He, Lin
2009-07-13
We report here an approach to grafting DNA-polymer bioconjugates on a planar solid support using reversible addition-fragmentation chain transfer (RAFT) polymerization. In particular, a trithiocarbonate compound as the RAFT chain transfer agent (CTA) is attached to the distal point of a surface-immobilized oligonucleotide. Initiation of RAFT polymerization leads to controlled growth of polymers atop DNA molecules on the surface. Growth kinetics of poly(monomethoxy-capped oligo(ethylene glycol) methacrylate) atop DNA molecules is investigated by monitoring the change of polymer film thickness as a function of reaction time. The reaction conditions, including the polymerization temperature, the initiator concentration, the CTA surface density, and the selection of monomers, are varied to examine their impacts on the grafting efficiency of DNA-polymer conjugates. Comparing to polymer growth atop small molecules, the experimental results suggest that DNA molecules significantly accelerate polymer growth, which is speculated as a result of the presence of highly charged DNA backbones and purine/pyrimidine moieties surrounding the reaction sites.
Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.
Gahlon, Hailey L; Romano, Louis J; Rueda, David
2017-11-20
Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.
Accurate FRET Measurements within Single Diffusing Biomolecules Using Alternating-Laser Excitation
Lee, Nam Ki; Kapanidis, Achillefs N.; Wang, You; Michalet, Xavier; Mukhopadhyay, Jayanta; Ebright, Richard H.; Weiss, Shimon
2005-01-01
Fluorescence resonance energy transfer (FRET) between a donor (D) and an acceptor (A) at the single-molecule level currently provides qualitative information about distance, and quantitative information about kinetics of distance changes. Here, we used the sorting ability of confocal microscopy equipped with alternating-laser excitation (ALEX) to measure accurate FRET efficiencies and distances from single molecules, using corrections that account for cross-talk terms that contaminate the FRET-induced signal, and for differences in the detection efficiency and quantum yield of the probes. ALEX yields accurate FRET independent of instrumental factors, such as excitation intensity or detector alignment. Using DNA fragments, we showed that ALEX-based distances agree well with predictions from a cylindrical model of DNA; ALEX-based distances fit better to theory than distances obtained at the ensemble level. Distance measurements within transcription complexes agreed well with ensemble-FRET measurements, and with structural models based on ensemble-FRET and x-ray crystallography. ALEX can benefit structural analysis of biomolecules, especially when such molecules are inaccessible to conventional structural methods due to heterogeneity or transient nature. PMID:15653725
DNA glycosylases search for and remove oxidized DNA bases.
Wallace, Susan S
2013-12-01
This review article presents, an overview of the DNA glycosylases that recognize oxidized DNA bases using the Fpg/Nei family of DNA glycosylases as models for how structure can inform function. For example, even though human NEIL1 and the plant and fungal orthologs lack the zinc finger shown to be required for binding, DNA crystal structures revealed a "zincless finger" with the same properties. Moreover, the "lesion recognition loop" is not involved in lesion recognition, rather, it stabilizes 8-oxoG in the active site pocket. Unlike the other Fpg/Nei family members, Neil3 lacks two of the three void-filling residues that stabilize the DNA duplex and interact with the opposite strand to the damage which may account for its preference for lesions in single-stranded DNA. Also single-molecule approaches show that DNA glycosylases search for their substrates in a sea of undamaged DNA by using a wedge residue that is inserted into the DNA helix to probe for the presence of damage. Copyright © 2013 Wiley Periodicals, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Serwer, Philip, E-mail: serwer@uthscsa.edu; Wright, Elena T.; Liu, Zheng
DNA packaging of phages phi29, T3 and T7 sometimes produces incompletely packaged DNA with quantized lengths, based on gel electrophoretic band formation. We discover here a packaging ATPase-free, in vitro model for packaged DNA length quantization. We use directed evolution to isolate a five-site T3 point mutant that hyper-produces tail-free capsids with mature DNA (heads). Three tail gene mutations, but no head gene mutations, are present. A variable-length DNA segment leaks from some mutant heads, based on DNase I-protection assay and electron microscopy. The protected DNA segment has quantized lengths, based on restriction endonuclease analysis: six sharp bands of DNAmore » missing 3.7–12.3% of the last end packaged. Native gel electrophoresis confirms quantized DNA expulsion and, after removal of external DNA, provides evidence that capsid radius is the quantization-ruler. Capsid-based DNA length quantization possibly evolved via selection for stalling that provides time for feedback control during DNA packaging and injection. - Graphical abstract: Highlights: • We implement directed evolution- and DNA-sequencing-based phage assembly genetics. • We purify stable, mutant phage heads with a partially leaked mature DNA molecule. • Native gels and DNase-protection show leaked DNA segments to have quantized lengths. • Native gels after DNase I-removal of leaked DNA reveal the capsids to vary in radius. • Thus, we hypothesize leaked DNA quantization via variably quantized capsid radius.« less
