Electrochemical and spectroscopic study on the interaction between isoprenaline and DNA using multivariate curve resolution-alternating least squares.

PubMed

Ni, Yongnian; Wei, Min; Kokot, Serge

2011-11-01

Interaction of isoprenaline (ISO) with calf-thymus DNA was studied by spectroscopic and electrochemical methods. The behavior of ISO was investigated at a glassy carbon electrode (GCE) by cyclic voltammetry (CV) and differential pulse stripping voltammetry (DPSV); ISO was oxidized and an irreversible oxidation peak was observed. The binding constant K and the stoichiometric coefficient m of ISO with DNA were evaluated. Also, with the addition of DNA, hyperchromicity of the UV-vis absorption spectra of ISO was noted, while the fluorescence intensity decreased significantly. Multivariate curve resolution-alternating least squares (MCR-ALS) chemometrics method was applied to resolve the combined spectroscopic data matrix, which was obtained by the UV-vis and fluorescence methods. Pure spectra of ISO, DNA and ISO-DNA complex, and their concentration profiles were then successfully obtained. The results indicated that the ISO molecule intercalated into the base-pairs of DNA, and the complex of ISO-DNA was formed. Copyright © 2011 Elsevier B.V. All rights reserved.

Model of DNA topology simplification has come full (supercoiled) circle after two decades of research. Comment on "Disentangling DNA molecules" by Alexander Vologodskii

NASA Astrophysics Data System (ADS)

Stasiak, Andrzej

2016-09-01

Being a geek of DNA topology, I remember very well the stir caused by 1997 Science paper showing that DNA topoisomerases have the ability to simplify DNA topology below the topological equilibrium values [1]. In their seminal experiments Rybenkov et al. [1] started with linear double-stranded DNA molecules with cohesive ends. The mutual cohesiveness of DNA ends was due to mutual complementarity of single-stranded extensions at both ends of linear double-stranded DNA molecules. When such DNA molecules were heated up and then slowly cooled down the single-stranded ends eventually annealed with each other causing DNA circularization. This experimental protocol permitted the authors to establish topological/thermodynamic equilibrium within samples of circularized DNA molecules. Among simple unknotted circles one also observed knotted and catenated DNA molecules. The fraction of knotted molecules in DNA samples at topological equilibrium was increasing with the length of DNA molecules undergoing slow circularization. The fraction of catenated molecules was increasing with the length and the concentration of the molecules undergoing slow circularization. Rybenkov et al. incubated then such equilibrated DNA samples with type II DNA topoisomerases, which pass DNA duplex regions through each other, and observed that as the result of it the fraction of knotted and catenated DNA molecules was dramatically decreased (up to 80-fold). This elegant experiment indicated for the first time that type II DNA topoisomerases acting on knotted or catenated DNA molecules have the ability to select among many potential sites of DNA-DNA passages these that result in DNA unknotting or decatenation. Without such a selection topoisomerases could only maintain the original topological equilibrium obtained during the slow cyclization. The big question was how DNA topoisomerases can be directed to do DNA-DNA passages that preferentially result in DNA unknotting and decatenation.

Problems with mitochondrial DNA as a marker in population, phylogeographic and phylogenetic studies: the effects of inherited symbionts

PubMed Central

Hurst, Gregory D.D; Jiggins, Francis M

2005-01-01

Mitochondrial DNA (mtDNA) has been a marker of choice for reconstructing historical patterns of population demography, admixture, biogeography and speciation. However, it has recently been suggested that the pervasive nature of direct and indirect selection on this molecule renders any conclusion derived from it ambiguous. We review here the evidence for indirect selection on mtDNA in arthropods arising from linkage disequilibrium with maternally inherited symbionts. We note first that these symbionts are very common in arthropods and then review studies that reveal the extent to which they shape mtDNA evolution. mtDNA diversity patterns are compatible with neutral expectations for an uninfected population in only 2 of 19 cases. The remaining 17 studies revealed cases of symbiont-driven reduction in mtDNA diversity, symbiont-driven increases in diversity, symbiont-driven changes in mtDNA variation over space and symbiont-associated paraphyly of mtDNA. We therefore conclude that these elements often confound the inference of an organism's evolutionary history from mtDNA data and that mtDNA on its own is an unsuitable marker for the study of recent historical events in arthropods. We also discuss the impact of these studies on the current programme of taxonomy based on DNA bar-coding. PMID:16048766

Simple method of DNA stretching on glass substrate for fluorescence image and spectroscopy

NASA Astrophysics Data System (ADS)

Neupane, Guru P.; Dhakal, Krishna P.; Lee, Hyunsoo; Guthold, Martin; Joseph, Vincent S.; Hong, Jong-Dal; Kim, Jeongyong

2013-05-01

Study of biological molecule DNA has contributed to developing many breaking thoughts and wide applications in multidisciplinary fields, such as genomic, medical, sensing and forensic fields. Stretching of DNA molecules is an important supportive tool for AFM or spectroscopic studies of DNA in a single molecular level. In this article, we established a simple method of DNA stretching (to its full length) that occurred on a rotating negatively-charged surface of glass substrate. The isolation of a single DNA molecule was attained by the two competitive forces on DNA molecules, that is, the electrostatic attraction developed between the positively charged YOYO-1 stained DNA and the negatively charged substrate, and the centrifugal force of the rotating substrate, which separates the DNA aggregates into the single molecule. Density of stretched DNA molecules was controlled by selecting the specific parameters such as spinning time and rates, loading volume of DNA-dye complex solution etc. The atomic force microscopy image exhibited a single DNA molecule on the negatively-charged substrate in an isolated state. Further, the photoluminescence spectra of a single DNA molecule stained with YOYO-1 were achieved using the method developed in the present study, which is strongly believed to effectively support the spectroscopic analysis of DNA in a single molecular level.

Deformation of DNA molecules by hydrodynamic focusing

NASA Astrophysics Data System (ADS)

Wong, Pak Kin; Lee, Yi-Kuen; Ho, Chih-Ming

2003-12-01

The motion of a DNA molecule in a solvent flow reflects the deformation of a nano/microscale flexible mass spring structure by the forces exerted by the fluid molecules. The dynamics of individual molecules can reveal both fundamental properties of the DNA and basic understanding of the complex rheological properties of long-chain molecules. In this study, we report the dynamics of isolated DNA molecules under homogeneous extensional flow. Hydrodynamic focusing generates homogeneous extensional flow with uniform velocity in the transverse direction. The deformation of individual DNA molecules in the flow was visualized with video fluorescence microscopy. A coil stretch transition was observed when the Deborah number (De) is larger than 0.8. With a sudden stopping of the flow, the DNA molecule relaxes and recoils. The longest relaxation time of T2 DNA was determined to be 0.63 s when scaling viscosity to 0.9 cP.

DNA Molecules Adsorbed on Rippled Supported Cationic Lipid Membranes -- A new way to stretch DNAs

NASA Astrophysics Data System (ADS)

Golubovic, Leonardo

2005-03-01

We discuss a novel approach to control to shapes of DNA molecules. We elucidate the recent experimental work of M. Hochrein, L. Golubovic and J. Raedler, on the conformational behavior of DNA molecules adsorbed on lipid membranes that are supported on grooved micro-structured surfaces. We explain the striking ability of the edges formed on these supported membranes to adsorb and completely orient (stretch) very long DNA molecules. Here we explain the experimentally observed DNA stretching effect in terms of the surface curvature dependent electrostatic potential seen by the adsorbed DNA molecules. On the curved, rippled membrane, we show that the DNA molecules undergo localization transitions causing them to stretch by binding to the ripple edges of the supported membrane. In the future, this stretching will allow to directly image, by the common fluorescence microscopy, fundamental biological processes of the interactions between DNA and single protein molecules.

Enhanced post wash retention of combed DNA molecules by varying multiple combing parameters.

PubMed

Yadav, Hemendra; Sharma, Pulkit

2017-11-01

Recent advances in genomics have created a need for efficient techniques for deciphering information hidden in various genomes. Single molecule analysis is one such technique to understand molecular processes at single molecule level. Fiber- FISH performed with the help of DNA combing can help us in understanding genetic rearrangements and changes in genome at single DNA molecule level. For performing Fiber-FISH we need high retention of combed DNA molecules post wash as Fiber-FISH requires profuse washing. We optimized combing process involving combing solution, method of DNA mounting on glass slides and coating of glass slides to enhance post-wash retention of DNA molecules. It was found that average number of DNA molecules observed post-wash per field of view was maximum with our optimized combing solution. APTES coated glass slides showed lesser retention than PEI surface but fluorescent intensity was higher in case of APTES coated surface. Capillary method used to mount DNA on glass slides also showed lesser retention but straight DNA molecules were observed as compared to force flow method. Copyright © 2017 Elsevier Inc. All rights reserved.

Methods of DNA methylation detection

NASA Technical Reports Server (NTRS)

Maki, Wusi Chen (Inventor); Filanoski, Brian John (Inventor); Mishra, Nirankar (Inventor); Rastogi, Shiva (Inventor)

2010-01-01

The present invention provides for methods of DNA methylation detection. The present invention provides for methods of generating and detecting specific electronic signals that report the methylation status of targeted DNA molecules in biological samples.Two methods are described, direct and indirect detection of methylated DNA molecules in a nano transistor based device. In the direct detection, methylated target DNA molecules are captured on the sensing surface resulting in changes in the electrical properties of a nano transistor. These changes generate detectable electronic signals. In the indirect detection, antibody-DNA conjugates are used to identify methylated DNA molecules. RNA signal molecules are generated through an in vitro transcription process. These RNA molecules are captured on the sensing surface change the electrical properties of nano transistor thereby generating detectable electronic signals.

A mathematical model for DNA

NASA Astrophysics Data System (ADS)

Sepehri, Alireza

Recently, some authors have shown that a DNA molecule produces electromagnetic signals and communicates with other DNA molecules or other molecules. In fact, a DNA acts like a receiver or transmitter of radio waves. In this paper, we suggest a mathematical model for the DNA molecule and use of its communication to cure some diseases like cancer. In this model, first, by using concepts from string theory and M-theory, we calculate the energy of a DNA in terms of interactions between free electrons and bound electrons. We show that when a DNA is damaged, its energy changes and an extra current is produced. This extra current causes the electromagnetic signals of a damaged DNA molecule to be different when compared to the electromagnetic signals of a normal DNA molecule. The electromagnetic signals of a damaged DNA molecule induce an extra current in a normal DNA molecule and lead to its destruction. By sending crafted electromagnetic signals to normal DNA molecules and inducing an opposite current with respect to this extra current, we can prevent the destruction of normal DNA. Finally, we argue that the type of packing of DNA in chromosomes of men and women is different. This causes radiated waves from DNAs of men and women to have opposite signs and cancel the effect of each other in a pair. Using this property, we suggest another mechanism to cancel the effect of extra waves, which are produced by DNAs in cancer cells of a male or a female, by extra waves which are produced by DNAs in similar cells of a female or a male and prevent the progression of the disease.

DNA molecule stretching through thermo-electrophoresis and thermal convection in a heated converging-diverging microchannel.

PubMed

Hsieh, Shou-Shing; Chen, Jyun-Hong; Tsai, Cheng-Fung

2013-02-18

A novel DNA molecule stretching technique is developed and tested herein. Through a heated converging-diverging microchannel, thermal convection and thermophoresis induced by regional heating are shown to significantly elongate single DNA molecules; they are visualized via a confocal laser scanning microscopy. In addition, electrophoretic stretching is also implemented to examine the hybrid effect on the conformation and dynamics of single DNA molecules. The physical properties of the DNA molecules are secured via experimental measurements.

Directional rolling of positively charged nanoparticles along a flexibility gradient on long DNA molecules.

PubMed

Park, Suehyun; Joo, Heesun; Kim, Jun Soo

2018-01-31

Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.

Nucleic Acid Nanostructures: Bottom-Up Control of Geometry on the Nanoscale

PubMed Central

Seeman, Nadrian C.; Lukeman, Philip S.

2012-01-01

DNA may seem an unlikely molecule from which to build nanostructures, but this is not correct. The specificity of interaction that enables DNA to function so successfully as genetic material also enables its use as a smart molecule for construction on the nanoscale. The key to using DNA for this purpose is the design of stable branched molecules, which expand its ability to interact specifically with other nucleic acid molecules. The same interactions used by genetic engineers can be used to make cohesive interactions with other DNA molecules that lead to a variety of new species. Branched DNA molecules are easy to design, and the can assume a variety of structural motifs. These can be used for purposes both of specific construction, such as polyhedra, and for the assembly of topological targets. A variety of two-dimensional periodic arrays with specific patterns have been made. DNA nanomechanical devices have been built with a series of different triggers, small molecules, nucleic acid molecules and proteins. Recently, progress has been made in self-replication of DNA nano-constructs, and in the scaffolding of other species into DNA arrangements. PMID:25152542

Theoretical electrical conductivity of hydrogen-bonded benzamide-derived molecules and single DNA bases.

PubMed

Chen, Xiang

2013-09-01

A benzamide molecule is used as a "reader" molecule to form hydrogen bonds with five single DNA bases, i.e., four normal single DNA bases A,T,C,G and one for 5methylC. The whole molecule is then attached to the gold surface so that a meta-molecule junction is formed. We calculate the transmission function and conductance for the five metal-molecule systems, with the implementation of density functional theory-based non-equilibrium Green function method. Our results show that each DNA base exhibits a unique conductance and most of them are on the pS level. The distinguishable conductance of each DNA base provides a way for the fast sequencing of DNA. We also investigate the dependence of conductivity of such a metal-molecule system on the hydrogen bond length between the "reader" molecule and DNA base, which shows that conductance follows an exponential decay as the hydrogen bond length increases, i.e., the conductivity is highly sensitive to the change in hydrogen bond length.

The shear flow processing of controlled DNA tethering and stretching for organic molecular electronics.

PubMed

Yu, Guihua; Kushwaha, Amit; Lee, Jungkyu K; Shaqfeh, Eric S G; Bao, Zhenan

2011-01-25

DNA has been recently explored as a powerful tool for developing molecular scaffolds for making reproducible and reliable metal contacts to single organic semiconducting molecules. A critical step in the process of exploiting DNA-organic molecule-DNA (DOD) array structures is the controlled tethering and stretching of DNA molecules. Here we report the development of reproducible surface chemistry for tethering DNA molecules at tunable density and demonstrate shear flow processing as a rationally controlled approach for stretching/aligning DNA molecules of various lengths. Through enzymatic cleavage of λ-phage DNA to yield a series of DNA chains of various lengths from 17.3 μm down to 4.2 μm, we have investigated the flow/extension behavior of these tethered DNA molecules under different flow strengths in the flow-gradient plane. We compared Brownian dynamic simulations for the flow dynamics of tethered λ-DNA in shear, and found our flow-gradient plane experimental results matched well with our bead-spring simulations. The shear flow processing demonstrated in our studies represents a controllable approach for tethering and stretching DNA molecules of various lengths. Together with further metallization of DNA chains within DOD structures, this bottom-up approach can potentially enable efficient and reliable fabrication of large-scale nanoelectronic devices based on single organic molecules, therefore opening opportunities in both fundamental understanding of charge transport at the single molecular level and many exciting applications for ever-shrinking molecular circuits.

Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy

NASA Astrophysics Data System (ADS)

Chao, J.; Zhang, P.; Wang, Q.; Wu, N.; Zhang, F.; Hu, J.; Fan, C. H.; Li, B.

2016-03-01

We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06544e

Chemical synthesis and characterization of branched oligodeoxyribonucleotides (bDNA) for use as signal amplifiers in nucleic acid quantification assays.

PubMed

Horn, T; Chang, C A; Urdea, M S

1997-12-01

The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology.

Chemical synthesis and characterization of branched oligodeoxyribonucleotides (bDNA) for use as signal amplifiers in nucleic acid quantification assays.

PubMed Central

Horn, T; Chang, C A; Urdea, M S

1997-01-01

The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology. PMID:9365266

DNA-psoralen interaction: a single molecule experiment.

PubMed

Rocha, M S; Viana, N B; Mesquita, O N

2004-11-15

By attaching one end of a single lambda-DNA molecule to a microscope coverslip and the other end to a polystyrene microsphere trapped by an optical tweezers, we can study the entropic elasticity of the lambda-DNA by measuring force versus extension as we stretch the molecule. This powerful method permits single molecule studies. We are particularly interested in the effects of the photosensitive drug psoralen on the elasticity of the DNA molecule. We have illuminated the sample with different light sources, studying how the different wavelengths affect the psoralen-DNA linkage. To do this, we measure the persistence length of individual DNA-psoralen complexes.

DNA of a Human Hepatitis B Virus Candidate

PubMed Central

Robinson, William S.; Clayton, David A.; Greenman, Richard L.

1974-01-01

Particles containing DNA polymerase (Dane particles) were purified from the plasma of chronic carriers of hepatitis B antigen. After a DNA polymerase reaction with purified Dane particle preparations treated with Nonidet P-40 detergent, Dane particle core structures containing radioactive DNA product were isolated by sedimentation in a sucrose density gradient. The radioactive DNA was extracted with sodium dodecyl sulfate and isolated by band sedimentation in a preformed CsCl gradient. Examination of the radioactive DNA band by electron microscopy revealed exclusively circular double-stranded DNA molecules approximately 0.78 μm in length. Identical circular molecules were observed when DNA was isolated by a similar procedure from particles that had not undergone a DNA polymerase reaction. The molecules were completely degraded by DNase 1. When Dane particle core structures were treated with DNase 1 before DNA extraction, only 0.78-μm circular DNA molecules were detected. Without DNase treatment of core structures, linear molecules with lengths between 0.5 and 12 μm, in addition to the 0.78-μm circles were found. These results suggest that the 0.78-μm circular molecules were in a protected position within Dane particle cores and the linear molecules were not within core structures. Length measurements on 225 circular molecules revealed a mean length of 0.78 ± 0.09 μm which would correspond to a molecular weight of around 1.6 × 106. The circular molecules probably serve as primer-template for the DNA polymerase reaction carried out by Dane particle cores. Thermal denaturation and buoyant density measurements on the Dane particle DNA polymerase reaction product revealed a guanosine plus cytosine content of 48 to 49%. Images PMID:4847328

Did the Pre-RNA World Rest Upon DNA Molecules?

NASA Technical Reports Server (NTRS)

Lazcano, Antonio; Dworkin, Jason P.; Miller, Stanley L.

2004-01-01

The isolation of a DNA sequence that catalyzes the ligation of oligodeoxynucleotides via the formation of 3' - 5' phosphodiester linkage significance in selection experiments has been reported. Ball recently used this to discuss the possibility that natural DNA molecules may have formed in the primitive Earth leading to the origin of life. As noted by Ferris and Usher, if metabolic pathways evolved backwards, it could be argued that the biosynthesis of 2-deoxyribose from ribose suggests that RNA came from DNA. As summarized elsewhere, there are several properties of deoxyribose which could be interpreted to support the possibility that DNA-like molecules arose prior to the RNA world. For example, 2-deoxyribose is slightly more soluble than ribose (which may have been an advantage in a drying pool scenario), may have been more reactive under possible prebiotic conditions (it forms a nucleoside approx. 150 times faster than ribose with the alternative base urazole at 25 C), while it decomposes in solution (approximately 2.6 times more slowly than ribose at 100 C). Other advantages of DNA over RNA are that it has one fewer chiral center, has a greater stability at the 8.2 pH value of the current oceans, and does not has the 2'5' and 3'5' ambiguity in polymerizations. Yet, there is strong molecular biological and biochemical evidence that RNA was featured in the biology well before the last common ancestor. The presence of sugar acids, including both ribo- and deoxysugar acids, in the 4.6 Ga old Murchison meteorite suggest that both may have been available in the primitive Earth, derived from the accretion of extraterrestrial sources and/or from endogenous processes involving formaldehyde and its derivatives. However, the abiotic synthesis of deoxyribose, ribose, and other sugars from glyceraldehyde and acetaldehyde under alkaline conditions is inefficient and unespecific. Although sugars are labile compounds, the role of cyanamide or borate minerals in the stabilization of the cyclic forms of ribose and other pentoses has recently been demonstrated. Nonetheless, the assumption either RNA or DNA was the first genetic material needs to be supplemented by laboratory models demonstrating that the prebiotic synthesis of activated beta-D-(deoxy)ribonucleotides and their polymers was feasible. As of today such evidence is lacking, and there is no convincing synthesis of any nucleotide, since all model experiments produce complex mixtures of products in which there is no preferential synthesis of chiral D-nucleotides. This strongly suggests that both DNA and RNA may have been preceded by pairing structures much simpler than extant nucleic acids. It is doubtful that DNA molecules, or indeed other (de0xy)ribofuranoid oligonucleotides formed the basis of these as yet undescribed pre-RNA worlds.

Using Synthetic Nanopores for Single-Molecule Analyses: Detecting SNPs, Trapping DNA Molecules, and the Prospects for Sequencing DNA

ERIC Educational Resources Information Center

Dimitrov, Valentin V.

2009-01-01

This work focuses on studying properties of DNA molecules and DNA-protein interactions using synthetic nanopores, and it examines the prospects of sequencing DNA using synthetic nanopores. We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. There exists…

Improved DNA hybridization parameters by Twisted Intercalating Nucleic Acid (TINA).

PubMed

Schneider, Uffe Vest

2012-01-01

This thesis establishes oligonucleotide design rules and applications of a novel group of DNA stabilizing molecules collectively called Twisted Intercalating Nucleic Acid - TINA. Three peer-reviewed publications form the basis for the thesis. One publication describes an improved and rapid method for determination of DNA melting points and two publications describe the effects of positioning TINA molecules in parallel triplex helix and antiparallel duplex helix forming DNA structures. The third publication establishes that TINA molecules containing oligonucleotides improve an antiparallel duplex hybridization based capture assay's analytical sensitivity compared to conventionel DNA oligonucleotides. Clinical microbiology is traditionally based on pathogenic microorganisms' culture and serological tests. The introduction of DNA target amplification methods like PCR has improved the analytical sensitivity and total turn around time involved in clinical diagnostics of infections. Due to the relatively weak hybridization between the two strands of double stranded DNA, a number of nucleic acid stabilizing molecules have been developed to improve the sensitivity of DNA based diagnostics through superior binding properties. A short introduction is given to Watson-Crick and Hoogsteen based DNA binding and the derived DNA structures. A number of other nucleic acid stabilizing molecules are described. The stabilizing effect of TINA molecules on different DNA structures is discussed and considered in relation to other nucleic acid stabilizing molecules and in relation to future use of TINA containing oligonucleotides in clinical diagnostics and therapy. In conclusion, design of TINA modified oligonucleotides for antiparallel duplex helixes and parallel triplex helixes follows simple purpose dependent rules. TINA molecules are well suited for improving multiplex PCR assays and can be used as part of novel technologies. Future research should test whether combinations of TINA molecules and other nucleic acid stabilizing molecules can increase analytical sensitivity whilst maintaining nucleobase mismatch discrimination in triplex helix based diagnostic assays.

One-by-one single-molecule detection of mutated nucleobases by monitoring tunneling current using a DNA tip.

PubMed

Bui, Phuc Tan; Nishino, Tomoaki; Shiigi, Hiroshi; Nagaoka, Tsutomu

2015-01-31

A DNA molecule was utilized as a probe tip to achieve single-molecule genetic diagnoses. Hybridization of the probe and target DNAs resulted in electron tunneling along the emergent double-stranded DNA. Simple stationary monitoring of the tunneling current leads to single-molecule DNA detection and discovery of base mismatches and methylation.

DNA origami as biocompatible surface to match single-molecule and ensemble experiments

PubMed Central

Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip

2012-01-01

Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements. PMID:22523083

Visualization of yeast chromosomal DNA

NASA Technical Reports Server (NTRS)

Lubega, Seth

1990-01-01

The DNA molecule is the most significant life molecule since it codes the blue print for other structural and functional molecules of all living organisms. Agarose gel electrophoresis is now being widely used to separate DNA of virus, bacteria, and lower eukaryotes. The task was undertaken of reviewing the existing methods of DNA fractionation and microscopic visualization of individual chromosonal DNA molecules by gel electrophoresis as a basis for a proposed study to investigate the feasibility of separating DNA molecules in free fluids as an alternative to gel electrophoresis. Various techniques were studied. On the molecular level, agarose gel electrophoresis is being widely used to separate chromosomal DNA according to molecular weight. Carl and Olson separate and characterized the entire karyotype of a lab strain of Saccharomyces cerevisiae. Smith et al. and Schwartz and Koval independently reported the visualization of individual DNA molecules migrating through agarose gel matrix during electrophoresis. The techniques used by these researchers are being reviewed in the lab as a basis for the proposed studies.

Transformation of Escherichia coli with large DNA molecules by electroporation.

PubMed Central

Sheng, Y; Mancino, V; Birren, B

1995-01-01

We have examined bacterial electroporation with a specific interest in the transformation of large DNA, i.e. molecules > 100 kb. We have used DNA from bacterial artificial chromosomes (BACs) ranging from 7 to 240 kb, as well as BAC ligation mixes containing a range o different sized molecules. The efficiency of electroporation with large DNA is strongly dependent on the strain of Escherichia coli used; strains which offer comparable efficiencies for 7 kb molecules differ in their uptake of 240 kb DNA by as much as 30-fold. Even with a host strain that transforms relatively well with large DNA, transformation efficiency drops dramatically with increasing size of the DNA. Molecules of 240 kb transform approximately 30-fold less well, on a molar basis, than molecules of 80 kb. Maximum transformation of large DNA occurs with different voltage gradients and with different time constants than are optimal for smaller DNA. This provides the opportunity to increase the yield of transformants which have taken up large DNA relative to the number incorporating smaller molecules. We have demonstrated that conditions may be selected which increase the average size of BAC clones generated by electroporation and compare the overall efficiency of each of the conditions tested. Images PMID:7596828

The study of electrical conductivity of DNA molecules by scanning tunneling spectroscopy

NASA Astrophysics Data System (ADS)

Sharipov, T. I.; Bakhtizin, R. Z.

2017-10-01

An interest to the processes of charge transport in DNA molecules is very high, due to perspective of their using in nanoelectronics. The original sample preparation for studying electrical conductivity of DNA molecules by scanning tunneling spectroscopy has been proposed and tested. The DNA molecules immobilized on gold surface have been imaged clearly and their current-voltage curves have been measured.

The Kinetic Mechanism for DNA Unwinding by Multiple Molecules of Dda Helicase Aligned on DNA†

PubMed Central

Eoff, Robert L.; Raney, Kevin D.

2010-01-01

Helicases catalyze the separation of double-stranded nucleic acids to form single-stranded intermediates. Using transient state kinetic methods we have determined the kinetic properties of DNA unwinding under conditions that favor a monomeric form of the Dda helicase as well as conditions that allow multiple molecules to function on the same substrate. Multiple helicase molecules can align like a train on the DNA track. The number of base pairs unwound in a single binding event for Dda is increased from ~19 bp for the monomeric form to ~64 bp when as many as four Dda molecules are aligned on the same substrate, while the kinetic step-size (3.2 ± 0.7 bp) and unwinding rate (242 ± 25 bp s−1) appear to be independent of the number of Dda molecules present on a given substrate. The data support a model in which the helicase molecules bound to the same substrate move along the DNA track independently during DNA unwinding. The observed increase in processivity arises from the increased probability that at least one of the helicases will completely unwind the DNA prior to dissociation. These results are in contrast to previous reports in which multiple Dda molecules on the same track greatly enhanced the rate and amplitude for displacement of protein blocks on the track. Therefore, only when the progress of the lead molecule in the train is impeded by some type of block, such as a protein bound to DNA, do the trailing molecules interact with the lead molecule in order to overcome the block. The fact that trailing helicase molecules have little impact on the lead molecule in the train during routine DNA unwinding suggests that the trailing molecules are moving at similar rates as the lead molecule. This result implicates a step in the translocation mechanism as contributing greatly to the overall rate-limiting step for unwinding of duplex DNA. PMID:20408588

Torsional mechanics of DNA are regulated by small-molecule intercalation.

PubMed

Celedon, Alfredo; Wirtz, Denis; Sun, Sean

2010-12-23

Whether the bend and twist mechanics of DNA molecules are coupled is unclear. Here, we report the direct measurement of the resistive torque of single DNA molecules to study the effect of ethidium bromide (EtBr) intercalation and pulling force on DNA twist mechanics. DNA molecules were overwound and unwound using recently developed magnetic tweezers where the molecular resistive torque was obtained from Brownian angular fluctuations. The effect of EtBr intercalation on the twist stiffness was found to be significantly different from the effect on the bend persistence length. The twist stiffness of DNA was dramatically reduced at low intercalator concentration (<10 nM); however, it did not decrease further when the intercalator concentration was increased by 3 orders of magnitude. We also determined the dependence of EtBr intercalation on the torque applied to DNA. We propose a model for the elasticity of DNA base pairs with intercalated EtBr molecules to explain the abrupt decrease of twist stiffness at low EtBr concentration. These results indicate that the bend and twist stiffnesses of DNA are independent and can be differently affected by small-molecule binding.

Method for performing site-specific affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

1999-01-01

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

Miniaturized reaction vessel system, method for performing site-specific biochemical reactions and affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

2000-01-01

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

Method for performing site-specific affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, A.D.; Lysov, Y.P.; Dubley, S.A.

1999-05-18

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between the cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting the extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to the extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from the array. 14 figs.

DNA molecules on periodically microstructured lipid membranes: Localization and coil stretching

NASA Astrophysics Data System (ADS)

Hochrein, Marion B.; Leierseder, Judith A.; Golubović, Leonardo; Rädler, Joachim O.

2007-02-01

We explore large scale conformations of DNA molecules adsorbed on curved surfaces. For that purpose, we investigate the behavior of DNA adsorbed on periodically shaped cationic lipid membranes. These unique membrane morphologies are supported on grooved, one-dimensionally periodic microstructured surfaces. Strikingly, we find that these periodically structured membranes are capable to stretch DNA coils. We elucidate this phenomenon in terms of surface curvature dependent potential energy attained by the adsorbed DNA molecules. Due to it, DNA molecules undergo a localization transition causing them to stretch by binding to highly curved sections (edges) of the supported membranes. This effect provides a new venue for controlling conformations of semiflexible polymers such as DNA by employing their interactions with specially designed biocompatible surfaces. We report the first experimental observation of semiflexible polymers unbinding transition in which DNA molecules unbind from one-dimensional manifolds (edges) while remaining bound to two-dimensional manifolds (cationic membranes).

Observation of DNA Molecules Using Fluorescence Microscopy and Atomic Force Microscopy

ERIC Educational Resources Information Center

Ito, Takashi

2008-01-01

This article describes experiments for an undergraduate instrumental analysis laboratory that aim to observe individual double-stranded DNA (dsDNA) molecules using fluorescence microscopy and atomic force microscopy (AFM). dsDNA molecules are observed under several different conditions to discuss their chemical and physical properties. In…

A Single-Molecule Barcoding System using Nanoslits for DNA Analysis

NASA Astrophysics Data System (ADS)

Jo, Kyubong; Schramm, Timothy M.; Schwartz, David C.

Single DNA molecule approaches are playing an increasingly central role in the analytical genomic sciences because single molecule techniques intrinsically provide individualized measurements of selected molecules, free from the constraints of bulk techniques, which blindly average noise and mask the presence of minor analyte components. Accordingly, a principal challenge that must be addressed by all single molecule approaches aimed at genome analysis is how to immobilize and manipulate DNA molecules for measurements that foster construction of large, biologically relevant data sets. For meeting this challenge, this chapter discusses an integrated approach for microfabricated and nanofabricated devices for the manipulation of elongated DNA molecules within nanoscale geometries. Ideally, large DNA coils stretch via nanoconfinement when channel dimensions are within tens of nanometers. Importantly, stretched, often immobilized, DNA molecules spanning hundreds of kilobase pairs are required by all analytical platforms working with large genomic substrates because imaging techniques acquire sequence information from molecules that normally exist in free solution as unrevealing random coils resembling floppy balls of yarn. However, nanoscale devices fabricated with sufficiently small dimensions fostering molecular stretching make these devices impractical because of the requirement of exotic fabrication technologies, costly materials, and poor operational efficiencies. In this chapter, such problems are addressed by discussion of a new approach to DNA presentation and analysis that establishes scaleable nanoconfinement conditions through reduction of ionic strength; stiffening DNA molecules thus enabling their arraying for analysis using easily fabricated devices that can also be mass produced. This new approach to DNA nanoconfinement is complemented by the development of a novel labeling scheme for reliable marking of individual molecules with fluorochrome labels, creating molecular barcodes, which are efficiently read using fluorescence resonance energy transfer techniques for minimizing noise from unincorporated labels. As such, our integrative approach for the realization of genomic analysis through nanoconfinement, named nanocoding, was demonstrated through the barcoding and mapping of bacterial artificial chromosomal molecules, thereby providing the basis for a high-throughput platform competent for whole genome investigations.

Visualization of DNA molecules in time during electrophoresis

NASA Technical Reports Server (NTRS)

Lubega, Seth

1991-01-01

For several years individual DNA molecules have been observed and photographed during agarose gel electrophoresis. The DNA molecule is clearly the largest molecule known. Nevertheless, the largest molecule is still too small to be seen using a microscope. A technique developed by Morikawa and Yanagida has made it possible to visualize individual DNA molecules. When these long molecules are labeled with appropriate fluorescence dyes and observed under a fluorescence microscope, although it is not possible to directly visualize the local ultrastructure of the molecules, yet because they are long light emitting chains, their microscopic dynamical behavior can be observed. This visualization works in the same principle that enables one to observe a star through a telescope because it emits light against a dark background. The dynamics of individual DNA molecules migrating through agarose matrix during electrophoresis have been described by Smith et al. (1989), Schwartz and Koval (1989), and Bustamante et al. (1990). DNA molecules during agarose gel electrophoresis advance lengthwise thorough the gel in an extended configuration. They display an extension-contraction motion and tend to bunch up in their leading ends as the 'heads' find new pores through the gel. From time to time they get hooked on obstacles in the gel to form U-shaped configurations before they resume their linear configuration.

Single molecule characterization of DNA binding and strand displacement reactions on lithographic DNA origami microarrays.

PubMed

Scheible, Max B; Pardatscher, Günther; Kuzyk, Anton; Simmel, Friedrich C

2014-03-12

The combination of molecular self-assembly based on the DNA origami technique with lithographic patterning enables the creation of hierarchically ordered nanosystems, in which single molecules are positioned at precise locations on multiple length scales. Based on a hybrid assembly protocol utilizing DNA self-assembly and electron-beam lithography on transparent glass substrates, we here demonstrate a DNA origami microarray, which is compatible with the requirements of single molecule fluorescence and super-resolution microscopy. The spatial arrangement allows for a simple and reliable identification of single molecule events and facilitates automated read-out and data analysis. As a specific application, we utilize the microarray to characterize the performance of DNA strand displacement reactions localized on the DNA origami structures. We find considerable variability within the array, which results both from structural variations and stochastic reaction dynamics prevalent at the single molecule level.

Single Molecule Visualization of Protein-DNA Complexes: Watching Machines at Work

NASA Astrophysics Data System (ADS)

Kowalczykowski, Stephen

2013-03-01

We can now watch individual proteins acting on single molecules of DNA. Such imaging provides unprecedented interrogation of fundamental biophysical processes. Visualization is achieved through the application of two complementary procedures. In one, single DNA molecules are attached to a polystyrene bead and are then captured by an optical trap. The DNA, a worm-like coil, is extended either by the force of solution flow in a micro-fabricated channel, or by capturing the opposite DNA end in a second optical trap. In the second procedure, DNA is attached by one end to a glass surface. The coiled DNA is elongated either by continuous solution flow or by subsequently tethering the opposite end to the surface. Protein action is visualized by fluorescent reporters: fluorescent dyes that bind double-stranded DNA (dsDNA), fluorescent biosensors for single-stranded DNA (ssDNA), or fluorescently-tagged proteins. Individual molecules are imaged using either epifluorescence microscopy or total internal reflection fluorescence (TIRF) microscopy. Using these approaches, we imaged the search for DNA sequence homology conducted by the RecA-ssDNA filament. The manner by which RecA protein finds a single homologous sequence in the genome had remained undefined for almost 30 years. Single-molecule imaging revealed that the search occurs through a mechanism termed ``intersegmental contact sampling,'' in which the randomly coiled structure of DNA is essential for reiterative sampling of DNA sequence identity: an example of parallel processing. In addition, the assembly of RecA filaments on single molecules of single-stranded DNA was visualized. Filament assembly requires nucleation of a protein dimer on DNA, and subsequent growth occurs via monomer addition. Furthermore, we discovered a class of proteins that catalyzed both nucleation and growth of filaments, revealing how the cell controls assembly of this protein-DNA complex.

Global structure of forked DNA in solution revealed by high-resolution single-molecule FRET.

PubMed

Sabir, Tara; Schröder, Gunnar F; Toulmin, Anita; McGlynn, Peter; Magennis, Steven W

2011-02-09

Branched DNA structures play critical roles in DNA replication, repair, and recombination in addition to being key building blocks for DNA nanotechnology. Here we combine single-molecule multiparameter fluorescence detection and molecular dynamics simulations to give a general approach to global structure determination of branched DNA in solution. We reveal an open, planar structure of a forked DNA molecule with three duplex arms and demonstrate an ion-induced conformational change. This structure will serve as a benchmark for DNA-protein interaction studies.

Application of differential scanning calorimetry to measure the differential binding of ions, water and protons in the unfolding of DNA molecules.

PubMed

Olsen, Chris M; Shikiya, Ronald; Ganugula, Rajkumar; Reiling-Steffensmeier, Calliste; Khutsishvili, Irine; Johnson, Sarah E; Marky, Luis A

2016-05-01

The overall stability of DNA molecules globally depends on base-pair stacking, base-pairing, polyelectrolyte effect and hydration contributions. In order to understand how they carry out their biological roles, it is essential to have a complete physical description of how the folding of nucleic acids takes place, including their ion and water binding. To investigate the role of ions, water and protons in the stability and melting behavior of DNA structures, we report here an experimental approach i.e., mainly differential scanning calorimetry (DSC), to determine linking numbers: the differential binding of ions (Δnion), water (ΔnW) and protons (ΔnH(+)) in the helix-coil transition of DNA molecules. We use DSC and temperature-dependent UV spectroscopic techniques to measure the differential binding of ions, water, and protons for the unfolding of a variety of DNA molecules: salmon testes DNA (ST-DNA), one dodecamer, one undecamer and one decamer duplexes, nine hairpin loops, and two triplexes. These methods can be applied to any conformational transition of a biomolecule. We determined complete thermodynamic profiles, including all three linking numbers, for the unfolding of each molecule. The favorable folding of a DNA helix results from a favorable enthalpy-unfavorable entropy compensation. DSC thermograms and UV melts as a function of salt, osmolyte and proton concentrations yielded releases of ions and water. Therefore, the favorable folding of each DNA molecule results from the formation of base-pair stacks and uptake of both counterions and water molecules. In addition, the triplex with C(+)GC base triplets yielded an uptake of protons. Furthermore, the folding of a DNA duplex is accompanied by a lower uptake of ions and a similar uptake of four water molecules as the DNA helix gets shorter. In addition, the oligomer duplexes and hairpin thermodynamic data suggest ion and water binding depends on the DNA sequence rather than DNA composition. Copyright © 2015. Published by Elsevier B.V.

DNA-Based Single-Molecule Electronics: From Concept to Function.

PubMed

Wang, Kun

2018-01-17

Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.

DNA-Based Single-Molecule Electronics: From Concept to Function

PubMed Central

2018-01-01

Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091

Logic Gate Operation by DNA Translocation through Biological Nanopores.

PubMed

Yasuga, Hiroki; Kawano, Ryuji; Takinoue, Masahiro; Tsuji, Yutaro; Osaki, Toshihisa; Kamiya, Koki; Miki, Norihisa; Takeuchi, Shoji

2016-01-01

Logical operations using biological molecules, such as DNA computing or programmable diagnosis using DNA, have recently received attention. Challenges remain with respect to the development of such systems, including label-free output detection and the rapidity of operation. Here, we propose integration of biological nanopores with DNA molecules for development of a logical operating system. We configured outputs "1" and "0" as single-stranded DNA (ssDNA) that is or is not translocated through a nanopore; unlabeled DNA was detected electrically. A negative-AND (NAND) operation was successfully conducted within approximately 10 min, which is rapid compared with previous studies using unlabeled DNA. In addition, this operation was executed in a four-droplet network. DNA molecules and associated information were transferred among droplets via biological nanopores. This system would facilitate linking of molecules and electronic interfaces. Thus, it could be applied to molecular robotics, genetic engineering, and even medical diagnosis and treatment.

Logic Gate Operation by DNA Translocation through Biological Nanopores

PubMed Central

Takinoue, Masahiro; Tsuji, Yutaro; Osaki, Toshihisa; Kamiya, Koki; Miki, Norihisa; Takeuchi, Shoji

2016-01-01

Logical operations using biological molecules, such as DNA computing or programmable diagnosis using DNA, have recently received attention. Challenges remain with respect to the development of such systems, including label-free output detection and the rapidity of operation. Here, we propose integration of biological nanopores with DNA molecules for development of a logical operating system. We configured outputs “1” and “0” as single-stranded DNA (ssDNA) that is or is not translocated through a nanopore; unlabeled DNA was detected electrically. A negative-AND (NAND) operation was successfully conducted within approximately 10 min, which is rapid compared with previous studies using unlabeled DNA. In addition, this operation was executed in a four-droplet network. DNA molecules and associated information were transferred among droplets via biological nanopores. This system would facilitate linking of molecules and electronic interfaces. Thus, it could be applied to molecular robotics, genetic engineering, and even medical diagnosis and treatment. PMID:26890568

An evolution based biosensor receptor DNA sequence generation algorithm.

PubMed

Kim, Eungyeong; Lee, Malrey; Gatton, Thomas M; Lee, Jaewan; Zang, Yupeng

2010-01-01

A biosensor is composed of a bioreceptor, an associated recognition molecule, and a signal transducer that can selectively detect target substances for analysis. DNA based biosensors utilize receptor molecules that allow hybridization with the target analyte. However, most DNA biosensor research uses oligonucleotides as the target analytes and does not address the potential problems of real samples. The identification of recognition molecules suitable for real target analyte samples is an important step towards further development of DNA biosensors. This study examines the characteristics of DNA used as bioreceptors and proposes a hybrid evolution-based DNA sequence generating algorithm, based on DNA computing, to identify suitable DNA bioreceptor recognition molecules for stable hybridization with real target substances. The Traveling Salesman Problem (TSP) approach is applied in the proposed algorithm to evaluate the safety and fitness of the generated DNA sequences. This approach improves efficiency and stability for enhanced and variable-length DNA sequence generation and allows extension to generation of variable-length DNA sequences with diverse receptor recognition requirements.

Basic quantitative polymerase chain reaction using real-time fluorescence measurements.

PubMed

Ares, Manuel

2014-10-01

This protocol uses quantitative polymerase chain reaction (qPCR) to measure the number of DNA molecules containing a specific contiguous sequence in a sample of interest (e.g., genomic DNA or cDNA generated by reverse transcription). The sample is subjected to fluorescence-based PCR amplification and, theoretically, during each cycle, two new duplex DNA molecules are produced for each duplex DNA molecule present in the sample. The progress of the reaction during PCR is evaluated by measuring the fluorescence of dsDNA-dye complexes in real time. In the early cycles, DNA duplication is not detected because inadequate amounts of DNA are made. At a certain threshold cycle, DNA-dye complexes double each cycle for 8-10 cycles, until the DNA concentration becomes so high and the primer concentration so low that the reassociation of the product strands blocks efficient synthesis of new DNA and the reaction plateaus. There are two types of measurements: (1) the relative change of the target sequence compared to a reference sequence and (2) the determination of molecule number in the starting sample. The first requires a reference sequence, and the second requires a sample of the target sequence with known numbers of the molecules of sequence to generate a standard curve. By identifying the threshold cycle at which a sample first begins to accumulate DNA-dye complexes exponentially, an estimation of the numbers of starting molecules in the sample can be extrapolated. © 2014 Cold Spring Harbor Laboratory Press.

Topological events in single molecules of E. coli DNA confined in nanochannels

PubMed Central

Reifenberger, Jeffrey G.; Dorfman, Kevin D.; Cao, Han

2015-01-01

We present experimental data concerning potential topological events such as folds, internal backfolds, and/or knots within long molecules of double-stranded DNA when they are stretched by confinement in a nanochannel. Genomic DNA from E. coli was labeled near the ‘GCTCTTC’ sequence with a fluorescently labeled dUTP analog and stained with the DNA intercalator YOYO. Individual long molecules of DNA were then linearized and imaged using methods based on the NanoChannel Array technology (Irys® System) available from BioNano Genomics. Data were collected on 189,153 molecules of length greater than 50 kilobases. A custom code was developed to search for abnormal intensity spikes in the YOYO backbone profile along the length of individual molecules. By correlating the YOYO intensity spikes with the aligned barcode pattern to the reference, we were able to correlate the bright intensity regions of YOYO with abnormal stretching in the molecule, which suggests these events were either a knot or a region of internal backfolding within the DNA. We interpret the results of our experiments involving molecules exceeding 50 kilobases in the context of existing simulation data for relatively short DNA, typically several kilobases. The frequency of these events is lower than the predictions from simulations, while the size of the events is larger than simulation predictions and often exceeds the molecular weight of the simulated molecules. We also identified DNA molecules that exhibit large, single folds as they enter the nanochannels. Overall, topological events occur at a low frequency (~7% of all molecules) and pose an easily surmountable obstacle for the practice of genome mapping in nanochannels. PMID:25991508

Direct observation of λ-DNA molecule reversal movement within microfluidic channels under electric field with single molecule imaging technique

NASA Astrophysics Data System (ADS)

Fengyun, Yang; Kaige, Wang; Dan, Sun; Wei, Zhao; Hai-qing, Wang; Xin, He; Gui-ren, Wang; Jin-tao, Bai

2016-07-01

The electrodynamic characteristics of single DNA molecules moving within micro-/nano-fluidic channels are important in the design of biomedical chips and bimolecular sensors. In this study, the dynamic properties of λ-DNA molecules transferring along the microchannels driven by the external electrickinetic force were systemically investigated with the single molecule fluorescence imaging technique. The experimental results indicated that the velocity of DNA molecules was strictly dependent on the value of the applied electric field and the diameter of the channel. The larger the external electric field, the larger the velocity, and the more significant deformation of DNA molecules. More meaningfully, it was found that the moving directions of DNA molecules had two completely different directions: (i) along the direction of the external electric field, when the electric field intensity was smaller than a certain threshold value; (ii) opposite to the direction of the external electric field, when the electric field intensity was greater than the threshold electric field intensity. The reversal movement of DNA molecules was mainly determined by the competition between the electrophoresis force and the influence of electro-osmosis flow. These new findings will theoretically guide the practical application of fluidic channel sensors and lab-on-chips for precisely manipulating single DNA molecules. Project supported by the National Natural Science Foundation of China (Grant No. 61378083), the International Cooperation Foundation of the National Science and Technology Major Project of the Ministry of Science and Technology of China (Grant No. 2011DFA12220), the Major Research Plan of National Natural Science Foundation of China (Grant No. 91123030), and the Natural Science Foundation of Shaanxi Province of China (Grant Nos. 2010JS110 and 2013SZS03-Z01).

Nanopore detection of DNA molecules in crowded neutral polymer solutions

NASA Astrophysics Data System (ADS)

Sharma, Rajesh Kumar; Dai, Liang; Doyle, Patrick; Garaj, Slaven

Nanopore sensing is a precise technique for analysis of the structure and dynamics of individual biomolecules in different environments, and has even become a prominent technique for next-gen DNA sequencing. In the nanopore sensor, an individual DNA molecule is electrophoretically translocated through a single, nanometer-scaled pore in a solid-state membrane separating two chambers filled with electrolyte. The conformation of the molecule is deduced from modulations in the ionic current through the pore during the translocation event. Using nanopores, we investigated the dynamics of the DNA molecules in a crowded solution of neutral polymers of different sizes and concentrations. The translocation dynamics depends significantly on the size and concentration of the polymers, as different contributions to the electrophoretic and entropic forces on the DNA molecules come into play. This setup offers an excellent, tuneable model-system for probing biologically relevant questions regarding the behaviour of DNA molecules in highly confined and crowded environments. Singapore-MIT Alliance for Research and Technology.

Single molecule techniques in DNA repair: A primer

PubMed Central

Hughes, Craig D.; Simons, Michelle; Mackenzie, Cassidy E.; Van Houten, Bennett; Kad, Neil M.

2016-01-01

A powerful new approach has become much more widespread and offers insights into aspects of DNA repair unattainable with billions of molecules. Single molecule techniques can be used to image, manipulate or characterize the action of a single repair protein on a single strand of DNA. This allows search mechanisms to be probed, and the effects of force to be understood. These physical aspects can dominate a biochemical reaction, where at the ensemble level their nuances are obscured. In this paper we discuss some of the many technical advances that permit study at the single molecule level. We focus on DNA repair to which these techniques are actively being applied. DNA repair is also a process that encompasses so much of what single molecule studies benefit – searching for targets, complex formation, sequential biochemical reactions and substrate hand-off to name just a few. We discuss how single molecule biophysics is poised to transform our understanding of biological systems, in particular DNA repair. PMID:24819596

Biosensing via light scattering from plasmonic core-shell nanospheres coated with DNA molecules

NASA Astrophysics Data System (ADS)

Xie, Huai-Yi; Chen, Minfeng; Chang, Yia-Chung; Moirangthem, Rakesh Singh

2017-05-01

We present both experimental and theoretical studies for investigating DNA molecules attached on metallic nanospheres. We have developed an efficient and accurate numerical method to investigate light scattering from plasmonic nanospheres on a substrate covered by a shell, based on the Green's function approach with suitable spherical harmonic basis. Next, we use this method to study optical scattering from DNA molecules attached to metallic nanoparticles placed on a substrate and compare with experimental results. We obtain fairly good agreement between theoretical predictions and the measured ellipsometric spectra. The metallic nanoparticles were used to detect the binding with DNA molecules in a microfluidic setup via spectroscopic ellipsometry (SE), and a detectable change in ellipsometric spectra was found when DNA molecules are captured on Au nanoparticles. Our theoretical simulation indicates that the coverage of Au nanosphere by a submonolayer of DNA molecules, which is modeled by a thin layer of dielectric material (which may absorb light), can lead to a small but detectable spectroscopic shift in both the Ψ and Δ spectra with more significant change in Δ spectra in agreement with experimental results. Our studies demonstrated the ultrasensitive capability of SE for sensing submonolayer coverage of DNA molecules on Au nanospheres. Hence the spectroscopic ellipsometric measurements coupled with theoretical analysis via an efficient computation method can be an effective tool for detecting DNA molecules attached on Au nanoparticles, thus achieving label-free, non-destructive, and high-sensitivity biosensing with nanoscale resolution.

Fluorescence Microscopy of Nanochannel-Confined DNA.

PubMed

Westerlund, Fredrik; Persson, Fredrik; Fritzsche, Joachim; Beech, Jason P; Tegenfeldt, Jonas O

2018-01-01

Stretching of DNA in nanoscale confinement allows for several important studies. The genetic contents of the DNA can be visualized on the single DNA molecule level and both the polymer physics of confined DNA and also DNA/protein and other DNA/DNA-binding molecule interactions can be explored. This chapter describes the basic steps to fabricate the nanostructures, perform the experiments and analyze the data.

Genetics Home Reference: mitochondrial neurogastrointestinal encephalopathy disease

MedlinePlus

... modification) is used as a building block of DNA . Thymidine phosphorylase breaks down thymidine into smaller molecules, ... molecule is damaging to a particular kind of DNA known as mitochondrial DNA or mtDNA. Mitochondria are ...

Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in

2015-07-28

Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging themore » ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.« less

DNA recombination activity in soybean mitochondria.

PubMed

Manchekar, Medha; Scissum-Gunn, Karyn; Song, Daqing; Khazi, Fayaz; McLean, Stephanie L; Nielsen, Brent L

2006-02-17

Mitochondrial genomes in higher plants are much larger and more complex as compared to animal mitochondrial genomes. There is growing evidence that plant mitochondrial genomes exist predominantly as a collection of linear and highly branched DNA molecules and replicate by a recombination-dependent mechanism. However, biochemical evidence of mitochondrial DNA (mtDNA) recombination activity in plants has previously been lacking. We provide the first report of strand-invasion activity in plant mitochondria. Similar to bacterial RecA, this activity from soybean is dependent on the presence of ATP and Mg(2+). Western blot analysis using an antibody against the Arabidopsis mitochondrial RecA protein shows cross-reaction with a soybean protein of about 44 kDa, indicating conservation of this protein in at least these two plant species. mtDNA structure was analyzed by electron microscopy of total soybean mtDNA and molecules recovered after field-inversion gel electrophoresis (FIGE). While most molecules were found to be linear, some molecules contained highly branched DNA structures and a small but reproducible proportion consisted of circular molecules (many with tails) similar to recombination intermediates. The presence of recombination intermediates in plant mitochondria preparations is further supported by analysis of mtDNA molecules by 2-D agarose gel electrophoresis, which indicated the presence of complex recombination structures along with a considerable amount of single-stranded DNA. These data collectively provide convincing evidence for the occurrence of homologous DNA recombination in plant mitochondria.

Recombinant DNA encoding a desulfurization biocatalyst

DOEpatents

Rambosek, John; Piddington, Chris S.; Kovacevich, Brian R.; Young, Kevin D.; Denome, Sylvia A.

1994-01-01

This invention relates to a recombinant DNA molecule containing a gene or genes which encode a biocatalyst capable of desulfurizing a fossil fuel which contains organic sulfur molecules. For example, the present invention encompasses a recombinant DNA molecule containing a gene or genes of a strain of Rhodococcus rhodochrous.

Functional helicoidal model of DNA molecule with elastic nonlinearity

NASA Astrophysics Data System (ADS)

Tseytlin, Y. M.

2013-06-01

We constructed a functional DNA molecule model on the basis of a flexible helicoidal sensor, specifically, a pretwisted hollow nano-strip. We study in this article the helicoidal nano- sensor model with a pretwisted strip axial extension corresponding to the overstretching transition of DNA from dsDNA to ssDNA. Our model and the DNA molecule have similar geometrical and nonlinear mechanical features unlike models based on an elastic rod, accordion bellows, or an imaginary combination of "multiple soft and hard linear springs", presented in some recent publications.

Rapid purification of circular DNA by triplex-mediated affinity capture

DOEpatents

Ji, Huamin; Smith, Lloyd M.

1997-01-01

A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support.

Linearisation of λDNA molecules by instantaneous variation of the trapping electrode voltage inside a micro-channel

NASA Astrophysics Data System (ADS)

Hanasaki, Itsuo; Yukimoto, Naoya; Uehara, Satoshi; Shintaku, Hirofumi; Kawano, Satoyuki

2015-04-01

Because long DNA molecules usually exist in random coil states due to the entropic effect, linearisation is required for devices equipped with nanopores where electrical sequencing is necessary during single-file translocation. We present a novel technique for linearising DNA molecules in a micro-channel. In our device, electrodes are embedded in the bottom surface of the channel. The application of a voltage induces the trapping of λDNA molecules on the positive electrode. An instantaneous voltage drop is used to put the λDNA molecules in a partly released state and the hydrodynamic force of the solution induces linearisation. Phenomena were directly observed using an optical microscopy system equipped with a high-speed camera and the linearisation principle was explored in detail. Furthermore, we estimate the tensile characteristics produced by the flow of the solution through a numerical model of a tethered polymer subject to a Poiseuille flow. The mean tensile force is in the range of 0.1-1 pN. This is sufficiently smaller than the structural transition point of λDNA but counterbalances the entropic elasticity that causes the random coil shape of λDNA molecules in solution. We show the important role of thermal fluctuation in the manipulation of molecules in solution and clarify the tensile conditions required for DNA linearisation using a combination of solution flow and voltage variation in a microchannel.

Single-Molecule Electrical Random Resequencing of DNA and RNA

NASA Astrophysics Data System (ADS)

Ohshiro, Takahito; Matsubara, Kazuki; Tsutsui, Makusu; Furuhashi, Masayuki; Taniguchi, Masateru; Kawai, Tomoji

2012-07-01

Two paradigm shifts in DNA sequencing technologies--from bulk to single molecules and from optical to electrical detection--are expected to realize label-free, low-cost DNA sequencing that does not require PCR amplification. It will lead to development of high-throughput third-generation sequencing technologies for personalized medicine. Although nanopore devices have been proposed as third-generation DNA-sequencing devices, a significant milestone in these technologies has been attained by demonstrating a novel technique for resequencing DNA using electrical signals. Here we report single-molecule electrical resequencing of DNA and RNA using a hybrid method of identifying single-base molecules via tunneling currents and random sequencing. Our method reads sequences of nine types of DNA oligomers. The complete sequence of 5'-UGAGGUA-3' from the let-7 microRNA family was also identified by creating a composite of overlapping fragment sequences, which was randomly determined using tunneling current conducted by single-base molecules as they passed between a pair of nanoelectrodes.

Identifying DNA methylation in a nanochannel

NASA Astrophysics Data System (ADS)

Sun, Xiaoyin; Yasui, Takao; Yanagida, Takeshi; Kaji, Noritada; Rahong, Sakon; Kanai, Masaki; Nagashima, Kazuki; Kawai, Tomoji; Baba, Yoshinobu

2016-01-01

DNA methylation is a stable epigenetic modification, which is well known to be involved in gene expression regulation. In general, however, analyzing DNA methylation requires rather time consuming processes (24-96 h) via DNA replication and protein modification. Here we demonstrate a methodology to analyze DNA methylation at a single DNA molecule level without any protein modifications by measuring the contracted length and relaxation time of DNA within a nanochannel. Our methodology is based on the fact that methylation makes DNA molecules stiffer, resulting in a longer contracted length and a longer relaxation time (a slower contraction rate). The present methodology offers a promising way to identify DNA methylation without any protein modification at a single DNA molecule level within 2 h.

Recombinant DNA encoding a desulfurization biocatalyst

DOEpatents

Rambosek, J.; Piddington, C.S.; Kovacevich, B.R.; Young, K.D.; Denome, S.A.

1994-10-18

This invention relates to a recombinant DNA molecule containing a gene or genes which encode a biocatalyst capable of desulfurizing a fossil fuel which contains organic sulfur molecules. For example, the present invention encompasses a recombinant DNA molecule containing a gene or genes of a strain of Rhodococcus rhodochrous. 13 figs.

Photoinduced Oxidative DNA Damage Revealed by an Agarose Gel Nicking Assay: A Biophysical Chemistry Laboratory Experiment

NASA Astrophysics Data System (ADS)

Shafirovich, Vladimir; Singh, Carolyn; Geacintov, Nicholas E.

2003-11-01

Oxidative damage of DNA molecules associated with electron-transfer reactions is an important phenomenon in living cells, which can lead to mutations and contribute to carcinogenesis and the aging processes. This article describes the design of several simple experiments to explore DNA damage initiated by photoinduced electron-transfer reactions sensitized by the acridine derivative, proflavine (PF). A supercoiled DNA agarose gel nicking assay is employed as a sensitive probe of DNA strand cleavage. A low-cost experimental and computer-interfaced imaging apparatus is described allowing for the digital recording and analysis of the gel electrophoresis results. The first experiment describes the formation of direct strand breaks in double-stranded DNA induced by photoexcitation of the intercalated PF molecules. The second experiment demonstrates that the addition of the well-known electron acceptor, methylviologen, gives rise to a significant enhancement of the photochemical DNA strand cleavage effect. This occurs by an electron transfer step to methylviologen that renders the inital photoinduced charge separation between photoexcited PF and DNA irreversible. The third experiment demonstrates that the action spectrum of the DNA photocleavage matches the absorption spectrum of DNA-bound, intercalated PF molecules, which differs from that of free PF molecules. This result demonstrates that the photoinduced DNA strand cleavage is initiated by intercalated rather than free PF molecules.

CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

NASA Astrophysics Data System (ADS)

Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

2018-03-01

CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of <220>. Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

Parallel Arrays of Geometric Nanowells for Assembling Curtains of DNA with Controlled Lateral Dispersion

PubMed Central

Visnapuu, Mari-Liis; Fazio, Teresa; Wind, Shalom; Greene, Eric C.

2009-01-01

The analysis of individual molecules is evolving into an important tool for biological research, and presents conceptually new ways of approaching experimental design strategies. However, more robust methods are required if these technologies are to be made broadly available to the biological research community. To help achieve this goal we have combined nanofabrication techniques with single-molecule optical microscopy for assembling and visualizing curtains comprised of thousands of individual DNA molecules organized at engineered diffusion barriers on a lipid bilayer-coated surface. Here we present an important extension of this technology that implements geometric barrier patterns comprised of thousands of nanoscale wells that can be loaded with single molecules of DNA. We show that these geometric nanowells can be used to precisely control the lateral distribution of the individual DNA molecules within curtains assembled along the edges of the engineered barrier patterns. The individual molecules making up the DNA curtain can be separated from one another by a user-defined distance dictated by the dimensions of the nanowells. We demonstrate the broader utility of these patterned DNA curtains in a novel, real time restriction assay that we refer to as dynamic optical restriction mapping, which can be used to rapidly identify entire sets of cleavage sites within a large DNA molecule. PMID:18788761

Agarose gel electrophoresis for the separation of DNA fragments.

