Sample records for dna response elements

  1. Densely ionizing radiation affects DNA methylation of selective LINE-1 elements

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Prior, Sara; Miousse, Isabelle R.

    Long Interspersed Nucleotide Element 1 (LINE-1) retrotransposons are heavily methylated and are the most abundant transposable elements in mammalian genomes. Here, we investigated the differential DNA methylation within the LINE-1 under normal conditions and in response to environmentally relevant doses of sparsely and densely ionizing radiation. We demonstrate that DNA methylation of LINE-1 elements in the lungs of C57BL6 mice is dependent on their evolutionary age, where the elder age of the element is associated with the lower extent of DNA methylation. Exposure to 5-aza-2′-deoxycytidine and methionine-deficient diet affected DNA methylation of selective LINE-1 elements in an age- and promotermore » type-dependent manner. Exposure to densely IR, but not sparsely IR, resulted in DNA hypermethylation of older LINE-1 elements, while the DNA methylation of evolutionary younger elements remained mostly unchanged. We also demonstrate that exposure to densely IR increased mRNA and protein levels of LINE-1 via the loss of the histone H3K9 dimethylation and an increase in the H3K4 trimethylation at the LINE-1 5′-untranslated region, independently of DNA methylation. Our findings suggest that DNA methylation is important for regulation of LINE-1 expression under normal conditions, but histone modifications may dictate the transcriptional activity of LINE-1 in response to exposure to densely IR. - Highlights: • DNA methylation of LINE-1 elements is dependent on their evolutionary age. • Densely ionizing radiation affects DNA methylation of selective LINE-1 elements. • Radiation-induced reactivation of LINE-1 is DNA methylation-independent. • Histone modifications dictate the transcriptional activity of LINE-1.« less

  2. Densely ionizing radiation affects DNA methylation of selective LINE-1 elements1

    PubMed Central

    Prior, Sara; Miousse, Isabelle R.; Nzabarushimana, Etienne; Pathak, Rupak; Skinner, Charles; Kutanzi, Kristy R.; Allen, Antiño R.; Raber, Jacob; Tackett, Alan J.; Hauer-Jensen, Martin; Nelson, Gregory A.; Koturbash, Igor

    2016-01-01

    Long Interspersed Nucleotide Element 1 (LINE-1) retrotransposons are heavily methylated and are the most abundant transposable elements in mammalian genomes. Here, we investigated the differential DNA methylation within the LINE-1 under normal conditions and in response to environmentally relevant doses of sparsely and densely ionizing radiation. We demonstrate that DNA methylation of LINE-1 elements in the lungs of C57BL6 mice is dependent on their evolutionary age, where the elder age of the element is associated with the lower extent of DNA methylation. Exposure to 5-aza-2′-deoxycytidine and methionine-deficient diet affected DNA methylation of selective LINE-1 elements in an age- and promoter type-dependent manner. Exposure to densely IR, but not sparsely IR, resulted in DNA hypermethylation of older LINE-1 elements, while the DNA methylation of evolutionary younger elements remained mostly unchanged. We also demonstrate that exposure to densely IR increased mRNA and protein levels of LINE-1 via the loss of the histone H3K9 dimethylation and an increase in the H3K4 trimethylation at the LINE-1 5′-untranslated region, independently of DNA methylation. Our findings suggest that DNA methylation is important for regulation of LINE-1 expression under normal conditions, but histone modifications may dictate the transcriptional activity of LINE-1 in response to exposure to densely IR. PMID:27419368

  3. The MluI cell cycle box (MCB) motifs, but not damage-responsive elements (DREs), are responsible for the transcriptional induction of the rhp51+ gene in response to DNA replication stress.

    PubMed

    Sartagul, Wugangerile; Zhou, Xin; Yamada, Yuki; Ma, Ning; Tanaka, Katsunori; Furuyashiki, Tomoyuki; Ma, Yan

    2014-01-01

    DNA replication stress induces the transcriptional activation of rhp51+, a fission yeast recA homolog required for repair of DNA double strand breaks. However, the mechanism by which DNA replication stress activates rhp51+ transcription is not understood. The promoter region of rhp51+ contains two damage-responsive elements (DREs) and two MluI cell cycle box (MCB) motifs. Using luciferase reporter assays, we examined the role of these elements in rhp51+ transcription. The full-length rhp51+ promoter and a promoter fragment containing MCB motifs only, but not a fragment containing DREs, mediated transcriptional activation upon DNA replication stress. Removal of the MCB motifs from the rhp51+ promoter abolished the induction of rhp51+ transcription by DNA replication stress. Consistent with a role for MCB motifs in rhp51+ transcription activation, deletion of the MBF (MCB-binding factor) co-repressors Nrm1 and Yox1 precluded rhp51+ transcriptional induction in response to DNA replication stress. Using cells deficient in checkpoint signaling molecules, we found that the Rad3-Cds1/Chk1 pathway partially mediated rhp51+ transcription in response to DNA replication stress, suggesting the involvement of unidentified checkpoint signaling pathways. Because MBF is critical for G1/S transcription, we examined how the cell cycle affected rhp51+ transcription. The transcription of rhp51+ and cdc18+, an MBF-dependent G1/S gene, peaked simultaneously in synchronized cdc25-22 cells. Furthermore, DNA replication stress maintained transcription of rhp51+ similarly to cdc18+. Collectively, these results suggest that MBF and its regulators mediate rhp51+ transcription in response to DNA replication stress, and underlie rhp51+ transcription at the G1/S transition.

  4. Conserved Elements Vaccine for HIV | NCI Technology Transfer Center | TTC

    Cancer.gov

    Researchers at the National Cancer Institute (NCI) developed a DNA vaccine using conserved elements of HIV-1 Gag, administered in a prime-boost vaccination protocol. Two of the HIV Gag CE DNA vectors have been tested in a rhesus macaque model. Priming with the Gag CE vaccine and boosting with full length Gag DNA showed increased immune responses when compared to vaccination with Gag alone. Researchers seek licensing and/or co-development research collaborations for development this DNA vaccine.

  5. Novel DNA Motif Binding Activity Observed In Vivo With an Estrogen Receptor α Mutant Mouse

    PubMed Central

    Li, Leping; Grimm, Sara A.; Winuthayanon, Wipawee; Hamilton, Katherine J.; Pockette, Brianna; Rubel, Cory A.; Pedersen, Lars C.; Fargo, David; Lanz, Rainer B.; DeMayo, Francesco J.; Schütz, Günther; Korach, Kenneth S.

    2014-01-01

    Estrogen receptor α (ERα) interacts with DNA directly or indirectly via other transcription factors, referred to as “tethering.” Evidence for tethering is based on in vitro studies and a widely used “KIKO” mouse model containing mutations that prevent direct estrogen response element DNA- binding. KIKO mice are infertile, due in part to the inability of estradiol (E2) to induce uterine epithelial proliferation. To elucidate the molecular events that prevent KIKO uterine growth, regulation of the pro-proliferative E2 target gene Klf4 and of Klf15, a progesterone (P4) target gene that opposes the pro-proliferative activity of KLF4, was evaluated. Klf4 induction was impaired in KIKO uteri; however, Klf15 was induced by E2 rather than by P4. Whole uterine chromatin immunoprecipitation-sequencing revealed enrichment of KIKO ERα binding to hormone response elements (HREs) motifs. KIKO binding to HRE motifs was verified using reporter gene and DNA-binding assays. Because the KIKO ERα has HRE DNA-binding activity, we evaluated the “EAAE” ERα, which has more severe DNA-binding domain mutations, and demonstrated a lack of estrogen response element or HRE reporter gene induction or DNA-binding. The EAAE mouse has an ERα null–like phenotype, with impaired uterine growth and transcriptional activity. Our findings demonstrate that the KIKO mouse model, which has been used by numerous investigators, cannot be used to establish biological functions for ERα tethering, because KIKO ERα effectively stimulates transcription using HRE motifs. The EAAE-ERα DNA-binding domain mutant mouse demonstrates that ERα DNA-binding is crucial for biological and transcriptional processes in reproductive tissues and that ERα tethering may not contribute to estrogen responsiveness in vivo. PMID:24713037

  6. Promoter selection in human mitochondria involves binding of a transcription factor to orientation-independent upstream regulatory elements.

    PubMed

    Fisher, R P; Topper, J N; Clayton, D A

    1987-07-17

    Selective transcription of human mitochondrial DNA requires a transcription factor (mtTF) in addition to an essentially nonselective RNA polymerase. Partially purified mtTF is able to sequester promoter-containing DNA in preinitiation complexes in the absence of mitochondrial RNA polymerase, suggesting a DNA-binding mechanism for factor activity. Functional domains, required for positive transcriptional regulation by mtTF, are identified within both major promoters of human mtDNA through transcription of mutant promoter templates in a reconstituted in vitro system. These domains are essentially coextensive with DNA sequences protected from nuclease digestion by mtTF-binding. Comparison of the sequences of the two mtTF-responsive elements reveals significant homology only when one sequence is inverted; the binding sites are in opposite orientations with respect to the predominant direction of transcription. Thus mtTF may function bidirectionally, requiring additional protein-DNA interactions to dictate transcriptional polarity. The mtTF-responsive elements are arrayed as direct repeats, separated by approximately 80 bp within the displacement-loop region of human mitochondrial DNA; this arrangement may reflect duplication of an ancestral bidirectional promoter, giving rise to separate, unidirectional promoters for each strand.

  7. Functional consequences of inducible genetic elements from the p53 SOS response in a mammalian organ system.

    PubMed

    Guthrie, O'neil W

    2017-10-01

    In response to DNA damage from ultraviolet (UV) radiation, bacteria deploy the SOS response in order to limit cell death. This bacterial SOS response is characterized by an increase in the recA gene that transactivates expression of multiple DNA repair genes. The current series of experiments demonstrate that a mammalian organ system (the cochlea) that is not evolutionarily conditioned to UV radiation can elicit SOS responses that are reminiscent of that of bacteria. This mammalian SOS response is characterized by an increase in the p53 gene with activation of multiple DNA repair genes that harbor p53 response elements in their promoters. Furthermore, the experimental results provide support for the notion of a convergent trigger paradox, where independent SOS triggers facilitate disparate physiologic sequelae (loss vs. recovery of function). Therefore, it is proposed that the mammalian SOS response is multifunctional and manipulation of this endogenous response could be exploited in future biomedical interventions. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Two CGTCA motifs and a GHF1/Pit1 binding site mediate cAMP-dependent protein kinase A regulation of human growth hormone gene expression in rat anterior pituitary GC cells.

    PubMed

    Shepard, A R; Zhang, W; Eberhardt, N L

    1994-01-21

    We established the cis-acting elements which mediate cAMP responsiveness of the human growth hormone (hGH) gene in transiently transfected rat anterior pituitary tumor GC cells. Analysis of the intact hGH gene or hGH 5'-flanking DNA (5'-FR) coupled to the hGh cDNA or chloramphenicol acetyltransferase or luciferase genes, indicated that cAMP primarily stimulated hGH promoter activity. Cotransfection of a protein kinase A inhibitory protein cDNA demonstrated that the cAMP response was mediated by protein kinase A. Mutational analysis of the hGH promoter identified two core cAMP response element motifs (CGTCA) located at nucleotides -187/-183 (distal cAMP response element; dCRE) and -99/-95 (proximal cAMP response element; pCRE) and a pituitary-specific transcription factor (GHF1/Pit1) binding site at nucleotides -123/-112 (dGHF1) which were required for cAMP responsiveness. GHF1 was not a limiting factor, since overexpression of GHF1 in cotransfections increased basal but not forskolin induction levels. Gel shift analyses indicated that similar, ubiquitous, thermostable protein(s) specifically bound the pCRE and dCRE motifs. The CGTCA motif-binding factors were cAMP response element binding protein (CREB)/activating transcription factor-1 (ATF-1)-related, since the DNA-protein complex was competed by unlabeled CREB consensus oligonucleotide, specifically supershifted by antisera to CREB and ATF-1 but not ATF-2, and was bound by purified CREB with the same relative binding affinity (pCRE < dCRE < CREB) and mobility as the GC nuclear extract. UV cross-linking and Southwestern blot analyses revealed multiple DNA-protein interactions of which approximately 100- and approximately 45-kDa proteins were predominant; the approximately 45-kDa protein may represent CREB. These results indicate that CREB/ATF-1-related factors act coordinately with the cell-specific factor GHF1 to mediate cAMP-dependent regulation of hGH-1 gene transcription in anterior pituitary somatotrophs.

  9. Characterizing the stress/defense transcriptome of Arabidopsis

    PubMed Central

    Mahalingam, Ramamurthy; Gomez-Buitrago, AnaMaria; Eckardt, Nancy; Shah, Nigam; Guevara-Garcia, Angel; Day, Philip; Raina, Ramesh; Fedoroff, Nina V

    2003-01-01

    Background To understand the gene networks that underlie plant stress and defense responses, it is necessary to identify and characterize the genes that respond both initially and as the physiological response to the stress or pathogen develops. We used PCR-based suppression subtractive hybridization to identify Arabidopsis genes that are differentially expressed in response to ozone, bacterial and oomycete pathogens and the signaling molecules salicylic acid (SA) and jasmonic acid. Results We identified a total of 1,058 differentially expressed genes from eight stress cDNA libraries. Digital northern analysis revealed that 55% of the stress-inducible genes are rarely transcribed in unstressed plants and 17% of them were not previously represented in Arabidopsis expressed sequence tag databases. More than two-thirds of the genes in the stress cDNA collection have not been identified in previous studies as stress/defense response genes. Several stress-responsive cis-elements showed a statistically significant over-representation in the promoters of the genes in the stress cDNA collection. These include W- and G-boxes, the SA-inducible element, the abscisic acid response element and the TGA motif. Conclusions The stress cDNA collection comprises a broad repertoire of stress-responsive genes encoding proteins that are involved in both the initial and subsequent stages of the physiological response to abiotic stress and pathogens. This set of stress-, pathogen- and hormone-modulated genes is an important resource for understanding the genetic interactions underlying stress signaling and responses and may contribute to the characterization of the stress transcriptome through the construction of standardized specialized arrays. PMID:12620105

  10. Quantification of transcription factor-DNA binding affinity in a living cell

    PubMed Central

    Belikov, Sergey; Berg, Otto G.; Wrange, Örjan

    2016-01-01

    The apparent dissociation constant (Kd) for specific binding of glucocorticoid receptor (GR) and androgen receptor (AR) to DNA was determined in vivo in Xenopus oocytes. The total nuclear receptor concentration was quantified as specifically retained [3H]-hormone in manually isolated oocyte nuclei. DNA was introduced by nuclear microinjection of single stranded phagemid DNA, chromatin is then formed during second strand synthesis. The fraction of DNA sites occupied by the expressed receptor was determined by dimethylsulphate in vivo footprinting and used for calculation of the receptor-DNA binding affinity. The forkhead transcription factor FoxA1 enhanced the DNA binding by GR with an apparent Kd of ∼1 μM and dramatically stimulated DNA binding by AR with an apparent Kd of ∼0.13 μM at a composite androgen responsive DNA element containing one FoxA1 binding site and one palindromic hormone receptor binding site known to bind one receptor homodimer. FoxA1 exerted a weak constitutive- and strongly cooperative DNA binding together with AR but had a less prominent effect with GR, the difference reflecting the licensing function of FoxA1 at this androgen responsive DNA element. PMID:26657626

  11. cDNA cloning, genomic organization and expression analysis during somatic embryogenesis of the translationally controlled tumor protein (TCTP) gene from Japanese larch (Larix leptolepis).

    PubMed

    Zhang, Li-Feng; Li, Wan-Feng; Han, Su-Ying; Yang, Wen-Hua; Qi, Li-Wang

    2013-10-15

    A full-length cDNA and genomic sequences of a translationally controlled tumor protein (TCTP) gene were isolated from Japanese larch (Larix leptolepis) and designated LaTCTP. The length of the cDNA was 1, 043 bp and contained a 504 bp open reading frame that encodes a predicted protein of 167 amino acids, characterized by two signature sequences of the TCTP protein family. Analysis of the LaTCTP gene structure indicated four introns and five exons, and it is the largest of all currently known TCTP genes in plants. The 5'-flanking promoter region of LaTCTP was cloned using an improved TAIL-PCR technique. In this region we identified many important potential cis-acting elements, such as a Box-W1 (fungal elicitor responsive element), a CAT-box (cis-acting regulatory element related to meristem expression), a CGTCA-motif (cis-acting regulatory element involved in MeJA-responsiveness), a GT1-motif (light responsive element), a Skn-1-motif (cis-acting regulatory element required for endosperm expression) and a TGA-element (auxin-responsive element), suggesting that expression of LaTCTP is highly regulated. Expression analysis demonstrated ubiquitous localization of LaTCTP mRNA in the roots, stems and needles, high mRNA levels in the embryonal-suspensor mass (ESM), browning embryogenic cultures and mature somatic embryos, and low levels of mRNA at day five during somatic embryogenesis. We suggest that LaTCTP might participate in the regulation of somatic embryo development. These results provide a theoretical basis for understanding the molecular regulatory mechanism of LaTCTP and lay the foundation for artificial regulation of somatic embryogenesis. © 2013.

  12. Repeated administration of CGP 46381, a gamma-aminobutyric acidB antagonist, and ethosuximide suppresses seizure-associated cyclic adenosine 3'5' monophosphate response element- and activator protein-1 DNA-binding activities in lethargic (lh/lh) mice.

    PubMed

    Ishige, K; Endo, H; Saito, H; Ito, Y

    2001-01-19

    To characterize seizure-associated increases in cerebral cortical and thalamic cyclic AMP responsive element (CRE)- and activator protein 1 (AP-1) DNA-binding activities in lethargic (lh/lh) mice, a genetic model of absence seizures, we examined the effects of ethosuximide and CGP 46381 on these DNA-binding activities. Repeated administration (twice a day for 5 days) of ethosuximide (200 mg/kg) or CGP 46381 (60 mg/kg) attenuated both seizure behavior and the increased DNA-binding activities, and was more effective than a single administration of these drugs. These treatments did not affect either normal behavior or basal DNA-binding activities in non-epileptic control (+/+) mice. Gel supershift assays revealed that the increased CRE-binding activity was attributable to activation of the binding activity of CREB, and that the c-Fos-c-Jun complex was a component of the increased AP-1 DNA-binding activity.

  13. In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax.

    PubMed

    Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z

    1994-01-01

    The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.

  14. Specificity determinants for the abscisic acid response element.

    PubMed

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interaction with ACGT core motif-containing ABRE sequences. We have also examined the variation in the stability of the protein-DNA complex upon mutating ABRE sequences using the protein design algorithm FoldX. The high throughput free energy calculations successfully predicted the ability of ABF1 to bind to alternative core motifs like GCGT or AAGT and also rationalized the role of the flanking sequences in determining the specificity of the protein-DNA interaction.

  15. Detection of DNA polymerase λ activity during seed germination and enhancement after salinity stress and dehydration in the plumules of indica rice (Oryza sativa L.

    PubMed

    Sihi, Sayantani; Bakshi, Sankar; Sengupta, Dibyendu Narayan

    2015-02-01

    DNA polymerase λ (DNA pol λ) is the only reported X-family DNA polymerases in plants and has been shown to play a significant role in dry quiescent seeds, growth, development and nuclear DNA repair. cDNA for DNA pol λ has been reported in Arabidopsis and japonica rice cultivar and has been characterized from E. coli expressed protein, but very little is known about its activity at protein level in plants. The enzymatic activity of DNA pol λ was studied in dry, imbibed and during different germination stages of indica rice IR-8 (salt sensitive) by in-gel activity assay to determine its physiological role in important stages of growth and development. The upstream sequence was also analyzed using plantCARE database and was found to contain several cis-acting elements, including light responsive elements, dehydration responsive elements, Myb binding sites, etc. Hence, 4-day-old germinating seedlings of IR29, a salt-sensitive, but high yielding indica rice cultivar and Nonabokra, a salt-tolerant, but low yielding cultivar were treated with water (control) or 250 mM NaCl or 20% polyethyleneglycol-6000 for 4 and 8 h. The protein was analyzed by in vitro DNA pol λ activity assay, in-gel activity assay and Western blot analysis. DNA pol λ was not detected in dry seeds, but enhanced after imbibition and detectable from low level to high level during subsequent germination steps. Both salinity and dehydration stress led to the enhancement of the activity and protein level of DNA pol λ, as compared to control tissues. This is the first evidence of the salinity or dehydration stress induced enhancement of DNA pol λ activity in the plumules of rice (Oryza sativa L.) cultivars.

  16. The human haptoglobin gene promoter: interleukin-6-responsive elements interact with a DNA-binding protein induced by interleukin-6.

    PubMed Central

    Oliviero, S; Cortese, R

    1989-01-01

    Transcription of the human haptoglobin (Hp) gene is induced by interleukin-6 (IL-6) in the human hepatoma cell line Hep3B. Cis-acting elements responsible for this response are localized within the first 186 bp of the 5'-flanking region. Site-specific mutants of the Hp promoter fused to the chloramphenicol acetyl transferase (CAT) gene were analysed by transient transfection into uninduced and IL-6-treated Hep3B cells. We identified three regions, A, B and C, defined by mutation, which are important for the IL-6 response. Band shift experiments using nuclear extracts from untreated or IL-6-treated cells revealed the presence of IL-6-inducible DNA binding activities when DNA fragments containing the A or the C sequences were used. Competition experiments showed that both sequences bind to the same nuclear factors. Polymers of oligonucleotides containing either the A or the C regions confer IL-6 responsiveness to a truncated SV40 promoter. The B region forms several complexes with specific DNA-binding proteins different from those which bind to the A and C region. The B region complexes are identical in nuclear extracts from IL-6-treated and untreated cells. While important for IL-6 induction in the context of the haptoglobin promoter, the B site does not confer IL-6 inducibility to the SV40 promoter. Our results indicate that the IL-6 response of the haptoglobin promoter is dependent on the presence of multiple, partly redundant, cis-acting elements. Images PMID:2787245

  17. Structure of p73 DNA-binding domain tetramer modulates p73 transactivation

    PubMed Central

    Ethayathulla, Abdul S.; Tse, Pui-Wah; Monti, Paola; Nguyen, Sonha; Inga, Alberto; Fronza, Gilberto; Viadiu, Hector

    2012-01-01

    The transcription factor p73 triggers developmental pathways and overlaps stress-induced p53 transcriptional pathways. How p53-family response elements determine and regulate transcriptional specificity remains an unsolved problem. In this work, we have determined the first crystal structures of p73 DNA-binding domain tetramer bound to response elements with spacers of different length. The structure and function of the adaptable tetramer are determined by the distance between two half-sites. The structures with zero and one base-pair spacers show compact p73 DNA-binding domain tetramers with large tetramerization interfaces; a two base-pair spacer results in DNA unwinding and a smaller tetramerization interface, whereas a four base-pair spacer hinders tetramerization. Functionally, p73 is more sensitive to spacer length than p53, with one base-pair spacer reducing 90% of transactivation activity and longer spacers reducing transactivation to basal levels. Our results establish the quaternary structure of the p73 DNA-binding domain required as a scaffold to promote transactivation. PMID:22474346

  18. Surveying DNA Elements within Functional Genes of Heterocyst-Forming Cyanobacteria

    PubMed Central

    Hilton, Jason A.; Meeks, John C.; Zehr, Jonathan P.

    2016-01-01

    Some cyanobacteria are capable of differentiating a variety of cell types in response to environmental factors. For instance, in low nitrogen conditions, some cyanobacteria form heterocysts, which are specialized for N2 fixation. Many heterocyst-forming cyanobacteria have DNA elements interrupting key N2 fixation genes, elements that are excised during heterocyst differentiation. While the mechanism for the excision of the element has been well-studied, many questions remain regarding the introduction of the elements into the cyanobacterial lineage and whether they have been retained ever since or have been lost and reintroduced. To examine the evolutionary relationships and possible function of DNA sequences that interrupt genes of heterocyst-forming cyanobacteria, we identified and compared 101 interruption element sequences within genes from 38 heterocyst-forming cyanobacterial genomes. The interruption element lengths ranged from about 1 kb (the minimum able to encode the recombinase responsible for element excision), up to nearly 1 Mb. The recombinase gene sequences served as genetic markers that were common across the interruption elements and were used to track element evolution. Elements were found that interrupted 22 different orthologs, only five of which had been previously observed to be interrupted by an element. Most of the newly identified interrupted orthologs encode proteins that have been shown to have heterocyst-specific activity. However, the presence of interruption elements within genes with no known role in N2 fixation, as well as in three non-heterocyst-forming cyanobacteria, indicates that the processes that trigger the excision of elements may not be limited to heterocyst development or that the elements move randomly within genomes. This comprehensive analysis provides the framework to study the history and behavior of these unique sequences, and offers new insight regarding the frequency and persistence of interruption elements in heterocyst-forming cyanobacteria. PMID:27206019

  19. Surveying DNA Elements within Functional Genes of Heterocyst-Forming Cyanobacteria.

    PubMed

    Hilton, Jason A; Meeks, John C; Zehr, Jonathan P

    2016-01-01

    Some cyanobacteria are capable of differentiating a variety of cell types in response to environmental factors. For instance, in low nitrogen conditions, some cyanobacteria form heterocysts, which are specialized for N2 fixation. Many heterocyst-forming cyanobacteria have DNA elements interrupting key N2 fixation genes, elements that are excised during heterocyst differentiation. While the mechanism for the excision of the element has been well-studied, many questions remain regarding the introduction of the elements into the cyanobacterial lineage and whether they have been retained ever since or have been lost and reintroduced. To examine the evolutionary relationships and possible function of DNA sequences that interrupt genes of heterocyst-forming cyanobacteria, we identified and compared 101 interruption element sequences within genes from 38 heterocyst-forming cyanobacterial genomes. The interruption element lengths ranged from about 1 kb (the minimum able to encode the recombinase responsible for element excision), up to nearly 1 Mb. The recombinase gene sequences served as genetic markers that were common across the interruption elements and were used to track element evolution. Elements were found that interrupted 22 different orthologs, only five of which had been previously observed to be interrupted by an element. Most of the newly identified interrupted orthologs encode proteins that have been shown to have heterocyst-specific activity. However, the presence of interruption elements within genes with no known role in N2 fixation, as well as in three non-heterocyst-forming cyanobacteria, indicates that the processes that trigger the excision of elements may not be limited to heterocyst development or that the elements move randomly within genomes. This comprehensive analysis provides the framework to study the history and behavior of these unique sequences, and offers new insight regarding the frequency and persistence of interruption elements in heterocyst-forming cyanobacteria.

  20. Characterization of human glucocorticoid receptor complexes formed with DNA fragments containing or lacking glucocorticoid response elements

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tully, D.B.; Cidlowski, J.A.

    1989-03-07

    Sucrose density gradient shift assays were used to study the interactions of human glucocorticoid receptors (GR) with small DNA fragments either containing or lacking glucocorticoid response element (GRE) DNA consensus sequences. When crude cytoplasmic extracts containing ({sup 3}H)triamcinolone acetonide (({sup 3}H)TA) labeled GR were incubated with unlabeled DNA under conditions of DNA excess, a GRE-containing DNA fragment obtained from the 5' long terminal repeat of mouse mammary tumor virus (MMTV LTR) formed a stable 12-16S complex with activated, but not nonactivated, ({sup 3}H)TA receptor. By contrast, if the cytosols were treated with calf thymus DNA-cellulose to deplete non-GR-DNA-binding proteins priormore » to heat activation, a smaller 7-10S complex was formed with the MMTV LTR DNA fragment. Activated ({sup 3}H)TA receptor from DNA-cellulose pretreated cytosols also interacted with two similarly sized fragments from pBR322 DNA. Stability of the complexes formed between GR and these three DNA fragments was strongly affected by even moderate alterations in either the salt concentration or the pH of the gradient buffer. Under all conditions tested, the complex formed with the MMTV LTR DNA fragment was more stable than the complexes formed with either of the pBR322 DNA fragments. Together these observations indicate that the formation of stable complexes between activated GR and isolated DNA fragments requires the presence of GRE consensus sequences in the DNA.« less

  1. Photoinduced Regeneration of an Aptamer-Based Electrochemical Sensor for Sensitively Detecting Adenosine Triphosphate.

    PubMed

    Zhang, Xiaoyu; Song, Chunxia; Yang, Ke; Hong, Wenwen; Lu, Ying; Yu, Ping; Mao, Lanqun

    2018-04-17

    Electrochemical aptasensors generally include three elements, that is, recognition element, signal-transformation element, and regeneration element. In this study, a new adenosine triphosphate (ATP) aptasensor is developed by combining three elements into one DNA oligonucleotide chain. In the DNA oligonucleotide chain, DNA aptamer is used as the recognition element, ferrocene group attached at the 3'-end of the aptamer is used as the signal-transformation element, and azobenzene moiety embedded into the DNA chain is used as the regeneration element. In addition to the similar analytical properties with the traditional ones, the aptasensor developed here is easily regenerated with UV-light irradiation. The current response recorded on the aptasensor increases with increasing the concentration of ATP in the incubation solution and is linear with the logarithm of ATP concentration in the range from 1 nM to 100 μM. The limit of detection is 0.5 nM (S/N = 3). The basal level of ATP in the rat brain cortex microdialysate is determined to be 21.33 ± 4.1 nM ( n = 3). After being challenged with ATP, the aptasensor could be readily regenerated by UV-light irradiation for more than seven cycles. The regeneration of the aptasensor is proposed to be regulated by conversing azobenzene from its trans to cis form under UV irradiation.

  2. Cryptic MCAT enhancer regulation in fibroblasts and smooth muscle cells. Suppression of TEF-1 mediated activation by the single-stranded DNA-binding proteins, Pur alpha, Pur beta, and MSY1.

