Efficiency, error and yield in light-directed maskless synthesis of DNA microarrays

PubMed Central

2011-01-01

Background Light-directed in situ synthesis of DNA microarrays using computer-controlled projection from a digital micromirror device--maskless array synthesis (MAS)--has proved to be successful at both commercial and laboratory scales. The chemical synthetic cycle in MAS is quite similar to that of conventional solid-phase synthesis of oligonucleotides, but the complexity of microarrays and unique synthesis kinetics on the glass substrate require a careful tuning of parameters and unique modifications to the synthesis cycle to obtain optimal deprotection and phosphoramidite coupling. In addition, unintended deprotection due to scattering and diffraction introduce insertion errors that contribute significantly to the overall error rate. Results Stepwise phosphoramidite coupling yields have been greatly improved and are now comparable to those obtained in solid phase synthesis of oligonucleotides. Extended chemical exposure in the synthesis of complex, long oligonucleotide arrays result in lower--but still high--final average yields which approach 99%. The new synthesis chemistry includes elimination of the standard oxidation until the final step, and improved coupling and light deprotection. Coupling Insertions due to stray light are the limiting factor in sequence quality for oligonucleotide synthesis for gene assembly. Diffraction and local flare are by far the largest contributors to loss of optical contrast. Conclusions Maskless array synthesis is an efficient and versatile method for synthesizing high density arrays of long oligonucleotides for hybridization- and other molecular binding-based experiments. For applications requiring high sequence purity, such as gene assembly, diffraction and flare remain significant obstacles, but can be significantly reduced with straightforward experimental strategies. PMID:22152062

Universal Oligonucleotide Microarray for Sub-Typing of Influenza A Virus

PubMed Central

Ryabinin, Vladimir A.; Kostina, Elena V.; Maksakova, Galiya A.; Neverov, Alexander A.; Chumakov, Konstantin M.; Sinyakov, Alexander N.

2011-01-01

A universal microchip was developed for genotyping Influenza A viruses. It contains two sets of oligonucleotide probes allowing viruses to be classified by the subtypes of hemagglutinin (H1–H13, H15, H16) and neuraminidase (N1–N9). Additional sets of probes are used to detect H1N1 swine influenza viruses. Selection of probes was done in two steps. Initially, amino acid sequences specific to each subtype were identified, and then the most specific and representative oligonucleotide probes were selected. Overall, between 19 and 24 probes were used to identify each subtype of hemagglutinin (HA) and neuraminidase (NA). Genotyping included preparation of fluorescently labeled PCR amplicons of influenza virus cDNA and their hybridization to microarrays of specific oligonucleotide probes. Out of 40 samples tested, 36 unambiguously identified HA and NA subtypes of Influenza A virus. PMID:21559081

High-density fiber optic biosensor arrays

NASA Astrophysics Data System (ADS)

Epstein, Jason R.; Walt, David R.

2002-02-01

Novel approaches are required to coordinate the immense amounts of information derived from diverse genomes. This concept has influenced the expanded role of high-throughput DNA detection and analysis in the biological sciences. A high-density fiber optic DNA biosensor was developed consisting of oligonucleotide-functionalized, 3.1 mm diameter microspheres deposited into the etched wells on the distal face of a 500 micrometers imaging fiber bundle. Imaging fiber bundles containing thousands of optical fibers, each associated with a unique oligonucleotide probe sequence, were the foundation for an optically connected, individually addressable DNA detection platform. Different oligonucleotide-functionalized microspheres were combined in a stock solution, and randomly dispersed into the etched wells. Microsphere positions were registered from optical dyes incorporated onto the microspheres. The distribution process provided an inherent redundancy that increases the signal-to-noise ratio as the square root of the number of sensors examined. The representative amount of each probe-type in the array was dependent on their initial stock solution concentration, and as other sequences of interest arise, new microsphere elements can be added to arrays without altering the existing detection capabilities. The oligonucleotide probe sequences hybridize to fluorescently-labeled, complementary DNA target solutions. Fiber optic DNA microarray research has included DNA-protein interaction profiles, microbial strain differentiation, non-labeled target interrogation with molecular beacons, and single cell-based assays. This biosensor array is proficient in DNA detection linked to specific disease states, single nucleotide polymorphism (SNP's) discrimination, and gene expression analysis. This array platform permits multiple detection formats, provides smaller feature sizes, and enables sensor design flexibility. High-density fiber optic microarray biosensors provide a fast, reversible format with the detection limit of a few hundred molecules.

Microarray Detection of Duplex and Triplex DNA Binders with DNA-Modified Gold Nanoparticles

PubMed Central

Lytton-Jean, Abigail K. R.; Han, Min Su; Mirkin, Chad A.

2008-01-01

We have designed a chip-based assay, using microarray technology, for determining the relative binding affinities of duplex and triplex DNA binders. This assay combines the high discrimination capabilities afforded by DNA-modified Au nanoparticles with the high-throughput capabilities of DNA microarrays. The detection and screening of duplex DNA binders are important because these molecules, in many cases, are potential anticancer agents as well as toxins. Triplex DNA binders are also promising drug candidates. These molecules, in conjunction with triplex forming oligonucleotides, could potentially be used to achieve control of gene expression by interfering with transcription factors that bind to DNA. Therefore, the ability to screen for these molecules in a high-throughput fashion could dramatically improve the drug screening process. The assay reported here provides excellent discrimination between strong, intermediate, and weak duplex and triplex DNA binders in a high-throughput fashion. PMID:17614366

Development and experimental validation of a 20K Atlantic cod (Gadus morhua) oligonucleotide microarray based on a collection of over 150,000 ESTs.

PubMed

Booman, Marije; Borza, Tudor; Feng, Charles Y; Hori, Tiago S; Higgins, Brent; Culf, Adrian; Léger, Daniel; Chute, Ian C; Belkaid, Anissa; Rise, Marlies; Gamperl, A Kurt; Hubert, Sophie; Kimball, Jennifer; Ouellette, Rodney J; Johnson, Stewart C; Bowman, Sharen; Rise, Matthew L

2011-08-01

The collapse of Atlantic cod (Gadus morhua) wild populations strongly impacted the Atlantic cod fishery and led to the development of cod aquaculture. In order to improve aquaculture and broodstock quality, we need to gain knowledge of genes and pathways involved in Atlantic cod responses to pathogens and other stressors. The Atlantic Cod Genomics and Broodstock Development Project has generated over 150,000 expressed sequence tags from 42 cDNA libraries representing various tissues, developmental stages, and stimuli. We used this resource to develop an Atlantic cod oligonucleotide microarray containing 20,000 unique probes. Selection of sequences from the full range of cDNA libraries enables application of the microarray for a broad spectrum of Atlantic cod functional genomics studies. We included sequences that were highly abundant in suppression subtractive hybridization (SSH) libraries, which were enriched for transcripts responsive to pathogens or other stressors. These sequences represent genes that potentially play an important role in stress and/or immune responses, making the microarray particularly useful for studies of Atlantic cod gene expression responses to immune stimuli and other stressors. To demonstrate its value, we used the microarray to analyze the Atlantic cod spleen response to stimulation with formalin-killed, atypical Aeromonas salmonicida, resulting in a gene expression profile that indicates a strong innate immune response. These results were further validated by quantitative PCR analysis and comparison to results from previous analysis of an SSH library. This study shows that the Atlantic cod 20K oligonucleotide microarray is a valuable new tool for Atlantic cod functional genomics research.

[Research progress of probe design software of oligonucleotide microarrays].

PubMed

Chen, Xi; Wu, Zaoquan; Liu, Zhengchun

2014-02-01

DNA microarray has become an essential medical genetic diagnostic tool for its high-throughput, miniaturization and automation. The design and selection of oligonucleotide probes are critical for preparing gene chips with high quality. Several sets of probe design software have been developed and are available to perform this work now. Every set of the software aims to different target sequences and shows different advantages and limitations. In this article, the research and development of these sets of software are reviewed in line with three main criteria, including specificity, sensitivity and melting temperature (Tm). In addition, based on the experimental results from literatures, these sets of software are classified according to their applications. This review will be helpful for users to choose an appropriate probe-design software. It will also reduce the costs of microarrays, improve the application efficiency of microarrays, and promote both the research and development (R&D) and commercialization of high-performance probe design software.

Microarray-Based Mapping for the Detection of Molecular Markers in Response to Aspergillus flavus Infection in Susceptible and Resistant Maize Lines

USDA-ARS?s Scientific Manuscript database

The objectives of this study were (1) to evaluate differential gene expression levels for resistance to A. flavus kernel infection in susceptible (Va35) and resistant (Mp313E) maize lines using Oligonucleotide and cDNA microarray analysis, (2) to evaluate differences in A. flavus accumulation betwee...

Extending Immunological Profiling in the Gilthead Sea Bream, Sparus aurata, by Enriched cDNA Library Analysis, Microarray Design and Initial Studies upon the Inflammatory Response to PAMPs.

PubMed

Boltaña, Sebastian; Castellana, Barbara; Goetz, Giles; Tort, Lluis; Teles, Mariana; Mulero, Victor; Novoa, Beatriz; Figueras, Antonio; Goetz, Frederick W; Gallardo-Escarate, Cristian; Planas, Josep V; Mackenzie, Simon

2017-02-03

This study describes the development and validation of an enriched oligonucleotide-microarray platform for Sparus aurata (SAQ) to provide a platform for transcriptomic studies in this species. A transcriptome database was constructed by assembly of gilthead sea bream sequences derived from public repositories of mRNA together with reads from a large collection of expressed sequence tags (EST) from two extensive targeted cDNA libraries characterizing mRNA transcripts regulated by both bacterial and viral challenge. The developed microarray was further validated by analysing monocyte/macrophage activation profiles after challenge with two Gram-negative bacterial pathogen-associated molecular patterns (PAMPs; lipopolysaccharide (LPS) and peptidoglycan (PGN)). Of the approximately 10,000 EST sequenced, we obtained a total of 6837 EST longer than 100 nt, with 3778 and 3059 EST obtained from the bacterial-primed and from the viral-primed cDNA libraries, respectively. Functional classification of contigs from the bacterial- and viral-primed cDNA libraries by Gene Ontology (GO) showed that the top five represented categories were equally represented in the two libraries: metabolism (approximately 24% of the total number of contigs), carrier proteins/membrane transport (approximately 15%), effectors/modulators and cell communication (approximately 11%), nucleoside, nucleotide and nucleic acid metabolism (approximately 7.5%) and intracellular transducers/signal transduction (approximately 5%). Transcriptome analyses using this enriched oligonucleotide platform identified differential shifts in the response to PGN and LPS in macrophage-like cells, highlighting responsive gene-cassettes tightly related to PAMP host recognition. As observed in other fish species, PGN is a powerful activator of the inflammatory response in S. aurata macrophage-like cells. We have developed and validated an oligonucleotide microarray (SAQ) that provides a platform enriched for the study of gene expression in S. aurata with an emphasis upon immunity and the immune response.

High-density, microsphere-based fiber optic DNA microarrays.

PubMed

Epstein, Jason R; Leung, Amy P K; Lee, Kyong Hoon; Walt, David R

2003-05-01

A high-density fiber optic DNA microarray has been developed consisting of oligonucleotide-functionalized, 3.1-microm-diameter microspheres randomly distributed on the etched face of an imaging fiber bundle. The fiber bundles are comprised of 6000-50000 fused optical fibers and each fiber terminates with an etched well. The microwell array is capable of housing complementary-sized microspheres, each containing thousands of copies of a unique oligonucleotide probe sequence. The array fabrication process results in random microsphere placement. Determining the position of microspheres in the random array requires an optical encoding scheme. This array platform provides many advantages over other array formats. The microsphere-stock suspension concentration added to the etched fiber can be controlled to provide inherent sensor redundancy. Examining identical microspheres has a beneficial effect on the signal-to-noise ratio. As other sequences of interest are discovered, new microsphere sensing elements can be added to existing microsphere pools and new arrays can be fabricated incorporating the new sequences without altering the existing detection capabilities. These microarrays contain the smallest feature sizes (3 microm) of any DNA array, allowing interrogation of extremely small sample volumes. Reducing the feature size results in higher local target molecule concentrations, creating rapid and highly sensitive assays. The microsphere array platform is also flexible in its applications; research has included DNA-protein interaction profiles, microbial strain differentiation, and non-labeled target interrogation with molecular beacons. Fiber optic microsphere-based DNA microarrays have a simple fabrication protocol enabling their expansion into other applications, such as single cell-based assays.

The illusion of specific capture: surface and solution studies of suboptimal oligonucleotide hybridization

PubMed Central

2013-01-01

Background Hybridization based assays and capture systems depend on the specificity of hybridization between a probe and its intended target. A common guideline in the construction of DNA microarrays, for instance, is that avoiding complementary stretches of more than 15 nucleic acids in a 50 or 60-mer probe will eliminate sequence specific cross-hybridization reactions. Here we present a study of the behavior of partially matched oligonucleotide pairs with complementary stretches starting well below this threshold complementarity length – in silico, in solution, and at the microarray surface. The modeled behavior of pairs of oligonucleotide probes and their targets suggests that even a complementary stretch of sequence 12 nt in length would give rise to specific cross-hybridization. We designed a set of binding partners to a 50-mer oligonucleotide containing complementary stretches from 6 nt to 21 nt in length. Results Solution melting experiments demonstrate that stable partial duplexes can form when only 12 bp of complementary sequence are present; surface hybridization experiments confirm that a signal close in magnitude to full-strength signal can be obtained from hybridization of a 12 bp duplex within a 50mer oligonucleotide. Conclusions Microarray and other molecular capture strategies that rely on a 15 nt lower complementarity bound for eliminating specific cross-hybridization may not be sufficiently conservative. PMID:23445545

Methylation oligonucleotide microarray: a novel tool to analyze methylation patterns

NASA Astrophysics Data System (ADS)

Hou, Peng; Ji, Meiju; He, Nongyao; Lu, Zuhong

2003-04-01

A new technique to analyze methylation patterns in several adjacent CpG sites was developed and reported here. We selected a 336bp segment of the 5"-untranslated region and the first exon of the p16Ink4a gene, which include the most densely packed CpG fragment of the islands containing 32 CpG dinucleotides, as the investigated target. The probes that include all types of methylation patterns were designed to fabricate a DNA microarray to determine the methylation patterns of seven adjacent CpG dinucleotides sites. High accuracy and reproducibility were observed in several parallel experiments. The results led us to the conclusion that the methylation oligonucleotide microarray can be applied as a novel and powerful tool to map methylation patterns and changes in multiple CpG island loci in a variety of tumors.

Oligonucleotide Microarray for 16S rRNA Gene-Based Detection of All Recognized Lineages of Sulfate-Reducing Prokaryotes in the Environment

PubMed Central

Loy, Alexander; Lehner, Angelika; Lee, Natuschka; Adamczyk, Justyna; Meier, Harald; Ernst, Jens; Schleifer, Karl-Heinz; Wagner, Michael

2002-01-01

For cultivation-independent detection of sulfate-reducing prokaryotes (SRPs) an oligonucleotide microarray consisting of 132 16S rRNA gene-targeted oligonucleotide probes (18-mers) having hierarchical and parallel (identical) specificity for the detection of all known lineages of sulfate-reducing prokaryotes (SRP-PhyloChip) was designed and subsequently evaluated with 41 suitable pure cultures of SRPs. The applicability of SRP-PhyloChip for diversity screening of SRPs in environmental and clinical samples was tested by using samples from periodontal tooth pockets and from the chemocline of a hypersaline cyanobacterial mat from Solar Lake (Sinai, Egypt). Consistent with previous studies, SRP-PhyloChip indicated the occurrence of Desulfomicrobium spp. in the tooth pockets and the presence of Desulfonema- and Desulfomonile-like SRPs (together with other SRPs) in the chemocline of the mat. The SRP-PhyloChip results were confirmed by several DNA microarray-independent techniques, including specific PCR amplification, cloning, and sequencing of SRP 16S rRNA genes and the genes encoding the dissimilatory (bi)sulfite reductase (dsrAB). PMID:12324358

Structured oligonucleotides for target indexing to allow single-vessel PCR amplification and solid support microarray hybridization

PubMed Central

Girard, Laurie D.; Boissinot, Karel; Peytavi, Régis; Boissinot, Maurice; Bergeron, Michel G.

2014-01-01

The combination of molecular diagnostic technologies is increasingly used to overcome limitations on sensitivity, specificity or multiplexing capabilities, and provide efficient lab-on-chip devices. Two such techniques, PCR amplification and microarray hybridization are used serially to take advantage of the high sensitivity and specificity of the former combined with high multiplexing capacities of the latter. These methods are usually performed in different buffers and reaction chambers. However, these elaborate methods have a high complexity cost related to reagent requirements, liquid storage and the number of reaction chambers to integrate into automated devices. Furthermore, microarray hybridizations have a sequence dependent efficiency not always predictable. In this work, we have developed the concept of a structured oligonucleotide probe which is activated by cleavage from polymerase exonuclease activity. This technology is called SCISSOHR for Structured Cleavage Induced Single-Stranded Oligonucleotide Hybridization Reaction. The SCISSOHR probes enable indexing the target sequence to a tag sequence. The SCISSOHR technology also allows the combination of nucleic acid amplification and microarray hybridization in a single vessel in presence of the PCR buffer only. The SCISSOHR technology uses an amplification probe that is irreversibly modified in presence of the target, releasing a single-stranded DNA tag for microarray hybridization. Each tag is composed of a 3-nucleotidesequence-dependent segment and a unique “target sequence-independent” 14-nucleotide segment allowing for optimal hybridization with minimal cross-hybridization. We evaluated the performance of five (5) PCR buffers to support microarray hybridization, compared to a conventional hybridization buffer. Finally, as a proof of concept, we developed a multiplexed assay for the amplification, detection, and identification of three (3) DNA targets. This new technology will facilitate the design of lab-on-chip microfluidic devices, while also reducing consumable costs. At term, it will allow the cost-effective automation of highly multiplexed assays for detection and identification of genetic targets. PMID:25489607

Structured oligonucleotides for target indexing to allow single-vessel PCR amplification and solid support microarray hybridization.

PubMed

Girard, Laurie D; Boissinot, Karel; Peytavi, Régis; Boissinot, Maurice; Bergeron, Michel G

2015-02-07

The combination of molecular diagnostic technologies is increasingly used to overcome limitations on sensitivity, specificity or multiplexing capabilities, and provide efficient lab-on-chip devices. Two such techniques, PCR amplification and microarray hybridization are used serially to take advantage of the high sensitivity and specificity of the former combined with high multiplexing capacities of the latter. These methods are usually performed in different buffers and reaction chambers. However, these elaborate methods have high complexity and cost related to reagent requirements, liquid storage and the number of reaction chambers to integrate into automated devices. Furthermore, microarray hybridizations have a sequence dependent efficiency not always predictable. In this work, we have developed the concept of a structured oligonucleotide probe which is activated by cleavage from polymerase exonuclease activity. This technology is called SCISSOHR for Structured Cleavage Induced Single-Stranded Oligonucleotide Hybridization Reaction. The SCISSOHR probes enable indexing the target sequence to a tag sequence. The SCISSOHR technology also allows the combination of nucleic acid amplification and microarray hybridization in a single vessel in presence of the PCR buffer only. The SCISSOHR technology uses an amplification probe that is irreversibly modified in presence of the target, releasing a single-stranded DNA tag for microarray hybridization. Each tag is composed of a 3-nucleotide sequence-dependent segment and a unique "target sequence-independent" 14-nucleotide segment allowing for optimal hybridization with minimal cross-hybridization. We evaluated the performance of five (5) PCR buffers to support microarray hybridization, compared to a conventional hybridization buffer. Finally, as a proof of concept, we developed a multiplexed assay for the amplification, detection, and identification of three (3) DNA targets. This new technology will facilitate the design of lab-on-chip microfluidic devices, while also reducing consumable costs. At term, it will allow the cost-effective automation of highly multiplexed assays for detection and identification of genetic targets.

DNA microarrays for identifying fishes.

PubMed

Kochzius, M; Nölte, M; Weber, H; Silkenbeumer, N; Hjörleifsdottir, S; Hreggvidsson, G O; Marteinsson, V; Kappel, K; Planes, S; Tinti, F; Magoulas, A; Garcia Vazquez, E; Turan, C; Hervet, C; Campo Falgueras, D; Antoniou, A; Landi, M; Blohm, D

2008-01-01

In many cases marine organisms and especially their diverse developmental stages are difficult to identify by morphological characters. DNA-based identification methods offer an analytically powerful addition or even an alternative. In this study, a DNA microarray has been developed to be able to investigate its potential as a tool for the identification of fish species from European seas based on mitochondrial 16S rDNA sequences. Eleven commercially important fish species were selected for a first prototype. Oligonucleotide probes were designed based on the 16S rDNA sequences obtained from 230 individuals of 27 fish species. In addition, more than 1200 sequences of 380 species served as sequence background against which the specificity of the probes was tested in silico. Single target hybridisations with Cy5-labelled, PCR-amplified 16S rDNA fragments from each of the 11 species on microarrays containing the complete set of probes confirmed their suitability. True-positive, fluorescence signals obtained were at least one order of magnitude stronger than false-positive cross-hybridisations. Single nontarget hybridisations resulted in cross-hybridisation signals at approximately 27% of the cases tested, but all of them were at least one order of magnitude lower than true-positive signals. This study demonstrates that the 16S rDNA gene is suitable for designing oligonucleotide probes, which can be used to differentiate 11 fish species. These data are a solid basis for the second step to create a "Fish Chip" for approximately 50 fish species relevant in marine environmental and fisheries research, as well as control of fisheries products.

High density DNA loading on the M13 bacteriophage provides access to colorimetric and fluorescent protein microarray biosensors.

PubMed

Domaille, Dylan W; Lee, Ju Hun; Cha, Jennifer N

2013-02-28

We report the synthesis, characterization, and protein sensing capabilities of M13 bacteriophage-DNA bioconjugates. DNA oligonucleotides were conjugated to M13 through acyl hydrazone linkages. In one case, DNAzymes retained their catalytic ability when anchored to the virus coat, and in a separate study, the dynamic nature of the hydrazone allowed for liberation of DNA from the phage under mild conditions.

An oligonucleotide microarray to characterize multidrug resistant plasmids

USDA-ARS?s Scientific Manuscript database

Bacteria plasmids are fragments of extra-chromosomal double stranded deoxyribonucleic acid (DNA) that can contain a variety of genes beneficial to the host organism like antibiotic drug resistance. Many of the Enterobacteriaceae carry multiple drug resistance (MDR) genes on large plasmids of replic...

Multiple primer extension by DNA polymerase on a novel plastic DNA array coated with a biocompatible polymer

PubMed Central

Kinoshita, Kenji; Fujimoto, Kentaro; Yakabe, Toru; Saito, Shin; Hamaguchi, Yuzo; Kikuchi, Takayuki; Nonaka, Ken; Murata, Shigenori; Masuda, Daisuke; Takada, Wataru; Funaoka, Sohei; Arai, Susumu; Nakanishi, Hisao; Yokoyama, Kanehisa; Fujiwara, Kazuhiko; Matsubara, Kenichi

2007-01-01

DNA microarrays are routinely used to monitor gene expression profiling and single nucleotide polymorphisms (SNPs). However, for practically useful high performance, the detection sensitivity is still not adequate, leaving low expression genes undetected. To resolve this issue, we have developed a new plastic S-BIO® PrimeSurface® with a biocompatible polymer; its surface chemistry offers an extraordinarily stable thermal property for a lack of pre-activated glass slide surface. The oligonucleotides immobilized on this substrate are robust in boiling water and show no significant loss of hybridization activity during dissociation treatment. This allowed us to hybridize the templates, extend the 3′ end of the immobilized DNA primers on the S-Bio® by DNA polymerase using deoxynucleotidyl triphosphates (dNTP) as extender units, release the templates by denaturalization and use the same templates for a second round of reactions similar to that of the PCR method. By repeating this cycle, the picomolar concentration range of the template oligonucleotide can be detected as stable signals via the incorporation of labeled dUTP into primers. This method of Multiple Primer EXtension (MPEX) could be further extended as an alternative route for producing DNA microarrays for SNP analyses via simple template preparation such as reverse transcript cDNA or restriction enzyme treatment of genome DNA. PMID:17135189

EvOligo: A Novel Software to Design and Group Libraries of Oligonucleotides Applicable for Nucleic Acid-Based Experiments.

PubMed

Milewski, Marek C; Kamel, Karol; Kurzynska-Kokorniak, Anna; Chmielewski, Marcin K; Figlerowicz, Marek

2017-10-01

Experimental methods based on DNA and RNA hybridization, such as multiplex polymerase chain reaction, multiplex ligation-dependent probe amplification, or microarray analysis, require the use of mixtures of multiple oligonucleotides (primers or probes) in a single test tube. To provide an optimal reaction environment, minimal self- and cross-hybridization must be achieved among these oligonucleotides. To address this problem, we developed EvOligo, which is a software package that provides the means to design and group DNA and RNA molecules with defined lengths. EvOligo combines two modules. The first module performs oligonucleotide design, and the second module performs oligonucleotide grouping. The software applies a nearest-neighbor model of nucleic acid interactions coupled with a parallel evolutionary algorithm to construct individual oligonucleotides, and to group the molecules that are characterized by the weakest possible cross-interactions. To provide optimal solutions, the evolutionary algorithm sorts oligonucleotides into sets, preserves preselected parts of the oligonucleotides, and shapes their remaining parts. In addition, the oligonucleotide sets can be designed and grouped based on their melting temperatures. For the user's convenience, EvOligo is provided with a user-friendly graphical interface. EvOligo was used to design individual oligonucleotides, oligonucleotide pairs, and groups of oligonucleotide pairs that are characterized by the following parameters: (1) weaker cross-interactions between the non-complementary oligonucleotides and (2) more uniform ranges of the oligonucleotide pair melting temperatures than other available software products. In addition, in contrast to other grouping algorithms, EvOligo offers time-efficient sorting of paired and unpaired oligonucleotides based on various parameters defined by the user.

Nucleic acid sequence detection using multiplexed oligonucleotide PCR

DOEpatents

Nolan, John P [Santa Fe, NM; White, P Scott [Los Alamos, NM

2006-12-26

Methods for rapidly detecting single or multiple sequence alleles in a sample nucleic acid are described. Provided are all of the oligonucleotide pairs capable of annealing specifically to a target allele and discriminating among possible sequences thereof, and ligating to each other to form an oligonucleotide complex when a particular sequence feature is present (or, alternatively, absent) in the sample nucleic acid. The design of each oligonucleotide pair permits the subsequent high-level PCR amplification of a specific amplicon when the oligonucleotide complex is formed, but not when the oligonucleotide complex is not formed. The presence or absence of the specific amplicon is used to detect the allele. Detection of the specific amplicon may be achieved using a variety of methods well known in the art, including without limitation, oligonucleotide capture onto DNA chips or microarrays, oligonucleotide capture onto beads or microspheres, electrophoresis, and mass spectrometry. Various labels and address-capture tags may be employed in the amplicon detection step of multiplexed assays, as further described herein.

Spotting and validation of a genome wide oligonucleotide chip with duplicate measurement of each gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thomassen, Mads; Skov, Vibe; Eiriksdottir, Freyja

2006-06-16

The quality of DNA microarray based gene expression data relies on the reproducibility of several steps in a microarray experiment. We have developed a spotted genome wide microarray chip with oligonucleotides printed in duplicate in order to minimise undesirable biases, thereby optimising detection of true differential expression. The validation study design consisted of an assessment of the microarray chip performance using the MessageAmp and FairPlay labelling kits. Intraclass correlation coefficient (ICC) was used to demonstrate that MessageAmp was significantly more reproducible than FairPlay. Further examinations with MessageAmp revealed the applicability of the system. The linear range of the chips wasmore » three orders of magnitude, the precision was high, as 95% of measurements deviated less than 1.24-fold from the expected value, and the coefficient of variation for relative expression was 13.6%. Relative quantitation was more reproducible than absolute quantitation and substantial reduction of variance was attained with duplicate spotting. An analysis of variance (ANOVA) demonstrated no significant day-to-day variation.« less

SINGLE-BASE-PAIR MISMATCH DISCRIMINATION USING OLIGONUCLEOTIDE DNA MICROARRAYS AND MELTING PROFILES. (R829458C004)

EPA Science Inventory

The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

Oligonucleotide microarray for the identification of potential mycotoxigenic fungi

PubMed Central

2010-01-01

Background Mycotoxins are secondary metabolites which are produced by numerous fungi and pose a continuous challenge to the safety and quality of food commodities in South Africa. These toxins have toxicologically relevant effects on humans and animals that eat contaminated foods. In this study, a diagnostic DNA microarray was developed for the identification of the most common food-borne fungi, as well as the genes leading to toxin production. Results A total of 40 potentially mycotoxigenic fungi isolated from different food commodities, as well as the genes that are involved in the mycotoxin synthetic pathways, were analyzed. For fungal identification, oligonucleotide probes were designed by exploiting the sequence variations of the elongation factor 1-alpha (EF-1 α) coding regions and the internal transcribed spacer (ITS) regions of the rRNA gene cassette. For the detection of fungi able to produce mycotoxins, oligonucleotide probes directed towards genes leading to toxin production from different fungal strains were identified in data available in the public domain. The probes selected for fungal identification and the probes specific for toxin producing genes were spotted onto microarray slides. Conclusions The diagnostic microarray developed can be used to identify single pure strains or cultures of potentially mycotoxigenic fungi as well as genes leading to toxin production in both laboratory samples and maize-derived foods offering an interesting potential for microbiological laboratories. PMID:20307326

DNA Microarray for Detection of Macrolide Resistance Genes

PubMed Central

Cassone, Marco; D'Andrea, Marco M.; Iannelli, Francesco; Oggioni, Marco R.; Rossolini, Gian Maria; Pozzi, Gianni

2006-01-01

A DNA microarray was developed to detect bacterial genes conferring resistance to macrolides and related antibiotics. A database containing 65 nonredundant genes selected from publicly available DNA sequences was constructed and used to design 100 oligonucleotide probes that could specifically detect and discriminate all 65 genes. Probes were spotted on a glass slide, and the array was reacted with DNA templates extracted from 20 reference strains of eight different bacterial species (Streptococcus pneumoniae, Streptococcus pyogenes, Enterococcus faecalis, Enterococcus faecium, Staphylococcus aureus, Staphylococcus haemolyticus, Escherichia coli, and Bacteroides fragilis) known to harbor 29 different macrolide resistance genes. Hybridization results showed that probes reacted with, and only with, the expected DNA templates and allowed discovery of three unexpected genes, including msr(SA) in B. fragilis, an efflux gene that has not yet been described for gram-negative bacteria. PMID:16723563

Single molecule fluorescence microscopy for ultra-sensitive RNA expression profiling

NASA Astrophysics Data System (ADS)

Hesse, Jan; Jacak, Jaroslaw; Regl, Gerhard; Eichberger, Thomas; Aberger, Fritz; Schlapak, Robert; Howorka, Stefan; Muresan, Leila; Frischauf, Anna-Maria; Schütz, Gerhard J.

2007-02-01

We developed a microarray analysis platform for ultra-sensitive RNA expression profiling of minute samples. It utilizes a novel scanning system for single molecule fluorescence detection on cm2 size samples in combination with specialized biochips, optimized for low autofluorescence and weak unspecific adsorption. 20 μg total RNA was extracted from 10 6 cells of a human keratinocyte cell line (HaCaT) and reversely transcribed in the presence of Alexa647-aha-dUTP. 1% of the resulting labeled cDNA was used for complex hybridization to a custom-made oligonucleotide microarray representing a set of 125 different genes. For low abundant genes, individual cDNA molecules hybridized to the microarray spots could be resolved. Single cDNA molecules hybridized to the chip surface appeared as diffraction limited features in the fluorescence images. The à trous wavelet method was utilized for localization and counting of the separated cDNA signals. Subsequently, the degree of labeling of the localized cDNA molecules was determined by brightness analysis for the different genes. Variations by factors up to 6 were found, which in conventional microarray analysis would result in a misrepresentation of the relative abundance of mRNAs.

Mapping of transcription factor binding regions in mammalian cells by ChIP: Comparison of array- and sequencing-based technologies

PubMed Central

Euskirchen, Ghia M.; Rozowsky, Joel S.; Wei, Chia-Lin; Lee, Wah Heng; Zhang, Zhengdong D.; Hartman, Stephen; Emanuelsson, Olof; Stolc, Viktor; Weissman, Sherman; Gerstein, Mark B.; Ruan, Yijun; Snyder, Michael

2007-01-01

Recent progress in mapping transcription factor (TF) binding regions can largely be credited to chromatin immunoprecipitation (ChIP) technologies. We compared strategies for mapping TF binding regions in mammalian cells using two different ChIP schemes: ChIP with DNA microarray analysis (ChIP-chip) and ChIP with DNA sequencing (ChIP-PET). We first investigated parameters central to obtaining robust ChIP-chip data sets by analyzing STAT1 targets in the ENCODE regions of the human genome, and then compared ChIP-chip to ChIP-PET. We devised methods for scoring and comparing results among various tiling arrays and examined parameters such as DNA microarray format, oligonucleotide length, hybridization conditions, and the use of competitor Cot-1 DNA. The best performance was achieved with high-density oligonucleotide arrays, oligonucleotides ≥50 bases (b), the presence of competitor Cot-1 DNA and hybridizations conducted in microfluidics stations. When target identification was evaluated as a function of array number, 80%–86% of targets were identified with three or more arrays. Comparison of ChIP-chip with ChIP-PET revealed strong agreement for the highest ranked targets with less overlap for the low ranked targets. With advantages and disadvantages unique to each approach, we found that ChIP-chip and ChIP-PET are frequently complementary in their relative abilities to detect STAT1 targets for the lower ranked targets; each method detected validated targets that were missed by the other method. The most comprehensive list of STAT1 binding regions is obtained by merging results from ChIP-chip and ChIP-sequencing. Overall, this study provides information for robust identification, scoring, and validation of TF targets using ChIP-based technologies. PMID:17568005

Microarray Genomic Systems Development

DTIC Science & Technology

2008-06-01

11 species), Escherichia coli TOP10 (7 strains), and Geobacillus stearothermophilus . Using standard molecular biology methods, we isolated genomic...comparisons. Results: Different species of bacteria, including Escherichia coli, Bacillus bacteria, and Geobacillus stearothermophilus produce qualitatively...oligonucleotides to labelled genomic DNA from a set of test samples, including eleven Bacillus species, Geobacillus stearothermophilus , and seven Escherichia

Transcriptome analysis of salinity stress responses in common wheat using a 22k oligo-DNA microarray.

PubMed

Kawaura, Kanako; Mochida, Keiichi; Yamazaki, Yukiko; Ogihara, Yasunari

2006-04-01

In this study, we constructed a 22k wheat oligo-DNA microarray. A total of 148,676 expressed sequence tags of common wheat were collected from the database of the Wheat Genomics Consortium of Japan. These were grouped into 34,064 contigs, which were then used to design an oligonucleotide DNA microarray. Following a multistep selection of the sense strand, 21,939 60-mer oligo-DNA probes were selected for attachment on the microarray slide. This 22k oligo-DNA microarray was used to examine the transcriptional response of wheat to salt stress. More than 95% of the probes gave reproducible hybridization signals when targeted with RNAs extracted from salt-treated wheat shoots and roots. With the microarray, we identified 1,811 genes whose expressions changed more than 2-fold in response to salt. These included genes known to mediate response to salt, as well as unknown genes, and they were classified into 12 major groups by hierarchical clustering. These gene expression patterns were also confirmed by real-time reverse transcription-PCR. Many of the genes with unknown function were clustered together with genes known to be involved in response to salt stress. Thus, analysis of gene expression patterns combined with gene ontology should help identify the function of the unknown genes. Also, functional analysis of these wheat genes should provide new insight into the response to salt stress. Finally, these results indicate that the 22k oligo-DNA microarray is a reliable method for monitoring global gene expression patterns in wheat.

GermOnline 4.0 is a genomics gateway for germline development, meiosis and the mitotic cell cycle.

PubMed

Lardenois, Aurélie; Gattiker, Alexandre; Collin, Olivier; Chalmel, Frédéric; Primig, Michael

2010-01-01

GermOnline 4.0 is a cross-species database portal focusing on high-throughput expression data relevant for germline development, the meiotic cell cycle and mitosis in healthy versus malignant cells. It is thus a source of information for life scientists as well as clinicians who are interested in gene expression and regulatory networks. The GermOnline gateway provides unlimited access to information produced with high-density oligonucleotide microarrays (3'-UTR GeneChips), genome-wide protein-DNA binding assays and protein-protein interaction studies in the context of Ensembl genome annotation. Samples used to produce high-throughput expression data and to carry out genome-wide in vivo DNA binding assays are annotated via the MIAME-compliant Multiomics Information Management and Annotation System (MIMAS 3.0). Furthermore, the Saccharomyces Genomics Viewer (SGV) was developed and integrated into the gateway. SGV is a visualization tool that outputs genome annotation and DNA-strand specific expression data produced with high-density oligonucleotide tiling microarrays (Sc_tlg GeneChips) which cover the complete budding yeast genome on both DNA strands. It facilitates the interpretation of expression levels and transcript structures determined for various cell types cultured under different growth and differentiation conditions. Database URL: www.germonline.org/

GermOnline 4.0 is a genomics gateway for germline development, meiosis and the mitotic cell cycle

PubMed Central

Lardenois, Aurélie; Gattiker, Alexandre; Collin, Olivier; Chalmel, Frédéric; Primig, Michael

2010-01-01

GermOnline 4.0 is a cross-species database portal focusing on high-throughput expression data relevant for germline development, the meiotic cell cycle and mitosis in healthy versus malignant cells. It is thus a source of information for life scientists as well as clinicians who are interested in gene expression and regulatory networks. The GermOnline gateway provides unlimited access to information produced with high-density oligonucleotide microarrays (3′-UTR GeneChips), genome-wide protein–DNA binding assays and protein–protein interaction studies in the context of Ensembl genome annotation. Samples used to produce high-throughput expression data and to carry out genome-wide in vivo DNA binding assays are annotated via the MIAME-compliant Multiomics Information Management and Annotation System (MIMAS 3.0). Furthermore, the Saccharomyces Genomics Viewer (SGV) was developed and integrated into the gateway. SGV is a visualization tool that outputs genome annotation and DNA-strand specific expression data produced with high-density oligonucleotide tiling microarrays (Sc_tlg GeneChips) which cover the complete budding yeast genome on both DNA strands. It facilitates the interpretation of expression levels and transcript structures determined for various cell types cultured under different growth and differentiation conditions. Database URL: www.germonline.org/ PMID:21149299

Dendrimeric coating of glass slides for sensitive DNA microarrays analysis

PubMed Central

Le Berre, Véronique; Trévisiol, Emmanuelle; Dagkessamanskaia, Adilia; Sokol, Serguei; Caminade, Anne-Marie; Majoral, Jean Pierre; Meunier, Bernard; François, Jean

2003-01-01

Successful use and reliability of microarray technology is highly dependent on several factors, including surface chemistry parameters and accessibility of cDNA targets to the DNA probes fixed onto the surface. Here, we show that functionalisation of glass slides with homemade dendrimers allow production of more sensitive and reliable DNA microarrays. The dendrimers are nanometric structures of size-controlled diameter with aldehyde function at their periphery. Covalent attachment of these spherical reactive chemical structures on amino-silanised glass slides generates a reactive ∼100 Å layer onto which amino-modified DNA probes are covalently bound. This new grafting chemistry leads to the formation of uniform and homogenous spots. More over, probe concentration before spotting could be reduced from 0.2 to 0.02 mg/ml with PCR products and from 20 to 5 µM with 70mer oligonucleotides without affecting signal intensities after hybridisation with Cy3- and Cy5-labelled targets. More interestingly, while the binding capacity of captured probes on dendrimer-activated glass surface (named dendrislides) is roughly similar to other functionalised glass slides from commercial sources, detection sensitivity was 2-fold higher than with other available DNA microarrays. This detection limit was estimated to 0.1 pM of cDNA targets. Altogether, these features make dendrimer-activated slides ideal for manufacturing cost-effective DNA arrays applicable for gene expression and detection of mutations. PMID:12907740

PRACTICAL STRATEGIES FOR PROCESSING AND ANALYZING SPOTTED OLIGONUCLEOTIDE MICROARRAY DATA

EPA Science Inventory

Thoughtful data analysis is as important as experimental design, biological sample quality, and appropriate experimental procedures for making microarrays a useful supplement to traditional toxicology. In the present study, spotted oligonucleotide microarrays were used to profile...

A DNA microarray for identification of selected Korean birds based on mitochondrial cytochrome c oxidase I gene sequences.

PubMed

Chung, In-Hyuk; Yoo, Hye Sook; Eah, Jae-Yong; Yoon, Hyun-Kyu; Jung, Jin-Wook; Hwang, Seung Yong; Kim, Chang-Bae

2010-10-01

DNA barcoding with the gene encoding cytochrome c oxidase I (COI) in the mitochondrial genome has been proposed as a standard marker to identify and discover animal species. Some migratory wild birds are suspected of transmitting avian influenza and pose a threat to aircraft safety because of bird strikes. We have previously reported the COI gene sequences of 92 Korean bird species. In the present study, we developed a DNA microarray to identify 17 selected bird species on the basis of nucleotide diversity. We designed and synthesized 19 specific oligonucleotide probes; these probes were arrayed on a silylated glass slide. The length of the probes was 19-24 bps. The COI sequences amplified from the tissues of the selected birds were labeled with a fluorescent probe for microarray hybridization, and unique hybridization patterns were detected for each selected species. These patterns may be considered diagnostic patterns for species identification. This microarray system will provide a sensitive and a high-throughput method for identification of Korean birds.

Analysis of large-scale gene expression data.

PubMed

Sherlock, G

2000-04-01

The advent of cDNA and oligonucleotide microarray technologies has led to a paradigm shift in biological investigation, such that the bottleneck in research is shifting from data generation to data analysis. Hierarchical clustering, divisive clustering, self-organizing maps and k-means clustering have all been recently used to make sense of this mass of data.

Application of HLA-DRB1 genotyping by oligonucleotide micro-array technology in forensic medicine.

PubMed

Jiang, Bin; Li, Yao; Wu, Hai; He, Xianmin; Li, Chengtao; Li, Li; Tang, Rong; Xie, Yi; Mao, Yumin

2006-10-16

The human leukocyte antigen (HLA) system is known to be the most complex polymorphic system in the human genome. Among all of the HLA loci, HLA-DRB1 has the second largest number of alleles. The purpose of this study is to develop an oligonucleotide micro-array based HLA-DRB1 typing system for use in forensic identification, anthropology, tissue transplantation, and other genetic research fields. The system was developed by analyzing the HLA-DRB1 (DRB1) genotypes in 1198 unrelated healthy Chinese Han individuals originating from various parts of China and residing in Shanghai, China. Polymerase chain reaction (PCR) coupled with the oligonucleotide micro-array technology was used to detect and type HLA-DRB1 alleles of the sample individuals. The reliability, sensitivity, consistency and specificity were evaluated for use in forensic identification. Furthermore, a meta-analysis was carried out by comparing the allele frequencies of the HLA-DRB1 locus with those of other Chinese Han groups, Chinese minorities and other ethnic populations. All the DNA samples yielded a 273 bp amplification product, with no other amplification products in this length range. The minimum quantity of DNA detected by this method is 15 ng in a PCR reaction system of 25 microl. The population studied appeared to be not in Hardy-Weinberg equilibrium. Observed heterozygosity (Ho), expected heterozygosity (He), expected probability of exclusion (PE), polymorphic information content (PIC), and discrimination power (DP) of the HLA-DRB1 locus from the Shanghai Han ethnic group were evaluated to be 0.8022, 0.8870, 0.7741, 0.8771, 0.9750, respectively. A total of 25 HLA-DRB1 alleles were identified. HLA-DRB1*09XX, *04XX, *12XX and *15XX were the most frequent DRB1 alleles, which were observed in 58.76% of the sample. One hundred and sixteen genotypes were found. The five most frequent genotypes were: *04XX/*04XX (0.0626), *09XX/*09XX (0.0593), *04XX/*09XX (0.0551), *09XX/*15XX (0.0384) and *08XX/*12XX (0.0351). The meta-analysis showed that there were uniquely distributed features of DRB1 alleles among various ethnic populations and among the studied population groups from various regions with the same ethnic origin. An HLA-DRB1 genotyping system has been developed and established based on the oligonucleotide micro-array technology. The HLA-DRB1 typing of the Han population in Shanghai has revealed a relatively high heterogeneity. Information obtained in this study will be useful for medical and forensic applications as well as in anthropology research. Large-scale micro-array detection is highly accurate and reliable for DNA-based HLA-DRB1 genotyping. These results suggest that HLA-DRB1 DNA polymorphisms and the database of the Shanghai Han group have useful applications in processing forensic casework (as personal identification, paternity test), tracing population migration and genetic diagnosis.

Parallel characterization of anaerobic toluene- and ethylbenzene-degrading microbial consortia by PCR-denaturing gradient gel electrophoresis, RNA-DNA membrane hybridization, and DNA microarray technology

NASA Technical Reports Server (NTRS)

Koizumi, Yoshikazu; Kelly, John J.; Nakagawa, Tatsunori; Urakawa, Hidetoshi; El-Fantroussi, Said; Al-Muzaini, Saleh; Fukui, Manabu; Urushigawa, Yoshikuni; Stahl, David A.

2002-01-01

A mesophilic toluene-degrading consortium (TDC) and an ethylbenzene-degrading consortium (EDC) were established under sulfate-reducing conditions. These consortia were first characterized by denaturing gradient gel electrophoresis (DGGE) fingerprinting of PCR-amplified 16S rRNA gene fragments, followed by sequencing. The sequences of the major bands (T-1 and E-2) belonging to TDC and EDC, respectively, were affiliated with the family Desulfobacteriaceae. Another major band from EDC (E-1) was related to an uncultured non-sulfate-reducing soil bacterium. Oligonucleotide probes specific for the 16S rRNAs of target organisms corresponding to T-1, E-1, and E-2 were designed, and hybridization conditions were optimized for two analytical formats, membrane and DNA microarray hybridization. Both formats were used to characterize the TDC and EDC, and the results of both were consistent with DGGE analysis. In order to assess the utility of the microarray format for analysis of environmental samples, oil-contaminated sediments from the coast of Kuwait were analyzed. The DNA microarray successfully detected bacterial nucleic acids from these samples, but probes targeting specific groups of sulfate-reducing bacteria did not give positive signals. The results of this study demonstrate the limitations and the potential utility of DNA microarrays for microbial community analysis.

Parallel Characterization of Anaerobic Toluene- and Ethylbenzene-Degrading Microbial Consortia by PCR-Denaturing Gradient Gel Electrophoresis, RNA-DNA Membrane Hybridization, and DNA Microarray Technology

PubMed Central

Koizumi, Yoshikazu; Kelly, John J.; Nakagawa, Tatsunori; Urakawa, Hidetoshi; El-Fantroussi, Saïd; Al-Muzaini, Saleh; Fukui, Manabu; Urushigawa, Yoshikuni; Stahl, David A.

2002-01-01

A mesophilic toluene-degrading consortium (TDC) and an ethylbenzene-degrading consortium (EDC) were established under sulfate-reducing conditions. These consortia were first characterized by denaturing gradient gel electrophoresis (DGGE) fingerprinting of PCR-amplified 16S rRNA gene fragments, followed by sequencing. The sequences of the major bands (T-1 and E-2) belonging to TDC and EDC, respectively, were affiliated with the family Desulfobacteriaceae. Another major band from EDC (E-1) was related to an uncultured non-sulfate-reducing soil bacterium. Oligonucleotide probes specific for the 16S rRNAs of target organisms corresponding to T-1, E-1, and E-2 were designed, and hybridization conditions were optimized for two analytical formats, membrane and DNA microarray hybridization. Both formats were used to characterize the TDC and EDC, and the results of both were consistent with DGGE analysis. In order to assess the utility of the microarray format for analysis of environmental samples, oil-contaminated sediments from the coast of Kuwait were analyzed. The DNA microarray successfully detected bacterial nucleic acids from these samples, but probes targeting specific groups of sulfate-reducing bacteria did not give positive signals. The results of this study demonstrate the limitations and the potential utility of DNA microarrays for microbial community analysis. PMID:12088997

eSensor®: A Microarray Technology Based on Electrochemical Detection of Nucleic Acids and Its Application to Cystic Fibrosis Carrier Screening

NASA Astrophysics Data System (ADS)

Reed, Michael R.; Coty, William A.

We have developed a test for identification of carriers for cystic fibrosis using the eSensor® DNA detection technology. Oligonucleotide probes are deposited within self-assembled monolayers on gold electrodes arrayed upon printed circuit boards. These probes allow sequence-specific capture of amplicons containing a panel of mutation sites associated with cystic fibrosis. DNA targets are detected and mutations genotyped using a “sandwich” assay methodology employing electrochemical detection of ferrocene-labeled oligonucleotides for discrimination of carrier and non-carrier alleles. Performance of the cystic fibrosis application demonstrates sufficient accuracy and reliability for clinical diagnostic use, and the procedure can be performed by trained medical technologists available in the hospital laboratory.

Development and assessment of whole-genome oligonucleotide microarrays to analyze an anaerobic microbial community and its responses to oxidative stress.

PubMed

Scholten, Johannes C M; Culley, David E; Nie, Lei; Munn, Kyle J; Chow, Lely; Brockman, Fred J; Zhang, Weiwen

2007-06-29

The application of DNA microarray technology to investigate multiple-species microbial communities presents great challenges. In this study, we reported the design and quality assessment of four whole genome oligonucleotide microarrays for two syntroph bacteria, Desulfovibrio vulgaris and Syntrophobacter fumaroxidans, and two archaeal methanogens, Methanosarcina barkeri, and Methanospirillum hungatei, and their application to analyze global gene expression in a four-species microbial community in response to oxidative stress. In order to minimize the possibility of cross-hybridization, cross-genome comparison was performed to assure all probes unique to each genome so that the microarrays could provide species-level resolution. Microarray quality was validated by the good reproducibility of experimental measurements of multiple biological and analytical replicates. This study showed that S. fumaroxidans and M. hungatei responded to the oxidative stress with up-regulation of several genes known to be involved in reactive oxygen species (ROS) detoxification, such as catalase and rubrerythrin in S. fumaroxidans and thioredoxin and heat shock protein Hsp20 in M. hungatei. However, D. vulgaris seemed to be less sensitive to the oxidative stress as a member of a four-species community, since no gene involved in ROS detoxification was up-regulated. Our work demonstrated the successful application of microarrays to a multiple-species microbial community, and our preliminary results indicated that this approach could provide novel insights on the metabolism within microbial communities.

Study of hepatitis B virus gene mutations with enzymatic colorimetry-based DNA microarray.

PubMed

Mao, Hailei; Wang, Huimin; Zhang, Donglei; Mao, Hongju; Zhao, Jianlong; Shi, Jian; Cui, Zhichu

2006-01-01

To establish a modified microarray method for detecting HBV gene mutations in the clinic. Site-specific oligonucleotide probes were immobilized to microarray slides and hybridized to biotin-labeled HBV gene fragments amplified from two-step PCR. Hybridized targets were transferred to nitrocellulose membranes, followed by intensity measurement using BCIP/NBT colorimetry. HBV genes from 99 Hepatitis B patients and 40 healthy blood donors were analyzed. Mutation frequencies of HBV pre-core/core and basic core promoter (BCP) regions were found to be significantly higher in the patient group (42%, 40% versus 2.5%, 5%, P < 0.01). Compared with a traditional fluorescence method, the colorimetry method exhibited the same level of sensitivity and reproducibility. An enzymatic colorimetry-based DNA microarray assay was successfully established to monitor HBV mutations. Pre-core/core and BCP mutations of HBV genes could be major causes of HBV infection in HBeAg-negative patients and could also be relevant to chronicity and aggravation of hepatitis B.

A low density microarray method for the identification of human papillomavirus type 18 variants.

PubMed

Meza-Menchaca, Thuluz; Williams, John; Rodríguez-Estrada, Rocío B; García-Bravo, Aracely; Ramos-Ligonio, Ángel; López-Monteon, Aracely; Zepeda, Rossana C

2013-09-26

We describe a novel microarray based-method for the screening of oncogenic human papillomavirus 18 (HPV-18) molecular variants. Due to the fact that sequencing methodology may underestimate samples containing more than one variant we designed a specific and sensitive stacking DNA hybridization assay. This technology can be used to discriminate between three possible phylogenetic branches of HPV-18. Probes were attached covalently on glass slides and hybridized with single-stranded DNA targets. Prior to hybridization with the probes, the target strands were pre-annealed with the three auxiliary contiguous oligonucleotides flanking the target sequences. Screening HPV-18 positive cell lines and cervical samples were used to evaluate the performance of this HPV DNA microarray. Our results demonstrate that the HPV-18's variants hybridized specifically to probes, with no detection of unspecific signals. Specific probes successfully reveal detectable point mutations in these variants. The present DNA oligoarray system can be used as a reliable, sensitive and specific method for HPV-18 variant screening. Furthermore, this simple assay allows the use of inexpensive equipment, making it accessible in resource-poor settings.

A Low Density Microarray Method for the Identification of Human Papillomavirus Type 18 Variants

PubMed Central

Meza-Menchaca, Thuluz; Williams, John; Rodríguez-Estrada, Rocío B.; García-Bravo, Aracely; Ramos-Ligonio, Ángel; López-Monteon, Aracely; Zepeda, Rossana C.

2013-01-01

We describe a novel microarray based-method for the screening of oncogenic human papillomavirus 18 (HPV-18) molecular variants. Due to the fact that sequencing methodology may underestimate samples containing more than one variant we designed a specific and sensitive stacking DNA hybridization assay. This technology can be used to discriminate between three possible phylogenetic branches of HPV-18. Probes were attached covalently on glass slides and hybridized with single-stranded DNA targets. Prior to hybridization with the probes, the target strands were pre-annealed with the three auxiliary contiguous oligonucleotides flanking the target sequences. Screening HPV-18 positive cell lines and cervical samples were used to evaluate the performance of this HPV DNA microarray. Our results demonstrate that the HPV-18's variants hybridized specifically to probes, with no detection of unspecific signals. Specific probes successfully reveal detectable point mutations in these variants. The present DNA oligoarray system can be used as a reliable, sensitive and specific method for HPV-18 variant screening. Furthermore, this simple assay allows the use of inexpensive equipment, making it accessible in resource-poor settings. PMID:24077317

Development of oligonucleotide microarrays for simultaneous multi-species identification of Phellinus tree-pathogenic fungi.

PubMed

Tzean, Yuh; Shu, Po-Yao; Liou, Ruey-Fen; Tzean, Shean-Shong

2016-03-01

Polyporoid Phellinus fungi are ubiquitously present in the environment and play an important role in shaping forest ecology. Several species of Phellinus are notorious pathogens that can affect a broad variety of tree species in forest, plantation, orchard and urban habitats; however, current detection methods are overly complex and lack the sensitivity required to identify these pathogens at the species level in a timely fashion for effective infestation control. Here, we describe eight oligonucleotide microarray platforms for the simultaneous and specific detection of 17 important Phellinus species, using probes generated from the internal transcribed spacer regions unique to each species. The sensitivity, robustness and efficiency of this Phellinus microarray system was subsequently confirmed against template DNA from two key Phellinus species, as well as field samples collected from tree roots, trunks and surrounding soil. This system can provide early, specific and convenient detection of Phellinus species for forestry, arboriculture and quarantine inspection, and could potentially help to mitigate the environmental and economic impact of Phellinus-related diseases. © 2015 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

Evolution of the MIDTAL microarray: the adaption and testing of oligonucleotide 18S and 28S rDNA probes and evaluation of subsequent microarray generations with Prymnesium spp. cultures and field samples.

PubMed

McCoy, Gary R; Touzet, Nicolas; Fleming, Gerard T A; Raine, Robin

2015-07-01

The toxic microalgal species Prymnesium parvum and Prymnesium polylepis are responsible for numerous fish kills causing economic stress on the aquaculture industry and, through the consumption of contaminated shellfish, can potentially impact on human health. Monitoring of toxic phytoplankton is traditionally carried out by light microscopy. However, molecular methods of identification and quantification are becoming more common place. This study documents the optimisation of the novel Microarrays for the Detection of Toxic Algae (MIDTAL) microarray from its initial stages to the final commercial version now available from Microbia Environnement (France). Existing oligonucleotide probes used in whole-cell fluorescent in situ hybridisation (FISH) for Prymnesium species from higher group probes to species-level probes were adapted and tested on the first-generation microarray. The combination and interaction of numerous other probes specific for a whole range of phytoplankton taxa also spotted on the chip surface caused high cross reactivity, resulting in false-positive results on the microarray. The probe sequences were extended for the subsequent second-generation microarray, and further adaptations of the hybridisation protocol and incubation temperatures significantly reduced false-positive readings from the first to the second-generation chip, thereby increasing the specificity of the MIDTAL microarray. Additional refinement of the subsequent third-generation microarray protocols with the addition of a poly-T amino linker to the 5' end of each probe further enhanced the microarray performance but also highlighted the importance of optimising RNA labelling efficiency when testing with natural seawater samples from Killary Harbour, Ireland.

Direct on-chip DNA synthesis using electrochemically modified gold electrodes as solid support

NASA Astrophysics Data System (ADS)

Levrie, Karen; Jans, Karolien; Schepers, Guy; Vos, Rita; Van Dorpe, Pol; Lagae, Liesbet; Van Hoof, Chris; Van Aerschot, Arthur; Stakenborg, Tim

2018-04-01

DNA microarrays have propelled important advancements in the field of genomic research by enabling the monitoring of thousands of genes in parallel. The throughput can be increased even further by scaling down the microarray feature size. In this respect, microelectronics-based DNA arrays are promising as they can leverage semiconductor processing techniques with lithographic resolutions. We propose a method that enables the use of metal electrodes for de novo DNA synthesis without the need for an insulating support. By electrochemically functionalizing gold electrodes, these electrodes can act as solid support for phosphoramidite-based synthesis. The proposed method relies on the electrochemical reduction of diazonium salts, enabling site-specific incorporation of hydroxyl groups onto the metal electrodes. An automated DNA synthesizer was used to couple phosphoramidite moieties directly onto the OH-modified electrodes to obtain the desired oligonucleotide sequence. Characterization was done via cyclic voltammetry and fluorescence microscopy. Our results present a valuable proof-of-concept for the integration of solid-phase DNA synthesis with microelectronics.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Andersen, G.L.; He, Z.; DeSantis, T.Z.

Microarrays have proven to be a useful and high-throughput method to provide targeted DNA sequence information for up to many thousands of specific genetic regions in a single test. A microarray consists of multiple DNA oligonucleotide probes that, under high stringency conditions, hybridize only to specific complementary nucleic acid sequences (targets). A fluorescent signal indicates the presence and, in many cases, the abundance of genetic regions of interest. In this chapter we will look at how microarrays are used in microbial ecology, especially with the recent increase in microbial community DNA sequence data. Of particular interest to microbial ecologists, phylogeneticmore » microarrays are used for the analysis of phylotypes in a community and functional gene arrays are used for the analysis of functional genes, and, by inference, phylotypes in environmental samples. A phylogenetic microarray that has been developed by the Andersen laboratory, the PhyloChip, will be discussed as an example of a microarray that targets the known diversity within the 16S rRNA gene to determine microbial community composition. Using multiple, confirmatory probes to increase the confidence of detection and a mismatch probe for every perfect match probe to minimize the effect of cross-hybridization by non-target regions, the PhyloChip is able to simultaneously identify any of thousands of taxa present in an environmental sample. The PhyloChip is shown to reveal greater diversity within a community than rRNA gene sequencing due to the placement of the entire gene product on the microarray compared with the analysis of up to thousands of individual molecules by traditional sequencing methods. A functional gene array that has been developed by the Zhou laboratory, the GeoChip, will be discussed as an example of a microarray that dynamically identifies functional activities of multiple members within a community. The recent version of GeoChip contains more than 24,000 50mer oligonucleotide probes and covers more than 10,000 gene sequences in 150 gene categories involved in carbon, nitrogen, sulfur, and phosphorus cycling, metal resistance and reduction, and organic contaminant degradation. GeoChip can be used as a generic tool for microbial community analysis, and also link microbial community structure to ecosystem functioning. Examples of the application of both arrays in different environmental samples will be described in the two subsequent sections.« less

Oligonucleotide DNA microarray profiling of lung adenocarcinoma revealed significant downregulation and deletions of vasoactive intestinal peptide receptor 1.

PubMed

Mlakar, Vid; Strazisar, Mojca; Sok, Mihael; Glavac, Damjan

2010-06-01

The purpose of this study was to find novel gene(s) involved in the development of lung adenocarcinoma (AD). Using DNA microarrays, we identified 31 up-regulated and 8 downregulated genes in 12 AD. Real time PCR was used to measure expression of VIPR1 and SPP1 mRNA and possible losses or gains of genes in 32 AD. We describe significant upregulation of the SPP1 gene, downregulation of VIPR1, and losses of the VIPR1 gene. Our findings complement a proposed VIPR1 tumor suppressor role, in which deletions in the 3p22 chromosome region are an important mechanism leading to loss of the VIPR1 gene.

A highly oriented hybrid microarray modified electrode fabricated by a template-free method for ultrasensitive electrochemical DNA recognition

NASA Astrophysics Data System (ADS)

Shi, Lei; Chu, Zhenyu; Dong, Xueliang; Jin, Wanqin; Dempsey, Eithne

2013-10-01

Highly oriented growth of a hybrid microarray was realized by a facile template-free method on gold substrates for the first time. The proposed formation mechanism involves an interfacial structure-directing force arising from self-assembled monolayers (SAMs) between gold substrates and hybrid crystals. Different SAMs and variable surface coverage of the assembled molecules play a critical role in the interfacial directing forces and influence the morphologies of hybrid films. A highly oriented hybrid microarray was formed on the highly aligned and vertical SAMs of 1,4-benzenedithiol molecules with rigid backbones, which afforded an intense structure-directing power for the oriented growth of hybrid crystals. Additionally, the density of the microarray could be adjusted by controlling the surface coverage of assembled molecules. Based on the hybrid microarray modified electrode with a large specific area (ca. 10 times its geometrical area), a label-free electrochemical DNA biosensor was constructed for the detection of an oligonucleotide fragment of the avian flu virus H5N1. The DNA biosensor displayed a significantly low detection limit of 5 pM (S/N = 3), a wide linear response from 10 pM to 10 nM, as well as excellent selectivity, good regeneration and high stability. We expect that the proposed template-free method can provide a new reference for the fabrication of a highly oriented hybrid array and the as-prepared microarray modified electrode will be a promising paradigm in constructing highly sensitive and selective biosensors.Highly oriented growth of a hybrid microarray was realized by a facile template-free method on gold substrates for the first time. The proposed formation mechanism involves an interfacial structure-directing force arising from self-assembled monolayers (SAMs) between gold substrates and hybrid crystals. Different SAMs and variable surface coverage of the assembled molecules play a critical role in the interfacial directing forces and influence the morphologies of hybrid films. A highly oriented hybrid microarray was formed on the highly aligned and vertical SAMs of 1,4-benzenedithiol molecules with rigid backbones, which afforded an intense structure-directing power for the oriented growth of hybrid crystals. Additionally, the density of the microarray could be adjusted by controlling the surface coverage of assembled molecules. Based on the hybrid microarray modified electrode with a large specific area (ca. 10 times its geometrical area), a label-free electrochemical DNA biosensor was constructed for the detection of an oligonucleotide fragment of the avian flu virus H5N1. The DNA biosensor displayed a significantly low detection limit of 5 pM (S/N = 3), a wide linear response from 10 pM to 10 nM, as well as excellent selectivity, good regeneration and high stability. We expect that the proposed template-free method can provide a new reference for the fabrication of a highly oriented hybrid array and the as-prepared microarray modified electrode will be a promising paradigm in constructing highly sensitive and selective biosensors. Electronic supplementary information (ESI) available: Four-probe method for determining the conductivity of the hybrid crystal (Fig. S1); stability comparisons of the hybrid films (Fig. S2); FESEM images of the hybrid microarray (Fig. S3); electrochemical characterizations of the hybrid films (Fig. S4); DFT simulations (Fig. S5); cross-sectional FESEM image of the hybrid microarray (Fig. S6); regeneration and stability tests of the DNA biosensor (Fig. S7). See DOI: 10.1039/c3nr03097k

Oligonucleotide primers, probes and molecular methods for the environmental monitoring of methanogenic archaea

PubMed Central

Narihiro, Takashi; Sekiguchi, Yuji

2011-01-01

Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721

Detection of pathogenic Vibrio spp. in shellfish by using multiplex PCR and DNA microarrays.

PubMed

Panicker, Gitika; Call, Douglas R; Krug, Melissa J; Bej, Asim K

2004-12-01

This study describes the development of a gene-specific DNA microarray coupled with multiplex PCR for the comprehensive detection of pathogenic vibrios that are natural inhabitants of warm coastal waters and shellfish. Multiplex PCR with vvh and viuB for Vibrio vulnificus, with ompU, toxR, tcpI, and hlyA for V. cholerae, and with tlh, tdh, trh, and open reading frame 8 for V. parahaemolyticus helped to ensure that total and pathogenic strains, including subtypes of the three Vibrio spp., could be detected and discriminated. For DNA microarrays, oligonucleotide probes for these targeted genes were deposited onto epoxysilane-derivatized, 12-well, Teflon-masked slides by using a MicroGrid II arrayer. Amplified PCR products were hybridized to arrays at 50 degrees C and detected by using tyramide signal amplification with Alexa Fluor 546 fluorescent dye. Slides were imaged by using an arrayWoRx scanner. The detection sensitivity for pure cultures without enrichment was 10(2) to 10(3) CFU/ml, and the specificity was 100%. However, 5 h of sample enrichment followed by DNA extraction with Instagene matrix and multiplex PCR with microarray hybridization resulted in the detection of 1 CFU in 1 g of oyster tissue homogenate. Thus, enrichment of the bacterial pathogens permitted higher sensitivity in compliance with the Interstate Shellfish Sanitation Conference guideline. Application of the DNA microarray methodology to natural oysters revealed the presence of V. vulnificus (100%) and V. parahaemolyticus (83%). However, V. cholerae was not detected in natural oysters. An assay involving a combination of multiplex PCR and DNA microarray hybridization would help to ensure rapid and accurate detection of pathogenic vibrios in shellfish, thereby improving the microbiological safety of shellfish for consumers.

Detection of Pathogenic Vibrio spp. in Shellfish by Using Multiplex PCR and DNA Microarrays

PubMed Central

Panicker, Gitika; Call, Douglas R.; Krug, Melissa J.; Bej, Asim K.

2004-01-01

This study describes the development of a gene-specific DNA microarray coupled with multiplex PCR for the comprehensive detection of pathogenic vibrios that are natural inhabitants of warm coastal waters and shellfish. Multiplex PCR with vvh and viuB for Vibrio vulnificus, with ompU, toxR, tcpI, and hlyA for V. cholerae, and with tlh, tdh, trh, and open reading frame 8 for V. parahaemolyticus helped to ensure that total and pathogenic strains, including subtypes of the three Vibrio spp., could be detected and discriminated. For DNA microarrays, oligonucleotide probes for these targeted genes were deposited onto epoxysilane-derivatized, 12-well, Teflon-masked slides by using a MicroGrid II arrayer. Amplified PCR products were hybridized to arrays at 50°C and detected by using tyramide signal amplification with Alexa Fluor 546 fluorescent dye. Slides were imaged by using an arrayWoRx scanner. The detection sensitivity for pure cultures without enrichment was 102 to 103 CFU/ml, and the specificity was 100%. However, 5 h of sample enrichment followed by DNA extraction with Instagene matrix and multiplex PCR with microarray hybridization resulted in the detection of 1 CFU in 1 g of oyster tissue homogenate. Thus, enrichment of the bacterial pathogens permitted higher sensitivity in compliance with the Interstate Shellfish Sanitation Conference guideline. Application of the DNA microarray methodology to natural oysters revealed the presence of V. vulnificus (100%) and V. parahaemolyticus (83%). However, V. cholerae was not detected in natural oysters. An assay involving a combination of multiplex PCR and DNA microarray hybridization would help to ensure rapid and accurate detection of pathogenic vibrios in shellfish, thereby improving the microbiological safety of shellfish for consumers. PMID:15574946

An automated microfluidic DNA microarray platform for genetic variant detection in inherited arrhythmic diseases.

PubMed

Huang, Shu-Hong; Chang, Yu-Shin; Juang, Jyh-Ming Jimmy; Chang, Kai-Wei; Tsai, Mong-Hsun; Lu, Tzu-Pin; Lai, Liang-Chuan; Chuang, Eric Y; Huang, Nien-Tsu

2018-03-12

In this study, we developed an automated microfluidic DNA microarray (AMDM) platform for point mutation detection of genetic variants in inherited arrhythmic diseases. The platform allows for automated and programmable reagent sequencing under precise conditions of hybridization flow and temperature control. It is composed of a commercial microfluidic control system, a microfluidic microarray device, and a temperature control unit. The automated and rapid hybridization process can be performed in the AMDM platform using Cy3 labeled oligonucleotide exons of SCN5A genetic DNA, which produces proteins associated with sodium channels abundant in the heart (cardiac) muscle cells. We then introduce a graphene oxide (GO)-assisted DNA microarray hybridization protocol to enable point mutation detection. In this protocol, a GO solution is added after the staining step to quench dyes bound to single-stranded DNA or non-perfectly matched DNA, which can improve point mutation specificity. As proof-of-concept we extracted the wild-type and mutant of exon 12 and exon 17 of SCN5A genetic DNA from patients with long QT syndrome or Brugada syndrome by touchdown PCR and performed a successful point mutation discrimination in the AMDM platform. Overall, the AMDM platform can greatly reduce laborious and time-consuming hybridization steps and prevent potential contamination. Furthermore, by introducing the reciprocating flow into the microchannel during the hybridization process, the total assay time can be reduced to 3 hours, which is 6 times faster than the conventional DNA microarray. Given the automatic assay operation, shorter assay time, and high point mutation discrimination, we believe that the AMDM platform has potential for low-cost, rapid and sensitive genetic testing in a simple and user-friendly manner, which may benefit gene screening in medical practice.

Cambridge Healthtech Institute's Third Annual Conference on Lab-on-a-Chip and Microarrays. 22-24 January 2001, Zurich, Switzerland.

PubMed

Jain, K K

2001-02-01

Cambridge Healthtech Institute's Third Annual Conference on Lab-on-a-Chip and Microarray technology covered the latest advances in this technology and applications in life sciences. Highlights of the meetings are reported briefly with emphasis on applications in genomics, drug discovery and molecular diagnostics. There was an emphasis on microfluidics because of the wide applications in laboratory and drug discovery. The lab-on-a-chip provides the facilities of a complete laboratory in a hand-held miniature device. Several microarray systems have been used for hybridisation and detection techniques. Oligonucleotide scanning arrays provide a versatile tool for the analysis of nucleic acid interactions and provide a platform for improving the array-based methods for investigation of antisense therapeutics. A method for analysing combinatorial DNA arrays using oligonucleotide-modified gold nanoparticle probes and a conventional scanner has considerable potential in molecular diagnostics. Various applications of microarray technology for high-throughput screening in drug discovery and single nucleotide polymorphisms (SNP) analysis were discussed. Protein chips have important applications in proteomics. With the considerable amount of data generated by the different technologies using microarrays, it is obvious that the reading of the information and its interpretation and management through the use of bioinformatics is essential. Various techniques for data analysis were presented. Biochip and microarray technology has an essential role to play in the evolving trends in healthcare, which integrate diagnosis with prevention/treatment and emphasise personalised medicines.

Curation of microarray oligonucleotides and corresponding ESTs/cDNAs used for gene expression analysis in zebra finches.

PubMed

Lovell, Peter V; Huizinga, Nicole A; Getachew, Abel; Mees, Brianna; Friedrich, Samantha R; Wirthlin, Morgan; Mello, Claudio V

2018-05-18

Zebra finches are a major model organism for investigating mechanisms of vocal learning, a trait that enables spoken language in humans. The development of cDNA collections with expressed sequence tags (ESTs) and microarrays has allowed for extensive molecular characterizations of circuitry underlying vocal learning and production. However, poor database curation can lead to errors in transcriptome and bioinformatics analyses, limiting the impact of these resources. Here we used genomic alignments and synteny analysis for orthology verification to curate and reannotate ~ 35% of the oligonucleotides and corresponding ESTs/cDNAs that make-up Agilent microarrays for gene expression analysis in finches. We found that: (1) 5475 out of 43,084 oligos (a) failed to align to the zebra finch genome, (b) aligned to multiple loci, or (c) aligned to Chr_un only, and thus need to be flagged until a better genome assembly is available, or (d) reflect cloning artifacts; (2) Out of 9635 valid oligos examined further, 3120 were incorrectly named, including 1533 with no known orthologs; and (3) 2635 oligos required name update. The resulting curated dataset provides a reference for correcting gene identification errors in previous finch microarrays studies, and avoiding such errors in future studies.

ChIP-chip.

PubMed

Kim, Tae Hoon; Dekker, Job

2018-05-01

ChIP-chip can be used to analyze protein-DNA interactions in a region-wide and genome-wide manner. DNA microarrays contain PCR products or oligonucleotide probes that are designed to represent genomic sequences. Identification of genomic sites that interact with a specific protein is based on competitive hybridization of the ChIP-enriched DNA and the input DNA to DNA microarrays. The ChIP-chip protocol can be divided into two main sections: Amplification of ChIP DNA and hybridization of ChIP DNA to arrays. A large amount of DNA is required to hybridize to DNA arrays, and hybridization to a set of multiple commercial arrays that represent the entire human genome requires two rounds of PCR amplifications. The relative hybridization intensity of ChIP DNA and that of the input DNA is used to determine whether the probe sequence is a potential site of protein-DNA interaction. Resolution of actual genomic sites bound by the protein is dependent on the size of the chromatin and on the genomic distance between the probes on the array. As with expression profiling using gene chips, ChIP-chip experiments require multiple replicates for reliable statistical measure of protein-DNA interactions. © 2018 Cold Spring Harbor Laboratory Press.

A Unique Procedure to Identify Cell Surface Markers Through a Spherical Self-Organizing Map Applied to DNA Microarray Analysis.