Computer-Aided Drug Discovery: Molecular Docking of Diminazene Ligands to DNA Minor Groove
ERIC Educational Resources Information Center
Kholod, Yana; Hoag, Erin; Muratore, Katlynn; Kosenkov, Dmytro
2018-01-01
The reported project-based laboratory unit introduces upper-division undergraduate students to the basics of computer-aided drug discovery as a part of a computational chemistry laboratory course. The students learn to perform model binding of organic molecules (ligands) to the DNA minor groove with computer-aided drug discovery (CADD) tools. The…
NASA Astrophysics Data System (ADS)
Alshehri, Mansoor H.; Cox, Barry J.; Hill, James M.
2014-09-01
Fullerenes have attracted considerable attention in various areas of science and technology. Owing to their exceptional physical, chemical, and biological properties, they have many applications, particularly in cosmetic and medical products. Using the Lennard-Jones 6-12 potential function and the continuum approximation, which assumes that intermolecular interactions can be approximated by average atomic surface densities, we determine the binding energies of a C60 fullerene with respect to both single-strand and double-strand DNA molecules. We assume that all configurations are in a vacuum and that the C60 fullerene is initially at rest. Double integrals are performed to determine the interaction energy of the system. We find that the C60 fullerene binds to the double-strand DNA molecule, at either the major or minor grooves, with binding energies of -4.7 eV or -2.3 eV, respectively, and that the C60 molecule binds to the single-strand DNA molecule with a binding energy of -1.6 eV. Our results suggest that the C60 molecule is most likely to be linked to the major groove of the dsDNA molecule.
DNA origami based Au-Ag-core-shell nanoparticle dimers with single-molecule SERS sensitivity
NASA Astrophysics Data System (ADS)
Prinz, J.; Heck, C.; Ellerik, L.; Merk, V.; Bald, I.
2016-03-01
DNA origami nanostructures are a versatile tool to arrange metal nanostructures and other chemical entities with nanometer precision. In this way gold nanoparticle dimers with defined distance can be constructed, which can be exploited as novel substrates for surface enhanced Raman scattering (SERS). We have optimized the size, composition and arrangement of Au/Ag nanoparticles to create intense SERS hot spots, with Raman enhancement up to 1010, which is sufficient to detect single molecules by Raman scattering. This is demonstrated using single dye molecules (TAMRA and Cy3) placed into the center of the nanoparticle dimers. In conjunction with the DNA origami nanostructures novel SERS substrates are created, which can in the future be applied to the SERS analysis of more complex biomolecular targets, whose position and conformation within the SERS hot spot can be precisely controlled.DNA origami nanostructures are a versatile tool to arrange metal nanostructures and other chemical entities with nanometer precision. In this way gold nanoparticle dimers with defined distance can be constructed, which can be exploited as novel substrates for surface enhanced Raman scattering (SERS). We have optimized the size, composition and arrangement of Au/Ag nanoparticles to create intense SERS hot spots, with Raman enhancement up to 1010, which is sufficient to detect single molecules by Raman scattering. This is demonstrated using single dye molecules (TAMRA and Cy3) placed into the center of the nanoparticle dimers. In conjunction with the DNA origami nanostructures novel SERS substrates are created, which can in the future be applied to the SERS analysis of more complex biomolecular targets, whose position and conformation within the SERS hot spot can be precisely controlled. Electronic supplementary information (ESI) available: Additional information about materials and methods, designs of DNA origami templates, height profiles, additional SERS spectra, assignment of DNA bands, SEM images, additional AFM images, FDTD simulations, additional reference spectra for Cy3 and detailed description of EF estimation, simulated absorption and scattering spectra. See DOI: 10.1039/c5nr08674d
Improving the prospects of cleavage-based nanopore sequencing engines
NASA Astrophysics Data System (ADS)
Brady, Kyle T.; Reiner, Joseph E.