    PubMed

    Carlini, Leslie E; Getz, Michael J; Strauch, Arthur R; Kelm, Robert J

    2002-03-08

    An asymmetric polypurine-polypyrimidine cis-element located in the 5' region of the mouse vascular smooth muscle alpha-actin gene serves as a binding site for multiple proteins with specific affinity for either single- or double-stranded DNA. Here, we test the hypothesis that single-stranded DNA-binding proteins are responsible for preventing a cryptic MCAT enhancer centered within this element from cooperating with a nearby serum response factor-interacting CArG motif to trans-activate the minimal promoter in fibroblasts and smooth muscle cells. DNA binding studies revealed that the core MCAT sequence mediates binding of transcription enhancer factor-1 to the double-stranded polypurine-polypyrimidine element while flanking nucleotides account for interaction of Pur alpha and Pur beta with the purine-rich strand and MSY1 with the complementary pyrimidine-rich strand. Mutations that selectively impaired high affinity single-stranded DNA binding by fibroblast or smooth muscle cell-derived Pur alpha, Pur beta, and MSY1 in vitro, released the cryptic MCAT enhancer from repression in transfected cells. Additional experiments indicated that Pur alpha, Pur beta, and MSY1 also interact specifically, albeit weakly, with double-stranded DNA and with transcription enhancer factor-1. These results are consistent with two plausible models of cryptic MCAT enhancer regulation by Pur alpha, Pur beta, and MSY1 involving either competitive single-stranded DNA binding or masking of MCAT-bound transcription enhancer factor-1.

  3. Multivalent DNA-binding properties of the HMG-1 proteins.

    PubMed Central

    Maher, J F; Nathans, D

    1996-01-01

    HMG-I proteins are DNA-binding proteins thought to affect the formation and function of transcription complexes. Each protein contains three DNA-binding motifs, known as AT-hooks, that bind in the minor groove of AT tracts in DNA. Multiple AT-hooks within a polypeptide chain should contact multiple AT tracts, but the rules governing these interactions have not been defined. In this study, we demonstrate that high-affinity binding uses two or three appropriately spaced AT tracts as a single multivalent binding site. These principles have implications for binding to regulatory elements such as the interferon beta enhancer, TATA boxes, and serum response elements. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8692884

  4. The high mobility group protein 1 enhances binding of the estrogen receptor DNA binding domain to the estrogen response element.

    PubMed

    Romine, L E; Wood, J R; Lamia, L A; Prendergast, P; Edwards, D P; Nardulli, A M

    1998-05-01

    We have examined the ability of the high-mobility group protein 1 (HMG1) to alter binding of the estrogen receptor DNA-binding domain (DBD) to the estrogen response element (ERE). HMG1 dramatically enhanced binding of purified, bacterially expressed DBD to the consensus vitellogenin A2 ERE in a dose-dependent manner. The ability of HMG1 to stabilize the DBD-ERE complex resulted in part from a decrease in the dissociation rate of the DBD from the ERE. Antibody supershift experiments demonstrated that HMG1 was also capable of forming a ternary complex with the ERE-bound DBD in the presence of HMG1-specific antibody. HMG1 did not substantially affect DBD-ERE contacts as assessed by methylation interference assays, nor did it alter the ability of the DBD to induce distortion in ERE-containing DNA fragments. Because HMG1 dramatically enhanced estrogen receptor DBD binding to the ERE, and the DBD is the most highly conserved region among the nuclear receptor superfamily members, HMG1 may function to enhance binding of other nuclear receptors to their respective response elements and act in concert with coactivator proteins to regulate expression of hormone-responsive genes.

  5. Inducible in vivo DNA footprints define sequences necessary for UV light activation of the parsley chalcone synthase gene.

    PubMed Central

    Schulze-Lefert, P; Dangl, J L; Becker-André, M; Hahlbrock, K; Schulz, W

    1989-01-01

    We began characterization of the protein--DNA interactions necessary for UV light induced transcriptional activation of the gene encoding chalcone synthase (CHS), a key plant defense enzyme. Three light dependent in vivo footprints appear on a 90 bp stretch of the CHS promoter with a time course correlated with the onset of CHS transcription. We define a minimal light responsive promoter by functional analysis of truncated CHS promoter fusions with a reporter gene in transient expression experiments in parsley protoplasts. Two of the three footprinted sequence 'boxes' reside within the minimal promoter. Replacement of 10 bp within either of these 'boxes' leads to complete loss of light responsiveness. We conclude that these sequences define the necessary cis elements of the minimal CHS promoter's light responsive element. One of the functionally defined 'boxes' is homologous to an element implicated in regulation of genes involved in photosynthesis. These data represent the first example in a plant defense gene of an induced change in protein--DNA contacts necessary for transcriptional activation. Also, our data argue strongly that divergent light induced biosynthetic pathways share common regulatory units. Images PMID:2566481

  6. [Construction of a general AAV vector regulated by minimal and artificial hypoxic-responsive element].

    PubMed

    Nie, Xiao-wei; Sun, Li-jun; Hao, Yue-wen; Yang, Guang-xiao; Wang, Quan-ying

    2011-03-01

    To synthesize the minimal and artificial HRE, and to insert it into the anterior extremity of CMV promoter of a AAV plasmid, and then to construct the AAV regulated by hypoxic-responsive element which was introduced into 293 cell by method of Ca3(PO4)2 using three plasmids. Thus obtaining the adenoassociated virus vector regulated by hypoxic-responsive element was possibly used for gene therapy in ischemia angiocardiopathy and cerebrovascular disease. Artificially synthesize the 36 bp nucleotide sequences of four connection in series HIF-binding sites A/GCGTG(4×HBS)and a 35 bp nucleotide sequences spacing inserted into anterior extremity of CMV promoter TATA Box, then amplified by PCR. The cDNA fragment was confirmed to be right by DNA sequencing. Molecular biology routine method was used to construct a AAV vector regulated by minimal hypoxic-responsive element after the normal CMV promoter in AAV vector was replaced by the CMV promoter included minimal hypoxic-responsive element. Then, NT4-6His-PR39 fusogenic peptide was inserted into MCS of the plasmid, the recombinant AAV vector was obtained by three plasmid co-transfection in 293 cells, in which we can also investigate the expression of 6×His using immunochemistry in hypoxia environment. Artificial HRE was inserted into anterior extremity of CMV promoter and there was a correct spacing between the HRE and the TATA-box. The DNA sequencing and restriction enzyme digestion results indicated that the AAV regulated by hypoxic-responsive element was successfully constructed. Compared to the control group, the expressions of 6×His was significantly increased in the experimental groups in hypoxia environment, which confirmed that the AAV effectually regulated by the minimal HRE was inserted into anterior extremity of CMV promoter. The HRE is inserted into anterior extremity of CMV promoter to lack incision enzyme recognition site by PCR. And eukaryotic expression vector regulated by hypoxic-responsive is constructed. The AAV effectually regulated by the minimal HRE inserted into anterior extremity of CMV promoter. The vector is successfully constructed and it has important theoretical and practical value in the synteresis and therapy of ischemia angiocardiopathy and cerebrovascular disease.

  7. Dual DNA binding property of ABA insensitive 3 like factors targeted to promoters responsive to ABA and auxin.

    PubMed

    Nag, Ronita; Maity, Manas Kanti; Dasgupta, Maitrayee

    2005-11-01

    The ABA responsive ABI3 and the auxin responsive ARF family of transcription factors bind the CATGCATG (Sph) and TGTCTC core motifs in ABA and auxin response elements (ABRE and AuxRE), respectively. Several evidences indicate ABI3s to act downstream to auxin too. Because DNA binding domain of ABI3s shows significant overlap with ARFs we enquired whether auxin responsiveness through ABI3s could be mediated by their binding to canonical AuxREs. Investigations were undertaken through in vitro gel mobility shift assays (GMSA) using the DNA binding domain B3 of PvAlf (Phaseolus vulgaris ABI3 like factor) and upstream regions of auxin responsive gene GH3 (-267 to -141) and ABA responsive gene Em (-316 to -146) harboring AuxRE and ABRE, respectively. We demonstrate that B3 domain of PvAlf could bind AuxRE only when B3 was associated with its flanking domain B2 (B2B3). Such strict requirement of B2 domain was not observed with ABRE, where B3 could bind with or without being associated with B2. This dual specificity in DNA binding of ABI3s was also demonstrated with nuclear extracts of cultured cells of Arachis hypogea. Supershift analysis of ABRE and AuxRE bound nuclear proteins with antibodies raised against B2B3 domains of PvAlf revealed that ABI3 associated complexes were detectable in association with both cis elements. Competition GMSA confirmed the same complexes to bind ABRE and AuxRE. This dual specificity of ABI3 like factors in DNA binding targeted to natural promoters responsive to ABA and auxin suggests them to have a potential role in conferring crosstalk between these two phytohormones.

  8. The SOS response is permitted in Escherichia coli strains deficient in the expression of the mazEF pathway.

    PubMed

    Kalderon, Ziva; Kumar, Sathish; Engelberg-Kulka, Hanna

    2014-01-01

    The Escherichia coli (E. coli) SOS response is the largest, most complex, and best characterized bacterial network induced by DNA damage. It is controlled by a complex network involving the RecA and LexA proteins. We have previously shown that the SOS response to DNA damage is inhibited by various elements involved in the expression of the E. coli toxin-antitoxin mazEF pathway. Since the mazEF module is present on the chromosomes of most E. coli strains, here we asked: Why is the SOS response found in so many E. coli strains? Is the mazEF module present but inactive in those strains? We examined three E. coli strains used for studies of the SOS response, strains AB1932, BW25113, and MG1655. We found that each of these strains is either missing or inhibiting one of several elements involved in the expression of the mazEF-mediated death pathway. Thus, the SOS response only takes place in E. coli cells in which one or more elements of the E. coli toxin-antitoxin module mazEF or its downstream pathway is not functioning.

  9. The SOS Response is Permitted in Escherichia coli Strains Deficient in the Expression of the mazEF Pathway

    PubMed Central

    Kalderon, Ziva; Kumar, Sathish; Engelberg-Kulka, Hanna

    2014-01-01

    The Escherichia coli (E. coli) SOS response is the largest, most complex, and best characterized bacterial network induced by DNA damage. It is controlled by a complex network involving the RecA and LexA proteins. We have previously shown that the SOS response to DNA damage is inhibited by various elements involved in the expression of the E. coli toxin-antitoxin mazEF pathway. Since the mazEF module is present on the chromosomes of most E. coli strains, here we asked: Why is the SOS response found in so many E. coli strains? Is the mazEF module present but inactive in those strains? We examined three E. coli strains used for studies of the SOS response, strains AB1932, BW25113, and MG1655. We found that each of these strains is either missing or inhibiting one of several elements involved in the expression of the mazEF-mediated death pathway. Thus, the SOS response only takes place in E. coli cells in which one or more elements of the E. coli toxin-antitoxin module mazEF or its downstream pathway is not functioning. PMID:25470502

  10. Identification and functional characterization of BTas transactivator as a DNA-binding protein.

    PubMed

    Tan, Juan; Hao, Peng; Jia, Rui; Yang, Wei; Liu, Ruichang; Wang, Jinzhong; Xi, Zhen; Geng, Yunqi; Qiao, Wentao

    2010-09-30

    The genome of bovine foamy virus (BFV) encodes a transcriptional transactivator, namely BTas, that remarkably enhances gene expression by binding to the viral long-terminal repeat promoter (LTR) and internal promoter (IP). In this report, we characterized the functional domains of BFV BTas. BTas contains two major functional domains: the N-terminal DNA-binding domain (residues 1-133) and the C-terminal activation domain (residues 198-249). The complete BTas responsive regions were mapped to the positions -380/-140 of LTR and 9205/9276 of IP. Four BTas responsive elements were identified at the positions -368/-346, -327/-307, -306/-285 and -186/-165 of the BFV LTR, and one element was identified at the position 9243/9264 of the BFV IP. Unlike other foamy viruses, the five BTas responsive elements in BFV shared obvious sequence homology. These data suggest that among the complex retroviruses, BFV appears to have a unique transactivation mechanism. Crown Copyright 2010. Published by Elsevier Inc. All rights reserved.

  11. A role for circadian evening elements in cold-regulated gene expression in Arabidopsis.

    PubMed

    Mikkelsen, Michael D; Thomashow, Michael F

    2009-10-01

    The plant transcriptome is dramatically altered in response to low temperature. The cis-acting DNA regulatory elements and trans-acting factors that regulate the majority of cold-regulated genes are unknown. Previous bioinformatic analysis has indicated that the promoters of cold-induced genes are enriched in the Evening Element (EE), AAAATATCT, a DNA regulatory element that has a role in circadian-regulated gene expression. Here we tested the role of EE and EE-like (EEL) elements in cold-induced expression of two Arabidopsis genes, CONSTANS-like 1 (COL1; At5g54470) and a gene encoding a 27-kDa protein of unknown function that we designated COLD-REGULATED GENE 27 (COR27; At5g42900). Mutational analysis indicated that the EE/EEL elements were required for cold induction of COL1 and COR27, and that their action was amplified through coupling with ABA response element (ABRE)-like (ABREL) motifs. An artificial promoter consisting solely of four EE motifs interspersed with three ABREL motifs was sufficient to impart cold-induced gene expression. Both COL1 and COR27 were found to be regulated by the circadian clock at warm growth temperatures and cold-induction of COR27 was gated by the clock. These results suggest that cold- and clock-regulated gene expression are integrated through regulatory proteins that bind to EE and EEL elements supported by transcription factors acting at ABREL sequences. Bioinformatic analysis indicated that the coupling of EE and EEL motifs with ABREL motifs is highly enriched in cold-induced genes and thus may constitute a DNA regulatory element pair with a significant role in configuring the low-temperature transcriptome.

  12. Transcriptional activation of transforming growth factor alpha by estradiol: requirement for both a GC-rich site and an estrogen response element half-site.

    PubMed

    Vyhlidal, C; Samudio, I; Kladde, M P; Safe, S

    2000-06-01

    17beta-Estradiol (E2) induces transforming growth factor alpha (TGFalpha) gene expression in MCF-7 cells and previous studies have identified a 53 bp (-252 to -200) sequence containing two imperfect estrogen responsive elements (EREs) that contribute to E2 responsiveness. Deletion analysis of the TGFalpha gene promoter in this study identified a second upstream region of the promoter (-623 to -549) that is also E2 responsive. This sequence contains three GC-rich sites and an imperfect ERE half-site, and the specific cis-elements and trans-acting factors were determined by promoter analysis in transient transfection experiments, gel mobility shift assays and in vitro DNA footprinting. The results are consistent with an estrogen receptor alpha (ERalpha)/Sp1 complex interacting with an Sp1(N)(30) ERE half-site ((1/2)) motif in which both ERalpha and Sp1 bind promoter DNA. The ER/Sp1-DNA complex is formed using nuclear extracts from MCF-7 cells but not with recombinant human ERalpha or Sp1 proteins, suggesting that other nuclear factor(s) are required for complex stabilization. The E2-responsive Sp1(N)(x)ERE(1/2) motif identified in the TGFalpha gene promoter has also been characterized in the cathepsin D and heat shock protein 27 gene promoters; however, in the latter two promoters the numbers of intervening nucleotides are 23 and 10 respectively.

  13. Evolution of Genome Size and Complexity in Pinus

    PubMed Central

    Morse, Alison M.; Peterson, Daniel G.; Islam-Faridi, M. Nurul; Smith, Katherine E.; Magbanua, Zenaida; Garcia, Saul A.; Kubisiak, Thomas L.; Amerson, Henry V.; Carlson, John E.; Nelson, C. Dana; Davis, John M.

    2009-01-01

    Background Genome evolution in the gymnosperm lineage of seed plants has given rise to many of the most complex and largest plant genomes, however the elements involved are poorly understood. Methodology/Principal Findings Gymny is a previously undescribed retrotransposon family in Pinus that is related to Athila elements in Arabidopsis. Gymny elements are dispersed throughout the modern Pinus genome and occupy a physical space at least the size of the Arabidopsis thaliana genome. In contrast to previously described retroelements in Pinus, the Gymny family was amplified or introduced after the divergence of pine and spruce (Picea). If retrotransposon expansions are responsible for genome size differences within the Pinaceae, as they are in angiosperms, then they have yet to be identified. In contrast, molecular divergence of Gymny retrotransposons together with other families of retrotransposons can account for the large genome complexity of pines along with protein-coding genic DNA, as revealed by massively parallel DNA sequence analysis of Cot fractionated genomic DNA. Conclusions/Significance Most of the enormous genome complexity of pines can be explained by divergence of retrotransposons, however the elements responsible for genome size variation are yet to be identified. Genomic resources for Pinus including those reported here should assist in further defining whether and how the roles of retrotransposons differ in the evolution of angiosperm and gymnosperm genomes. PMID:19194510

  14. What triggers differential DNA methylation of genes and TEs: contribution of body methylation?

    PubMed

    Inagaki, S; Kakutani, T

    2012-01-01

    Transposable elements (TEs) are epigenetically silenced with extensive DNA methylation. The silent epigenetic marks should, however, be excluded from active genes. By genetic approaches, we study mechanisms to remove the heterochromatin marks from transcribed genes. Based on our observations on control of TE transcription, we propose a possible trigger for the TE-specific accumulation of DNA methylation. A critical difference between TEs and genes could be their responses to the DNA methylation in the internal part of transcribed regions. When their internal region is methylated, genes are still transcribed, but TEs could be silenced, which may reflect the obligatory position of every critical cis-acting element within the TE itself. This initial difference of TEs and genes will be amplified by positive feedback loops to stabilize active or silent states. Thus, the mechanisms to accumulate heterochromatin marks within transcribed regions could provide a trigger to induce differential DNA methylation between genes and TEs.

  15. pH-Driven Reversible Self-Assembly of Micron-Scale DNA Scaffolds.

    PubMed

    Green, Leopold N; Amodio, Alessia; Subramanian, Hari K K; Ricci, Francesco; Franco, Elisa

    2017-12-13

    Inspired by cytoskeletal scaffolds that sense and respond dynamically to environmental changes and chemical inputs with a unique capacity for reconfiguration, we propose a strategy that allows the dynamic and reversible control of the growth and breakage of micron-scale synthetic DNA structures upon pH changes. We do so by rationally designing a pH-responsive system composed of synthetic DNA strands that act as pH sensors, regulators, and structural elements. Sensor strands can dynamically respond to pH changes and route regulatory strands to direct the self-assembly of structural elements into tubular structures. This example represents the first demonstration of the reversible assembly and disassembly of micron-scale DNA scaffolds using an external chemical input other than DNA. The capacity to reversibly modulate nanostructure size may promote the development of smart devices for catalysis or drug-delivery applications.

  16. A nuclear factor I-like activity and a liver-specific repressor govern estrogen-regulated in vitro transcription from the Xenopus laevis vitellogenin B1 promoter.

    PubMed

    Corthésy, B; Cardinaux, J R; Claret, F X; Wahli, W

    1989-12-01

    A hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to identify novel cis-acting elements within the vitellogenin gene B1 promoter region. In addition to the already well-documented estrogen-responsive element (ERE), two elements were found within the 140 base pairs upstream of the transcription initiation site. One of them, a negative regulatory element, is responsible for the lack of promoter activity in the absence of the hormone and, as demonstrated by DNA-binding assays, interacts with a liver-specific transcription factor. The second is required in association with the estrogen-responsive element to mediate hormonal induction and is recognized by the Xenopus liver homolog of nuclear factor I.

  17. Cytosolic sensing of immuno-stimulatory DNA, the enemy within.

    PubMed

    Dhanwani, Rekha; Takahashi, Mariko; Sharma, Sonia

    2018-02-01

    In the cytoplasm, DNA is sensed as a universal danger signal by the innate immune system. Cyclic GMP-AMP synthase (cGAS) is a cytosolic DNA sensor/enzyme that catalyzes formation of 2'-5'-cGAMP, an atypical cyclic di-nucleotide second messenger that binds and activates the Stimulator of Interferon Genes (STING), resulting in recruitment of Tank Binding Kinase 1 (TBK1), activation of the transcription factor Interferon Regulatory Factor 3 (IRF3), and trans-activation of innate immune response genes, including type I Interferon cytokines (IFN-I). Activation of the pro-inflammatory cGAS-STING-IRF3 response is triggered by direct recognition of the DNA genomes of bacteria and viruses, but also during RNA virus infection, neoplastic transformation, tumor immunotherapy and systemic auto-inflammatory diseases. In these circumstances, the source of immuno-stimulatory DNA has often represented a fundamental yet poorly understood aspect of the response. This review focuses on recent findings related to cGAS activation by an array of self-derived DNA substrates, including endogenous retroviral elements, mitochondrial DNA (mtDNA) and micronuclei generated as a result of genotoxic stress and DNA damage. These findings emphasize the role of the cGAS axis as a cell-intrinsic innate immune response to a wide variety of genomic insults. Copyright © 2017. Published by Elsevier Ltd.

  18. An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

    PubMed

    Itzhaki, H; Maxson, J M; Woodson, W R

    1994-09-13

    The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.

  19. Modeling Interactions between Transposable Elements and the Plant Epigenetic Response: A Surprising Reliance on Element Retention.

    PubMed

    Roessler, Kyria; Bousios, Alexandros; Meca, Esteban; Gaut, Brandon S

    2018-03-01

    Transposable elements (TEs) compose the majority of angiosperm DNA. Plants counteract TE activity by silencing them epigenetically. One form of epigenetic silencing requires 21-22 nt small interfering RNAs that act to degrade TE mRNA and may also trigger DNA methylation. DNA methylation is reinforced by a second mechanism, the RNA-dependent DNA methylation (RdDM) pathway. RdDM relies on 24 nt small interfering RNAs and ultimately establishes TEs in a quiescent state. These host factors interact at a systems level, but there have been no system level analyses of their interactions. Here, we define a deterministic model that represents the propagation of active TEs, aspects of the host response and the accumulation of silenced TEs. We describe general properties of the model and also fit it to biological data in order to explore two questions. The first is why two overlapping pathways are maintained, given that both are likely energetically expensive. Under our model, RdDM silenced TEs effectively even when the initiation of silencing was weak. This relationship implies that only a small amount of RNAi is needed to initiate TE silencing, but reinforcement by RdDM is necessary to efficiently counter TE propagation. Second, we investigated the reliance of the host response on rates of TE deletion. The model predicted that low levels of deletion lead to few active TEs, suggesting that silencing is most efficient when methylated TEs are retained in the genome, thereby providing one explanation for the large size of plant genomes.

  20. Vitamin D receptor displays DNA binding and transactivation as a heterodimer with the retinoid X receptor, but not with the thyroid hormone receptor.

    PubMed

    Thompson, P D; Hsieh, J C; Whitfield, G K; Haussler, C A; Jurutka, P W; Galligan, M A; Tillman, J B; Spindler, S R; Haussler, M R

    1999-12-01

    The vitamin D receptor (VDR) is a transcription factor believed to function as a heterodimer with the retinoid X receptor (RXR). However, it was reported [Schräder et al., 1994] that, on putative vitamin D response elements (VDREs) within the rat 9k and mouse 28k calcium binding protein genes (rCaBP 9k and mCaBP 28k), VDR and thyroid hormone receptor (TR) form heterodimers that transactivate in response to both 1,25-dihydroxyvitamin D(3) (1,25(OH)(2)D(3)) and triiodothyronine (T(3)). We, therefore, examined associations of these receptors on the putative rCaBP 9k and mCaBP 28k VDREs, as well as on established VDREs from the rat osteocalcin (rOC) and mouse osteopontin (mOP) genes, plus the thyroid hormone response element (TRE) from the rat myosin heavy chain (rMHC) gene. In gel mobility shift assays, we found no evidence for VDR-TR heterodimer interaction with any tested element. Further, employing these hormone response elements linked to reporter genes in transfected cells, VDR and TR mediated responses to their cognate ligands only from the rOC/mOP and rMHC elements, respectively, while the CaBP elements were unresponsive to any combination of ligand(s). Utilizing the rOC and mOP VDREs, two distinct repressive actions of TR on VDR-mediated signaling were demonstrated: a T(3)-independent action, presumably via direct TR-RXR competition for DNA binding, and a T(3)-dependent repression, likely by diversion of limiting RXR from VDR-RXR toward the formation of TR-RXR heterodimers. The relative importance of these two mechanisms differed in a response element-specific manner. These results may provide a partial explanation for the observed association between hyperthyroidism and bone demineralization/osteoporosis. Copyright 1999 Wiley-Liss, Inc.

  1. ICE Afe 1, an actively excising genetic element from the biomining bacterium Acidithiobacillus ferrooxidans.

    PubMed

    Bustamante, Paula; Covarrubias, Paulo C; Levicán, Gloria; Katz, Assaf; Tapia, Pablo; Holmes, David; Quatrini, Raquel; Orellana, Omar

    2012-01-01

    Integrative conjugative elements (ICEs) are self-transferred mobile genetic elements that contribute to horizontal gene transfer. An ICE (ICEAfe1) was identified in the genome of Acidithiobacillus ferrooxidans ATCC 23270. Excision of the element and expression of relevant genes under normal and DNA-damaging growth conditions was analyzed. Bioinformatic tools and DNA amplification methods were used to identify and to assess the excision and expression of genes related to the mobility of the element. Both basal and mitomycin C-inducible excision as well as expression and induction of the genes for integration/excision are demonstrated, suggesting that ICEAfe1 is an actively excising SOS-regulated mobile genetic element. The presence of a complete set of genes encoding self-transfer functions that are induced in response to DNA damage caused by mitomycin C additionally suggests that this element is capable of conjugative transfer to suitable recipient strains. Transfer of ICEAfe1 may provide selective advantages to other acidophiles in this ecological niche through dissemination of gene clusters expressing transfer RNAs, CRISPRs, and exopolysaccharide biosynthesis enzymes, probably by modification of translation efficiency, resistance to bacteriophage infection and biofilm formation, respectively. These data open novel avenues of research on conjugative transformation of biotechnologically relevant microorganisms recalcitrant to genetic manipulation. Copyright © 2013 S. Karger AG, Basel.

  2. Isolation, characterization and expression analysis of the BABY BOOM (BBM) gene from Larix kaempferi × L. olgensis during adventitious rooting.

    PubMed

    Li, Kui-Peng; Sun, Xiao-Mei; Han, Hua; Zhang, Shou-Gong

    2014-11-10

    The full-length cDNA and genomic sequences of the BABY BOOM (BBM) gene, designated LkBBM, were isolated from Larix kaempferi × Larix olgensis. The 3324 bp cDNA was cloned and its open reading frame (ORF) consists of 2370 nucleotides. The deduced 789 amino acid protein contains two AP2 domains and a BBM specific motif. Four conserved motifs between BBM and PLT were identified, which may be conducive to the similar function of BBM and PLT. The three dimensional (3D) structure of LkBBM was predicted and β-sheets in the AP2-R2 domain of LkBBM might recognize the specific base pairs in the major groove. Analysis of the LkBBM gene structure indicates that the gene has eight introns and nine exons. In the 5'-flanking promoter region of LkBBM, many important potential cis-acting elements were identified, such as the TATABOX5 element (a functional TATA element), ROOTMOTIFTAPOX1 element (element of root specificity), AUXREPSIAA4 element (element involved in auxin responsiveness and gene expression in root meristem), MYB1AT element (element involved in MYB recognition), ARR1AT element (element involved in cytokinin responsiveness), GARE1OSREP1 element (element involved in gibberellin responsiveness) and PYRIMIDINEBOXHVEPB1 element (element involved in abscisic acid responsiveness), which all suggested that the expression of LkBBM is highly regulated. Compared with gene expression levels in the stem, stem tip and leaf, LkBBM shows a specific expression in the root, which indicates that LkBBM plays a key role in regulating the development and growth of root in larch. In the processing of larch adventitious root formation, LkBBM started to express on the eighth day after rooting treatment and its transcript level increased continuously afterwards. According to the gene characteristics, LkBBM is proposed as a molecular marker for root primordia of larch, and the initial period of LkBBM expression may be the formation period of root primordia in the processing of adventitious rooting of larch. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Tunable regulation of CREB DNA binding activity couples genotoxic stress response and metabolism

    PubMed Central

    Kim, Sang Hwa; Trinh, Anthony T.; Larsen, Michele Campaigne; Mastrocola, Adam S.; Jefcoate, Colin R.; Bushel, Pierre R.; Tibbetts, Randal S.

    2016-01-01

    cAMP response element binding protein (CREB) is a key regulator of glucose metabolism and synaptic plasticity that is canonically regulated through recruitment of transcriptional coactivators. Here we show that phosphorylation of CREB on a conserved cluster of Ser residues (the ATM/CK cluster) by the DNA damage-activated protein kinase ataxia-telangiectasia-mutated (ATM) and casein kinase1 (CK1) and casein kinase2 (CK2) positively and negatively regulates CREB-mediated transcription in a signal dependent manner. In response to genotoxic stress, phosphorylation of the ATM/CK cluster inhibited CREB-mediated gene expression, DNA binding activity and chromatin occupancy proportional to the number of modified Ser residues. Paradoxically, substoichiometric, ATM-independent, phosphorylation of the ATM/CK cluster potentiated bursts in CREB-mediated transcription by promoting recruitment of the CREB coactivator, cAMP-regulated transcriptional coactivators (CRTC2). Livers from mice expressing a non-phosphorylatable CREB allele failed to attenuate gluconeogenic genes in response to DNA damage or fully activate the same genes in response to glucagon. We propose that phosphorylation-dependent regulation of DNA binding activity evolved as a tunable mechanism to control CREB transcriptional output and promote metabolic homeostasis in response to rapidly changing environmental conditions. PMID:27431323

  4. Dynamics and biological relevance of DNA demethylation in Arabidopsis antibacterial defense.

    PubMed

    Yu, Agnès; Lepère, Gersende; Jay, Florence; Wang, Jingyu; Bapaume, Laure; Wang, Yu; Abraham, Anne-Laure; Penterman, Jon; Fischer, Robert L; Voinnet, Olivier; Navarro, Lionel

    2013-02-05

    DNA methylation is an epigenetic mark that silences transposable elements (TEs) and repeats. Whereas the establishment and maintenance of DNA methylation are relatively well understood, little is known about their dynamics and biological relevance in plant and animal innate immunity. Here, we show that some TEs are demethylated and transcriptionally reactivated during antibacterial defense in Arabidopsis. This effect is correlated with the down-regulation of key transcriptional gene silencing factors and is partly dependent on an active demethylation process. DNA demethylation restricts multiplication and vascular propagation of the bacterial pathogen Pseudomonas syringae in leaves and, accordingly, some immune-response genes, containing repeats in their promoter regions, are negatively regulated by DNA methylation. This study provides evidence that DNA demethylation is part of a plant-induced immune response, potentially acting to prime transcriptional activation of some defense genes linked to TEs/repeats.