PubMed

Sugii, Yuh; Kasai, Tomonari; Ikeda, Masashi; Vaidyanath, Arun; Kumon, Kazuki; Mizutani, Akifumi; Seno, Akimasa; Tokutaka, Heizo; Kudoh, Takayuki; Seno, Masaharu

2016-01-01

To identify cell-specific markers, we designed a DNA microarray platform with oligonucleotide probes for human membrane-anchored proteins. Human glioma cell lines were analyzed using microarray and compared with normal and fetal brain tissues. For the microarray analysis, we employed a spherical self-organizing map, which is a clustering method suitable for the conversion of multidimensional data into two-dimensional data and displays the relationship on a spherical surface. Based on the gene expression profile, the cell surface characteristics were successfully mirrored onto the spherical surface, thereby distinguishing normal brain tissue from the disease model based on the strength of gene expression. The clustered glioma-specific genes were further analyzed by polymerase chain reaction procedure and immunocytochemical staining of glioma cells. Our platform and the following procedure were successfully demonstrated to categorize the genes coding for cell surface proteins that are specific to glioma cells. Our assessment demonstrates that a spherical self-organizing map is a valuable tool for distinguishing cell surface markers and can be employed in marker discovery studies for the treatment of cancer.

A New Oligonucleotide Microarray for Detection of Pathogenic and Non-Pathogenic Legionella spp.

PubMed Central

Cao, Boyang; Liu, Xiangqian; Yu, Xiang; Chen, Min; Feng, Lu; Wang, Lei

2014-01-01

Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS) of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii) and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp. PMID:25469776

A new oligonucleotide microarray for detection of pathogenic and non-pathogenic Legionella spp.

PubMed

Cao, Boyang; Liu, Xiangqian; Yu, Xiang; Chen, Min; Feng, Lu; Wang, Lei

2014-01-01

Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS) of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii) and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp.

Validation of the Swine Protein-Annotated Oligonucleotide Microarray

USDA-ARS?s Scientific Manuscript database

The specificity and utility of the Swine Protein-Annotated Oligonucleotide Microarray, or Pigoligoarray (www.pigoligoarray.org), has been evaluated by profiling the expression of transcripts from four porcine tissues. Tools for comparative analyses of expression on the Pigoligoarray were developed i...

Systematic validation and atomic force microscopy of non-covalent short oligonucleotide barcode microarrays.

PubMed

Cook, Michael A; Chan, Chi-Kin; Jorgensen, Paul; Ketela, Troy; So, Daniel; Tyers, Mike; Ho, Chi-Yip

2008-02-06

Molecular barcode arrays provide a powerful means to analyze cellular phenotypes in parallel through detection of short (20-60 base) unique sequence tags, or "barcodes", associated with each strain or clone in a collection. However, costs of current methods for microarray construction, whether by in situ oligonucleotide synthesis or ex situ coupling of modified oligonucleotides to the slide surface are often prohibitive to large-scale analyses. Here we demonstrate that unmodified 20mer oligonucleotide probes printed on conventional surfaces show comparable hybridization signals to covalently linked 5'-amino-modified probes. As a test case, we undertook systematic cell size analysis of the budding yeast Saccharomyces cerevisiae genome-wide deletion collection by size separation of the deletion pool followed by determination of strain abundance in size fractions by barcode arrays. We demonstrate that the properties of a 13K unique feature spotted 20 mer oligonucleotide barcode microarray compare favorably with an analogous covalently-linked oligonucleotide array. Further, cell size profiles obtained with the size selection/barcode array approach recapitulate previous cell size measurements of individual deletion strains. Finally, through atomic force microscopy (AFM), we characterize the mechanism of hybridization to unmodified barcode probes on the slide surface. These studies push the lower limit of probe size in genome-scale unmodified oligonucleotide microarray construction and demonstrate a versatile, cost-effective and reliable method for molecular barcode analysis.

Electrochemical detection of synthetic DNA and native 16S rRNA fragments on a microarray using a biotinylated intercalator as coupling site for an enzyme label.

PubMed

Zimdars, Andreas; Gebala, Magdalena; Hartwich, Gerhard; Neugebauer, Sebastian; Schuhmann, Wolfgang

2015-10-01

The direct electrochemical detection of synthetic DNA and native 16S rRNA fragments isolated from Escherichia coli is described. Oligonucleotides are detected via selective post-labeling of double stranded DNA and DNA-RNA duplexes with a biotinylated intercalator that enables high-specific binding of a streptavidin/alkaline phosphatase conjugate. The alkaline phosphatase catalyzes formation of p-aminophenol that is subsequently oxidized at the underlying gold electrode and hence enables the detection of complementary hybridization of the DNA capture strands due to the enzymatic signal amplification. The hybridization assay was performed on microarrays consisting of 32 individually addressable gold microelectrodes. Synthetic DNA strands with sequences representing six different pathogens which are important for the diagnosis of urinary tract infections could be detected at concentrations of 60 nM. Native 16S rRNA isolated from the different pathogens could be detected at a concentration of 30 fM. Optimization of the sensing surface is described and influences on the assay performance are discussed. Copyright © 2015 Elsevier B.V. All rights reserved.

Identifying Fishes through DNA Barcodes and Microarrays.

PubMed

Kochzius, Marc; Seidel, Christian; Antoniou, Aglaia; Botla, Sandeep Kumar; Campo, Daniel; Cariani, Alessia; Vazquez, Eva Garcia; Hauschild, Janet; Hervet, Caroline; Hjörleifsdottir, Sigridur; Hreggvidsson, Gudmundur; Kappel, Kristina; Landi, Monica; Magoulas, Antonios; Marteinsson, Viggo; Nölte, Manfred; Planes, Serge; Tinti, Fausto; Turan, Cemal; Venugopal, Moleyur N; Weber, Hannes; Blohm, Dietmar

2010-09-07

International fish trade reached an import value of 62.8 billion Euro in 2006, of which 44.6% are covered by the European Union. Species identification is a key problem throughout the life cycle of fishes: from eggs and larvae to adults in fisheries research and control, as well as processed fish products in consumer protection. This study aims to evaluate the applicability of the three mitochondrial genes 16S rRNA (16S), cytochrome b (cyt b), and cytochrome oxidase subunit I (COI) for the identification of 50 European marine fish species by combining techniques of "DNA barcoding" and microarrays. In a DNA barcoding approach, neighbour Joining (NJ) phylogenetic trees of 369 16S, 212 cyt b, and 447 COI sequences indicated that cyt b and COI are suitable for unambiguous identification, whereas 16S failed to discriminate closely related flatfish and gurnard species. In course of probe design for DNA microarray development, each of the markers yielded a high number of potentially species-specific probes in silico, although many of them were rejected based on microarray hybridisation experiments. None of the markers provided probes to discriminate the sibling flatfish and gurnard species. However, since 16S-probes were less negatively influenced by the "position of label" effect and showed the lowest rejection rate and the highest mean signal intensity, 16S is more suitable for DNA microarray probe design than cty b and COI. The large portion of rejected COI-probes after hybridisation experiments (>90%) renders the DNA barcoding marker as rather unsuitable for this high-throughput technology. Based on these data, a DNA microarray containing 64 functional oligonucleotide probes for the identification of 30 out of the 50 fish species investigated was developed. It represents the next step towards an automated and easy-to-handle method to identify fish, ichthyoplankton, and fish products.

Identification of Escherichia coli O157 by Using a Novel Colorimetric Detection Method with DNA Microarrays

PubMed Central

Swimley, Michelle S.; Taylor, Amber W.; Dawson, Erica D.

2011-01-01

Abstract Shiga toxin–producing Escherichia coli O157 is a leading cause of foodborne illness worldwide. To evaluate better methods to rapidly detect and genotype E. coli O157 strains, the present study evaluated the use of ampliPHOX, a novel colorimetric detection method based on photopolymerization, for pathogen identification with DNA microarrays. A low-density DNA oligonucleotide microarray was designed to target stx1 and stx2 genes encoding Shiga toxin production, the eae gene coding for adherence membrane protein, and the per gene encoding the O157-antigen perosamine synthetase. Results from the validation experiments demonstrated that the use of ampliPHOX allowed the accurate genotyping of the tested E. coli strains, and positive hybridization signals were observed for only probes targeting virulence genes present in the reference strains. Quantification showed that the average signal-to-noise ratio values ranged from 47.73 ± 7.12 to 76.71 ± 8.33, whereas average signal-to-noise ratio values below 2.5 were determined for probes where no polymer was formed due to lack of specific hybridization. Sensitivity tests demonstrated that the sensitivity threshold for E. coli O157 detection was 100–1000 CFU/mL. Thus, the use of DNA microarrays in combination with photopolymerization allowed the rapid and accurate genotyping of E. coli O157 strains. PMID:21288130

Heterologous oligonucleotide microarrays for transcriptomics in a non-model species; a proof-of-concept study of drought stress in Musa

PubMed Central

Davey, Mark W; Graham, Neil S; Vanholme, Bartel; Swennen, Rony; May, Sean T; Keulemans, Johan

2009-01-01

Background 'Systems-wide' approaches such as microarray RNA-profiling are ideally suited to the study of the complex overlapping responses of plants to biotic and abiotic stresses. However, commercial microarrays are only available for a limited number of plant species and development costs are so substantial as to be prohibitive for most research groups. Here we evaluate the use of cross-hybridisation to Affymetrix oligonucleotide GeneChip® microarrays to profile the response of the banana (Musa spp.) leaf transcriptome to drought stress using a genomic DNA (gDNA)-based probe-selection strategy to improve the efficiency of detection of differentially expressed Musa transcripts. Results Following cross-hybridisation of Musa gDNA to the Rice GeneChip® Genome Array, ~33,700 gene-specific probe-sets had a sufficiently high degree of homology to be retained for transcriptomic analyses. In a proof-of-concept approach, pooled RNA representing a single biological replicate of control and drought stressed leaves of the Musa cultivar 'Cachaco' were hybridised to the Affymetrix Rice Genome Array. A total of 2,910 Musa gene homologues with a >2-fold difference in expression levels were subsequently identified. These drought-responsive transcripts included many functional classes associated with plant biotic and abiotic stress responses, as well as a range of regulatory genes known to be involved in coordinating abiotic stress responses. This latter group included members of the ERF, DREB, MYB, bZIP and bHLH transcription factor families. Fifty-two of these drought-sensitive Musa transcripts were homologous to genes underlying QTLs for drought and cold tolerance in rice, including in 2 instances QTLs associated with a single underlying gene. The list of drought-responsive transcripts also included genes identified in publicly-available comparative transcriptomics experiments. Conclusion Our results demonstrate that despite the general paucity of nucleotide sequence data in Musa and only distant phylogenetic relations to rice, gDNA probe-based cross-hybridisation to the Rice GeneChip® is a highly promising strategy to study complex biological responses and illustrates the potential of such strategies for gene discovery in non-model species. PMID:19758430

SIMULATION AND VISUALIZATION OF FLOW PATTERN IN MICROARRAYS FOR LIQUID PHASE OLIGONUCLEOTIDE AND PEPTIDE SYNTHESIS

PubMed Central

O-Charoen, Sirimon; Srivannavit, Onnop; Gulari, Erdogan

2008-01-01

Microfluidic microarrays have been developed for economical and rapid parallel synthesis of oligonucleotide and peptide libraries. For a synthesis system to be reproducible and uniform, it is crucial to have a uniform reagent delivery throughout the system. Computational fluid dynamics (CFD) is used to model and simulate the microfluidic microarrays to study geometrical effects on flow patterns. By proper design geometry, flow uniformity could be obtained in every microreactor in the microarrays. PMID:17480053

Plant-pathogen interactions: what microarray tells about it?

PubMed

Lodha, T D; Basak, J

2012-01-01

Plant defense responses are mediated by elementary regulatory proteins that affect expression of thousands of genes. Over the last decade, microarray technology has played a key role in deciphering the underlying networks of gene regulation in plants that lead to a wide variety of defence responses. Microarray is an important tool to quantify and profile the expression of thousands of genes simultaneously, with two main aims: (1) gene discovery and (2) global expression profiling. Several microarray technologies are currently in use; most include a glass slide platform with spotted cDNA or oligonucleotides. Till date, microarray technology has been used in the identification of regulatory genes, end-point defence genes, to understand the signal transduction processes underlying disease resistance and its intimate links to other physiological pathways. Microarray technology can be used for in-depth, simultaneous profiling of host/pathogen genes as the disease progresses from infection to resistance/susceptibility at different developmental stages of the host, which can be done in different environments, for clearer understanding of the processes involved. A thorough knowledge of plant disease resistance using successful combination of microarray and other high throughput techniques, as well as biochemical, genetic, and cell biological experiments is needed for practical application to secure and stabilize yield of many crop plants. This review starts with a brief introduction to microarray technology, followed by the basics of plant-pathogen interaction, the use of DNA microarrays over the last decade to unravel the mysteries of plant-pathogen interaction, and ends with the future prospects of this technology.

OCaPPI-Db: an oligonucleotide probe database for pathogen identification through hybridization capture.

PubMed

Gasc, Cyrielle; Constantin, Antony; Jaziri, Faouzi; Peyret, Pierre

2017-01-01

The detection and identification of bacterial pathogens involved in acts of bio- and agroterrorism are essential to avoid pathogen dispersal in the environment and propagation within the population. Conventional molecular methods, such as PCR amplification, DNA microarrays or shotgun sequencing, are subject to various limitations when assessing environmental samples, which can lead to inaccurate findings. We developed a hybridization capture strategy that uses a set of oligonucleotide probes to target and enrich biomarkers of interest in environmental samples. Here, we present Oligonucleotide Capture Probes for Pathogen Identification Database (OCaPPI-Db), an online capture probe database containing a set of 1,685 oligonucleotide probes allowing for the detection and identification of 30 biothreat agents up to the species level. This probe set can be used in its entirety as a comprehensive diagnostic tool or can be restricted to a set of probes targeting a specific pathogen or virulence factor according to the user's needs. : http://ocappidb.uca.works. © The Author(s) 2017. Published by Oxford University Press.

The Use of Atomic Force Microscopy for 3D Analysis of Nucleic Acid Hybridization on Microarrays.

PubMed

Dubrovin, E V; Presnova, G V; Rubtsova, M Yu; Egorov, A M; Grigorenko, V G; Yaminsky, I V

2015-01-01

Oligonucleotide microarrays are considered today to be one of the most efficient methods of gene diagnostics. The capability of atomic force microscopy (AFM) to characterize the three-dimensional morphology of single molecules on a surface allows one to use it as an effective tool for the 3D analysis of a microarray for the detection of nucleic acids. The high resolution of AFM offers ways to decrease the detection threshold of target DNA and increase the signal-to-noise ratio. In this work, we suggest an approach to the evaluation of the results of hybridization of gold nanoparticle-labeled nucleic acids on silicon microarrays based on an AFM analysis of the surface both in air and in liquid which takes into account of their three-dimensional structure. We suggest a quantitative measure of the hybridization results which is based on the fraction of the surface area occupied by the nanoparticles.

Mining microarrays for metabolic meaning: nutritional regulation of hypothalamic gene expression.

PubMed

Mobbs, Charles V; Yen, Kelvin; Mastaitis, Jason; Nguyen, Ha; Watson, Elizabeth; Wurmbach, Elisa; Sealfon, Stuart C; Brooks, Andrew; Salton, Stephen R J

2004-06-01

DNA microarray analysis has been used to investigate relative changes in the level of gene expression in the CNS, including changes that are associated with disease, injury, psychiatric disorders, drug exposure or withdrawal, and memory formation. We have used oligonucleotide microarrays to identify hypothalamic genes that respond to nutritional manipulation. In addition to commonly used microarray analysis based on criteria such as fold-regulation, we have also found that simply carrying out multiple t tests then sorting by P value constitutes a highly reliable method to detect true regulation, as assessed by real-time polymerase chain reaction (PCR), even for relatively low abundance genes or relatively low magnitude of regulation. Such analyses directly suggested novel mechanisms that mediate effects of nutritional state on neuroendocrine function and are being used to identify regulated gene products that may elucidate the metabolic pathology of obese ob/ob, lean Vgf-/Vgf-, and other models with profound metabolic impairments.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Farahani, Poupak; Chiu, Sally; Bowlus, Christopher L.

Obesity is a complex disease. To date, over 100 chromosomal loci for body weight, body fat, regional white adipose tissue weight, and other obesity-related traits have been identified in humans and in animal models. For most loci, the underlying genes are not yet identified; some of these chromosomal loci will be alleles of known obesity genes, whereas many will represent alleles of unknown genes. Microarray analysis allows simultaneous multiple gene and pathway discovery. cDNA and oligonucleotide arrays are commonly used to identify differentially expressed genes by surveys of large numbers of known and unnamed genes. Two papers previously identified genesmore » differentially expressed in adipose tissue of mouse models of obesity and diabetes by analysis of hybridization to Affymetrix oligonucleotide chips.« less

UniPROBE, update 2011: expanded content and search tools in the online database of protein-binding microarray data on protein-DNA interactions.

PubMed

Robasky, Kimberly; Bulyk, Martha L

2011-01-01

The Universal PBM Resource for Oligonucleotide-Binding Evaluation (UniPROBE) database is a centralized repository of information on the DNA-binding preferences of proteins as determined by universal protein-binding microarray (PBM) technology. Each entry for a protein (or protein complex) in UniPROBE provides the quantitative preferences for all possible nucleotide sequence variants ('words') of length k ('k-mers'), as well as position weight matrix (PWM) and graphical sequence logo representations of the k-mer data. In this update, we describe >130% expansion of the database content, incorporation of a protein BLAST (blastp) tool for finding protein sequence matches in UniPROBE, the introduction of UniPROBE accession numbers and additional database enhancements. The UniPROBE database is available at http://uniprobe.org.

Systematic Validation and Atomic Force Microscopy of Non-Covalent Short Oligonucleotide Barcode Microarrays

PubMed Central

Cook, Michael A.; Chan, Chi-Kin; Jorgensen, Paul; Ketela, Troy; So, Daniel; Tyers, Mike; Ho, Chi-Yip

2008-01-01

Background Molecular barcode arrays provide a powerful means to analyze cellular phenotypes in parallel through detection of short (20–60 base) unique sequence tags, or “barcodes”, associated with each strain or clone in a collection. However, costs of current methods for microarray construction, whether by in situ oligonucleotide synthesis or ex situ coupling of modified oligonucleotides to the slide surface are often prohibitive to large-scale analyses. Methodology/Principal Findings Here we demonstrate that unmodified 20mer oligonucleotide probes printed on conventional surfaces show comparable hybridization signals to covalently linked 5′-amino-modified probes. As a test case, we undertook systematic cell size analysis of the budding yeast Saccharomyces cerevisiae genome-wide deletion collection by size separation of the deletion pool followed by determination of strain abundance in size fractions by barcode arrays. We demonstrate that the properties of a 13K unique feature spotted 20 mer oligonucleotide barcode microarray compare favorably with an analogous covalently-linked oligonucleotide array. Further, cell size profiles obtained with the size selection/barcode array approach recapitulate previous cell size measurements of individual deletion strains. Finally, through atomic force microscopy (AFM), we characterize the mechanism of hybridization to unmodified barcode probes on the slide surface. Conclusions/Significance These studies push the lower limit of probe size in genome-scale unmodified oligonucleotide microarray construction and demonstrate a versatile, cost-effective and reliable method for molecular barcode analysis. PMID:18253494

Parallel gene analysis with allele-specific padlock probes and tag microarrays

PubMed Central

Banér, Johan; Isaksson, Anders; Waldenström, Erik; Jarvius, Jonas; Landegren, Ulf; Nilsson, Mats

2003-01-01

Parallel, highly specific analysis methods are required to take advantage of the extensive information about DNA sequence variation and of expressed sequences. We present a scalable laboratory technique suitable to analyze numerous target sequences in multiplexed assays. Sets of padlock probes were applied to analyze single nucleotide variation directly in total genomic DNA or cDNA for parallel genotyping or gene expression analysis. All reacted probes were then co-amplified and identified by hybridization to a standard tag oligonucleotide array. The technique was illustrated by analyzing normal and pathogenic variation within the Wilson disease-related ATP7B gene, both at the level of DNA and RNA, using allele-specific padlock probes. PMID:12930977

Development of a rapid microarray-based DNA subtyping assay for the alleles of Shiga toxins 1 and 2 of Escherichia coli.

PubMed

Geue, Lutz; Stieber, Bettina; Monecke, Stefan; Engelmann, Ines; Gunzer, Florian; Slickers, Peter; Braun, Sascha D; Ehricht, Ralf

2014-08-01

In this study, we developed a new rapid, economic, and automated microarray-based genotyping test for the standardized subtyping of Shiga toxins 1 and 2 of Escherichia coli. The microarrays from Alere Technologies can be used in two different formats, the ArrayTube and the ArrayStrip (which enables high-throughput testing in a 96-well format). One microarray chip harbors all the gene sequences necessary to distinguish between all Stx subtypes, facilitating the identification of single and multiple subtypes within a single isolate in one experiment. Specific software was developed to automatically analyze all data obtained from the microarray. The assay was validated with 21 Shiga toxin-producing E. coli (STEC) reference strains that were previously tested by the complete set of conventional subtyping PCRs. The microarray results showed 100% concordance with the PCR results. Essentially identical results were detected when the standard DNA extraction method was replaced by a time-saving heat lysis protocol. For further validation of the microarray, we identified the Stx subtypes or combinations of the subtypes in 446 STEC field isolates of human and animal origin. In summary, this oligonucleotide array represents an excellent diagnostic tool that provides some advantages over standard PCR-based subtyping. The number of the spotted probes on the microarrays can be increased by additional probes, such as for novel alleles, species markers, or resistance genes, should the need arise. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

NAIMA: target amplification strategy allowing quantitative on-chip detection of GMOs.

PubMed

Morisset, Dany; Dobnik, David; Hamels, Sandrine; Zel, Jana; Gruden, Kristina

2008-10-01

We have developed a novel multiplex quantitative DNA-based target amplification method suitable for sensitive, specific and quantitative detection on microarray. This new method named NASBA Implemented Microarray Analysis (NAIMA) was applied to GMO detection in food and feed, but its application can be extended to all fields of biology requiring simultaneous detection of low copy number DNA targets. In a first step, the use of tailed primers allows the multiplex synthesis of template DNAs in a primer extension reaction. A second step of the procedure consists of transcription-based amplification using universal primers. The cRNA product is further on directly ligated to fluorescent dyes labelled 3DNA dendrimers allowing signal amplification and hybridized without further purification on an oligonucleotide probe-based microarray for multiplex detection. Two triplex systems have been applied to test maize samples containing several transgenic lines, and NAIMA has shown to be sensitive down to two target copies and to provide quantitative data on the transgenic contents in a range of 0.1-25%. Performances of NAIMA are comparable to singleplex quantitative real-time PCR. In addition, NAIMA amplification is faster since 20 min are sufficient to achieve full amplification.

NAIMA: target amplification strategy allowing quantitative on-chip detection of GMOs

PubMed Central

Morisset, Dany; Dobnik, David; Hamels, Sandrine; Žel, Jana; Gruden, Kristina

2008-01-01

We have developed a novel multiplex quantitative DNA-based target amplification method suitable for sensitive, specific and quantitative detection on microarray. This new method named NASBA Implemented Microarray Analysis (NAIMA) was applied to GMO detection in food and feed, but its application can be extended to all fields of biology requiring simultaneous detection of low copy number DNA targets. In a first step, the use of tailed primers allows the multiplex synthesis of template DNAs in a primer extension reaction. A second step of the procedure consists of transcription-based amplification using universal primers. The cRNA product is further on directly ligated to fluorescent dyes labelled 3DNA dendrimers allowing signal amplification and hybridized without further purification on an oligonucleotide probe-based microarray for multiplex detection. Two triplex systems have been applied to test maize samples containing several transgenic lines, and NAIMA has shown to be sensitive down to two target copies and to provide quantitative data on the transgenic contents in a range of 0.1–25%. Performances of NAIMA are comparable to singleplex quantitative real-time PCR. In addition, NAIMA amplification is faster since 20 min are sufficient to achieve full amplification. PMID:18710880

Profiling cellular protein complexes by proximity ligation with dual tag microarray readout.

PubMed

Hammond, Maria; Nong, Rachel Yuan; Ericsson, Olle; Pardali, Katerina; Landegren, Ulf

2012-01-01

Patterns of protein interactions provide important insights in basic biology, and their analysis plays an increasing role in drug development and diagnostics of disease. We have established a scalable technique to compare two biological samples for the levels of all pairwise interactions among a set of targeted protein molecules. The technique is a combination of the proximity ligation assay with readout via dual tag microarrays. In the proximity ligation assay protein identities are encoded as DNA sequences by attaching DNA oligonucleotides to antibodies directed against the proteins of interest. Upon binding by pairs of antibodies to proteins present in the same molecular complexes, ligation reactions give rise to reporter DNA molecules that contain the combined sequence information from the two DNA strands. The ligation reactions also serve to incorporate a sample barcode in the reporter molecules to allow for direct comparison between pairs of samples. The samples are evaluated using a dual tag microarray where information is decoded, revealing which pairs of tags that have become joined. As a proof-of-concept we demonstrate that this approach can be used to detect a set of five proteins and their pairwise interactions both in cellular lysates and in fixed tissue culture cells. This paper provides a general strategy to analyze the extent of any pairwise interactions in large sets of molecules by decoding reporter DNA strands that identify the interacting molecules.

ASSESSMENT OF THE SWINE PROTEIN-ANNOTATED OLIGONUCLEOTIDE MICROARRAY AND UTILITY OF THE ARRAYS FOR EQTL AND TRANSCRIPTIONAL PROFILING STUDIES

USDA-ARS?s Scientific Manuscript database

We have evaluated the new Swine Protein-Annotated Oligonucleotide Microarray (http://www.pigoligoarray.org) by analyzing transcriptional profiles for longissimus dorsi muscle (LD), Bronchial lymph node (BLN) and Lung. Four LD samples were used to assess the stringency of hybridization conditions com...

Design of oligonucleotides for microarrays and perspectives for design of multi-transcriptome arrays.

PubMed

Nielsen, Henrik Bjørn; Wernersson, Rasmus; Knudsen, Steen

2003-07-01

Optimal design of oligonucleotides for microarrays involves tedious and laborious work evaluating potential oligonucleotides relative to a series of parameters. The currently available tools for this purpose are limited in their flexibility and do not present the oligonucleotide designer with an overview of these parameters. We present here a flexible tool named OligoWiz for designing oligonucleotides for multiple purposes. OligoWiz presents a set of parameter scores in a graphical interface to facilitate an overview for the user. Additional custom parameter scores can easily be added to the program to extend the default parameters: homology, DeltaTm, low-complexity, position and GATC-only. Furthermore we present an analysis of the limitations in designing oligonucleotide sets that can detect transcripts from multiple organisms. OligoWiz is available at www.cbs.dtu.dk/services/OligoWiz/.

Detecting and Genotyping Escherichia coli O157:H7 using multiplexed PCR and nucleic acid microarrays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Call, Douglas R.; Brockman, Fred J.; Chandler, Darrell P.

2000-12-01

Rapid detection and characterization of food borne pathogens such as Escherichia coli O157:H7 is crucial for epidemiological investigations and food safety surveillance. As an alternative to conventional technologies, we examined the sensitivity and specificity of nucleic acid microarrays for detecting and genotyping E. coli O157:H7. The array was composed of oligonucleotide probes (25-30 mer) complementary to four virulence loci (intimin, Shiga-like toxins I and II, and hemolysin A). Target DNA was amplified from whole cells or from purified DNA via single or multiplexed polymerase chain reaction (PCR), and PCR products were hybridized to the array without further modification or purification.more » The array was 32-fold more sensitive than gel electrophoresis and capable of detecting amplification products from < 1 cell equivalent of genomic DNA (1 fg). Immunomagnetic capture, PCR and a microarray were subsequently used to detect 55 CFU ml-1 (E. coli O157:H7) from chicken rinsate without the aid of pre-enrichment. Four isolates of E. coli O157:H7 and one isolate of O91:H2, for which genotypic data were available, were unambiguously genotyped with this array. Glass based microarrays are relatively simple to construct and provide a rapid and sensitive means to detect multiplexed PCR products and the system is amenable to automation.« less

Detecting and genotyping Escherichia coli O157:H7 using multiplexed PCR and nucleic acid microarrays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Call, Douglas R.; Brockman, Fred J.; Chandler, Darrell P.

2001-07-05

Rapid detection and characterization of food borne pathogens such as Escherichia coli O157:H7 is crucial for epidemiological investigations and food safety surveillance. As an alternative to conventional technologies, we examined the sensitivity and specificity of nucleic acid microarrays for detecting and genotyping E. coli O157:H7. The array was composed of oligonucleotide probes (25-30 mer) complementary to four virulence loci (intimin, Shiga-like toxins I and II, and hemolysin A). Target DNA was amplified from whole cells or from purified DNA via single or multiplexed polymerase chain reaction (PCR), and PCR products were hybridized to the array without further modification or purification.more » The array was 32-fold more sensitive than gel electrophoresis and capable of detecting amplification products from < 1 cell equivalent of genomic DNA (1 fg). Immunomagnetic capture, PCR and a microarray were subsequently used to detect 55 CFUs ml-1 (E. coli O157:H7) from chicken rinsate without the aid of pre-enrichment. Four isolates of E. coli O157:H7 and one isolate of O91:H2, for which genotypic data were available, were unambiguously genotyped with this array. Glass based microarrays are relatively simple to construct and provide a rapid and sensitive means to detect multiplexed PCR products and the system is amenable to automation.« less

Designing oligo libraries taking alternative splicing into account

NASA Astrophysics Data System (ADS)

Shoshan, Avi; Grebinskiy, Vladimir; Magen, Avner; Scolnicov, Ariel; Fink, Eyal; Lehavi, David; Wasserman, Alon

2001-06-01

We have designed sequences for DNA microarrays and oligo libraries, taking alternative splicing into account. Alternative splicing is a common phenomenon, occurring in more than 25% of the human genes. In many cases, different splice variants have different functions, are expressed in different tissues or may indicate different stages of disease. When designing sequences for DNA microarrays or oligo libraries, it is very important to take into account the sequence information of all the mRNA transcripts. Therefore, when a gene has more than one transcript (as a result of alternative splicing, alternative promoter sites or alternative poly-adenylation sites), it is very important to take all of them into account in the design. We have used the LEADS transcriptome prediction system to cluster and assemble the human sequences in GenBank and design optimal oligonucleotides for all the human genes with a known mRNA sequence based on the LEADS predictions.

Construction of a robust microarray from a non-model species (largemouth bass) using pyrosequencing technology

PubMed Central

Garcia-Reyero, Natàlia; Griffitt, Robert J.; Liu, Li; Kroll, Kevin J.; Farmerie, William G.; Barber, David S.; Denslow, Nancy D.

2009-01-01

A novel custom microarray for largemouth bass (Micropterus salmoides) was designed with sequences obtained from a normalized cDNA library using the 454 Life Sciences GS-20 pyrosequencer. This approach yielded in excess of 58 million bases of high-quality sequence. The sequence information was combined with 2,616 reads obtained by traditional suppressive subtractive hybridizations to derive a total of 31,391 unique sequences. Annotation and coding sequences were predicted for these transcripts where possible. 16,350 annotated transcripts were selected as target sequences for the design of the custom largemouth bass oligonucleotide microarray. The microarray was validated by examining the transcriptomic response in male largemouth bass exposed to 17β-œstradiol. Transcriptomic responses were assessed in liver and gonad, and indicated gene expression profiles typical of exposure to œstradiol. The results demonstrate the potential to rapidly create the tools necessary to assess large scale transcriptional responses in non-model species, paving the way for expanded impact of toxicogenomics in ecotoxicology. PMID:19936325

The detection and differentiation of canine respiratory pathogens using oligonucleotide microarrays.

PubMed

Wang, Lih-Chiann; Kuo, Ya-Ting; Chueh, Ling-Ling; Huang, Dean; Lin, Jiunn-Horng

2017-05-01

Canine respiratory diseases are commonly seen in dogs along with co-infections with multiple respiratory pathogens, including viruses and bacteria. Virus infections in even vaccinated dogs were also reported. The clinical signs caused by different respiratory etiological agents are similar, which makes differential diagnosis imperative. An oligonucleotide microarray system was developed in this study. The wild type and vaccine strains of canine distemper virus (CDV), influenza virus, canine herpesvirus (CHV), Bordetella bronchiseptica and Mycoplasma cynos were detected and differentiated simultaneously on a microarray chip. The detection limit is 10, 10, 100, 50 and 50 copy numbers for CDV, influenza virus, CHV, B. bronchiseptica and M. cynos, respectively. The clinical test results of nasal swab samples showed that the microarray had remarkably better efficacy than the multiplex PCR-agarose gel method. The positive detection rate of microarray and agarose gel was 59.0% (n=33) and 41.1% (n=23) among the 56 samples, respectively. CDV vaccine strain and pathogen co-infections were further demonstrated by the microarray but not by the multiplex PCR-agarose gel. The oligonucleotide microarray provides a highly efficient diagnosis alternative that could be applied to clinical usage, greatly assisting in disease therapy and control. Copyright © 2017 Elsevier B.V. All rights reserved.

Multi-Gene Detection and Identification of Mosquito-Borne RNA Viruses Using an Oligonucleotide Microarray

PubMed Central

Grubaugh, Nathan D.; McMenamy, Scott S.; Turell, Michael J.; Lee, John S.

2013-01-01

Background Arthropod-borne viruses are important emerging pathogens world-wide. Viruses transmitted by mosquitoes, such as dengue, yellow fever, and Japanese encephalitis viruses, infect hundreds of millions of people and animals each year. Global surveillance of these viruses in mosquito vectors using molecular based assays is critical for prevention and control of the associated diseases. Here, we report an oligonucleotide DNA microarray design, termed ArboChip5.1, for multi-gene detection and identification of mosquito-borne RNA viruses from the genera Flavivirus (family Flaviviridae), Alphavirus (Togaviridae), Orthobunyavirus (Bunyaviridae), and Phlebovirus (Bunyaviridae). Methodology/Principal Findings The assay utilizes targeted PCR amplification of three genes from each virus genus for electrochemical detection on a portable, field-tested microarray platform. Fifty-two viruses propagated in cell-culture were used to evaluate the specificity of the PCR primer sets and the ArboChip5.1 microarray capture probes. The microarray detected all of the tested viruses and differentiated between many closely related viruses such as members of the dengue, Japanese encephalitis, and Semliki Forest virus clades. Laboratory infected mosquitoes were used to simulate field samples and to determine the limits of detection. Additionally, we identified dengue virus type 3, Japanese encephalitis virus, Tembusu virus, Culex flavivirus, and a Quang Binh-like virus from mosquitoes collected in Thailand in 2011 and 2012. Conclusions/Significance We demonstrated that the described assay can be utilized in a comprehensive field surveillance program by the broad-range amplification and specific identification of arboviruses from infected mosquitoes. Furthermore, the microarray platform can be deployed in the field and viral RNA extraction to data analysis can occur in as little as 12 h. The information derived from the ArboChip5.1 microarray can help to establish public health priorities, detect disease outbreaks, and evaluate control programs. PMID:23967358

Specific Discrimination of Three Pathogenic Salmonella enterica subsp. enterica Serotypes by carB-Based Oligonucleotide Microarray

PubMed Central

Shin, Hwa Hui; Hwang, Byeong Hee; Seo, Jeong Hyun

2014-01-01

It is important to rapidly and selectively detect and analyze pathogenic Salmonella enterica subsp. enterica in contaminated food to reduce the morbidity and mortality of Salmonella infection and to guarantee food safety. In the present work, we developed an oligonucleotide microarray containing duplicate specific capture probes based on the carB gene, which encodes the carbamoyl phosphate synthetase large subunit, as a competent biomarker evaluated by genetic analysis to selectively and efficiently detect and discriminate three S. enterica subsp. enterica serotypes: Choleraesuis, Enteritidis, and Typhimurium. Using the developed microarray system, three serotype targets were successfully analyzed in a range as low as 1.6 to 3.1 nM and were specifically discriminated from each other without nonspecific signals. In addition, the constructed microarray did not have cross-reactivity with other common pathogenic bacteria and even enabled the clear discrimination of the target Salmonella serotype from a bacterial mixture. Therefore, these results demonstrated that our novel carB-based oligonucleotide microarray can be used as an effective and specific detection system for S. enterica subsp. enterica serotypes. PMID:24185846

Specific discrimination of three pathogenic Salmonella enterica subsp. enterica serotypes by carB-based oligonucleotide microarray.

PubMed

Shin, Hwa Hui; Hwang, Byeong Hee; Seo, Jeong Hyun; Cha, Hyung Joon

2014-01-01

It is important to rapidly and selectively detect and analyze pathogenic Salmonella enterica subsp. enterica in contaminated food to reduce the morbidity and mortality of Salmonella infection and to guarantee food safety. In the present work, we developed an oligonucleotide microarray containing duplicate specific capture probes based on the carB gene, which encodes the carbamoyl phosphate synthetase large subunit, as a competent biomarker evaluated by genetic analysis to selectively and efficiently detect and discriminate three S. enterica subsp. enterica serotypes: Choleraesuis, Enteritidis, and Typhimurium. Using the developed microarray system, three serotype targets were successfully analyzed in a range as low as 1.6 to 3.1 nM and were specifically discriminated from each other without nonspecific signals. In addition, the constructed microarray did not have cross-reactivity with other common pathogenic bacteria and even enabled the clear discrimination of the target Salmonella serotype from a bacterial mixture. Therefore, these results demonstrated that our novel carB-based oligonucleotide microarray can be used as an effective and specific detection system for S. enterica subsp. enterica serotypes.

Rapid and reliable detection and identification of GM events using multiplex PCR coupled with oligonucleotide microarray.

PubMed

Xu, Xiaodan; Li, Yingcong; Zhao, Heng; Wen, Si-yuan; Wang, Sheng-qi; Huang, Jian; Huang, Kun-lun; Luo, Yun-bo

2005-05-18

To devise a rapid and reliable method for the detection and identification of genetically modified (GM) events, we developed a multiplex polymerase chain reaction (PCR) coupled with a DNA microarray system simultaneously aiming at many targets in a single reaction. The system included probes for screening gene, species reference gene, specific gene, construct-specific gene, event-specific gene, and internal and negative control genes. 18S rRNA was combined with species reference genes as internal controls to assess the efficiency of all reactions and to eliminate false negatives. Two sets of the multiplex PCR system were used to amplify four and five targets, respectively. Eight different structure genes could be detected and identified simultaneously for Roundup Ready soybean in a single microarray. The microarray specificity was validated by its ability to discriminate two GM maizes Bt176 and Bt11. The advantages of this method are its high specificity and greatly reduced false-positives and -negatives. The multiplex PCR coupled with microarray technology presented here is a rapid and reliable tool for the simultaneous detection of GM organism ingredients.

Open-target sparse sensing of biological agents using DNA microarray

PubMed Central

2011-01-01

Background Current biosensors are designed to target and react to specific nucleic acid sequences or structural epitopes. These 'target-specific' platforms require creation of new physical capture reagents when new organisms are targeted. An 'open-target' approach to DNA microarray biosensing is proposed and substantiated using laboratory generated data. The microarray consisted of 12,900 25 bp oligonucleotide capture probes derived from a statistical model trained on randomly selected genomic segments of pathogenic prokaryotic organisms. Open-target detection of organisms was accomplished using a reference library of hybridization patterns for three test organisms whose DNA sequences were not included in the design of the microarray probes. Results A multivariate mathematical model based on the partial least squares regression (PLSR) was developed to detect the presence of three test organisms in mixed samples. When all 12,900 probes were used, the model correctly detected the signature of three test organisms in all mixed samples (mean(R2)) = 0.76, CI = 0.95), with a 6% false positive rate. A sampling algorithm was then developed to sparsely sample the probe space for a minimal number of probes required to capture the hybridization imprints of the test organisms. The PLSR detection model was capable of correctly identifying the presence of the three test organisms in all mixed samples using only 47 probes (mean(R2)) = 0.77, CI = 0.95) with nearly 100% specificity. Conclusions We conceived an 'open-target' approach to biosensing, and hypothesized that a relatively small, non-specifically designed, DNA microarray is capable of identifying the presence of multiple organisms in mixed samples. Coupled with a mathematical model applied to laboratory generated data, and sparse sampling of capture probes, the prototype microarray platform was able to capture the signature of each organism in all mixed samples with high sensitivity and specificity. It was demonstrated that this new approach to biosensing closely follows the principles of sparse sensing. PMID:21801424

Development and validation of a mixed-tissue oligonucleotide DNA microarray for Atlantic bluefin tuna, Thunnus thynnus (Linnaeus, 1758).

PubMed

Trumbić, Željka; Bekaert, Michaël; Taggart, John B; Bron, James E; Gharbi, Karim; Mladineo, Ivona

2015-11-25

The largest of the tuna species, Atlantic bluefin tuna (Thunnus thynnus), inhabits the North Atlantic Ocean and the Mediterranean Sea and is considered to be an endangered species, largely a consequence of overfishing. T. thynnus aquaculture, referred to as fattening or farming, is a capture based activity dependent on yearly renewal from the wild. Thus, the development of aquaculture practices independent of wild resources can provide an important contribution towards ensuring security and sustainability of this species in the longer-term. The development of such practices is today greatly assisted by large scale transcriptomic studies. We have used pyrosequencing technology to sequence a mixed-tissue normalised cDNA library, derived from adult T. thynnus. A total of 976,904 raw sequence reads were assembled into 33,105 unique transcripts having a mean length of 893 bases and an N50 of 870. Of these, 33.4% showed similarity to known proteins or gene transcripts and 86.6% of them were matched to the congeneric Pacific bluefin tuna (Thunnus orientalis) genome, compared to 70.3% for the more distantly related Nile tilapia (Oreochromis niloticus) genome. Transcript sequences were used to develop a novel 15 K Agilent oligonucleotide DNA microarray for T. thynnus and comparative tissue gene expression profiles were inferred for gill, heart, liver, ovaries and testes. Functional contrasts were strongest between gills and ovaries. Gills were particularly associated with immune system, signal transduction and cell communication, while ovaries displayed signatures of glycan biosynthesis, nucleotide metabolism, transcription, translation, replication and repair. Sequence data generated from a novel mixed-tissue T. thynnus cDNA library provide an important transcriptomic resource that can be further employed for study of various aspects of T. thynnus ecology and genomics, with strong applications in aquaculture. Tissue-specific gene expression profiles inferred through the use of novel oligo-microarray can serve in the design of new and more focused transcriptomic studies for future research of tuna physiology and assessment of the welfare in a production environment.

[Differential gene expression in incompatible interaction between Lilium regale Wilson and Fusarium oxysporum f. sp. lilii revealed by combined SSH and microarray analysis].

PubMed

Rao, J; Liu, D; Zhang, N; He, H; Ge, F; Chen, C

2014-01-01

Fusarium wilt, caused by a soilborne pathogen Fusarium oxysporum f. sp. lilii, is the major disease of lily (Lilium L.). In order to isolate the genes differentially expressed in a resistant reaction to F. oxysporum in L. regale Wilson, a cDNA library was constructed with L. regale root during F. oxysporum infection using the suppression subtractive hybridization (SSH), and a total of 585 unique expressed sequence tags (ESTs) were obtained. Furthermore, the gene expression profiles in the incompatible interaction between L. regale and F. oxysporum were revealed by oligonucleotide microarray analysis of 585 unique ESTs comparison to the compatible interaction between a susceptible Lilium Oriental Hybrid 'Siberia' and F. oxysporum. The result of expression profile analysis indicated that the genes encoding pathogenesis-related proteins (PRs), antioxidative stress enzymes, secondary metabolism enzymes, transcription factors, signal transduction proteins as well as a large number of unknown genes were involved in early defense response of L. regale to F. oxysporum infection. Moreover, the following quantitative reverse transcription PCR (QRT-PCR) analysis confirmed reliability of the oligonucleotide microarray data. In the present study, isolation of differentially expressed genes in L. regale during response to F. oxysporum helped to uncover the molecular mechanism associated with the resistance of L. regale against F. oxysporum.

Synthesis of 3'-, or 5'-, or internal methacrylamido-modified oligonucleotides

DOEpatents

Golova, Julia B.; Chernov, Boris K.

2010-04-27

New modifiers were synthesized for incorporation of a methacrylic function in 3'-, 5'- and internal positions of oligonucleotides during solid phase synthesis. A modifier was used for synthesis of 5'-methacrylated oligonucleotides for preparation of microarrays by a co-polymerization method.

UniPROBE, update 2015: new tools and content for the online database of protein-binding microarray data on protein-DNA interactions.

PubMed

Hume, Maxwell A; Barrera, Luis A; Gisselbrecht, Stephen S; Bulyk, Martha L

2015-01-01

The Universal PBM Resource for Oligonucleotide Binding Evaluation (UniPROBE) serves as a convenient source of information on published data generated using universal protein-binding microarray (PBM) technology, which provides in vitro data about the relative DNA-binding preferences of transcription factors for all possible sequence variants of a length k ('k-mers'). The database displays important information about the proteins and displays their DNA-binding specificity data in terms of k-mers, position weight matrices and graphical sequence logos. This update to the database documents the growth of UniPROBE since the last update 4 years ago, and introduces a variety of new features and tools, including a new streamlined pipeline that facilitates data deposition by universal PBM data generators in the research community, a tool that generates putative nonbinding (i.e. negative control) DNA sequences for one or more proteins and novel motifs obtained by analyzing the PBM data using the BEEML-PBM algorithm for motif inference. The UniPROBE database is available at http://uniprobe.org. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Detection and identification of intestinal pathogenic bacteria by hybridization to oligonucleotide microarrays

PubMed Central

Jin, Lian-Qun; Li, Jun-Wen; Wang, Sheng-Qi; Chao, Fu-Huan; Wang, Xin-Wei; Yuan, Zheng-Quan

2005-01-01

AIM: To detect the common intestinal pathogenic bacteria quickly and accurately. METHODS: A rapid (<3 h) experimental procedure was set up based upon the gene chip technology. Target genes were amplified and hybridized by oligonucleotide microarrays. RESULTS: One hundred and seventy strains of bacteria in pure culture belonging to 11 genera were successfully discriminated under comparatively same conditions, and a series of specific hybridization maps corresponding to each kind of bacteria were obtained. When this method was applied to 26 divided cultures, 25 (96.2%) were identified. CONCLUSION: Salmonella sp., Escherichia coli, Shigella sp., Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, Proteus sp., Bacillus cereus, Vibrio cholerae, Enterococcus faecalis, Yersinia enterocolitica, and Campylobacter jejuni can be detected and identified by our microarrays. The accuracy, range, and discrimination power of this assay can be continually improved by adding further oligonucleotides to the arrays without any significant increase of complexity or cost. PMID:16437687

Oligonucleotide microarray analysis of apoptosis induced by 15-methoxypinusolidic acid in microglial BV2 cells

PubMed Central

Choi, Y; Lim, SY; Jeong, HS; Koo, KA; Sung, SH; Kim, YC

2009-01-01

Background and purpose: We conducted a genome wide gene expression analysis to explore the biological aspects of 15-methoxypinusolidic acid (15-MPA) isolated from Biota orientalis and tried to confirm the suitability of 15-MPA as a therapeutic candidate for CNS injuries focusing on microglia. Experimental approach: Murine microglial BV2 cells were treated with 15-MPA, and their transcriptome was analysed by using oligonucleotide microarrays. Genes differentially expressed upon 15-MPA treatment were selected for RT-PCR (reverse transcription-polymerase chain reaction) analysis to confirm the gene expression. Inhibition of cell proliferation and induction of apoptosis by 15-MPA were examined by bromodeoxyuridine assay, Western blot analysis of poly-ADP-ribose polymerase and flow cytometry. Key results: A total of 514 genes were differentially expressed by 15-MPA treatment. Biological pathway analysis revealed that 15-MPA induced significant changes in expression of genes in the cell cycle pathway. Genes involved in growth arrest and DNA damage [gadd45α, gadd45γ and ddit3 (DNA damage-inducible transcript 3)] and cyclin-dependent kinase inhibitor (cdkn2b) were up-regulated, whereas genes involved in cell cycle progression (ccnd1, ccnd3 and ccne1), DNA replication (mcm4, orc1l and cdc6) and cell proliferation (fos and jun) were down-regulated. RT-PCR analysis for representative genes confirmed the expression levels. 15-MPA significantly reduced bromodeoxyuridine incorporation, increased poly-ADP-ribose polymerase cleavage and the number of apoptotic cells, indicating that 15-MPA induces apoptosis in BV2 cells. Conclusion and implications: 15-MPA induced apoptosis in murine microglial cells, presumably via inhibition of the cell cycle progression. As microglial activation is detrimental in CNS injuries, these data suggest a strong therapeutic potential of 15-MPA. PMID:19466985

Enzymatic production of 'monoclonal stoichiometric' single-stranded DNA oligonucleotides.

PubMed

Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M; Högberg, Björn

2013-07-01

Single-stranded oligonucleotides are important as research tools, as diagnostic probes, in gene therapy and in DNA nanotechnology. Oligonucleotides are typically produced via solid-phase synthesis, using polymer chemistries that are limited relative to what biological systems produce. The number of errors in synthetic DNA increases with oligonucleotide length, and the resulting diversity of sequences can be a problem. Here we present the 'monoclonal stoichiometric' (MOSIC) method for enzyme-mediated production of DNA oligonucleotides. We amplified oligonucleotides from clonal templates derived from single bacterial colonies and then digested cutter hairpins in the products, which released pools of oligonucleotides with precisely controlled relative stoichiometric ratios. We prepared 14-378-nucleotide MOSIC oligonucleotides either by in vitro rolling-circle amplification or by amplification of phagemid DNA in Escherichia coli. Analyses of the formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides.

BioconductorBuntu: a Linux distribution that implements a web-based DNA microarray analysis server.

PubMed

Geeleher, Paul; Morris, Dermot; Hinde, John P; Golden, Aaron

2009-06-01

BioconductorBuntu is a custom distribution of Ubuntu Linux that automatically installs a server-side microarray processing environment, providing a user-friendly web-based GUI to many of the tools developed by the Bioconductor Project, accessible locally or across a network. System installation is via booting off a CD image or by using a Debian package provided to upgrade an existing Ubuntu installation. In its current version, several microarray analysis pipelines are supported including oligonucleotide, dual-or single-dye experiments, including post-processing with Gene Set Enrichment Analysis. BioconductorBuntu is designed to be extensible, by server-side integration of further relevant Bioconductor modules as required, facilitated by its straightforward underlying Python-based infrastructure. BioconductorBuntu offers an ideal environment for the development of processing procedures to facilitate the analysis of next-generation sequencing datasets. BioconductorBuntu is available for download under a creative commons license along with additional documentation and a tutorial from (http://bioinf.nuigalway.ie).

Assessment of a direct hybridization microarray strategy for comprehensive monitoring of genetically modified organisms (GMOs).

PubMed

Turkec, Aydin; Lucas, Stuart J; Karacanli, Burçin; Baykut, Aykut; Yuksel, Hakki

2016-03-01

Detection of GMO material in crop and food samples is the primary step in GMO monitoring and regulation, with the increasing number of GM events in the world market requiring detection solutions with high multiplexing capacity. In this study, we test the suitability of a high-density oligonucleotide microarray platform for direct, quantitative detection of GMOs found in the Turkish feed market. We tested 1830 different 60nt probes designed to cover the GM cassettes from 12 different GM cultivars (3 soya, 9 maize), as well as plant species-specific and contamination controls, and developed a data analysis method aiming to provide maximum throughput and sensitivity. The system was able specifically to identify each cultivar, and in 10/12 cases was sensitive enough to detect GMO DNA at concentrations of ⩽1%. These GMOs could also be quantified using the microarray, as their fluorescence signals increased linearly with GMO concentration. Copyright © 2015 Elsevier Ltd. All rights reserved.

Enzymatic Production of Monoclonal Stoichiometric Single-Stranded DNA Oligonucleotides

PubMed Central

Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M.; Högberg, Björn

2013-01-01

Single-stranded oligonucleotides are important as research tools as probes for diagnostics and gene therapy. Today, production of oligonucleotides is done via solid-phase synthesis. However, the capabilities of current polymer chemistry are limited in comparison to what can be produced in biological systems. The errors in synthetic DNA increases with oligonucleotide length, and sequence diversity can often be a problem. Here, we present the Monoclonal Stoichiometric (MOSIC) method for enzymatic DNA oligonucleotide production. Using this method, we amplify oligonucleotides from clonal templates followed by digestion of a cutter-hairpin, resulting in pools of monoclonal oligonucleotides with precisely controlled relative stoichiometric ratios. We present data where MOSIC oligonucleotides, 14–378 nt long, were prepared either by in vitro rolling-circle amplification, or by amplification in Escherichia coli in the form of phagemid DNA. The formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides. PMID:23727986

Direct profiling of environmental microbial populations by thermal dissociation analysis of native rRNAs hybridized to oligonucleotide microarrays

NASA Technical Reports Server (NTRS)

El Fantroussi, Said; Urakawa, Hidetoshi; Bernhard, Anne E.; Kelly, John J.; Noble, Peter A.; Smidt, H.; Yershov, G. M.; Stahl, David A.

2003-01-01

Oligonucleotide microarrays were used to profile directly extracted rRNA from environmental microbial populations without PCR amplification. In our initial inspection of two distinct estuarine study sites, the hybridization patterns were reproducible and varied between estuarine sediments of differing salinities. The determination of a thermal dissociation curve (i.e., melting profile) for each probe-target duplex provided information on hybridization specificity, which is essential for confirming adequate discrimination between target and nontarget sequences.

Transcript copy number estimation using a mouse whole-genome oligonucleotide microarray

PubMed Central

Carter, Mark G; Sharov, Alexei A; VanBuren, Vincent; Dudekula, Dawood B; Carmack, Condie E; Nelson, Charlie; Ko, Minoru SH

2005-01-01

The ability to quantitatively measure the expression of all genes in a given tissue or cell with a single assay is an exciting promise of gene-expression profiling technology. An in situ-synthesized 60-mer oligonucleotide microarray designed to detect transcripts from all mouse genes was validated, as well as a set of exogenous RNA controls derived from the yeast genome (made freely available without restriction), which allow quantitative estimation of absolute endogenous transcript abundance. PMID:15998450

Rapid synthesis of DNA-cysteine conjugates for expressed protein ligation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lovrinovic, Marina; Niemeyer, Christof M.

2005-09-30

We report a rapid method for the covalent modification of commercially available amino-modified DNA oligonucleotides with a cysteine moiety. The resulting DNA-cysteine conjugates are versatile reagents for the efficient preparation of covalent DNA-protein conjugates by means of expressed protein ligation (EPL). The EPL method allows for the site-specific coupling of cysteine-modified DNA oligomers with recombinant intein-fusion proteins, the latter of which contain a C-terminal thioester enabling the mild and highly specific reaction with N-terminal cysteine compounds. We prepared a cysteine-modifier reagent in a single-step reaction which allows for the rapid and near quantitative synthesis of cysteine-DNA conjugates. The latter weremore » ligated with the green fluorescent protein mutant EYFP, recombinantly expressed as an intein-fusion protein, allowing for the mild and selective formation of EYFP-DNA conjugates in high yields of about 60%. We anticipate many applications of our approach, ranging from protein microarrays to the arising field of nanobiotechnology.« less

Drop drying on surfaces determines chemical reactivity - the specific case of immobilization of oligonucleotides on microarrays

PubMed Central

2013-01-01

Background Drop drying is a key factor in a wide range of technical applications, including spotted microarrays. The applied nL liquid volume provides specific reaction conditions for the immobilization of probe molecules to a chemically modified surface. Results We investigated the influence of nL and μL liquid drop volumes on the process of probe immobilization and compare the results obtained to the situation in liquid solution. In our data, we observe a strong relationship between drop drying effects on immobilization and surface chemistry. In this work, we present results on the immobilization of dye labeled 20mer oligonucleotides with and without an activating 5′-aminoheptyl linker onto a 2D epoxysilane and a 3D NHS activated hydrogel surface. Conclusions Our experiments identified two basic processes determining immobilization. First, the rate of drop drying that depends on the drop volume and the ambient relative humidity. Oligonucleotides in a dried spot react unspecifically with the surface and long reaction times are needed. 3D hydrogel surfaces allow for immobilization in a liquid environment under diffusive conditions. Here, oligonucleotide immobilization is much faster and a specific reaction with the reactive linker group is observed. Second, the effect of increasing probe concentration as a result of drop drying. On a 3D hydrogel, the increasing concentration of probe molecules in nL spotting volumes accelerates immobilization dramatically. In case of μL volumes, immobilization depends on whether the drop is allowed to dry completely. At non-drying conditions, very limited immobilization is observed due to the low oligonucleotide concentration used in microarray spotting solutions. The results of our study provide a general guideline for microarray assay development. They allow for the initial definition and further optimization of reaction conditions for the immobilization of oligonucleotides and other probe molecule classes to different surfaces in dependence of the applied spotting and reaction volume. PMID:23758982

arrayCGHbase: an analysis platform for comparative genomic hybridization microarrays

PubMed Central

Menten, Björn; Pattyn, Filip; De Preter, Katleen; Robbrecht, Piet; Michels, Evi; Buysse, Karen; Mortier, Geert; De Paepe, Anne; van Vooren, Steven; Vermeesch, Joris; Moreau, Yves; De Moor, Bart; Vermeulen, Stefan; Speleman, Frank; Vandesompele, Jo

2005-01-01

Background The availability of the human genome sequence as well as the large number of physically accessible oligonucleotides, cDNA, and BAC clones across the entire genome has triggered and accelerated the use of several platforms for analysis of DNA copy number changes, amongst others microarray comparative genomic hybridization (arrayCGH). One of the challenges inherent to this new technology is the management and analysis of large numbers of data points generated in each individual experiment. Results We have developed arrayCGHbase, a comprehensive analysis platform for arrayCGH experiments consisting of a MIAME (Minimal Information About a Microarray Experiment) supportive database using MySQL underlying a data mining web tool, to store, analyze, interpret, compare, and visualize arrayCGH results in a uniform and user-friendly format. Following its flexible design, arrayCGHbase is compatible with all existing and forthcoming arrayCGH platforms. Data can be exported in a multitude of formats, including BED files to map copy number information on the genome using the Ensembl or UCSC genome browser. Conclusion ArrayCGHbase is a web based and platform independent arrayCGH data analysis tool, that allows users to access the analysis suite through the internet or a local intranet after installation on a private server. ArrayCGHbase is available at . PMID:15910681

Microelectroporation device for genomic screening

DOEpatents

Perroud, Thomas D.; Renzi, Ronald F.; Negrete, Oscar; Claudnic, Mark R.

2014-09-09

We have developed an microelectroporation device that combines microarrays of oligonucleotides, microfluidic channels, and electroporation for cell transfection and high-throughput screening applications (e.g. RNA interference screens). Microarrays allow the deposition of thousands of different oligonucleotides in microscopic spots. Microfluidic channels and microwells enable efficient loading of cells into the device and prevent cross-contamination between different oligonucleotides spots. Electroporation allows optimal transfection of nucleic acids into cells (especially hard-to-transfect cells such as primary cells) by minimizing cell death while maximizing transfection efficiency. This invention has the advantage of a higher throughput and lower cost, while preventing cross-contamination compared to conventional screening technologies. Moreover, this device does not require bulky robotic liquid handling equipment and is inherently safer given that it is a closed system.

Automation of complex assays: pharmacogenetics of warfarin dosing.

PubMed

Wu, Whei-Kuo; Hujsak, Paul G; Kureshy, Fareed

2007-10-01

AutoGenomics, Inc. (Carlsbad, CA, USA) have developed a multiplex microarray assay for genotyping both VKORC1 and CYP2C9 using the INFINITI(™) Analyzer. Multiple alleles in each DNA sample are analyzed by polymerase chain reaction amplification, followed by detection primer extension using the INFINITI Analyzer. The INFINITI Analyzer performs single-nucleotide polymorphism (SNP) analysis using universal oligonucleotides immobilized on the biochip. To genotype broader ethnic groups, genomic DNA from whole blood was tested for nine SNPs for VKORC1 and six for CYP2C9 genotypes. Information related to all 15 SNPs is needed to determine dosing of population of diverse ethnic origin. The INFINITI system provides genotyping information for same day dosing of warfarin.

AccuTyping: new algorithms for automated analysis of data from high-throughput genotyping with oligonucleotide microarrays

PubMed Central

Hu, Guohong; Wang, Hui-Yun; Greenawalt, Danielle M.; Azaro, Marco A.; Luo, Minjie; Tereshchenko, Irina V.; Cui, Xiangfeng; Yang, Qifeng; Gao, Richeng; Shen, Li; Li, Honghua

2006-01-01

Microarray-based analysis of single nucleotide polymorphisms (SNPs) has many applications in large-scale genetic studies. To minimize the influence of experimental variation, microarray data usually need to be processed in different aspects including background subtraction, normalization and low-signal filtering before genotype determination. Although many algorithms are sophisticated for these purposes, biases are still present. In the present paper, new algorithms for SNP microarray data analysis and the software, AccuTyping, developed based on these algorithms are described. The algorithms take advantage of a large number of SNPs included in each assay, and the fact that the top and bottom 20% of SNPs can be safely treated as homozygous after sorting based on their ratios between the signal intensities. These SNPs are then used as controls for color channel normalization and background subtraction. Genotype calls are made based on the logarithms of signal intensity ratios using two cutoff values, which were determined after training the program with a dataset of ∼160 000 genotypes and validated by non-microarray methods. AccuTyping was used to determine >300 000 genotypes of DNA and sperm samples. The accuracy was shown to be >99%. AccuTyping can be downloaded from . PMID:16982644

DEVELOPMENT AND VALIDATION OF A 2,000 GENE MICROARRAY FOR THE FATHEAD MINNOW, PIMEPHALES PROMELAS

EPA Science Inventory

The development of the gene microarray has provided the field of ecotoxicology a new tool to identify modes of action (MOA) of chemicals and chemical mixtures. Herein we describe the development and application of a 2,000 gene oligonucleotide microarray for the fathead minnow (P...

nuID: a universal naming scheme of oligonucleotides for Illumina, Affymetrix, and other microarrays

PubMed Central

Du, Pan; Kibbe, Warren A; Lin, Simon M

2007-01-01

Background Oligonucleotide probes that are sequence identical may have different identifiers between manufacturers and even between different versions of the same company's microarray; and sometimes the same identifier is reused and represents a completely different oligonucleotide, resulting in ambiguity and potentially mis-identification of the genes hybridizing to that probe. Results We have devised a unique, non-degenerate encoding scheme that can be used as a universal representation to identify an oligonucleotide across manufacturers. We have named the encoded representation 'nuID', for nucleotide universal identifier. Inspired by the fact that the raw sequence of the oligonucleotide is the true definition of identity for a probe, the encoding algorithm uniquely and non-degenerately transforms the sequence itself into a compact identifier (a lossless compression). In addition, we added a redundancy check (checksum) to validate the integrity of the identifier. These two steps, encoding plus checksum, result in an nuID, which is a unique, non-degenerate, permanent, robust and efficient representation of the probe sequence. For commercial applications that require the sequence identity to be confidential, we have an encryption schema for nuID. We demonstrate the utility of nuIDs for the annotation of Illumina microarrays, and we believe it has universal applicability as a source-independent naming convention for oligomers. Reviewers This article was reviewed by Itai Yanai, Rong Chen (nominated by Mark Gerstein), and Gregory Schuler (nominated by David Lipman). PMID:17540033

Homogeneous versus heterogeneous probes for microbial ecological microarrays.

PubMed

Bae, Jin-Woo; Park, Yong-Ha

2006-07-01

Microbial ecological microarrays have been developed for investigating the composition and functions of microorganism communities in environmental niches. These arrays include microbial identification microarrays, which use oligonucleotides, gene fragments or microbial genomes as probes. In this article, the advantages and disadvantages of each type of probe are reviewed. Oligonucleotide probes are currently useful for probing uncultivated bacteria that are not amenable to gene fragment probing, whereas the functional gene fragments amplified randomly from microbial genomes require phylogenetic and hierarchical categorization before use as microbial identification probes, despite their high resolution for both specificity and sensitivity. Until more bacteria are sequenced and gene fragment probes are thoroughly validated, heterogeneous bacterial genome probes will provide a simple, sensitive and quantitative tool for exploring the ecosystem structure.

Emerging Use of Gene Expression Microarrays in Plant Physiology

DOE PAGES

Wullschleger, Stan D.; Difazio, Stephen P.

2003-01-01

Microarrays have become an important technology for the global analysis of gene expression in humans, animals, plants, and microbes. Implemented in the context of a well-designed experiment, cDNA and oligonucleotide arrays can provide highthroughput, simultaneous analysis of transcript abundance for hundreds, if not thousands, of genes. However, despite widespread acceptance, the use of microarrays as a tool to better understand processes of interest to the plant physiologist is still being explored. To help illustrate current uses of microarrays in the plant sciences, several case studies that we believe demonstrate the emerging application of gene expression arrays in plant physiology weremore » selected from among the many posters and presentations at the 2003 Plant and Animal Genome XI Conference. Based on this survey, microarrays are being used to assess gene expression in plants exposed to the experimental manipulation of air temperature, soil water content and aluminium concentration in the root zone. Analysis often includes characterizing transcript profiles for multiple post-treatment sampling periods and categorizing genes with common patterns of response using hierarchical clustering techniques. In addition, microarrays are also providing insights into developmental changes in gene expression associated with fibre and root elongation in cotton and maize, respectively. Technical and analytical limitations of microarrays are discussed and projects attempting to advance areas of microarray design and data analysis are highlighted. Finally, although much work remains, we conclude that microarrays are a valuable tool for the plant physiologist interested in the characterization and identification of individual genes and gene families with potential application in the fields of agriculture, horticulture and forestry.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Zhen; Department of Biochemistry and Molecular Biology, Program in Molecular Cell Biology, Zhejiang University School of Medicine, Hangzhou, Zhejiang 310058; Xiang, Wenqing

Highlights: {yields} LNA-modified oligonucleotides can pass through the plasma membrane of cultured cells even without using transfection machinery. {yields} LNA-modified oligonucleotides passed efficiently across the cell membrane, and lipid-coating facilitated translocation from the cytoplasm to the nucleus. {yields} LNA-oligonucleotide designed to target nuclear HBV DNA efficiently suppresses HBV replication and transcription in cultured hepatic cells. -- Abstract: Silencing target genes with small regulatory RNAs is widely used to investigate gene function and therapeutic drug development. Recently, triplex-based approaches have provided another attractive means to achieve targeted gene regulation and gene manipulation at the molecular and cellular levels. Nuclear entry ofmore » oligonucleotides and enhancement of their affinity to the DNA targets are key points of such approaches. In this study, we developed lipid-based transport of a locked-nucleic-acid (LNA)-modified oligonucleotide for hepatitis B virus (HBV) DNA interference in human hepatocytes expressing HBV genomic DNA. In these cells, the LNA-modified oligonucleotides passed efficiently across the cell membrane, and lipid-coating facilitated translocation from the cytoplasm to the nucleus. The oligonucleotide specifically targeting HBV DNA clearly interfered with HBV DNA transcription as shown by a block in pregenomic RNA (pgRNA) production. The HBV DNA-targeted oligonucleotide suppressed HBV DNA replication and HBV protein production more efficiently than small interfering RNAs directed to the pgRNA. These results demonstrate that fusion with lipid can carry LNA-modified oligonucleotides to the nucleus where they regulate gene expression. Interfering with HBV DNA transcription by LNA-modified oligonucleotides has strong potential as a new strategy for HBV inhibition.« less

Characterization of Antimicrobial Resistance Patterns and Detection of Virulence Genes in Campylobacter Isolates in Italy

PubMed Central

Di Giannatale, Elisabetta; Di Serafino, Gabriella; Zilli, Katiuscia; Alessiani, Alessandra; Sacchini, Lorena; Garofolo, Giuliano; Aprea, Giuseppe; Marotta, Francesca

2014-01-01

Campylobacter has developed resistance to several antimicrobial agents over the years, including macrolides, quinolones and fluoroquinolones, becoming a significant public health hazard. A total of 145 strains derived from raw milk, chicken faeces, chicken carcasses, cattle faeces and human faeces collected from various Italian regions, were screened for antimicrobial susceptibility, molecular characterization (SmaI pulsed-field gel electrophoresis) and detection of virulence genes (sequencing and DNA microarray analysis). The prevalence of C. jejuni and C. coli was 62.75% and 37.24% respectively. Antimicrobial susceptibility revealed a high level of resistance for ciprofloxacin (62.76%), tetracycline (55.86%) and nalidixic acid (55.17%). Genotyping of Campylobacter isolates using PFGE revealed a total of 86 unique SmaI patterns. Virulence gene profiles were determined using a new microbial diagnostic microarray composed of 70-mer oligonucleotide probes targeting genes implicated in Campylobacter pathogenicity. Correspondence between PFGE and microarray clusters was observed. Comparisons of PFGE and virulence profiles reflected the high genetic diversity of the strains examined, leading us to speculate different degrees of pathogenicity inside Campylobacter populations. PMID:24556669

Characterization of antimicrobial resistance patterns and detection of virulence genes in Campylobacter isolates in Italy.

PubMed

Di Giannatale, Elisabetta; Di Serafino, Gabriella; Zilli, Katiuscia; Alessiani, Alessandra; Sacchini, Lorena; Garofolo, Giuliano; Aprea, Giuseppe; Marotta, Francesca

2014-02-19

Campylobacter has developed resistance to several antimicrobial agents over the years, including macrolides, quinolones and fluoroquinolones, becoming a significant public health hazard. A total of 145 strains derived from raw milk, chicken faeces, chicken carcasses, cattle faeces and human faeces collected from various Italian regions, were screened for antimicrobial susceptibility, molecular characterization (SmaI pulsed-field gel electrophoresis) and detection of virulence genes (sequencing and DNA microarray analysis). The prevalence of C. jejuni and C. coli was 62.75% and 37.24% respectively. Antimicrobial susceptibility revealed a high level of resistance for ciprofloxacin (62.76%), tetracycline (55.86%) and nalidixic acid (55.17%). Genotyping of Campylobacter isolates using PFGE revealed a total of 86 unique SmaI patterns. Virulence gene profiles were determined using a new microbial diagnostic microarray composed of 70-mer oligonucleotide probes targeting genes implicated in Campylobacter pathogenicity. Correspondence between PFGE and microarray clusters was observed. Comparisons of PFGE and virulence profiles reflected the high genetic diversity of the strains examined, leading us to speculate different degrees of pathogenicity inside Campylobacter populations.

The GermOnline cross-species systems browser provides comprehensive information on genes and gene products relevant for sexual reproduction.

PubMed

Gattiker, Alexandre; Niederhauser-Wiederkehr, Christa; Moore, James; Hermida, Leandro; Primig, Michael

2007-01-01

We report a novel release of the GermOnline knowledgebase covering genes relevant for the cell cycle, gametogenesis and fertility. GermOnline was extended into a cross-species systems browser including information on DNA sequence annotation, gene expression and the function of gene products. The database covers eight model organisms and Homo sapiens, for which complete genome annotation data are available. The database is now built around a sophisticated genome browser (Ensembl), our own microarray information management and annotation system (MIMAS) used to extensively describe experimental data obtained with high-density oligonucleotide microarrays (GeneChips) and a comprehensive system for online editing of database entries (MediaWiki). The RNA data include results from classical microarrays as well as tiling arrays that yield information on RNA expression levels, transcript start sites and lengths as well as exon composition. Members of the research community are solicited to help GermOnline curators keep database entries on genes and gene products complete and accurate. The database is accessible at http://www.germonline.org/.

Microfabricated Fountain Pens for High-Density DNA Arrays

PubMed Central

Reese, Matthew O.; van Dam, R. Michae; Scherer, Axel; Quake, Stephen R.

2003-01-01

We used photolithographic microfabrication techniques to create very small stainless steel fountain pens that were installed in place of conventional pens on a microarray spotter. Because of the small feature size produced by the microfabricated pens, we were able to print arrays with up to 25,000 spots/cm2, significantly higher than can be achieved by other deposition methods. This feature density is sufficiently large that a standard microscope slide can contain multiple replicates of every gene in a complex organism such as a mouse or human. We tested carryover during array printing with dye solution, labeled DNA, and hybridized DNA, and we found it to be indistinguishable from background. Hybridization also showed good sequence specificity to printed oligonucleotides. In addition to improved slide capacity, the microfabrication process offers the possibility of low-cost mass-produced pens and the flexibility to include novel pen features that cannot be machined with conventional techniques. PMID:12975313

Microarray analysis of genes associated with cell surface NIS protein levels in breast cancer.

PubMed

Beyer, Sasha J; Zhang, Xiaoli; Jimenez, Rafael E; Lee, Mei-Ling T; Richardson, Andrea L; Huang, Kun; Jhiang, Sissy M

2011-10-11

Na+/I- symporter (NIS)-mediated iodide uptake allows radioiodine therapy for thyroid cancer. NIS is also expressed in breast tumors, raising potential for radionuclide therapy of breast cancer. However, NIS expression in most breast cancers is low and may not be sufficient for radionuclide therapy. We aimed to identify biomarkers associated with NIS expression such that mechanisms underlying NIS modulation in human breast tumors may be elucidated. Published oligonucleotide microarray data within the National Center for Biotechnology Information Gene Expression Omnibus database were analyzed to identify gene expression tightly correlated with NIS mRNA level among human breast tumors. NIS immunostaining was performed in a tissue microarray composed of 28 human breast tumors which had corresponding oligonucleotide microarray data available for each tumor such that gene expression associated with cell surface NIS protein level could be identified. NIS mRNA levels do not vary among breast tumors or when compared to normal breast tissues when detected by Affymetrix oligonucleotide microarray platforms. Cell surface NIS protein levels are much more variable than their corresponding NIS mRNA levels. Despite a limited number of breast tumors examined, our analysis identified cysteinyl-tRNA synthetase as a biomarker that is highly associated with cell surface NIS protein levels in the ER-positive breast cancer subtype. Further investigation on genes associated with cell surface NIS protein levels within each breast cancer molecular subtype may lead to novel targets for selectively increasing NIS expression/function in a subset of breast cancers patients.

sigReannot: an oligo-set re-annotation pipeline based on similarities with the Ensembl transcripts and Unigene clusters.

PubMed

Casel, Pierrot; Moreews, François; Lagarrigue, Sandrine; Klopp, Christophe

2009-07-16

Microarray is a powerful technology enabling to monitor tens of thousands of genes in a single experiment. Most microarrays are now using oligo-sets. The design of the oligo-nucleotides is time consuming and error prone. Genome wide microarray oligo-sets are designed using as large a set of transcripts as possible in order to monitor as many genes as possible. Depending on the genome sequencing state and on the assembly state the knowledge of the existing transcripts can be very different. This knowledge evolves with the different genome builds and gene builds. Once the design is done the microarrays are often used for several years. The biologists working in EADGENE expressed the need of up-to-dated annotation files for the oligo-sets they share including information about the orthologous genes of model species, the Gene Ontology, the corresponding pathways and the chromosomal location. The results of SigReannot on a chicken micro-array used in the EADGENE project compared to the initial annotations show that 23% of the oligo-nucleotide gene annotations were not confirmed, 2% were modified and 1% were added. The interest of this up-to-date annotation procedure is demonstrated through the analysis of real data previously published. SigReannot uses the oligo-nucleotide design procedure criteria to validate the probe-gene link and the Ensembl transcripts as reference for annotation. It therefore produces a high quality annotation based on reference gene sets.