2015-08-01
Recently proposed methods for DNA sequencing involve the use of cleavage-based enzymes attached to the opening of a nanopore. The idea is that DNA interacting with either an exonuclease or polymerase protein will lead to a small molecule being cleaved near the mouth of the nanopore, and subsequent entry into the pore will yield information about the DNA sequence. The prospects for this approach seem promising, but it has been shown that diffusion related effects impose a limit on the capture probability of molecules by the pore, which limits the efficacy of the technique. Here, we revisit the problem with the goal of optimizing the capture probability via a step decrease in the nucleotide diffusion coefficient between the pore and bulk solutions. It is shown through random walk simulations and a simplified analytical model that decreasing the molecule's diffusion coefficient in the bulk relative to its value in the pore increases the nucleotide capture probability. Specifically, we show that at sufficiently high applied transmembrane potentials (≥100 mV), increasing the potential by a factor f is equivalent to decreasing the diffusion coefficient ratio Dbulk/Dpore by the same factor f. This suggests a promising route toward implementation of cleavage-based sequencing protocols. We also discuss the feasibility of forming a step function in the diffusion coefficient across the pore-bulk interface.
Balcioglu, Mustafa; Rana, Muhit; Robertson, Neil; Yigit, Mehmet V
2014-08-13
We controlled the fluorescence emission of a fluorescently labeled iron oxide nanoparticle using three different nanomaterials with ultraefficient quenching capabilities. The control over the fluorescence emission was investigated via spacing introduced by the surface-functionalized single-stranded DNA molecules. DNA molecules were conjugated on different templates, either on the surface of the fluorescently labeled iron oxide nanoparticles or gold and nanographene oxide. The efficiency of the quenching was determined and compared with various fluorescently labeled iron oxide nanoparticle and nanoquencher combinations using DNA molecules with three different lengths. We have found that the template for DNA conjugation plays significant role on quenching the fluorescence emission of the fluorescently labeled iron oxide nanoparticles. We have observed that the size of the DNA controls the quenching efficiency when conjugated only on the fluorescently labeled iron oxide nanoparticles by setting a spacer between the surfaces and resulting change in the hydrodynamic size. The quenching efficiency with 12mer, 23mer and 36mer oligonucleotides decreased to 56%, 54% and 53% with gold nanoparticles, 58%, 38% and 32% with nanographene oxide, 46%, 38% and 35% with MoS2, respectively. On the other hand, the presence, not the size, of the DNA molecules on the other surfaces quenched the fluorescence significantly with different degrees. To understand the effect of the mobility of the DNA molecules on the nanoparticle surface, DNA molecules were attached to the surface with two different approaches. Covalently immobilized oligonucleotides decreased the quenching efficiency of nanographene oxide and gold nanoparticles to ∼22% and ∼21%, respectively, whereas noncovalently adsorbed oligonucleotides decreased it to ∼25% and ∼55%, respectively. As a result, we have found that each nanoquencher has a powerful quenching capability against a fluorescent nanoparticle, which can be tuned with surface functionalized DNA molecules.
Solid surface vs. liquid surface: nanoarchitectonics, molecular machines, and DNA origami.
Ariga, Katsuhiko; Mori, Taizo; Nakanishi, Waka; Hill, Jonathan P
2017-09-13
The investigation of molecules and materials at interfaces is critical for the accumulation of new scientific insights and technological advances in the chemical and physical sciences. Immobilization on solid surfaces permits the investigation of different properties of functional molecules or materials with high sensitivity and high spatial resolution. Liquid surfaces also present important media for physicochemical innovation and insight based on their great flexibility and dynamicity, rapid diffusion of molecular components for mixing and rearrangements, as well as drastic spatial variation in the prevailing dielectric environment. Therefore, a comparative discussion of the relative merits of the properties of materials when positioned at solid or liquid surfaces would be informative regarding present-to-future developments of surface-based technologies. In this perspective article, recent research examples of nanoarchitectonics, molecular machines, DNA nanotechnology, and DNA origami are compared with respect to the type of surface used, i.e. solid surfaces vs. liquid surfaces, for future perspectives of interfacial physics and chemistry.