PubMed

Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon

2012-04-20

Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate concentration for their needs Prepare an agarose gel for electrophoresis of DNA samples Set up the gel electrophoresis apparatus and power supply Select an appropriate voltage for the separation of DNA fragments Understand the mechanism by which ethidium bromide allows for the visualization of DNA bands Determine the sizes of separated DNA fragments.

Drug-DNA interactions at single molecule level: A view with optical tweezers

NASA Astrophysics Data System (ADS)

Paramanathan, Thayaparan

Studies of small molecule--DNA interactions are essential for developing new drugs for challenging diseases like cancer and HIV. The main idea behind developing these molecules is to target and inhibit the reproduction of the tumor cells and infected cells. We mechanically manipulate single DNA molecule using optical tweezers to investigate two molecules that have complex and multiple binding modes. Mononuclear ruthenium complexes have been extensively studied as a test for rational drug design. Potential drug candidates should have high affinity to DNA and slow dissociation kinetics. To achieve this, motifs of the ruthenium complexes are altered. Our collaborators designed a dumb-bell shaped binuclear ruthenium complex that can only intercalate DNA by threading through its bases. Studying the binding properties of this complex in bulk studies took hours. By mechanically manipulating a single DNA molecule held with optical tweezers, we lower the barrier to thread and make it fast compared to the bulk experiments. Stretching single DNA molecules with different concentration of drug molecules and holding it at a constant force allows the binding to reach equilibrium. By this we can obtain the equilibrium fractional ligand binding and length of DNA at saturated binding. Fitting these results yields quantitative measurements of the binding thermodynamics and kinetics of this complex process. The second complex discussed in this study is Actinomycin D (ActD), a well studied anti-cancer agent that is used as a prototype for developing new generations of drugs. However, the biophysical basis of its activity is still unclear. Because ActD is known to intercalate double stranded DNA (dsDNA), it was assumed to block replication by stabilizing dsDNA in front of the replication fork. However, recent studies have shown that ActD binds with even higher affinity to imperfect duplexes and some sequences of single stranded DNA (ssDNA). We directly measure the on and off rates by stretching the DNA molecule to a certain force and holding it at constant force while adding the drug and then while washing off the drug. Our finding resolves the long lasting controversy of ActD binding modes, clearly showing that both the dsDNA binding and ssDNA binding converge to the same single mode. The result supports the hypothesis that the primary characteristic of ActD that contributes to its biological activity is its ability to inhibit cellular replication by binding to transcription bubbles and causing cell death.

Increasing the Analytical Sensitivity by Oligonucleotides Modified with Para- and Ortho-Twisted Intercalating Nucleic Acids – TINA

PubMed Central

Schneider, Uffe V.; Géci, Imrich; Jøhnk, Nina; Mikkelsen, Nikolaj D.; Pedersen, Erik B.; Lisby, Gorm

2011-01-01

The sensitivity and specificity of clinical diagnostic assays using DNA hybridization techniques are limited by the dissociation of double-stranded DNA (dsDNA) antiparallel duplex helices. This situation can be improved by addition of DNA stabilizing molecules such as nucleic acid intercalators. Here, we report the synthesis of a novel ortho-Twisted Intercalating Nucleic Acid (TINA) amidite utilizing the phosphoramidite approach, and examine the stabilizing effect of ortho- and para-TINA molecules in antiparallel DNA duplex formation. In a thermal stability assay, ortho- and para-TINA molecules increased the melting point (Tm) of Watson-Crick based antiparallel DNA duplexes. The increase in Tm was greatest when the intercalators were placed at the 5′ and 3′ termini (preferable) or, if placed internally, for each half or whole helix turn. Terminally positioned TINA molecules improved analytical sensitivity in a DNA hybridization capture assay targeting the Escherichia coli rrs gene. The corresponding sequence from the Pseudomonas aeruginosa rrs gene was used as cross-reactivity control. At 150 mM ionic strength, analytical sensitivity was improved 27-fold by addition of ortho-TINA molecules and 7-fold by addition of para-TINA molecules (versus the unmodified DNA oligonucleotide), with a 4-fold increase retained at 1 M ionic strength. Both intercalators sustained the discrimination of mismatches in the dsDNA (indicated by ΔTm), unless placed directly adjacent to the mismatch – in which case they partly concealed ΔTm (most pronounced for para-TINA molecules). We anticipate that the presented rules for placement of TINA molecules will be broadly applicable in hybridization capture assays and target amplification systems. PMID:21673988

Detecting the Length of Double-stranded DNA with Solid State Nanopores

NASA Astrophysics Data System (ADS)

Li, Jiali; Gershow, Marc; Stein, Derek; Qun, Cai; Brandin, Eric; Wang, Hui; Huang, Albert; Branton, Dan; Golovchenko, Jene

2003-03-01

We report on the use of nanometer scale diameter, solid-state nanopores as single molecule detectors of double stranded DNA molecules. These solid-state nanopores are fabricated in thin membranes of silicon nitride, by ion beam sculpting 1. They produce discrete electronic signals: current blockages, when an electrically biased nanopore is exposed to DNA molecules in aqueous salt solutions. We demonstrate examples of such electronic signals for 3k base pairs (bp) and 10k bp double stranded DNA molecules, which suggest that these molecules are individually translocating through the nanopore during the detection process. The translocating time for the 10k bp double stranded DNA is about 3 times longer than the 3k bp, demonstrating that a solid-state nanopore device can be used to detect the lengths of double stranded DNA molecules. Similarities and differences with signals obtained from single stranded DNA in a biological nanopores are discussed 2. 1. Li, J., Stein, D., McMullan, C., Branton, D. Aziz, M. J. and Golovchenko, J. Ion Beam Sculpting at nanometer length scales. Nature 412, 166-169 (2001). 2. Meller, A., L. Nivon, E. Brandin, Golovchenko, J. & Branton, D. Proc. Natl. Acad. Sci. USA 97, 1079-1084 (2000).

Effects of electrostatic screening on the conformation of single DNA molecules confined in a nanochannel

NASA Astrophysics Data System (ADS)

Zhang, Ce; Zhang, Fang; van Kan, Jeroen A.; van der Maarel, Johan R. C.

2008-06-01

Single T4-DNA molecules were confined in rectangular-shaped channels with a depth of 300 nm and a width in the range of 150-300 nm casted in a poly(dimethylsiloxane) nanofluidic chip. The extensions of the DNA molecules were measured with fluorescence microscopy as a function of the ionic strength and composition of the buffer as well as the DNA intercalation level by the YOYO-1 dye. The data were interpreted with the scaling theory for a wormlike polymer in good solvent, including the effects of confinement, charge, and self-avoidance. It was found that the elongation of the DNA molecules with decreasing ionic strength can be interpreted in terms of an increase of the persistence length. Self-avoidance effects on the extension are moderate, due to the small correlation length imposed by the channel cross-sectional diameter. Intercalation of the dye results in an increase of the DNA contour length and a partial neutralization of the DNA charge, but besides effects of electrostatic origin it has no significant effect on the bare bending rigidity. In the presence of divalent cations, the DNA molecules were observed to contract, but they do not collapse into a condensed structure. It is proposed that this contraction results from a divalent counterion mediated attractive force between the segments of the DNA molecule.

Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

PubMed

Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

2007-09-15

We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

Nanofabricated Racks of Aligned and Anchored DNA Substrates for Single-Molecule Imaging

PubMed Central

2009-01-01

Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This “double-tethered” DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein−DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA. PMID:19736980

Nanofabricated racks of aligned and anchored DNA substrates for single-molecule imaging.

PubMed

Gorman, Jason; Fazio, Teresa; Wang, Feng; Wind, Shalom; Greene, Eric C

2010-01-19

Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This "double-tethered" DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein-DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA.

Binding mechanism of PicoGreen to DNA characterized by magnetic tweezers and fluorescence spectroscopy.

PubMed

Wang, Ying; Schellenberg, Helene; Walhorn, Volker; Toensing, Katja; Anselmetti, Dario

2017-09-01

Fluorescent dyes are broadly used in many biotechnological applications to detect and visualize DNA molecules. However, their binding to DNA alters the structural and nanomechanical properties of DNA and, thus, interferes with associated biological processes. In this work we employed magnetic tweezers and fluorescence spectroscopy to investigate the binding of PicoGreen to DNA at room temperature in a concentration-dependent manner. PicoGreen is an ultrasensitive quinolinium nucleic acid stain exhibiting hardly any background signal from unbound dye molecules. By means of stretching and overwinding single, torsionally constrained, nick-free double-stranded DNA molecules, we acquired force-extension and supercoiling curves which allow quantifying DNA contour length, persistence length and other thermodynamical binding parameters, respectively. The results of our magnetic tweezers single-molecule binding study were well supported through analyzing the fluorescent spectra of stained DNA. On the basis of our work, we could identify a concentration-dependent bimodal binding behavior, where, apparently, PicoGreen associates to DNA as an intercalator and minor-groove binder simultaneously.

Small-Molecule Inhibitors Targeting DNA Repair and DNA Repair Deficiency in Research and Cancer Therapy.

PubMed

Hengel, Sarah R; Spies, M Ashley; Spies, Maria

2017-09-21

To maintain stable genomes and to avoid cancer and aging, cells need to repair a multitude of deleterious DNA lesions, which arise constantly in every cell. Processes that support genome integrity in normal cells, however, allow cancer cells to develop resistance to radiation and DNA-damaging chemotherapeutics. Chemical inhibition of the key DNA repair proteins and pharmacologically induced synthetic lethality have become instrumental in both dissecting the complex DNA repair networks and as promising anticancer agents. The difficulty in capitalizing on synthetically lethal interactions in cancer cells is that many potential targets do not possess well-defined small-molecule binding determinates. In this review, we discuss several successful campaigns to identify and leverage small-molecule inhibitors of the DNA repair proteins, from PARP1, a paradigm case for clinically successful small-molecule inhibitors, to coveted new targets, such as RAD51 recombinase, RAD52 DNA repair protein, MRE11 nuclease, and WRN DNA helicase. Copyright © 2017 Elsevier Ltd. All rights reserved.

Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules

NASA Astrophysics Data System (ADS)

Buyukdagli, Sahin

2017-02-01

We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test-charge theory [S. Buyukdagli et al., Phys. Rev. E 94, 042502 (2016), 10.1103/PhysRevE.94.042502] to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the experimental phase diagrams for polymer solutions. First, the addition of polyvalent cations to the electrolyte solution results in the attraction of the negatively charged polymer by the DNA molecule. The glue of the like-charge attraction is the enhanced shielding of the polymer charges by the dense counterion layer at the DNA surface. Second, through the shielding of the DNA-induced electrostatic potential, mono- and polyvalent cations of large concentration both suppress the like-charge attraction. Within the same formalism, we also predict a new opposite-charge repulsion effect between the DNA molecule and a positively charged polymer. In the presence of polyvalent anions such as sulfate or phosphate, their repulsion by the DNA charges leads to the charge screening deficiency of the region around the DNA molecule. This translates into a repulsive force that results in the decomplexation of the polymer from DNA. This opposite-charge repulsion phenomenon can be verified by current experiments and the underlying mechanism can be beneficial to gene therapeutic applications where the control over polymer-DNA interactions is the key factor.

Charging YOYO-1 on Capillary Wall for Online DNA Intercalation and Integrating This Approach with Multiplex PCR and Bare Narrow Capillary–Hydrodynamic Chromatography for Online DNA Analysis

PubMed Central

2016-01-01

Multiplex polymerase chain reaction (PCR) has been widely utilized for high-throughput pathogen identification. Often, a dye is used to intercalate the amplified DNA fragments, and identifications of the pathogens are carried out by DNA melting curve analysis or gel electrophoresis. Integrating DNA amplification and identification is a logic path toward maximizing the benefit of multiplex PCR. Although PCR and gel electrophoresis have been integrated, replenishing the gels after each run is tedious and time-consuming. In this technical note, we develop an approach to address this issue. We perform multiplex PCR inside a capillary, transfer the amplified fragments to a bare narrow capillary, and measure their lengths online using bare narrow capillary–hydrodynamic chromatography (BaNC-HDC), a new technique recently developed in our laboratory for free-solution DNA separation. To intercalate the DNA with YOYO-1 (a fluorescent dye) for BaNC-HDC, we flush the capillary column with a YOYO-1 solution; positively charged YOYO-1 is adsorbed (or charged) onto the negatively charged capillary wall. As DNA molecules are driven down the column for separation, they react with the YOYO-1 stored on the capillary wall and are online-intercalated with the dye. With a single YOYO-1 charging, the column can be used for more than 40 runs, although the fluorescence signal intensities of the DNA peaks decrease gradually. Although the dye-DNA intercalation occurs during the separation, it does not affect the retention times, separation efficiencies, or resolutions. PMID:25555111

Transforming single DNA molecules into fluorescent magnetic particles for detection and enumeration of genetic variations

PubMed Central

Dressman, Devin; Yan, Hai; Traverso, Giovanni; Kinzler, Kenneth W.; Vogelstein, Bert

2003-01-01

Many areas of biomedical research depend on the analysis of uncommon variations in individual genes or transcripts. Here we describe a method that can quantify such variation at a scale and ease heretofore unattainable. Each DNA molecule in a collection of such molecules is converted into a single magnetic particle to which thousands of copies of DNA identical in sequence to the original are bound. This population of beads then corresponds to a one-to-one representation of the starting DNA molecules. Variation within the original population of DNA molecules can then be simply assessed by counting fluorescently labeled particles via flow cytometry. This approach is called BEAMing on the basis of four of its principal components (beads, emulsion, amplification, and magnetics). Millions of individual DNA molecules can be assessed in this fashion with standard laboratory equipment. Moreover, specific variants can be isolated by flow sorting and used for further experimentation. BEAMing can be used for the identification and quantification of rare mutations as well as to study variations in gene sequences or transcripts in specific populations or tissues. PMID:12857956

DNA combing on low-pressure oxygen plasma modified polysilsesquioxane substrates for single-molecule studies

PubMed Central

Sriram, K. K.; Chang, Chun-Ling; Rajesh Kumar, U.; Chou, Chia-Fu

2014-01-01

Molecular combing and flow-induced stretching are the most commonly used methods to immobilize and stretch DNA molecules. While both approaches require functionalization steps for the substrate surface and the molecules, conventionally the former does not take advantage of, as the latter, the versatility of microfluidics regarding robustness, buffer exchange capability, and molecule manipulation using external forces for single molecule studies. Here, we demonstrate a simple one-step combing process involving only low-pressure oxygen (O2) plasma modified polysilsesquioxane (PSQ) polymer layer to facilitate both room temperature microfluidic device bonding and immobilization of stretched single DNA molecules without molecular functionalization step. Atomic force microscopy and Kelvin probe force microscopy experiments revealed a significant increase in surface roughness and surface potential on low-pressure O2 plasma treated PSQ, in contrast to that with high-pressure O2 plasma treatment, which are proposed to be responsible for enabling effective DNA immobilization. We further demonstrate the use of our platform to observe DNA-RNA polymerase complexes and cancer drug cisplatin induced DNA condensation using wide-field fluorescence imaging. PMID:25332730

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

NASA Astrophysics Data System (ADS)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Single-molecule dilution and multiple displacement amplification for molecular haplotyping.

PubMed

Paul, Philip; Apgar, Josh

2005-04-01

Separate haploid analysis is frequently required for heterozygous genotyping to resolve phase ambiguity or confirm allelic sequence. We demonstrate a technique of single-molecule dilution followed by multiple strand displacement amplification to haplotype polymorphic alleles. Dilution of DNA to haploid equivalency, or a single molecule, is a simple method for separating di-allelic DNA. Strand displacement amplification is a robust method for non-specific DNA expansion that employs random hexamers and phage polymerase Phi29 for double-stranded DNA displacement and primer extension, resulting in high processivity and exceptional product length. Single-molecule dilution was followed by strand displacement amplification to expand separated alleles to microgram quantities of DNA for more efficient haplotype analysis of heterozygous genes.

Rapid purification of circular DNA by triplex-mediated affinity capture

DOEpatents

Ji, H.; Smith, L.M.

1997-01-07

A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support. 3 figs.

Disentangling DNA molecules

NASA Astrophysics Data System (ADS)

Vologodskii, Alexander

2016-09-01

The widespread circular form of DNA molecules inside cells creates very serious topological problems during replication. Due to the helical structure of the double helix the parental strands of circular DNA form a link of very high order, and yet they have to be unlinked before the cell division. DNA topoisomerases, the enzymes that catalyze passing of one DNA segment through another, solve this problem in principle. However, it is very difficult to remove all entanglements between the replicated DNA molecules due to huge length of DNA comparing to the cell size. One strategy that nature uses to overcome this problem is to create the topoisomerases that can dramatically reduce the fraction of linked circular DNA molecules relative to the corresponding fraction at thermodynamic equilibrium. This striking property of the enzymes means that the enzymes that interact with DNA only locally can access their topology, a global property of circular DNA molecules. This review considers the experimental studies of the phenomenon and analyzes the theoretical models that have been suggested in attempts to explain it. We describe here how various models of enzyme action can be investigated computationally. There is no doubt at the moment that we understand basic principles governing enzyme action. Still, there are essential quantitative discrepancies between the experimental data and the theoretical predictions. We consider how these discrepancies can be overcome.

Rolling Circle Amplification For Spatially Directed Synthesis Of A Solid Phase Anchored Single-Stranded DNA Molecule

NASA Astrophysics Data System (ADS)

Reiß, Edda; Hölzel, Ralph; von Nickisch-Rosenegk, Markus; Bier, Frank F.

2006-09-01

In this article the usefulness of the enzyme phi29 DNA polymerase and the principle of rolling circle amplification (RCA) for creating single-stranded DNA (ssDNA) nanostructures is described. Currently we are working on the spatial orientation of a growing ssDNA molecule during its RCA-based synthesis by the application of a hydrodynamic force. Starting at an immobilized primer at single molecule level, the aim is to construct a nanostructure of known location and orientation, providing multiple repeating binding sites that can be addressed via complementary base-pairing. Proof-of-principle experiments demonstrate the potential of the enzymatic reaction. ssDNA molecules of more than 20 μm length were created at an immobilized primer and detected by means of fluorescence microscopy.

Single molecule fluorescence burst detection of DNA fragments separated by capillary electrophoresis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Haab, B.B.; Mathies, R.A.

A method has been developed for detecting DNA separated by capillary gel electrophoresis (CGE) using single molecule photon burst counting. A confocal fluorescence microscope was used to observe the fluorescence bursts from single molecules of DNA multiply labeled with the thiazole orange derivative TO6 as they passed through the nearly 2-{mu}m diameter focused laser beam. Amplified photo-electron pulses from the photomultiplier are grouped into bins of 360-450 {mu}s in duration, and the resulting histogram is stored in a computer for analysis. Solutions of M13 DNA were first flowed through the capillary at various concentrations, and the resulting data were usedmore » to optimize the parameters for digital filtering using a low-pass Fourier filter, selecting a discriminator level for peak detection, and applying a peak-calling algorithm. The optimized single molecule counting method was then applied to an electrophoretic separation of M13 DNA and to a separation of pBR 322 DNA from pRL 277 DNA. Clusters of discreet fluorescence bursts were observed at the expected appearance time of each DNA band. The auto-correlation function of these data indicated transit times that were consistent with the observed electrophoretic velocity. These separations were easily detected when only 50-100 molecules of DNA per band traveled through the detection region. This new detection technology should lead to the routine analysis of DNA in capillary columns with an on-column sensitivity of nearly 100 DNA molecules/band or better. 45 refs., 10 figs.« less

Winding single-molecule double-stranded DNA on a nanometer-sized reel

PubMed Central

You, Huijuan; Iino, Ryota; Watanabe, Rikiya; Noji, Hiroyuki

2012-01-01

A molecular system of a nanometer-sized reel was developed from F1–ATPase, a rotary motor protein. By combination with magnetic tweezers and optical tweezers, single-molecule double-stranded DNA (dsDNA) was wound around the molecular reel. The bending stiffness of dsDNA was determined from the winding tension (0.9–6.0 pN) and the diameter of the wound loop (21.4–8.5 nm). Our results were in good agreement with the conventional worm-like chain model and a persistence length of 54 ± 9 nm was estimated. This molecular reel system offers a new platform for single-molecule study of micromechanics of sharply bent DNA molecules and is expected to be applicable to the elucidation of the molecular mechanism of DNA-associating proteins on sharply bent DNA strands. PMID:22772992

DNA intermediates and telomere addition during genome reorganization in Euplotes crassus.

PubMed

Roth, M; Prescott, D M

1985-06-01

Three gene-sized molecules cloned intact from macronuclear DNA served as hybridization probes to study excision of these molecules from chromosomes and their processing during macronuclear development in the hypotrich Euplotes crassus. These molecules occur in integrated forms within polytene chromosomal DNA during macronuclear developmental. After transection of the polytene chromosomes, the three molecules occur in intermediate forms. One of the three molecules first appeared in a large intermediate that was subsequently replaced by a second intermediate, approximately 140 bp larger than the final molecule. The other two macronuclear molecules were detected only in intermediates approximately 140 bp larger than the mature form. These penultimate intermediates are larger by virtue of oversized telomeres, which are pared to yield the mature gene-sized molecules.

High-throughput DNA separation in nanofilter arrays.

PubMed

Choi, Sungup; Kim, Ju Min; Ahn, Kyung Hyun; Lee, Seung Jong

2014-08-01

We numerically investigated the dynamics of short double-stranded DNA molecules moving through a deep-shallow alternating nanofilter, by utilizing Brownian dynamics simulation. We propose a novel mechanism for high-throughput DNA separation with a high electric field, which was originally predicted by Laachi et al. [Phys. Rev. Lett. 2007, 98, 098106]. In this work, we show that DNA molecules deterministically move along different electrophoretic streamlines according to their length, owing to geometric constraint at the exit of the shallow region. Consequently, it is more probable that long DNA molecules pass over a deep well region without significant lateral migration toward the bottom of the deep well, which is in contrast to the long dwelling time for short DNA molecules. We investigated the dynamics of DNA passage through a nanofilter facilitating electrophoretic field kinematics. The statistical distribution of the DNA molecules according to their size clearly corroborates our assumption. On the other hand, it was also found that the tapering angle between the shallow and deep regions significantly affects the DNA separation performance. The current results show that the nonuniform field effect combined with geometric constraint plays a key role in nanofilter-based DNA separation. We expect that our results will be helpful in designing and operating nanofluidics-based DNA separation devices and in understanding the polymer dynamics in confined geometries. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases

PubMed Central

Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef

2012-01-01

Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110

DNA mechanics as a tool to probe helicase and translocase activity.

PubMed

Lionnet, Timothée; Dawid, Alexandre; Bigot, Sarah; Barre, François-Xavier; Saleh, Omar A; Heslot, François; Allemand, Jean-François; Bensimon, David; Croquette, Vincent

2006-01-01

Helicases and translocases are proteins that use the energy derived from ATP hydrolysis to move along or pump nucleic acid substrates. Single molecule manipulation has proved to be a powerful tool to investigate the mechanochemistry of these motors. Here we first describe the basic mechanical properties of DNA unraveled by single molecule manipulation techniques. Then we demonstrate how the knowledge of these properties has been used to design single molecule assays to address the enzymatic mechanisms of different translocases. We report on four single molecule manipulation systems addressing the mechanism of different helicases using specifically designed DNA substrates: UvrD enzyme activity detection on a stretched nicked DNA molecule, HCV NS3 helicase unwinding of a RNA hairpin under tension, the observation of RecBCD helicase/nuclease forward and backward motion, and T7 gp4 helicase mediated opening of a synthetic DNA replication fork. We then discuss experiments on two dsDNA translocases: the RuvAB motor studied on its natural substrate, the Holliday junction, and the chromosome-segregation motor FtsK, showing its unusual coupling to DNA supercoiling.

Enhancement of the thermoelectric figure of merit in DNA-like systems induced by Fano and Dicke effects.

PubMed

Fu, Hua-Hua; Gu, Lei; Wu, Dan-Dan; Zhang, Zu-Quan

2015-04-28

We report a theoretical study highlighting the thermoelectric properties of biological and synthetic DNA molecules. Based on an effective tight-binding model of duplex DNA and by using the nonequilibrium Green's function technique, the thermal conductance, electrical conductance, Seebeck coefficient and thermoelectric figure of merit in the system are numerically calculated by varying the asymmetries of energies and electronic hoppings in the backbone sites to simulate the environmental complications and fluctuations. We find that due to the multiple transport paths in the DNA molecule, the Fano antiresonance occurs, and enhances the Seebeck coefficient and the figure of merit. When the energy difference is produced in every opposite backbone site, the Dicke effect appears. This effect gives rise to a semiconducting-metallic transition, and enhances the thermoelectric efficiency of the DNA molecule remarkably. Moreover, as the Fano antiresonance point is close to the Dicke resonance one, a giant enhancement in the thermoelectric figure of merit in the DNA molecule has been found. These results provide a scenario to obtain effective routes to enhance the thermoelectric efficiency in the DNA molecules, and suggest perspectives for future experiments intending to control the thermoelectric transport in DNA-like nanodevices.

Development of a reference material of a single DNA molecule for the quality control of PCR testing.

PubMed

Mano, Junichi; Hatano, Shuko; Futo, Satoshi; Yoshii, Junji; Nakae, Hiroki; Naito, Shigehiro; Takabatake, Reona; Kitta, Kazumi

2014-09-02

We developed a reference material of a single DNA molecule with a specific nucleotide sequence. The double-strand linear DNA which has PCR target sequences at the both ends was prepared as a reference DNA molecule, and we named the PCR targets on each side as confirmation sequence and standard sequence. The highly diluted solution of the reference molecule was dispensed into 96 wells of a plastic PCR plate to make the average number of molecules in a well below one. Subsequently, the presence or absence of the reference molecule in each well was checked by real-time PCR targeting for the confirmation sequence. After an enzymatic treatment of the reaction mixture in the positive wells for the digestion of PCR products, the resultant solution was used as the reference material of a single DNA molecule with the standard sequence. PCR analyses revealed that the prepared samples included only one reference molecule with high probability. The single-molecule reference material developed in this study will be useful for the absolute evaluation of a detection limit of PCR-based testing methods, the quality control of PCR analyses, performance evaluations of PCR reagents and instruments, and the preparation of an accurate calibration curve for real-time PCR quantitation.

Cell-targetable DNA nanocapsules for spatiotemporal release of caged bioactive small molecules

NASA Astrophysics Data System (ADS)

Veetil, Aneesh T.; Chakraborty, Kasturi; Xiao, Kangni; Minter, Myles R.; Sisodia, Sangram S.; Krishnan, Yamuna

2017-12-01

Achieving triggered release of small molecules with spatial and temporal precision at designated cells within an organism remains a challenge. By combining a cell-targetable, icosahedral DNA-nanocapsule loaded with photoresponsive polymers, we show cytosolic delivery of small molecules with the spatial resolution of single endosomes in specific cells in Caenorhabditis elegans. Our technology can report on the extent of small molecules released after photoactivation as well as pinpoint the location at which uncaging of the molecules occurred. We apply this technology to release dehydroepiandrosterone (DHEA), a neurosteroid that promotes neurogenesis and neuron survival, and determined the timescale of neuronal activation by DHEA, using light-induced release of DHEA from targeted DNA nanocapsules. Importantly, sequestration inside the DNA capsule prevents photocaged DHEA from activating neurons prematurely. Our methodology can in principle be generalized to diverse neurostimulatory molecules.

Design of stapled DNA-minor-groove-binding molecules with a mutable atom simulated annealing method

NASA Astrophysics Data System (ADS)

Walker, Wynn L.; Kopka, Mary L.; Dickerson, Richard E.; Goodsell, David S.

1997-11-01

We report the design of optimal linker geometries for the synthesis of stapledDNA-minor-groove-binding molecules. Netropsin, distamycin, and lexitropsinsbind side-by-side to mixed-sequence DNA and offer an opportunity for thedesign of sequence-reading molecules. Stapled molecules, with two moleculescovalently linked side-by-side, provide entropic gains and restrain theposition of one molecule relative to its neighbor. Using a free-atom simulatedannealing technique combined with a discrete mutable atom definition, optimallengths and atomic composition for covalent linkages are determined, and anovel hydrogen bond `zipper' is proposed to phase two molecules accuratelyside-by-side.

Single-Molecule Denaturation Mapping of Genomic DNA in Nanofluidic Channels

NASA Astrophysics Data System (ADS)

Reisner, Walter; Larsen, Niels; Kristensen, Anders; Tegenfeldt, Jonas O.; Flyvbjerg, Henrik

2009-03-01

We have developed a new DNA barcoding technique based on the partial denaturation of extended fluorescently labeled DNA molecules. We partially melt DNA extended in nanofluidic channels via a combination of local heating and added chemical denaturants. The melted molecules, imaged via a standard fluorescence videomicroscopy setup, exhibit a nonuniform fluorescence profile corresponding to a series of local dips and peaks in the intensity trace along the stretched molecule. We show that this barcode is consistent with the presence of locally melted regions and can be explained by calculations of sequence-dependent melting probability. We believe this melting mapping technology is the first optically based single molecule technique sensitive to genome wide sequence variation that does not require an additional enzymatic labeling or restriction scheme.

Gating electrical transport through DNA molecules that bridge between silicon nanogaps.

PubMed

Takagi, Shogo; Takada, Tadao; Matsuo, Naoto; Yokoyama, Shin; Nakamura, Mitsunobu; Yamana, Kazushige

2012-03-21

DNA electronic devices were prepared on silicon-based three-terminal electrodes. Both ends of DNA molecules (400 bp long, mixed sequences) were bridged via chemical bonds between the source-drain nanogap (120 nm) electrodes. S-Shaped I-V curves were obtained and the electric current can be modulated by the gate voltage. The DNA molecules act as semiconducting p-type nanowires in the three-terminal device. This journal is © The Royal Society of Chemistry 2012

Separation of large DNA molecules by applying pulsed electric field to size exclusion chromatography-based microchip

NASA Astrophysics Data System (ADS)

Azuma, Naoki; Itoh, Shintaro; Fukuzawa, Kenji; Zhang, Hedong

2018-02-01

Through electrophoresis driven by a pulsed electric field, we succeeded in separating large DNA molecules with an electrophoretic microchip based on size exclusion chromatography (SEC), which was proposed in our previous study. The conditions of the pulsed electric field required to achieve the separation were determined by numerical analyses using our originally proposed separation model. From the numerical results, we succeeded in separating large DNA molecules (λ DNA and T4 DNA) within 1600 s, which was approximately half of that achieved under a direct electric field in our previous study. Our SEC-based electrophoresis microchip will be one of the effective tools to meet the growing demand of faster and more convenient separation of large DNA molecules, especially in the field of epidemiological research of infectious diseases.

Antibody-Mediated Small Molecule Detection Using Programmable DNA-Switches.

PubMed

Rossetti, Marianna; Ippodrino, Rudy; Marini, Bruna; Palleschi, Giuseppe; Porchetta, Alessandro

2018-06-13

The development of rapid, cost-effective, and single-step methods for the detection of small molecules is crucial for improving the quality and efficiency of many applications ranging from life science to environmental analysis. Unfortunately, current methodologies still require multiple complex, time-consuming washing and incubation steps, which limit their applicability. In this work we present a competitive DNA-based platform that makes use of both programmable DNA-switches and antibodies to detect small target molecules. The strategy exploits both the advantages of proximity-based methods and structure-switching DNA-probes. The platform is modular and versatile and it can potentially be applied for the detection of any small target molecule that can be conjugated to a nucleic acid sequence. Here the rational design of programmable DNA-switches is discussed, and the sensitive, rapid, and single-step detection of different environmentally relevant small target molecules is demonstrated.

Counterion accumulation effects on a suspension of DNA molecules: Equation of state and pressure-driven denaturation

NASA Astrophysics Data System (ADS)

Nicasio-Collazo, Luz Adriana; Delgado-González, Alexandra; Hernández-Lemus, Enrique; Castañeda-Priego, Ramón

2017-04-01

The study of the effects associated with the electrostatic properties of DNA is of fundamental importance to understand both its molecular properties at the single molecule level, like the rigidity of the chain, and its interaction with other charged bio-molecules, including other DNA molecules; such interactions are crucial to maintain the thermodynamic stability of the intra-cellular medium. In the present work, we combine the Poisson-Boltzmann mean-field theory with an irreversible thermodynamic approximation to analyze the effects of counterion accumulation inside DNA on both the denaturation profile of the chain and the equation of state of the suspension. To this end, we model the DNA molecule as a porous charged cylinder immersed in an aqueous solution. These thermo-electrostatic effects are explicitly studied in the particular case of some genes for which damage in their sequence is associated with diffuse large B-cell lymphoma.

Allosteric analysis of glucocorticoid receptor-DNA interface induced by cyclic Py-Im polyamide: a molecular dynamics simulation study.

PubMed

Wang, Yaru; Ma, Na; Wang, Yan; Chen, Guangju

2012-01-01

It has been extensively developed in recent years that cell-permeable small molecules, such as polyamide, can be programmed to disrupt transcription factor-DNA interfaces and can silence aberrant gene expression. For example, cyclic pyrrole-imidazole polyamide that competes with glucocorticoid receptor (GR) for binding to glucocorticoid response elements could be expected to affect the DNA dependent binding by interfering with the protein-DNA interface. However, how such small molecules affect the transcription factor-DNA interfaces and gene regulatory pathways through DNA structure distortion is not fully understood so far. In the present work, we have constructed some models, especially the ternary model of polyamides+DNA+GR DNA-binding domain (GRDBD) dimer, and carried out molecular dynamics simulations and free energy calculations for them to address how polyamide molecules disrupt the GRDBD and DNA interface when polyamide and protein bind at the same sites on opposite grooves of DNA. We found that the cyclic polyamide binding in minor groove of DNA can induce a large structural perturbation of DNA, i.e. a >4 Å widening of the DNA minor groove and a compression of the major groove by more than 4 Å as compared with the DNA molecule in the GRDBD dimer+DNA complex. Further investigations for the ternary system of polyamides+DNA+GRDBD dimer and the binary system of allosteric DNA+GRDBD dimer revealed that the compression of DNA major groove surface causes GRDBD to move away from the DNA major groove with the initial average distance of ∼4 Å to the final average distance of ∼10 Å during 40 ns simulation course. Therefore, this study straightforward explores how small molecule targeting specific sites in the DNA minor groove disrupts the transcription factor-DNA interface in DNA major groove, and consequently modulates gene expression.

Development of novel vaccines using DNA shuffling and screening strategies.

PubMed

Locher, Christopher P; Soong, Nay Wei; Whalen, Robert G; Punnonen, Juha

2004-02-01

DNA shuffling and screening technologies recombine and evolve genes in vitro to rapidly obtain molecules with improved biological activity and fitness. In this way, genes from related strains are bred like plants or livestock and their successive progeny are selected. These technologies have also been called molecular breeding-directed molecular evolution. Recent developments in bioinformatics-assisted computer programs have facilitated the design, synthesis and analysis of DNA shuffled libraries of chimeric molecules. New applications in vaccine development are among the key features of DNA shuffling and screening technologies because genes from several strains or antigenic variants of pathogens can be recombined to create novel molecules capable of inducing immune responses that protect against infections by multiple strains of pathogens. In addition, molecules such as co-stimulatory molecules and cytokines have been evolved to have improved T-cell proliferation and cytokine production compared with the wild-type human molecules. These molecules can be used to immunomodulate vaccine responsiveness and have multiple applications in infectious diseases, cancer, allergy and autoimmunity. Moreover, DNA shuffling and screening technologies can facilitate process development of vaccine manufacturing through increased expression of recombinant polypeptides and viruses. Therefore, DNA shuffling and screening technologies can overcome some of the challenges that vaccine development currently faces.

Molecular structure of r/GCG/d/TATACGC/ - A DNA-RNA hybrid helix joined to double helical DNA

NASA Technical Reports Server (NTRS)

Wang, A. H.-J.; Fujii, S.; Rich, A.; Van Boom, J. H.; Van Der Marel, G. A.; Van Boeckel, S. A. A.

1982-01-01

The molecule r(GCG)d(TATACGC) is self-complementary and forms two DNA-RNA hybrid segments surrounding a central region of double helical DNA; its molecular structure has been solved by X-ray analysis. All three parts of the molecule adopt a conformation which is close to that seen in the 11-fold RNA double helix. The conformation of the ribonucleotides is partly determined by water molecules bridging between the ribose O2' hydroxyl group and cytosine O2. The hybrid-DNA duplex junction contains no structural discontinuities. However, the central DNA TATA sequence has some structural irregularities.

DNA confinement in nanochannels: physics and biological applications

NASA Astrophysics Data System (ADS)

Reisner, Walter; Pedersen, Jonas N.; Austin, Robert H.

2012-10-01

DNA is the central storage molecule of genetic information in the cell, and reading that information is a central problem in biology. While sequencing technology has made enormous advances over the past decade, there is growing interest in platforms that can readout genetic information directly from long single DNA molecules, with the ultimate goal of single-cell, single-genome analysis. Such a capability would obviate the need for ensemble averaging over heterogeneous cellular populations and eliminate uncertainties introduced by cloning and molecular amplification steps (thus enabling direct assessment of the genome in its native state). In this review, we will discuss how the information contained in genomic-length single DNA molecules can be accessed via physical confinement in nanochannels. Due to self-avoidance interactions, DNA molecules will stretch out when confined in nanochannels, creating a linear unscrolling of the genome along the channel for analysis. We will first review the fundamental physics of DNA nanochannel confinement—including the effect of varying ionic strength—and then discuss recent applications of these systems to genomic mapping. Apart from the intense biological interest in extracting linear sequence information from elongated DNA molecules, from a physics view these systems are fascinating as they enable probing of single-molecule conformation in environments with dimensions that intersect key physical length-scales in the 1 nm to 100 µm range.

DNA confinement in nanochannels: physics and biological applications.

PubMed

Reisner, Walter; Pedersen, Jonas N; Austin, Robert H

2012-10-01

DNA is the central storage molecule of genetic information in the cell, and reading that information is a central problem in biology. While sequencing technology has made enormous advances over the past decade, there is growing interest in platforms that can readout genetic information directly from long single DNA molecules, with the ultimate goal of single-cell, single-genome analysis. Such a capability would obviate the need for ensemble averaging over heterogeneous cellular populations and eliminate uncertainties introduced by cloning and molecular amplification steps (thus enabling direct assessment of the genome in its native state). In this review, we will discuss how the information contained in genomic-length single DNA molecules can be accessed via physical confinement in nanochannels. Due to self-avoidance interactions, DNA molecules will stretch out when confined in nanochannels, creating a linear unscrolling of the genome along the channel for analysis. We will first review the fundamental physics of DNA nanochannel confinement--including the effect of varying ionic strength--and then discuss recent applications of these systems to genomic mapping. Apart from the intense biological interest in extracting linear sequence information from elongated DNA molecules, from a physics view these systems are fascinating as they enable probing of single-molecule conformation in environments with dimensions that intersect key physical length-scales in the 1 nm to 100 µm range.

DNA Binding Peptide Directed Synthesis of Continuous DNA Nanowires for Analysis of Large DNA Molecules by Scanning Electron Microscope.

PubMed

Kim, Kyung-Il; Lee, Seonghyun; Jin, Xuelin; Kim, Su Ji; Jo, Kyubong; Lee, Jung Heon

2017-01-01

Synthesis of smooth and continuous DNA nanowires, preserving the original structure of native DNA, and allowing its analysis by scanning electron microscope (SEM), is demonstrated. Gold nanoparticles densely assembled on the DNA backbone via thiol-tagged DNA binding peptides work as seeds for metallization of DNA. This method allows whole analysis of DNA molecules with entangled 3D features. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Current-voltage characteristics of double stranded versus single stranded DNA molecules

NASA Astrophysics Data System (ADS)

Hartzell, B.; Chen, Hong; Heremans, J. J.; McCord, B.; Soghomonian, V.

2004-03-01

Investigation of DNA conductivity has focused on the native, duplex structure, with controversial results. Here, we present the influence of the double-helical structure on charge transport through lambda DNA molecules. The current-voltage (I-V) characteristics of both disulfide-labeled double stranded DNA (dsDNA) and disulfide-labeled single stranded DNA (ssDNA) were measured. The ssDNA was formed from the dsDNA using two different methods for comparison purposes: a thermal/chemical denaturation and enzymatic digestion utilizing lambda exonuclease. Resulting I-V characteristics of both the double stranded and single stranded samples were close-to-linear when measured at room temperature. However, the ssDNA samples consistently gave conductivity values about two orders of magnitude smaller in amplitude. Our results suggest an integral relationship between the native structure of DNA with its stacked base pairs and the molecule's ability to support charge transport.(NSF NIRT 0103034)

Synthesis, DNA binding and cytotoxic activity of pyrimido[4',5':4,5]thieno(2,3-b)quinoline with 9-hydroxy-4-(3-diethylaminopropylamino) and 8-methoxy-4-(3-diethylaminopropylamino) substitutions.

PubMed

KiranKumar, Hulihalli N; RohitKumar, Heggodu G; Advirao, Gopal M

2018-01-01

Two new derivatives of pyrimido[4',5';4,5]thieno(2,3-b)quinoline (PTQ), 9-hydroxy-4-(3-diethylaminopropylamino)pyrimido[4',5';4,5]thieno(2,3-b)quinoline (Hydroxy-DPTQ) and 8-methoxy-4-(3-diethylaminopropylamino)pyrimido[4',5';4,5]thieno(2,3-b)quinoline (Methoxy-DPTQ) were synthesized and their DNA binding ability was analyzed using spectroscopy (UV-visible, fluorescence and circular dichroism), ethidium bromide dye displacement assay, melting temperature (T m ) analysis and computational docking studies. The hypochromism in UV-visible spectrum and increased fluorescence emission of Hydroxy-DPTQ and Methoxy-DPTQ in the presence of DNA suggested the molecule-DNA interaction. The association constants calculated from UV-visible and spectral titrations were of the order 10 4 to 10 6 M -1 . Circular dichroism studies corroborated the induced conformational changes in DNA upon addition of molecules. The change in the ellipticity was observed both in negative and positive peak of DNA, thus, suggesting the intercalation of molecules. The observed displacement of ethidium bromide from the DNA and increased T m , upon addition of DNA confirmed the intercalative mode of binding. This was further validated by computational docking, which showed clear intercalation of molecules into the d(GpC)-d(CpG) site of the receptor DNA. Anticancer activities of these molecules are evaluated by using MTT assay. Both molecules showed antiproliferative activity against all the three cancer cells studied, with Hydroxy-DPTQ being more potential molecule among the two. IC 50 value of Hydroxy-DPTQ and Methoxy-DPTQ were in the range of 3-5μM and 130-250μM, respectively. Copyright © 2017 Elsevier B.V. All rights reserved.

Single-molecule analysis of DNA uncoiling by a type II topoisomerase

NASA Astrophysics Data System (ADS)

Strick, Terence R.; Croquette, Vincent; Bensimon, David

2000-04-01

Type II DNA topoisomerases are ubiquitous ATP-dependent enzymes capable of transporting a DNA through a transient double-strand break in a second DNA segment. This enables them to untangle DNA and relax the interwound supercoils (plectonemes) that arise in twisted DNA. In vivo, they are responsible for untangling replicated chromosomes and their absence at mitosis or meiosis ultimately causes cell death. Here we describe a micromanipulation experiment in which we follow in real time a single Drosophila melanogaster topoisomerase II acting on a linear DNA molecule which is mechanically stretched and supercoiled. By monitoring the DNA's extension in the presence of ATP, we directly observe the relaxation of two supercoils during a single catalytic turnover. By controlling the force pulling on the molecule, we determine the variation of the reaction rate with the applied stress. Finally, in the absence of ATP, we observe the clamping of a DNA crossover by a single topoisomerase on at least two different timescales (configurations). These results show that single molecule experiments are a powerful new tool for the study of topoisomerases.

Screening by imaging: scaling up single-DNA-molecule analysis with a novel parabolic VA-TIRF reflector and noise-reduction techniques.

PubMed

van 't Hoff, Marcel; Reuter, Marcel; Dryden, David T F; Oheim, Martin

2009-09-21

Bacteriophage lambda-DNA molecules are frequently used as a scaffold to characterize the action of single proteins unwinding, translocating, digesting or repairing DNA. However, scaling up such single-DNA-molecule experiments under identical conditions to attain statistically relevant sample sizes remains challenging. Additionally the movies obtained are frequently noisy and difficult to analyse with any precision. We address these two problems here using, firstly, a novel variable-angle total internal reflection fluorescence (VA-TIRF) reflector composed of a minimal set of optical reflective elements, and secondly, using single value decomposition (SVD) to improve the signal-to-noise ratio prior to analysing time-lapse image stacks. As an example, we visualize under identical optical conditions hundreds of surface-tethered single lambda-DNA molecules, stained with the intercalating dye YOYO-1 iodide, and stretched out in a microcapillary flow. Another novelty of our approach is that we arrange on a mechanically driven stage several capillaries containing saline, calibration buffer and lambda-DNA, respectively, thus extending the approach to high-content, high-throughput screening of single molecules. Our length measurements of individual DNA molecules from noise-reduced kymograph images using SVD display a 6-fold enhanced precision compared to raw-data analysis, reaching approximately 1 kbp resolution. Combining these two methods, our approach provides a straightforward yet powerful way of collecting statistically relevant amounts of data in a semi-automated manner. We believe that our conceptually simple technique should be of interest for a broader range of single-molecule studies, well beyond the specific example of lambda-DNA shown here.

Single DNA molecule detection using nanopipettes and nanoparticles.

PubMed

Karhanek, Miloslav; Kemp, Jennifer T; Pourmand, Nader; Davis, Ronald W; Webb, Chris D

2005-02-01

Single DNA molecules labeled with nanoparticles can be detected by blockades of ionic current as they are translocated through a nanopipette tip formed by a pulled glass capillary. The nanopipette detection technique can provide not only tools for detection and identification of single DNA and protein molecules but also deeper insight and understanding of stochastic interactions of various biomolecules with their environment.

Second-generation DNA-templated macrocycle libraries for the discovery of bioactive small molecules.

PubMed

Usanov, Dmitry L; Chan, Alix I; Maianti, Juan Pablo; Liu, David R

2018-07-01

DNA-encoded libraries have emerged as a widely used resource for the discovery of bioactive small molecules, and offer substantial advantages compared with conventional small-molecule libraries. Here, we have developed and streamlined multiple fundamental aspects of DNA-encoded and DNA-templated library synthesis methodology, including computational identification and experimental validation of a 20 × 20 × 20 × 80 set of orthogonal codons, chemical and computational tools for enhancing the structural diversity and drug-likeness of library members, a highly efficient polymerase-mediated template library assembly strategy, and library isolation and purification methods. We have integrated these improved methods to produce a second-generation DNA-templated library of 256,000 small-molecule macrocycles with improved drug-like physical properties. In vitro selection of this library for insulin-degrading enzyme affinity resulted in novel insulin-degrading enzyme inhibitors, including one of unusual potency and novel macrocycle stereochemistry (IC 50  = 40 nM). Collectively, these developments enable DNA-templated small-molecule libraries to serve as more powerful, accessible, streamlined and cost-effective tools for bioactive small-molecule discovery.

Method for in vitro recombination

DOEpatents

Gibson, Daniel Glenn; Smith, Hamilton O

2013-05-07

The present invention relates to an in vitro method, using isolated protein reagents, for joining two double-stranded (ds) DNA molecules of interest, wherein the distal region of the first DNA molecule and the proximal region of the second DNA molecule share a region of sequence identity. The method allows the joining of a number of DNA fragments, in a predetermined order and orientation, without the use of restriction enzymes. It can be used, e.g., to join synthetically produced sub-fragments of a gene or genome of interest.

Preliminary morphological and X-ray diffraction studies of the crystals of the DNA cetyltrimethylammonium salt.

PubMed

Osica, V D; Pyatigorskaya, T L; Polyvtsev, O F; Dembo, A T; Kliya, M O; Vasilchenko, V N; Verkin, B I; Sukharevskya, B Y

1977-04-01

Double-stranded DNA molecules (molecular weight 2.5 X 10(5) - 5 X 10(5) daltons) have been crystallized from water-salt solutions as cetyltrimethylammonium salts (CTA-DNA). Variation of crystallization conditions results in a production of different types of CTA-DNA crystals: spherulits, dendrites, needle-shaped and faceted rhombic crystals, the latter beeing up to 0.3 mm on a side. X-ray diffraction data indicate that DNA molecules in the crystals form a hexagonal lattice which parameters vary slightly with the morphological type of the crystal. Comparison of the melting curves of the DNA preparation before and after crystallization suggests that DNA molecules are partially fractionated in the course of crystallization. Crystals of the CTA-DNA-proflavine complex have also been obtained.

Preliminary morphological and X-ray diffraction studies of the crystals of the DNA cetyltrimethylammonium salt.

PubMed Central

Osica, V D; Pyatigorskaya, T L; Polyvtsev, O F; Dembo, A T; Kliya, M O; Vasilchenko, V N; Verkin, B I; Sukharevskya, B Y

1977-01-01

Double-stranded DNA molecules (molecular weight 2.5 X 10(5) - 5 X 10(5) daltons) have been crystallized from water-salt solutions as cetyltrimethylammonium salts (CTA-DNA). Variation of crystallization conditions results in a production of different types of CTA-DNA crystals: spherulits, dendrites, needle-shaped and faceted rhombic crystals, the latter beeing up to 0.3 mm on a side. X-ray diffraction data indicate that DNA molecules in the crystals form a hexagonal lattice which parameters vary slightly with the morphological type of the crystal. Comparison of the melting curves of the DNA preparation before and after crystallization suggests that DNA molecules are partially fractionated in the course of crystallization. Crystals of the CTA-DNA-proflavine complex have also been obtained. Images PMID:866188

How to read and write mechanical information in DNA molecules

NASA Astrophysics Data System (ADS)

Schiessel, Helmut

In this talk I will show that DNA molecules contain another layer of information on top of the classical genetic information. This different type of information is of mechanical nature and guides the folding of DNA molecules inside cells. With the help of a new Monte Carlo technique, the Mutation Monte Carlo method, we demonstrate that the two layers of information can be multiplexed (as one can have two phone conversations on the same wire). For instance, we can guide on top of genes with single base-pair precision the packaging of DNA into nucleosomes. Finally, we study the mechanical properties of DNA molecules belonging to organisms all across the tree of life. From this we learn that in multicellular organisms the stiffness of DNA around transcription start sites differs dramatically from that of unicellular life. The reason for this difference is surprising.

Spontaneous Transport of Single-Stranded DNA through Graphene-MoS2 Heterostructure Nanopores.

PubMed

Luan, Binquan; Zhou, Ruhong

2018-04-24

The effective transport of a single-stranded DNA (ssDNA) molecule through a solid-state nanopore is essential to the future success of high-throughput and low-cost DNA sequencing. Compatible with current electric sensing technologies, here, we propose and demonstrate by molecular dynamics simulations the ssDNA transport through a quasi-two-dimensional nanopore in a heterostructure stacked together with different 2D materials, such as graphene and molybdenum disulfide (MoS 2 ). Due to different chemical potentials, U, of DNA bases on different 2D materials, it is energetically favorable for a ssDNA molecule to move from the low- U MoS 2 surface to the high- U graphene surface through a nanopore. With the proper attraction between the negatively charged phosphate group in each nucleotide and the positively charged Mo atoms exposed on the pore surface, the ssDNA molecule can be temporarily seized and released thereafter through a thermal activation, that is, a slow and possible nucleotide-by-nucleotide transport. A theoretical formulation is then developed for the free energy of the ssDNA transiting a heterostructure nanopore to properly characterize the non-equilibrium stick-slip-like motion of a ssDNA molecule.

Heterologous mitochondrial DNA recombination in human cells.

PubMed

D'Aurelio, Marilena; Gajewski, Carl D; Lin, Michael T; Mauck, William M; Shao, Leon Z; Lenaz, Giorgio; Moraes, Carlos T; Manfredi, Giovanni

2004-12-15

Inter-molecular heterologous mitochondrial DNA (mtDNA) recombination is known to occur in yeast and plants. Nevertheless, its occurrence in human cells is still controversial. To address this issue we have fused two human cytoplasmic hybrid cell lines, each containing a distinct pathogenic mtDNA mutation and specific sets of genetic markers. In this hybrid model, we found direct evidence of recombination between these two mtDNA haplotypes. Recombinant mtDNA molecules in the hybrid cells were identified using three independent experimental approaches. First, recombinant molecules containing genetic markers from both parental alleles were demonstrated with restriction fragment length polymorphism of polymerase chain reaction products, by measuring the relative frequencies of each marker. Second, fragments of recombinant mtDNA were cloned and sequenced to identify the regions involved in the recombination events. Finally, recombinant molecules were demonstrated directly by Southern blot using appropriate combinations of polymorphic restriction sites and probes. This combined approach confirmed the existence of heterogeneous species of recombinant mtDNA molecules in the hybrid cells. These findings have important implications for mtDNA-related diseases, the interpretation of human evolution and population genetics and forensic analyses based on mtDNA genotyping.

Single Molecule Study of Metalloregulatory Protein-DNA Interactions

NASA Astrophysics Data System (ADS)

Sarkar, Susanta; Benitez, Jaime; Huang, Zhengxi; Wang, Qi; Chen, Peng

2007-03-01

Control of metal concentrations is essential for living body. Metalloregulatory proteins respond to metal concentrations by regulating transcriptions of metal resistance genes via protein-DNA interactions. It is thus necessary to understand interactions of metalloregulatory proteins with DNA. Ensemble measurements provide average behavior of a vast number of biomolecules. In contrast, single molecule spectroscopy can track single molecules individually and elucidate dynamics of processes of short time scales and intermediate structures not revealed by ensemble measurements. Here we present single molecule study of interactions between PbrR691, a MerR-family metalloregulatory protein and DNA. We presume that the dynamics of protein/DNA conformational changes and interactions are important for the transcription regulation and kinetics of these dynamic processes can provide useful information about the mechanisms of these metalloregulatory proteins.

Synthetic-Molecule/Protein Hybrid Probe with Fluorogenic Switch for Live-Cell Imaging of DNA Methylation.

PubMed

Hori, Yuichiro; Otomura, Norimichi; Nishida, Ayuko; Nishiura, Miyako; Umeno, Maho; Suetake, Isao; Kikuchi, Kazuya

2018-02-07

Hybrid probes consisting of synthetic molecules and proteins are powerful tools for detecting biological molecules and signals in living cells. To date, most targets of the hybrid probes have been limited to pH and small analytes. Although biomacromolecules are essential to the physiological function of cells, the hybrid-probe-based approach has been scarcely employed for live-cell detection of biomacromolecules. Here, we developed a hybrid probe with a chemical switch for live-cell imaging of methylated DNA, an important macromolecule in the repression of gene expression. Using a protein labeling technique, we created a hybrid probe containing a DNA-binding fluorogen and a methylated-DNA-binding domain. The hybrid probe enhanced fluorescence intensity upon binding to methylated DNA and successfully monitored methylated DNA during mitosis. The hybrid probe offers notable advantages absent from probes based on small molecules or fluorescent proteins and is useful for live-cell analyses of epigenetic phenomena and diseases related to DNA methylation.

Synthesis of surface-anchored DNA-polymer bioconjugates using reversible addition-fragmentation chain transfer polymerization.

PubMed

He, Peng; He, Lin

2009-07-13

We report here an approach to grafting DNA-polymer bioconjugates on a planar solid support using reversible addition-fragmentation chain transfer (RAFT) polymerization. In particular, a trithiocarbonate compound as the RAFT chain transfer agent (CTA) is attached to the distal point of a surface-immobilized oligonucleotide. Initiation of RAFT polymerization leads to controlled growth of polymers atop DNA molecules on the surface. Growth kinetics of poly(monomethoxy-capped oligo(ethylene glycol) methacrylate) atop DNA molecules is investigated by monitoring the change of polymer film thickness as a function of reaction time. The reaction conditions, including the polymerization temperature, the initiator concentration, the CTA surface density, and the selection of monomers, are varied to examine their impacts on the grafting efficiency of DNA-polymer conjugates. Comparing to polymer growth atop small molecules, the experimental results suggest that DNA molecules significantly accelerate polymer growth, which is speculated as a result of the presence of highly charged DNA backbones and purine/pyrimidine moieties surrounding the reaction sites.

Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.

PubMed

Gahlon, Hailey L; Romano, Louis J; Rueda, David

2017-11-20

Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.

Small Molecule Protection of Bone Marrow Hematopoietic Stem Cells

DTIC Science & Technology

2015-10-01

several recently identified small molecules can protect hematopoietic stem cells (HSCs) from damage or killing by endogenous aldehydes . Proof-of-concept...anemia bone marrow failure CD34+ hematopoietic stem cells aldehydes formaldehyde DNA damage DNA base adduct DNA-protein crosslink mass...below. Revised Specific Aim 1: Small molecule protection of human cells from aldehyde - induced killing (in vitro studies - no mice or human subjects

C60 fullerene binding to DNA

NASA Astrophysics Data System (ADS)

Alshehri, Mansoor H.; Cox, Barry J.; Hill, James M.

2014-09-01

Fullerenes have attracted considerable attention in various areas of science and technology. Owing to their exceptional physical, chemical, and biological properties, they have many applications, particularly in cosmetic and medical products. Using the Lennard-Jones 6-12 potential function and the continuum approximation, which assumes that intermolecular interactions can be approximated by average atomic surface densities, we determine the binding energies of a C60 fullerene with respect to both single-strand and double-strand DNA molecules. We assume that all configurations are in a vacuum and that the C60 fullerene is initially at rest. Double integrals are performed to determine the interaction energy of the system. We find that the C60 fullerene binds to the double-strand DNA molecule, at either the major or minor grooves, with binding energies of -4.7 eV or -2.3 eV, respectively, and that the C60 molecule binds to the single-strand DNA molecule with a binding energy of -1.6 eV. Our results suggest that the C60 molecule is most likely to be linked to the major groove of the dsDNA molecule.

DNA hybridization detection on electrical microarrays using coulostatic pulse technique.

PubMed

Dharuman, V; Nebling, E; Grunwald, T; Albers, J; Blohm, L; Elsholz, B; Wörl, R; Hintsche, R

2006-12-15

We demonstrated a novel application of transient coulostatic pulse technique for the detection of label free DNA hybridization on nm-sized gold interdigitated ultramicroelectrode arrays (Au-IDA) made in silicon technology. The array consists of eight different positions with an Au-IDA pair at each position arranged on the Si-based Biochip. Immobilization of capture probes onto the Au-IDA was accomplished by self-assembling of thiol-modified oligonucleotides. Target hybridization was indicated by a change in the magnitude of the time dependant potential relaxation curve in presence of electroactive Fe(CN)(6)(3-) in the phosphate buffer solution. While complementary DNA hybridization showed 50% increase in the relaxation potential, the non-complementary DNA showed a negligible change. A constant behaviour was noted for all positions. The dsDNA specific intercalating molecule, methylene blue, was found to be enhancing the discrimination effect. The changes in the relaxation potential curves were further corroborated following the ELISA like experiments using ExtraAvidine alkaline phosphatase labelling and redox recycling of para-aminophenol phosphate at IDAs. The coulostatic pulse technique was shown to be useful for identifying DNA sequences from brain tumour gene CK20, human herpes simplex virus, cytomegalovirus, Epstein-Barr virus and M13 phage. Compared to the hybridization of short chain ONTs (27 mers), the hybridization of long chain M13 phage DNA showed three times higher increase in the relaxation curves. The method is fast enough to monitor hybridization interactions in milli or microsecond time scales and is well suitable for miniaturization and integration compared to the common impedance techniques for developing capacitative DNA sensors.

DNA-length-dependent quenching of fluorescently labeled iron oxide nanoparticles with gold, graphene oxide and MoS2 nanostructures.

PubMed

Balcioglu, Mustafa; Rana, Muhit; Robertson, Neil; Yigit, Mehmet V

2014-08-13

We controlled the fluorescence emission of a fluorescently labeled iron oxide nanoparticle using three different nanomaterials with ultraefficient quenching capabilities. The control over the fluorescence emission was investigated via spacing introduced by the surface-functionalized single-stranded DNA molecules. DNA molecules were conjugated on different templates, either on the surface of the fluorescently labeled iron oxide nanoparticles or gold and nanographene oxide. The efficiency of the quenching was determined and compared with various fluorescently labeled iron oxide nanoparticle and nanoquencher combinations using DNA molecules with three different lengths. We have found that the template for DNA conjugation plays significant role on quenching the fluorescence emission of the fluorescently labeled iron oxide nanoparticles. We have observed that the size of the DNA controls the quenching efficiency when conjugated only on the fluorescently labeled iron oxide nanoparticles by setting a spacer between the surfaces and resulting change in the hydrodynamic size. The quenching efficiency with 12mer, 23mer and 36mer oligonucleotides decreased to 56%, 54% and 53% with gold nanoparticles, 58%, 38% and 32% with nanographene oxide, 46%, 38% and 35% with MoS2, respectively. On the other hand, the presence, not the size, of the DNA molecules on the other surfaces quenched the fluorescence significantly with different degrees. To understand the effect of the mobility of the DNA molecules on the nanoparticle surface, DNA molecules were attached to the surface with two different approaches. Covalently immobilized oligonucleotides decreased the quenching efficiency of nanographene oxide and gold nanoparticles to ∼22% and ∼21%, respectively, whereas noncovalently adsorbed oligonucleotides decreased it to ∼25% and ∼55%, respectively. As a result, we have found that each nanoquencher has a powerful quenching capability against a fluorescent nanoparticle, which can be tuned with surface functionalized DNA molecules.