Simple and rapid enzymatic method for the synthesis of single-strand oligonucleotides containing trifluorothymidine.

PubMed

Suzuki, Norihiko; Fukushima, Masakazu

2010-11-01

To investigate the mechanism of trifluorothymidine (TFT)-induced DNA damage, we developed an enzymatic method for the synthesis of single-strand oligonucleotides containing TFT-monophosphate residues. Sixteen-mer oligonucleotides and 14-mer 5'-phosphorylated oligonucleotides were annealed to the template of 25-mer, so as to empty one nucleotide site. TFT-triphosphate was incorporated into the site by DNA polymerase and then ligated to 5'-phosphorylated oligonucleotides by DNA ligase. The synthesized 31-mer oligonucleotides containing TFT residues were isolated from the 25-mer complementary template by denaturing polyacrylamide electrophoresis. Using these single-strand oligonucleotides containing TFT residues, the cleavage of TFT residues from DNA, using mismatch uracil-DNA glycosylase (MUG) of E.coli origin, was compared with that of 5-fluorouracil (5FU) and 5-bromodeoxyuridine (BrdU). The TFT/A pair was not cleaved by MUG, while the other pairs, namely, 5FU/A, 5FU/G, BrdU/A, BrdU/G, and TFT/G, were easily cleaved from each synthesized DNA. Thus, this method is useful for obtaining some site-specifically modified oligonucleotides.

Genomic Analysis of Vaccine-Derived Poliovirus Strains in Stool Specimens by Combination of Full-Length PCR and Oligonucleotide Microarray Hybridization

PubMed Central

Laassri, Majid; Dragunsky, Eugenia; Enterline, Joan; Eremeeva, Tatiana; Ivanova, Olga; Lottenbach, Kathleen; Belshe, Robert; Chumakov, Konstantin

2005-01-01

Sabin strains of poliovirus used in the manufacture of oral poliovirus vaccine (OPV) are prone to genetic variations that occur during growth in cell cultures and the organisms of vaccine recipients. Such derivative viruses often have increased neurovirulence and transmissibility, and in some cases they can reestablish chains of transmission in human populations. Monitoring for vaccine-derived polioviruses is an important part of the worldwide campaign to eradicate poliomyelitis. Analysis of vaccine-derived polioviruses requires, as a first step, their isolation in cell cultures, which takes significant time and may yield viral stocks that are not fully representative of the strains present in the original sample. Here we demonstrate that full-length viral cDNA can be PCR amplified directly from stool samples and immediately subjected to genomic analysis by oligonucleotide microarray hybridization and nucleotide sequencing. Most fecal samples from healthy children who received OPV were found to contain variants of Sabin vaccine viruses. Sequence changes in the 5′ untranslated region were common, as were changes in the VP1-coding region, including changes in a major antigenic site. Analysis of stool samples taken from cases of acute flaccid paralysis revealed the presence of mixtures of recombinant polioviruses, in addition to the emergence of new sequence variants. Avoiding the need for cell culture isolation dramatically shortened the time needed for identification and analysis of vaccine-derived polioviruses and could be useful for preliminary screening of clinical samples. The amplified full-length viral cDNA can be archived and used to recover live virus for further virological studies. PMID:15956413

Oligonucleotide microarray for subtyping of influenza A viruses

NASA Astrophysics Data System (ADS)

Klotchenko, S. A.; Vasin, A. V.; Sandybaev, N. T.; Plotnikova, M. A.; Chervyakova, O. V.; Smirnova, E. A.; Kushnareva, E. V.; Strochkov, V. M.; Taylakova, E. T.; Egorov, V. V.; Koshemetov, J. K.; Kiselev, O. I.; Sansyzbay, A. R.

2012-02-01

Influenza is one of the most widespread respiratory viral diseases, infecting humans, horses, pigs, poultry and some other animal populations. Influenza A viruses (IAV) are classified into subtypes on the basis of the surface hemagglutinin (H1 to H16) and neuraminidase (N1 to N9) glycoproteins. The correct determination of IAV subtype is necessary for clinical and epidemiological studies. In this article we propose an oligonucleotide microarray for subtyping of IAV using universal one-step multisegment RT-PCR fluorescent labeling of viral gene segments. It showed to be an advanced approach for fast detection and identification of IAV.

16S rRNA gene-based phylogenetic microarray for simultaneous identification of members of the genus Burkholderia.

PubMed

Schönmann, Susan; Loy, Alexander; Wimmersberger, Céline; Sobek, Jens; Aquino, Catharine; Vandamme, Peter; Frey, Beat; Rehrauer, Hubert; Eberl, Leo

2009-04-01

For cultivation-independent and highly parallel analysis of members of the genus Burkholderia, an oligonucleotide microarray (phylochip) consisting of 131 hierarchically nested 16S rRNA gene-targeted oligonucleotide probes was developed. A novel primer pair was designed for selective amplification of a 1.3 kb 16S rRNA gene fragment of Burkholderia species prior to microarray analysis. The diagnostic performance of the microarray for identification and differentiation of Burkholderia species was tested with 44 reference strains of the genera Burkholderia, Pandoraea, Ralstonia and Limnobacter. Hybridization patterns based on presence/absence of probe signals were interpreted semi-automatically using the novel likelihood-based strategy of the web-tool Phylo- Detect. Eighty-eight per cent of the reference strains were correctly identified at the species level. The evaluated microarray was applied to investigate shifts in the Burkholderia community structure in acidic forest soil upon addition of cadmium, a condition that selected for Burkholderia species. The microarray results were in agreement with those obtained from phylogenetic analysis of Burkholderia 16S rRNA gene sequences recovered from the same cadmiumcontaminated soil, demonstrating the value of the Burkholderia phylochip for determinative and environmental studies.

ASSESSING THE USE OF OLIGONUCLEOTIDE MICROARRAYS FOR FATHEAD MINNOW (PIMEPHALES PROMELAS) TO EXAMINE EXPOSURE VARIABLES

EPA Science Inventory

Microarray technology has proven to be a useful tool for analyzing the transcriptome of various organisms representing conditions such as disease states, developmental stages, and responses to chemical exposure. Although most commercially available arrays are limited to organism...

Evaluation of chronic lymphocytic leukemia by oligonucleotide-based microarray analysis uncovers novel aberrations not detected by FISH or cytogenetic analysis

PubMed Central

2011-01-01

Background Cytogenetic evaluation is a key component of the diagnosis and prognosis of chronic lymphocytic leukemia (CLL). We performed oligonucleotide-based comparative genomic hybridization microarray analysis on 34 samples with CLL and known abnormal karyotypes previously determined by cytogenetics and/or fluorescence in situ hybridization (FISH). Results Using a custom designed microarray that targets >1800 genes involved in hematologic disease and other malignancies, we identified additional cryptic aberrations and novel findings in 59% of cases. These included gains and losses of genes associated with cell cycle regulation, apoptosis and susceptibility loci on 3p21.31, 5q35.2q35.3, 10q23.31q23.33, 11q22.3, and 22q11.23. Conclusions Our results show that microarray analysis will detect known aberrations, including microscopic and cryptic alterations. In addition, novel genomic changes will be uncovered that may become important prognostic predictors or treatment targets for CLL in the future. PMID:22087757

Particle-Based Microarrays of Oligonucleotides and Oligopeptides.

PubMed

Nesterov-Mueller, Alexander; Maerkle, Frieder; Hahn, Lothar; Foertsch, Tobias; Schillo, Sebastian; Bykovskaya, Valentina; Sedlmayr, Martyna; Weber, Laura K; Ridder, Barbara; Soehindrijo, Miriam; Muenster, Bastian; Striffler, Jakob; Bischoff, F Ralf; Breitling, Frank; Loeffler, Felix F

2014-10-28

In this review, we describe different methods of microarray fabrication based on the use of micro-particles/-beads and point out future tendencies in the development of particle-based arrays. First, we consider oligonucleotide bead arrays, where each bead is a carrier of one specific sequence of oligonucleotides. This bead-based array approach, appearing in the late 1990s, enabled high-throughput oligonucleotide analysis and had a large impact on genome research. Furthermore, we consider particle-based peptide array fabrication using combinatorial chemistry. In this approach, particles can directly participate in both the synthesis and the transfer of synthesized combinatorial molecules to a substrate. Subsequently, we describe in more detail the synthesis of peptide arrays with amino acid polymer particles, which imbed the amino acids inside their polymer matrix. By heating these particles, the polymer matrix is transformed into a highly viscous gel, and thereby, imbedded monomers are allowed to participate in the coupling reaction. Finally, we focus on combinatorial laser fusing of particles for the synthesis of high-density peptide arrays. This method combines the advantages of particles and combinatorial lithographic approaches.

Particle-Based Microarrays of Oligonucleotides and Oligopeptides

PubMed Central

Nesterov-Mueller, Alexander; Maerkle, Frieder; Hahn, Lothar; Foertsch, Tobias; Schillo, Sebastian; Bykovskaya, Valentina; Sedlmayr, Martyna; Weber, Laura K.; Ridder, Barbara; Soehindrijo, Miriam; Muenster, Bastian; Striffler, Jakob; Bischoff, F. Ralf; Breitling, Frank; Loeffler, Felix F.

2014-01-01

In this review, we describe different methods of microarray fabrication based on the use of micro-particles/-beads and point out future tendencies in the development of particle-based arrays. First, we consider oligonucleotide bead arrays, where each bead is a carrier of one specific sequence of oligonucleotides. This bead-based array approach, appearing in the late 1990s, enabled high-throughput oligonucleotide analysis and had a large impact on genome research. Furthermore, we consider particle-based peptide array fabrication using combinatorial chemistry. In this approach, particles can directly participate in both the synthesis and the transfer of synthesized combinatorial molecules to a substrate. Subsequently, we describe in more detail the synthesis of peptide arrays with amino acid polymer particles, which imbed the amino acids inside their polymer matrix. By heating these particles, the polymer matrix is transformed into a highly viscous gel, and thereby, imbedded monomers are allowed to participate in the coupling reaction. Finally, we focus on combinatorial laser fusing of particles for the synthesis of high-density peptide arrays. This method combines the advantages of particles and combinatorial lithographic approaches. PMID:27600347

Differentiation of the seven major lyssavirus species by oligonucleotide microarray.

PubMed

Xi, Jin; Guo, Huancheng; Feng, Ye; Xu, Yunbin; Shao, Mingfu; Su, Nan; Wan, Jiayu; Li, Jiping; Tu, Changchun

2012-03-01

An oligonucleotide microarray, LyssaChip, has been developed and verified as a highly specific diagnostic tool for differentiation of the 7 major lyssavirus species. As with conventional typing microarray methods, the LyssaChip relies on sequence differences in the 371-nucleotide region coding for the nucleoprotein. This region was amplified using nested reverse transcription-PCR primers that bind to the 7 major lyssaviruses. The LyssaChip includes 57 pairs of species typing and corresponding control oligonucleotide probes (oligoprobes) immobilized on glass slides, and it can analyze 12 samples on a single slide within 8 h. Analysis of 111 clinical brain specimens (65 from animals with suspected rabies submitted to the laboratory and 46 of butchered dog brain tissues collected from restaurants) showed that the chip method was 100% sensitive and highly consistent with the "gold standard," a fluorescent antibody test (FAT). The chip method could detect rabies virus in highly decayed brain tissues, whereas the FAT did not, and therefore the chip test may be more applicable to highly decayed brain tissues than the FAT. LyssaChip may provide a convenient and inexpensive alternative for diagnosis and differentiation of rabies and rabies-related diseases.

Synthesis, properties, and NMR studies of a C8-phenylguanine modified oligonucleotide that preferentially adopts the Z DNA conformation.

PubMed

Gannett, Peter M; Heavner, Sue; Daft, Jonathan R; Shaughnessy, Kevin H; Epperson, Jon D; Greenbaum, Nancy L

2003-10-01

Carcinogenic aryl hydrazines produce C8-arylated purine adducts. The effect of these adducts on DNA conformation and their role in hydrazine carcinogenesis are unknown. Here, we describe a new synthetic route to produce these adducts that is also compatible with the synthesis of the corresponding phosphoramidites needed for oligonucleotide synthesis. Two oligonucleotides were prepared, an unmodified oligonucleotide, d((5)(')CGCGCGCGCG(3)(')), and a C8-phenylguanine modified oligonucleotide, d((5)(')CGCGCGCGCG(3)(')) (G = 8-phenylguanine). These oligonucleotides were compared using thermal denaturation, circular dichroism, NMR, and molecular modeling. The phenyl modification destabilizes the B DNA form and stabilizes the Z DNA form such that the B:Z ratio is near one under physiological conditions. In light of recent studies that show a role for Z DNA in gene expression and cell transformation, Z DNA stabilization by C8-arylguanine formation from aryl hydrazines may be relevant to their role in carcinogenesis.

Efficient self-assembly of DNA-functionalized fluorophores and gold nanoparticles with DNA functionalized silicon surfaces: the effect of oligomer spacers

PubMed Central

Milton, James A.; Patole, Samson; Yin, Huabing; Xiao, Qiang; Brown, Tom; Melvin, Tracy

2013-01-01

Although strategies for the immobilization of DNA oligonucleotides onto surfaces for bioanalytical and top-down bio-inspired nanobiofabrication approaches are well developed, the effect of introducing spacer molecules between the surface and the DNA oligonucleotide for the hybridization of nanoparticle–DNA conjugates has not been previously assessed in a quantitative manner. The hybridization efficiency of DNA oligonucleotides end-labelled with gold nanoparticles (1.4 or 10 nm diameter) with DNA sequences conjugated to silicon surfaces via hexaethylene glycol phosphate diester oligomer spacers (0, 1, 2, 6 oligomers) was found to be independent of spacer length. To quantify both the density of DNA strands attached to the surfaces and hybridization with the surface-attached DNA, new methodologies have been developed. Firstly, a simple approach based on fluorescence has been developed for determination of the immobilization density of DNA oligonucleotides. Secondly, an approach using mass spectrometry has been created to establish (i) the mean number of DNA oligonucleotides attached to the gold nanoparticles and (ii) the hybridization density of nanoparticle–oligonucleotide conjugates with the silicon surface–attached complementary sequence. These methods and results will be useful for application with nanosensors, the self-assembly of nanoelectronic devices and the attachment of nanoparticles to biomolecules for single-molecule biophysical studies. PMID:23361467

Automated detection and quantitation of bacterial RNA by using electrical microarrays.

PubMed

Elsholz, B; Wörl, R; Blohm, L; Albers, J; Feucht, H; Grunwald, T; Jürgen, B; Schweder, T; Hintsche, Rainer

2006-07-15

Low-density electrical 16S rRNA specific oligonucleotide microarrays and an automated analysis system have been developed for the identification and quantitation of pathogens. The pathogens are Escherichia coli, Pseudomonas aeruginosa, Enterococcus faecalis, Staphylococcus aureus, and Staphylococcus epidermidis, which are typically involved in urinary tract infections. Interdigitated gold array electrodes (IDA-electrodes), which have structures in the nanometer range, have been used for very sensitive analysis. Thiol-modified oligonucleotides are immobilized on the gold IDA as capture probes. They mediate the specific recognition of the target 16S rRNA by hybridization. Additionally three unlabeled oligonucleotides are hybridized in close proximity to the capturing site. They are supporting molecules, because they improve the RNA hybridization at the capturing site. A biotin labeled detector oligonucleotide is also allowed to hybridize to the captured RNA sequence. The biotin labels enable the binding of avidin alkaline phophatase conjugates. The phosphatase liberates the electrochemical mediator p-aminophenol from its electrically inactive phosphate derivative. The electrical signals were generated by amperometric redox cycling and detected by a unique multipotentiostat. The read out signals of the microarray are position specific current and change over time in proportion to the analyte concentration. If two additional biotins are introduced into the affinity binding complex via the supporting oligonucleotides, the sensitivity of the assays increase more than 60%. The limit of detection of Escherichia coli total RNA has been determined to be 0.5 ng/microL. The control of fluidics for variable assay formats as well as the multichannel electrical read out and data handling have all been fully automated. The fast and easy procedure does not require any amplification of the targeted nucleic acids by PCR.

Genomic resources for Myzus persicae: EST sequencing, SNP identification, and microarray design

PubMed Central

Ramsey, John S; Wilson, Alex CC; de Vos, Martin; Sun, Qi; Tamborindeguy, Cecilia; Winfield, Agnese; Malloch, Gaynor; Smith, Dawn M; Fenton, Brian; Gray, Stewart M; Jander, Georg

2007-01-01

Background The green peach aphid, Myzus persicae (Sulzer), is a world-wide insect pest capable of infesting more than 40 plant families, including many crop species. However, despite the significant damage inflicted by M. persicae in agricultural systems through direct feeding damage and by its ability to transmit plant viruses, limited genomic information is available for this species. Results Sequencing of 16 M. persicae cDNA libraries generated 26,669 expressed sequence tags (ESTs). Aphids for library construction were raised on Arabidopsis thaliana, Nicotiana benthamiana, Brassica oleracea, B. napus, and Physalis floridana (with and without Potato leafroll virus infection). The M. persicae cDNA libraries include ones made from sexual and asexual whole aphids, guts, heads, and salivary glands. In silico comparison of cDNA libraries identified aphid genes with tissue-specific expression patterns, and gene expression that is induced by feeding on Nicotiana benthamiana. Furthermore, 2423 genes that are novel to science and potentially aphid-specific were identified. Comparison of cDNA data from three aphid lineages identified single nucleotide polymorphisms that can be used as genetic markers and, in some cases, may represent functional differences in the protein products. In particular, non-conservative amino acid substitutions in a highly expressed gut protease may be of adaptive significance for M. persicae feeding on different host plants. The Agilent eArray platform was used to design an M. persicae oligonucleotide microarray representing over 10,000 unique genes. Conclusion New genomic resources have been developed for M. persicae, an agriculturally important insect pest. These include previously unknown sequence data, a collection of expressed genes, molecular markers, and a DNA microarray that can be used to study aphid gene expression. These resources will help elucidate the adaptations that allow M. persicae to develop compatible interactions with its host plants, complementing ongoing work illuminating plant molecular responses to phloem-feeding insects. PMID:18021414

NMR of enzymatically synthesized uniformly 13C15N-labeled DNA oligonucleotides.

PubMed Central

Zimmer, D P; Crothers, D M

1995-01-01

A procedure for the enzymatic synthesis of uniformly 13C15N-labeled DNA oligonucleotides in milligram quantities for NMR studies is described. Deoxynucleotides obtained from microorganisms grown on 13C and 15N nutrient sources are enzymatically phosphorylated to dNTPs, and the dNTPs are incorporated into oligonucleotides using a 3'-5' exonuclease-deficient mutant of Klenow fragment of DNA polymerase I and an oligonucleotide template primer designed for efficient separation of labeled product DNA from unlabeled template. The labeling strategy has been used to uniformly label one or the other oligonucleotide strand in the DNA duplex dGGCAAAACGG.dCCGTTTTGCC in order to facilitate assignment and structure determination by NMR. Application of 15N and 13C heteronuclear NMR experiments to isotopically labeled DNA is presented. Images Fig. 2 Fig. 3 Fig. 4 PMID:7724521

Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

PubMed

Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

2004-03-01

A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick base pair in SECIS element plays an important role in the selenocysteine expression by UGA codon.

Label-Free Potentiometry for Detecting DNA Hybridization Using Peptide Nucleic Acid and DNA Probes

PubMed Central

Goda, Tatsuro; Singi, Ankit Balram; Maeda, Yasuhiro; Matsumoto, Akira; Torimura, Masaki; Aoki, Hiroshi; Miyahara, Yuji

2013-01-01

Peptide nucleic acid (PNA) has outstanding affinity over DNA for complementary nucleic acid sequences by forming a PNA-DNA heterodimer upon hybridization via Watson-Crick base-pairing. To verify whether PNA probes on an electrode surface enhance sensitivity for potentiometric DNA detection or not, we conducted a comparative study on the hybridization of PNA and DNA probes on the surface of a 10-channel gold electrodes microarray. Changes in the charge density as a result of hybridization at the solution/electrode interface on the self-assembled monolayer (SAM)-formed microelectrodes were directly transformed into potentiometric signals using a high input impedance electrometer. The charge readout allows label-free, reagent-less, and multi-parallel detection of target oligonucleotides without any optical assistance. The differences in the probe lengths between 15- to 22-mer dramatically influenced on the sensitivity of the PNA and DNA sensors. Molecular type of the capturing probe did not affect the degree of potential shift. Theoretical model for charged rod-like duplex using the Gouy-Chapman equation indicates the dominant effect of electrostatic attractive forces between anionic DNA and underlying electrode at the electrolyte/electrode interface in the potentiometry. PMID:23435052

Derivation of Tissue-specific Functional Gene Sets to Aid Transcriptomic Analysis of Chemical Impacts on the Teleost Reproductive Axis.

EPA Science Inventory

Oligonucleotide microarrays are a powerful tool for unsupervised analysis of chemical impacts on biological systems. However, the lack of well annotated biological pathways for many aquatic organisms, including fish, and the poor power of microarray-based analyses to detect diffe...

Part-per-trillion level detection of estradiol by competitive fluorescence immunoassay using DNA/dye conjugate as antibody multiple labels.

PubMed

Zhu, Shengchao; Zhang, Qin; Guo, Liang-Hong

2008-08-22

Fluorescent organic dyes are currently the standard signal-generating labels used in microarray quantification. However, new labeling strategies are needed to meet the demand for high sensitivity in the detection of low-abundance proteins and small molecules. In this report, a long-chain DNA/dye conjugate was used to attach multiple fluorescence labels on antibodies to improve signal intensity and immunoassay sensitivity. Compared with the 30 base-pair (bp) oligonucleotide used in our previous work [Q. Zhang, L.-H. Guo, Bioconjugate Chem. 18 (2007) 1668-1672], conjugation of a 219 bp DNA in solution with a fluorescent DNA binder SYBR Green I resulted in more than sixfold increase in signal intensity, consistent with the increase in bp number. In a direct immunoassay for the detection of goat anti-mouse IgG in a mouse IgG-coated 96-well plate, the long DNA conjugate label also produced higher fluorescence than the short one, accompanied by about 15-fold improvement in the detection limit. To demonstrate its advantage in real applications, the DNA/dye conjugate was employed in the competitive immunoassay of 17beta-estradiol, a clinically and environmentally important analyte. The biotin-terminated DNA was attached to biotinylated anti-estradiol antibody through the biotin/streptavidin/biotin bridge after the immuno-reaction was completed, followed by conjugation with SYBR Green I. The limit of detection for 17beta-estradiol is 1.9 pg mL(-1), which is 200-fold lower than the assay using fluorescein-labeled antibodies. The new multiple labeling strategy uses readily available reagents, and is also compatible with current biochip platform. It has great potential in the sensitive detection of protein and antibody microarrays.

Construction and Validation of the Rhodobacter sphaeroides 2.4.1 DNA Microarray: Transcriptome Flexibility at Diverse Growth Modes

PubMed Central

Pappas, Christopher T.; Sram, Jakub; Moskvin, Oleg V.; Ivanov, Pavel S.; Mackenzie, R. Christopher; Choudhary, Madhusudan; Land, Miriam L.; Larimer, Frank W.; Kaplan, Samuel; Gomelsky, Mark

2004-01-01

A high-density oligonucleotide DNA microarray, a genechip, representing the 4.6-Mb genome of the facultative phototrophic proteobacterium, Rhodobacter sphaeroides 2.4.1, was custom-designed and manufactured by Affymetrix, Santa Clara, Calif. The genechip contains probe sets for 4,292 open reading frames (ORFs), 47 rRNA and tRNA genes, and 394 intergenic regions. The probe set sequences were derived from the genome annotation generated by Oak Ridge National Laboratory after extensive revision, which was based primarily upon codon usage characteristic of this GC-rich bacterium. As a result of the revision, numerous missing ORFs were uncovered, nonexistent ORFs were deleted, and misidentified start codons were corrected. To evaluate R. sphaeroides transcriptome flexibility, expression profiles for three diverse growth modes—aerobic respiration, anaerobic respiration in the dark, and anaerobic photosynthesis—were generated. Expression levels of one-fifth to one-third of the R. sphaeroides ORFs were significantly different in cells under any two growth modes. Pathways involved in energy generation and redox balance maintenance under three growth modes were reconstructed. Expression patterns of genes involved in these pathways mirrored known functional changes, suggesting that massive changes in gene expression are the major means used by R. sphaeroides in adaptation to diverse conditions. Differential expression was observed for genes encoding putative new participants in these pathways (additional photosystem genes, duplicate NADH dehydrogenase, ATP synthases), whose functionality has yet to be investigated. The DNA microarray data correlated well with data derived from quantitative reverse transcription-PCR, as well as with data from the literature, thus validating the R. sphaeroides genechip as a powerful and reliable tool for studying unprecedented metabolic versatility of this bacterium. PMID:15231807

PhyloFlu, a DNA microarray for determining the phylogenetic origin of influenza A virus gene segments and the genomic fingerprint of viral strains.

PubMed

Paulin, Luis F; de los D Soto-Del Río, María; Sánchez, Iván; Hernández, Jesús; Gutiérrez-Ríos, Rosa M; López-Martínez, Irma; Wong-Chew, Rosa M; Parissi-Crivelli, Aurora; Isa, P; López, Susana; Arias, Carlos F

2014-03-01

Recent evidence suggests that most influenza A virus gene segments can contribute to the pathogenicity of the virus. In this regard, the hemagglutinin (HA) subtype of the circulating strains has been closely surveyed, but the reassortment of internal gene segments is usually not monitored as a potential source of an increased pathogenicity. In this work, an oligonucleotide DNA microarray (PhyloFlu) designed to determine the phylogenetic origins of the eight segments of the influenza virus genome was constructed and validated. Clades were defined for each segment and also for the 16 HA and 9 neuraminidase (NA) subtypes. Viral genetic material was amplified by reverse transcription-PCR (RT-PCR) with primers specific to the conserved 5' and 3' ends of the influenza A virus genes, followed by PCR amplification with random primers and Cy3 labeling. The microarray unambiguously determined the clades for all eight influenza virus genes in 74% (28/38) of the samples. The microarray was validated with reference strains from different animal origins, as well as from human, swine, and avian viruses from field or clinical samples. In most cases, the phylogenetic clade of each segment defined its animal host of origin. The genomic fingerprint deduced by the combined information of the individual clades allowed for the determination of the time and place that strains with the same genomic pattern were previously reported. PhyloFlu is useful for characterizing and surveying the genetic diversity and variation of animal viruses circulating in different environmental niches and for obtaining a more detailed surveillance and follow up of reassortant events that can potentially modify virus pathogenicity.

DNA microarray-based detection and identification of Burkholderia mallei, Burkholderia pseudomallei and Burkholderia spp.

PubMed

Schmoock, Gernot; Ehricht, Ralf; Melzer, Falk; Rassbach, Astrid; Scholz, Holger C; Neubauer, Heinrich; Sachse, Konrad; Mota, Rinaldo Aparecido; Saqib, Muhammad; Elschner, Mandy

2009-01-01

We developed a rapid oligonucleotide microarray assay based on genetic markers for the accurate identification and differentiation of Burkholderia (B.) mallei and Burkholderia pseudomallei, the agents of glanders and melioidosis, respectively. These two agents were clearly identified using at least 4 independent genetic markers including 16S rRNA gene, fliC, motB and also by novel species-specific target genes, identified by in silico sequence analysis. Specific hybridization signal profiles allowed the detection and differentiation of up to 10 further Burkholderia spp., including the closely related species Burkholderia thailandensis and Burkholderia-like agents, such as Burkholderia cepacia, Burkholderia cenocepacia, Burkholderia vietnamiensis, Burkholderia ambifaria, and Burkholderia gladioli, which are often associated with cystic fibrosis (CF) lung disease. The assay was developed using the easy-to-handle and economical ArrayTube (AT) platform. A representative strain panel comprising 44 B. mallei, 32 B. pseudomallei isolates, and various Burkholderia type strains were examined to validate the test. Assay specificity was determined by examination of 40 non-Burkholderia strains.

Pentopyranosyl Oligonucleotide Systems. Part 11: Systems with Shortened Backbones: D)-beta-Ribopyranosyl-(4 yields 3 )- and (L)-alpha - Lyxopyranosyl-(4 yields 3 )-oligonucleotides

NASA Technical Reports Server (NTRS)

Wippo, Harald; Reck, Folkert; Kudick, Rene; Ramaseshan, Mahesh; Ceulemans, Griet; Bolli, Martin; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

2001-01-01

The (L)-a-lyxopyranosyl-(4'yields 3')-oligonucleotide system-a member of a pentopyranosyl oligonucleotide family containing a shortened backbone-is capable of cooperative base-pairing and of cross-pairing with DNA and RNA. In contrast, corresponding (D)-beta-ribopyransoyl-(4' yields 3')-oligonucleotides do not show base-pairing under similar conditions. We conclude that oligonucleotide systems can violate the six-bonds-per-backbone-unit rule by having five bonds instead, if their vicinally bound phosphodiester bridges can assume an antiperiplanar conformation. An additional structural feature that seems relevant to the cross-pairing capability of the (L)-a-lyxopyranosyl-(4' yields 3')-oligonucleotide system is its (small) backbone/basepair axes inclination. An inclination which is similar to that in B-DNA seems to be a prerequisite for an oligonucleotide system s capability to cross-pair with DNA.

A Graphical Systems Model and Tissue-specific Functional Gene Sets to Aid Transcriptomic Analysis of Chemical Impacts on the Female Teleost Reproductive Axis

EPA Science Inventory

Oligonucleotide microarrays and other ‘omics’ approaches are powerful tools for unsupervised analysis of chemical impacts on biological systems. However, the lack of well annotated biological pathways for many aquatic organisms, including fish, and the poor power of microarray-b...

Microarray Technology for the Diagnosis of Fetal Chromosomal Aberrations: Which Platform Should We Use?

PubMed Central

Karampetsou, Evangelia; Morrogh, Deborah; Chitty, Lyn

2014-01-01

The advantage of microarray (array) over conventional karyotype for the diagnosis of fetal pathogenic chromosomal anomalies has prompted the use of microarrays in prenatal diagnostics. In this review we compare the performance of different array platforms (BAC, oligonucleotide CGH, SNP) and designs (targeted, whole genome, whole genome, and targeted, custom) and discuss their advantages and disadvantages in relation to prenatal testing. We also discuss the factors to consider when implementing a microarray testing service for the diagnosis of fetal chromosomal aberrations. PMID:26237396

Biocompatible artificial DNA linker that is read through by DNA polymerases and is functional in Escherichia coli

PubMed Central

El-Sagheer, Afaf H.; Sanzone, A. Pia; Gao, Rachel; Tavassoli, Ali; Brown, Tom

2011-01-01

A triazole mimic of a DNA phosphodiester linkage has been produced by templated chemical ligation of oligonucleotides functionalized with 5′-azide and 3′-alkyne. The individual azide and alkyne oligonucleotides were synthesized by standard phosphoramidite methods and assembled using a straightforward ligation procedure. This highly efficient chemical equivalent of enzymatic DNA ligation has been used to assemble a 300-mer from three 100-mer oligonucleotides, demonstrating the total chemical synthesis of very long oligonucleotides. The base sequences of the DNA strands containing this artificial linkage were copied during PCR with high fidelity and a gene containing the triazole linker was functional in Escherichia coli. PMID:21709264

Detection and genotyping of Entamoeba histolytica, Entamoeba dispar, Giardia lamblia, and Cryptosporidium parvum by oligonucleotide microarray.

PubMed

Wang, Zheng; Vora, Gary J; Stenger, David A

2004-07-01

Entamoeba histolytica, Giardia lamblia, and Cryptosporidium parvum are the most frequently identified protozoan parasites causing waterborne disease outbreaks. The morbidity and mortality associated with these intestinal parasitic infections warrant the development of rapid and accurate detection and genotyping methods to aid public health efforts aimed at preventing and controlling outbreaks. In this study, we describe the development of an oligonucleotide microarray capable of detecting and discriminating between E. histolytica, Entamoeba dispar, G. lamblia assemblages A and B, and C. parvum types 1 and 2 in a single assay. Unique hybridization patterns for each selected protozoan were generated by amplifying six to eight diagnostic sequences/organism by multiplex PCR; fluorescent labeling of the amplicons via primer extension; and subsequent hybridization to a set of genus-, species-, and subtype-specific covalently immobilized oligonucleotide probes. The profile-based specificity of this methodology not only permitted for the unequivocal identification of the six targeted species and subtypes, but also demonstrated its potential in identifying related species such as Cryptosporidium meleagridis and Cryptosporidium muris. In addition, sensitivity assays demonstrated lower detection limits of five trophozoites of G. lamblia. Taken together, the specificity and sensitivity of the microarray-based approach suggest that this methodology may provide a promising tool to detect and genotype protozoa from clinical and environmental samples.

Genome-wide polymorphisms and development of a microarray platform to detect genetic variations in Plasmodium yoelii.

PubMed

Nair, Sethu C; Pattaradilokrat, Sittiporn; Zilversmit, Martine M; Dommer, Jennifer; Nagarajan, Vijayaraj; Stephens, Melissa T; Xiao, Wenming; Tan, John C; Su, Xin-Zhuan

2014-01-01

The rodent malaria parasite Plasmodium yoelii is an important model for studying malaria immunity and pathogenesis. One approach for studying malaria disease phenotypes is genetic mapping, which requires typing a large number of genetic markers from multiple parasite strains and/or progeny from genetic crosses. Hundreds of microsatellite (MS) markers have been developed to genotype the P. yoelii genome; however, typing a large number of MS markers can be labor intensive, time consuming, and expensive. Thus, development of high-throughput genotyping tools such as DNA microarrays that enable rapid and accurate large-scale genotyping of the malaria parasite will be highly desirable. In this study, we sequenced the genomes of two P. yoelii strains (33X and N67) and obtained a large number of single nucleotide polymorphisms (SNPs). Based on the SNPs obtained, we designed sets of oligonucleotide probes to develop a microarray that could interrogate ∼11,000 SNPs across the 14 chromosomes of the parasite in a single hybridization. Results from hybridizations of DNA samples of five P. yoelii strains or cloned lines (17XNL, YM, 33X, N67 and N67C) and two progeny from a genetic cross (N67×17XNL) to the microarray showed that the array had a high call rate (∼97%) and accuracy (99.9%) in calling SNPs, providing a simple and reliable tool for typing the P. yoelii genome. Our data show that the P. yoelii genome is highly polymorphic, although isogenic pairs of parasites were also detected. Additionally, our results indicate that the 33X parasite is a progeny of 17XNL (or YM) and an unknown parasite. The highly accurate and reliable microarray developed in this study will greatly facilitate our ability to study the genetic basis of important traits and the disease it causes. Published by Elsevier B.V.

Remediation of petroleum hydrocarbon-contaminated sites by DNA diagnosis-based bioslurping technology.

PubMed

Kim, Seungjin; Krajmalnik-Brown, Rosa; Kim, Jong-Oh; Chung, Jinwook

2014-11-01

The application of effective remediation technologies can benefit from adequate preliminary testing, such as in lab-scale and Pilot-scale systems. Bioremediation technologies have demonstrated tremendous potential with regards to cost, but they cannot be used for all contaminated sites due to limitations in biological activity. The purpose of this study was to develop a DNA diagnostic method that reduces the time to select contaminated sites that are good candidates for bioremediation. We applied an oligonucleotide microarray method to detect and monitor genes that lead to aliphatic and aromatic degradation. Further, the bioremediation of a contaminated site, selected based on the results of the genetic diagnostic method, was achieved successfully by applying bioslurping in field tests. This gene-based diagnostic technique is a powerful tool to evaluate the potential for bioremediation in petroleum hydrocarbon contaminated soil. Copyright © 2014 Elsevier B.V. All rights reserved.

Rapid purification of circular DNA by triplex-mediated affinity capture

DOEpatents

Ji, Huamin; Smith, Lloyd M.

1997-01-01

A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support.

Fiber-optic microarray for simultaneous detection of multiple harmful algal bloom species.

PubMed

Ahn, Soohyoun; Kulis, David M; Erdner, Deana L; Anderson, Donald M; Walt, David R

2006-09-01

Harmful algal blooms (HABs) are a serious threat to coastal resources, causing a variety of impacts on public health, regional economies, and ecosystems. Plankton analysis is a valuable component of many HAB monitoring and research programs, but the diversity of plankton poses a problem in discriminating toxic from nontoxic species using conventional detection methods. Here we describe a sensitive and specific sandwich hybridization assay that combines fiber-optic microarrays with oligonucleotide probes to detect and enumerate the HAB species Alexandrium fundyense, Alexandrium ostenfeldii, and Pseudo-nitzschia australis. Microarrays were prepared by loading oligonucleotide probe-coupled microspheres (diameter, 3 mum) onto the distal ends of chemically etched imaging fiber bundles. Hybridization of target rRNA from HAB cells to immobilized probes on the microspheres was visualized using Cy3-labeled secondary probes in a sandwich-type assay format. We applied these microarrays to the detection and enumeration of HAB cells in both cultured and field samples. Our study demonstrated a detection limit of approximately 5 cells for all three target organisms within 45 min, without a separate amplification step, in both sample types. We also developed a multiplexed microarray to detect the three HAB species simultaneously, which successfully detected the target organisms, alone and in combination, without cross-reactivity. Our study suggests that fiber-optic microarrays can be used for rapid and sensitive detection and potential enumeration of HAB species in the environment.

Assessing the impact of Benzo[a]pyrene on Marine Mussels: Application of a novel targeted low density microarray complementing classical biomarker responses

PubMed Central

Sforzini, Susanna; Arlt, Volker M.; Barranger, Audrey; Dallas, Lorna J.; Oliveri, Caterina; Aminot, Yann; Pacchioni, Beniamina; Millino, Caterina; Lanfranchi, Gerolamo; Readman, James W.; Moore, Michael N.; Viarengo, Aldo; Jha, Awadhesh N.

2017-01-01

Despite the increasing use of mussels in environmental monitoring and ecotoxicological studies, their genomes and gene functions have not been thoroughly explored. Several cDNA microarrays were recently proposed for Mytilus spp., but putatively identified partial transcripts have rendered the generation of robust transcriptional responses difficult in terms of pathway identification. We developed a new low density oligonucleotide microarray with 465 probes covering the same number of genes. Target genes were selected to cover most of the well-known biological processes in the stress response documented over the last decade in bivalve species at the cellular and tissue levels. Our new ‘STressREsponse Microarray’ (STREM) platform consists of eight sub-arrays with three replicates for each target in each sub-array. To assess the potential use of the new array, we tested the effect of the ubiquitous environmental pollutant benzo[a]pyrene (B[a]P) at 5, 50, and 100 μg/L on two target tissues, the gills and digestive gland, of Mytilus galloprovincialis exposed invivo for three days. Bioaccumulation of B[a]P was also determined demonstrating exposure in both tissues. In addition to the well-known effects of B[a]P on DNA metabolism and oxidative stress, the new array data provided clues about the implication of other biological processes, such as cytoskeleton, immune response, adhesion to substrate, and mitochondrial activities. Transcriptional data were confirmed using qRT-PCR. We further investigated cellular functions and possible alterations related to biological processes highlighted by the microarray data using oxidative stress biomarkers (Lipofuscin content) and the assessment of genotoxicity. DNA damage, as measured by the alkaline comet assay, increased as a function of dose.DNA adducts measurements using 32P-postlabeling method also showed the presence of bulky DNA adducts (i.e. dG-N2-BPDE). Lipofiscin content increased significantly in B[a]P exposed mussels. Immunohistochemical analysis of tubulin and actin showed changes in cytoskeleton organisation. Our results adopting an integrated approach confirmed that the combination of newly developed transcriptomic approcah, classical biomarkers along with chemical analysis of water and tissue samples should be considered for environmental bioimonitoring and ecotoxicological studies to obtain holistic information to assess the impact of contaminants on the biota. PMID:28651000

DNA - peptide polyelectrolyte complexes: Phase control by hybridization

NASA Astrophysics Data System (ADS)

Vieregg, Jeffrey; Lueckheide, Michael; Marciel, Amanda; Leon, Lorraine; Tirrell, Matthew

DNA is one of the most highly-charged molecules known, and interacts strongly with charged molecules in the cell. Condensation of long double-stranded DNA is one of the classic problems of biophysics, but the polyelectrolyte behavior of short and/or single-stranded nucleic acids has attracted far less study despite its importance for both biological and engineered systems. We report here studies of DNA oligonucleotides complexed with cationic peptides and polyamines. As seen previously for longer sequences, double-stranded oligonucleotides form solid precipitates, but single-stranded oligonucleotides instead undergo liquid-liquid phase separation to form coacervate droplets. Complexed oligonucleotides remain competent for hybridization, and display sequence-dependent environmental response. We observe similar behavior for RNA oligonucleotides, and methylphosphonate substitution of the DNA backbone indicates that nucleic acid charge density controls whether liquid or solid complexes are formed. Liquid-liquid phase separations of this type have been implicated in formation of membraneless organelles in vivo, and have been suggested as protocells in early life scenarios; oligonucleotides offer an excellent method to probe the physics controlling these phenomena.

DNA Microarray Profiling Highlights Nrf2-Mediated Chemoprevention Targeted by Wasabi-Derived Isothiocyanates in HepG2 Cells.

PubMed

Trio, Phoebe Zapanta; Kawahara, Atsuyoshi; Tanigawa, Shunsuke; Sakao, Kozue; Hou, De-Xing

2017-01-01

6-MSITC and 6-MTITC are sulforaphane (SFN) analogs found in Japanese Wasabi. As we reported previously, Wasabi isothiocyanates (ITCs) are activators of Nrf2-antioxidant response element pathway, and also inhibitors of pro-inflammatory cyclooxygenase-2. This study is the first to assess the global changes in transcript levels by Wasabi ITCs, comparing with SFN, in HepG2 cells. We performed comparative gene expression profiling by treating HepG2 cells with ITCs, followed by DNA microarray analyses using HG-U133 plus 2.0 oligonucleotide array. Partial array data on selected gene products were confirmed by RT-PCR and Western blotting. Ingenuity Pathway Analysis (IPA) was used to identify functional subsets of genes and biologically significant network pathways. 6-MTITC showed the highest number of differentially altered (≥2 folds) gene expression, of which 114 genes were upregulated and 75 were downregulated. IPA revealed that Nrf2-mediated pathway, together with glutamate metabolism, is the common significantly modulated pathway across treatments. Interestingly, 6-MSITC exhibited the most potent effect toward Nrf2-mediated pathway. Our data suggest that 6-MSITC could exert chemopreventive role against cancer through its underlying antioxidant activity via the activation of Nrf2-mediated subsequent induction of cytoprotective genes.

Oligonucleotide and Parylene Surface Coating of Polystyrene and ePTFE for Improved Endothelial Cell Attachment and Hemocompatibility

PubMed Central

Schleicher, Martina; Hansmann, Jan; Elkin, Bentsian; Kluger, Petra J.; Liebscher, Simone; Huber, Agnes J. T.; Fritze, Olaf; Schille, Christine; Müller, Michaela; Schenke-Layland, Katja; Seifert, Martina; Walles, Heike; Wendel, Hans-Peter; Stock, Ulrich A.

2012-01-01

In vivo self-endothelialization by endothelial cell adhesion on cardiovascular implants is highly desirable. DNA-oligonucleotides are an intriguing coating material with nonimmunogenic characteristics and the feasibility of easy and rapid chemical fabrication. The objective of this study was the creation of cell adhesive DNA-oligonucleotide coatings on vascular implant surfaces. DNA-oligonucleotides immobilized by adsorption on parylene (poly(monoaminomethyl-para-xylene)) coated polystyrene and ePTFE were resistant to high shear stress (9.5 N/m2) and human blood serum for up to 96 h. Adhesion of murine endothelial progenitor cells, HUVECs and endothelial cells from human adult saphenous veins as well as viability over a period of 14 days of HUVECs on oligonucleotide coated samples under dynamic culture conditions was significantly enhanced (P < 0.05). Oligonucleotide-coated surfaces revealed low thrombogenicity and excellent hemocompatibility after incubation with human blood. These properties suggest the suitability of immobilization of DNA-oligonucleotides for biofunctionalization of blood vessel substitutes for improved in vivo endothelialization. PMID:22481939

Analytical Devices Based on Direct Synthesis of DNA on Paper.

PubMed

Glavan, Ana C; Niu, Jia; Chen, Zhen; Güder, Firat; Cheng, Chao-Min; Liu, David; Whitesides, George M

2016-01-05

This paper addresses a growing need in clinical diagnostics for parallel, multiplex analysis of biomarkers from small biological samples. It describes a new procedure for assembling arrays of ssDNA and proteins on paper. This method starts with the synthesis of DNA oligonucleotides covalently linked to paper and proceeds to assemble microzones of DNA-conjugated paper into arrays capable of simultaneously capturing DNA, DNA-conjugated protein antigens, and DNA-conjugated antibodies. The synthesis of ssDNA oligonucleotides on paper is convenient and effective with 32% of the oligonucleotides cleaved and eluted from the paper substrate being full-length by HPLC for a 32-mer. These ssDNA arrays can be used to detect fluorophore-linked DNA oligonucleotides in solution, and as the basis for DNA-directed assembly of arrays of DNA-conjugated capture antibodies on paper, detect protein antigens by sandwich ELISAs. Paper-anchored ssDNA arrays with different sequences can be used to assemble paper-based devices capable of detecting DNA and antibodies in the same device and enable simple microfluidic paper-based devices.

Lipophilic oligonucleotides spontaneously insert into lipid membranes, bind complementary DNA strands, and sequester into lipid-disordered domains.

PubMed

Bunge, Andreas; Kurz, Anke; Windeck, Anne-Kathrin; Korte, Thomas; Flasche, Wolfgang; Liebscher, Jürgen; Herrmann, Andreas; Huster, Daniel

2007-04-10

For the development of surface functionalized bilayers, we have synthesized lipophilic oligonucleotides to combine the molecular recognition mechanism of nucleic acids and the self-assembly characteristics of lipids in planar membranes. A lipophilic oligonucleotide consisting of 21 thymidine units and two lipophilic nucleotides with an alpha-tocopherol moiety as a lipophilic anchor was synthesized using solid-phase methods with a phosphoramadite strategy. The interaction of the water soluble lipophilic oligonucleotide with vesicular lipid membranes and its capability to bind complementary DNA strands was studied using complementary methods such as NMR, EPR, DSC, fluorescence spectroscopy, and fluorescence microscopy. This oligonucleotide inserted stably into preformed membranes from the aqueous phase. Thereby, no significant perturbation of the lipid bilayer and its stability was observed. However, the non-lipidated end of the oligonucleotide is exposed to the aqueous environment, is relatively mobile, and is free to interact with complementary DNA strands. Binding of the complementary single-stranded DNA molecules is fast and accomplished by the formation of Watson-Crick base pairs, which was confirmed by 1H NMR chemical shift analysis and fluorescence resonance energy transfer. The molecular structure of the membrane bound DNA double helix is very similar to the free double-stranded DNA. Further, the membrane bound DNA double strands also undergo regular melting. Finally, in raft-like membrane mixtures, the lipophilic oligonucleotide was shown to preferentially sequester into liquid-disordered membrane domains.

Hybrid genetic algorithm-neural network: feature extraction for unpreprocessed microarray data.

PubMed

Tong, Dong Ling; Schierz, Amanda C

2011-09-01

Suitable techniques for microarray analysis have been widely researched, particularly for the study of marker genes expressed to a specific type of cancer. Most of the machine learning methods that have been applied to significant gene selection focus on the classification ability rather than the selection ability of the method. These methods also require the microarray data to be preprocessed before analysis takes place. The objective of this study is to develop a hybrid genetic algorithm-neural network (GANN) model that emphasises feature selection and can operate on unpreprocessed microarray data. The GANN is a hybrid model where the fitness value of the genetic algorithm (GA) is based upon the number of samples correctly labelled by a standard feedforward artificial neural network (ANN). The model is evaluated by using two benchmark microarray datasets with different array platforms and differing number of classes (a 2-class oligonucleotide microarray data for acute leukaemia and a 4-class complementary DNA (cDNA) microarray dataset for SRBCTs (small round blue cell tumours)). The underlying concept of the GANN algorithm is to select highly informative genes by co-evolving both the GA fitness function and the ANN weights at the same time. The novel GANN selected approximately 50% of the same genes as the original studies. This may indicate that these common genes are more biologically significant than other genes in the datasets. The remaining 50% of the significant genes identified were used to build predictive models and for both datasets, the models based on the set of genes extracted by the GANN method produced more accurate results. The results also suggest that the GANN method not only can detect genes that are exclusively associated with a single cancer type but can also explore the genes that are differentially expressed in multiple cancer types. The results show that the GANN model has successfully extracted statistically significant genes from the unpreprocessed microarray data as well as extracting known biologically significant genes. We also show that assessing the biological significance of genes based on classification accuracy may be misleading and though the GANN's set of extra genes prove to be more statistically significant than those selected by other methods, a biological assessment of these genes is highly recommended to confirm their functionality. Copyright © 2011 Elsevier B.V. All rights reserved.

Derivatized versions of ligase enzymes for constructing DNA sequences

DOEpatents

Mariella, Jr., Raymond P.; Christian, Allen T [Tracy, CA; Tucker, James D [Novi, MN; Dzenitis, John M [Livermore, CA; Papavasiliou, Alexandros P [Oakland, CA

2006-08-15

A method of making very long, double-stranded synthetic poly-nucleotides. A multiplicity of short oligonucleotides is provided. The short oligonucleotides are sequentially hybridized to each other. Enzymatic ligation of the oligonucleotides provides a contiguous piece of PCR-ready DNA of predetermined sequence.

NAA-modified DNA oligonucleotides with zwitterionic backbones: stereoselective synthesis of A-T phosphoramidite building blocks.

PubMed

Schmidtgall, Boris; Höbartner, Claudia; Ducho, Christian

2015-01-01

Modifications of the nucleic acid backbone are essential for the development of oligonucleotide-derived bioactive agents. The NAA-modification represents a novel artificial internucleotide linkage which enables the site-specific introduction of positive charges into the otherwise polyanionic backbone of DNA oligonucleotides. Following initial studies with the introduction of the NAA-linkage at T-T sites, it is now envisioned to prepare NAA-modified oligonucleotides bearing the modification at X-T motifs (X = A, C, G). We have therefore developed the efficient and stereoselective synthesis of NAA-linked 'dimeric' A-T phosphoramidite building blocks for automated DNA synthesis. Both the (S)- and the (R)-configured NAA-motifs were constructed with high diastereoselectivities to furnish two different phosphoramidite reagents, which were employed for the solid phase-supported automated synthesis of two NAA-modified DNA oligonucleotides. This represents a significant step to further establish the NAA-linkage as a useful addition to the existing 'toolbox' of backbone modifications for the design of bioactive oligonucleotide analogues.

Rapid purification of circular DNA by triplex-mediated affinity capture

DOEpatents

Ji, H.; Smith, L.M.

1997-01-07

A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support. 3 figs.

Genome-Wide Requirements for Resistance to Functionally Distinct DNA-Damaging Agents

PubMed Central

Proctor, Michael; Flaherty, Patrick; Jordan, Michael I; Arkin, Adam P; Davis, Ronald W; Nislow, Corey; Giaever, Guri

2005-01-01

The mechanistic and therapeutic differences in the cellular response to DNA-damaging compounds are not completely understood, despite intense study. To expand our knowledge of DNA damage, we assayed the effects of 12 closely related DNA-damaging agents on the complete pool of ~4,700 barcoded homozygous deletion strains of Saccharomyces cerevisiae. In our protocol, deletion strains are pooled together and grown competitively in the presence of compound. Relative strain sensitivity is determined by hybridization of PCR-amplified barcodes to an oligonucleotide array carrying the barcode complements. These screens identified genes in well-characterized DNA-damage-response pathways as well as genes whose role in the DNA-damage response had not been previously established. High-throughput individual growth analysis was used to independently confirm microarray results. Each compound produced a unique genome-wide profile. Analysis of these data allowed us to determine the relative importance of DNA-repair modules for resistance to each of the 12 profiled compounds. Clustering the data for 12 distinct compounds uncovered both known and novel functional interactions that comprise the DNA-damage response and allowed us to define the genetic determinants required for repair of interstrand cross-links. Further genetic analysis allowed determination of epistasis for one of these functional groups. PMID:16121259

Human herpesvirus-6 and -7 DNA in cerebrospinal fluid of facial palsy patients.

PubMed

Kanerva, Mervi; Jääskeläinen, Anne J; Suvela, Minna; Piiparinen, Heli; Vaheri, Antti; Pitkäranta, Anne

2008-04-01

Finding human herpesvirus (HHV)-7 and dual HHV-6A and -6B DNA in cerebrospinal fluid (CSF) of two facial palsy (FP) patients is intriguing but does not allow etiologic conclusions as such. HHV-6 or -7 DNA was revealed in 10% of the CSF samples tested from 70 immunocompetent adolescents and adults; a highly unusual result. How these findings are associated with the diseases they accompany remains to be defined. To determine whether herpes simplex virus (HSV)-1 and -2, varicella-zoster virus (VZV), HHV-6A, -6B, and -7, Epstein-Barr virus (EBV), and cytomegalovirus (CMV) DNA could be found in CSF of FP patients or controls. In all, 33 peripheral FP patients (26 idiopathic, 5 with herpesvirus infection, 1 puerperal, 1 Melkersson-Rosenthal syndrome) (34 CSF samples) and 36 controls (16 nonidiopathic FP, 7 hearing loss, 6 vertigo, 5 headache, 2 other) previously tested for HSV-1, VZV, and HHV-6 DNA by polymerase chain reaction (PCR) were tested with highly sensitive multiplex-PCR and an oligonucleotide microarray method. One FP patient had HHV-7 DNA and another had HHV-6A and -6B DNA simultaneously. In the control group, one HHV-7, one HHV-6A, and three HHV-6B DNA-positive specimens were found.

Development and Use of Integrated Microarray-Based Genomic Technologies for Assessing Microbial Community Composition and Dynamics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, J.; Wu, L.; Gentry, T.

2006-04-05

To effectively monitor microbial populations involved in various important processes, a 50-mer-based oligonucleotide microarray was developed based on known genes and pathways involved in: biodegradation, metal resistance and reduction, denitrification, nitrification, nitrogen fixation, methane oxidation, methanogenesis, carbon polymer decomposition, and sulfate reduction. This array contains approximately 2000 unique and group-specific probes with <85% similarity to their non-target sequences. Based on artificial probes, our results showed that at hybridization conditions of 50 C and 50% formamide, the 50-mer microarray hybridization can differentiate sequences having <88% similarity. Specificity tests with representative pure cultures indicated that the designed probes on the arrays appearedmore » to be specific to their corresponding target genes. Detection limits were about 5-10ng genomic DNA in the absence of background DNA, and 50-100ng ({approx}1.3{sup o} 10{sup 7} cells) in the presence background DNA. Strong linear relationships between signal intensity and target DNA and RNA concentration were observed (r{sup 2} = 0.95-0.99). Application of this microarray to naphthalene-amended enrichments and soil microcosms demonstrated that composition of the microflora varied depending on incubation conditions. While the naphthalene-degrading genes from Rhodococcus-type microorganisms were dominant in enrichments, the genes involved in naphthalene degradation from Gram-negative microorganisms such as Ralstonia, Comamonas, and Burkholderia were most abundant in the soil microcosms (as well as those for polyaromatic hydrocarbon and nitrotoluene degradation). Although naphthalene degradation is widely known and studied in Pseudomonas, Pseudomonas genes were not detected in either system. Real-time PCR analysis of 4 representative genes was consistent with microarray-based quantification (r{sup 2} = 0.95). Currently, we are also applying this microarray to the study of several different microbial communities and processes at the NABIR-FRC in Oak Ridge, TN. One project involves the monitoring of the development and dynamics of the microbial community of a fluidized bed reactor (FBR) used for reducing nitrate and the other project monitors microbial community responses to stimulation of uranium reducing populations via ethanol donor additions in situ and in a model system. Additionally, we are developing novel strategies for increasing microarray hybridization sensitivity. Finally, great improvements to our methods of probe design were made by the development of a new computer program, CommOligo. CommOligo designs unique and group-specific oligo probes for whole-genomes, metagenomes, and groups of environmental sequences and uses a new global alignment algorithm to design single or multiple probes for each gene or group. We are now using this program to design a more comprehensive functional gene array for environmental studies. Overall, our results indicate that the 50mer-based microarray technology has potential as a specific and quantitative tool to reveal the composition of microbial communities and their dynamics important to processes within contaminated environments.« less

Ethical issues raised by genetic testing with oligonucleotide microarrays.

PubMed

Grody, Wayne W

2003-02-01

Because genes and alterations within them determine the identity, characteristics, and inheritance of every individual, the application of genetic science to humans has long been surrounded by apprehension, controversy, and real or perceived potential for abuse. Crude eugenics practices of the past now find a theoretical rebirth and transformation through the use of modern molecular genetic technologies for mutation detection, predictive and prenatal diagnosis, and, ultimately, gene replacement. The advent of oligonucleotide microarray analysis, in which hundreds or thousands of genes and mutations can be tested in parallel, offers tremendous promise for more accurate, sensitive, and efficient genetic testing. At the same time, however, this powerful technology dramatically increases the number and scope of ethical concerns accompanying each individual test request. This article considers the evolution and implications of these concerns, from the initial ordering of a microarray test by the physician to such issues as informed consent, privacy, confidentiality, clinical utility, discrimination, stigmatization, ethnic and population impact, and reimbursement.

Issues in the analysis of oligonucleotide tiling microarrays for transcript mapping

NASA Technical Reports Server (NTRS)

Royce, Thomas E.; Rozowsky, Joel S.; Bertone, Paul; Samanta, Manoj; Stolc, Viktor; Weissman, Sherman; Snyder, Michael; Gerstein, Mark

2005-01-01

Traditional microarrays use probes complementary to known genes to quantitate the differential gene expression between two or more conditions. Genomic tiling microarray experiments differ in that probes that span a genomic region at regular intervals are used to detect the presence or absence of transcription. This difference means the same sets of biases and the methods for addressing them are unlikely to be relevant to both types of experiment. We introduce the informatics challenges arising in the analysis of tiling microarray experiments as open problems to the scientific community and present initial approaches for the analysis of this nascent technology.

High Quality Genomic Copy Number Data from Archival Formalin-Fixed Paraffin-Embedded Leiomyosarcoma: Optimisation of Universal Linkage System Labelling

PubMed Central

Salawu, Abdulazeez; Ul-Hassan, Aliya; Hammond, David; Fernando, Malee; Reed, Malcolm; Sisley, Karen

2012-01-01

Most soft tissue sarcomas are characterized by genetic instability and frequent genomic copy number aberrations that are not subtype-specific. Oligonucleotide microarray-based Comparative Genomic Hybridisation (array CGH) is an important technique used to map genome-wide copy number aberrations, but the traditional requirement for high-quality DNA typically obtained from fresh tissue has limited its use in sarcomas. Although large archives of Formalin-fixed Paraffin-embedded (FFPE) tumour samples are available for research, the degradative effects of formalin on DNA from these tissues has made labelling and analysis by array CGH technically challenging. The Universal Linkage System (ULS) may be used for a one-step chemical labelling of such degraded DNA. We have optimised the ULS labelling protocol to perform aCGH on archived FFPE leiomyosarcoma tissues using the 180k Agilent platform. Preservation age of samples ranged from a few months to seventeen years and the DNA showed a wide range of degradation (when visualised on agarose gels). Consistently high DNA labelling efficiency and low microarray probe-to-probe variation (as measured by the derivative log ratio spread) was seen. Comparison of paired fresh and FFPE samples from identical tumours showed good correlation of CNAs detected. Furthermore, the ability to macro-dissect FFPE samples permitted the detection of CNAs that were masked in fresh tissue. Aberrations were visually confirmed using Fluorescence in situ Hybridisation. These results suggest that archival FFPE tissue, with its relative abundance and attendant clinical data may be used for effective mapping for genomic copy number aberrations in such rare tumours as leiomyosarcoma and potentially unravel clues to tumour origins, progression and ultimately, targeted treatment. PMID:23209738

Ultrasensitive Label-free Electronic Chip for DNA Analysis Using Carbon Nanotube Nanoelectrode Arrays

NASA Technical Reports Server (NTRS)

Li, Jun; Koehne, Jessica; Chen, Hua; Cassell, Alan; Ng, Hou Tee; Ye, Qi; Han, Jie; Meyyappan, M.

2004-01-01

There is a strong need for faster, cheaper, and simpler methods for nucleic acid analysis in today s clinical tests. Nanotechnologies can potentially provide solutions to these requirements by integrating nanomaterials with biofunctionalities. Dramatic improvement in the sensitivity and multiplexing can be achieved through the high-degree miniaturization. Here, we present our study in the development of an ultrasensitive label-free electronic chip for DNA/RNA analysis based on carbon nanotube nanoelectrode arrays. A reliable nanoelectrode array based on vertically aligned multi-walled carbon nanotubes (MWNTs) embedded in a SiO2 matrix is fabricated using a bottom-up approach. Characteristic nanoelectrode behavior is observed with a low-density MWNT nanoelectrode array in measuring both the bulk and surface immobilized redox species. The open-end of MWNTs are found to present similar properties as graphite edge-plane electrodes, with a wide potential window, flexible chemical functionalities, and good biocompatibility. A BRCA1 related oligonucleotide probe with 18 bases is covalently functionalized at the open ends of the MWNTs and specifically hybridized with an oligonucleotide target as well as a PCR amplicon. The guanine bases in the target molecules are employed as the signal moieties for the electrochemical measurements. Ru(bpy)3(2+) mediator is used to further amplify the guanine oxidation signal. This technique has been employed for direct electrochemical detection of label-free PCR amplicon through specific hybridization with the BRCAl probe. The detection limit is estimated to be less than approximately 1000 DNA molecules, approaching the limit of the sensitivity by laser-based fluorescence techniques in DNA microarray. This system provides a general electronic platform for rapid molecular diagnostics in applications requiring ultrahigh sensitivity, high-degree of miniaturization, simple sample preparation, and low- cost operation.

Salivary gland carcinosarcoma: oligonucleotide array CGH reveals similar genomic profiles in epithelial and mesenchymal components.

PubMed

Vékony, Hedy; Leemans, C René; Ylstra, Bauke; Meijer, Gerrit A; van der Waal, Isaäc; Bloemena, Elisabeth

2009-03-01

In this study, we present a case of parotid gland de novo carcinosarcoma. Salivary gland carcinosarcoma (or true malignant mixed tumor) is a rare biphasic neoplasm, composed of both malignant epithelial and malignant mesenchymal components. It is yet unclear whether these two phenotypes occur by collision of two independent tumors or if they are of clonal origin. To analyze the clonality of the different morphologic tumor components, oligonucleotide microarray-based comparative genomic hybridization (oaCGH) was performed on the carcinoma and the sarcoma entity separately. This technique enables a high-resolution, genome-wide overview of the chromosomal alterations in the distinct tumor elements. Analysis of both fractions showed a high number of DNA copy number changes. Losses were more prevalent than gains (82 and 49, respectively). The carcinomatous element displayed more chromosomal aberrations than the sarcomatous component. Specific amplifications of MUC20 (in mesenchymal element) and BMI-1 (in both elements) loci were observed. Overall homology between the two genomic profiles was 75%. DNA copy number profiles of the epithelial and mesenchymal components in this salivary gland carcinosarcoma displayed extensive overlap, indicating a monoclonal origin. Since losses are shared to a larger extent than gains, they seem to be more essential for initial oncogenic events. Furthermore, specific amplifications of a mucin and a Polycomb group gene imply these proteins in the tumorigenesis of carcinosarcomas.

Methods of DNA sequencing by hybridization based on optimizing concentration of matrix-bound oligonucleotide and device for carrying out same

DOEpatents

Khrapko, Konstantin R [Moscow, RU; Khorlin, Alexandr A [Moscow, RU; Ivanov, Igor B [Moskovskaya, RU; Ershov, Gennady M [Moscow, RU; Lysov, Jury P [Moscow, RU; Florentiev, Vladimir L [Moscow, RU; Mirzabekov, Andrei D [Moscow, RU

1996-09-03

A method for sequencing DNA by hybridization that includes the following steps: forming an array of oligonucleotides at such concentrations that either ensure the same dissociation temperature for all fully complementary duplexes or allows hybridization and washing of such duplexes to be conducted at the same temperature; hybridizing said oligonucleotide array with labeled test DNA; washing in duplex dissociation conditions; identifying single-base substitutions in the test DNA by analyzing the distribution of the dissociation temperatures and reconstructing the DNA nucleotide sequence based on the above analysis. A device for carrying out the method comprises a solid substrate and a matrix rigidly bound to the substrate. The matrix contains the oligonucleotide array and consists of a multiplicity of gel portions. Each gel portion contains one oligonucleotide of desired length. The gel portions are separated from one another by interstices and have a thickness not exceeding 30 .mu.m.

Oligonucleotide-arrayed TFT photosensor applicable for DNA chip technology.

PubMed

Tanaka, Tsuyoshi; Hatakeyama, Keiichi; Sawaguchi, Masahiro; Iwadate, Akihito; Mizutani, Yasushi; Sasaki, Kazuhiro; Tateishi, Naofumi; Takeyama, Haruko; Matsunaga, Tadashi

2006-09-05

A thin film transistor (TFT) photosensor fabricated by semiconductor integrated circuit (IC) technology was applied to DNA chip technology. The surface of the TFT photosensor was coated with TiO2 using a vapor deposition technique for the fabrication of optical filters. The immobilization of thiolated oligonucleotide probes onto a TiO2-coated TFT photosensor using gamma-aminopropyltriethoxysilane (APTES) and N-(gamma-maleimidobutyloxy) sulfosuccinimide ester (GMBS) was optimized. The coverage value of immobilized oligonucleotides reached a plateau at 33.7 pmol/cm2, which was similar to a previous analysis using radioisotope-labeled oligonucleotides. The lowest detection limits were 0.05 pmol/cm2 for quantum dot and 2.1 pmol/cm2 for Alexa Fluor 350. Furthermore, single nucleotide polymorphism (SNP) detection was examined using the oligonucleotide-arrayed TFT photosensor. A SNP present in the aldehyde dehydrogenase 2 (ALDH2) gene was used as a target. The SNPs in ALDH2*1 and ALDH2*2 target DNA were detected successfully using the TFT photosensor. DNA hybridization in the presence of both ALDH2*1 and ALDH2*2 target DNA was observed using both ALDH2*1 and ALDH2*2 detection oligonucleotides-arrayed TFT photosensor. Use of the TFT photosensor will allow the development of a disposable photodetecting device for DNA chip systems. (c) 2006 Wiley Periodicals, Inc.

Optimised laser microdissection of the human ocular surface epithelial regions for microarray studies

PubMed Central

2013-01-01

Background The most important challenge of performing insitu transcriptional profiling of the human ocular surface epithelial regions is obtaining samples in sufficient amounts, without contamination from adjacent tissue, as the region of interest is microscopic and closely apposed to other tissues regions. We have effectively collected ocular surface (OS) epithelial tissue samples from the Limbal Epithelial Crypt (LEC), limbus, cornea and conjunctiva of post-mortem cadaver eyes with laser microdissection (LMD) technique for gene expression studies with spotted oligonucleotide microarrays and Gene 1.0 ST arrays. Methods Human donor eyes (4 pairs for spotted oligonucleotide microarrays, 3 pairs for Gene 1.0 ST arrays) consented for research were included in this study with due ethical approval of the Nottingham Research Ethics Committee. Eye retrieval was performed within 36 hours of post-mortem period. The dissected corneoscleral buttons were immersed in OCT media and frozen in liquid nitrogen and stored at −80°C till further use. Microscopic tissue sections of interest were taken on PALM slides and stained with Toluidine Blue for laser microdissection with PALM microbeam systems. Optimisation of the laser microdissection technique was crucial for efficient and cost effective sample collection. Results The starting concentration of RNA as stipulated by the protocol of microarray platforms was taken as the cut-off concentration of RNA samples in our studies. The area of LMD tissue processed for spotted oligonucleotide microarray study ranged from 86,253 μm2 in LEC to 392,887 μm2 in LEC stroma. The RNA concentration of the LMD samples ranged from 22 to 92 pg/μl. The recommended starting concentration of the RNA samples used for Gene 1.0 ST arrays was 6 ng/5 μl. To achieve the desired RNA concentration the area of ocular surface epithelial tissue sample processed for the Gene 1.0 ST array experiments was approximately 100,0000 μm2 to 130,0000 μm2. RNA concentration of these samples ranged from 10.88 ng/12 μl to 25.8 ng/12 μl, with the RNA integrity numbers (RIN) for these samples from 3.3 to 7.9. RNA samples with RIN values below 2, that had failed to amplify satisfactorily were discarded. Conclusions The optimised protocol for sample collection and laser microdissection improved the RNA yield of the insitu ocular surface epithelial regions for effective microarray studies on spotted oligonucleotide and affymetrix platforms. PMID:24160452

Soft Lithography for Oligonucleotide Arrays Fabrication

DTIC Science & Technology

2001-10-25

adenosine; Abbreviated T, C, G, A respectively), the other synthesis reagents and solvents except oxidation agent (seen in Table 1) were purchased...dried by cold blowing before hybridization. Oligonucleotide arrays were hybridized in 200 nM 3’-TCC TCC GAT TCA GAG AGT CC- HEX (PE Biosystems... citrate buffer), 0.1% SDS in 0.1xSSC respectively. The probe array was scanned on the Scanarray Microarray Systems (Packard Biochip Technologies, USA

Selection of optimal oligonucleotide probes for microarrays usingmultiple criteria, global alignment and parameter estimation.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Xingyuan; He, Zhili; Zhou, Jizhong

2005-10-30

The oligonucleotide specificity for microarray hybridizationcan be predicted by its sequence identity to non-targets, continuousstretch to non-targets, and/or binding free energy to non-targets. Mostcurrently available programs only use one or two of these criteria, whichmay choose 'false' specific oligonucleotides or miss 'true' optimalprobes in a considerable proportion. We have developed a software tool,called CommOligo using new algorithms and all three criteria forselection of optimal oligonucleotide probes. A series of filters,including sequence identity, free energy, continuous stretch, GC content,self-annealing, distance to the 3'-untranslated region (3'-UTR) andmelting temperature (Tm), are used to check each possibleoligonucleotide. A sequence identity is calculated based onmore » gapped globalalignments. A traversal algorithm is used to generate alignments for freeenergy calculation. The optimal Tm interval is determined based on probecandidates that have passed all other filters. Final probes are pickedusing a combination of user-configurable piece-wise linear functions andan iterative process. The thresholds for identity, stretch and freeenergy filters are automatically determined from experimental data by anaccessory software tool, CommOligo_PE (CommOligo Parameter Estimator).The program was used to design probes for both whole-genome and highlyhomologous sequence data. CommOligo and CommOligo_PE are freely availableto academic users upon request.« less

Non-Enzymatic Detection of Bacterial Genomic DNA Using the Bio-Barcode Assay

PubMed Central

Hill, Haley D.; Vega, Rafael A.; Mirkin, Chad A.

2011-01-01

The detection of bacterial genomic DNA through a non-enzymatic nanomaterials based amplification method, the bio-barcode assay, is reported. The assay utilizes oligonucleotide functionalized magnetic microparticles to capture the target of interest from the sample. A critical step in the new assay involves the use of blocking oligonucleotides during heat denaturation of the double stranded DNA. These blockers bind to specific regions of the target DNA upon cooling, and prevent the duplex DNA from re-hybridizing, which allows the particle probes to bind. Following target isolation using the magnetic particles, oligonucleotide functionalized gold nanoparticles act as target recognition agents. The oligonucleotides on the nanoparticle (barcodes) act as amplification surrogates. The barcodes are then detected using the Scanometric method. The limit of detection for this assay was determined to be 2.5 femtomolar, and this is the first demonstration of a barcode type assay for the detection of double stranded, genomic DNA. PMID:17927207

A Novel Pan-Flavivirus Detection and Identification Assay Based on RT-qPCR and Microarray

PubMed Central

Sachse, Konrad; Ziegler, Ute; Keller, Markus

2017-01-01

The genus Flavivirus includes arthropod-borne viruses responsible for a large number of infections in humans and economically important animals. While RT-PCR protocols for specific detection of most Flavivirus species are available, there has been also a demand for a broad-range Flavivirus assay covering all members of the genus. It is particularly challenging to balance specificity at genus level with equal sensitivity towards each target species. In the present study, a novel assay combining a SYBR Green-based RT-qPCR with a low-density DNA microarray has been developed. Validation experiments confirmed that the RT-qPCR exhibited roughly equal sensitivity of detection and quantification for all flaviviruses tested. These PCR products are subjected to hybridization on a microarray carrying 84 different oligonucleotide probes that represent all known Flavivirus species. This assay has been used as a screening and confirmation tool for Flavivirus presence in laboratory and field samples, and it performed successfully in international External Quality Assessment of NAT studies. Twenty-six Flavivirus strains were tested with the assay, showing equivalent or superior characteristics compared with the original or even with species-specific RT-PCRs. As an example, test results on West Nile virus detection in a panel of 340 mosquito pool samples from Greece are presented. PMID:28626758

Fluorescent triplex-forming DNA oligonucleotides labeled with a thiazole orange dimer unit

PubMed Central

Ikeda, Shuji; Yanagisawa, Hiroyuki; Yuki, Mizue; Okamoto, Akimitsu

2013-01-01

Fluorescent probes for the detection of a double-stranded DNA were prepared by labeling a triplex-forming DNA oligonucleotide with a thiazole orange (TO) dimer unit. They belong to ECHO (exciton-controlled hybridization-sensitive fluorescent oligonucleotide) probes which we have previously reported. The excitonic interaction between the two TO molecules was expected to effectively suppress the background fluorescence of the probes. The applicability of the ECHO probes for the detection of double-stranded DNA was confirmed by examining the thermal stability and photophysical and kinetic properties of the DNA triplexes formed by the ECHO probes. PMID:23445822

Preparation of a DNA matrix via an electrochemically directed copolymerization of pyrrole and oligonucleotides bearing a pyrrole group.