  5. A HLA class I cis-regulatory element whose activity can be modulated by hormones.

    PubMed

    Sim, B C; Hui, K M

    1994-12-01

    To elucidate the basis of the down-regulation in major histocompatibility complex (MHC) class I gene expression and to identify possible DNA-binding regulatory elements that have the potential to interact with class I MHC genes, we have studied the transcriptional regulation of class I HLA genes in human breast carcinoma cells. A 9 base pair (bp) negative cis-regulatory element (NRE) has been identified using band-shift assays employing DNA sequences derived from the 5'-flanking region of HLA class I genes. This 9-bp element, GTCATGGCG, located within exon I of the HLA class I gene, can potently inhibit the expression of a heterologous thymidine kinase (TK) gene promoter and the HLA enhancer element. Furthermore, this regulatory element can exert its suppressive function in either the sense or anti-sense orientation. More interestingly, NRE can suppress dexamethasone-mediated gene activation in the context of the reported glucocorticoid-responsive element (GRE) in MCF-7 cells but has no influence on the estrogen-mediated transcriptional activation of MCF-7 cells in the context of the reported estrogen-responsive element (ERE). Furthermore, the presence of such a regulatory element within the HLA class I gene whose activity can be modulated by hormones correlates well with our observation that the level of HLA class I gene expression can be down-regulated by hormones in human breast carcinoma cells. Such interactions between negative regulatory elements and specific hormone trans-activators are novel and suggest a versatile form of transcriptional control.

  6. Plasticity of DNA methylation and gene expression under zinc deficiency in Arabidopsis roots.

    PubMed

    Chen, Xiaochao; Schönberger, Brigitte; Menz, Jochen; Ludewig, Uwe

    2018-05-25

    DNA methylation is a heritable chromatin modification that maintains chromosome stability, regulates transposon silencing and appears to be involved in gene expression in response to environmental conditions. Environmental stress alters DNA methylation patterns that are correlated with gene expression differences. Here, genome-wide differential DNA-methylation was identified upon prolonged Zn deficiency, leading to hypo- and hyper-methylated chromosomal regions. Preferential CpG methylation changes occurred in gene promoters and gene bodies, but did not overlap with transcriptional start sites. Methylation changes were also prominent in transposable elements. By contrast, non-CG methylation differences were exclusively found in promoters of protein coding genes and in transposable elements. Strongly Zn deficiency-induced genes and their promoters were mostly non-methylated, irrespective of Zn supply. Differential DNA methylation in the CpG and CHG, but not in the CHH context, was found close to a few up-regulated Zn-deficiency genes. However, the transcriptional Zn-deficiency response in roots appeared little correlated with associated DNA methylation changes in promoters or gene bodies. Furthermore, under Zn deficiency, developmental defects were identified in an Arabidopsis mutant lacking non-CpG methylation. The root methylome thus responds specifically to a micro-nutrient deficiency and is important for efficient Zn utilization at low availability, but the relationship of differential methylation and differentially expressed genes is surprisingly poor.

  7. E2F1 induces p19INK4d, a protein involved in the DNA damage response, following UV irradiation.

    PubMed

    Carcagno, Abel L; Giono, Luciana E; Marazita, Mariela C; Castillo, Daniela S; Pregi, Nicolás; Cánepa, Eduardo T

    2012-07-01

    Central to the maintenance of genomic integrity is the cellular DNA damage response. Depending on the type of genotoxic stress and through the activation of multiple signaling cascades, it can lead to cell cycle arrest, DNA repair, senescence, and apoptosis. p19INK4d, a member of the INK4 family of CDK inhibitors, plays a dual role in the DNA damage response, inhibiting cell proliferation and promoting DNA repair. Consistently, p19INK4d has been reported to become upregulated in response to UV irradiation and a great variety of genotoxic agents. Here, this induction is shown to result from a transcriptional stimulatory mechanism that can occur at every phase of the cell cycle except during mitosis. Moreover, evidence is presented that demonstrates that E2F1 is involved in the induction of p19INK4d following UV treatment, as it is prevented by E2F1 protein ablation and DNA-binding inhibition. Specific inhibition of this regulation using triplex-forming oligonucleotides that target the E2F response elements present in the p19INK4d promoter also block p19INK4d upregulation and sensitize cells to DNA damage. These results constitute the first description of a mechanism for the induction of p19INK4d in response to UV irradiation and demonstrate the physiological relevance of this regulation following DNA damage.

  8. DNA Supercoiling and the Lrp Protein Determine the Directionality of fim Switch DNA Inversion in Escherichia coli K-12

    PubMed Central

    Kelly, Arlene; Conway, Colin; Ó Cróinín, Tadhg; Smith, Stephen G. J.; Dorman, Charles J.

    2006-01-01

    Site-specific recombinases of the integrase family usually require cofactors to impart directionality in the recombination reactions that they catalyze. The FimB integrase inverts the Escherichia coli fim switch (fimS) in the on-to-off and off-to-on directions with approximately equal efficiency. Inhibiting DNA gyrase with novobiocin caused inversion to become biased in the off-to-on direction. This directionality was not due to differential DNA topological distortion of fimS in the on and off phases by the activity of its resident PfimA promoter. Instead, the leucine-responsive regulatory (Lrp) protein was found to determine switching outcomes. Knocking out the lrp gene or abolishing Lrp binding sites 1 and 2 within fimS completely reversed the response of the switch to DNA relaxation. Inactivation of either Lrp site alone resulted in mild on-to-off bias, showing that they act together to influence the response of the switch to changes in DNA supercoiling. Thus, Lrp is not merely an architectural element organizing the fim invertasome, it collaborates with DNA supercoiling to determine the directionality of the DNA inversion event. PMID:16855224

  9. Satellite DNA Modulates Gene Expression in the Beetle Tribolium castaneum after Heat Stress

    PubMed Central

    Feliciello, Isidoro; Akrap, Ivana; Ugarković, Đurđica

    2015-01-01

    Non-coding repetitive DNAs have been proposed to perform a gene regulatory role, however for tandemly repeated satellite DNA no such role was defined until now. Here we provide the first evidence for a role of satellite DNA in the modulation of gene expression under specific environmental conditions. The major satellite DNA TCAST1 in the beetle Tribolium castaneum is preferentially located within pericentromeric heterochromatin but is also dispersed as single repeats or short arrays in the vicinity of protein-coding genes within euchromatin. Our results show enhanced suppression of activity of TCAST1-associated genes and slower recovery of their activity after long-term heat stress relative to the same genes without associated TCAST1 satellite DNA elements. The level of gene suppression is not influenced by the distance of TCAST1 elements from the associated genes up to 40 kb from the genes’ transcription start sites, but it does depend on the copy number of TCAST1 repeats within an element, being stronger for the higher number of copies. The enhanced gene suppression correlates with the enrichment of the repressive histone marks H3K9me2/3 at dispersed TCAST1 elements and their flanking regions as well as with increased expression of TCAST1 satellite DNA. The results reveal transient, RNAi based heterochromatin formation at dispersed TCAST1 repeats and their proximal regions as a mechanism responsible for enhanced silencing of TCAST1-associated genes. Differences in the pattern of distribution of TCAST1 elements contribute to gene expression diversity among T. castaneum strains after long-term heat stress and might have an impact on adaptation to different environmental conditions. PMID:26275223

  10. Epigenetics of the antibody response

    PubMed Central

    Li, Guideng; Zan, Hong; Xu, Zhenming; Casali, Paolo

    2013-01-01

    Epigenetic marks, such as DNA methylation, histone posttranslational modifications and microRNAs, are induced in B cells by the same stimuli that drive the antibody response. They play major roles in regulating somatic hypermutation (SHM), class switch DNA recombination (CSR) and differentiation to plasma cells or long-lived memory B cells. Histone modifications target the CSR and, possibly, SHM machinery to the immunoglobulin locus; they together with DNA methylation and microRNAs modulate the expression of critical elements of that machinery, such as AID, as well as factors central to plasma cell differentiation, such as Blimp-1. These inducible B cell-intrinsic epigenetic marks instruct the maturation of antibody responses. Their dysregulation plays an important role in aberrant antibody responses to foreign antigens, such as those of microbial pathogens, and self-antigens, such those targeted in autoimmunity, and B cell neoplasias. PMID:23643790

  11. Stress induced gene expression drives transient DNA methylation changes at adjacent repetitive elements.

    PubMed

    Secco, David; Wang, Chuang; Shou, Huixia; Schultz, Matthew D; Chiarenza, Serge; Nussaume, Laurent; Ecker, Joseph R; Whelan, James; Lister, Ryan

    2015-07-21

    Cytosine DNA methylation (mC) is a genome modification that can regulate the expression of coding and non-coding genetic elements. However, little is known about the involvement of mC in response to environmental cues. Using whole genome bisulfite sequencing to assess the spatio-temporal dynamics of mC in rice grown under phosphate starvation and recovery conditions, we identified widespread phosphate starvation-induced changes in mC, preferentially localized in transposable elements (TEs) close to highly induced genes. These changes in mC occurred after changes in nearby gene transcription, were mostly DCL3a-independent, and could partially be propagated through mitosis, however no evidence of meiotic transmission was observed. Similar analyses performed in Arabidopsis revealed a very limited effect of phosphate starvation on mC, suggesting a species-specific mechanism. Overall, this suggests that TEs in proximity to environmentally induced genes are silenced via hypermethylation, and establishes the temporal hierarchy of transcriptional and epigenomic changes in response to stress.

  12. Genome-wide DNA methylation map of human neutrophils reveals widespread inter-individual epigenetic variation

    PubMed Central

    Chatterjee, Aniruddha; Stockwell, Peter A.; Rodger, Euan J.; Duncan, Elizabeth J.; Parry, Matthew F.; Weeks, Robert J.; Morison, Ian M.

    2015-01-01

    The extent of variation in DNA methylation patterns in healthy individuals is not yet well documented. Identification of inter-individual epigenetic variation is important for understanding phenotypic variation and disease susceptibility. Using neutrophils from a cohort of healthy individuals, we generated base-resolution DNA methylation maps to document inter-individual epigenetic variation. We identified 12851 autosomal inter-individual variably methylated fragments (iVMFs). Gene promoters were the least variable, whereas gene body and upstream regions showed higher variation in DNA methylation. The iVMFs were relatively enriched in repetitive elements compared to non-iVMFs, and were associated with genome regulation and chromatin function elements. Further, variably methylated genes were disproportionately associated with regulation of transcription, responsive function and signal transduction pathways. Transcriptome analysis indicates that iVMF methylation at differentially expressed exons has a positive correlation and local effect on the inclusion of that exon in the mRNA transcript. PMID:26612583

  13. Strip biosensor for amplified detection of nerve growth factor-beta based on a molecular translator and catalytic DNA circuit.

    PubMed

    Liu, Jun; Lai, Ting; Mu, Kejie; Zhou, Zheng

    2014-10-07

    We have demonstrated a new visual detection approach based on a molecular translator and a catalytic DNA circuit for the detection of nerve growth factor-beta (NGF-β). In this assay, a molecular translator based on the binding-induced DNA strand-displacement reaction was employed to convert the input protein to an output DNA signal. The molecular translator is composed of a target recognition element and a signal output element. Target recognition is achieved by the binding of the anti-NGF-β antibody to the target protein. Polyclonal anti-NGF-β antibody is conjugated to DNA1 and DNA2. The antibody conjugated DNA1 is initially hybridized to DNA3 to form a stable DNA1/DNA3 duplex. In the presence of NGF-β, the binding of the same target protein brings DNA1 and DNA2 into close proximity, resulting in an increase in their local effective concentration. This process triggers the strand-displacement reaction between DNA2 and DNA3 and releases the output DNA3. The released DNA3 is further amplified by a catalytic DNA circuit. The product of the catalytic DNA circuit is detected by a strip biosensor. This proposed assay has high sensitivity and selectivity with a dynamic response ranging from 10 fM to 10 pM, and its detection limit is 10 fM of NGF-β. This work provides a sensitive, enzyme-free, and universal strategy for the detection of other proteins.

  14. Isolation and analysis of a multifunctional triterpene synthase KcMS promoter region from mangrove plant kandelia candel

    NASA Astrophysics Data System (ADS)

    Basyuni, M.; Wati, R.; Sulistiyono, N.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

    2018-03-01

    Molecular cloning of Kandelia candel KcMS gene has previously been cloned and encoded a multifunctional triterpene synthase. In this study, the KcMS gene promoter was cloned through Genome walking, sequenced, and analyzed. A 1,358 bp genomic DNA fragment of KcMS promoter was obtained. PLACE and PlantCARE analysis of the KcMS promoter revealed that there was some regulatory elements in response to environmental signals and involved in the regulation of gene expression. Results showed that four kinds of elements are regulated by hormone binding, namely 2 MeJA-responsiveness elements (CGTCA-motif and TGACG-motif), the ABRE (TACGTG) involved in abscisic acid responsiveness, gibberellin-related GARE-motif (AAACAGA), and the TGA-element (AACGAC) as an auxin-responsive element. Several elements in the KcMS have been shown in other plants to be responsive to abiotic stress. These motifs were MBS (CAACTG), TC-rich repeats, and eight light responsive elements. The KcMS promoter was also involved in the activation of defense genes in plants such as HSE (AAAAAATTC) and four circadian control elements (CAANNNNATC). The presence of multipotential regulatory motifs suggested that KcMS may be involved in regulation of plant tolerance to several types of stresses.

  15. Neisseria conserved protein DMP19 is a DNA mimic protein that prevents DNA binding to a hypothetical nitrogen-response transcription factor

    PubMed Central

    Wang, Hao-Ching; Ko, Tzu-Ping; Wu, Mao-Lun; Ku, Shan-Chi; Wu, Hsing-Ju; Wang, Andrew H.-J.

    2012-01-01

    DNA mimic proteins occupy the DNA binding sites of DNA-binding proteins, and prevent these sites from being accessed by DNA. We show here that the Neisseria conserved hypothetical protein DMP19 acts as a DNA mimic. The crystal structure of DMP19 shows a dsDNA-like negative charge distribution on the surface, suggesting that this protein should be added to the short list of known DNA mimic proteins. The crystal structure of another related protein, NHTF (Neisseria hypothetical transcription factor), provides evidence that it is a member of the xenobiotic-response element (XRE) family of transcriptional factors. NHTF binds to a palindromic DNA sequence containing a 5′-TGTNAN11TNACA-3′ recognition box that controls the expression of an NHTF-related operon in which the conserved nitrogen-response protein [i.e. (Protein-PII) uridylyltransferase] is encoded. The complementary surface charges between DMP19 and NHTF suggest specific charge–charge interaction. In a DNA-binding assay, we found that DMP19 can prevent NHTF from binding to its DNA-binding sites. Finally, we used an in situ gene regulation assay to provide evidence that NHTF is a repressor of its down-stream genes and that DMP19 can neutralize this effect. We therefore conclude that the interaction of DMP19 and NHTF provides a novel gene regulation mechanism in Neisseria spps. PMID:22373915

  16. Effect of DNA type on response of DNA biosensor for carcinogens

    NASA Astrophysics Data System (ADS)

    Sani, Nor Diyana bt. Md.; Heng, Lee Yook; Surif, Salmijah; Lazim, Azwani Mat

    2013-11-01

    Carcinogens are cancer causing chemicals that can bind to DNA and cause damage to the DNA. These chemicals are available everywhere including in water, air, soil and food. Therefore, a sensor that can detect the presence of these chemicals will be a very useful tool. Since carcinogens bind to DNA, DNA can be used as the biological element in a biosensor. This study has utilized different types of DNA in a biosensor for carcinogen detection. The DNAs include double stranded calf thymus DNA, single stranded calf thymus DNA and guanine rich single stranded DNA. The modified SPE was exposed to a carcinogen followed by interaction with methylene blue which acts as the electroactive indicator. The SPE was then analysed using differential pulse voltammetry (DPV). Optimization studies were conducted for MB concentration and accumulation time, DNA concentration, as well as effect of buffer concentration, buffer pH and ionic strength. The performance of the biosensor was tested on a group 1 carcinogen, formaldehyde. The results indicated that the usage of guanine rich single stranded DNA also gives higher response as carcinogens prefer to bind with guanine compared to other bases.

  17. A novel cold-inducible zinc finger protein from soybean, SCOF-1, enhances cold tolerance in transgenic plants.

    PubMed

    Kim, J C; Lee, S H; Cheong, Y H; Yoo, C M; Lee, S I; Chun, H J; Yun, D J; Hong, J C; Lee, S Y; Lim, C O; Cho, M J

    2001-02-01

    Cold stress on plants induces changes in the transcription of cold response genes. A cDNA clone encoding C2H2-type zinc finger protein, SCOF-1, was isolated from soybean. The transcription of SCOF-1 is specifically induced by low temperature and abscisic acid (ABA) but not by dehydration or high salinity. Constitutive overexpression of SCOF-1 induced cold-regulated (COR) gene expression and enhanced cold tolerance of non-acclimated transgenic Arabidopsis and tobacco plants. SCOF-1 localized to the nucleus but did not bind directly to either C-repeat/dehydration (CRT/DRE) or ABA responsive element (ABRE), cis-acting DNA regulatory elements present in COR gene promoters. However, SCOF-1 greatly enhanced the DNA binding activity of SGBF-1, a soybean G-box binding bZIP transcription factor, to ABRE in vitro. SCOF-1 also interacted with SGBF-1 in a yeast two-hybrid system. The SGBF-1 transactivated the beta-glucuronidase reporter gene driven by the ABRE element in Arabidopsis leaf protoplasts. Furthermore, the SCOF-1 enhanced ABRE-dependent gene expression mediated by SGBF-1. These results suggest that SCOF-1 may function as a positive regulator of COR gene expression mediated by ABRE via protein-protein interaction, which in turn enhances cold tolerance of plants.

  18. pH-Dependent DNA Distortion and Repression of Gene Expression by Pectobacterium atrosepticum PecS.

    PubMed

    Deochand, Dinesh K; Meariman, Jacob K; Grove, Anne

    2016-07-15

    Transcriptional activity is exquisitely sensitive to changes in promoter DNA topology. Transcription factors may therefore control gene activity by modulating the relative positioning of -10 and -35 promoter elements. The plant pathogen Pectobacterium atrosepticum, which causes soft rot in potatoes, must alter gene expression patterns to ensure growth in planta. In the related soft-rot enterobacterium Dickeya dadantii, PecS functions as a master regulator of virulence gene expression. Here, we report that P. atrosepticum PecS controls gene activity by altering promoter DNA topology in response to pH. While PecS binds the pecS promoter with high affinity regardless of pH, it induces significant DNA distortion only at neutral pH, the pH at which the pecS promoter is repressed in vivo. At pH ∼8, DNA distortions are attenuated, and PecS no longer represses the pecS promoter. A specific histidine (H142) located in a crevice between the dimerization- and DNA-binding regions is required for pH-dependent changes in DNA distortion and repression of gene activity, and mutation of this histidine renders the mutant protein incapable of repressing the pecS promoter. We propose that protonated PecS induces a DNA conformation at neutral pH in which -10 and -35 promoter elements are suboptimally positioned for RNA polymerase binding; on deprotonation of PecS, binding is no longer associated with significant changes in DNA conformation, allowing gene expression. We suggest that this mode of gene regulation leads to differential expression of the PecS regulon in response to alkalinization of the plant apoplast.

  19. Huntingtin interacting protein 1 modulates the transcriptional activity of nuclear hormone receptors.

    PubMed

    Mills, Ian G; Gaughan, Luke; Robson, Craig; Ross, Theodora; McCracken, Stuart; Kelly, John; Neal, David E

    2005-07-18

    Internalization of activated receptors regulates signaling, and endocytic adaptor proteins are well-characterized in clathrin-mediated uptake. One of these adaptor proteins, huntingtin interacting protein 1 (HIP1), induces cellular transformation and is overexpressed in some prostate cancers. We have discovered that HIP1 associates with the androgen receptor through a central coiled coil domain and is recruited to DNA response elements upon androgen stimulation. HIP1 is a novel androgen receptor regulator, significantly repressing transcription when knocked down using a silencing RNA approach and activating transcription when overexpressed. We have also identified a functional nuclear localization signal at the COOH terminus of HIP1, which contributes to the nuclear translocation of the protein. In conclusion, we have discovered that HIP1 is a nucleocytoplasmic protein capable of associating with membranes and DNA response elements and regulating transcription.

  20. Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in

    The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitablemore » statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.« less

  1. Characterization of the repetitive DNA elements in the genome of fish lymphocystis disease viruses.

    PubMed

    Schnitzler, P; Darai, G

    1989-09-01

    The complete DNA nucleotide sequence of the repetitive DNA elements in the genome of fish lymphocystis disease virus (FLDV) isolated from two different species (flounder and dab) was determined. The size of these repetitive DNA elements was found to be 1413 bp which corresponds to the DNA sequences of the 5' terminus of the EcoRI DNA fragment B (0.034 to 0.052 m.u.) and to the EcoRI DNA fragment M (0.718 to 0.736 m.u.) of the FLDV genome causing lymphocystis disease in flounder and plaice. The degree of DNA nucleotide homology between both regions was found to be 99%. The repetitive DNA element in the genome of FLDV isolated from other fish species (dab) was identified and is located within the EcoRI DNA fragment B and J of the viral genome. The DNA nucleotide sequence of one duplicate of this repetition (EcoRI DNA fragment J) was determined (1410 bp) and compared to the DNA nucleotide sequences of the repetitive DNA elements of the genome of FLDV isolated from flounder. It was found that the repetitive DNA elements of the genome of FLDV derived from two different fish species are highly conserved and possess a degree of DNA sequence homology of 94%. The DNA sequences of each strand of the individual repetitive element possess one open reading frame.

  2. A Helitron-like Transposon Superfamily from Lepidoptera Disrupts (GAAA)n Microsatellites and is Responsible for Flanking Sequence Similarity within a Microsatellite Family

    USDA-ARS?s Scientific Manuscript database

    Transposable elements (TEs) are mobile DNA regions that alter host genome structure and gene expression. A novel 588 bp non-autonomous high copy number TE in the Ostrinia nubilalis genome has features in common with miniature inverted-repeat transposable elements (MITEs): high A+T content (62.3%),...

  3. The cis decoy against the estrogen response element suppresses breast cancer cells via target disrupting c-fos not mitogen-activated protein kinase activity.

    PubMed

    Wang, Li Hua; Yang, Xiao Yi; Zhang, Xiaohu; Mihalic, Kelly; Xiao, Weihua; Farrar, William L

    2003-05-01

    Breast cancer, the most common malignancy in women, has been demonstrated to be associated with the steroid hormone estrogen and its receptor (ER), a ligand-activated transcription factor. Therefore, we developed a phosphorothiolate cis-element decoy against the estrogen response element (ERE decoy) to target disruption of ER DNA binding and transcriptional activity. Here, we showed that the ERE decoy potently ablated the 17beta-estrogen-inducible cell proliferation and induced apoptosis of human breast carcinoma cells by functionally affecting expression of c-fos gene and AP-1 luciferase gene reporter activity. Specificity of the decoy was demonstrated by its ability to directly block ER binding to a cis-element probe and transactivation. Moreover, the decoy failed to inhibit ER-mediated mitogen-activated protein kinase signaling pathways and cell growth of ER-negative breast cancer cells. Taken together, these data suggest that estrogen-mediated cell growth of breast cancer cells can be preferentially restricted via targeted disruption of ER at the level of DNA binding by a novel and specific decoy strategy applied to steroid nuclear receptors.

  4. Analysis of LexA binding sites and transcriptomics in response to genotoxic stress in Leptospira interrogans.

    PubMed

    Schons-Fonseca, Luciane; da Silva, Josefa B; Milanez, Juliana S; Domingos, Renan H; Smith, Janet L; Nakaya, Helder I; Grossman, Alan D; Ho, Paulo L; da Costa, Renata M A

    2016-02-18

    We determined the effects of DNA damage caused by ultraviolet radiation on gene expression in Leptospira interrogans using DNA microarrays. These data were integrated with DNA binding in vivo of LexA1, a regulator of the DNA damage response, assessed by chromatin immunoprecipitation and massively parallel DNA sequencing (ChIP-seq). In response to DNA damage, Leptospira induced expression of genes involved in DNA metabolism, in mobile genetic elements and defective prophages. The DNA repair genes involved in removal of photo-damage (e.g. nucleotide excision repair uvrABC, recombinases recBCD and resolvases ruvABC) were not induced. Genes involved in various metabolic pathways were down regulated, including genes involved in cell growth, RNA metabolism and the tricarboxylic acid cycle. From ChIP-seq data, we observed 24 LexA1 binding sites located throughout chromosome 1 and one binding site in chromosome 2. Expression of many, but not all, genes near those sites was increased following DNA damage. Binding sites were found as far as 550 bp upstream from the start codon, or 1 kb into the coding sequence. Our findings indicate that there is a shift in gene expression following DNA damage that represses genes involved in cell growth and virulence, and induces genes involved in mutagenesis and recombination. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Intercalation of XR5944 with the estrogen response element is modulated by the tri-nucleotide spacer sequence between half-sites

    PubMed Central

    Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou

    2011-01-01

    DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738

  6. APOBEC3G Inhibits HIV-1 RNA Elongation by Inactivating the Viral Trans-Activation Response Element

    PubMed Central

    Nowarski, Roni; Prabhu, Ponnandy; Kenig, Edan; Smith, Yoav; Britan-Rosich, Elena; Kotler, Moshe

    2014-01-01

    Deamination of cytidine residues in viral DNA (vDNA) is a major mechanism by which APOBEC3G (A3G) inhibits vif-deficient HIV-1 replication. dC to dU transition following RNase-H activity leads to viral cDNA degradation, production of non-functional proteins, formation of undesired stop codons and decreased viral protein synthesis. Here we demonstrate that A3G provides an additional layer of defence against HIV-1 infection dependent on inhibition of proviral transcription. HIV-1 transcription elongation is regulated by the trans-activation response (TAR) element, a short stem-loop RNA structure required for elongation factors binding. Vif-deficient HIV-1-infected cells accumulate short viral transcripts and produce lower amounts of full-length HIV-1 transcripts due to A3G deamination of the TAR apical loop cytidine, highlighting the requirement for TAR loop integrity in HIV-1 transcription. Finally, we show that free ssDNA termini are not essential for A3G activity and a gap of CCC motif blocked with juxtaposed DNA or RNA on either or 3′+5′ ends is sufficient for A3G deamination, identifying A3G as an efficient mutator, and that deamination of (−)SSDNA results in an early block of HIV-1 transcription. PMID:24859335

  7. APOBEC3G inhibits HIV-1 RNA elongation by inactivating the viral trans-activation response element.

    PubMed

    Nowarski, Roni; Prabhu, Ponnandy; Kenig, Edan; Smith, Yoav; Britan-Rosich, Elena; Kotler, Moshe

    2014-07-29

    Deamination of cytidine residues in viral DNA is a major mechanism by which APOBEC3G (A3G) inhibits vif-deficient human immunodeficiency virus type 1 (HIV-1) replication. dC-to-dU transition following RNase-H activity leads to viral cDNA degradation, production of non-functional proteins, formation of undesired stop codons and decreased viral protein synthesis. Here, we demonstrate that A3G provides an additional layer of defense against HIV-1 infection dependent on inhibition of proviral transcription. HIV-1 transcription elongation is regulated by the trans-activation response (TAR) element, a short stem-loop RNA structure required for elongation factors binding. Vif-deficient HIV-1-infected cells accumulate short viral transcripts and produce lower amounts of full-length HIV-1 transcripts due to A3G deamination of the TAR apical loop cytidine, highlighting the requirement for TAR loop integrity in HIV-1 transcription. We further show that free single-stranded DNA (ssDNA) termini are not essential for A3G activity and a gap of CCC motif blocked with juxtaposed DNA or RNA on either or 3'+5' ends is sufficient for A3G deamination. These results identify A3G as an efficient mutator and that deamination of (-)SSDNA results in an early block of HIV-1 transcription. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. DNA Repair, Redox Regulation and Modulation of Estrogen Receptor Alpha Mediated Transcription

    ERIC Educational Resources Information Center

    Curtis-Ducey, Carol Dianne

    2009-01-01

    Interaction of estrogen receptor [alpha] (ER[alpha]) with 17[beta]-estradiol (E[subscript 2]) facilitates binding of the receptor to estrogen response elements (EREs) in target genes, which in turn leads to recruitment of coregulatory proteins. To better understand how estrogen-responsive genes are regulated, our laboratory identified a number of…

  9. Genome-wide analysis of salinity-stress induced DNA methylation alterations in cotton (Gossypium hirsutum L.) using the Me-DIP sequencing technology.

    PubMed

    Lu, X K; Shu, N; Wang, J J; Chen, X G; Wang, D L; Wang, S; Fan, W L; Guo, X N; Guo, L X; Ye, W W

    2017-06-29

    Cytosine DNA methylation is a significant form of DNA modification closely associated with gene expression in eukaryotes, fungi, animals, and plants. Although the reference genomes of cotton (Gossypium hirsutum L.) have been publically available, the salinity-stress-induced DNA methylome alterations in cotton are not well understood. Here, we constructed a map of genome-wide DNA methylation characteristics of cotton leaves under salt stress using the methylated DNA immunoprecipitation sequencing method. The results showed that the methylation reads on chromosome 9 were most comparable with those on the other chromosomes, but the greatest changes occurred on chromosome 8 under salt stress. The DNA methylation pattern analysis indicated that a relatively higher methylation density was found in the upstream2k and downstream2k elements of the CDS region and CG-islands. Almost 94% of the reads belonged to LTR-gspsy and LTR-copia, and the number of methylation reads in LTR-gypsy was four times greater than that in LTR-copia in both control and stressed samples. The analysis of differentially methylated regions (DMRs) showed that the gene elements upstream2k, intron, and downstream2k were hypomethylated, but the CDS regions were hypermethylated. The GO (Gene Ontology) analysis suggested that the methylated genes were most enriched in cellular processes, metabolic processes, cell parts and catalytic activities, which might be closely correlated with response to NaCl stress. In this study, we completed a genomic DNA methylation profile and conducted a DMR analysis under salt stress, which provided valuable information for the better understanding of epigenetics in response to salt stress in cotton.