Promoter binding, initiation, and elongation by bacteriophage T7 RNA polymerase. A single-molecule view of the transcription cycle.

PubMed

Skinner, Gary M; Baumann, Christoph G; Quinn, Diana M; Molloy, Justin E; Hoggett, James G

2004-01-30

A single-molecule transcription assay has been developed that allows, for the first time, the direct observation of promoter binding, initiation, and elongation by a single RNA polymerase (RNAP) molecule in real-time. To promote DNA binding and transcription initiation, a DNA molecule tethered between two optically trapped beads was held near a third immobile surface bead sparsely coated with RNAP. By driving the optical trap holding the upstream bead with a triangular oscillation while measuring the position of both trapped beads, we observed the onset of promoter binding, promoter escape (productive initiation), and processive elongation by individual RNAP molecules. After DNA template release, transcription re-initiation on the same DNA template is possible; thus, multiple enzymatic turnovers by an individual RNAP molecule can be observed. Using bacteriophage T7 RNAP, a commonly used RNAP paradigm, we observed the association and dissociation (k(off)= 2.9 s(-1)) of T7 RNAP and promoter DNA, the transition to the elongation mode (k(for) = 0.36 s(-1)), and the processive synthesis (k(pol) = 43 nt s(-1)) and release of a gene-length RNA transcript ( approximately 1200 nt). The transition from initiation to elongation is much longer than the mean lifetime of the binary T7 RNAP-promoter DNA complex (k(off) > k(for)), identifying a rate-limiting step between promoter DNA binding and promoter escape.

Double-strand breaks in genome-sized DNA caused by mechanical stress under mixing: Quantitative evaluation through single-molecule observation

NASA Astrophysics Data System (ADS)

Kikuchi, Hayato; Nose, Keiji; Yoshikawa, Yuko; Yoshikawa, Kenichi

2018-06-01

It is becoming increasingly apparent that changes in the higher-order structure of genome-sized DNA molecules of more than several tens kbp play important roles in the self-control of genome activity in living cells. Unfortunately, it has been rather difficult to prepare genome-sized DNA molecules without damage or fragmentation. Here, we evaluated the degree of double-strand breaks (DSBs) caused by mechanical mixing by single-molecule observation with fluorescence microscopy. The results show that DNA breaks are most significant for the first second after the initiation of mechanical agitation. Based on such observation, we propose a novel mixing procedure to significantly decrease DSBs.

[Synthesis of Circular DNA Templates with T4 RNA Ligase for Rolling Circle Amplification].

PubMed

Sakhabutdinova, A R; Maksimova, M A; Garafutdinov, R R

2017-01-01

Currently, isothermal methods of nucleic acid amplification have been well established; in particular, rolling circle amplification is of great interest. In this approach, circular ssDNA molecules have been used as a target that can be obtained by the intramolecular template-dependent ligation of an oligonucleotide C-probe. Here, a new method of synthesizing small circular DNA molecules via the cyclization of ssDNA based on T4 RNA ligase has been proposed. Circular ssDNA is further used as the template for the rolling circle amplification. The maximum yield of the cyclization products was observed in the presence of 5-10% polyethylene glycol 4000, and the optimum DNA length for the cyclization constituted 50 nucleotides. This highly sensitive method was shown to detect less than 10^(2) circular DNA molecules. The method reliability was proved based on artificially destroyed dsDNA, which suggests its implementation for analyzing any significantly fragmented dsDNA.

Microarray Detection of Duplex and Triplex DNA Binders with DNA-Modified Gold Nanoparticles

PubMed Central

Lytton-Jean, Abigail K. R.; Han, Min Su; Mirkin, Chad A.

2008-01-01

We have designed a chip-based assay, using microarray technology, for determining the relative binding affinities of duplex and triplex DNA binders. This assay combines the high discrimination capabilities afforded by DNA-modified Au nanoparticles with the high-throughput capabilities of DNA microarrays. The detection and screening of duplex DNA binders are important because these molecules, in many cases, are potential anticancer agents as well as toxins. Triplex DNA binders are also promising drug candidates. These molecules, in conjunction with triplex forming oligonucleotides, could potentially be used to achieve control of gene expression by interfering with transcription factors that bind to DNA. Therefore, the ability to screen for these molecules in a high-throughput fashion could dramatically improve the drug screening process. The assay reported here provides excellent discrimination between strong, intermediate, and weak duplex and triplex DNA binders in a high-throughput fashion. PMID:17614366

Single helically folded aromatic oligoamides that mimic the charge surface of double-stranded B-DNA

NASA Astrophysics Data System (ADS)

Ziach, Krzysztof; Chollet, Céline; Parissi, Vincent; Prabhakaran, Panchami; Marchivie, Mathieu; Corvaglia, Valentina; Bose, Partha Pratim; Laxmi-Reddy, Katta; Godde, Frédéric; Schmitter, Jean-Marie; Chaignepain, Stéphane; Pourquier, Philippe; Huc, Ivan

2018-05-01

Numerous essential biomolecular processes require the recognition of DNA surface features by proteins. Molecules mimicking these features could potentially act as decoys and interfere with pharmacologically or therapeutically relevant protein-DNA interactions. Although naturally occurring DNA-mimicking proteins have been described, synthetic tunable molecules that mimic the charge surface of double-stranded DNA are not known. Here, we report the design, synthesis and structural characterization of aromatic oligoamides that fold into single helical conformations and display a double helical array of negatively charged residues in positions that match the phosphate moieties in B-DNA. These molecules were able to inhibit several enzymes possessing non-sequence-selective DNA-binding properties, including topoisomerase 1 and HIV-1 integrase, presumably through specific foldamer-protein interactions, whereas sequence-selective enzymes were not inhibited. Such modular and synthetically accessible DNA mimics provide a versatile platform to design novel inhibitors of protein-DNA interactions.

Nanomaterials Based on DNA

PubMed Central

Seeman, Nadrian C.

2012-01-01

The combination of synthetic stable branched DNA and sticky ended cohesion has led to the development of structural DNA nanotechnology over the past 30 years. The basis of this enterprise is that it is possible to construct novel DNA-based materials by combining these features in a self-assembly protocol. Thus, simple branched molecules lead directly to the construction of polyhedra whose edges consist of double helical DNA, and whose vertices correspond to the branch points. Stiffer branched motifs can be used to produce self-assembled two-dimensional and three-dimensional periodic lattices of DNA (crystals). DNA has also been used to make a variety of nanomechanical devices, including molecules that change their shapes, and molecules that can walk along a DNA sidewalk. Devices have been incorporated into two-dimensional DNA arrangements; sequence-dependent devices are driven by increases in nucleotide pairing at each step in their machine cycles. PMID:20222824

Mechanisms of small molecule–DNA interactions probed by single-molecule force spectroscopy

PubMed Central

Almaqwashi, Ali A.; Paramanathan, Thayaparan; Rouzina, Ioulia; Williams, Mark C.

2016-01-01

There is a wide range of applications for non-covalent DNA binding ligands, and optimization of such interactions requires detailed understanding of the binding mechanisms. One important class of these ligands is that of intercalators, which bind DNA by inserting aromatic moieties between adjacent DNA base pairs. Characterizing the dynamic and equilibrium aspects of DNA-intercalator complex assembly may allow optimization of DNA binding for specific functions. Single-molecule force spectroscopy studies have recently revealed new details about the molecular mechanisms governing DNA intercalation. These studies can provide the binding kinetics and affinity as well as determining the magnitude of the double helix structural deformations during the dynamic assembly of DNA–ligand complexes. These results may in turn guide the rational design of intercalators synthesized for DNA-targeted drugs, optical probes, or integrated biological self-assembly processes. Herein, we survey the progress in experimental methods as well as the corresponding analysis framework for understanding single molecule DNA binding mechanisms. We discuss briefly minor and major groove binding ligands, and then focus on intercalators, which have been probed extensively with these methods. Conventional mono-intercalators and bis-intercalators are discussed, followed by unconventional DNA intercalation. We then consider the prospects for using these methods in optimizing conventional and unconventional DNA-intercalating small molecules. PMID:27085806

Enzymatic DNA molecules

NASA Technical Reports Server (NTRS)

Joyce, Gerald F. (Inventor); Breaker, Ronald R. (Inventor)

1998-01-01

The present invention discloses deoxyribonucleic acid enzymes--catalytic or enzymatic DNA molecules--capable of cleaving nucleic acid sequences or molecules, particularly RNA, in a site-specific manner, as well as compositions including same. Methods of making and using the disclosed enzymes and compositions are also disclosed.

Preparation and self-folding of amphiphilic DNA origami.

PubMed

Zhou, Chao; Wang, Dianming; Dong, Yuanchen; Xin, Ling; Sun, Yawei; Yang, Zhongqiang; Liu, Dongsheng

2015-03-01

Amphiphilic DNA origami is prepared by dressing multiple hydrophobic molecules on a rectangular single layer DNA origami, which is then folded or coupled in sandwich-like structures with two outer DNA origami layer and one inner hydrophobic molecules layer. The preference to form different kinds of structures could be tailored by rational design of DNA origami. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

End labeling procedures: an overview.

PubMed

Hilario, Elena

2004-09-01

There are two ways to label a DNA molecular; by the ends or all along the molecule. End labeling can be performed at the 3'- or 5'-end. Labeling at the 3' end is performed by filling 3'-end recessed ends with a mixture or labeled and unlabeled dNTPs using Klenow or T4 DNA polymerases. Both reactions are template dependent. Terminal deoxynucleotide transferase incorporates dNTPs at the 3' end of any kind of DNA molecule or RNA. Labels incorporated at the 3'-end of the DNA molecule prevent any further extension or ligation to any other molecule, but this can be overcome by labeling the 5'-end of the desired DNA molecule. 5'-end labeling is performed by enzymatic methods (T4 polynucleotide kinase exchange and forward reactions), by chemical modification of sensitized oligonucleotides with phosphoroamidite, or by combined methods. Probe cleanup is recommended when high background problems occur, but caution should be taken not to damage the attached probe with harsh chemicals or by light exposure.

Elongated unique DNA strand deposition on microstructured substrate by receding meniscus assembly and capillary force

PubMed Central

Charlot, B.; Bardin, F.; Sanchez, N.; Roux, P.; Teixeira, S.; Schwob, E.

2014-01-01

Ordered deposition of elongated DNA molecules was achieved by the forced dewetting of a DNA solution droplet over a microstructured substrate. This technique allows trapping, uncoiling, and deposition of DNA fragments without the need of a physicochemical anchoring of the molecule and results in the combing of double stranded DNA from the edge of microwells on a polydimethylsiloxane (PDMS) substrate. The technique involves scanning a droplet of DNA solution caught between a movable blade and a PDMS substrate containing an array of microwells. The deposition and elongation appears when the receding meniscus dewets microwells, the latter acting here as a perturbation in the dewetting line forcing the water film to break locally. Thus, DNA molecules can be deposited in an ordered manner and elongated conformation based solely on a physical phenomenon, allowing uncoiled DNA molecules to be observed in all their length. However, the exact mechanism that governs the deposition of DNA strands is not well understood. This paper is an analysis of the physical phenomenon occurring in the deposition process and is based on observations made with the use of high frame/second rate video microscopy. PMID:24753724

Discriminating Intercalative Effects of Threading Intercalator Nogalamycin, from Classical Intercalator Daunomycin, Using Single Molecule Atomic Force Spectroscopy.

PubMed

Banerjee, T; Banerjee, S; Sett, S; Ghosh, S; Rakshit, T; Mukhopadhyay, R

2016-01-01

DNA threading intercalators are a unique class of intercalating agents, albeit little biophysical information is available on their intercalative actions. Herein, the intercalative effects of nogalamycin, which is a naturally-occurring DNA threading intercalator, have been investigated by high-resolution atomic force microscopy (AFM) and spectroscopy (AFS). The results have been compared with those of the well-known chemotherapeutic drug daunomycin, which is a non-threading classical intercalator bearing structural similarity to nogalamycin. A comparative AFM assessment revealed a greater increase in DNA contour length over the entire incubation period of 48 h for nogalamycin treatment, whereas the contour length increase manifested faster in case of daunomycin. The elastic response of single DNA molecules to an externally applied force was investigated by the single molecule AFS approach. Characteristic mechanical fingerprints in the overstretching behaviour clearly distinguished the nogalamycin/daunomycin-treated dsDNA from untreated dsDNA-the former appearing less elastic than the latter, and the nogalamycin-treated DNA distinguished from the daunomycin-treated DNA-the classically intercalated dsDNA appearing the least elastic. A single molecule AFS-based discrimination of threading intercalation from the classical type is being reported for the first time.

3D DNA Crystals and Nanotechnology

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paukstelis, Paul; Seeman, Nadrian

DNA's molecular recognition properties have made it one of the most widely used biomacromolecular construction materials. The programmed assembly of DNA oligonucleotides has been used to create complex 2D and 3D self-assembled architectures and to guide the assembly of other molecules. The origins of DNA nanotechnology are rooted in the goal of assembling DNA molecules into designed periodic arrays, i.e., crystals. Here, we highlight several DNA crystal structures, the progress made in designing DNA crystals, and look at the current prospects and future directions of DNA crystals in nanotechnology.

3D DNA Crystals and Nanotechnology

DOE PAGES

Paukstelis, Paul; Seeman, Nadrian

2016-08-18

DNA's molecular recognition properties have made it one of the most widely used biomacromolecular construction materials. The programmed assembly of DNA oligonucleotides has been used to create complex 2D and 3D self-assembled architectures and to guide the assembly of other molecules. The origins of DNA nanotechnology are rooted in the goal of assembling DNA molecules into designed periodic arrays, i.e., crystals. Here, we highlight several DNA crystal structures, the progress made in designing DNA crystals, and look at the current prospects and future directions of DNA crystals in nanotechnology.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maaloum, M.; Muller, P.; Beker, A-F.

Almost two decades ago, measurements of force versus extension on isolated double-stranded DNA molecules revealed a force plateau. This unusual stretching phenomenon in DNA suggests that the long molecules may be extended from the usual B form into a new conformation. Different models have been proposed to describe the nature of DNA in its stretched form, S-DNA. Using atomic force microscopy combined with a molecular combing method, we identified the structure of {lambda}-phage DNA for different stretching values. We provide strong evidence for the existence of a first-order transition between B form and S form. Beyond a certain extension ofmore » the natural length, DNA molecules adopt a new double-helix conformation characterized by a diameter of 1.2 nm and a helical pitch of18 nm.« less

Thermoelectric effect and its dependence on molecular length and sequence in single DNA molecules.

PubMed

Li, Yueqi; Xiang, Limin; Palma, Julio L; Asai, Yoshihiro; Tao, Nongjian

2016-04-15

Studying the thermoelectric effect in DNA is important for unravelling charge transport mechanisms and for developing relevant applications of DNA molecules. Here we report a study of the thermoelectric effect in single DNA molecules. By varying the molecular length and sequence, we tune the charge transport in DNA to either a hopping- or tunnelling-dominated regimes. The thermoelectric effect is small and insensitive to the molecular length in the hopping regime. In contrast, the thermoelectric effect is large and sensitive to the length in the tunnelling regime. These findings indicate that one may control the thermoelectric effect in DNA by varying its sequence and length. We describe the experimental results in terms of hopping and tunnelling charge transport models.

Thermoelectric effect and its dependence on molecular length and sequence in single DNA molecules

PubMed Central

Li, Yueqi; Xiang, Limin; Palma, Julio L.; Asai, Yoshihiro; Tao, Nongjian

2016-01-01

Studying the thermoelectric effect in DNA is important for unravelling charge transport mechanisms and for developing relevant applications of DNA molecules. Here we report a study of the thermoelectric effect in single DNA molecules. By varying the molecular length and sequence, we tune the charge transport in DNA to either a hopping- or tunnelling-dominated regimes. The thermoelectric effect is small and insensitive to the molecular length in the hopping regime. In contrast, the thermoelectric effect is large and sensitive to the length in the tunnelling regime. These findings indicate that one may control the thermoelectric effect in DNA by varying its sequence and length. We describe the experimental results in terms of hopping and tunnelling charge transport models. PMID:27079152

Recycling of protein subunits during DNA translocation and cleavage by Type I restriction-modification enzymes

PubMed Central

Simons, Michelle; Szczelkun, Mark D.

2011-01-01

The Type I restriction-modification enzymes comprise three protein subunits; HsdS and HsdM that form a methyltransferase (MTase) and HsdR that associates with the MTase and catalyses Adenosine-5′-triphosphate (ATP)-dependent DNA translocation and cleavage. Here, we examine whether the MTase and HsdR components can ‘turnover’ in vitro, i.e. whether they can catalyse translocation and cleavage events on one DNA molecule, dissociate and then re-bind a second DNA molecule. Translocation termination by both EcoKI and EcoR124I leads to HsdR dissociation from linear DNA but not from circular DNA. Following DNA cleavage, the HsdR subunits appear unable to dissociate even though the DNA is linear, suggesting a tight interaction with the cleaved product. The MTases of EcoKI and EcoAI can dissociate from DNA following either translocation or cleavage and can initiate reactions on new DNA molecules as long as free HsdR molecules are available. In contrast, the MTase of EcoR124I does not turnover and additional cleavage of circular DNA is not observed by inclusion of RecBCD, a helicase–nuclease that degrades the linear DNA product resulting from Type I cleavage. Roles for Type I restriction endonuclease subunit dynamics in restriction alleviation in the cell are discussed. PMID:21712244

Multiplexed Sequence Encoding: A Framework for DNA Communication.

PubMed

Zakeri, Bijan; Carr, Peter A; Lu, Timothy K

2016-01-01

Synthetic DNA has great propensity for efficiently and stably storing non-biological information. With DNA writing and reading technologies rapidly advancing, new applications for synthetic DNA are emerging in data storage and communication. Traditionally, DNA communication has focused on the encoding and transfer of complete sets of information. Here, we explore the use of DNA for the communication of short messages that are fragmented across multiple distinct DNA molecules. We identified three pivotal points in a communication-data encoding, data transfer & data extraction-and developed novel tools to enable communication via molecules of DNA. To address data encoding, we designed DNA-based individualized keyboards (iKeys) to convert plaintext into DNA, while reducing the occurrence of DNA homopolymers to improve synthesis and sequencing processes. To address data transfer, we implemented a secret-sharing system-Multiplexed Sequence Encoding (MuSE)-that conceals messages between multiple distinct DNA molecules, requiring a combination key to reveal messages. To address data extraction, we achieved the first instance of chromatogram patterning through multiplexed sequencing, thereby enabling a new method for data extraction. We envision these approaches will enable more widespread communication of information via DNA.

Development of a simulation method for dynamics of electrons ejected from DNA molecules irradiated with X-rays.

PubMed

Kai, Takeshi; Higuchi, Mariko; Fujii, Kentaro; Watanabe, Ritsuko; Yokoya, Akinari

2012-12-01

To develop a method for simulating the dynamics of the photoelectrons and Auger electrons ejected from DNA molecules irradiated with pulsed monochromatic X-rays. A 30-base-pair (bp) DNA molecule was used as the target model, and the X-rays were assumed to have a Gaussian-shaped time distribution. Photoionization and Auger decay were considered as the atomic processes. The atoms from which the photoelectrons or Auger electrons were emitted were specified in the DNA molecule (or DNA ion) using the Monte Carlo method, and the trajectory of each electron in the electric field formed around the positively charged DNA molecule was calculated with a Newtonian equation. The kinetics of the electrons produced by irradiation with X-rays at an intensity ranging from 1 × 10(12) to 1 × 10(16) photons/mm(2) and energies of 380 eV (below the carbon K-edge), 435 eV (above the nitrogen K-edge), and 560 eV (above the oxygen K-edge) were evaluated. It was found that at an X-ray intensity of 1 × 10(14) photons/mm(2) or less, all the produced electrons escaped from the target. However, above an X-ray intensity of 1 × 10(15) photons/mm(2) and an energy of 560 eV, some photoelectrons that were ejected from the oxygen atoms were trapped near the target DNA. A simulation method for studying the trajectories of electrons ejected from a 30-bp DNA molecule irradiated with pulsed monochromatic X-rays has been developed. The present results show that electron dynamics are strongly dependent on the charged density induced in DNA by pulsed X-ray irradiation.

Supercoiled circular DNA of an insect granulosis virus

PubMed Central

Tweeten, Kathleen A.; Bulla, Lee A.; Consigli, Richard A.

1977-01-01

The DNA of the granulosis virus of the Indian meal moth, Plodia interpunctella, was characterized by physical chemical and electron microscopic techniques. Twenty-five percent of the DNA extracted from purified virus was isolated as supercoiled circular molecules. The remaining 75% consisted of relaxed circular molecules. These molecular forms were indicated by the production of two radioactive bands during sedimentation of 3H-labeled granulosis virus DNA in alkaline sucrose gradients or in equilibrium density gradients of neutral cesium chloride/propidium iodide. Electron microscopic visualization of the DNA that banded at the higher density in the latter gradients revealed supercoiled structures whereas that of DNA that banded at the lower density demonstrated relaxed circular molecules. The superhelical molecules were converted to relaxed circles by treatment with pancreatic DNase. The molecular weight of the viral DNA was calculated to be 81 × 106 by sedimentation in neutral sucrose and 78 × 106 by sedimentation in alkaline sucrose. The molecular weight estimated from length measurements in electron micrographs was 76 × 106. The buoyant density of the granulosis virus DNA was 1.703 g/cm3 and that of its insect host DNA was 1.697 g/cm3. Equilibrium sedimentation in cesium chloride and thermal denaturation indicated G + C contents of 44% and 39% for the viral and host DNA, respectively. Images PMID:198791

Supercoiled circular DNA of an insect granulosis virus.

PubMed

Tweeten, K A; Bulla, L A; Consigli, R A

1977-08-01

The DNA of the granulosis virus of the Indian meal moth, Plodia interpunctella, was characterized by physical chemical and electron microscopic techniques. Twenty-five percent of the DNA extracted from purified virus was isolated as supercoiled circular molecules. The remaining 75% consisted of relaxed circular molecules. These molecular forms were indicated by the production of two radioactive bands during sedimentation of (3)H-labeled granulosis virus DNA in alkaline sucrose gradients or in equilibrium density gradients of neutral cesium chloride/propidium iodide. Electron microscopic visualization of the DNA that banded at the higher density in the latter gradients revealed supercoiled structures whereas that of DNA that banded at the lower density demonstrated relaxed circular molecules. The superhelical molecules were converted to relaxed circles by treatment with pancreatic DNase. The molecular weight of the viral DNA was calculated to be 81 x 10(6) by sedimentation in neutral sucrose and 78 x 10(6) by sedimentation in alkaline sucrose. The molecular weight estimated from length measurements in electron micrographs was 76 x 10(6). The buoyant density of the granulosis virus DNA was 1.703 g/cm(3) and that of its insect host DNA was 1.697 g/cm(3). Equilibrium sedimentation in cesium chloride and thermal denaturation indicated G + C contents of 44% and 39% for the viral and host DNA, respectively.

Mitochondrial genome of the moon jelly Aurelia aurita (Cnidaria, Scyphozoa): A linear DNA molecule encoding a putative DNA-dependent DNA polymerase.

PubMed

Shao, Zhiyong; Graf, Shannon; Chaga, Oleg Y; Lavrov, Dennis V

2006-10-15

The 16,937-nuceotide sequence of the linear mitochondrial DNA (mt-DNA) molecule of the moon jelly Aurelia aurita (Cnidaria, Scyphozoa) - the first mtDNA sequence from the class Scypozoa and the first sequence of a linear mtDNA from Metazoa - has been determined. This sequence contains genes for 13 energy pathway proteins, small and large subunit rRNAs, and methionine and tryptophan tRNAs. In addition, two open reading frames of 324 and 969 base pairs in length have been found. The deduced amino-acid sequence of one of them, ORF969, displays extensive sequence similarity with the polymerase [but not the exonuclease] domain of family B DNA polymerases, and this ORF has been tentatively identified as dnab. This is the first report of dnab in animal mtDNA. The genes in A. aurita mtDNA are arranged in two clusters with opposite transcriptional polarities; transcription proceeding toward the ends of the molecule. The determined sequences at the ends of the molecule are nearly identical but inverted and lack any obvious potential secondary structures or telomere-like repeat elements. The acquisition of mitochondrial genomic data for the second class of Cnidaria allows us to reconstruct characteristic features of mitochondrial evolution in this animal phylum.

Assembling of G-strands into novel tetra-molecular parallel G4-DNA nanostructures using avidin-biotin recognition.

PubMed

Borovok, Natalia; Iram, Natalie; Zikich, Dragoslav; Ghabboun, Jamal; Livshits, Gideon I; Porath, Danny; Kotlyar, Alexander B

2008-09-01

We describe a method for the preparation of novel long (hundreds of nanometers), uniform, inter-molecular G4-DNA molecules composed of four parallel G-strands. The only long continuous G4-DNA reported so far are intra-molecular structures made of a single G-strand. To enable a tetra-molecular assembly of the G-strands we developed a novel approach based on avidin-biotin biological recognition. The steps of the G4-DNA production include: (i) Enzymatic synthesis of long poly(dG)-poly(dC) molecules with biotinylated poly(dG)-strand; (ii) Formation of a complex between avidin-tetramer and four biotinylated poly(dG)-poly(dC) molecules; (iii) Separation of the poly(dC) strands from the poly(dG)-strands, which are connected to the avidin; (iv) Assembly of the four G-strands attached to the avidin into tetra-molecular G4-DNA. The average contour length of the formed structures, as measured by AFM, is equal to that of the initial poly(dG)-poly(dC) molecules, suggesting a tetra-molecular mechanism of the G-strands assembly. The height of tetra-molecular G4-nanostructures is larger than that of mono-molecular G4-DNA molecules having similar contour length. The CD spectra of the tetra- and mono-molecular G4-DNA are markedly different, suggesting different structural organization of these two types of molecules. The tetra-molecular G4-DNA nanostructures showed clear electrical polarizability. This suggests that they may be useful for molecular electronics.

Spectrophotometric study on binding of 2-thioxanthone acetic acid with ct-DNA.

PubMed

Ataci, Nese; Ozcelik, Elif; Arsu, Nergis

2018-06-02

Thioxanthone and its derivatives are the most remarkable molecules due to their vast variety of application such as radiation curing that is, until using them as a therapeutic drug. Therefore, in this study it was intended to use 2-Thioxanthone acetic acid with and without NaCl in Tris HCl buffer solution (pH:7.0) to represent the interaction with ct-DNA. The UV-vis absorption spectra of TXCH 2 COOH in the presence of ct-DNA showed hypochromism and the intrinstic binding constant (K b ) was determined as 6 × 10 3  L mol -1 . The fluoresence intensity of TXCH 2 COOH with ct-DNA clearly increased up to 101% which indicated that the fluorescence intensity was very sensitive to ct-DNA concentration. The binding constant (K) and the values of number of binding sites (n) and were calculated as 1.8 × 10 3  L mol -1 and 0.69, respectively. When the quenching constants (K sv ) of free TXCH 2 COOH and TXCH 2 COOH, which were bonded with ct-DNA were compared, slightly changed values of Ksv were seen. Moreover, displacement assay with Hoechst 33,258 and viscosity measurements in the presence and absence of NaCl salt also confirmed the binding mode which noted the electrostatic interaction following groove binding between TXCH 2 COOH and ct-DNA. Last but not least, the salt effect was examined on ct-DNA binding with TXCH 2 COOH. The results of the experiments indicated that the groove binding was strengthened by NaCl whereas in the high NaCl concentration, the binding ability of TXCH 2 COOH to ct-DNA was inversely affected. Copyright © 2018 Elsevier B.V. All rights reserved.

DNA nanotechnology-enabled biosensors.

PubMed

Chao, Jie; Zhu, Dan; Zhang, Yinan; Wang, Lianhui; Fan, Chunhai

2016-02-15

Biosensors employ biological molecules to recognize the target and utilize output elements which can translate the biorecognition event into electrical, optical or mass-sensitive signals to determine the quantities of the target. DNA-based biosensors, as a sub-field to biosensor, utilize DNA strands with short oligonucleotides as probes for target recognition. Although DNA-based biosensors have offered a promising alternative for fast, simple and cheap detection of target molecules, there still exist key challenges including poor stability and reproducibility that hinder their competition with the current gold standard for DNA assays. By exploiting the self-recognition properties of DNA molecules, researchers have dedicated to make versatile DNA nanostructures in a highly rigid, controllable and functionalized manner, which offers unprecedented opportunities for developing DNA-based biosensors. In this review, we will briefly introduce the recent advances on design and fabrication of static and dynamic DNA nanostructures, and summarize their applications for fabrication and functionalization of DNA-based biosensors. Copyright © 2015 Elsevier B.V. All rights reserved.

Logical NAND and NOR Operations Using Algorithmic Self-assembly of DNA Molecules

NASA Astrophysics Data System (ADS)

Wang, Yanfeng; Cui, Guangzhao; Zhang, Xuncai; Zheng, Yan

DNA self-assembly is the most advanced and versatile system that has been experimentally demonstrated for programmable construction of patterned systems on the molecular scale. It has been demonstrated that the simple binary arithmetic and logical operations can be computed by the process of self assembly of DNA tiles. Here we report a one-dimensional algorithmic self-assembly of DNA triple-crossover molecules that can be used to execute five steps of a logical NAND and NOR operations on a string of binary bits. To achieve this, abstract tiles were translated into DNA tiles based on triple-crossover motifs. Serving as input for the computation, long single stranded DNA molecules were used to nucleate growth of tiles into algorithmic crystals. Our method shows that engineered DNA self-assembly can be treated as a bottom-up design techniques, and can be capable of designing DNA computer organization and architecture.

DNA Motion Capture Reveals the Mechanical Properties of DNA at the Mesoscale

PubMed Central

Price, Allen C.; Pilkiewicz, Kevin R.; Graham, Thomas G.W.; Song, Dan; Eaves, Joel D.; Loparo, Joseph J.

2015-01-01

Single-molecule studies probing the end-to-end extension of long DNAs have established that the mechanical properties of DNA are well described by a wormlike chain force law, a polymer model where persistence length is the only adjustable parameter. We present a DNA motion-capture technique in which DNA molecules are labeled with fluorescent quantum dots at specific sites along the DNA contour and their positions are imaged. Tracking these positions in time allows us to characterize how segments within a long DNA are extended by flow and how fluctuations within the molecule are correlated. Utilizing a linear response theory of small fluctuations, we extract elastic forces for the different, ∼2-μm-long segments along the DNA backbone. We find that the average force-extension behavior of the segments can be well described by a wormlike chain force law with an anomalously small persistence length. PMID:25992731

Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

PubMed Central

Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

2003-01-01

Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

Structure and Environment Influence in DNA Conduction

NASA Technical Reports Server (NTRS)

Adessi, C.; Walch, S.; Anantram, M. P.; Biegel, Bryan A. (Technical Monitor)

2002-01-01

Results for transmission through a poly(G) DNA molecule are presented. We show that a modification of the rise of a B-DNA form can induce a shift of the conduction channel toward the valence one. We clearly prove that deformation of the backbone of the molecule has a significant influence on hole transport. Finally, we observe that the presence of ionic species, such Na, near the molecule can create new conduction channels.

DNA interactions with a Methylene Blue redox indicator depend on the DNA length and are sequence specific.

PubMed

Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E

2010-06-01

A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.

10 CFR 602.10 - Additional requirements.

Code of Federal Regulations, 2010 CFR

2010-01-01

... conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...

10 CFR 605.11 - Additional requirements.

Code of Federal Regulations, 2010 CFR

2010-01-01

... Conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...

10 CFR 605.11 - Additional requirements.

Code of Federal Regulations, 2011 CFR

2011-01-01

... Conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...

10 CFR 602.10 - Additional requirements.

Code of Federal Regulations, 2011 CFR

2011-01-01

... conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...

10 CFR 602.10 - Additional requirements.

Code of Federal Regulations, 2013 CFR

2013-01-01

... conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...

10 CFR 602.10 - Additional requirements.

Code of Federal Regulations, 2012 CFR

2012-01-01

... conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...

10 CFR 605.11 - Additional requirements.

Code of Federal Regulations, 2012 CFR

2012-01-01

... Conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...

10 CFR 602.10 - Additional requirements.

Code of Federal Regulations, 2014 CFR

2014-01-01

... conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...

10 CFR 605.11 - Additional requirements.

Code of Federal Regulations, 2013 CFR

2013-01-01

... Conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...

10 CFR 605.11 - Additional requirements.

Code of Federal Regulations, 2014 CFR

2014-01-01

... Conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...

Imaging and sizing of single DNA molecules on a mobile phone.

PubMed

Wei, Qingshan; Luo, Wei; Chiang, Samuel; Kappel, Tara; Mejia, Crystal; Tseng, Derek; Chan, Raymond Yan Lok; Yan, Eddie; Qi, Hangfei; Shabbir, Faizan; Ozkan, Haydar; Feng, Steve; Ozcan, Aydogan

2014-12-23

DNA imaging techniques using optical microscopy have found numerous applications in biology, chemistry and physics and are based on relatively expensive, bulky and complicated set-ups that limit their use to advanced laboratory settings. Here we demonstrate imaging and length quantification of single molecule DNA strands using a compact, lightweight and cost-effective fluorescence microscope installed on a mobile phone. In addition to an optomechanical attachment that creates a high contrast dark-field imaging setup using an external lens, thin-film interference filters, a miniature dovetail stage and a laser-diode for oblique-angle excitation, we also created a computational framework and a mobile phone application connected to a server back-end for measurement of the lengths of individual DNA molecules that are labeled and stretched using disposable chips. Using this mobile phone platform, we imaged single DNA molecules of various lengths to demonstrate a sizing accuracy of <1 kilobase-pairs (kbp) for 10 kbp and longer DNA samples imaged over a field-of-view of ∼2 mm2.

Genome organization of Tobacco leaf curl Zimbabwe virus, a new, distinct monopartite begomovirus associated with subgenomic defective DNA molecules.

PubMed

Paximadis, M; Rey, M E

2001-12-01

The complete DNA A of the begomovirus Tobacco leaf curl Zimbabwe virus (TbLCZWV) was sequenced: it comprises 2767 nucleotides with six major open reading frames encoding proteins with molecular masses greater than 9 kDa. Full-length TbLCZWV DNA A tandem dimers, cloned in binary vectors (pBin19 and pBI121) and transformed into Agrobacterium tumefaciens, were systemically infectious upon agroinoculation of tobacco and tomato. Efforts to identify a DNA B component were unsuccessful. These findings suggest that TbLCZWV is a new member of the monopartite group of begomoviruses. Phylogenetic analysis identified TbLCZWV as a distinct begomovirus with its closest relative being Chayote mosaic virus. Abutting primer PCR amplified ca. 1300 bp molecules, and cloning and sequencing of two of these molecules revealed them to be subgenomic defective DNA molecules originating from TbLCZWV DNA A. Variable symptom severity associated with tobacco leaf curl disease and TbLCZWV is discussed.

Simple horizontal magnetic tweezers for micromanipulation of single DNA molecules and DNA–protein complexes

PubMed Central

McAndrew, Christopher P.; Tyson, Christopher; Zischkau, Joseph; Mehl, Patrick; Tuma, Pamela L.; Pegg, Ian L.; Sarkar, Abhijit

2016-01-01

We report the development of a simple-to-implement magnetic force transducer that can apply a wide range of piconewton (pN) scale forces on single DNA molecules and DNA–protein complexes in the horizontal plane. The resulting low-noise force-extension data enable very high-resolution detection of changes in the DNA tether’s extension: ~0.05 pN in force and <10 nm change in extension. We have also verified that we can manipulate DNA in near equilibrium conditions through the wide range of forces by ramping the force from low to high and back again, and observing minimal hysteresis in the molecule’s force response. Using a calibration technique based on Stokes’ drag law, we have confirmed our force measurements from DNA force-extension experiments obtained using the fluctuation-dissipation theorem applied to transverse fluctuations of the magnetic microsphere. We present data on the force-distance characteristics of a DNA molecule complexed with histones. The results illustrate how the tweezers can be used to study DNA binding proteins at the single molecule level. PMID:26757808

MobB protein stimulates nicking at the R1162 origin of transfer by increasing the proportion of complexed plasmid DNA.

PubMed Central

Perwez, T; Meyer, R

1996-01-01

An essential early step in conjugal mobilization of R1162, nicking of the DNA strand that is subsequently transferred, is carried out in the relaxosome, a complex of two plasmid-encoded proteins and DNA at the origin of transfer (oriT). A third protein, MobB, is also required for efficient mobilization. We show that in the cell this protein increases the proportion of molecules specifically nicked at oriT, resulting in lower yields of covalently closed molecules after alkaline extraction. These nicked molecules largely remain supercoiled, with unwinding presumably constrained by the relaxosome. MobB enhances the sensitivity of the oriT DNA to oxidation by permanganate, indicating that the protein acts by increasing the fraction of complexed molecules. Mutations that significantly reduce the amount of complexed DNA in the cell were isolated. However, plasmids with these mutations were mobilized at nearly the normal frequency, were nicked at a commensurate level, and still required MobB. Our results indicate that the frequency of transfer is determined both by the amount of time each molecule is in the nicked form and by the proportion of complexed molecules in the total population. PMID:8824623

Sub-Ensemble Monitoring of DNA Strand Displacement Using Multiparameter Single-Molecule FRET.

PubMed

Baltierra-Jasso, Laura E; Morten, Michael J; Magennis, Steven W

2018-03-05

Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here, we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constant of 10 m -1  s -1 . We also followed the displacement from a DNA three-way junction (3WJ) by ssDNA. The presence of three internal mismatched bases in the middle of the invading strand did not prevent displacement from the 3WJ, but reduced the second-order rate constant by about 50 %. We attribute strand exchange in the dsDNA and 3WJ to a zero-toehold pathway from the blunt-ended duplex arms. The single-molecule approach demonstrated here will be useful for studying complex DNA networks. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Illegitimate recombination mediated by calf thymus DNA topoisomerase II in vitro.

PubMed Central

Bae, Y S; Kawasaki, I; Ikeda, H; Liu, L F

1988-01-01

We have found that purified calf thymus DNA topoisomerase II mediates recombination between two phage lambda DNA molecules in an in vitro system. The enzyme mainly produced a linear monomer recombinant DNA that can be packaged in vitro. Novobiocin and anti-calf thymus DNA topoisomerase II antibody inhibit this ATP-dependent recombination. The recombinant molecules contain duplications or deletions, and most crossovers take place between nonhomologous sequences of lambda DNA, as judged by the sequences of recombination junctions. Therefore, the recombination mediated by the calf thymus DNA topoisomerase II is an illegitimate recombination that is similar to recombination mediated by Escherichia coli DNA gyrase or phage T4 DNA topoisomerase. The subunit exchange model, which has been suggested for the DNA gyrase-mediated recombination, is now generalized as follows: DNA topoisomerase II molecules bind to DNAs, associate with each other, and lead to the exchange of DNA strands through the exchange of topoisomerase II subunits. Illegitimate recombination might be carried out by a general mechanism in organisms ranging from prokaryotes to higher eukaryotes. Images PMID:2832845

Microfluidic DNA sample preparation method and device

DOEpatents

Krulevitch, Peter A.; Miles, Robin R.; Wang, Xiao-Bo; Mariella, Raymond P.; Gascoyne, Peter R. C.; Balch, Joseph W.

2002-01-01

Manipulation of DNA molecules in solution has become an essential aspect of genetic analyses used for biomedical assays, the identification of hazardous bacterial agents, and in decoding the human genome. Currently, most of the steps involved in preparing a DNA sample for analysis are performed manually and are time, labor, and equipment intensive. These steps include extraction of the DNA from spores or cells, separation of the DNA from other particles and molecules in the solution (e.g. dust, smoke, cell/spore debris, and proteins), and separation of the DNA itself into strands of specific lengths. Dielectrophoresis (DEP), a phenomenon whereby polarizable particles move in response to a gradient in electric field, can be used to manipulate and separate DNA in an automated fashion, considerably reducing the time and expense involved in DNA analyses, as well as allowing for the miniaturization of DNA analysis instruments. These applications include direct transport of DNA, trapping of DNA to allow for its separation from other particles or molecules in the solution, and the separation of DNA into strands of varying lengths.

Exploring protein-DNA interactions in 3D using in situ construction, manipulation, and visualization of individual DNA-dumbbells with optical traps, microfluidics, and fluorescence microscopy

PubMed Central

Forget, Anthony L.; Dombrowski, Christopher C.; Amitani, Ichiro; Kowalczykowski, Stephen C.

2015-01-01

In this Protocol, we describe a procedure to generate ‘DNA-dumbbells’ — single molecules of DNA with a microscopic bead attached at each end — and techniques for manipulating individual DNA-dumbbells. We also detail the design and fabrication of a microfluidic device (flow cell) used in conjunction with dual optical trapping to manipulate DNA-dumbbells and to visualize individual protein–DNA complexes by single-molecule epifluorescence microscopy. Our design of the flow cell enables the rapid movement of trapped molecules between laminar flow channels and a flow-free ‘reservoir’. The reservoir provides the means to examine formation of DNA–protein complexes in solution in the absence of external flow forces, while still maintaining a predetermined end-to-end extension of the DNA. These features facilitate examination of the role of three-dimensional DNA conformation and dynamics in protein–DNA interactions. Preparation of flow cells and reagents requires two days each; in situ DNA-dumbbell assembly and imaging of single protein–DNA complexes requires another day. PMID:23411634

End-to-end distance and contour length distribution functions of DNA helices

NASA Astrophysics Data System (ADS)

Zoli, Marco

2018-06-01

I present a computational method to evaluate the end-to-end and the contour length distribution functions of short DNA molecules described by a mesoscopic Hamiltonian. The method generates a large statistical ensemble of possible configurations for each dimer in the sequence, selects the global equilibrium twist conformation for the molecule, and determines the average base pair distances along the molecule backbone. Integrating over the base pair radial and angular fluctuations, I derive the room temperature distribution functions as a function of the sequence length. The obtained values for the most probable end-to-end distance and contour length distance, providing a measure of the global molecule size, are used to examine the DNA flexibility at short length scales. It is found that, also in molecules with less than ˜60 base pairs, coiled configurations maintain a large statistical weight and, consistently, the persistence lengths may be much smaller than in kilo-base DNA.

Single-Molecule Denaturation Mapping of DNA in Nanofluidic Channels

NASA Astrophysics Data System (ADS)

Reisner, Walter; Larsen, Niels; Silahtaroglu, Asli; Kristensen, Anders; Tommerup, Niels; Tegenfeldt, Jonas O.; Flyvbjerg, Henrik

2010-03-01

Nanochannel based DNA stretching can serve as a platform for a new optical mapping technique based on measuring the pattern of partial melting along the extended molecules. We partially melt DNA extended in nanofluidic channels via a combination of local heating and added chemical denaturants. The melted molecules, imaged via a standard fluorescence videomicroscopy setup, exhibit a nonuniform fluorescence profile corresponding to a series of local dips and peaks in the intensity trace along the stretched molecule. We show that this barcode is consistent with the presence of locally melted regions along the molecule and can be explained by calculations of sequence-dependent melting probability. Specifically, we obtain experimental melting profiles for T4, T7, lambda-phage and bacterial artificial chromosome DNA (from human chromosome 12) and compare these profiles to theory. In addition, we demonstrate that the BAC melting profile can be used to align the BAC to its correct position on chromosome 12.

Restriction-modification mediated barriers to exogenous DNA uptake and incorporation employed by Prevotella intermedia.

PubMed

Johnston, Christopher D; Skeete, Chelsey A; Fomenkov, Alexey; Roberts, Richard J; Rittling, Susan R

2017-01-01

Prevotella intermedia, a major periodontal pathogen, is increasingly implicated in human respiratory tract and cystic fibrosis lung infections. Nevertheless, the specific mechanisms employed by this pathogen remain only partially characterized and poorly understood, largely due to its total lack of genetic accessibility. Here, using Single Molecule, Real-Time (SMRT) genome and methylome sequencing, bisulfite sequencing, in addition to cloning and restriction analysis, we define the specific genetic barriers to exogenous DNA present in two of the most widespread laboratory strains, P. intermedia ATCC 25611 and P. intermedia Strain 17. We identified and characterized multiple restriction-modification (R-M) systems, some of which are considerably divergent between the two strains. We propose that these R-M systems are the root cause of the P. intermedia transformation barrier. Additionally, we note the presence of conserved Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) systems in both strains, which could provide a further barrier to exogenous DNA uptake and incorporation. This work will provide a valuable resource during the development of a genetic system for P. intermedia, which will be required for fundamental investigation of this organism's physiology, metabolism, and pathogenesis in human disease.

Restriction-modification mediated barriers to exogenous DNA uptake and incorporation employed by Prevotella intermedia

PubMed Central

Skeete, Chelsey A.; Fomenkov, Alexey; Roberts, Richard J.; Rittling, Susan R.

2017-01-01

Prevotella intermedia, a major periodontal pathogen, is increasingly implicated in human respiratory tract and cystic fibrosis lung infections. Nevertheless, the specific mechanisms employed by this pathogen remain only partially characterized and poorly understood, largely due to its total lack of genetic accessibility. Here, using Single Molecule, Real-Time (SMRT) genome and methylome sequencing, bisulfite sequencing, in addition to cloning and restriction analysis, we define the specific genetic barriers to exogenous DNA present in two of the most widespread laboratory strains, P. intermedia ATCC 25611 and P. intermedia Strain 17. We identified and characterized multiple restriction-modification (R-M) systems, some of which are considerably divergent between the two strains. We propose that these R-M systems are the root cause of the P. intermedia transformation barrier. Additionally, we note the presence of conserved Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) systems in both strains, which could provide a further barrier to exogenous DNA uptake and incorporation. This work will provide a valuable resource during the development of a genetic system for P. intermedia, which will be required for fundamental investigation of this organism’s physiology, metabolism, and pathogenesis in human disease. PMID:28934361

Nanochannel Device with Embedded Nanopore: a New Approach for Single-Molecule DNA Analysis and Manipulation

NASA Astrophysics Data System (ADS)

Zhang, Yuning; Reisner, Walter

2013-03-01

Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with embedded pore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a pore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We demonstrate that we can optically detect successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule. Furthermore, electrical measurements through the nanopore are performed, indicating that DNA sensing is feasible using the nanochannel-nanopore device.

A 3D-DNA Molecule Made of PlayMais

ERIC Educational Resources Information Center

Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl

2015-01-01

More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…

Procedure for normalization of cDNA libraries

DOEpatents

Bonaldo, Maria DeFatima; Soares, Marcelo Bento

1997-01-01

This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.

Building block synthesis using the polymerase chain assembly method.

PubMed

Marchand, Julie A; Peccoud, Jean

2012-01-01

De novo gene synthesis allows the creation of custom DNA molecules without the typical constraints of traditional cloning assembly: scars, restriction site incompatibility, and the quest to find all the desired parts to name a few. Moreover, with the help of computer-assisted design, the perfect DNA molecule can be created along with its matching sequence ready to download. The challenge is to build the physical DNA molecules that have been designed with the software. Although there are several DNA assembly methods, this section presents and describes a method using the polymerase chain assembly (PCA).

SINGLE STRAND-CONTAINING REPLICATING MOLECULES OF CIRCULAR MITOCHONDRIAL DNA

PubMed Central

Wolstenholme, David R.; Koike, Katsuro; Cochran-Fouts, Patricia

1973-01-01

Mitochondrial DNAs (mtDNAs) from Chang rat solid hepatomas and Novikoff rat ascites hepatomas were examined in the electron microscope after preparation by the aqueous and by the formamide protein monolayer techniques. MtDNAs from both tumors were found to include double-forked circular molecules with a form and size suggesting they were replicative intermediates. These molecules were of two classes. In molecules of one class, all three segments were apparently totally double stranded. Molecules of the second class were distinguished by the fact that one of the segments spanning the region between the forks in which replication had occurred (the daughter segments) was either totally single stranded, or contained a single-stranded region associated with one of the forks. Daughter segments of both totally double-stranded and single strand-containing replicating molecules varied in length from about 3 to about 80% of the circular contour length of the molecule. Similar classes of replicating molecules were found in mtDNA from regenerating rat liver and chick embryos, indicating them to be normal intermediates in the replication of mtDNA All of the mtDNAs examined included partially single-stranded simple (nonforked) circular molecules. A possible scheme for the replication of mtDNA is presented, based on the different molecular forms observed PMID:4345165

Localization microscopy of DNA in situ using Vybrant{sup ®} DyeCycle™ Violet fluorescent probe: A new approach to study nuclear nanostructure at single molecule resolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Żurek-Biesiada, Dominika; Szczurek, Aleksander T.; Prakash, Kirti

Higher order chromatin structure is not only required to compact and spatially arrange long chromatids within a nucleus, but have also important functional roles, including control of gene expression and DNA processing. However, studies of chromatin nanostructures cannot be performed using conventional widefield and confocal microscopy because of the limited optical resolution. Various methods of superresolution microscopy have been described to overcome this difficulty, like structured illumination and single molecule localization microscopy. We report here that the standard DNA dye Vybrant{sup ®} DyeCycle™ Violet can be used to provide single molecule localization microscopy (SMLM) images of DNA in nuclei ofmore » fixed mammalian cells. This SMLM method enabled optical isolation and localization of large numbers of DNA-bound molecules, usually in excess of 10{sup 6} signals in one cell nucleus. The technique yielded high-quality images of nuclear DNA density, revealing subdiffraction chromatin structures of the size in the order of 100 nm; the interchromatin compartment was visualized at unprecedented optical resolution. The approach offers several advantages over previously described high resolution DNA imaging methods, including high specificity, an ability to record images using a single wavelength excitation, and a higher density of single molecule signals than reported in previous SMLM studies. The method is compatible with DNA/multicolor SMLM imaging which employs simple staining methods suited also for conventional optical microscopy. - Highlights: • Super-resolution imaging of nuclear DNA with Vybrant Violet and blue excitation. • 90nm resolution images of DNA structures in optically thick eukaryotic nuclei. • Enhanced resolution confirms the existence of DNA-free regions inside the nucleus. • Optimized imaging conditions enable multicolor super-resolution imaging.« less

Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore

NASA Technical Reports Server (NTRS)

Vercoutere, Wenonah; DeGuzman, Veronica

2003-01-01

The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.

Replication of each copy of the yeast 2 micron DNA plasmid occurs during the S phase.

PubMed

Zakian, V A; Brewer, B J; Fangman, W L

1979-08-01

Saccharomyces cerevisiae contains 50-100 copies per cell of a circular plasmid called 2 micron DNA. Replication of this DNA was studied in two ways. The distribution of replication events among 2 micron DNA molecules was examined by density transfer experiments with asynchronous cultures. The data show that 2 micron DNA replication is similar to chromosomal DNA replication: essentially all 2 micron duplexes were of hybrid density at one cell doubling after the density transfer, with the majority having one fully dense strand and one fully light strand. The results show that replication of 2 micron DNA occurs by a semiconservative mechanism where each of the plasmid molecules replicates once each cell cycle. 2 micron DNA is the only known example of a multiple-copy, extrachromosomal DNA in which every molecule replicates in each cell cycle. Quantitative analysis of the data indicates that 2 micron DNA replication is limited to a fraction of the cell cycle. The period in the cell cycle when 2 micron DNA replicates was examined directly with synchronous cell cultures. Synchronization was accomplished by sequentially arresting cells in G1 phase using the yeast pheromone alpha-factor and incubating at the restrictive temperature for a cell cycle (cdc 7) mutant. Replication was monitored by adding 3H-uracil to cells previously labeled with 14C-uracil, and determining the 3H/14C ratio for purified DNA species. 2 micron DNA replication did not occur during the G1 arrest periods. However, the population of 2 micron DNA doubled during the synchronous S phase at the permissive temperature, with most of the replication occurring in the first third of S phase. Our results indicate that a mechanism exists which insures that the origin of replication of each 2 micron DNA molecule is activated each S phase. As with chromosomal DNA, further activation is prevented until the next cell cycle. We propose that the mechanism which controls the replication initiation of each 2 micron DNA molecule is identical to that which controls the initiation of chromosomal DNA.

Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

DOEpatents

Gardner, Shea N [San Leandro, CA; Mariella, Jr., Raymond P.; Christian, Allen T [Tracy, CA; Young, Jennifer A [Berkeley, CA; Clague, David S [Livermore, CA

2011-01-18

A method of fabricating a DNA molecule of user-defined sequence. The method comprises the steps of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an even or odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths. In one embodiment starting sequence fragments are of different lengths, n, n+1, n+2, etc.

Prominent mitochondrial DNA recombination intermediates in human heart muscle.

PubMed

Kajander, O A; Karhunen, P J; Holt, I J; Jacobs, H T

2001-11-01

Recombination intermediates containing four-way (Holliday) junctions are generated during DNA repair and replication in many systems, including yeast mitochondrial DNA (mtDNA). In contrast, convincing evidence for recombination in mammalian mtDNA is lacking. We have used two-dimensional agarose-gel electrophoresis to analyse non-linear forms of mtDNA in human heart muscle. Replication intermediates from both the coupled and strand-asynchronous mtDNA replication pathways were detected. An additional class of non-linear molecules, with the electrophoretic properties of four-way junctions, was also prominent. These molecules were insensitive to topoisomerase I or RNase H, but were diminished by branch migration or RuvC treatment. Junctional molecules were detected in all regions of the mitochondrial genome, were found in myocardial DNA from young and old adults, but were present at lower levels in skeletal muscle and placenta. We suggest that they could represent intermediates of mtDNA repair, given their prevalence in the oxyradical-rich environment of heart muscle mitochondria.

Secondary structure prediction and structure-specific sequence analysis of single-stranded DNA.

PubMed

Dong, F; Allawi, H T; Anderson, T; Neri, B P; Lyamichev, V I

2001-08-01

DNA sequence analysis by oligonucleotide binding is often affected by interference with the secondary structure of the target DNA. Here we describe an approach that improves DNA secondary structure prediction by combining enzymatic probing of DNA by structure-specific 5'-nucleases with an energy minimization algorithm that utilizes the 5'-nuclease cleavage sites as constraints. The method can identify structural differences between two DNA molecules caused by minor sequence variations such as a single nucleotide mutation. It also demonstrates the existence of long-range interactions between DNA regions separated by >300 nt and the formation of multiple alternative structures by a 244 nt DNA molecule. The differences in the secondary structure of DNA molecules revealed by 5'-nuclease probing were used to design structure-specific probes for mutation discrimination that target the regions of structural, rather than sequence, differences. We also demonstrate the performance of structure-specific 'bridge' probes complementary to non-contiguous regions of the target molecule. The structure-specific probes do not require the high stringency binding conditions necessary for methods based on mismatch formation and permit mutation detection at temperatures from 4 to 37 degrees C. Structure-specific sequence analysis is applied for mutation detection in the Mycobacterium tuberculosis katG gene and for genotyping of the hepatitis C virus.

DNA conformation on surfaces measured by fluorescence self-interference.

PubMed

Moiseev, Lev; Unlü, M Selim; Swan, Anna K; Goldberg, Bennett B; Cantor, Charles R

2006-02-21

The conformation of DNA molecules tethered to the surface of a microarray may significantly affect the efficiency of hybridization. Although a number of methods have been applied to determine the structure of the DNA layer, they are not very sensitive to variations in the shape of DNA molecules. Here we describe the application of an interferometric technique called spectral self-interference fluorescence microscopy to the precise measurement of the average location of a fluorescent label in a DNA layer relative to the surface and thus determine specific information on the conformation of the surface-bound DNA molecules. Using spectral self-interference fluorescence microscopy, we have estimated the shape of coiled single-stranded DNA, the average tilt of double-stranded DNA of different lengths, and the amount of hybridization. The data provide important proofs of concept for the capabilities of novel optical surface analytical methods of the molecular disposition of DNA on surfaces. The determination of DNA conformations on surfaces and hybridization behavior provide information required to move DNA interfacial applications forward and thus impact emerging clinical and biotechnological fields.

Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules

PubMed Central

Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David

2003-01-01

We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

The Alarmin Properties of DNA and DNA-associated Nuclear Proteins.

PubMed

Magna, Melinda; Pisetsky, David S

2016-05-01

The communication of cell injury and death is a critical element in host defense. Although immune cells can serve this function by elaborating cytokines and chemokines, somatic cells can repurpose nuclear macromolecules to function as damage-associated molecular patterns (DAMPs) or alarmins to exert similar activity. Among these molecules, DNA, high-mobility group box-1, and histone proteins can all act as DAMPs once they are in an extracellular location. This review describes current information on the role of the nuclear DAMPs, their translocation to the outside of cells, and pathways of activation after uptake into the inside of immune cells. MEDLINE and PubMed databases were searched for citations (1990-2016) in English related to the following terms: DAMPs, high-mobility group box-1, DNA, histones, cell death, danger, and immune activation. Selected articles with the most relevant studies were included for a more detailed consideration. Although nuclear molecules have important structural and genetic regulatory roles inside the cell nucleus, when released into the extracellular space during cell death, these molecules can acquire immune activity and serve as alarmins or DAMPs. Although apoptosis is generally considered the source of extracellular nuclear material, other cell death pathways such as necroptosis, NETosis, and pyroptosis can contribute to the release of nuclear molecules. Importantly, the release of nuclear DAMPs occurs with both soluble and particulate forms of these molecules. The activity of nuclear molecules may depend on posttranslational modifications, redox changes, and the binding of other molecules. Once in an extracellular location, nuclear DAMPs can engage the same pattern recognition receptors as do pathogen-associated molecular patterns. These interactions can activate immune cells and lead to cytokine and chemokine production. Among these receptors, internal receptors for DNA are key to the response to this molecule; the likely function of these internal sensors is the recognition of DNA from intracellular infection by bacteria or viruses. Activation of these receptors requires translocation of extracellular DNA into specialized compartments. In addition to nuclear DNA, mitochondrial DNA can also serve as a DAMP. The communication of cell injury and death is a critical element in host defense and involves the repurposing of nuclear molecules as immune triggers. As such, the presence of extracellular nuclear material can serve as novel biomarkers for conditions involving cell injury and death. Targeting of these molecules may also represent an important new approach to therapy. Published by Elsevier Inc.

DNA under Force: Mechanics, Electrostatics, and Hydration.

PubMed

Li, Jingqiang; Wijeratne, Sithara S; Qiu, Xiangyun; Kiang, Ching-Hwa

2015-02-25

Quantifying the basic intra- and inter-molecular forces of DNA has helped us to better understand and further predict the behavior of DNA. Single molecule technique elucidates the mechanics of DNA under applied external forces, sometimes under extreme forces. On the other hand, ensemble studies of DNA molecular force allow us to extend our understanding of DNA molecules under other forces such as electrostatic and hydration forces. Using a variety of techniques, we can have a comprehensive understanding of DNA molecular forces, which is crucial in unraveling the complex DNA functions in living cells as well as in designing a system that utilizes the unique properties of DNA in nanotechnology.

Substrate preparation for reliable imaging of DNA molecules with the scanning force microscope.

PubMed

Vesenka, J; Guthold, M; Tang, C L; Keller, D; Delaine, E; Bustamante, C

1992-07-01

A simple method of substrate preparation for imaging circular DNA molecules with the scanning force microscope (SFM) is presented. These biomolecules are adsorbed onto mica that has been soaked in magnesium acetate, sonicated and glow-discharged. The stylus-sample forces that may be endured before sample damage occurs depends on the ambient relative humidity. Images of circular DNA molecules have been obtained routinely using tips specially modified by an electron beam with a radius of curvature, Rc, of about 10 nm [D. Keller and C. Chih-Chung, Surf. Sci. 268 (1992) 333]. The resolution of these adsorbed biomolecules is determined by the Rc. At higher forces individual circular DNA molecules can be manipulated with the SFM stylus. Strategies to develop still sharper probes will be discussed.

DNA and RNA sequencing by nanoscale reading through programmable electrophoresis and nanoelectrode-gated tunneling and dielectric detection

DOEpatents

Lee, James W.; Thundat, Thomas G.

2005-06-14

An apparatus and method for performing nucleic acid (DNA and/or RNA) sequencing on a single molecule. The genetic sequence information is obtained by probing through a DNA or RNA molecule base by base at nanometer scale as though looking through a strip of movie film. This DNA sequencing nanotechnology has the theoretical capability of performing DNA sequencing at a maximal rate of about 1,000,000 bases per second. This enhanced performance is made possible by a series of innovations including: novel applications of a fine-tuned nanometer gap for passage of a single DNA or RNA molecule; thin layer microfluidics for sample loading and delivery; and programmable electric fields for precise control of DNA or RNA movement. Detection methods include nanoelectrode-gated tunneling current measurements, dielectric molecular characterization, and atomic force microscopy/electrostatic force microscopy (AFM/EFM) probing for nanoscale reading of the nucleic acid sequences.

Nanomechanical DNA origami 'single-molecule beacons' directly imaged by atomic force microscopy

PubMed Central

Kuzuya, Akinori; Sakai, Yusuke; Yamazaki, Takahiro; Xu, Yan; Komiyama, Makoto

2011-01-01

DNA origami involves the folding of long single-stranded DNA into designed structures with the aid of short staple strands; such structures may enable the development of useful nanomechanical DNA devices. Here we develop versatile sensing systems for a variety of chemical and biological targets at molecular resolution. We have designed functional nanomechanical DNA origami devices that can be used as 'single-molecule beacons', and function as pinching devices. Using 'DNA origami pliers' and 'DNA origami forceps', which consist of two levers ~170 nm long connected at a fulcrum, various single-molecule inorganic and organic targets ranging from metal ions to proteins can be visually detected using atomic force microscopy by a shape transition of the origami devices. Any detection mechanism suitable for the target of interest, pinching, zipping or unzipping, can be chosen and used orthogonally with differently shaped origami devices in the same mixture using a single platform. PMID:21863016

[Single-molecule detection and characterization of DNA replication based on DNA origami].