PubMed Central

Livache, T; Roget, A; Dejean, E; Barthet, C; Bidan, G; Téoule, R

1994-01-01

A new methodology for the preparation of addressed DNA matrices is described. The process includes an electrochemically directed copolymerization of pyrrole and oligonucleotides bearing on their 5' end a pyrrole moiety introduced by phosphoramidite chemistry. The electro-controlled synthesis of the copolymer (poly-pyrrole) gives, in one step, a solid conducting film deposited on the surface of an electrode. The resulting polymer consists of pyrrole chains bearing covalently linked oligonucleotide. The polymer growth is limited to the electrode surface, so that it is possible to prepare a DNA matrix on a multiple electrode device by successive copolymerizations. A support bearing four oligonucleotides was used to detect three ras mutations on a synthetic DNA fragment. PMID:8065902

Modulating nanoparticle superlattice structure using proteins with tunable bond distributions

DOE PAGES

McMillan, Janet R.; Brodin, Jeffrey D.; Millan, Jaime A.; ...

2017-01-25

Here, we investigate the use of proteins with tunable DNA modification distributions to modulate nanoparticle superlattice structure. Using Beta-galactosidase (βgal) as a model system, we have employed the orthogonal chemical reactivities of surface amines and thiols to synthesize protein-DNA conjugates with 36 evenly distributed or 8 specifically positioned oligonucleotides. When assembled into crystalline superlattices with AuNPs, we find that the distribution of DNA modifications modulates the favored structure: βgal with uniformly distributed DNA bonding elements results in body-centered cubic crystals, whereas DNA functionalization of cysteines results in AB 2 packing. We probe the role of protein oligonucleotide number and conjugatemore » size on this observation, which revealed the importance of oligonucleotide distribution and number in this observed assembly behavior. These results indicate that proteins with defined DNA-modification patterns are powerful tools to control the nanoparticle superlattices architecture, and establish the importance of oligonucleotide distribution in the assembly behavior of protein-DNA conjugates.« less

Method for performing site-specific affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

1999-01-01

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

Miniaturized reaction vessel system, method for performing site-specific biochemical reactions and affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

2000-01-01

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

Method for performing site-specific affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, A.D.; Lysov, Y.P.; Dubley, S.A.

1999-05-18

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between the cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting the extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to the extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from the array. 14 figs.

Research and development of biochip technologies in Taiwan

NASA Astrophysics Data System (ADS)

Ting, Solomon J.; Chiou, Arthur E. T.

2000-07-01

Recent advancements in several genome-sequencing projects have stimulated an enormous interest in microarray DNA chip technology, especially in the biomedical sciences and pharmaceutical industries. The DNA chips facilitated the miniaturization of conventional nucleic acid hybridizations, by either robotically spotting thousands of library cDNAs or in situ synthesis of high-density oligonucleotides onto solid supports. These innovations have found a wide range of applications in molecular biology, especially in studying gene expression and discovering new genes from the global view of genomic analysis. The research and development of this powerful tool has also received great attentions in Taiwan. In this paper, we report the current progresses of our DNA chip project, along with the current status of other biochip projects in Taiwan, such as protein chip, PCR chip, electrophoresis chip, olfactory chip, etc. The new development of biochip technologies integrates the biotechnology with the semiconductor processing, the micro- electro-mechanical, optoelectronic, and digital signal processing technologies. Most of these biochip technologies utilitze optical detection methods for data acquisition and analysis. The strengths and advantages of different approaches are compared and discussed in this report.

Towards MRI microarrays.

PubMed

Hall, Andrew; Mundell, Victoria J; Blanco-Andujar, Cristina; Bencsik, Martin; McHale, Glen; Newton, Michael I; Cave, Gareth W V

2010-04-14

Superparamagnetic iron oxide nanometre scale particles have been utilised as contrast agents to image staked target binding oligonucleotide arrays using MRI to correlate the signal intensity and T(2)* relaxation times in different NMR fluids.

A System for Multiplexed Direct Electrical Detection of DNA Synthesis.

PubMed

Anderson, Erik P; Daniels, Jonathan S; Yu, Heng; Karhanek, Miloslav; Lee, Thomas H; Davis, Ronald W; Pourmand, Nader

2008-01-29

An electronic system for the multiplexed detection of DNA polymerization is designed and characterized. DNA polymerization is detected by the measurement of small transient currents arising from ion diffusion during polymerization. A transimpedance amplifier is used to detect these small currents; we implemented a twenty-four channel recording system on a single printed circuit board. Various contributions to the input-referred current noise are analyzed and characterized, as it limits the minimum detectable current and thus the biological limit of detection. We obtained 8.5 pA RMS mean noise current (averaged over all 24 channels) over the recording bandwidth (DC to 2 kHz). With digital filtering, the input-referred current noise of the acquisition system is reduced to 2.4 pA, which is much lower than the biological noise. Electrical crosstalk between channels is measured, and a model for the crosstalk is presented. Minimizing the crosstalk is critical because it can lead to erroneous microarray data. With proper precautions, crosstalk is reduced to a negligible value (less than 1.4%). Using a micro-fabricated array of 24 gold electrodes, we demonstrated system functionality by detecting the presence of a target DNA oligonucleotide which hybridized onto its corresponding target.

Identification of Cell Cycle-regulated Genes in Fission YeastD⃞

PubMed Central

Peng, Xu; Karuturi, R. Krishna Murthy; Miller, Lance D.; Lin, Kui; Jia, Yonghui; Kondu, Pinar; Wang, Long; Wong, Lim-Soon; Liu, Edison T.; Balasubramanian, Mohan K.; Liu, Jianhua

2005-01-01

Cell cycle progression is both regulated and accompanied by periodic changes in the expression levels of a large number of genes. To investigate cell cycle-regulated transcriptional programs in the fission yeast Schizosaccharomyces pombe, we developed a whole-genome oligonucleotide-based DNA microarray. Microarray analysis of both wild-type and cdc25 mutant cell cultures was performed to identify transcripts whose levels oscillated during the cell cycle. Using an unsupervised algorithm, we identified 747 genes that met the criteria for cell cycle-regulated expression. Peaks of gene expression were found to be distributed throughout the entire cell cycle. Furthermore, we found that four promoter motifs exhibited strong association with cell cycle phase-specific expression. Examination of the regulation of MCB motif-containing genes through the perturbation of DNA synthesis control/MCB-binding factor (DSC/MBF)-mediated transcription in arrested synchronous cdc10 mutant cell cultures revealed a subset of functional targets of the DSC/MBF transcription factor complex, as well as certain gene promoter requirements. Finally, we compared our data with those for the budding yeast Saccharomyces cerevisiae and found ∼140 genes that are cell cycle regulated in both yeasts, suggesting that these genes may play an evolutionarily conserved role in regulation of cell cycle-specific processes. Our complete data sets are available at http://giscompute.gis.a-star.edu.sg/~gisljh/CDC. PMID:15616197

DNA polymorphism identity determination using flow cytometry

DOEpatents

Nolan, John P.; White, P. Scott; Cai, Hong

2001-01-01

DNA polymorphism identity determination using flow cytometry. Primers designed to be immobilized on microspheres are allowed to anneal to the DNA strand under investigation, and are extended by either DNA polymerase using fluorescent dideoxynucleotides or ligated by DNA ligase to fluorescent reporter oligonucleotides. The fluorescence of either the dideoxynucleotide or the reporter oligonucleotide attached to the immobilized primer is measured by flow cytometry, thereby identifying the nucleotide polymorphism on the DNA strand.

Human Leukocyte Antigen Typing Using a Knowledge Base Coupled with a High-Throughput Oligonucleotide Probe Array Analysis

PubMed Central

Zhang, Guang Lan; Keskin, Derin B.; Lin, Hsin-Nan; Lin, Hong Huang; DeLuca, David S.; Leppanen, Scott; Milford, Edgar L.; Reinherz, Ellis L.; Brusic, Vladimir

2014-01-01

Human leukocyte antigens (HLA) are important biomarkers because multiple diseases, drug toxicity, and vaccine responses reveal strong HLA associations. Current clinical HLA typing is an elimination process requiring serial testing. We present an alternative in situ synthesized DNA-based microarray method that contains hundreds of thousands of probes representing a complete overlapping set covering 1,610 clinically relevant HLA class I alleles accompanied by computational tools for assigning HLA type to 4-digit resolution. Our proof-of-concept experiment included 21 blood samples, 18 cell lines, and multiple controls. The method is accurate, robust, and amenable to automation. Typing errors were restricted to homozygous samples or those with very closely related alleles from the same locus, but readily resolved by targeted DNA sequencing validation of flagged samples. High-throughput HLA typing technologies that are effective, yet inexpensive, can be used to analyze the world’s populations, benefiting both global public health and personalized health care. PMID:25505899

Genome-wide comparison of paired fresh frozen and formalin-fixed paraffin-embedded gliomas by custom BAC and oligonucleotide array comparative genomic hybridization: facilitating analysis of archival gliomas.

PubMed

Mohapatra, Gayatry; Engler, David A; Starbuck, Kristen D; Kim, James C; Bernay, Derek C; Scangas, George A; Rousseau, Audrey; Batchelor, Tracy T; Betensky, Rebecca A; Louis, David N

2011-04-01

Array comparative genomic hybridization (aCGH) is a powerful tool for detecting DNA copy number alterations (CNA). Because diffuse malignant gliomas are often sampled by small biopsies, formalin-fixed paraffin-embedded (FFPE) blocks are often the only tissue available for genetic analysis; FFPE tissues are also needed to study the intratumoral heterogeneity that characterizes these neoplasms. In this paper, we present a combination of evaluations and technical advances that provide strong support for the ready use of oligonucleotide aCGH on FFPE diffuse gliomas. We first compared aCGH using bacterial artificial chromosome (BAC) arrays in 45 paired frozen and FFPE gliomas, and demonstrate a high concordance rate between FFPE and frozen DNA in an individual clone-level analysis of sensitivity and specificity, assuring that under certain array conditions, frozen and FFPE DNA can perform nearly identically. However, because oligonucleotide arrays offer advantages to BAC arrays in genomic coverage and practical availability, we next developed a method of labeling DNA from FFPE tissue that allows efficient hybridization to oligonucleotide arrays. To demonstrate utility in FFPE tissues, we applied this approach to biphasic anaplastic oligoastrocytomas and demonstrate CNA differences between DNA obtained from the two components. Therefore, BAC and oligonucleotide aCGH can be sensitive and specific tools for detecting CNAs in FFPE DNA, and novel labeling techniques enable the routine use of oligonucleotide arrays for FFPE DNA. In combination, these advances should facilitate genome-wide analysis of rare, small and/or histologically heterogeneous gliomas from FFPE tissues.

The prevalence of chromosomal deletions relating to developmental delay and/or intellectual disability in human euploid blastocysts.

PubMed

He, Wenyin; Sun, Xiaofang; Liu, Lian; Li, Man; Jin, Hua; Wang, Wei-Hua

2014-01-01

Chromosomal anomalies in human embryos produced by in vitro fertilization are very common, which include numerical (aneuploidy) and structural (deletion, duplication or others) anomalies. Our previous study indicated that chromosomal deletion(s) is the most common structural anomaly accounting for approximately 8% of euploid blastocysts. It is still unknown if these deletions in human euploid blastocysts have clinical significance. In this study, we analyzed 15 previously diagnosed euploid blastocysts that had chromosomal deletion(s) using Agilent oligonucleotide DNA microarray platform and localized the gene location in each deletion. Then, we used OMIM gene map and phenotype database to investigate if these deletions are related with some important genes that cause genetic diseases, especially developmental delay or intellectual disability. As results, we found that the detectable chromosomal deletion size with Agilent microarray is above 2.38 Mb, while the deletions observed in human blastocysts are between 11.6 to 103 Mb. With OMIM gene map and phenotype database information, we found that deletions can result in loss of 81-464 genes. Out of these genes, 34-149 genes are related with known genetic problems. Furthermore, we found that 5 out of 15 samples lost genes in the deleted region, which were related to developmental delay and/or intellectual disability. In conclusion, our data indicates that all human euploid blastocysts with chromosomal deletion(s) are abnormal and transfer of these embryos may cause birth defects and/or developmental and intellectual disabilities. Therefore, the embryos with chromosomal deletion revealed by DNA microarray should not be transferred to the patients, or further gene map and/or phenotype seeking is necessary before making a final decision.

Methods for immobilizing nucleic acids on a gel substrate

DOEpatents

Mirzabekov, Andrei Darievich; Proudnikov, Dimitri Y.; Timofeev, Edward N.; Kochetkova, Svetlana V.; Florentiev, Vladimir L.; Shick, Valentine V.

1999-01-01

A method for labeling oligonucleotide molecules, and for immobilizing oligonucleotide and DNA molecules is provided comprising modifying the molecules to create a chemically active group, and contacting activated fluorescent dyes to the region. A method for preparing an immobilization substrate is also provided comprising modifying a gel to contain desired functional groups which covalently interact with certain moieties of the oligonucleotide molecules. A method for immobilizing biomolecules and other molecules within a gel by copolymerization of allyl-substituted oligonucleotides, DNA and proteins with acrylamide is also provided.

Method for promoting specific alignment of short oligonucleotides on nucleic acids

DOEpatents

Studier, F. William; Kieleczawa, Jan; Dunn, John J.

1996-01-01

Disclosed is a method for promoting specific alignment of short oligonucleotides on a nucleic acid polymer. The nucleic acid polymer is incubated in a solution containing a single-stranded DNA-binding protein and a plurality of oligonucleotides which are perfectly complementary to distinct but adjacent regions of a predetermined contiguous nucleotide sequence in the nucleic acid polymer. The plurality of oligonucleotides anneal to the nucleic acid polymer to form a contiguous region of double stranded nucleic acid. Specific application of the methods disclosed include priming DNA synthesis and template-directed ligation.

Analytical chemistry at the interface between materials science and biology

NASA Astrophysics Data System (ADS)

O'Brien, Janese Christine

This work describes several research efforts that lie at the new interfaces between analytical chemistry and other disciplines, namely materials science and biology. In the materials science realm, the search for new materials that may have useful or unique chromatographic properties motivated the synthesis and characterization of electrically conductive sol-gels. In the biology realm, the search for new surface fabrication schemes that would permit or even improve the detection of specific biological reactions motivated the design of miniaturized biological arrays. Collectively, this work represents some of analytical chemistry's newest forays into these disciplines. This dissertation is divided into six chapters. Chapter 1 is an introductory chapter that provides background information pertinent to several key aspects of the work contained in this dissertation. Chapter 2 describes the synthesis and characterization of electrically conductive sol-gels derived from the acid-catalyzed hydrolysis of a vanadium alkoxide. Specifically, this chapter describes our attempts to increase the conductivity of vanadium sol-gels by optimizing the acidic and drying conditions used during synthesis. Chapter 3 reports the construction of novel antigenic immunosensing platforms of increased epitope density using Fab'-SH antibody fragments on gold. Here, X-ray photoelectron spectroscopy (XPS), thin-layer cell (TLC) and confocal fluorescence spectroscopies, and scanning force microscopy (SFM) are employed to characterize the fragment-substrate interaction, to quantify epitope density, and to demonstrate fragment viability and specificity. Chapter 4 presents a novel method for creating and interrogating double-stranded DNA (dsDNA) microarrays suitable for screening protein:dsDNA interactions. Using the restriction enzyme ECoR1, we demonstrate the ability of the atomic force microscope (AFM) to detect changes in topography that result from the enzymatic cleavage of dsDNA microarrays containing the correct recognition sequence. Chapter 5 explores more fully the microarray fabrication process described in Chapter 4. Specifically, experiments characterizing the effect of deposition conditions on oligonucleotide topography and as well as those that describe array density optimization are presented. Chapter 6 presents general conclusions from the work recorded in this dissertation and speculates on its extension.

Development of the first oligonucleotide microarray for global gene expression profiling in guinea pigs: defining the transcription signature of infectious diseases.

PubMed

Jain, Ruchi; Dey, Bappaditya; Tyagi, Anil K

2012-10-02

The Guinea pig (Cavia porcellus) is one of the most extensively used animal models to study infectious diseases. However, despite its tremendous contribution towards understanding the establishment, progression and control of a number of diseases in general and tuberculosis in particular, the lack of fully annotated guinea pig genome sequence as well as appropriate molecular reagents has severely hampered detailed genetic and immunological analysis in this animal model. By employing the cross-species hybridization technique, we have developed an oligonucleotide microarray with 44,000 features assembled from different mammalian species, which to the best of our knowledge is the first attempt to employ microarray to study the global gene expression profile in guinea pigs. To validate and demonstrate the merit of this microarray, we have studied, as an example, the expression profile of guinea pig lungs during the advanced phase of M. tuberculosis infection. A significant upregulation of 1344 genes and a marked down regulation of 1856 genes in the lungs identified a disease signature of pulmonary tuberculosis infection. We report the development of first comprehensive microarray for studying the global gene expression profile in guinea pigs and validation of its usefulness with tuberculosis as a case study. An important gap in the area of infectious diseases has been addressed and a valuable molecular tool is provided to optimally harness the potential of guinea pig model to develop better vaccines and therapies against human diseases.

Single-base-pair discrimination of terminal mismatches by using oligonucleotide microarrays and neural network analyses

NASA Technical Reports Server (NTRS)

Urakawa, Hidetoshi; Noble, Peter A.; El Fantroussi, Said; Kelly, John J.; Stahl, David A.

2002-01-01

The effects of single-base-pair near-terminal and terminal mismatches on the dissociation temperature (T(d)) and signal intensity of short DNA duplexes were determined by using oligonucleotide microarrays and neural network (NN) analyses. Two perfect-match probes and 29 probes having a single-base-pair mismatch at positions 1 to 5 from the 5' terminus of the probe were designed to target one of two short sequences representing 16S rRNA. Nonequilibrium dissociation rates (i.e., melting profiles) of all probe-target duplexes were determined simultaneously. Analysis of variance revealed that position of the mismatch, type of mismatch, and formamide concentration significantly affected the T(d) and signal intensity. Increasing the concentration of formamide in the washing buffer decreased the T(d) and signal intensity, and it decreased the variability of the signal. Although T(d)s of probe-target duplexes with mismatches in the first or second position were not significantly different from one another, duplexes with mismatches in the third to fifth positions had significantly lower T(d)s than those with mismatches in the first or second position. The trained NNs predicted the T(d) with high accuracies (R(2) = 0.93). However, the NNs predicted the signal intensity only moderately accurately (R(2) = 0.67), presumably due to increased noise in the signal intensity at low formamide concentrations. Sensitivity analysis revealed that the concentration of formamide explained most (75%) of the variability in T(d)s, followed by position of the mismatch (19%) and type of mismatch (6%). The results suggest that position of the mismatch at or near the 5' terminus plays a greater role in determining the T(d) and signal intensity of duplexes than the type of mismatch.

Under the influence of the active deodorant ingredient 4-hydroxy-3-methoxybenzyl alcohol, the skin bacterium Corynebacterium jeikeium moderately responds with differential gene expression.

PubMed

Brune, Iris; Becker, Anke; Paarmann, Daniel; Albersmeier, Andreas; Kalinowski, Jörn; Pühler, Alfred; Tauch, Andreas

2006-12-15

A 70mer oligonucleotide microarray was constructed to analyze genome-wide expression profiles of Corynebacterium jeikeium, a skin bacterium that is predominantly present in the human axilla and involved in axillary odor formation. Oligonucleotides representing 100% of the predicted coding regions of the C. jeikeium K411 genome were designed and spotted in quadruplicate onto epoxy-coated glass slides. The quality of the printed microarray was demonstrated by co-hybridization with fluorescently labeled cDNA probes obtained from exponentially growing C. jeikeium cultures. Accordingly, genes detected with different intensities resulting in log(2) transformed ratios greater than 0.8 or smaller than -0.8 can be regarded as differentially expressed with a confidence level greater than 99%. In an application example, we measured global changes of gene expression during growth of C. jeikeium in the presence of different concentrations of the deodorant component 4-hydroxy-3-methoxybenzyl alcohol that is active in preventing body odor formation. Global expression profiling revealed that low concentrations of 4-hydroxy-3-methoxybenzyl alcohol (0.5 and 2.5mg/ml) had almost no detectable effect on the transcriptome of C. jeikeium. A slightly higher concentration of 4-hydroxy-3-methoxybenzyl alcohol (5mg/ml) resulted in differential expression of 95 genes, 86 of which showed an enhanced expression when compared to a control culture. Besides many genes encoding proteins that apparently participate in transcription and translation, the drug resistance determinant cmx and the predicted virulence factors sapA and sapD showed significantly enhanced expression levels. Differential expression of relevant genes was validated by real-time reverse transcription PCR assays.

Voltammetric behaviour of free DNA bases, methylcytosine and oligonucleotides at disposable screen printed graphite electrode platforms.

PubMed

Brotons, Ariadna; Mas, Luis Alcaraz; Metters, Jonathan P; Banks, Craig E; Iniesta, Jesús

2013-09-21

Improvements in analytical methods for the determination and quantification of methylcytosine in DNA are vital since it has the potential to be used as a biomarker to detect different diseases in the first stage such as in the case of carcinomas and sterility. In this work we utilized screen printed graphite electrodes (SPGE) for studying the electrochemical response of all free DNA bases, methylcytosine and short oligonucleotides by cyclic voltammetry (CV) and square wave voltammetry (SWV). CV and SWV responses of free DNA bases and methylcytosine have been investigated by using SPGE platforms and the feasibility of detecting and quantifying cytosine and methylcytosine as free DNA moieties has been evaluated as a function of pH, concentration and the presence of the other free DNA bases in solution simultaneously. Repeatability of using SWV has been performed for the electrochemical behavior of both 250 μM cytosine and 250 μM methylcytosine in the presence of 25 μM guanine, with coefficient of variations of 6.9% and 2.6% respectively based upon peak current (N = 5). Six-mer oligonucleotides with a sequence 5'-XXXCGC-3', where the XXX motif corresponds to TTT, TTA, TAA and AAA have been performed using SWV in 0.1 M acetate buffer pH 5.0 to explore how the DNA base position effects the electrooxidation of guanine and cytosine into the oligonucleotide. Furthermore SWV comparisons of the electrooxidation of the oligonucleotides 5'-CGCGCG-3' and its methylated 5'-mCGmCGmCG-3' have been performed with concentrations in acetate buffer solutions, and the interaction of both oligonucleotides with the graphitic surface of the SPGE has been demonstrated by fitting well-known adsorption models such as Freundlich and Langmuir kinetics according to the SWV current response of guanine, cytosine and methylcytosine into the oligonucleotide.

Specific DNA duplex formation at an artificial lipid bilayer: towards a new DNA biosensor technology.

PubMed

Werz, Emma; Korneev, Sergei; Montilla-Martinez, Malayko; Wagner, Richard; Hemmler, Roland; Walter, Claudius; Eisfeld, Jörg; Gall, Karsten; Rosemeyer, Helmut

2012-02-01

A novel technique is described which comprises a base-specific DNA duplex formation at a lipid bilayer-H(2) O-phase boundary layer. Two different probes of oligonucleotides both carrying a double-tailed lipid at the 5'-terminus were incorporated into stable artificial lipid bilayers separating two compartments (cis/trans-channel) of an optically transparent microfluidic sample carrier with perfusion capabilities. Both the cis- and trans-channels are filled with saline buffer. Injection of a cyanine-5-labeled target DNA sequence, which is complementary to only one of the oligonucleotide probes, into the cis-channel, followed by a thorough perfusion, leads to an immobilization of the labeled complementary oligonucleotide on the membrane as detected by single-molecule fluorescence spectroscopy and microscopy. In the case of fluorescent but non-complementary DNA sequences, no immobilized fluorescent oligonucleotide duplex could be detected on the membrane. This clearly verifies a specific duplex formation at the membrane interface. Copyright © 2012 Verlag Helvetica Chimica Acta AG, Zürich.

Replication dynamics of the yeast genome.

PubMed

Raghuraman, M K; Winzeler, E A; Collingwood, D; Hunt, S; Wodicka, L; Conway, A; Lockhart, D J; Davis, R W; Brewer, B J; Fangman, W L

2001-10-05

Oligonucleotide microarrays were used to map the detailed topography of chromosome replication in the budding yeast Saccharomyces cerevisiae. The times of replication of thousands of sites across the genome were determined by hybridizing replicated and unreplicated DNAs, isolated at different times in S phase, to the microarrays. Origin activations take place continuously throughout S phase but with most firings near mid-S phase. Rates of replication fork movement vary greatly from region to region in the genome. The two ends of each of the 16 chromosomes are highly correlated in their times of replication. This microarray approach is readily applicable to other organisms, including humans.

Versatile Method for the Site-Specific Modification of DNA with Boron Clusters: Anti-Epidermal Growth Factor Receptor (EGFR) Antisense Oligonucleotide Case.

PubMed

Ebenryter-Olbińska, Katarzyna; Kaniowski, Damian; Sobczak, Milena; Wojtczak, Błażej A; Janczak, Sławomir; Wielgus, Ewelina; Nawrot, Barbara; Leśnikowski, Zbigniew J

2017-11-21

A general and convenient approach for the incorporation of different types of boron clusters into specific locations of the DNA-oligonucleotide chain based on the automated phosphoramidite method of oligonucleotide synthesis and post-synthetic "click chemistry" modification has been developed. Pronounced effects of boron-cluster modification on the physico- and biochemical properties of the antisense oligonucleotides were observed. The silencing activity of antisense oligonucleotides bearing a single boron cluster modification in the middle of the oligonucleotide chain was substantially higher than that of unmodified oligonucleotides. This finding may be of importance for the design of therapeutic nucleic acids with improved properties. The proposed synthetic methodology broadens the availability of nucleic acid-boron cluster conjugates and opens up new avenues for their potential practical use. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries

PubMed Central

Schmidt, Thorsten L.; Beliveau, Brian J.; Uca, Yavuz O.; Theilmann, Mark; Da Cruz, Felipe; Wu, Chao-Ting; Shih, William M.

2015-01-01

Synthetic oligonucleotides are the main cost factor for studies in DNA nanotechnology, genetics and synthetic biology, which all require thousands of these at high quality. Inexpensive chip-synthesized oligonucleotide libraries can contain hundreds of thousands of distinct sequences, however only at sub-femtomole quantities per strand. Here we present a selective oligonucleotide amplification method, based on three rounds of rolling-circle amplification, that produces nanomole amounts of single-stranded oligonucleotides per millilitre reaction. In a multistep one-pot procedure, subsets of hundreds or thousands of single-stranded DNAs with different lengths can selectively be amplified and purified together. These oligonucleotides are used to fold several DNA nanostructures and as primary fluorescence in situ hybridization probes. The amplification cost is lower than other reported methods (typically around US$ 20 per nanomole total oligonucleotides produced) and is dominated by the use of commercial enzymes. PMID:26567534

Improved DNA hybridization parameters by Twisted Intercalating Nucleic Acid (TINA).

PubMed

Schneider, Uffe Vest

2012-01-01

This thesis establishes oligonucleotide design rules and applications of a novel group of DNA stabilizing molecules collectively called Twisted Intercalating Nucleic Acid - TINA. Three peer-reviewed publications form the basis for the thesis. One publication describes an improved and rapid method for determination of DNA melting points and two publications describe the effects of positioning TINA molecules in parallel triplex helix and antiparallel duplex helix forming DNA structures. The third publication establishes that TINA molecules containing oligonucleotides improve an antiparallel duplex hybridization based capture assay's analytical sensitivity compared to conventionel DNA oligonucleotides. Clinical microbiology is traditionally based on pathogenic microorganisms' culture and serological tests. The introduction of DNA target amplification methods like PCR has improved the analytical sensitivity and total turn around time involved in clinical diagnostics of infections. Due to the relatively weak hybridization between the two strands of double stranded DNA, a number of nucleic acid stabilizing molecules have been developed to improve the sensitivity of DNA based diagnostics through superior binding properties. A short introduction is given to Watson-Crick and Hoogsteen based DNA binding and the derived DNA structures. A number of other nucleic acid stabilizing molecules are described. The stabilizing effect of TINA molecules on different DNA structures is discussed and considered in relation to other nucleic acid stabilizing molecules and in relation to future use of TINA containing oligonucleotides in clinical diagnostics and therapy. In conclusion, design of TINA modified oligonucleotides for antiparallel duplex helixes and parallel triplex helixes follows simple purpose dependent rules. TINA molecules are well suited for improving multiplex PCR assays and can be used as part of novel technologies. Future research should test whether combinations of TINA molecules and other nucleic acid stabilizing molecules can increase analytical sensitivity whilst maintaining nucleobase mismatch discrimination in triplex helix based diagnostic assays.

Circular DNA by "Bis-Click" Ligation: Template-Independent Intramolecular Circularization of Oligonucleotides with Terminal Alkynyl Groups Utilizing Bifunctional Azides.

PubMed

Yang, Haozhe; Seela, Frank

2016-01-22

A highly effective and convenient "bis-click" strategy was developed for the template-independent circularization of single-stranded oligonucleotides by employing copper(I)-assisted azide-alkyne cycloaddition. Terminal triple bonds were incorporated at both ends of linear oligonucleotides. Alkynylated 7-deaza-2'-deoxyadenosine and 2'-deoxyuridine residues with different side chains were used in solid-phase synthesis with phosphoramidite chemistry. The bis-click ligation of linear 9- to 36-mer oligonucleotides with 1,4-bis(azidomethyl)benzene afforded circular DNA in a simple and selective way; azido modification of the oligonucleotide was not necessary. Short ethynyl side chains were compatible with the circularization of longer oligonucleotides, whereas octadiynyl residues were used for short 9-mers. Compared with linear duplexes, circular bis-click constructs exhibit a significantly increased duplex stability over their linear counterparts. The intramolecular bis-click ligation protocol is not limited to DNA, but may also be suitable for the construction of other macrocycles, such as circular RNAs, peptides, or polysaccharides. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Development of a genotyping microarray for Usher syndrome.

PubMed

Cremers, Frans P M; Kimberling, William J; Külm, Maigi; de Brouwer, Arjan P; van Wijk, Erwin; te Brinke, Heleen; Cremers, Cor W R J; Hoefsloot, Lies H; Banfi, Sandro; Simonelli, Francesca; Fleischhauer, Johannes C; Berger, Wolfgang; Kelley, Phil M; Haralambous, Elene; Bitner-Glindzicz, Maria; Webster, Andrew R; Saihan, Zubin; De Baere, Elfride; Leroy, Bart P; Silvestri, Giuliana; McKay, Gareth J; Koenekoop, Robert K; Millan, Jose M; Rosenberg, Thomas; Joensuu, Tarja; Sankila, Eeva-Marja; Weil, Dominique; Weston, Mike D; Wissinger, Bernd; Kremer, Hannie

2007-02-01

Usher syndrome, a combination of retinitis pigmentosa (RP) and sensorineural hearing loss with or without vestibular dysfunction, displays a high degree of clinical and genetic heterogeneity. Three clinical subtypes can be distinguished, based on the age of onset and severity of the hearing impairment, and the presence or absence of vestibular abnormalities. Thus far, eight genes have been implicated in the syndrome, together comprising 347 protein-coding exons. To improve DNA diagnostics for patients with Usher syndrome, we developed a genotyping microarray based on the arrayed primer extension (APEX) method. Allele-specific oligonucleotides corresponding to all 298 Usher syndrome-associated sequence variants known to date, 76 of which are novel, were arrayed. Approximately half of these variants were validated using original patient DNAs, which yielded an accuracy of >98%. The efficiency of the Usher genotyping microarray was tested using DNAs from 370 unrelated European and American patients with Usher syndrome. Sequence variants were identified in 64/140 (46%) patients with Usher syndrome type I, 45/189 (24%) patients with Usher syndrome type II, 6/21 (29%) patients with Usher syndrome type III and 6/20 (30%) patients with atypical Usher syndrome. The chip also identified two novel sequence variants, c.400C>T (p.R134X) in PCDH15 and c.1606T>C (p.C536S) in USH2A. The Usher genotyping microarray is a versatile and affordable screening tool for Usher syndrome. Its efficiency will improve with the addition of novel sequence variants with minimal extra costs, making it a very useful first-pass screening tool.

Development of a genotyping microarray for Usher syndrome

PubMed Central

Cremers, Frans P M; Kimberling, William J; Külm, Maigi; de Brouwer, Arjan P; van Wijk, Erwin; te Brinke, Heleen; Cremers, Cor W R J; Hoefsloot, Lies H; Banfi, Sandro; Simonelli, Francesca; Fleischhauer, Johannes C; Berger, Wolfgang; Kelley, Phil M; Haralambous, Elene; Bitner‐Glindzicz, Maria; Webster, Andrew R; Saihan, Zubin; De Baere, Elfride; Leroy, Bart P; Silvestri, Giuliana; McKay, Gareth J; Koenekoop, Robert K; Millan, Jose M; Rosenberg, Thomas; Joensuu, Tarja; Sankila, Eeva‐Marja; Weil, Dominique; Weston, Mike D; Wissinger, Bernd; Kremer, Hannie

2007-01-01

Background Usher syndrome, a combination of retinitis pigmentosa (RP) and sensorineural hearing loss with or without vestibular dysfunction, displays a high degree of clinical and genetic heterogeneity. Three clinical subtypes can be distinguished, based on the age of onset and severity of the hearing impairment, and the presence or absence of vestibular abnormalities. Thus far, eight genes have been implicated in the syndrome, together comprising 347 protein‐coding exons. Methods: To improve DNA diagnostics for patients with Usher syndrome, we developed a genotyping microarray based on the arrayed primer extension (APEX) method. Allele‐specific oligonucleotides corresponding to all 298 Usher syndrome‐associated sequence variants known to date, 76 of which are novel, were arrayed. Results Approximately half of these variants were validated using original patient DNAs, which yielded an accuracy of >98%. The efficiency of the Usher genotyping microarray was tested using DNAs from 370 unrelated European and American patients with Usher syndrome. Sequence variants were identified in 64/140 (46%) patients with Usher syndrome type I, 45/189 (24%) patients with Usher syndrome type II, 6/21 (29%) patients with Usher syndrome type III and 6/20 (30%) patients with atypical Usher syndrome. The chip also identified two novel sequence variants, c.400C>T (p.R134X) in PCDH15 and c.1606T>C (p.C536S) in USH2A. Conclusion The Usher genotyping microarray is a versatile and affordable screening tool for Usher syndrome. Its efficiency will improve with the addition of novel sequence variants with minimal extra costs, making it a very useful first‐pass screening tool. PMID:16963483

Selective Amplification of SPR Biosensor Signal for Recognition of rpoB Gene Fragments by Use of Gold Nanoparticles Modified by Thiolated DNA

NASA Astrophysics Data System (ADS)

Matsishin, M.; Rachkov, A.; Lopatynskyi, A.; Chegel, V.; Soldatkin, A.; El'skaya, A.

2017-04-01

An experimental approach for improving the sensitivity of the surface plasmon resonance (SPR) DNA hybridization sensor using gold nanoparticles (GNPs), modified by specific oligonucleotides, was elaborated. An influence of the ionic strength on the aggregation stability of unmodified GNPs and GNPs modified by the thiolated oligonucleotides was investigated by monitoring a value of light extinction at 520 nm that can be considered as a measure of a quantity of the non-aggregated GNPs. While the unmodified GNPs started to aggregate in 0.2 × saline-sodium citrate (SSC), GNPs modified by the negatively charged oligonucleotides were more stable at increasing ionic strength up to 0.5 × SSC. A bioselective element of the SPR DNA hybridization sensor was formed by immobilization on the gold sensor surface of the thiolated oligonucleotides P2, the sequence of which is a fragment of the rpoB gene of Mycobacterium tuberculosis. The injections into the measuring flow cell of the SPR spectrometer of various concentrations of GNPs modified by the complementary oligonucleotides T2-18m caused the pronounced concentration-dependent sequence-specific sensor responses. The magnitude of the sensor responses was much higher than in the case of the free standing complementary oligonucleotides. According to the obtained experimental data, the usage of GNPs modified by specific oligonucleotides can amplify the sensor response of the SPR DNA hybridization sensor in 1200 times.

Gene ARMADA: an integrated multi-analysis platform for microarray data implemented in MATLAB.

PubMed

Chatziioannou, Aristotelis; Moulos, Panagiotis; Kolisis, Fragiskos N

2009-10-27

The microarray data analysis realm is ever growing through the development of various tools, open source and commercial. However there is absence of predefined rational algorithmic analysis workflows or batch standardized processing to incorporate all steps, from raw data import up to the derivation of significantly differentially expressed gene lists. This absence obfuscates the analytical procedure and obstructs the massive comparative processing of genomic microarray datasets. Moreover, the solutions provided, heavily depend on the programming skills of the user, whereas in the case of GUI embedded solutions, they do not provide direct support of various raw image analysis formats or a versatile and simultaneously flexible combination of signal processing methods. We describe here Gene ARMADA (Automated Robust MicroArray Data Analysis), a MATLAB implemented platform with a Graphical User Interface. This suite integrates all steps of microarray data analysis including automated data import, noise correction and filtering, normalization, statistical selection of differentially expressed genes, clustering, classification and annotation. In its current version, Gene ARMADA fully supports 2 coloured cDNA and Affymetrix oligonucleotide arrays, plus custom arrays for which experimental details are given in tabular form (Excel spreadsheet, comma separated values, tab-delimited text formats). It also supports the analysis of already processed results through its versatile import editor. Besides being fully automated, Gene ARMADA incorporates numerous functionalities of the Statistics and Bioinformatics Toolboxes of MATLAB. In addition, it provides numerous visualization and exploration tools plus customizable export data formats for seamless integration by other analysis tools or MATLAB, for further processing. Gene ARMADA requires MATLAB 7.4 (R2007a) or higher and is also distributed as a stand-alone application with MATLAB Component Runtime. Gene ARMADA provides a highly adaptable, integrative, yet flexible tool which can be used for automated quality control, analysis, annotation and visualization of microarray data, constituting a starting point for further data interpretation and integration with numerous other tools.

Static magnetic field reduced exogenous oligonucleotide uptake by spermatozoa using magnetic nanoparticle gene delivery system

NASA Astrophysics Data System (ADS)

Katebi, Samira; Esmaeili, Abolghasem; Ghaedi, Kamran

2016-03-01

Spermatozoa could introduce exogenous oligonucleotides of interest to the oocyte. The most important reason of low efficiency of sperm mediated gene transfer (SMGT) is low uptake of exogenous DNA by spermatozoa. The aim of this study was to evaluate the effects of static magnetic field on exogenous oligonucleotide uptake of spermatozoa using magnetofection method. Magnetic nanoparticles (MNPs) associated with the labeled oligonucleotides were used to increase the efficiency of exogenous oligonucleotide uptake by rooster spermatozoa. We used high-field/high-gradient magnet (NdFeB) to enhance and accelerate exogenous DNA sedimentation at the spermatozoa surface. Flow cytometry analysis was performed to measure viability and percentage of exogenous oligonucleotide uptake by sperm. Flow cytometry analysis showed a significant increase in exogenous oligonucleotide uptake by rooster spermatozoa (P<0.001) when spermatozoa were incubated in exogenous oligonucleotide solution and MNPs. However, by applying static magnetic field during magnetofection method, a significant decrease in exogenous oligonucleotide uptake was observed (P<0.05). Findings of this study showed that MNPs were effective to increase exogenous oligonucleotide uptake by rooster spermatozoa; however unlike others studies, static magnetic field, was not only ineffective to enhance exogenous oligonucleotide uptake by rooster spermatozoa but also led to reduction in efficiency of magnetic nanoparticles in gene transfer.

Microarray-based determination of anti-inflammatory genes targeted by 6-(methylsulfinyl)hexyl isothiocyanate in macrophages.

PubMed

Chen, Jihua; Uto, Takuhiro; Tanigawa, Shunsuke; Yamada-Kato, Tomeo; Fujii, Makoto; Hou, DE-Xing

2010-01-01

6-(Methylsulfinyl)hexyl isothiocyanate (6-MSITC) is a bioactive ingredient of wasabi [Wasabia japonica (Miq.) Matsumura], which is a popular pungent spice of Japan. To evaluate the anti-inflammatory function and underlying genes targeted by 6-MSITC, gene expression profiling through DNA microarray was performed in mouse macrophages. Among 22,050 oligonucleotides, the expression levels of 406 genes were increased by ≥3-fold in lipopolysaccharide (LPS)-activated RAW264 cells, 238 gene signals of which were attenuated by 6-MSITC (≥2-fold). Expression levels of 717 genes were decreased by ≥3-fold in LPS-activated cells, of which 336 gene signals were restored by 6-MSITC (≥2-fold). Utilizing group analysis, 206 genes affected by 6-MSITC with a ≥2-fold change were classified into 35 categories relating to biological processes (81), molecular functions (108) and signaling pathways (17). The genes were further categorized as 'defense, inflammatory response, cytokine activities and receptor activities' and some were confirmed by real-time polymerase chain reaction. Ingenuity pathway analysis further revealed that wasabi 6-MSITC regulated the relevant networks of chemokines, interleukins and interferons to exert its anti-inflammatory function.

Microarray-based determination of anti-inflammatory genes targeted by 6-(methylsulfinyl)hexyl isothiocyanate in macrophages

PubMed Central

CHEN, JIHUA; UTO, TAKUHIRO; TANIGAWA, SHUNSUKE; YAMADA-KATO, TOMEO; FUJII, MAKOTO; HOU, DE-XING

2010-01-01

6-(Methylsulfinyl)hexyl isothiocyanate (6-MSITC) is a bioactive ingredient of wasabi [Wasabia japonica (Miq.) Matsumura], which is a popular pungent spice of Japan. To evaluate the anti-inflammatory function and underlying genes targeted by 6-MSITC, gene expression profiling through DNA microarray was performed in mouse macrophages. Among 22,050 oligonucleotides, the expression levels of 406 genes were increased by ≥3-fold in lipopolysaccharide (LPS)-activated RAW264 cells, 238 gene signals of which were attenuated by 6-MSITC (≥2-fold). Expression levels of 717 genes were decreased by ≥3-fold in LPS-activated cells, of which 336 gene signals were restored by 6-MSITC (≥2-fold). Utilizing group analysis, 206 genes affected by 6-MSITC with a ≥2-fold change were classified into 35 categories relating to biological processes (81), molecular functions (108) and signaling pathways (17). The genes were further categorized as ‘defense, inflammatory response, cytokine activities and receptor activities’ and some were confirmed by real-time polymerase chain reaction. Ingenuity pathway analysis further revealed that wasabi 6-MSITC regulated the relevant networks of chemokines, interleukins and interferons to exert its anti-inflammatory function. PMID:23136589

cn.FARMS: a latent variable model to detect copy number variations in microarray data with a low false discovery rate.

PubMed

Clevert, Djork-Arné; Mitterecker, Andreas; Mayr, Andreas; Klambauer, Günter; Tuefferd, Marianne; De Bondt, An; Talloen, Willem; Göhlmann, Hinrich; Hochreiter, Sepp

2011-07-01

Cost-effective oligonucleotide genotyping arrays like the Affymetrix SNP 6.0 are still the predominant technique to measure DNA copy number variations (CNVs). However, CNV detection methods for microarrays overestimate both the number and the size of CNV regions and, consequently, suffer from a high false discovery rate (FDR). A high FDR means that many CNVs are wrongly detected and therefore not associated with a disease in a clinical study, though correction for multiple testing takes them into account and thereby decreases the study's discovery power. For controlling the FDR, we propose a probabilistic latent variable model, 'cn.FARMS', which is optimized by a Bayesian maximum a posteriori approach. cn.FARMS controls the FDR through the information gain of the posterior over the prior. The prior represents the null hypothesis of copy number 2 for all samples from which the posterior can only deviate by strong and consistent signals in the data. On HapMap data, cn.FARMS clearly outperformed the two most prevalent methods with respect to sensitivity and FDR. The software cn.FARMS is publicly available as a R package at http://www.bioinf.jku.at/software/cnfarms/cnfarms.html.

Akt/FOXO3a signaling modulates the endothelial stress response through regulation of heat shock protein 70 expression.

PubMed

Kim, Hyo-Soo; Skurk, Carsten; Maatz, Henrike; Shiojima, Ichiro; Ivashchenko, Yuri; Yoon, Suk-Won; Park, Young-Bae; Walsh, Kenneth

2005-06-01

To identify new antiapoptotic targets of the PI3K-Akt signaling pathway in endothelial cells, adenovirus-mediated Akt1 gene transfer and oligonucleotide microarrays were used to examine Akt-regulated transcripts. DNA microarray analysis revealed that HSP70 expression underwent the greatest fold activation of 12,532 transcripts examined in human umbilical vein endothelial cells (HUVEC) transduced with constitutively active Akt1. Akt1 gene transfer increased HSP70 transcript expression by 24.8-fold as determined by quantitative PCR and promoted a dose-dependent up-regulation of HSP70 protein as determined by Western immunoblot analysis. Gene transfer of FOXO3a, a downstream target of Akt in endothelial cells, significantly suppressed both basal and stress-induced HSP70 protein expression. FOXO3a induced caspase-9-dependent apoptosis in HUVEC, and cotransduction with Ad-HSP70 rescued endothelial cells from FOXO3a-induced apoptosis under basal and stress conditions. Our results identify HSP70 as a new antiapoptotic target of Akt-FOXO3a signaling in endothelial cells that controls viability through modulation of the stress-induced intrinsic cell death pathway.

Validation of the high-throughput marker technology DArT using the model plant Arabidopsis thaliana.

PubMed

Wittenberg, Alexander H J; van der Lee, Theo; Cayla, Cyril; Kilian, Andrzej; Visser, Richard G F; Schouten, Henk J

2005-08-01

Diversity Arrays Technology (DArT) is a microarray-based DNA marker technique for genome-wide discovery and genotyping of genetic variation. DArT allows simultaneous scoring of hundreds of restriction site based polymorphisms between genotypes and does not require DNA sequence information or site-specific oligonucleotides. This paper demonstrates the potential of DArT for genetic mapping by validating the quality and molecular basis of the markers, using the model plant Arabidopsis thaliana. Restriction fragments from a genomic representation of the ecotype Landsberg erecta (Ler) were amplified by PCR, individualized by cloning and spotted onto glass slides. The arrays were then hybridized with labeled genomic representations of the ecotypes Columbia (Col) and Ler and of individuals from an F(2) population obtained from a Col x Ler cross. The scoring of markers with specialized software was highly reproducible and 107 markers could unambiguously be ordered on a genetic linkage map. The marker order on the genetic linkage map coincided with the order on the DNA sequence map. Sequencing of the Ler markers and alignment with the available Col genome sequence confirmed that the polymorphism in DArT markers is largely a result of restriction site polymorphisms.

Transcriptional profiling of Epstein–Barr virus (EBV) genes and host cellular genes in nasal NK/T-cell lymphoma and chronic active EBV infection

PubMed Central

Zhang, Y; Ohyashiki, J H; Takaku, T; Shimizu, N; Ohyashiki, K

2006-01-01

Nasal NK/T-cell lymphoma is an aggressive subtype of non-Hodgkin lymphoma (NHL) that is closely associated with Epstein–Barr virus (EBV). The clonal expansion of EBV-infected NK or T cells is also seen in patients with chronic active EBV (CAEBV) infection, suggesting that two diseases might share a partially similar mechanism by which EBV affects host cellular gene expression. To understand the pathogenesis of EBV-associated NK/T-cell lymphoproliferative disorders (LPD) and design new therapies, we employed a novel EBV DNA microarray to compare patterns of EBV expression in six cell lines established from EBV-associated NK/T-cell LPD. We found that expression of BZLF1, which encodes the immediate-early gene product Zta, was expressed in SNK/T cells and the expression levels were preferentially high in cell lines from CAEBV infection. We also analyzsd the gene expression patterns of host cellular genes using a human oligonucleotide DNA microarray. We identified a subset of pathogenically and clinically relevant host cellular genes, including TNFRSF10D, CDK2, HSPCA, IL12A as a common molecular biological properties of EBV-associated NK/T-cell LPD and a subset of genes, such as PDCD4 as a putative contributor for disease progression. This study describes a novel approach from the aspects of viral and host gene expression, which could identify novel therapeutic targets in EBV-associated NK/T-cell LPD. PMID:16449999

Ferrocene conjugated oligonucleotide for electrochemical detection of DNA base mismatch.

PubMed

Hasegawa, Yusuke; Takada, Tadao; Nakamura, Mitsunobu; Yamana, Kazushige

2017-08-01

We describe the synthesis, binding, and electrochemical properties of ferrocene-conjugated oligonucleotides (Fc-oligos). The key step for the preparation of Fc-oligos contains the coupling of vinylferrocene to 5-iododeoxyuridine via Heck reaction. The Fc-conjugated deoxyuridine phosphoramidite was used in the Fc-oligonucleotide synthesis. We show that thiol-modified Fc-oligos deposited onto gold electrodes possess potential ability in electrochemical detection of DNA base mismatch. Copyright © 2017 Elsevier Ltd. All rights reserved.

Oligonucleotide-genotyping as a method of detecting the HLA-DR2 (DRw15)-Dw2, -DR2 (DRw15)-Dw12, -DR4-Dw15, and -DR4-D"KT2" haplotypes in the Japanese population.

PubMed

Obata, F; Ito, I; Kaneko, T; Ohkubo, M; Ishimoto, A L; Abe, A; Kashiwagi, N

1989-05-01

We synthesized pairs of four different oligonucleotides, F22, F29, F42, and F158, to analyse the HLA-DR2 (DRw15) and -DR4 haplotypes in the Japanese population. After enzymatically amplifying the HLA-DRB1 gene, we hybridized the oligonucleotide probes with DNA extracted from 42 donors. Hybridization was completed between F22 and the DNA of haplotype DR2 (DRw15)-Dw2, between F29 and the DNA of DR2 (DRw15)-Dw12, between F42 and the DNA of DR4-D"KT2", and between F158 and the DNA of DR4-Dw15. In keeping with the nucleotide sequences of the probes, F29 hybridized also with DNA from the DR9-Dw23 haplotype and F158 with that from some of the DRw8 haplotypes (DRw8-Dw8.3) in the Japanese population. Results of this study demonstrate that the four oligonucleotides make useful probes for detecting the haplotypes above.

Current genetic methodologies in the identification of disaster victims and in forensic analysis.

PubMed

Ziętkiewicz, Ewa; Witt, Magdalena; Daca, Patrycja; Zebracka-Gala, Jadwiga; Goniewicz, Mariusz; Jarząb, Barbara; Witt, Michał

2012-02-01

This review presents the basic problems and currently available molecular techniques used for genetic profiling in disaster victim identification (DVI). The environmental conditions of a mass disaster often result in severe fragmentation, decomposition and intermixing of the remains of victims. In such cases, traditional identification based on the anthropological and physical characteristics of the victims is frequently inconclusive. This is the reason why DNA profiling became the gold standard for victim identification in mass-casualty incidents (MCIs) or any forensic cases where human remains are highly fragmented and/or degraded beyond recognition. The review provides general information about the sources of genetic material for DNA profiling, the genetic markers routinely used during genetic profiling (STR markers, mtDNA and single-nucleotide polymorphisms [SNP]) and the basic statistical approaches used in DNA-based disaster victim identification. Automated technological platforms that allow the simultaneous analysis of a multitude of genetic markers used in genetic identification (oligonucleotide microarray techniques and next-generation sequencing) are also presented. Forensic and population databases containing information on human variability, routinely used for statistical analyses, are discussed. The final part of this review is focused on recent developments, which offer particularly promising tools for forensic applications (mRNA analysis, transcriptome variation in individuals/populations and genetic profiling of specific cells separated from mixtures).

Chemical synthesis and characterization of branched oligodeoxyribonucleotides (bDNA) for use as signal amplifiers in nucleic acid quantification assays.

PubMed

Horn, T; Chang, C A; Urdea, M S

1997-12-01

The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology.

Chemical synthesis and characterization of branched oligodeoxyribonucleotides (bDNA) for use as signal amplifiers in nucleic acid quantification assays.

PubMed Central

Horn, T; Chang, C A; Urdea, M S

1997-01-01

The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology. PMID:9365266

High-throughput assays for DNA gyrase and other topoisomerases

PubMed Central

Maxwell, Anthony; Burton, Nicolas P.; O'Hagan, Natasha

2006-01-01

We have developed high-throughput microtitre plate-based assays for DNA gyrase and other DNA topoisomerases. These assays exploit the fact that negatively supercoiled plasmids form intermolecular triplexes more efficiently than when they are relaxed. Two assays are presented, one using capture of a plasmid containing a single triplex-forming sequence by an oligonucleotide tethered to the surface of a microtitre plate and subsequent detection by staining with a DNA-specific fluorescent dye. The other uses capture of a plasmid containing two triplex-forming sequences by an oligonucleotide tethered to the surface of a microtitre plate and subsequent detection by a second oligonucleotide that is radiolabelled. The assays are shown to be appropriate for assaying DNA supercoiling by Escherichia coli DNA gyrase and DNA relaxation by eukaryotic topoisomerases I and II, and E.coli topoisomerase IV. The assays are readily adaptable to other enzymes that change DNA supercoiling (e.g. restriction enzymes) and are suitable for use in a high-throughput format. PMID:16936317

High-throughput assays for DNA gyrase and other topoisomerases.

PubMed

Maxwell, Anthony; Burton, Nicolas P; O'Hagan, Natasha

2006-01-01

We have developed high-throughput microtitre plate-based assays for DNA gyrase and other DNA topoisomerases. These assays exploit the fact that negatively supercoiled plasmids form intermolecular triplexes more efficiently than when they are relaxed. Two assays are presented, one using capture of a plasmid containing a single triplex-forming sequence by an oligonucleotide tethered to the surface of a microtitre plate and subsequent detection by staining with a DNA-specific fluorescent dye. The other uses capture of a plasmid containing two triplex-forming sequences by an oligonucleotide tethered to the surface of a microtitre plate and subsequent detection by a second oligonucleotide that is radiolabelled. The assays are shown to be appropriate for assaying DNA supercoiling by Escherichia coli DNA gyrase and DNA relaxation by eukaryotic topoisomerases I and II, and E.coli topoisomerase IV. The assays are readily adaptable to other enzymes that change DNA supercoiling (e.g. restriction enzymes) and are suitable for use in a high-throughput format.

DNA/RNA heteroduplex oligonucleotide for highly efficient gene silencing

PubMed Central

Nishina, Kazutaka; Piao, Wenying; Yoshida-Tanaka, Kie; Sujino, Yumiko; Nishina, Tomoko; Yamamoto, Tsuyoshi; Nitta, Keiko; Yoshioka, Kotaro; Kuwahara, Hiroya; Yasuhara, Hidenori; Baba, Takeshi; Ono, Fumiko; Miyata, Kanjiro; Miyake, Koichi; Seth, Punit P.; Low, Audrey; Yoshida, Masayuki; Bennett, C. Frank; Kataoka, Kazunori; Mizusawa, Hidehiro; Obika, Satoshi; Yokota, Takanori

2015-01-01

Antisense oligonucleotides (ASOs) are recognized therapeutic agents for the modulation of specific genes at the post-transcriptional level. Similar to any medical drugs, there are opportunities to improve their efficacy and safety. Here we develop a short DNA/RNA heteroduplex oligonucleotide (HDO) with a structure different from double-stranded RNA used for short interfering RNA and single-stranded DNA used for ASO. A DNA/locked nucleotide acid gapmer duplex with an α-tocopherol-conjugated complementary RNA (Toc-HDO) is significantly more potent at reducing the expression of the targeted mRNA in liver compared with the parent single-stranded gapmer ASO. Toc-HDO also improves the phenotype in disease models more effectively. In addition, the high potency of Toc-HDO results in a reduction of liver dysfunction observed in the parent ASO at a similar silencing effect. HDO technology offers a novel concept of therapeutic oligonucleotides, and the development of this molecular design opens a new therapeutic field. PMID:26258894

OligArch: A software tool to allow artificially expanded genetic information systems (AEGIS) to guide the autonomous self-assembly of long DNA constructs from multiple DNA single strands.

PubMed

Bradley, Kevin M; Benner, Steven A

2014-01-01

Synthetic biologists wishing to self-assemble large DNA (L-DNA) constructs from small DNA fragments made by automated synthesis need fragments that hybridize predictably. Such predictability is difficult to obtain with nucleotides built from just the four standard nucleotides. Natural DNA's peculiar combination of strong and weak G:C and A:T pairs, the context-dependence of the strengths of those pairs, unimolecular strand folding that competes with desired interstrand hybridization, and non-Watson-Crick interactions available to standard DNA, all contribute to this unpredictability. In principle, adding extra nucleotides to the genetic alphabet can improve the predictability and reliability of autonomous DNA self-assembly, simply by increasing the information density of oligonucleotide sequences. These extra nucleotides are now available as parts of artificially expanded genetic information systems (AEGIS), and tools are now available to generate entirely standard DNA from AEGIS DNA during PCR amplification. Here, we describe the OligArch (for "oligonucleotide architecting") software, an application that permits synthetic biologists to engineer optimally self-assembling DNA constructs from both six- and eight-letter AEGIS alphabets. This software has been used to design oligonucleotides that self-assemble to form complete genes from 20 or more single-stranded synthetic oligonucleotides. OligArch is therefore a key element of a scalable and integrated infrastructure for the rapid and designed engineering of biology.

Direct fluorescence in situ hybridization on human metaphase chromosomes using quantum dot-platinum labeled DNA probes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hwang, Gyoyeon; Biological Chemistry, Korea University of Science and Technology, 217, Gajeong-ro, Yuseong-gu, Deajeon; Lee, Hansol

The telomere shortening in chromosomes implies the senescence, apoptosis, or oncogenic transformation of cells. Since detecting telomeres in aging and diseases like cancer, is important, the direct detection of telomeres has been a very useful biomarker. We propose a telomere detection method using a newly synthesized quantum dot (QD) based probe with oligonucleotide conjugation and direct fluorescence in situ hybridization (FISH). QD-oligonucleotides were prepared with metal coordination bonding based on platinum-guanine binding reported in our previous work. The QD-oligonucleotide conjugation method has an advantage where any sequence containing guanine at the end can be easily bound to the starting QD-Ptmore » conjugate. A synthesized telomeric oligonucleotide was bound to the QD-Pt conjugate successfully and this probe hybridized specifically on the telomere of fabricated MV-4-11 and MOLT-4 chromosomes. Additionally, the QD-telomeric oligonucleotide probe successfully detected the telomeres on the CGH metaphase slide. Due to the excellent photostability and high quantum yield of QDs, the QD-oligonucleotide probe has high fluorescence intensity when compared to the organic dye-oligonucleotide probe. Our QD-oligonucleotide probe, conjugation method of this QD probe, and hybridization protocol with the chromosomes can be a useful tool for chromosome painting and FISH. - Highlights: • We prepared a probe linked between QD and telomeric oligonucleotide with platinum-guanine bonding. • Telomeres were detected by our new telomere probes successfully in three different human metaphase chromosomes. • QDPt-DNA probe has high fluorescence intensity in comparison with organic dye-DNA probe.« less

Contribution of the first K-homology domain of poly(C)-binding protein 1 to its affinity and specificity for C-rich oligonucleotides

PubMed Central

Yoga, Yano M. K.; Traore, Daouda A. K.; Sidiqi, Mahjooba; Szeto, Chris; Pendini, Nicole R.; Barker, Andrew; Leedman, Peter J.; Wilce, Jacqueline A.; Wilce, Matthew C. J.

2012-01-01

Poly-C-binding proteins are triple KH (hnRNP K homology) domain proteins with specificity for single stranded C-rich RNA and DNA. They play diverse roles in the regulation of protein expression at both transcriptional and translational levels. Here, we analyse the contributions of individual αCP1 KH domains to binding C-rich oligonucleotides using biophysical and structural methods. Using surface plasmon resonance (SPR), we demonstrate that KH1 makes the most stable interactions with both RNA and DNA, KH3 binds with intermediate affinity and KH2 only interacts detectibly with DNA. The crystal structure of KH1 bound to a 5′-CCCTCCCT-3′ DNA sequence shows a 2:1 protein:DNA stoichiometry and demonstrates a molecular arrangement of KH domains bound to immediately adjacent oligonucleotide target sites. SPR experiments, with a series of poly-C-sequences reveals that cytosine is preferred at all four positions in the oligonucleotide binding cleft and that a C-tetrad binds KH1 with 10 times higher affinity than a C-triplet. The basis for this high affinity interaction is finally detailed with the structure determination of a KH1.W.C54S mutant bound to 5′-ACCCCA-3′ DNA sequence. Together, these data establish the lead role of KH1 in oligonucleotide binding by αCP1 and reveal the molecular basis of its specificity for a C-rich tetrad. PMID:22344691

Contribution of the first K-homology domain of poly(C)-binding protein 1 to its affinity and specificity for C-rich oligonucleotides.

PubMed

Yoga, Yano M K; Traore, Daouda A K; Sidiqi, Mahjooba; Szeto, Chris; Pendini, Nicole R; Barker, Andrew; Leedman, Peter J; Wilce, Jacqueline A; Wilce, Matthew C J

2012-06-01

Poly-C-binding proteins are triple KH (hnRNP K homology) domain proteins with specificity for single stranded C-rich RNA and DNA. They play diverse roles in the regulation of protein expression at both transcriptional and translational levels. Here, we analyse the contributions of individual αCP1 KH domains to binding C-rich oligonucleotides using biophysical and structural methods. Using surface plasmon resonance (SPR), we demonstrate that KH1 makes the most stable interactions with both RNA and DNA, KH3 binds with intermediate affinity and KH2 only interacts detectibly with DNA. The crystal structure of KH1 bound to a 5'-CCCTCCCT-3' DNA sequence shows a 2:1 protein:DNA stoichiometry and demonstrates a molecular arrangement of KH domains bound to immediately adjacent oligonucleotide target sites. SPR experiments, with a series of poly-C-sequences reveals that cytosine is preferred at all four positions in the oligonucleotide binding cleft and that a C-tetrad binds KH1 with 10 times higher affinity than a C-triplet. The basis for this high affinity interaction is finally detailed with the structure determination of a KH1.W.C54S mutant bound to 5'-ACCCCA-3' DNA sequence. Together, these data establish the lead role of KH1 in oligonucleotide binding by αCP1 and reveal the molecular basis of its specificity for a C-rich tetrad.

PCR amplification on microarrays of gel immobilized oligonucleotides

DOEpatents

Strizhkov, Boris; Tillib, Sergei; Mikhailovich, Vladimir; Mirzabekov, Andrei

2003-11-04

The invention relates two general methods for performing PCR amplification, combined with the detection and analysis of the PCR products on a microchip. In the first method, the amplification occurs both outside and within a plurality of gel pads on a microchip, with at least one oligonucleotide primer immobilized in a gel pad. In the second method, PCR amplification also takes place within gel pads on a microchip, but the pads are surrounded by a hydrophobic liquid such as that which separates the individual gel pads into environments which resemble micro-miniaturized test tubes.

The high stability of the triple helices formed between short purine oligonucleotides and SIV/HIV-2 vpx genes is determined by the targeted DNA structure.

PubMed Central

Svinarchuk, F; Monnot, M; Merle, A; Malvy, C; Fermandjian, S

1995-01-01

In our previous works we have shown that the oligonucleotides 5'-GGGGAGGGGGAGG-3' and 5'-GGAGGGGGAGGGG-3' give very stable and specific triplexes with their target double stranded DNAs [Svinarchuk, F., Bertrand, J.-R. and Malvy, C. (1994) Nucleic Acids Res., 22, 3742-3747; Svinarchuk, F., Paoletti, J. and Malvy, C. (1995) J. Biol. Chem., 270, 14 068-14,071]. The target for the invariable part of these oligonucleotides, 5'-GGAGGGGGAGG-3', is found in a highly conserved 20 bp long purine/pyrimidine tract of the vpx gene of the SIV and HIV-2 viruses and could be a target for oligonucleotide directed antivirus therapy. Here were report on the ability of four purine oligonucleotides with different lengths (11-, 14-, 17- and 20-mer) to form triplexes with the purine/pyrimidine stretch of the vpx gene. Triplex formation was tested by joint dimethyl sulfate (DMS) footprint, gel-retardation assay, circular dichroism (CD) and UV-melting studies. Dimethyl sulfate footprint studies revealed the antiparallel orientation of the third strand to the purine strand of the Watson-Crick duplex. However, the protection of the guanines at the ends of the target sequence decreased as the length of the third strand oligonucleotide increased. Melting temperature studies provided profiles with only one transition for all of the triplexes. The melting temperatures of the triplexes were found to be the same as for the targeted duplex in the case of the 11- and 14-mer third strands while for the 17- and 20-mer third strands the melting temperature of the triplexes were correspondingly 4 and 8 degrees C higher than for the duplex. Heating and cooling melting curves were reversible for all of the tested triplexes except one with the 20-mer third strand oligonucleotide. Circular dichroism spectra showed the ability of the target DNA to adopt an A-like DNA conformation. Upon triplex formation the A-DNA form becomes even more pronounced. This effect depends on the length of the third strand oligonucleotide: the CD spectrum shows a 'classical' A-DNA shape with the 20-mer. This is not observed with the purine/pyrimidine stretch of the HIV-1 DNA which keeps a B-like spectrum even after triplex formation. We suggest, that an A-like duplex DNA is required for the formation of a stable DNA purine(purine-pyrimidine) triplex. Images PMID:7479024

Exploring the Use of a Guanine-Rich Catalytic DNA for Sulfoxide Preparation

PubMed Central

Dellafiore, María A.; Montserrat, Javier M.; Iribarren, Adolfo M.

2015-01-01

A guanine-rich DNA oligonucleotide complexed with hemin was used to catalyze controlled oxygen transfer reactions to different sulfides for sulfoxide preparation in the presence of H2O2. Comparable activities were obtained when using fully modified L-DNA. In addition, oligonucleotide immobilization led to an active catalyst which could be successfully recovered and reused without loss of activity. PMID:26066510

Programmable display of DNA-protein chimeras for controlling cell-hydrogel interactions via reversible intermolecular hybridization.

PubMed

Zhang, Zhaoyang; Li, Shihui; Chen, Niancao; Yang, Cheng; Wang, Yong

2013-04-08

Extensive studies have been recently carried out to achieve dynamic control of cell-material interactions primarily through physicochemical stimulation. The purpose of this study was to apply reversible intermolecular hybridization to program cell-hydrogel interactions in physiological conditions based on DNA-antibody chimeras and complementary oligonucleotides. The results showed that DNA oligonucleotides could be captured to and released from the immobilizing DNA-functionalized hydrogels with high specificity via DNA hybridization. Accordingly, DNA-antibody chimeras were captured to the hydrogels, successfully inducing specific cell attachment. The cell attachment to the hydrogels reached the plateau at approximately half an hour after the functionalized hydrogels and the cells were incubated together. The attached cells were rapidly released from the bound hydrogels when triggering complementary oligonucleotides were introduced to the system. However, the capability of the triggering complementary oligonucleotides in releasing cells was affected by the length of intermolecular hybridization. The length needed to be at least more than 20 base pairs in the current experimental setting. Notably, because the procedure of intermolecular hybridization did not involve any harsh condition, the released cells maintained the same viability as that of the cultured cells. The functionalized hydrogels also exhibited the potential to catch and release cells repeatedly. Therefore, this study demonstrates that it is promising to regulate cell-material interactions dynamically through the DNA-programmed display of DNA-protein chimeras.

Microarrays Made Simple: "DNA Chips" Paper Activity

ERIC Educational Resources Information Center

Barnard, Betsy

2006-01-01

DNA microarray technology is revolutionizing biological science. DNA microarrays (also called DNA chips) allow simultaneous screening of many genes for changes in expression between different cells. Now researchers can obtain information about genes in days or weeks that used to take months or years. The paper activity described in this article…

Silver Nanoparticle Oligonucleotide Conjugates Based on DNA with Triple Cyclic Disulfide Moieties

PubMed Central

Lee, Jae-Seung; Lytton-Jean, Abigail K. R.; Hurst, Sarah J.; Mirkin, Chad A.

2011-01-01

We report a new strategy for preparing silver nanoparticle oligonucleotide conjugates that are based upon DNA with cyclic disulfide-anchoring groups. These particles are extremely stable and can withstand NaCl concentrations up to 1.0 M. When silver nanoparticles functionalized with complementary sequences are combined, they assemble to form DNA-linked nanoparticle networks. This assembly process is reversible with heating and is associated with a red-shifting of the particle surface plasmon resonance and a concomitant color change from yellow to pale red. Analogous to the oligonucleotide-functionalized gold nanoparticles, these particles also exhibit highly cooperative binding properties with extremely sharp melting transitions. This work is an important step towards being able to use silver nanoparticle oligonucleotide conjugates for a variety of purposes, including molecular diagnostic labels, synthons in programmable materials synthesis approaches, and functional components for nanoelectronic and plasmonic devices. PMID:17571909

Characterization and simulation of cDNA microarray spots using a novel mathematical model

PubMed Central

Kim, Hye Young; Lee, Seo Eun; Kim, Min Jung; Han, Jin Il; Kim, Bo Kyung; Lee, Yong Sung; Lee, Young Seek; Kim, Jin Hyuk

2007-01-01

Background The quality of cDNA microarray data is crucial for expanding its application to other research areas, such as the study of gene regulatory networks. Despite the fact that a number of algorithms have been suggested to increase the accuracy of microarray gene expression data, it is necessary to obtain reliable microarray images by improving wet-lab experiments. As the first step of a cDNA microarray experiment, spotting cDNA probes is critical to determining the quality of spot images. Results We developed a governing equation of cDNA deposition during evaporation of a drop in the microarray spotting process. The governing equation included four parameters: the surface site density on the support, the extrapolated equilibrium constant for the binding of cDNA molecules with surface sites on glass slides, the macromolecular interaction factor, and the volume constant of a drop of cDNA solution. We simulated cDNA deposition from the single model equation by varying the value of the parameters. The morphology of the resulting cDNA deposit can be classified into three types: a doughnut shape, a peak shape, and a volcano shape. The spot morphology can be changed into a flat shape by varying the experimental conditions while considering the parameters of the governing equation of cDNA deposition. The four parameters were estimated by fitting the governing equation to the real microarray images. With the results of the simulation and the parameter estimation, the phenomenon of the formation of cDNA deposits in each type was investigated. Conclusion This study explains how various spot shapes can exist and suggests which parameters are to be adjusted for obtaining a good spot. This system is able to explore the cDNA microarray spotting process in a predictable, manageable and descriptive manner. We hope it can provide a way to predict the incidents that can occur during a real cDNA microarray experiment, and produce useful data for several research applications involving cDNA microarrays. PMID:18096047

Evolution of thermophilic DNA polymerases for the recognition and amplification of C2ʹ-modified DNA

NASA Astrophysics Data System (ADS)

Chen, Tingjian; Hongdilokkul, Narupat; Liu, Zhixia; Adhikary, Ramkrishna; Tsuen, Shujian S.; Romesberg, Floyd E.

2016-06-01

The PCR amplification of oligonucleotides enables the evolution of sequences called aptamers that bind specific targets with antibody-like affinity. However, in many applications the use of these aptamers is limited by nuclease-mediated degradation. In contrast, oligonucleotides that are modified at their sugar C2ʹ positions with methoxy or fluorine substituents are stable to nucleases, but they cannot be synthesized by natural polymerases. Here we report the development of a polymerase-evolution system and its use to evolve thermostable polymerases that efficiently interconvert C2ʹ-OMe-modified oligonucleotides and their DNA counterparts via ‘transcription’ and ‘reverse transcription’ or, more importantly, that PCR-amplify partially C2ʹ-OMe- or C2ʹ-F-modified oligonucleotides. A mechanistic analysis demonstrates that the ability to amplify the modified oligonucleotides evolved by optimizing interdomain interactions that stabilize the catalytically competent closed conformation of the polymerase. The evolved polymerases should find practical applications and the developed evolution system should be a powerful tool for tailoring polymerases to have other types of novel function.

The Development of Protein Microarrays and Their Applications in DNA-Protein and Protein-Protein Interaction Analyses of Arabidopsis Transcription Factors

PubMed Central

Gong, Wei; He, Kun; Covington, Mike; Dinesh-Kumar, S. P.; Snyder, Michael; Harmer, Stacey L.; Zhu, Yu-Xian; Deng, Xing Wang

2009-01-01

We used our collection of Arabidopsis transcription factor (TF) ORFeome clones to construct protein microarrays containing as many as 802 TF proteins. These protein microarrays were used for both protein-DNA and protein-protein interaction analyses. For protein-DNA interaction studies, we examined AP2/ERF family TFs and their cognate cis-elements. By careful comparison of the DNA-binding specificity of 13 TFs on the protein microarray with previous non-microarray data, we showed that protein microarrays provide an efficient and high throughput tool for genome-wide analysis of TF-DNA interactions. This microarray protein-DNA interaction analysis allowed us to derive a comprehensive view of DNA-binding profiles of AP2/ERF family proteins in Arabidopsis. It also revealed four TFs that bound the EE (evening element) and had the expected phased gene expression under clock-regulation, thus providing a basis for further functional analysis of their roles in clock regulation of gene expression. We also developed procedures for detecting protein interactions using this TF protein microarray and discovered four novel partners that interact with HY5, which can be validated by yeast two-hybrid assays. Thus, plant TF protein microarrays offer an attractive high-throughput alternative to traditional techniques for TF functional characterization on a global scale. PMID:19802365

Method of identifying hairpin DNA probes by partial fold analysis

DOEpatents

Miller, Benjamin L [Penfield, NY; Strohsahl, Christopher M [Saugerties, NY

2009-10-06

Method of identifying molecular beacons in which a secondary structure prediction algorithm is employed to identify oligonucleotide sequences within a target gene having the requisite hairpin structure. Isolated oligonucleotides, molecular beacons prepared from those oligonucleotides, and their use are also disclosed.

Method of identifying hairpin DNA probes by partial fold analysis

DOEpatents

Miller, Benjamin L.; Strohsahl, Christopher M.

2008-10-28

Methods of identifying molecular beacons in which a secondary structure prediction algorithm is employed to identify oligonucleotide sequences within a target gene having the requisite hairpin structure. Isolated oligonucleotides, molecular beacons prepared from those oligonucleotides, and their use are also disclosed.

Oligonucleotide Array for Identification and Detection of Pythium Species†

PubMed Central

Tambong, J. T.; de Cock, A. W. A. M.; Tinker, N. A.; Lévesque, C. A.