Gene-Based Detection of Microorganisms in Environmental Samples Using PCR
NASA Technical Reports Server (NTRS)
Glass, John I.; Lefkowitz, Elliot J.; Cassell, Gail H.; Wechser, Mark; Taylor, Theresa B.; Albin, Michael; Paszko-Kolva, Christine; Roman, Monsi C.
1997-01-01
Contaminating microorganisms pose a serious potential risk to the crew's well being and water system integrity aboard the International Space Station (ISS). We are developing a gene-based microbial monitor that functions by replicating specific segments of DNA as much as 10(exp 12) x. Thus a single molecule of DNA can be replicated to detectable levels, and the kinetics of that molecule's accumulation can be used to determine the original concentration of specific microorganisms in a sample. Referred to as the polymerase chain reaction (PCR), this enzymatic amplification of specific segments of the DNA or RNA from contaminating microbes offers the promise of rapid, sensitive, quantitative detection and identification of bacteria, fungi, viruses, and parasites. We envision a small instrument capable of assaying an ISS water sample for 48 different microbes in a 24 hour period. We will report on both the developments in the chemistry necessary for the PCR assays to detect microbial contaminants in ISS water, and on progress towards the miniaturization and automation of the instrumentation.
Skinner, Gary M; Baumann, Christoph G; Quinn, Diana M; Molloy, Justin E; Hoggett, James G
2004-01-30
A single-molecule transcription assay has been developed that allows, for the first time, the direct observation of promoter binding, initiation, and elongation by a single RNA polymerase (RNAP) molecule in real-time. To promote DNA binding and transcription initiation, a DNA molecule tethered between two optically trapped beads was held near a third immobile surface bead sparsely coated with RNAP. By driving the optical trap holding the upstream bead with a triangular oscillation while measuring the position of both trapped beads, we observed the onset of promoter binding, promoter escape (productive initiation), and processive elongation by individual RNAP molecules. After DNA template release, transcription re-initiation on the same DNA template is possible; thus, multiple enzymatic turnovers by an individual RNAP molecule can be observed. Using bacteriophage T7 RNAP, a commonly used RNAP paradigm, we observed the association and dissociation (k(off)= 2.9 s(-1)) of T7 RNAP and promoter DNA, the transition to the elongation mode (k(for) = 0.36 s(-1)), and the processive synthesis (k(pol) = 43 nt s(-1)) and release of a gene-length RNA transcript ( approximately 1200 nt). The transition from initiation to elongation is much longer than the mean lifetime of the binary T7 RNAP-promoter DNA complex (k(off) > k(for)), identifying a rate-limiting step between promoter DNA binding and promoter escape.
Two-stage DNA compaction induced by silver ions suggests a cooperative binding mechanism
NASA Astrophysics Data System (ADS)
Jiang, Wen-Yan; Ran, Shi-Yong
2018-05-01
The interaction between silver ions and DNA plays an important role in the therapeutic use of silver ions and in related technologies such as DNA sensors. However, the underlying mechanism has not been fully understood. In this study, the dynamics of Ag+-DNA interaction at a single-molecule level was studied using magnetic tweezers. AgNO3 solutions with concentrations ranging from 1 μM to 20 μM led to a 1.4-1.8 μm decrease in length of a single λ-DNA molecule, indicating that Ag+ has a strong binding with DNA, causing the DNA conformational change. The compaction process comprises one linear declining stage and another sigmoid-shaped stage, which can be attributed to the interaction mechanism. Considering the cooperative effect, the sigmoid trend was well explained using a phenomenological model. By contrast, addition of silver nanoparticle solution induced no detectable transition of DNA. The dependence of the interaction on ionic strength and DNA concentration was examined via morphology characterization and particle size distribution measurement. The size of the Ag+-DNA complex decreased with an increase in Ag+ ionic strength ranging from 1 μM to 1 mM. Morphology characterization confirmed that silver ions induced DNA to adopt a compacted globular conformation. At a fixed [AgNO3]:[DNA base pairs] ratio, increasing DNA concentration led to increased sizes of the complexes. Intermolecular interaction is believed to affect the Ag+-DNA complex formation to a large extent.