PubMed

Wang, Qi; Fan, Youjie; Li, Bin

2014-08-01

To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.

Nanochannel Device with Embedded Nanopore: a New Approach for Single-Molecule DNA Analysis and Manipulation

NASA Astrophysics Data System (ADS)

Zhang, Yuning; Reisner, Walter

2012-02-01

Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with nanpore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a nanopore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We will discuss our recent progress on device fabrication and characterization. In particular, we demonstrate that we can detect - using fluorescent microscopy - successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the embedded pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule.

Multiplexed Sequence Encoding: A Framework for DNA Communication

PubMed Central

Zakeri, Bijan; Carr, Peter A.; Lu, Timothy K.

2016-01-01

Synthetic DNA has great propensity for efficiently and stably storing non-biological information. With DNA writing and reading technologies rapidly advancing, new applications for synthetic DNA are emerging in data storage and communication. Traditionally, DNA communication has focused on the encoding and transfer of complete sets of information. Here, we explore the use of DNA for the communication of short messages that are fragmented across multiple distinct DNA molecules. We identified three pivotal points in a communication—data encoding, data transfer & data extraction—and developed novel tools to enable communication via molecules of DNA. To address data encoding, we designed DNA-based individualized keyboards (iKeys) to convert plaintext into DNA, while reducing the occurrence of DNA homopolymers to improve synthesis and sequencing processes. To address data transfer, we implemented a secret-sharing system—Multiplexed Sequence Encoding (MuSE)—that conceals messages between multiple distinct DNA molecules, requiring a combination key to reveal messages. To address data extraction, we achieved the first instance of chromatogram patterning through multiplexed sequencing, thereby enabling a new method for data extraction. We envision these approaches will enable more widespread communication of information via DNA. PMID:27050646

Localization microscopy of DNA in situ using Vybrant(®) DyeCycle™ Violet fluorescent probe: A new approach to study nuclear nanostructure at single molecule resolution.

PubMed

Żurek-Biesiada, Dominika; Szczurek, Aleksander T; Prakash, Kirti; Mohana, Giriram K; Lee, Hyun-Keun; Roignant, Jean-Yves; Birk, Udo J; Dobrucki, Jurek W; Cremer, Christoph

2016-05-01

Higher order chromatin structure is not only required to compact and spatially arrange long chromatids within a nucleus, but have also important functional roles, including control of gene expression and DNA processing. However, studies of chromatin nanostructures cannot be performed using conventional widefield and confocal microscopy because of the limited optical resolution. Various methods of superresolution microscopy have been described to overcome this difficulty, like structured illumination and single molecule localization microscopy. We report here that the standard DNA dye Vybrant(®) DyeCycle™ Violet can be used to provide single molecule localization microscopy (SMLM) images of DNA in nuclei of fixed mammalian cells. This SMLM method enabled optical isolation and localization of large numbers of DNA-bound molecules, usually in excess of 10(6) signals in one cell nucleus. The technique yielded high-quality images of nuclear DNA density, revealing subdiffraction chromatin structures of the size in the order of 100nm; the interchromatin compartment was visualized at unprecedented optical resolution. The approach offers several advantages over previously described high resolution DNA imaging methods, including high specificity, an ability to record images using a single wavelength excitation, and a higher density of single molecule signals than reported in previous SMLM studies. The method is compatible with DNA/multicolor SMLM imaging which employs simple staining methods suited also for conventional optical microscopy. Copyright © 2016. Published by Elsevier Inc.

A single molecule study of G-quadruplex and short duplex DNA structures

NASA Astrophysics Data System (ADS)

Roy, William A., Jr.

Given that certain conditions are met, a single stranded DNA/RNA (ssDNA/RNA) structure called G-quadruplex (GQ) can form in regions throughout the genome, including at the telomeres and internal regions of the chromosomes. These structures serve various functions depending on the region in which they form which include protecting the chromosome ends, interfering with telomere elongation in cancer cells, and regulating transcription and translation level gene expression. Due to their high stability, various cellular mechanisms, such as GQ destabilizing proteins, are employed to unfold these structures during DNA replication or repair. Yet, their distinct layered structure has made GQs an attractive drug target in cancer treatment as GQ stabilizing molecules could inhibit telomerase dependent telomere elongation, a mechanism occurring in the majority of cancer cells to avoid senescence and apoptosis. However, proteins or small molecules interact with GQ that is under the influence of various cellular tension mechanisms, including the tension applied by other nearby molecules or the tension due to DNA structure within the chromatin context. Therefore, it is important to characterize the stability of various GQs and their response to interacting molecules when subjected to a tensile force. We employed a novel DNA-based nano tension generator that utilizes the elastic properties of circularized short double-stranded DNA (dsDNA) oligonucleotides to apply tension on the GQ. Since this is a completely new approach, the majority of this thesis was dedicated to proof-of-principle studies that demonstrated the feasibility and functionality of the method.

Contactless experiments on individual DNA molecules show no evidence for molecular wire behavior.

PubMed

Gómez-Navarro, C; Moreno-Herrero, F; de Pablo, P J; Colchero, J; Gómez-Herrero, J; Baró, A M

2002-06-25

A fundamental requirement for a molecule to be considered a molecular wire (MW) is the ability to transport electrical charge with a reasonably low resistance. We have carried out two experiments that measure first, the charge transfer from an electrode to the molecule, and second, the dielectric response of the MW. The latter experiment requires no contacts to either end of the molecule. From our experiments we conclude that adsorbed individual DNA molecules have a resistivity similar to mica, glass, and silicon oxide substrates. Therefore adsorbed DNA is not a conductor, and it should not be considered as a viable candidate for MW applications. Parallel studies on other nanowires, including single-walled carbon nanotubes, showed conductivity as expected.

Molecular threading: mechanical extraction, stretching and placement of DNA molecules from a liquid-air interface.

PubMed

Payne, Andrew C; Andregg, Michael; Kemmish, Kent; Hamalainen, Mark; Bowell, Charlotte; Bleloch, Andrew; Klejwa, Nathan; Lehrach, Wolfgang; Schatz, Ken; Stark, Heather; Marblestone, Adam; Church, George; Own, Christopher S; Andregg, William

2013-01-01

We present "molecular threading", a surface independent tip-based method for stretching and depositing single and double-stranded DNA molecules. DNA is stretched into air at a liquid-air interface, and can be subsequently deposited onto a dry substrate isolated from solution. The design of an apparatus used for molecular threading is presented, and fluorescence and electron microscopies are used to characterize the angular distribution, straightness, and reproducibility of stretched DNA deposited in arrays onto elastomeric surfaces and thin membranes. Molecular threading demonstrates high straightness and uniformity over length scales from nanometers to micrometers, and represents an alternative to existing DNA deposition and linearization methods. These results point towards scalable and high-throughput precision manipulation of single-molecule polymers.

Molecule counting with alkanethiol and DNA immobilized on gold microplates for extended gate FET.

PubMed

Cao, Zhong; Xiao, Zhong-Liang; Zhang, Ling; Luo, Dong-Mei; Kamahori, Masao; Shimoda, Maki

2013-04-01

Several molecule counting methods based on electrochemical characterization of alkanethiol and thiolated single-stranded oligonucleotide (HS-ssDNA) immobilized on gold microplates, which were used as extended gates of field effect transistors (FETs), have been investigated in this paper. The surface density of alkanethiol and DNA monolayers on gold microplates were quantitatively evaluated from the reductive desorption charge by using cyclic voltammetry (CV) and fast CV (FCV) methods in strong alkali solution. Typically, the surface density of 6-hydroxy-1-hexanethiol (6-HHT) was evaluated to be 4.639 molecules/nm(2), and the 28 base-pair dsDNA about 1.226-4.849 molecules/100 nm(2) on Au microplates after post-treatment with 6-HHT. The behaviors on surface potential and capacitance of different aminoalkanethiols on Au microplates were measured in 0.1 mol/L Na2SO4 and 10 mmol/L Tris-HCl (pH=7.4) solutions, indicating that the surface potential increases and the double-layer capacitance decreases with the length of carbon chain increased for the thiol monolayers, which obey a physics relationship for a capacitor. Comparably, a simple sensing method based on the electronic signals of biochemical reaction events on DNA immobilization and hybridization at the Au surface of the extended gate FET (EGFET) was developed, with which the surface density of the hybridized dsDNA on the gold surface of the EGFET was evaluated to be 1.36 molecules per 100 nm(2), showing that the EGFET is a promising sensing biochip for DNA molecule counting. Copyright © 2012 Elsevier B.V. All rights reserved.

Probing the dynamics of restriction endonuclease NgoMIV-DNA interaction by single-molecule FRET.

PubMed

Tutkus, Marijonas; Sasnauskas, Giedrius; Rutkauskas, Danielis

2017-12-01

Many type II restriction endonucleases require two copies of their recognition sequence for optimal activity. Concomitant binding of two DNA sites by such an enzyme produces a DNA loop. Here we exploit single-molecule Förster resonance energy transfer (smFRET) of surface-immobilized DNA fragments to study the dynamics of DNA looping induced by tetrameric endonuclease NgoMIV. We have employed a DNA fragment with two NgoMIV recognition sites and a FRET dye pair such that upon protein-induced DNA looping the dyes are brought to close proximity resulting in a FRET signal. The dynamics of DNA-NgoMIV interactions proved to be heterogeneous, with individual smFRET trajectories exhibiting broadly different average looped state durations. Distinct types of the dynamics were attributed to different types of DNA-protein complexes, mediated either by one NgoMIV tetramer simultaneously bound to two specific sites ("slow" trajectories) or by semi-specific interactions of two DNA-bound NgoMIV tetramers ("fast" trajectories), as well as to conformational heterogeneity of individual NgoMIV molecules. © 2017 Wiley Periodicals, Inc.

Live-Cell Imaging of DNA Methylation Based on Synthetic-Molecule/Protein Hybrid Probe.

PubMed

Kumar, Naresh; Hori, Yuichiro; Kikuchi, Kazuya

2018-06-04

The epigenetic modification of DNA involves the conversion of cytosine to 5-methylcytosine, also known as DNA methylation. DNA methylation is important in modulating gene expression and thus, regulating genome and cellular functions. Recent studies have shown that aberrations in DNA methylation are associated with various epigenetic disorders or diseases including cancer. This stimulates great interest in the development of methods that can detect and visualize DNA methylation. For instance, fluorescent proteins (FPs) in conjugation with methyl-CpG-binding domain (MBD) have been employed for live-cell imaging of DNA methylation. However, the FP-based approach showed fluorescence signals for both the DNA-bound and -unbound states and thus differentiation between these states is difficult. Synthetic-molecule/protein hybrid probes can provide an alternative to overcome this restriction. In this article, we discuss the synthetic-molecule/protein hybrid probe that we developed recently for live-cell imaging of DNA methylation, which exhibited fluorescence enhancement only after binding to methylated DNA. © 2018 The Chemical Society of Japan & Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Of Molecules and Models.

ERIC Educational Resources Information Center

Brinner, Bonnie

1992-01-01

Presents an activity in which models help students visualize both the DNA process and transcription. After constructing DNA, RNA messenger, and RNA transfer molecules; students model cells, protein synthesis, codons, and RNA movement. (MDH)

Light-Triggered Release of DNA from Plasmon-Resonant Nanoparticles

NASA Astrophysics Data System (ADS)

Huschka, Ryan

Plasmon-resonant nanoparticle complexes show promising potential for lighttriggered, controllable delivery of deoxyribonucleic acids (DNA) for research and therapeutic purposes. For example, the approach of RNA interference (RNAi) . using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein . is very useful in dissecting genetic function and holds promise as a molecular therapeutic. Herein, we investigate the mechanism and probe the in vitro therapeutic potential of DNA light-triggered release from plasmonic nanoparticles. First, we investigate the mechanism of light-triggered release by dehybridizing double-stranded (dsDNA) via laser illumination from two types of nanoparticle substrates: gold (Au) nanoshells and Au nanorods. Both light-triggered and thermally induced releases are distinctly observable from nanoshell-based complexes. Surprisingly, no analogous measurable light-triggered release was observable from nanorod-based complexes below the DNA melting temperature. These results suggest that a nonthermal mechanism may play a role in light-triggered DNA release. Second, we demonstrate the in vitro light-triggered release of molecules noncovalently attached within dsDNA bound to the Au nanoshell surface. DAPI (4',6- diamidino-2-phenylindole), a bright blue fluorescent molecule that binds reversibly to double-stranded DNA, was chosen to visualize this intracellular light-induced release process. Illumination through the cell membrane of the nanoshell-dsDNA-DAPI complexes dehybridizes the DNA and releases the DAPI molecules within living cells. The DAPI molecules diffuse to the nucleus and associate with the cell's endogenous DNA. This work could have future applications towards drug delivery of molecules that associate with dsDNA. Finally, we demonstrate an engineered Au nanoshell (AuNS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on demand upon illumination with a near-infrared (NIR) laser. A poly(L)lysine peptide (PLL) epilayer coated onto the AuNS surface (AuNS-PLL) is used to capture intact, single-stranded antisense DNA oligonucleotide, or alternatively, double-stranded short-interfering RNA (siRNA) molecules. A green fluorescent protein (GFP)-expressing human lung cancer H1299 cell line was used to determine cellular uptake and GFP gene silencing mediated by AuNS-PLL delivery vector. The light-triggered release of oligonucleotides could have broad applications in the study of cellular processes and in the development of intracellular targeted therapies.

Cooperative Assembly of Co-Smad4 MH1 with R-Smad1/3 MH1 on DNA: A Molecular Dynamics Simulation Study

PubMed Central

Wang, Guihong; Li, Chaoqun; Wang, Yan; Chen, Guangju

2013-01-01

Background Smads, the homologs of Sma and MAD proteins, play a key role in gene expression regulation in the transforming growth factor-β (TGF-β) signaling pathway. Recent experimental studies have revealed that Smad4/R-Smad heterodimers bound on DNA are energetically more favorable than homodimeric R-Smad/R-Smad complexes bound on DNA, which indicates that Smad4 might act as binding vehicle to cooperatively assemble with activated R-Smads on DNA in the nucleus. However, the details of interaction mechanism for cooperative recruitment of Smad4 protein to R-Smad proteins on DNA, and allosteric communication between the Smad4-DNA and R-Smad-DNA interfaces via DNA mediating are not yet clear so far. Methodology In the present work, we have constructed a series of Smadn+DNA+Smadn (n = 1, 3, 4) models and carried out molecular dynamics simulations, free energy calculations and DNA dynamics analysis for them to study the interaction properties of Smadn (n = 1, 3, 4) with DNA molecule. Results The results revealed that the binding of Smad4 protein to DNA molecule facilitates energetically the formation of the heteromeric Smad4+DNA+Smad1/3 complex by increasing the affinity of Smad1/3 with DNA molecule. Further investigations through the residue/base motion correlation and DNA dynamics analyses predicted that the binding of Smad4 protein to DNA molecule in the heteromeric Smad4+DNA+Smad1/3 model induces an allosteric communication from the Smad4-DNA interface to Smad1/Smad3-DNA interface via DNA base-pair helical motions, surface conformation changes and new hydrogen bond formations. The present work theoretically explains the mechanism of cooperative recruitment of Smad4 protein to Smad1/3 protein via DNA-mediated indirect readout mode in the nucleus. PMID:23326519

The complete mitochondrial genome of Hydra vulgaris (Hydroida: Hydridae).

PubMed

Pan, Hong-Chun; Fang, Hong-Yan; Li, Shi-Wei; Liu, Jun-Hong; Wang, Ying; Wang, An-Tai

2014-12-01

The complete mitochondrial genome of Hydra vulgaris (Hydroida: Hydridae) is composed of two linear DNA molecules. The mitochondrial DNA (mtDNA) molecule 1 is 8010 bp long and contains six protein-coding genes, large subunit rRNA, methionine and tryptophan tRNAs, two pseudogenes consisting respectively of a partial copy of COI, and terminal sequences at two ends of the linear mtDNA, while the mtDNA molecule 2 is 7576 bp long and contains seven protein-coding genes, small subunit rRNA, methionine tRNA, a pseudogene consisting of a partial copy of COI and terminal sequences at two ends of the linear mtDNA. COI gene begins with GTG as start codon, whereas other 12 protein-coding genes start with a typical ATG initiation codon. In addition, all protein-coding genes are terminated with TAA as stop codon.

Homebuilt single-molecule scanning confocal fluorescence microscope studies of single DNA/protein interactions.

PubMed

Zheng, Haocheng; Goldner, Lori S; Leuba, Sanford H

2007-03-01

Many technical improvements in fluorescence microscopy over the years have focused on decreasing background and increasing the signal to noise ratio (SNR). The scanning confocal fluorescence microscope (SCFM) represented a major improvement in these efforts. The SCFM acquires signal from a thin layer of a thick sample, rejecting light whose origin is not in the focal plane thereby dramatically decreasing the background signal. A second major innovation was the advent of high quantum-yield, low noise, single-photon counting detectors. The superior background rejection of SCFM combined with low-noise, high-yield detectors makes it possible to detect the fluorescence from single-dye molecules. By labeling a DNA molecule or a DNA/protein complex with a donor/acceptor dye pair, fluorescence resonance energy transfer (FRET) can be used to track conformational changes in the molecule/complex itself, on a single molecule/complex basis. In this methods paper, we describe the core concepts of SCFM in the context of a study that uses FRET to reveal conformational fluctuations in individual Holliday junction DNA molecules and nucleosomal particles. We also discuss data processing methods for SCFM.

Single-molecule DNA detection with an engineered MspA protein nanopore

PubMed Central

Butler, Tom Z.; Pavlenok, Mikhail; Derrington, Ian M.; Niederweis, Michael; Gundlach, Jens H.

2008-01-01

Nanopores hold great promise as single-molecule analytical devices and biophysical model systems because the ionic current blockades they produce contain information about the identity, concentration, structure, and dynamics of target molecules. The porin MspA of Mycobacterium smegmatis has remarkable stability against environmental stresses and can be rationally modified based on its crystal structure. Further, MspA has a short and narrow channel constriction that is promising for DNA sequencing because it may enable improved characterization of short segments of a ssDNA molecule that is threaded through the pore. By eliminating the negative charge in the channel constriction, we designed and constructed an MspA mutant capable of electronically detecting and characterizing single molecules of ssDNA as they are electrophoretically driven through the pore. A second mutant with additional exchanges of negatively-charged residues for positively-charged residues in the vestibule region exhibited a factor of ≈20 higher interaction rates, required only half as much voltage to observe interaction, and allowed ssDNA to reside in the vestibule ≈100 times longer than the first mutant. Our results introduce MspA as a nanopore for nucleic acid analysis and highlight its potential as an engineerable platform for single-molecule detection and characterization applications. PMID:19098105

Procedure for normalization of cDNA libraries

DOEpatents

Bonaldo, M.D.; Soares, M.B.

1997-12-30

This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library. 1 fig.

Definition of the persistence length in the coarse-grained models of DNA elasticity.

PubMed

Fathizadeh, A; Eslami-Mossallam, B; Ejtehadi, M R

2012-11-01

By considering the detailed structure of DNA in the base pair level, two possible definitions of the persistence length are compared. One definition is related to the orientation of the terminal base pairs, and the other is based on the vectors which connect two adjacent base pairs at each end of the molecule. It is shown that although these definitions approach each other for long DNA molecules, they are dramatically different on short length scales. We show analytically that the difference mostly comes from the shear flexibility of the molecule and can be used to measure the shear modulus of DNA.

DNA motion capture reveals the mechanical properties of DNA at the mesoscale.

PubMed

Price, Allen C; Pilkiewicz, Kevin R; Graham, Thomas G W; Song, Dan; Eaves, Joel D; Loparo, Joseph J

2015-05-19

Single-molecule studies probing the end-to-end extension of long DNAs have established that the mechanical properties of DNA are well described by a wormlike chain force law, a polymer model where persistence length is the only adjustable parameter. We present a DNA motion-capture technique in which DNA molecules are labeled with fluorescent quantum dots at specific sites along the DNA contour and their positions are imaged. Tracking these positions in time allows us to characterize how segments within a long DNA are extended by flow and how fluctuations within the molecule are correlated. Utilizing a linear response theory of small fluctuations, we extract elastic forces for the different, ∼2-μm-long segments along the DNA backbone. We find that the average force-extension behavior of the segments can be well described by a wormlike chain force law with an anomalously small persistence length. Copyright © 2015 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Effect of DNA-CTMA complex on optical properties of LDS 821 dye

NASA Astrophysics Data System (ADS)

Udayan, Sony; Ramachandran, Vijesh Kavumoottil; Sebastian, Mathew; Chandran, Pradeep; Nampoori, Vadakkedath Parameswaran Narayanan; Thomas, Sheenu

2017-07-01

We have investigated the fluorescence behavior of LDS 821 dye (Styryl 9 M) with deoxyribonucleic acid attached with cetyltrimethyl-ammonium (DNA-CTMA). Optical absorption studies confirm the intercalation of the dye molecules with DNA-CTMA. Fluorescence studies show an enhancement of fluorescence intensity of dye with DNA-CTMA, which suggest the reduction of TICT states of the dye molecule. The FWHM of the fluorescence spectrum increases from 95 nm to 161 nm indicating the formation of new energy levels when DNA-CTMA forms a complex with LDS 821 dye. Fluorescence lifetime measurements shows that lifetime of LDS 821 varies from 507ps to 953 ps with the addition of DNA-CTMA, which also confirms the deactivation of TICT states of dye molecule. Results show that the incorporation of DNA-CTMA with LDS 821 dye improves the optical characteristics of LDS 821 dye and therefore, can be used as a good fluorescence probe for DNA visualization as well as in lasing applications.

Digital DNA detection based on a compact optofluidic laser with ultra-low sample consumption.

PubMed

Lee, Wonsuk; Chen, Qiushu; Fan, Xudong; Yoon, Dong Ki

2016-11-29

DNA lasers self-amplify optical signals from a DNA analyte as well as thermodynamic differences between sequences, allowing quasi-digital DNA detection. However, these systems have drawbacks, such as relatively large sample consumption and complicated dye labelling. Moreover, although the lasing signal can detect the target DNA, it is superimposed on an unintended fluorescence background, which persists for non-target DNA samples as well. From an optical point of view, it is thus not truly digital detection and requires spectral analysis to identify the target. In this work, we propose and demonstrate an optofluidic laser that has a single layer of DNA molecules as the gain material. A target DNA produces intensive laser emission comparable to existing DNA lasers, while any unnecessary fluorescence background is successfully suppressed. As a result, the target DNA can be detected with a single laser pulse, in a truly digital manner. Since the DNA molecules cover only a single layer on the surface of the laser microcavity, the DNA sample consumption is a few orders of magnitude lower than that of existing DNA lasers. Furthermore, the DNA molecules are stained by simply immersing the microcavity in the intercalating dye solution, and thus the proposed DNA laser is free of any complex dye-labelling process prior to analysis.

Nano-funnels as electro-osmotic ``tweezers and pistons''

NASA Astrophysics Data System (ADS)

Wang, Yanqian; Panyukov, Sergey; Zhou, Jinsheng; Menard, Laurent D.; Ramsey, J. Michael; Rubinstien, Michael

2014-03-01

An electric field is used to force a DNA molecule into a nano-channel by compensating the free energy penalty that results from the reduced conformational entropy of the confined macromolecule. Narrow nano-channels require high critical electric fields to achieve DNA translocation, leading to short dwell times of DNA in these channels. We demonstrate that nano-funnels integrated with nano-channels reduce the free energy barrier and lower the critical electric field required for DNA translocation. A focused electric field within the funnel increases the electric force on the DNA, compresses the molecule, and increases the osmotic pressure at the nano-channel entrance. This ``electro-osmotic piston'' forces the molecule into the nano-channel at lower electric fields than those observed without the funnel. Appropirately designed nano-funnels can also function as tweezers that allow manipulation of the position of the DNA molecule. The predictions of our theory describing double-stranded DNA behavior in nano-funnel - nano-channel devices are consistent with experimental results. Thanks for the financial support from NSF (DMR-1309892, DMR-1121107, DMR-1122483), NIH (1-P50-HL107168, 1-P01-HL108808-01A1, R01HG02647), NHGRI and CF Foundation.

Model systems for single molecule polymer dynamics

PubMed Central

Latinwo, Folarin

2012-01-01

Double stranded DNA (dsDNA) has long served as a model system for single molecule polymer dynamics. However, dsDNA is a semiflexible polymer, and the structural rigidity of the DNA double helix gives rise to local molecular properties and chain dynamics that differ from flexible chains, including synthetic organic polymers. Recently, we developed single stranded DNA (ssDNA) as a new model system for single molecule studies of flexible polymer chains. In this work, we discuss model polymer systems in the context of “ideal” and “real” chain behavior considering thermal blobs, tension blobs, hydrodynamic drag and force–extension relations. In addition, we present monomer aspect ratio as a key parameter describing chain conformation and dynamics, and we derive dynamical scaling relations in terms of this molecular-level parameter. We show that asymmetric Kuhn segments can suppress monomer–monomer interactions, thereby altering global chain dynamics. Finally, we discuss ssDNA in the context of a new model system for single molecule polymer dynamics. Overall, we anticipate that future single polymer studies of flexible chains will reveal new insight into the dynamic behavior of “real” polymers, which will highlight the importance of molecular individualism and the prevalence of non-linear phenomena. PMID:22956980

Discriminating Intercalative Effects of Threading Intercalator Nogalamycin, from Classical Intercalator Daunomycin, Using Single Molecule Atomic Force Spectroscopy

PubMed Central

Sett, S.; Ghosh, S.; Rakshit, T.; Mukhopadhyay, R.

2016-01-01

DNA threading intercalators are a unique class of intercalating agents, albeit little biophysical information is available on their intercalative actions. Herein, the intercalative effects of nogalamycin, which is a naturally-occurring DNA threading intercalator, have been investigated by high-resolution atomic force microscopy (AFM) and spectroscopy (AFS). The results have been compared with those of the well-known chemotherapeutic drug daunomycin, which is a non-threading classical intercalator bearing structural similarity to nogalamycin. A comparative AFM assessment revealed a greater increase in DNA contour length over the entire incubation period of 48 h for nogalamycin treatment, whereas the contour length increase manifested faster in case of daunomycin. The elastic response of single DNA molecules to an externally applied force was investigated by the single molecule AFS approach. Characteristic mechanical fingerprints in the overstretching behaviour clearly distinguished the nogalamycin/daunomycin-treated dsDNA from untreated dsDNA—the former appearing less elastic than the latter, and the nogalamycin-treated DNA distinguished from the daunomycin-treated DNA—the classically intercalated dsDNA appearing the least elastic. A single molecule AFS-based discrimination of threading intercalation from the classical type is being reported for the first time. PMID:27183010

Histone H3 phosphorylation near the nucleosome dyad alters chromatin structure

PubMed Central

North, Justin A.; Šimon, Marek; Ferdinand, Michelle B.; Shoffner, Matthew A.; Picking, Jonathan W.; Howard, Cecil J.; Mooney, Alex M.; van Noort, John; Poirier, Michael G.; Ottesen, Jennifer J.

2014-01-01

Nucleosomes contain ∼146 bp of DNA wrapped around a histone protein octamer that controls DNA accessibility to transcription and repair complexes. Posttranslational modification (PTM) of histone proteins regulates nucleosome function. To date, only modest changes in nucleosome structure have been directly attributed to histone PTMs. Histone residue H3(T118) is located near the nucleosome dyad and can be phosphorylated. This PTM destabilizes nucleosomes and is implicated in the regulation of transcription and repair. Here, we report gel electrophoretic mobility, sucrose gradient sedimentation, thermal disassembly, micrococcal nuclease digestion and atomic force microscopy measurements of two DNA–histone complexes that are structurally distinct from nucleosomes. We find that H3(T118ph) facilitates the formation of a nucleosome duplex with two DNA molecules wrapped around two histone octamers, and an altosome complex that contains one DNA molecule wrapped around two histone octamers. The nucleosome duplex complex forms within short ∼150 bp DNA molecules, whereas altosomes require at least ∼250 bp of DNA and form repeatedly along 3000 bp DNA molecules. These results are the first report of a histone PTM significantly altering the nucleosome structure. PMID:24561803

Model Checking Temporal Logic Formulas Using Sticker Automata

PubMed Central

Feng, Changwei; Wu, Huanmei

2017-01-01

As an important complex problem, the temporal logic model checking problem is still far from being fully resolved under the circumstance of DNA computing, especially Computation Tree Logic (CTL), Interval Temporal Logic (ITL), and Projection Temporal Logic (PTL), because there is still a lack of approaches for DNA model checking. To address this challenge, a model checking method is proposed for checking the basic formulas in the above three temporal logic types with DNA molecules. First, one-type single-stranded DNA molecules are employed to encode the Finite State Automaton (FSA) model of the given basic formula so that a sticker automaton is obtained. On the other hand, other single-stranded DNA molecules are employed to encode the given system model so that the input strings of the sticker automaton are obtained. Next, a series of biochemical reactions are conducted between the above two types of single-stranded DNA molecules. It can then be decided whether the system satisfies the formula or not. As a result, we have developed a DNA-based approach for checking all the basic formulas of CTL, ITL, and PTL. The simulated results demonstrate the effectiveness of the new method. PMID:29119114

DNA-encoded libraries - an efficient small molecule discovery technology for the biomedical sciences.

PubMed

Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas

2018-06-27

DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.

Conjugates of classical DNA/RNA binder with nucleobase: chemical, biochemical and biomedical applications.

PubMed

Saftic, Dijana; Ban, Zeljka; Matic, Josipa; Tumir, Lidija-Marija; Piantanida, Ivo

2018-05-07

Among the most intensively studied classes of small molecules (molecular weight < 650) in biomedical research are small molecules that non-covalently bind to DNA/RNA, and another intensively studied class are nucleobase derivatives. Both classes have been intensively elaborated in many books and reviews. However, conjugates consisting of DNA/RNA binder covalently linked to nucleobase are much less studied and have not been reviewed in the last two decades. Therefore, this review summarized reports on the design of classical DNA/RNA binder - nucleobase conjugates, as well as data about their interactions with various DNA or RNA targets, and even in some cases protein targets involved. According to these data, the most important structural aspects of selective or even specific recognition between small molecule and target are proposed, and where possible related biochemical and biomedical aspects were discussed. The general conclusion is that this, rather new class of molecules showed an amazing set of recognition tools for numerous DNA or RNA targets in the last two decades, as well as few intriguing in vitro and in vivo selectivities. Several lead research lines show promising advancements toward either novel, highly selective markers or bioactive, potentially druggable molecules. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Single-molecule study of thymidine glycol and i-motif through the alpha-hemolysin ion channel

NASA Astrophysics Data System (ADS)

He, Lidong

Nanopore-based devices have emerged as a single-molecule detection and analysis tool for a wide range of applications. Through electrophoretically driving DNA molecules across a nanosized pore, a lot of information can be received, including unfolding kinetics and DNA-protein interactions. This single-molecule method has the potential to sequence kilobase length DNA polymers without amplification or labeling, approaching "the third generation" genome sequencing for around $1000 within 24 hours. alpha-Hemolysin biological nanopores have the advantages of excellent stability, low-noise level, and precise site-directed mutagenesis for engineering this protein nanopore. The first work presented in this thesis established the current signal of the thymidine glycol lesion in DNA oligomers through an immobilization experiment. The thymidine glycol enantiomers were differentiated from each other by different current blockage levels. Also, the effect of bulky hydrophobic adducts to the current blockage was investigated. Secondly, the alpha-hemolysin nanopore was used to study the human telomere i-motif and RET oncogene i-motif at a single-molecule level. In Chapter 3, it was demonstrated that the alpha-hemolysin nanopore can differentiate an i-motif form and single-strand DNA form at different pH values based on the same sequence. In addition, it shows potential to differentiate the folding topologies generated from the same DNA sequence.

DNA curtains for high-throughput single-molecule optical imaging.

PubMed

Greene, Eric C; Wind, Shalom; Fazio, Teresa; Gorman, Jason; Visnapuu, Mari-Liis

2010-01-01

Single-molecule approaches provide a valuable tool in the arsenal of the modern biologist, and new discoveries continue to be made possible through the use of these state-of-the-art technologies. However, it can be inherently difficult to obtain statistically relevant data from experimental approaches specifically designed to probe individual reactions. This problem is compounded with more complex biochemical reactions, heterogeneous systems, and/or reactions requiring the use of long DNA substrates. Here we give an overview of a technology developed in our laboratory, which relies upon simple micro- or nanofabricated structures in combination with "bio-friendly" lipid bilayers, to align thousands of long DNA molecules into defined patterns on the surface of a microfluidic sample chamber. We call these "DNA curtains," and we have developed several different versions varying in complexity and DNA substrate configuration, which are designed to meet different experimental needs. This novel approach to single-molecule imaging provides a powerful experimental platform that offers the potential for concurrent observation of hundreds or even thousands of protein-DNA interactions in real time. Copyright 2010 Elsevier Inc. All rights reserved.

Attomole-level Genomics with Single-molecule Direct DNA, cDNA and RNA Sequencing Technologies.

PubMed

Ozsolak, Fatih

2016-01-01

With the introduction of next-generation sequencing (NGS) technologies in 2005, the domination of microarrays in genomics quickly came to an end due to NGS's superior technical performance and cost advantages. By enabling genetic analysis capabilities that were not possible previously, NGS technologies have started to play an integral role in all areas of biomedical research. This chapter outlines the low-quantity DNA and cDNA sequencing capabilities and applications developed with the Helicos single molecule DNA sequencing technology.

Molecular modelling study of changes induced by netropsin binding to nucleosome core particles.

PubMed Central

Pérez, J J; Portugal, J

1990-01-01

It is well known that certain sequence-dependent modulators in structure appear to determine the rotational positioning of DNA on the nucleosome core particle. That preference is rather weak and could be modified by some ligands as netropsin, a minor-groove binding antibiotic. We have undertaken a molecular modelling approach to calculate the relative energy of interaction between a DNA molecule and the protein core particle. The histones particle is considered as a distribution of positive charges on the protein surface that interacts with the DNA molecule. The molecular electrostatic potentials for the DNA, simulated as a discontinuous cylinder, were calculated using the values for all the base pairs. Computing these parameters, we calculated the relative energy of interaction and the more stable rotational setting of DNA. The binding of four molecules of netropsin to this model showed that a new minimum of energy is obtained when the DNA turns toward the protein surface by about 180 degrees, so a new energetically favoured structure appears where netropsin binding sites are located facing toward the histones surface. The effect of netropsin could be explained in terms of an induced change in the phasing of DNA on the core particle. The induced rotation is considered to optimize non-bonded contacts between the netropsin molecules and the DNA backbone. PMID:2165249

Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

DOEpatents

Soares, Marcelo Bento; Bonaldo, Maria de Fatima

1998-01-01

This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods.

Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

DOEpatents

Soares, M.B.; Fatima Bonaldo, M. de

1998-12-08

This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods. 25 figs.

Fixed-Gap Tunnel Junction for Reading DNA Nucleotides

PubMed Central

2015-01-01

Previous measurements of the electronic conductance of DNA nucleotides or amino acids have used tunnel junctions in which the gap is mechanically adjusted, such as scanning tunneling microscopes or mechanically controllable break junctions. Fixed-junction devices have, at best, detected the passage of whole DNA molecules without yielding chemical information. Here, we report on a layered tunnel junction in which the tunnel gap is defined by a dielectric layer, deposited by atomic layer deposition. Reactive ion etching is used to drill a hole through the layers so that the tunnel junction can be exposed to molecules in solution. When the metal electrodes are functionalized with recognition molecules that capture DNA nucleotides via hydrogen bonds, the identities of the individual nucleotides are revealed by characteristic features of the fluctuating tunnel current associated with single-molecule binding events. PMID:25380505

Controlled enzymatic cutting of DNA molecules adsorbed on surfaces using soft lithography

NASA Astrophysics Data System (ADS)

Auerbach, Alyssa; Budassi, Julia; Shea, Emily; Zhu, Ke; Sokolov, Jonathan

2013-03-01

The enzyme DNase I was applied to adsorbed and aligned DNA molecules (Lamda, 48.5 kilobase pairs (kbp), and T4, 165.6 kbp), stretched linearly on a surface, by stamping with a polydimethylsiloxane (PDMS) grating. The DNAs were cut by the enzyme into separated, micron-sized segments along the length of the molecules at positions determined by the grating dimensions (3-20 microns). Ozone-treated PDMS stamps were coated with DNase I solutions and placed in contact with surface-adsorbed DNA molecules deposited on a 750 polymethylmethacrylate (PMMA) film spun-cast onto a silicon substrate. The stamps were applied under pressure for times up to 15 minutes at 37 C. The cutting was observed by fluorescence microscopy imaging of DNA labeled with YOYO dye. Cutting was found to be efficient despite the steric hindrance due to surface attachment of the molecules. Methods for detaching and separating the cut segments for sequencing applications will be discussed. Supported by NSF-DMR program.

Application of encoded library technology (ELT) to a protein-protein interaction target: discovery of a potent class of integrin lymphocyte function-associated antigen 1 (LFA-1) antagonists.

PubMed

Kollmann, Christopher S; Bai, Xiaopeng; Tsai, Ching-Hsuan; Yang, Hongfang; Lind, Kenneth E; Skinner, Steven R; Zhu, Zhengrong; Israel, David I; Cuozzo, John W; Morgan, Barry A; Yuki, Koichi; Xie, Can; Springer, Timothy A; Shimaoka, Motomu; Evindar, Ghotas

2014-04-01

The inhibition of protein-protein interactions remains a challenge for traditional small molecule drug discovery. Here we describe the use of DNA-encoded library technology for the discovery of small molecules that are potent inhibitors of the interaction between lymphocyte function-associated antigen 1 and its ligand intercellular adhesion molecule 1. A DNA-encoded library with a potential complexity of 4.1 billion compounds was exposed to the I-domain of the target protein and the bound ligands were affinity selected, yielding an enriched small-molecule hit family. Compounds representing this family were synthesized without their DNA encoding moiety and found to inhibit the lymphocyte function-associated antigen 1/intercellular adhesion molecule-1 interaction with submicromolar potency in both ELISA and cell adhesion assays. Re-synthesized compounds conjugated to DNA or a fluorophore were demonstrated to bind to cells expressing the target protein. Copyright © 2014 Elsevier Ltd. All rights reserved.

Integrity and Biological Activity of DNA after UV Exposure

NASA Astrophysics Data System (ADS)

Lyon, Delina Y.; Monier, Jean-Michel; Dupraz, Sébastien; Freissinet, Caroline; Simonet, Pascal; Vogel, Timothy M.

2010-04-01

The field of astrobiology lacks a universal marker with which to indicate the presence of life. This study supports the proposal to use nucleic acids, specifically DNA, as a signature of life (biosignature). In addition to its specificity to living organisms, DNA is a functional molecule that can confer new activities and characteristics to other organisms, following the molecular biology dogma, that is, DNA is transcribed to RNA, which is translated into proteins. Previous criticisms of the use of DNA as a biosignature have asserted that DNA molecules would be destroyed by UV radiation in space. To address this concern, DNA in plasmid form was deposited onto different surfaces and exposed to UVC radiation. The surviving DNA was quantified via the quantitative polymerase chain reaction (qPCR). Results demonstrate increased survivability of DNA attached to surfaces versus non-adsorbed DNA. The DNA was also tested for biological activity via transformation into the bacterium Acinetobacter sp. and assaying for antibiotic resistance conferred by genes encoded by the plasmid. The success of these methods to detect DNA and its gene products after UV exposure (254 nm, 3.5 J/m2s) not only supports the use of the DNA molecule as a biosignature on mineral surfaces but also demonstrates that the DNA retained biological activity.

An isolated Hda-clamp complex is functional in the regulatory inactivation of DnaA and DNA replication.

PubMed

Kawakami, Hironori; Su'etsugu, Masayuki; Katayama, Tsutomu

2006-10-01

In Escherichia coli, a complex consisting of Hda and the DNA-loaded clamp-subunit of the DNA polymerase III holoenzyme promotes hydrolysis of DnaA-ATP. The resultant ADP-DnaA is inactive for initiation of chromosomal DNA replication, thereby repressing excessive initiations. As the cellular content of the clamp is 10-100 times higher than that of Hda, most Hda molecules might be complexed with the clamp in vivo. Although Hda predominantly forms irregular aggregates when overexpressed, in the present study we found that co-overexpression of the clamp with Hda enhances Hda solubility dramatically and we efficiently isolated the Hda-clamp complex. A single molecule of the complex appears to consist of two Hda molecules and a single clamp. The complex is competent in DnaA-ATP hydrolysis and DNA replication in the presence of DNA and the clamp deficient subassembly of the DNA polymerase III holoenzyme (pol III*). These findings indicate that the clamp contained in the complex is loaded onto DNA through an interaction with the pol III* and that the Hda activity is preserved in these processes. The complex consisting of Hda and the DNA-unloaded clamp may play a specific role in a process proceeding to the DnaA-ATP hydrolysis in vivo.

Cell-Based Selection Expands the Utility of DNA-Encoded Small-Molecule Library Technology to Cell Surface Drug Targets: Identification of Novel Antagonists of the NK3 Tachykinin Receptor.

PubMed

Wu, Zining; Graybill, Todd L; Zeng, Xin; Platchek, Michael; Zhang, Jean; Bodmer, Vera Q; Wisnoski, David D; Deng, Jianghe; Coppo, Frank T; Yao, Gang; Tamburino, Alex; Scavello, Genaro; Franklin, G Joseph; Mataruse, Sibongile; Bedard, Katie L; Ding, Yun; Chai, Jing; Summerfield, Jennifer; Centrella, Paolo A; Messer, Jeffrey A; Pope, Andrew J; Israel, David I

2015-12-14

DNA-encoded small-molecule library technology has recently emerged as a new paradigm for identifying ligands against drug targets. To date, this technology has been used with soluble protein targets that are produced and used in a purified state. Here, we describe a cell-based method for identifying small-molecule ligands from DNA-encoded libraries against integral membrane protein targets. We use this method to identify novel, potent, and specific inhibitors of NK3, a member of the tachykinin family of G-protein coupled receptors (GPCRs). The method is simple and broadly applicable to other GPCRs and integral membrane proteins. We have extended the application of DNA-encoded library technology to membrane-associated targets and demonstrate the feasibility of selecting DNA-tagged, small-molecule ligands from complex combinatorial libraries against targets in a heterogeneous milieu, such as the surface of a cell.

Single-molecule live-cell imaging of bacterial DNA repair and damage tolerance.

PubMed

Ghodke, Harshad; Ho, Han; van Oijen, Antoine M

2018-02-19

Genomic DNA is constantly under threat from intracellular and environmental factors that damage its chemical structure. Uncorrected DNA damage may impede cellular propagation or even result in cell death, making it critical to restore genomic integrity. Decades of research have revealed a wide range of mechanisms through which repair factors recognize damage and co-ordinate repair processes. In recent years, single-molecule live-cell imaging methods have further enriched our understanding of how repair factors operate in the crowded intracellular environment. The ability to follow individual biochemical events, as they occur in live cells, makes single-molecule techniques tremendously powerful to uncover the spatial organization and temporal regulation of repair factors during DNA-repair reactions. In this review, we will cover practical aspects of single-molecule live-cell imaging and highlight recent advances accomplished by the application of these experimental approaches to the study of DNA-repair processes in prokaryotes. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

An effective model of DNA like helicoidal structure: with length fluctuation nonlinearity

NASA Astrophysics Data System (ADS)

Tseytlin, Y. M.

2011-03-01

One of the natural helicoidal nanostructure, which thermomechanical features are studied carefully with the help of different mechanical models, is a DNA cell / molecule. Our study proves that the experimentally determined nonlinear fluctuations of the molecular length of DNA can be better understood by modeling the molecule as a helicoidal pretwisted nanostrip sensor with nonlinear function. The calculations presented here are in good agreement with the experimental data within 10%. Other used by many researchers mechanical models such as an elastic rod, wormlike chain (WLC), accordion bellows, or an elastic core wrapped with rigid wires do not show the possible variance nonlinearity of thermomechanical DNA molecular length fluctuations. We have found that the nonlinear variance of the length fluctuations is an intrinsic property of the micro-nano-sensors with helicoidal shape. This model allows us to estimate the persistence length and twist-stretch coupling of a DNA molecule as well. It also shows the molecule's overwinding possibility at initial stretching with correct numerical representation.

Unraveling DNA dynamics using atomic force microscopy.

PubMed

Suzuki, Yuki; Yoshikawa, Yuko; Yoshimura, Shige H; Yoshikawa, Kenichi; Takeyasu, Kunio

2011-01-01

The elucidation of structure-function relationships of biological samples has become important issue in post-genomic researches. In order to unveil the molecular mechanisms controlling gene regulations, it is essential to understand the interplay between fundamental DNA properties and the dynamics of the entire molecule. The wide range of applicability of atomic force microscopy (AFM) has allowed us to extract physicochemical properties of DNA and DNA-protein complexes, as well as to determine their topographical information. Here, we review how AFM techniques have been utilized to study DNA and DNA-protein complexes and what types of analyses have accelerated the understanding of the DNA dynamics. We begin by illustrating the application of AFM to investigate the fundamental feature of DNA molecules; topological transition of DNA, length dependent properties of DNA molecules, flexibility of double-stranded DNA, and capability of the formation of non-Watson-Crick base pairing. These properties of DNA are critical for the DNA folding and enzymatic reactions. The technical advancement in the time-resolution of AFM and sample preparation methods enabled visual analysis of DNA-protein interactions at sub-second time region. DNA tension-dependent enzymatic reaction and DNA looping dynamics by restriction enzymes were examined at a nanoscale in physiological environments. Contribution of physical properties of DNA to dynamics of nucleosomes and transition of the higher-order structure of reconstituted chromatin are also reviewed. Copyright © 2011 John Wiley & Sons, Inc.

Single molecule fluorescence microscopy for ultra-sensitive RNA expression profiling

NASA Astrophysics Data System (ADS)

Hesse, Jan; Jacak, Jaroslaw; Regl, Gerhard; Eichberger, Thomas; Aberger, Fritz; Schlapak, Robert; Howorka, Stefan; Muresan, Leila; Frischauf, Anna-Maria; Schütz, Gerhard J.

2007-02-01

We developed a microarray analysis platform for ultra-sensitive RNA expression profiling of minute samples. It utilizes a novel scanning system for single molecule fluorescence detection on cm2 size samples in combination with specialized biochips, optimized for low autofluorescence and weak unspecific adsorption. 20 μg total RNA was extracted from 10 6 cells of a human keratinocyte cell line (HaCaT) and reversely transcribed in the presence of Alexa647-aha-dUTP. 1% of the resulting labeled cDNA was used for complex hybridization to a custom-made oligonucleotide microarray representing a set of 125 different genes. For low abundant genes, individual cDNA molecules hybridized to the microarray spots could be resolved. Single cDNA molecules hybridized to the chip surface appeared as diffraction limited features in the fluorescence images. The à trous wavelet method was utilized for localization and counting of the separated cDNA signals. Subsequently, the degree of labeling of the localized cDNA molecules was determined by brightness analysis for the different genes. Variations by factors up to 6 were found, which in conventional microarray analysis would result in a misrepresentation of the relative abundance of mRNAs.

Analysis of branched DNA replication and recombination intermediates from prokaryotic cells by two-dimensional (2D) native-native agarose gel electrophoresis.

PubMed

Robinson, Nicholas P

2013-01-01

Branched DNA molecules are generated by the essential processes of replication and recombination. Owing to their distinctive extended shapes, these intermediates migrate differently from linear double-stranded DNA under certain electrophoretic conditions. However, these branched species exist in the cell at much low abundance than the bulk linear DNA. Consequently, branched molecules cannot be visualized by conventional electrophoresis and ethidium bromide staining. Two-dimensional native-native agarose electrophoresis has therefore been developed as a method to facilitate the separation and visualization of branched replication and recombination intermediates. A wide variety of studies have employed this technique to examine branched molecules in eukaryotic, archaeal, and bacterial cells, providing valuable insights into how DNA is duplicated and repaired in all three domains of life.

Single-molecule FRET studies of the cooperative and non-cooperative binding kinetics of the bacteriophage T4 single-stranded DNA binding protein (gp32) to ssDNA lattices at replication fork junctions

PubMed Central

Lee, Wonbae; Gillies, John P.; Jose, Davis; Israels, Brett A.; von Hippel, Peter H.; Marcus, Andrew H.

2016-01-01

Gene 32 protein (gp32) is the single-stranded (ss) DNA binding protein of the bacteriophage T4. It binds transiently and cooperatively to ssDNA sequences exposed during the DNA replication process and regulates the interactions of the other sub-assemblies of the replication complex during the replication cycle. We here use single-molecule FRET techniques to build on previous thermodynamic studies of gp32 binding to initiate studies of the dynamics of the isolated and cooperative binding of gp32 molecules within the replication complex. DNA primer/template (p/t) constructs are used as models to determine the effects of ssDNA lattice length, gp32 concentration, salt concentration, binding cooperativity and binding polarity at p/t junctions. Hidden Markov models (HMMs) and transition density plots (TDPs) are used to characterize the dynamics of the multi-step assembly pathway of gp32 at p/t junctions of differing polarity, and show that isolated gp32 molecules bind to their ssDNA targets weakly and dissociate quickly, while cooperatively bound dimeric or trimeric clusters of gp32 bind much more tightly, can ‘slide’ on ssDNA sequences, and exhibit binding dynamics that depend on p/t junction polarities. The potential relationships of these binding dynamics to interactions with other components of the T4 DNA replication complex are discussed. PMID:27694621

Protein Detection via Direct Enzymatic Amplification of Short DNA Aptamers

PubMed Central

Fischer, Nicholas O.; Tarasow, Theodore M.; Tok, Jeffrey B.-H.

2008-01-01

Aptamers are single-stranded nucleic acids that fold into defined tertiary structures to bind target molecules with high specificities and affinities. DNA aptamers have garnered much interest as recognition elements for biodetection and diagnostic applications due to their small size, ease of discovery and synthesis, and chemical and thermal stability. Herein, we describe the design and application of a short DNA molecule capable of both protein target binding and amplifiable bioreadout processes. As both recognition and readout capabilities are incorporated into a single DNA molecule, tedious conjugation procedures required for protein-DNA hybrids can be omitted. The DNA aptamer is designed to be amplified directly by either the polymerase chain reaction (PCR) or rolling circle amplification (RCA) processes, taking advantage of real-time amplification monitoring techniques for target detection. A combination of both RCA and PCR provides a wide protein target dynamic range (1 μM to 10 pM). PMID:17980857

DNA Structure and Supercoiling: Ribbons and a Yo-Yo Model

ERIC Educational Resources Information Center

Van Horn, J. David

2011-01-01

The double-helical structure of DNA is a pop cultural icon. Images of the DNA molecule appear in newspapers, popular journals, and advertisements. In addition to scientific instrument sales, the aura surrounding the central molecule of life has been used to sell everything from perfume to beverages and is the inspiration of items ranging from…

Effect of gold nanoparticle on stability of the DNA molecule: A study of molecular dynamics simulation.

PubMed

Izanloo, Cobra

2017-09-02

An understanding of the mechanism of DNA interactions with gold nanoparticles is useful in today medicine applications. We have performed a molecular dynamics simulation on a B-DNA duplex (CCTCAGGCCTCC) in the vicinity of a gold nanoparticle with a truncated octahedron structure composed of 201 gold atoms (diameter ∼1.8 nm) to investigate gold nanoparticle (GNP) effects on the stability of DNA. During simulation, the nanoparticle is closed to DNA and phosphate groups direct the particles into the major grooves of the DNA molecule. Because of peeling and untwisting states that are occur at end of DNA, the nucleotide base lies flat on the surface of GNP. The configuration entropy is estimated using the covariance matrix of atom-positional fluctuations for different bases. The results show that when a gold nanoparticle has interaction with DNA, entropy increases. The results of conformational energy and the hydrogen bond numbers for DNA indicated that DNA becomes unstable in the vicinity of a gold nanoparticle. The radial distribution function was calculated for water hydrogen-phosphate oxygen pairs. Almost for all nucleotide, the presence of a nanoparticle around DNA caused water molecules to be released from the DNA duplex and cations were close to the DNA.

Single molecule analysis of Thermus thermophilus SSB protein dynamics on single-stranded DNA.

PubMed

Zhang, Jichuan; Zhou, Ruobo; Inoue, Jin; Mikawa, Tsutomu; Ha, Taekjip

2014-04-01

Single-stranded (ss) DNA binding (SSB) proteins play central roles in DNA replication, recombination and repair in all organisms. We previously showed that Escherichia coli (Eco) SSB, a homotetrameric bacterial SSB, undergoes not only rapid ssDNA-binding mode transitions but also one-dimensional diffusion (or migration) while remaining bound to ssDNA. Whereas the majority of bacterial SSB family members function as homotetramers, dimeric SSB proteins were recently discovered in a distinct bacterial lineage of extremophiles, the Thermus-Deinococcus group. Here we show, using single-molecule fluorescence resonance energy transfer (FRET), that homodimeric bacterial SSB from Thermus thermophilus (Tth) is able to diffuse spontaneously along ssDNA over a wide range of salt concentrations (20-500 mM NaCl), and that TthSSB diffusion can help transiently melt the DNA hairpin structures. Furthermore, we show that two TthSSB molecules undergo transitions among different DNA-binding modes while remaining bound to ssDNA. Our results extend our previous observations on homotetrameric SSBs to homodimeric SSBs, indicating that the dynamic features may be shared among different types of SSB proteins. These dynamic features of SSBs may facilitate SSB redistribution and removal on/from ssDNA, and help recruit other SSB-interacting proteins onto ssDNA for subsequent DNA processing in DNA replication, recombination and repair.

Periodic Assembly of Nanospecies on Repetitive DNA Sequences Generated on Gold Nanoparticles by Rolling Circle Amplification

NASA Astrophysics Data System (ADS)

Zhao, Weian; Brook, Michael A.; Li, Yingfu

Periodical assembly of nanospecies is desirable for the construction of nanodevices. We provide a protocol for the preparation of a gold nanoparticle (AuNP)/DNA scaffold on which nanospecies can be assembled in a periodical manner. AuNP/DNA scaffold is prepared by growing long single-stranded DNA (ssDNA) molecules (typically hundreds of nanometers to a few microns in length) on AuNPs via rolling circle amplification (RCA). Since these long ssDNA molecules contain many repetitive sequence units, complementary DNA-attached nanospecies can be assembled through specific hybridization in a controllable and periodical manner.

Single DNA molecules on freestanding and supported cationic lipid bilayers: diverse conformational dynamics controlled by the local bilayer properties

NASA Astrophysics Data System (ADS)

Herold, Christoph; Schwille, Petra; Petrov, Eugene P.

2016-02-01

We present experimental results on the interaction of DNA macromolecules with cationic lipid membranes with different properties, including freestanding membranes in the fluid and gel state, and supported lipid membranes in the fluid state and under conditions of fluid-gel phase coexistence. We observe diverse conformational dynamics of membrane-bound DNA molecules controlled by the local properties of the lipid bilayer. In case of fluid-state freestanding lipid membranes, the behaviour of DNA on the membrane is controlled by the membrane charge density: whereas DNA bound to weakly charged membranes predominantly behaves as a 2D random coil, an increase in the membrane charge density leads to membrane-driven irreversible DNA collapse and formation of subresolution-sized DNA globules. On the other hand, electrostatic binding of DNA macromolecules to gel-state freestanding membranes leads to completely arrested diffusion and conformational dynamics of membrane-adsorbed DNA. A drastically different picture is observed in case of DNA interaction with supported cationic lipid bilayers: When the supported bilayer is in the fluid state, membrane-bound DNA molecules undergo 2D translational Brownian motion and conformational fluctuations, irrespectively of the charge density of the supported bilayer. At the same time, when the supported cationic membrane shows fluid-gel phase coexistence, membrane-bound DNA molecules are strongly attracted to micrometre-sized gel-phase domains enriched with the cationic lipid, which results in 2D compaction of the membrane-bound macromolecules. This DNA compaction, however, is fully reversible, and disappears as soon as the membrane is heated above the fluid-gel coexistence. We also discuss possible biological implications of our experimental findings.

An introduction to the mechanics of DNA.

PubMed

Travers, A A; Thompson, J M T

2004-07-15

This article gives an overview of recent research on the mechanical properties and spatial deformations of the DNA molecule. Globally the molecule behaves like a uniform elastic rod, and its twisting and writhing govern its compaction and packaging within a cell. Meanwhile high mechanical stresses can induce structural transitions of DNA giving, for example, a phase diagram in the space of the applied tension and torque. Locally, the mechanical properties vary according to the local sequence organization. These variations play a vital role in the biological functioning of the molecule.

Characterization of individual polynucleotide molecules using a membrane channel

NASA Technical Reports Server (NTRS)

Kasianowicz, J. J.; Brandin, E.; Branton, D.; Deamer, D. W.

1996-01-01

We show that an electric field can drive single-stranded RNA and DNA molecules through a 2.6-nm diameter ion channel in a lipid bilayer membrane. Because the channel diameter can accommodate only a single strand of RNA or DNA, each polymer traverses the membrane as an extended chain that partially blocks the channel. The passage of each molecule is detected as a transient decrease of ionic current whose duration is proportional to polymer length. Channel blockades can therefore be used to measure polynucleotide length. With further improvements, the method could in principle provide direct, high-speed detection of the sequence of bases in single molecules of DNA or RNA.

Surface Biology of DNA by Atomic Force Microscopy

NASA Astrophysics Data System (ADS)

Hansma, Helen G.

2001-10-01

The atomic force microscope operates on surfaces. Since surfaces occupy much of the space in living organisms, surface biology is a valid and valuable form of biology that has been difficult to investigate in the past owing to a lack of good technology. Atomic force microscopy (AFM) of DNA has been used to investigate DNA condensation for gene therapy, DNA mapping and sizing, and a few applications to cancer research and to nanotechnology. Some of the most exciting new applications for atomic force microscopy of DNA involve pulling on single DNA molecules to obtain measurements of single-molecule mechanics and thermodynamics.

Direct Observation of Azimuthal Correlations between DNA in Hydrated Aggregates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kornyshev, Alexei A.; Lee, Dominic J.; Wynveen, Aaron

2005-09-30

This study revisits the classical x-ray diffraction patterns from hydrated, noncrystalline fibers originally used to establish the helical structure of DNA. We argue that changes in these diffraction patterns with DNA packing density reveal strong azimuthally dependent interactions between adjacent molecules up to {approx}40 A interaxial or {approx}20 A surface-to-surface separations. These interactions appear to force significant torsional 'straightening' of DNA and strong azimuthal alignment of nearest neighbor molecules. The results are in good agreement with the predictions of recent theoretical models relating DNA-DNA interactions to the helical symmetry of their surface charge patterns.

Coaxial atomic force microscope probes for dielectrophoresis of DNA under different buffer conditions

NASA Astrophysics Data System (ADS)

Tao, Yinglei; Kumar Wickramasinghe, H.

2017-02-01

We demonstrate a coaxial AFM nanoprobe device for dielectrophoretic (DEP) trapping of DNA molecules in Tris-EDTA (TE) and phosphate-buffered saline (PBS) buffers. The DEP properties of 20 nm polystyrene beads were studied with coaxial probes in media with different conductivities. Due to the special geometry of our DEP probe device, sufficiently high electric fields were generated at the probe end to focus DNA molecules with positive DEP. DEP trapping for both polystyrene beads and DNA molecules was quantitatively analyzed over the frequency range from 100 kHz to 50 MHz and compared with the Clausius-Mossotti theory. Finally, we discussed the negative effect of medium salinity during DEP trapping.

Probing the size of proteins with glass nanopores

NASA Astrophysics Data System (ADS)

Steinbock, L. J.; Krishnan, S.; Bulushev, R. D.; Borgeaud, S.; Blokesch, M.; Feletti, L.; Radenovic, A.

2014-11-01

Single molecule studies using nanopores have gained attention due to the ability to sense single molecules in aqueous solution without the need to label them. In this study, short DNA molecules and proteins were detected with glass nanopores, whose sensitivity was enhanced by electron reshaping which decreased the nanopore diameter and created geometries with a reduced sensing length. Further, proteins having molecular weights (MW) ranging from 12 kDa to 480 kDa were detected, which showed that their corresponding current peak amplitude changes according to their MW. In the case of the 12 kDa ComEA protein, its DNA-binding properties to an 800 bp long DNA molecule was investigated. Moreover, the influence of the pH on the charge of the protein was demonstrated by showing a change in the translocation direction. This work emphasizes the wide spectrum of detectable molecules using nanopores from glass nanocapillaries, which stand out because of their inexpensive, lithography-free, and rapid manufacturing process.Single molecule studies using nanopores have gained attention due to the ability to sense single molecules in aqueous solution without the need to label them. In this study, short DNA molecules and proteins were detected with glass nanopores, whose sensitivity was enhanced by electron reshaping which decreased the nanopore diameter and created geometries with a reduced sensing length. Further, proteins having molecular weights (MW) ranging from 12 kDa to 480 kDa were detected, which showed that their corresponding current peak amplitude changes according to their MW. In the case of the 12 kDa ComEA protein, its DNA-binding properties to an 800 bp long DNA molecule was investigated. Moreover, the influence of the pH on the charge of the protein was demonstrated by showing a change in the translocation direction. This work emphasizes the wide spectrum of detectable molecules using nanopores from glass nanocapillaries, which stand out because of their inexpensive, lithography-free, and rapid manufacturing process. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr05001k

Micromanipulation by laser microbeam and optical tweezers: from plant cells to single molecules.