2006-01-01

A DNA array containing 172 oligonucleotides complementary to specific diagnostic regions of internal transcribed spacers (ITS) of more than 100 species was developed for identification and detection of Pythium species. All of the species studied, with the exception of Pythium ostracodes, exhibited a positive hybridization reaction with at least one corresponding species-specific oligonucleotide. Hybridization patterns were distinct for each species. The array hybridization patterns included cluster-specific oligonucleotides that facilitated the recognition of species, including new ones, belonging to groups such as those producing filamentous or globose sporangia. BLAST analyses against 500 publicly available Pythium sequences in GenBank confirmed that species-specific oligonucleotides were unique to all of the available strains of each species, of which there were numerous economically important ones. GenBank entries of newly described species that are not putative synonyms showed no homology to sequences of the spotted species-specific oligonucleotides, but most new species did match some of the cluster-specific oligonucleotides. Further verification of the specificity of the DNA array was done with 50 additional Pythium isolates obtained by soil dilution plating. The hybridization patterns obtained were consistent with the identification of these isolates based on morphology and ITS sequence analyses. In another blind test, total DNA of the same soil samples was amplified and hybridized on the array, and the results were compared to those of 130 Pythium isolates obtained by soil dilution plating and root baiting. The 13 species detected by the DNA array corresponded to the isolates obtained by a combination of soil dilution plating and baiting, except for one new species that was not represented on the array. We conclude that the reported DNA array is a reliable tool for identification and detection of the majority of Pythium species in environmental samples. Simultaneous detection and identification of multiple species of soilborne pathogens such as Pythium species could be a major step forward for epidemiological and ecological studies. PMID:16597974

Development and application of a 6.5 million feature Affymetrix Genechip® for massively parallel discovery of single position polymorphisms in lettuce (Lactuca spp.)

PubMed Central

2012-01-01

Background High-resolution genetic maps are needed in many crops to help characterize the genetic diversity that determines agriculturally important traits. Hybridization to microarrays to detect single feature polymorphisms is a powerful technique for marker discovery and genotyping because of its highly parallel nature. However, microarrays designed for gene expression analysis rarely provide sufficient gene coverage for optimal detection of nucleotide polymorphisms, which limits utility in species with low rates of polymorphism such as lettuce (Lactuca sativa). Results We developed a 6.5 million feature Affymetrix GeneChip® for efficient polymorphism discovery and genotyping, as well as for analysis of gene expression in lettuce. Probes on the microarray were designed from 26,809 unigenes from cultivated lettuce and an additional 8,819 unigenes from four related species (L. serriola, L. saligna, L. virosa and L. perennis). Where possible, probes were tiled with a 2 bp stagger, alternating on each DNA strand; providing an average of 187 probes covering approximately 600 bp for each of over 35,000 unigenes; resulting in up to 13 fold redundancy in coverage per nucleotide. We developed protocols for hybridization of genomic DNA to the GeneChip® and refined custom algorithms that utilized coverage from multiple, high quality probes to detect single position polymorphisms in 2 bp sliding windows across each unigene. This allowed us to detect greater than 18,000 polymorphisms between the parental lines of our core mapping population, as well as numerous polymorphisms between cultivated lettuce and wild species in the lettuce genepool. Using marker data from our diversity panel comprised of 52 accessions from the five species listed above, we were able to separate accessions by species using both phylogenetic and principal component analyses. Additionally, we estimated the diversity between different types of cultivated lettuce and distinguished morphological types. Conclusion By hybridizing genomic DNA to a custom oligonucleotide array designed for maximum gene coverage, we were able to identify polymorphisms using two approaches for pair-wise comparisons, as well as a highly parallel method that compared all 52 genotypes simultaneously. PMID:22583801

Development and application of a 6.5 million feature Affymetrix Genechip® for massively parallel discovery of single position polymorphisms in lettuce (Lactuca spp.).

PubMed

Stoffel, Kevin; van Leeuwen, Hans; Kozik, Alexander; Caldwell, David; Ashrafi, Hamid; Cui, Xinping; Tan, Xiaoping; Hill, Theresa; Reyes-Chin-Wo, Sebastian; Truco, Maria-Jose; Michelmore, Richard W; Van Deynze, Allen

2012-05-14

High-resolution genetic maps are needed in many crops to help characterize the genetic diversity that determines agriculturally important traits. Hybridization to microarrays to detect single feature polymorphisms is a powerful technique for marker discovery and genotyping because of its highly parallel nature. However, microarrays designed for gene expression analysis rarely provide sufficient gene coverage for optimal detection of nucleotide polymorphisms, which limits utility in species with low rates of polymorphism such as lettuce (Lactuca sativa). We developed a 6.5 million feature Affymetrix GeneChip® for efficient polymorphism discovery and genotyping, as well as for analysis of gene expression in lettuce. Probes on the microarray were designed from 26,809 unigenes from cultivated lettuce and an additional 8,819 unigenes from four related species (L. serriola, L. saligna, L. virosa and L. perennis). Where possible, probes were tiled with a 2 bp stagger, alternating on each DNA strand; providing an average of 187 probes covering approximately 600 bp for each of over 35,000 unigenes; resulting in up to 13 fold redundancy in coverage per nucleotide. We developed protocols for hybridization of genomic DNA to the GeneChip® and refined custom algorithms that utilized coverage from multiple, high quality probes to detect single position polymorphisms in 2 bp sliding windows across each unigene. This allowed us to detect greater than 18,000 polymorphisms between the parental lines of our core mapping population, as well as numerous polymorphisms between cultivated lettuce and wild species in the lettuce genepool. Using marker data from our diversity panel comprised of 52 accessions from the five species listed above, we were able to separate accessions by species using both phylogenetic and principal component analyses. Additionally, we estimated the diversity between different types of cultivated lettuce and distinguished morphological types. By hybridizing genomic DNA to a custom oligonucleotide array designed for maximum gene coverage, we were able to identify polymorphisms using two approaches for pair-wise comparisons, as well as a highly parallel method that compared all 52 genotypes simultaneously.

Optical properties and electronic transitions of DNA oligonucleotides as a function of composition and stacking sequence.

PubMed

Schimelman, Jacob B; Dryden, Daniel M; Poudel, Lokendra; Krawiec, Katherine E; Ma, Yingfang; Podgornik, Rudolf; Parsegian, V Adrian; Denoyer, Linda K; Ching, Wai-Yim; Steinmetz, Nicole F; French, Roger H

2015-02-14

The role of base pair composition and stacking sequence in the optical properties and electronic transitions of DNA is of fundamental interest. We present and compare the optical properties of DNA oligonucleotides (AT)10, (AT)5(GC)5, and (AT-GC)5 using both ab initio methods and UV-vis molar absorbance measurements. Our data indicate a strong dependence of both the position and intensity of UV absorbance features on oligonucleotide composition and stacking sequence. The partial densities of states for each oligonucleotide indicate that the valence band edge arises from a feature associated with the PO4(3-) complex anion, and the conduction band edge arises from anti-bonding states in DNA base pairs. The results show a strong correspondence between the ab initio and experimentally determined optical properties. These results highlight the benefit of full spectral analysis of DNA, as opposed to reductive methods that consider only the 260 nm absorbance (A260) or simple purity ratios, such as A260/A230 or A260/A280, and suggest that the slope of the absorption edge onset may provide a useful metric for the degree of base pair stacking in DNA. These insights may prove useful for applications in biology, bioelectronics, and mesoscale self-assembly.

5' modification of duplex DNA with a ruthenium electron donor-acceptor pair using solid-phase DNA synthesis

NASA Technical Reports Server (NTRS)

Frank, Natia L.; Meade, Thomas J.

2003-01-01

Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.

Voltage-gated calcium channel and antisense oligonucleotides thereto

NASA Technical Reports Server (NTRS)

Friedman, Peter A. (Inventor); Duncan, Randall L. (Inventor); Hruska, Keith A. (Inventor); Barry, Elizabeth L. R. (Inventor)

1998-01-01

An antisense oligonucleotide of 10 to 35 nucleotides in length that can hybridize with a region of the .alpha..sub.1 subunit of the SA-Cat channel gene DNA or mRNA is provided, together with pharmaceutical compositions containing and methods utilizing such antisense oligonucleotide.

Synthesis and hybridization of a series of biotinylated oligonucleotides.

PubMed Central

Cook, A F; Vuocolo, E; Brakel, C L

1988-01-01

A series of oligonucleotides containing biotin-11-dUMP at various positions were synthesized and compared in quantitative, colorimetric hybridization-detection studies. A deoxyuridine phosphoramidite containing a protected allylamino sidearm was synthesized and used in standard, automated synthesis cycles to prepare oligonucleotides with allylamino residues at various positions within a standard 17-base sequence. Biotin substituents were subsequently attached to the allylamino sidearms by reaction with N-biotinyl-6-aminocaproic acid N-hydroxysuccinimide ester. These oligomers were hybridized to target DNA immobilized on microtiter wells (ELISA plates), and were detected with a streptavidin-biotinylated horseradish peroxidase complex using hydrogen peroxide as substrate and o-phenylenediamine as chromogen. We found that the sensitivity of detection of target DNA by biotin-labeled oligonucleotide probes was strongly dependent upon the position of the biotin label. Oligonucleotides containing biotin labels near or off the ends of the hybridizing sequence were more effective probes than oligonucleotides containing internal biotin labels. An additive effect of increasing numbers of biotin-dUMP residues was found for some labeling configurations. PMID:3375076

Linear model for fast background subtraction in oligonucleotide microarrays.

PubMed

Kroll, K Myriam; Barkema, Gerard T; Carlon, Enrico

2009-11-16

One important preprocessing step in the analysis of microarray data is background subtraction. In high-density oligonucleotide arrays this is recognized as a crucial step for the global performance of the data analysis from raw intensities to expression values. We propose here an algorithm for background estimation based on a model in which the cost function is quadratic in a set of fitting parameters such that minimization can be performed through linear algebra. The model incorporates two effects: 1) Correlated intensities between neighboring features in the chip and 2) sequence-dependent affinities for non-specific hybridization fitted by an extended nearest-neighbor model. The algorithm has been tested on 360 GeneChips from publicly available data of recent expression experiments. The algorithm is fast and accurate. Strong correlations between the fitted values for different experiments as well as between the free-energy parameters and their counterparts in aqueous solution indicate that the model captures a significant part of the underlying physical chemistry.

Predicting oligonucleotide affinity to nucleic acid targets.

PubMed Central

Mathews, D H; Burkard, M E; Freier, S M; Wyatt, J R; Turner, D H

1999-01-01

A computer program, OligoWalk, is reported that predicts the equilibrium affinity of complementary DNA or RNA oligonucleotides to an RNA target. This program considers the predicted stability of the oligonucleotide-target helix and the competition with predicted secondary structure of both the target and the oligonucleotide. Both unimolecular and bimolecular oligonucleotide self structure are considered with a user-defined concentration. The application of OligoWalk is illustrated with three comparisons to experimental results drawn from the literature. PMID:10580474

Specific interaction of mutant p53 with regions of matrix attachment region DNA elements (MARs) with a high potential for base-unpairing

PubMed Central

Will, Katrin; Warnecke, Gabriele; Wiesmüller, Lisa; Deppert, Wolfgang

1998-01-01

Mutant, but not wild-type p53 binds with high affinity to a variety of MAR-DNA elements (MARs), suggesting that MAR-binding of mutant p53 relates to the dominant-oncogenic activities proposed for mutant p53. MARs recognized by mutant p53 share AT richness and contain variations of an AATATATTT “DNA-unwinding motif,” which enhances the structural dynamics of chromatin and promotes regional DNA base-unpairing. Mutant p53 specifically interacted with MAR-derived oligonucleotides carrying such unwinding motifs, catalyzing DNA strand separation when this motif was located within a structurally labile sequence environment. Addition of GC-clamps to the respective MAR-oligonucleotides or introducing mutations into the unwinding motif strongly reduced DNA strand separation, but supported the formation of tight complexes between mutant p53 and such oligonucleotides. We conclude that the specific interaction of mutant p53 with regions of MAR-DNA with a high potential for base-unpairing provides the basis for the high-affinity binding of mutant p53 to MAR-DNA. PMID:9811860

The effect of column purification on cDNA indirect labelling for microarrays

PubMed Central

Molas, M Lia; Kiss, John Z

2007-01-01

Background The success of the microarray reproducibility is dependent upon the performance of standardized procedures. Since the introduction of microarray technology for the analysis of global gene expression, reproducibility of results among different laboratories has been a major problem. Two of the main contributors to this variability are the use of different microarray platforms and different laboratory practices. In this paper, we address the latter question in terms of how variation in one of the steps of a labelling procedure affects the cDNA product prior to microarray hybridization. Results We used a standard procedure to label cDNA for microarray hybridization and employed different types of column chromatography for cDNA purification. After purifying labelled cDNA, we used the Agilent 2100 Bioanalyzer and agarose gel electrophoresis to assess the quality of the labelled cDNA before its hybridization onto a microarray platform. There were major differences in the cDNA profile (i.e. cDNA fragment lengths and abundance) as a result of using four different columns for purification. In addition, different columns have different efficiencies to remove rRNA contamination. This study indicates that the appropriate column to use in this type of protocol has to be experimentally determined. Finally, we present new evidence establishing the importance of testing the method of purification used during an indirect labelling procedure. Our results confirm the importance of assessing the quality of the sample in the labelling procedure prior to hybridization onto a microarray platform. Conclusion Standardization of column purification systems to be used in labelling procedures will improve the reproducibility of microarray results among different laboratories. In addition, implementation of a quality control check point of the labelled samples prior to microarray hybridization will prevent hybridizing a poor quality sample to expensive micorarrays. PMID:17597522

The effect of column purification on cDNA indirect labelling for microarrays.

PubMed

Molas, M Lia; Kiss, John Z

2007-06-27

The success of the microarray reproducibility is dependent upon the performance of standardized procedures. Since the introduction of microarray technology for the analysis of global gene expression, reproducibility of results among different laboratories has been a major problem. Two of the main contributors to this variability are the use of different microarray platforms and different laboratory practices. In this paper, we address the latter question in terms of how variation in one of the steps of a labelling procedure affects the cDNA product prior to microarray hybridization. We used a standard procedure to label cDNA for microarray hybridization and employed different types of column chromatography for cDNA purification. After purifying labelled cDNA, we used the Agilent 2100 Bioanalyzer and agarose gel electrophoresis to assess the quality of the labelled cDNA before its hybridization onto a microarray platform. There were major differences in the cDNA profile (i.e. cDNA fragment lengths and abundance) as a result of using four different columns for purification. In addition, different columns have different efficiencies to remove rRNA contamination. This study indicates that the appropriate column to use in this type of protocol has to be experimentally determined. Finally, we present new evidence establishing the importance of testing the method of purification used during an indirect labelling procedure. Our results confirm the importance of assessing the quality of the sample in the labelling procedure prior to hybridization onto a microarray platform. Standardization of column purification systems to be used in labelling procedures will improve the reproducibility of microarray results among different laboratories. In addition, implementation of a quality control check point of the labelled samples prior to microarray hybridization will prevent hybridizing a poor quality sample to expensive micorarrays.

Development of a DNA microarray for species identification of quarantine aphids.

PubMed

Lee, Won Sun; Choi, Hwalran; Kang, Jinseok; Kim, Ji-Hoon; Lee, Si Hyeock; Lee, Seunghwan; Hwang, Seung Yong

2013-12-01

Aphid pests are being brought into Korea as a result of increased crop trading. Aphids exist on growth areas of plants, and thus plant growth is seriously affected by aphid pests. However, aphids are very small and have several sexual morphs and life stages, so it is difficult to identify species on the basis of morphological features. This problem was approached using DNA microarray technology. DNA targets of the cytochrome c oxidase subunit I gene were generated with a fluorescent dye-labelled primer and were hybridised onto a DNA microarray consisting of specific probes. After analysing the signal intensity of the specific probes, the unique patterns from the DNA microarray, consisting of 47 species-specific probes, were obtained to identify 23 aphid species. To confirm the accuracy of the developed DNA microarray, ten individual blind samples were used in blind trials, and the identifications were completely consistent with the sequencing data of all individual blind samples. A microarray has been developed to distinguish aphid species. DNA microarray technology provides a rapid, easy, cost-effective and accurate method for identifying aphid species for pest control management. © 2013 Society of Chemical Industry.

Structural properties of oligonucleotide monolayers on gold surfaces probed by fluorescence investigations.

PubMed

Rant, Ulrich; Arinaga, Kenji; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard; Tornow, Marc

2004-11-09

We present optical investigations on the conformation of oligonucleotide layers on Au surfaces. Our studies concentrate on the effect of varying surface coverage densities on the structural properties of layers of 12- and 24mer single-stranded DNA, tethered to the Au surface at one end while being labeled with a fluorescent marker at the opposing end. The distance-dependent energy transfer from the marker dye to the metal surface, which causes quenching of the observed fluorescence, is used to provide information on the orientation of the DNA strands relative to the surface. Variations in the oligonucleotide coverage density, as determined from electrochemical quantification, over 2 orders of magnitude are achieved by employing different preparation conditions. The observed enhancement in fluorescence intensity with increasing DNA coverage can be related to a model involving mutual steric interactions of oligonucleotides on the surface, as well as fluorescence quenching theory. Finally, the applicability of the presented concepts for investigations of heterogeneous monolayers is demonstrated by means of studying the coadsorption of mercaptohexanol onto DNA-modified Au surfaces.

The application of DNA microarrays in gene expression analysis.

PubMed

van Hal, N L; Vorst, O; van Houwelingen, A M; Kok, E J; Peijnenburg, A; Aharoni, A; van Tunen, A J; Keijer, J

2000-03-31

DNA microarray technology is a new and powerful technology that will substantially increase the speed of molecular biological research. This paper gives a survey of DNA microarray technology and its use in gene expression studies. The technical aspects and their potential improvements are discussed. These comprise array manufacturing and design, array hybridisation, scanning, and data handling. Furthermore, it is discussed how DNA microarrays can be applied in the working fields of: safety, functionality and health of food and gene discovery and pathway engineering in plants.

High-Throughput Identification of Combinatorial Ligands for DNA Delivery in Cell Culture

NASA Astrophysics Data System (ADS)

Svahn, Mathias G.; Rabe, Kersten S.; Barger, Geoffrey; EL-Andaloussi, Samir; Simonson, Oscar E.; Didier, Boturyn; Olivier, Renaudet; Dumy, Pascal; Brandén, Lars J.; Niemeyer, Christof M.; Smith, C. I. Edvard

2008-10-01

Finding the optimal combinations of ligands for tissue-specific delivery is tedious even if only a few well-established compounds are tested. The cargo affects the receptor-ligand interaction, especially when it is charged like DNA. The ligand should therefore be evaluated together with its cargo. Several viruses have been shown to interact with more than one receptor, for efficient internalization. We here present a DNA oligonucleotide-based method for inexpensive and rapid screening of biotin labeled ligands for combinatorial effects on cellular binding and uptake. The oligonucleotide complex was designed as a 44 bp double-stranded DNA oligonucleotide with one central streptavidin molecule and a second streptavidin at the terminus. The use of a highly advanced robotic platform ensured stringent processing and execution of the experiments. The oligonucleotides were fluorescently labeled and used for detection and analysis of cell-bound, internalized and intra-cellular compartmentalized constructs by an automated line-scanning confocal microscope, IN Cell Analyzer 3000. All possible combinations of 22 ligands were explored in sets of 2 and tested on 6 different human cell lines in triplicates. In total, 10 000 transfections were performed on the automation platform. Cell-specific combinations of ligands were identified and their relative position on the scaffold oligonucleotide was found to be of importance. The ligands were found to be cargo dependent, carbohydrates were more potent for DNA delivery whereas cell penetrating peptides were more potent for delivery of less charged particles.

Manufacturing of microarrays.

PubMed

Petersen, David W; Kawasaki, Ernest S

2007-01-01

DNA microarray technology has become a powerful tool in the arsenal of the molecular biologist. Capitalizing on high precision robotics and the wealth of DNA sequences annotated from the genomes of a large number of organisms, the manufacture of microarrays is now possible for the average academic laboratory with the funds and motivation. Microarray production requires attention to both biological and physical resources, including DNA libraries, robotics, and qualified personnel. While the fabrication of microarrays is a very labor-intensive process, production of quality microarrays individually tailored on a project-by-project basis will help researchers shed light on future scientific questions.

Multiplex amplification of large sets of human exons.

PubMed

Porreca, Gregory J; Zhang, Kun; Li, Jin Billy; Xie, Bin; Austin, Derek; Vassallo, Sara L; LeProust, Emily M; Peck, Bill J; Emig, Christopher J; Dahl, Fredrik; Gao, Yuan; Church, George M; Shendure, Jay

2007-11-01

A new generation of technologies is poised to reduce DNA sequencing costs by several orders of magnitude. But our ability to fully leverage the power of these technologies is crippled by the absence of suitable 'front-end' methods for isolating complex subsets of a mammalian genome at a scale that matches the throughput at which these platforms will routinely operate. We show that targeting oligonucleotides released from programmable microarrays can be used to capture and amplify approximately 10,000 human exons in a single multiplex reaction. Additionally, we show integration of this protocol with ultra-high-throughput sequencing for targeted variation discovery. Although the multiplex capture reaction is highly specific, we found that nonuniform capture is a key issue that will need to be resolved by additional optimization. We anticipate that highly multiplexed methods for targeted amplification will enable the comprehensive resequencing of human exons at a fraction of the cost of whole-genome resequencing.

Aberrant expression of the PHF14 gene in biliary tract cancer cells

PubMed Central

AKAZAWA, TAKAKO; YASUI, KOHICHIROH; GEN, YASUYUKI; YAMADA, NOBUHISA; TOMIE, AKIRA; DOHI, OSAMU; MITSUYOSHI, HIRONORI; YAGI, NOBUAKI; ITOH, YOSHITO; NAITO, YUJI; YOSHIKAWA, TOSHIKAZU

2013-01-01

DNA copy number aberrations in human biliary tract cancer (BTC) cell lines were investigated using a high-density oligonucleotide microarray. A novel homozygous deletion was detected at chromosomal region 7p21.3 in the OZ cell line. Further validation experiments using genomic PCR revealed a homozygous deletion of a single gene, plant homeodomain (PHD) finger protein 14 (PHF14). No PHF14 mRNA or protein expression was detected, thus demonstrating the absence of PHF14 expression in the OZ cell line. Although the PHD finger protein is considered to be involved in chromatin-mediated transcriptional regulation, little is known about the function of PHF14 in cancer. The present study observed that the knock down of PHF14 using small interfering RNA (siRNA) enhanced the growth of the BTC cells. These observations suggest that aberrant PHF14 expression may have a role in the tumorigenesis of BTC. PMID:23833654

Multiplex cDNA quantification method that facilitates the standardization of gene expression data

PubMed Central

Gotoh, Osamu; Murakami, Yasufumi; Suyama, Akira

2011-01-01

Microarray-based gene expression measurement is one of the major methods for transcriptome analysis. However, current microarray data are substantially affected by microarray platforms and RNA references because of the microarray method can provide merely the relative amounts of gene expression levels. Therefore, valid comparisons of the microarray data require standardized platforms, internal and/or external controls and complicated normalizations. These requirements impose limitations on the extensive comparison of gene expression data. Here, we report an effective approach to removing the unfavorable limitations by measuring the absolute amounts of gene expression levels on common DNA microarrays. We have developed a multiplex cDNA quantification method called GEP-DEAN (Gene expression profiling by DCN-encoding-based analysis). The method was validated by using chemically synthesized DNA strands of known quantities and cDNA samples prepared from mouse liver, demonstrating that the absolute amounts of cDNA strands were successfully measured with a sensitivity of 18 zmol in a highly multiplexed manner in 7 h. PMID:21415008

DNA microdevice for electrochemical detection of Escherichia coli 0157:H7 molecular markers.

PubMed

Berganza, J; Olabarria, G; García, R; Verdoy, D; Rebollo, A; Arana, S

2007-04-15

An electrochemical DNA sensor based on the hybridization recognition of a single-stranded DNA (ssDNA) probe immobilized onto a gold electrode to its complementary ssDNA is presented. The DNA probe is bound on gold surface electrode by using self-assembled monolayer (SAM) technology. An optimized mixed SAM with a blocking molecule preventing the nonspecific adsorption on the electrode surface has been prepared. In this paper, a DNA biosensor is designed by means of the immobilization of a single stranded DNA probe on an electrochemical transducer surface to recognize specifically Escherichia coli (E. coli) 0157:H7 complementary target DNA sequence via cyclic voltammetry experiments. The 21 mer DNA probe including a C6 alkanethiol group at the 5' phosphate end has been synthesized to form the SAM onto the gold surface through the gold sulfur bond. The goal of this paper has been to design, characterise and optimise an electrochemical DNA sensor. In order to investigate the oligonucleotide probe immobilization and the hybridization detection, experiments with different concentration of DNA and mismatch sequences have been performed. This microdevice has demonstrated the suitability of oligonucleotide Self-assembled monolayers (SAMs) on gold as immobilization method. The DNA probes deposited on gold surface have been functional and able to detect changes in bases sequence in a 21-mer oligonucleotide.

DNA hybridization detection on electrical microarrays using coulostatic pulse technique.

PubMed

Dharuman, V; Nebling, E; Grunwald, T; Albers, J; Blohm, L; Elsholz, B; Wörl, R; Hintsche, R

2006-12-15

We demonstrated a novel application of transient coulostatic pulse technique for the detection of label free DNA hybridization on nm-sized gold interdigitated ultramicroelectrode arrays (Au-IDA) made in silicon technology. The array consists of eight different positions with an Au-IDA pair at each position arranged on the Si-based Biochip. Immobilization of capture probes onto the Au-IDA was accomplished by self-assembling of thiol-modified oligonucleotides. Target hybridization was indicated by a change in the magnitude of the time dependant potential relaxation curve in presence of electroactive Fe(CN)(6)(3-) in the phosphate buffer solution. While complementary DNA hybridization showed 50% increase in the relaxation potential, the non-complementary DNA showed a negligible change. A constant behaviour was noted for all positions. The dsDNA specific intercalating molecule, methylene blue, was found to be enhancing the discrimination effect. The changes in the relaxation potential curves were further corroborated following the ELISA like experiments using ExtraAvidine alkaline phosphatase labelling and redox recycling of para-aminophenol phosphate at IDAs. The coulostatic pulse technique was shown to be useful for identifying DNA sequences from brain tumour gene CK20, human herpes simplex virus, cytomegalovirus, Epstein-Barr virus and M13 phage. Compared to the hybridization of short chain ONTs (27 mers), the hybridization of long chain M13 phage DNA showed three times higher increase in the relaxation curves. The method is fast enough to monitor hybridization interactions in milli or microsecond time scales and is well suitable for miniaturization and integration compared to the common impedance techniques for developing capacitative DNA sensors.

[Oligonucleotide derivatives in the nucleic acid hybridization analysis. III. Synthesis and investigation of properties of oligonucleotides, bearing bifunctional non-nucleotide insert].

PubMed

Kupriushkin, M S; Pyshnyĭ, D V

2012-01-01

Non-nucleotide phosporamidites were synthetized, having branched backbone with different position of functional groups. Obtained phosphoramidite monomers contain intercalator moiety--6-chloro-2-methoxyacridine, and additional hydroxyl residue protected with dimethoxytrityl group or with tert-butyldimethylsilyl group for post-synthetic modification. Synthesized oligothymidilates contain one or more modified units in different positions of sequence. Melting temperature and thermodynamic parameters of formation of complementary duplexes formed by modified oligonucleotides was defined (change in enthalpy and entropy). The introduction of intercalating residue causes a significant stabilization of DNA duplexes. It is shown that the efficiency of the fluorescence of acridine residue in the oligonucleotide conjugate significantly changes upon hybridization with DNA.

Quantitative multiplex quantum dot in-situ hybridisation based gene expression profiling in tissue microarrays identifies prognostic genes in acute myeloid leukaemia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tholouli, Eleni; MacDermott, Sarah; Hoyland, Judith

2012-08-24

Highlights: Black-Right-Pointing-Pointer Development of a quantitative high throughput in situ expression profiling method. Black-Right-Pointing-Pointer Application to a tissue microarray of 242 AML bone marrow samples. Black-Right-Pointing-Pointer Identification of HOXA4, HOXA9, Meis1 and DNMT3A as prognostic markers in AML. -- Abstract: Measurement and validation of microarray gene signatures in routine clinical samples is problematic and a rate limiting step in translational research. In order to facilitate measurement of microarray identified gene signatures in routine clinical tissue a novel method combining quantum dot based oligonucleotide in situ hybridisation (QD-ISH) and post-hybridisation spectral image analysis was used for multiplex in-situ transcript detection inmore » archival bone marrow trephine samples from patients with acute myeloid leukaemia (AML). Tissue-microarrays were prepared into which white cell pellets were spiked as a standard. Tissue microarrays were made using routinely processed bone marrow trephines from 242 patients with AML. QD-ISH was performed for six candidate prognostic genes using triplex QD-ISH for DNMT1, DNMT3A, DNMT3B, and for HOXA4, HOXA9, Meis1. Scrambled oligonucleotides were used to correct for background staining followed by normalisation of expression against the expression values for the white cell pellet standard. Survival analysis demonstrated that low expression of HOXA4 was associated with poorer overall survival (p = 0.009), whilst high expression of HOXA9 (p < 0.0001), Meis1 (p = 0.005) and DNMT3A (p = 0.04) were associated with early treatment failure. These results demonstrate application of a standardised, quantitative multiplex QD-ISH method for identification of prognostic markers in formalin-fixed paraffin-embedded clinical samples, facilitating measurement of gene expression signatures in routine clinical samples.« less

A DNA microarray-based methylation-sensitive (MS)-AFLP hybridization method for genetic and epigenetic analyses.

PubMed

Yamamoto, F; Yamamoto, M

2004-07-01

We previously developed a PCR-based DNA fingerprinting technique named the Methylation Sensitive (MS)-AFLP method, which permits comparative genome-wide scanning of methylation status with a manageable number of fingerprinting experiments. The technique uses the methylation sensitive restriction enzyme NotI in the context of the existing Amplified Fragment Length Polymorphism (AFLP) method. Here we report the successful conversion of this gel electrophoresis-based DNA fingerprinting technique into a DNA microarray hybridization technique (DNA Microarray MS-AFLP). By performing a total of 30 (15 x 2 reciprocal labeling) DNA Microarray MS-AFLP hybridization experiments on genomic DNA from two breast and three prostate cancer cell lines in all pairwise combinations, and Southern hybridization experiments using more than 100 different probes, we have demonstrated that the DNA Microarray MS-AFLP is a reliable method for genetic and epigenetic analyses. No statistically significant differences were observed in the number of differences between the breast-prostate hybridization experiments and the breast-breast or prostate-prostate comparisons.

A Platform for Combined DNA and Protein Microarrays Based on Total Internal Reflection Fluorescence

PubMed Central

Asanov, Alexander; Zepeda, Angélica; Vaca, Luis

2012-01-01

We have developed a novel microarray technology based on total internal reflection fluorescence (TIRF) in combination with DNA and protein bioassays immobilized at the TIRF surface. Unlike conventional microarrays that exhibit reduced signal-to-background ratio, require several stages of incubation, rinsing and stringency control, and measure only end-point results, our TIRF microarray technology provides several orders of magnitude better signal-to-background ratio, performs analysis rapidly in one step, and measures the entire course of association and dissociation kinetics between target DNA and protein molecules and the bioassays. In many practical cases detection of only DNA or protein markers alone does not provide the necessary accuracy for diagnosing a disease or detecting a pathogen. Here we describe TIRF microarrays that detect DNA and protein markers simultaneously, which reduces the probabilities of false responses. Supersensitive and multiplexed TIRF DNA and protein microarray technology may provide a platform for accurate diagnosis or enhanced research studies. Our TIRF microarray system can be mounted on upright or inverted microscopes or interfaced directly with CCD cameras equipped with a single objective, facilitating the development of portable devices. As proof-of-concept we applied TIRF microarrays for detecting molecular markers from Bacillus anthracis, the pathogen responsible for anthrax. PMID:22438738

DNA-based species detection capabilities using laser transmission spectroscopy

PubMed Central

Mahon, A. R.; Barnes, M. A.; Li, F.; Egan, S. P.; Tanner, C. E.; Ruggiero, S. T.; Feder, J. L.; Lodge, D. M.

2013-01-01

Early detection of invasive species is critical for effective biocontrol to mitigate potential ecological and economic damage. Laser transmission spectroscopy (LTS) is a powerful solution offering real-time, DNA-based species detection in the field. LTS can measure the size, shape and number of nanoparticles in a solution and was used here to detect size shifts resulting from hybridization of the polymerase chain reaction product to nanoparticles functionalized with species-specific oligonucleotide probes or with the species-specific oligonucleotide probes alone. We carried out a series of DNA detection experiments using the invasive freshwater quagga mussel (Dreissena bugensis) to evaluate the capability of the LTS platform for invasive species detection. Specifically, we tested LTS sensitivity to (i) DNA concentrations of a single target species, (ii) the presence of a target species within a mixed sample of other closely related species, (iii) species-specific functionalized nanoparticles versus species-specific oligonucleotide probes alone, and (iv) amplified DNA fragments versus unamplified genomic DNA. We demonstrate that LTS is a highly sensitive technique for rapid target species detection, with detection limits in the picomolar range, capable of successful identification in multispecies samples containing target and non-target species DNA. These results indicate that the LTS DNA detection platform will be useful for field application of target species. Additionally, we find that LTS detection is effective with species-specific oligonucleotide tags alone or when they are attached to polystyrene nanobeads and with both amplified and unamplified DNA, indicating that the technique may also have versatility for broader applications. PMID:23015524

Surface-enhanced Raman scattering detection of DNA derived from the West Nile virus genome using magnetic capture of Raman-active gold nanoparticles

USDA-ARS?s Scientific Manuscript database

A model paramagnetic nanoparticle (MNP) assay is demonstrated for surface-enhanced Raman scattering (SERS) detection of DNA oligonucleotides derived from the West Nile virus (WNV) genome. Detection is based on the capture of WNV target sequences by hybridization with complementary oligonucleotide pr...

Dynamic of active microorganisms inhabiting a bioleaching industrial heap of low‐grade copper sulfide ore monitored by real‐time PCR and oligonucleotide prokaryotic acidophile microarray

PubMed Central

Remonsellez, Francisco; Galleguillos, Felipe; Moreno‐Paz, Mercedes; Parro, Víctor; Acosta, Mauricio; Demergasso, Cecilia

2009-01-01

Summary The bioleaching of metal sulfide has developed into a very important industrial process and understanding the microbial dynamic is key to advancing commercial bioleaching operations. Here we report the first quantitative description of the dynamic of active communities in an industrial bioleaching heap. Acidithiobacillus ferrooxidans was the most abundant during the first part of the leaching cycle, while the abundance of Leptospirillum ferriphilum and Ferroplasma acidiphilum increased with age of the heap. Acidithiobacillus thiooxidans kept constant throughout the leaching cycle, and Firmicutes group showed a low and a patchy distribution in the heap. The Acidiphilium‐like bacteria reached their highest abundance corresponding to the amount of autotrophs. The active microorganisms in the leaching system were determined using two RNA‐based sensitive techniques. In most cases, the 16S rRNA copy numbers of At. ferrooxidans, L. ferriphilum, At. thiooxidans and F. acidiphilum, was concomitant with the DNA copy numbers, whereas Acidiphilium‐like bacteria and some Firmicutes members did not show a clear correlation between 16S rRNA accumulation and DNA copy numbers. However, the prokaryotic acidophile microarray (PAM) analysis showed active members of Alphaproteobacteria in all samples and of Sulfobacillus genus in older ones. Also, new active groups such as Actinobacteria and Acidobacterium genus were detected by PAM. The results suggest that changes during the leaching cycle in chemical and physical conditions, such as pH and Fe3+/Fe2+ ion rate, are primary factors shaping the microbial dynamic in the heap. PMID:21255296

Hetero-oligonucleotide Nanoscale Tiles Capable of Two-Dimensional Lattice Formation as Testbeds for a Rapid, Affordable Purification Methodology

DTIC Science & Technology

2013-01-01

SUBJECT TERMS DNA nanotechnology, purification, origami , 2d arrays Philip S. Lukeman St. John’s University, New York 8000 Utopia Parkway Queens, NY... origami ; DNA double-crossover (“DX”) tile based arrays5 have been constructed using PNA6 and LNA7 oligonucleotides. RNA/ DNA duplexes have been used8 for...the assembly of multiply armed tiles9 and as a template10 to fold DNA origami ;11 all-RNA systems known as ‘tecto-RNA’ have been used to generate a wide

Microarrays

ERIC Educational Resources Information Center

Plomin, Robert; Schalkwyk, Leonard C.

2007-01-01

Microarrays are revolutionizing genetics by making it possible to genotype hundreds of thousands of DNA markers and to assess the expression (RNA transcripts) of all of the genes in the genome. Microarrays are slides the size of a postage stamp that contain millions of DNA sequences to which single-stranded DNA or RNA can hybridize. This…

Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides.

PubMed

Rivera-Torres, Natalia; Banas, Kelly; Bialk, Pawel; Bloh, Kevin M; Kmiec, Eric B

2017-01-01

CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and CRISPR/Cas9 ribonucleoprotein complex.

Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides

PubMed Central

Rivera-Torres, Natalia; Bialk, Pawel; Bloh, Kevin M.; Kmiec, Eric B.

2017-01-01

CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and CRISPR/Cas9 ribonucleoprotein complex. PMID:28052104

A Perspective on DNA Microarrays in Pathology Research and Practice

PubMed Central

Pollack, Jonathan R.

2007-01-01

DNA microarray technology matured in the mid-1990s, and the past decade has witnessed a tremendous growth in its application. DNA microarrays have provided powerful tools for pathology researchers seeking to describe, classify, and understand human disease. There has also been great expectation that the technology would advance the practice of pathology. This review highlights some of the key contributions of DNA microarrays to experimental pathology, focusing in the area of cancer research. Also discussed are some of the current challenges in translating utility to clinical practice. PMID:17600117

A regenerated electrochemical biosensor for label-free detection of glucose and urea based on conformational switch of i-motif oligonucleotide probe.

PubMed

Gao, Zhong Feng; Chen, Dong Mei; Lei, Jing Lei; Luo, Hong Qun; Li, Nian Bing

2015-10-15

Improving the reproducibility of electrochemical signal remains a great challenge over the past decades. In this work, i-motif oligonucleotide probe-based electrochemical DNA (E-DNA) sensor is introduced for the first time as a regenerated sensing platform, which enhances the reproducibility of electrochemical signal, for label-free detection of glucose and urea. The addition of glucose or urea is able to activate glucose oxidase-catalyzed or urease-catalyzed reaction, inducing or destroying the formation of i-motif oligonucleotide probe. The conformational switch of oligonucleotide probe can be recorded by electrochemical impedance spectroscopy. Thus, the difference of electron transfer resistance is utilized for the quantitative determination of glucose and urea. We further demonstrate that the E-DNA sensor exhibits high selectivity, excellent stability, and remarkable regenerated ability. The human serum analysis indicates that this simple and regenerated strategy holds promising potential in future biosensing applications. Copyright © 2015 Elsevier B.V. All rights reserved.

The estimation of quantitative parameters of oligonucleotides immobilization on mica surface

NASA Astrophysics Data System (ADS)

Sharipov, T. I.; Bakhtizin, R. Z.

2017-05-01

Immobilization of nucleic acids on the surface of various materials is increasingly being used in research and some practical applications. Currently, the DNA chip technology is rapidly developing. The basis of the immobilization process can be both physical adsorption and chemisorption. A useful way to control the immobilization of nucleic acids on a surface is to use atomic force microscopy. It allows you to investigate the topography of the surface by its direct imaging with high resolution. Usually, to fix the DNA on the surface of mica are used cations which mediate the interaction between the mica surface and the DNA molecules. In our work we have developed a method for estimation of quantitative parameter of immobilization of oligonucleotides is their degree of aggregation depending on the fixation conditions on the surface of mica. The results on study of aggregation of oligonucleotides immobilized on mica surface will be presented. The single oligonucleotides molecules have been imaged clearly, whereas their surface areas have been calculated and calibration curve has been plotted.

DNA assembly with error correction on a droplet digital microfluidics platform.

PubMed

Khilko, Yuliya; Weyman, Philip D; Glass, John I; Adams, Mark D; McNeil, Melanie A; Griffin, Peter B

2018-06-01

Custom synthesized DNA is in high demand for synthetic biology applications. However, current technologies to produce these sequences using assembly from DNA oligonucleotides are costly and labor-intensive. The automation and reduced sample volumes afforded by microfluidic technologies could significantly decrease materials and labor costs associated with DNA synthesis. The purpose of this study was to develop a gene assembly protocol utilizing a digital microfluidic device. Toward this goal, we adapted bench-scale oligonucleotide assembly methods followed by enzymatic error correction to the Mondrian™ digital microfluidic platform. We optimized Gibson assembly, polymerase chain reaction (PCR), and enzymatic error correction reactions in a single protocol to assemble 12 oligonucleotides into a 339-bp double- stranded DNA sequence encoding part of the human influenza virus hemagglutinin (HA) gene. The reactions were scaled down to 0.6-1.2 μL. Initial microfluidic assembly methods were successful and had an error frequency of approximately 4 errors/kb with errors originating from the original oligonucleotide synthesis. Relative to conventional benchtop procedures, PCR optimization required additional amounts of MgCl 2 , Phusion polymerase, and PEG 8000 to achieve amplification of the assembly and error correction products. After one round of error correction, error frequency was reduced to an average of 1.8 errors kb - 1 . We demonstrated that DNA assembly from oligonucleotides and error correction could be completely automated on a digital microfluidic (DMF) platform. The results demonstrate that enzymatic reactions in droplets show a strong dependence on surface interactions, and successful on-chip implementation required supplementation with surfactants, molecular crowding agents, and an excess of enzyme. Enzymatic error correction of assembled fragments improved sequence fidelity by 2-fold, which was a significant improvement but somewhat lower than expected compared to bench-top assays, suggesting an additional capacity for optimization.

New redox-active layer create via epoxy-amine reaction - The base of genosensor for the detection of specific DNA and RNA sequences of avian influenza virus H5N1.

PubMed

Malecka, Kamila; Stachyra, Anna; Góra-Sochacka, Anna; Sirko, Agnieszka; Zagórski-Ostoja, Włodzimierz; Dehaen, Wim; Radecka, Hanna; Radecki, Jerzy

2015-03-15

This paper concerns the development of a redox-active monolayer and its application for the construction of an electrochemical genosensor designed for the detection of specific DNA and RNA oligonucleotide sequences related to the avian influenza virus (AIV) type H5N1. This new redox layer was created on a gold electrode surface step by step. Cyclic Voltammetry, Osteryoung Square-Wave Voltammetry and Differential Pulse Voltammetry were used for its characterization. This new redox-active layer was applied for the construction of the DNA biosensor. The NH2-NC3 probe (20-mer) was covalently attached to the gold electrode surface via a "click" reaction between the amine and an epoxide group. The hybridization process was monitored using the Osteryoung Square-Wave Voltammetry. The 20-mer DNA and ca. 280-mer RNA oligonucleotides were used as the targets. The constructed genosensor was capable to determine complementary oligonucleotide sequences with a detection limit in the pM range. It is able to distinguish the different position of the part RNA complementary to the DNA probe. The genosensor was very selective. The 20-mer DNA as well as the 280-mer RNA oligonucleotides without a complementary sequence generated a weak signal. Copyright © 2014 Elsevier B.V. All rights reserved.

Gene Silencing by Gold Nanoshell-Mediated Delivery and Laser-Triggered Release of Antisense Oligonucleotide and siRNA

PubMed Central

Huschka, Ryan; Barhoumi, Aoune; Liu, Qing; Roth, Jack A.; Ji, Lin; Halas, Naomi J.

2013-01-01

The approach of RNA interference (RNAi)- using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein- is very useful in dissecting genetic function and holds significant promise as a molecular therapeutic. A major obstacle in achieving gene silencing with RNAi technology is the systemic delivery of therapeutic oligonucleotides. Here we demonstrate an engineered gold nanoshell (NS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on demand upon illumination with a near-infrared (NIR) laser. A poly(L)lysine peptide (PLL) epilayer covalently attached to the NS surface (NS-PLL) is used to capture intact, single-stranded antisense DNA oligonucleotides, or alternatively, double-stranded short-interfering RNA (siRNA) molecules. Controlled release of the captured therapeutic oligonucleotides in each case is accomplished by continuous wave NIR laser irradiation at 800 nm, near the resonance wavelength of the nanoshell. Fluorescently tagged oligonucleotides were used to monitor the time-dependent release process and light-triggered endosomal release. A green fluorescent protein (GFP)-expressing human lung cancer H1299 cell line was used to determine cellular uptake and gene silencing mediated by the NS-PLL carrying GFP gene-specific single-stranded DNA antisense oligonucleotide (AON-GFP), or a double-stranded siRNA (siRNA-GFP), in vitro. Light-triggered delivery resulted in ∼ 47% and ∼49% downregulation of the targeted GFP expression by AON-GFP and siRNA-GFP, respectively. Cytotoxicity induced by both the NS-PLL delivery vector and by laser irradiation is minimal, as demonstrated by a XTT cell proliferation assay. PMID:22862291

Genomic expression patterns of cardiac tissues from dogs with dilated cardiomyopathy.

PubMed

Oyama, Mark A; Chittur, Sridar

2005-07-01

To evaluate global genome expression patterns of left ventricular tissues from dogs with dilated cardiomyopathy (DCM). Tissues obtained from the left ventricle of 2 Doberman Pinschers with end-stage DCM and 5 healthy control dogs. Transcriptional activities of 23,851 canine DNA sequences were determined by use of an oligonucleotide microarray. Genome expression patterns of DCM tissue were evaluated by measuring the relative amount of complementary RNA hybridization to the microarray probes and comparing it with gene expression for tissues from 5 healthy control dogs. 478 transcripts were differentially expressed (> or = 2.5-fold change). In DCM tissue, expression of 173 transcripts was upregulated and expression of 305 transcripts was downregulated, compared with expression for control tissues. Of the 478 transcripts, 167 genes could be specifically identified. These genes were grouped into 1 of 8 categories on the basis of their primary physiologic function. Grouping revealed that pathways involving cellular energy production, signaling and communication, and cell structure were generally downregulated, whereas pathways involving cellular defense and stress responses were upregulated. Many previously unreported genes that may contribute to the pathophysiologic aspects of heart disease were identified. Evaluation of global expression patterns provides a molecular portrait of heart failure, yields insights into the pathophysiologic aspects of DCM, and identifies intriguing genes and pathways for further study.

[Ru(phen)2DPPZ]2+ is in contact with DNA bases when it forms a luminescent complex with single-stranded oligonucleotides.

PubMed

Moon, Seok Joon; Kim, Jong Moon; Choi, Ji Youn; Kim, Seog K; Lee, Je Seung; Jang, Ho G

2005-05-01

The luminescence intensity of the Delta- and Lambda-enantiomer of [Ru(phen)2DPPZ]2+ ([Ru(phenanthroline)2 dipyrido[3,2-a:2',3'-c]phenazine]2+) complex enhanced upon binding to double stranded DNA, which has been known as "light switch effect". The enhancement of the luminescence required the intercalation of the large ligand between DNA base pairs. In this study, we report the enhancement in the luminescence intensity when the metal complexes bind to single stranded oligonucleotides, indicating that the "light switch effect" does not require intercalation of the large DPPZ ligand. Oligonucleotides may provide a hydrophobic cavity for the [Ru(phen)2DPPZ]2+ complex to prevent the quenching by the water molecule. In the cavity, the metal complex is in contact with DNA bases as is evidenced by the observation that the excited energy of the DNA bases transfer to the bound metal complex. However, the contact of the metal complex with DNA bases is different from the stacking of DPPZ in the intercalation pocket. In addition to the normal two luminescence lifetimes, a short lifetime in the range of 1-2 ns was found for both the delta- and lambda-enantiomer of [Ru(phen)2DPPZ]2+ when complexed with single stranded oligonucleotides, which may be assigned to the metal complex that is outside of the cavity, interacting with phosphate groups of DNA.

DNA microarrays and their use in dermatology.

PubMed

Mlakar, Vid; Glavac, Damjan

2007-03-01

Multiple different DNA microarray technologies are available on the market today. They can be used for studying either DNA or RNA with the purpose of identifying and explaining the role of genes involved in different processes. This paper reviews different DNA microarray platforms available for such studies and their usage in cases of malignant melanomas, psoriasis, and exposure of keratinocytes and melanocytes to UV illumination.

DNA Microarray Wet Lab Simulation Brings Genomics into the High School Curriculum

ERIC Educational Resources Information Center

Campbell, A. Malcolm; Zanta, Carolyn A.; Heyer, Laurie J.; Kittinger, Ben; Gabric, Kathleen M.; Adler, Leslie

2006-01-01

We have developed a wet lab DNA microarray simulation as part of a complete DNA microarray module for high school students. The wet lab simulation has been field tested with high school students in Illinois and Maryland as well as in workshops with high school teachers from across the nation. Instead of using DNA, our simulation is based on pH…

Photouncaged Sequence-specific Interstrand DNA Cross-Linking with Photolabile 4-oxo-enal-modified Oligonucleotides

PubMed Central

Sun, Jingjing; Tang, Xinjing

2015-01-01

DNA cross-linking technology is an attractive tool for the detection, regulation, and manipulation of genes. In this study, a series of photolabile 4-oxo-enal-modified oligonucleotides functionalized with photosensitive ο-nitrobenzyl derivatives were rationally designed as a new kind of photocaged cross-linking agents. A comprehensive evaluation of cross-linking reactions for different nucleobases in complementary strands under different conditions suggested that the modified DNA oligonucleotides tended to form interstrand cross-linking to nucleobases with the potential of thymidine > guanosine » cytidine ~ adenosine. Different from previous literature reports that cytidine and adenosine were preferential cross-linked nucleobases with 4-oxo-enal moieties, our study represents the first example of DNA cross-linking for T and G selectivity using 4-oxo-enal moiety. The cross-linked adducts were identified and their cross-linking mechanism was also illustrated. This greatly expands the applications of 4-oxo-enal derivatives in the studies of DNA damage and RNA structure PMID:26020694

Photouncaged Sequence-specific Interstrand DNA Cross-Linking with Photolabile 4-oxo-enal-modified Oligonucleotides.

PubMed

Sun, Jingjing; Tang, Xinjing

2015-05-28

DNA cross-linking technology is an attractive tool for the detection, regulation, and manipulation of genes. In this study, a series of photolabile 4-oxo-enal-modified oligonucleotides functionalized with photosensitive ο-nitrobenzyl derivatives were rationally designed as a new kind of photocaged cross-linking agents. A comprehensive evaluation of cross-linking reactions for different nucleobases in complementary strands under different conditions suggested that the modified DNA oligonucleotides tended to form interstrand cross-linking to nucleobases with the potential of thymidine > guanosine » cytidine ~ adenosine. Different from previous literature reports that cytidine and adenosine were preferential cross-linked nucleobases with 4-oxo-enal moieties, our study represents the first example of DNA cross-linking for T and G selectivity using 4-oxo-enal moiety. The cross-linked adducts were identified and their cross-linking mechanism was also illustrated. This greatly expands the applications of 4-oxo-enal derivatives in the studies of DNA damage and RNA structure.

Immune and inflammatory gene signature in rat cerebrum in subarachnoid hemorrhage with microarray analysis.

PubMed

Lee, Chu-I; Chou, An-Kuo; Lin, Ching-Chih; Chou, Chia-Hua; Loh, Joon-Khim; Lieu, Ann-Shung; Wang, Chih-Jen; Huang, Chi-Ying F; Howng, Shen-Long; Hong, Yi-Ren

2012-01-01

Cerebral vasospasm following subarachnoid hemorrhage (SAH) has been studied in terms of a contraction of the major cerebral arteries, but the effect of cerebrum tissue in SAH is not yet well understood. To gain insight into the biology of SAH-expressing cerebrum, we employed oligonucleotide microarrays to characterize the gene expression profiles of cerebrum tissue at the early stage of SAH. Functional gene expression in the cerebrum was analyzed 2 h following stage 1-hemorrhage in Sprague-Dawley rats. mRNA was investigated by performing microarray and quantitative real-time PCR analyses, and protein expression was determined by Western blot analysis. In this study, 18 upregulated and 18 downregulated genes displayed at least a 1.5-fold change. Five genes were verified by real-time PCR, including three upregulated genes [prostaglandin E synthase (PGES), CD14 antigen, and tissue inhibitor of metalloproteinase 1 (TIMP1)] as well as two downregulated genes [KRAB-zinc finger protein-2 (KZF-2) and γ-aminobutyric acid B receptor 1 (GABA B receptor)]. Notably, there were functional implications for the three upregulated genes involved in the inflammatory SAH process. However, the mechanisms leading to decreased KZF-2 and GABA B receptor expression in SAH have never been characterized. We conclude that oligonucleotide microarrays have the potential for use as a method to identify candidate genes associated with SAH and to provide novel investigational targets, including genes involved in the immune and inflammatory response. Furthermore, understanding the regulation of MMP9/TIMP1 during the early stages of SAH may elucidate the pathophysiological mechanisms in SAH rats.

Scar-less multi-part DNA assembly design automation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hillson, Nathan J.

The present invention provides a method of a method of designing an implementation of a DNA assembly. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding flanking homology sequences to each of the DNA oligos. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which tomore » assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding optimized overhang sequences to each of the DNA oligos.« less

Synthesis of the Tellurium-Derivatized Phosphoramidites and their Incorporation into DNA Oligonucleotides

PubMed Central

Jiang, Sibo; Sheng, Jia

2015-01-01

Introduction In this unit, an efficient method for the synthesis of 2’-tellerium modified phosphoramidite and its incorporation into oligonucleotide are presented. We choose 5’-O-DMTr-2,2’-anhydro-uridine and -thymidine nucleosides (S.1, S.2) as starting materials due to their easy preparation. The 5’-O-DMTr-2,2’-anhydro-uridine and -thymidine can be converted to corresponding the 2’-tellerium-derivatized nucleosides by treating with the telluride nucleophiles. Subsequently, the 2’-Te-nucleosides can be transformed into 3’-phosphoramidites, which are the building blocks for DNA/RNA synthesis. The DNA synthesis, purification and applications of oligonucleotides containing 2’-Te-U or 2’-Te-T are described in this protocol. PMID:22147418

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hsia, Chu Chieh; Chizhikov, Vladimir E.; Yang, Amy X.

Hepatitis B virus (HBV), hepatitis C virus (HCV), and human immunodeficiency virus type-1 (HIV-1) are transfusion-transmitted human pathogens that have a major impact on blood safety and public health worldwide. We developed a microarray multiplex assay for the simultaneous detection and discrimination of these three viruses. The microarray consists of 16 oligonucleotide probes, immobilized on a silylated glass slide. Amplicons from multiplex PCR were labeled with Cy-5 and hybridized to the microarray. The assay detected 1 International Unit (IU), 10 IU, 20 IU of HBV, HCV, and HIV-1, respectively, in a single multiplex reaction. The assay also detected and discriminatedmore » the presence of two or three of these viruses in a single sample. Our data represent a proof-of-concept for the possible use of highly sensitive multiplex microarray assay to screen and confirm the presence of these viruses in blood donors and patients.« less

Identification of transcribed sequences in Arabidopsis thaliana by using high-resolution genome tiling arrays

PubMed Central

Stolc, Viktor; Samanta, Manoj Pratim; Tongprasit, Waraporn; Sethi, Himanshu; Liang, Shoudan; Nelson, David C.; Hegeman, Adrian; Nelson, Clark; Rancour, David; Bednarek, Sebastian; Ulrich, Eldon L.; Zhao, Qin; Wrobel, Russell L.; Newman, Craig S.; Fox, Brian G.; Phillips, George N.; Markley, John L.; Sussman, Michael R.

2005-01-01

Using a maskless photolithography method, we produced DNA oligonucleotide microarrays with probe sequences tiled throughout the genome of the plant Arabidopsis thaliana. RNA expression was determined for the complete nuclear, mitochondrial, and chloroplast genomes by tiling 5 million 36-mer probes. These probes were hybridized to labeled mRNA isolated from liquid grown T87 cells, an undifferentiated Arabidopsis cell culture line. Transcripts were detected from at least 60% of the nearly 26,330 annotated genes, which included 151 predicted genes that were not identified previously by a similar genome-wide hybridization study on four different cell lines. In comparison with previously published results with 25-mer tiling arrays produced by chromium masking-based photolithography technique, 36-mer oligonucleotide probes were found to be more useful in identifying intron–exon boundaries. Using two-dimensional HPLC tandem mass spectrometry, a small-scale proteomic analysis was performed with the same cells. A large amount of strongly hybridizing RNA was found in regions “antisense” to known genes. Similarity of antisense activities between the 25-mer and 36-mer data sets suggests that it is a reproducible and inherent property of the experiments. Transcription activities were also detected for many of the intergenic regions and the small RNAs, including tRNA, small nuclear RNA, small nucleolar RNA, and microRNA. Expression of tRNAs correlates with genome-wide amino acid usage. PMID:15755812

Identification of transcribed sequences in Arabidopsis thaliana by using high-resolution genome tiling arrays

NASA Technical Reports Server (NTRS)

Stolc, Viktor; Samanta, Manoj Pratim; Tongprasit, Waraporn; Sethi, Himanshu; Liang, Shoudan; Nelson, David C.; Hegeman, Adrian; Nelson, Clark; Rancour, David; Bednarek, Sebastian;

Decreased triadin and increased calstabin2 expression in Great Danes with dilated cardiomyopathy.

PubMed

Oyama, M A; Chittur, S V; Reynolds, C A

2009-01-01

Dilated cardiomyopathy (DCM) is a common cardiac disease of Great Dane dogs, yet very little is known about the underlying molecular abnormalities that contribute to disease. Discover a set of genes that are differentially expressed in Great Dane dogs with DCM as a way to identify candidate genes for further study as well as to better understand the molecular abnormalities that underlie the disease. Three Great Dane dogs with end-stage DCM and 3 large breed control dogs. Prospective study. Transcriptional activity of 42,869 canine DNA sequences was determined with a canine-specific oligonucleotide microarray. Genome expression patterns of left ventricular tissue samples from affected Great Dane dogs were evaluated by measuring the relative amount of complementary RNA hybridization to the microarray probes and comparing it with expression from large breed dogs with noncardiac disease. Three hundred and twenty-three transcripts were differentially expressed (> or = 2-fold change). The transcript with the greatest degree of upregulation (+61.3-fold) was calstabin2 (FKBP12.6), whereas the transcript with the greatest degree of downregulation (-9.07-fold) was triadin. Calstabin2 and triadin are both regulatory components of the cardiac ryanodine receptor (RyR2) and are critical to normal intracellular Ca2+ release and excitation-contraction coupling. Great Dane dogs with DCM demonstrate abnormal calstabin2 and triadin expression. These changes likely affect Ca2+ flux within cardiac cells and may contribute to the pathophysiology of disease. Microarray-based analysis identifies calstabin2, triadin, and RyR2 function as targets of future study.

cDNA Microarray Screening in Food Safety

PubMed Central

ROY, SASHWATI; SEN, CHANDAN K

2009-01-01

The cDNA microarray technology and related bioinformatics tools presents a wide range of novel application opportunities. The technology may be productively applied to address food safety. In this mini-review article, we present an update highlighting the late breaking discoveries that demonstrate the vitality of cDNA microarray technology as a tool to analyze food safety with reference to microbial pathogens and genetically modified foods. In order to bring the microarray technology to mainstream food safety, it is important to develop robust user-friendly tools that may be applied in a field setting. In addition, there needs to be a standardized process for regulatory agencies to interpret and act upon microarray-based data. The cDNA microarray approach is an emergent technology in diagnostics. Its values lie in being able to provide complimentary molecular insight when employed in addition to traditional tests for food safety, as part of a more comprehensive battery of tests. PMID:16466843

Genome-wide screening identifies Plasmodium chabaudi-induced modifications of DNA methylation status of Tlr1 and Tlr6 gene promoters in liver, but not spleen, of female C57BL/6 mice.

PubMed

Al-Quraishy, Saleh; Dkhil, Mohamed A; Abdel-Baki, Abdel Azeem S; Delic, Denis; Santourlidis, Simeon; Wunderlich, Frank

2013-11-01

Epigenetic reprogramming of host genes via DNA methylation is increasingly recognized as critical for the outcome of diverse infectious diseases, but information for malaria is not yet available. Here, we investigate the effect of blood-stage malaria of Plasmodium chabaudi on the DNA methylation status of host gene promoters on a genome-wide scale using methylated DNA immunoprecipitation and Nimblegen microarrays containing 2,000 bp oligonucleotide features that were split into -1,500 to -500 bp Ups promoters and -500 to +500 bp Cor promoters, relative to the transcription site, for evaluation of differential DNA methylation. Gene expression was analyzed by Agilent and Affymetrix microarray technology. Challenging of female C57BL/6 mice with 10(6) P. chabaudi-infected erythrocytes resulted in a self-healing outcome of infections with peak parasitemia on day 8 p.i. These infections induced organ-specific modifications of DNA methylation of gene promoters. Among the 17,354 features on Nimblegen arrays, only seven gene promoters were identified to be hypermethylated in the spleen, whereas the liver exhibited 109 hyper- and 67 hypomethylated promoters at peak parasitemia in comparison with non-infected mice. Among the identified genes with differentially methylated Cor-promoters, only the 7 genes Pigr, Ncf1, Klkb1, Emr1, Ndufb11, and Tlr6 in the liver and Apol6 in the spleen were detected to have significantly changed their expression. Remarkably, the Cor promoter of the toll-like receptor Tlr6 became hypomethylated and Tlr6 expression increased by 3.4-fold during infection. Concomitantly, the Ups promoter of the Tlr1 was hypermethylated, but Tlr1 expression also increased by 11.3-fold. TLR6 and TLR1 are known as auxillary receptors to form heterodimers with TLR2 in plasma membranes of macrophages, which recognize different pathogen-associated molecular patterns (PAMPs), as, e.g., intact 3-acyl and sn-2-lyso-acyl glycosylphosphatidylinositols of P. falciparum, respectively. Our data suggest therefore that malaria-induced epigenetic fine-tuning of Tlr6 and Tlr1 through DNA methylation of their gene promoters in the liver is critically important for initial recognition of PAMPs and, thus, for the final self-healing outcome of blood-stage infections with P. chabaudi malaria.

Detection of Alicyclobacillus species in fruit juice using a random genomic DNA microarray chip.

PubMed

Jang, Jun Hyeong; Kim, Sun-Joong; Yoon, Bo Hyun; Ryu, Jee-Hoon; Gu, Man Bock; Chang, Hyo-Ihl

2011-06-01

This study describes a method using a DNA microarray chip to rapidly and simultaneously detect Alicyclobacillus species in orange juice based on the hybridization of genomic DNA with random probes. Three food spoilage bacteria were used in this study: Alicyclobacillus acidocaldarius, Alicyclobacillus acidoterrestris, and Alicyclobacillus cycloheptanicus. The three Alicyclobacillus species were adjusted to 2 × 10(3) CFU/ml and inoculated into pasteurized 100% pure orange juice. Cy5-dCTP labeling was used for reference signals, and Cy3-dCTP was labeled for target genomic DNA. The molar ratio of 1:1 of Cy3-dCTP and Cy5-dCTP was used. DNA microarray chips were fabricated using randomly fragmented DNA of Alicyclobacillus spp. and were hybridized with genomic DNA extracted from Bacillus spp. Genomic DNA extracted from Alicyclobacillus spp. showed a significantly higher hybridization rate compared with DNA of Bacillus spp., thereby distinguishing Alicyclobacillus spp. from Bacillus spp. The results showed that the microarray DNA chip containing randomly fragmented genomic DNA was specific and clearly identified specific food spoilage bacteria. This microarray system is a good tool for rapid and specific detection of thermophilic spoilage bacteria, mainly Alicyclobacillus spp., and is useful and applicable to the fruit juice industry.

Integrated in silico and biological validation of the blocking effect of Cot-1 DNA on Microarray-CGH.

PubMed

Kang, Seung-Hui; Park, Chan Hee; Jeung, Hei Cheul; Kim, Ki-Yeol; Rha, Sun Young; Chung, Hyun Cheol

2007-06-01

In array-CGH, various factors may act as variables influencing the result of experiments. Among them, Cot-1 DNA, which has been used as a repetitive sequence-blocking agent, may become an artifact-inducing factor in BAC array-CGH. To identify the effect of Cot-1 DNA on Microarray-CGH experiments, Cot-1 DNA was labeled directly and Microarray-CGH experiments were performed. The results confirmed that probes which hybridized more completely with Cot-1 DNA had a higher sequence similarity to the Alu element. Further, in the sex-mismatched Microarray-CGH experiments, the variation and intensity in the fluorescent signal were reduced in the high intensity probe group in which probes were better hybridized with Cot-1 DNA. Otherwise, those of the low intensity probe group showed no alterations regardless of Cot-1 DNA. These results confirmed by in silico methods that Cot-1 DNA could block repetitive sequences in gDNA and probes. In addition, it was confirmed biologically that the blocking effect of Cot-1 DNA could be presented via its repetitive sequences, especially Alu elements. Thus, in contrast to BAC-array CGH, the use of Cot-1 DNA is advantageous in controlling experimental variation in Microarray-CGH.

Rapid Microarray Detection of DNA and Proteins in Microliter Volumes with SPR Imaging Measurements

PubMed Central

Seefeld, Ting Hu; Zhou, Wen-Juan; Corn, Robert M.

2011-01-01

A four chamber microfluidic biochip is fabricated for the rapid detection of multiple proteins and nucleic acids from microliter volume samples with the technique of surface plasmon resonance imaging (SPRI). The 18 mm × 18 mm biochip consists of four 3 μL microfluidic chambers attached to an SF10 glass substrate, each of which contains three individually addressable SPRI gold thin film microarray elements. The twelve element (4 × 3) SPRI microarray consists of gold thin film spots (1 mm2 area; 45 nm thickness) each in individually addressable 0.5 μL volume microchannels. Microarrays of single-stranded DNA and RNA (ssDNA and ssRNA respectively) are fabricated by either chemical and/or enzymatic attachment reactions in these microchannels; the SPRI microarrays are then used to detect femtomole amounts (nanomolar concentrations) of DNA and proteins (single stranded DNA binding protein and thrombin via aptamer-protein bioaffinity interactions). Microarrays of ssRNA microarray elements were also used for the ultrasensitive detection of zeptomole amounts (femtomolar concentrations) of DNA via the technique of RNase H-amplified SPRI. Enzymatic removal of ssRNA from the surface due to the hybridization adsorption of target ssDNA is detected as a reflectivity decrease in the SPR imaging measurements. The observed reflectivity loss was proportional to the log of the target ssDNA concentration with a detection limit of 10 fM or 30 zeptomoles (18,000 molecules). This enzymatic amplified ssDNA detection method is not limited by diffusion of ssDNA to the interface, and thus is extremely fast, requiring only 200 seconds in the microliter volume format. PMID:21488682

Endoplasmic Reticulum-Associated Degradation Factor ERLIN2: Oncogenic Roles and Molecular Targeting of Breast Cancer

DTIC Science & Technology

2013-06-01

Chemicals were purchased from Sigma unless indicated otherwise. Synthetic oligonucleotides were purchased from Integrated DNA Technologies. Human insulin was...otherwise. Synthetic oligonucleotides were purchased from Integrated DNA Technolo- gies, Inc. (Coralville, IA). Antibodies against XBP1, C/EBPα, and...component of marijuana , induces human glioma cancer cell death through stimulation of ER stress-associated autophagy [92]. δ- tetrahydrocannabinol can

Exploring optimization parameters to increase ssDNA recombineering in Lactococcus lactis and Lactobacillus reuteri

PubMed Central

van Pijkeren, Jan-Peter; Neoh, Kar Mun; Sirias, Denise; Findley, Anthony S.; Britton, Robert A.

2012-01-01

Single-stranded DNA (ssDNA) recombineering is a technology which is used to make subtle changes in the chromosome of several bacterial genera. Cells which express a single-stranded DNA binding protein (RecT or Bet) are transformed with an oligonucleotide which is incorporated via an annealing and replication-dependent mechanism. By in silico analysis we identified ssDNA binding protein homologs in the genus Lactobacillus and Lactococcus lactis. To assess whether we could further improve the recombineering efficiency in Lactobacillus reuteri ATCC PTA 6475 we expressed several RecT homologs in this strain. RecT derived from Enterococcus faecalis CRMEN 19 yielded comparable efficiencies compared with a native RecT protein, but none of the other proteins further increased the recombineering efficiency. We successfully improved recombineering efficiency 10-fold in L. lactis by increasing oligonucleotide concentration combined with the use of oligonucleotides containing phosphorothioate-linkages (PTOs). Surprisingly, neither increased oligonucleotide concentration nor PTO linkages enhanced recombineering in L. reuteri 6475. To emphasize the utility of this technology in improving probiotic features we modified six bases in a transcriptional regulatory element region of the pdu-operon of L. reuteri 6475, yielding a 3-fold increase in the production of the antimicrobial compound reuterin. Directed genetic modification of lactic acid bacteria through ssDNA recombineering will simplify strain improvement in a way that, when mutating a single base, is genetically indistinguishable from strains obtained through directed evolution. PMID:22750793

Differences in X-chromosome transcriptional activity and cholesterol metabolism between placentae from swine breeds from asian and western origins

USDA-ARS?s Scientific Manuscript database

To gain insight into placental physiology differences between the Chinese Meishan and white composite (WC) swine breeds, short-oligonucleotide microarray gene expression profiles of gestational Day 25, 45, 65, 85, and 105 placental tissues were compared. Differential expression was determined by a ...

Oligonucleotide microarray analysis reveals dysregulation of energy-related metabolism in insulin-sensitive tissues of type 2 diabetes patients.

PubMed

Wang, M; Wang, X C; Zhao, L; Zhang, Y; Yao, L L; Lin, Y; Peng, Y D; Hu, R M

2014-06-17

Impaired insulin action within skeletal muscle, adipose tissue, and the liver is an important characteristic of type 2 diabetes (T2D). In order to identify common underlying defects in insulin-sensitive tissues that may be involved in the pathogenesis of T2D, the gene expression profiles of skeletal muscle, visceral adipose tissue, and liver from autopsy donors with or without T2D were examined using oligonucleotide microarrays and quantitative reverse transcriptase-PCR. Compared with controls, 691 genes were commonly dysregulated in these three insulin-sensitive tissues of humans with T2D. These co-expressed genes were enriched within the mitochondrion, with suggested involvement in energy metabolic processes such as glycolysis and gluconeogenesis, fatty acid beta oxidative, tricarboxylic acid cycle, and electron transport. Genes related to energy metabolism were mostly downregulated in diabetic skeletal muscle and visceral adipose tissue, while they were upregulated in the diabetic liver. This observed dysregulation in energy-related metabolism may be the underlying factor leading to the molecular mechanisms responsible for the insulin resistance of patients with T2D.

Assembly of a biocompatible triazole-linked gene by one-pot click-DNA ligation

NASA Astrophysics Data System (ADS)

Kukwikila, Mikiembo; Gale, Nittaya; El-Sagheer, Afaf H.; Brown, Tom; Tavassoli, Ali

2017-11-01

The chemical synthesis of oligonucleotides and their enzyme-mediated assembly into genes and genomes has significantly advanced multiple scientific disciplines. However, these approaches are not without their shortcomings; enzymatic amplification and ligation of oligonucleotides into genes and genomes makes automation challenging, and site-specific incorporation of epigenetic information and/or modified bases into large constructs is not feasible. Here we present a fully chemical one-pot method for the assembly of oligonucleotides into a gene by click-DNA ligation. We synthesize the 335 base-pair gene that encodes the green fluorescent protein iLOV from ten functionalized oligonucleotides that contain 5ʹ-azide and 3ʹ-alkyne units. The resulting click-linked iLOV gene contains eight triazoles at the sites of chemical ligation, and yet is fully biocompatible; it is replicated by DNA polymerases in vitro and encodes a functional iLOV protein in Escherichia coli. We demonstrate the power and potential of our one-pot gene-assembly method by preparing an epigenetically modified variant of the iLOV gene.

Hydrated electrons react with high specificity with cisplatin bound to single-stranded DNA.

PubMed

Behmand, B; Cloutier, P; Girouard, S; Wagner, J R; Sanche, L; Hunting, D J

2013-12-19

Short oligonucleotides TTTTTGTGTTT and TTTTTTTGTTT in solution with and without cisplatin (cisPt) bound to the guanine bases were irradiated with γ-rays at doses varying from 0 to 2500 Gy. To determine the effect of hydrated electrons from water radiolysis on the oligonucleotides, we quenched (•)OH radicals with ethylenediaminetetraacetic acid (EDTA) and displaced oxygen, which reacts with hydrated electrons, by bubbling the solution with wet nitrogen. DNA strand breaks and platinum detachment were quantified by gel electrophoresis. Our results demonstrate that hydrated electrons react almost exclusively at the position of the cisPt adduct, where they induce cisPt detachment from one or both guanines in the oligonucleotide. Given the high yield of hydrated electrons in irradiated tissues, this reaction may be an important step in the mechanism of radiosensitization of DNA by cisPt.

Preparation of genosensor for detection of specific DNA sequence of the hepatitis B virus

NASA Astrophysics Data System (ADS)

Honorato Castro, Ana C.; França, Erick G.; de Paula, Lucas F.; Soares, Marcia M. C. N.; Goulart, Luiz R.; Madurro, João M.; Brito-Madurro, Ana G.

2014-09-01

An electrochemical genosensor was constructed for detection of specific DNA sequence of the hepatitis B virus, based on graphite electrodes modified with poly(4-aminophenol) and incorporating a specific oligonucleotide probe. The modified electrode containing the probe was evaluated by differential pulse voltammetry, before and after incubation with the complementary oligonucleotide target. Detection was performed by monitoring oxidizable DNA bases (direct detection) or using ethidium bromide as indicator of the hybridization process (indirect detection). The device showed a detection limit for the oligonucleotide target of 2.61 nmol L-1. Indirect detection using ethidium bromide was promising in discriminating mismatches, which is a very desirable attribute for detection of disease-related point mutations. In addition, it was possible to observe differences between hybridized and non-hybridized surfaces by atomic force microscopy.

Regulation of the activity of the promoter of RNA-induced silencing, C3PO.

PubMed

Sahu, Shriya; Williams, Leo; Perez, Alberto; Philip, Finly; Caso, Giuseppe; Zurawsky, Walter; Scarlata, Suzanne

2017-09-01

RNA-induced silencing is a process which allows cells to regulate the synthesis of specific proteins. RNA silencing is promoted by the protein C3PO (component 3 of RISC). We have previously found that phospholipase Cβ, which increases intracellular calcium levels in response to specific G protein signals, inhibits C3PO activity towards certain genes. Understanding the parameters that control C3PO activity and which genes are impacted by G protein activation would help predict which genes are more vulnerable to downregulation. Here, using a library of 10 18 oligonucleotides, we show that C3PO binds oligonucleotides with structural specificity but little sequence specificity. Alternately, C3PO hydrolyzes oligonucleotides with a rate that is sensitive to substrate stability. Importantly, we find that oligonucleotides with higher Tm values are inhibited by bound PLCβ. This finding is supported by microarray analysis in cells over-expressing PLCβ1. Taken together, this study allows predictions of the genes whose post-transcriptional regulation is responsive to the G protein/phospholipase Cβ/calcium signaling pathway. © 2017 The Protein Society.