  10. Studies on the mechanism of functional cooperativity between progesterone and estrogen receptors.

    PubMed

    Bradshaw, M S; Tsai, S Y; Leng, X H; Dobson, A D; Conneely, O M; O'Malley, B W; Tsai, M J

    1991-09-05

    Steroid response elements (SREs) cooperate with many different cis-acting elements including NF-1 sites, CACCC boxes, and other SREs to induce target gene expression (Schule, R., Muller, M., Otsuka-Murakami, H., and Renkawitz, R. (1988) Nature 332, 87-90; Strahle, U., Schmid, W., and Schutz, G. (1988) EMBO J. 7, 3389-3395). Induction of gene expression can be additive or synergistic with respect to the level of activation by either transactivators. Two mechanisms have been proposed for how synergism occurs: 1) cooperative binding of transcriptional activators to DNA or 2) simultaneous interaction of individually bound activators with a common target protein. We have shown previously that cooperative binding of receptors is important for synergism between two progesterone response elements (PREs). Here we showed that an estrogen response element (ERE) and a PRE can also functionally cooperate and this synergism between an ERE and a PRE is not contributed by cooperative DNA binding. Furthermore, we have demonstrated that the activation domains of the progesterone receptor (PR) (C1Act) are required for synergism between two PREs and sufficient for confirming cooperative binding. However these two activation domains of PR are not sufficient for synergism between an ERE and a PRE. Additional regions within the NH2-terminal and COOH-terminal domains are also required for synergistic interaction between two heterologous SREs.

  11. A novel non prophage(-like) gene-intervening element within gerE that is reconstituted during sporulation in Bacillus cereus ATCC10987.

    PubMed

    Abe, Kimihiro; Shimizu, Shin-Ya; Tsuda, Shuhei; Sato, Tsutomu

    2017-09-12

    Gene rearrangement is a widely-shared phenomenon in spore forming bacteria, in which prophage(-like) elements interrupting sporulation-specific genes are excised from the host genome to reconstitute the intact gene. Here, we report a novel class of gene-intervening elements, named gin, inserted in the 225 bp gerE-coding region of the B. cereus ATCC10987 genome, which generates a sporulation-specific rearrangement. gin has no phage-related genes and possesses three site-specific recombinase genes; girA, girB, and girC. We demonstrated that the gerE rearrangement occurs at the middle stage of sporulation, in which site-specific DNA recombination took place within the 9 bp consensus sequence flanking the disrupted gerE segments. Deletion analysis of gin uncovered that GirC and an additional factor, GirX, are responsible for gerE reconstitution. Involvement of GirC and GirX in DNA recombination was confirmed by an in vitro recombination assay. These results broaden the definition of the sporulation-specific gene rearrangement phenomenon: gene-intervening elements are not limited to phage DNA but may include non-viral genetic elements that carry a developmentally-regulated site-specific recombination system.

  12. Mechanism of DNA-binding enhancement by the human T-cell leukaemia virus transactivator Tax.

    PubMed

    Baranger, A M; Palmer, C R; Hamm, M K; Giebler, H A; Brauweiler, A; Nyborg, J K; Schepartz, A

    1995-08-17

    Tax protein activates transcription of the human T-cell leukaemia virus type I (HTLV-I) genome through three imperfect cyclic AMP-responsive element (CRE) target sites located within the viral promoter. Previous work has shown that Tax interacts with the bZIP element of proteins that bind the CRE target site to promote peptide dimerization, suggesting an association between Tax and bZIP coiled coil. Here we show that the site of interaction with Tax is not the coiled coil, but the basic segment. This interaction increases the stability of the GCN4 bZIP dimer by 1.7 kcal mol-1 and the DNA affinity of the dimer by 1.9 kcal mol-1. The differential effect of Tax on several bZip-DNA complexes that differ in peptide sequence or DNA conformation suggests a model for Tax action based on stabilization of a distinct DNA-bound protein structure. This model may explain how Tax interacts with transcription factors of considerable sequence diversity to alter patterns of gene expression.

  13. Huntingtin interacting protein 1 modulates the transcriptional activity of nuclear hormone receptors

    PubMed Central

    Mills, Ian G.; Gaughan, Luke; Robson, Craig; Ross, Theodora; McCracken, Stuart; Kelly, John; Neal, David E.

    2005-01-01

    Internalization of activated receptors regulates signaling, and endocytic adaptor proteins are well-characterized in clathrin-mediated uptake. One of these adaptor proteins, huntingtin interacting protein 1 (HIP1), induces cellular transformation and is overexpressed in some prostate cancers. We have discovered that HIP1 associates with the androgen receptor through a central coiled coil domain and is recruited to DNA response elements upon androgen stimulation. HIP1 is a novel androgen receptor regulator, significantly repressing transcription when knocked down using a silencing RNA approach and activating transcription when overexpressed. We have also identified a functional nuclear localization signal at the COOH terminus of HIP1, which contributes to the nuclear translocation of the protein. In conclusion, we have discovered that HIP1 is a nucleocytoplasmic protein capable of associating with membranes and DNA response elements and regulating transcription. PMID:16027218

  14. Engineering the Structure and Properties of DNA-Nanoparticle Superstructures Using Polyvalent Counterions.

    PubMed

    Chou, Leo Y T; Song, Fayi; Chan, Warren C W

    2016-04-06

    DNA assembly of nanoparticles is a powerful approach to control their properties and prototype new materials. However, the structure and properties of DNA-assembled nanoparticles are labile and sensitive to interactions with counterions, which vary with processing and application environment. Here we show that substituting polyamines in place of elemental counterions significantly enhanced the structural rigidity and plasmonic properties of DNA-assembled metal nanoparticles. These effects arose from the ability of polyamines to condense DNA and cross-link DNA-coated nanoparticles. We further used polyamine wrapped DNA nanostructures as structural templates to seed the growth of polymer multilayers via layer-by-layer assembly, and controlled the degree of DNA condensation, plasmon coupling efficiency, and material responsiveness to environmental stimuli by varying polyelectrolyte composition. These results highlight counterion engineering as a versatile strategy to tailor the properties of DNA-nanoparticle assemblies for various applications, and should be applicable to other classes of DNA nanostructures.

  15. Stress induced gene expression drives transient DNA methylation changes at adjacent repetitive elements

    PubMed Central

    Secco, David; Wang, Chuang; Shou, Huixia; Schultz, Matthew D; Chiarenza, Serge; Nussaume, Laurent; Ecker, Joseph R; Whelan, James; Lister, Ryan

    2015-01-01

    Cytosine DNA methylation (mC) is a genome modification that can regulate the expression of coding and non-coding genetic elements. However, little is known about the involvement of mC in response to environmental cues. Using whole genome bisulfite sequencing to assess the spatio-temporal dynamics of mC in rice grown under phosphate starvation and recovery conditions, we identified widespread phosphate starvation-induced changes in mC, preferentially localized in transposable elements (TEs) close to highly induced genes. These changes in mC occurred after changes in nearby gene transcription, were mostly DCL3a-independent, and could partially be propagated through mitosis, however no evidence of meiotic transmission was observed. Similar analyses performed in Arabidopsis revealed a very limited effect of phosphate starvation on mC, suggesting a species-specific mechanism. Overall, this suggests that TEs in proximity to environmentally induced genes are silenced via hypermethylation, and establishes the temporal hierarchy of transcriptional and epigenomic changes in response to stress. DOI: http://dx.doi.org/10.7554/eLife.09343.001 PMID:26196146

  16. E2F mediates induction of the Sp1-controlled promoter of the human DNA polymerase ɛ B-subunit gene POLE2

    PubMed Central

    Huang, Deqi; Jokela, Maarit; Tuusa, Jussi; Skog, Sven; Poikonen, Kari; Syväoja, Juhani E.

    2001-01-01

    The B-subunits of replicative DNA polymerases from Archaea to humans belong to the same protein family, suggesting that they share a common fundamental function. We report here the gene structure for the B-subunit of human DNA polymerase ɛ (POLE2), whose expression and transcriptional regulation is typical for replication proteins with some unique features. The 75 bp core promoter region, located within exon 1, contains an Sp1 element that is a critical determinant of promoter activity as shown by the luciferase reporter, electrophoretic mobility shift and DNase I footprinting assays. Two overlapping E2F elements adjacent to the Sp1 element are essential for full promoter activity and serum response. Binding sites for E2F1 and NF-1 reside immediately downstream from the core promoter region. Our results suggest that human POLE2 is regulated by two E2F–pocket protein complexes, one associated with Sp1 and the other with NF-1. So far, only one replicative DNA polymerase B-subunit gene promoter, POLA2 encoding the B-subunit of DNA polymerase α, has been characterized. Mitogenic activation of the POLE2 promoter by an E2F-mediated mechanism resembles that of POLA2, but the regulation of basal promoter activity is different between these two genes. PMID:11433027

  17. In and out of the rRNA genes: characterization of Pokey elements in the sequenced Daphnia genome

    PubMed Central

    2013-01-01

    Background Only a few transposable elements are known to exhibit site-specific insertion patterns, including the well-studied R-element retrotransposons that insert into specific sites within the multigene rDNA. The only known rDNA-specific DNA transposon, Pokey (superfamily: piggyBac) is found in the freshwater microcrustacean, Daphnia pulex. Here, we present a genome-wide analysis of Pokey based on the recently completed whole genome sequencing project for D. pulex. Results Phylogenetic analysis of Pokey elements recovered from the genome sequence revealed the presence of four lineages corresponding to two divergent autonomous families and two related lineages of non-autonomous miniature inverted repeat transposable elements (MITEs). The MITEs are also found at the same 28S rRNA gene insertion site as the Pokey elements, and appear to have arisen as deletion derivatives of autonomous elements. Several copies of the full-length Pokey elements may be capable of producing an active transposase. Surprisingly, both families of Pokey possess a series of 200 bp repeats upstream of the transposase that is derived from the rDNA intergenic spacer (IGS). The IGS sequences within the Pokey elements appear to be evolving in concert with the rDNA units. Finally, analysis of the insertion sites of Pokey elements outside of rDNA showed a target preference for sites similar to the specific sequence that is targeted within rDNA. Conclusions Based on the target site preference of Pokey elements and the concerted evolution of a segment of the element with the rDNA unit, we propose an evolutionary path by which the ancestors of Pokey elements have invaded the rDNA niche. We discuss how specificity for the rDNA unit may have evolved and how this specificity has played a role in the long-term survival of these elements in the subgenus Daphnia. PMID:24059783

  18. In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum.

    PubMed

    Hong, Ka L; Battistella, Luisa; Salva, Alysia D; Williams, Ryan M; Sooter, Letha J

    2015-01-27

    Alpha toxin is one of the major virulence factors secreted by Staphylococcus aureus, a bacterium that is responsible for a wide variety of infections in both community and hospital settings. Due to the prevalence of S. aureus related infections and the emergence of methicillin-resistant S. aureus, rapid and accurate diagnosis of S. aureus infections is crucial in benefiting patient health outcomes. In this study, a rigorous Systematic Evolution of Ligands by Exponential Enrichment (SELEX) variant previously developed by our laboratory was utilized to select a single-stranded DNA molecular recognition element (MRE) targeting alpha toxin with high affinity and specificity. At the end of the 12-round selection, the selected MRE had an equilibrium dissociation constant (Kd) of 93.7 ± 7.0 nM. Additionally, a modified sandwich enzyme-linked immunosorbent assay (ELISA) was developed by using the selected ssDNA MRE as the toxin-capturing element and a sensitive detection of 200 nM alpha toxin in undiluted human serum samples was achieved.

  19. Structural hierarchy controlling dimerization and target DNA recognition in the AHR transcriptional complex.

    PubMed

    Seok, Seung-Hyeon; Lee, Woojong; Jiang, Li; Molugu, Kaivalya; Zheng, Aiping; Li, Yitong; Park, Sanghyun; Bradfield, Christopher A; Xing, Yongna

    2017-05-23

    The aryl hydrocarbon receptor (AHR) belongs to the PAS (PER-ARNT-SIM) family transcription factors and mediates broad responses to numerous environmental pollutants and cellular metabolites, modulating diverse biological processes from adaptive metabolism, acute toxicity, to normal physiology of vascular and immune systems. The AHR forms a transcriptionally active heterodimer with ARNT (AHR nuclear translocator), which recognizes the dioxin response element (DRE) in the promoter of downstream genes. We determined the crystal structure of the mammalian AHR-ARNT heterodimer in complex with the DRE, in which ARNT curls around AHR into a highly intertwined asymmetric architecture, with extensive heterodimerization interfaces and AHR interdomain interactions. Specific recognition of the DRE is determined locally by the DNA-binding residues, which discriminates it from the closely related hypoxia response element (HRE), and is globally affected by the dimerization interfaces and interdomain interactions. Changes at the interdomain interactions caused either AHR constitutive nuclear localization or failure to translocate to nucleus, underlying an allosteric structural pathway for mediating ligand-induced exposure of nuclear localization signal. These observations, together with the global higher flexibility of the AHR PAS-A and its loosely packed structural elements, suggest a dynamic structural hierarchy for complex scenarios of AHR activation induced by its diverse ligands.

  20. Structural hierarchy controlling dimerization and target DNA recognition in the AHR transcriptional complex

    PubMed Central

    Lee, Woojong; Jiang, Li; Molugu, Kaivalya; Zheng, Aiping; Li, Yitong; Park, Sanghyun; Bradfield, Christopher A.; Xing, Yongna

    2017-01-01

    The aryl hydrocarbon receptor (AHR) belongs to the PAS (PER-ARNT-SIM) family transcription factors and mediates broad responses to numerous environmental pollutants and cellular metabolites, modulating diverse biological processes from adaptive metabolism, acute toxicity, to normal physiology of vascular and immune systems. The AHR forms a transcriptionally active heterodimer with ARNT (AHR nuclear translocator), which recognizes the dioxin response element (DRE) in the promoter of downstream genes. We determined the crystal structure of the mammalian AHR–ARNT heterodimer in complex with the DRE, in which ARNT curls around AHR into a highly intertwined asymmetric architecture, with extensive heterodimerization interfaces and AHR interdomain interactions. Specific recognition of the DRE is determined locally by the DNA-binding residues, which discriminates it from the closely related hypoxia response element (HRE), and is globally affected by the dimerization interfaces and interdomain interactions. Changes at the interdomain interactions caused either AHR constitutive nuclear localization or failure to translocate to nucleus, underlying an allosteric structural pathway for mediating ligand-induced exposure of nuclear localization signal. These observations, together with the global higher flexibility of the AHR PAS-A and its loosely packed structural elements, suggest a dynamic structural hierarchy for complex scenarios of AHR activation induced by its diverse ligands. PMID:28396409

  1. Structural hierarchy controlling dimerization and target DNA recognition in the AHR transcriptional complex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Seok, Seung-Hyeon; Lee, Woojong; Jiang, Li

    he aryl hydrocarbon receptor (AHR) belongs to the PAS (PER-ARNT-SIM) family transcription factors and mediates broad responses to numerous environmental pollutants and cellular metabolites, modulating diverse biological processes from adaptive metabolism, acute toxicity, to normal physiology of vascular and immune systems. The AHR forms a transcriptionally active heterodimer with ARNT (AHR nuclear translocator), which recognizes the dioxin response element (DRE) in the promoter of downstream genes. We determined the crystal structure of the mammalian AHR–ARNT heterodimer in complex with the DRE, in which ARNT curls around AHR into a highly intertwined asymmetric architecture, with extensive heterodimerization interfaces and AHR interdomainmore » interactions. Specific recognition of the DRE is determined locally by the DNA-binding residues, which discriminates it from the closely related hypoxia response element (HRE), and is globally affected by the dimerization interfaces and interdomain interactions. Changes at the interdomain interactions caused either AHR constitutive nuclear localization or failure to translocate to nucleus, underlying an allosteric structural pathway for mediating ligand-induced exposure of nuclear localization signal. These observations, together with the global higher flexibility of the AHR PAS-A and its loosely packed structural elements, suggest a dynamic structural hierarchy for complex scenarios of AHR activation induced by its diverse ligands.« less

  2. cDNA sequence and expression of a cold-responsive gene in Citrus unshiu.

    PubMed

    Hara, M; Wakasugi, Y; Ikoma, Y; Yano, M; Ogawa, K; Kuboi, T

    1999-02-01

    A cDNA clone encoding a protein (CuCOR19), the sequence of which is similar to Poncirus COR19, of the dehydrin family was isolated from the epicarp of Citrus unshiu. The molecular mass of the predicted protein was 18,980 daltons. CuCOR19 was highly hydrophilic and contained three repeating elements including Lys-rich motifs. The gene expression in leaves increased by cold stress.

  3. DNA preservation in skeletal elements from the World Trade Center disaster: recommendations for mass fatality management.

    PubMed

    Mundorff, Amy Z; Bartelink, Eric J; Mar-Cash, Elaine

    2009-07-01

    The World Trade Center (WTC) victim identification effort highlights taphonomic influences on the degradation of DNA from victims of mass fatality incidents. This study uses a subset of the WTC-Human Remains Database to evaluate differential preservation of DNA by skeletal element. Recovery location, sex, and victim type (civilian, firefighter, or plane passenger) do not appear to influence DNA preservation. Results indicate that more intact elements, as well as elements encased in soft tissue, produced slightly higher identification rates than more fragmented remains. DNA identification rates by element type conform to previous findings, with higher rates generally found in denser, weight-bearing bones. However, smaller bones including patellae, metatarsals, and foot phalanges yielded rates comparable to both femora and tibiae. These elements can be easily sampled with a disposable scalpel, and thus reduce potential DNA contamination. These findings have implications for DNA sampling guidelines in future mass fatality incidents.

  4. Illustrative cases for monitoring by quantitative analysis of BRAF/NRAS ctDNA mutations in liquid biopsies of metastatic melanoma patients who gained clinical benefits from anti-PD1 antibody therapy.

    PubMed

    Seremet, Teofila; Planken, Simon; Schreuer, Max; Jansen, Yanina; Delaunoy, Mélanie; El Housni, Hakim; Lienard, Danielle; Del Marmol, Véronique; Heimann, Pierre; Neyns, Bart

    2018-02-01

    Anti-programmed death 1 (PD-1) monoclonal antibodies improve the survival of metastatic melanoma patients. Predictive or monitoring biomarkers for response to this therapy could improve the clinical management of these patients. To date, no established biomarkers are available for monitoring the response to immunotherapy. Tumor- specific mutations in circulating tumor DNA (ctDNA) such as BRAF and NRAS mutations for melanoma patients have been proposed for monitoring of immunotherapy response. We present seven illustrative cases for the use of ctDNA BRAF and NRAS mutations' monitoring in plasma. The cases described exemplify four distinct clinical benefit patterns: rapid and durable complete response (CR), early progression, followed by CR, CR followed by early progression after interrupting treatment and long-term disease stabilization. These representative cases suggest that comprehensive BRAF/NRAS ctDNA monitoring during anti-PD1 therapy is informative and can be of added value for the monitoring of melanoma patients gaining clinical benefit on anti-PD1 treatment. An important advantage of our approach is that using the cartridge system on the Idylla platform for mutation analysis, the results become available the same day 2 h after plasma collection. Therefore, in the future, the ctDNA level can be an element in the clinical management of the patients.

  5. Expanded CAG/CTG Repeat DNA Induces a Checkpoint Response That Impacts Cell Proliferation in Saccharomyces cerevisiae

    PubMed Central

    Sundararajan, Rangapriya; Freudenreich, Catherine H.

    2011-01-01

    Repetitive DNA elements are mutational hotspots in the genome, and their instability is linked to various neurological disorders and cancers. Although it is known that expanded trinucleotide repeats can interfere with DNA replication and repair, the cellular response to these events has not been characterized. Here, we demonstrate that an expanded CAG/CTG repeat elicits a DNA damage checkpoint response in budding yeast. Using microcolony and single cell pedigree analysis, we found that cells carrying an expanded CAG repeat frequently experience protracted cell division cycles, persistent arrests, and morphological abnormalities. These phenotypes were further exacerbated by mutations in DSB repair pathways, including homologous recombination and end joining, implicating a DNA damage response. Cell cycle analysis confirmed repeat-dependent S phase delays and G2/M arrests. Furthermore, we demonstrate that the above phenotypes are due to the activation of the DNA damage checkpoint, since expanded CAG repeats induced the phosphorylation of the Rad53 checkpoint kinase in a rad52Δ recombination deficient mutant. Interestingly, cells mutated for the MRX complex (Mre11-Rad50-Xrs2), a central component of DSB repair which is required to repair breaks at CAG repeats, failed to elicit repeat-specific arrests, morphological defects, or Rad53 phosphorylation. We therefore conclude that damage at expanded CAG/CTG repeats is likely sensed by the MRX complex, leading to a checkpoint response. Finally, we show that repeat expansions preferentially occur in cells experiencing growth delays. Activation of DNA damage checkpoints in repeat-containing cells could contribute to the tissue degeneration observed in trinucleotide repeat expansion diseases. PMID:21437275

  6. Abnormal expression and functional characteristics of cyclic adenosine monophosphate response element binding protein in postmortem brain of suicide subjects.

    PubMed

    Dwivedi, Yogesh; Rao, Jagadeesh Sridhara; Rizavi, Hooriyah S; Kotowski, Jacek; Conley, Robert R; Roberts, Rosalinda C; Tamminga, Carol A; Pandey, Ghanshyam N

    2003-03-01

    Cyclic adenosine monophosphate response element binding protein (CREB) is a transcription factor that, on phosphorylation by protein kinases, is activated, and in response, regulates the transcription of many neuronally expressed genes. In view of the recent observations that catalytic properties and/or expression of many kinases that mediate their physiological responses through the activation of CREB are altered in the postmortem brain of subjects who commit suicide (hereafter referred to as suicide subjects), we examined the status of CREB in suicidal behavior. These studies were performed in Brodmann area (BA) 9 and hippocampus obtained from 26 suicide subjects and 20 nonpsychiatric healthy control subjects. Messenger RNA levels of CREB and neuron-specific enolase were determined in total RNA by means of quantitative reverse transcriptase-polymerase chain reaction. Protein levels and the functional characteristics of CREB were determined in nuclear fractions by means of Western blot and cyclic adenosine monophosphate response element (CRE)-DNA binding activity, respectively. In the same nuclear fraction, we determined the catalytic activity of cyclic adenosine monophosphate-stimulated protein kinase A by means of enzymatic assay. We observed a significant reduction in messenger RNA and protein levels of CREB, CRE-DNA binding activity, and basal and cyclic adenosine monophosphate-stimulated protein kinase A activity in BA 9 and hippocampus of suicide subjects, without any change in messenger RNA levels of neuron-specific enolase in BA 9. Except for protein kinase A activity, changes in CREB expression and CRE-DNA binding activity were present in all suicide subjects, irrespective of diagnosis. These changes were unrelated to postmortem intervals, age, sex, or antidepressant treatment. Given the significance of CREB in mediating various physiological functions through gene transcription, our results of decreased expression and functional characteristics of CREB in postmortem brain of suicide subjects suggest that CREB may play an important role in suicidal behavior.

  7. Accelerated Evolution in Distinctive Species Reveals Candidate Elements for Clinically Relevant Traits, Including Mutation and Cancer Resistance.

    PubMed

    Ferris, Elliott; Abegglen, Lisa M; Schiffman, Joshua D; Gregg, Christopher

    2018-03-06

    The identity of most functional elements in the mammalian genome and the phenotypes they impact are unclear. Here, we perform a genome-wide comparative analysis of patterns of accelerated evolution in species with highly distinctive traits to discover candidate functional elements for clinically important phenotypes. We identify accelerated regions (ARs) in the elephant, hibernating bat, orca, dolphin, naked mole rat, and thirteen-lined ground squirrel lineages in mammalian conserved regions, uncovering ∼33,000 elements that bind hundreds of different regulatory proteins in humans and mice. ARs in the elephant, the largest land mammal, are uniquely enriched near elephant DNA damage response genes. The genomic hotspot for elephant ARs is the E3 ligase subunit of the Fanconi anemia complex, a master regulator of DNA repair. Additionally, ARs in the six species are associated with specific human clinical phenotypes that have apparent concordance with overt traits in each species. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  8. Characterization and electrochemical response of DNA functionalized 2nm gold nanoparticles confined in a nanochannel array.

    PubMed

    Peinetti, Ana S; Ceretti, Helena; Mizrahi, Martín; González, Graciela A; Ramírez, Silvana A; Requejo, Félix G; Montserrat, Javier M; Battaglini, Fernando

    2018-06-01

    Polyvalent gold nanoparticle oligonucleotide conjugates are subject of intense research. Even though 2nm diameter AuNPs have been previously modified with DNA, little is known about their structure and electrochemical behavior. In this work, we examine the influence of different surface modification strategies on the interplay between the meso-organization and the molecular recognition properties of a 27-mer DNA strand. This DNA strand is functionalized with different sulfur-containing moieties and immobilized on 2nm gold nanoparticles confined on a nanoporous alumina, working the whole system as an electrode array. Surface coverages were determined by EXAFS and the performance as recognition elements for impedance-based sensors is evaluated. Our results prove that low DNA coverages on the confined nanoparticles prompt to a more sensitive response, showing the relevance in avoiding the DNA strand overcrowding. The system was able to determine a concentration as low as 100pM of the complementary strand, thus introducing the foundations for the construction of label-free genosensors at the nanometer scale. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Diversification, phylogeny and evolution of auxin response factor (ARF) family: insights gained from analyzing maize ARF genes.

    PubMed

    Wang, Yijun; Deng, Dexiang; Shi, Yating; Miao, Nan; Bian, Yunlong; Yin, Zhitong

    2012-03-01

    Auxin response factors (ARFs), member of the plant-specific B3 DNA binding superfamily, target specifically to auxin response elements (AuxREs) in promoters of primary auxin-responsive genes and heterodimerize with Aux/IAA proteins in auxin signaling transduction cascade. In previous research, we have isolated and characterized maize Aux/IAA genes in whole-genome scale. Here, we report the comprehensive analysis of ARF genes in maize. A total of 36 ARF genes were identified and validated from the B73 maize genome through an iterative strategy. Thirty-six maize ARF genes are distributed in all maize chromosomes except chromosome 7. Maize ARF genes expansion is mainly due to recent segmental duplications. Maize ARF proteins share one B3 DNA binding domain which consists of seven-stranded β sheets and two short α helixes. Twelve maize ARFs with glutamine-rich middle regions could be as activators in modulating expression of auxin-responsive genes. Eleven maize ARF proteins are lack of homo- and heterodimerization domains. Putative cis-elements involved in phytohormones and light signaling responses, biotic and abiotic stress adaption locate in promoters of maize ARF genes. Expression patterns vary greatly between clades and sister pairs of maize ARF genes. The B3 DNA binding and auxin response factor domains of maize ARF proteins are primarily subjected to negative selection during selective sweep. The mixed selective forces drive the diversification and evolution of genomic regions outside of B3 and ARF domains. Additionally, the dicot-specific proliferation of ARF genes was detected. Comparative genomics analysis indicated that maize, sorghum and rice duplicate chromosomal blocks containing ARF homologs are highly syntenic. This study provides insights into the distribution, phylogeny and evolution of ARF gene family.

  10. RNA polymerase gate loop guides the nontemplate DNA strand in transcription complexes.

    PubMed

    NandyMazumdar, Monali; Nedialkov, Yuri; Svetlov, Dmitri; Sevostyanova, Anastasia; Belogurov, Georgiy A; Artsimovitch, Irina

    2016-12-27

    Upon RNA polymerase (RNAP) binding to a promoter, the σ factor initiates DNA strand separation and captures the melted nontemplate DNA, whereas the core enzyme establishes interactions with the duplex DNA in front of the active site that stabilize initiation complexes and persist throughout elongation. Among many core RNAP elements that participate in these interactions, the β' clamp domain plays the most prominent role. In this work, we investigate the role of the β gate loop, a conserved and essential structural element that lies across the DNA channel from the clamp, in transcription regulation. The gate loop was proposed to control DNA loading during initiation and to interact with NusG-like proteins to lock RNAP in a closed, processive state during elongation. We show that the removal of the gate loop has large effects on promoter complexes, trapping an unstable intermediate in which the RNAP contacts with the nontemplate strand discriminator region and the downstream duplex DNA are not yet fully established. We find that although RNAP lacking the gate loop displays moderate defects in pausing, transcript cleavage, and termination, it is fully responsive to the transcription elongation factor NusG. Together with the structural data, our results support a model in which the gate loop, acting in concert with initiation or elongation factors, guides the nontemplate DNA in transcription complexes, thereby modulating their regulatory properties.

  11. Structures of Escherichia coli DNA adenine methyltransferase (Dam) in complex with a non-GATC sequence: Potential implications for methylation-independent transcriptional repression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Horton, John R.; Zhang, Xing; Blumenthal, Robert M.

    DNA adenine methyltransferase (Dam) is widespread and conserved among the γ-proteobacteria. Methylation of the Ade in GATC sequences regulates diverse bacterial cell functions, including gene expression, mismatch repair and chromosome replication. Dam also controls virulence in many pathogenic Gram-negative bacteria. An unexplained and perplexing observation about Escherichia coli Dam (EcoDam) is that there is no obvious relationship between the genes that are transcriptionally responsive to Dam and the promoter-proximal presence of GATC sequences. Here, we demonstrate that EcoDam interacts with a 5-base pair non-cognate sequence distinct from GATC. The crystal structure of a non-cognate complex allowed us to identify amore » DNA binding element, GTYTA/TARAC (where Y = C/T and R = A/G). This element immediately flanks GATC sites in some Dam-regulated promoters, including the Pap operon which specifies pyelonephritis-associated pili. In addition, Dam interacts with near-cognate GATC sequences (i.e. 3/4-site ATC and GAT). All together, these results imply that Dam, in addition to being responsible for GATC methylation, could also function as a methylation-independent transcriptional repressor.« less

  12. Structures of Escherichia coli DNA adenine methyltransferase (Dam) in complex with a non-GATC sequence: Potential implications for methylation-independent transcriptional repression

    DOE PAGES

    Horton, John R.; Zhang, Xing; Blumenthal, Robert M.; ...