PubMed

Greulich, K O; Pilarczyk, G; Hoffmann, A; Meyer Zu Hörste, G; Schäfer, B; Uhl, V; Monajembashi, S

2000-06-01

Complete manipulation by laser light allows precise and gentle treatment of plant cells, subcellular structures, and even individual DNA molecules. Recently, affordable lasers have become available for the construction of microbeams as well as for optical tweezers. This may generate new interest in these tools for plant biologists. Early experiments, reviewed in this journal, showed that laser supported microinjection of material into plant cells or tissues circumvents mechanical problems encountered in microinjection by fragile glass capillaries. Plant protoplasts could be fused with each other when under microscopical observation, and it was no major problem to generate a triple or quadruple fusion product. In the present paper we review experiments where membrane material was prepared from root hair tips and microgravity was simulated in algae. As many plant cells are transparent, it is possible to work inside living, intact cells. New experiments show that it is possible to release by optical micromanipulation, with high spatial resolutions, intracellular calcium from caged compounds and to study calcium oscillations. An example for avian cardiac tissue is given, but the technique is also suitable for plant cell research. As a more technical tool, optical tweezers can be used to spatially fix subcellular structures otherwise moving inside a cell and thus make them available for investigation with a confocal microscope even when the time for image formation is extended (for example at low fluorescence emission). A molecular biological example is the handling of chromosomes and isolated individual DNA molecules by laser microtools. For example, chromosomes can be cut along complex trajectories, not only perpendicular to their long axis. Single DNA molecules are cut by the laser microbeam and, after coupling such a molecule to a polystrene microbead, are handled in complex geometries. Here, the individual DNA molecules are made visible with a conventional fluorescence microscope by fluorescent dyes such as SYBRGreen. The cutting of a single DNA molecule by molecules of the restriction endonuclease EcoRI can be observed directly, i.e. a type of single molecule restriction analysis is possible. Finally, mechanical properties of individual DNA molecules can be observed directly.

Methods for immobilizing nucleic acids on a gel substrate

DOEpatents

Mirzabekov, Andrei Darievich; Proudnikov, Dimitri Y.; Timofeev, Edward N.; Kochetkova, Svetlana V.; Florentiev, Vladimir L.; Shick, Valentine V.

1999-01-01

A method for labeling oligonucleotide molecules, and for immobilizing oligonucleotide and DNA molecules is provided comprising modifying the molecules to create a chemically active group, and contacting activated fluorescent dyes to the region. A method for preparing an immobilization substrate is also provided comprising modifying a gel to contain desired functional groups which covalently interact with certain moieties of the oligonucleotide molecules. A method for immobilizing biomolecules and other molecules within a gel by copolymerization of allyl-substituted oligonucleotides, DNA and proteins with acrylamide is also provided.

Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

NASA Astrophysics Data System (ADS)

Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

2018-04-01

We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

Laser microtreatment for genetic manipulations and DNA diagnostics by a combination of microbeam and photonic tweezers (laser microbeam trap)

NASA Astrophysics Data System (ADS)

Greulich, Karl-Otto; Monajembashi, Shamci; Celeda, D.; Endlich, N.; Eickhoff, Holger; Hoyer, Carsten; Leitz, G.; Weber, Gerd; Scheef, J.; Rueterjans, H.

1994-12-01

Genomes of higher organisms are larger than one typically expects. For example, the DNA of a single human cell is almost two meters long, the DNA in the human body covers the distance Earth-Sun approximately 140 times. This is often not considered in typical molecular biological approaches for DNA diagnostics, where usually only DNA of the length of a gene is investigated. Also, one basic aspect of sequencing the human genome is not really solved: the problem how to prepare the huge amounts of DNA required. Approaches from biomedical optics combined with new developments in single molecule biotechnology may at least contribute some parts of the puzzle. A large genome can be partitioned into portions comprising approximately 1% of the whole DNA using a laser microbeam. The single DNA fragment can be amplified by the polymerase chain reaction in order to obtain a sufficient amount of molecules for conventional DNA diagnostics or for analysis by octanucleotide hybridization. When not amplified by biotechnological processes, the individual DNA molecule can be visualized in the light microscope and can be manipulated and dissected with the laser microbeam trap. The DNA probes obtained by single molecule biotechnology can be employed for fluorescence in situ introduced into plant cells and subcellular structures even when other techniques fail. Since the laser microbeam trap allows to work in the interior of a cell without opening it, subcellular structures can be manipulated. For example, in algae, such structures can be moved out of their original position and used to study intracellular viscosities.

Multicopy Single-Stranded DNA Directs Intestinal Colonization of Enteric Pathogens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.

Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking itsmore » retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.« less

Multicopy single-stranded DNA directs intestinal colonization of enteric pathogens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.

Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking itsmore » retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate, but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.« less

Multicopy single-stranded DNA directs intestinal colonization of enteric pathogens

DOE PAGES

Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; ...

2015-09-14

Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking itsmore » retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate, but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.« less

DNA profiles, computer searches, and the Fourth Amendment.

PubMed

Kimel, Catherine W

2013-01-01

Pursuant to federal statutes and to laws in all fifty states, the United States government has assembled a database containing the DNA profiles of over eleven million citizens. Without judicial authorization, the government searches each of these profiles one-hundred thousand times every day, seeking to link database subjects to crimes they are not suspected of committing. Yet, courts and scholars that have addressed DNA databasing have focused their attention almost exclusively on the constitutionality of the government's seizure of the biological samples from which the profiles are generated. This Note fills a gap in the scholarship by examining the Fourth Amendment problems that arise when the government searches its vast DNA database. This Note argues that each attempt to match two DNA profiles constitutes a Fourth Amendment search because each attempted match infringes upon database subjects' expectations of privacy in their biological relationships and physical movements. The Note further argues that database searches are unreasonable as they are currently conducted, and it suggests an adaptation of computer-search procedures to remedy the constitutional deficiency.

Selective inhibition of c-Myc/Max dimerization and DNA binding by small molecules.

PubMed

Kiessling, Anke; Sperl, Bianca; Hollis, Angela; Eick, Dirk; Berg, Thorsten

2006-07-01

bZip and bHLHZip protein family members comprise a large fraction of eukaryotic transcription factors and need to bind DNA in order to exert most of their fundamental biological roles. Their binding to DNA requires homo- or heterodimerization via alpha-helical domains, which generally do not contain obvious binding sites for small molecules. We have identified two small molecules, dubbed Mycro1 and Mycro2, which inhibit the protein-protein interactions between the bHLHZip proteins c-Myc and Max. Mycros are the first inhibitors of c-Myc/Max dimerization, which have been demonstrated to inhibit DNA binding of c-Myc with preference over other dimeric transcription factors in vitro. Mycros inhibit c-Myc-dependent proliferation, gene transcription, and oncogenic transformation in the low micromolar concentration range. Our data support the idea that dimeric transcription factors can be druggable even in the absence of obvious small-molecule binding pockets.

Adaptive resolution simulation of oligonucleotides

NASA Astrophysics Data System (ADS)

Netz, Paulo A.; Potestio, Raffaello; Kremer, Kurt

2016-12-01

Nucleic acids are characterized by a complex hierarchical structure and a variety of interaction mechanisms with other molecules. These features suggest the need of multiscale simulation methods in order to grasp the relevant physical properties of deoxyribonucleic acid (DNA) and RNA using in silico experiments. Here we report an implementation of a dual-resolution modeling of a DNA oligonucleotide in physiological conditions; in the presented setup only the nucleotide molecule and the solvent and ions in its proximity are described at the atomistic level; in contrast, the water molecules and ions far from the DNA are represented as computationally less expensive coarse-grained particles. Through the analysis of several structural and dynamical parameters, we show that this setup reliably reproduces the physical properties of the DNA molecule as observed in reference atomistic simulations. These results represent a first step towards a realistic multiscale modeling of nucleic acids and provide a quantitatively solid ground for their simulation using dual-resolution methods.

Targeting of loaded Sendai virus envelopes by covalently attached insulin molecules to virus receptor-depleted cells: fusion-mediated microinjection of ricin A and simian virus 40 DNA.

PubMed

Gitman, A G; Graessmann, A; Loyter, A

1985-11-01

Insulin molecules were covalently attached to detergent-solubilized Sendai virus envelope glycoproteins (HN and F polypeptides) by the use of the crosslinking reagent succinimidyl 4-(p-maleimidophenyl)butyrate (SMPB). Reconstitution of modified viral glycoproteins (carrying covalently attached insulin) together with unmodified viral glycoproteins resulted in the formation of "fusogenic" viral envelopes bearing insulin molecules. Reconstitution of such fusogenic viral envelopes in the presence of ricin A or simian virus 40 (SV40) DNA resulted in the formation of viral envelopes bearing insulin molecules and loaded with ricin A or SV40 DNA. Such viral envelopes were able to bind to hepatoma tissue culture cells (HTCC) from which Sendai virus receptors were removed by treatment with neuraminidase. Incubation of viral envelopes loaded with ricin A with virus receptor-depleted HTCC resulted in fusion-mediated injection of the toxin, as inferred from inhibition of protein synthesis and decrease in cell viability of the microinjected cells. Fusion-mediated injection of SV40 DNA was inferred from the appearance of SV40 tumor antigen in microinjected cells. Binding and fusion of the loaded viral envelopes to neuraminidase-treated HTCC was mediated solely by the virus-associated insulin molecules. Addition of free insulin molecules inhibited binding of the viral envelopes and, consequently, the microinjection of ricin A and SV40 DNA.

Targeting of loaded Sendai virus envelopes by covalently attached insulin molecules to virus receptor-depleted cells: fusion-mediated microinjection of ricin A and simian virus 40 DNA.

PubMed Central

Gitman, A G; Graessmann, A; Loyter, A

1985-01-01

Insulin molecules were covalently attached to detergent-solubilized Sendai virus envelope glycoproteins (HN and F polypeptides) by the use of the crosslinking reagent succinimidyl 4-(p-maleimidophenyl)butyrate (SMPB). Reconstitution of modified viral glycoproteins (carrying covalently attached insulin) together with unmodified viral glycoproteins resulted in the formation of "fusogenic" viral envelopes bearing insulin molecules. Reconstitution of such fusogenic viral envelopes in the presence of ricin A or simian virus 40 (SV40) DNA resulted in the formation of viral envelopes bearing insulin molecules and loaded with ricin A or SV40 DNA. Such viral envelopes were able to bind to hepatoma tissue culture cells (HTCC) from which Sendai virus receptors were removed by treatment with neuraminidase. Incubation of viral envelopes loaded with ricin A with virus receptor-depleted HTCC resulted in fusion-mediated injection of the toxin, as inferred from inhibition of protein synthesis and decrease in cell viability of the microinjected cells. Fusion-mediated injection of SV40 DNA was inferred from the appearance of SV40 tumor antigen in microinjected cells. Binding and fusion of the loaded viral envelopes to neuraminidase-treated HTCC was mediated solely by the virus-associated insulin molecules. Addition of free insulin molecules inhibited binding of the viral envelopes and, consequently, the microinjection of ricin A and SV40 DNA. PMID:2997783

In vitro selection of shape-changing DNA nanostructures capable of binding-induced cargo release.

PubMed

Oh, Seung Soo; Plakos, Kory; Xiao, Yi; Eisenstein, Michael; Soh, H Tom

2013-11-26

Many biological systems employ allosteric regulatory mechanisms, which offer a powerful means of directly linking a specific binding event to a wide spectrum of molecular functionalities. There is considerable interest in generating synthetic allosteric regulators that can perform useful molecular functions for applications in diagnostics, imaging and targeted therapies, but generating such molecules through either rational design or directed evolution has proven exceptionally challenging. To address this need, we present an in vitro selection strategy for generating conformation-switching DNA nanostructures that selectively release a small-molecule payload in response to binding of a specific trigger molecule. As an exemplar, we have generated a DNA nanostructure that hybridizes with a separate 'cargo strand' containing an abasic site. This abasic site stably sequesters a fluorescent cargo molecule in an inactive state until the DNA nanostructure encounters an ATP trigger molecule. This ATP trigger causes the nanostructure to release the cargo strand, thereby liberating the fluorescent payload and generating a detectable fluorescent readout. Our DNA nanostructure is highly sensitive, with an EC50 of 30 μM, and highly specific, releasing its payload in response to ATP but not to other chemically similar nucleotide triphosphates. We believe that this selection approach could be generalized to generate synthetic nanostructures capable of selective and controlled release of other small-molecule cargos in response to a variety of triggers, for both research and clinical applications.

Extracellular Mitochondria and Mitochondrial Components Act as Damage-Associated Molecular Pattern Molecules in the Mouse Brain.

PubMed

Wilkins, Heather M; Koppel, Scott J; Weidling, Ian W; Roy, Nairita; Ryan, Lauren N; Stanford, John A; Swerdlow, Russell H

2016-12-01

Mitochondria and mitochondrial debris are found in the brain's extracellular space, and extracellular mitochondrial components can act as damage associated molecular pattern (DAMP) molecules. To characterize the effects of potential mitochondrial DAMP molecules on neuroinflammation, we injected either isolated mitochondria or mitochondrial DNA (mtDNA) into hippocampi of C57BL/6 mice and seven days later measured markers of inflammation. Brains injected with whole mitochondria showed increased Tnfα and decreased Trem2 mRNA, increased GFAP protein, and increased NFκB phosphorylation. Some of these effects were also observed in brains injected with mtDNA (decreased Trem2 mRNA, increased GFAP protein, and increased NFκB phosphorylation), and mtDNA injection also caused several unique changes including increased CSF1R protein and AKT phosphorylation. To further establish the potential relevance of this response to Alzheimer's disease (AD), a brain disorder characterized by neurodegeneration, mitochondrial dysfunction, and neuroinflammation we also measured App mRNA, APP protein, and Aβ 1-42 levels. We found mitochondria (but not mtDNA) injections increased these parameters. Our data show that in the mouse brain extracellular mitochondria and its components can induce neuroinflammation, extracellular mtDNA or mtDNA-associated proteins can contribute to this effect, and mitochondria derived-DAMP molecules can influence AD-associated biomarkers.

Integration of single-molecule detection with magnetic separation for multiplexed detection of DNA glycosylases.

PubMed

Li, Chen-Chen; Zhang, Yan; Tang, Bo; Zhang, Chun-Yang

2018-06-05

We combine single-molecule detection with magnetic separation for simultaneous measurement of human 8-oxoG DNA glycosylase 1 (hOGG1) and uracil DNA glycosylase (UDG) based on excision repair-initiated endonuclease IV (Endo IV)-assisted signal amplification. This method can sensitively detect multiple DNA glycosylases, and it can be further applied for the simultaneous measurement of enzyme kinetic parameters and screening of both hOGG1 and UDG inhibitors.

Biomedical Requirements for High Productivity Computing Systems

DTIC Science & Technology

2005-04-01

server at http://www.ncbi.nlm.nih.gov/BLAST/. There are many variants of BLAST, including: 1. BLASTN - Compares a DNA query to a DNA database. Searches ...database (3 reading frames from each strand of the DNA) searching . 13 4. TBLASTN - Compares a protein query to a DNA database, in the 6 possible...the molecular during this phase. After eliminating molecules that could not match the query , an atom-by-atom search for the molecules in conducted

Electrophoresis of DNA in agarose gels, polyacrylamide gels and in free solution

PubMed Central

Stellwagen, Nancy C.

2009-01-01

This review describes the electrophoresis of curved and normal DNA molecules in agarose gels, polyacrylamide gels and in free solution. These studies were undertaken to clarify why curved DNA molecules migrate anomalously slowly in polyacrylamide gels but not in agarose gels. Two milestone papers are cited, in which Ferguson plots were used to estimate the effective pore size of agarose and polyacrylamide gels. Subsequent studies on the effect of the electric field on agarose and polyacrylamide gel matrices, DNA interactions with the two gel matrices, and the effect of curvature on the free solution mobility of DNA are also described. The combined results suggest that the anomalously slow mobilities observed for curved DNA molecules in polyacrylamide gels are due primarily to preferential interactions of curved DNAs with the polyacrylamide gel matrix; the restrictive pore size of the matrix is of lesser importance. In free solution, DNA mobilities increase with increasing molecular mass until leveling off at a plateau value of (3.17 ± 0.01) × 10-4 cm2/Vs in 40 mM Tris-acetate-EDTA buffer at 20°C. Curved DNA molecules migrate anomalously slowly in free solution as well as in polyacrylamide gels, explaining why the Ferguson plots of curved and normal DNAs containing the same number of base pairs extrapolate to different mobilities at zero gel concentration. PMID:19517510

Static and Dynamic Properties of DNA Confined in Nanochannels

NASA Astrophysics Data System (ADS)

Gupta, Damini

Next-generation sequencing (NGS) techniques have considerably reduced the cost of high-throughput DNA sequencing. However, it is challenging to detect large-scale genomic variations by NGS due to short read lengths. Genome mapping can easily detect large-scale structural variations because it operates on extremely large intact molecules of DNA with adequate resolution. One of the promising methods of genome mapping is based on confining large DNA molecules inside a nanochannel whose cross-sectional dimensions are approximately 50 nm. Even though this genome mapping technology has been commercialized, the current understanding of the polymer physics of DNA in nanochannel confinement is based on theories and lacks much needed experimental support. The results of this dissertation are aimed at providing a detailed experimental understanding of equilibrium properties of nanochannel-confined DNA molecules. The results are divided into three parts. In first part, we evaluate the role of channel shape on thermodynamic properties of channel confined DNA molecules using a combination of fluorescence microscopy and simulations. Specifically, we show that high aspect ratio of rectangular channels significantly alters the chain statistics as compared to an equivalent square channel with same cross-sectional area. In the second part, we present experimental evidence that weak excluded volume effects arise in DNA nanochannel confinement, which form the physical basis for the extended de Gennes regime. We also show how confinement spectroscopy and simulations can be combined to reduce molecular weight dispersity effects arising from shearing, photo-cleavage, and nonuniform staining of DNA. Finally, the third part of the thesis concerns the dynamic properties of nanochannel confined DNA. We directly measure the center-of-mass diffusivity of single DNA molecules in confinement and show that that it is necessary to modify the classical results of de Gennes to account for local chain stiffness of DNA in order to explain the experimental results. In the end, we believe that our findings from the experimental test of the phase diagram for channel-confined DNA, with careful control over molecular weight dispersity, channel geometry, and electrostatic interactions, will provide a firm foundation for the emerging genome mapping technology.

Cancer, viruses, and mass migration: Paul Berg's venture into eukaryotic biology and the advent of recombinant DNA research and technology, 1967-1980.

PubMed

Yi, Doogab

2008-01-01

The existing literature on the development of recombinant DNA technology and genetic engineering tends to focus on Stanley Cohen and Herbert Boyer's recombinant DNA cloning technology and its commercialization starting in the mid-1970s. Historians of science, however, have pointedly noted that experimental procedures for making recombinant DNA molecules were initially developed by Stanford biochemist Paul Berg and his colleagues, Peter Lobban and A. Dale Kaiser in the early 1970s. This paper, recognizing the uneasy disjuncture between scientific authorship and legal invention in the history of recombinant DNA technology, investigates the development of recombinant DNA technology in its full scientific context. I do so by focusing on Stanford biochemist Berg's research on the genetic regulation of higher organisms. As I hope to demonstrate, Berg's new venture reflected a mass migration of biomedical researchers as they shifted from studying prokaryotic organisms like bacteria to studying eukaryotic organisms like mammalian and human cells. It was out of this boundary crossing from prokaryotic to eukaryotic systems through virus model systems that recombinant DNA technology and other significant new research techniques and agendas emerged. Indeed, in their attempt to reconstitute 'life' as a research technology, Stanford biochemists' recombinant DNA research recast genes as a sequence that could be rewritten thorough biochemical operations. The last part of this paper shifts focus from recombinant DNA technology's academic origins to its transformation into a genetic engineering technology by examining the wide range of experimental hybridizations which occurred as techniques and knowledge circulated between Stanford biochemists and the Bay Area's experimentalists. Situating their interchange in a dense research network based at Stanford's biochemistry department, this paper helps to revise the canonized history of genetic engineering's origins that emerged during the patenting of Cohen-Boyer's recombinant DNA cloning procedures.

Identification of column edges of DNA fragments by using K-means clustering and mean algorithm on lane histograms of DNA agarose gel electrophoresis images

NASA Astrophysics Data System (ADS)

Turan, Muhammed K.; Sehirli, Eftal; Elen, Abdullah; Karas, Ismail R.

2015-07-01

Gel electrophoresis (GE) is one of the most used method to separate DNA, RNA, protein molecules according to size, weight and quantity parameters in many areas such as genetics, molecular biology, biochemistry, microbiology. The main way to separate each molecule is to find borders of each molecule fragment. This paper presents a software application that show columns edges of DNA fragments in 3 steps. In the first step the application obtains lane histograms of agarose gel electrophoresis images by doing projection based on x-axis. In the second step, it utilizes k-means clustering algorithm to classify point values of lane histogram such as left side values, right side values and undesired values. In the third step, column edges of DNA fragments is shown by using mean algorithm and mathematical processes to separate DNA fragments from the background in a fully automated way. In addition to this, the application presents locations of DNA fragments and how many DNA fragments exist on images captured by a scientific camera.

Model of biological quantum logic in DNA.

PubMed

Mihelic, F Matthew

2013-08-02

The DNA molecule has properties that allow it to act as a quantum logic processor. It has been demonstrated that there is coherent conduction of electrons longitudinally along the DNA molecule through pi stacking interactions of the aromatic nucleotide bases, and it has also been demonstrated that electrons moving longitudinally along the DNA molecule are subject to a very efficient electron spin filtering effect as the helicity of the DNA molecule interacts with the spin of the electron. This means that, in DNA, electrons are coherently conducted along a very efficient spin filter. Coherent electron spin is held in a logically and thermodynamically reversible chiral symmetry between the C2-endo and C3-endo enantiomers of the deoxyribose moiety in each nucleotide, which enables each nucleotide to function as a quantum gate. The symmetry break that provides for quantum decision in the system is determined by the spin direction of an electron that has an orbital angular momentum that is sufficient to overcome the energy barrier of the double well potential separating the C2-endo and C3-endo enantiomers, and that enantiomeric energy barrier is appropriate to the Landauer limit of the energy necessary to randomize one bit of information.

Understanding the mechanism of DNA deactivation in ion therapy of cancer cells: hydrogen peroxide action*

NASA Astrophysics Data System (ADS)

Piatnytskyi, Dmytro V.; Zdorevskyi, Oleksiy O.; Perepelytsya, Sergiy M.; Volkov, Sergey N.

2015-11-01

Changes in the medium of biological cells under ion beam irradiation has been considered as a possible cause of cell function disruption in the living body. The interaction of hydrogen peroxide, a long-lived molecular product of water radiolysis, with active sites of DNA macromolecule was studied, and the formation of stable DNA-peroxide complexes was considered. The phosphate groups of the macromolecule backbone were picked out among the atomic groups of DNA double helix as a probable target for interaction with hydrogen peroxide molecules. Complexes consisting of combinations including: the DNA phosphate group, H2O2 and H2O molecules, and Na+ counterion, were considered. The counterions have been taken into consideration insofar as under the natural conditions they neutralise DNA sugar-phosphate backbone. The energy of the complexes have been determined by considering the electrostatic and the Van der Waals interactions within the framework of atom-atom potential functions. As a result, the stability of various configurations of molecular complexes was estimated. It was shown that DNA phosphate groups and counterions can form stable complexes with hydrogen peroxide molecules, which are as stable as the complexes with water molecules. It has been demonstrated that the formation of stable complexes of H2O2-Na+-PO4- may be detected experimentally by observing specific vibrations in the low-frequency Raman spectra. The interaction of H2O2 molecule with phosphate group of the double helix backbone can disrupt DNA biological function and induce the deactivation of the cell genetic apparatus. Thus, the production of hydrogen peroxide molecules in the nucleus of living cells can be considered as an additional mechanism by which high-energy ion beams destroy tumour cells during ion beam therapy. Contribution to the Topical Issue "COST Action Nano-IBCT: Nano-scale Processes Behind Ion-Beam Cancer Therapy", edited by Andrey Solov'yov, Nigel Mason, Gustavo García, Eugene Surdutovich.

Single-Molecule Methods for Nucleotide Excision Repair: Building a System to Watch Repair in Real Time.

PubMed

Kong, Muwen; Beckwitt, Emily C; Springall, Luke; Kad, Neil M; Van Houten, Bennett

2017-01-01

Single-molecule approaches to solving biophysical problems are powerful tools that allow static and dynamic real-time observations of specific molecular interactions of interest in the absence of ensemble-averaging effects. Here, we provide detailed protocols for building an experimental system that employs atomic force microscopy and a single-molecule DNA tightrope assay based on oblique angle illumination fluorescence microscopy. Together with approaches for engineering site-specific lesions into DNA substrates, these complementary biophysical techniques are well suited for investigating protein-DNA interactions that involve target-specific DNA-binding proteins, such as those engaged in a variety of DNA repair pathways. In this chapter, we demonstrate the utility of the platform by applying these techniques in the studies of proteins participating in nucleotide excision repair. © 2017 Elsevier Inc. All rights reserved.

Threading dynamics of a polymer through parallel pores: Potential applications to DNA size separation

NASA Astrophysics Data System (ADS)

Åkerman, Björn

1997-04-01

DNA orientation measurements by linear dichroism (LD) spectroscopy and single molecule imaging by fluorescence microscopy are used to investigate the effect of DNA size (71-740 kilo base pairs) and field strength E (1-5.9 V/cm) on the conformation dynamics during the field-driven threading of DNA molecules through a set of parallel pores in agarose gels, with average pore radii between 380 Å and 1400 Å. Locally relaxed but globally oriented DNA molecules are subjected to a perpendicular field, and the observed LD time profile is compared with a recent theory for the threading [D. Long and J.-L. Viovy, Phys. Rev. E 53, 803 (1996)] which assumes the same initial state. As predicted the DNA is driven by the ends into a U-form, leading to an overshoot in the LD. The overshoot-time scales as E-(1.2-1.4) as predicted, but grows more slowly with DNA size than the predicted linear dependence. For long molecules loops form initially in the threading process but are finally consumed by the ends, and the process of transfer of DNA segments, from the loops to the arms of the U, leads to a shoulder in the LD as predicted. The critical size below which loops do not form (as indicated by the LD shoulder being absent) is between 71 and 105 kbp (0.5% agarose, 5.9 V/cm), and considerably larger than predicted because in the initial state the DNA molecules are housed in gel cavities with effective pore sizes about four times larger than the average pore size. From the data, the separation of DNA by exploiting the threading dynamics in pulsed fields [D. Long et al., CR Acad. Sci. Paris, Ser. IIb 321, 239 (1995)] is shown to be feasible in principle in an agarose-based system.

Repurposing a Benchtop Centrifuge for High-Throughput Single-Molecule Force Spectroscopy.

PubMed

Yang, Darren; Wong, Wesley P

2018-01-01

We present high-throughput single-molecule manipulation using a benchtop centrifuge, overcoming limitations common in other single-molecule approaches such as high cost, low throughput, technical difficulty, and strict infrastructure requirements. An inexpensive and compact Centrifuge Force Microscope (CFM) adapted to a commercial centrifuge enables use by nonspecialists, and integration with DNA nanoswitches facilitates both reliable measurements and repeated molecular interrogation. Here, we provide detailed protocols for constructing the CFM, creating DNA nanoswitch samples, and carrying out single-molecule force measurements.

"DNA Origami Traffic Lights" with a Split Aptamer Sensor for a Bicolor Fluorescence Readout.

PubMed

Walter, Heidi-Kristin; Bauer, Jens; Steinmeyer, Jeannine; Kuzuya, Akinori; Niemeyer, Christof M; Wagenknecht, Hans-Achim

2017-04-12

A split aptamer for adenosine triphosphate (ATP) was embedded as a recognition unit into two levers of a nanomechanical DNA origami construct by extension and modification of selected staple strands. An additional optical module in the stem of the split aptamer comprised two different cyanine-styryl dyes that underwent an energy transfer from green (donor) to red (acceptor) emission if two ATP molecules were bound as target molecule to the recognition module and thereby brought the dyes in close proximity. As a result, the ATP as a target triggered the DNA origami shape transition and yielded a fluorescence color change from green to red as readout. Conventional atomic force microscopy (AFM) images confirmed the topology change from the open form of the DNA origami in the absence of ATP into the closed form in the presence of the target molecule. The obtained closed/open ratios in the absence and presence of target molecules tracked well with the fluorescence color ratios and thereby validated the bicolor fluorescence readout. The correct positioning of the split aptamer as the functional unit farthest away from the fulcrum of the DNA origami was crucial for the aptasensing by fluorescence readout. The fluorescence color change allowed additionally to follow the topology change of the DNA origami aptasensor in real time in solution. The concepts of fluorescence energy transfer for bicolor readout in a split aptamer in solution, and AFM on surfaces, were successfully combined in a single DNA origami construct to obtain a bimodal readout. These results are important for future custom DNA devices for chemical-biological and bioanalytical purposes because they are not only working as simple aptamers but are also visible by AFM on the single-molecule level.

The tilt-dependent potential of mean force of a pair of DNA oligomers from all-atom molecular dynamics simulations

DOE PAGES

Cortini, Ruggero; Cheng, Xiaolin; Smith, Jeremy C.

2017-01-16

Electrostatic interactions between DNA molecules have been extensively studied experimentally and theoretically, but several aspects (e.g. its role in determining the pitch of the cholesteric DNA phase) still remain unclear. Here, we performed large-scale all-atom molecular dynamics simulations in explicit water and 150 mM sodium chloride, to reconstruct the potential of mean force (PMF) of two DNA oligomers 24 base pairs long as a function of their interaxial angle and intermolecular distance. We find that the potential of mean force is dominated by total DNA charge, and not by the helical geometry of its charged groups. The theory of homogeneously charged cylinders fits well all our simulation data, and the fit yields the optimal value of the total compensated charge on DNA to ≈65% of its total fixed charge (arising from the phosphorous atoms), close to the value expected from Manning's theory of ion condensation. The PMF calculated from our simulations does not show a significant dependence on the handedness of the angle between the two DNA molecules, or its size is on the order ofmore » $$1{{k}_{\\text{B}}}T$$ . Thermal noise for molecules of the studied length seems to mask the effect of detailed helical charge patterns of DNA. The fact that in monovalent salt the effective interaction between two DNA molecules is independent on the handedness of the tilt may suggest that alternative mechanisms are required to understand the cholesteric phase of DNA.« less

The tilt-dependent potential of mean force of a pair of DNA oligomers from all-atom molecular dynamics simulations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cortini, Ruggero; Cheng, Xiaolin; Smith, Jeremy C.

Electrostatic interactions between DNA molecules have been extensively studied experimentally and theoretically, but several aspects (e.g. its role in determining the pitch of the cholesteric DNA phase) still remain unclear. Here, we performed large-scale all-atom molecular dynamics simulations in explicit water and 150 mM sodium chloride, to reconstruct the potential of mean force (PMF) of two DNA oligomers 24 base pairs long as a function of their interaxial angle and intermolecular distance. We find that the potential of mean force is dominated by total DNA charge, and not by the helical geometry of its charged groups. The theory of homogeneously charged cylinders fits well all our simulation data, and the fit yields the optimal value of the total compensated charge on DNA to ≈65% of its total fixed charge (arising from the phosphorous atoms), close to the value expected from Manning's theory of ion condensation. The PMF calculated from our simulations does not show a significant dependence on the handedness of the angle between the two DNA molecules, or its size is on the order ofmore » $$1{{k}_{\\text{B}}}T$$ . Thermal noise for molecules of the studied length seems to mask the effect of detailed helical charge patterns of DNA. The fact that in monovalent salt the effective interaction between two DNA molecules is independent on the handedness of the tilt may suggest that alternative mechanisms are required to understand the cholesteric phase of DNA.« less

Reshaping the Energy Landscape Transforms the Mechanism and Binding Kinetics of DNA Threading Intercalation.

PubMed

Clark, Andrew G; Naufer, M Nabuan; Westerlund, Fredrik; Lincoln, Per; Rouzina, Ioulia; Paramanathan, Thayaparan; Williams, Mark C

2018-02-06

Molecules that bind DNA via threading intercalation show high binding affinity as well as slow dissociation kinetics, properties ideal for the development of anticancer drugs. To this end, it is critical to identify the specific molecular characteristics of threading intercalators that result in optimal DNA interactions. Using single-molecule techniques, we quantify the binding of a small metal-organic ruthenium threading intercalator (Δ,Δ-B) and compare its binding characteristics to a similar molecule with significantly larger threading moieties (Δ,Δ-P). The binding affinities of the two molecules are the same, while comparison of the binding kinetics reveals significantly faster kinetics for Δ,Δ-B. However, the kinetics is still much slower than that observed for conventional intercalators. Comparison of the two threading intercalators shows that the binding affinity is modulated independently by the intercalating section and the binding kinetics is modulated by the threading moiety. In order to thread DNA, Δ,Δ-P requires a "lock mechanism", in which a large length increase of the DNA duplex is required for both association and dissociation. In contrast, measurements of the force-dependent binding kinetics show that Δ,Δ-B requires a large DNA length increase for association but no length increase for dissociation from DNA. This contrasts strongly with conventional intercalators, for which almost no DNA length change is required for association but a large DNA length change must occur for dissociation. This result illustrates the fundamentally different mechanism of threading intercalation compared with conventional intercalation and will pave the way for the rational design of therapeutic drugs based on DNA threading intercalation.

Structural DNA Nanotechnology: Artificial Nanostructures for Biomedical Research.

PubMed

Ke, Yonggang; Castro, Carlos; Choi, Jong Hyun

2018-06-04

Structural DNA nanotechnology utilizes synthetic or biologic DNA as designer molecules for the self-assembly of artificial nanostructures. The field is founded upon the specific interactions between DNA molecules, known as Watson-Crick base pairing. After decades of active pursuit, DNA has demonstrated unprecedented versatility in constructing artificial nanostructures with significant complexity and programmability. The nanostructures could be either static, with well-controlled physicochemical properties, or dynamic, with the ability to reconfigure upon external stimuli. Researchers have devoted considerable effort to exploring the usability of DNA nanostructures in biomedical research. We review the basic design methods for fabricating both static and dynamic DNA nanostructures, along with their biomedical applications in fields such as biosensing, bioimaging, and drug delivery.

May the Best Molecule Win: Competition ESI Mass Spectrometry

PubMed Central

Laughlin, Sarah; Wilson, W. David

2015-01-01

Electrospray ionization mass spectrometry has become invaluable in the characterization of macromolecular biological systems such as nucleic acids and proteins. Recent advances in the field of mass spectrometry and the soft conditions characteristic of electrospray ionization allow for the investigation of non-covalent interactions among large biomolecules and ligands. Modulation of genetic processes through the use of small molecule inhibitors with the DNA minor groove is gaining attention as a potential therapeutic approach. In this review, we discuss the development of a competition method using electrospray ionization mass spectrometry to probe the interactions of multiple DNA sequences with libraries of minor groove binding molecules. Such an approach acts as a high-throughput screening method to determine important information including the stoichiometry, binding mode, cooperativity, and relative binding affinity. In addition to small molecule-DNA complexes, we highlight other applications in which competition mass spectrometry has been used. A competitive approach to simultaneously investigate complex interactions promises to be a powerful tool in the discovery of small molecule inhibitors with high specificity and for specific, important DNA sequences. PMID:26501262

DNA Origami Directed Au Nanostar Dimers for Single-Molecule Surface-Enhanced Raman Scattering.

PubMed

Tanwar, Swati; Haldar, Krishna Kanta; Sen, Tapasi

2017-12-06

We demonstrate the synthesis of Au nanostar dimers with tunable interparticle gap and controlled stoichiometry assembled on DNA origami. Au nanostars with uniform and sharp tips were immobilized on rectangular DNA origami dimerized structures to create nanoantennas containing monomeric and dimeric Au nanostars. Single Texas red (TR) dye was specifically attached in the junction of the dimerized origami to act as a Raman reporter molecule. The SERS enhancement factors of single TR dye molecules located in the conjunction region in dimer structures having interparticle gaps of 7 and 13 nm are 2 × 10 10 and 8 × 10 9 , respectively, which are strong enough for single analyte detection. The highly enhanced electromagnetic field generated by the plasmon coupling between sharp tips and cores of two Au nanostars in the wide conjunction region allows the accommodation and specific detection of large biomolecules. Such DNA-directed assembled nanoantennas with controlled interparticle separation distance and stoichiometry, and well-defined geometry, can be used as excellent substrates in single-molecule SERS spectroscopy and will have potential applications as a reproducible platform in single-molecule sensing.

Internal twisting motion dependent conductance of an aperiodic DNA molecule

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

Quantification of differential gene expression by multiplexed targeted resequencing of cDNA

PubMed Central

Arts, Peer; van der Raadt, Jori; van Gestel, Sebastianus H.C.; Steehouwer, Marloes; Shendure, Jay; Hoischen, Alexander; Albers, Cornelis A.

2017-01-01

Whole-transcriptome or RNA sequencing (RNA-Seq) is a powerful and versatile tool for functional analysis of different types of RNA molecules, but sample reagent and sequencing cost can be prohibitive for hypothesis-driven studies where the aim is to quantify differential expression of a limited number of genes. Here we present an approach for quantification of differential mRNA expression by targeted resequencing of complementary DNA using single-molecule molecular inversion probes (cDNA-smMIPs) that enable highly multiplexed resequencing of cDNA target regions of ∼100 nucleotides and counting of individual molecules. We show that accurate estimates of differential expression can be obtained from molecule counts for hundreds of smMIPs per reaction and that smMIPs are also suitable for quantification of relative gene expression and allele-specific expression. Compared with low-coverage RNA-Seq and a hybridization-based targeted RNA-Seq method, cDNA-smMIPs are a cost-effective high-throughput tool for hypothesis-driven expression analysis in large numbers of genes (10 to 500) and samples (hundreds to thousands). PMID:28474677

Ultralocalized thermal reactions in subnanoliter droplets-in-air.

PubMed

Salm, Eric; Guevara, Carlos Duarte; Dak, Piyush; Dorvel, Brian Ross; Reddy, Bobby; Alam, Muhammad Ashraf; Bashir, Rashid

2013-02-26

Miniaturized laboratory-on-chip systems promise rapid, sensitive, and multiplexed detection of biological samples for medical diagnostics, drug discovery, and high-throughput screening. Within miniaturized laboratory-on-chips, static and dynamic droplets of fluids in different immiscible media have been used as individual vessels to perform biochemical reactions and confine the products. Approaches to perform localized heating of these individual subnanoliter droplets can allow for new applications that require parallel, time-, and space-multiplex reactions on a single integrated circuit. Our method positions droplets on an array of individual silicon microwave heaters on chip to precisely control the temperature of droplets-in-air, allowing us to perform biochemical reactions, including DNA melting and detection of single base mismatches. We also demonstrate that ssDNA probe molecules can be placed on heaters in solution, dried, and then rehydrated by ssDNA target molecules in droplets for hybridization and detection. This platform enables many applications in droplets including hybridization of low copy number DNA molecules, lysing of single cells, interrogation of ligand-receptor interactions, and rapid temperature cycling for amplification of DNA molecules.

Photonic-plasmonic hybrid single-molecule nanosensor measures the effect of fluorescent labels on DNA-protein dynamics

PubMed Central

Liang, Feng; Guo, Yuzheng; Hou, Shaocong; Quan, Qimin

2017-01-01

Current methods to study molecular interactions require labeling the subject molecules with fluorescent reporters. However, the effect of the fluorescent reporters on molecular dynamics has not been quantified because of a lack of alternative methods. We develop a hybrid photonic-plasmonic antenna-in-a-nanocavity single-molecule biosensor to study DNA-protein dynamics without using fluorescent labels. Our results indicate that the fluorescein and fluorescent protein labels decrease the interaction between a single DNA and a protein due to weakened electrostatic interaction. Although the study is performed on the DNA-XPA system, the conclusion has a general implication that the traditional fluorescent labeling methods might be misestimating the molecular interactions. PMID:28560341

Single Molecule Nano-Metronome

PubMed Central

Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip

2008-01-01

We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule sensor of minute sequence differences of a target DNA. PMID:16522050

Rapid screening for plasmid DNA.

PubMed

Hughes, C; Meynell, G G

1977-03-07

A procedure is described for demonstrating plasmid DNA and its molecular weight, based on rate zonal centrifugation of unlabelled DNA in neutral sucrose gradients containing a low concentration of ethidium bromide. Each DNA species is then visualized as a discrete fluorescent band when the centrifuge tube is illuminated with ultra-violet light. Plasmids exist as closed circular and as relaxed circular molecules, which sediment separately, but during preparation of lysates, closed circular molecules are nicked so that each plasmid forms only a single band of relaxed circles within the gradient.

Scraping and stapling of end-grafted DNA chains by a bioadhesive spreading vesicle to reveal chain internal friction and topological complexity.

PubMed

Nam, Gimoon; Hisette, Marie Laure; Sun, Yuting Liang; Gisler, Thomas; Johner, Albert; Thalmann, Fabrice; Schröder, André Pierre; Marques, Carlos Manuel; Lee, Nam-Kyung

2010-08-20

Stained end-grafted DNA molecules about 20 μm long are scraped away and stretched out by the spreading front of a bioadhesive vesicle. Tethered biotin ligands bind the vesicle bilayer to a streptavidin substrate, stapling the DNAs into frozen confinement paths. Image analysis of the stapled DNA gives access, within optical resolution, to the local stretching values of individual DNA molecules swept by the spreading front, and provides evidence of self-entanglements.

Comparative evaluation of the VERSANT HCV RNA 3.0, QUANTIPLEX HCV RNA 2.0, and COBAS AMPLICOR HCV MONITOR version 2.0 Assays for quantification of hepatitis C virus RNA in serum.

PubMed

Germer, Jeffrey J; Heimgartner, Paul J; Ilstrup, Duane M; Harmsen, W Scott; Jenkins, Greg D; Patel, Robin

2002-02-01

A comparison of quantitative results expressed in hepatitis C virus (HCV) international units per milliliter, obtained from the VERSANT HCV RNA 3.0 (bDNA-3.0) assay, the QUANTIPLEX HCV RNA 2.0 (bDNA-2.0) assay, and the COBAS AMPLICOR HCV MONITOR version 2.0 (HCM-2.0) test was performed. A total of 168 patient specimens submitted to the Mayo Clinic Molecular Microbiology Laboratory for HCV quantification or HCV genotyping were studied. Of the specimens tested, 97, 88, and 79% yielded quantitative results within the dynamic range of the bDNA-3.0, bDNA-2.0, and HCM-2.0 assays, respectively. Overall, there was substantial agreement between the results generated by all three assays. A total of 15 out of 29 (52%) of the specimens determined to contain viral loads of <31,746 IU/ml by the bDNA-3.0 assay were categorized as containing viral loads within the range of 31,746 to 500,000 IU/ml by the bDNA-2.0 assay. Although substantial agreement was noted between the results generated by the bDNA-2.0 and bDNA-3.0 assays, a bias toward higher viral titer by the bDNA-2.0 assay was noted (P = 0.001). Likewise, although substantial agreement was noted between the results generated by the HCM-2.0 and bDNA-3.0 assays, a bias toward higher viral titer by the bDNA-3.0 assay was noted (P < or = 0.001). The discrepancy between the HCM-2.0 and bDNA-3.0 results was more pronounced when viral loads were >500,000 IU/ml and resulted in statistically significant differences (P < or = 0.001) in determining whether viral loads were above or below 800,000 IU/ml of HCV RNA, the proposed threshold value for tailoring the duration of combination therapy. The expression of quantitative values in HCV international units per milliliter was a strength of both the bDNA-3.0 and HCM-2.0 assays.

Comparative Evaluation of the VERSANT HCV RNA 3.0, QUANTIPLEX HCV RNA 2.0, and COBAS AMPLICOR HCV MONITOR Version 2.0 Assays for Quantification of Hepatitis C Virus RNA in Serum

PubMed Central

Germer, Jeffrey J.; Heimgartner, Paul J.; Ilstrup, Duane M.; Harmsen, W. Scott; Jenkins, Greg D.; Patel, Robin

2002-01-01

A comparison of quantitative results expressed in hepatitis C virus (HCV) international units per milliliter, obtained from the VERSANT HCV RNA 3.0 (bDNA-3.0) assay, the QUANTIPLEX HCV RNA 2.0 (bDNA-2.0) assay, and the COBAS AMPLICOR HCV MONITOR version 2.0 (HCM-2.0) test was performed. A total of 168 patient specimens submitted to the Mayo Clinic Molecular Microbiology Laboratory for HCV quantification or HCV genotyping were studied. Of the specimens tested, 97, 88, and 79% yielded quantitative results within the dynamic range of the bDNA-3.0, bDNA-2.0, and HCM-2.0 assays, respectively. Overall, there was substantial agreement between the results generated by all three assays. A total of 15 out of 29 (52%) of the specimens determined to contain viral loads of <31,746 IU/ml by the bDNA-3.0 assay were categorized as containing viral loads within the range of 31,746 to 500,000 IU/ml by the bDNA-2.0 assay. Although substantial agreement was noted between the results generated by the bDNA-2.0 and bDNA-3.0 assays, a bias toward higher viral titer by the bDNA-2.0 assay was noted (P = 0.001). Likewise, although substantial agreement was noted between the results generated by the HCM-2.0 and bDNA-3.0 assays, a bias toward higher viral titer by the bDNA-3.0 assay was noted (P ≤ 0.001). The discrepancy between the HCM-2.0 and bDNA-3.0 results was more pronounced when viral loads were >500,000 IU/ml and resulted in statistically significant differences (P ≤ 0.001) in determining whether viral loads were above or below 800,000 IU/ml of HCV RNA, the proposed threshold value for tailoring the duration of combination therapy. The expression of quantitative values in HCV international units per milliliter was a strength of both the bDNA-3.0 and HCM-2.0 assays. PMID:11825962

The DNA of ciliated protozoa.

PubMed Central

Prescott, D M

1994-01-01

Ciliates contain two types of nuclei: a micronucleus and a macronucleus. The micronucleus serves as the germ line nucleus but does not express its genes. The macronucleus provides the nuclear RNA for vegetative growth. Mating cells exchange haploid micronuclei, and a new macronucleus develops from a new diploid micronucleus. The old macronucleus is destroyed. This conversion consists of amplification, elimination, fragmentation, and splicing of DNA sequences on a massive scale. Fragmentation produces subchromosomal molecules in Tetrahymena and Paramecium cells and much smaller, gene-sized molecules in hypotrichous ciliates to which telomere sequences are added. These molecules are then amplified, some to higher copy numbers than others. rDNA is differentially amplified to thousands of copies per macronucleus. Eliminated sequences include transposonlike elements and sequences called internal eliminated sequences that interrupt gene coding regions in the micronuclear genome. Some, perhaps all, of these are excised as circular molecules and destroyed. In at least some hypotrichs, segments of some micronuclear genes are scrambled in a nonfunctional order and are recorded during macronuclear development. Vegetatively growing ciliates appear to possess a mechanism for adjusting copy numbers of individual genes, which corrects gene imbalances resulting from random distribution of DNA molecules during amitosis of the macronucleus. Other distinctive features of ciliate DNA include an altered use of the conventional stop codons. Images PMID:8078435

Structure of nascent replicative form DNA of coliphage M13

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dasgupta, S.; Mitra, S.

Nascent replicative form type II (RFII) DNA of coliphage M13 synthesized in an Escherichia coli mutant deficient in the 5' ..-->.. 3' exonuclease associated with DNA polymerase I contains ribonucleotides that are retained in the covalently closed RFI DNA sealed in vitro by the joint action of T5 phage DNA polymerase and T4 phage DNA ligase. These RFI molecules are labile to alkali and RNase H, unlike the RFI produced either in vivo or from RFII with E. coli DNA polymerase I and E. coli DNA ligase. The ribonucleotides are located at one site and predominantly in one strand ofmore » the nascent RF DNA. Furthermore, these molecules contain multiple small gaps, randomly located, and one large gap in the intracistronic region.« less

DNA adsorption characteristics of hollow spherule allophane nano-particles.

PubMed

Matsuura, Yoko; Iyoda, Fumitoshi; Arakawa, Shuichi; John, Baiju; Okamoto, Masami; Hayashi, Hidetomo

2013-12-01

To understand the propensity of natural allophane to adsorb the DNA molecules, the adsorption characteristics were assessed against natural allophane (AK70), using single-stranded DNA (ss-DNA) and adenosine 5'-monophosphate (5'-AMP) as a reference molecule. The adsorption capacity of ss-DNA on AK70 exhibited one order of magnitude lower value as compared with that of 5'-AMP. The adsorption capacity of ss-DNA decreased with increasing pH due to the interaction generated between phosphate groups of ss-DNA and functional Al-OH groups on the wall perforations through deprotonating, associated with higher energy barrier for the adsorption of ss-DNA. The adsorption morphologies consisting of the individual ss-DNA with mono-layer coverage of the clustered allophane particle were observed successfully through transmission electron microscopy analysis. © 2013.

Single DNA imaging and length quantification through a mobile phone microscope

NASA Astrophysics Data System (ADS)

Wei, Qingshan; Luo, Wei; Chiang, Samuel; Kappel, Tara; Mejia, Crystal; Tseng, Derek; Chan, Raymond Yan L.; Yan, Eddie; Qi, Hangfei; Shabbir, Faizan; Ozkan, Haydar; Feng, Steve; Ozcan, Aydogan

2016-03-01

The development of sensitive optical microscopy methods for the detection of single DNA molecules has become an active research area which cultivates various promising applications including point-of-care (POC) genetic testing and diagnostics. Direct visualization of individual DNA molecules usually relies on sophisticated optical microscopes that are mostly available in well-equipped laboratories. For POC DNA testing/detection, there is an increasing need for the development of new single DNA imaging and sensing methods that are field-portable, cost-effective, and accessible for diagnostic applications in resource-limited or field-settings. For this aim, we developed a mobile-phone integrated fluorescence microscopy platform that allows imaging and sizing of single DNA molecules that are stretched on a chip. This handheld device contains an opto-mechanical attachment integrated onto a smartphone camera module, which creates a high signal-to-noise ratio dark-field imaging condition by using an oblique illumination/excitation configuration. Using this device, we demonstrated imaging of individual linearly stretched λ DNA molecules (48 kilobase-pair, kbp) over 2 mm2 field-of-view. We further developed a robust computational algorithm and a smartphone app that allowed the users to quickly quantify the length of each DNA fragment imaged using this mobile interface. The cellphone based device was tested by five different DNA samples (5, 10, 20, 40, and 48 kbp), and a sizing accuracy of <1 kbp was demonstrated for DNA strands longer than 10 kbp. This mobile DNA imaging and sizing platform can be very useful for various diagnostic applications including the detection of disease-specific genes and quantification of copy-number-variations at POC settings.

Two-Way Gold Nanoparticle Label-Free Sensing of Specific Sequence and Small Molecule Targets Using Switchable Concatemers.

PubMed

Zhu, Longjiao; Shao, Xiangli; Luo, Yunbo; Huang, Kunlung; Xu, Wentao

2017-05-19

A two-way colorimetric biosensor based on unmodified gold nanoparticles (GNPs) and a switchable double-stranded DNA (dsDNA) concatemer have been demonstrated. Two hairpin probes (H1 and H2) were first designed that provided the fuels to assemble the dsDNA concatemers via hybridization chain reaction (HCR). A functional hairpin (FH) was rationally designed to recognize the target sequences. All the hairpins contained a single-stranded DNA (ssDNA) loop and sticky end to prevent GNPs from salt-induced aggregation. In the presence of target sequence, the capture probe blocked in the FH recognizes the target to form a duplex DNA, which causes the release of the initiator probe by FH conformational change. This process then starts the alternate-opening of H1 and H2 through HCR, and dsDNA concatemers grow from the target sequence. As a result, unmodified GNPs undergo salt-induced aggregation because the formed dsDNA concatemers are stiffer and provide less stabilization. A light purple-to-blue color variation was observed in the bulk solution, termed the light-off sensing way. Furthermore, H1 ingeniously inserted an aptamer sequence to generate dsDNA concatemers with multiple small molecule binding sites. In the presence of small molecule targets, concatemers can be disassembled into mixtures with ssDNA sticky ends. A blue-to-purple reverse color variation was observed due to the regeneration of the ssDNA, termed the light-on way. The two-way biosensor can detect both nucleic acids and small molecule targets with one sensing device. This switchable sensing element is label-free, enzyme-free, and sophisticated-instrumentation-free. The detection limits of both targets were below nanomolar.

DNA double-strand break in vivo at the 3' extremity of exons located upstream of group II introns. Senescence and circular DNA introns in Podospora mitochondria.

PubMed

Sainsard-Chanet, A; Begel, O; Belcour, L

1994-10-07

In the filamentous fungus Podospora anserina, the unavoidable phenomenon of senescence is associated with the amplification of the first intron of the mitochondrial cox1 that accumulates as circular DNA molecules consisting of tandem repeats. This group II intron (cox1-i1 or alpha) is able to transpose and contains an open reading frame with significant amino acid similarity with reverse transcriptases. The generation of these intronic circular DNA molecules, their amplification and their involvement in the senescence process are unresolved questions. We demonstrate here that: (1) another group II intron, the fourth intron of gene cox1, cox1-i4, is also able to give precise DNA end to end junctions; (2) this intronic sequence can be found amplified during senescence, although to a lesser extent than cox1-i1; (3) the amplification of the DNA multimeric cox1-i1 molecules likely does not proceed by autonomous replication; (4) the generation of the DNA intronic circles does not require efficient intron splicing; (5) a DNA double-strand break occurs in vivo at the 3' extremity of the cox1-e1 and cox1-e4 exons preceding the group II introns that form circular DNAs. On the whole, these results show that the ability to form DNA circular molecules is a property of some group II introns and they demonstrate the occurrence of a specific DNA cleavage at or near the integration site of these group II introns. The results strongly suggest that this cleavage is involved in the formation of the group II intronic DNA circles and could also be involved in the phenomenon of group II intron homing.

Adsorption of DNA to mica mediated by divalent counterions: a theoretical and experimental study.

PubMed

Pastré, David; Piétrement, Olivier; Fusil, Stéphane; Landousy, Fabrice; Jeusset, Josette; David, Marie-Odile; Hamon, Loïc; Le Cam, Eric; Zozime, Alain

2003-10-01

The adsorption of DNA molecules onto a flat mica surface is a necessary step to perform atomic force microscopy studies of DNA conformation and observe DNA-protein interactions in physiological environment. However, the phenomenon that pulls DNA molecules onto the surface is still not understood. This is a crucial issue because the DNA/surface interactions could affect the DNA biological functions. In this paper we develop a model that can explain the mechanism of the DNA adsorption onto mica. This model suggests that DNA attraction is due to the sharing of the DNA and mica counterions. The correlations between divalent counterions on both the negatively charged DNA and the mica surface can generate a net attraction force whereas the correlations between monovalent counterions are ineffective in the DNA attraction. DNA binding is then dependent on the fractional surface densities of the divalent and monovalent cations, which can compete for the mica surface and DNA neutralizations. In addition, the attraction can be enhanced when the mica has been pretreated by transition metal cations (Ni(2+), Zn(2+)). Mica pretreatment simultaneously enhances the DNA attraction and reduces the repulsive contribution due to the electrical double-layer force. We also perform end-to-end distance measurement of DNA chains to study the binding strength. The DNA binding strength appears to be constant for a fixed fractional surface density of the divalent cations at low ionic strength (I < 0.1 M) as predicted by the model. However, at higher ionic strength, the binding is weakened by the screening effect of the ions. Then, some equations were derived to describe the binding of a polyelectrolyte onto a charged surface. The electrostatic attraction due to the sharing of counterions is particularly effective if the polyelectrolyte and the surface have nearly the same surface charge density. This characteristic of the attraction force can explain the success of mica for performing single DNA molecule observation by AFM. In addition, we explain how a reversible binding of the DNA molecules can be obtained with a pretreated mica surface.

Dynamics of flexible molecules in thinning fluid filaments

NASA Astrophysics Data System (ADS)

Arratia, Paulo E.; Juarez, Gabriel

2011-11-01

Newtonian liquids that contain small amounts (~ppm) of flexible polymers can exhibit viscoelastic behavior in extensional flows. In this talk, we report the results of experiments on the thinning and breakup of polymeric fluids in a simple microfluidic device. We aim to understand the stretching dynamics of flexible polymers by direct visualization of fluorescent DNA molecules, a model polymer. A Boger fluid, composed of 100 ppm polyacrylamide and 85% w/w glycerol, is seeded with stained lambdaâDNA molecules (<10% v/v) imaged by high speed epifluorescence microscopy. We observe that the strong flow in the thinning fluid threads provide sufficient forces to stretch the DNA molecules away from their equilibrium coiled state. The distribution of stretch lengths, however, is very heterogeneous due to molecular individualism and initial conditions. Once the molecules are stretched to their full length and aligned with the flow, they translate along the fluid thread as rigid rods until the point of pinch off. After pinch off, both the fluid and molecules return to a relaxed state.

Identification of DNA primase inhibitors via a combined fragment-based and virtual screening

NASA Astrophysics Data System (ADS)

Ilic, Stefan; Akabayov, Sabine R.; Arthanari, Haribabu; Wagner, Gerhard; Richardson, Charles C.; Akabayov, Barak

2016-11-01

The structural differences between bacterial and human primases render the former an excellent target for drug design. Here we describe a technique for selecting small molecule inhibitors of the activity of T7 DNA primase, an ideal model for bacterial primases due to their common structural and functional features. Using NMR screening, fragment molecules that bind T7 primase were identified and then exploited in virtual filtration to select larger molecules from the ZINC database. The molecules were docked to the primase active site using the available primase crystal structure and ranked based on their predicted binding energies to identify the best candidates for functional and structural investigations. Biochemical assays revealed that some of the molecules inhibit T7 primase-dependent DNA replication. The binding mechanism was delineated via NMR spectroscopy. Our approach, which combines fragment based and virtual screening, is rapid and cost effective and can be applied to other targets.

Cellular strategies for regulating DNA supercoiling: A single-molecule perspective

PubMed Central

Koster, Daniel A.; Crut, Aurélien; Shuman, Stewart; Bjornsti, Mary-Ann; Dekker, Nynke H.

2010-01-01

Summary Excess entangling and twisting of cellular DNA (i.e., DNA supercoiling) are problems inherent to the helical structure of double-stranded DNA. Supercoiling affects transcription, DNA replication, and chromosomal segregation. Consequently the cell must fine-tune supercoiling to optimize these key processes. Here, we summarize how supercoiling is generated and review experimental and theoretical insights into supercoil relaxation. We distinguish between the passive dissipation of supercoils by diffusion and the active removal of supercoils by topoisomerase enzymes. We also review single-molecule studies that elucidate the timescales and mechanisms of supercoil removal. PMID:20723754

Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

NASA Astrophysics Data System (ADS)

Risqi, A. M.; Yudiarsah, E.

2017-07-01

Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

Gel electrophoresis of partially denatured DNA. Retardation effect: its analysis and application.

PubMed Central

Lyamichev, V I; Panyutin, I G; Lyubchenko YuL

1982-01-01

The hypothesis about the role of partial denaturation in DNA retardation during its electrophoresis in denaturing gel /1,2/ was tested. We used partially melted DNA molecules in which the size of the melted regions and their location were known. They were obtained through glyoxal treatment of the melted regions by a procedure allowing the denatured state to be fixed at any point within the melting range. The approach and the availability of the melting maps of DNAs made it possible to investigate DNA molecules differing in length and in the size of the melted regions. The presence of a denatured region at the end of the molecule or inside of it was shown to decrease its electrophoretic mobility, the effect depending on the size of the melted region and on the DNA length. On the basis of the experimental results an explanation is proposed for the cause of retardation in the case of partially denatured DNA. Images PMID:7133999

Quantitative Single-Molecule Surface-Enhanced Raman Scattering by Optothermal Tuning of DNA Origami-Assembled Plasmonic Nanoantennas.

PubMed

Simoncelli, Sabrina; Roller, Eva-Maria; Urban, Patrick; Schreiber, Robert; Turberfield, Andrew J; Liedl, Tim; Lohmüller, Theobald

2016-11-22

DNA origami is a powerful approach for assembling plasmonic nanoparticle dimers and Raman dyes with high yields and excellent positioning control. Here we show how optothermal-induced shrinking of a DNA origami template can be employed to control the gap sizes between two 40 nm gold nanoparticles in a range from 1 to 2 nm. The high field confinement achieved with this optothermal approach was demonstrated by detection of surface-enhanced Raman spectroscopy (SERS) signals from single molecules that are precisely placed within the DNA origami template that spans the nanoparticle gap. By comparing the SERS intensity with respect to the field enhancement in the plasmonic hot-spot region, we found good agreement between measurement and theory. Our straightforward approach for the fabrication of addressable plasmonic nanosensors by DNA origami demonstrates a path toward future sensing applications with single-molecule resolution.

Distinguishing Individual DNA Bases in a Network by Non-Resonant Tip-Enhanced Raman Scattering.