An evaluation of two-channel ChIP-on-chip and DNA methylation microarray normalization strategies

PubMed Central

2012-01-01

Background The combination of chromatin immunoprecipitation with two-channel microarray technology enables genome-wide mapping of binding sites of DNA-interacting proteins (ChIP-on-chip) or sites with methylated CpG di-nucleotides (DNA methylation microarray). These powerful tools are the gateway to understanding gene transcription regulation. Since the goals of such studies, the sample preparation procedures, the microarray content and study design are all different from transcriptomics microarrays, the data pre-processing strategies traditionally applied to transcriptomics microarrays may not be appropriate. Particularly, the main challenge of the normalization of "regulation microarrays" is (i) to make the data of individual microarrays quantitatively comparable and (ii) to keep the signals of the enriched probes, representing DNA sequences from the precipitate, as distinguishable as possible from the signals of the un-enriched probes, representing DNA sequences largely absent from the precipitate. Results We compare several widely used normalization approaches (VSN, LOWESS, quantile, T-quantile, Tukey's biweight scaling, Peng's method) applied to a selection of regulation microarray datasets, ranging from DNA methylation to transcription factor binding and histone modification studies. Through comparison of the data distributions of control probes and gene promoter probes before and after normalization, and assessment of the power to identify known enriched genomic regions after normalization, we demonstrate that there are clear differences in performance between normalization procedures. Conclusion T-quantile normalization applied separately on the channels and Tukey's biweight scaling outperform other methods in terms of the conservation of enriched and un-enriched signal separation, as well as in identification of genomic regions known to be enriched. T-quantile normalization is preferable as it additionally improves comparability between microarrays. In contrast, popular normalization approaches like quantile, LOWESS, Peng's method and VSN normalization alter the data distributions of regulation microarrays to such an extent that using these approaches will impact the reliability of the downstream analysis substantially. PMID:22276688

DNA Microarray for Rapid Detection and Identification of Food and Water Borne Bacteria: From Dry to Wet Lab.

PubMed

Ranjbar, Reza; Behzadi, Payam; Najafi, Ali; Roudi, Raheleh

2017-01-01

A rapid, accurate, flexible and reliable diagnostic method may significantly decrease the costs of diagnosis and treatment. Designing an appropriate microarray chip reduces noises and probable biases in the final result. The aim of this study was to design and construct a DNA Microarray Chip for a rapid detection and identification of 10 important bacterial agents. In the present survey, 10 unique genomic regions relating to 10 pathogenic bacterial agents including Escherichia coli (E.coli), Shigella boydii, Sh.dysenteriae, Sh.flexneri, Sh.sonnei, Salmonella typhi, S.typhimurium, Brucella sp., Legionella pneumophila, and Vibrio cholera were selected for designing specific long oligo microarray probes. For this reason, the in-silico operations including utilization of the NCBI RefSeq database, Servers of PanSeq and Gview, AlleleID 7.7 and Oligo Analyzer 3.1 was done. On the other hand, the in-vitro part of the study comprised stages of robotic microarray chip probe spotting, bacterial DNAs extraction and DNA labeling, hybridization and microarray chip scanning. In wet lab section, different tools and apparatus such as Nexterion® Slide E, Qarray mini spotter, NimbleGen kit, TrayMix TM S4, and Innoscan 710 were used. A DNA microarray chip including 10 long oligo microarray probes was designed and constructed for detection and identification of 10 pathogenic bacteria. The DNA microarray chip was capable to identify all 10 bacterial agents tested simultaneously. The presence of a professional bioinformatician as a probe designer is needed to design appropriate multifunctional microarray probes to increase the accuracy of the outcomes.

On-Chip Synthesis of Protein Microarrays from DNA Microarrays Via Coupled In Vitro Transcription and Translation for Surface Plasmon Resonance Imaging Biosensor Applications

PubMed Central

Seefeld, Ting H.; Halpern, Aaron R.; Corn, Robert M.

2012-01-01

Protein microarrays are fabricated from double-stranded DNA (dsDNA) microarrays by a one-step, multiplexed enzymatic synthesis in an on-chip microfluidic format and then employed for antibody biosensing measurements with surface plasmon resonance imaging (SPRI). A microarray of dsDNA elements (denoted as generator elements) that encode either a His-tagged green fluorescent protein (GFP) or a His-tagged luciferase protein is utilized to create multiple copies of messenger RNA (mRNA) in a surface RNA polymerase reaction; the mRNA transcripts are then translated into proteins by cell-free protein synthesis in a microfluidic format. The His-tagged proteins diffuse to adjacent Cu(II)-NTA microarray elements (denoted as detector elements) and are specifically adsorbed. The net result is the on-chip, cell-free synthesis of a protein microarray that can be used immediately for SPRI protein biosensing. The dual element format greatly reduces any interference from the nonspecific adsorption of enzyme or proteins. SPRI measurements for the detection of the antibodies anti-GFP and anti-luciferase were used to verify the formation of the protein microarray. This convenient on-chip protein microarray fabrication method can be implemented for multiplexed SPRI biosensing measurements in both clinical and research applications. PMID:22793370

Design and evaluation of Actichip, a thematic microarray for the study of the actin cytoskeleton

PubMed Central

Muller, Jean; Mehlen, André; Vetter, Guillaume; Yatskou, Mikalai; Muller, Arnaud; Chalmel, Frédéric; Poch, Olivier; Friederich, Evelyne; Vallar, Laurent

2007-01-01

Background The actin cytoskeleton plays a crucial role in supporting and regulating numerous cellular processes. Mutations or alterations in the expression levels affecting the actin cytoskeleton system or related regulatory mechanisms are often associated with complex diseases such as cancer. Understanding how qualitative or quantitative changes in expression of the set of actin cytoskeleton genes are integrated to control actin dynamics and organisation is currently a challenge and should provide insights in identifying potential targets for drug discovery. Here we report the development of a dedicated microarray, the Actichip, containing 60-mer oligonucleotide probes for 327 genes selected for transcriptome analysis of the human actin cytoskeleton. Results Genomic data and sequence analysis features were retrieved from GenBank and stored in an integrative database called Actinome. From these data, probes were designed using a home-made program (CADO4MI) allowing sequence refinement and improved probe specificity by combining the complementary information recovered from the UniGene and RefSeq databases. Actichip performance was analysed by hybridisation with RNAs extracted from epithelial MCF-7 cells and human skeletal muscle. Using thoroughly standardised procedures, we obtained microarray images with excellent quality resulting in high data reproducibility. Actichip displayed a large dynamic range extending over three logs with a limit of sensitivity between one and ten copies of transcript per cell. The array allowed accurate detection of small changes in gene expression and reliable classification of samples based on the expression profiles of tissue-specific genes. When compared to two other oligonucleotide microarray platforms, Actichip showed similar sensitivity and concordant expression ratios. Moreover, Actichip was able to discriminate the highly similar actin isoforms whereas the two other platforms did not. Conclusion Our data demonstrate that Actichip is a powerful alternative to commercial high density microarrays for cytoskeleton gene profiling in normal or pathological samples. Actichip is available upon request. PMID:17727702

[Individual identification of cadaver parts after a bomb explosion using oligonucleotide fingerprinting by (GTG)5].

PubMed

Kondo, T; Ohshima, T

1998-01-01

A blind shell suddenly and unexpectedly exploded, and 20 dismembered human remains were discovered. DNA fingerprint was performed to determine whether the 20 human remains were derived from one person or not. DNA was isolated from each of the remains and digested by the restriction enzyme Hinf I and Hae III and hybridized with the oligonucleotide probe (GTG)5. DNA fingerprint using Hinf I demonstrated the same band pattern in 17 out of the 20 remains. However, in the remaining 3 samples, two novel strange bands were observed. DNA fingerprint using Hae III showed completely identical pattern in all of the remains.

An improved divergent synthesis of comb-type branched oligodeoxyribonucleotides (bDNA) containing multiple secondary sequences.

PubMed

Horn, T; Chang, C A; Urdea, M S

1997-12-01

The divergent synthesis of branched DNA (bDNA) comb structures is described. This new type of bDNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branch network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb structures were assembled on a solid support and several synthesis parameters were investigated and optimized. The bDNA comb molecules were characterized by polyacrylamide gel electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The developed chemistry allows synthesis of bDNA comb molecules containing multiple secondary sequences. In the accompanying article we describe the synthesis and characterization of large bDNA combs containing all four deoxynucleotides for use as signal amplifiers in nucleic acid quantification assays.

An improved divergent synthesis of comb-type branched oligodeoxyribonucleotides (bDNA) containing multiple secondary sequences.

PubMed Central

Horn, T; Chang, C A; Urdea, M S

1997-01-01

The divergent synthesis of branched DNA (bDNA) comb structures is described. This new type of bDNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branch network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb structures were assembled on a solid support and several synthesis parameters were investigated and optimized. The bDNA comb molecules were characterized by polyacrylamide gel electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The developed chemistry allows synthesis of bDNA comb molecules containing multiple secondary sequences. In the accompanying article we describe the synthesis and characterization of large bDNA combs containing all four deoxynucleotides for use as signal amplifiers in nucleic acid quantification assays. PMID:9365265

Synthesis of nucleosides and oligonucleotides containing adducts of acrolein and vinyl chloride.

PubMed

Nechev, L V; Harris, C M; Harris, T M

2000-05-01

Vinyl chloride and acrolein are important industrial chemicals. Both form DNA adducts, vinyl chloride after enzymatic oxidation to chlorooxirane and acrolein by direct reaction. Reaction at the N(2) position of guanine is a major pathway. The resulting 2-oxoethyl and 3-oxopropyl adducts cyclize spontaneously to hydroxyethano and hydroxypropano derivatives, respectively. The two cyclic adducts have been detected in DNA exposed to these mutagens. A new method has been developed for the synthesis of deoxyguanosine adducts of chlorooxirane and acrolein, as well as oligonucleotides containing these adducts. Reaction of O(6)-[(trimethylsilyl)ethyl]-2-fluoro-2'-deoxyinosine with the appropriate aminodiol followed by oxidative cleavage of the diol with NaIO(4) gave the adducts in excellent yields. Reaction of oligonucleotides containing the halonucleoside with the aminodiols followed by NaIO(4) efficiently created the nucleosides in the oligonucleotides. Deoxyadenosine adducts were created similarly using 6-chloropurine 9-(2'-deoxyriboside).

Analysis of High-Throughput ELISA Microarray Data

DOE Office of Scientific and Technical Information (OSTI.GOV)

White, Amanda M.; Daly, Don S.; Zangar, Richard C.

Our research group develops analytical methods and software for the high-throughput analysis of quantitative enzyme-linked immunosorbent assay (ELISA) microarrays. ELISA microarrays differ from DNA microarrays in several fundamental aspects and most algorithms for analysis of DNA microarray data are not applicable to ELISA microarrays. In this review, we provide an overview of the steps involved in ELISA microarray data analysis and how the statistically sound algorithms we have developed provide an integrated software suite to address the needs of each data-processing step. The algorithms discussed are available in a set of open-source software tools (http://www.pnl.gov/statistics/ProMAT).

DNA cross-linking by dehydromonocrotaline lacks apparent base sequence preference.

PubMed

Rieben, W Kurt; Coulombe, Roger A

2004-12-01

Pyrrolizidine alkaloids (PAs) are ubiquitous plant toxins, many of which, upon oxidation by hepatic mixed-function oxidases, become reactive bifunctional pyrrolic electrophiles that form DNA-DNA and DNA-protein cross-links. The anti-mitotic, toxic, and carcinogenic action of PAs is thought to be caused, at least in part, by these cross-links. We wished to determine whether the activated PA pyrrole dehydromonocrotaline (DHMO) exhibits base sequence preferences when cross-linked to a set of model duplex poly A-T 14-mer oligonucleotides with varying internal and/or end 5'-d(CG), 5'-d(GC), 5'-d(TA), 5'-d(CGCG), or 5'-d(GCGC) sequences. DHMO-DNA cross-links were assessed by electrophoretic mobility shift assay (EMSA) of 32P endlabeled oligonucleotides and by HPLC analysis of cross-linked DNAs enzymatically digested to their constituent deoxynucleosides. The degree of DNA cross-links depended upon the concentration of the pyrrole, but not on the base sequence of the oligonucleotide target. Likewise, HPLC chromatograms of cross-linked and digested DNAs showed no discernible sequence preference for any nucleotide. Added glutathione, tyrosine, cysteine, and aspartic acid, but not phenylalanine, threonine, serine, lysine, or methionine competed with DNA as alternate nucleophiles for cross-linking by DHMO. From these data it appears that DHMO exhibits no strong base preference when forming cross-links with DNA, and that some cellular nucleophiles can inhibit DNA cross-link formation.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeo, Hyun Koo; Lee, Jae Young

2012-04-18

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

PubMed

Yeo, Hyun Koo; Lee, Jae Young

2010-05-01

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

Oligonucleotides Containing Aminated 2'-Amino-LNA Nucleotides: Synthesis and Strong Binding to Complementary DNA and RNA.

PubMed

Lou, Chenguang; Samuelsen, Simone V; Christensen, Niels Johan; Vester, Birte; Wengel, Jesper

2017-04-19

Mono- and diaminated 2'-amino-LNA monomers were synthesized and introduced into oligonucleotides. Each modification imparts significant stabilization of nucleic acid duplexes and triplexes, excellent sequence selectivity, and significant nuclease resistance. Molecular modeling suggested that structural stabilization occurs via intrastrand electrostatic attraction between the protonated amino groups of the aminated 2'-amino-LNA monomers and the host oligonucleotide backbone.

Hybridization chain reaction amplification for highly sensitive fluorescence detection of DNA with dextran coated microarrays.

PubMed

Chao, Jie; Li, Zhenhua; Li, Jing; Peng, Hongzhen; Su, Shao; Li, Qian; Zhu, Changfeng; Zuo, Xiaolei; Song, Shiping; Wang, Lianhui; Wang, Lihua

2016-07-15

Microarrays of biomolecules hold great promise in the fields of genomics, proteomics, and clinical assays on account of their remarkably parallel and high-throughput assay capability. However, the fluorescence detection used in most conventional DNA microarrays is still limited by sensitivity. In this study, we have demonstrated a novel universal and highly sensitive platform for fluorescent detection of sequence specific DNA at the femtomolar level by combining dextran-coated microarrays with hybridization chain reaction (HCR) signal amplification. Three-dimensional dextran matrix was covalently coated on glass surface as the scaffold to immobilize DNA recognition probes to increase the surface binding capacity and accessibility. DNA nanowire tentacles were formed on the matrix surface for efficient signal amplification by capturing multiple fluorescent molecules in a highly ordered way. By quantifying microscopic fluorescent signals, the synergetic effects of dextran and HCR greatly improved sensitivity of DNA microarrays, with a detection limit of 10fM (1×10(5) molecules). This detection assay could recognize one-base mismatch with fluorescence signals dropped down to ~20%. This cost-effective microarray platform also worked well with samples in serum and thus shows great potential for clinical diagnosis. Copyright © 2016 Elsevier B.V. All rights reserved.

Analysis of Protein-DNA Interaction by Chromatin Immunoprecipitation and DNA Tiling Microarray (ChIP-on-chip).

PubMed

Gao, Hui; Zhao, Chunyan

2018-01-01

Chromatin immunoprecipitation (ChIP) has become the most effective and widely used tool to study the interactions between specific proteins or modified forms of proteins and a genomic DNA region. Combined with genome-wide profiling technologies, such as microarray hybridization (ChIP-on-chip) or massively parallel sequencing (ChIP-seq), ChIP could provide a genome-wide mapping of in vivo protein-DNA interactions in various organisms. Here, we describe a protocol of ChIP-on-chip that uses tiling microarray to obtain a genome-wide profiling of ChIPed DNA.

Isolation of a complementary DNA clone for the human complement protein C2 and its use in the identification of a restriction fragment length polymorphism.

PubMed Central

Woods, D E; Edge, M D; Colten, H R

1984-01-01

Complementary DNA (cDNA) clones corresponding to the major histocompatibility (MHC) class III antigen, complement protein C2, have been isolated from human liver cDNA libraries with the use of a complex mixture of synthetic oligonucleotides (17 mer) that contains 576 different oligonucleotide sequences. The C2 cDNA were used to identify a DNA restriction enzyme fragment length polymorphism that provides a genetic marker within the MHC that was not detectable at the protein level. An extensive search for genomic polymorphisms using a cDNA clone for another MHC class III gene, factor B, failed to reveal any DNA variants. The genomic variants detected with the C2 cDNA probe provide an additional genetic marker for analysis of MHC-linked diseases. Images PMID:6086718

Hydrated Electrons React with High Specificity with Cisplatin Bound to Single-Stranded DNA

PubMed Central

Behmand, B.; Cloutier, P.; Girouard, S.; Wagner, J. R.; Sanche, L.; Hunting, D. J.

2015-01-01

Short oligonucleotides TTTTTGTGTTT and TTTTTTTGTTT in solution with and without cisplatin (cisPt) bound to the guanine bases were irradiated with γ-rays at doses varying from 0 to 2500 Gy. To determine the effect of hydrated electrons from water radiolysis on the oligonucleotides, we quenched •OH radicals with ethylenediaminetetraacetic acid (EDTA) and displaced oxygen, which reacts with hydrated electrons, by bubbling the solution with wet nitrogen. DNA strand breaks and platinum detachment were quantified by gel electrophoresis. Our results demonstrate that hydrated electrons react almost exclusively at the position of the cisPt adduct, where they induce cisPt detachment from one or both guanines in the oligonucleotide. Given the high yield of hydrated electrons in irradiated tissues, this reaction may be an important step in the mechanism of radiosensitization of DNA by cisPt. PMID:24205952

A reliable confirmation of the chemical structure of synthetic oligonucleotides: Detection of active protons in DNA oligomers by low-temperature FT infrared spectroscopy

NASA Astrophysics Data System (ADS)

Rozenberg, M.; Shoham, G.

2009-01-01

Cooling the samples allowed us to characterize solid oligonucleotides such as dimers, trimers and pentamers of cytidine, for the first time, in the IR range of the out-of-plane bending molecular modes (1000-400 cm -1) at 20 K. Especially interesting are the narrow IR bands of the out-of-plane bending ν4 NH 2 proton mode, which are apparently invisible at room temperature. This unequivocally defined and well-resolved NH 2 bending band should provide important information on the exact chemical form and hydrogen bonding interactions of cytidine amine groups. As such, this unique IR spectroscopy is suggested as a practical analytical tool to validate and characterize synthetic DNA bases and oligonucleotides. Using an approach of this type it was found that desalted oligonucleotide samples of the same nominal composition, but which had been produced by three different manufacturers, differ significantly in their IR spectra. These data suggest that the presumably identical oligonucleotides are in fact different, at least with respect to the content and nature of their NH protons.

A reliable confirmation of the chemical structure of synthetic oligonucleotides: detection of active protons in DNA oligomers by low-temperature FT infrared spectroscopy.

PubMed

Rozenberg, M; Shoham, G

2009-01-01

Cooling the samples allowed us to characterize solid oligonucleotides such as dimers, trimers and pentamers of cytidine, for the first time, in the IR range of the out-of-plane bending molecular modes (1000-400 cm(-1)) at 20K. Especially interesting are the narrow IR bands of the out-of-plane bending nu(4) NH(2) proton mode, which are apparently invisible at room temperature. This unequivocally defined and well-resolved NH(2) bending band should provide important information on the exact chemical form and hydrogen bonding interactions of cytidine amine groups. As such, this unique IR spectroscopy is suggested as a practical analytical tool to validate and characterize synthetic DNA bases and oligonucleotides. Using an approach of this type it was found that desalted oligonucleotide samples of the same nominal composition, but which had been produced by three different manufacturers, differ significantly in their IR spectra. These data suggest that the presumably identical oligonucleotides are in fact different, at least with respect to the content and nature of their NH protons.

Gallium-68-labelled NOTA-oligonucleotides: an optimized method for their preparation.

PubMed

Gijs, Marlies; Dammicco, Sylvestre; Warnier, Corentin; Aerts, An; Impens, Nathalie R E N; D'Huyvetter, Matthias; Léonard, Marc; Baatout, Sarah; Luxen, André

2016-02-01

One of the most essential aspects to the success of radiopharmaceuticals is an easy and reliable radiolabelling protocol to obtain pure and stable products. In this study, we optimized the bioconjugation and gallium-68 ((68) Ga) radiolabelling conditions for a single-stranded 40-mer DNA oligonucleotide, in order to obtain highly pure and stable radiolabelled oligonucleotides. Quantitative bioconjugation was obtained for a disulfide-functionalized oligonucleotide conjugated to the macrocylic bifunctional chelator MMA-NOTA (maleimido-mono-amide (1,4,7-triazanonane-1,4,7-triyl)triacetic acid). Next, this NOTA-oligonucleotide bioconjugate was radiolabelled at room temperature with purified and pre-concentrated (68) Ga with quantitative levels of radioactive incorporation and high radiochemical and chemical purity. In addition, high chelate stability was observed in physiological-like conditions (37 °C, PBS and serum), in the presence of a transchelator (EDTA) and transferrin. A specific activity of 51.1 MBq/nmol was reached using a 1470-fold molar excess bioconjugate over (68) Ga. This study presents a fast, straightforward and reliable protocol for the preparation of (68) Ga-radiolabelled DNA oligonucleotides under mild reaction conditions and without the use of organic solvents. The methodology herein developed will be applied to the preparation of oligonucleotidic sequences (aptamers) targeting the human epidermal growth factor receptor 2 (HER2) for cancer imaging. Copyright © 2015 John Wiley & Sons, Ltd.

Accurate and rapid modeling of iron-bleomycin-induced DNA damage using tethered duplex oligonucleotides and electrospray ionization ion trap mass spectrometric analysis.

PubMed

Harsch, A; Marzilli, L A; Bunt, R C; Stubbe, J; Vouros, P

2000-05-01

Bleomycin B(2)(BLM) in the presence of iron [Fe(II)] and O(2)catalyzes single-stranded (ss) and double-stranded (ds) cleavage of DNA. Electrospray ionization ion trap mass spectrometry was used to monitor these cleavage processes. Two duplex oligonucleotides containing an ethylene oxide tether between both strands were used in this investigation, allowing facile monitoring of all ss and ds cleavage events. A sequence for site-specific binding and cleavage by Fe-BLM was incorporated into each analyte. One of these core sequences, GTAC, is a known hot-spot for ds cleavage, while the other sequence, GGCC, is a hot-spot for ss cleavage. Incubation of each oligo-nucleotide under anaerobic conditions with Fe(II)-BLM allowed detection of the non-covalent ternary Fe-BLM/oligonucleotide complex in the gas phase. Cleavage studies were then performed utilizing O(2)-activated Fe(II)-BLM. No work-up or separation steps were required and direct MS and MS/MS analyses of the crude reaction mixtures confirmed sequence-specific Fe-BLM-induced cleavage. Comparison of the cleavage patterns for both oligonucleotides revealed sequence-dependent preferences for ss and ds cleavages in accordance with previously established gel electrophoresis analysis of hairpin oligonucleotides. This novel methodology allowed direct, rapid and accurate determination of cleavage profiles of model duplex oligonucleotides after exposure to activated Fe-BLM.

Importance of the efficiency of double-stranded DNA formation in cDNA synthesis for the imprecision of microarray expression analysis.

PubMed

Thormar, Hans G; Gudmundsson, Bjarki; Eiriksdottir, Freyja; Kil, Siyoen; Gunnarsson, Gudmundur H; Magnusson, Magnus Karl; Hsu, Jason C; Jonsson, Jon J

2013-04-01

The causes of imprecision in microarray expression analysis are poorly understood, limiting the use of this technology in molecular diagnostics. Two-dimensional strandness-dependent electrophoresis (2D-SDE) separates nucleic acid molecules on the basis of length and strandness, i.e., double-stranded DNA (dsDNA), single-stranded DNA (ssDNA), and RNA·DNA hybrids. We used 2D-SDE to measure the efficiency of cDNA synthesis and its importance for the imprecision of an in vitro transcription-based microarray expression analysis. The relative amount of double-stranded cDNA formed in replicate experiments that used the same RNA sample template was highly variable, ranging between 0% and 72% of the total DNA. Microarray experiments showed an inverse relationship between the difference between sample pairs in probe variance and the relative amount of dsDNA. Approximately 15% of probes showed between-sample variation (P < 0.05) when the dsDNA percentage was between 12% and 35%. In contrast, only 3% of probes showed between-sample variation when the dsDNA percentage was 69% and 72%. Replication experiments of the 35% dsDNA and 72% dsDNA samples were used to separate sample variation from probe replication variation. The estimated SD of the sample-to-sample variation and of the probe replicates was lower in 72% dsDNA samples than in 35% dsDNA samples. Variation in the relative amount of double-stranded cDNA synthesized can be an important component of the imprecision in T7 RNA polymerase-based microarray expression analysis. © 2013 American Association for Clinical Chemistry

Ketone-DNA: a versatile postsynthetic DNA decoration platform.

PubMed

Dey, S; Sheppard, T L

2001-12-13

[reaction: see text] A general strategy for the functional diversification of DNA oligonucleotides under physiological conditions was developed. We describe the synthesis of DNA molecules bearing ketone ports (ketone-DNA) and the efficient postsynthetic decoration of ketone-DNA with structurally diverse aminooxy compounds.

Crystal structure of an Okazaki fragment at 2-A resolution

NASA Technical Reports Server (NTRS)

Egli, M.; Usman, N.; Zhang, S. G.; Rich, A.

1992-01-01

In DNA replication, Okazaki fragments are formed as double-stranded intermediates during synthesis of the lagging strand. They are composed of the growing DNA strand primed by RNA and the template strand. The DNA oligonucleotide d(GGGTATACGC) and the chimeric RNA-DNA oligonucleotide r(GCG)d(TATACCC) were combined to form a synthetic Okazaki fragment and its three-dimensional structure was determined by x-ray crystallography. The fragment adopts an overall A-type conformation with 11 residues per turn. Although the base-pair geometry, particularly in the central TATA part, is distorted, there is no evidence for a transition from the A- to the B-type conformation at the junction between RNA.DNA hybrid and DNA duplex. The RNA trimer may, therefore, lock the complete fragment in an A-type conformation.

Construction of a cDNA microarray derived from the ascidian Ciona intestinalis.

PubMed

Azumi, Kaoru; Takahashi, Hiroki; Miki, Yasufumi; Fujie, Manabu; Usami, Takeshi; Ishikawa, Hisayoshi; Kitayama, Atsusi; Satou, Yutaka; Ueno, Naoto; Satoh, Nori

2003-10-01

A cDNA microarray was constructed from a basal chordate, the ascidian Ciona intestinalis. The draft genome of Ciona has been read and inferred to contain approximately 16,000 protein-coding genes, and cDNAs for transcripts of 13,464 genes have been characterized and compiled as the "Ciona intestinalis Gene Collection Release I". In the present study, we constructed a cDNA microarray of these 13,464 Ciona genes. A preliminary experiment with Cy3- and Cy5-labeled probes showed extensive differential gene expression between fertilized eggs and larvae. In addition, there was a good correlation between results obtained by the present microarray analysis and those from previous EST analyses. This first microarray of a large collection of Ciona intestinalis cDNA clones should facilitate the analysis of global gene expression and gene networks during the embryogenesis of basal chordates.

Improvement in the amine glass platform by bubbling method for a DNA microarray

PubMed Central

Jee, Seung Hyun; Kim, Jong Won; Lee, Ji Hyeong; Yoon, Young Soo

2015-01-01

A glass platform with high sensitivity for sexually transmitted diseases microarray is described here. An amino-silane-based self-assembled monolayer was coated on the surface of a glass platform using a novel bubbling method. The optimized surface of the glass platform had highly uniform surface modifications using this method, as well as improved hybridization properties with capture probes in the DNA microarray. On the basis of these results, the improved glass platform serves as a highly reliable and optimal material for the DNA microarray. Moreover, in this study, we demonstrated that our glass platform, manufactured by utilizing the bubbling method, had higher uniformity, shorter processing time, lower background signal, and higher spot signal than the platforms manufactured by the general dipping method. The DNA microarray manufactured with a glass platform prepared using bubbling method can be used as a clinical diagnostic tool. PMID:26468293

Improvement in the amine glass platform by bubbling method for a DNA microarray.

PubMed

Jee, Seung Hyun; Kim, Jong Won; Lee, Ji Hyeong; Yoon, Young Soo

2015-01-01

A glass platform with high sensitivity for sexually transmitted diseases microarray is described here. An amino-silane-based self-assembled monolayer was coated on the surface of a glass platform using a novel bubbling method. The optimized surface of the glass platform had highly uniform surface modifications using this method, as well as improved hybridization properties with capture probes in the DNA microarray. On the basis of these results, the improved glass platform serves as a highly reliable and optimal material for the DNA microarray. Moreover, in this study, we demonstrated that our glass platform, manufactured by utilizing the bubbling method, had higher uniformity, shorter processing time, lower background signal, and higher spot signal than the platforms manufactured by the general dipping method. The DNA microarray manufactured with a glass platform prepared using bubbling method can be used as a clinical diagnostic tool.

Click nucleic acid ligation: applications in biology and nanotechnology.

PubMed

El-Sagheer, Afaf H; Brown, Tom

2012-08-21

Biochemical strategies that use a combination of synthetic oligonucleotides, thermostable DNA polymerases, and DNA ligases can produce large DNA constructs up to 1 megabase in length. Although these ambitious targets are feasible biochemically, comparable technologies for the chemical synthesis of long DNA strands lag far behind. The best available chemical approach is the solid-phase phosphoramidite method, which can be used to assemble DNA strands up to 150 bases in length. Beyond this point, deficiencies in the chemistry make it impossible to produce pure DNA. A possible alternative approach to the chemical synthesis of large DNA strands is to join together carefully purified synthetic oligonucleotides by chemical methods. Click ligation by the copper-catalyzed azide-alkyne (CuAAC) reaction could facilitate this process. In this Account, we describe the synthesis, characterization, and applications of oligonucleotides prepared by click ligation. The alkyne and azide oligonucleotide strands can be prepared by standard protocols, and the ligation reaction is compatible with a wide range of chemical modifications to DNA and RNA. We have employed click ligation to synthesize DNA constructs up to 300 bases in length and much longer sequences are feasible. When the resulting triazole linkage is placed in a PCR template, various DNA polymerases correctly copy the entire base sequence. We have also successfully demonstrated both in vitro transcription and rolling circle amplification through the modified linkage. This linkage has shown in vivo biocompatibility: an antibiotic resistance gene containing triazole linkages functions in E. coli . Using click ligation, we have synthesized hairpin ribozymes up to 100 nucleotides in length and a hammerhead ribozyme with the triazole linkage located at the substrate cleavage site. At the opposite end of the length scale, click-ligated, cyclic mini-DNA duplexes have been used as models to study base pairing. Cyclic duplexes have potential therapeutic applications. They have extremely high thermodynamic stability, have increased resistance to enzymatic degradation, and have been investigated as decoys for regulatory proteins. For potential nanotechnology applications, we have synthesized double stranded DNA catenanes by click ligation. Other researchers have studied covalently fixed multistranded DNA constructs including triplexes and quadruplexes.

Comparison of DNA Microarray, Loop-Mediated Isothermal Amplification (LAMP) and Real-Time PCR with DNA Sequencing for Identification of Fusarium spp. Obtained from Patients with Hematologic Malignancies.

PubMed

de Souza, Marcela; Matsuzawa, Tetsuhiro; Sakai, Kanae; Muraosa, Yasunori; Lyra, Luzia; Busso-Lopes, Ariane Fidelis; Levin, Anna Sara Shafferman; Schreiber, Angélica Zaninelli; Mikami, Yuzuru; Gonoi, Tohoru; Kamei, Katsuhiko; Moretti, Maria Luiza; Trabasso, Plínio

2017-08-01

The performance of three molecular biology techniques, i.e., DNA microarray, loop-mediated isothermal amplification (LAMP), and real-time PCR were compared with DNA sequencing for properly identification of 20 isolates of Fusarium spp. obtained from blood stream as etiologic agent of invasive infections in patients with hematologic malignancies. DNA microarray, LAMP and real-time PCR identified 16 (80%) out of 20 samples as Fusarium solani species complex (FSSC) and four (20%) as Fusarium spp. The agreement among the techniques was 100%. LAMP exhibited 100% specificity, while DNA microarray, LAMP and real-time PCR showed 100% sensitivity. The three techniques had 100% agreement with DNA sequencing. Sixteen isolates were identified as FSSC by sequencing, being five Fusarium keratoplasticum, nine Fusarium petroliphilum and two Fusarium solani. On the other hand, sequencing identified four isolates as Fusarium non-solani species complex (FNSSC), being three isolates as Fusarium napiforme and one isolate as Fusarium oxysporum. Finally, LAMP proved to be faster and more accessible than DNA microarray and real-time PCR, since it does not require a thermocycler. Therefore, LAMP signalizes as emerging and promising methodology to be used in routine identification of Fusarium spp. among cases of invasive fungal infections.

DNA mismatch repair and oligonucleotide end-protection promote base-pair substitution distal from a CRISPR/Cas9-induced DNA break

PubMed Central

Harmsen, Tim; Klaasen, Sjoerd; van de Vrugt, Henri; te Riele, Hein

2018-01-01

Abstract Single-stranded oligodeoxyribonucleotide (ssODN)-mediated repair of CRISPR/Cas9-induced DNA double-strand breaks (DSB) can effectively be used to introduce small genomic alterations in a defined locus. Here, we reveal DNA mismatch repair (MMR) activity is crucial for efficient nucleotide substitution distal from the Cas9-induced DNA break when the substitution is instructed by the 3′ half of the ssODN. Furthermore, protecting the ssODN 3′ end with phosphorothioate linkages enhances MMR-dependent gene editing events. Our findings can be exploited to optimize efficiencies of nucleotide substitutions distal from the DSB and imply that oligonucleotide-mediated gene editing is effectuated by templated break repair. PMID:29447381

Response of Desulfovibrio vulgaris to Alkaline Stress▿ †

PubMed Central

Stolyar, Sergey; He, Qiang; Joachimiak, Marcin P.; He, Zhili; Yang, Zamin Koo; Borglin, Sharon E.; Joyner, Dominique C.; Huang, Katherine; Alm, Eric; Hazen, Terry C.; Zhou, Jizhong; Wall, Judy D.; Arkin, Adam P.; Stahl, David A.

2007-01-01

The response of exponentially growing Desulfovibrio vulgaris Hildenborough to pH 10 stress was studied using oligonucleotide microarrays and a study set of mutants with genes suggested by microarray data to be involved in the alkaline stress response deleted. The data showed that the response of D. vulgaris to increased pH is generally similar to that of Escherichia coli but is apparently controlled by unique regulatory circuits since the alternative sigma factors (sigma S and sigma E) contributing to this stress response in E. coli appear to be absent in D. vulgaris. Genes previously reported to be up-regulated in E. coli were up-regulated in D. vulgaris; these genes included three ATPase genes and a tryptophan synthase gene. Transcription of chaperone and protease genes (encoding ATP-dependent Clp and La proteases and DnaK) was also elevated in D. vulgaris. As in E. coli, genes involved in flagellum synthesis were down-regulated. The transcriptional data also identified regulators, distinct from sigma S and sigma E, that are likely part of a D. vulgaris Hildenborough-specific stress response system. Characterization of a study set of mutants with genes implicated in alkaline stress response deleted confirmed that there was protective involvement of the sodium/proton antiporter NhaC-2, tryptophanase A, and two putative regulators/histidine kinases (DVU0331 and DVU2580). PMID:17921288

Application of an oligonucleotide microarray-based nano-amplification technique for the detection of fungal pathogens.

PubMed

Lu, Weiping; Gu, Dayong; Chen, Xingyun; Xiong, Renping; Liu, Ping; Yang, Nan; Zhou, Yuanguo

2010-10-01

The traditional techniques for diagnosis of invasive fungal infections in the clinical microbiology laboratory need improvement. These techniques are prone to delay results due to their time-consuming process, or result in misidentification of the fungus due to low sensitivity or low specificity. The aim of this study was to develop a method for the rapid detection and identification of fungal pathogens. The internal transcribed spacer two fragments of fungal ribosomal DNA were amplified using a polymerase chain reaction for all samples. Next, the products were hybridized with the probes immobilized on the surface of a microarray. These species-specific probes were designed to detect nine different clinical pathogenic fungi including Candida albicans, Candida tropocalis, Candida glabrata, Candida parapsilosis, Candida krusei, Candida lusitaniae, Candida guilliermondii, Candida keyfr, and Cryptococcus neoformans. The hybridizing signals were enhanced with gold nanoparticles and silver deposition, and detected using a flatbed scanner or visually. Fifty-nine strains of fungal pathogens, including standard and clinically isolated strains, were correctly identified by this method. The sensitivity of the assay for Candida albicans was 10 cells/mL. Ten cultures from clinical specimens and 12 clinical samples spiked with fungi were also identified correctly. This technique offers a reliable alternative to conventional methods for the detection and identification of fungal pathogens. It has higher efficiency, specificity and sensitivity compared with other methods commonly used in the clinical laboratory.

DNA purification by triplex-affinity capture and affinity capture electrophoresis

DOEpatents

Cantor, Charles R.; Ito, Takashi; Smith, Cassandra L.

1996-01-01

The invention provides a method for purifying or isolating double stranded DNA intact using triple helix formation. The method includes the steps of complexing an oligonucleotide and double stranded DNA to generate a triple helix and immobilization of the triple helix on a solid phase by means of a molecular recognition system such as avidin/biotin. The purified DNA is then recovered intact by treating the solid phase with a reagent that breaks the bonds between the oligonucleotide and the intact double stranded DNA while not affecting the Watson-Crick base pairs of the double helix. The present invention also provides a method for purifying or isolating double stranded DNA intact by complexing the double stranded DNA with a specific binding partner and recovering the complex during electrophoresis by immobilizing it on a solid phase trap imbedded in an electrophoretic gel.

Direct inhibition of excision/synthesis DNA repair activities by cadmium: analysis on dedicated biochips.

PubMed

Candéias, S; Pons, B; Viau, M; Caillat, S; Sauvaigo, S

2010-12-10

The well established toxicity of cadmium and cadmium compounds results from their additive effects on several key cellular processes, including DNA repair. Mammalian cells have evolved several biochemical pathways to repair DNA lesions and maintain genomic integrity. By interfering with the homeostasis of redox metals and antioxidant systems, cadmium promotes the development of an intracellular environment that results in oxidative DNA damage which can be mutagenic if unrepaired. Small base lesions are recognised by specialized glycosylases and excised from the DNA molecule. The resulting abasic sites are incised, and the correct sequences restored by DNA polymerases using the opposite strands as template. Bulky lesions are recognised by a different set of proteins and excised from DNA as part of an oligonucleotide. As in base repair, the resulting gaps are filled by DNA polymerases using the opposite strands as template. Thus, these two repair pathways consist in excision of the lesion followed by DNA synthesis. In this study, we analysed in vitro the direct effects of cadmium exposure on the functionality of base and nucleotide DNA repair pathways. To this end, we used recently described dedicated microarrays that allow the parallel monitoring in cell extracts of the repair activities directed against several model base and/or nucleotide lesions. Both base and nucleotide excision/repair pathways are inhibited by CdCl₂, with different sensitivities. The inhibitory effects of cadmium affect mainly the recognition and excision stages of these processes. Furthermore, our data indicate that the repair activities directed against different damaged bases also exhibit distinct sensitivities, and the direct comparison of cadmium effects on the excision of uracile in different sequences even allows us to propose a hierarchy of cadmium sensibility within the glycosylases removing U from DNA. These results indicate that, in our experimental conditions, cadmium is a very potent DNA repair poison. Copyright © 2010 Elsevier B.V. All rights reserved.

Genome-wide transcriptional analysis of flagellar regeneration in Chlamydomonas reinhardtii identifies orthologs of ciliary disease genes

NASA Technical Reports Server (NTRS)

Stolc, Viktor; Samanta, Manoj Pratim; Tongprasit, Waraporn; Marshall, Wallace F.

2005-01-01

The important role that cilia and flagella play in human disease creates an urgent need to identify genes involved in ciliary assembly and function. The strong and specific induction of flagellar-coding genes during flagellar regeneration in Chlamydomonas reinhardtii suggests that transcriptional profiling of such cells would reveal new flagella-related genes. We have conducted a genome-wide analysis of RNA transcript levels during flagellar regeneration in Chlamydomonas by using maskless photolithography method-produced DNA oligonucleotide microarrays with unique probe sequences for all exons of the 19,803 predicted genes. This analysis represents previously uncharacterized whole-genome transcriptional activity profiling study in this important model organism. Analysis of strongly induced genes reveals a large set of known flagellar components and also identifies a number of important disease-related proteins as being involved with cilia and flagella, including the zebrafish polycystic kidney genes Qilin, Reptin, and Pontin, as well as the testis-expressed tubby-like protein TULP2.

Experimental annotation of the human genome using microarray technology.

PubMed

Shoemaker, D D; Schadt, E E; Armour, C D; He, Y D; Garrett-Engele, P; McDonagh, P D; Loerch, P M; Leonardson, A; Lum, P Y; Cavet, G; Wu, L F; Altschuler, S J; Edwards, S; King, J; Tsang, J S; Schimmack, G; Schelter, J M; Koch, J; Ziman, M; Marton, M J; Li, B; Cundiff, P; Ward, T; Castle, J; Krolewski, M; Meyer, M R; Mao, M; Burchard, J; Kidd, M J; Dai, H; Phillips, J W; Linsley, P S; Stoughton, R; Scherer, S; Boguski, M S

2001-02-15

The most important product of the sequencing of a genome is a complete, accurate catalogue of genes and their products, primarily messenger RNA transcripts and their cognate proteins. Such a catalogue cannot be constructed by computational annotation alone; it requires experimental validation on a genome scale. Using 'exon' and 'tiling' arrays fabricated by ink-jet oligonucleotide synthesis, we devised an experimental approach to validate and refine computational gene predictions and define full-length transcripts on the basis of co-regulated expression of their exons. These methods can provide more accurate gene numbers and allow the detection of mRNA splice variants and identification of the tissue- and disease-specific conditions under which genes are expressed. We apply our technique to chromosome 22q under 69 experimental condition pairs, and to the entire human genome under two experimental conditions. We discuss implications for more comprehensive, consistent and reliable genome annotation, more efficient, full-length complementary DNA cloning strategies and application to complex diseases.

Protein detection using biobarcodes.

PubMed

Müller, Uwe R

2006-10-01

Over the past 50 years the development of assays for the detection of protein analytes has been driven by continuing demands for higher levels of sensitivity and multiplexing. The result has been a progression of sandwich-type immunoassays, starting with simple radioisotopic, colorimetric, or fluorescent labeling systems to include various enzymatic or nanostructure-based signal amplification schemes, with a concomitant sensitivity increase of over 1 million fold. Multiplexing of samples and tests has been enabled by microplate and microarray platforms, respectively, or lately by various molecular barcoding systems. Two different platforms have emerged as the current front-runners by combining a nucleic acid amplification step with the standard two-sided immunoassay. In both, the captured protein analyte is replaced by a multiplicity of oligonucleotides that serve as surrogate targets. One of these platforms employs DNA or RNA polymerases for the amplification step, while detection is by fluorescence. The other is based on gold nanoparticles for both amplification as well as detection. The latter technology, now termed Biobarcode, is completely enzyme-free and offers potentially much higher multiplexing power.

Genome Expression Pathway Analysis Tool – Analysis and visualization of microarray gene expression data under genomic, proteomic and metabolic context

PubMed Central

Weniger, Markus; Engelmann, Julia C; Schultz, Jörg

2007-01-01

Background Regulation of gene expression is relevant to many areas of biology and medicine, in the study of treatments, diseases, and developmental stages. Microarrays can be used to measure the expression level of thousands of mRNAs at the same time, allowing insight into or comparison of different cellular conditions. The data derived out of microarray experiments is highly dimensional and often noisy, and interpretation of the results can get intricate. Although programs for the statistical analysis of microarray data exist, most of them lack an integration of analysis results and biological interpretation. Results We have developed GEPAT, Genome Expression Pathway Analysis Tool, offering an analysis of gene expression data under genomic, proteomic and metabolic context. We provide an integration of statistical methods for data import and data analysis together with a biological interpretation for subsets of probes or single probes on the chip. GEPAT imports various types of oligonucleotide and cDNA array data formats. Different normalization methods can be applied to the data, afterwards data annotation is performed. After import, GEPAT offers various statistical data analysis methods, as hierarchical, k-means and PCA clustering, a linear model based t-test or chromosomal profile comparison. The results of the analysis can be interpreted by enrichment of biological terms, pathway analysis or interaction networks. Different biological databases are included, to give various information for each probe on the chip. GEPAT offers no linear work flow, but allows the usage of any subset of probes and samples as a start for a new data analysis. GEPAT relies on established data analysis packages, offers a modular approach for an easy extension, and can be run on a computer grid to allow a large number of users. It is freely available under the LGPL open source license for academic and commercial users at . Conclusion GEPAT is a modular, scalable and professional-grade software integrating analysis and interpretation of microarray gene expression data. An installation available for academic users can be found at . PMID:17543125

Label-free detection of DNA hybridization using carbon nanotube network field-effect transistors

NASA Astrophysics Data System (ADS)

Star, Alexander; Tu, Eugene; Niemann, Joseph; Gabriel, Jean-Christophe P.; Joiner, C. Steve; Valcke, Christian

2006-01-01

We report carbon nanotube network field-effect transistors (NTNFETs) that function as selective detectors of DNA immobilization and hybridization. NTNFETs with immobilized synthetic oligonucleotides have been shown to specifically recognize target DNA sequences, including H63D single-nucleotide polymorphism (SNP) discrimination in the HFE gene, responsible for hereditary hemochromatosis. The electronic responses of NTNFETs upon single-stranded DNA immobilization and subsequent DNA hybridization events were confirmed by using fluorescence-labeled oligonucleotides and then were further explored for label-free DNA detection at picomolar to micromolar concentrations. We have also observed a strong effect of DNA counterions on the electronic response, thus suggesting a charge-based mechanism of DNA detection using NTNFET devices. Implementation of label-free electronic detection assays using NTNFETs constitutes an important step toward low-cost, low-complexity, highly sensitive and accurate molecular diagnostics. hemochromatosis | SNP | biosensor

Data-adaptive test statistics for microarray data.

PubMed

Mukherjee, Sach; Roberts, Stephen J; van der Laan, Mark J

2005-09-01

An important task in microarray data analysis is the selection of genes that are differentially expressed between different tissue samples, such as healthy and diseased. However, microarray data contain an enormous number of dimensions (genes) and very few samples (arrays), a mismatch which poses fundamental statistical problems for the selection process that have defied easy resolution. In this paper, we present a novel approach to the selection of differentially expressed genes in which test statistics are learned from data using a simple notion of reproducibility in selection results as the learning criterion. Reproducibility, as we define it, can be computed without any knowledge of the 'ground-truth', but takes advantage of certain properties of microarray data to provide an asymptotically valid guide to expected loss under the true data-generating distribution. We are therefore able to indirectly minimize expected loss, and obtain results substantially more robust than conventional methods. We apply our method to simulated and oligonucleotide array data. By request to the corresponding author.

Base-Pairing Systems Related to TNA: alpha-Threofuranosyl Oligonucleotides Containing Phosphoramidate Linkages

NASA Technical Reports Server (NTRS)

Meyer, Michael (Technical Monitor); Wu, Xiaolin; Guntha, Sreenivasulu; Ferenclc, Mathias; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

2002-01-01

(3'NH)- and (2'NH)-TNA, two isomeric phosphoramidate analogues of TNA (alpha-threofuranosyl-(3'-2') oligonucleotides), are shown to be efficient Watson-Crick base-pairing systems and to undergo intersystem crosspairing with TNA, RNA, and DNA.

Detection of Porphyromonas endodontalis, Porphyromonas gingivalis and Prevotella intermedia in primary endodontic infections in a Chinese population.

PubMed

Cao, H; Qi, Z; Jiang, H; Zhao, J; Liu, Z; Tang, Z

2012-08-01

To assess the prevalence of three black-pigmented bacterial species (Porphyromonas endodontalis, Porphyromonas gingivalis and Prevotella intermedia) using microarray technology in root canals of teeth associated with primary endodontic infections in a Chinese population. Microbial samples were taken from root canals of 80 teeth with pulp necrosis and primary endodontic infections in a Chinese population. DNA extracted from the samples was amplified by PCR with universal bacterial primers based on 16S rRNA gene sequences, and the products hybridized with the microarrays in which the specific oligonucleotide probes were added. The results of hybridization were screened by a confocal laser scanner. Pearson chi-square test and the two-sided Fisher exact test were used to analyse whether a significant association existed between the species and symptoms as well as in co-existence of two target organisms by a statistical software package (SAS 8.02). The 16S rRNA gene microarray detected at least one of the three test species in 76% of the study teeth. P. endodontalis, P. gingivalis and P. intermedia were found in 50%, 33% and 45%, respectively. A significant association was found in the presence of the pair P. endodontalis / P. gingivalis (P < 0.005). Both P. endodontalis (P <0.05) and P. gingivalis (P <0.005) had a statistically significant association with the presence of a sinus tract. The simultaneous presence of P. endodontalis and P. gingivalis was also associated with the presence of a sinus tract (P<0.005) and abscess formation (P<0.05). The three black-pigmented bacteria were prevalent in teeth with pulp necrosis and primary endodontic infections in a Chinese population. P. gingivalis and P. endodontalis were associated with the presence of sinus tract and abscess formation. © 2012 International Endodontic Journal.

Altered gene expression in the brain and ovaries of zebrafish (Danio rerio) exposed to the aromatase inhibitor fadrozole: microarray analysis and hypothesis generation.

PubMed

Villeneuve, L; Wang, Rong-Lin; Bencic, David C; Biales, Adam D; Martinović, Dalma; Lazorchak, James M; Toth, Gregory; Ankley, Gerald T

2009-08-01

As part of a research effort examining system-wide responses of the hypothalamic-pituitary-gonadal (HPG) axis in fish to endocrine-active chemicals (EACs) with different modes of action, zebrafish (Danio rerio) were exposed to 25 or 100 microg/L of the aromatase inhibitor fadrozole for 24, 48, or 96 h. Global transcriptional response in brain and ovarian tissue of fish exposed to 25 microg/L of fadrozole was compared to that in control fish using a commercially available, 22,000-gene oligonucleotide microarray. Transcripts altered in brain were functionally linked to differentiation, development, DNA replication, and cell cycle. Additionally, multiple genes associated with the one-carbon pool by folate pathway (KEGG 00670) were significantly up-regulated. Transcripts altered in ovary were functionally linked to cell-cell adhesion, extracellular matrix, vasculogenesis, and development. Promoter motif analysis identified GATA-binding factor 2, Ikaros 2, alcohol dehydrogenase gene regulator 1, myoblast-determining factor, and several heat shock factors as being associated with coexpressed gene clusters that were differentially expressed following exposure to fadrozole. Based on the transcriptional changes observed, it was hypothesized that fadrozole elicits neurodegenerative stress in brain tissue and that fish cope with this stress through proliferation of radial glial cells. Additionally, it was hypothesized that changes of gene expression in the ovary of fadrozole-exposed zebrafish reflect disruption of oocyte maturation and ovulation because of impaired vitellogenesis. These hypotheses and others derived from the microarray results provide a foundation for future studies aimed at understanding responses of the HPG axis to EACs and other chemical stressors.

Triple helix purification and sequencing

DOEpatents

Wang, Renfeng; Smith, Lloyd M.; Tong, Xinchun E.

1995-01-01

Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis.

Triazole-linked DNA as a primer surrogate in the synthesis of first-strand cDNA.

PubMed

Fujino, Tomoko; Yasumoto, Ken-ichi; Yamazaki, Naomi; Hasome, Ai; Sogawa, Kazuhiro; Isobe, Hiroyuki

2011-11-04

A phosphate-eliminated nonnatural oligonucleotide serves as a primer surrogate in reverse transcription reaction of mRNA. Despite of the nonnatural triazole linkages in the surrogate, the reverse transcriptase effectively elongated cDNA sequences on the 3'-downstream of the primer by transcription of the complementary sequence of mRNA. A structure-activity comparison with the reference natural oligonucleotides shows the superior priming activity of the surrogate containing triazole-linkages. The nonnatural linkages also protect the transcribed cDNA from digestion reactions with 5'-exonuclease and enable us to remove noise transcripts of unknown origins. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Triple helix purification and sequencing

DOEpatents

Wang, R.; Smith, L.M.; Tong, X.E.

1995-03-28

Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis. 4 figures.

Precise and selective sensing of DNA-DNA hybridization by graphene/Si-nanowires diode-type biosensors.

PubMed

Kim, Jungkil; Park, Shin-Young; Kim, Sung; Lee, Dae Hun; Kim, Ju Hwan; Kim, Jong Min; Kang, Hee; Han, Joong-Soo; Park, Jun Woo; Lee, Hosun; Choi, Suk-Ho

2016-08-18

Single-Si-nanowire (NW)-based DNA sensors have been recently developed, but their sensitivity is very limited because of high noise signals, originating from small source-drain current of the single Si NW. Here, we demonstrate that chemical-vapor-deposition-grown large-scale graphene/surface-modified vertical-Si-NW-arrays junctions can be utilized as diode-type biosensors for highly-sensitive and -selective detection of specific oligonucleotides. For this, a twenty-seven-base-long synthetic oligonucleotide, which is a fragment of human DENND2D promoter sequence, is first decorated as a probe on the surface of vertical Si-NW arrays, and then the complementary oligonucleotide is hybridized to the probe. This hybridization gives rise to a doping effect on the surface of Si NWs, resulting in the increase of the current in the biosensor. The current of the biosensor increases from 19 to 120% as the concentration of the target DNA varies from 0.1 to 500 nM. In contrast, such biosensing does not come into play by the use of the oligonucleotide with incompatible or mismatched sequences. Similar results are observed from photoluminescence microscopic images and spectra. The biosensors show very-uniform current changes with standard deviations ranging ~1 to ~10% by ten-times endurance tests. These results are very promising for their applications in accurate, selective, and stable biosensing.

Flow-pattern Guided Fabrication of High-density Barcode Antibody Microarray

PubMed Central

Ramirez, Lisa S.; Wang, Jun

2016-01-01

Antibody microarray as a well-developed technology is currently challenged by a few other established or emerging high-throughput technologies. In this report, we renovate the antibody microarray technology by using a novel approach for manufacturing and by introducing new features. The fabrication of our high-density antibody microarray is accomplished through perpendicularly oriented flow-patterning of single stranded DNAs and subsequent conversion mediated by DNA-antibody conjugates. This protocol outlines the critical steps in flow-patterning DNA, producing and purifying DNA-antibody conjugates, and assessing the quality of the fabricated microarray. The uniformity and sensitivity are comparable with conventional microarrays, while our microarray fabrication does not require the assistance of an array printer and can be performed in most research laboratories. The other major advantage is that the size of our microarray units is 10 times smaller than that of printed arrays, offering the unique capability of analyzing functional proteins from single cells when interfacing with generic microchip designs. This barcode technology can be widely employed in biomarker detection, cell signaling studies, tissue engineering, and a variety of clinical applications. PMID:26780370

Comparing Charge Transport in Oligonucleotides: RNA:DNA Hybrids and DNA Duplexes.

PubMed

Li, Yuanhui; Artés, Juan M; Qi, Jianqing; Morelan, Ian A; Feldstein, Paul; Anantram, M P; Hihath, Joshua

2016-05-19

Understanding the electronic properties of oligonucleotide systems is important for applications in nanotechnology, biology, and sensing systems. Here the charge-transport properties of guanine-rich RNA:DNA hybrids are compared to double-stranded DNA (dsDNA) duplexes with identical sequences. The conductance of the RNA:DNA hybrids is ∼10 times higher than the equivalent dsDNA, and conformational differences are determined to be the primary reason for this difference. The conductance of the RNA:DNA hybrids is also found to decrease more rapidly than dsDNA when the length is increased. Ab initio electronic structure and Green's function-based density of states calculations demonstrate that these differences arise because the energy levels are more spatially distributed in the RNA:DNA hybrid but that the number of accessible hopping sites is smaller. These combination results indicate that a simple hopping model that treats each individual guanine as a hopping site is insufficient to explain both a higher conductance and β value for RNA:DNA hybrids, and larger delocalization lengths must be considered.

Selective Inhibition of the Human tie-1 Promoter with Triplex-Forming Oligonucleotides Targeted to Ets Binding Sites

PubMed Central

Hewett, Peter W; Daft, Emma L; Laughton, Charles A; Ahmad, Shakil; Ahmed, Asif; Murray, J Clifford

2006-01-01

The Tie receptors (Tie-1 and Tie-2/Tek) are essential for angiogenesis and vascular remodeling/integrity. Tie receptors are up-regulated in tumor-associated endothelium, and their inhibition disrupts angiogenesis and can prevent tumor growth as a consequence. To investigate the potential of anti-gene approaches to inhibit tie gene expression for anti-angiogenic therapy, we have examined triple-helical (triplex) DNA formation at 2 tandem Ets transcription factor binding motifs (designated E-1 and E-2) in the human tie-1 promoter. Various tie-1 promoter deletion/mutation luciferase reporter constructs were generated and transfected into endothelial cells to examine the relative activities of E-1 and E-2. The binding of antiparallel and parallel (control) purine motif oligonucleotides (21–22 bp) targeted to E-1 and E-2 was assessed by plasmid DNA fragment binding and electrophoretic mobility shift assays. Triplex-forming oligonucleotides were incubated with tie-1 reporter constructs and transfected into endothelial cells to determine their activity. The Ets binding motifs in the E-1 sequence were essential for human tie-1 promoter activity in endothelial cells, whereas the deletion of E-2 had no effect. Antiparallel purine motif oligonucleotides targeted at E-1 or E-2 selectively formed strong triplex DNA (Kd ~10−7 M) at 37 °C. Transfection of tie-1 reporter constructs with triplex DNA at E-1, but not E-2, specifically inhibited tie-1 promoter activity by up to 75% compared with control oligonucleotides in endothelial cells. As similar multiple Ets binding sites are important for the regulation of several endothelial-restricted genes, this approach may have broad therapeutic potential for cancer and other pathologies involving endothelial proliferation/dysfunction. PMID:16838069

Selective inhibition of the human tie-1 promoter with triplex-forming oligonucleotides targeted to Ets binding sites.

PubMed

Hewett, Peter W; Daft, Emma L; Laughton, Charles A; Ahmad, Shakil; Ahmed, Asif; Murray, J Clifford

2006-01-01

The Tie receptors (Tie-1 and Tie-2/Tek) are essential for angiogenesis and vascular remodeling/integrity. Tie receptors are up-regulated in tumor-associated endothelium, and their inhibition disrupts angiogenesis and can prevent tumor growth as a consequence. To investigate the potential of anti-gene approaches to inhibit tie gene expression for anti-angiogenic therapy, we have examined triple-helical (triplex) DNA formation at 2 tandem Ets transcription factor binding motifs (designated E-1 and E-2) in the human tie-1 promoter. Various tie-1 promoter deletion/mutation luciferase reporter constructs were generated and transfected into endothelial cells to examine the relative activities of E-1 and E-2. The binding of antiparallel and parallel (control) purine motif oligonucleotides (21-22 bp) targeted to E-1 and E-2 was assessed by plasmid DNA fragment binding and electrophoretic mobility shift assays. Triplex-forming oligonucleotides were incubated with tie-1 reporter constructs and transfected into endothelial cells to determine their activity. The Ets binding motifs in the E-1 sequence were essential for human tie-1 promoter activity in endothelial cells, whereas the deletion of E-2 had no effect. Antiparallel purine motif oligonucleotides targeted at E-1 or E-2 selectively formed strong triplex DNA (K(d) approximately 10(-7) M) at 37 degrees C. Transfection of tie-1 reporter constructs with triplex DNA at E-1, but not E-2, specifically inhibited tie-1 promoter activity by up to 75% compared with control oligonucleotides in endothelial cells. As similar multiple Ets binding sites are important for the regulation of several endothelial-restricted genes, this approach may have broad therapeutic potential for cancer and other pathologies involving endothelial proliferation/dysfunction.

DNA Microarray Technology

MedlinePlus

Skip to main content DNA Microarray Technology Enter Search Term(s): Español Research Funding An Overview Bioinformatics Current Grants Education and Training Funding Extramural Research News Features Funding Divisions Funding ...

Oligonucleotide labeling methods. 3. Direct labeling of oligonucleotides employing a novel, non-nucleosidic, 2-aminobutyl-1,3-propanediol backbone.

PubMed Central

Nelson, P S; Kent, M; Muthini, S

1992-01-01

Novel CE-phosphoramidite (7a-e) and CPG (8a, c, d, e) reagents have been prepared from a unique 2-aminobutyl-1,3-propanediol backbone. The reagents have been used to directly label oligonucleotides with fluorescein, acridine, and biotin via automated DNA synthesis. The versatile 2-aminobutyl-1,3-propanediol backbone allows for labeling at any position (5', internal, and 3') during solid phase oligonucleotide synthesis. Multiple labels can be achieved by repetitive coupling cycles. Furthermore, the 3-carbon atom internucleotide phosphate distance is retained when inserted internally. Using this method, individual oligonucleotides possessing two and three different reporter molecules have been prepared. PMID:1475185

A method for high-throughput production of sequence-verified DNA libraries and strain collections.

PubMed

Smith, Justin D; Schlecht, Ulrich; Xu, Weihong; Suresh, Sundari; Horecka, Joe; Proctor, Michael J; Aiyar, Raeka S; Bennett, Richard A O; Chu, Angela; Li, Yong Fuga; Roy, Kevin; Davis, Ronald W; Steinmetz, Lars M; Hyman, Richard W; Levy, Sasha F; St Onge, Robert P

2017-02-13

The low costs of array-synthesized oligonucleotide libraries are empowering rapid advances in quantitative and synthetic biology. However, high synthesis error rates, uneven representation, and lack of access to individual oligonucleotides limit the true potential of these libraries. We have developed a cost-effective method called Recombinase Directed Indexing (REDI), which involves integration of a complex library into yeast, site-specific recombination to index library DNA, and next-generation sequencing to identify desired clones. We used REDI to generate a library of ~3,300 DNA probes that exhibited > 96% purity and remarkable uniformity (> 95% of probes within twofold of the median abundance). Additionally, we created a collection of ~9,000 individually accessible CRISPR interference yeast strains for > 99% of genes required for either fermentative or respiratory growth, demonstrating the utility of REDI for rapid and cost-effective creation of strain collections from oligonucleotide pools. Our approach is adaptable to any complex DNA library, and fundamentally changes how these libraries can be parsed, maintained, propagated, and characterized. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

Silver-dendrimer nanocomposites as oligonucleotide labels for electrochemical stripping detection of DNA hybridization.

PubMed

Jin, Xin; Zhou, Ling; Zhu, Bo; Jiang, Xue; Zhu, Ningning

2018-06-01

Silver-dendrimer nanocomposites were synthesized and used as oligonucleotide labels for electrochemical stripping detection of DNA hybridization. The synthesized silver-dendrimer nanocomposites were characterized by UV-vis spectrophotometry, X-ray photoelectron spectroscopy (XPS) and transmission electron microscopy (TEM). Ratios of silver/dendrimer were optimized in order to obtain stable nanocomposites with maximal silver loading in the interior of a polymeric shell. The silver-dendrimer nanocomposites were attached to sequence-known DNA probes specific to colitoxin, and used to detect probe hybridization by dissolution of the silver nanoparticles in the interior of dendrimer in a diluted nitric acid, followed by measurement of Ag + ions by anodic stripping voltammetry (ASV). Use of differential pulse voltammetry for the stripping step, along with optimization of the ASV conditions, enabled a detection limit of 0.78 pM. The present strategy, in combination with dendrimer-encapsulated copper labeled oligonucleotides probe reported previously, could potentially be used to detect single or multiple DNA targets in one sample. Copyright © 2018 Elsevier B.V. All rights reserved.

5-Fluoro pyrimidines: labels to probe DNA and RNA secondary structures by 1D 19F NMR spectroscopy

PubMed Central

Puffer, Barbara; Kreutz, Christoph; Rieder, Ulrike; Ebert, Marc-Olivier; Konrat, Robert; Micura, Ronald

2009-01-01

19F NMR spectroscopy has proved to be a valuable tool to monitor functionally important conformational transitions of nucleic acids. Here, we present a systematic investigation on the application of 5-fluoro pyrimidines to probe DNA and RNA secondary structures. Oligonucleotides with the propensity to adapt secondary structure equilibria were chosen as model systems and analyzed by 1D 19F and 1H NMR spectroscopy. A comparison with the unmodified analogs revealed that the equilibrium characteristics of the bistable DNA and RNA oligonucleotides were hardly affected upon fluorine substitution at C5 of pyrimidines. This observation was in accordance with UV spectroscopic melting experiments which demonstrated that single 5-fluoro substitutions in double helices lead to comparable thermodynamic stabilities. Thus, 5-fluoro pyrimidine labeling of DNA and RNA can be reliably applied for NMR based nucleic acid secondary structure evaluation. Furthermore, we developed a facile synthetic route towards 5-fluoro cytidine phosphoramidites that enables their convenient site-specific incorporation into oligonucleotides by solid-phase synthesis. PMID:19843610

5-Fluoro pyrimidines: labels to probe DNA and RNA secondary structures by 1D 19F NMR spectroscopy.

PubMed

Puffer, Barbara; Kreutz, Christoph; Rieder, Ulrike; Ebert, Marc-Olivier; Konrat, Robert; Micura, Ronald

2009-12-01

(19)F NMR spectroscopy has proved to be a valuable tool to monitor functionally important conformational transitions of nucleic acids. Here, we present a systematic investigation on the application of 5-fluoro pyrimidines to probe DNA and RNA secondary structures. Oligonucleotides with the propensity to adapt secondary structure equilibria were chosen as model systems and analyzed by 1D (19)F and (1)H NMR spectroscopy. A comparison with the unmodified analogs revealed that the equilibrium characteristics of the bistable DNA and RNA oligonucleotides were hardly affected upon fluorine substitution at C5 of pyrimidines. This observation was in accordance with UV spectroscopic melting experiments which demonstrated that single 5-fluoro substitutions in double helices lead to comparable thermodynamic stabilities. Thus, 5-fluoro pyrimidine labeling of DNA and RNA can be reliably applied for NMR based nucleic acid secondary structure evaluation. Furthermore, we developed a facile synthetic route towards 5-fluoro cytidine phosphoramidites that enables their convenient site-specific incorporation into oligonucleotides by solid-phase synthesis.

Assessment of data processing to improve reliability of microarray experiments using genomic DNA reference.

PubMed

Yang, Yunfeng; Zhu, Mengxia; Wu, Liyou; Zhou, Jizhong

2008-09-16

Using genomic DNA as common reference in microarray experiments has recently been tested by different laboratories. Conflicting results have been reported with regard to the reliability of microarray results using this method. To explain it, we hypothesize that data processing is a critical element that impacts the data quality. Microarray experiments were performed in a gamma-proteobacterium Shewanella oneidensis. Pair-wise comparison of three experimental conditions was obtained either with two labeled cDNA samples co-hybridized to the same array, or by employing Shewanella genomic DNA as a standard reference. Various data processing techniques were exploited to reduce the amount of inconsistency between both methods and the results were assessed. We discovered that data quality was significantly improved by imposing the constraint of minimal number of replicates, logarithmic transformation and random error analyses. These findings demonstrate that data processing significantly influences data quality, which provides an explanation for the conflicting evaluation in the literature. This work could serve as a guideline for microarray data analysis using genomic DNA as a standard reference.

Differential Transcriptional Response to Nonassociative and Associative Components of Classical Fear Conditioning in the Amygdala and Hippocampus

ERIC Educational Resources Information Center

Isiegas, Carolina; Stein, Joel; Hellman, Kevin; Hannenhalli, Sridhar; Abel, Ted; Keeley, Michael B.; Wood, Marcelo A.

2006-01-01

Classical fear conditioning requires the recognition of conditioned stimuli (CS) and the association of the CS with an aversive stimulus. We used Affymetrix oligonucleotide microarrays to characterize changes in gene expression compared to naive mice in both the amygdala and the hippocampus 30 min after classical fear conditioning and 30 min after…

Functional link between DNA damage responses and transcriptional regulation by ATM in response to a histone deacetylase inhibitor TSA.

PubMed

Lee, Jong-Soo

2007-09-01

Mutations in the ATM (ataxia-telangiectasia mutated) gene, which encodes a 370 kd protein with a kinase catalytic domain, predisposes people to cancers, and these mutations are also linked to ataxia-telangiectasia (A-T). The histone acetylaion/deacetylation- dependent chromatin remodeling can activate the ATM kinase-mediated DNA damage signal pathway (in an accompanying work, Lee, 2007). This has led us to study whether this modification can impinge on the ATM-mediated DNA damage response via transcriptional modulation in order to understand the function of ATM in the regulation of gene transcription. To identify the genes whose expression is regulated by ATM in response to histone deaceylase (HDAC) inhibition, we performed an analysis of oligonucleotide microarrays with using the appropriate cell lines, isogenic A-T (ATM(-)) and control (ATM(+)) cells, following treatment with a HDAC inhibitor TSA. Treatment with TSA reprograms the differential gene expression profile in response to HDAC inhibition in ATM(-) cells and ATM(+) cells. We analyzed the genes that are regulated by TSA in the ATM-dependent manner, and we classified these genes into different functional categories, including those involved in cell cycle/DNA replication, DNA repair, apoptosis, growth/differentiation, cell- cell adhesion, signal transduction, metabolism and transcription. We found that while some genes are regulated by TSA without regard to ATM, the patterns of gene regulation are differentially regulated in an ATM-dependent manner. Taken together, these finding indicate that ATM can regulate the transcription of genes that play critical roles in the molecular response to DNA damage, and this response is modulated through an altered HDAC inhibition-mediated gene expression.

OY-TES-1 may regulate the malignant behavior of liver cancer via NANOG, CD9, CCND2 and CDCA3: a bioinformatic analysis combine with RNAi and oligonucleotide microarray.

PubMed

Hu, Qiping; Fu, Jun; Luo, Bin; Huang, Miao; Guo, Wenwen; Lin, Yongda; Xie, Xiaoxun; Xiao, Shaowen

2015-04-01

Given its tumor-specific expression, including liver cancer, OY-TES-1 is a potential molecular marker for the diagnosis and immunotherapy of liver cancers. However, investigations of the mechanisms and the role of OY-TES-1 in liver cancer are rare. In the present study, based on a comprehensive bioinformatic analysis combined with RNA interference (RNAi) and oligonucleotide microarray, we report for the first time that downregulation of OY-TES-1 resulted in significant changes in expression of NANOG, CD9, CCND2 and CDCA3 in the liver cancer cell line BEL-7404. NANOG, CD9, CCND2 and CDCA3 may be involved in cell proliferation, migration, invasion and apoptosis, yet also may be functionally related to each other and OY-TES-1. Among these molecules, we identified that NANOG, containing a Kazal-2 binding motif and homeobox, may be the most likely candidate protein interacting with OY-TES-1 in liver cancer. Thus, the present study may provide important information for further investigation of the roles of OY-TES-1 in liver cancer.

DNA Hydrogel with Tunable pH-Responsive Properties Produced by Rolling Circle Amplification.

PubMed

Xu, Wanlin; Huang, Yishun; Zhao, Haoran; Li, Pan; Liu, Guoyuan; Li, Jing; Zhu, Chengshen; Tian, Leilei

2017-12-22

Recently, smart DNA hydrogels, which are generally formed by the self-assembly of oligonucleotides or through the cross-linking of oligonucleotide-polymer hybrids, have attracted tremendous attention. However, the difficulties of fabricating DNA hydrogels limit their practical applications. We report herein a novel method for producing pH-responsive hydrogels by rolling circle amplification (RCA). In this method, pH-sensitive cross-linking sites were introduced into the polymeric DNA chains during DNA synthesis. As the DNA sequence can be precisely defined by its template, the properties of such hydrogels can be finely tuned in a very facile way through template design. We have investigated the process of hydrogel formation and pH-responsiveness to provide rationales for functional hydrogel design based on the RCA reaction. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

DNA purification by triplex-affinity capture and affinity capture electrophoresis

DOEpatents

Cantor, C.R.; Ito, Takashi; Smith, C.L.

1996-01-09

The invention provides a method for purifying or isolating double stranded DNA intact using triple helix formation. The method includes the steps of complexing an oligonucleotide and double stranded DNA to generate a triple helix and immobilization of the triple helix on a solid phase by means of a molecular recognition system such as avidin/biotin. The purified DNA is then recovered intact by treating the solid phase with a reagent that breaks the bonds between the oligonucleotide and the intact double stranded DNA while not affecting the Watson-Crick base pairs of the double helix. The present invention also provides a method for purifying or isolating double stranded DNA intact by complexing the double stranded DNA with a specific binding partner and recovering the complex during electrophoresis by immobilizing it on a solid phase trap imbedded in an electrophoretic gel. 6 figs.

Rat L (long interspersed repeated DNA) elements contain guanine-rich homopurine sequences that induce unpairing of contiguous duplex DNA.

PubMed Central

Usdin, K; Furano, A V

1988-01-01

The L family (long interspersed repeated DNA) of mobile genetic elements is a persistent feature of the mammalian genome. In rats, this family contains approximately equal to 40,000 members and accounts for approximately equal to 10% of the haploid genome. We demonstrate here that the guanine-rich homopurine stretches located at the right end of L-DNA induce oligonucleotide uptake by contiguous duplex DNA. The uptake is dependent on negative supercoiling and the length of the homopurine stretch and occurs even when the L-DNA homopurine stretches are introduced into a different DNA environment. The bound oligomer primes DNA synthesis when DNA polymerase and deoxyribonucleoside triphosphates are added, resulting in a faithful copy of the template to which the oligonucleotide had bound. The implications of this property of the L-DNA guanine-rich homopurine stretches in the amplification, recombination, and dispersal of L elements is discussed. Images PMID:2837766

Aptamer-based electrochemical sensors with aptamer-complementary DNA oligonucleotides as probe.