    2015-04-06

    DNA adenine methyltransferase (Dam) is widespread and conserved among the γ-proteobacteria. Methylation of the Ade in GATC sequences regulates diverse bacterial cell functions, including gene expression, mismatch repair and chromosome replication. Dam also controls virulence in many pathogenic Gram-negative bacteria. An unexplained and perplexing observation about Escherichia coli Dam (EcoDam) is that there is no obvious relationship between the genes that are transcriptionally responsive to Dam and the promoter-proximal presence of GATC sequences. Here, we demonstrate that EcoDam interacts with a 5-base pair non-cognate sequence distinct from GATC. The crystal structure of a non-cognate complex allowed us to identify amore » DNA binding element, GTYTA/TARAC (where Y = C/T and R = A/G). This element immediately flanks GATC sites in some Dam-regulated promoters, including the Pap operon which specifies pyelonephritis-associated pili. In addition, Dam interacts with near-cognate GATC sequences (i.e. 3/4-site ATC and GAT). All together, these results imply that Dam, in addition to being responsible for GATC methylation, could also function as a methylation-independent transcriptional repressor.« less

  13. Heat shock factor-1 modulates p53 activity in the transcriptional response to DNA damage

    PubMed Central

    Logan, Ian R.; McNeill, Hesta V.; Cook, Susan; Lu, Xiaohong; Meek, David W.; Fuller-Pace, Frances V.; Lunec, John; Robson, Craig N.

    2009-01-01

    Here we define an important role for heat shock factor 1 (HSF1) in the cellular response to genotoxic agents. We demonstrate for the first time that HSF1 can complex with nuclear p53 and that both proteins are co-operatively recruited to p53-responsive genes such as p21. Analysis of natural and synthetic cis elements demonstrates that HSF1 can enhance p53-mediated transcription, whilst depletion of HSF1 reduces the expression of p53-responsive transcripts. We find that HSF1 is required for optimal p21 expression and p53-mediated cell-cycle arrest in response to genotoxins while loss of HSF1 attenuates apoptosis in response to these agents. To explain these novel properties of HSF1 we show that HSF1 can complex with DNA damage kinases ATR and Chk1 to effect p53 phosphorylation in response to DNA damage. Our data reveal HSF1 as a key transcriptional regulator in response to genotoxic compounds widely used in the clinical setting, and suggest that HSF1 will contribute to the efficacy of these agents. PMID:19295133

  14. Estrogen receptor accessory proteins augment receptor-DNA interaction and DNA bending.

    PubMed

    Landel, C C; Potthoff, S J; Nardulli, A M; Kushner, P J; Greene, G L

    1997-01-01

    Increasing evidence suggests that accessory proteins play an important role in the ability of the estrogen receptor (ER) and other nuclear hormone receptors to modulate transcription when bound to cis-acting hormone response elements in target genes. We have previously shown that four proteins, hsp70, protein disulfide isomerase (PDI) and two unknown proteins (p48 and p45), copurify with ER that has been isolated by site-specific DNA chromatography (BERE) and influence the interaction of ER with DNA in vitro. To better define the nature of these effects, we used filter binding and electrophoretic mobility shift assays to study the ability of these proteins to alter the kinetics of ER-DNA interaction and to influence the ability of ER to bend DNA when bound to an estrogen response element (ERE). The results of both assays indicate that ERE-purified ER, with its four associated proteins (hsp70, PDI, p48, p45), has a greater ability to bind to the vitellogenin A2 ERE than ER purified by estradiol-Sepharose chromatography in the absence (ESeph) or presence (EATP) of ATP, in which p48, p45 (ESeph) and hsp70 (EATP) are removed. Surprisingly, the rates of association and dissociation of ER and ERE were essentially the same for all three mixtures, suggesting that one or more ER-associated proteins, especially p45 and p48, may be required for ER to attain maximum DNA binding activity. In addition, circular permutation and phasing analyses demonstrated that the same ER-associated proteins produced higher order ER-DNA complexes that significantly increased the magnitude of DNA distortion, but did not alter the direction of the ER-induced bend of ERE-containing DNA fragments, which was toward the major groove of the DNA helix. These results suggest that p45 and/or p48 and possibly hsp70, play an important role both in the specific DNA binding and bending activities of ER and thus contribute to the overall stimulation of transcription in target genes that contain cis-acting EREs.

  15. Lanthanum Element Induced Imbalance of Mineral Nutrients, HSP 70 Production and DNA-Protein Crosslink, Leading to Hormetic Response of Cell Cycle Progression in Root Tips of Vicia faba L. seedlings.

    PubMed

    Wang, Chengrun; Shi, Cuie; Liu, Ling; Wang, Chen; Qiao, Wei; Gu, Zhimang; Wang, Xiaorong

    2012-01-01

    The effects and mechanisms of rare earth elements on plant growth have not been extensively characterized. In the current study, Vicia faba L. seedlings were cultivated in lanthanum (La)-containing solutions for 10 days to investigate the possible effects and mechanisms of La on cell proliferation and root lengthening in roots. The results showed that increasing La levels resulted in abnormal calcium (Ca), Ferrum (Fe) or Potassium (K) contents in the roots. Flow cytometry analysis revealed G1/S and S/G2 arrests in response to La treatments in the root tips. Heat shock protein 70 (HSP 70) production showed a U-shaped dose response to increasing La levels. Consistent with its role in cell cycle regulation, HSP 70 fluctuated in parallel with the S-phase ratios and proliferation index. Furthermore, DNA-protein crosslinks (DPCs) enhanced at higher La concentrations, perhaps involved in blocking cell progression. Taken together, these data provide important insights into the hormetic effects and mechanisms of REE(s) on plant cell proliferation and growth.

  16. Mechanisms of radiation-induced gene responses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Woloschak, G.E.; Paunesku, T.

    1996-10-01

    In the process of identifying genes differentially expressed in cells exposed ultraviolet radiation, we have identified a transcript having a 26-bp region that is highly conserved in a variety of species including Bacillus circulans, yeast, pumpkin, Drosophila, mouse, and man. When the 5` region (flanking region or UTR) of a gene, the sequence is predominantly in +/+ orientation with respect to the coding DNA strand; while in the coding region and the 3` region (UTR), the sequence is most frequently in the +/-orientation with respect to the coding DNA strand. In two genes, the element is split into two parts;more » however, in most cases, it is found only once but with a minimum of 11 consecutive nucleotides precisely depicting the original sequence. The element is found in a large number of different genes with diverse functions (from human ras p21 to B. circulans chitonase). Gel shift assays demonstrated the presence of a protein in HeLa cell extracts that binds to the sense and antisense single-stranded consensus oligomers, as well as to the double- stranded oligonucleotide. When double-stranded oligomer was used, the size shift demonstrated as additional protein-oligomer complex larger than the one bound to either sense or antisense single-stranded consensus oligomers alone. It is speculated either that this element binds to protein(s) important in maintaining DNA is a single-stranded orientation for transcription or, alternatively that this element is important in the transcription-coupled DNA repair process.« less

  17. Hyperosmotic stress memory in Arabidopsis is mediated by distinct epigenetically labile sites in the genome and is restricted in the male germline by DNA glycosylase activity

    PubMed Central

    Wibowo, Anjar; Becker, Claude; Marconi, Gianpiero; Durr, Julius; Price, Jonathan; Hagmann, Jorg; Papareddy, Ranjith; Putra, Hadi; Kageyama, Jorge; Becker, Jorg; Weigel, Detlef; Gutierrez-Marcos, Jose

    2016-01-01

    Inducible epigenetic changes in eukaryotes are believed to enable rapid adaptation to environmental fluctuations. We have found distinct regions of the Arabidopsis genome that are susceptible to DNA (de)methylation in response to hyperosmotic stress. The stress-induced epigenetic changes are associated with conditionally heritable adaptive phenotypic stress responses. However, these stress responses are primarily transmitted to the next generation through the female lineage due to widespread DNA glycosylase activity in the male germline, and extensively reset in the absence of stress. Using the CNI1/ATL31 locus as an example, we demonstrate that epigenetically targeted sequences function as distantly-acting control elements of antisense long non-coding RNAs, which in turn regulate targeted gene expression in response to stress. Collectively, our findings reveal that plants use a highly dynamic maternal ‘short-term stress memory’ with which to respond to adverse external conditions. This transient memory relies on the DNA methylation machinery and associated transcriptional changes to extend the phenotypic plasticity accessible to the immediate offspring. DOI: http://dx.doi.org/10.7554/eLife.13546.001 PMID:27242129

  18. DNA nanotechnology for nanophotonic applications.

    PubMed

    Samanta, Anirban; Banerjee, Saswata; Liu, Yan

    2015-02-14

    DNA nanotechnology has touched the epitome of miniaturization by integrating various nanometer size particles with nanometer precision. This enticing bottom-up approach has employed small DNA tiles, large multi-dimensional polymeric structures or more recently DNA origami to organize nanoparticles of different inorganic materials, small organic molecules or macro-biomolecules like proteins, and RNAs into fascinating patterns that are difficult to achieve by other conventional methods. Here, we are especially interested in the self-assembly of nanomaterials that are potentially attractive elements in the burgeoning field of nanophotonics. These materials include plasmonic nanoparticles, quantum dots, fluorescent organic dyes, etc. DNA based self-assembly allows excellent control over distance, orientation and stoichiometry of these nano-elements that helps to engineer intelligent systems that can potentially pave the path for future technology. Many outstanding structures have been fabricated that are capable of fine tuning optical properties, such as fluorescence intensity and lifetime modulation, enhancement of Raman scattering and emergence of circular dichroism responses. Within the limited scope of this review we have tried to give a glimpse of the development of this still nascent but highly promising field to its current status as well as the existing challenges before us.

  19. Specific DNA binding of a potential transcriptional regulator, inosine 5'-monophosphate dehydrogenase-related protein VII, to the promoter region of a methyl coenzyme m reductase I-encoding operon retrieved from Methanothermobacter thermautotrophicus strain DeltaH.

    PubMed

    Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi

    2008-10-01

    Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.

  20. Recent Insights into the Control of Human Papillomavirus (HPV) Genome Stability, Loss, and Degradation.

    PubMed

    Fisher, Chris

    2015-01-01

    Most human papillomavirus (HPV) antiviral strategies have focused upon inhibiting viral DNA replication, but it is increasingly apparent that viral DNA levels can be chemically controlled by approaches that promote its instability. HPVs and other DNA viruses have a tenuous relationship with their hosts. They must replicate and hide from the DNA damage response (DDR) and innate immune systems, which serve to protect cells from foreign or "non-self" DNA, and yet they draft these same systems to support their life cycles. DNA binding antiviral agents promoting massive viral DNA instability and elimination are reviewed. Mechanistic studies of these agents have identified genetic antiviral enhancers and repressors, antiviral sensitizers, and host cell elements that protect and stabilize HPV genomes. Viral DNA degradation appears to be an important means of controlling HPV DNA levels in some cases, but the underlying mechanisms remain poorly understood. These findings may prove useful not only for understanding viral DNA persistence but also in devising future antiviral strategies.

  1. Control of transcriptional pausing by biased thermal fluctuations on repetitive genomic sequences

    PubMed Central

    Imashimizu, Masahiko; Afek, Ariel; Takahashi, Hiroki; Lubkowska, Lucyna; Lukatsky, David B.

    2016-01-01

    In the process of transcription elongation, RNA polymerase (RNAP) pauses at highly nonrandom positions across genomic DNA, broadly regulating transcription; however, molecular mechanisms responsible for the recognition of such pausing positions remain poorly understood. Here, using a combination of statistical mechanical modeling and high-throughput sequencing and biochemical data, we evaluate the effect of thermal fluctuations on the regulation of RNAP pausing. We demonstrate that diffusive backtracking of RNAP, which is biased by repetitive DNA sequence elements, causes transcriptional pausing. This effect stems from the increased microscopic heterogeneity of an elongation complex, and thus is entropy-dominated. This report shows a linkage between repetitive sequence elements encoded in the genome and regulation of RNAP pausing driven by thermal fluctuations. PMID:27830653

  2. Programming a topologically constrained DNA nanostructure into a sensor

    NASA Astrophysics Data System (ADS)

    Liu, Meng; Zhang, Qiang; Li, Zhongping; Gu, Jimmy; Brennan, John D.; Li, Yingfu

    2016-06-01

    Many rationally engineered DNA nanostructures use mechanically interlocked topologies to connect individual DNA components, and their physical connectivity is achieved through the formation of a strong linking duplex. The existence of such a structural element also poses a significant topological constraint on functions of component rings. Herein, we hypothesize and confirm that DNA catenanes with a strong linking duplex prevent component rings from acting as the template for rolling circle amplification (RCA). However, by using an RNA-containing DNA [2] catenane with a strong linking duplex, we show that a stimuli-responsive RNA-cleaving DNAzyme can linearize one component ring, and thus enable RCA, producing an ultra-sensitive biosensing system. As an example, a DNA catenane biosensor is engineered to detect the model bacterial pathogen Escherichia coli through binding of a secreted protein, with a detection limit of 10 cells ml-1, thus establishing a new platform for further applications of mechanically interlocked DNA nanostructures.

  3. Programming a topologically constrained DNA nanostructure into a sensor

    PubMed Central

    Liu, Meng; Zhang, Qiang; Li, Zhongping; Gu, Jimmy; Brennan, John D.; Li, Yingfu

    2016-01-01

    Many rationally engineered DNA nanostructures use mechanically interlocked topologies to connect individual DNA components, and their physical connectivity is achieved through the formation of a strong linking duplex. The existence of such a structural element also poses a significant topological constraint on functions of component rings. Herein, we hypothesize and confirm that DNA catenanes with a strong linking duplex prevent component rings from acting as the template for rolling circle amplification (RCA). However, by using an RNA-containing DNA [2] catenane with a strong linking duplex, we show that a stimuli-responsive RNA-cleaving DNAzyme can linearize one component ring, and thus enable RCA, producing an ultra-sensitive biosensing system. As an example, a DNA catenane biosensor is engineered to detect the model bacterial pathogen Escherichia coli through binding of a secreted protein, with a detection limit of 10 cells ml−1, thus establishing a new platform for further applications of mechanically interlocked DNA nanostructures. PMID:27337657

  4. The cellular transcription factor CREB corresponds to activating transcription factor 47 (ATF-47) and forms complexes with a group of polypeptides related to ATF-43.

    PubMed

    Hurst, H C; Masson, N; Jones, N C; Lee, K A

    1990-12-01

    Promoter elements containing the sequence motif CGTCA are important for a variety of inducible responses at the transcriptional level. Multiple cellular factors specifically bind to these elements and are encoded by a multigene family. Among these factors, polypeptides termed activating transcription factor 43 (ATF-43) and ATF-47 have been purified from HeLa cells and a factor referred to as cyclic AMP response element-binding protein (CREB) has been isolated from PC12 cells and rat brain. We demonstrated that CREB and ATF-47 are identical and that CREB and ATF-43 form protein-protein complexes. We also found that the cis requirements for stable DNA binding by ATF-43 and CREB are different. Using antibodies to ATF-43 we have identified a group of polypeptides (ATF-43) in the size range from 40 to 43 kDa. ATF-43 polypeptides are related by their reactivity with anti-ATF-43, DNA-binding specificity, complex formation with CREB, heat stability, and phosphorylation by protein kinase A. Certain cell types vary in their ATF-43 complement, suggesting that CREB activity is modulated in a cell-type-specific manner through interaction with ATF-43. ATF-43 polypeptides do not appear simply to correspond to the gene products of the ATF multigene family, suggesting that the size of the ATF family at the protein level is even larger than predicted from cDNA-cloning studies.

  5. Mapping Fifteen Trace Elements in Human Seminal Plasma and Sperm DNA.

    PubMed

    Ali, Sazan; Chaspoul, Florence; Anderson, Loundou; Bergé-Lefranc, David; Achard, Vincent; Perrin, Jeanne; Gallice, Philippe; Guichaoua, Marie

    2017-02-01

    Studies suggest a relationship between semen quality and the concentration of trace elements in serum or seminal plasma. However, trace elements may be linked to DNA and capable of altering the gene expression patterns. Thus, trace element interactions with DNA may contribute to the mechanisms for a trans-generational reproductive effect. We developed an analytical method to determine the amount of trace elements bound to the sperm DNA, and to estimate their affinity for the sperm DNA by the ratio: R = Log [metal concentration in the sperm DNA/metal concentration in seminal plasma]. We then analyzed the concentrations of 15 trace elements (Al, Cd, Cr, Cu, Hg, Mn, Mo, Ni, Pb, Ti, V, Zn, As, Sb, and Se) in the seminal plasma and the sperm DNA in 64 normal and 30 abnormal semen specimens with Inductively Coupled Plasma/Mass Spectrometry (ICP-MS). This study showed all trace elements were detected in the seminal plasma and only metals were detected in the sperm DNA. There was no correlation between the metals' concentrations in the seminal plasma and the sperm DNA. Al had the highest affinity for DNA followed by Pb and Cd. This strong affinity is consistent with the known mutagenic effects of these metals. The lowest affinity was observed for Zn and Ti. We observed a significant increase of Al linked to the sperm DNA of patients with oligozoospermia and teratozoospermia. Al's reproductive toxicity might be due to Al linked to DNA, by altering spermatogenesis and expression patterns of genes involved in the function of reproduction.

  6. Characterization of an estrogen-responsive element implicated in regulation of the rainbow trout estrogen receptor gene.

    PubMed

    Le Dréan, Y; Lazennec, G; Kern, L; Saligaut, D; Pakdel, F; Valotaire, Y

    1995-08-01

    We previously reported that the expression of the rainbow trout estrogen receptor (rtER) gene is markedly increased by estradiol (E2). In this paper, we have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyl transferase (CAT), linked to 5' flanking regions of the rtER gene promoter, to identify cis-elements responsible for E2 inducibility. Deletion analysis localized an estrogen-responsive element (ERE), at position +242, with one mutation on the first base compared with the consensus sequence. This element confers estrogen responsiveness to CAT reporter linked to both the herpes simplex virus thymidine kinase promoter and the homologous rtER promoter. Moreover, using a 0.2 kb fragment of the rtER promoter encompassing the ERE and the rtER DNA binding domain obtained from a bacterial expression system, DNase I footprinting experiments demonstrated a specific protection covering 20 bp (+240/+260) containing the ERE sequence. Based on these studies, we believe that this ERE sequence, identified in the rtER gene promoter, may be a major cis-acting element involved in the regulation of the gene by estrogen.

  7. Function of the Plant DNA Polymerase Epsilon in Replicative Stress Sensing, a Genetic Analysis.

    PubMed

    Pedroza-García, José-Antonio; Mazubert, Christelle; Del Olmo, Ivan; Bourge, Mickael; Domenichini, Séverine; Bounon, Rémi; Tariq, Zakia; Delannoy, Etienne; Piñeiro, Manuel; Jarillo, José A; Bergounioux, Catherine; Benhamed, Moussa; Raynaud, Cécile

    2017-03-01

    Faithful transmission of the genetic information is essential in all living organisms. DNA replication is therefore a critical step of cell proliferation, because of the potential occurrence of replication errors or DNA damage when progression of a replication fork is hampered causing replicative stress. Like other types of DNA damage, replicative stress activates the DNA damage response, a signaling cascade allowing cell cycle arrest and repair of lesions. The replicative DNA polymerase ε (Pol ε) was shown to activate the S-phase checkpoint in yeast in response to replicative stress, but whether this mechanism functions in multicellular eukaryotes remains unclear. Here, we explored the genetic interaction between Pol ε and the main elements of the DNA damage response in Arabidopsis ( Arabidopsis thaliana ). We found that mutations affecting the polymerase domain of Pol ε trigger ATR-dependent signaling leading to SOG1 activation, WEE1-dependent cell cycle inhibition, and tolerance to replicative stress induced by hydroxyurea, but result in enhanced sensitivity to a wide range of DNA damaging agents. Using knock-down lines, we also provide evidence for the direct role of Pol ε in replicative stress sensing. Together, our results demonstrate that the role of Pol ε in replicative stress sensing is conserved in plants, and provide, to our knowledge, the first genetic dissection of the downstream signaling events in a multicellular eukaryote. © 2017 American Society of Plant Biologists. All Rights Reserved.

  8. Expression of AtWRKY33 encoding a pathogen- or PAMP-responsive WRKY transcription factor is regulated by a composite DNA motif containing W box elements.

    PubMed

    Lippok, Bernadette; Birkenbihl, Rainer P; Rivory, Gaelle; Brümmer, Janna; Schmelzer, Elmon; Logemann, Elke; Somssich, Imre E

    2007-04-01

    WRKY transcription factors regulate distinct parts of the plant defense transcriptome. Expression of many WRKY genes themselves is induced by pathogens or pathogen-mimicking molecules. Here, we demonstrate that Arabidopsis WRKY33 responds to various stimuli associated with plant defense as well as to different kinds of phytopathogens. Although rapid pathogen-induced AtWRKY33 expression does not require salicylic acid (SA) signaling, it is dependent on PAD4, a key regulator upstream of SA. Activation of AtWRKY33 is independent of de novo protein synthesis, suggesting that it is at least partly under negative regulatory control. We show that a set of three WRKY-specific cis-acting DNA elements (W boxes) within the AtWRKY33 promoter is required for efficient pathogen- or PAMP-triggered gene activation. This strongly indicates that WRKY transcription factors are major components of the regulatory machinery modulating immediate to early expression of this gene in response to pathogen attack.

  9. Two residues in the basic region of the yeast transcription factor Yap8 are crucial for its DNA-binding specificity.

    PubMed

    Amaral, Catarina; Pimentel, Catarina; Matos, Rute G; Arraiano, Cecília M; Matzapetakis, Manolis; Rodrigues-Pousada, Claudina

    2013-01-01

    In Saccharomyces cerevisiae, the transcription factor Yap8 is a key determinant in arsenic stress response. Contrary to Yap1, another basic region-leucine zipper (bZIP) yeast regulator, Yap8 has a very restricted DNA-binding specificity and only orchestrates the expression of ACR2 and ACR3 genes. In the DNA-binding basic region, Yap8 has three distinct amino acids residues, Leu26, Ser29 and Asn31, at sites of highly conserved positions in the other Yap family of transcriptional regulators and Pap1 of Schizosaccharomyces pombe. To evaluate whether these residues are relevant to Yap8 specificity, we first built a homology model of the complex Yap8bZIP-DNA based on Pap1-DNA crystal structure. Several Yap8 mutants were then generated in order to confirm the contribution of the residues predicted to interact with DNA. Using bioinformatics analysis together with in vivo and in vitro approaches, we have identified several conserved residues critical for Yap8-DNA binding. Moreover, our data suggest that Leu26 is required for Yap8 binding to DNA and that this residue together with Asn31, hinder Yap1 response element recognition by Yap8, thus narrowing its DNA-binding specificity. Furthermore our results point to a role of these two amino acids in the stability of the Yap8-DNA complex.

  10. The prokaryotic enhancer binding protein NTRC has an ATPase activity which is phosphorylation and DNA dependent.

    PubMed Central

    Austin, S; Dixon, R

    1992-01-01

    The prokaryotic activator protein NTRC binds to enhancer-like elements and activates transcription in response to nitrogen limitation by catalysing open complex formation by sigma 54 RNA polymerase holoenzyme. Formation of open complexes requires the phosphorylated form of NTRC and the reaction is ATP dependent. We find that NTRC has an ATPase activity which is activated by phosphorylation and is strongly stimulated by the presence of DNA containing specific NTRC binding sites. Images PMID:1534752

  11. Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana.

    PubMed

    Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S

    2005-07-15

    A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.

  12. Mutations on the DNA Binding Surface of TBP Discriminate between Yeast TATA and TATA-Less Gene Transcription

    PubMed Central

    Kamenova, Ivanka; Warfield, Linda

    2014-01-01

    Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. PMID:24865972

  13. Mutations on the DNA binding surface of TBP discriminate between yeast TATA and TATA-less gene transcription.

    PubMed

    Kamenova, Ivanka; Warfield, Linda; Hahn, Steven

    2014-08-01

    Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  14. Actuation method and apparatus, micropump, and PCR enhancement method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ullakko, Kari; Mullner, Peter; Hampikian, Greg

    An actuation apparatus includes at least one magnetic shape memory (MSM) element containing a material configured to expand and/or contract in response to exposure to a magnetic field. Among other things, the MSM element may be configured to pump fluid through a micropump by expanding and/or contracting in response to the magnetic field. The magnetic field may rotate about an axis of rotation and exhibit a distribution having a component substantially perpendicular to the axis of rotation. Further, the magnetic field distribution may include at least two components substantially orthogonal to one another lying in one or more planes perpendicularmore » to the axis of rotation. The at least one MSM element may contain nickel, manganese, and gallium. A polymerase chain reaction (PCR) may be enhanced by contacting a PCR reagent and DNA material with the MSM element.« less

  15. Cryptic glucocorticoid receptor-binding sites pervade genomic NF-κB response elements.

    PubMed

    Hudson, William H; Vera, Ian Mitchelle S de; Nwachukwu, Jerome C; Weikum, Emily R; Herbst, Austin G; Yang, Qin; Bain, David L; Nettles, Kendall W; Kojetin, Douglas J; Ortlund, Eric A

    2018-04-06

    Glucocorticoids (GCs) are potent repressors of NF-κB activity, making them a preferred choice for treatment of inflammation-driven conditions. Despite the widespread use of GCs in the clinic, current models are inadequate to explain the role of the glucocorticoid receptor (GR) within this critical signaling pathway. GR binding directly to NF-κB itself-tethering in a DNA binding-independent manner-represents the standing model of how GCs inhibit NF-κB-driven transcription. We demonstrate that direct binding of GR to genomic NF-κB response elements (κBREs) mediates GR-driven repression of inflammatory gene expression. We report five crystal structures and solution NMR data of GR DBD-κBRE complexes, which reveal that GR recognizes a cryptic response element between the binding footprints of NF-κB subunits within κBREs. These cryptic sequences exhibit high sequence and functional conservation, suggesting that GR binding to κBREs is an evolutionarily conserved mechanism of controlling the inflammatory response.

  16. DNA transposon-based gene vehicles - scenes from an evolutionary drive

    PubMed Central

    2013-01-01

    DNA transposons are primitive genetic elements which have colonized living organisms from plants to bacteria and mammals. Through evolution such parasitic elements have shaped their host genomes by replicating and relocating between chromosomal loci in processes catalyzed by the transposase proteins encoded by the elements themselves. DNA transposable elements are constantly adapting to life in the genome, and self-suppressive regulation as well as defensive host mechanisms may assist in buffering ‘cut-and-paste’ DNA mobilization until accumulating mutations will eventually restrict events of transposition. With the reconstructed Sleeping Beauty DNA transposon as a powerful engine, a growing list of transposable elements with activity in human cells have moved into biomedical experimentation and preclinical therapy as versatile vehicles for delivery and genomic insertion of transgenes. In this review, we aim to link the mechanisms that drive transposon evolution with the realities and potential challenges we are facing when adapting DNA transposons for gene transfer. We argue that DNA transposon-derived vectors may carry inherent, and potentially limiting, traits of their mother elements. By understanding in detail the evolutionary journey of transposons, from host colonization to element multiplication and inactivation, we may better exploit the potential of distinct transposable elements. Hence, parallel efforts to investigate and develop distinct, but potent, transposon-based vector systems will benefit the broad applications of gene transfer. Insight and clever optimization have shaped new DNA transposon vectors, which recently debuted in the first DNA transposon-based clinical trial. Learning from an evolutionary drive may help us create gene vehicles that are safer, more efficient, and less prone for suppression and inactivation. PMID:24320156

  17. Downstream promoter interactions of TFIID TAFs facilitate transcription reinitiation

    PubMed Central

    Joo, Yoo Jin; Ficarro, Scott B.; Soares, Luis M.; Chun, Yujin; Marto, Jarrod A.; Buratowski, Stephen

    2017-01-01

    TFIID binds promoter DNA to recruit RNA polymerase II and other basal factors for transcription. Although the TATA-binding protein (TBP) subunit of TFIID is necessary and sufficient for in vitro transcription, the TBP-associated factor (TAF) subunits recognize downstream promoter elements, act as coactivators, and interact with nucleosomes. In yeast nuclear extracts, transcription induces stable TAF binding to downstream promoter DNA, promoting subsequent activator-independent transcription reinitiation. In vivo, promoter responses to TAF mutations correlate with the level of downstream, rather than overall, Taf1 cross-linking. We propose a new model in which TAFs function as reinitiation factors, accounting for the differential responses of promoters to various transcription factor mutations. PMID:29203645

  18. Characterization of various promoter regions of the human DNA helicase-encoding genes and identification of duplicated ets (GGAA) motifs as an essential transcription regulatory element.

    PubMed

    Uchiumi, Fumiaki; Watanabe, Takeshi; Tanuma, Sei-ichi

    2010-05-15

    DNA helicases are important in the regulation of DNA transaction and thereby various cellular functions. In this study, we developed a cost-effective multiple DNA transfection assay with DEAE-dextran reagent and analyzed the promoter activities of the human DNA helicases. The 5'-flanking regions of the human DNA helicase-encoding genes were isolated and subcloned into luciferase (Luc) expression plasmids. They were coated onto 96-well plate and used for co-transfection with a renilla-Luc expression vector into various cells, and dual-Luc assays were performed. The profiles of promoter activities were dependent on cell lines used. Among these human DNA helicase genes, XPB, RecQL5, and RTEL promoters were activated during TPA-induced HL-60 cell differentiation. Interestingly, duplicated ets (GGAA) elements are commonly located around the transcription start sites of these genes. The duplicated GGAA motifs are also found in the promoters of DNA replication/repair synthesis factor genes including PARG, ATR, TERC, and Rb1. Mutation analyses suggested that the duplicated GGAA-motifs are necessary for the basal promoter activity in various cells and some of them positively respond to TPA in HL-60 cells. TPA-induced response of 44-bp in the RTEL promoter was attenuated by co-transfection of the PU.1 expression vector. These findings suggest that the duplicated ets motifs regulate DNA-repair associated gene expressions during macrophage-like differentiation of HL-60 cells. Copyright 2010 Elsevier Inc. All rights reserved.