PubMed

Zhang, Rui; Zhang, Xianbiao; Wang, Huifang; Zhang, Yao; Jiang, Song; Hu, Chunrui; Zhang, Yang; Luo, Yi; Dong, Zhenchao

2017-05-08

The importance of identifying DNA bases at the single-molecule level is well recognized for many biological applications. Although such identification can be achieved by electrical measurements using special setups, it is still not possible to identify single bases in real space by optical means owing to the diffraction limit. Herein, we demonstrate the outstanding ability of scanning tunneling microscope (STM)-controlled non-resonant tip-enhanced Raman scattering (TERS) to unambiguously distinguish two individual complementary DNA bases (adenine and thymine) with a spatial resolution down to 0.9 nm. The distinct Raman fingerprints identified for the two molecules allow to differentiate in real space individual DNA bases in coupled base pairs. The demonstrated ability of non-resonant Raman scattering with super-high spatial resolution will significantly extend the applicability of TERS, opening up new routes for single-molecule DNA sequencing. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Small-molecule inhibitors of DNA damage-repair pathways: an approach to overcome tumor resistance to alkylating anticancer drugs

PubMed Central

Srinivasan, Ajay; Gold, Barry

2013-01-01

A major challenge in the future development of cancer therapeutics is the identification of biological targets and pathways, and the subsequent design of molecules to combat the drug-resistant cells hiding in virtually all cancers. This therapeutic approach is justified based upon the limited advances in cancer cures over the past 30 years, despite the development of many novel chemotherapies and earlier detection, which often fail due to drug resistance. Among the various targets to overcome tumor resistance are the DNA repair systems that can reverse the cytotoxicity of many clinically used DNA-damaging agents. Some progress has already been made but much remains to be done. We explore some components of the DNA-repair process, which are involved in repair of alkylation damage of DNA, as targets for the development of novel and effective molecules designed to improve the efficacy of existing anticancer drugs. PMID:22709253

[Interactions of DNA bases with individual water molecules. Molecular mechanics and quantum mechanics computation results vs. experimental data].

PubMed

Gonzalez, E; Lino, J; Deriabina, A; Herrera, J N F; Poltev, V I

2013-01-01

To elucidate details of the DNA-water interactions we performed the calculations and systemaitic search for minima of interaction energy of the systems consisting of one of DNA bases and one or two water molecules. The results of calculations using two force fields of molecular mechanics (MM) and correlated ab initio method MP2/6-31G(d, p) of quantum mechanics (QM) have been compared with one another and with experimental data. The calculations demonstrated a qualitative agreement between geometry characteristics of the most of local energy minima obtained via different methods. The deepest minima revealed by MM and QM methods correspond to water molecule position between two neighbor hydrophilic centers of the base and to the formation by water molecule of hydrogen bonds with them. Nevertheless, the relative depth of some minima and peculiarities of mutual water-base positions in' these minima depend on the method used. The analysis revealed insignificance of some differences in the results of calculations performed via different methods and the importance of other ones for the description of DNA hydration. The calculations via MM methods enable us to reproduce quantitatively all the experimental data on the enthalpies of complex formation of single water molecule with the set of mono-, di-, and trimethylated bases, as well as on water molecule locations near base hydrophilic atoms in the crystals of DNA duplex fragments, while some of these data cannot be rationalized by QM calculations.

Cd hyperfine interactions in DNA bases and DNA of mouse strains infected with Trypanosoma cruzi investigated by perturbed angular correlation spectroscopy and ab initio calculations.

PubMed

Petersen, Philippe A D; Silva, Andreia S; Gonçalves, Marcos B; Lapolli, André L; Ferreira, Ana Maria C; Carbonari, Artur W; Petrilli, Helena M

2014-06-03

In this work, perturbed angular correlation (PAC) spectroscopy is used to study differences in the nuclear quadrupole interactions of Cd probes in DNA molecules of mice infected with the Y-strain of Trypanosoma cruzi. The possibility of investigating the local genetic alterations in DNA, which occur along generations of mice infected with T. cruzi, using hyperfine interactions obtained from PAC measurements and density functional theory (DFT) calculations in DNA bases is discussed. A comparison of DFT calculations with PAC measurements could determine the type of Cd coordination in the studied molecules. To the best of our knowledge, this is the first attempt to use DFT calculations and PAC measurements to investigate the local environment of Cd ions bound to DNA bases in mice infected with Chagas disease. The obtained results also allowed the detection of local changes occurring in the DNA molecules of different generations of mice infected with T. cruzi, opening the possibility of using this technique as a complementary tool in the characterization of complicated biological systems.

Probabilistic switching circuits in DNA

PubMed Central

Wilhelm, Daniel; Bruck, Jehoshua

2018-01-01

A natural feature of molecular systems is their inherent stochastic behavior. A fundamental challenge related to the programming of molecular information processing systems is to develop a circuit architecture that controls the stochastic states of individual molecular events. Here we present a systematic implementation of probabilistic switching circuits, using DNA strand displacement reactions. Exploiting the intrinsic stochasticity of molecular interactions, we developed a simple, unbiased DNA switch: An input signal strand binds to the switch and releases an output signal strand with probability one-half. Using this unbiased switch as a molecular building block, we designed DNA circuits that convert an input signal to an output signal with any desired probability. Further, this probability can be switched between 2n different values by simply varying the presence or absence of n distinct DNA molecules. We demonstrated several DNA circuits that have multiple layers and feedback, including a circuit that converts an input strand to an output strand with eight different probabilities, controlled by the combination of three DNA molecules. These circuits combine the advantages of digital and analog computation: They allow a small number of distinct input molecules to control a diverse signal range of output molecules, while keeping the inputs robust to noise and the outputs at precise values. Moreover, arbitrarily complex circuit behaviors can be implemented with just a single type of molecular building block. PMID:29339484

Ultrasonic irradiation enhanced the ability of Fluorescein-DA-Fe(III) on sonodynamic and sonocatalytic damages of DNA molecules.

PubMed

Wu, Qiong; Chen, Xia; Jia, Lizhen; Wang, Yi; Sun, Ying; Huang, Xingjun; Shen, Yuxiang; Wang, Jun

2017-11-01

The interaction of DNA with Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein-Ferrous(III) (Fluorescein-DA-Fe(III)) with dual functional (sonodynamic and sonocatalytic) activity was studied by UV-vis spectroscopy, fluorescence spectroscopy, FT-IR spectroscopy, circular dichroism (CD) spectroscopy and viscosity measurements. And then, the damage of DNA caused by Fluorescein-DA-Fe(III) under ultrasonic irradiation (US) was researched by agarose gel electrophoresis and cytotoxicity assay. Meanwhile, some influenced factors such as ultrasonic irradiation time and Fluorescein-DA-Fe(III) concentration on the damage degree of DNA molecules were also examined. As a control, for Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein (Fluorescein-DA), the same experiments were carried out. The results showed that both Fluorescein-DA-Fe(III) and Fluorescein-DA can interact with DNA molecules. Under ultrasonic irradiation, Fluorescein-DA shows sonodynamic activity, which can damage DNA molecules. While, in the presence of Fe(III) ion, the Fluorescein-DA-Fe(III) displays not only sonodynamic activity but also sonocatalytic activity under ultrasonic irradiation, which injures DNA more serious than Fluorescein-DA. The researches confirmed the dual function (sonodynamic activity and sonocatalytic activity) of Fluorescein-DA-Fe(III) and expanded the usage of Fluorescein-DA-Fe(III) as a sonosensitizer in sonodynamic therapy (SDT). Copyright © 2017 Elsevier B.V. All rights reserved.

Fluorescence correlation spectroscopy analysis for accurate determination of proportion of doubly labeled DNA in fluorescent DNA pool for quantitative biochemical assays.

PubMed

Hou, Sen; Sun, Lili; Wieczorek, Stefan A; Kalwarczyk, Tomasz; Kaminski, Tomasz S; Holyst, Robert

2014-01-15

Fluorescent double-stranded DNA (dsDNA) molecules labeled at both ends are commonly produced by annealing of complementary single-stranded DNA (ssDNA) molecules, labeled with fluorescent dyes at the same (3' or 5') end. Because the labeling efficiency of ssDNA is smaller than 100%, the resulting dsDNA have two, one or are without a dye. Existing methods are insufficient to measure the percentage of the doubly-labeled dsDNA component in the fluorescent DNA sample and it is even difficult to distinguish the doubly-labeled DNA component from the singly-labeled component. Accurate measurement of the percentage of such doubly labeled dsDNA component is a critical prerequisite for quantitative biochemical measurements, which has puzzled scientists for decades. We established a fluorescence correlation spectroscopy (FCS) system to measure the percentage of doubly labeled dsDNA (PDL) in the total fluorescent dsDNA pool. The method is based on comparative analysis of the given sample and a reference dsDNA sample prepared by adding certain amount of unlabeled ssDNA into the original ssDNA solution. From FCS autocorrelation functions, we obtain the number of fluorescent dsDNA molecules in the focal volume of the confocal microscope and PDL. We also calculate the labeling efficiency of ssDNA. The method requires minimal amount of material. The samples have the concentration of DNA in the nano-molar/L range and the volume of tens of microliters. We verify our method by using restriction enzyme Hind III to cleave the fluorescent dsDNA. The kinetics of the reaction depends strongly on PDL, a critical parameter for quantitative biochemical measurements. Copyright © 2013 Elsevier B.V. All rights reserved.

Extracting physical chemistry from mechanics: a new approach to investigate DNA interactions with drugs and proteins in single molecule experiments.

PubMed

Rocha, M S

2015-09-01

In this review we focus on the idea of establishing connections between the mechanical properties of DNA-ligand complexes and the physical chemistry of DNA-ligand interactions. This type of connection is interesting because it opens the possibility of performing a robust characterization of such interactions by using only one experimental technique: single molecule stretching. Furthermore, it also opens new possibilities in comparing results obtained by very different approaches, in particular when comparing single molecule techniques to ensemble-averaging techniques. We start the manuscript reviewing important concepts of DNA mechanics, from the basic mechanical properties to the Worm-Like Chain model. Next we review the basic concepts of the physical chemistry of DNA-ligand interactions, revisiting the most important models used to analyze the binding data and discussing their binding isotherms. Then, we discuss the basic features of the single molecule techniques most used to stretch DNA-ligand complexes and to obtain "force × extension" data, from which the mechanical properties of the complexes can be determined. We also discuss the characteristics of the main types of interactions that can occur between DNA and ligands, from covalent binding to simple electrostatic driven interactions. Finally, we present a historical survey of the attempts to connect mechanics to physical chemistry for DNA-ligand systems, emphasizing a recently developed fitting approach useful to connect the persistence length of DNA-ligand complexes to the physicochemical properties of the interaction. Such an approach in principle can be used for any type of ligand, from drugs to proteins, even if multiple binding modes are present.

Subangstrom Measurements of Enzyme Function Using a Biological Nanopore, SPRNT.

PubMed

Laszlo, A H; Derrrington, I M; Gundlach, J H

2017-01-01

Nanopores are emerging as new single-molecule tools in the study of enzymes. Based on the progress in nanopore sequencing of DNA, a tool called Single-molecule Picometer Resolution Nanopore Tweezers (SPRNT) was developed to measure the movement of enzymes along DNA in real time. In this new method, an enzyme is loaded onto a DNA (or RNA) molecule. A single-stranded DNA end of this complex is drawn into a nanopore by an electrostatic potential that is applied across the pore. The single-stranded DNA passes through the pore's constriction until the enzyme comes into contact with the pore. Further progression of the DNA through the pore is then controlled by the enzyme. An ion current that flows through the pore's constriction is modulated by the DNA in the constriction. Analysis of ion current changes reveals the advance of the DNA with high spatiotemporal precision, thereby providing a real-time record of the enzyme's activity. Using an engineered version of the protein nanopore MspA, SPRNT has spatial resolution as small as 40pm at millisecond timescales, while simultaneously providing the DNA's sequence within the enzyme. In this chapter, SPRNT is introduced and its extraordinary potential is exemplified using the helicase Hel308. Two distinct substates are observed for each one-nucleotide advance; one of these about half-nucleotide long steps is ATP dependent and the other is ATP independent. The spatiotemporal resolution of this low-cost single-molecule technique lifts the study of enzymes to a new level of precision, enabling exploration of hitherto unobservable enzyme dynamics in real time. © 2017 Elsevier Inc. All rights reserved.

The Incorporation of Ribonucleotides Induces Structural and Conformational Changes in DNA.

PubMed

Meroni, Alice; Mentegari, Elisa; Crespan, Emmanuele; Muzi-Falconi, Marco; Lazzaro, Federico; Podestà, Alessandro

2017-10-03

Ribonucleotide incorporation is the most common error occurring during DNA replication. Cells have hence developed mechanisms to remove ribonucleotides from the genome and restore its integrity. Indeed, the persistence of ribonucleotides into DNA leads to severe consequences, such as genome instability and replication stress. Thus, it becomes important to understand the effects of ribonucleotides incorporation, starting from their impact on DNA structure and conformation. Here we present a systematic study of the effects of ribonucleotide incorporation into DNA molecules. We have developed, to our knowledge, a new method to efficiently synthesize long DNA molecules (hundreds of basepairs) containing ribonucleotides, which is based on a modified protocol for the polymerase chain reaction. By means of atomic force microscopy, we could therefore investigate the changes, upon ribonucleotide incorporation, of the structural and conformational properties of numerous DNA populations at the single-molecule level. Specifically, we characterized the scaling of the contour length with the number of basepairs and the scaling of the end-to-end distance with the curvilinear distance, the bending angle distribution, and the persistence length. Our results revealed that ribonucleotides affect DNA structure and conformation on scales that go well beyond the typical dimension of the single ribonucleotide. In particular, the presence of ribonucleotides induces a systematic shortening of the molecules, together with a decrease of the persistence length. Such structural changes are also likely to occur in vivo, where they could directly affect the downstream DNA transactions, as well as interfere with protein binding and recognition. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

β -Cyclodextrin polymer binding to DNA: Modulating the physicochemical parameters

NASA Astrophysics Data System (ADS)

Rocha, J. C. B.; Silva, E. F.; Oliveira, M. F.; Sousa, F. B.; Teixeira, A. V. N. C.; Rocha, M. S.

2017-05-01

Cyclodextrins and cyclodextrins-modified molecules have interesting and appealing properties due to their capacity to host components that are normally insoluble or poorly soluble in water. In this work, we investigate the interaction of a β -cyclodextrin polymer (poly-β -CD) with λ -DNA. The polymers are obtained by the reaction of β -CD with epichlorohydrin in alkaline conditions. We have used optical tweezers to characterize the changes of the mechanical properties of DNA molecules by increasing the concentration of poly-β -CD in the sample. The physical chemistry of the interaction is then deduced from these measurements by using a recently developed quenched-disorder statistical model. It is shown that the contour length of the DNA does not change in the whole range of poly-β -CD concentration (<300 μ M ). On the other hand, significant alterations were observed in the persistence length that identifies two binding modes corresponding to the clustering of ˜2.6 and ˜14 polymer molecules along the DNA double helix, depending on the polymer concentration. Comparing these results with the ones obtained for monomeric β -CD, it was observed that the concentration of CD that alters the DNA persistence length is considerably smaller when in the polymeric form. Also, the binding constant of the polymer-DNA interaction is three orders of magnitude higher than the one found for native (monomeric) β -CD. These results show that the polymerization of the β -CD strongly increases its binding affinity to the DNA molecule. This property can be wisely used to modulate the binding of cyclodextrins to the DNA double helix.

Deinococcus radiodurans RecA nucleoprotein filaments characterized at the single-molecule level with optical tweezers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pobegalov, Georgii, E-mail: george.pobegalov@nanobio.spbstu.ru; Cherevatenko, Galina; Alekseev, Aleksandr

2015-10-23

Deinococcus radiodurans can survive extreme doses of ionizing radiation due to the very efficient DNA repair mechanisms that are able to cope even with hundreds of double-strand breaks. RecA, the critical protein of homologous recombination in bacteria, is one of the key components of the DNA-repair system. Repair of double-strand breaks requires RecA binding to DNA and assembly of the RecA nucleoprotein helical filaments. The Escherichia coli RecA protein (EcRecA) and its interactions with DNA have been extensively studied using various approaches including single-molecule techniques, while the D. radiodurans RecA (DrRecA) remains much less characterized. However, DrRecA shows some remarkable differencesmore » from E. coli homolog. Here we combine microfluidics and single-molecule DNA manipulation with optical tweezers to follow the binding of DrRecA to long double-stranded DNA molecules and probe the mechanical properties of DrRecA nucleoprotein filaments at physiological pH. Our data provide a direct comparison of DrRecA and EcRecA binding to double-stranded DNA under identical conditions. We report a significantly faster filaments assembly as well as lower values of persistence length and contour length for DrRecA nucleoprotein filaments compared to EcRecA. Our results support the existing model of DrRecA forming more frequent and less continuous filaments relative to those of EcRecA. - Highlights: • We investigate Deinococcus radiodurans RecA interactions with long double-stranded DNA at the single-molecule level. • At physiological pH D. radiodurans RecA forms nucleoprotein filaments significantly faster relative to Escherichia coli RecA. • D. radiodurans RecA-dsDNA nucleoprotein filaments are more flexible and slightly shorter compared to those of E. coli RecA.« less

Recent advances in DNA nanotechnology.

PubMed

Chidchob, Pongphak; Sleiman, Hanadi F

2018-05-08

DNA is a powerful guiding molecule to achieve the precise construction of arbitrary structures and high-resolution organization of functional materials. The combination of sequence programmability, rigidity and highly specific molecular recognition in this molecule has resulted in a wide range of exquisitely designed DNA frameworks. To date, the impressive potential of DNA nanomaterials has been demonstrated from fundamental research to technological advancements in materials science and biomedicine. This review presents a summary of some of the most recent developments in structural DNA nanotechnology regarding new assembly approaches and efforts in translating DNA nanomaterials into practical use. Recent work on incorporating blunt-end stacking and hydrophobic interactions as orthogonal instruction rules in DNA assembly, and several emerging applications of DNA nanomaterials will also be highlighted. Copyright © 2018. Published by Elsevier Ltd.

Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

DOEpatents

Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S

2013-06-25

A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.

DNA-Based Applications in Nanobiotechnology

PubMed Central

Abu-Salah, Khalid M.; Ansari, Anees A.; Alrokayan, Salman A.

2010-01-01

Biological molecules such as deoxyribonucleic acid (DNA) have shown great potential in fabrication and construction of nanostructures and devices. The very properties that make DNA so effective as genetic material also make it a very suitable molecule for programmed self-assembly. The use of DNA to assemble metals or semiconducting particles has been extended to construct metallic nanowires and functionalized nanotubes. This paper highlights some important aspects of conjugating the unique physical properties of dots or wires with the remarkable recognition capabilities of DNA which could lead to miniaturizing biological electronics and optical devices, including biosensors and probes. Attempts to use DNA-based nanocarriers for gene delivery are discussed. In addition, the ecological advantages and risks of nanotechnology including DNA-based nanobiotechnology are evaluated. PMID:20652049

DNA-based applications in nanobiotechnology.

PubMed

Abu-Salah, Khalid M; Ansari, Anees A; Alrokayan, Salman A

2010-01-01

Biological molecules such as deoxyribonucleic acid (DNA) have shown great potential in fabrication and construction of nanostructures and devices. The very properties that make DNA so effective as genetic material also make it a very suitable molecule for programmed self-assembly. The use of DNA to assemble metals or semiconducting particles has been extended to construct metallic nanowires and functionalized nanotubes. This paper highlights some important aspects of conjugating the unique physical properties of dots or wires with the remarkable recognition capabilities of DNA which could lead to miniaturizing biological electronics and optical devices, including biosensors and probes. Attempts to use DNA-based nanocarriers for gene delivery are discussed. In addition, the ecological advantages and risks of nanotechnology including DNA-based nanobiotechnology are evaluated.

Identification of small molecules capable of regulating conformational changes of telomeric G-quadruplex

NASA Astrophysics Data System (ADS)

Chen, Shuo-Bin; Liu, Guo-Cai; Gu, Lian-Quan; Huang, Zhi-Shu; Tan, Jia-Heng

2018-02-01

Design of small molecules targeted at human telomeric G-quadruplex DNA is an extremely active research area. Interestingly, the telomeric G-quadruplex is a highly polymorphic structure. Changes in its conformation upon small molecule binding may be a powerful method to achieve a desired biological effect. However, the rational development of small molecules capable of regulating conformational change of telomeric G-quadruplex structures is still challenging. In this study, we developed a reliable ligand-based pharmacophore model based on isaindigotone derivatives with conformational change activity toward telomeric G-quadruplex DNA. Furthermore, virtual screening of database was conducted using this pharmacophore model and benzopyranopyrimidine derivatives in the database were identified as a strong inducer of the telomeric G-quadruplex DNA conformation, transforming it from hybrid-type structure to parallel structure.

Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory

PubMed Central

Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

2015-01-01

In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600

DNA origami-based shape IDs for single-molecule nanomechanical genotyping

NASA Astrophysics Data System (ADS)

Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

2017-04-01

Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.

DNA origami-based shape IDs for single-molecule nanomechanical genotyping

PubMed Central

Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

2017-01-01

Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ∼10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level. PMID:28382928

Direct Single-Molecule Observation of Mode and Geometry of RecA-Mediated Homology Search.

PubMed

Lee, Andrew J; Endo, Masayuki; Hobbs, Jamie K; Wälti, Christoph

2018-01-23

Genomic integrity, when compromised by accrued DNA lesions, is maintained through efficient repair via homologous recombination. For this process the ubiquitous recombinase A (RecA), and its homologues such as the human Rad51, are of central importance, able to align and exchange homologous sequences within single-stranded and double-stranded DNA in order to swap out defective regions. Here, we directly observe the widely debated mechanism of RecA homology searching at a single-molecule level using high-speed atomic force microscopy (HS-AFM) in combination with tailored DNA origami frames to present the reaction targets in a way suitable for AFM-imaging. We show that RecA nucleoprotein filaments move along DNA substrates via short-distance facilitated diffusions, or slides, interspersed with longer-distance random moves, or hops. Importantly, from the specific interaction geometry, we find that the double-stranded substrate DNA resides in the secondary DNA binding-site within the RecA nucleoprotein filament helical groove during the homology search. This work demonstrates that tailored DNA origami, in conjunction with HS-AFM, can be employed to reveal directly conformational and geometrical information on dynamic protein-DNA interactions which was previously inaccessible at an individual single-molecule level.

Diffusion modulation of DNA by toehold exchange

NASA Astrophysics Data System (ADS)

Rodjanapanyakul, Thanapop; Takabatake, Fumi; Abe, Keita; Kawamata, Ibuki; Nomura, Shinichiro M.; Murata, Satoshi

2018-05-01

We propose a method to control the diffusion speed of DNA molecules with a target sequence in a polymer solution. The interaction between solute DNA and diffusion-suppressing DNA that has been anchored to a polymer matrix is modulated by the concentration of the third DNA molecule called the competitor by a mechanism called toehold exchange. Experimental results show that the sequence-specific modulation of the diffusion coefficient is successfully achieved. The diffusion coefficient can be modulated up to sixfold by changing the concentration of the competitor. The specificity of the modulation is also verified under the coexistence of a set of DNA with noninteracting base sequences. With this mechanism, we are able to control the diffusion coefficient of individual DNA species by the concentration of another DNA species. This methodology introduces a programmability to a DNA-based reaction-diffusion system.

Atomic force microscope observation of branching in single transcript molecules derived from human cardiac muscle

NASA Astrophysics Data System (ADS)

Reed, Jason; Hsueh, Carlin; Mishra, Bud; Gimzewski, James K.

2008-09-01

We have used an atomic force microscope to examine a clinically derived sample of single-molecule gene transcripts, in the form of double-stranded cDNA, (c: complementary) obtained from human cardiac muscle without the use of polymerase chain reaction (PCR) amplification. We observed a log-normal distribution of transcript sizes, with most molecules being in the range of 0.4-7.0 kilobase pairs (kb) or 130-2300 nm in contour length, in accordance with the expected distribution of mRNA (m: messenger) sizes in mammalian cells. We observed novel branching structures not previously known to exist in cDNA, and which could have profound negative effects on traditional analysis of cDNA samples through cloning, PCR and DNA sequencing.

A novel single-stranded DNA detection method based on organic semiconductor heterojunction

NASA Astrophysics Data System (ADS)

Gu, Wen; Liu, Hongbo; Zhang, Xia; Zhang, Hao; Chen, Xiong; Wang, Jun

2016-12-01

We demonstrate a novel DNA detection method with low-cost and disposable advantages by utilizing F16CuPc/CuPc planar organic heterojunction device. Single-stranded DNA (ssDNA) molecules have been well immobilized on the surface of CuPc film observed by atomic force microscopy, producing an obvious electrical response of the device. The conductivity of the organic heterojunction film was significantly increased by ssDNA immobilization because ssDNA molecules brought additional positive charges at heterojunction interface. Furthermore, the thickness dependence of CuPc upper layer on the electrical response was studied to optimize the sensitivity. This study will be helpful for the development of organic heterojunction based biosensors.

Directed self-organization of single DNA molecules in a nanoslit via embedded nanopit arrays

PubMed Central

Reisner, Walter; Larsen, Niels B.; Flyvbjerg, Henrik; Tegenfeldt, Jonas O.; Kristensen, Anders

2009-01-01

We show that arrays of nanopit structures etched in a nanoslit can control the positioning and conformation of single DNA molecules in nanofluidic devices. By adjusting the spacing, organization and placement of the nanopits it is possible to immobilize DNA at predetermined regions of a device without additional chemical modification and achieve a high degree of control over local DNA conformation. DNA can be extended between two nanopits and in closely spaced arrays will self-assemble into “connect-the-dots” conformations consisting of locally pinned segments joined by fluctuating linkers. These results have broad implications for nanotechnology fields that require methods for the nanoscale positioning and manipulation of DNA. PMID:19122138

The Brain Physics: Multi Laser Beam Interaction with the Brain Topions (the Brain Neurocenters)

NASA Astrophysics Data System (ADS)

Stefan, V. Alexander

2015-03-01

A novel method for the treatment of the neurological diseases is proposed. The multiple-energy laser photons (the blue scanning photons and ultraviolet focusing photons) interact with the specific DNA molecules within the topion (such as Parkinson's and Alzheimer's brain topion) via the matching of laser frequency with the oscillation eigen-frequency of a particular molecule within the DNA. In this way, the corrupt molecules (the structure of molecules) can be manipulated so as to treat (eliminate) the neurological disease. Supported by Nikola Tesla Labs, Stefan University.

Micropatterning stretched and aligned DNA using microfluidics and surface patterning for applications in hybridization-mediated templated assembly of nanostructures

NASA Astrophysics Data System (ADS)

Carbeck, Jeffrey; Petit, Cecilia

2004-03-01

Current efforts in nanotechnology use one of two basic approaches: top-down fabrication and bottom-up assembly. Top-down strategies use lithography and contact printing to create patterned surfaces and microfluidic channels that, in turn, can corral and organize nanoscale structures. Bottom-up approaches use templates to direct the assembly of atoms, molecules, and nanoparticles through molecular recognition. The goal of this work is to integrate these strategies by first patterning and orienting DNA molecules through top-down tools so that single DNA chains can then serve as templates for the bottom-up construction of hetero-structures composed of proteins and nanoparticles, both metallic and semi-conducting. The first part of this talk focuses on the top-down strategies used to create microscopic patterns of stretched and aligned molecules of DNA. Specifically, it presents a new method in which molecular combing -- a process by which molecules are deposited and stretched onto a surface by the passage of an air-water interface -- is performed in microchannels. This approach demonstrates that the shape and motion of this interface serve as an effective local field directing the chains dynamically as they are stretched onto the surface. The geometry of the microchannel directs the placement of the DNA molecules, while the geometry of the air-water interface directs the local orientation and curvature of the molecules. This ability to control both the placement and orientation of chains has implication for the use of this technique in genetic analysis and in the bottom up approach to nanofabrication.The second half of this talk presents our bottom-up strategy, which allows placement of nanoparticles along individual DNA chains with a theoretical resolution of less than 1 nm. Specifically, we demonstrate the sequence-specific patterning of nanoparticles via the hybridization of functionalized complementary probes to surface-bound chains of double-stranded DNA. Using this technique, we demonstrate the ability to assemble metals, semiconductors, and a composite of both on a single molecule.

No recombination of mtDNA after heteroplasmy for 50 generations in the mouse maternal germline

PubMed Central

Hagström, Erik; Freyer, Christoph; Battersby, Brendan J.; Stewart, James B.; Larsson, Nils-Göran

2014-01-01

Variants of mitochondrial DNA (mtDNA) are commonly used as markers to track human evolution because of the high sequence divergence and exclusive maternal inheritance. It is assumed that the inheritance is clonal, i.e. that mtDNA is transmitted between generations without germline recombination. In contrast to this assumption, a number of studies have reported the presence of recombinant mtDNA molecules in cell lines and animal tissues, including humans. If germline recombination of mtDNA is frequent, it would strongly impact phylogenetic and population studies by altering estimates of coalescent time and branch lengths in phylogenetic trees. Unfortunately, this whole area is controversial and the experimental approaches have been widely criticized as they often depend on polymerase chain reaction (PCR) amplification of mtDNA and/or involve studies of transformed cell lines. In this study, we used an in vivo mouse model that has had germline heteroplasmy for a defined set of mtDNA mutations for more than 50 generations. To assess recombination, we adapted and validated a method based on cloning of single mtDNA molecules in the λ phage, without prior PCR amplification, followed by subsequent mutation analysis. We screened 2922 mtDNA molecules and found no germline recombination after transmission of mtDNA under genetically and evolutionary relevant conditions in mammals. PMID:24163253

A role for recombination junctions in the segregation of mitochondrial DNA in yeast.

PubMed

Lockshon, D; Zweifel, S G; Freeman-Cook, L L; Lorimer, H E; Brewer, B J; Fangman, W L

1995-06-16

In S. cerevisiae, mitochondrial DNA (mtDNA) molecules, in spite of their high copy number, segregate as if there were a small number of heritable units. The rapid segregation of mitochondrial genomes can be analyzed using mtDNA deletion variants. These small, amplified genomes segregate preferentially from mixed zygotes relative to wild-type mtDNA. This segregation advantage is abolished by mutations in a gene, MGT1, that encodes a recombination junction-resolving enzyme. We show here that resolvase deficiency causes a larger proportion of molecules to be linked together by recombination junctions, resulting in the aggregation of mtDNA into a small number of cytological structures. This change in mtDNA structure can account for the increased mitotic loss of mtDNA and the altered pattern of mtDNA segregation from zygotes. We propose that the level of unresolved recombination junctions influences the number of heritable units of mtDNA.

Chemical Biology Probes from Advanced DNA-encoded Libraries.

PubMed

Salamon, Hazem; Klika Škopić, Mateja; Jung, Kathrin; Bugain, Olivia; Brunschweiger, Andreas

2016-02-19

The identification of bioactive compounds is a crucial step toward development of probes for chemical biology studies. Screening of DNA-encoded small molecule libraries (DELs) has emerged as a validated technology to interrogate vast chemical space. DELs consist of chimeric molecules composed of a low-molecular weight compound that is conjugated to a DNA identifier tag. They are screened as pooled libraries using selection to identify "hits." Screening of DELs has identified numerous bioactive compounds. Some of these molecules were instrumental in gaining a deeper understanding of biological systems. One of the main challenges in the field is the development of synthesis methodology for DELs.

DNA-cisplatin binding mechanism peculiarities studied with single molecule stretching experiments

NASA Astrophysics Data System (ADS)

Crisafuli, F. A. P.; Cesconetto, E. C.; Ramos, E. B.; Rocha, M. S.

2012-02-01

We propose a method to determine the DNA-cisplatin binding mechanism peculiarities by monitoring the mechanical properties of these complexes. To accomplish this task, we have performed single molecule stretching experiments by using optical tweezers, from which the persistence and contour lengths of the complexes can be promptly measured. The persistence length of the complexes as a function of the drug total concentration in the sample was used to deduce the binding data, from which we show that cisplatin binds cooperatively to the DNA molecule, a point which so far has not been stressed in binding equilibrium studies of this ligand.

The interaction of DiaA and DnaA regulates the replication cycle in E. coli by directly promoting ATP–DnaA-specific initiation complexes

PubMed Central

Keyamura, Kenji; Fujikawa, Norie; Ishida, Takuma; Ozaki, Shogo; Su’etsugu, Masayuki; Fujimitsu, Kazuyuki; Kagawa, Wataru; Yokoyama, Shigeyuki; Kurumizaka, Hitoshi; Katayama, Tsutomu

2007-01-01

Escherichia coli DiaA is a DnaA-binding protein that is required for the timely initiation of chromosomal replication during the cell cycle. In this study, we determined the crystal structure of DiaA at 1.8 Å resolution. DiaA forms a homotetramer consisting of a symmetrical pair of homodimers. Mutational analysis revealed that the DnaA-binding activity and formation of homotetramers are required for the stimulation of initiation by DiaA. DiaA tetramers can bind multiple DnaA molecules simultaneously. DiaA stimulated the assembly of multiple DnaA molecules on oriC, conformational changes in ATP–DnaA-specific initiation complexes, and unwinding of oriC duplex DNA. The mutant DiaA proteins are defective in these stimulations. DiaA associated also with ADP–DnaA, and stimulated the assembly of inactive ADP–DnaA–oriC complexes. Specific residues in the putative phosphosugar-binding motif of DiaA were required for the stimulation of initiation and formation of ATP–DnaA-specific–oriC complexes. Our data indicate that DiaA regulates initiation by a novel mechanism, in which DiaA tetramers most likely bind to multiple DnaA molecules and stimulate the assembly of specific ATP–DnaA–oriC complexes. These results suggest an essential role for DiaA in the promotion of replication initiation in a cell cycle coordinated manner. PMID:17699754

Ketone-DNA: a versatile postsynthetic DNA decoration platform.

PubMed

Dey, S; Sheppard, T L

2001-12-13

[reaction: see text] A general strategy for the functional diversification of DNA oligonucleotides under physiological conditions was developed. We describe the synthesis of DNA molecules bearing ketone ports (ketone-DNA) and the efficient postsynthetic decoration of ketone-DNA with structurally diverse aminooxy compounds.

Adsorption of plasmid DNA on anion exchange chromatography media.

PubMed

Tarmann, Christina; Jungbauer, Alois

2008-08-01

Anion exchange chromatography (AEC) is a useful and effective tool for DNA purification, but due to average pore sizes between 40 and 100 nm most AEC resins lack truly useful binding capacities for plasmid DNA (pDNA). Equilibrium binding capacities and uptake kinetics of AEC media including conventional media (Source 30 Q, Q Sepharose HP), a polymer grafted medium (Fractogel EMD DEAE (M)), media with large pores (Celbeads DEAE, PL SAX 4000 A 30 microm) and a monolithic medium (CIM-DEAE) were investigated by batch uptake or shallow bed experiments at two salt concentrations. Theoretical and experimental binding capacities suggest that the shape of the pDNA molecule can be described by a rod with a length to diameter ratio of 20:1 and that the molecule binds in upright position. The arrangement of DNA like a brush at the surface can be considered as entropy driven, kind of self-assembly process which is inherent to highly and uniformly charged DNA molecules. The initial phase of adsorption is very fast and levels off, associated with a change in mass transfer mechanism. Feed concentrations higher than 0.1 mg/mL pDNA pronounce this effect. Monolithic media showed the fastest adsorption rate and highest binding capacity with 13 mg pDNA per mL.

Profiling cellular protein complexes by proximity ligation with dual tag microarray readout.

PubMed

Hammond, Maria; Nong, Rachel Yuan; Ericsson, Olle; Pardali, Katerina; Landegren, Ulf

2012-01-01

Patterns of protein interactions provide important insights in basic biology, and their analysis plays an increasing role in drug development and diagnostics of disease. We have established a scalable technique to compare two biological samples for the levels of all pairwise interactions among a set of targeted protein molecules. The technique is a combination of the proximity ligation assay with readout via dual tag microarrays. In the proximity ligation assay protein identities are encoded as DNA sequences by attaching DNA oligonucleotides to antibodies directed against the proteins of interest. Upon binding by pairs of antibodies to proteins present in the same molecular complexes, ligation reactions give rise to reporter DNA molecules that contain the combined sequence information from the two DNA strands. The ligation reactions also serve to incorporate a sample barcode in the reporter molecules to allow for direct comparison between pairs of samples. The samples are evaluated using a dual tag microarray where information is decoded, revealing which pairs of tags that have become joined. As a proof-of-concept we demonstrate that this approach can be used to detect a set of five proteins and their pairwise interactions both in cellular lysates and in fixed tissue culture cells. This paper provides a general strategy to analyze the extent of any pairwise interactions in large sets of molecules by decoding reporter DNA strands that identify the interacting molecules.

Single-Molecule Interactions of a Monoclonal Anti-DNA Antibody with DNA

PubMed Central

Nevzorova, Tatiana A.; Zhao, Qingze; Lomakin, Yakov A.; Ponomareva, Anastasia A.; Mukhitov, Alexander R.; Purohit, Prashant K.; Weisel, John W.; Litvinov, Rustem I.

2017-01-01

Interactions of DNA with proteins are essential for key biological processes and have both a fundamental and practical significance. In particular, DNA binding to anti-DNA antibodies is a pathogenic mechanism in autoimmune pathology, such as systemic lupus erythematosus. Here we measured at the single-molecule level binding and forced unbinding of surface-attached DNA and a monoclonal anti-DNA antibody MRL4 from a lupus erythematosus mouse. In optical trap-based force spectroscopy, a microscopic antibodycoated latex bead is trapped by a focused laser beam and repeatedly brought into contact with a DNA-coated surface. After careful discrimination of non-specific interactions, we showed that the DNA-antibody rupture force spectra had two regimes, reflecting formation of weaker (20–40 pN) and stronger (>40 pN) immune complexes that implies the existence of at least two bound states with different mechanical stability. The two-dimensional force-free off-rate for the DNA-antibody complexes was ~2.2 × 10−3 s−1, the transition state distance was ~0.94 nm, the apparent on-rate was ~5.26 s−1, and the stiffness of the DNA-antibody complex was characterized by a spring constant of 0.0021 pN/nm, suggesting that the DNA-antibody complex is a relatively stable, but soft and deformable macromolecular structure. The stretching elasticity of the DNA molecules was characteristic of single-stranded DNA, suggesting preferential binding of the MRL4 antibody to one strand of DNA. Collectively, the results provide fundamental characteristics of formation and forced dissociation of DNA-antibody complexes that help to understand principles of DNA-protein interactions and shed light on the molecular basis of autoimmune diseases accompanied by formation of anti-DNA antibodies. PMID:29104846

An optical deoxyribonucleic acid-based half-subtractor.

PubMed

Yang, Chia-Ning; Chen, Yi-Li; Lin, Hung-Yin; Hsu, Chun-Yu

2013-10-09

This study introduces an optical DNA-based logic circuit that mimics a half-subtractor. The system contains an Au-surface immobilized molecular-beacon molecule that serves as a dual-gate molecule and outputs two series of fluorescence signals following Boolean INH and XOR patterns after interacting with one or two single-stranded DNA molecules as input. To the best of our knowledge, the system reported herein is rather concise compared to other molecular logic gate systems.

Studies on the accessibility of deoxyribonucleic acid in deoxyribonucleoprotein to cationic molecules

PubMed Central

Itzhaki, Ruth F.

1971-01-01

The binding of deoxyribonucleoprotein to Toluidine Blue, to cetylpyridinium chloride and to polylysine of various molecular weights was studied to determine the percentage of free DNA phosphate groups in deoxyribonucleoprotein. Binding was measured by addition of these reagents to deoxyribonucleoprotein at a range of concentrations such that complete precipitation of the deoxyribonucleoprotein occurred. With Toluidine Blue the binding corresponded to about 48% of the DNA phosphates in deoxyribonucleoprotein. The dye did not cause appreciable displacement of protein from the DNA. With cetylpyridinium chloride the binding corresponded to about 41% of the DNA phosphates. With polylysine preparations of molecular weight 1250 and 7790 the binding values for deoxyribonucleoprotein were 46 and 38% respectively. The results suggest that the free phosphates lie in stretches sufficiently long to accommodate most of each polylysine molecule. With polylysine of molecular weight 62000 cross-linking of free stretches of DNA on different deoxyribonucleoprotein molecules probably occurs. It is concluded that although most of the free phosphates are probably `hidden' beneath covering histone, corresponding perhaps to runs of non-basic residues in the latter, they are surprisingly accessible to very large molecules. The relevance of this finding to the problem of gene repression is discussed. PMID:5166331

Control of microtubule trajectory within an electric field by altering surface charge density

PubMed Central

Isozaki, Naoto; Ando, Suguru; Nakahara, Tasuku; Shintaku, Hirofumi; Kotera, Hidetoshi; Meyhöfer, Edgar; Yokokawa, Ryuji

2015-01-01

One of challenges for using microtubules (MTs) driven by kinesin motors in microfluidic environments is to control their direction of movement. Although applying physical biases to rectify MTs is prevalent, it has not been established as a design methodology in conjunction with microfluidic devices. In the future, the methodology is expected to achieve functional motor-driven nanosystems. Here, we propose a method to guide kinesin-propelled MTs in multiple directions under an electric field by designing a charged surface of MT minus ends labeled with dsDNA via a streptavidin-biotin interaction. MTs labeled with 20-bp or 50-bp dsDNA molecules showed significantly different trajectories according to the DNA length, which were in good agreement with values predicted from electrophoretic mobilities measured for their minus ends. Since the effective charge of labeled DNA molecules was equal to that of freely dispersed DNA molecules in a buffer solution, MT trajectory could be estimated by selecting labeling molecules with known charges. Moreover, the estimated trajectory enables to define geometrical sizes of a microfluidic device. This rational molecular design and prediction methodology allows MTs to be guided in multiple directions, demonstrating the feasibility of using molecular sorters driven by motor proteins. PMID:25567007

Control of microtubule trajectory within an electric field by altering surface charge density.

PubMed

Isozaki, Naoto; Ando, Suguru; Nakahara, Tasuku; Shintaku, Hirofumi; Kotera, Hidetoshi; Meyhöfer, Edgar; Yokokawa, Ryuji

2015-01-08

One of challenges for using microtubules (MTs) driven by kinesin motors in microfluidic environments is to control their direction of movement. Although applying physical biases to rectify MTs is prevalent, it has not been established as a design methodology in conjunction with microfluidic devices. In the future, the methodology is expected to achieve functional motor-driven nanosystems. Here, we propose a method to guide kinesin-propelled MTs in multiple directions under an electric field by designing a charged surface of MT minus ends labeled with dsDNA via a streptavidin-biotin interaction. MTs labeled with 20-bp or 50-bp dsDNA molecules showed significantly different trajectories according to the DNA length, which were in good agreement with values predicted from electrophoretic mobilities measured for their minus ends. Since the effective charge of labeled DNA molecules was equal to that of freely dispersed DNA molecules in a buffer solution, MT trajectory could be estimated by selecting labeling molecules with known charges. Moreover, the estimated trajectory enables to define geometrical sizes of a microfluidic device. This rational molecular design and prediction methodology allows MTs to be guided in multiple directions, demonstrating the feasibility of using molecular sorters driven by motor proteins.

Sequence Dependencies of DNA Deformability and Hydration in the Minor Groove

PubMed Central

Yonetani, Yoshiteru; Kono, Hidetoshi

2009-01-01

Abstract DNA deformability and hydration are both sequence-dependent and are essential in specific DNA sequence recognition by proteins. However, the relationship between the two is not well understood. Here, systematic molecular dynamics simulations of 136 DNA sequences that differ from each other in their central tetramer revealed that sequence dependence of hydration is clearly correlated with that of deformability. We show that this correlation can be illustrated by four typical cases. Most rigid basepair steps are highly likely to form an ordered hydration pattern composed of one water molecule forming a bridge between the bases of distinct strands, but a few exceptions favor another ordered hydration composed of two water molecules forming such a bridge. Steps with medium deformability can display both of these hydration patterns with frequent transition. Highly flexible steps do not have any stable hydration pattern. A detailed picture of this correlation demonstrates that motions of hydration water molecules and DNA bases are tightly coupled with each other at the atomic level. These results contribute to our understanding of the entropic contribution from water molecules in protein or drug binding and could be applied for the purpose of predicting binding sites. PMID:19686662

The nature of the force-induced conformation transition of dsDNA studied by using single molecule force spectroscopy.

PubMed

Liu, Ningning; Bu, Tianjia; Song, Yu; Zhang, Wei; Li, Jinjing; Zhang, Wenke; Shen, Jiacong; Li, Hongbin

2010-06-15

Single-stranded DNA binding proteins (SSB) interact with single-stranded DNA (ssDNA) specifically. Taking advantage of this character, we have employed Bacillus subtilis SSB protein to investigate the nature of force-induced conformation transition of double-stranded DNA (dsDNA) by using AFM-based single molecule force spectroscopy (SMFS) technique. Our results show that, when a dsDNA is stretched beyond its contour length, the dsDNA is partially melted, producing some ssDNA segments which can be captured by SSB proteins. We have also systematically investigated the effects of stretching length, waiting time, and salt concentration on the conformation transition of dsDNA and SSB-ssDNA interactions, respectively. Furthermore, the effect of proflavine, a DNA intercalator, on the SSB-DNA interactions has been investigated, and the results indicate that the proflavine-saturated dsDNA can be stabilized to the extent that the dsDNA will no longer melt into ssDNA under the mechanical force even up to 150 pN, and no SSB-DNA interactions are detectable.

Problem-Solving Test: Restriction Endonuclease Mapping

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2011-01-01

The term "restriction endonuclease mapping" covers a number of related techniques used to identify specific restriction enzyme recognition sites on small DNA molecules. A method for restriction endonuclease mapping of a 1,000-basepair (bp)-long DNA molecule is described in the fictitious experiment of this test. The most important fact needed to…

An improved divergent synthesis of comb-type branched oligodeoxyribonucleotides (bDNA) containing multiple secondary sequences.

PubMed

Horn, T; Chang, C A; Urdea, M S

1997-12-01

The divergent synthesis of branched DNA (bDNA) comb structures is described. This new type of bDNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branch network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb structures were assembled on a solid support and several synthesis parameters were investigated and optimized. The bDNA comb molecules were characterized by polyacrylamide gel electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The developed chemistry allows synthesis of bDNA comb molecules containing multiple secondary sequences. In the accompanying article we describe the synthesis and characterization of large bDNA combs containing all four deoxynucleotides for use as signal amplifiers in nucleic acid quantification assays.

An improved divergent synthesis of comb-type branched oligodeoxyribonucleotides (bDNA) containing multiple secondary sequences.

PubMed Central

Horn, T; Chang, C A; Urdea, M S

1997-01-01

The divergent synthesis of branched DNA (bDNA) comb structures is described. This new type of bDNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branch network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb structures were assembled on a solid support and several synthesis parameters were investigated and optimized. The bDNA comb molecules were characterized by polyacrylamide gel electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The developed chemistry allows synthesis of bDNA comb molecules containing multiple secondary sequences. In the accompanying article we describe the synthesis and characterization of large bDNA combs containing all four deoxynucleotides for use as signal amplifiers in nucleic acid quantification assays. PMID:9365265

Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

PubMed

Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

2017-11-28

Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

The Maintenance of Mitochondrial DNA Integrity—Critical Analysis and Update

PubMed Central

Alexeyev, Mikhail; Shokolenko, Inna; Wilson, Glenn; LeDoux, Susan

2013-01-01

DNA molecules in mitochondria, just like those in the nucleus of eukaryotic cells, are constantly damaged by noxious agents. Eukaryotic cells have developed efficient mechanisms to deal with this assault. The process of DNA repair in mitochondria, initially believed nonexistent, has now evolved into a mature area of research. In recent years, it has become increasingly appreciated that mitochondria possess many of the same DNA repair pathways that the nucleus does. Moreover, a unique pathway that is enabled by high redundancy of the mitochondrial DNA and allows for the disposal of damaged DNA molecules operates in this organelle. In this review, we attempt to present a unified view of our current understanding of the process of DNA repair in mitochondria with an emphasis on issues that appear controversial. PMID:23637283

Autonomous generation and loading of DNA guides by bacterial Argonaute

PubMed Central

Chandradoss, Stanley D.; Zhu, Yifan; Timmers, Elizabeth M.; Zhang, Yong; Zhao, Hongtu; Lou, Jizhong; Wang, Yanli; Joo, Chirlmin; van der Oost, John

2018-01-01

Summary Several prokaryotic Argonaute proteins (pAgos) utilize small DNA guides to mediate host defense by targeting invading DNA complementary to the DNA guide. It is unknown how these DNA guides are being generated and loaded onto pAgo. Here we demonstrate that guide-free Argonaute from Thermus thermophilus (TtAgo) can degrade dsDNA, thereby generating small dsDNA fragments that subsequently are loaded onto TtAgo. Combining single-molecule fluorescence, molecular dynamic simulations and structural studies, we show that TtAgo loads dsDNA molecules with a preference towards a deoxyguanosine on the passenger strand at the position opposite to the 5’-end of the guide strand. This explains why in vivo TtAgo is preferentially loaded with guides with a 5’-end deoxycytidine. Our data demonstrate that TtAgo can independently generate and selectively load functional DNA guides. PMID:28262506

Bio-recognitive photonics of a DNA-guided organic semiconductor.

PubMed

Back, Seung Hyuk; Park, Jin Hyuk; Cui, Chunzhi; Ahn, Dong June

2016-01-04

Incorporation of duplex DNA with higher molecular weights has attracted attention for a new opportunity towards a better organic light-emitting diode (OLED) capability. However, biological recognition by OLED materials is yet to be addressed. In this study, specific oligomeric DNA-DNA recognition is successfully achieved by tri (8-hydroxyquinoline) aluminium (Alq3), an organic semiconductor. Alq3 rods crystallized with guidance from single-strand DNA molecules show, strikingly, a unique distribution of the DNA molecules with a shape of an 'inverted' hourglass. The crystal's luminescent intensity is enhanced by 1.6-fold upon recognition of the perfect-matched target DNA sequence, but not in the case of a single-base mismatched one. The DNA-DNA recognition forming double-helix structure is identified to occur only in the rod's outer periphery. This study opens up new opportunities of Alq3, one of the most widely used OLED materials, enabling biological recognition.

Bio-recognitive photonics of a DNA-guided organic semiconductor

NASA Astrophysics Data System (ADS)

Back, Seung Hyuk; Park, Jin Hyuk; Cui, Chunzhi; Ahn, Dong June

2016-01-01

Incorporation of duplex DNA with higher molecular weights has attracted attention for a new opportunity towards a better organic light-emitting diode (OLED) capability. However, biological recognition by OLED materials is yet to be addressed. In this study, specific oligomeric DNA-DNA recognition is successfully achieved by tri (8-hydroxyquinoline) aluminium (Alq3), an organic semiconductor. Alq3 rods crystallized with guidance from single-strand DNA molecules show, strikingly, a unique distribution of the DNA molecules with a shape of an `inverted' hourglass. The crystal's luminescent intensity is enhanced by 1.6-fold upon recognition of the perfect-matched target DNA sequence, but not in the case of a single-base mismatched one. The DNA-DNA recognition forming double-helix structure is identified to occur only in the rod's outer periphery. This study opens up new opportunities of Alq3, one of the most widely used OLED materials, enabling biological recognition.

Changes in solvation during DNA binding and cleavage are critical to altered specificity of the EcoRI endonuclease

PubMed Central

Robinson, Clifford R.; Sligar, Stephen G.

1998-01-01

Restriction endonucleases such as EcoRI bind and cleave DNA with great specificity and represent a paradigm for protein–DNA interactions and molecular recognition. Using osmotic pressure to induce water release, we demonstrate the participation of bound waters in the sequence discrimination of substrate DNA by EcoRI. Changes in solvation can play a critical role in directing sequence-specific DNA binding by EcoRI and are also crucial in assisting site discrimination during catalysis. By measuring the volume change for complex formation, we show that at the cognate sequence (GAATTC) EcoRI binding releases about 70 fewer water molecules than binding at an alternate DNA sequence (TAATTC), which differs by a single base pair. EcoRI complexation with nonspecific DNA releases substantially less water than either of these specific complexes. In cognate substrates (GAATTC) kcat decreases as osmotic pressure is increased, indicating the binding of about 30 water molecules accompanies the cleavage reaction. For the alternate substrate (TAATTC), release of about 40 water molecules accompanies the reaction, indicated by a dramatic acceleration of the rate when osmotic pressure is raised. These large differences in solvation effects demonstrate that water molecules can be key players in the molecular recognition process during both association and catalytic phases of the EcoRI reaction, acting to change the specificity of the enzyme. For both the protein–DNA complex and the transition state, there may be substantial conformational differences between cognate and alternate sites, accompanied by significant alterations in hydration and solvent accessibility. PMID:9482860

Probe DNA-Cisplatin Interaction with Solid-State Nanopores

NASA Astrophysics Data System (ADS)

Zhou, Zhi; Hu, Ying; Li, Wei; Xu, Zhi; Wang, Pengye; Bai, Xuedong; Shan, Xinyan; Lu, Xinghua; Nanopore Collaboration

2014-03-01

Understanding the mechanism of DNA-cisplatin interaction is essential for clinical application and novel drug design. As an emerging single-molecule technology, solid-state nanopore has been employed in biomolecule detection and probing DNA-molecule interactions. Herein, we reported a real-time monitoring of DNA-cisplatin interaction by employing solid-state SiN nanopores. The DNA-cisplatin interacting process is clearly classified into three stages by measuring the capture rate of DNA-cisplatin adducts. In the first stage, the negative charged DNA molecules were partially discharged due to the bonding of positive charged cisplatin and forming of mono-adducts. In the second stage, forming of DNA-cisplatin di-adducts with the adjacent bases results in DNA bending and softening. The capture rate increases since the softened bi-adducts experience a lower barrier to thread into the nanopores. In the third stage, complex structures, such as micro-loop, are formed and the DNA-cisplatin adducts are aggregated. The capture rate decreases to zero as the aggregated adduct grows to the size of the pore. The characteristic time of this stage was found to be linear with the diameter of the nanopore and this dynamic process can be described with a second-order reaction model. We are grateful to Laboratory of Microfabrication, Dr. Y. Yao, and Prof. R.C. Yu (Institute of Physics, Chinese Academy of Sciences) for technical assistance.

Methods And Devices For Characterizing Duplex Nucleic Acid Molecules

DOEpatents

Akeson, Mark; Vercoutere, Wenonah; Haussler, David; Winters-Hilt, Stephen

2005-08-30

Methods and devices are provided for characterizing a duplex nucleic acid, e.g., a duplex DNA molecule. In the subject methods, a fluid conducting medium that includes a duplex nucleic acid molecule is contacted with a nanopore under the influence of an applied electric field and the resulting changes in current through the nanopore caused by the duplex nucleic acid molecule are monitored. The observed changes in current through the nanopore are then employed as a set of data values to characterize the duplex nucleic acid, where the set of data values may be employed in raw form or manipulated, e.g., into a current blockade profile. Also provided are nanopore devices for practicing the subject methods, where the subject nanopore devices are characterized by the presence of an algorithm which directs a processing means to employ monitored changes in current through a nanopore to characterize a duplex nucleic acid molecule responsible for the current changes. The subject methods and devices find use in a variety of applications, including, among other applications, the identification of an analyte duplex DNA molecule in a sample, the specific base sequence at a single nulceotide polymorphism (SNP), and the sequencing of duplex DNA molecules.

The Dynamics of Entangled DNA Networks using Single-Molecule Methods

NASA Astrophysics Data System (ADS)

Chapman, Cole David

Single molecule experiments were performed on DNA, a model polymer, and entangled DNA networks to explore diffusion within complex polymeric fluids and their linear and non-linear viscoelasticity. DNA molecules of varying length and topology were prepared using biological methods. An ensemble of individual molecules were then fluorescently labeled and tracked in blends of entangled linear and circular DNA to examine the dependence of diffusion on polymer length, topology, and blend ratio. Diffusion was revealed to possess a non-monotonic dependence on the blend ratio, which we believe to be due to a second-order effect where the threading of circular polymers by their linear counterparts greatly slows the mobility of the system. Similar methods were used to examine the diffusive and conformational behavior of DNA within highly crowded environments, comparable to that experienced within the cell. A previously unseen gamma distributed elongation of the DNA in the presence of crowders, proposed to be due to entropic effects and crowder mobility, was observed. Additionally, linear viscoelastic properties of entangled DNA networks were explored using active microrheology. Plateau moduli values verified for the first time the predicted independence from polymer length. However, a clear bead-size dependence was observed for bead radii less than ~3x the tube radius, a newly discovered limit, above which microrheology results are within the continuum limit and may access the bulk properties of the fluid. Furthermore, the viscoelastic properties of entangled DNA in the non-linear regime, where the driven beads actively deform the network, were also examined. By rapidly driving a bead through the network utilizing optical tweezers, then removing the trap and tracking the bead's subsequent motion we are able to model the system as an over-damped harmonic oscillator and find the elasticity to be dominated by stress-dependent entanglements.

Flow cytometric sex sorting affects CD4 membrane distribution and binding of exogenous DNA on bovine sperm cells.

PubMed

Domingues, William Borges; da Silveira, Tony Leandro Rezende; Komninou, Eliza Rossi; Monte, Leonardo Garcia; Remião, Mariana Härter; Dellagostin, Odir Antônio; Corcini, Carine Dahl; Varela Junior, Antônio Sergio; Seixas, Fabiana Kömmling; Collares, Tiago; Campos, Vinicius Farias

2017-08-01

Bovine sex-sorted sperm have been commercialized and successfully used for the production of transgenic embryos of the desired sex through the sperm-mediated gene transfer (SMGT) technique. However, sex-sorted sperm show a reduced ability to internalize exogenous DNA. The interaction between sperm cells and the exogenous DNA has been reported in other species to be a CD4-like molecule-dependent process. The flow cytometry-based sex-sorting process subjects the spermatozoa to different stresses causing changes in the cell membrane. The aim of this study was to elucidate the relationship between the redistribution of CD4-like molecules and binding of exogenous DNA to sex-sorted bovine sperm. In the first set of experiments, the membrane phospholipid disorder and the redistribution of the CD4 were evaluated. The second set of experiments was conducted to investigate the effect of CD4 redistribution on the mechanism of binding of exogenous DNA to sperm cells and the efficiency of lipofection in sex-sorted bovine sperm. Sex-sorting procedure increased the membrane phospholipid disorder and induced the redistribution of CD4-like molecules. Both X-sorted and Y-sorted sperm had decreased DNA bound to membrane in comparison with the unsorted sperm; however, the binding of the exogenous DNA was significantly increased with the addition of liposomes. Moreover, we demonstrated that the number of sperm-bound exogenous DNA was decreased when these cells were preincubated with anti-bovine CD4 monoclonal antibody, supporting our hypothesis that CD4-like molecules indeed play a crucial role in the process of exogenous DNA/bovine sperm cells interaction.

Branchpoint expansion in a fully complementary three-way DNA junction.

PubMed

Sabir, Tara; Toulmin, Anita; Ma, Long; Jones, Anita C; McGlynn, Peter; Schröder, Gunnar F; Magennis, Steven W

2012-04-11

Branched nucleic acid molecules serve as key intermediates in DNA replication, recombination, and repair; architectural elements in RNA; and building blocks and functional components for nanoscience applications. Using a combination of high-resolution single-molecule FRET, time-resolved spectroscopy, and molecular modeling, we have probed the local and global structure of a DNA three-way junction (3WJ) in solution. We found that it adopts a Y-shaped, pyramidal structure, in which the bases adjacent to the branchpoint are unpaired, despite the full Watson-Crick complementarity of the molecule. The unpairing allows a nanoscale cavity to form at the junction center. Our structure accounts for earlier observations made of the structure, flexibility, and reactivity of 3WJs. We anticipate that these results will guide the development of new DNA-based supramolecular receptors and nanosystems. © 2012 American Chemical Society

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Mechanisms of DNA disentangling by type II topoisomerases. Comment on "Disentangling DNA molecules" by Alexander Vologodskii

NASA Astrophysics Data System (ADS)

Yan, Jie

2016-09-01

In this article [1] Dr. Vologodskii presents a comprehensive discussion on the mechanisms by which the type II topoisomerases unknot/disentangle DNA molecules. It is motivated by a mysterious capability of the nanometer-size enzymes to keep the steady-state probability of DNA entanglement/knot almost two orders of magnitude below that expected from thermal equilibrium [2-5]. In spite of obvious functional advantages of the enzymes, it raises a question regarding how such high efficiency could be achieved. The off-equilibrium steady state distribution of DNA topology is powered by ATP consumption. However, it remains unclear how this energy is utilized to bias the distribution toward disentangled/unknotted topological states of DNA.

Characterization of the tunneling conductance across DNA bases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zikic, Radomir; Krstic, Predrag S; Zhang, Xiaoguang

2006-01-01

Characterization of the electrical properties of the DNA bases, Adenine, Cytosine, Guanine and Thymine, besides building the basic knowledge on these fundamental constituents of a DNA, is a crucial step in developing a DNA sequencing technology. We present a first-principles study of the current-voltage characteristics of nucleotide-like molecules of the DNA bases, placed in a 1.5 nm gap formed between gold nanoelectrodes. The quantum transport calculations in the tunneling regime are shown to vary strongly with the electrode-molecule geometry and the choice of the DFT exchangecorrelation functionals. Analysis of the results in the zero-bias limit indicates that distinguishable current-voltage characteristicsmore » of different DNA bases are dominated by the geometrical conformations of the bases and nanoelectrodes.« less

Characterization of the tunneling conductance across DNA bases.