PubMed

Lu, Ying; Li, Xianchan; Zhang, Limin; Yu, Ping; Su, Lei; Mao, Lanqun

2008-03-15

This study describes a facile and general strategy for the development of aptamer-based electrochemical sensors with a high specificity toward the targets and a ready regeneration feature. Very different from the existing strategies for the development of electrochemical aptasensors with the aptamers as the probes, the strategy proposed here is essentially based on the utilization of the aptamer-complementary DNA (cDNA) oligonucleotides as the probes for electrochemical sensing. In this context, the sequences at both ends of the cDNA are tailor-made to be complementary and both the redox moiety (i.e., ferrocene in this study) and thiol group are labeled onto the cDNA. The labeled cDNA are hybridized with their respective aptamers (i.e., ATP- and thrombin-binding aptamers in this study) to form double-stranded DNA (ds-DNA) and the electrochemical aptasensors are prepared by self-assembling the labeled ds-DNA onto Au electrodes. Upon target binding, the aptamers confined onto electrode surface dissociate from their respective cDNA oligonucleotides into the solution and the single-stranded cDNA could thus tend to form a hairpin structure through the hybridization of the complementary sequences at both its ends. Such a conformational change of the cDNA resulting from the target binding-induced dissociation of the aptamers essentially leads to the change in the voltammetric signal of the redox moiety labeled onto the cDNA and thus constitutes the mechanism for the electrochemical aptasensors for specific target sensing. The aptasensors demonstrated here with the cDNA as the probe are readily regenerated and show good responses toward the targets. This study may offer a new and relatively general approach to electrochemical aptasensors with good analytical properties and potential applications.

A novel activity of HMG domains: promotion of the triple-stranded complex formation between DNA containing (GGA/TCC)11 and d(GGA)11 oligonucleotides.

PubMed Central

Suda, T; Mishima, Y; Takayanagi, K; Asakura, H; Odani, S; Kominami, R

1996-01-01

The high mobility group protein (HMG)-box is a DNA-binding domain found in many proteins that bind preferentially to DNA of irregular structures in a sequence-independent manner and can bend the DNA. We show here that GST-fusion proteins of HMG domains from HMG1 and HMG2 promote a triple-stranded complex formation between DNA containing the (GGA/TCC)11 repeat and oligonucleotides of d(GGA)11 probably due to G:G base pairing. The activity is to reduce association time and requirements of Mg2+ and oligonucleotide concentrations. The HMG box of SRY, the protein determining male-sex differentiation, also has the activity, suggesting that it is not restricted to the HMG-box domains derived from HMG1/2 but is common to those from other members of the HMG-box family of proteins. Interestingly, the box-AB and box-B of HMG1 bend DNA containing the repeat, but SRY fails to bend in a circularization assay. The difference suggests that the two activities of association-promotion and DNA bending are distinct. These results suggest that the HMG-box domain has a novel activity of promoting the association between GGA repeats which might be involved in higher-order architecture of chromatin. PMID:8972860

Use of DNA Microarrays to Identify Diagnostic Signature Transcription Profiles for Host Responses to Infectious Agents

DTIC Science & Technology

2004-10-01

informative in this regard. Key signature genes will serve as the basis for rapid diagnostic approaches that could be accessed when an outbreak is suspected...AD Award Number: DAMD17-01-1-0787 TITLE: Use of DNA Microarrays to Identify Diagnostic Signature Transcription Profiles for Host Responses to...Sep 2004) 4. TITLE AND SUBTITLE 5. FUNDING NUMBERS Use of DNA Microarrays to Identify Diagnostic Signature DAMD17-01-1-0787 Transcription Profiles for

PNA-COMBO-FISH: From combinatorial probe design in silico to vitality compatible, specific labelling of gene targets in cell nuclei.

PubMed

Müller, Patrick; Rößler, Jens; Schwarz-Finsterle, Jutta; Schmitt, Eberhard; Hausmann, Michael

2016-07-01

Recently, advantages concerning targeting specificity of PCR constructed oligonucleotide FISH probes in contrast to established FISH probes, e.g. BAC clones, have been demonstrated. These techniques, however, are still using labelling protocols with DNA denaturing steps applying harsh heat treatment with or without further denaturing chemical agents. COMBO-FISH (COMBinatorial Oligonucleotide FISH) allows the design of specific oligonucleotide probe combinations in silico. Thus, being independent from primer libraries or PCR laboratory conditions, the probe sequences extracted by computer sequence data base search can also be synthesized as single stranded PNA-probes (Peptide Nucleic Acid probes) or TINA-DNA (Twisted Intercalating Nucleic Acids). Gene targets can be specifically labelled with at least about 20 probes obtaining visibly background free specimens. By using appropriately designed triplex forming oligonucleotides, the denaturing procedures can completely be omitted. These results reveal a significant step towards oligonucleotide-FISH maintaining the 3d-nanostructure and even the viability of the cell target. The method is demonstrated with the detection of Her2/neu and GRB7 genes, which are indicators in breast cancer diagnosis and therapy. Copyright © 2016. Published by Elsevier Inc.

Biological and molecular characterization of cellular differentiation in Tetrahymena vorax: a potential biocontrol protozoan.

PubMed

Green, M M; LeBoeuf, R D; Churchill, P F

2000-01-01

Tetrahymena vorax (T. vorax) is an indigenous fresh water protozoan with the natural biological potential to maintain a specific aquatic microbial flora by ingesting and eliminating specific microorganism. To investigate the molecular mechanisms controlling Tetrahymena vorax (T. vorax) cellular differentiation from a small-mouth vegetative cell to a voracious large-mouth carnivore capable of ingesting prey ciliates and bacteria from aquatic environments, we use DNA subtraction and gene discovery techniques to identify and isolate T. vorax differentiation-specific genes. The physiological necessity for one newly discovered gene, SUBII-TG, was determined in vivo using an antisense oligonucleotide directed against the 5' SUBII-TG DNA sequence. The barriers to delivering antisense oligonucleotides to the cytoplasm of T. vorax were circumvented by employing a new but simple procedure of processing the oligonucleotide with the differentiation stimulus, stomatin. In these studies, the antisense oligonucleotide down-regulated SUBII-TG mRNA expression, and blocked differentiation and ingestion of prey ciliates. The ability to down-regulate SUBII-TG expression with the antisense oligonucleotide suggests that the molecular mechanisms controlling the natural biological activities of T. vorax can be manipulated to further study its cellular differentiation and potential as a biocontrol microorganism.

Genome-wide high-resolution screening in Dupuytren's disease reveals common regions of DNA copy number alterations.

PubMed

Shih, Barbara B; Tassabehji, May; Watson, James S; McGrouther, Angus D; Bayat, Ardeshir

2010-07-01

Dupuytren's disease (DD) is a familial disorder with a high genetic susceptibility in white people; however, its etiopathogenesis remains unknown. Previous comparative genomic hybridization studies using lower-resolution, 44-k oligonucleotide-based arrays revealed no copy number variation (CNV) changes in DD. In this study, we used a higher-resolution genome-wide screening (next-generation microarrays) comprising 963,331 human sequences (3 kb spacing between probes) for whole genome DNA variation analysis. The objective was to detect cryptic chromosomal imbalances in DD. Agilent SurePrint G3 microarrays, one million format (Agilent Technologies, Santa Clara, CA), were used to detect CNV regions (CNVRs) in DNA extracted from nodules of 4 white men with DD (age, 69 +/- 4 y). Reference samples were from the DNA of 10 men who served as control patients. Copy number variations that were common to greater than 3 assessed DD individuals (p < .05) were selected as candidate loci for DD etiology. In addition, quantitative polymerase chain reactions (qPCR) assays were designed for selected CNVRs on DNA from 13 DD patients and 11 control patients. Independent t-tests and Fisher's exact tests were carried out for statistical analysis. Three novel CNVs previously unreported in the phenotypically normal population were detected in 3 DD cases, located at 10q22, 16p12.1, and 17p12. Nine polymorphic CNVRs potentially associated with DD were determined using our strategic selection criteria, locating to chromosomes 1q31, 6p21, 7p14, 8p11, 12p13, 14q11, 17q21 and 20p13. More than 3 of the DD cases tested had a CNVR located to a small region on 6p21 and 4 CNVRs within 6p21-22 of the human leukocyte antigen (HLA) genes. Three novel copy number alterations were observed in 3 unrelated patients with sporadic (no known family history) DD. Nine polymorphic CNVRs were found to be common among the DD cases. These variants might contain genes involved in DD formation, indicating that important gene networks expressed within the palmar fascia might contribute to genetic susceptibility of DD. Copyright 2010. Published by Elsevier Inc.

Light-Triggered Release of DNA from Plasmon-Resonant Nanoparticles

NASA Astrophysics Data System (ADS)

Huschka, Ryan

Plasmon-resonant nanoparticle complexes show promising potential for lighttriggered, controllable delivery of deoxyribonucleic acids (DNA) for research and therapeutic purposes. For example, the approach of RNA interference (RNAi) . using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein . is very useful in dissecting genetic function and holds promise as a molecular therapeutic. Herein, we investigate the mechanism and probe the in vitro therapeutic potential of DNA light-triggered release from plasmonic nanoparticles. First, we investigate the mechanism of light-triggered release by dehybridizing double-stranded (dsDNA) via laser illumination from two types of nanoparticle substrates: gold (Au) nanoshells and Au nanorods. Both light-triggered and thermally induced releases are distinctly observable from nanoshell-based complexes. Surprisingly, no analogous measurable light-triggered release was observable from nanorod-based complexes below the DNA melting temperature. These results suggest that a nonthermal mechanism may play a role in light-triggered DNA release. Second, we demonstrate the in vitro light-triggered release of molecules noncovalently attached within dsDNA bound to the Au nanoshell surface. DAPI (4',6- diamidino-2-phenylindole), a bright blue fluorescent molecule that binds reversibly to double-stranded DNA, was chosen to visualize this intracellular light-induced release process. Illumination through the cell membrane of the nanoshell-dsDNA-DAPI complexes dehybridizes the DNA and releases the DAPI molecules within living cells. The DAPI molecules diffuse to the nucleus and associate with the cell's endogenous DNA. This work could have future applications towards drug delivery of molecules that associate with dsDNA. Finally, we demonstrate an engineered Au nanoshell (AuNS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on demand upon illumination with a near-infrared (NIR) laser. A poly(L)lysine peptide (PLL) epilayer coated onto the AuNS surface (AuNS-PLL) is used to capture intact, single-stranded antisense DNA oligonucleotide, or alternatively, double-stranded short-interfering RNA (siRNA) molecules. A green fluorescent protein (GFP)-expressing human lung cancer H1299 cell line was used to determine cellular uptake and GFP gene silencing mediated by AuNS-PLL delivery vector. The light-triggered release of oligonucleotides could have broad applications in the study of cellular processes and in the development of intracellular targeted therapies.

Sequence selective capture, release and analysis of DNA using a magnetic microbead-assisted toehold-mediated DNA strand displacement reaction.

PubMed

Khodakov, Dmitriy A; Khodakova, Anastasia S; Linacre, Adrian; Ellis, Amanda V

2014-07-21

This paper reports on the modification of magnetic beads with oligonucleotide capture probes with a specially designed pendant toehold (overhang) aimed specifically to capture double-stranded PCR products. After capture, the PCR products were selectively released from the magnetic beads by means of a toehold-mediated strand displacement reaction using short artificial oligonucleotide triggers and analysed using capillary electrophoresis. The approach was successfully shown on two genes widely used in human DNA genotyping, namely human c-fms (macrophage colony-stimulating factor) proto-oncogene for the CSF-1 receptor (CSF1PO) and amelogenin.

A high-throughput and quantitative method to assess the mutagenic potential of translesion DNA synthesis

PubMed Central

Taggart, David J.; Camerlengo, Terry L.; Harrison, Jason K.; Sherrer, Shanen M.; Kshetry, Ajay K.; Taylor, John-Stephen; Huang, Kun; Suo, Zucai

2013-01-01

Cellular genomes are constantly damaged by endogenous and exogenous agents that covalently and structurally modify DNA to produce DNA lesions. Although most lesions are mended by various DNA repair pathways in vivo, a significant number of damage sites persist during genomic replication. Our understanding of the mutagenic outcomes derived from these unrepaired DNA lesions has been hindered by the low throughput of existing sequencing methods. Therefore, we have developed a cost-effective high-throughput short oligonucleotide sequencing assay that uses next-generation DNA sequencing technology for the assessment of the mutagenic profiles of translesion DNA synthesis catalyzed by any error-prone DNA polymerase. The vast amount of sequencing data produced were aligned and quantified by using our novel software. As an example, the high-throughput short oligonucleotide sequencing assay was used to analyze the types and frequencies of mutations upstream, downstream and at a site-specifically placed cis–syn thymidine–thymidine dimer generated individually by three lesion-bypass human Y-family DNA polymerases. PMID:23470999

[Preparation of the cDNA microarray on the differential expressed cDNA of senescence-accelerated mouse's hippocampus].

PubMed

Cheng, Xiao-Rui; Zhou, Wen-Xia; Zhang, Yong-Xiang

2006-05-01

Alzheimer' s disease (AD) is the most common form of dementia in the elderly. AD is an invariably fatal neurodegenerative disorder with no effective treatment. Senescence-accelerated mouse prone 8 (SAMP8) is a model for studying age-related cognitive impairments and also is a good model to study brain aging and one of mouse model of AD. The technique of cDNA microarray can monitor the expression levels of thousands of genes simultaneously and can be used to study AD with the character of multi-mechanism, multi-targets and multi-pathway. In order to disclose the mechanism of AD and find the drug targets of AD, cDNA microarray containing 3136 cDNAs amplified from the suppression subtracted cDNA library of hippocampus of SAMP8 and SAMR1 was prepared with 16 blocks and 14 x 14 pins, the housekeeping gene beta-actin and G3PDH as inner conference. The background of this microarray was low and unanimous, and dots divided evenly. The conditions of hybridization and washing were optimized during the hybridization of probe and target molecule. After the data of hybridization analysis, the differential expressed cDNAs were sequenced and analyzed by the bioinformatics, and some of genes were quantified by the real time RT-PCR and the reliability of this cDNA microarray were validated. This cDNA microarray may be the good means to select the differential expressed genes and disclose the molecular mechanism of SAMP8's brain aging and AD.

DNA-binding and oxidative properties of cationic phthalocyanines and their dimeric complexes with anionic phthalocyanines covalently linked to oligonucleotides.

PubMed

Kuznetsova, A A; Lukyanets, E A; Solovyeva, L I; Knorre, D G; Fedorova, O S

2008-12-01

Design of chemically modified oligonucleotides for regulation of gene expression has attracted considerable attention over the past decades. One actively pursued approach involves antisense or antigene oligonucleotide constructs carrying reactive groups, many of these based on transition metal complexes. The complexes of Fe(II) and Co(II) with phthalocyanines are extremely good catalysts of oxidation of organic compounds with molecular oxygen and hydrogen peroxide. The binding of positively charged Fe(II) and Co(II) phthalocyanines with single- and double-stranded DNA was investigated. It was shown that these phthalocyanines interact with nucleic acids through an outside binding mode. The site-directed modification of single-stranded DNA by O2 and H2O2 in the presence of dimeric complexes of negatively and positively charged Fe(II) and Co(II) phthalocyanines was investigated. These complexes were formed directly on single-stranded DNA through interaction between negatively charged phthalocyanine in conjugate and positively charged phthalocyanine in solution. The resulting oppositely charged phthalocyanine complexes showed significant increase of catalytic activity compared with monomeric forms of phthalocyanines Fe(II) and Co(II). These complexes catalyzed the DNA oxidation with high efficacy and led to direct DNA strand cleavage. It was determined that oxidation of DNA by molecular oxygen catalyzed by complex of Fe(II)-phthalocyanines proceeds with higher rate than in the case of Co(II)-phthalocyanines but the latter led to a greater extent of target DNA modification.

Metastasizing patent claims on BRCA1.

PubMed

Kepler, Thomas B; Crossman, Colin; Cook-Deegan, Robert

2010-05-01

Many patents make claims on DNA sequences; some include claims on oligonucleotides related to the primary patented gene. We used bioinformatics to quantify the reach of one such claim from patent 4,747,282 on BRCA1. We find that human chromosome 1 (which does not contain BRCA1) contains over 300,000 oligonucleotides covered by this claim, and that 80% of cDNA and mRNA sequences contributed to GenBank before the patent application was filed also contain at least one claimed oligonucleotide. Any "isolated" DNA molecules that include such 15 bp nucleotide sequences would fall under the claim as granted by the US Patent and Trademark Office. Anyone making, using, selling, or importing such a molecule for any purpose within the United States would thus be infringing the claim. This claim and others like it turn out, on examination, to be surprisingly broad, and if enforced would have substantial implications for medical practice and scientific research. Copyright 2010 Elsevier Inc. All rights reserved.

Optimized oligonucleotide probes for DNA fingerprinting.

PubMed

Schäfer, R; Zischler, H; Birsner, U; Becker, A; Epplen, J T

1988-08-01

The three different simple repetitive oligonucleotide probes (CT)8, (CAC)5 and (TCC)5 were hybridized to a panel of human DNAs which had been digested with the restriction endonucleases Alu I, Hinf I and Mbo I. The resulting DNA fingerprints were analyzed and different parameters calculated, such as the maximal mean allele frequency and the average number of polymorphic bands per individual. The highest number of bands was obtained after hybridization of Hinf I digested DNA with (CAC)5. The probability of finding the same band pattern as in individual A in individual B is 2 x 10(-8). The DNAs of monozygous twins show indistinguishable banding patterns and the bands are inherited according to the Mendelian laws. Thus this procedure reveals informative fingerprints that can be used for individual identification, e.g. in paternity testing and in forensic applications. In most of these experiments 32P-labelled probes were employed, yet the biotinylated oligonucleotide (GACA)4 produced results which were equivalent to those obtained by hybridization with the 32P-labelled probe (GACA)4.

APPLICATION OF DNA MICROARRAYS TO REPRODUCTIVE TOXICOLOGY AND THE DEVELOPMENT OF A TESTIS ARRAY

EPA Science Inventory

With the advent of sequence information for entire mammalian genomes, it is now possible to analyze gene expression and gene polymorphisms on a genomic scale. The primary tool for analysis of gene expression is the DNA microarray. We have used commercially available cDNA micro...

BIOPHYSICAL PROPERTIES OF NUCLEIC ACIDS AT SURFACES RELEVANT TO MICROARRAY PERFORMANCE.

PubMed

Rao, Archana N; Grainger, David W

2014-04-01

Both clinical and analytical metrics produced by microarray-based assay technology have recognized problems in reproducibility, reliability and analytical sensitivity. These issues are often attributed to poor understanding and control of nucleic acid behaviors and properties at solid-liquid interfaces. Nucleic acid hybridization, central to DNA and RNA microarray formats, depends on the properties and behaviors of single strand (ss) nucleic acids (e.g., probe oligomeric DNA) bound to surfaces. ssDNA's persistence length, radius of gyration, electrostatics, conformations on different surfaces and under various assay conditions, its chain flexibility and curvature, charging effects in ionic solutions, and fluorescent labeling all influence its physical chemistry and hybridization under assay conditions. Nucleic acid (e.g., both RNA and DNA) target interactions with immobilized ssDNA strands are highly impacted by these biophysical states. Furthermore, the kinetics, thermodynamics, and enthalpic and entropic contributions to DNA hybridization reflect global probe/target structures and interaction dynamics. Here we review several biophysical issues relevant to oligomeric nucleic acid molecular behaviors at surfaces and their influences on duplex formation that influence microarray assay performance. Correlation of biophysical aspects of single and double-stranded nucleic acids with their complexes in bulk solution is common. Such analysis at surfaces is not commonly reported, despite its importance to microarray assays. We seek to provide further insight into nucleic acid-surface challenges facing microarray diagnostic formats that have hindered their clinical adoption and compromise their research quality and value as genomics tools.

Fluorescence-based bioassays for the detection and evaluation of food materials.

PubMed

Nishi, Kentaro; Isobe, Shin-Ichiro; Zhu, Yun; Kiyama, Ryoiti

2015-10-13

We summarize here the recent progress in fluorescence-based bioassays for the detection and evaluation of food materials by focusing on fluorescent dyes used in bioassays and applications of these assays for food safety, quality and efficacy. Fluorescent dyes have been used in various bioassays, such as biosensing, cell assay, energy transfer-based assay, probing, protein/immunological assay and microarray/biochip assay. Among the arrays used in microarray/biochip assay, fluorescence-based microarrays/biochips, such as antibody/protein microarrays, bead/suspension arrays, capillary/sensor arrays, DNA microarrays/polymerase chain reaction (PCR)-based arrays, glycan/lectin arrays, immunoassay/enzyme-linked immunosorbent assay (ELISA)-based arrays, microfluidic chips and tissue arrays, have been developed and used for the assessment of allergy/poisoning/toxicity, contamination and efficacy/mechanism, and quality control/safety. DNA microarray assays have been used widely for food safety and quality as well as searches for active components. DNA microarray-based gene expression profiling may be useful for such purposes due to its advantages in the evaluation of pathway-based intracellular signaling in response to food materials.

Fluorescence-Based Bioassays for the Detection and Evaluation of Food Materials

PubMed Central

Nishi, Kentaro; Isobe, Shin-Ichiro; Zhu, Yun; Kiyama, Ryoiti

2015-01-01

We summarize here the recent progress in fluorescence-based bioassays for the detection and evaluation of food materials by focusing on fluorescent dyes used in bioassays and applications of these assays for food safety, quality and efficacy. Fluorescent dyes have been used in various bioassays, such as biosensing, cell assay, energy transfer-based assay, probing, protein/immunological assay and microarray/biochip assay. Among the arrays used in microarray/biochip assay, fluorescence-based microarrays/biochips, such as antibody/protein microarrays, bead/suspension arrays, capillary/sensor arrays, DNA microarrays/polymerase chain reaction (PCR)-based arrays, glycan/lectin arrays, immunoassay/enzyme-linked immunosorbent assay (ELISA)-based arrays, microfluidic chips and tissue arrays, have been developed and used for the assessment of allergy/poisoning/toxicity, contamination and efficacy/mechanism, and quality control/safety. DNA microarray assays have been used widely for food safety and quality as well as searches for active components. DNA microarray-based gene expression profiling may be useful for such purposes due to its advantages in the evaluation of pathway-based intracellular signaling in response to food materials. PMID:26473869

Fabrication of high quality cDNA microarray using a small amount of cDNA.

PubMed

Park, Chan Hee; Jeong, Ha Jin; Jung, Jae Jun; Lee, Gui Yeon; Kim, Sang-Chul; Kim, Tae Soo; Yang, Sang Hwa; Chung, Hyun Cheol; Rha, Sun Young

2004-05-01

DNA microarray technology has become an essential part of biological research. It enables the genome-scale analysis of gene expression in various types of model systems. Manufacturing high quality cDNA microarrays of microdeposition type depends on some key factors including a printing device, spotting pins, glass slides, spotting solution, and humidity during spotting. UsingEthe Microgrid II TAS model printing device, this study defined the optimal conditions for producing high density, high quality cDNA microarrays with the least amount of cDNA product. It was observed that aminosilane-modified slides were superior to other types of surface modified-slides. A humidity of 30+/-3% in a closed environment and the overnight drying of the spotted slides gave the best conditions for arraying. In addition, the cDNA dissolved in 30% DMSO gave the optimal conditions for spotting compared to the 1X ArrayIt, 3X SSC and 50% DMSO. Lastly, cDNA in the concentration range of 100-300 ng/ micro l was determined to be best for arraying and post-processing. Currently, the printing system in this study yields reproducible 9000 spots with a spot size 150 mm diameter, and a 200 nm spot spacing.

Functionalization of quantum rods with oligonucleotides for programmable assembly with DNA origami

NASA Astrophysics Data System (ADS)

Doane, Tennyson L.; Alam, Rabeka; Maye, Mathew M.

2015-02-01

The DNA-mediated self-assembly of CdSe/CdS quantum rods (QRs) onto DNA origami is described. Two QR types with unique optical emission and high polarization were synthesized, and then functionalized with oligonucleotides (ssDNA) using a novel protection-deprotection approach, which harnessed ssDNA's tailorable rigidity and denaturation temperature to increase DNA coverage by reducing non-specific coordination and wrapping. The QR assembly was programmable, and occurred at two different assembly zones that had capture strands in parallel alignment. QRs with different optical properties were assembled, opening up future studies on orientation dependent QR FRET. The QR-origami conjugates could be purified via gel electrophoresis and sucrose gradient ultracentrifugation. Assembly yields, QR stoichiometry and orientation, as well as energy transfer implications were studied in light of QR distances, origami flexibility, and conditions.The DNA-mediated self-assembly of CdSe/CdS quantum rods (QRs) onto DNA origami is described. Two QR types with unique optical emission and high polarization were synthesized, and then functionalized with oligonucleotides (ssDNA) using a novel protection-deprotection approach, which harnessed ssDNA's tailorable rigidity and denaturation temperature to increase DNA coverage by reducing non-specific coordination and wrapping. The QR assembly was programmable, and occurred at two different assembly zones that had capture strands in parallel alignment. QRs with different optical properties were assembled, opening up future studies on orientation dependent QR FRET. The QR-origami conjugates could be purified via gel electrophoresis and sucrose gradient ultracentrifugation. Assembly yields, QR stoichiometry and orientation, as well as energy transfer implications were studied in light of QR distances, origami flexibility, and conditions. Electronic supplementary information (ESI) available: Experimental conditions, DNA origami blueprint and sequences, FRET calculations. Additional Fig. S1-S13. See DOI: 10.1039/c4nr07662a

Strategies for comparing gene expression profiles from different microarray platforms: application to a case-control experiment.

PubMed

Severgnini, Marco; Bicciato, Silvio; Mangano, Eleonora; Scarlatti, Francesca; Mezzelani, Alessandra; Mattioli, Michela; Ghidoni, Riccardo; Peano, Clelia; Bonnal, Raoul; Viti, Federica; Milanesi, Luciano; De Bellis, Gianluca; Battaglia, Cristina

2006-06-01

Meta-analysis of microarray data is increasingly important, considering both the availability of multiple platforms using disparate technologies and the accumulation in public repositories of data sets from different laboratories. We addressed the issue of comparing gene expression profiles from two microarray platforms by devising a standardized investigative strategy. We tested this procedure by studying MDA-MB-231 cells, which undergo apoptosis on treatment with resveratrol. Gene expression profiles were obtained using high-density, short-oligonucleotide, single-color microarray platforms: GeneChip (Affymetrix) and CodeLink (Amersham). Interplatform analyses were carried out on 8414 common transcripts represented on both platforms, as identified by LocusLink ID, representing 70.8% and 88.6% of annotated GeneChip and CodeLink features, respectively. We identified 105 differentially expressed genes (DEGs) on CodeLink and 42 DEGs on GeneChip. Among them, only 9 DEGs were commonly identified by both platforms. Multiple analyses (BLAST alignment of probes with target sequences, gene ontology, literature mining, and quantitative real-time PCR) permitted us to investigate the factors contributing to the generation of platform-dependent results in single-color microarray experiments. An effective approach to cross-platform comparison involves microarrays of similar technologies, samples prepared by identical methods, and a standardized battery of bioinformatic and statistical analyses.

Fully Automated Complementary DNA Microarray Segmentation using a Novel Fuzzy-based Algorithm.

PubMed

Saberkari, Hamidreza; Bahrami, Sheyda; Shamsi, Mousa; Amoshahy, Mohammad Javad; Ghavifekr, Habib Badri; Sedaaghi, Mohammad Hossein

2015-01-01

DNA microarray is a powerful approach to study simultaneously, the expression of 1000 of genes in a single experiment. The average value of the fluorescent intensity could be calculated in a microarray experiment. The calculated intensity values are very close in amount to the levels of expression of a particular gene. However, determining the appropriate position of every spot in microarray images is a main challenge, which leads to the accurate classification of normal and abnormal (cancer) cells. In this paper, first a preprocessing approach is performed to eliminate the noise and artifacts available in microarray cells using the nonlinear anisotropic diffusion filtering method. Then, the coordinate center of each spot is positioned utilizing the mathematical morphology operations. Finally, the position of each spot is exactly determined through applying a novel hybrid model based on the principle component analysis and the spatial fuzzy c-means clustering (SFCM) algorithm. Using a Gaussian kernel in SFCM algorithm will lead to improving the quality in complementary DNA microarray segmentation. The performance of the proposed algorithm has been evaluated on the real microarray images, which is available in Stanford Microarray Databases. Results illustrate that the accuracy of microarray cells segmentation in the proposed algorithm reaches to 100% and 98% for noiseless/noisy cells, respectively.

Synthetic oligonucleotide antigens modified with locked nucleic acids detect disease specific antibodies

NASA Astrophysics Data System (ADS)

Samuelsen, Simone V.; Solov'Yov, Ilia A.; Balboni, Imelda M.; Mellins, Elizabeth; Nielsen, Christoffer Tandrup; Heegaard, Niels H. H.; Astakhova, Kira

2016-10-01

New techniques to detect and quantify antibodies to nucleic acids would provide a significant advance over current methods, which often lack specificity. We investigate the potential of novel antigens containing locked nucleic acids (LNAs) as targets for antibodies. Particularly, employing molecular dynamics we predict optimal nucleotide composition for targeting DNA-binding antibodies. As a proof of concept, we address a problem of detecting anti-DNA antibodies that are characteristic of systemic lupus erythematosus, a chronic autoimmune disease with multiple manifestations. We test the best oligonucleotide binders in surface plasmon resonance studies to analyze binding and kinetic aspects of interactions between antigens and target DNA. These DNA and LNA/DNA sequences showed improved binding in enzyme-linked immunosorbent assay using human samples of pediatric lupus patients. Our results suggest that the novel method is a promising tool to create antigens for research and point-of-care monitoring of anti-DNA antibodies.

Fundamental mechanisms of DNA radiosensitization: damage induced by low-energy electrons in brominated oligonucleotide trimers.

PubMed

Park, Yeunsoo; Polska, Katarzyna; Rak, Janusz; Wagner, J Richard; Sanche, Léon

2012-08-16

The replacement of nucleobases with brominated analogs enhances DNA radiosensitivity. We examine the chemistry of low-energy electrons (LEEs) in this sensitization process by experiments with thin films of the oligonucleotide trimers TBrXT, where BrX = 5-BrU (5-bromouracil), 5-BrC (5-bromocytosine), 8-BrA (8-bromoadenine), or 8-BrG (8-bromoguanine). The products induced from irradiation of thin (∼ 2.5 nm) oligonucleotide films, with 10 eV electrons, under ultrahigh vacuum (UHV) are analyzed by HPLC-UV. The number of damaged brominated trimers ranges from about 12 to 15 × 10(-3) molecules per incident electron, whereas under the identical conditions, these numbers drop to 4-7 × 10(-3) for the same, but nonbrominated oligonucleotides. The results of HPLC analysis show that the main degradation pathway of trinucleotides containing brominated bases involve debromination (i.e., loss of the bromine atom and its replacement with a hydrogen atom). The electron-induced sum of products upon bromination increases by factors of 2.1 for the pyrimidines and 3.2 for the purines. Thus, substitution of any native nucleobase with a brominated one in simple models of DNA increases LEE-induced damage to DNA and hence its radiosensitivity. Furthermore, besides the brominated pyrimidines that have already been tested in clinical trials, brominated purines not only appear to be promising sensitizers for radiotherapy, but could provide a higher degree of radiosensitization.

MIGS-GPU: Microarray Image Gridding and Segmentation on the GPU.

PubMed

Katsigiannis, Stamos; Zacharia, Eleni; Maroulis, Dimitris

2017-05-01

Complementary DNA (cDNA) microarray is a powerful tool for simultaneously studying the expression level of thousands of genes. Nevertheless, the analysis of microarray images remains an arduous and challenging task due to the poor quality of the images that often suffer from noise, artifacts, and uneven background. In this study, the MIGS-GPU [Microarray Image Gridding and Segmentation on Graphics Processing Unit (GPU)] software for gridding and segmenting microarray images is presented. MIGS-GPU's computations are performed on the GPU by means of the compute unified device architecture (CUDA) in order to achieve fast performance and increase the utilization of available system resources. Evaluation on both real and synthetic cDNA microarray images showed that MIGS-GPU provides better performance than state-of-the-art alternatives, while the proposed GPU implementation achieves significantly lower computational times compared to the respective CPU approaches. Consequently, MIGS-GPU can be an advantageous and useful tool for biomedical laboratories, offering a user-friendly interface that requires minimum input in order to run.

Development of a low-cost detection method for miRNA microarray.

PubMed

Li, Wei; Zhao, Botao; Jin, Youxin; Ruan, Kangcheng

2010-04-01

MicroRNA (miRNA) microarray is a powerful tool to explore the expression profiling of miRNA. The current detection method used in miRNA microarray is mainly fluorescence based, which usually requires costly detection system such as laser confocal scanner of tens of thousands of dollars. Recently, we developed a low-cost yet sensitive detection method for miRNA microarray based on enzyme-linked assay. In this approach, the biotinylated miRNAs were captured by the corresponding oligonucleotide probes immobilized on microarray slide; and then the biotinylated miRNAs would capture streptavidin-conjugated alkaline phosphatase. A purple-black precipitation on each biotinylated miRNA spot was produced by the enzyme catalytic reaction. It could be easily detected by a charge-coupled device digital camera mounted on a microscope, which lowers the detection cost more than 100 fold compared with that of fluorescence method. Our data showed that signal intensity of the spot correlates well with the biotinylated miRNA concentration and the detection limit for miRNAs is at least 0.4 fmol and the detection dynamic range spans about 2.5 orders of magnitude, which is comparable to that of fluorescence method.

A meta-data based method for DNA microarray imputation.

PubMed

Jörnsten, Rebecka; Ouyang, Ming; Wang, Hui-Yu

2007-03-29

DNA microarray experiments are conducted in logical sets, such as time course profiling after a treatment is applied to the samples, or comparisons of the samples under two or more conditions. Due to cost and design constraints of spotted cDNA microarray experiments, each logical set commonly includes only a small number of replicates per condition. Despite the vast improvement of the microarray technology in recent years, missing values are prevalent. Intuitively, imputation of missing values is best done using many replicates within the same logical set. In practice, there are few replicates and thus reliable imputation within logical sets is difficult. However, it is in the case of few replicates that the presence of missing values, and how they are imputed, can have the most profound impact on the outcome of downstream analyses (e.g. significance analysis and clustering). This study explores the feasibility of imputation across logical sets, using the vast amount of publicly available microarray data to improve imputation reliability in the small sample size setting. We download all cDNA microarray data of Saccharomyces cerevisiae, Arabidopsis thaliana, and Caenorhabditis elegans from the Stanford Microarray Database. Through cross-validation and simulation, we find that, for all three species, our proposed imputation using data from public databases is far superior to imputation within a logical set, sometimes to an astonishing degree. Furthermore, the imputation root mean square error for significant genes is generally a lot less than that of non-significant ones. Since downstream analysis of significant genes, such as clustering and network analysis, can be very sensitive to small perturbations of estimated gene effects, it is highly recommended that researchers apply reliable data imputation prior to further analysis. Our method can also be applied to cDNA microarray experiments from other species, provided good reference data are available.

Global gene expression profiles of Phytophthora ramorum strain pr102 in response to plant host and tissue differentiation

Treesearch

Caroline M. Press; Niklaus J. Grunwald

2008-01-01

The release of the draft genome sequence of P. ramorum strain Pr102, enabled the construction of an oligonucleotide microarray of the entire genome of Pr102. The array contains 344,680 features (oligos) that represent the transcriptome of Pr102. P. ramorum RNA was extracted from mycelium and sporangia and used to compare gene...

Bacterial identification and subtyping using DNA microarray and DNA sequencing.

PubMed

Al-Khaldi, Sufian F; Mossoba, Magdi M; Allard, Marc M; Lienau, E Kurt; Brown, Eric D

2012-01-01

The era of fast and accurate discovery of biological sequence motifs in prokaryotic and eukaryotic cells is here. The co-evolution of direct genome sequencing and DNA microarray strategies not only will identify, isotype, and serotype pathogenic bacteria, but also it will aid in the discovery of new gene functions by detecting gene expressions in different diseases and environmental conditions. Microarray bacterial identification has made great advances in working with pure and mixed bacterial samples. The technological advances have moved beyond bacterial gene expression to include bacterial identification and isotyping. Application of new tools such as mid-infrared chemical imaging improves detection of hybridization in DNA microarrays. The research in this field is promising and future work will reveal the potential of infrared technology in bacterial identification. On the other hand, DNA sequencing by using 454 pyrosequencing is so cost effective that the promise of $1,000 per bacterial genome sequence is becoming a reality. Pyrosequencing technology is a simple to use technique that can produce accurate and quantitative analysis of DNA sequences with a great speed. The deposition of massive amounts of bacterial genomic information in databanks is creating fingerprint phylogenetic analysis that will ultimately replace several technologies such as Pulsed Field Gel Electrophoresis. In this chapter, we will review (1) the use of DNA microarray using fluorescence and infrared imaging detection for identification of pathogenic bacteria, and (2) use of pyrosequencing in DNA cluster analysis to fingerprint bacterial phylogenetic trees.

Rapid detection of IHNV by molecular padlock recognition and surface-associated isothermal amplification

NASA Astrophysics Data System (ADS)

McCarthy, Erik L.; Egeler, Teressa J.; Bickerstaff, Lee E.; Pereira da Cunha, Mauricio; Millard, Paul J.

2005-11-01

RNA sequences derived from infectious hematopoeitic necrosis virus (IHNV) could be detected using a combination of surface-associated molecular padlock DNA probes (MPP) and rolling circle amplification (RCA) in microcapillary tubes. DNA oligonucleotides with base sequences identical to RNA obtained from IHNV were recognized by MPP. Circularized MPP were then captured on the inner surface of glass microcapillary tubes by immobilized DNA oligonucleotide primers. Extension of the immobilized primers by isothermal RCA gave rise to DNA concatamers, which were in turn bound by the fluorescent reporter SYBR Green II nucleic acid stain, and measured by microfluorimetry. Surface-associated molecular padlock technology, combined with isothermal RCA, exhibited high selectivity and sensitivity without thermal cycling. This technology is applicable to direct RNA and DNA detection, permitting detection of a variety of viral or bacterial pathogens.

Genome-wide inference of transcription factor-DNA binding specificity in cell regeneration using a combination strategy.

PubMed

Wang, Xiaofeng; Zhang, Aiqun; Ren, Weizheng; Chen, Caiyu; Dong, Jiahong

2012-11-01

The cell growth, development, and regeneration of tissue and organ are associated with a large number of gene regulation events, which are mediated in part by transcription factors (TFs) binding to cis-regulatory elements involved in the genome. Predicting the binding affinity and inferring the binding specificity of TF-DNA interactions at the genomic level would be fundamentally helpful for our understanding of the molecular mechanism and biological implication underlying sequence-specific TF-DNA recognition. In this study, we report the development of a combination method to characterize the interaction behavior of a 11-mer oligonucleotide segment and its mutations with the Gcn4p protein, a homodimeric, basic leucine zipper TF, and to predict the binding affinity and specificity of potential Gcn4p binders in the genome-wide scale. In this procedure, a position-mutated energy matrix is created based on molecular modeling analysis of native and mutated Gcn4p-DNA complex structures to describe the position-independent interaction energy profile of Gcn4p with different nucleotide types at each position of the oligonucleotide, and the energy terms extracted from the matrix and their interactives are then correlated with experimentally measured affinities of 19268 distinct oligonucleotides using statistical modeling methodology. Subsequently, the best one of built regression models is successfully applied to screen those of potential high-affinity Gcn4p binders from the complete genome. The findings arising from this study are briefly listed below: (i) The 11 positions of oligonucleotides are highly interactive and non-additive in contribution to Gcn4p-DNA binding affinity; (ii) Indirect conformational effects upon nucleotide mutations as well as associated subtle changes in interfacial atomic contacts, but not the direct nonbonded interactions, are primarily responsible for the sequence-specific recognition; (iii) The intrinsic synergistic effects among the sequence positions of oligonucleotides determine Gcn4p-DNA binding affinity and specificity; (iv) Linear regression models in conjunction with variable selection seem to perform fairly well in capturing the internal dependences hidden in the Gcn4p-DNA system, albeit ignoring nonlinear factors may lead the models to systematically underestimate and overestimate high- and low-affinity samples, respectively. © 2012 John Wiley & Sons A/S.

Cadmium sulfide nanocluster-based electrochemical stripping detection of DNA hybridization.

PubMed

Zhu, Ningning; Zhang, Aiping; He, Pingang; Fang, Yuzhi

2003-03-01

A novel, sensitive electrochemical DNA hybridization detection assay, using cadmium sulfide (CdS) nanoclusters as the oligonucleotide labeling tag, is described. The assay relies on the hybridization of the target DNA with the CdS nanocluster oligonucleotide DNA probe, followed by the dissolution of the CdS nanoclusters anchored on the hybrids and the indirect determination of the dissolved cadmium ions by sensitive anodic stripping voltammetry (ASV) at a mercury-coated glassy carbon electrode (GCE). The results showed that only a complementary sequence could form a double-stranded dsDNA-CdS with the DNA probe and give an obvious electrochemical response. A three-base mismatch sequence and non-complementary sequence had negligible response. The combination of the large number of cadmium ions released from each dsDNA hybrid with the remarkable sensitivity of the electrochemical stripping analysis for cadmium at mercury-film GCE allows detection at levels as low as 0.2 pmol L(-1) of the complementary sequence of DNA.

Electrochemical DNA biosensor for detection of porcine oligonucleotides using ruthenium(II) complex as intercalator label redox

DOE Office of Scientific and Technical Information (OSTI.GOV)

Halid, Nurul Izni Abdullah; Hasbullah, Siti Aishah; Heng, Lee Yook

2014-09-03

A DNA biosensor detection of oligonucleotides via the interactions of porcine DNA with redox active complex based on the electrochemical transduction is described. A ruthenium(II) complex, [Ru(bpy){sub 2}(PIP)]{sup 2+}, (bpy = 2,2′bipyridine, PIP = 2-phenylimidazo[4,5-f[[1,10-phenanthroline]) as DNA label has been synthesized and characterized by 1H NMR and mass spectra. The study was carried out by covalent bonding immobilization of porcine aminated DNA probes sequences on screen printed electrode (SPE) modified with succinimide-acrylic microspheres and [Ru(bpy){sub 2}(PIP)]{sup 2+} was used as electrochemical redox intercalator label to detect DNA hybridization event. Electrochemical detection was performed by cyclic voltammetry (CV) and differential pulsemore » voltammetry (DPV) over the potential range where the ruthenium (II) complex was active. The results indicate that the interaction of [Ru(bpy){sub 2}(PIP)]{sup 2+} with hybridization complementary DNA has higher response compared to single-stranded and mismatch complementary DNA.« less

Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions

NASA Astrophysics Data System (ADS)

Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory

1989-04-01

The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.

Efficient synthesis of supercoiled M13 DNA molecule containing a site specifically placed psoralen adduct and its use as a substrate for DNA replication

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kodadek, T.; Gamper, H.

The authors report a simple method for the in vitro synthesis of large quantities of site specifically modified DNA. The protocol involves extension of an oligonucleotide primer annealed to M13 single-stranded DNA using part of the T4 DNA polymerase holoenzyme. The resulting nicked double-stranded circles are ligated and supercoiled in the same tube, producing good yields of form I DNA. When the oligonucleotide primer is chemically modified, the resultant product contains a site-specific lesion. In this study, they report the synthesis of an M13 mp19 form I DNA which contains a psoralen monoadduct or cross-link at the KpnI site. Theymore » demonstrate the utility of these modified substrates by assessing the ability of the bacteriophage T4 DNA replication complex to bypass the damage and show that the psoralen monoadduct poses a severe block to the holoenzyme when attached to the template strand.« less

Mapping the affinity landscape of Thrombin-binding aptamers on 2΄F-ANA/DNA chimeric G-Quadruplex microarrays

PubMed Central

Abou Assi, Hala; Gómez-Pinto, Irene; González, Carlos

2017-01-01

Abstract In situ fabricated nucleic acids microarrays are versatile and very high-throughput platforms for aptamer optimization and discovery, but the chemical space that can be probed against a given target has largely been confined to DNA, while RNA and non-natural nucleic acid microarrays are still an essentially uncharted territory. 2΄-Fluoroarabinonucleic acid (2΄F-ANA) is a prime candidate for such use in microarrays. Indeed, 2΄F-ANA chemistry is readily amenable to photolithographic microarray synthesis and its potential in high affinity aptamers has been recently discovered. We thus synthesized the first microarrays containing 2΄F-ANA and 2΄F-ANA/DNA chimeric sequences to fully map the binding affinity landscape of the TBA1 thrombin-binding G-quadruplex aptamer containing all 32 768 possible DNA-to-2΄F-ANA mutations. The resulting microarray was screened against thrombin to identify a series of promising 2΄F-ANA-modified aptamer candidates with Kds significantly lower than that of the unmodified control and which were found to adopt highly stable, antiparallel-folded G-quadruplex structures. The solution structure of the TBA1 aptamer modified with 2΄F-ANA at position T3 shows that fluorine substitution preorganizes the dinucleotide loop into the proper conformation for interaction with thrombin. Overall, our work strengthens the potential of 2΄F-ANA in aptamer research and further expands non-genomic applications of nucleic acids microarrays. PMID:28100695

In Vitro Interactions between 17β-Estradiol and DNA Result in Formation of the Hormone-DNA Complexes

PubMed Central

Heger, Zbynek; Guran, Roman; Zitka, Ondrej; Beklova, Miroslava; Adam, Vojtech; Kizek, Rene

2014-01-01

Beyond the role of 17β-estradiol (E2) in reproduction and during the menstrual cycle, it has been shown to modulate numerous physiological processes such as cell proliferation, apoptosis, inflammation and ion transport in many tissues. The pathways in which estrogens affect an organism have been partially described, although many questions still exist regarding estrogens’ interaction with biomacromolecules. Hence, the present study showed the interaction of four oligonucleotides (17, 20, 24 and/or 38-mer) with E2. The strength of these interactions was evaluated using optical methods, showing that the interaction is influenced by three major factors, namely: oligonucleotide length, E2 concentration and interaction time. In addition, the denaturation phenomenon of DNA revealed that the binding of E2 leads to destabilization of hydrogen bonds between the nitrogenous bases of DNA strands resulting in a decrease of their melting temperatures (Tm). To obtain a more detailed insight into these interactions, MALDI-TOF mass spectrometry was employed. This study revealed that E2 with DNA forms non-covalent physical complexes, observed as the mass shifts for app. 270 Da (Mr of E2) to higher molecular masses. Taken together, our results indicate that E2 can affect biomacromolecules, as circulating oligonucleotides, which can trigger mutations, leading to various unwanted effects. PMID:25089777

Temperature-controlled microintaglio printing for high-resolution micropatterning of RNA molecules.

PubMed

Kobayashi, Ryo; Biyani, Manish; Ueno, Shingo; Kumal, Subhashini Raj; Kuramochi, Hiromi; Ichiki, Takanori

2015-05-15

We have developed an advanced microintaglio printing method for fabricating fine and high-density micropatterns and applied it to the microarraying of RNA molecules. The microintaglio printing of RNA reported here is based on the hybridization of RNA with immobilized complementary DNA probes. The hybridization was controlled by switching the RNA conformation via the temperature, and an RNA microarray with a diameter of 1.5 µm and a density of 40,000 spots/mm(2) with high contrast was successfully fabricated. Specifically, no size effects were observed in the uniformity of patterned signals over a range of microarray feature sizes spanning one order of magnitude. Additionally, we have developed a microintaglio printing method for transcribed RNA microarrays on demand using DNA-immobilized magnetic beads. The beads were arrayed on wells fabricated on a printing mold and the wells were filled with in vitro transcription reagent and sealed with a DNA-immobilized glass substrate. Subsequently, RNA was in situ synthesized using the bead-immobilized DNA as a template and printed onto the substrate via hybridization. Since the microintaglio printing of RNA using DNA-immobilized beads enables the fabrication of a microarray of spots composed of multiple RNA sequences, it will be possible to screen or analyze RNA functions using an RNA microarray fabricated by temperature-controlled microintaglio printing (TC-µIP). Copyright © 2014 Elsevier B.V. All rights reserved.

Design and verification of a pangenome microarray oligonucleotide probe set for Dehalococcoides spp.

PubMed

Hug, Laura A; Salehi, Maryam; Nuin, Paulo; Tillier, Elisabeth R; Edwards, Elizabeth A

2011-08-01

Dehalococcoides spp. are an industrially relevant group of Chloroflexi bacteria capable of reductively dechlorinating contaminants in groundwater environments. Existing Dehalococcoides genomes revealed a high level of sequence identity within this group, including 98 to 100% 16S rRNA sequence identity between strains with diverse substrate specificities. Common molecular techniques for identification of microbial populations are often not applicable for distinguishing Dehalococcoides strains. Here we describe an oligonucleotide microarray probe set designed based on clustered Dehalococcoides genes from five different sources (strain DET195, CBDB1, BAV1, and VS genomes and the KB-1 metagenome). This "pangenome" probe set provides coverage of core Dehalococcoides genes as well as strain-specific genes while optimizing the potential for hybridization to closely related, previously unknown Dehalococcoides strains. The pangenome probe set was compared to probe sets designed independently for each of the five Dehalococcoides strains. The pangenome probe set demonstrated better predictability and higher detection of Dehalococcoides genes than strain-specific probe sets on nontarget strains with <99% average nucleotide identity. An in silico analysis of the expected probe hybridization against the recently released Dehalococcoides strain GT genome and additional KB-1 metagenome sequence data indicated that the pangenome probe set performs more robustly than the combined strain-specific probe sets in the detection of genes not included in the original design. The pangenome probe set represents a highly specific, universal tool for the detection and characterization of Dehalococcoides from contaminated sites. It has the potential to become a common platform for Dehalococcoides-focused research, allowing meaningful comparisons between microarray experiments regardless of the strain examined.

Folding- and Dynamics-Based Electrochemical DNA Sensors.

PubMed

Lai, Rebecca Y

2017-01-01

A number of electrochemical DNA sensors based on the target-induced change in the conformation and/or flexibility of surface-bound oligonucleotides have been developed in recent years. These sensors, which are often termed E-DNA sensors, are comprised of an oligonucleotide probe modified with a redox label (e.g., methylene blue) at one terminus and attached to a gold electrode via a thiol-gold bond at the other. Binding of the target to the DNA probe changes its structure and dynamics, which, in turn, influences the efficiency of electron transfer to the interrogating electrode. Since electrochemically active contaminants are less common, these sensors are resistant to false-positive signals arising from the nonspecific adsorption of contaminants and perform well even when employed directly in serum, whole blood, and other realistically complex sample matrices. Moreover, because all of the sensor components are chemisorbed to the electrode, the E-DNA sensors are essentially label-free and readily reusable. To date, these sensors have achieved state-of-the-art sensitivity, while offering the unprecedented selectivity, reusability, and the operational convenience of direct electrochemical detection. This chapter reviews the recent advances in the development of both "signal-off" and "signal-on" E-DNA sensors. Critical aspects that dictate the stability and performance of these sensors are also addressed so as to provide a realistic overview of this oligonucleotide detection platform. © 2017 Elsevier Inc. All rights reserved.

Organometallic DNA-B12 Conjugates as Potential Oligonucleotide Vectors: Synthesis and Structural and Binding Studies with Human Cobalamin-Transport Proteins.

PubMed

Mutti, Elena; Hunger, Miriam; Fedosov, Sergey; Nexo, Ebba; Kräutler, Bernhard

2017-11-16

The synthesis and structural characterization of Co-(dN) 25 -Cbl (Cbl: cobalamin; dN: deoxynucleotide) and Co-(dN) 39 -Cbl, which are organometallic DNA-B 12 conjugates with single DNA strands consisting of 25 and 39 deoxynucleotides, respectively, and binding studies of these two DNA-Cbl conjugates to three homologous human Cbl transporting proteins, transcobalamin (TC), intrinsic factor (IF), and haptocorrin (HC), are reported. This investigation tests the suitability of such DNA-Cbls for the task of eventual in vivo oligonucleotide delivery. The binding of DNA-Cbl to TC, IF, and HC was investigated in competition with either a fluorescent Cbl derivative and Co-(dN) 25 -Cbl, or radiolabeled vitamin B 12 ( 57 Co-CNCbl) and Co-(dN) 25 -Cbl or Co-(dN) 39 -Cbl. Binding of the new DNA-Cbl conjugates was fast and tight with TC, but poorer with HC and IF, which extends a similar original finding with the simpler DNA-Cbl, Co-(dN) 18 -Cbl. The contrasting affinities of TC versus IF and HC for the DNA-Cbl conjugates are rationalized herein by a stepwise mechanism of Cbl binding. Critical contributions to overall affinity result from gradual conformational adaptations of the Cbl-binding proteins to the DNA-Cbl, which is first bound to the respective β domains. This transition is fast with TC, but slow with IF and HC, with which weaker binding results. The invariably tight interaction of the DNA-Cbl conjugates with TC makes the Cbl moiety a potential natural vector for the specific delivery of oligonucleotide loads from the blood into cells. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Innovative approaches to the use of polyamines for DNA nanoparticle preparation for gene therapy.

PubMed

Vijayanathan, Veena; Agostinelli, Enzo; Thomas, Thresia; Thomas, T J

2014-03-01

Advances in genomic technologies, such as next generation sequencing and disease specific gene targeting through anti-sense, anti-gene, siRNA and microRNA approaches require the transport of nucleic acid drugs through the cell membrane. Membrane transport of DNA/RNA drugs is an inefficient process, and the mechanism(s) by which this process occurs is not clear. A pre-requisite for effective transport of DNA and RNA in cells is their condensation to nanoparticles of ~100 nm size. Although viral vectors are effective in gene therapy, the immune response elicited by viral proteins poses a major challenge. Multivalent cations, such as natural polyamines are excellent promoters of DNA/RNA condensation to nanoparticles. During the past 20 years, our laboratory has synthesized and tested several analogs of the natural polyamine, spermine, for their efficacy to provoke DNA condensation to nanoparticles. We determined the thermodynamics of polyamine-mediated DNA condensation, measured the structural specificity effects of polyamine analogs in facilitating the cellular uptake of oligonucleotides, and evaluated the gene silencing activity of DNA nanoparticles in breast cancer cells. Polyamine-complexed oligonucleotides showed a synergistic effect on target gene inhibition at the mRNA level compared to the use of polyamines and oligonucleotides as single agents. Ionic and structural specificity effects were evident in DNA condensation and cellular transportation effects of polyamines. In condensed DNA structures, correlation exists between the attractive and repulsive forces with structurally different polyamines and cobalt hexamine, indicating the existence of a common force in stabilizing the condensed structures. Future studies aimed at defining the mechanism(s) of DNA compaction and structural features of DNA nanoparticles might aid in the development of novel gene delivery vehicles.

Comparison of dkgB-linked intergenic sequence ribotyping to DNA microarray hybridization for assigning serotype to Salmonella enterica

PubMed Central

Guard, Jean; Sanchez-Ingunza, Roxana; Morales, Cesar; Stewart, Tod; Liljebjelke, Karen; Kessel, JoAnn; Ingram, Kim; Jones, Deana; Jackson, Charlene; Fedorka-Cray, Paula; Frye, Jonathan; Gast, Richard; Hinton, Arthur

2012-01-01

Two DNA-based methods were compared for the ability to assign serotype to 139 isolates of Salmonella enterica ssp. I. Intergenic sequence ribotyping (ISR) evaluated single nucleotide polymorphisms occurring in a 5S ribosomal gene region and flanking sequences bordering the gene dkgB. A DNA microarray hybridization method that assessed the presence and the absence of sets of genes was the second method. Serotype was assigned for 128 (92.1%) of submissions by the two DNA methods. ISR detected mixtures of serotypes within single colonies and it cost substantially less than Kauffmann–White serotyping and DNA microarray hybridization. Decreasing the cost of serotyping S. enterica while maintaining reliability may encourage routine testing and research. PMID:22998607

Microarrays (DNA Chips) for the Classroom Laboratory

ERIC Educational Resources Information Center

Barnard, Betsy; Sussman, Michael; BonDurant, Sandra Splinter; Nienhuis, James; Krysan, Patrick

2006-01-01

We have developed and optimized the necessary laboratory materials to make DNA microarray technology accessible to all high school students at a fraction of both cost and data size. The primary component is a DNA chip/array that students "print" by hand and then analyze using research tools that have been adapted for classroom use. The…

A statistical model for investigating binding probabilities of DNA nucleotide sequences using microarrays.

PubMed

Lee, Mei-Ling Ting; Bulyk, Martha L; Whitmore, G A; Church, George M

2002-12-01

There is considerable scientific interest in knowing the probability that a site-specific transcription factor will bind to a given DNA sequence. Microarray methods provide an effective means for assessing the binding affinities of a large number of DNA sequences as demonstrated by Bulyk et al. (2001, Proceedings of the National Academy of Sciences, USA 98, 7158-7163) in their study of the DNA-binding specificities of Zif268 zinc fingers using microarray technology. In a follow-up investigation, Bulyk, Johnson, and Church (2002, Nucleic Acid Research 30, 1255-1261) studied the interdependence of nucleotides on the binding affinities of transcription proteins. Our article is motivated by this pair of studies. We present a general statistical methodology for analyzing microarray intensity measurements reflecting DNA-protein interactions. The log probability of a protein binding to a DNA sequence on an array is modeled using a linear ANOVA model. This model is convenient because it employs familiar statistical concepts and procedures and also because it is effective for investigating the probability structure of the binding mechanism.

Charge-induced geometrical reorganization of DNA oligonucleotides studied by tandem mass spectrometry and ion mobility.

PubMed

Ickert, Stefanie; Hofmann, Johanna; Riedel, Jens; Beck, Sebastian; Pagel, Kevin; Linscheid, Michael W

2018-04-01

Mass spectrometry is applied as a tool for the elucidation of molecular structures. This premises that gas-phase structures reflect the original geometry of the analytes, while it requires a thorough understanding and investigation of the forces controlling and affecting the gas-phase structures. However, only little is known about conformational changes of oligonucleotides in the gas phase. In this study, a series of multiply charged DNA oligonucleotides (n = 15-40) has been subjected to a comprehensive tandem mass spectrometric study to unravel transitions between different ionic gas-phase structures. The nucleobase sequence and the chain length were varied to gain insights into their influence on the geometrical oligonucleotide organization. Altogether, 23 oligonucleotides were analyzed using collision-induced fragmentation. All sequences showed comparable correlation regarding the characteristic collision energy. This value that is also a measure for stability, strongly correlates with the net charge density of the precursor ions. With decreasing charge of the oligonucleotides, an increase in the fragmentation energy was observed. At a distinct charge density, a deviation from linearity was observed for all studied species, indicating a structural reorganization. To corroborate the proposed geometrical change, collisional cross-sections of the oligonucleotides at different charge states were determined using ion mobility-mass spectrometry. The results clearly indicate that an increase in charge density and thus Coulomb repulsion results in the transition from a folded, compact form to elongated structures of the precursor ions. Our data show this structural transition to depend mainly on the charge density, whereas sequence and size do not have an influence.

Gene expression analysis of the biocontrol fungus Trichoderma harzianum in the presence of tomato plants, chitin, or glucose using a high-density oligonucleotide microarray.

PubMed

Samolski, Ilanit; de Luis, Alberto; Vizcaíno, Juan Antonio; Monte, Enrique; Suárez, M Belén

2009-10-13

It has recently been shown that the Trichoderma fungal species used for biocontrol of plant diseases are capable of interacting with plant roots directly, behaving as symbiotic microorganisms. With a view to providing further information at transcriptomic level about the early response of Trichoderma to a host plant, we developed a high-density oligonucleotide (HDO) microarray encompassing 14,081 Expressed Sequence Tag (EST)-based transcripts from eight Trichoderma spp. and 9,121 genome-derived transcripts of T. reesei, and we have used this microarray to examine the gene expression of T. harzianum either alone or in the presence of tomato plants, chitin, or glucose. Global microarray analysis revealed 1,617 probe sets showing differential expression in T. harzianum mycelia under at least one of the culture conditions tested as compared with one another. Hierarchical clustering and heat map representation showed that the expression patterns obtained in glucose medium clustered separately from the expression patterns observed in the presence of tomato plants and chitin. Annotations using the Blast2GO suite identified 85 of the 257 transcripts whose probe sets afforded up-regulated expression in response to tomato plants. Some of these transcripts were predicted to encode proteins related to Trichoderma-host (fungus or plant) associations, such as Sm1/Elp1 protein, proteases P6281 and PRA1, enchochitinase CHIT42, or QID74 protein, although previously uncharacterized genes were also identified, including those responsible for the possible biosynthesis of nitric oxide, xenobiotic detoxification, mycelium development, or those related to the formation of infection structures in plant tissues. The effectiveness of the Trichoderma HDO microarray to detect different gene responses under different growth conditions in the fungus T. harzianum strongly indicates that this tool should be useful for further assays that include different stages of plant colonization, as well as for expression studies in other Trichoderma spp. represented on it. Using this microarray, we have been able to define a number of genes probably involved in the transcriptional response of T. harzianum within the first hours of contact with tomato plant roots, which may provide new insights into the mechanisms and roles of this fungus in the Trichoderma-plant interaction.

Gene expression analysis of the biocontrol fungus Trichoderma harzianum in the presence of tomato plants, chitin, or glucose using a high-density oligonucleotide microarray

PubMed Central

2009-01-01

Background It has recently been shown that the Trichoderma fungal species used for biocontrol of plant diseases are capable of interacting with plant roots directly, behaving as symbiotic microorganisms. With a view to providing further information at transcriptomic level about the early response of Trichoderma to a host plant, we developed a high-density oligonucleotide (HDO) microarray encompassing 14,081 Expressed Sequence Tag (EST)-based transcripts from eight Trichoderma spp. and 9,121 genome-derived transcripts of T. reesei, and we have used this microarray to examine the gene expression of T. harzianum either alone or in the presence of tomato plants, chitin, or glucose. Results Global microarray analysis revealed 1,617 probe sets showing differential expression in T. harzianum mycelia under at least one of the culture conditions tested as compared with one another. Hierarchical clustering and heat map representation showed that the expression patterns obtained in glucose medium clustered separately from the expression patterns observed in the presence of tomato plants and chitin. Annotations using the Blast2GO suite identified 85 of the 257 transcripts whose probe sets afforded up-regulated expression in response to tomato plants. Some of these transcripts were predicted to encode proteins related to Trichoderma-host (fungus or plant) associations, such as Sm1/Elp1 protein, proteases P6281 and PRA1, enchochitinase CHIT42, or QID74 protein, although previously uncharacterized genes were also identified, including those responsible for the possible biosynthesis of nitric oxide, xenobiotic detoxification, mycelium development, or those related to the formation of infection structures in plant tissues. Conclusion The effectiveness of the Trichoderma HDO microarray to detect different gene responses under different growth conditions in the fungus T. harzianum strongly indicates that this tool should be useful for further assays that include different stages of plant colonization, as well as for expression studies in other Trichoderma spp. represented on it. Using this microarray, we have been able to define a number of genes probably involved in the transcriptional response of T. harzianum within the first hours of contact with tomato plant roots, which may provide new insights into the mechanisms and roles of this fungus in the Trichoderma-plant interaction. PMID:19825185

2'-O-[2-[2-(N,N-Dimethylamino)ethoxy]ethyl] Modified Antisense Oligonucleotides: Symbiosis of Charge Interaction Factors and Stereoelectronic Effects

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prhavc, M.; Prakash, T.P.; Minasov, G.

Oligonucleotides with a novel, 2'-O-[2-[2-(N,N-dimethylamino)ethoxy]ethyl] (2'-O-DMAEOE) modification have been synthesized. This modification, a cationic analogue of the 2'-O-(2-methoxyethyl) (2'-O-MOE) modification, exhibits high binding affinity to target RNA (but not to DNA) and exceptional resistance to nuclease degradation. Analysis of the crystal structure of a self-complementary oligonucleotide containing a single 2'-O-DMAEOE modification explains the importance of charge factors and gauche effects on the observed antisense properties. 2'-O-DMAEOE modified oligonucleotides are ideal candidates for antisense drugs.

Oligonucleotide fingerprinting of rRNA genes for analysis of fungal community composition.

PubMed

Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James

2002-12-01

Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones derived from soil generated 455 clusters. A pairwise sequence analysis showed that clones with average sequence identities of 99.2% were grouped into the same cluster. To examine the accuracy of the taxonomic identities produced by this OFRG experiment, we determined the nucleotide sequences for 117 clones distributed throughout the tree. For all but two of these clones, the taxonomic identities generated by this OFRG experiment were consistent with those generated by a nucleotide sequence analysis. Eighty-eight percent of the clones were affiliated with Ascomycota, while 12% belonged to BASIDIOMYCOTA: A large fraction of the clones were affiliated with the genera Fusarium (404 clones) and Raciborskiomyces (176 clones). Smaller assemblages of clones had high sequence identities to the Alternaria, Ascobolus, Chaetomium, Cryptococcus, and Rhizoctonia clades.

High Boron-loaded DNA-Oligomers as Potential Boron Neutron Capture Therapy and Antisense Oligonucleotide Dual-Action Anticancer Agents.

PubMed

Kaniowski, Damian; Ebenryter-Olbińska, Katarzyna; Sobczak, Milena; Wojtczak, Błażej; Janczak, Sławomir; Leśnikowski, Zbigniew J; Nawrot, Barbara

2017-08-23

Boron cluster-modified therapeutic nucleic acids with improved properties are of interest in gene therapy and in cancer boron neutron capture therapy (BNCT). High metallacarborane-loaded antisense oligonucleotides (ASOs) targeting epidermal growth factor receptor (EGFR) were synthesized through post-synthetic Cu (I)-assisted "click" conjugation of alkyne-modified DNA-oligonucleotides with a boron cluster alkyl azide component. The obtained oligomers exhibited increased lipophilicity compared to their non-modified precursors, while their binding affinity to complementary DNA and RNA strands was slightly decreased. Multiple metallacarborane residues present in the oligonucleotide chain, each containing 18 B-H groups, enabled the use of IR spectroscopy as a convenient analytical method for these oligomers based on the diagnostic B-H signal at 2400-2650 cm -1 . The silencing activity of boron cluster-modified ASOs used at higher concentrations was similar to that of unmodified oligonucleotides. The screened ASOs, when used in low concentrations (up to 50 μM), exhibited pro-oxidative properties by inducing ROS production and an increase in mitochondrial activities in HeLa cells. In contrast, when used at higher concentrations, the ASOs exhibited anti-oxidative properties by lowering ROS species levels. In the HeLa cells (tested in the MTT assay) treated (without lipofectamine) or transfected with the screened compounds, the mitochondrial activity remained equal to the control level or only slightly changed (±30%). These findings may be useful in the design of dual-action boron cluster-modified therapeutic nucleic acids with combined antisense and anti-oxidant properties.

Selective recognition of DNA from olive leaves and olive oil by PNA and modified-PNA microarrays

PubMed Central

Rossi, Stefano; Calabretta, Alessandro; Tedeschi, Tullia; Sforza, Stefano; Arcioni, Sergio; Baldoni, Luciana; Corradini, Roberto; Marchelli, Rosangela

2012-01-01

PNA probes for the specific detection of DNA from olive oil samples by microarray technology were developed. The presence of as low as 5% refined hazelnut (Corylus avellana) oil in extra-virgin olive oil (Olea europaea L.) could be detected by using a PNA microarray. A set of two single nucleotide polymorphisms (SNPs) from the Actin gene of Olive was chosen as a model for evaluating the ability of PNA probes for discriminating olive cultivars. Both unmodified and C2-modified PNAs bearing an arginine side-chain were used, the latter showing higher sequence specificity. DNA extracted from leaves of three different cultivars (Ogliarola leccese, Canino and Frantoio) could be easily discriminated using a microarray with unmodified PNA probes, whereas discrimination of DNA from oil samples was more challenging, and could be obtained only by using chiral PNA probes. PMID:22772038

Species-Level Identification of Orthopoxviruses with an Oligonucleotide Microchip

PubMed Central

Lapa, Sergey; Mikheev, Maxim; Shchelkunov, Sergei; Mikhailovich, Vladimir; Sobolev, Alexander; Blinov, Vladimir; Babkin, Igor; Guskov, Alexander; Sokunova, Elena; Zasedatelev, Alexander; Sandakhchiev, Lev; Mirzabekov, Andrei

2002-01-01

A method for species-specific detection of orthopoxviruses pathogenic for humans and animals is described. The method is based on hybridization of a fluorescently labeled amplified DNA specimen with the oligonucleotide DNA probes immobilized on a microchip (MAGIChip). The probes identify species-specific sites within the crmB gene encoding the viral analogue of tumor necrosis factor receptor, one of the most important determinants of pathogenicity in this genus of viruses. The diagnostic procedure takes 6 h and does not require any sophisticated equipment (a portable fluorescence reader can be used). PMID:11880388

Direct Detection and Genotyping of Klebsiella pneumoniae Carbapenemases from Urine by Use of a New DNA Microarray Test

PubMed Central

Peter, Harald; Berggrav, Kathrine; Thomas, Peter; Pfeifer, Yvonne; Witte, Wolfgang; Templeton, Kate

2012-01-01

Klebsiella pneumoniae carbapenemases (KPCs) are considered a serious threat to antibiotic therapy, as they confer resistance to carbapenems, which are used to treat extended-spectrum beta-lactamase (ESBL)-producing bacteria. Here, we describe the development and evaluation of a DNA microarray for the detection and genotyping of KPC genes (blaKPC) within a 5-h period. To test the whole assay procedure (DNA extraction plus a DNA microarray assay) directly from clinical specimens, we compared two commercial DNA extraction kits (the QIAprep Spin miniprep kit [Qiagen] and the urine bacterial DNA isolation kit [Norgen]) for the direct DNA extraction from urine samples (dilution series spiked in human urine). Reliable single nucleotide polymorphism (SNP) typing was demonstrated using 1 × 105 CFU/ml urine for Escherichia coli (Qiagen and Norgen) and 80 CFU/ml urine, on average, for K. pneumoniae (Norgen). This study presents, for the first time, the combination of a new KPC microarray with commercial sample preparation for detecting and genotyping microbial pathogens directly from clinical specimens; this paves the way toward tests providing epidemiological and diagnostic data, enabling better antimicrobial stewardship. PMID:23035190

Poly(o-phenylenediamine) colloid-quenched fluorescent oligonucleotide as a probe for fluorescence-enhanced nucleic acid detection.

PubMed

Tian, Jingqi; Li, Hailong; Luo, Yonglan; Wang, Lei; Zhang, Yingwei; Sun, Xuping

2011-02-01

In this Letter, we demonstrate that chemical oxidation polymerization of o-phenylenediamine (OPD) by potassium bichromate at room temperature results in the formation of submicrometer-scale poly(o-phenylenediamine) (POPD) colloids. Such colloids can absorb and quench dye-labeled single-stranded DNA (ssDNA) very effectively. In the presence of a target, a hybridization event occurs, which produces a double-stranded DNA (dsDNA) that detaches from the POPD surface, leading to recovery of dye fluorescence. With the use of an oligonucleotide (OND) sequence associated with human immunodeficiency virus (HIV) as a model system, we demonstrate the proof of concept that POPD colloid-quenched fluorescent OND can be used as a probe for fluorescence-enhanced nucleic acid detection with selectivity down to single-base mismatch.

Single molecule characterization of DNA binding and strand displacement reactions on lithographic DNA origami microarrays.

PubMed

Scheible, Max B; Pardatscher, Günther; Kuzyk, Anton; Simmel, Friedrich C

2014-03-12

The combination of molecular self-assembly based on the DNA origami technique with lithographic patterning enables the creation of hierarchically ordered nanosystems, in which single molecules are positioned at precise locations on multiple length scales. Based on a hybrid assembly protocol utilizing DNA self-assembly and electron-beam lithography on transparent glass substrates, we here demonstrate a DNA origami microarray, which is compatible with the requirements of single molecule fluorescence and super-resolution microscopy. The spatial arrangement allows for a simple and reliable identification of single molecule events and facilitates automated read-out and data analysis. As a specific application, we utilize the microarray to characterize the performance of DNA strand displacement reactions localized on the DNA origami structures. We find considerable variability within the array, which results both from structural variations and stochastic reaction dynamics prevalent at the single molecule level.

Rare genomic rearrangement in a boy with Williams-Beuren syndrome associated to XYY syndrome and intriguing behavior.

PubMed

Dutra, Roberta L; Piazzon, Flavia B; Zanardo, Évelin A; Costa, Thais Virginia Moura Machado; Montenegro, Marília M; Novo-Filho, Gil M; Dias, Alexandre T; Nascimento, Amom M; Kim, Chong Ae; Kulikowski, Leslie D

2015-12-01

Williams-Beuren syndrome (WBS) is caused by a hemizygous contiguous gene microdeletion of 1.55-1.84 Mb at 7q11.23 region. Approximately, 28 genes have been shown to contribute to classical phenotype of SWB with presence of dysmorphic facial features, supravalvular aortic stenosis (SVAS), intellectual disability, and overfriendliness. With the use of Microarray-based comparative genomic hybridization and other molecular cytogenetic techniques, is possible define with more accuracy partial or atypical deletion and refine the genotype-phenotype correlation. Here, we report on a rare genomic structural rearrangement in a boy with atypical deletion in 7q11.23 and XYY syndrome with characteristic clinical signs, but not sufficient for the diagnosis of WBS. Cytogenetic analysis of G-banding showed a karyotype 47,XYY. Analysis of DNA with the technique of MLPA (Multiplex Ligation-dependent Probe Amplification) using kits a combination of kits (P064, P036, P070, and P029) identified an atypical deletion on 7q11.23. In addition, high resolution SNP Oligonucleotide Microarray Analysis (SNP-array) confirmed the alterations found by MLPA and revealed others pathogenic CNVs, in the chromosomes 7 and X. The present report demonstrates an association not yet described in literature, between Williams-Beuren syndrome and 47,XYY. The identification of atypical deletion in 7q11.23 concomitant to additional pathogenic CNVs in others genomic regions allows a better comprehension of clinical consequences of atypical genomic rearrangements. © 2015 Wiley Periodicals, Inc.

Alteration of Gene Expression Profile in Kidney of Spontaneously Hypertensive Rats Treated with Protein Hydrolysate of Blue Mussel (Mytilus edulis) by DNA Microarray Analysis

PubMed Central

Feng, Junli; Dai, Zhiyuan; Zhang, Yanping; Meng, Lu; Ye, Jian; Ma, Xuting

2015-01-01

Marine organisms are rich sources of bioactive components, which are often reported to have antihypertensive effects. However, the underlying mechanisms have yet to be fully identified. The aim of this study was to investigate the antihypertensive effect of enzymatic hydrolysis of blue mussel protein (HBMP) in rats. Peptides with in vitro ACE inhibitory activity were purified from HBMP by ultrafiltration, gel filtration chromatography and reversed-phase high performance liquid chromatography. And the amino acid sequences of isolated peptides were estimated to be Val-Trp, Leu-Gly-Trp, and Met-Val-Trp-Thr. To study its in vivo action, spontaneously hypertensive rats (SHRs) were orally administration with high- or low-dose of HBMP for 28 days. Major components of the renin-angiotensin (RAS) system in serum of SHRs from different groups were analyzed, and gene expression profiling were performed in the kidney of SHRs, using the Whole Rat Genome Oligonucleotide Microarray. Results indicated although genes involved in RAS system were not significantly altered, those related to blood coagulation system, cytokine and growth factor, and fatty acids metabolism were remarkablely changed. Several genes which were seldom reported to be implicated in pathogenesis of hypertension also showed significant expression alterations after oral administration of HBMP. These data provided valuable information for our understanding of the molecular mechanisms that underlie the potential antihypertensive activities of HBMP, and will contribute towards increased value-added utilization of blue mussel protein. PMID:26517713

Quantitative characterization of conformational-specific protein-DNA binding using a dual-spectral interferometric imaging biosensor.