  19. Sex change strategy and the aromatase genes.

    PubMed

    Gardner, L; Anderson, T; Place, A R; Dixon, B; Elizur, A

    2005-04-01

    Sequential hermaphroditism is a common reproductive strategy in many teleosts. Steroid production is known to mediate both the natural and induced sex change, yet beyond this the physiology directing this process has received little attention. Cytochrome P450 aromatase is a key enzyme in the hormonal pathway catalysing the conversion of sex steroids, androgens to oestrogens, and thus is highly relevant to the process of sex change. This study reports the isolation of cDNA sequences for aromatase isoforms CYP19A1 and CYP19A2 from teleost species representing three forms of sexual hermaphroditism: Lates calcarifer (protandry), Cromileptes altivelis (protogyny), and Gobiodon histrio (bi-directional). Deduced amino acid analysis of these isoforms with other reported isoforms from gonochoristic (single sex) teleosts revealed 56-95% identity within the same isoform while only 48-65% identity between isoforms irrespective of species and sexual strategy. Phylogenetic analysis supported this result separating sequences into isoform exclusive clades in spite of species apparent evolutionary distance. Furthermore, this study isolates 5' flanking regions of all above genes and describes putative cis-acting elements therein. Elements identified include steroidogenic factor 1 binding site (SF-1), oestrogen response element (ERE), progesterone response element (PRE), androgen response element (ARE), glucocorticoid response elements (GRE), peroxisome proliferator-activated receptor alpha/retinoid X receptor alpha heterodimer responsive element (PPARalpha/RXRalpha), nuclear factor kappabeta (NF-kappabeta), SOX 5, SOX 9, and Wilms tumor suppressor (WTI). A hypothetical in vivo model was constructed for both isoforms highlighting potential roles of these putative cis-acting elements with reference to normal function and sexual hermaphroditism.

  20. Hypoxia inducible factor-1 mediates the expression of the immune checkpoint HLA-G in glioma cells through hypoxia response element located in exon 2.

    PubMed

    Yaghi, Layale; Poras, Isabelle; Simoes, Renata T; Donadi, Eduardo A; Tost, Jörg; Daunay, Antoine; de Almeida, Bibiana Sgorla; Carosella, Edgardo D; Moreau, Philippe

    2016-09-27

    HLA-G is an immune checkpoint molecule with specific relevance in cancer immunotherapy. It was first identified in cytotrophoblasts, protecting the fetus from maternal rejection. HLA-G tissue expression is very restricted but induced in numerous malignant tumors such as glioblastoma, contributing to their immune escape. Hypoxia occurs during placenta and tumor development and was shown to activate HLA-G. We aimed to elucidate the mechanisms of HLA-G activation under conditions combining hypoxia-mimicking treatment and 5-aza-2'deoxycytidine, a DNA demethylating agent used in anti-cancer therapy which also induces HLA-G. Both treatments enhanced the amount of HLA-G mRNA and protein in HLA-G negative U251MG glioma cells. Electrophoretic Mobility Shift Assays and luciferase reporter gene assays revealed that HLA-G upregulation depends on Hypoxia Inducible Factor-1 (HIF-1) and a hypoxia responsive element (HRE) located in exon 2. A polymorphic HRE at -966 bp in the 5'UT region may modulate the magnitude of the response mediated by the exon 2 HRE. We suggest that therapeutic strategies should take into account that HLA-G expression in response to hypoxic tumor environment is dependent on HLA-G gene polymorphism and DNA methylation state at the HLA-G locus.

  1. Lanthanum Element Induced Imbalance of Mineral Nutrients, HSP 70 Production and DNA-Protein Crosslink, Leading to Hormetic Response of Cell Cycle Progression in Root Tips of Vicia faba L. seedlings

    PubMed Central

    Wang, Chengrun; Shi, Cuie; Liu, Ling; Wang, Chen; Qiao, Wei; Gu, Zhimang; Wang, Xiaorong

    2011-01-01

    The effects and mechanisms of rare earth elements on plant growth have not been extensively characterized. In the current study, Vicia faba L. seedlings were cultivated in lanthanum (La)-containing solutions for 10 days to investigate the possible effects and mechanisms of La on cell proliferation and root lengthening in roots. The results showed that increasing La levels resulted in abnormal calcium (Ca), Ferrum (Fe) or Potassium (K) contents in the roots. Flow cytometry analysis revealed G1/S and S/G2 arrests in response to La treatments in the root tips. Heat shock protein 70 (HSP 70) production showed a U-shaped dose response to increasing La levels. Consistent with its role in cell cycle regulation, HSP 70 fluctuated in parallel with the S-phase ratios and proliferation index. Furthermore, DNA-protein crosslinks (DPCs) enhanced at higher La concentrations, perhaps involved in blocking cell progression. Taken together, these data provide important insights into the hormetic effects and mechanisms of REE(s) on plant cell proliferation and growth. PMID:22423233

  2. Reversible Modulation of DNA-Based Hydrogel Shapes by Internal Stress Interactions.

    PubMed

    Hu, Yuwei; Kahn, Jason S; Guo, Weiwei; Huang, Fujian; Fadeev, Michael; Harries, Daniel; Willner, Itamar

    2016-12-14

    We present the assembly of asymmetric two-layer hybrid DNA-based hydrogels revealing stimuli-triggered reversibly modulated shape transitions. Asymmetric, linear hydrogels that include layer-selective switchable stimuli-responsive elements that control the hydrogel stiffness are designed. Trigger-induced stress in one of the layers results in the bending of the linear hybrid structure, thereby minimizing the elastic free energy of the systems. The removal of the stress by a counter-trigger restores the original linear bilayer hydrogel. The stiffness of the DNA hydrogel layers is controlled by thermal, pH (i-motif), K + ion/crown ether (G-quadruplexes), chemical (pH-doped polyaniline), or biocatalytic (glucose oxidase/urease) triggers. A theoretical model relating the experimental bending radius of curvatures of the hydrogels with the Young's moduli and geometrical parameters of the hydrogels is provided. Promising applications of shape-regulated stimuli-responsive asymmetric hydrogels include their use as valves, actuators, sensors, and drug delivery devices.

  3. EBP1 is a novel E2F target gene regulated by transforming growth factor-β.

    PubMed

    Judah, David; Chang, Wing Y; Dagnino, Lina

    2010-11-10

    Regulation of gene expression requires transcription factor binding to specific DNA elements, and a large body of work has focused on the identification of such sequences. However, it is becoming increasingly clear that eukaryotic transcription factors can exhibit widespread, nonfunctional binding to genomic DNA sites. Conversely, some of these proteins, such as E2F, can also modulate gene expression by binding to non-consensus elements. E2F comprises a family of transcription factors that play key roles in a wide variety of cellular functions, including survival, differentiation, activation during tissue regeneration, metabolism, and proliferation. E2F factors bind to the Erb3-binding protein 1 (EBP1) promoter in live cells. We now show that E2F binding to the EBP1 promoter occurs through two tandem DNA elements that do not conform to typical consensus E2F motifs. Exogenously expressed E2F1 activates EBP1 reporters lacking one, but not both sites, suggesting a degree of redundancy under certain conditions. E2F1 increases the levels of endogenous EBP1 mRNA in breast carcinoma and other transformed cell lines. In contrast, in non-transformed primary epidermal keratinocytes, E2F, together with the retinoblastoma family of proteins, appears to be involved in decreasing EBP1 mRNA abundance in response to growth inhibition by transforming growth factor-β1. Thus, E2F is likely a central coordinator of multiple responses that culminate in regulation of EBP1 gene expression, and which may vary depending on cell type and context.

  4. Is the Fungus Magnaporthe Losing DNA Methylation?

    PubMed Central

    Ikeda, Ken-ichi; Van Vu, Ba; Kadotani, Naoki; Tanaka, Masaki; Murata, Toshiki; Shiina, Kohta; Chuma, Izumi; Tosa, Yukio; Nakayashiki, Hitoshi

    2013-01-01

    The long terminal repeat retrotransposon, Magnaporthe gypsy-like element (MAGGY), has been shown to be targeted for cytosine methylation in a subset of Magnaporthe oryzae field isolates. Analysis of the F1 progeny from a genetic cross between methylation-proficient (Br48) and methylation-deficient (GFSI1-7-2) isolates revealed that methylation of the MAGGY element was governed by a single dominant gene. Positional cloning followed by gene disruption and complementation experiments revealed that the responsible gene was the DNA methyltransferase, MoDMT1, an ortholog of Neurospora crassa Dim-2. A survey of MAGGY methylation in 60 Magnaporthe field isolates revealed that 42 isolates from rice, common millet, wheat, finger millet, and buffelgrass were methylation proficient while 18 isolates from foxtail millet, green bristlegrass, Japanese panicgrass, torpedo grass, Guinea grass, and crabgrass were methylation deficient. Phenotypic analyses showed that MoDMT1 plays no major role in development and pathogenicity of the fungus. Quantitative polymerase chain reaction analysis showed that the average copy number of genomic MAGGY elements was not significantly different between methylation-deficient and -proficient field isolates even though the levels of MAGGY transcript were generally higher in the former group. MoDMT1 gene sequences in the methylation-deficient isolates suggested that at least three independent mutations were responsible for the loss of MoDMT1 function. Overall, our data suggest that MoDMT1 is not essential for the natural life cycle of the fungus and raise the possibility that the genus Magnaporthe may be losing the mechanism of DNA methylation on the evolutionary time scale. PMID:23979580

  5. Dehydration responsive element binding transcription factors and their applications for the engineering of stress tolerance.

    PubMed

    Agarwal, Pradeep K; Gupta, Kapil; Lopato, Sergiy; Agarwal, Parinita

    2017-04-01

    Dehydration responsive element binding (DREB) factors or CRT element binding factors (CBFs) are members of the AP2/ERF family, which comprises a large number of stress-responsive regulatory genes. This review traverses almost two decades of research, from the discovery of DREB/CBF factors to their optimization for application in plant biotechnology. In this review, we describe (i) the discovery, classification, structure, and evolution of DREB genes and proteins; (ii) induction of DREB genes by abiotic stresses and involvement of their products in stress responses; (iii) protein structure and DNA binding selectivity of different groups of DREB proteins; (iv) post-transcriptional and post-translational mechanisms of DREB transcription factor (TF) regulation; and (v) physical and/or functional interaction of DREB TFs with other proteins during plant stress responses. We also discuss existing issues in applications of DREB TFs for engineering of enhanced stress tolerance and improved performance under stress of transgenic crop plants. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  6. A versatile transfection assay system to evaluate the biological effects of diverse industrial chemicals.

    PubMed

    Koizumi, Shinji; Ohno, Shotaro; Otsuka, Fuminori

    2012-01-01

    Gene expression processes are now recognized as important targets of the toxic effects exerted by industrial chemicals. The transient transfection assay is a powerful tool to evaluate such effects. Thus, we developed a versatile assay system by constructing a basic reporter plasmid in which the regulatory DNA sequence to be studied can easily be substituted. To verify the performance of this system, reporter plasmids carrying any of the three distinct regulatory sequences, estrogen responsive element (ERE), glucocorticoid responsive element (GRE) and xenobiotic responsive element (XRE) were constructed. After transfection of human cells, these plasmids successfully expressed the relevant reporter genes in response to specific inducers, β-estradiol, dexamethasone and 3-methylcholanthrene, respectively. Several industrial chemicals were assayed using these reporter plasmids, and the ability of p-dimethylaminoazobenzene to elevate GRE- and XRE-mediated transcription was detected. α-Naphthylamine and o-tolidine were also observed to increase the XRE-mediated response. The transfection assay system established here will be useful to evaluate the effects of a wide variety of industrial chemicals.

  7. Modular structural elements in the replication origin region of Tetrahymena rDNA.

    PubMed Central

    Du, C; Sanzgiri, R P; Shaiu, W L; Choi, J K; Hou, Z; Benbow, R M; Dobbs, D L

    1995-01-01

    Computer analyses of the DNA replication origin region in the amplified rRNA genes of Tetrahymena thermophila identified a potential initiation zone in the 5'NTS [Dobbs, Shaiu and Benbow (1994), Nucleic Acids Res. 22, 2479-2489]. This region consists of a putative DNA unwinding element (DUE) aligned with predicted bent DNA segments, nuclear matrix or scaffold associated region (MAR/SAR) consensus sequences, and other common modular sequence elements previously shown to be clustered in eukaryotic chromosomal origin regions. In this study, two mung bean nuclease-hypersensitive sites in super-coiled plasmid DNA were localized within the major DUE-like element predicted by thermodynamic analyses. Three restriction fragments of the 5'NTS region predicted to contain bent DNA segments exhibited anomalous migration characteristic of bent DNA during electrophoresis on polyacrylamide gels. Restriction fragments containing the 5'NTS region bound Tetrahymena nuclear matrices in an in vitro binding assay, consistent with an association of the replication origin region with the nuclear matrix in vivo. The direct demonstration in a protozoan origin region of elements previously identified in Drosophila, chick and mammalian origin regions suggests that clusters of modular structural elements may be a conserved feature of eukaryotic chromosomal origins of replication. Images PMID:7784181

  8. Exploring the read-write genome: mobile DNA and mammalian adaptation.

    PubMed

    Shapiro, James A

    2017-02-01

    The read-write genome idea predicts that mobile DNA elements will act in evolution to generate adaptive changes in organismal DNA. This prediction was examined in the context of mammalian adaptations involving regulatory non-coding RNAs, viviparous reproduction, early embryonic and stem cell development, the nervous system, and innate immunity. The evidence shows that mobile elements have played specific and sometimes major roles in mammalian adaptive evolution by generating regulatory sites in the DNA and providing interaction motifs in non-coding RNA. Endogenous retroviruses and retrotransposons have been the predominant mobile elements in mammalian adaptive evolution, with the notable exception of bats, where DNA transposons are the major agents of RW genome inscriptions. A few examples of independent but convergent exaptation of mobile DNA elements for similar regulatory rewiring functions are noted.

  9. Cytoplasmic transfer of heritable elements other than mtDNA from SAMP1 mice into mouse tumor cells suppresses their ability to form tumors in C57BL6 mice.

    PubMed

    Shimizu, Akinori; Tani, Haruna; Takibuchi, Gaku; Ishikawa, Kaori; Sakurazawa, Ryota; Inoue, Takafumi; Hashimoto, Tetsuo; Nakada, Kazuto; Takenaga, Keizo; Hayashi, Jun-Ichi

    2017-11-04

    In a previous study, we generated transmitochondrial P29mtSAMP1 cybrids, which had nuclear DNA from the C57BL6 (referred to as B6) mouse strain-derived P29 tumor cells and mitochondrial DNA (mtDNA) exogenously-transferred from the allogeneic strain SAMP1. Because P29mtSAMP1 cybrids did not form tumors in syngeneic B6 mice, we proposed that allogeneic SAMP1 mtDNA suppressed tumor formation of P29mtSAMP1 cybrids. To test this hypothesis, current study generated P29mt(sp)B6 cybrids carrying all genomes (nuclear DNA and mtDNA) from syngeneic B6 mice by eliminating SAMP1 mtDNA from P29mtSAMP1 cybrids and reintroducing B6 mtDNA. However, the P29mt(sp)B6 cybrids did not form tumors in B6 mice, even though they had no SAMP1 mtDNA, suggesting that SAMP1 mtDNA is not involved in tumor suppression. Then, we examined another possibility of whether SAMP1 mtDNA fragments potentially integrated into the nuclear DNA of P29mtSAMP1 cybrids are responsible for tumor suppression. We generated P29 H (sp)B6 cybrids by eliminating nuclear DNA from P29mt(sp)B6 cybrids and reintroducing nuclear DNA with no integrated SAMP1 mtDNA fragment from mtDNA-less P29 cells resistant to hygromycin in selection medium containing hygromycin. However, the P29 H (sp)B6 cybrids did not form tumors in B6 mice, even though they carried neither SAMP1 mtDNA nor nuclear DNA with integrated SAMP1 mtDNA fragments. Moreover, overproduction of reactive oxygen species (ROS) and bacterial infection were not involved in tumor suppression. These observations suggest that tumor suppression was caused not by mtDNA with polymorphic mutations or infection of cytozoic bacteria but by hypothetical heritable cytoplasmic elements other than mtDNA from SAMP1 mice. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  10. A Surrogate Approach to Study the Evolution of Noncoding DNA Elements That Organize Eukaryotic Genomes

    PubMed Central

    Vermaak, Danielle; Bayes, Joshua J.

    2009-01-01

    Comparative genomics provides a facile way to address issues of evolutionary constraint acting on different elements of the genome. However, several important DNA elements have not reaped the benefits of this new approach. Some have proved intractable to current day sequencing technology. These include centromeric and heterochromatic DNA, which are essential for chromosome segregation as well as gene regulation, but the highly repetitive nature of the DNA sequences in these regions make them difficult to assemble into longer contigs. Other sequences, like dosage compensation X chromosomal sites, origins of DNA replication, or heterochromatic sequences that encode piwi-associated RNAs, have proved difficult to study because they do not have recognizable DNA features that allow them to be described functionally or computationally. We have employed an alternate approach to the direct study of these DNA elements. By using proteins that specifically bind these noncoding DNAs as surrogates, we can indirectly assay the evolutionary constraints acting on these important DNA elements. We review the impact that such “surrogate strategies” have had on our understanding of the evolutionary constraints shaping centromeres, origins of DNA replication, and dosage compensation X chromosomal sites. These have begun to reveal that in contrast to the view that such structural DNA elements are either highly constrained (under purifying selection) or free to drift (under neutral evolution), some of them may instead be shaped by adaptive evolution and genetic conflicts (these are not mutually exclusive). These insights also help to explain why the same elements (e.g., centromeres and replication origins), which are so complex in some eukaryotic genomes, can be simple and well defined in other where similar conflicts do not exist. PMID:19635763

  11. PRAP1 is a novel executor of p53-dependent mechanisms in cell survival after DNA damage

    PubMed Central

    Huang, B H; Zhuo, J L; Leung, C H W; Lu, G D; Liu, J J; Yap, C T; Hooi, S C

    2012-01-01

    p53 has a crucial role in governing cellular mechanisms in response to a broad range of genotoxic stresses. During DNA damage, p53 can either promote cell survival by activating senescence or cell-cycle arrest and DNA repair to maintain genomic integrity for cell survival or direct cells to undergo apoptosis to eliminate extensively damaged cells. The ability of p53 to execute these two opposing cell fates depends on distinct signaling pathways downstream of p53. In this study, we showed that under DNA damage conditions induced by chemotherapeutic drugs, gamma irradiation and hydrogen peroxide, p53 upregulates a novel protein, proline-rich acidic protein 1 (PRAP1). We identified functional p53-response elements within intron 1 of PRAP1 gene and showed that these regions interact directly with p53 using ChIP assays, indicating that PRAP1 is a novel p53 target gene. The induction of PRAP1 expression by p53 may promote resistance of cancer cells to chemotherapeutic drugs such as 5-fluorouracil (5-FU), as knockdown of PRAP1 increases apoptosis in cancer cells after 5-FU treatment. PRAP1 appears to protect cells from apoptosis by inducing cell-cycle arrest, suggesting that the induction of PRAP1 expression by p53 in response to DNA-damaging agents contributes to cancer cell survival. Our findings provide a greater insight into the mechanisms underlying the pro-survival role of p53 in response to cytotoxic treatments. PMID:23235459

  12. PRAP1 is a novel executor of p53-dependent mechanisms in cell survival after DNA damage.

    PubMed

    Huang, B H; Zhuo, J L; Leung, C H W; Lu, G D; Liu, J J; Yap, C T; Hooi, S C

    2012-12-13

    p53 has a crucial role in governing cellular mechanisms in response to a broad range of genotoxic stresses. During DNA damage, p53 can either promote cell survival by activating senescence or cell-cycle arrest and DNA repair to maintain genomic integrity for cell survival or direct cells to undergo apoptosis to eliminate extensively damaged cells. The ability of p53 to execute these two opposing cell fates depends on distinct signaling pathways downstream of p53. In this study, we showed that under DNA damage conditions induced by chemotherapeutic drugs, gamma irradiation and hydrogen peroxide, p53 upregulates a novel protein, proline-rich acidic protein 1 (PRAP1). We identified functional p53-response elements within intron 1 of PRAP1 gene and showed that these regions interact directly with p53 using ChIP assays, indicating that PRAP1 is a novel p53 target gene. The induction of PRAP1 expression by p53 may promote resistance of cancer cells to chemotherapeutic drugs such as 5-fluorouracil (5-FU), as knockdown of PRAP1 increases apoptosis in cancer cells after 5-FU treatment. PRAP1 appears to protect cells from apoptosis by inducing cell-cycle arrest, suggesting that the induction of PRAP1 expression by p53 in response to DNA-damaging agents contributes to cancer cell survival. Our findings provide a greater insight into the mechanisms underlying the pro-survival role of p53 in response to cytotoxic treatments.

  13. Plasmids encoding PKI(1-31), a specific inhibitor of cAMP-stimulated gene expression, inhibit the basal transcriptional activity of some but not all cAMP-regulated DNA response elements in JEG-3 cells.

    PubMed

    Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J

    1989-11-25

    Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids encoding PKI(1-31) inhibit the expression that is stimulated by the addition of cAMP analogs in both cell lines; basal expression, however, is inhibited by PKI(1-31) only in the JEG-3 cell line and not in the CV-1 cells. These observations indicate that, in JEG-3 cells, PKI(1-31) is a specific inhibitor of kinase A-mediated gene transcription, but it does not modify kinase C-directed transcription.(ABSTRACT TRUNCATED AT 400 WORDS)

  14. Validation of an entirely in vitro approach for rapid prototyping of DNA regulatory elements for synthetic biology

    PubMed Central

    Chappell, James; Jensen, Kirsten; Freemont, Paul S.

    2013-01-01

    A bottleneck in our capacity to rationally and predictably engineer biological systems is the limited number of well-characterized genetic elements from which to build. Current characterization methods are tied to measurements in living systems, the transformation and culturing of which are inherently time-consuming. To address this, we have validated a completely in vitro approach for the characterization of DNA regulatory elements using Escherichia coli extract cell-free systems. Importantly, we demonstrate that characterization in cell-free systems correlates and is reflective of performance in vivo for the most frequently used DNA regulatory elements. Moreover, we devise a rapid and completely in vitro method to generate DNA templates for cell-free systems, bypassing the need for DNA template generation and amplification from living cells. This in vitro approach is significantly quicker than current characterization methods and is amenable to high-throughput techniques, providing a valuable tool for rapidly prototyping libraries of DNA regulatory elements for synthetic biology. PMID:23371936

  15. Translocation and gross deletion breakpoints in human inherited disease and cancer II: Potential involvement of repetitive sequence elements in secondary structure formation between DNA ends.

    PubMed

    Chuzhanova, Nadia; Abeysinghe, Shaun S; Krawczak, Michael; Cooper, David N

    2003-09-01

    Translocations and gross deletions are responsible for a significant proportion of both cancer and inherited disease. Although such gene rearrangements are nonuniformly distributed in the human genome, the underlying mutational mechanisms remain unclear. We have studied the potential involvement of various types of repetitive sequence elements in the formation of secondary structure intermediates between the single-stranded DNA ends that recombine during rearrangements. Complexity analysis was used to assess the potential of these ends to form secondary structures, the maximum decrease in complexity consequent to a gross rearrangement being used as an indicator of the type of repeat and the specific DNA ends involved. A total of 175 pairs of deletion/translocation breakpoint junction sequences available from the Gross Rearrangement Breakpoint Database [GRaBD; www.uwcm.ac.uk/uwcm/mg/grabd/grabd.html] were analyzed. Potential secondary structure was noted between the 5' flanking sequence of the first breakpoint and the 3' flanking sequence of the second breakpoint in 49% of rearrangements and between the 5' flanking sequence of the second breakpoint and the 3' flanking sequence of the first breakpoint in 36% of rearrangements. Inverted repeats, inversions of inverted repeats, and symmetric elements were found in association with gross rearrangements at approximately the same frequency. However, inverted repeats and inversions of inverted repeats accounted for the vast majority (83%) of deletions plus small insertions, symmetric elements for one-half of all antigen receptor-mediated translocations, while direct repeats appear only to be involved in mediating simple deletions. These findings extend our understanding of illegitimate recombination by highlighting the importance of secondary structure formation between single-stranded DNA ends at breakpoint junctions. Copyright 2003 Wiley-Liss, Inc.

  16. Activation of the carbohydrate response element binding protein (ChREBP) in response to anoxia in the turtle Trachemys scripta elegans.

    PubMed

    Krivoruchko, Anastasia; Storey, Kenneth B

    2014-10-01

    ChREBP (carbohydrate response element binding protein) is a glucose-responsive transcription factor that is known to be an important regulator of glycolytic and lipogenic genes in response to glucose. We hypothesized that activation of ChREBP could be relevant to anoxia survival by the anoxia-tolerant turtle, Trachemys scripta elegans. Expression of ChREBP in response to 5 and 20h of anoxia was examined using RT-PCR and Western immunoblotting. In addition, subcellular localization and DNA-binding activity of ChREBP protein were assessed and transcript levels of liver pyruvate kinase (LPK), a downstream gene under ChREBP control were quantified using RT-PCR. ChREBP was anoxia-responsive in kidney and liver, with transcript levels increasing by 1.2-1.8 fold in response to anoxia and protein levels increasing by 1.8-1.9 fold. Enhanced nuclear presence under anoxia was also observed in both tissues by 2.2-2.8 fold. A 4.2 fold increase in DNA binding activity of ChREBP was also observed in liver in response to 5h of anoxia. In addition, transcript levels of LPK increased by 2.1 fold in response to 5h of anoxia in the liver. The results suggest that activation of ChREBP in response to anoxia might be a crucial factor for anoxia survival in turtle liver by contributing to elevated glycolytic flux in the initial phases of oxygen limitation. This study provides the first demonstration of activation of ChREBP in response to anoxia in a natural model of anoxia tolerance, further improving our understanding of the molecular nature of anoxia tolerance. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Structural integration in hypoxia-inducible factors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Dalei; Potluri, Nalini; Lu, Jingping

    The hypoxia-inducible factors (HIFs) coordinate cellular adaptations to low oxygen stress by regulating transcriptional programs in erythropoiesis, angiogenesis and metabolism. These programs promote the growth and progression of many tumours, making HIFs attractive anticancer targets. Transcriptionally active HIFs consist of HIF-alpha and ARNT (also called HIF-1 beta) subunits. Here we describe crystal structures for each of mouse HIF-2 alpha-ARNT and HIF-1 alpha-ARNT heterodimers in states that include bound small molecules and their hypoxia response element. A highly integrated quaternary architecture is shared by HIF-2 alpha-ARNT and HIF-1 alpha-ARNT, wherein ARNT spirals around the outside of each HIF-alpha subunit. Five distinctmore » pockets are observed that permit small-molecule binding, including PAS domain encapsulated sites and an interfacial cavity formed through subunit heterodimerization. The DNA-reading head rotates, extends and cooperates with a distal PAS domain to bind hypoxia response elements. HIF-alpha mutations linked to human cancers map to sensitive sites that establish DNA binding and the stability of PAS domains and pockets.« less

  18. Porcine bocavirus NP1 negatively regulates interferon signaling pathway by targeting the DNA-binding domain of IRF9

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Ruoxi; The Cooperative Innovation Center for Sustainable Pig Production, Wuhan 430070; Fang, Liurong, E-mail: fanglr@mail.hzau.edu.cn

    2015-11-15

    To subvert host antiviral immune responses, many viruses have evolved countermeasures to inhibit IFN signaling pathway. Porcine bocavirus (PBoV), a newly identified porcine parvovirus, has received attention because it shows clinically high co-infection prevalence with other pathogens in post-weaning multisystemic wasting syndrome (PWMS) and diarrheic piglets. In this study, we screened the structural and non-structural proteins encoded by PBoV and found that the non-structural protein NP1 significantly suppressed IFN-stimulated response element (ISRE) activity and subsequent IFN-stimulated gene (ISG) expression. However, NP1 affected neither the activation and translocation of STAT1/STAT2, nor the formation of the heterotrimeric transcription factor complex ISGF3 (STAT1/STAT2/IRF9).more » Detailed analysis demonstrated that PBoV NP1 blocked the ISGF3 DNA-binding activity by combining with the DNA-binding domain (DBD) of IRF9. In summary, these results indicate that PBoV NP1 interferes with type I IFN signaling pathway by blocking DNA binding of ISGF3 to attenuate innate immune responses. - Highlights: • Porcine bocavirus (PBoV) NP1 interferes with the IFN α/β signaling pathway. • PBoV NP1 does not prevent STAT1/STAT2 phosphorylation and nuclear translocation. • PBoV NP1 inhibits the DNA-binding activity of ISGF3. • PBoV NP1 interacts with the DNA-binding domain of IRF9.« less

  19. The DnaJ Gene Family in Pepper (Capsicum annuum L.): Comprehensive Identification, Characterization and Expression Profiles.

    PubMed

    Fan, FangFei; Yang, Xian; Cheng, Yuan; Kang, Yunyan; Chai, Xirong

    2017-01-01

    The DnaJ proteins which function as molecular chaperone played critical roles in plant growth and development and response to heat stress (HS) and also called heat shock protein 40 based on molecular weight. However, little was reported on this gene family in pepper. Recently, the release of the whole pepper genome provided an opportunity for identifying putative DnaJ homologous. In this study, a total of 76 putative pepper DnaJ genes (CaDnaJ01 to CaDnaJ76) were identified using bioinformatics methods and classified into five groups by the presence of the complete three domains (J-domain, zinc finger domain, and C-terminal domain). Chromosome mapping suggested that segmental duplication and tandem duplication were occurred in evolution. The multiple stress-related cis -elements were found in the promoter region of these CaDnaJ genes, which indicated that the CaDnaJs might be involved in the process of responding to complex stress conditions. In addition, expression profiles based on RNA-seq showed that the 47 CaDnaJs were expressed in at least one tissue tested. The result implied that they could be involved in the process of pepper growth and development. qRT-PCR analysis found that 80.60% (54/67) CaDnaJs were induced by HS, indicated that they could participated in pepper response to high temperature treatments. In conclusion, all these results would provide a comprehensive basis for further analyzing the function of CaDnaJ members and be also significant for elucidating the evolutionary relationship in pepper.