PubMed

Zikic, Radomir; Krstić, Predrag S; Zhang, X-G; Fuentes-Cabrera, Miguel; Wells, Jack; Zhao, Xiongce

2006-07-01

Characterization of the electrical properties of the DNA bases (adenine, cytosine, guanine, and thymine), in addition to building the basic knowledge on these fundamental constituents of a DNA, is a crucial step in developing a DNA sequencing technology. We present a first-principles study of the current-voltage characteristics of nucleotidelike molecules of the DNA bases, placed in a 1.5 nm gap formed between gold nanoelectrodes. The quantum transport calculations in the tunneling regime are shown to vary strongly with the electrode-molecule geometry and the choice of the density-functional theory exchange-correlation functionals. Analysis of the results in the zero-bias limit indicates that distinguishable current-voltage characteristics of different DNA bases are dominated by the geometrical conformations of the bases and nanoelectrodes.

Raman study of CaDNA films as a function of water content and excess CaCl2 concentration: Stability of the B conformation.

NASA Astrophysics Data System (ADS)

Schwenker, Megan; Marlowe, Robert; Lee, Scott; Rupprecht, Allan

2006-03-01

Highly oriented, wet-spun films of CaDNA expand in the direction perpendicular to the helical axis as the hydration of the film is increased. CaDNA films with a high CaCl2 content show an unexpected shrinkage at a relative humidity of about 93%. We have performed Raman experiments on CaDNA films as a function of both water content and excess CaCl2 concentration in order to determine if this unexpected shrinkage might be related to a conformational transition of the DNA molecules. We find that the DNA molecules remain in the B conformation for all salt contents down to a relative humidity of 59%.

In vitro molecular machine learning algorithm via symmetric internal loops of DNA.

PubMed

Lee, Ji-Hoon; Lee, Seung Hwan; Baek, Christina; Chun, Hyosun; Ryu, Je-Hwan; Kim, Jin-Woo; Deaton, Russell; Zhang, Byoung-Tak

2017-08-01

Programmable biomolecules, such as DNA strands, deoxyribozymes, and restriction enzymes, have been used to solve computational problems, construct large-scale logic circuits, and program simple molecular games. Although studies have shown the potential of molecular computing, the capability of computational learning with DNA molecules, i.e., molecular machine learning, has yet to be experimentally verified. Here, we present a novel molecular learning in vitro model in which symmetric internal loops of double-stranded DNA are exploited to measure the differences between training instances, thus enabling the molecules to learn from small errors. The model was evaluated on a data set of twenty dialogue sentences obtained from the television shows Friends and Prison Break. The wet DNA-computing experiments confirmed that the molecular learning machine was able to generalize the dialogue patterns of each show and successfully identify the show from which the sentences originated. The molecular machine learning model described here opens the way for solving machine learning problems in computer science and biology using in vitro molecular computing with the data encoded in DNA molecules. Copyright © 2017. Published by Elsevier B.V.

DNA Immobilization and Hybridization Detection by the Intrinsic Molecular Charge Using Capacitive Field-Effect Sensors Modified with a Charged Weak Polyelectrolyte Layer.

PubMed

Bronder, Thomas S; Poghossian, Arshak; Scheja, Sabrina; Wu, Chunsheng; Keusgen, Michael; Mewes, Dieter; Schöning, Michael J

2015-09-16

Miniaturized setup, compatibility with advanced micro- and nanotechnologies, and ability to detect biomolecules by their intrinsic molecular charge favor the semiconductor field-effect platform as one of the most attractive approaches for the development of label-free DNA chips. In this work, a capacitive field-effect EIS (electrolyte-insulator-semiconductor) sensor covered with a layer-by-layer prepared, positively charged weak polyelectrolyte layer of PAH (poly(allylamine hydrochloride)) was used for the label-free electrical detection of DNA (deoxyribonucleic acid) immobilization and hybridization. The negatively charged probe single-stranded DNA (ssDNA) molecules were electrostatically adsorbed onto the positively charged PAH layer, resulting in a preferentially flat orientation of the ssDNA molecules within the Debye length, thus yielding a reduced charge-screening effect and a higher sensor signal. Each sensor-surface modification step (PAH adsorption, probe ssDNA immobilization, hybridization with complementary target DNA (cDNA), reducing an unspecific adsorption by a blocking agent, incubation with noncomplementary DNA (ncDNA) solution) was monitored by means of capacitance-voltage and constant-capacitance measurements. In addition, the surface morphology of the PAH layer was studied by atomic force microscopy and contact-angle measurements. High hybridization signals of 34 and 43 mV were recorded in low-ionic strength solutions of 10 and 1 mM, respectively. In contrast, a small signal of 4 mV was recorded in the case of unspecific adsorption of fully mismatched ncDNA. The density of probe ssDNA and dsDNA molecules as well as the hybridization efficiency was estimated using the experimentally measured DNA immobilization and hybridization signals and a simplified double-layer capacitor model. The results of field-effect experiments were supported by fluorescence measurements, verifying the DNA-immobilization and hybridization event.

Direct optical mapping of transcription factor binding sites on field-stretched λ-DNA in nanofluidic devices

PubMed Central

Sriram, K. K.; Yeh, Jia-Wei; Lin, Yii-Lih; Chang, Yi-Ren; Chou, Chia-Fu

2014-01-01

Mapping transcription factor (TF) binding sites along a DNA backbone is crucial in understanding the regulatory circuits that control cellular processes. Here, we deployed a method adopting bioconjugation, nanofluidic confinement and fluorescence single molecule imaging for direct mapping of TF (RNA polymerase) binding sites on field-stretched single DNA molecules. Using this method, we have mapped out five of the TF binding sites of E. coli RNA polymerase to bacteriophage λ-DNA, where two promoter sites and three pseudo-promoter sites are identified with the corresponding binding frequency of 45% and 30%, respectively. Our method is quick, robust and capable of resolving protein-binding locations with high accuracy (∼ 300 bp), making our system a complementary platform to the methods currently practiced. It is advantageous in parallel analysis and less prone to false positive results over other single molecule mapping techniques such as optical tweezers, atomic force microscopy and molecular combing, and could potentially be extended to general mapping of protein–DNA interaction sites. PMID:24753422

Nanotechnology Approaches to Studying Epigenetic Changes in Cancer

NASA Astrophysics Data System (ADS)

Riehn, Robert

2011-03-01

Placing polyelectrolytes into confined geometries has a profound effect on their molecular configuration. For instance, placing long DNA molecules into channels with a cross-section of about 100 nm 2 stretches them out to about 70% of their contour length. We are using this effect to map epigenetic changes on single DNA and chromatin strands. This mapping on single molecules becomes central in the study of the heterogeneity of cell population in cancer, since rapid change of epigenetic makeup, propagated through rare cancer stem cells, is a hallmark of its progression. We demonstrate the basic building blocks for the single-molecule epigenetic analysis of genomic sized DNA. In particular, we have achieved the mapping of methylated regions in DNA with heterogeneous 5-methyl cytosine modification using a specific fluorescent marker. We further show that chromatin with an intact histone structure can be stretched similar to DNA, and that the epigenetic state of histone tails can be detected using fluorescent antibodies.

Single-molecule study of DNA unlinking by eukaryotic and prokaryotic type-II topoisomerases

PubMed Central

Charvin, G.; Bensimon, D.; Croquette, V.

2003-01-01

Type-II topoisomerases are responsible for untangling DNA during replication by removing supercoiled and interlinked DNA structures. Using a single-molecule micromanipulation setup, we follow the real-time decatenation of two mechanically braided DNA molecules by Drosophila melanogaster topoisomerase (Topo) II and Escherichia coli Topo IV. Although Topo II relaxes left-handed (L) and right-handed (R-) braids similarly at a rate of ≈2.9 s–1, Topo IV has a marked preference for L-braids, which it relaxes completely and processively at a rate of ≈2.4 s–1. However, Topo IV can unlink R-braids at about half that rate when they supercoil to form L-plectonemes. These results imply that the preferred substrate for unlinking by Topo IV has the symmetry of an L-crossing and shed new light on the decatenation of daughter strands during DNA replication, which are usually assumed to be linked in an R-braid. PMID:12902541

DNA melting profiles from a matrix method.

PubMed

Poland, Douglas

2004-02-05

In this article we give a new method for the calculation of DNA melting profiles. Based on the matrix formulation of the DNA partition function, the method relies for its efficiency on the fact that the required matrices are very sparse, essentially reducing matrix multiplication to vector multiplication and thus making the computer time required to treat a DNA molecule containing N base pairs proportional to N(2). A key ingredient in the method is the result that multiplication by the inverse matrix can also be reduced to vector multiplication. The task of calculating the melting profile for the entire genome is further reduced by treating regions of the molecule between helix-plateaus, thus breaking the molecule up into independent parts that can each be treated individually. The method is easily modified to incorporate changes in the assignment of statistical weights to the different structural features of DNA. We illustrate the method using the genome of Haemophilus influenzae. Copyright 2003 Wiley Periodicals, Inc.

Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory.

PubMed

Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-Ichi; Sugimoto, Naoki

2015-12-02

In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water-water interactions, (ii) ethylene glycol more effectively disrupted water-water interactions around Watson-Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson-Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Regulation of DNA conformations and dynamics in flows with hybrid field microfluidics.

PubMed

Ren, Fangfang; Zu, Yingbo; Kumar Rajagopalan, Kartik; Wang, Shengnian

2012-01-01

Visualizing single DNA dynamics in flow provides a wealth of physical insights in biophysics and complex flow study. However, large signal fluctuations, generated from diversified conformations, deformation history dependent dynamics and flow induced stochastic tumbling, often frustrate its wide adoption in single molecule and polymer flow study. We use a hybrid field microfluidic (HFM) approach, in which an electric field is imposed at desired locations and appropriate moments to balance the flow stress on charged molecules, to effectively regulate the initial conformations and the deformation dynamics of macromolecules in flow. With λ-DNA and a steady laminar shear flow as the model system, we herein studied the performance of HFM on regulating DNA trapping, relaxation, coil-stretch transition, and accumulation. DNA molecules were found to get captured in the focused planes when motions caused by flow, and the electric field were balanced. The trapped macromolecules relaxed in two different routes while eventually became more uniform in size and globule conformations. When removing the electric field, the sudden stretching dynamics of DNA molecules exhibited a more pronounced extension overshoot in their transient response under a true step function of flow stress while similar behaviors to what other pioneering work in steady shear flow. Such regulation strategies could be useful to control the conformations of other important macromolecules (e.g., proteins) and help better reveal their molecular dynamics.

Reverse Transcriptase Activity in Mature Spermatozoa of Mouse

PubMed Central

Giordano, Roberto; Magnano, Anna Rosa; Zaccagnini, Germana; Pittoggi, Carmine; Moscufo, Nicola; Lorenzini, Rodolfo; Spadafora, Corrado

2000-01-01

We show here that a reverse transcriptase (RT) activity is present in murine epididymal spermatozoa. Sperm cells incubated with human poliovirus RNA can take up exogenous RNA molecules and internalize them in nuclei. Direct PCR amplification of DNA extracted from RNA-incubated spermatozoa indicate that poliovirus RNA is reverse-transcribed in cDNA fragments. PCR analysis of two-cell embryos shows that poliovirus RNA-challenged spermatozoa transfer retrotranscribed cDNA molecules into eggs during in vitro fertilization. Finally, RT molecules can be visualized on sperm nuclear scaffolds by immunogold electron microscopy. These results, therefore, reveal a novel metabolic function in spermatozoa, which may play a role during early embryonic development. PMID:10725323

Searching target sites on DNA by proteins: Role of DNA dynamics under confinement

PubMed Central

Mondal, Anupam; Bhattacherjee, Arnab

2015-01-01

DNA-binding proteins (DBPs) rapidly search and specifically bind to their target sites on genomic DNA in order to trigger many cellular regulatory processes. It has been suggested that the facilitation of search dynamics is achieved by combining 3D diffusion with one-dimensional sliding and hopping dynamics of interacting proteins. Although, recent studies have advanced the knowledge of molecular determinants that affect one-dimensional search efficiency, the role of DNA molecule is poorly understood. In this study, by using coarse-grained simulations, we propose that dynamics of DNA molecule and its degree of confinement due to cellular crowding concertedly regulate its groove geometry and modulate the inter-communication with DBPs. Under weak confinement, DNA dynamics promotes many short, rotation-decoupled sliding events interspersed by hopping dynamics. While this results in faster 1D diffusion, associated probability of missing targets by jumping over them increases. In contrast, strong confinement favours rotation-coupled sliding to locate targets but lacks structural flexibility to achieve desired specificity. By testing under physiological crowding, our study provides a plausible mechanism on how DNA molecule may help in maintaining an optimal balance between fast hopping and rotation-coupled sliding dynamics, to locate target sites rapidly and form specific complexes precisely. PMID:26400158

Scanning confocal fluorescence microscopy for single molecule analysis of nucleotide excision repair complexes.

PubMed

Segers-Nolten, G M J; Wyman, C; Wijgers, N; Vermeulen, W; Lenferink, A T M; Hoeijmakers, J H J; Greve, J; Otto, C

2002-11-01

We used scanning confocal fluorescence microscopy to observe and analyze individual DNA- protein complexes formed between human nucleotide excision repair (NER) proteins and model DNA substrates. For this purpose human XPA protein was fused to EGFP, purified and shown to be functional. Binding of EGFP-labeled XPA protein to a Cy3.5-labeled DNA substrate, in the presence and absence of RPA, was assessed quantitatively by simultaneous excitation and emission detection of both fluorophores. Co-localization of Cy3.5 and EGFP signals within one diffraction limited spot indicated complexes of XPA with DNA. Measurements were performed on samples in a 1% agarose matrix in conditions that are compatible with protein activity and where reactions can be studied under equilibrium conditions. In these samples DNA alone was freely diffusing and protein-bound DNA was immobile, whereby they could be discriminated resulting in quantitative data on DNA binding. On the single molecule level approximately 10% of XPA co-localized with DNA; this increased to 32% in the presence of RPA. These results, especially the enhanced binding of XPA in the presence of RPA, are similar to those obtained in bulk experiments, validating the utility of scanning confocal fluorescence microscopy for investigating functional interactions at the single molecule level.

Detection of urea-induced internal denaturation of dsDNA using solid-state nanopores.

PubMed

Singer, Alon; Kuhn, Heiko; Frank-Kamenetskii, Maxim; Meller, Amit

2010-11-17

The ability to detect and measure dsDNA thermal fluctuations is of immense importance in understanding the underlying mechanisms responsible for transcription and replication regulation. We describe here the ability of solid-state nanopores to detect sub-nanometer changes in DNA structure as a result of chemically enhanced thermal fluctuations. In this study, we investigate the subtle changes in the mean effective diameter of a dsDNA molecule with 3-5 nm solid-state nanopores as a function of urea concentration and the DNA's AT content. Our studies reveal an increase in the mean effective diameter of a DNA molecule of approximately 0.6 nm at 8.7 M urea. In agreement with the mechanism of DNA local denaturation, we observe a sigmoid dependence of these effects on urea concentration. We find that the translocation times in urea are markedly slower than would be expected if the dynamics were governed primarily by viscous effects. Furthermore, we find that the sensitivity of the nanopore is sufficient to statistically differentiate between DNA molecules of nearly identical lengths differing only in sequence and AT content when placed in 3.5 M urea. Our results demonstrate that nanopores can detect subtle structural changes and are thus a valuable tool for detecting differences in biomolecules' environment.

All-Atom MD Simulation of DNA Condensation Using Ab Initio Derived Force Field Parameters of Cobalt(III)-Hexammine.

PubMed

Sun, Tiedong; Mirzoev, Alexander; Korolev, Nikolay; Lyubartsev, Alexander P; Nordenskiöld, Lars

2017-08-24

It is well established that the presence of the trivalent cobalt(III)-hexammine cation (CoHex 3+ ) at submillimolar concentrations leads to bundling (condensation) of double-stranded DNA molecules, which is caused by DNA-DNA attraction induced by the multivalent counterions. However, the detailed mechanism of this process is still not fully understood. Furthermore, in all-atom molecular dynamics (MD) simulations, spontaneous aggregation of several DNA oligonucleotides in the presence of CoHex 3+ has previously not been demonstrated. In order to obtain a rigorous description of CoHex 3+ -nucleic acid interactions and CoHex 3+ -induced DNA condensation to be used in MD simulations, we have derived optimized force field parameters of the CoHex 3+ ion. They were obtained from Car-Parrinello molecular dynamics simulation of a single CoHex 3+ ion in the presence of 125 water molecules. The new set of force field parameters reproduces the experimentally known transition of DNA from B- to A-form, and qualitatively describes changes of DNA and RNA persistence lengths. We then carried out a 2 μs long atomistic simulation of four DNA oligomers each consisting of 36 base pairs in the presence of CoHex 3+ . We demonstrate that, in this system, DNA molecules display attractive interactions and aggregate into bundle-like structures. This behavior depends critically on the details of the CoHex 3+ interaction with DNA. A control simulation with a similar setup but in the presence of Mg 2+ does not induce DNA-DNA attraction, which is also in agreement with experiment.

Inhibition mechanisms of hemoglobin, immunoglobulin G, and whole blood in digital and real-time PCR.

PubMed

Sidstedt, Maja; Hedman, Johannes; Romsos, Erica L; Waitara, Leticia; Wadsö, Lars; Steffen, Carolyn R; Vallone, Peter M; Rådström, Peter

2018-04-01

Blood samples are widely used for PCR-based DNA analysis in fields such as diagnosis of infectious diseases, cancer diagnostics, and forensic genetics. In this study, the mechanisms behind blood-induced PCR inhibition were evaluated by use of whole blood as well as known PCR-inhibitory molecules in both digital PCR and real-time PCR. Also, electrophoretic mobility shift assay was applied to investigate interactions between inhibitory proteins and DNA, and isothermal titration calorimetry was used to directly measure effects on DNA polymerase activity. Whole blood caused a decrease in the number of positive digital PCR reactions, lowered amplification efficiency, and caused severe quenching of the fluorescence of the passive reference dye 6-carboxy-X-rhodamine as well as the double-stranded DNA binding dye EvaGreen. Immunoglobulin G was found to bind to single-stranded genomic DNA, leading to increased quantification cycle values. Hemoglobin affected the DNA polymerase activity and thus lowered the amplification efficiency. Hemoglobin and hematin were shown to be the molecules in blood responsible for the fluorescence quenching. In conclusion, hemoglobin and immunoglobulin G are the two major PCR inhibitors in blood, where the first affects amplification through a direct effect on the DNA polymerase activity and quenches the fluorescence of free dye molecules, and the latter binds to single-stranded genomic DNA, hindering DNA polymerization in the first few PCR cycles. Graphical abstract PCR inhibition mechanisms of hemoglobin and immunoglobulin G (IgG). Cq quantification cycle, dsDNA double-stranded DNA, ssDNA single-stranded DNA.

Evidence of animal mtDNA recombination between divergent populations of the potato cyst nematode Globodera pallida.

PubMed

Hoolahan, Angelique H; Blok, Vivian C; Gibson, Tracey; Dowton, Mark

2012-03-01

Recombination is typically assumed to be absent in animal mitochondrial genomes (mtDNA). However, the maternal mode of inheritance means that recombinant products are indistinguishable from their progenitor molecules. The majority of studies of mtDNA recombination assess past recombination events, where patterns of recombination are inferred by comparing the mtDNA of different individuals. Few studies assess contemporary mtDNA recombination, where recombinant molecules are observed as direct mosaics of known progenitor molecules. Here we use the potato cyst nematode, Globodera pallida, to investigate past and contemporary recombination. Past recombination was assessed within and between populations of G. pallida, and contemporary recombination was assessed in the progeny of experimental crosses of these populations. Breeding of genetically divergent organisms may cause paternal mtDNA leakage, resulting in heteroplasmy and facilitating the detection of recombination. To assess contemporary recombination we looked for evidence of recombination between the mtDNA of the parental populations within the mtDNA of progeny. Past recombination was detected between a South American population and several UK populations of G. pallida, as well as between two South American populations. This suggests that these populations may have interbred, paternal mtDNA leakage occurred, and the mtDNA of these populations subsequently recombined. This evidence challenges two dogmas of animal mtDNA evolution; no recombination and maternal inheritance. No contemporary recombination between the parental populations was detected in the progeny of the experimental crosses. This supports current arguments that mtDNA recombination events are rare. More sensitive detection methods may be required to adequately assess contemporary mtDNA recombination in animals.

Visualization and quantitative analysis of extrachromosomal telomere-repeat DNA in individual human cells by Halo-FISH

PubMed Central

Komosa, Martin; Root, Heather; Meyn, M. Stephen

2015-01-01

Current methods for characterizing extrachromosomal nuclear DNA in mammalian cells do not permit single-cell analysis, are often semi-quantitative and frequently biased toward the detection of circular species. To overcome these limitations, we developed Halo-FISH to visualize and quantitatively analyze extrachromosomal DNA in single cells. We demonstrate Halo-FISH by using it to analyze extrachromosomal telomere-repeat (ECTR) in human cells that use the Alternative Lengthening of Telomeres (ALT) pathway(s) to maintain telomere lengths. We find that GM847 and VA13 ALT cells average ∼80 detectable G/C-strand ECTR DNA molecules/nucleus, while U2OS ALT cells average ∼18 molecules/nucleus. In comparison, human primary and telomerase-positive cells contain <5 ECTR DNA molecules/nucleus. ECTR DNA in ALT cells exhibit striking cell-to-cell variations in number (<20 to >300), range widely in length (<1 to >200 kb) and are composed of primarily G- or C-strand telomere-repeat DNA. Halo-FISH enables, for the first time, the simultaneous analysis of ECTR DNA and chromosomal telomeres in a single cell. We find that ECTR DNA comprises ∼15% of telomere-repeat DNA in GM847 and VA13 cells, but <4% in U2OS cells. In addition to its use in ALT cell analysis, Halo-FISH can facilitate the study of a wide variety of extrachromosomal DNA in mammalian cells. PMID:25662602

DNA encoding a DNA repair protein

DOEpatents

Petrini, John H.; Morgan, William Francis; Maser, Richard Scott; Carney, James Patrick

2006-08-15

An isolated and purified DNA molecule encoding a DNA repair protein, p95, is provided, as is isolated and purified p95. Also provided are methods of detecting p95 and DNA encoding p95. The invention further provides p95 knock-out mice.

Studying DNA looping by single-molecule FRET.

PubMed

Le, Tung T; Kim, Harold D

2014-06-28

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.

Studying DNA Looping by Single-Molecule FRET

PubMed Central

Le, Tung T.; Kim, Harold D.

2014-01-01

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA. PMID:24998459

Influence of amine and thiol modifications at the 3' ends of single stranded DNA molecules on their adsorption on gold surface and the efficiency of their hybridization.

PubMed

Jaworska, Aleksandra; Jablonska, Anna; Wilanowski, Tomasz; Palys, Barbara; Sek, Slawomir; Kudelski, Andrzej

2018-05-24

Adsorption of molecules of DNA (deoxyribonucleic acid) or modified DNA on gold surfaces is often the first step in construction of many various biosensors, including biosensors for detection of DNA with a particular sequence. In this work we study the influence of amine and thiol modifications at the 3' ends of single stranded DNA (ssDNA) molecules on their adsorption on the surface of gold substrates and on the efficiency of hybridization of immobilized DNA with the complementary single stranded DNA. The characterization of formed layers has been carried out using infrared spectroscopy and atomic force microscopy. As model single stranded DNA we used DNA containing 20 adenine bases, whereas the complementary DNA contained 20 thymine bases. We found that the bands in polarization modulation-infrared reflection-adsorption spectroscopy (PM-IRRAS) spectra of layers formed from thiol-modified DNA are significantly narrower and sharper, indicating their higher regularity in the orientation of DNA on gold surface when using thiol linker. Also, hybridization of the layer of thiol-modified DNA containing 20 adenine bases with the respective DNA containing thymine bases leads to formation of much more organized structures than in the case of unmodified DNA or DNA with the amine linker. We conclude that the thiol-modified ssDNA is more promising for the preparation of biosensors, in comparison with the amine-modified or unmodified ssDNA. We have also found that the above-mentioned modifications at the 3' end of ssDNA significantly influence the IR spectrum (and hence the structure) of polycrystalline films formed from such compounds, even though adsorbed fragments contain less than 5% of the DNA chain. This effect should be taken into account when comparing IR spectra of various polycrystalline films formed from modified and unmodified DNA. Copyright © 2018. Published by Elsevier B.V.

Visualizing biological reaction intermediates with DNA curtains

NASA Astrophysics Data System (ADS)

Zhao, Yiling; Jiang, Yanzhou; Qi, Zhi

2017-04-01

Single-molecule approaches have tremendous potential analyzing dynamic biological reaction with heterogeneity that cannot be effectively accessed via traditional ensemble-level biochemical approaches. The approach of deoxyribonucleic acid (DNA) curtains developed by Dr Eric Greene and his research team at Columbia University is a high-throughput single-molecule technique that utilizes fluorescent imaging to visualize protein-DNA interactions directly and allows the acquisition of statistically relevant information from hundreds or even thousands of individual reactions. This review aims to summarize the past, present, and future of DNA curtains, with an emphasis on its applications to solve important biological questions.

Visualization of nanoconstructions with DNA-Aptamers for targeted molecules binding on the surface of screen-printed electrodes

NASA Astrophysics Data System (ADS)

Lapin, Ivan N.; Shabalina, Anastasiia V.; Svetlichyi, Valery A.; Kolovskaya, Olga S.

2018-04-01

Nanoconstructions of gold nanoparticles (NPs) obtained via pulsed laser ablation in liquid with DNA-aptamer specific to protein tumor marker were visualized on the surface of screen-printed electrode using scanning electron microscopy (SEM) and confocal laser scanning microscopy (CLSM). AuNPs/aptamer nanoconstuctions distribution on the solid surface was studied. More uniform coverage of the carbon electrode surface with the nanoconstuctions was showed in comparison with DNA-aptamer alone on the golden electrode surface. Targeted binding of the tumor marker molecules with the AuNPs/DNA-aptamer nanoconstuctions was approved.

A New Three-Dimensional Educational Model Kit for Building DNA and RNA Molecules: Development and Evaluation

ERIC Educational Resources Information Center

Beltramini, Leila Maria; Araujo, Ana Paula Ulian; de Oliveira, Tales Henrique Goncalves; dos Santos Abel, Luciano Douglas; da Silva, Aparecido Rodrigues; dos Santos, Neusa Fernandes

2006-01-01

International specialized literature focused on research in biology education is sadly scarce, especially regarding biochemical and molecular aspects. In this light, researchers from this Centre for Structural Molecular Biotechnology developed and evaluated a three-dimensional educational model named "Building Life Molecules DNA and RNA." The…

Molecular traffic jams on DNA.

PubMed

Finkelstein, Ilya J; Greene, Eric C

2013-01-01

All aspects of DNA metabolism-including transcription, replication, and repair-involve motor enzymes that move along genomic DNA. These processes must all take place on chromosomes that are occupied by a large number of other proteins. However, very little is known regarding how nucleic acid motor proteins move along the crowded DNA substrates that are likely to exist in physiological settings. This review summarizes recent progress in understanding how DNA-binding motor proteins respond to the presence of other proteins that lie in their paths. We highlight recent single-molecule biophysical experiments aimed at addressing this question, with an emphasis placed on analyzing the single-molecule, ensemble biochemical, and in vivo data from a mechanistic perspective.

DNA nanotechnology

NASA Astrophysics Data System (ADS)

Seeman, Nadrian C.; Sleiman, Hanadi F.

2018-01-01

DNA is the molecule that stores and transmits genetic information in biological systems. The field of DNA nanotechnology takes this molecule out of its biological context and uses its information to assemble structural motifs and then to connect them together. This field has had a remarkable impact on nanoscience and nanotechnology, and has been revolutionary in our ability to control molecular self-assembly. In this Review, we summarize the approaches used to assemble DNA nanostructures and examine their emerging applications in areas such as biophysics, diagnostics, nanoparticle and protein assembly, biomolecule structure determination, drug delivery and synthetic biology. The introduction of orthogonal interactions into DNA nanostructures is discussed, and finally, a perspective on the future directions of this field is presented.

The origin of in situ hybridization - A personal history.

PubMed

Gall, Joseph G

2016-04-01

In situ hybridization is the technique by which specific RNA or DNA molecules are detected in cytological preparations. Basically it involves formation of a hybrid molecule between an endogenous single-stranded RNA or DNA in the cell and a complementary single-stranded RNA or DNA probe. In its original form the probe was labeled with (3)H and the hybrid was detected by autoradiography. The first successful experiments in 1968 involved detection of the highly amplified ribosomal DNA in oocytes of the frog Xenopus, followed soon after by the reiterated "satellite DNA" in mouse and Drosophila chromosomes. Fluorescent probes were developed about ten years later. Copyright © 2015 Elsevier Inc. All rights reserved.

Single-molecule comparison of DNA Pol I activity with native and analog nucleotides

NASA Astrophysics Data System (ADS)

Gul, Osman; Olsen, Tivoli; Choi, Yongki; Corso, Brad; Weiss, Gregory; Collins, Philip

2014-03-01

DNA polymerases are critical enzymes for DNA replication, and because of their complex catalytic cycle they are excellent targets for investigation by single-molecule experimental techniques. Recently, we studied the Klenow fragment (KF) of DNA polymerase I using a label-free, electronic technique involving single KF molecules attached to carbon nanotube transistors. The electronic technique allowed long-duration monitoring of a single KF molecule while processing thousands of template strands. Processivity of up to 42 nucleotide bases was directly observed, and statistical analysis of the recordings determined key kinetic parameters for the enzyme's open and closed conformations. Subsequently, we have used the same technique to compare the incorporation of canonical nucleotides like dATP to analogs like 1-thio-2'-dATP. The analog had almost no affect on duration of the closed conformation, during which the nucleotide is incorporated. On the other hand, the analog increased the rate-limiting duration of the open conformation by almost 40%. We propose that the thiolated analog interferes with KF's recognition and binding, two key steps that determine its ensemble turnover rate.

Studying DNA in the Classroom.

ERIC Educational Resources Information Center

Zarins, Silja

1993-01-01

Outlines a workshop for teachers that illustrates a method of extracting DNA and provides instructions on how to do some simple work with DNA without sophisticated and expensive equipment. Provides details on viscosity studies and breaking DNA molecules. (DDR)

Interaction of cationic surfactants with DNA: a single-molecule study

PubMed Central

Husale, Sudhir; Grange, Wilfried; Karle, Marc; Bürgi, Stephan; Hegner, Martin

2008-01-01

The interaction of cationic surfactants with single dsDNA molecules has been studied using force-measuring optical tweezers. For hydrophobic chains of length 12 and greater, pulling experiments show characteristic features (e.g. hysteresis between the pulling and relaxation curves, force-plateau along the force curves), typical of a condensed phase (compaction of a long DNA into a micron-sized particle). Depending on the length of the hydrophobic chain of the surfactant, we observe different mechanical behaviours of the complex (DNA-surfactants), which provide evidence for different binding modes. Taken together, our measurements suggest that short-chain surfactants, which do not induce any condensation, could lie down on the DNA surface and directly interact with the DNA grooves through hydrophobic–hydrophobic interactions. In contrast, long-chain surfactants could have their aliphatic tails pointing away from the DNA surface, which could promote inter-molecular interactions between hydrophobic chains and subsequently favour DNA condensation. PMID:18203749

Visualizing the Search for Radiation-damaged DNA Bases in Real Time.

PubMed

Lee, Andrea J; Wallace, Susan S

2016-11-01

The Base Excision Repair (BER) pathway removes the vast majority of damages produced by ionizing radiation, including the plethora of radiation-damaged purines and pyrimidines. The first enzymes in the BER pathway are DNA glycosylases, which are responsible for finding and removing the damaged base. Although much is known about the biochemistry of DNA glycosylases, how these enzymes locate their specific damage substrates among an excess of undamaged bases has long remained a mystery. Here we describe the use of single molecule fluorescence to observe the bacterial DNA glycosylases, Nth, Fpg and Nei, scanning along undamaged and damaged DNA. We show that all three enzymes randomly diffuse on the DNA molecule and employ a wedge residue to search for and locate damage. The search behavior of the Escherichia coli DNA glycosylases likely provides a paradigm for their homologous mammalian counterparts.

Visualizing the search for radiation-damaged DNA bases in real time

NASA Astrophysics Data System (ADS)

Lee, Andrea J.; Wallace, Susan S.

2016-11-01

The Base Excision Repair (BER) pathway removes the vast majority of damages produced by ionizing radiation, including the plethora of radiation-damaged purines and pyrimidines. The first enzymes in the BER pathway are DNA glycosylases, which are responsible for finding and removing the damaged base. Although much is known about the biochemistry of DNA glycosylases, how these enzymes locate their specific damage substrates among an excess of undamaged bases has long remained a mystery. Here we describe the use of single molecule fluorescence to observe the bacterial DNA glycosylases, Nth, Fpg and Nei, scanning along undamaged and damaged DNA. We show that all three enzymes randomly diffuse on the DNA molecule and employ a wedge residue to search for and locate damage. The search behavior of the Escherichia coli DNA glycosylases likely provides a paradigm for their homologous mammalian counterparts.

Deciphering the genomic targets of alkylating polyamide conjugates using high-throughput sequencing

PubMed Central

Chandran, Anandhakumar; Syed, Junetha; Taylor, Rhys D.; Kashiwazaki, Gengo; Sato, Shinsuke; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

2016-01-01

Chemically engineered small molecules targeting specific genomic sequences play an important role in drug development research. Pyrrole-imidazole polyamides (PIPs) are a group of molecules that can bind to the DNA minor-groove and can be engineered to target specific sequences. Their biological effects rely primarily on their selective DNA binding. However, the binding mechanism of PIPs at the chromatinized genome level is poorly understood. Herein, we report a method using high-throughput sequencing to identify the DNA-alkylating sites of PIP-indole-seco-CBI conjugates. High-throughput sequencing analysis of conjugate 2 showed highly similar DNA-alkylating sites on synthetic oligos (histone-free DNA) and on human genomes (chromatinized DNA context). To our knowledge, this is the first report identifying alkylation sites across genomic DNA by alkylating PIP conjugates using high-throughput sequencing. PMID:27098039

Bioorthogonal Metabolic DNA Labelling using Vinyl Thioether-Modified Thymidine and o-Quinolinone Quinone Methide.

PubMed

Gubu, Amu; Li, Long; Ning, Yan; Zhang, Xiaoyun; Lee, Seonghyun; Feng, Mengke; Li, Qiang; Lei, Xiaoguang; Jo, Kyubong; Tang, Xinjing

2018-04-17

Bioorthogonal metabolic DNA labeling with fluorochromes is a powerful strategy to visualize DNA molecules and their functions. Here, we report the development of a new DNA metabolic labeling strategy enabled by the catalyst-free bioorthogonal ligation using vinyl thioether modified thymidine and o-quinolinone quinone methide. With the newly designed vinyl thioether-modified thymidine (VTdT), we added labeling tags on cellular DNA, which could further be linked to fluorochromes in cells. Therefore, we successfully visualized the DNA localization within cells as well as single DNA molecules without other staining reagents. In addition, we further characterized this bioorthogonal DNA metabolic labeling using DNase I digestion, MS characterization of VTdT as well as VTdT-oQQF conjugate in cell nuclei or mitochondria. This technique provides a powerful strategy to study DNA in cells, which paves the way to achieve future spatiotemporal deciphering of DNA synthesis and functions. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Supercoil Formation During DNA Melting

NASA Astrophysics Data System (ADS)

Sayar, Mehmet; Avsaroglu, Baris; Kabakcioglu, Alkan

2009-03-01

Supercoil formation plays a key role in determining the structure-function relationship in DNA. Biological and technological processes, such as protein synthesis, polymerase chain reaction, and microarrays relys on separation of the two strands in DNA, which is coupled to the unwinding of the supercoiled structure. This problem has been studied theoretically via Peyrard-Bishop and Poland-Scheraga type models, which include a simple representation of the DNA structural properties. In recent years, computational models, which provide a more realtistic representaion of DNA molecule, have been used to study the melting behavior of short DNA chains. Here, we will present a new coarse-grained model of DNA which is capable of simulating sufficiently long DNA chains for studying the supercoil formation during melting, without sacrificing the local structural properties. Our coarse-grained model successfully reproduces the local geometry of the DNA molecule, such as the 3'-5' directionality, major-minor groove structure, and the helical pitch. We will present our initial results on the dynamics of supercoiling during DNA melting.

Assessment of DNA damage and repair efficiency in drug naïve schizophrenia using comet assay.

PubMed

Muraleedharan, Aparna; Menon, Vikas; Rajkumar, Ravi Philip; Chand, Parkash

2015-09-01

The etiology of schizophrenia continues to be confounding and elusive. Some knowledge gaps exist in the neurodegenerative theory of schizophrenia. Oxidative DNA damage and repair deficits are relevant to the mechanisms of neurodegeneration but have not been studied in drug naïve schizophrenia. The present study used the comet assay technique to study the extent of DNA damage in circulating peripheral lymphocytes of patients with drug naïve schizophrenia (n = 40) along with an age and gender matched control group (n = 40). We also assessed the DNA repair efficiency in cases following incubation in a nutrient medium. All the assayed comet parameters demonstrated significantly greater baseline DNA damage in cases in comparison to the controls except for head diameter (p < 0.001 for all significant results, p = 0.32 for head diameter). Gender, age and duration of illness (p = 0.21, 0.69 and 0.12 respectively for tail length) did not influence any of the parameters significantly. Significant decrease was noted in the comet tail length and percentage of DNA in comet tail (p < 0.001 for both) in cases following incubation suggesting that the DNA repair machinery was preserved. No difference in DNA repair efficiency was noted between the genders (p = 0.23 for tail length). Our findings confirm the presence of significant baseline DNA damage in schizophrenia even prior to the initiation of anti-psychotic treatment. Additionally, intact genomic repair efficiency was noted in this group as a whole. These results provide some evidence for oxidative DNA damage as molecular link underpinning neurodegeneration in drug naïve schizophrenia. Copyright © 2015 Elsevier Ltd. All rights reserved.

A DNA Crystal Designed to Contain Two Molecules per Asymmetric Unit

DOE Office of Scientific and Technical Information (OSTI.GOV)

T Wang; R Sha; J Birktoft

2011-12-31

We describe the self-assembly of a DNA crystal that contains two tensegrity triangle molecules per asymmetric unit. We have used X-ray crystallography to determine its crystal structure. In addition, we have demonstrated control over the colors of the crystals by attaching either Cy3 dye (pink) or Cy5 dye (blue-green) to the components of the crystal, yielding crystals of corresponding colors. Attaching the pair of dyes to the pair of molecules yields a purple crystal.

Decomposition of the linking number of a closed ribbon: A problem from molecular biology

PubMed Central

Fuller, F. Brock

1978-01-01

A closed duplex DNA molecule relaxed and containing nucleosomes has a different linking number from the same molecule relaxed and without nucleosomes. What does this say about the structure of the nucleosome? A mathematical study of this question is made, representing the DNA molecule by a ribbon. It is shown that the linking number of a closed ribbon can be decomposed into the linking number of a reference ribbon plus a sum of locally determined “linking differences.” PMID:16592550

Conserved linear dynamics of single-molecule Brownian motion.

PubMed

Serag, Maged F; Habuchi, Satoshi

2017-06-06

Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.

Conserved linear dynamics of single-molecule Brownian motion

PubMed Central

Serag, Maged F.; Habuchi, Satoshi

2017-01-01

Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance. PMID:28585925

Conserved linear dynamics of single-molecule Brownian motion

NASA Astrophysics Data System (ADS)

Serag, Maged F.; Habuchi, Satoshi

2017-06-01

Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.

Effect of genomic long-range correlations on DNA persistence length: from theory to single molecule experiments.

PubMed

Moukhtar, Julien; Faivre-Moskalenko, Cendrine; Milani, Pascale; Audit, Benjamin; Vaillant, Cedric; Fontaine, Emeline; Mongelard, Fabien; Lavorel, Guillaume; St-Jean, Philippe; Bouvet, Philippe; Argoul, Françoise; Arneodo, Alain

2010-04-22

Sequence dependency of DNA intrinsic bending properties has been emphasized as a possible key ingredient to in vivo chromatin organization. We use atomic force microscopy (AFM) in air and liquid to image intrinsically straight (synthetic), uncorrelated (hepatitis C RNA virus) and persistent long-range correlated (human) DNA fragments in various ionic conditions such that the molecules freely equilibrate on the mica surface before being captured in a particular conformation. 2D thermodynamic equilibrium is experimentally verified by a detailed statistical analysis of the Gaussian nature of the DNA bend angle fluctuations. We show that the worm-like chain (WLC) model, commonly used to describe the average conformation of long semiflexible polymers, reproduces remarkably well the persistence length estimates for the first two molecules as consistently obtained from (i) mean square end-to-end distance measurement and (ii) mean projection of the end-to-end vector on the initial orientation. Whatever the operating conditions (air or liquid, concentration of metal cations Mg(2+) and/or Ni(2+)), the persistence length found for the uncorrelated viral DNA underestimates the value obtained for the straight DNA. We show that this systematic difference is the signature of the presence of an uncorrelated structural intrinsic disorder in the hepatitis C virus (HCV) DNA fragment that superimposes on local curvatures induced by thermal fluctuations and that only the entropic disorder depends upon experimental conditions. In contrast, the WLC model fails to describe the human DNA conformations. We use a mean-field extension of the WLC model to account for the presence of long-range correlations (LRC) in the intrinsic curvature disorder of human genomic DNA: the stronger the LRC, the smaller the persistence length. The comparison of AFM imaging of human DNA with LRC DNA simulations confirms that the rather small mean square end-to-end distance observed, particularly for G+C-rich human DNA molecules, more likely results from a large-scale intrinsic curvature due to a persistent distribution of DNA curvature sites than from some increased flexibility.

How to measure separations and angles between intra-molecular fluorescent markers

NASA Astrophysics Data System (ADS)

Flyvbjerg, Henrik; Mortensen, Kim I.; Sung, Jongmin; Spudich, James A.

We demonstrate a novel, yet simple tool for the study of structure and function of biomolecules by extending two-colour co-localization microscopy to fluorescent molecules with fixed orientations and in intra-molecular proximity. From each color-separated microscope image in a time-lapse movie and using only simple means, we simultaneously determine both the relative (x,y)-separation of the fluorophores and their individual orientations in space with accuracy and precision. The positions and orientations of two domains of the same molecule are thus time-resolved. Using short double-stranded DNA molecules internally labelled with two fixed fluorophores, we demonstrate the accuracy and precision of our method using the known structure of double-stranded DNA as a benchmark, resolve 10-base-pair differences in fluorophore separations, and determine the unique 3D orientation of each DNA molecule, thereby establishing short, double-labelled DNA molecules as probes of 3D orientation of anything to which one can attach them firmly. This work was supported by a Lundbeck fellowship to K.I.M; a Stanford Bio-X fellowship to J.S. and Grants from the NIH (GM33289) to J.A.S. and the Human Frontier Science Program (GP0054/2009-C) to J.A.S. and H.F.

Activation-induced deoxycytidine deaminase (AID) co-transcriptional scanning at single-molecule resolution

NASA Astrophysics Data System (ADS)

Senavirathne, Gayan; Bertram, Jeffrey G.; Jaszczur, Malgorzata; Chaurasiya, Kathy R.; Pham, Phuong; Mak, Chi H.; Goodman, Myron F.; Rueda, David

2015-12-01

Activation-induced deoxycytidine deaminase (AID) generates antibody diversity in B cells by initiating somatic hypermutation (SHM) and class-switch recombination (CSR) during transcription of immunoglobulin variable (IgV) and switch region (IgS) DNA. Using single-molecule FRET, we show that AID binds to transcribed dsDNA and translocates unidirectionally in concert with RNA polymerase (RNAP) on moving transcription bubbles, while increasing the fraction of stalled bubbles. AID scans randomly when constrained in an 8 nt model bubble. When unconstrained on single-stranded (ss) DNA, AID moves in random bidirectional short slides/hops over the entire molecule while remaining bound for ~5 min. Our analysis distinguishes dynamic scanning from static ssDNA creasing. That AID alone can track along with RNAP during transcription and scan within stalled transcription bubbles suggests a mechanism by which AID can initiate SHM and CSR when properly regulated, yet when unregulated can access non-Ig genes and cause cancer.

Characterization of Nanofluidic Entropic Trap Array for DNA Separation

NASA Astrophysics Data System (ADS)

Han, Jongyoon

2003-03-01

Micromachined nanoscale fluidic structures can provide new opportunities in biomolecule manipulation and sorting, because their chemical and physical properties can be controlled easily unlike random nanoporous materials. As an example of regular nanostructures used for biomolecule manipulation and sorting, a nanofluidic entropic trap array for DNA separation is presented. Nanofluidic channels as thin as 75nm were used as a molecular sieve instead of agarose gel for DNA separation. The interaction between DNA molecules and the nanofluidic structure determines the DNA migration speed, which was used to separate DNA molecules in a dc electrophoresis. Separation of long DNA (up to 200kbp) has been achieved within 30 minutes, using less than a picogram quantities of DNA, with only 1.5cm long channels.[1] In addition to the efficiency improvement, nanofluidic DNA entropic traps have a regular structure that can be easily modeled theoretically. The theoretical model could be the basis for improving the system performance for further optimization in separation size range and resolution. The process of DNA moving out of the entropic trap was theoretically modeled, and the prediction of the theoretical model was compared with the experimental data.[2] The selectivity, resolution, and the separation range of DNA for a given entropic trap separation system was discussed in terms of the number of entropic traps, various structural parameters of the system, and the electric field. It is expected that this system could be used for analyzing a small amount of ultra-long DNA molecules. (1) Han, J.; Craighead, H. G. Science 2000, 288, 1026-1029. (2) Han, J.; Craighead, H. G. Anal. Chem. 2002, 74, 394-401.

Identification of Biomolecular Building Blocks by Recognition Tunneling: Stride towards Nanopore Sequencing of Biomolecules

NASA Astrophysics Data System (ADS)

Sen, Suman

DNA, RNA and Protein are three pivotal biomolecules in human and other organisms, playing decisive roles in functionality, appearance, diseases development and other physiological phenomena. Hence, sequencing of these biomolecules acquires the prime interest in the scientific community. Single molecular identification of their building blocks can be done by a technique called Recognition Tunneling (RT) based on Scanning Tunneling Microscope (STM). A single layer of specially designed recognition molecule is attached to the STM electrodes, which trap the targeted molecules (DNA nucleoside monophosphates, RNA nucleoside monophosphates or amino acids) inside the STM nanogap. Depending on their different binding interactions with the recognition molecules, the analyte molecules generate stochastic signal trains accommodating their "electronic fingerprints". Signal features are used to detect the molecules using a machine learning algorithm and different molecules can be identified with significantly high accuracy. This, in turn, paves the way for rapid, economical nanopore sequencing platform, overcoming the drawbacks of Next Generation Sequencing (NGS) techniques. To read DNA nucleotides with high accuracy in an STM tunnel junction a series of nitrogen-based heterocycles were designed and examined to check their capabilities to interact with naturally occurring DNA nucleotides by hydrogen bonding in the tunnel junction. These recognition molecules are Benzimidazole, Imidazole, Triazole and Pyrrole. Benzimidazole proved to be best among them showing DNA nucleotide classification accuracy close to 99%. Also, Imidazole reader can read an abasic monophosphate (AP), a product from depurination or depyrimidination that occurs 10,000 times per human cell per day. In another study, I have investigated a new universal reader, 1-(2-mercaptoethyl)pyrene (Pyrene reader) based on stacking interactions, which should be more specific to the canonical DNA nucleosides. In addition, Pyrene reader showed higher DNA base-calling accuracy compare to Imidazole reader, the workhorse in our previous projects. In my other projects, various amino acids and RNA nucleoside monophosphates were also classified with significantly high accuracy using RT. Twenty naturally occurring amino acids and various RNA nucleosides (four canonical and two modified) were successfully identified. Thus, we envision nanopore sequencing biomolecules using Recognition Tunneling (RT) that should provide comprehensive betterment over current technologies in terms of time, chemical and instrumental cost and capability of de novo sequencing.

Going Vertical To Improve the Accuracy of Atomic Force Microscopy Based Single-Molecule Force Spectroscopy.

PubMed

Walder, Robert; Van Patten, William J; Adhikari, Ayush; Perkins, Thomas T

2018-01-23

Single-molecule force spectroscopy (SMFS) is a powerful technique to characterize the energy landscape of individual proteins, the mechanical properties of nucleic acids, and the strength of receptor-ligand interactions. Atomic force microscopy (AFM)-based SMFS benefits from ongoing progress in improving the precision and stability of cantilevers and the AFM itself. Underappreciated is that the accuracy of such AFM studies remains hindered by inadvertently stretching molecules at an angle while measuring only the vertical component of the force and extension, degrading both measurements. This inaccuracy is particularly problematic in AFM studies using double-stranded DNA and RNA due to their large persistence length (p ≈ 50 nm), often limiting such studies to other SMFS platforms (e.g., custom-built optical and magnetic tweezers). Here, we developed an automated algorithm that aligns the AFM tip above the DNA's attachment point to a coverslip. Importantly, this algorithm was performed at low force (10-20 pN) and relatively fast (15-25 s), preserving the connection between the tip and the target molecule. Our data revealed large uncorrected lateral offsets for 100 and 650 nm DNA molecules [24 ± 18 nm (mean ± standard deviation) and 180 ± 110 nm, respectively]. Correcting this offset yielded a 3-fold improvement in accuracy and precision when characterizing DNA's overstretching transition. We also demonstrated high throughput by acquiring 88 geometrically corrected force-extension curves of a single individual 100 nm DNA molecule in ∼40 min and versatility by aligning polyprotein- and PEG-based protein-ligand assays. Importantly, our software-based algorithm was implemented on a commercial AFM, so it can be broadly adopted. More generally, this work illustrates how to enhance AFM-based SMFS by developing more sophisticated data-acquisition protocols.

Construction of Biologically Functional Bacterial Plasmids In Vitro

PubMed Central

Cohen, Stanley N.; Chang, Annie C. Y.; Boyer, Herbert W.; Helling, Robert B.

1973-01-01

The construction of new plasmid DNA species by in vitro joining of restriction endonuclease-generated fragments of separate plasmids is described. Newly constructed plasmids that are inserted into Escherichia coli by transformation are shown to be biologically functional replicons that possess genetic properties and nucleotide base sequences from both of the parent DNA molecules. Functional plasmids can be obtained by reassociation of endonuclease-generated fragments of larger replicons, as well as by joining of plasmid DNA molecules of entirely different origins. Images PMID:4594039

Nanosecond to submillisecond dynamics in dye-labeled single-stranded DNA, as revealed by ensemble measurements and photon statistics at single-molecule level.

PubMed

Kaji, Takahiro; Ito, Syoji; Iwai, Shigenori; Miyasaka, Hiroshi

2009-10-22

Single-molecule and ensemble time-resolved fluorescence measurements were applied for the investigation of the conformational dynamics of single-stranded DNA, ssDNA, connected with a fluorescein dye by a C6 linker, where the motions both of DNA and the C6 linker affect the geometry of the system. From the ensemble measurement of the fluorescence quenching via photoinduced electron transfer with a guanine base in the DNA sequence, three main conformations were found in aqueous solution: a conformation unaffected by the guanine base in the excited state lifetime of fluorescein, a conformation in which the fluorescence is dynamically quenched in the excited-state lifetime, and a conformation leading to rapid quenching via nonfluorescent complex. The analysis by using the parameters acquired from the ensemble measurements for interphoton time distribution histograms and FCS autocorrelations by the single-molecule measurement revealed that interconversion in these three conformations took place with two characteristic time constants of several hundreds of nanoseconds and tens of microseconds. The advantage of the combination use of the ensemble measurements with the single-molecule detections for rather complex dynamic motions is discussed by integrating the experimental results with those obtained by molecular dynamics simulation.

DNA nanomechanics allows direct digital detection of complementary DNA and microRNA targets.

PubMed

Husale, Sudhir; Persson, Henrik H J; Sahin, Ozgur

2009-12-24

Techniques to detect and quantify DNA and RNA molecules in biological samples have had a central role in genomics research. Over the past decade, several techniques have been developed to improve detection performance and reduce the cost of genetic analysis. In particular, significant advances in label-free methods have been reported. Yet detection of DNA molecules at concentrations below the femtomolar level requires amplified detection schemes. Here we report a unique nanomechanical response of hybridized DNA and RNA molecules that serves as an intrinsic molecular label. Nanomechanical measurements on a microarray surface have sufficient background signal rejection to allow direct detection and counting of hybridized molecules. The digital response of the sensor provides a large dynamic range that is critical for gene expression profiling. We have measured differential expressions of microRNAs in tumour samples; such measurements have been shown to help discriminate between the tissue origins of metastatic tumours. Two hundred picograms of total RNA is found to be sufficient for this analysis. In addition, the limit of detection in pure samples is found to be one attomolar. These results suggest that nanomechanical read-out of microarrays promises attomolar-level sensitivity and large dynamic range for the analysis of gene expression, while eliminating biochemical manipulations, amplification and labelling.

Single-Molecule Counting of Point Mutations by Transient DNA Binding

NASA Astrophysics Data System (ADS)

Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan

2017-03-01

High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.

Probing the rate-limiting step for intramolecular transfer of a transcription factor between specific sites on the same DNA molecule by (15)Nz-exchange NMR spectroscopy.

PubMed

Ryu, Kyoung-Seok; Tugarinov, Vitali; Clore, G Marius

2014-10-15

The kinetics of translocation of the homeodomain transcription factor HoxD9 between specific sites of the same or opposite polarities on the same DNA molecule have been studied by (15)Nz-exchange NMR spectroscopy. We show that exchange occurs by two facilitated diffusion mechanisms: a second-order intermolecular exchange reaction between specific sites located on different DNA molecules without the protein dissociating into free solution that predominates at high concentrations of free DNA, and a first-order intramolecular process involving direct transfer between specific sites located on the same DNA molecule. Control experiments using a mixture of two DNA molecules, each possessing only a single specific site, indicate that transfer between specific sites by full dissociation of HoxD9 into solution followed by reassociation is too slow to measure by z-exchange spectroscopy. Intramolecular transfer with comparable rate constants occurs between sites of the same and opposing polarity, indicating that both rotation-coupled sliding and hopping/flipping (analogous to geminate recombination) occur. The half-life for intramolecular transfer (0.5-1 s) is many orders of magnitude larger than the calculated transfer time (1-100 μs) by sliding, leading us to conclude that the intramolecular transfer rates measured by z-exchange spectroscopy represent the rate-limiting step for a one-base-pair shift from the specific site to the immediately adjacent nonspecific site. At zero concentration of added salt, the intramolecular transfer rate constants between sites of opposing polarity are smaller than those between sites of the same polarity, suggesting that hopping/flipping may become rate-limiting at very low salt concentrations.

Tunable graphene quantum point contact transistor for DNA detection and characterization

PubMed Central

Girdhar, Anuj; Sathe, Chaitanya; Schulten, Klaus; Leburton, Jean-Pierre

2015-01-01

A graphene membrane conductor containing a nanopore in a quantum point contact (QPC) geometry is a promising candidate to sense, and potentially sequence, DNA molecules translocating through the nanopore. Within this geometry, the shape, size, and position of the nanopore as well as the edge configuration influences the membrane conductance caused by the electrostatic interaction between the DNA nucleotides and the nanopore edge. It is shown that the graphene conductance variations resulting from DNA translocation can be enhanced by choosing a particular geometry as well as by modulating the graphene Fermi energy, which demonstrates the ability to detect conformational transformations of a double-stranded DNA, as well as the passage of individual base pairs of a single-stranded DNA molecule through the nanopore. PMID:25765702

DNA condensation and size effects of DNA condensation agent

NASA Astrophysics Data System (ADS)

Liu, Yan-Hui; Jiang, Chong-Ming; Guo, Xin-Miao; Tang, Yan-Lin; Hu, Lin

2013-08-01

Based on the model of the strong correlation of counterions condensed on DNA molecule, by tailoring interaction potential, interduplex spacing and correlation spacing between condensed counterions on DNA molecule and interduplex spacing fluctuation strength, toroidal configuration, rod-like configuration and two-hole configurations are possible. The size effects of counterion structure on the toroidal structure can be detected by this model. The autocorrelation function of the tangent vectors is found as an effective way to detect the structure of toroidal conformations and the generic pathway of the process of DNA condensation. The generic pathway of all of the configurations involves an initial nucleation loop, and the next part of the DNA chain is folded on the top of the initial nucleation loop with different manners, in agreement with the recent experimental results.

Torsional stress in DNA limits collaboration among reverse gyrase molecules.

PubMed

Ogawa, Taisaku; Sutoh, Kazuo; Kikuchi, Akihiko; Kinosita, Kazuhiko

2016-04-01

Reverse gyrase is an enzyme that can overwind (introduce positive supercoils into) DNA using the energy obtained from ATP hydrolysis. The enzyme is found in hyperthermophiles, and the overwinding reaction generally requires a temperature above 70 °C. In a previous study using microscopy, we have shown that 30 consecutive mismatched base pairs (a bubble) in DNA serve as a well-defined substrate site for reverse gyrase, warranting the processive overwinding activity down to 50 °C. Here, we inquire how multiple reverse gyrase molecules may collaborate with each other in overwinding one DNA molecule. We introduced one, two, or four bubbles in a linear DNA that tethered a magnetic bead to a coverslip surface. At 40-71 °C in the presence of reverse gyrase, the bead rotated clockwise as viewed from above, to relax the DNA twisted by reverse gyrase. Dependence on the enzyme concentration indicated that each bubble binds reverse gyrase tightly (dissociation constant < 0.1 nm) and that bound enzyme continuously overwinds DNA for > 5 min. Rotation with two bubbles was significantly faster compared with one bubble, indicating that overwinding actions are basically additive, but four bubbles did not show further acceleration except at 40 °C where the activity was very low. The apparent saturation is due to the hydrodynamic friction against the rotating bead, as confirmed by increasing the medium viscosity. When torsional stress in the DNA, determined by the friction, approaches ~ 7 pN·nm (at 71 °C), the overwinding activity of reverse gyrase drops sharply. Multiple molecules of reverse gyrase collaborate additively within this limit. © 2016 The Authors. The FEBS Journal published by John Wiley & Sons Ltd on behalf of Federation of European Biochemical Societies.

Investigations of nanoscale variations in spin and charge transport in manganites and organic semiconductors using spin polarized scanning tunneling spectroscopy

NASA Astrophysics Data System (ADS)

Hughes, Cameron Richard

Analysis of DNA structure and behavior, up to and including full sequencing of a genome's bases, and of biological processes such as replication, transcription and translation, is essential for an understanding of genetic variation, heritable diseases and the effects of environmental factors. Recently, single-molecule techniques have been developed to study DNA properties in unprecedented detail. For a number of these techniques, controlled adsorption of linearly stretched DNA molecules on surfaces is necessary. In experiments where hybridization of adsorbed molecules to labeled probes is used to determine DNA structure, single-stranded DNA is needed. Conventionally, for long DNA's (up to Mbp), double-stranded DNA is deposited on a surface and denatured in-situ. While successful, this method has several disadvantages. This thesis reports efforts to directly adsorb long single-stranded DNA's out of solution as an alternative strategy. It consists of three parts: (1) Establishment of a simple method using Acridine Orange (AO) staining dye to determine whether DNA's are ss or ds on the surface. The method allows for the assessment of the degree of renaturation during deposition. Incubation of surface-adsorbed DNA in solutions of AO dye in the concentration range of 10--15uM were found to be effective for discriminating between ss DNA and ds DNA based on differences in the fluorescence emission spectra. (2) Deposition of ss DNA produced by heat denaturation on polymer-coated surfaces. Lambda DNA (48502bp) was adsorbed by drop evaporation or dipping/extraction of surface out of a buffered solution. The efficiency of deposition was optimized with respect to DNA concentration, buffer type and pH. (3) Separation of complementary single strands of Lambda, mono-cut digest and HindIII digest by gel electrophoresis. Using agarose gels in concentrations ranging from 0.4% to 1.4% (weight/volume), electric fields in the range 1--4V/cm in 1x Tris-Acetate-EDTA (TAE) buffer, good strand separation could be obtained. Both DC and pulsed electric fields were used and compared. Following separation, sense and anti-sense strands of lambda DNA were extracted from gels and deposited separately onto surfaces, and length distributions of the isolated molecules were measured by fluorescence microscopy.

Introduction to the Natural Anticipator and the Artificial Anticipator

NASA Astrophysics Data System (ADS)

Dubois, Daniel M.