PubMed

Zhang, Xirui; Daaboul, George G; Spuhler, Philipp S; Dröge, Peter; Ünlü, M Selim

2016-03-14

DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions.

Quantitative surface-enhanced resonance Raman scattering of phthalocyanine-labelled oligonucleotides

PubMed Central

Macaskill, A.; Chernonosov, A. A.; Koval, V. V.; Lukyanets, E. A.; Fedorova, O. S.; Smith, W. E.; Faulds, K.; Graham, D.

2007-01-01

The evaluation of phthalocyanine labels for the surface-enhanced resonance Raman scattering (SERRS) detection of oligonucleotides is reported. Three phthalocyanine-labelled oligonucleotides were assessed, each containing a different metal centre. Detection limits for each labelled oligonucleotide were determined using two excitation frequencies where possible. Limits of detection as low as 2.8 × 10−11 mol. dm−3 were obtained which are comparable to standard fluorescently labelled probes used in previous SERRS studies. The identification of two phthalocyanine-labelled oligonucleotides without separation was also demonstrated indicating their suitability for multiplexing. This study extends the range of labels suitable for quantitative surface-enhanced resonance Raman scattering with silver nanoparticles and offers more flexibility and choice when considering SERRS for quantitative DNA detection. PMID:17289751

Development of species-specific rDNA probes for Giardia by multiple fluorescent in situ hybridization combined with immunocytochemical identification of cyst wall antigens.

PubMed

Erlandsen, Stanley L; Jarroll, Edward; Wallis, Peter; van Keulen, Harry

2005-08-01

In this study, we describe the development of fluorescent oligonucleotide probes to variable regions in the small subunit of 16S rRNA in three distinct Giardia species. Sense and antisense probes (17-22 mer) to variable regions 1, 3, and 8 were labeled with digoxygenin or selected fluorochomes (FluorX, Cy3, or Cy5). Optimal results were obtained with fluorochome-labeled oligonucleotides for detection of rRNA in Giardia cysts. Specificity of fluorescent in situ hybridization (FISH) was shown using RNase digestion and high stringency to diminish the hybridization signal, and oligonucleotide probes for rRNA in Giardia lamblia, Giardia muris, and Giardia ardeae were shown to specifically stain rRNA only within cysts or trophozoites of those species. The fluorescent oligonucleotide specific for rRNA in human isolates of Giardia was positive for ten different strains. A method for simultaneous FISH detection of cysts using fluorescent antibody (genotype marker) and two oligonucleotide probes (species marker) permitted visualization of G. lamblia and G. muris cysts in the same preparation. Testing of an environmental water sample revealed the presence of FISH-positive G. lamblia cysts with a specific rDNA probe for rRNA, while negative cysts were presumed to be of animal or bird origin.

Plastic Polymers for Efficient DNA Microarray Hybridization: Application to Microbiological Diagnostics▿

PubMed Central

Zhao, Zhengshan; Peytavi, Régis; Diaz-Quijada, Gerardo A.; Picard, Francois J.; Huletsky, Ann; Leblanc, Éric; Frenette, Johanne; Boivin, Guy; Veres, Teodor; Dumoulin, Michel M.; Bergeron, Michel G.

2008-01-01

Fabrication of microarray devices using traditional glass slides is not easily adaptable to integration into microfluidic systems. There is thus a need for the development of polymeric materials showing a high hybridization signal-to-background ratio, enabling sensitive detection of microbial pathogens. We have developed such plastic supports suitable for highly sensitive DNA microarray hybridizations. The proof of concept of this microarray technology was done through the detection of four human respiratory viruses that were amplified and labeled with a fluorescent dye via a sensitive reverse transcriptase PCR (RT-PCR) assay. The performance of the microarray hybridization with plastic supports made of PMMA [poly(methylmethacrylate)]-VSUVT or Zeonor 1060R was compared to that with high-quality glass slide microarrays by using both passive and microfluidic hybridization systems. Specific hybridization signal-to-background ratios comparable to that obtained with high-quality commercial glass slides were achieved with both polymeric substrates. Microarray hybridizations demonstrated an analytical sensitivity equivalent to approximately 100 viral genome copies per RT-PCR, which is at least 100-fold higher than the sensitivities of previously reported DNA hybridizations on plastic supports. Testing of these plastic polymers using a microfluidic microarray hybridization platform also showed results that were comparable to those with glass supports. In conclusion, PMMA-VSUVT and Zeonor 1060R are both suitable for highly sensitive microarray hybridizations. PMID:18784318

Development and application of a microarray meter tool to optimize microarray experiments

PubMed Central

Rouse, Richard JD; Field, Katrine; Lapira, Jennifer; Lee, Allen; Wick, Ivan; Eckhardt, Colleen; Bhasker, C Ramana; Soverchia, Laura; Hardiman, Gary

2008-01-01

Background Successful microarray experimentation requires a complex interplay between the slide chemistry, the printing pins, the nucleic acid probes and targets, and the hybridization milieu. Optimization of these parameters and a careful evaluation of emerging slide chemistries are a prerequisite to any large scale array fabrication effort. We have developed a 'microarray meter' tool which assesses the inherent variations associated with microarray measurement prior to embarking on large scale projects. Findings The microarray meter consists of nucleic acid targets (reference and dynamic range control) and probe components. Different plate designs containing identical probe material were formulated to accommodate different robotic and pin designs. We examined the variability in probe quality and quantity (as judged by the amount of DNA printed and remaining post-hybridization) using three robots equipped with capillary printing pins. Discussion The generation of microarray data with minimal variation requires consistent quality control of the (DNA microarray) manufacturing and experimental processes. Spot reproducibility is a measure primarily of the variations associated with printing. The microarray meter assesses array quality by measuring the DNA content for every feature. It provides a post-hybridization analysis of array quality by scoring probe performance using three metrics, a) a measure of variability in the signal intensities, b) a measure of the signal dynamic range and c) a measure of variability of the spot morphologies. PMID:18710498

Genetic spell-checking: gene editing using single-stranded DNA oligonucleotides.

PubMed

Rivera-Torres, Natalia; Kmiec, Eric B

2016-02-01

Single-stranded oligonucleotides (ssODNs) can be used to direct the exchange of a single nucleotide or the repair of a single base within the coding region of a gene in a process that is known, generically, as gene editing. These molecules are composed of either all DNA residues or a mixture of RNA and DNA bases and utilize inherent metabolic functions to execute the genetic alteration within the context of a chromosome. The mechanism of action of gene editing is now being elucidated as well as an understanding of its regulatory circuitry, work that has been particularly important in establishing a foundation for designing effective gene editing strategies in plants. Double-strand DNA breakage and the activation of the DNA damage response pathway play key roles in determining the frequency with which gene editing activity takes place. Cellular regulators respond to such damage and their action impacts the success or failure of a particular nucleotide exchange reaction. A consequence of such activation is the natural slowing of replication fork progression, which naturally creates a more open chromatin configuration, thereby increasing access of the oligonucleotide to the DNA template. Herein, how critical reaction parameters influence the effectiveness of gene editing is discussed. Functional interrelationships between DNA damage, the activation of DNA response pathways and the stalling of replication forks are presented in detail as potential targets for increasing the frequency of gene editing by ssODNs in plants and plant cells. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Biorecognition by DNA oligonucleotides after Exposure to Photoresists and Resist Removers

PubMed Central

Dean, Stacey L.; Morrow, Thomas J.; Patrick, Sue; Li, Mingwei; Clawson, Gary; Mayer, Theresa S.; Keating, Christine D.

2013-01-01

Combining biological molecules with integrated circuit technology is of considerable interest for next generation sensors and biomedical devices. Current lithographic microfabrication methods, however, were developed for compatibility with silicon technology rather than bioorganic molecules and consequently it cannot be assumed that biomolecules will remain attached and intact during on-chip processing. Here, we evaluate the effects of three common photoresists (Microposit S1800 series, PMGI SF6, and Megaposit SPR 3012) and two photoresist removers (acetone and 1165 remover) on the ability of surface-immobilized DNA oligonucleotides to selectively recognize their reverse-complementary sequence. Two common DNA immobilization methods were compared: adsorption of 5′-thiolated sequences directly to gold nanowires and covalent attachment of 5′-thiolated sequences to surface amines on silica coated nanowires. We found that acetone had deleterious effects on selective hybridization as compared to 1165 remover, presumably due to incomplete resist removal. Use of the PMGI photoresist, which involves a high temperature bake step, was detrimental to the later performance of nanowire-bound DNA in hybridization assays, especially for DNA attached via thiol adsorption. The other three photoresists did not substantially degrade DNA binding capacity or selectivity for complementary DNA sequences. To determine if the lithographic steps caused more subtle damage, we also tested oligonucleotides containing a single base mismatch. Finally, a two-step photolithographic process was developed and used in combination with dielectrophoretic nanowire assembly to produce an array of doubly-contacted, electrically isolated individual nanowire components on a chip. Post-fabrication fluorescence imaging indicated that nanowire-bound DNA was present and able to selectively bind complementary strands. PMID:23952639

APPLICATION OF CDNA MICROARRAY TECHNOLOGY TO IN VITRO TOXICOLOGY AND THE SELECTION OF GENES FOR A REAL TIME RT-PCR-BASED SCREEN FOR OXIDATIVE STRESS IN HEP-G2 CELLS

EPA Science Inventory

Large-scale analysis of gene expression using cDNA microarrays promises the
rapid detection of the mode of toxicity for drugs and other chemicals. cDNA
microarrays were used to examine chemically-induced alterations of gene
expression in HepG2 cells exposed to oxidative ...

Use of continuous/contiguous stacking hybridization as a diagnostic tool

DOEpatents

Mirzabekov, Andrei Darievich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Dubiley, Svetlana Alekseevna

2002-01-01

A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. A method is also provided for determining the length of a repeat sequence in DNA or RNA, and also for determining the base sequence of unknown DNA or RNA.

Use of continuous/contiguous stacking hybridization as a diagnostic tool

DOEpatents

Mirzabekov, Andrei Darievich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Dubiley, Svetlana Alekseevna

2000-01-01

A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. A method is also provided for determining the length of a repeat sequence in DNA or RNA, and also for determining the base sequence of unknown DNA or RNA.

DNA Microarray Detection of 18 Important Human Blood Protozoan Species

PubMed Central

Chen, Jun-Hu; Feng, Xin-Yu; Chen, Shao-Hong; Cai, Yu-Chun; Lu, Yan; Zhou, Xiao-Nong; Chen, Jia-Xu; Hu, Wei

2016-01-01

Background Accurate detection of blood protozoa from clinical samples is important for diagnosis, treatment and control of related diseases. In this preliminary study, a novel DNA microarray system was assessed for the detection of Plasmodium, Leishmania, Trypanosoma, Toxoplasma gondii and Babesia in humans, animals, and vectors, in comparison with microscopy and PCR data. Developing a rapid, simple, and convenient detection method for protozoan detection is an urgent need. Methodology/Principal Findings The microarray assay simultaneously identified 18 species of common blood protozoa based on the differences in respective target genes. A total of 20 specific primer pairs and 107 microarray probes were selected according to conserved regions which were designed to identify 18 species in 5 blood protozoan genera. The positive detection rate of the microarray assay was 91.78% (402/438). Sensitivity and specificity for blood protozoan detection ranged from 82.4% (95%CI: 65.9% ~ 98.8%) to 100.0% and 95.1% (95%CI: 93.2% ~ 97.0%) to 100.0%, respectively. Positive predictive value (PPV) and negative predictive value (NPV) ranged from 20.0% (95%CI: 2.5% ~ 37.5%) to 100.0% and 96.8% (95%CI: 95.0% ~ 98.6%) to 100.0%, respectively. Youden index varied from 0.82 to 0.98. The detection limit of the DNA microarrays ranged from 200 to 500 copies/reaction, similar to PCR findings. The concordance rate between microarray data and DNA sequencing results was 100%. Conclusions/Significance Overall, the newly developed microarray platform provides a convenient, highly accurate, and reliable clinical assay for the determination of blood protozoan species. PMID:27911895

Resolving prokaryotic taxonomy without rRNA: longer oligonucleotide word lengths improve genome and metagenome taxonomic classification.

PubMed

Alsop, Eric B; Raymond, Jason

2013-01-01

Oligonucleotide signatures, especially tetranucleotide signatures, have been used as method for homology binning by exploiting an organism's inherent biases towards the use of specific oligonucleotide words. Tetranucleotide signatures have been especially useful in environmental metagenomics samples as many of these samples contain organisms from poorly classified phyla which cannot be easily identified using traditional homology methods, including NCBI BLAST. This study examines oligonucleotide signatures across 1,424 completed genomes from across the tree of life, substantially expanding upon previous work. A comprehensive analysis of mononucleotide through nonanucleotide word lengths suggests that longer word lengths substantially improve the classification of DNA fragments across a range of sizes of relevance to high throughput sequencing. We find that, at present, heptanucleotide signatures represent an optimal balance between prediction accuracy and computational time for resolving taxonomy using both genomic and metagenomic fragments. We directly compare the ability of tetranucleotide and heptanucleotide world lengths (tetranucleotide signatures are the current standard for oligonucleotide word usage analyses) for taxonomic binning of metagenome reads. We present evidence that heptanucleotide word lengths consistently provide more taxonomic resolving power, particularly in distinguishing between closely related organisms that are often present in metagenomic samples. This implies that longer oligonucleotide word lengths should replace tetranucleotide signatures for most analyses. Finally, we show that the application of longer word lengths to metagenomic datasets leads to more accurate taxonomic binning of DNA scaffolds and have the potential to substantially improve taxonomic assignment and assembly of metagenomic data.

Manipulation of oligonucleotides immobilized on solid supports - DNA computations on surfaces

NASA Astrophysics Data System (ADS)

Liu, Qinghua

The manipulation of DNA oligonucleotides immobilized on various solid supports has been studied intensively, especially in the area of surface hybridization. Recently, surface-based biotechnology has been applied to the area of molecular computing. These surface-based methods have advantages with regard to ease of handling, facile purification, and less interference when compared to solution methodologies. This dissertation describes the investigation of molecular approaches to DNA computing. The feasibility of encoding a bit (0 or 1) of information for DNA-based computations at the single nucleotide level was studied, particularly with regard to the efficiency and specificity of hybridization discrimination. Both gold and glass surfaces, with addressed arrays of 32 oligonucleotides, were employed with similar hybridization results. Although single-base discrimination may be achieved in the system, it is at the cost of a severe decrease in the efficiency of hybridization to perfectly matched sequences. This compromises the utility of single nucleotide encoding for DNA computing applications in the absence of some additional mechanism for increasing specificity. Several methods are suggested including a multiple-base encoding strategy. The multiple-base encoding strategy was employed to develop a prototype DNA computer. The approach was demonstrated by solving a small example of the Satisfiability (SAT) problem, an NP-complete problem in Boolean logic. 16 distinct DNA oligonucleotides, encoding all candidate solutions to the 4-variable-4-clause-3-SAT problem, were immobilized on a gold surface in the non-addressed format. Four cycles of MARK (hybridization), DESTROY (enzymatic destruction) and UNMARK (denaturation) were performed, which identified and eliminated members of the set which were not solutions to the problem. Determination of the answer was accomplished in the READOUT (sequence identification) operation by PCR amplification of the remaining molecules and hybridization to an addressed array. Four answers were determined and the S/N ratio between correct and incorrect solutions ranged from 10 to 777, making discrimination between correct and incorrect solutions to the problem straightforward. Additionally, studies of enzymatic manipulations of DNA molecules on surfaces suggested the use of E. coli Exonuclease I (Exo I) and perhaps EarI in the DESTROY operation.

NDI and DAN DNA: nucleic acid-directed assembly of NDI and DAN.

PubMed

Ikkanda, Brian A; Samuel, Stevan A; Iverson, Brent L

2014-03-07

Two novel DNA base surrogate phosphoramidites 1 and 2, based upon relatively electron-rich 1,5-dialkoxynaphthalene (DAN) and relatively electron-deficient 1,4,5,8-naphthalenetetracarboxylic diimide (NDI), respectively, were designed, synthesized, and incorporated into DNA oligonucleotide strands. The DAN and NDI artificial DNA bases were inserted within a three-base-pair region within the interior of a 12-mer oligonucleotide duplex in various sequential arrangements and investigated with CD spectroscopy and UV melting curve analysis. The CD spectra of the modified duplexes indicated B-form DNA topology. Melting curve analyses revealed trends in DNA duplex stability that correlate with the known association of DAN and NDI moieties in aqueous solution as well as the known favorable interactions between NDI and natural DNA base pairs. This demonstrates that DNA duplex stability and specificity can be driven by the electrostatic complementarity between DAN and NDI. In the most favorable case, an NDI-DAN-NDI arrangement in the middle of the DNA duplex was found to be approximately as stabilizing as three A-T base pairs.

Molecular Biology and Prevention of Endometrial Cancer

DTIC Science & Technology

2009-07-01

us time to complete the study. Aim 2: To analyze vaginal and cervical adenocarcinomas , that have arisen in women exposed to DES in- utero , for...therapy. Methods: 1) Oligonucleotide microarray analysis was performed on a panel of endometrial cancers. 2) A subset of adenocarcinoma cases...from the International DES Registry (IDESR) was analyzed for MSI 3) A case-control study of the CASH database was performed to evaluate the

Combination of ICP-MS, capillary electrophoresis, and their hyphenation for probing Ru(III) metallodrug-DNA interactions.

PubMed

Foteeva, Lidia S; Matczuk, Magdalena; Pawlak, Katarzyna; Aleksenko, Svetlana S; Nosenko, Sergey V; Karandashev, Vasily K; Jarosz, Maciej; Timerbaev, Andrei R

2017-03-01

Determination of the DNA-binding reactivity and affinity is an important part of a successful program for the selection of metallodrug candidates. For such assaying, a range of complementary analytical techniques was proposed and tested here using one of few anticancer metal-based drugs that are currently in clinical trials, indazolium trans-[tetrachloridobis(1H-indazole)ruthenate(III), and a DNA oligonucleotide. A high reactivity of the Ru drug was confirmed in affinity capillary electrophoresis (CE) mode, where adduct formation takes place in situ (i.e., in the capillary filled with an oligonucleotide-containing electrolyte). To further characterize the binding kinetics, a drug-oligonucleotide mixture was incubated for a different period of time, followed by ultrafiltration separation into two different in molecular weight fractions (>3 and <3 kDa). The time-dependent distribution profiles of the Ru drug were then assessed by CE-inductively coupled plasma mass spectrometry (ICP-MS), revealing that at least two DNA adducts exist at equilibrium conditions. Using standalone ICP-MS, dominant equilibrium amount of the bound ruthenium was found to occur in a fraction of 5-10 kDa, which includes the oligonucleotide (ca. 6 kDa). Importantly, in all three assays, the drug was used for the first time in in-vitro studies, not in the intact form but as its active species released from the transferrin adduct at simulated cancer cytosolic conditions. This circumstance makes the established analytical platform promising to provide a detailed view on metallodrug targeting, including other possible biomolecules and ex vivo samples.

BIOPHYSICAL PROPERTIES OF NUCLEIC ACIDS AT SURFACES RELEVANT TO MICROARRAY PERFORMANCE

PubMed Central

Rao, Archana N.; Grainger, David W.

2014-01-01

Both clinical and analytical metrics produced by microarray-based assay technology have recognized problems in reproducibility, reliability and analytical sensitivity. These issues are often attributed to poor understanding and control of nucleic acid behaviors and properties at solid-liquid interfaces. Nucleic acid hybridization, central to DNA and RNA microarray formats, depends on the properties and behaviors of single strand (ss) nucleic acids (e.g., probe oligomeric DNA) bound to surfaces. ssDNA’s persistence length, radius of gyration, electrostatics, conformations on different surfaces and under various assay conditions, its chain flexibility and curvature, charging effects in ionic solutions, and fluorescent labeling all influence its physical chemistry and hybridization under assay conditions. Nucleic acid (e.g., both RNA and DNA) target interactions with immobilized ssDNA strands are highly impacted by these biophysical states. Furthermore, the kinetics, thermodynamics, and enthalpic and entropic contributions to DNA hybridization reflect global probe/target structures and interaction dynamics. Here we review several biophysical issues relevant to oligomeric nucleic acid molecular behaviors at surfaces and their influences on duplex formation that influence microarray assay performance. Correlation of biophysical aspects of single and double-stranded nucleic acids with their complexes in bulk solution is common. Such analysis at surfaces is not commonly reported, despite its importance to microarray assays. We seek to provide further insight into nucleic acid-surface challenges facing microarray diagnostic formats that have hindered their clinical adoption and compromise their research quality and value as genomics tools. PMID:24765522

A DNA microarray-based assay to detect dual infection with two dengue virus serotypes.

PubMed

Díaz-Badillo, Alvaro; Muñoz, María de Lourdes; Perez-Ramirez, Gerardo; Altuzar, Victor; Burgueño, Juan; Mendoza-Alvarez, Julio G; Martínez-Muñoz, Jorge P; Cisneros, Alejandro; Navarrete-Espinosa, Joel; Sanchez-Sinencio, Feliciano

2014-04-25

Here; we have described and tested a microarray based-method for the screening of dengue virus (DENV) serotypes. This DNA microarray assay is specific and sensitive and can detect dual infections with two dengue virus serotypes and single-serotype infections. Other methodologies may underestimate samples containing more than one serotype. This technology can be used to discriminate between the four DENV serotypes. Single-stranded DNA targets were covalently attached to glass slides and hybridised with specific labelled probes. DENV isolates and dengue samples were used to evaluate microarray performance. Our results demonstrate that the probes hybridized specifically to DENV serotypes; with no detection of unspecific signals. This finding provides evidence that specific probes can effectively identify single and double infections in DENV samples.

A DNA Microarray-Based Assay to Detect Dual Infection with Two Dengue Virus Serotypes

PubMed Central

Díaz-Badillo, Alvaro; de Lourdes Muñoz, María; Perez-Ramirez, Gerardo; Altuzar, Victor; Burgueño, Juan; Mendoza-Alvarez, Julio G.; Martínez-Muñoz, Jorge P.; Cisneros, Alejandro; Navarrete-Espinosa, Joel; Sanchez-Sinencio, Feliciano

2014-01-01

Here; we have described and tested a microarray based-method for the screening of dengue virus (DENV) serotypes. This DNA microarray assay is specific and sensitive and can detect dual infections with two dengue virus serotypes and single-serotype infections. Other methodologies may underestimate samples containing more than one serotype. This technology can be used to discriminate between the four DENV serotypes. Single-stranded DNA targets were covalently attached to glass slides and hybridised with specific labelled probes. DENV isolates and dengue samples were used to evaluate microarray performance. Our results demonstrate that the probes hybridized specifically to DENV serotypes; with no detection of unspecific signals. This finding provides evidence that specific probes can effectively identify single and double infections in DENV samples. PMID:24776933

Measuring DNA hybridization using fluorescent DNA-stabilized silver clusters to investigate mismatch effects on therapeutic oligonucleotides.

PubMed

de Bruin, Donny; Bossert, Nelli; Aartsma-Rus, Annemieke; Bouwmeester, Dirk

2018-04-06

Short nucleic acid oligomers have found a wide range of applications in experimental physics, biology and medicine, and show potential for the treatment of acquired and genetic diseases. These applications rely heavily on the predictability of hybridization through Watson-Crick base pairing to allow positioning on a nanometer scale, as well as binding to the target transcripts, but also off-target binding to transcripts with partial homology. These effects are of particular importance in the development of therapeutic oligonucleotides, where off-target effects caused by the binding of mismatched sequences need to be avoided. We employ a novel method of probing DNA hybridization using optically active DNA-stabilized silver clusters (Ag-DNA) to measure binding efficiencies through a change in fluorescence intensity. In this way we can determine their location-specific sensitivity to individual mismatches in the sequence. The results reveal a strong dependence of the hybridization on the location of the mismatch, whereby mismatches close to the edges and center show a relatively minor impact. In parallel, we propose a simple model for calculating the annealing ratios of mismatched DNA sequences, which supports our experimental results. The primary result shown in this work is a demonstration of a novel technique to measure DNA hybridization using fluorescent Ag-DNA. With this technique, we investigated the effect of mismatches on the hybridization efficiency, and found a significant dependence on the location of individual mismatches. These effects are strongly influenced by the length of the used oligonucleotides. The novel probe method based on fluorescent Ag-DNA functions as a reliable tool in measuring this behavior. As a secondary result, we formulated a simple model that is consistent with the experimental data.

Systematic evaluation and optimization of modification reactions of oligonucleotides with amines and carboxylic acids for the synthesis of DNA-encoded chemical libraries.

PubMed

Franzini, Raphael M; Samain, Florent; Abd Elrahman, Maaly; Mikutis, Gediminas; Nauer, Angela; Zimmermann, Mauro; Scheuermann, Jörg; Hall, Jonathan; Neri, Dario

2014-08-20

DNA-encoded chemical libraries are collections of small molecules, attached to DNA fragments serving as identification barcodes, which can be screened against multiple protein targets, thus facilitating the drug discovery process. The preparation of large DNA-encoded chemical libraries crucially depends on the availability of robust synthetic methods, which enable the efficient conjugation to oligonucleotides of structurally diverse building blocks, sharing a common reactive group. Reactions of DNA derivatives with amines and/or carboxylic acids are particularly attractive for the synthesis of encoded libraries, in view of the very large number of building blocks that are commercially available. However, systematic studies on these reactions in the presence of DNA have not been reported so far. We first investigated conditions for the coupling of primary amines to oligonucleotides, using either a nucleophilic attack on chloroacetamide derivatives or a reductive amination on aldehyde-modified DNA. While both methods could be used for the production of secondary amines, the reductive amination approach was generally associated with higher yields and better purity. In a second endeavor, we optimized conditions for the coupling of a diverse set of 501 carboxylic acids to DNA derivatives, carrying primary and secondary amine functions. The coupling efficiency was generally higher for primary amines, compared to secondary amine substituents, but varied considerably depending on the structure of the acids and on the synthetic methods used. Optimal reaction conditions could be found for certain sets of compounds (with conversions >80%), but multiple reaction schemes are needed when assembling large libraries with highly diverse building blocks. The reactions and experimental conditions presented in this article should facilitate the synthesis of future DNA-encoded chemical libraries, while outlining the synthetic challenges that remain to be overcome.

Site-directed DNA crosslinking of large multisubunit protein-DNA complexes.

PubMed

Persinger, Jim; Bartholomew, Blaine

2009-01-01

Several methods have been developed to site-specifically incorporate photoreactive nucleotide analogs into DNA for the purpose of identifying the proteins and their domains that are in contact with particular regions of DNA. The synthesis of several deoxynucleotide analogs that have a photoreactive group tethered to the nucleotide base and the incorporation of these analogs into DNA are described. In a second approach, oligonucleotide with a photoreactive group attached to the phosphate backbone is chemically synthesized. The photoreactive oligonucleotide is then enzymatically incorporated into DNA by annealing it to a complementary DNA template and extending with DNA polymerase. Both approaches have been effectively used to map protein-DNA interactions in large multisubunit complexes such as the eukaryotic transcription or ATP-dependent chromatin remodeling complexes. Not only do these techniques map the binding sites of the various subunits in these complexes, but when coupled with peptide mapping also determine the protein domain that is in close proximity to the different DNA sites. The strength of these techniques is the ability to scan a large number of potential sites by making combinations of different DNA probes and is facilitated by using an immobilized DNA template for synthesis.

A fiber optic biosensor for fluorimetric detection of triple-helical DNA.

PubMed

Uddin, A H; Piunno, P A; Hudson, R H; Damha, M J; Krull, U J

1997-10-15

A fiber optic biosensor was used for the fluorimetric detection of T/AT triple-helical DNA formation. The surfaces of two sets of fused silica optical fibers were functionalized with hexaethylene oxide linkers from which decaadenylic acid oligonucleotides were grown in the 3'to 5'and 5'to 3'direction, respectively, using a DNA synthesizer. Fluorescence studies of hybridization showed unequivocal hybridization between oligomers immobilized on the fibers and complementary oligonucleotides from the solution phase, as detected by fluorescence from intercalated ethidium bromide. The complementary oligonucleotide, dT10, which was expected to Watson-Crick hybridize upon cooling the system below the duplex melting temperature ( T m), provided a fluorescence intensity with a negative temperature coefficient. Upon further cooling, to the point where the pyrimidine motif T*AT triple-helix formation occurred, a fluorescence intensity change with a positive temperature coefficient was observed. The reverse-Hoogsteen T.AT triplex, which is known to form with branched nucleic acids, provided a corresponding decrease in fluorescence intensity with decreasing temperature. Full analytical signal evolution was attainable in minutes.

Analysis of oligonucleotide photoproducts produced by UV-A light and a riboflavin photosensitizer

NASA Astrophysics Data System (ADS)

Gelhaus, Stacy L.; LaCourse, William R.

2004-12-01

DNA damage is caused by a variety of foreign and endogenous compounds. There are endogenous photosensitizers in cells, such as porphyrins and flavins, which may create damage in the presence of UV-A light. Typically, samples are analyzed by 32P-postlabelling and electrophoretic separation or by LC-MS separation and detection. Separation by HPLC is common; however, in all instances, the DNA sample is hydrolyzed down to nucleosides prior to analysis. It will be shown here that ion-pairing reversed phase high performance liquid chromatography (IP-RPLC) has the ability to provide biophysical information concerning the sites of UV-A induced photosensitizer damage on an intact oligonucleotide concurrent with the separation. IP-RPLC is less labor intensive and faster than electrophoretic methods and it is less costly than LC-MS. IP-RPLC can also be used to purify modified oligonucleotides for further use and analysis. This technique is sensitive to the charge, conformation, and sequence characteristics of the nucleic acid sample and may be used to determine the damage or modifications made to DNA by a variety of compounds.

Oligonucleotide microarray analysis of gene expression profiles followed by real-time reverse-transcriptase polymerase chain reaction assay in chronic active Epstein-Barr virus infection.

PubMed

Ito, Yoshinori; Shibata-Watanabe, Yukiko; Ushijima, Yoko; Kawada, Jun-Ichi; Nishiyama, Yukihiro; Kojima, Seiji; Kimura, Hiroshi

2008-03-01

Chronic active Epstein-Barr virus infection (CAEBV) is characterized by recurrent infectious mononucleosis-like symptoms and has high mortality and morbidity. To clarify the mechanisms of CAEBV, the gene-expression profiles of peripheral blood obtained from patients with CAEBV were investigated. Twenty genes were differentially expressed in 4 patients with CAEBV. This microarray result was verified using a real-time reverse-transcriptase polymerase chain reaction assay in a larger group of patients with CAEBV. Eventually, 3 genes were found to be significantly upregulated: guanylate binding protein 1, tumor necrosis factor-induced protein 6, and guanylate binding protein 5. These genes may be associated with the inflammatory reaction or with cell proliferation.

Quantitative characterization of conformational-specific protein-DNA binding using a dual-spectral interferometric imaging biosensor

NASA Astrophysics Data System (ADS)

Zhang, Xirui; Daaboul, George G.; Spuhler, Philipp S.; Dröge, Peter; Ünlü, M. Selim

2016-03-01

DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions.DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions. Electronic supplementary information (ESI) available: DNA sequences and nomenclature (Table 1S); SDS-PAGE assay of IHF stock solution (Fig. 1S); determination of the concentration of IHF stock solution by Bradford assay (Fig. 2S); equilibrium binding isotherm fitting results of other DNA sequences (Table 2S); calculation of dissociation constants (Fig. 3S, 4S; Table 2S); geometric model for quantitation of DNA bending angle induced by specific IHF binding (Fig. 4S); customized flow cell assembly (Fig. 5S); real-time measurement of average fluorophore height change by SSFM (Fig. 6S); summary of binding parameters obtained from additive isotherm model fitting (Table 3S); average surface densities of 10 dsDNA spots and bound IHF at equilibrium (Table 4S); effects of surface densities on the binding and bending of dsDNA (Tables 5S, 6S and Fig. 7S-10S). See DOI: 10.1039/c5nr06785e

AFM 4.0: a toolbox for DNA microarray analysis

PubMed Central

Breitkreutz, Bobby-Joe; Jorgensen, Paul; Breitkreutz, Ashton; Tyers, Mike

2001-01-01

We have developed a series of programs, collectively packaged as Array File Maker 4.0 (AFM), that manipulate and manage DNA microarray data. AFM 4.0 is simple to use, applicable to any organism or microarray, and operates within the familiar confines of Microsoft Excel. Given a database of expression ratios, AFM 4.0 generates input files for clustering, helps prepare colored figures and Venn diagrams, and can uncover aneuploidy in yeast microarray data. AFM 4.0 should be especially useful to laboratories that do not have access to specialized commercial or in-house software. PMID:11532221

Progress in the application of DNA microarrays.

PubMed Central

Lobenhofer, E K; Bushel, P R; Afshari, C A; Hamadeh, H K

2001-01-01

Microarray technology has been applied to a variety of different fields to address fundamental research questions. The use of microarrays, or DNA chips, to study the gene expression profiles of biologic samples began in 1995. Since that time, the fundamental concepts behind the chip, the technology required for making and using these chips, and the multitude of statistical tools for analyzing the data have been extensively reviewed. For this reason, the focus of this review will be not on the technology itself but on the application of microarrays as a research tool and the future challenges of the field. PMID:11673116

SPERM RNA AMPLIFICATION FOR GENE EXPRESSION PROFILING BY DNA MICROARRAY TECHNOLOGY

EPA Science Inventory

Sperm RNA Amplification for Gene Expression Profiling by DNA Microarray Technology
Hongzu Ren, Kary E. Thompson, Judith E. Schmid and David J. Dix, Reproductive Toxicology Division, NHEERL, Office of Research and Development, US Environmental Protection Agency, Research Triang...

Development of DNA Microarrays for Metabolic Pathway and Bioprocess Monitoring

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gregory Stephanopoulos

Transcriptional profiling experiments utilizing DNA microarrays to study the intracellular accumulation of PHB in Synechocystis has proved difficult in large part because strains that show significant differences in PHB which would justify global analysis of gene expression have not been isolated.

Comparison of innovative molecular approaches and standard spore assays for assessment of surface cleanliness.

PubMed

Cooper, Moogega; La Duc, Myron T; Probst, Alexander; Vaishampayan, Parag; Stam, Christina; Benardini, James N; Piceno, Yvette M; Andersen, Gary L; Venkateswaran, Kasthuri

2011-08-01

A bacterial spore assay and a molecular DNA microarray method were compared for their ability to assess relative cleanliness in the context of bacterial abundance and diversity on spacecraft surfaces. Colony counts derived from the NASA standard spore assay were extremely low for spacecraft surfaces. However, the PhyloChip generation 3 (G3) DNA microarray resolved the genetic signatures of a highly diverse suite of microorganisms in the very same sample set. Samples completely devoid of cultivable spores were shown to harbor the DNA of more than 100 distinct microbial phylotypes. Furthermore, samples with higher numbers of cultivable spores did not necessarily give rise to a greater microbial diversity upon analysis with the DNA microarray. The findings of this study clearly demonstrated that there is not a statistically significant correlation between the cultivable spore counts obtained from a sample and the degree of bacterial diversity present. Based on these results, it can be stated that validated state-of-the-art molecular techniques, such as DNA microarrays, can be utilized in parallel with classical culture-based methods to further describe the cleanliness of spacecraft surfaces.

DNA-programmable nanoparticle crystallization.

PubMed

Park, Sung Yong; Lytton-Jean, Abigail K R; Lee, Byeongdu; Weigand, Steven; Schatz, George C; Mirkin, Chad A

2008-01-31

It was first shown more than ten years ago that DNA oligonucleotides can be attached to gold nanoparticles rationally to direct the formation of larger assemblies. Since then, oligonucleotide-functionalized nanoparticles have been developed into powerful diagnostic tools for nucleic acids and proteins, and into intracellular probes and gene regulators. In contrast, the conceptually simple yet powerful idea that functionalized nanoparticles might serve as basic building blocks that can be rationally assembled through programmable base-pairing interactions into highly ordered macroscopic materials remains poorly developed. So far, the approach has mainly resulted in polymerization, with modest control over the placement of, the periodicity in, and the distance between particles within the assembled material. That is, most of the materials obtained thus far are best classified as amorphous polymers, although a few examples of colloidal crystal formation exist. Here, we demonstrate that DNA can be used to control the crystallization of nanoparticle-oligonucleotide conjugates to the extent that different DNA sequences guide the assembly of the same type of inorganic nanoparticle into different crystalline states. We show that the choice of DNA sequences attached to the nanoparticle building blocks, the DNA linking molecules and the absence or presence of a non-bonding single-base flexor can be adjusted so that gold nanoparticles assemble into micrometre-sized face-centred-cubic or body-centred-cubic crystal structures. Our findings thus clearly demonstrate that synthetically programmable colloidal crystallization is possible, and that a single-component system can be directed to form different structures.

Universal strategies for the DNA-encoding of libraries of small molecules using the chemical ligation of oligonucleotide tags

PubMed Central

Litovchick, Alexander; Clark, Matthew A; Keefe, Anthony D

2014-01-01

The affinity-mediated selection of large libraries of DNA-encoded small molecules is increasingly being used to initiate drug discovery programs. We present universal methods for the encoding of such libraries using the chemical ligation of oligonucleotides. These methods may be used to record the chemical history of individual library members during combinatorial synthesis processes. We demonstrate three different chemical ligation methods as examples of information recording processes (writing) for such libraries and two different cDNA-generation methods as examples of information retrieval processes (reading) from such libraries. The example writing methods include uncatalyzed and Cu(I)-catalyzed alkyne-azide cycloadditions and a novel photochemical thymidine-psoralen cycloaddition. The first reading method “relay primer-dependent bypass” utilizes a relay primer that hybridizes across a chemical ligation junction embedded in a fixed-sequence and is extended at its 3′-terminus prior to ligation to adjacent oligonucleotides. The second reading method “repeat-dependent bypass” utilizes chemical ligation junctions that are flanked by repeated sequences. The upstream repeat is copied prior to a rearrangement event during which the 3′-terminus of the cDNA hybridizes to the downstream repeat and polymerization continues. In principle these reading methods may be used with any ligation chemistry and offer universal strategies for the encoding (writing) and interpretation (reading) of DNA-encoded chemical libraries. PMID:25483841

Roles of the amino group of purine bases in the thermodynamic stability of DNA base pairing.

PubMed

Nakano, Shu-ichi; Sugimoto, Naoki

2014-08-05

The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I) and 2'-deoxyribo-2,6-diaminopurine (D) as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G • C > D • T ≈ I • C > A • T > G • T > I • T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

Introduction of structural affinity handles as a tool in selective nucleic acid separations

NASA Technical Reports Server (NTRS)

Willson, III, Richard Coale (Inventor); Cano, Luis Antonio (Inventor)

2011-01-01

The method is used for separating nucleic acids and other similar constructs. It involves selective introduction, enhancement, or stabilization of affinity handles such as single-strandedness in the undesired (or desired) nucleic acids as compared to the usual structure (e.g., double-strandedness) of the desired (or undesired) nucleic acids. The undesired (or desired) nucleic acids are separated from the desired (or undesired) nucleic acids due to capture by methods including but not limited to immobilized metal affinity chromatography, immobilized single-stranded DNA binding (SSB) protein, and immobilized oligonucleotides. The invention is useful to: remove contaminating genomic DNA from plasmid DNA; remove genomic DNA from plasmids, BACs, and similar constructs; selectively separate oligonucleotides and similar DNA fragments from their partner strands; purification of aptamers, (deoxy)-ribozymes and other highly structured nucleic acids; Separation of restriction fragments without using agarose gels; manufacture recombinant Taq polymerase or similar products that are sensitive to host genomic DNA contamination; and other applications.

The detection of HBV DNA with gold-coated iron oxide nanoparticle gene probes

NASA Astrophysics Data System (ADS)

Xi, Dong; Luo, XiaoPing; Lu, QiangHua; Yao, KaiLun; Liu, ZuLi; Ning, Qin

2008-03-01

Gold-coated iron oxide nanoparticle Hepatitis B virus (HBV) DNA probes were prepared, and their application for HBV DNA measurement was studied. Gold-coated iron oxide nanoparticles were prepared by the citrate reduction of tetra-chloroauric acid in the presence of iron oxide nanoparticles which were added as seeds. With a fluorescence-based method, the maximal surface coverage of hexaethiol 30-mer oligonucleotides and the maximal percentage of hybridization strands on gold-coated iron oxide nanoparticles were (120 ± 8) oligonucleotides per nanoparticle, and (14 ± 2%), respectively, which were comparable with those of (132 ± 10) and (22 ± 3%) in Au nanoparticle groups. Large network aggregates were formed when gold-coated iron oxide nanoparticle HBV DNA gene probe was applied to detect HBV DNA molecules as evidenced by transmission electron microscopy and the high specificity was verified by blot hybridization. Our results further suggested that detecting DNA with iron oxide nanoparticles and magnetic separator was feasible and might be an alternative effective method.

Evaluation of the skin irritation using a DNA microarray on a reconstructed human epidermal model.

PubMed

Niwa, Makoto; Nagai, Kanji; Oike, Hideaki; Kobori, Masuko

2009-02-01

To avoid the need to use animals to test the skin irritancy potential of chemicals and cosmetics, it is important to establish an in vitro method based on the reconstructed human epidermal model. To evaluate skin irritancy efficiently and sensitively, we determined the gene expression induced by a topically-applied mild irritant sodium dodecyl sulfate (SDS) in a reconstructed human epidermal model LabCyte EPI-MODEL (LabCyte) using a DNA microarray carrying genes that were related to inflammation, immunity, stress and housekeeping. The expression and secretion of IL-1alpha in reconstructed human epidermal culture is known to be induced by irritation. We detected the induction of IL-1alpha expression and its secretion into the cell culture medium by treatment with 0.075% SDS for 18 h in LabCyte culture using DNA microarray, quantitative reverse-transcription polymerase chain reaction (RT-PCR) and ELISA. DNA microarray analysis indicated that the expression of 10 of the 205 genes carried on the DNA microarray was significantly induced in a LabCyte culture by 0.05% or 0.075% SDS irritation for 18 h. RT-PCR analysis confirmed that SDS treatment significantly induced the expressions of interleukin-1 receptor antagonist (IL-1RN), FOS-like antigen 1 (FOSL1), heat shock 70 kDa protein 1A (HSPA1) and myeloid differentiation primary response gene (88) (MYD88), as well as the known marker genes for irritation IL-1beta and IL-8 in a LabCyte culture. Our results showed that a DNA microarray is a useful tool for efficiently evaluating mild skin irritation using a reconstructed human epidermal model.

Arrhythmogenic right ventricular cardiomyopathy in Boxer dogs is associated with calstabin2 deficiency

PubMed Central

Oyama, Mark A.; Reiken, Steve; Lehnart, Stephan E.; Chittur, Sridar V.; Meurs, Kathryn M.; Stern, Joshua; Marks, Andrew R.

2010-01-01

Objective To examine the presence and effect of calstabin2-deficiency in Boxer dogs with arrhythmogenic right ventricular cardiomyopathy (ARVC). Animals Thirteen Boxer dogs with ARVC. Materials and methods Tissue samples were collected for histopathology, oligonucleotide microarray, PCR, immunoelectrophoresis, ryanodine channel immunoprecipitation and single-channel recordings, and calstabin2 DNA sequencing. Results In cardiomyopathic Boxer dogs, myocardial calstabin2 mRNA and protein were significantly decreased as compared to healthy control dogs (calstabin2 protein normalized to tetrameric cardiac ryanodine receptor (RyR2) complex: affected, 0.51 ± 0.04; control, 3.81 ± 0.22; P < 0.0001). Calstabin2 deficiency in diseased dog hearts was associated with a significantly increased open probability of single RyR2 channels indicating intracellular Ca2+ leak. PCR-based sequencing of the promoter, exonic and splice site regions of the canine calstabin2 gene did not identify any causative mutations. Conclusions Calstabin2 deficiency is a potential mechanism of Ca2+ leak-induced ventricular arrhythmias and heart disease in Boxer dogs with ARVC. PMID:18515204

Estrogen effects on cognition and hippocampal transcription in middle-aged mice.

PubMed

Aenlle, Kristina K; Kumar, Ashok; Cui, Li; Jackson, Travis C; Foster, Thomas C

2009-06-01

Young and middle-aged female mice were ovariectomized and given cyclic injections of either estradiol or vehicle treatments. During the fifth week after surgery the Morris water maze was used to assess cognitive function. Age and treatment effects emerged over the course of spatial training such that middle-aged vehicle treated mice exhibited deficits in acquiring a spatial search strategy compared to younger vehicle treated mice and middle-age estradiol treated mice. Following behavioral characterization, mice were maintained on their injection schedule until week seven and hippocampi were collected 24h after the last injection. Hippocampal RNA was extracted and genes responsive to age and estrogen were identified using cDNA microarrays. Estradiol treatment in middle-aged mice altered the expression of genes related to transcriptional regulation, biosynthesis, growth, neuroprotection, and elements of cell signaling pathways. Expression profiles for representative genes were confirmed in a separate set of animals using oligonucleotide arrays and RT-PCR. Our results indicate that estrogen treatment in middle-aged animals may promote hippocampal health during the aging process.

Drastic stabilization of parallel DNA hybridizations by a polylysine comb-type copolymer with hydrophilic graft chain.

PubMed

Miyoshi, Daisuke; Ueda, Yu-Mi; Shimada, Naohiko; Nakano, Shu-Ichi; Sugimoto, Naoki; Maruyama, Atsushi

2014-09-01

Electrostatic interactions play a major role in protein-DNA interactions. As a model system of a cationic protein, herein we focused on a comb-type copolymer of a polycation backbone and dextran side chains, poly(L-lysine)-graft-dextran (PLL-g-Dex), which has been reported to form soluble interpolyelectrolyte complexes with DNA strands. We investigated the effects of PLL-g-Dex on the conformation and thermodynamics of DNA oligonucleotides forming various secondary structures. Thermodynamic analysis of the DNA structures showed that the parallel conformations involved in both DNA duplexes and triplexes were significantly and specifically stabilized by PLL-g-Dex. On the basis of thermodynamic parameters, it was further possible to design DNA switches that undergo structural transition responding to PLL-g-Dex from an antiparallel duplex to a parallel triplex even with mismatches in the third strand hybridization. These results suggest that polycationic molecules are able to induce structural polymorphism of DNA oligonucleotides, because of the conformation-selective stabilization effects. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Novel DNA lesions generated by the interaction between therapeutic thiopurines and UVA light.

PubMed

Zhang, Xiaohong; Jeffs, Graham; Ren, Xiaolin; O'Donovan, Peter; Montaner, Beatriz; Perrett, Conal M; Karran, Peter; Xu, Yao-Zhong

2007-03-01

The therapeutic effect of the thiopurines, 6-thioguanine (6-TG), 6-mercaptopurine, and its prodrug azathioprine, depends on the incorporation of 6-TG into cellular DNA. Unlike normal DNA bases, 6-TG absorbs UVA radiation, and UVA-mediated photochemical damage of DNA 6-TG has potentially harmful side effects. When free 6-TG is UVA irradiated in solution in the presence of molecular oxygen, reactive oxygen species are generated and 6-TG is oxidized to guanine-6-sulfonate (G(SO3)) and guanine-6-thioguanine in reactions involving singlet oxygen. This conversion is prevented by antioxidants, including the dietary vitamin ascorbate. DNA G(SO3) is also the major photoproduct of 6-TG in DNA and it can be selectively introduced into DNA or oligonucleotides in vitro by mild chemical oxidation. Thermal stability measurements indicate that G(SO3) does not form stable base pairs with any of the normal DNA bases in duplex oligonucleotides and is a powerful block for elongation by Klenow DNA polymerase in primer extension experiments. In cultured human cells, DNA damage produced by 6-TG and UVA treatment is associated with replication inhibition and provokes a p53-dependent DNA damage response.

Rapid and sensitive PCR-dipstick DNA chromatography for multiplex analysis of the oral microbiota.

PubMed

Tian, Lingyang; Sato, Takuichi; Niwa, Kousuke; Kawase, Mitsuo; Tanner, Anne C R; Takahashi, Nobuhiro

2014-01-01

A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.

Rapid and Sensitive PCR-Dipstick DNA Chromatography for Multiplex Analysis of the Oral Microbiota

PubMed Central

Niwa, Kousuke; Kawase, Mitsuo; Tanner, Anne C. R.; Takahashi, Nobuhiro

2014-01-01

A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases. PMID:25485279

Identification and analysis of recombineering functions from Gram-negative and Gram-positive bacteria and their phages

PubMed Central

Datta, Simanti; Costantino, Nina; Zhou, Xiaomei; Court, Donald L.

2008-01-01

We report the identification and functional analysis of nine genes from Gram-positive and Gram-negative bacteria and their phages that are similar to lambda (λ) bet or Escherichia coli recT. Beta and RecT are single-strand DNA annealing proteins, referred to here as recombinases. Each of the nine other genes when expressed in E. coli carries out oligonucleotide-mediated recombination. To our knowledge, this is the first study showing single-strand recombinase activity from diverse bacteria. Similar to bet and recT, most of these other recombinases were found to be associated with putative exonuclease genes. Beta and RecT in conjunction with their cognate exonucleases carry out recombination of linear double-strand DNA. Among four of these foreign recombinase/exonuclease pairs tested for recombination with double-strand DNA, three had activity, albeit barely detectable. Thus, although these recombinases can function in E. coli to catalyze oligonucleotide recombination, the double-strand DNA recombination activities with their exonuclease partners were inefficient. This study also demonstrated that Gam, by inhibiting host RecBCD nuclease activity, helps to improve the efficiency of λ Red-mediated recombination with linear double-strand DNA, but Gam is not absolutely essential. Thus, in other bacterial species where Gam analogs have not been identified, double-strand DNA recombination may still work in the absence of a Gam-like function. We anticipate that at least some of the recombineering systems studied here will potentiate oligonucleotide and double-strand DNA-mediated recombineering in their native or related bacteria. PMID:18230724

[Differentially expressed genes of cell signal transduction associated with benzene poisoning by cDNA microarray].

PubMed

Wang, Hong; Bi, Yongyi; Tao, Ning; Wang, Chunhong

2005-08-01

To detect the differential expression of cell signal transduction genes associated with benzene poisoning, and to explore the pathogenic mechanisms of blood system damage induced by benzene. Peripheral white blood cell gene expression profile of 7 benzene poisoning patients, including one aplastic anemia, was determined by cDNA microarray. Seven chips from normal workers were served as controls. Cluster analysis of gene expression profile was performed. Among the 4265 target genes, 176 genes associated with cell signal transduction were differentially expressed. 35 up-regulated genes including PTPRC, STAT4, IFITM1 etc were found in at least 6 pieces of microarray; 45 down-regulated genes including ARHB, PPP3CB, CDC37 etc were found in at least 5 pieces of microarray. cDNA microarray technology is an effective technique for screening the differentially expressed genes of cell signal transduction. Disorder in cell signal transduction may play certain role in the pathogenic mechanism of benzene poisoning.

Recognition of multiple imbalanced cancer types based on DNA microarray data using ensemble classifiers.

PubMed

Yu, Hualong; Hong, Shufang; Yang, Xibei; Ni, Jun; Dan, Yuanyuan; Qin, Bin

2013-01-01

DNA microarray technology can measure the activities of tens of thousands of genes simultaneously, which provides an efficient way to diagnose cancer at the molecular level. Although this strategy has attracted significant research attention, most studies neglect an important problem, namely, that most DNA microarray datasets are skewed, which causes traditional learning algorithms to produce inaccurate results. Some studies have considered this problem, yet they merely focus on binary-class problem. In this paper, we dealt with multiclass imbalanced classification problem, as encountered in cancer DNA microarray, by using ensemble learning. We utilized one-against-all coding strategy to transform multiclass to multiple binary classes, each of them carrying out feature subspace, which is an evolving version of random subspace that generates multiple diverse training subsets. Next, we introduced one of two different correction technologies, namely, decision threshold adjustment or random undersampling, into each training subset to alleviate the damage of class imbalance. Specifically, support vector machine was used as base classifier, and a novel voting rule called counter voting was presented for making a final decision. Experimental results on eight skewed multiclass cancer microarray datasets indicate that unlike many traditional classification approaches, our methods are insensitive to class imbalance.

Microarray labeling extension values: laboratory signatures for Affymetrix GeneChips

PubMed Central

Lee, Yun-Shien; Chen, Chun-Houh; Tsai, Chi-Neu; Tsai, Chia-Lung; Chao, Angel; Wang, Tzu-Hao

2009-01-01

Interlaboratory comparison of microarray data, even when using the same platform, imposes several challenges to scientists. RNA quality, RNA labeling efficiency, hybridization procedures and data-mining tools can all contribute variations in each laboratory. In Affymetrix GeneChips, about 11–20 different 25-mer oligonucleotides are used to measure the level of each transcript. Here, we report that ‘labeling extension values (LEVs)’, which are correlation coefficients between probe intensities and probe positions, are highly correlated with the gene expression levels (GEVs) on eukayotic Affymetrix microarray data. By analyzing LEVs and GEVs in the publicly available 2414 cel files of 20 Affymetrix microarray types covering 13 species, we found that correlations between LEVs and GEVs only exist in eukaryotic RNAs, but not in prokaryotic ones. Surprisingly, Affymetrix results of the same specimens that were analyzed in different laboratories could be clearly differentiated only by LEVs, leading to the identification of ‘laboratory signatures’. In the examined dataset, GSE10797, filtering out high-LEV genes did not compromise the discovery of biological processes that are constructed by differentially expressed genes. In conclusion, LEVs provide a new filtering parameter for microarray analysis of gene expression and it may improve the inter- and intralaboratory comparability of Affymetrix GeneChips data. PMID:19295132

Rearing Water Treatment Induces Microbial Selection Influencing the Microbiota and Pathogen Associated Transcripts of Cod (Gadus morhua) Larvae.

PubMed

Vestrum, Ragnhild I; Attramadal, Kari J K; Winge, Per; Li, Keshuai; Olsen, Yngvar; Bones, Atle M; Vadstein, Olav; Bakke, Ingrid

2018-01-01

We have previously shown that K-selection and microbial stability in the rearing water increases survival and growth of Atlantic cod ( Gadus morhua ) larvae, and that recirculating aquaculture systems (RAS) are compatible with this. Here, we have assessed how water treatment influenced the larval microbiota and host responses at the gene expression level. Cod larvae were reared with two different rearing water systems: a RAS and a flow-through system (FTS). The water microbiota was examined using a 16S rDNA PCR/DGGE strategy. RNA extracted from larvae at 8, 13, and 17 days post hatching was used for microbiota and microarray gene expression analysis. Bacterial cDNA was synthesized and used for 16S rRNA amplicon 454 pyrosequencing of larval microbiota. Both water and larval microbiota differed significantly between the systems, and the larval microbiota appeared to become more dissimilar between systems with time. In total 4 phyla were identified for all larvae: Actinobacteria, Bacteroidetes, Firmicutes, and Proteobacteria. The most profound difference in larval microbiota was a high abundance of Arcobacter (Epsilonproteobacteria) in FTS larvae (34 ± 9% of total reads). Arcobacter includes several species that are known pathogens for humans and animals. Cod larval transcriptome responses were investigated using an oligonucleotide gene expression microarray covering approximately 24,000 genes. Interestingly, FTS larvae transcriptional profiles revealed an overrepresentation of upregulated transcripts associated with responses to pathogens and infections, such as c1ql3-like , pglyrp-2-like and zg16, compared to RAS larvae. In conclusion, distinct water treatment systems induced differences in the larval microbiota. FTS larvae showed up-regulation of transcripts associated with responses to microbial stress. These results are consistent with the hypothesis that RAS promotes K-selection and microbial stability by maintaining a microbial load close to the carrying capacity of the system, and ensuring long retention times for both bacteria and water in the system.

Rearing Water Treatment Induces Microbial Selection Influencing the Microbiota and Pathogen Associated Transcripts of Cod (Gadus morhua) Larvae

PubMed Central

Vestrum, Ragnhild I.; Attramadal, Kari J. K.; Winge, Per; Li, Keshuai; Olsen, Yngvar; Bones, Atle M.; Vadstein, Olav; Bakke, Ingrid

2018-01-01

We have previously shown that K-selection and microbial stability in the rearing water increases survival and growth of Atlantic cod (Gadus morhua) larvae, and that recirculating aquaculture systems (RAS) are compatible with this. Here, we have assessed how water treatment influenced the larval microbiota and host responses at the gene expression level. Cod larvae were reared with two different rearing water systems: a RAS and a flow-through system (FTS). The water microbiota was examined using a 16S rDNA PCR/DGGE strategy. RNA extracted from larvae at 8, 13, and 17 days post hatching was used for microbiota and microarray gene expression analysis. Bacterial cDNA was synthesized and used for 16S rRNA amplicon 454 pyrosequencing of larval microbiota. Both water and larval microbiota differed significantly between the systems, and the larval microbiota appeared to become more dissimilar between systems with time. In total 4 phyla were identified for all larvae: Actinobacteria, Bacteroidetes, Firmicutes, and Proteobacteria. The most profound difference in larval microbiota was a high abundance of Arcobacter (Epsilonproteobacteria) in FTS larvae (34 ± 9% of total reads). Arcobacter includes several species that are known pathogens for humans and animals. Cod larval transcriptome responses were investigated using an oligonucleotide gene expression microarray covering approximately 24,000 genes. Interestingly, FTS larvae transcriptional profiles revealed an overrepresentation of upregulated transcripts associated with responses to pathogens and infections, such as c1ql3-like, pglyrp-2-like and zg16, compared to RAS larvae. In conclusion, distinct water treatment systems induced differences in the larval microbiota. FTS larvae showed up-regulation of transcripts associated with responses to microbial stress. These results are consistent with the hypothesis that RAS promotes K-selection and microbial stability by maintaining a microbial load close to the carrying capacity of the system, and ensuring long retention times for both bacteria and water in the system. PMID:29765364

Cell cloning-based transcriptome analysis in Rett patients: relevance to the pathogenesis of Rett syndrome of new human MeCP2 target genes.

PubMed

Nectoux, J; Fichou, Y; Rosas-Vargas, H; Cagnard, N; Bahi-Buisson, N; Nusbaum, P; Letourneur, F; Chelly, J; Bienvenu, T

2010-07-01

More than 90% of Rett syndrome (RTT) patients have heterozygous mutations in the X-linked methyl-CpG binding protein 2 (MECP2) gene that encodes the methyl-CpG-binding protein 2, a transcriptional modulator. Because MECP2 is subjected to X chromosome inactivation (XCI), girls with RTT either express the wild-type or mutant allele in each individual cell. To test the consequences of MECP2 mutations resulting from a genome-wide transcriptional dysregulation and to identify its target genes in a system that circumvents the functional mosaicism resulting from XCI, we carried out gene expression profiling of clonal populations derived from fibroblast primary cultures expressing exclusively either the wild-type or the mutant MECP2 allele. Clonal cultures were obtained from skin biopsy of three RTT patients carrying either a non-sense or a frameshift MECP2 mutation. For each patient, gene expression profiles of wild-type and mutant clones were compared by oligonucleotide expression microarray analysis. Firstly, clustering analysis classified the RTT patients according to their genetic background and MECP2 mutation. Secondly, expression profiling by microarray analysis and quantitative RT-PCR indicated four up-regulated genes and five down-regulated genes significantly dysregulated in all our statistical analysis, including excellent potential candidate genes for the understanding of the pathophysiology of this neurodevelopmental disease. Thirdly, chromatin immunoprecipitation analysis confirmed MeCP2 binding to respective CpG islands in three out of four up-regulated candidate genes and sequencing of bisulphite-converted DNA indicated that MeCP2 preferentially binds to methylated-DNA sequences. Most importantly, the finding that at least two of these genes (BMCC1 and RNF182) were shown to be involved in cell survival and/or apoptosis may suggest that impaired MeCP2 function could alter the survival of neurons thus compromising brain function without inducing cell death.

Systematic study of association of four GABAergic genes: glutamic acid decarboxylase 1 gene, glutamic acid decarboxylase 2 gene, GABA(B) receptor 1 gene and GABA(A) receptor subunit beta2 gene, with schizophrenia using a universal DNA microarray.

PubMed

Zhao, Xu; Qin, Shengying; Shi, Yongyong; Zhang, Aiping; Zhang, Jing; Bian, Li; Wan, Chunling; Feng, Guoyin; Gu, Niufan; Zhang, Guangqi; He, Guang; He, Lin

2007-07-01

Several studies have suggested the dysfunction of the GABAergic system as a risk factor in the pathogenesis of schizophrenia. In the present study, case-control association analysis was conducted in four GABAergic genes: two glutamic acid decarboxylase genes (GAD1 and GAD2), a GABA(A) receptor subunit beta2 gene (GABRB2) and a GABA(B) receptor 1 gene (GABBR1). Using a universal DNA microarray procedure we genotyped a total of 20 SNPs on the above four genes in a study involving 292 patients and 286 controls of Chinese descent. Statistically significant differences were observed in the allelic frequencies of the rs187269C/T polymorphism in the GABRB2 gene (P=0.0450, chi(2)=12.40, OR=1.65) and the -292A/C polymorphism in the GAD1 gene (P=0.0450, chi(2)=14.64 OR=1.77). In addition, using an electrophoretic mobility shift assay (EMSA), we discovered differences in the U251 nuclear protein binding to oligonucleotides representing the -292 SNP on the GAD1 gene, which suggests that the -292C allele has reduced transcription factor binding efficiency compared with the 292A allele. Using the multifactor-dimensionality reduction method (MDR), we found that the interactions among the rs187269C/T polymorphism in the GABRB2 gene, the -243A/G polymorphism in the GAD2 gene and the 27379C/T and 661C/T polymorphisms in the GAD1 gene revealed a significant association with schizophrenia (P<0.001). These findings suggest that the GABRB2 and GAD1 genes alone and the combined effects of the polymorphisms in the four GABAergic system genes may confer susceptibility to the development of schizophrenia in the Chinese population.

Analysis of developmental gene conservation in the Actinomycetales using DNA/DNA microarray comparisons.

PubMed

Kirby, Ralph; Herron, Paul; Hoskisson, Paul

2011-02-01

Based on available genome sequences, Actinomycetales show significant gene synteny across a wide range of species and genera. In addition, many genera show varying degrees of complex morphological development. Using the presence of gene synteny as a basis, it is clear that an analysis of gene conservation across the Streptomyces and various other Actinomycetales will provide information on both the importance of genes and gene clusters and the evolution of morphogenesis in these bacteria. Genome sequencing, although becoming cheaper, is still relatively expensive for comparing large numbers of strains. Thus, a heterologous DNA/DNA microarray hybridization dataset based on a Streptomyces coelicolor microarray allows a cheaper and greater depth of analysis of gene conservation. This study, using both bioinformatical and microarray approaches, was able to classify genes previously identified as involved in morphogenesis in Streptomyces into various subgroups in terms of conservation across species and genera. This will allow the targeting of genes for further study based on their importance at the species level and at higher evolutionary levels.

DNA Microarray Wet Lab Simulation Brings Genomics into the High School Curriculum

PubMed Central

Zanta, Carolyn A.; Heyer, Laurie J.; Kittinger, Ben; Gabric, Kathleen M.; Adler, Leslie

2006-01-01

We have developed a wet lab DNA microarray simulation as part of a complete DNA microarray module for high school students. The wet lab simulation has been field tested with high school students in Illinois and Maryland as well as in workshops with high school teachers from across the nation. Instead of using DNA, our simulation is based on pH indicators, which offer many ideal teaching characteristics. The simulation requires no specialized equipment, is very inexpensive, is very reliable, and takes very little preparation time. Student and teacher assessment data indicate the simulation is popular with both groups, and students show significant learning gains. We include many resources with this publication, including all prelab introductory materials (e.g., a paper microarray activity), the student handouts, teachers notes, and pre- and postassessment tools. We did not test the simulation on other student populations, but based on teacher feedback, the simulation also may fit well in community college and in introductory and nonmajors' college biology curricula. PMID:17146040

DNA microarray wet lab simulation brings genomics into the high school curriculum.

PubMed

Campbell, A Malcolm; Zanta, Carolyn A; Heyer, Laurie J; Kittinger, Ben; Gabric, Kathleen M; Adler, Leslie; Schulz, Barbara

2006-01-01

We have developed a wet lab DNA microarray simulation as part of a complete DNA microarray module for high school students. The wet lab simulation has been field tested with high school students in Illinois and Maryland as well as in workshops with high school teachers from across the nation. Instead of using DNA, our simulation is based on pH indicators, which offer many ideal teaching characteristics. The simulation requires no specialized equipment, is very inexpensive, is very reliable, and takes very little preparation time. Student and teacher assessment data indicate the simulation is popular with both groups, and students show significant learning gains. We include many resources with this publication, including all prelab introductory materials (e.g., a paper microarray activity), the student handouts, teachers notes, and pre- and postassessment tools. We did not test the simulation on other student populations, but based on teacher feedback, the simulation also may fit well in community college and in introductory and nonmajors' college biology curricula.

Strand-specific transcriptome profiling with directly labeled RNA on genomic tiling microarrays

PubMed Central

2011-01-01

Background With lower manufacturing cost, high spot density, and flexible probe design, genomic tiling microarrays are ideal for comprehensive transcriptome studies. Typically, transcriptome profiling using microarrays involves reverse transcription, which converts RNA to cDNA. The cDNA is then labeled and hybridized to the probes on the arrays, thus the RNA signals are detected indirectly. Reverse transcription is known to generate artifactual cDNA, in particular the synthesis of second-strand cDNA, leading to false discovery of antisense RNA. To address this issue, we have developed an effective method using RNA that is directly labeled, thus by-passing the cDNA generation. This paper describes this method and its application to the mapping of transcriptome profiles. Results RNA extracted from laboratory cultures of Porphyromonas gingivalis was fluorescently labeled with an alkylation reagent and hybridized directly to probes on genomic tiling microarrays specifically designed for this periodontal pathogen. The generated transcriptome profile was strand-specific and produced signals close to background level in most antisense regions of the genome. In contrast, high levels of signal were detected in the antisense regions when the hybridization was done with cDNA. Five antisense areas were tested with independent strand-specific RT-PCR and none to negligible amplification was detected, indicating that the strong antisense cDNA signals were experimental artifacts. Conclusions An efficient method was developed for mapping transcriptome profiles specific to both coding strands of a bacterial genome. This method chemically labels and uses extracted RNA directly in microarray hybridization. The generated transcriptome profile was free of cDNA artifactual signals. In addition, this method requires fewer processing steps and is potentially more sensitive in detecting small amount of RNA compared to conventional end-labeling methods due to the incorporation of more fluorescent molecules per RNA fragment. PMID:21235785

Molecular classification of benign prostatic hyperplasia: A gene expression profiling study in a rat model.

PubMed

Hata, Junya; Satoh, Yuichi; Akaihata, Hidenori; Hiraki, Hiroyuki; Ogawa, Soichiro; Haga, Nobuhiro; Ishibashi, Kei; Aikawa, Ken; Kojima, Yoshiyuki

2016-07-01

To characterize the molecular features of benign prostatic hyperplasia by carrying out a gene expression profiling analysis in a rat model. Fetal urogenital sinus isolated from 20-day-old male rat embryo was implanted into a pubertal male rat ventral prostate. The implanted urogenital sinus grew time-dependently, and the pathological findings at 3 weeks after implantation showed epithelial hyperplasia as well as stromal hyperplasia. Whole-genome oligonucleotide microarray analysis utilizing approximately 30 000 oligonucleotide probes was carried out using prostate specimens during the prostate growth process (3 weeks after implantation). Microarray analyses showed 926 upregulated (>2-fold change, P < 0.01) and 3217 downregulated genes (<0.5-fold change, P < 0.01) in benign prostatic hyperplasia specimens compared with normal prostate. Gene ontology analyses of upregulated genes showed predominant genetic themes of involvement in development (162 genes, P = 2.01 × 10(-4) ), response to stimulus (163 genes, P = 7.37 × 10(-13) ) and growth (32 genes, P = 1.93 × 10(-5) ). When we used both normal prostate and non-transplanted urogenital sinuses as controls to identify benign prostatic hyperplasia-specific genes, 507 and 406 genes were upregulated and downregulated, respectively. Functional network and pathway analyses showed that genes associated with apoptosis modulation by heat shock protein 70, interleukin-1, interleukin-2 and interleukin-5 signaling pathways, KIT signaling pathway, and secretin-like G-protein-coupled receptors, class B, were relatively activated during the growth process in the benign prostatic hyperplasia specimens. In contrast, genes associated with cholesterol biosynthesis were relatively inactivated. Our microarray analyses of the benign prostatic hyperplasia model rat might aid in clarifying the molecular mechanism of benign prostatic hyperplasia progression, and identifying molecular targets for benign prostatic hyperplasia treatment. © 2016 The Japanese Urological Association.

Genome-wide profiling of gene expression in the epididymis of alpha-chlorohydrin-induced infertile rats using an oligonucleotide microarray

PubMed Central

2010-01-01

Background As one of the chlorinated antifertility compounds, alpha-chlorohydrin (ACH) can inhibit glyceraldehyde-3-phosphate dehydrogenase (G3PDH) activity in epididymal sperm and affect sperm energy metabolism, maturation and fertilization, eventually leading to male infertility. Further studies demonstrated that the inhibitory effect of ACH on G3PDH is not only confined to epididymal sperm but also to the epididymis. Moreover, little investigation on gene expression changes in the epididymis after ACH treatment has been conducted. Therefore, gene expression studies may indicate new epididymal targets related to sperm maturation and fertility through the analysis of ACH-treated infertile animals. Methods Rats were treated with ACH for ten consecutive days, and then each male rat copulated with two female rats in proestrus. Then sperm maturation and other fertility parameters were analyzed. Furthermore, we identified epididymal-specific genes that are associated with fertility between control and ACH groups using an Affymetrix Rat 230 2.0 oligo-microarray. Finally, we performed RT-PCR analysis for several differentially expressed genes to validate the alteration in gene expression observed by oligonucleotide microarray. Results Among all the differentially expressed genes, we analyzed and screened the down-regulated genes associated with metabolism processes, which are considered the major targets of ACH action. Simultaneously, the genes that were up-regulated by chlorohydrin were detected. The genes that negatively regulate sperm maturation and fertility include apoptosis and immune-related genes and have not been reported previously. The overall results of PCR analysis for selected genes were consistent with the array data. Conclusions In this study, we have described the genome-wide profiles of gene expression in the epididymides of infertile rats induced by ACH, which could become potential epididymal specific targets for male contraception and infertility treatment. PMID:20409345

Genome-wide profiling of gene expression in the epididymis of alpha-chlorohydrin-induced infertile rats using an oligonucleotide microarray.

PubMed

Xie, Shuwu; Zhu, Yan; Ma, Li; Lu, Yingying; Zhou, Jieyun; Gui, Youlun; Cao, Lin

2010-04-22

As one of the chlorinated antifertility compounds, alpha-chlorohydrin (ACH) can inhibit glyceraldehyde-3-phosphate dehydrogenase (G3PDH) activity in epididymal sperm and affect sperm energy metabolism, maturation and fertilization, eventually leading to male infertility. Further studies demonstrated that the inhibitory effect of ACH on G3PDH is not only confined to epididymal sperm but also to the epididymis. Moreover, little investigation on gene expression changes in the epididymis after ACH treatment has been conducted. Therefore, gene expression studies may indicate new epididymal targets related to sperm maturation and fertility through the analysis of ACH-treated infertile animals. Rats were treated with ACH for ten consecutive days, and then each male rat copulated with two female rats in proestrus. Then sperm maturation and other fertility parameters were analyzed. Furthermore, we identified epididymal-specific genes that are associated with fertility between control and ACH groups using an Affymetrix Rat 230 2.0 oligo-microarray. Finally, we performed RT-PCR analysis for several differentially expressed genes to validate the alteration in gene expression observed by oligonucleotide microarray. Among all the differentially expressed genes, we analyzed and screened the down-regulated genes associated with metabolism processes, which are considered the major targets of ACH action. Simultaneously, the genes that were up-regulated by chlorohydrin were detected. The genes that negatively regulate sperm maturation and fertility include apoptosis and immune-related genes and have not been reported previously. The overall results of PCR analysis for selected genes were consistent with the array data. In this study, we have described the genome-wide profiles of gene expression in the epididymides of infertile rats induced by ACH, which could become potential epididymal specific targets for male contraception and infertility treatment.

Evaluation of the efficacy of constitutional array-based comparative genomic hybridization in the diagnosis of aneuploidy using genomic and amplified DNA.

PubMed

Tan, Niap H; Palmer, Rodger; Wang, Rubin

2010-02-01

Array-based comparative genomic hybridization (array CGH) is a new molecular technique that has the potential to revolutionize cytogenetics. However, use of high resolution array CGH in the clinical setting is plagued by the problem of widespread copy number variations (CNV) in the human genome. Constitutional microarray, containing only clones that interrogate regions of known constitutional syndromes, may circumvent the dilemma of detecting CNV of unknown clinical significance. The present study investigated the efficacy of constitutional microarray in the diagnosis of trisomy. Test samples included genomic DNA from trisomic cell lines, amplification products of 50 ng of genomic DNA and whole genome amplification products of single cells. DNA amplification was achieved by means of multiple displacement amplification (MDA) over 16 h. The trisomic and sex chromosomes copy number imbalances in the genomic DNA were correctly identified by the constitutional microarrays. However, there was a failure to detect the trisomy in the amplification products of 50 ng of genomic DNA and whole genome amplification products of single cells. Using carefully selected clones, Spectral Genomics constitutional microarray was able to detect the chromosomal copy number imbalances in genomic DNA without the confounding effects of CNV. The diagnostic failure in amplified DNA samples could be attributed to the amplification process. The MDA duration of 16 h generated excessive amount of biases and shortening the duration might minimize the problem.

Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays.

PubMed

Kimura, Yasumasa; Soma, Takahiro; Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J L; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias

2016-01-01

Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download.