Lee, Chi-Ying; Gong, Ping; Harbers, Gregory M.; Grainger, David W.; Castner, David G.; Gamble, Lara J.
2006-01-01
Self-assembly of thiol-terminated single-stranded DNA (HS-ssDNA) on gold has served as an important model system for DNA immobilization at surfaces. Here, we report a detailed study of the surface composition and structure of mixed self-assembled DNA monolayers containing a short alkylthiol surface diluent [11-mercapto-1-undecanol (MCU)] on gold supports. These mixed DNA monolayers were studied with X-ray photoelectron spectroscopy (XPS), near-edge X-ray absorption fine structure spectroscopy (NEXAFS), and fluorescence intensity measurements. XPS results on sequentially adsorbed DNA/MCU monolayers on gold indicated that adsorbed MCU molecules first incorporate into the HS-ssDNA monolayer and, upon longer MCU exposures, displace adsorbed HS-ssDNA molecules from the surface. Thus, HS-ssDNA surface coverage steadily decreased with MCU exposure time. Polarization-dependent NEXAFS and fluorescence results both show changes in signals consistent with changes in DNA orientation after only 30 min of MCU exposure. NEXAFS polarization dependence (followed by monitoring the N 1s → π* transition) of the mixed DNA monolayers indicated that the DNA nucleotide base ring structures are oriented more parallel to the gold surface compared to DNA bases in pure HS-ssDNA monolayers. This indicates that HS-ssDNA oligomers reorient toward a more-upright position upon MCU incorporation. Fluorescence intensity results using end-labeled DNA probes on gold show little observable fluorescence on pure HS-ssDNA monolayers, likely due to substrate quenching effects between the fluorophore and the gold. MCU diluent incorporation into HS-ssDNA monolayers initially increases DNA fluorescence signal by densifying the chemisorbed monolayer, prompting an upright orientation of the DNA, and moving the terminal fluorophore away from the substrate. Immobilized DNA probe density and DNA target hybridization in these mixed DNA monolayers, as well as effects of MCU diluent on DNA hybridization in complex milieu (i.e., serum) were characterized by surface plasmon resonance (SPR) and 32P-radiometric assays and reported in a related study PMID:16689533
Single helically folded aromatic oligoamides that mimic the charge surface of double-stranded B-DNA
NASA Astrophysics Data System (ADS)
Ziach, Krzysztof; Chollet, Céline; Parissi, Vincent; Prabhakaran, Panchami; Marchivie, Mathieu; Corvaglia, Valentina; Bose, Partha Pratim; Laxmi-Reddy, Katta; Godde, Frédéric; Schmitter, Jean-Marie; Chaignepain, Stéphane; Pourquier, Philippe; Huc, Ivan
2018-05-01
Numerous essential biomolecular processes require the recognition of DNA surface features by proteins. Molecules mimicking these features could potentially act as decoys and interfere with pharmacologically or therapeutically relevant protein-DNA interactions. Although naturally occurring DNA-mimicking proteins have been described, synthetic tunable molecules that mimic the charge surface of double-stranded DNA are not known. Here, we report the design, synthesis and structural characterization of aromatic oligoamides that fold into single helical conformations and display a double helical array of negatively charged residues in positions that match the phosphate moieties in B-DNA. These molecules were able to inhibit several enzymes possessing non-sequence-selective DNA-binding properties, including topoisomerase 1 and HIV-1 integrase, presumably through specific foldamer-protein interactions, whereas sequence-selective enzymes were not inhibited. Such modular and synthetically accessible DNA mimics provide a versatile platform to design novel inhibitors of protein-DNA interactions.