2010-11-01

This short communication deals with the introduction of the concept of anticipator, which is one who anticipates, in the framework of computing anticipatory systems. The definition of anticipation deals with the concept of program. Indeed, the word program, comes from "pro-gram" meaning "to write before" by anticipation, and means a plan for the programming of a mechanism, or a sequence of coded instructions that can be inserted into a mechanism, or a sequence of coded instructions, as genes or behavioural responses, that is part of an organism. Any natural or artificial programs are thus related to anticipatory rewriting systems, as shown in this paper. All the cells in the body, and the neurons in the brain, are programmed by the anticipatory genetic code, DNA, in a low-level language with four signs. The programs in computers are also computing anticipatory systems. It will be shown, at one hand, that the genetic code DNA is a natural anticipator. As demonstrated by Nobel laureate McClintock [8], genomes are programmed. The fundamental program deals with the DNA genetic code. The properties of the DNA consist in self-replication and self-modification. The self-replicating process leads to reproduction of the species, while the self-modifying process leads to new species or evolution and adaptation in existing ones. The genetic code DNA keeps its instructions in memory in the DNA coding molecule. The genetic code DNA is a rewriting system, from DNA coding to DNA template molecule. The DNA template molecule is a rewriting system to the Messenger RNA molecule. The information is not destroyed during the execution of the rewriting program. On the other hand, it will be demonstrated that Turing machine is an artificial anticipator. The Turing machine is a rewriting system. The head reads and writes, modifying the content of the tape. The information is destroyed during the execution of the program. This is an irreversible process. The input data are lost.

Biomimetic nanochannels based biosensor for ultrasensitive and label-free detection of nucleic acids.

PubMed

Sun, Zhongyue; Liao, Tangbin; Zhang, Yulin; Shu, Jing; Zhang, Hong; Zhang, Guo-Jun

2016-12-15

A very simple sensing device based on biomimetic nanochannels has been developed for label-free, ultrasensitive and highly sequence-specific detection of DNA. Probe DNA was modified on the inner wall of the nanochannel surface by layer-by-layer (LBL) assembly. After probe DNA immobilization, DNA detection was realized by monitoring the rectified ion current when hybridization occurred. Due to three dimensional (3D) nanoscale environment of the nanochannel, this special geometry dramatically increased the surface area of the nanochannel for immobilization of probe molecules on the inner-surface and enlarged contact area between probes and target-molecules. Thus, the unique sensor reached a reliable detection limit of 10 fM for target DNA. In addition, this DNA sensor could discriminate complementary DNA (c-DNA) from non-complementary DNA (nc-DNA), two-base mismatched DNA (2bm-DNA) and one-base mismatched DNA (1bm-DNA) with high specificity. Moreover, the nanochannel-based biosensor was also able to detect target DNA even in an interfering environment and serum samples. This approach will provide a novel biosensing platform for detection and discrimination of disease-related molecular targets and unknown sequence DNA. Copyright © 2016 Elsevier B.V. All rights reserved.

High-fidelity target sequencing of individual molecules identified using barcode sequences: de novo detection and absolute quantitation of mutations in plasma cell-free DNA from cancer patients.

PubMed

Kukita, Yoji; Matoba, Ryo; Uchida, Junji; Hamakawa, Takuya; Doki, Yuichiro; Imamura, Fumio; Kato, Kikuya

2015-08-01

Circulating tumour DNA (ctDNA) is an emerging field of cancer research. However, current ctDNA analysis is usually restricted to one or a few mutation sites due to technical limitations. In the case of massively parallel DNA sequencers, the number of false positives caused by a high read error rate is a major problem. In addition, the final sequence reads do not represent the original DNA population due to the global amplification step during the template preparation. We established a high-fidelity target sequencing system of individual molecules identified in plasma cell-free DNA using barcode sequences; this system consists of the following two steps. (i) A novel target sequencing method that adds barcode sequences by adaptor ligation. This method uses linear amplification to eliminate the errors introduced during the early cycles of polymerase chain reaction. (ii) The monitoring and removal of erroneous barcode tags. This process involves the identification of individual molecules that have been sequenced and for which the number of mutations have been absolute quantitated. Using plasma cell-free DNA from patients with gastric or lung cancer, we demonstrated that the system achieved near complete elimination of false positives and enabled de novo detection and absolute quantitation of mutations in plasma cell-free DNA. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Developing DNA nanotechnology using single-molecule fluorescence.

PubMed

Tsukanov, Roman; Tomov, Toma E; Liber, Miran; Berger, Yaron; Nir, Eyal

2014-06-17

CONSPECTUS: An important effort in the DNA nanotechnology field is focused on the rational design and manufacture of molecular structures and dynamic devices made of DNA. As is the case for other technologies that deal with manipulation of matter, rational development requires high quality and informative feedback on the building blocks and final products. For DNA nanotechnology such feedback is typically provided by gel electrophoresis, atomic force microscopy (AFM), and transmission electron microscopy (TEM). These analytical tools provide excellent structural information; however, usually they do not provide high-resolution dynamic information. For the development of DNA-made dynamic devices such as machines, motors, robots, and computers this constitutes a major problem. Bulk-fluorescence techniques are capable of providing dynamic information, but because only ensemble averaged information is obtained, the technique may not adequately describe the dynamics in the context of complex DNA devices. The single-molecule fluorescence (SMF) technique offers a unique combination of capabilities that make it an excellent tool for guiding the development of DNA-made devices. The technique has been increasingly used in DNA nanotechnology, especially for the analysis of structure, dynamics, integrity, and operation of DNA-made devices; however, its capabilities are not yet sufficiently familiar to the community. The purpose of this Account is to demonstrate how different SMF tools can be utilized for the development of DNA devices and for structural dynamic investigation of biomolecules in general and DNA molecules in particular. Single-molecule diffusion-based Förster resonance energy transfer and alternating laser excitation (sm-FRET/ALEX) and immobilization-based total internal reflection fluorescence (TIRF) techniques are briefly described and demonstrated. To illustrate the many applications of SMF to DNA nanotechnology, examples of SMF studies of DNA hairpins and Holliday junctions and of the interactions of DNA strands with DNA origami and origami-related devices such as a DNA bipedal motor are provided. These examples demonstrate how SMF can be utilized for measurement of distances and conformational distributions and equilibrium and nonequilibrium kinetics, to monitor structural integrity and operation of DNA devices, and for isolation and investigation of minor subpopulations including malfunctioning and nonreactive devices. Utilization of a flow-cell to achieve measurements of dynamics with increased time resolution and for convenient and efficient operation of DNA devices is discussed briefly. We conclude by summarizing the various benefits provided by SMF for the development of DNA nanotechnology and suggest that the method can significantly assist in the design and manufacture and evaluation of operation of DNA devices.

Crystal Structure of Mycobacterium tuberculosis H37Rv AldR (Rv2779c), a Regulator of the ald Gene: DNA BINDING AND IDENTIFICATION OF SMALL MOLECULE INHIBITORS.

PubMed

Dey, Abhishek; Shree, Sonal; Pandey, Sarvesh Kumar; Tripathi, Rama Pati; Ramachandran, Ravishankar

2016-06-03

Here we report the crystal structure of M. tuberculosis AldR (Rv2779c) showing that the N-terminal DNA-binding domains are swapped, forming a dimer, and four dimers are assembled into an octamer through crystal symmetry. The C-terminal domain is involved in oligomeric interactions that stabilize the oligomer, and it contains the effector-binding sites. The latter sites are 30-60% larger compared with homologs like MtbFFRP (Rv3291c) and can consequently accommodate larger molecules. MtbAldR binds to the region upstream to the ald gene that is highly up-regulated in nutrient-starved tuberculosis models and codes for l-alanine dehydrogenase (MtbAld; Rv2780). Further, the MtbAldR-DNA complex is inhibited upon binding of Ala, Tyr, Trp and Asp to the protein. Studies involving a ligand-binding site G131T mutant show that the mutant forms a DNA complex that cannot be inhibited by adding the amino acids. Comparative studies suggest that binding of the amino acids changes the relative spatial disposition of the DNA-binding domains and thereby disrupt the protein-DNA complex. Finally, we identified small molecules, including a tetrahydroquinoline carbonitrile derivative (S010-0261), that inhibit the MtbAldR-DNA complex. The latter molecules represent the very first inhibitors of a feast/famine regulatory protein from any source and set the stage for exploring MtbAldR as a potential anti-tuberculosis target. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Built-in adjuvanticity of genetically and protein-engineered chimeric molecules for targeting of influenza A peptide epitopes.

PubMed

Kerekov, Nikola S; Ivanova, Iva I; Mihaylova, Nikolina M; Nikolova, Maria; Prechl, Jozsef; Tchorbanov, Andrey I

2014-10-01

Highly purified, subunit, or synthetic viral antigens are known to be weakly immunogenic and potentate only the antibody, rather than cell-mediated immune responses. An alternative approach for inducing protective immunity with small viral peptides would be the direct targeting of viral epitopes to the immunocompetent cells by DNA vaccines encoding antibody fragments specific to activating cell surface co-receptor molecules. Here, we are exploring as a new genetic vaccine, a DNA chimeric molecule encoding a T and B cell epitope-containing influenza A virus hemagglutinin peptide joined to sequences encoding a single-chain variable fragment antibody fragment specific for the costimulatory B cell complement receptors 1 and 2. This recombinant DNA molecule was inserted into eukaryotic expression vector and used as a naked DNA vaccine in WT and CR1/2 KO mice. The intramuscular administration of the DNA construct resulted in the in vivo expression of an immunogenic chimeric protein, which cross-links cell surface receptors on influenza-specific B cells. The DNA vaccination was followed by prime-boosting with the protein-engineered replica of the DNA construct, thus delivering an activation intracellular signal. Immunization with an expression vector containing the described construct and boosting with the protein chimera induced a strong anti-influenza cytotoxic response, modulation of cytokine profile, and a weak antibody response in Balb/c mice. The same immunization scheme did not result in generation of influenza-specific response in mice lacking the target receptor, underlining the molecular adjuvant effect of receptor targeting.

Modeling Reactivity to Biological Macromolecules with a Deep Multitask Network

PubMed Central

2016-01-01

Most small-molecule drug candidates fail before entering the market, frequently because of unexpected toxicity. Often, toxicity is detected only late in drug development, because many types of toxicities, especially idiosyncratic adverse drug reactions (IADRs), are particularly hard to predict and detect. Moreover, drug-induced liver injury (DILI) is the most frequent reason drugs are withdrawn from the market and causes 50% of acute liver failure cases in the United States. A common mechanism often underlies many types of drug toxicities, including both DILI and IADRs. Drugs are bioactivated by drug-metabolizing enzymes into reactive metabolites, which then conjugate to sites in proteins or DNA to form adducts. DNA adducts are often mutagenic and may alter the reading and copying of genes and their regulatory elements, causing gene dysregulation and even triggering cancer. Similarly, protein adducts can disrupt their normal biological functions and induce harmful immune responses. Unfortunately, reactive metabolites are not reliably detected by experiments, and it is also expensive to test drug candidates for potential to form DNA or protein adducts during the early stages of drug development. In contrast, computational methods have the potential to quickly screen for covalent binding potential, thereby flagging problematic molecules and reducing the total number of necessary experiments. Here, we train a deep convolution neural network—the XenoSite reactivity model—using literature data to accurately predict both sites and probability of reactivity for molecules with glutathione, cyanide, protein, and DNA. On the site level, cross-validated predictions had area under the curve (AUC) performances of 89.8% for DNA and 94.4% for protein. Furthermore, the model separated molecules electrophilically reactive with DNA and protein from nonreactive molecules with cross-validated AUC performances of 78.7% and 79.8%, respectively. On both the site- and molecule-level, the model’s performances significantly outperformed reactivity indices derived from quantum simulations that are reported in the literature. Moreover, we developed and applied a selectivity score to assess preferential reactions with the macromolecules as opposed to the common screening traps. For the entire data set of 2803 molecules, this approach yielded totals of 257 (9.2%) and 227 (8.1%) molecules predicted to be reactive only with DNA and protein, respectively, and hence those that would be missed by standard reactivity screening experiments. Site of reactivity data is an underutilized resource that can be used to not only predict if molecules are reactive, but also show where they might be modified to reduce toxicity while retaining efficacy. The XenoSite reactivity model is available at http://swami.wustl.edu/xenosite/p/reactivity. PMID:27610414

Conformation-dependent DNA attraction

NASA Astrophysics Data System (ADS)

Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang

2014-05-01

Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg2+ ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg2+ or Na+, benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg2+ bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg2+ ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg2+ or Na+, benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg2+ bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription. Electronic supplementary information (ESI) available. See DOI: 10.1039/c3nr03235c

Antibodies specific for HT.sub.m4

DOEpatents

Lim, Bing; Adra, Chaker N.; Lelias, Jean-Michel

1998-01-01

The invention relates to a recombinant DNA molecule which encodes a HT.sub.m4 protein, a transformed host cell which has been stably transfected with a DNA molecule which encodes a HT.sub.m4 protein and a recombinant HT.sub.m4 protein. The invention also relates to a method for detecting the presence of a hereditary atopy.

Motion of Knots in DNA Stretched by Elongational Fields

NASA Astrophysics Data System (ADS)

Klotz, Alexander R.; Soh, Beatrice W.; Doyle, Patrick S.

2018-05-01

Knots in DNA occur in biological systems, serve as a model system for polymer entanglement, and affect the efficacy of modern genomics technologies. We study the motion of complex knots in DNA by stretching molecules with a divergent electric field that provides an elongational force. We demonstrate that the motion of knots is nonisotropic and driven towards the closest end of the molecule. We show for the first time experimentally that knots can go from a mobile to a jammed state by varying an applied strain rate, and that this jamming is reversible. We measure the mobility of knots as a function of strain rate, demonstrating the conditions under which knots can be driven towards the ends of the molecule and untied.

Theoretical underpinning of the single-molecule-dilution (SMD) method of direct haplotype resolution.

PubMed Central

Stephens, J C; Rogers, J; Ruano, G

1990-01-01

In a recent paper we have shown that DNA haplotypes of multiply heterozygous individuals can be resolved directly by polymerase-chain-reaction (PCR) amplification of a single molecule of genomic template. Our method (the single-molecule-dilution [SMD] method) relies on the stochastic separation of maternal and paternal alleles at high dilution. The stochasticity of separation and the potential for DNA shearing (which could separate the loci of interest) are two factors that can compromise the results of the experiment. This paper explores the consequences of these two factors and shows that the SMD method can be expected to work very reliably even in the presence of a moderate amount of DNA shearing. PMID:2339707

Compositions and methods for detecting single nucleotide polymorphisms

DOEpatents

Yeh, Hsin-Chih; Werner, James; Martinez, Jennifer S.

2016-11-22

Described herein are nucleic acid based probes and methods for discriminating and detecting single nucleotide variants in nucleic acid molecules (e.g., DNA). The methods include use of a pair of probes can be used to detect and identify polymorphisms, for example single nucleotide polymorphism in DNA. The pair of probes emit a different fluorescent wavelength of light depending on the association and alignment of the probes when hybridized to a target nucleic acid molecule. Each pair of probes is capable of discriminating at least two different nucleic acid molecules that differ by at least a single nucleotide difference. The methods can probes can be used, for example, for detection of DNA polymorphisms that are indicative of a particular disease or condition.

Isolation and sequence of partial cDNA clones of human L1: homology of human and rodent L1 in the cytoplasmic region.

PubMed

Harper, J R; Prince, J T; Healy, P A; Stuart, J K; Nauman, S J; Stallcup, W B

1991-03-01

We have isolated cDNA clones coding for the human homologue of the neuronal cell adhesion molecule L1. The nucleotide sequence of the cDNA clones and the deduced primary amino acid sequence of the carboxy terminal portion of the human L1 are homologous to the corresponding sequences of mouse L1 and rat NILE glycoprotein, with an especially high sequences identity in the cytoplasmic regions of the proteins. There is also protein sequence homology with the cytoplasmic region of the Drosophila cell adhesion molecule, neuroglian. The conservation of the cytoplasmic domain argues for an important functional role for this portion of the molecule.

Depth of focus extended microscope configuration for imaging of incorporated groups of molecules, DNA constructs and clusters inside bacterial cells

NASA Astrophysics Data System (ADS)

Fessl, Tomas; Ben-Yaish, Shai; Vacha, Frantisek; Adamec, Frantisek; Zalevsky, Zeev

2009-07-01

Imaging of small objects such as single molecules, DNA clusters and single bacterial cells is problematic not only due to the lateral resolution that is obtainable in currently existing microscopy but also, and as much fundamentally limiting, due to the lack of sufficient axial depth of focus to have the full object focused simultaneously. Extension in depth of focus is helpful also for single molecule steady state FRET measurements. In this technique it is crucial to obtain data from many well focused molecules, which are often located in different axial depths. In this paper we present the implementation of an all-optical and a real time technique of extension in the depth of focus that may be incorporated in any high NA microscope system and to be used for the above mentioned applications. We demonstrate experimentally how after the integration of special optical element in high NA 100× objective lens of a single molecule imaging microscope system, the depth of focus is significantly improved while maintaining the same lateral resolution in imaging applications of incorporated groups of molecules, DNA constructs and clusters inside bacterial cells.

Conformation and stretching of end-tethered polymers in pressure-driven flow under confinement

NASA Astrophysics Data System (ADS)

Roy, Tamal; Hardt, Steffen; InstituteNano-; Microfludics, Technische Universität Darmstadt Team

2016-11-01

Understanding of the conformation and dynamics of polymers under confinement is important for both fundamental studies and applications. We experimentally study the conformation and stretching of surface-tethered polymer chains confined between parallel surfaces and exposed to a pressure-driven flow. λ-DNA molecules are tethered to the wall of a microchannel of height smaller than the contour lengths of the molecules. The DNA molecules, stained with a fluorescent dye, are visualized by epifluorescence and laser-scanning confocal microscopy (LSCM). The effects of the channel height, flow rate and contour length on the extension of the molecules are determined from epifluorescence images. From LSCM images the complete conformation and orientation of the DNA molecules is inferred. We find that the fractional extension of the molecules is uniquely determined by the fluid shear stress at the tethering surface and the chain contour length. There is no explicit influence of the channel height in the range of contour lengths we consider. We also derive analytical scaling relationships (in the weak and strong extension limits) that explain the experimentally observed stretching characteristics. This work is supported by Deutsche Forschungsgemeinschaft (Grant No. HA 2696/33-1).

New branched DNA constructs.

PubMed

Chandra, Madhavaiah; Keller, Sascha; Gloeckner, Christian; Bornemann, Benjamin; Marx, Andreas

2007-01-01

The Watson-Crick base pairing of DNA is an advantageous phenomenon that can be exploited when using DNA as a scaffold for directed self-organization of nanometer-sized objects. Several reports have appeared in the literature that describe the generation of branched DNA (bDNA) with variable numbers of arms that self-assembles into predesigned architectures. These bDNA units are generated by using cleverly designed rigid crossover DNA molecules. Alternatively, bDNA can be generated by using synthetic branch points derived from either nucleoside or non-nucleoside building blocks. Branched DNA has scarcely been explored for use in nanotechnology or from self-assembling perspectives. Herein, we wish to report our results for the synthesis, characterization, and assembling properties of asymmetrical bDNA molecules that are able to generate linear and circular bDNA constructs. Our strategy for the generation of bDNA is based on a branching point that makes use of a novel protecting-group strategy. The bDNA units were generated by means of automated DNA synthesis methods and were used to generate novel objects by employing chemical and biological techniques. The entities generated might be useful building blocks for DNA-based nanobiotechnology.

Human Mitochondrial DNA Replication

PubMed Central

Holt, Ian J.; Reyes, Aurelio

2012-01-01

Elucidation of the process of DNA replication in mitochondria is in its infancy. For many years, maintenance of the mitochondrial genome was regarded as greatly simplified compared to the nucleus. Mammalian mitochondria were reported to lack all DNA repair systems, to eschew DNA recombination, and to possess but a single DNA polymerase, polymerase γ. Polγ was said to replicate mitochondrial DNA exclusively via one mechanism, involving only two priming events and a handful of proteins. In this “strand-displacement model,” leading strand DNA synthesis begins at a specific site and advances approximately two-thirds of the way around the molecule before DNA synthesis is initiated on the “lagging” strand. Although the displaced strand was long-held to be coated with protein, RNA has more recently been proposed in its place. Furthermore, mitochondrial DNA molecules with all the features of products of conventional bidirectional replication have been documented, suggesting that the process and regulation of replication in mitochondria is complex, as befits a genome that is a core factor in human health and longevity. PMID:23143808

Direct Correlation of DNA Binding and Single Protein Domain Motion via Dual Illumination Fluorescence Microscopy

PubMed Central

2015-01-01

We report a dual illumination, single-molecule imaging strategy to dissect directly and in real-time the correlation between nanometer-scale domain motion of a DNA repair protein and its interaction with individual DNA substrates. The strategy was applied to XPD, an FeS cluster-containing DNA repair helicase. Conformational dynamics was assessed via FeS-mediated quenching of a fluorophore site-specifically incorporated into XPD. Simultaneously, binding of DNA molecules labeled with a spectrally distinct fluorophore was detected by colocalization of the DNA- and protein-derived signals. We show that XPD undergoes thermally driven conformational transitions that manifest in spatial separation of its two auxiliary domains. DNA binding does not strictly enforce a specific conformation. Interaction with a cognate DNA damage, however, stabilizes the compact conformation of XPD by increasing the weighted average lifetime of this state by 140% relative to an undamaged DNA. Our imaging strategy will be a valuable tool to study other FeS-containing nucleic acid processing enzymes. PMID:25204359

Effects of Near Infrared Radiation on DNA. DLS and ATR-FTIR Study

NASA Astrophysics Data System (ADS)

Szymborska-Małek, Katarzyna; Komorowska, Małgorzata; Gąsior-Głogowska, Marlena

2018-01-01

We presume that the primary effect of Near Infrared (NIR) radiation on aqueous solutions of biological molecules concerns modification of hydrogen bonded structures mainly the global and the hydration shell water molecules. Since water has a significant influence on the DNA structure, we expect that the thermal stability of DNA could be modified by NIR radiation. The herring sperm DNA was exposed to NIR radiation (700-1100 nm) for 5, 10, and 20 min periods. The temperature dependent infrared measurements were done for the thin films formed on the diamond ATR crystal from evaporated DNA solutions exposed and unexposed to NIR radiation. For the NIR-treated samples (at room temperature) the B form was better conserved than in the control sample independently of the irradiation period. Above 50 °C a considerable increase in the A form was only observed for 10 min NIR exposed samples. The hydrodynamic radius, (Rh), studied by the dynamic light scattering, showed drastic decrease with the increasing irradiation time. Principal components analysis (PCA) allowed to detect the spectral features correlated with the NIR effect and thermal stability of the DNA films. Obtained results strongly support the idea that the photoionization of water by NIR radiation in presence of DNA molecules is the main factor influencing on its physicochemical properties.

Measurement of inelastic cross sections for low-energy electron scattering from DNA bases.

PubMed

Michaud, Marc; Bazin, Marc; Sanche, Léon

2012-01-01

To determine experimentally the absolute cross sections (CS) to deposit various amount of energies into DNA bases by low-energy electron (LEE) impact. Electron energy loss (EEL) spectra of DNA bases were recorded for different LEE impact energies on the molecules deposited at very low coverage on an inert argon (Ar) substrate. Following their normalisation to the effective incident electron current and molecular surface number density, the EEL spectra were then fitted with multiple Gaussian functions in order to delimit the various excitation energy regions. The CS to excite a molecule into its various excitation modes were finally obtained from computing the area under the corresponding Gaussians. The EEL spectra and absolute CS for the electronic excitations of pyrimidine and the DNA bases thymine, adenine, and cytosine by electron impacts below 18 eV were reported for the molecules deposited at about monolayer coverage on a solid Ar substrate. The CS for electronic excitations of DNA bases by LEE impact were found to lie within the 10(216) to 10(218) cm(2) range. The large value of the total ionisation CS indicated that ionisation of DNA bases by LEE is an important dissipative process via which ionising radiation degrades and is absorbed in DNA.

Measurement of inelastic cross sections for low-energy electron scattering from DNA bases

PubMed Central

Michaud, Marc; Bazin, Marc.; Sanche, Léon

2013-01-01

Purpose Determine experimentally the absolute cross sections (CS) to deposit various amount of energies into DNA bases by low-energy electron (LEE) impact. Materials and methods Electron energy loss (EEL) spectra of DNA bases are recorded for different LEE impact energies on the molecules deposited at very low coverage on an inert argon (Ar) substrate. Following their normalisation to the effective incident electron current and molecular surface number density, the EEL spectra are then fitted with multiple Gaussian functions in order to delimit the various excitation energy regions. The CS to excite a molecule into its various excitation modes are finally obtained from computing the area under the corresponding Gaussians. Results The EEL spectra and absolute CS for the electronic excitations of pyrimidine and the DNA bases thymine, adenine, and cytosine by electron impacts below 18 eV are reported for the molecules deposited at about monolayer coverage on a solid Ar substrate. Conclusions The CS for electronic excitations of DNA bases by LEE impact are found to lie within the 10−16 – 10−18 cm2 range. The large value of the total ionisation CS indicates that ionisation of DNA bases by LEE is an important dissipative process via which ionising radiation degrades and is absorbed in DNA. PMID:21615242

Quantitative DNA fiber mapping

DOEpatents

Gray, Joe W.; Weier, Heinz-Ulrich G.

1998-01-01

The present invention relates generally to the DNA mapping and sequencing technologies. In particular, the present invention provides enhanced methods and compositions for the physical mapping and positional cloning of genomic DNA. The present invention also provides a useful analytical technique to directly map cloned DNA sequences onto individual stretched DNA molecules.

Study of intermolecular contacts in the proline-rich homeodomain (PRH)-DNA complex using molecular dynamics simulations.

PubMed

Jalili, Seifollah; Karami, Leila

2012-03-01

The proline-rich homeodomain (PRH)-DNA complex consists of a protein with 60 residues and a 13-base-pair DNA. The PRH protein is a transcription factor that plays a key role in the regulation of gene expression. PRH is a significant member of the Q50 class of homeodomain proteins. The homeodomain section of PRH is essential for binding to DNA and mediates sequence-specific DNA binding. Three 20-ns molecular dynamics (MD) simulations (free protein, free DNA and protein-DNA complex) in explicit solvent water were performed to elucidate the intermolecular contacts in the PRH-DNA complex and the role of dynamics of water molecules forming water-mediated contacts. The simulation provides a detailed explanation of the trajectory of hydration water molecules. The simulations show that some water molecules in the protein-DNA interface exchange with bulk waters. The simulation identifies that most of the contacts consisted of direct interactions between the protein and DNA including specific and non-specific contacts, but several water-mediated polar contacts were also observed. The specific interaction between Gln50 and C18 and water-mediated hydrogen bond between Gln50 and T7 were found to be present during almost the entire time of the simulation. These results show good consistency with experimental and previous computational studies. Structural properties such as root-mean-square deviations (RMSD), root-mean-square fluctuations (RMSF) and secondary structure were also analyzed as a function of time. Analyses of the trajectories showed that the dynamic fluctuations of both the protein and the DNA were lowered by the complex formation.

Physics behind the mechanical nucleosome positioning code

NASA Astrophysics Data System (ADS)

Zuiddam, Martijn; Everaers, Ralf; Schiessel, Helmut

2017-11-01

The positions along DNA molecules of nucleosomes, the most abundant DNA-protein complexes in cells, are influenced by the sequence-dependent DNA mechanics and geometry. This leads to the "nucleosome positioning code", a preference of nucleosomes for certain sequence motives. Here we introduce a simplified model of the nucleosome where a coarse-grained DNA molecule is frozen into an idealized superhelical shape. We calculate the exact sequence preferences of our nucleosome model and find it to reproduce qualitatively all the main features known to influence nucleosome positions. Moreover, using well-controlled approximations to this model allows us to come to a detailed understanding of the physics behind the sequence preferences of nucleosomes.

DNA sequence analysis with droplet-based microfluidics

PubMed Central

Abate, Adam R.; Hung, Tony; Sperling, Ralph A.; Mary, Pascaline; Rotem, Assaf; Agresti, Jeremy J.; Weiner, Michael A.; Weitz, David A.

2014-01-01

Droplet-based microfluidic techniques can form and process micrometer scale droplets at thousands per second. Each droplet can house an individual biochemical reaction, allowing millions of reactions to be performed in minutes with small amounts of total reagent. This versatile approach has been used for engineering enzymes, quantifying concentrations of DNA in solution, and screening protein crystallization conditions. Here, we use it to read the sequences of DNA molecules with a FRET-based assay. Using probes of different sequences, we interrogate a target DNA molecule for polymorphisms. With a larger probe set, additional polymorphisms can be interrogated as well as targets of arbitrary sequence. PMID:24185402

Three-dimensional characterization of tethered microspheres by total internal reflection fluorescence microscopy

NASA Technical Reports Server (NTRS)

Blumberg, Seth; Gajraj, Arivalagan; Pennington, Matthew W.; Meiners, Jens-Christian

2005-01-01

Tethered particle microscopy is a powerful tool to study the dynamics of DNA molecules and DNA-protein complexes in single-molecule experiments. We demonstrate that stroboscopic total internal reflection microscopy can be used to characterize the three-dimensional spatiotemporal motion of DNA-tethered particles. By calculating characteristic measures such as symmetry and time constants of the motion, well-formed tethers can be distinguished from defective ones for which the motion is dominated by aberrant surface effects. This improves the reliability of measurements on tether dynamics. For instance, in observations of protein-mediated DNA looping, loop formation is distinguished from adsorption and other nonspecific events.

Tethered particle analysis of supercoiled circular DNA using peptide nucleic acid handles.

PubMed

Norregaard, Kamilla; Andersson, Magnus; Nielsen, Peter Eigil; Brown, Stanley; Oddershede, Lene B

2014-09-01

This protocol describes how to monitor individual naturally supercoiled circular DNA plasmids bound via peptide nucleic acid (PNA) handles between a bead and a surface. The protocol was developed for single-molecule investigation of the dynamics of supercoiled DNA, and it allows the investigation of both the dynamics of the molecule itself and of its interactions with a regulatory protein. Two bis-PNA clamps designed to bind with extremely high affinity to predetermined homopurine sequence sites in supercoiled DNA are prepared: one conjugated with digoxigenin for attachment to an anti-digoxigenin-coated glass cover slide, and one conjugated with biotin for attachment to a submicron-sized streptavidin-coated polystyrene bead. Plasmids are constructed, purified and incubated with the PNA handles. The dynamics of the construct is analyzed by tracking the tethered bead using video microscopy: less supercoiling results in more movement, and more supercoiling results in less movement. In contrast to other single-molecule methodologies, the current methodology allows for studying DNA in its naturally supercoiled state with constant linking number and constant writhe. The protocol has potential for use in studying the influence of supercoils on the dynamics of DNA and its associated proteins, e.g., topoisomerase. The procedure takes ~4 weeks.

Single Molecule Bioelectronics and Their Application to Amplification-Free Measurement of DNA Lengths

PubMed Central

Gül, O. Tolga; Pugliese, Kaitlin M.; Choi, Yongki; Sims, Patrick C.; Pan, Deng; Rajapakse, Arith J.; Weiss, Gregory A.; Collins, Philip G.

2016-01-01

As biosensing devices shrink smaller and smaller, they approach a scale in which single molecule electronic sensing becomes possible. Here, we review the operation of single-enzyme transistors made using single-walled carbon nanotubes. These novel hybrid devices transduce the motions and catalytic activity of a single protein into an electronic signal for real-time monitoring of the protein’s activity. Analysis of these electronic signals reveals new insights into enzyme function and proves the electronic technique to be complementary to other single-molecule methods based on fluorescence. As one example of the nanocircuit technique, we have studied the Klenow Fragment (KF) of DNA polymerase I as it catalytically processes single-stranded DNA templates. The fidelity of DNA polymerases makes them a key component in many DNA sequencing techniques, and here we demonstrate that KF nanocircuits readily resolve DNA polymerization with single-base sensitivity. Consequently, template lengths can be directly counted from electronic recordings of KF’s base-by-base activity. After measuring as few as 20 copies, the template length can be determined with <1 base pair resolution, and different template lengths can be identified and enumerated in solutions containing template mixtures. PMID:27348011

Investigating Deinococcus radiodurans RecA protein filament formation on dsDNA by a real-time single-molecule approach

PubMed Central

Hsu, Hsin-Fang; Ngo, Khanh V.; Chitteni-Pattu, Sindhu; Cox, Michael M.; Li, Hung-Wen

2011-01-01

With the aid of an efficient, precise, and almost error-free DNA repair system, Deinococcus radiodurans can survive hundreds of double strand breaks inflicted by high doses of irradiation or desiccation. The RecA of Deinococcus radiodurans (DrRecA) plays a central role both in the early phase of repair by an extended synthesis-dependent strand annealing process and in the later more general homologous recombination phase. Both roles likely require DrRecA filament formation on duplex DNA. We have developed single-molecule tethered particle motion (TPM) experiments to study the assembly dynamics of RecA proteins on individual duplex DNA molecules by observing changes in DNA tether length resulting from RecA binding. We demonstrate that DrRecA nucleation on dsDNA is much faster than Escherichia coli (Ec) RecA protein, but the extension is slower. This combination of attributes would tend to increase the number and decrease the length of DrRecA filaments relative to those of EcRecA, a feature that may reflect the requirement to repair hundreds of genomic double strand breaks concurrently in irradiated Deinococcus cells. PMID:21853996

Single Molecule Bioelectronics and Their Application to Amplification-Free Measurement of DNA Lengths.

PubMed

Gül, O Tolga; Pugliese, Kaitlin M; Choi, Yongki; Sims, Patrick C; Pan, Deng; Rajapakse, Arith J; Weiss, Gregory A; Collins, Philip G

2016-06-24

As biosensing devices shrink smaller and smaller, they approach a scale in which single molecule electronic sensing becomes possible. Here, we review the operation of single-enzyme transistors made using single-walled carbon nanotubes. These novel hybrid devices transduce the motions and catalytic activity of a single protein into an electronic signal for real-time monitoring of the protein's activity. Analysis of these electronic signals reveals new insights into enzyme function and proves the electronic technique to be complementary to other single-molecule methods based on fluorescence. As one example of the nanocircuit technique, we have studied the Klenow Fragment (KF) of DNA polymerase I as it catalytically processes single-stranded DNA templates. The fidelity of DNA polymerases makes them a key component in many DNA sequencing techniques, and here we demonstrate that KF nanocircuits readily resolve DNA polymerization with single-base sensitivity. Consequently, template lengths can be directly counted from electronic recordings of KF's base-by-base activity. After measuring as few as 20 copies, the template length can be determined with <1 base pair resolution, and different template lengths can be identified and enumerated in solutions containing template mixtures.

Telomere Biology—Insights into an Intriguing Phenomenon

PubMed Central

Venkatesan, Shriram; Khaw, Aik Kia; Hande, Manoor Prakash

2017-01-01

Bacteria and viruses possess circular DNA, whereas eukaryotes with typically very large DNA molecules have had to evolve into linear chromosomes to circumvent the problem of supercoiling circular DNA of that size. Consequently, such organisms possess telomeres to cap chromosome ends. Telomeres are essentially tandem repeats of any DNA sequence that are present at the ends of chromosomes. Their biology has been an enigmatic one, involving various molecules interacting dynamically in an evolutionarily well-trimmed fashion. Telomeres range from canonical hexameric repeats in most eukaryotes to unimaginably random retrotransposons, which attach to chromosome ends and reverse-transcribe to DNA in some plants and insects. Telomeres invariably associate with specialised protein complexes that envelop it, also regulating access of the ends to legitimate enzymes involved in telomere metabolism. They also transcribe into repetitive RNA which also seems to be playing significant roles in telomere maintenance. Telomeres thus form the intersection of DNA, protein, and RNA molecules acting in concert to maintain chromosome integrity. Telomere biology is emerging to appear ever more complex than previously envisaged, with the continual discovery of more molecules and interplays at the telomeres. This review also includes a section dedicated to the history of telomere biology, and intends to target the scientific audience new to the field by rendering an understanding of the phenomenon of chromosome end protection at large, with more emphasis on the biology of human telomeres. The review provides an update on the field and mentions the questions that need to be addressed. PMID:28629193

Synthesis and DNA interaction of a mixed proflavine-phenanthroline Tröger base.

PubMed

Baldeyrou, Brigitte; Tardy, Christelle; Bailly, Christian; Colson, Pierre; Houssier, Claude; Charmantray, Franck; Demeunynck, Martine

2002-04-01

We report the synthesis of an asymmetric Tröger base containing the two well characterised DNA binding chromophores, proflavine and phenanthroline. The mode of interaction of the hybrid molecule was investigated by circular and linear dichroism experiments and a biochemical assay using DNA topoisomerase I. The data are compatible with a model in which the proflavine moiety intercalates between DNA base pairs and the phenanthroline ring occupies the DNA groove. DNase I cleavage experiments were carried out to investigate the sequence preference of the hybrid ligand and a well resolved footprint was detected at a site encompassing two adjacent 5'-GTC.5-GAC triplets. The sequence preference of the asymmetric molecule is compared to that of the symmetric analogues.

Bio-recognitive photonics of a DNA-guided organic semiconductor

PubMed Central

Back, Seung Hyuk; Park, Jin Hyuk; Cui, Chunzhi; Ahn, Dong June

2016-01-01

Incorporation of duplex DNA with higher molecular weights has attracted attention for a new opportunity towards a better organic light-emitting diode (OLED) capability. However, biological recognition by OLED materials is yet to be addressed. In this study, specific oligomeric DNA–DNA recognition is successfully achieved by tri (8-hydroxyquinoline) aluminium (Alq3), an organic semiconductor. Alq3 rods crystallized with guidance from single-strand DNA molecules show, strikingly, a unique distribution of the DNA molecules with a shape of an ‘inverted' hourglass. The crystal's luminescent intensity is enhanced by 1.6-fold upon recognition of the perfect-matched target DNA sequence, but not in the case of a single-base mismatched one. The DNA–DNA recognition forming double-helix structure is identified to occur only in the rod's outer periphery. This study opens up new opportunities of Alq3, one of the most widely used OLED materials, enabling biological recognition. PMID:26725969

Highly sensitive self-complementary DNA nanoswitches triggered by polyelectrolytes.

PubMed

Wu, Jincai; Yu, Feng; Zhang, Zheng; Chen, Yong; Du, Jie; Maruyama, Atsushi

2016-01-07

Dimerization of two homologous strands of genomic DNA/RNA is an essential feature of retroviral replication. Herein we show that a cationic comb-type copolymer (CCC), poly(L-lysine)-graft-dextran, accelerates the dimerization of self-complementary stem-loop DNA, frequently found in functional DNA/RNA molecules, such as aptamers. Furthermore, an anionic polymer poly(sodium vinylsulfonate) (PVS) dissociates CCC from the duplex shortly within a few seconds. Then single stem-loop DNA spontaneously transforms from its dimer. Thus we can easily control the dimer and stem-loop DNA by switching on/off CCC activity. Both polyelectrolytes and DNA concentrations are in the nanomole per liter range. The polyelectrolyte-assisted transconformation and sequences design strategy ensures the reversible state control with rapid response and effective switching under physiologically relevant conditions. A further application of this sensitive assembly is to construct an aptamer-type drug delivery system, bind or release functional molecules responding to its transconformation.

Combined DNA-RNA Fluorescent In situ Hybridization (FISH) to Study X Chromosome Inactivation in Differentiated Female Mouse Embryonic Stem Cells

PubMed Central

Barakat, Tahsin Stefan; Gribnau, Joost

2014-01-01

Fluorescent in situ hybridization (FISH) is a molecular technique which enables the detection of nucleic acids in cells. DNA FISH is often used in cytogenetics and cancer diagnostics, and can detect aberrations of the genome, which often has important clinical implications. RNA FISH can be used to detect RNA molecules in cells and has provided important insights in regulation of gene expression. Combining DNA and RNA FISH within the same cell is technically challenging, as conditions suitable for DNA FISH might be too harsh for fragile, single stranded RNA molecules. We here present an easily applicable protocol which enables the combined, simultaneous detection of Xist RNA and DNA encoded by the X chromosomes. This combined DNA-RNA FISH protocol can likely be applied to other systems where both RNA and DNA need to be detected. PMID:24961515

Triple Helix Formation in a Topologically Controlled DNA Nanosystem.

PubMed

Yamagata, Yutaro; Emura, Tomoko; Hidaka, Kumi; Sugiyama, Hiroshi; Endo, Masayuki

2016-04-11

In the present study, we demonstrate single-molecule imaging of triple helix formation in DNA nanostructures. The binding of the single-molecule third strand to double-stranded DNA in a DNA origami frame was examined using two different types of triplet base pairs. The target DNA strand and the third strand were incorporated into the DNA frame, and the binding of the third strand was controlled by the formation of Watson-Crick base pairing. Triple helix formation was monitored by observing the structural changes in the incorporated DNA strands. It was also examined using a photocaged third strand wherein the binding of the third strand was directly observed using high-speed atomic force microscopy during photoirradiation. We found that the binding of the third strand could be controlled by regulating duplex formation and the uncaging of the photocaged strands in the designed nanospace. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Cation-Induced Stabilization and Denaturation of DNA Origami Nanostructures in Urea and Guanidinium Chloride.

PubMed

Ramakrishnan, Saminathan; Krainer, Georg; Grundmeier, Guido; Schlierf, Michael; Keller, Adrian

2017-11-01

The stability of DNA origami nanostructures under various environmental conditions constitutes an important issue in numerous applications, including drug delivery, molecular sensing, and single-molecule biophysics. Here, the effect of Na + and Mg 2+ concentrations on DNA origami stability is investigated in the presence of urea and guanidinium chloride (GdmCl), two strong denaturants commonly employed in protein folding studies. While increasing concentrations of both cations stabilize the DNA origami nanostructures against urea denaturation, they are found to promote DNA origami denaturation by GdmCl. These inverse behaviors are rationalized by a salting-out of Gdm + to the hydrophobic DNA base stack. The effect of cation-induced DNA origami denaturation by GdmCl deserves consideration in the design of single-molecule studies and may potentially be exploited in future applications such as selective denaturation for purification purposes. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Preparation, Single-Molecule Manipulation, and Energy Transfer Investigation of a Polyfluorene-graft-DNA polymer.

PubMed

Madsen, Mikael; Christensen, Rasmus S; Krissanaprasit, Abhichart; Bakke, Mette R; Riber, Camilla F; Nielsen, Karina S; Zelikin, Alexander N; Gothelf, Kurt V

2017-08-04

Conjugated polymers have been intensively studied due to their unique optical and electronic properties combined with their physical flexibility and scalable bottom up synthesis. Although the bulk qualities of conjugated polymers have been extensively utilized in research and industry, the ability to handle and manipulate conjugated polymers at the nanoscale lacks significantly behind. Here, the toolbox for controlled manipulation of conjugated polymers was expanded through the synthesis of a polyfluorene-DNA graft-type polymer (poly(F-DNA)). The polymer possesses the characteristics associated with the conjugated polyfluorene backbone, but the protruding single-stranded DNA provides the material with an exceptional addressability. This study demonstrates controlled single-molecule patterning of poly(F-DNA), as well as energy transfer between two different polymer-DNA conjugates. Finally, highly efficient DNA-directed quenching of polyfluorene fluorescence was shown. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Tetrahelical monomolecular architecture of DNA: a new building block for nanotechnology.

PubMed

Kankia, Besik

2014-06-12

DNA nanotechnology typically relies on Watson-Crick base pairing as both a recognition and structural element. This limits structural versatility and introduces errors during self-assembly of DNA. Guanine (G) quartet motifs show promise as an alternative to DNA duplexes, but the synthesis of long, precisely defined molecules is a significant challenge. Here we demonstrate a continuous tetrahelical DNA architecture capable of programmed self-assembly. We report that the homopolymer consisting of (G3T)3G3 monomeric units has the capability to fold into a monomolecular DNA tetrahelix with unprecedented speed and stability. For instance, in the presence of 1 mM K(+) ions the dimer, (G3T)2, folds readily and melts above 100 °C. These findings have the potential to revolutionize DNA nanotechnology by introducing fast and error-free self-assembly of long and extraordinarily stable molecules.

PHYSICAL MODEL FOR RECOGNITION TUNNELING

PubMed Central

Krstić, Predrag; Ashcroft, Brian; Lindsay, Stuart

2015-01-01

Recognition tunneling (RT) identifies target molecules trapped between tunneling electrodes functionalized with recognition molecules that serve as specific chemical linkages between the metal electrodes and the trapped target molecule. Possible applications include single molecule DNA and protein sequencing. This paper addresses several fundamental aspects of RT by multiscale theory, applying both all-atom and coarse-grained DNA models: (1) We show that the magnitude of the observed currents are consistent with the results of non-equilibrium Green's function calculations carried out on a solvated all-atom model. (2) Brownian fluctuations in hydrogen bond-lengths lead to current spikes that are similar to what is observed experimentally. (3) The frequency characteristics of these fluctuations can be used to identify the trapped molecules with a machine-learning algorithm, giving a theoretical underpinning to this new method of identifying single molecule signals. PMID:25650375

[Expression of cell adhesion molecules in acute leukemia cell].

PubMed

Ju, Xiaoping; Peng, Min; Xu, Xiaoping; Lu, Shuqing; Li, Yao; Ying, Kang; Xie, Yi; Mao, Yumin; Xia, Fang

2002-11-01

To investigate the role of cell adhesion molecule in the development and extramedullary infiltration (EI) of acute leukemia. The expressions of neural cell adhesion molecule (NCAM) gene, intercellular adhesion molecule-1 (ICAM-1) and vascular cell adhesion molecule (VCAM-1) genes in 25 acute leukemia patients bone marrow cells were detected by microarray and reverse transcriptase-polymerase chain reaction (RT-PCR). The expressions of NCAM, ICAM-1 and VCAM-1 gene were significantly higher in acute leukemia cells and leukemia cells with EI than in normal tissues and leukemia cells without EI, respectively, both by cDNA microarray and by RT-PCR. The cDNA microarray is a powerful technique in analysis of acute leukemia cells associated genes. High expressions of cell adhesion molecule genes might be correlated with leukemia pathogenesis and infiltration of acute leukemia cell.

Single molecule photobleaching (SMPB) technology for counting of RNA, DNA, protein and other molecules in nanoparticles and biological complexes by TIRF instrumentation.

PubMed

Zhang, Hui; Guo, Peixuan

2014-05-15

Direct counting of biomolecules within biological complexes or nanomachines is demanding. Single molecule counting using optical microscopy is challenging due to the diffraction limit. The single molecule photobleaching (SMPB) technology for direct counting developed by our team (Shu et al., 2007 [18]; Zhang et al., 2007 [19]) offers a simple and straightforward method to determine the stoichiometry of molecules or subunits within biocomplexes or nanomachines at nanometer scales. Stoichiometry is determined by real-time observation of the number of descending steps resulted from the photobleaching of individual fluorophore. This technology has now been used extensively for single molecule counting of protein, RNA, and other macromolecules in a variety of complexes or nanostructures. Here, we elucidate the SMPB technology, using the counting of RNA molecules within a bacteriophage phi29 DNA-packaging biomotor as an example. The method described here can be applied to the single molecule counting of other molecules in other systems. The construction of a concise, simple and economical single molecule total internal reflection fluorescence (TIRF) microscope combining prism-type and objective-type TIRF is described. The imaging system contains a deep-cooled sensitive EMCCD camera with single fluorophore detection sensitivity, a laser combiner for simultaneous dual-color excitation, and a Dual-View™ imager to split the multiple outcome signals to different detector channels based on their wavelengths. Methodology of the single molecule photobleaching assay used to elucidate the stoichiometry of RNA on phi29 DNA packaging motor and the mechanism of protein/RNA interaction are described. Different methods for single fluorophore labeling of RNA molecules are reviewed. The process of statistical modeling to reveal the true copy number of the biomolecules based on binomial distribution is also described. Copyright © 2014 Elsevier Inc. All rights reserved.

Integrating a high-force optical trap with gold nanoposts and a robust gold-DNA bond.

PubMed

Paik, D Hern; Seol, Yeonee; Halsey, Wayne A; Perkins, Thomas T

2009-08-01

Gold-thiol chemistry is widely used in nanotechnology but has not been exploited in optical-trapping experiments due to laser-induced ablation of gold. We circumvented this problem by using an array of gold nanoposts (r = 50-250 nm, h approximately 20 nm) that allowed for quantitative optical-trapping assays without direct irradiation of the gold. DNA was covalently attached to the gold via dithiol phosphoramidite (DTPA). By using three DTPAs, the gold-DNA bond was not cleaved in the presence of excess thiolated compounds. This chemical robustness allowed us to reduce nonspecific sticking by passivating the unreacted gold with methoxy-(polyethylene glycol)-thiol. We routinely achieved single beads anchored to the nanoposts by single DNA molecules. We measured DNA's elasticity and its overstretching transition, demonstrating moderate- and high-force optical-trapping assays using gold-thiol chemistry. Force spectroscopy measurements were consistent with the rupture of the strepavidin-biotin bond between the bead and the DNA. This implied that the DNA remained anchored to the surface due to the strong gold-thiol bond. Consistent with this conclusion, we repeatedly reattached the trapped bead to the same individual DNA molecule. Thus, surface conjugation of biomolecules onto an array of gold nanostructures by chemically and mechanically robust bonds provides a unique way to carry out spatially controlled, repeatable measurements of single molecules.

Enzymatic repair of selected cross-linked homoduplex molecules enhances nuclear gene rescue from Pompeii and Herculaneum remains.

PubMed

Di Bernardo, Giovanni; Del Gaudio, Stefania; Cammarota, Marcella; Galderisi, Umberto; Cascino, Antonino; Cipollaro, Marilena

2002-02-15

Ancient DNA (aDNA) samples extracted from the bone remains of six equids buried by the Vesuvius eruption in 79 AD were investigated to test pre-amplification and enzymatic repair procedures designed to enhance the rescue of nuclear genes. The extracts, which proved all positive for Equidae mtDNA amplification, proved positive only four times out of 18 when tested for single-copy Equidae nuclear genes (epsilon globin, p53 and gamma interferon). Pre-amplification did not change the number of retrieved aDNA sequences but 10 times out of 14 enzymatic repair restored the amplifiability of the genes analysed, proving that repair increases the rate of successful rescue from 22 to alpha(lambda)mu(omicron)sigma(tau) 80%. These findings support the hypothesis that some of these cross-linked aDNA molecules, which are not completely separated when DNA is extracted under denaturing conditions, become homoduplex substrates for Pol I and/or T4 ligase action upon renaturation. aDNA authenticity is proved by the homology of the nucleotide sequences of loci tested to the corresponding modern Equidae sequences. Data also indicate that cross-linked homoduplex molecules selected by denaturation of the extract are repaired without any chimera formation. The general features of aDNA amplification with and without denaturation and enzymatic repair are discussed.

Enzymatic repair of selected cross-linked homoduplex molecules enhances nuclear gene rescue from Pompeii and Herculaneum remains

PubMed Central

Di Bernardo, Giovanni; Del Gaudio, Stefania; Cammarota, Marcella; Galderisi, Umberto; Cascino, Antonino; Cipollaro, Marilena

2002-01-01

Ancient DNA (aDNA) samples extracted from the bone remains of six equids buried by the Vesuvius eruption in 79 AD were investigated to test pre-amplification and enzymatic repair procedures designed to enhance the rescue of nuclear genes. The extracts, which proved all positive for Equidae mtDNA amplification, proved positive only four times out of 18 when tested for single-copy Equidae nuclear genes (ɛ globin, p53 and γ interferon). Pre-amplification did not change the number of retrieved aDNA sequences but 10 times out of 14 enzymatic repair restored the amplifiability of the genes analysed, proving that repair increases the rate of successful rescue from 22 to αλµοστ 80%. These findings support the hypothesis that some of these cross-linked aDNA molecules, which are not completely separated when DNA is extracted under denaturing conditions, become homoduplex substrates for Pol I and/or T4 ligase action upon renaturation. aDNA authenticity is proved by the homology of the nucleotide sequences of loci tested to the corresponding modern Equidae sequences. Data also indicate that cross-linked homoduplex molecules selected by denaturation of the extract are repaired without any chimera formation. The general features of aDNA amplification with and without denaturation and enzymatic repair are discussed. PMID:11842122

A simple procedure for parallel sequence analysis of both strands of 5'-labeled DNA.

PubMed

Razvi, F; Gargiulo, G; Worcel, A

1983-08-01

Ligation of a 5'-labeled DNA restriction fragment results in a circular DNA molecule carrying the two 32Ps at the reformed restriction site. Double digestions of the circular DNA with the original enzyme and a second restriction enzyme cleavage near the labeled site allows direct chemical sequencing of one 5'-labeled DNA strand. Similar double digestions, using an isoschizomer that cleaves differently at the 32P-labeled site, allows direct sequencing of the now 3'-labeled complementary DNA strand. It is possible to directly sequence both strands of cloned DNA inserts by using the above protocol and a multiple cloning site vector that provides the necessary restriction sites. The simultaneous and parallel visualization of both DNA strands eliminates sequence ambiguities. In addition, the labeled circular molecules are particularly useful for single-hit DNA cleavage studies and DNA footprint analysis. As an example, we show here an analysis of the micrococcal nuclease-induced breaks on the two strands of the somatic 5S RNA gene of Xenopus borealis, which suggests that the enzyme may recognize and cleave small AT-containing palindromes along the DNA helix.

Antibody specific for a DNA repair protein

DOEpatents

Petrini, John H.; Morgan, William Francis; Maser, Richard Scott; Carney, James Patrick

2006-07-11

An isolated and purified DNA molecule encoding a DNA repair protein, p95, is provided, as is isolated and purified p95. Also provided are methods of detecting p95 and DNA encoding p95. The invention further provides p95 knock-out mice.

Design, synthesis and DNA-binding study of some novel morpholine linked thiazolidinone derivatives

NASA Astrophysics Data System (ADS)

War, Javeed Ahmad; Srivastava, Santosh Kumar; Srivastava, Savitri Devi

2017-02-01

The emergence of multiple drug resistance amongst bacterial strains resulted in many clinical drugs to be ineffective. Being vulnerable to bacterial infections any lack in the development of new antimicrobial drugs could pose a serious threat to public health. Here we report design and synthesis of a novel class of morpholine linked thiazolidinone hybrid molecules. The compounds were characterized by FT-IR, NMR and HRMS techniques. Susceptibility tests showed that most of the synthesized molecules were highly active against multiple bacterial strains. Compound 3f displayed MIC values which were better than the standard drug for most of the tested strains. DNA being a well defined target for many antimicrobial drugs was probed as possible target for these synthetic molecules. DNA-binding study of 3f with sm-DNA was probed through UV-vis absorption, fluorescence quenching, gel electrophoresis and molecular docking techniques. The studies revealed that compound 3f has strong affinity towards DNA and binds at the minor groove. The docking studies revealed that the compound 3f shows preferential binding towards A/T residues.

Design, synthesis and DNA-binding study of some novel morpholine linked thiazolidinone derivatives.

PubMed

War, Javeed Ahmad; Srivastava, Santosh Kumar; Srivastava, Savitri Devi

2017-02-15

The emergence of multiple drug resistance amongst bacterial strains resulted in many clinical drugs to be ineffective. Being vulnerable to bacterial infections any lack in the development of new antimicrobial drugs could pose a serious threat to public health. Here we report design and synthesis of a novel class of morpholine linked thiazolidinone hybrid molecules. The compounds were characterized by FT-IR, NMR and HRMS techniques. Susceptibility tests showed that most of the synthesized molecules were highly active against multiple bacterial strains. Compound 3f displayed MIC values which were better than the standard drug for most of the tested strains. DNA being a well defined target for many antimicrobial drugs was probed as possible target for these synthetic molecules. DNA-binding study of 3f with sm-DNA was probed through UV-vis absorption, fluorescence quenching, gel electrophoresis and molecular docking techniques. The studies revealed that compound 3f has strong affinity towards DNA and binds at the minor groove. The docking studies revealed that the compound 3f shows preferential binding towards A/T residues. Copyright © 2016 Elsevier B.V. All rights reserved.

DNA Physical Mapping via the Controlled Translocation of Single Molecules through a 5-10nm Silicon Nitride Nanopore

NASA Astrophysics Data System (ADS)

Stein, Derek; Reisner, Walter; Jiang, Zhijun; Hagerty, Nick; Wood, Charles; Chan, Jason

2009-03-01

The ability to map the binding position of sequence-specific markers, including transcription-factors, protein-nucleic acids (PNAs) or deactivated restriction enzymes, along a single DNA molecule in a nanofluidic device would be of key importance for the life-sciences. Such markers could give an indication of the active genes at particular stage in a cell's transcriptional cycle, pinpoint the location of mutations or even provide a DNA barcode that could aid in genomics applications. We have developed a setup consisting of a 5-10 nm nanopore in a 20nm thick silicon nitride film coupled to an optical tweezer setup. The translocation of DNA across the nanopore can be detected via blockades in the electrical current through the pore. By anchoring one end of the translocating DNA to an optically trapped microsphere, we hope to stretch out the molecule in the nanopore and control the translocation speed, enabling us to slowly scan across the genome and detect changes in the baseline current due to the presence of bound markers.

A lab-on-chip for biothreat detection using single-molecule DNA mapping.

PubMed

Meltzer, Robert H; Krogmeier, Jeffrey R; Kwok, Lisa W; Allen, Richard; Crane, Bryan; Griffis, Joshua W; Knaian, Linda; Kojanian, Nanor; Malkin, Gene; Nahas, Michelle K; Papkov, Vyacheslav; Shaikh, Saad; Vyavahare, Kedar; Zhong, Qun; Zhou, Yi; Larson, Jonathan W; Gilmanshin, Rudolf

2011-03-07

Rapid, specific, and sensitive detection of airborne bacteria, viruses, and toxins is critical for biodefense, yet the diverse nature of the threats poses a challenge for integrated surveillance, as each class of pathogens typically requires different detection strategies. Here, we present a laboratory-on-a-chip microfluidic device (LOC-DLA) that integrates two unique assays for the detection of airborne pathogens: direct linear analysis (DLA) with unsurpassed specificity for bacterial threats and Digital DNA for toxins and viruses. The LOC-DLA device also prepares samples for analysis, incorporating upstream functions for concentrating and fractionating DNA. Both DLA and Digital DNA assays are single molecule detection technologies, therefore the assay sensitivities depend on the throughput of individual molecules. The microfluidic device and its accompanying operation protocols have been heavily optimized to maximize throughput and minimize the loss of analyzable DNA. We present here the design and operation of the LOC-DLA device, demonstrate multiplex detection of rare bacterial targets in the presence of 100-fold excess complex bacterial mixture, and demonstrate detection of picogram quantities of botulinum toxoid.

Analysis of DNA interactions using single-molecule force spectroscopy.

PubMed

Ritzefeld, Markus; Walhorn, Volker; Anselmetti, Dario; Sewald, Norbert

2013-06-01

Protein-DNA interactions are involved in many biochemical pathways and determine the fate of the corresponding cell. Qualitative and quantitative investigations on these recognition and binding processes are of key importance for an improved understanding of biochemical processes and also for systems biology. This review article focusses on atomic force microscopy (AFM)-based single-molecule force spectroscopy and its application to the quantification of forces and binding mechanisms that lead to the formation of protein-DNA complexes. AFM and dynamic force spectroscopy are exciting tools that allow for quantitative analysis of biomolecular interactions. Besides an overview on the method and the most important immobilization approaches, the physical basics of the data evaluation is described. Recent applications of AFM-based force spectroscopy to investigate DNA intercalation, complexes involving DNA aptamers and peptide- and protein-DNA interactions are given.

Beyond sequencing: optical mapping of DNA in the age of nanotechnology and nanoscopy.

PubMed

Levy-Sakin, Michal; Ebenstein, Yuval

2013-08-01

Next generation sequencing (NGS) is revolutionizing all fields of biological research but it fails to extract the full range of information associated with genetic material. Optical mapping of DNA grants access to genetic and epigenetic information on individual DNA molecules up to ∼1 Mbp in length. Fluorescent labeling of specific sequence motifs, epigenetic marks and other genomic information on individual DNA molecules generates a high content optical barcode along the DNA. By stretching the DNA to a linear configuration this barcode may be directly visualized by fluorescence microscopy. We discuss the advances of these methods in light of recent developments in nano-fabrication and super-resolution optical imaging (nanoscopy) and review the latest achievements of optical mapping in the context of genomic analysis. Copyright © 2013 Elsevier Ltd. All rights reserved.

Novel Replication-Competent Circular DNA Molecules from Healthy Cattle Serum and Milk and Multiple Sclerosis-Affected Human Brain Tissue

PubMed Central

Whitley, Corinna; Gunst, Karin; Müller, Hermann; Funk, Mathis; zur Hausen, Harald

2014-01-01

Epidemiological data point to the involvement of a cow milk factor in the etiology of multiple sclerosis (MS). Eleven circular DNA molecules closely related to transmissible spongiform encephalopathy (TSE)-associated isolate Sphinx 1.76 were isolated from healthy cattle serum, cow milk, and serum and brain tissue from MS patients. PMID:25169859

Recombinant HT{sub m4} gene, protein and assays

DOEpatents

Lim, B.; Adra, C.N.; Lelias, J.M.

1996-09-03

The invention relates to a recombinant DNA molecule which encodes a HT{sub m4} protein, a transformed host cell which has been stably transfected with a DNA molecule which encodes a HT{sub m4} protein and a recombinant HT{sub m4} protein. The invention also relates to a method for detecting the presence of a hereditary atopy. 2 figs.

Antibodies specific for HT{sub m4}

DOEpatents

Lim, B.; Adra, C.N.; Lelias, J.M.

1998-01-06

The invention relates to a recombinant DNA molecule which encodes a HT{sub m4} protein, a transformed host cell which has been stably transfected with a DNA molecule which encodes a HT{sub m4} protein and a recombinant HT{sub m4} protein. The invention also relates to a method for detecting the presence of a hereditary atopy. 2 figs.