  20. The DnaJ Gene Family in Pepper (Capsicum annuum L.): Comprehensive Identification, Characterization and Expression Profiles

    PubMed Central

    Fan, FangFei; Yang, Xian; Cheng, Yuan; Kang, Yunyan; Chai, Xirong

    2017-01-01

    The DnaJ proteins which function as molecular chaperone played critical roles in plant growth and development and response to heat stress (HS) and also called heat shock protein 40 based on molecular weight. However, little was reported on this gene family in pepper. Recently, the release of the whole pepper genome provided an opportunity for identifying putative DnaJ homologous. In this study, a total of 76 putative pepper DnaJ genes (CaDnaJ01 to CaDnaJ76) were identified using bioinformatics methods and classified into five groups by the presence of the complete three domains (J-domain, zinc finger domain, and C-terminal domain). Chromosome mapping suggested that segmental duplication and tandem duplication were occurred in evolution. The multiple stress-related cis-elements were found in the promoter region of these CaDnaJ genes, which indicated that the CaDnaJs might be involved in the process of responding to complex stress conditions. In addition, expression profiles based on RNA-seq showed that the 47 CaDnaJs were expressed in at least one tissue tested. The result implied that they could be involved in the process of pepper growth and development. qRT-PCR analysis found that 80.60% (54/67) CaDnaJs were induced by HS, indicated that they could participated in pepper response to high temperature treatments. In conclusion, all these results would provide a comprehensive basis for further analyzing the function of CaDnaJ members and be also significant for elucidating the evolutionary relationship in pepper. PMID:28507559

  1. Stimuli-Responsive DNA-Based Hydrogels: From Basic Principles to Applications.

    PubMed

    Kahn, Jason S; Hu, Yuwei; Willner, Itamar

    2017-04-18

    The base sequence of nucleic acids encodes structural and functional information into the DNA biopolymer. External stimuli such as metal ions, pH, light, or added nucleic acid fuel strands provide triggers to reversibly switch nucleic acid structures such as metal-ion-bridged duplexes, i-motifs, triplex nucleic acids, G-quadruplexes, or programmed double-stranded hybrids of oligonucleotides (DNA). The signal-triggered oligonucleotide structures have been broadly applied to develop switchable DNA nanostructures and DNA machines, and these stimuli-responsive assemblies provide functional scaffolds for the rapidly developing area of DNA nanotechnology. Stimuli-responsive hydrogels undergoing signal-triggered hydrogel-to-solution transitions or signal-controlled stiffness changes attract substantial interest as functional matrices for controlled drug delivery, materials exhibiting switchable mechanical properties, acting as valves or actuators, and "smart" materials for sensing and information processing. The integration of stimuli-responsive oligonucleotides with hydrogel-forming polymers provides versatile means to exploit the functional information encoded in the nucleic acid sequences to yield stimuli-responsive hydrogels exhibiting switchable physical, structural, and chemical properties. Stimuli-responsive DNA-based nucleic acid structures are integrated in acrylamide polymer chains and reversible, switchable hydrogel-to-solution transitions of the systems are demonstrated by applying external triggers, such as metal ions, pH-responsive strands, G-quadruplex, and appropriate counter triggers that bridge and dissociate the polymer chains. By combining stimuli-responsive nucleic acid bridges with thermosensitive poly(N-isopropylacrylamide) (pNIPAM) chains, systems undergoing reversible solution ↔ hydrogel ↔ solid transitions are demonstrated. Specifically, by bridging acrylamide polymer chains by two nucleic acid functionalities, where one type of bridging unit provides a stimuli-responsive element and the second unit acts as internal "bridging memory", shape-memory hydrogels undergoing reversible and switchable transitions between shaped hydrogels and shapeless quasi-liquid states are demonstrated. By using stimuli-responsive hydrogel cross-linking units that can assemble the bridging units by two different input signals, the orthogonally-triggered functions of the shape-memory were shown. Furthermore, a versatile approach to assemble stimuli-responsive DNA-based acrylamide hydrogel films on surfaces is presented. The method involves the activation of the hybridization chain-reaction (HCR) by a surface-confined promoter strand, in the presence of acrylamide chains modified with two DNA hairpin structures and appropriate stimuli-responsive tethers. The resulting hydrogel-modified surfaces revealed switchable stiffness properties and signal-triggered catalytic functions. By applying the method to assemble the hydrogel microparticles, substrate-loaded, stimuli-responsive microcapsules are prepared. The signal-triggered DNA-based hydrogel microcapsules are applied as drug carriers for controlled release. The different potential applications and future perspectives of stimuli responsive hydrogels are discussed. Specifically, the use of these smart materials and assemblies as carriers for controlled drug release and as shape-memory matrices for information storage and inscription and the use of surface-confined stimuli-responsive hydrogels, exhibiting switchable stiffness properties, for catalysis and controlled growth of cells are discussed.

  2. Nedd4 Family Interacting Protein 1 (Ndfip1) Is Required for Ubiquitination and Nuclear Trafficking of BRCA1-associated ATM Activator 1 (BRAT1) during the DNA Damage Response*

    PubMed Central

    Low, Ley-Hian; Chow, Yuh-Lit; Li, Yijia; Goh, Choo-Peng; Putz, Ulrich; Silke, John; Ouchi, Toru; Howitt, Jason; Tan, Seong-Seng

    2015-01-01

    During injury, cells are vulnerable to apoptosis from a variety of stress conditions including DNA damage causing double-stranded breaks. Without repair, these breaks lead to aberrations in DNA replication and transcription, leading to apoptosis. A major response to DNA damage is provided by the protein kinase ATM (ataxia telangiectasia mutated) that is capable of commanding a plethora of signaling networks for DNA repair, cell cycle arrest, and even apoptosis. A key element in the DNA damage response is the mobilization of activating proteins into the cell nucleus to repair damaged DNA. BRAT1 is one of these proteins, and it functions as an activator of ATM by maintaining its phosphorylated status while also keeping other phosphatases at bay. However, it is unknown how BRAT1 is trafficked into the cell nucleus to maintain ATM phosphorylation. Here we demonstrate that Ndfip1-mediated ubiquitination of BRAT1 leads to BRAT1 trafficking into the cell nucleus. Without Ndfip1, BRAT1 failed to translocate to the nucleus. Under genotoxic stress, cells showed increased expression of both Ndfip1 and phosphorylated ATM. Following brain injury, neurons show increased expression of Ndfip1 and nuclear translocation of BRAT1. These results point to Ndfip1 as a sensor protein during cell injury and Ndfip1 up-regulation as a cue for BRAT1 ubiquitination by Nedd4 E3 ligases, followed by nuclear translocation of BRAT1. PMID:25631046

  3. Functional dissection of drought-responsive gene expression patterns in Cynodon dactylon L.

    PubMed

    Kim, Changsoo; Lemke, Cornelia; Paterson, Andrew H

    2009-05-01

    Water deficit is one of the main abiotic factors that affect plant productivity in subtropical regions. To identify genes induced during the water stress response in Bermudagrass (Cynodon dactylon), cDNA macroarrays were used. The macroarray analysis identified 189 drought-responsive candidate genes from C. dactylon, of which 120 were up-regulated and 69 were down-regulated. The candidate genes were classified into seven groups by cluster analysis of expression levels across two intensities and three durations of imposed stress. Annotation using BLASTX suggested that up-regulated genes may be involved in proline biosynthesis, signal transduction pathways, protein repair systems, and removal of toxins, while down-regulated genes were mostly related to basic plant metabolism such as photosynthesis and glycolysis. The functional classification of gene ontology (GO) was consistent with the BLASTX results, also suggesting some crosstalk between abiotic and biotic stress. Comparative analysis of cis-regulatory elements from the candidate genes implicated specific elements in drought response in Bermudagrass. Although only a subset of genes was studied, Bermudagrass shared many drought-responsive genes and cis-regulatory elements with other botanical models, supporting a strategy of cross-taxon application of drought-responsive genes, regulatory cues, and physiological-genetic information.

  4. The site-specific ribosomal insertion element type II of Bombyx mori (R2Bm) contains the coding sequence for a reverse transcriptase-like enzyme.

    PubMed Central

    Burke, W D; Calalang, C C; Eickbush, T H

    1987-01-01

    Two classes of DNA elements interrupt a fraction of the rRNA repeats of Bombyx mori. We have analyzed by genomic blotting and sequence analysis one class of these elements which we have named R2. These elements occupy approximately 9% of the rDNA units of B. mori and appear to be homologous to the type II rDNA insertions detected in Drosophila melanogaster. Approximately 25 copies of R2 exist within the B. mori genome, of which at least 20 are located at a precise location within otherwise typical rDNA units. Nucleotide sequence analysis has revealed that the 4.2-kilobase-pair R2 element has a single large open reading frame, occupying over 82% of the total length of the element. The central region of this 1,151-amino-acid open reading frame shows homology to the reverse transcriptase enzymes found in retroviruses and certain transposable elements. Amino acid homology of this region is highest to the mobile line 1 elements of mammals, followed by the mitochondrial type II introns of fungi, and the pol gene of retroviruses. Less homology exists with transposable elements of D. melanogaster and Saccharomyces cerevisiae. Two additional regions of sequence homology between L1 and R2 elements were also found outside the reverse transcriptase region. We suggest that the R2 elements are retrotransposons that are site specific in their insertion into the genome. Such mobility would enable these elements to occupy a small fraction of the rDNA units of B. mori despite their continual elimination from the rDNA locus by sequence turnover. Images PMID:2439905

  5. Convergence of the transcriptional responses to heat shock and singlet oxygen stresses.

    PubMed

    Dufour, Yann S; Imam, Saheed; Koo, Byoung-Mo; Green, Heather A; Donohue, Timothy J

    2012-09-01

    Cells often mount transcriptional responses and activate specific sets of genes in response to stress-inducing signals such as heat or reactive oxygen species. Transcription factors in the RpoH family of bacterial alternative σ factors usually control gene expression during a heat shock response. Interestingly, several α-proteobacteria possess two or more paralogs of RpoH, suggesting some functional distinction. We investigated the target promoters of Rhodobacter sphaeroides RpoH(I) and RpoH(II) using genome-scale data derived from gene expression profiling and the direct interactions of each protein with DNA in vivo. We found that the RpoH(I) and RpoH(II) regulons have both distinct and overlapping gene sets. We predicted DNA sequence elements that dictate promoter recognition specificity by each RpoH paralog. We found that several bases in the highly conserved TTG in the -35 element are important for activity with both RpoH homologs; that the T-9 position, which is over-represented in the RpoH(I) promoter sequence logo, is critical for RpoH(I)-dependent transcription; and that several bases in the predicted -10 element were important for activity with either RpoH(II) or both RpoH homologs. Genes that are transcribed by both RpoH(I) and RpoH(II) are predicted to encode for functions involved in general cell maintenance. The functions specific to the RpoH(I) regulon are associated with a classic heat shock response, while those specific to RpoH(II) are associated with the response to the reactive oxygen species, singlet oxygen. We propose that a gene duplication event followed by changes in promoter recognition by RpoH(I) and RpoH(II) allowed convergence of the transcriptional responses to heat and singlet oxygen stress in R. sphaeroides and possibly other bacteria.

  6. Human T-cell leukemia virus type 1 Tax requires direct access to DNA for recruitment of CREB binding protein to the viral promoter.

    PubMed

    Lenzmeier, B A; Giebler, H A; Nyborg, J K

    1998-02-01

    Efficient human T-cell leukemia virus type 1 (HTLV-1) replication and viral gene expression are dependent upon the virally encoded oncoprotein Tax. To activate HTLV-1 transcription, Tax interacts with the cellular DNA binding protein cyclic AMP-responsive element binding protein (CREB) and recruits the coactivator CREB binding protein (CBP), forming a nucleoprotein complex on the three viral cyclic AMP-responsive elements (CREs) in the HTLV-1 promoter. Short stretches of dG-dC-rich (GC-rich) DNA, immediately flanking each of the viral CREs, are essential for Tax recruitment of CBP in vitro and Tax transactivation in vivo. Although the importance of the viral CRE-flanking sequences is well established, several studies have failed to identify an interaction between Tax and the DNA. The mechanistic role of the viral CRE-flanking sequences has therefore remained enigmatic. In this study, we used high resolution methidiumpropyl-EDTA iron(II) footprinting to show that Tax extended the CREB footprint into the GC-rich DNA flanking sequences of the viral CRE. The Tax-CREB footprint was enhanced but not extended by the KIX domain of CBP, suggesting that the coactivator increased the stability of the nucleoprotein complex. Conversely, the footprint pattern of CREB on a cellular CRE lacking GC-rich flanking sequences did not change in the presence of Tax or Tax plus KIX. The minor-groove DNA binding drug chromomycin A3 bound to the GC-rich flanking sequences and inhibited the association of Tax and the Tax-CBP complex without affecting CREB binding. Tax specifically cross-linked to the viral CRE in the 5'-flanking sequence, and this cross-link was blocked by chromomycin A3. Together, these data support a model where Tax interacts directly with both CREB and the minor-groove viral CRE-flanking sequences to form a high-affinity binding site for the recruitment of CBP to the HTLV-1 promoter.

  7. p53 isoform Δ113p53/Δ133p53 promotes DNA double-strand break repair to protect cell from death and senescence in response to DNA damage.

    PubMed

    Gong, Lu; Gong, Hongjian; Pan, Xiao; Chang, Changqing; Ou, Zhao; Ye, Shengfan; Yin, Le; Yang, Lina; Tao, Ting; Zhang, Zhenhai; Liu, Cong; Lane, David P; Peng, Jinrong; Chen, Jun

    2015-03-01

    The inhibitory role of p53 in DNA double-strand break (DSB) repair seems contradictory to its tumor-suppressing property. The p53 isoform Δ113p53/Δ133p53 is a p53 target gene that antagonizes p53 apoptotic activity. However, information on its functions in DNA damage repair is lacking. Here we report that Δ113p53 expression is strongly induced by γ-irradiation, but not by UV-irradiation or heat shock treatment. Strikingly, Δ113p53 promotes DNA DSB repair pathways, including homologous recombination, non-homologous end joining and single-strand annealing. To study the biological significance of Δ113p53 in promoting DNA DSB repair, we generated a zebrafish Δ113p53(M/M) mutant via the transcription activator-like effector nuclease technique and found that the mutant is more sensitive to γ-irradiation. The human ortholog, Δ133p53, is also only induced by γ-irradiation and functions to promote DNA DSB repair. Δ133p53-knockdown cells were arrested at the G2 phase at the later stage in response to γ-irradiation due to a high level of unrepaired DNA DSBs, which finally led to cell senescence. Furthermore, Δ113p53/Δ133p53 promotes DNA DSB repair via upregulating the transcription of repair genes rad51, lig4 and rad52 by binding to a novel type of p53-responsive element in their promoters. Our results demonstrate that Δ113p53/Δ133p53 is an evolutionally conserved pro-survival factor for DNA damage stress by preventing apoptosis and promoting DNA DSB repair to inhibit cell senescence. Our data also suggest that the induction of Δ133p53 expression in normal cells or tissues provides an important tolerance marker for cancer patients to radiotherapy.

  8. Concerted formation of macromolecular Suppressor–mutator transposition complexes

    PubMed Central

    Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina

    1998-01-01

    Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711

  9. Useful DNA polymorphisms are identified by snapback, a midrepetitive element in Tribolium castaneum.

    PubMed

    Stuart, J J; De Gortari, M J; Hall, P S; Maxwell, M E; Mocelin, G; Brown, S J; Muir, W M

    1996-06-01

    The red flour bettle, Tribolium castaneum, is both a pest of stored grain products and an important experimental organism. To improve its facility as a genetic model, we are developing DNA fingerprinting methods for this insect. A Tribolium DNA fragment, snapback-1 (SBI), identified among sequences that reassociate before a Cot of 0.03 mol.s/L, was found to produce a banding pattern in restriction endonuclease digested genomic DNA that is characteristic of a midrepetitive element. DNA fingerprints of individual beetles demonstrated that unvarying inherited DNA polymorphism is revealed, and that polymorphism is inherited in a dominant Mendelian fashion. Linkage between bands was minimal. The sequence of SBI was determined, and hybridization experiments indicated that SBI is a fragment of a larger midrepetitive element. Fingerprinting individuals with known inbreeding coefficients indicated that SBI loci have relatively high mutation rates. The possibility that SBI is a fragment of a transposable element is discussed.

  10. Early-life lead exposure results in dose- and sex-specific effects on weight and epigenetic gene regulation in weanling mice

    PubMed Central

    Faulk, Christopher; Barks, Amanda; Liu, Kevin; Goodrich, Jaclyn M; Dolinoy, Dana C

    2013-01-01

    Aims Epidemiological and animal data suggest that the development of adult chronic conditions is influenced by early-life exposure-induced changes to the epigenome. This study investigates the effects of perinatal lead (Pb) exposure on DNA methylation and bodyweight in weanling mice. Materials & methods Viable yellow agouti (Avy) mouse dams were exposed to 0, 2.1, 16 and 32 ppm Pb acetate before conception through weaning. Epigenetic effects were evaluated by scoring coat color of Avy/a offspring and quantitative bisulfite sequencing of two retrotransposon-driven (Avy and CDK5 activator-binding protein intracisternal A particle element) and two imprinted (Igf2 and Igf2r) loci in tail DNA. Results Maternal blood Pb levels were below the limit of detection in controls, and 4.1, 25.1 and 32.1 μg/dl for each dose, respectively. Pb exposure was associated with a trend of increased wean bodyweight in males (p = 0.03) and altered coat color in Avy/a offspring. DNA methylation at Avy and the CDK5 activator-binding protein intracisternal A-particle element was significantly different from controls following a cubic trend (p = 0.04; p = 0.01), with male-specific effects at the Avy locus. Imprinted genes did not shift in methylation across exposures. Conclusion Dose- and sex-specific responses in bodyweight and DNA methylation indicate that Pb acts on the epigenome in a locus-specific fashion, dependent on the genomic feature hosting the CpG site of interest, and that sex is a factor in epigenetic response. PMID:24059796

  11. UV-induced DNA damage is an intermediate step in UV-induced expression of human immunodeficiency virus type 1, collagenase, c-fos, and metallothionein.

    PubMed Central

    Stein, B; Rahmsdorf, H J; Steffen, A; Litfin, M; Herrlich, P

    1989-01-01

    UV irradiation of human and murine cells enhances the transcription of several genes. Here we report on the primary target of relevant UV absorption, on pathways leading to gene activation, and on the elements receiving the UV-induced signal in the human immunodeficiency virus type 1 (HIV-1) long terminal repeat, in the gene coding for collagenase, and in the cellular oncogene fos. In order to induce the expression of genes. UV radiation needs to be absorbed by DNA and to cause DNA damage of the kind that cannot be repaired by cells from patients with xeroderma pigmentosum group A. UV-induced activation of the three genes is mediated by the major enhancer elements (located between nucleotide positions -105 and -79 of HIV-1, between positions -72 and -65 of the collagenase gene, and between positions -320 and -299 of fos). These elements share no apparent sequence motif and bind different trans-acting proteins; a member of the NF kappa B family binds to the HIV-1 enhancer, the heterodimer of Jun and Fos (AP-1) binds to the collagenase enhancer, and the serum response factors p67 and p62 bind to fos. DNA-binding activities of the factors recognizing the HIV-1 and collagenase enhancers are augmented in extracts from UV-treated cells. The increase in activity is due to posttranslational modification. While AP-1 resides in the nucleus and must be modulated there, NF kappa B is activated in the cytoplasm, indicating the existence of a cytoplasmic signal transduction pathway triggered by UV-induced DNA damage. In addition to activation, new synthesis of AP-1 is induced by UV radiation. Images PMID:2557547

  12. Cell Type-Specific Chromatin Signatures Underline Regulatory DNA Elements in Human Induced Pluripotent Stem Cells and Somatic Cells.

    PubMed

    Zhao, Ming-Tao; Shao, Ning-Yi; Hu, Shijun; Ma, Ning; Srinivasan, Rajini; Jahanbani, Fereshteh; Lee, Jaecheol; Zhang, Sophia L; Snyder, Michael P; Wu, Joseph C

    2017-11-10

    Regulatory DNA elements in the human genome play important roles in determining the transcriptional abundance and spatiotemporal gene expression during embryonic heart development and somatic cell reprogramming. It is not well known how chromatin marks in regulatory DNA elements are modulated to establish cell type-specific gene expression in the human heart. We aimed to decipher the cell type-specific epigenetic signatures in regulatory DNA elements and how they modulate heart-specific gene expression. We profiled genome-wide transcriptional activity and a variety of epigenetic marks in the regulatory DNA elements using massive RNA-seq (n=12) and ChIP-seq (chromatin immunoprecipitation combined with high-throughput sequencing; n=84) in human endothelial cells (CD31 + CD144 + ), cardiac progenitor cells (Sca-1 + ), fibroblasts (DDR2 + ), and their respective induced pluripotent stem cells. We uncovered 2 classes of regulatory DNA elements: class I was identified with ubiquitous enhancer (H3K4me1) and promoter (H3K4me3) marks in all cell types, whereas class II was enriched with H3K4me1 and H3K4me3 in a cell type-specific manner. Both class I and class II regulatory elements exhibited stimulatory roles in nearby gene expression in a given cell type. However, class I promoters displayed more dominant regulatory effects on transcriptional abundance regardless of distal enhancers. Transcription factor network analysis indicated that human induced pluripotent stem cells and somatic cells from the heart selected their preferential regulatory elements to maintain cell type-specific gene expression. In addition, we validated the function of these enhancer elements in transgenic mouse embryos and human cells and identified a few enhancers that could possibly regulate the cardiac-specific gene expression. Given that a large number of genetic variants associated with human diseases are located in regulatory DNA elements, our study provides valuable resources for deciphering the epigenetic modulation of regulatory DNA elements that fine-tune spatiotemporal gene expression in human cardiac development and diseases. © 2017 American Heart Association, Inc.

  13. Alteration of Cyclic-AMP Response Element Binding Protein in the Postmortem Brain of Subjects with Bipolar Disorder and Schizophrenia

    PubMed Central

    Ren, Xinguo; Rizavi, Hooriyah S.; Khan, Mansoor A.; Bhaumik, Runa; Dwivedi, Yogesh; Pandey, Ghanshyam N.

    2013-01-01

    Background Abnormalities of cyclic-AMP (cAMP) response element binding protein (CREB) function has been suggested in bipolar (BP) illness and schizophrenia (SZ), based on both indirect and direct evidence. To further elucidate the role of CREB in these disorders, we studied CREB expression and function in two brain areas implicated in these disorders, i.e., dorsolateral prefrontal cortex (DLPFC) and cingulate gyrus (CG). Methods We determined CREB protein expression using Western blot technique, CRE-DNA binding using gel shift assay, and mRNA expression using real-time RT-polymerase chain reaction (qPCR) in DLPFC and CG of the postmortem brain of BP (n = 19), SZ (n = 20), and normal control (NC, n = 20) subjects. Results We observed that CREB protein and mRNA expression and CRE-DNA binding activity were significantly decreased in the nuclear fraction of DLPFC and CG obtained from BP subjects compared with NC subjects. However, the protein and mRNA expression and CRE-DNA binding in SZ subjects was significantly decreased in CG, but not in DLPFC, compared with NC. Conclusion These studies thus indicate region-specific abnormalities of CREB expression and function in both BP and SZ. They suggest that abnormalities of CREB in CG may be associated with both BP and SZ, but its abnormality in DLPFC is specific to BP illness. PMID:24148789

  14. Inhibitory Effects of Bangladeshi Medicinal Plant Extracts on Interactions between Transcription Factors and Target DNA Sequences

    PubMed Central

    Lampronti, Ilaria; Khan, Mahmud T.H.; Borgatti, Monica; Bianchi, Nicoletta

    2008-01-01

    Several transcription factors (TFs) play crucial roles in governing the expression of different genes involved in the immune response, embryo or cell lineage development, cell apoptosis, cell cycle progression, oncogenesis, repair and fibrosis processes and inflammation. As far as inflammation, TFs playing pivotal roles are nuclear factor kappa B (NF-kB), activator protein (AP-1), signal transducer and activator of transcription (STATs), cAMP response element binding protein (CREB) and GATA-1 factors. All these TFs regulate the expression of pro-inflammatory cytokines and are involved in the pathogenesis of a number of human disorders, particularly those with an inflammatory component. Since several medicinal plants can be employed to produce extracts exhibiting biological effects and because alteration of gene transcription represents a very interesting approach to control the expression of selected genes, this study sought to verify the ability of several extracts derived from Bangladeshi medicinal plants in interfering with molecular interactions between different TFs and specific DNA sequences. We first analyzed the antiproliferative activity of 19 medicinal plants on different human cell lines, including erythroleukemia K562, B lymphoid Raji and T lymphoid Jurkat cell lines. Secondly, we employed the electrophoretic mobility shift assay as a suitable technique for a fast screening of plant extracts altering the binding between NF-kB, AP-1, GATA-1, STAT-3, CREB and the relative target DNA elements. PMID:18830455

  15. Rapid Mitochondrial Genome Evolution through Invasion of Mobile Elements in Two Closely Related Species of Arbuscular Mycorrhizal Fungi

    PubMed Central

    Beaudet, Denis; Nadimi, Maryam; Iffis, Bachir; Hijri, Mohamed

    2013-01-01

    Arbuscular mycorrhizal fungi (AMF) are common and important plant symbionts. They have coenocytic hyphae and form multinucleated spores. The nuclear genome of AMF is polymorphic and its organization is not well understood, which makes the development of reliable molecular markers challenging. In stark contrast, their mitochondrial genome (mtDNA) is homogeneous. To assess the intra- and inter-specific mitochondrial variability in closely related Glomus species, we performed 454 sequencing on total genomic DNA of Glomus sp. isolate DAOM-229456 and we compared its mtDNA with two G. irregulare isolates. We found that the mtDNA of Glomus sp. is homogeneous, identical in gene order and, with respect to the sequences of coding regions, almost identical to G. irregulare. However, certain genomic regions vary substantially, due to insertions/deletions of elements such as introns, mitochondrial plasmid-like DNA polymerase genes and mobile open reading frames. We found no evidence of mitochondrial or cytoplasmic plasmids in Glomus species, and mobile ORFs in Glomus are responsible for the formation of four gene hybrids in atp6, atp9, cox2, and nad3, which are most probably the result of horizontal gene transfer and are expressed at the mRNA level. We found evidence for substantial sequence variation in defined regions of mtDNA, even among closely related isolates with otherwise identical coding gene sequences. This variation makes it possible to design reliable intra- and inter-specific markers. PMID:23637766

  16. Rapid mitochondrial genome evolution through invasion of mobile elements in two closely related species of arbuscular mycorrhizal fungi.

    PubMed

    Beaudet, Denis; Nadimi, Maryam; Iffis, Bachir; Hijri, Mohamed

    2013-01-01

    Arbuscular mycorrhizal fungi (AMF) are common and important plant symbionts. They have coenocytic hyphae and form multinucleated spores. The nuclear genome of AMF is polymorphic and its organization is not well understood, which makes the development of reliable molecular markers challenging. In stark contrast, their mitochondrial genome (mtDNA) is homogeneous. To assess the intra- and inter-specific mitochondrial variability in closely related Glomus species, we performed 454 sequencing on total genomic DNA of Glomus sp. isolate DAOM-229456 and we compared its mtDNA with two G. irregulare isolates. We found that the mtDNA of Glomus sp. is homogeneous, identical in gene order and, with respect to the sequences of coding regions, almost identical to G. irregulare. However, certain genomic regions vary substantially, due to insertions/deletions of elements such as introns, mitochondrial plasmid-like DNA polymerase genes and mobile open reading frames. We found no evidence of mitochondrial or cytoplasmic plasmids in Glomus species, and mobile ORFs in Glomus are responsible for the formation of four gene hybrids in atp6, atp9, cox2, and nad3, which are most probably the result of horizontal gene transfer and are expressed at the mRNA level. We found evidence for substantial sequence variation in defined regions of mtDNA, even among closely related isolates with otherwise identical coding gene sequences. This variation makes it possible to design reliable intra- and inter-specific markers.

  17. Functional analysis of the Arabidopsis PLDZ2 promoter reveals an evolutionarily conserved low-Pi-responsive transcriptional enhancer element

    PubMed Central

    Oropeza-Aburto, Araceli; Cruz-Ramírez, Alfredo; Acevedo-Hernández, Gustavo J.; Pérez-Torres, Claudia-Anahí; Caballero-Pérez, Juan; Herrera-Estrella, Luis

    2012-01-01

    Plants have evolved a plethora of responses to cope with phosphate (Pi) deficiency, including the transcriptional activation of a large set of genes. Among Pi-responsive genes, the expression of the Arabidopsis phospholipase DZ2 (PLDZ2) is activated to participate in the degradation of phospholipids in roots in order to release Pi to support other cellular activities. A deletion analysis was performed to identify the regions determining the strength, tissue-specific expression, and Pi responsiveness of this regulatory region. This study also reports the identification and characterization of a transcriptional enhancer element that is present in the PLDZ2 promoter and able to confer Pi responsiveness to a minimal, inactive 35S promoter. This enhancer also shares the cytokinin and sucrose responsive properties observed for the intact PLDZ2 promoter. The EZ2 element contains two P1BS motifs, each of which is the DNA binding site of transcription factor PHR1. Mutation analysis showed that the P1BS motifs present in EZ2 are necessary but not sufficient for the enhancer function, revealing the importance of adjacent sequences. The structural organization of EZ2 is conserved in the orthologous genes of at least eight families of rosids, suggesting that architectural features such as the distance between the two P1BS motifs are also important for the regulatory properties of this enhancer element. PMID:22210906

  18. A unique mitigator sequence determines the species specificity of the major late promoter in adenovirus type 12 DNA.

    PubMed Central

    Zock, C; Iselt, A; Doerfler, W

    1993-01-01

    Human adenovirus type 12 (Ad12) cannot replicate in hamster cells, whereas human cells are permissive for Ad12. Ad12 DNA replication and late-gene and virus-associated RNA expression are blocked in hamster cells. Early Ad12 genes are transcribed, and the viral DNA can be integrated into the host genome. Ad12 DNA replication and late-gene transcription can be complemented in hamster cells by E1 functions of Ad2 or Ad5, for which hamster cells are fully permissive (for a review, see W. Doerfler, Adv. Virus Res. 39:89-128, 1991). We have previously demonstrated that a 33-nucleotide mitigator sequence, which is located in the downstream region of the major late promoter (MLP) of Ad12 DNA, is responsible for the inactivity of the Ad12 MLP in hamster cells (C. Zock and W. Doerfler, EMBO J. 9:1615-1623, 1990). A similar negative regulator has not been found in the MLP of Ad2 DNA. We have now studied the mechanism of action of this mitigator element. The results of nuclear run-on experiments document the absence of MLP transcripts in the nuclei of Ad12-infected BHK21 hamster cells. Surprisingly, the mitigator element cannot elicit its function in in vitro transcription experiments with nuclear extracts from both hamster BHK21 and human HeLa cells. Intact nuclear topology and/or tightly bound nuclear elements that cannot be eluted in nuclear extracts are somehow required for recognition of the Ad12 mitigator. Electrophoretic mobility shift assays have not revealed significant differences in the binding of proteins from human HeLa or hamster BHK21 cells to the mitigator sequence in the MLP of Ad12 DNA or to the corresponding sequence in Ad2 DNA. We have converted the sequence of the mitigator in the MLP of Ad12 DNA to the equivalent sequence in the MLP of Ad2 DNA by site-directed mutagenesis. This construct was not active in hamster cells. When the Ad12 mitigator, on the other hand, was inserted into the Ad2 MLP, the latter's function in hamster cells was not compromised. Deletions in the 5' upstream region of the Ad12 MLP have provided evidence for the existence of additional sequences that codetermine the deficiency of the Ad12 MLP in hamster cells. The amphifunctional YY1 protein from HeLa cells can bind specifically to the mitigator and to upstream elements of the MLP of Ad12 DNA.(ABSTRACT TRUNCATED AT 400 WORDS) Images PMID:8419643

  19. BPF-1, a pathogen-induced DNA-binding protein involved in the plant defense response.

    PubMed

    da Costa e Silva, O; Klein, L; Schmelzer, E; Trezzini, G F; Hahlbrock, K

    1993-07-01

    The mechanisms by which plants restrict the growth of pathogens include transient activation of numerous defense-related genes. Box P is a putative cis-acting element of a distinct group of such genes, including those encoding the enzyme phenylalanine ammonialyase (PAL). A DNA-binding activity to Box P was identified in nuclear extracts from cultured parsley cells and a cDNA encoding the protein BPF-1 (Box P-binding Factor) partially characterized. BPF-1 binds to this element with specificity similar to that of the binding activity in nuclear extracts. BPF-1 mRNA accumulates rapidly in elicitor-treated parsley cells and around fungal infection sites on parsley leaves. This accumulation is, at least partly, due to a rapid and transient increase in the transcription rate of BPF-1. Moreover, tight correlation between the relative amounts of BPF-1 and PAL mRNAs was observed in different organs of a parsley plant. These results are consistent with the hypothesis that BPF-1 is involved in disease resistance by modulating plant defense gene expression.