Huryn, Donna M; Brodsky, Jeffrey L; Brummond, Kay M; Chambers, Peter G; Eyer, Benjamin; Ireland, Alex W; Kawasumi, Masaoki; Laporte, Matthew G; Lloyd, Kayla; Manteau, Baptiste; Nghiem, Paul; Quade, Bettina; Seguin, Sandlin P; Wipf, Peter
2011-04-26
Unique chemical methodology enables the synthesis of innovative and diverse scaffolds and chemotypes and allows access to previously unexplored "chemical space." Compound collections based on such new synthetic methods can provide small-molecule probes of proteins and/or pathways whose functions are not fully understood. We describe the identification, characterization, and evolution of two such probes. In one example, a pathway-based screen for DNA damage checkpoint inhibitors identified a compound, MARPIN (ATM and ATR pathway inhibitor) that sensitizes p53-deficient cells to DNA-damaging agents. Modification of the small molecule and generation of an immobilized probe were used to selectively bind putative protein target(s) responsible for the observed activity. The second example describes a focused library approach that relied on tandem multicomponent reaction methodologies to afford a series of modulators of the heat shock protein 70 (Hsp70) molecular chaperone. The synthesis of libraries based on the structure of MAL3-101 generated a collection of chemotypes, each modulating Hsp70 function, but exhibiting divergent pharmacological activities. For example, probes that compromise the replication of a disease-associated polyomavirus were identified. These projects highlight the importance of chemical methodology development as a source of small-molecule probes and as a drug discovery starting point.
Huryn, Donna M.; Brodsky, Jeffrey L.; Brummond, Kay M.; Chambers, Peter G.; Eyer, Benjamin; Ireland, Alex W.; Kawasumi, Masaoki; LaPorte, Matthew G.; Lloyd, Kayla; Manteau, Baptiste; Nghiem, Paul; Quade, Bettina; Seguin, Sandlin P.; Wipf, Peter
2011-01-01
Unique chemical methodology enables the synthesis of innovative and diverse scaffolds and chemotypes and allows access to previously unexplored “chemical space.” Compound collections based on such new synthetic methods can provide small-molecule probes of proteins and/or pathways whose functions are not fully understood. We describe the identification, characterization, and evolution of two such probes. In one example, a pathway-based screen for DNA damage checkpoint inhibitors identified a compound, MARPIN (ATM and ATR pathway inhibitor) that sensitizes p53-deficient cells to DNA-damaging agents. Modification of the small molecule and generation of an immobilized probe were used to selectively bind putative protein target(s) responsible for the observed activity. The second example describes a focused library approach that relied on tandem multicomponent reaction methodologies to afford a series of modulators of the heat shock protein 70 (Hsp70) molecular chaperone. The synthesis of libraries based on the structure of MAL3-101 generated a collection of chemotypes, each modulating Hsp70 function, but exhibiting divergent pharmacological activities. For example, probes that compromise the replication of a disease-associated polyomavirus were identified. These projects highlight the importance of chemical methodology development as a source of small-molecule probes and as a drug discovery starting point. PMID:21502524
NASA Technical Reports Server (NTRS)
Joyce, Gerald F. (Inventor); Breaker, Ronald R. (Inventor)
1998-01-01
The present invention discloses deoxyribonucleic acid enzymes--catalytic or enzymatic DNA molecules--capable of cleaving nucleic acid sequences or molecules, particularly RNA, in a site-specific manner, as well as compositions including same. Methods of making and using the disclosed enzymes and compositions are also disclosed.
Preparation and self-folding of amphiphilic DNA origami.
Zhou, Chao; Wang, Dianming; Dong, Yuanchen; Xin, Ling; Sun, Yawei; Yang, Zhongqiang; Liu, Dongsheng
2015-03-01
Amphiphilic DNA origami is prepared by dressing multiple hydrophobic molecules on a rectangular single layer DNA origami, which is then folded or coupled in sandwich-like structures with two outer DNA origami layer and one inner hydrophobic molecules layer. The preference to form different kinds of structures could be tailored by rational design of DNA origami. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Gel Electrophoresis of Gold-DNA Nano-Conjugates
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pellegrino, T.; Sperling, R.A.; Alivisatos, A.P.
2006-01-10
Single stranded DNA of different lengths and different amounts was attached to colloidal phosphine stabilized Au nanoparticles. The resulting conjugates were investigated in detail by a gel electrophoresis study based on 1200 gels. We demonstrate how these experiments help to understand the binding of DNA to Au particles. In particular we compare specific attachment of DNA via gold-thiol bonds with nonspecific adsorption of DNA. The maximum number of DNA molecules that can be bound per particle was determined. We also compare several methods to used gel electrophoresis for investigating the effective diameter of DNA-Au conjugates, such as using a calibrationmore » curve of particles with known diameters and Ferguson plots.« less
Solving traveling salesman problems with DNA molecules encoding numerical values.
Lee, Ji Youn; Shin, Soo-Yong; Park, Tai Hyun; Zhang, Byoung-Tak
2004-12-01
We introduce a DNA encoding method to represent numerical values and a biased molecular algorithm based on the thermodynamic properties of DNA. DNA strands are designed to encode real values by variation of their melting temperatures. The thermodynamic properties of DNA are used for effective local search of optimal solutions using biochemical techniques, such as denaturation temperature gradient polymerase chain reaction and temperature gradient gel electrophoresis. The proposed method was successfully applied to the traveling salesman problem, an instance of optimization problems on weighted graphs. This work extends the capability of DNA computing to solving numerical optimization problems, which is contrasted with other DNA computing methods focusing on logical problem solving.
Structural DNA nanotechnology: from design to applications.
Zadegan, Reza M; Norton, Michael L
2012-01-01
The exploitation of DNA for the production of nanoscale architectures presents a young yet paradigm breaking approach, which addresses many of the barriers to the self-assembly of small molecules into highly-ordered nanostructures via construct addressability. There are two major methods to construct DNA nanostructures, and in the current review we will discuss the principles and some examples of applications of both the tile-based and DNA origami methods. The tile-based approach is an older method that provides a good tool to construct small and simple structures, usually with multiply repeated domains. In contrast, the origami method, at this time, would appear to be more appropriate for the construction of bigger, more sophisticated and exactly defined structures.
End labeling procedures: an overview.
Hilario, Elena
2004-09-01
There are two ways to label a DNA molecular; by the ends or all along the molecule. End labeling can be performed at the 3'- or 5'-end. Labeling at the 3' end is performed by filling 3'-end recessed ends with a mixture or labeled and unlabeled dNTPs using Klenow or T4 DNA polymerases. Both reactions are template dependent. Terminal deoxynucleotide transferase incorporates dNTPs at the 3' end of any kind of DNA molecule or RNA. Labels incorporated at the 3'-end of the DNA molecule prevent any further extension or ligation to any other molecule, but this can be overcome by labeling the 5'-end of the desired DNA molecule. 5'-end labeling is performed by enzymatic methods (T4 polynucleotide kinase exchange and forward reactions), by chemical modification of sensitized oligonucleotides with phosphoroamidite, or by combined methods. Probe cleanup is recommended when high background problems occur, but caution should be taken not to damage the attached probe with harsh chemicals or by light exposure.
Potapov, Vladimir; Ong, Jennifer L; Langhorst, Bradley W; Bilotti, Katharina; Cahoon, Dan; Canton, Barry; Knight, Thomas F; Evans, Thomas C; Lohman, Gregory Js
2018-05-08
DNA ligases are key enzymes in molecular and synthetic biology that catalyze the joining of breaks in duplex DNA and the end-joining of DNA fragments. Ligation fidelity (discrimination against the ligation of substrates containing mismatched base pairs) and bias (preferential ligation of particular sequences over others) have been well-studied in the context of nick ligation. However, almost no data exist for fidelity and bias in end-joining ligation contexts. In this study, we applied Pacific Biosciences Single-Molecule Real-Time sequencing technology to directly sequence the products of a highly multiplexed ligation reaction. This method has been used to profile the ligation of all three-base 5'-overhangs by T4 DNA ligase under typical ligation conditions in a single experiment. We report the relative frequency of all ligation products with or without mismatches, the position-dependent frequency of each mismatch, and the surprising observation that 5'-TNA overhangs ligate extremely inefficiently compared to all other Watson-Crick pairings. The method can easily be extended to profile other ligases, end-types (e.g. blunt ends and overhangs of different lengths), and the effect of adjacent sequence on the ligation results. Further, the method has the potential to provide new insights into the thermodynamics of annealing and the kinetics of end-joining reactions.