  20. Extracellular self-DNA as a damage-associated molecular pattern (DAMP) that triggers self-specific immunity induction in plants.

    PubMed

    Duran-Flores, Dalia; Heil, Martin

    2017-10-16

    Mammals sense self or non-self extracellular or extranuclear DNA fragments (hereinafter collectively termed eDNA) as indicators of injury or infection and respond with immunity. We hypothesised that eDNA acts as a damage-associated molecular pattern (DAMP) also in plants and that it contributes to self versus non-self discrimination. Treating plants and suspension-cultured cells of common bean (Phaseolus vulgaris) with fragmented self eDNA (obtained from other plants of the same species) induced early, immunity-related signalling responses such as H 2 O 2 generation and MAPK activation, decreased the infection by a bacterial pathogen (Pseudomonas syringae) and increased an indirect defence to herbivores (extrafloral nectar secretion). By contrast, non-self DNA (obtained from lima bean, Phaseolus lunatus, and Acacia farnesiana) had significantly lower or no detectable effects. Only fragments below a size of 700 bp were active, and treating the eDNA preparation DNAse abolished its inducing effects, whereas treatment with RNAse or proteinase had no detectable effect. These findings indicate that DNA fragments, rather than small RNAs, single nucleotides or proteins, accounted for the observed effects. We suggest that eDNA functions a DAMP in plants and that plants discriminate self from non-self at a species-specific level. The immune systems of plants and mammals share multiple central elements, but further work will be required to understand the mechanisms and the selective benefits of an immunity response that is triggered by eDNA in a species-specific manner. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Hypoxia inducible factor-1 mediates the expression of the immune checkpoint HLA-G in glioma cells through hypoxia response element located in exon 2

    PubMed Central

    Yaghi, Layale; Poras, Isabelle; Simoes, Renata T.; Donadi, Eduardo A.; Tost, Jörg; Daunay, Antoine; de Almeida, Bibiana Sgorla; Carosella, Edgardo D.; Moreau, Philippe

    2016-01-01

    HLA-G is an immune checkpoint molecule with specific relevance in cancer immunotherapy. It was first identified in cytotrophoblasts, protecting the fetus from maternal rejection. HLA-G tissue expression is very restricted but induced in numerous malignant tumors such as glioblastoma, contributing to their immune escape. Hypoxia occurs during placenta and tumor development and was shown to activate HLA-G. We aimed to elucidate the mechanisms of HLA-G activation under conditions combining hypoxia-mimicking treatment and 5-aza-2′deoxycytidine, a DNA demethylating agent used in anti-cancer therapy which also induces HLA-G. Both treatments enhanced the amount of HLA-G mRNA and protein in HLA-G negative U251MG glioma cells. Electrophoretic Mobility Shift Assays and luciferase reporter gene assays revealed that HLA-G upregulation depends on Hypoxia Inducible Factor-1 (HIF-1) and a hypoxia responsive element (HRE) located in exon 2. A polymorphic HRE at −966 bp in the 5′UT region may modulate the magnitude of the response mediated by the exon 2 HRE. We suggest that therapeutic strategies should take into account that HLA-G expression in response to hypoxic tumor environment is dependent on HLA-G gene polymorphism and DNA methylation state at the HLA-G locus. PMID:27577073

  2. DNA damage and oxidative stress response to selenium yeast in the non-smoking individuals: a short-term supplementation trial with respect to GPX1 and SEPP1 polymorphism.

    PubMed

    Jablonska, E; Raimondi, S; Gromadzinska, J; Reszka, E; Wieczorek, E; Krol, M B; Smok-Pieniazek, A; Nocun, M; Stepnik, M; Socha, K; Borawska, M H; Wasowicz, W

    2016-12-01

    Selenium, both essential and toxic element, is considered to protect against cancer, though human supplementation trials have generated many inconsistent data. Genetic background may partially explain a great variability of the studies related to selenium and human health. The aim of this study was to assess whether functional polymorphisms within two selenoprotein-encoding genes modify the response to selenium at the level of oxidative stress, DNA damage, and mRNA expression, especially in the individuals with a relatively low selenium status. The trial involved 95 non-smoking individuals, stratified according to GPX1 rs1050450 and SEPP1 rs3877899 genotypes, and supplemented with selenium yeast (200 µg) for 6 weeks. Blood was collected at four time points, including 4 weeks of washout. After genotype stratification, the effect of GPX1 rs1050450 on lower GPx1 activity responsiveness was confirmed; however, in terms of DNA damage, we failed to indicate that individuals homozygous for variant allele may especially benefit from the increased selenium intake. Surprisingly, considering gene and time interaction, GPX1 polymorphism was observed to modify the level of DNA strand breaks during washout, showing a significant increase in GPX1 wild-type homozygotes. Regardless of the genotype, selenium supplementation was associated with a selectively suppressed selenoprotein mRNA expression and inconsistent changes in oxidative stress response, indicating for overlapped, antioxidant, and prooxidant effects. Intriguingly, DNA damage was not influenced by supplementation, but it was significantly increased during washout. These results point to an unclear relationship between selenium, genotype, and DNA damage.

  3. Regulatory motifs for CREB-binding protein and Nfe2l2 transcription factors in the upstream enhancer of the mitochondrial uncoupling protein 1 gene.

    PubMed

    Rim, Jong S; Kozak, Leslie P

    2002-09-13

    Thermogenesis against cold exposure in mammals occurs in brown adipose tissue (BAT) through mitochondrial uncoupling protein (UCP1). Expression of the Ucp1 gene is unique in brown adipocytes and is regulated tightly. The 5'-flanking region of the mouse Ucp1 gene contains cis-acting elements including PPRE, TRE, and four half-site cAMP-responsive elements (CRE) with BAT-specific enhancer elements. In the course of analyzing how these half-site CREs are involved in Ucp1 expression, we found that a DNA regulatory element for NF-E2 overlaps CRE2. Electrophoretic mobility shift assay and competition assays with the CRE2 element indicates that nuclear proteins from BAT, inguinal fat, and retroperitoneal fat tissue interact with the CRE2 motif (CGTCA) in a specific manner. A supershift assay using an antibody against the CRE-binding protein (CREB) shows specific affinity to the complex from CRE2 and nuclear extract of BAT. Additionally, Western blot analysis for phospho-CREB/ATF1 shows an increase in phosphorylation of CREB/ATF1 in HIB-1B cells after norepinephrine treatment. Transient transfection assay using luciferase reporter constructs also indicates that the two half-site CREs are involved in transcriptional regulation of Ucp1 in response to norepinephrine and cAMP. We also show that a second DNA regulatory element for NF-E2 is located upstream of the CRE2 region. This element, which is found in a similar location in the 5'-flanking region of the human and rodent Ucp1 genes, shows specific binding to rat and human NF-E2 by electrophoretic mobility shift assay with nuclear extracts from brown fat. Co-transfections with an Nfe2l2 expression vector and a luciferase reporter construct of the Ucp1 enhancer region provide additional evidence that Nfe2l2 is involved in the regulation of Ucp1 by cAMP-mediated signaling.

  4. Lithium promotes DNA stability and survival of ischemic retinal neurocytes by upregulating DNA ligase IV.

    PubMed

    Yang, Ying; Wu, Nandan; Tian, Sijia; Li, Fan; Hu, Huan; Chen, Pei; Cai, Xiaoxiao; Xu, Lijun; Zhang, Jing; Chen, Zhao; Ge, Jian; Yu, Keming; Zhuang, Jing

    2016-11-17

    Neurons display genomic fragility and show fragmented DNA in pathological degeneration. A failure to repair DNA breaks may result in cell death or apoptosis. Lithium protects retinal neurocytes following nutrient deprivation or partial nerve crush, but the underlying mechanisms are not well defined. Here we demonstrate that pretreatment with lithium protects retinal neurocytes from ischemia-induced damage and enhances light response in rat retina following ischemia-reperfusion injury. Moreover, we found that DNA nonhomologous end-joining (NHEJ) repair is implicated in this process because in ischemic retinal neurocytes, lithium significantly reduces the number of γ-H2AX foci (well-characterized markers of DNA double-strand breaks in situ) and increases the DNA ligase IV expression level. Furthermore, we also demonstrate that nuclear respiratory factor 1 (Nrf-1) and phosphorylated cyclic AMP-response element binding protein-1 (P-CREB1) bind to ligase IV promoter to cause upregulation of ligase IV in neurocytes. The ischemic upregulation of Nrf-1 and lithium-induced increase of P-CREB1 cooperate to promote transcription of ligase IV. Short hairpin RNAs against Nrf-1 and CREB1 could significantly inhibit the increase in promoter activity and expression of ligase IV observed in the control oligos following lithium treatment in retinal neurocytes. More importantly, ischemic stimulation triggers the expression of ligase IV. Taken together, our results thus reveal a novel mechanism that lithium offers neuroprotection from ischemia-induced damage by enhancing DNA NHEJ repair.

  5. Lithium promotes DNA stability and survival of ischemic retinal neurocytes by upregulating DNA ligase IV

    PubMed Central

    Yang, Ying; Wu, Nandan; Tian, Sijia; Li, Fan; Hu, Huan; Chen, Pei; Cai, Xiaoxiao; Xu, Lijun; Zhang, Jing; Chen, Zhao; Ge, Jian; Yu, Keming; Zhuang, Jing

    2016-01-01

    Neurons display genomic fragility and show fragmented DNA in pathological degeneration. A failure to repair DNA breaks may result in cell death or apoptosis. Lithium protects retinal neurocytes following nutrient deprivation or partial nerve crush, but the underlying mechanisms are not well defined. Here we demonstrate that pretreatment with lithium protects retinal neurocytes from ischemia-induced damage and enhances light response in rat retina following ischemia–reperfusion injury. Moreover, we found that DNA nonhomologous end-joining (NHEJ) repair is implicated in this process because in ischemic retinal neurocytes, lithium significantly reduces the number of γ-H2AX foci (well-characterized markers of DNA double-strand breaks in situ) and increases the DNA ligase IV expression level. Furthermore, we also demonstrate that nuclear respiratory factor 1 (Nrf-1) and phosphorylated cyclic AMP-response element binding protein-1 (P-CREB1) bind to ligase IV promoter to cause upregulation of ligase IV in neurocytes. The ischemic upregulation of Nrf-1 and lithium-induced increase of P-CREB1 cooperate to promote transcription of ligase IV. Short hairpin RNAs against Nrf-1 and CREB1 could significantly inhibit the increase in promoter activity and expression of ligase IV observed in the control oligos following lithium treatment in retinal neurocytes. More importantly, ischemic stimulation triggers the expression of ligase IV. Taken together, our results thus reveal a novel mechanism that lithium offers neuroprotection from ischemia-induced damage by enhancing DNA NHEJ repair. PMID:27853172

  6. Rat L (long interspersed repeated DNA) elements contain guanine-rich homopurine sequences that induce unpairing of contiguous duplex DNA.

    PubMed Central

    Usdin, K; Furano, A V

    1988-01-01

    The L family (long interspersed repeated DNA) of mobile genetic elements is a persistent feature of the mammalian genome. In rats, this family contains approximately equal to 40,000 members and accounts for approximately equal to 10% of the haploid genome. We demonstrate here that the guanine-rich homopurine stretches located at the right end of L-DNA induce oligonucleotide uptake by contiguous duplex DNA. The uptake is dependent on negative supercoiling and the length of the homopurine stretch and occurs even when the L-DNA homopurine stretches are introduced into a different DNA environment. The bound oligomer primes DNA synthesis when DNA polymerase and deoxyribonucleoside triphosphates are added, resulting in a faithful copy of the template to which the oligonucleotide had bound. The implications of this property of the L-DNA guanine-rich homopurine stretches in the amplification, recombination, and dispersal of L elements is discussed. Images PMID:2837766

  7. A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

    PubMed Central

    Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C

    1992-01-01

    Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867

  8. Recovery and separation of rare earth elements using columns loaded with DNA-filter hybrid.

    PubMed

    Takahashi, Yoshio; Kondo, Kazuhiro; Miyaji, Asami; Umeo, Miyuki; Honma, Tetsuo; Asaoka, Satoshi

    2012-01-01

    Given that the supply of several rare earth elements (REEs) is sometimes limited, recycling REEs used in various advanced materials, such as Nd magnets, is important for realizing efficient use of REE resources. In the present work, the feasibility of using DNA for REE recovery and separation was examined, along with the identification of the binding site of REEs in DNA. In particular, a DNA-cellulose filter paper hybrid was prepared so that DNA-based materials can be used for the separation of REEs using columns loaded with DNA. N,N'-Disuccinimidyl was used as a cross-linker reagent for the fixation of DNA onto a fibrous cellulose filter. The results showed that (i) the DNA-filter hybrid has a sufficiently high affinity to adsorb REEs; (ii) the adsorption capacity was 0.182 mg/g for Nd; and (iii) the affinity of REEs for DNA was stronger for REEs with larger atomic numbers. The difference of the affinity among REEs in the third result was compared with the adsorption patterns of REEs discussed in the literature. The comparison suggests that phosphate in the DNA-filter paper hybrid was responsible for REE adsorption onto the hybrid. The results were supported by the Nd, Dy, and Lu L(III)-edge EXAFS; the REE-P shell was identified for the second neighboring atom, showing the importance of the phosphate site as REE binding sites. The difference in the affinity among REEs suggest that group separation of REEs (such as La, Ce, (Pr and Nd), (Ho, Dy, and Er), (Tb and Gd), (Sm, Eu), Tm, Yb, and Lu) is possible, although complete isolation of each REE from a solution containing all REEs may be difficult. For practical applications, Nd and Fe(III) were successfully separated from a synthetic solution of Nd magnet waste using columns loaded with the DNA-filter hybrid.

  9. Characterization of the Fb-Nof Transposable Element of Drosophila Melanogaster

    PubMed Central

    Harden, N.; Ashburner, M.

    1990-01-01

    FB-NOF is a composite transposable element of Drosophila melanogaster. It is composed of foldback sequences, of variable length, which flank a 4-kb NOF sequence with 308-bp inverted repeat termini. The NOF sequence could potentially code for a 120-kD polypeptide. The FB-NOF element is responsible for unstable mutations of the white gene (w(c) and w(DZL)) and is associated with the large TEs of G. Ising. Although most strains of D. melanogaster have 20-30 sites of FB insertion, FB-NOF elements are usually rare, many strains lack this composite element or have only one copy of it. A few strains, including w(DZL) and Basc have many (8-21) copies of FB-NOF, and these show a tendency to insert at ``hot-spots.'' These strains also have an increased number of FB elements. The DNA sequence of the NOF region associated with TE146(Z) has been determined. PMID:2174013

  10. Elements in the transcriptional regulatory region flanking herpes simplex virus type 1 oriS stimulate origin function.

    PubMed

    Wong, S W; Schaffer, P A

    1991-05-01

    Like other DNA-containing viruses, the three origins of herpes simplex virus type 1 (HSV-1) DNA replication are flanked by sequences containing transcriptional regulatory elements. In a transient plasmid replication assay, deletion of sequences comprising the transcriptional regulatory elements of ICP4 and ICP22/47, which flank oriS, resulted in a greater than 80-fold decrease in origin function compared with a plasmid, pOS-822, which retains these sequences. In an effort to identify specific cis-acting elements responsible for this effect, we conducted systematic deletion analysis of the flanking region with plasmid pOS-822 and tested the resulting mutant plasmids for origin function. Stimulation by cis-acting elements was shown to be both distance and orientation dependent, as changes in either parameter resulted in a decrease in oriS function. Additional evidence for the stimulatory effect of flanking sequences on origin function was demonstrated by replacement of these sequences with the cytomegalovirus immediate-early promoter, resulting in nearly wild-type levels of oriS function. In competition experiments, cotransfection of cells with the test plasmid, pOS-822, and increasing molar concentrations of a competitor plasmid which contained the ICP4 and ICP22/47 transcriptional regulatory regions but lacked core origin sequences resulted in a significant reduction in the replication efficiency of pOS-822, demonstrating that factors which bind specifically to the oriS-flanking sequences are likely involved as auxiliary proteins in oriS function. Together, these studies demonstrate that trans-acting factors and the sites to which they bind play a critical role in the efficiency of HSV-1 DNA replication from oriS in transient-replication assays.

  11. NF-κB– and AP-1–Mediated DNA Looping Regulates Osteopontin Transcription in Endotoxin-Stimulated Murine Macrophages

    PubMed Central

    Zhao, Wei; Wang, Lijuan; Zhang, Meng; Wang, Peng; Zhang, Lei; Yuan, Chao; Qi, Jianni; Qiao, Yu; Kuo, Paul C.; Gao, Chengjiang

    2013-01-01

    Osteopontin (OPN) is expressed by various immune cells and modulates both innate and adaptive immune responses. However, the molecular mechanisms that control opn gene expression, especially at the chromatin level, remain largely unknown. We have previously demonstrated many specific cis- and trans-regulatory elements that determine the extent of endotoxin (LPS)-mediated induction of OPN synthesis in murine macrophages. In the present study, we confirm that NF-κB also plays an important role in the setting of LPS-stimulated OPN expression through binding to a distal regulatory element. Importantly, we demonstrate that LPS stimulates chromosomal loops in the OPN promoter between NF-κB binding site and AP-1 binding site using chromosome conformation capture technology. The crucial role of NF-κB and AP-1 in LPS-stimulated DNA looping was confirmed, as small interfering RNA knock-down of NF-κB p65 and AP-1 c-Jun exhibited decreased levels of DNA looping. Furthermore, we demonstrate that p300 can form a complex with NF-κB and AP-1 and is involved in DNA looping and LPS-induced OPN expression. Therefore, we have identified an essential mechanism to remodel the local chromatin structures and spatial conformations to regulate LPS-induced OPN expression. PMID:21257959

  12. Methylation-Sensitive Expression of a DNA Demethylase Gene Serves As an Epigenetic Rheostat

    PubMed Central

    Williams, Ben P.; Pignatta, Daniela; Henikoff, Steven; Gehring, Mary

    2015-01-01

    Genomes must balance active suppression of transposable elements (TEs) with the need to maintain gene expression. In Arabidopsis, euchromatic TEs are targeted by RNA-directed DNA methylation (RdDM). Conversely, active DNA demethylation prevents accumulation of methylation at genes proximal to these TEs. It is unknown how a cellular balance between methylation and demethylation activities is achieved. Here we show that both RdDM and DNA demethylation are highly active at a TE proximal to the major DNA demethylase gene ROS1. Unexpectedly, and in contrast to most other genomic targets, expression of ROS1 is promoted by DNA methylation and antagonized by DNA demethylation. We demonstrate that inducing methylation in the ROS1 proximal region is sufficient to restore ROS1 expression in an RdDM mutant. Additionally, methylation-sensitive expression of ROS1 is conserved in other species, suggesting it is adaptive. We propose that the ROS1 locus functions as an epigenetic rheostat, tuning the level of demethylase activity in response to methylation alterations, thus ensuring epigenomic stability. PMID:25826366

  13. Endogenous sex hormone exposure and repetitive element DNA methylation in healthy postmenopausal women.

    PubMed

    Boyne, Devon J; Friedenreich, Christine M; McIntyre, John B; Stanczyk, Frank Z; Courneya, Kerry S; King, Will D

    2017-12-01

    Epigenetic mechanisms may help to explain the complex and heterogeneous relation between sex hormones and cancer. Few studies have investigated the effects of sex hormones on epigenetic markers related to cancer risk such as levels of methylation within repetitive DNA elements. Our objective was to describe the association between endogenous sex hormone exposure and levels of LINE-1 and Alu methylation in healthy postmenopausal women. We nested a cross-sectional study within the Alberta Physical Activity and Breast Cancer Prevention Trial (2003-2006). Study participants consisted of healthy postmenopausal women who had never been diagnosed with cancer (n = 289). Sex hormone exposures included serum concentrations of estradiol, estrone, testosterone, androstenedione, and sex hormone-binding globulin. We estimated the participants' lifetime number of menstrual cycles (LNMC) as a proxy for cumulative exposure to ovarian sex hormones. Buffy coat samples were assessed for DNA methylation. Linear regression was used to model the associations of interest and to control for confounding. Both estradiol and estrone had a significant positive dose-response association with LINE-1 methylation. LNMC was associated with both LINE-1 and Alu methylation. Specifically, LNMC had a non-linear "U-shaped" association with LINE-1 methylation regardless of folate intake and a negative linear association with Alu methylation, but only amongst low folate consumers. Androgen exposure was not associated with either outcome. Current and cumulative estrogen exposure was associated with repetitive element DNA methylation in a group of healthy postmenopausal women. LINE-1 and Alu methylation may be epigenetic mechanisms through which estrogen exposure impacts cancer risk.

  14. Transcription factor trapping by RNA in gene regulatory elements.

    PubMed

    Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A

    2015-11-20

    Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs. Copyright © 2015, American Association for the Advancement of Science.

  15. Genomic patterns associated with paternal/maternal distribution of transposable elements

    NASA Astrophysics Data System (ADS)

    Jurka, Jerzy

    2003-03-01

    Transposable elements (TEs) are specialized DNA or RNA fragments capable of surviving in intragenomic niches. They are commonly, perhaps unjustifiably referred to as "selfish" or "parasitic" elements. TEs can be divided in two major classes: retroelements and DNA transposons. The former include non-LTR retrotransposons and retrovirus-like elements, using reverse transriptase for their reproduction prior to integration into host DNA. The latter depend mostly on host DNA replication, with possible exception of rolling-circle transposons recently discovered by our team. I will review basic information on TEs, with emphasis on human Alu and L1 retroelements discussed in the context of genomic organization. TEs are non-randomly distributed in chromosomal DNA. In particular, human Alu elements tend to prefer GC-rich regions, whereas L1 accumulate in AT-rich regions. Current explanations of this phenomenon focus on the so called "target effects" and post-insertional selection. However, the proposed models appear to be unsatisfactory and alternative explanations invoking "channeling" to different chromosomal regions will be a major focus of my presentation. Transposable elements (TEs) can be expressed and integrated into host DNA in the male or female germlines, or both. Different models of expression and integration imply different proportions of TEs on sex chromosomes and autosomes. The density of recently retroposed human Alu elements is around three times higher on chromosome Y than on chromosome X, and over two times higher than the average density for all human autosomes. This implies Alu activity in paternal germlines. Analogous inter-chromosomal proportions for other repeat families should determine their compatibility with one of the three basic models describing the inheritance of TEs. Published evidence indicates that maternally and paternally imprinted genes roughly correspond to GC-rich and AT-rich DNA. This may explain the observed chromosomal distribution of Alu and L1 elements. Finally, paternal models of inheritance predict rapid accumulation of active TEs on chromosome Y. I will discuss potential implications of this phenomenon for evolution of chromosome Y and transposable elements.

  16. Experimental mapping of DNA duplex shape enabled by global lineshape analyses of a nucleotide-independent nitroxide probe

    PubMed Central

    Ding, Yuan; Zhang, Xiaojun; Tham, Kenneth W.; Qin, Peter Z.

    2014-01-01

    Sequence-dependent variation in structure and dynamics of a DNA duplex, collectively referred to as ‘DNA shape’, critically impacts interactions between DNA and proteins. Here, a method based on the technique of site-directed spin labeling was developed to experimentally map shapes of two DNA duplexes that contain response elements of the p53 tumor suppressor. An R5a nitroxide spin label, which was covalently attached at a specific phosphate group, was scanned consecutively through the DNA duplex. X-band continuous-wave electron paramagnetic resonance spectroscopy was used to monitor rotational motions of R5a, which report on DNA structure and dynamics at the labeling site. An approach based on Pearson's coefficient analysis was developed to collectively examine the degree of similarity among the ensemble of R5a spectra. The resulting Pearson's coefficients were used to generate maps representing variation of R5a mobility along the DNA duplex. The R5a mobility maps were found to correlate with maps of certain DNA helical parameters, and were capable of revealing similarity and deviation in the shape of the two closely related DNA duplexes. Collectively, the R5a probe and the Pearson's coefficient-based lineshape analysis scheme yielded a generalizable method for examining sequence-dependent DNA shapes. PMID:25092920

  17. Transcriptional regulation of ABI3- and ABA-responsive genes including RD29B and RD29A in seeds, germinating embryos, and seedlings of Arabidopsis.

    PubMed

    Nakashima, Kazuo; Fujita, Yasunari; Katsura, Koji; Maruyama, Kyonoshin; Narusaka, Yoshihiro; Seki, Motoaki; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2006-01-01

    ABA-responsive elements (ABREs) are cis-acting elements and basic leucine zipper (bZIP)-type ABRE-binding proteins (AREBs) are transcriptional activators that function in the expression of RD29B in vegetative tissue of Arabidopsis in response to abscisic acid (ABA) treatment. Dehydration-responsive elements (DREs) function as coupling elements of ABRE in the expression of RD29A in response to ABA. Expression analysis using abi3 and abi5 mutants showed that ABI3 and ABI5 play important roles in the expression of RD29B in seeds. Base-substitution analysis showed that two ABREs function strongly and one ABRE coupled with DRE functions weakly in the expression of RD29A in embryos. In a transient transactivation experiment, ABI3, ABI5 and AREB1 activated transcription of a GUS reporter gene driven by the RD29B promoter strongly but these proteins activated the transcription driven by the RD29A promoter weakly. In 35S::ABI3 Arabidopsis plants, the expression of RD29B was up-regulated strongly, but that of RD29A was up-regulated weakly. These results indicate that the expression of RD29B having ABREs in the promoter is up-regulated strongly by ABI3, whereas that of RD29A having one ABRE coupled with DREs in the promoter is up-regulated weakly by ABI3. We compared the expression of 7000 Arabidopsis genes in response to ABA treatment during germination and in the vegetative growth stage, and that in 35S::ABI3 plants using a full-length cDNA microarray. The expression of ABI3- and/or ABA-responsive genes and cis-elements in the promoters are discussed.

  18. Identifying a Mechanism for Crosstalk Between the Estrogen and Glucocorticoid Receptors | Center for Cancer Research

    Cancer.gov

    Estrogen has long been known to play important roles in the development and progression of breast cancer. Its receptor (ER), a member of the steroid receptor family, binds to estrogen response elements (EREs) in DNA and regulates gene transcription. More recently, another steroid receptor family member, the glucocorticoid receptor (GR), has been implicated in breast cancer

  19. Genomic Heat Shock Element Sequences Drive Cooperative Human Heat Shock Factor 1 DNA Binding and Selectivity*

    PubMed Central

    Jaeger, Alex M.; Makley, Leah N.; Gestwicki, Jason E.; Thiele, Dennis J.

    2014-01-01

    The heat shock transcription factor 1 (HSF1) activates expression of a variety of genes involved in cell survival, including protein chaperones, the protein degradation machinery, anti-apoptotic proteins, and transcription factors. Although HSF1 activation has been linked to amelioration of neurodegenerative disease, cancer cells exhibit a dependence on HSF1 for survival. Indeed, HSF1 drives a program of gene expression in cancer cells that is distinct from that activated in response to proteotoxic stress, and HSF1 DNA binding activity is elevated in cycling cells as compared with arrested cells. Active HSF1 homotrimerizes and binds to a DNA sequence consisting of inverted repeats of the pentameric sequence nGAAn, known as heat shock elements (HSEs). Recent comprehensive ChIP-seq experiments demonstrated that the architecture of HSEs is very diverse in the human genome, with deviations from the consensus sequence in the spacing, orientation, and extent of HSE repeats that could influence HSF1 DNA binding efficacy and the kinetics and magnitude of target gene expression. To understand the mechanisms that dictate binding specificity, HSF1 was purified as either a monomer or trimer and used to evaluate DNA-binding site preferences in vitro using fluorescence polarization and thermal denaturation profiling. These results were compared with quantitative chromatin immunoprecipitation assays in vivo. We demonstrate a role for specific orientations of extended HSE sequences in driving preferential HSF1 DNA binding to target loci in vivo. These studies provide a biochemical basis for understanding differential HSF1 target gene recognition and transcription in neurodegenerative disease and in cancer. PMID:25204655

  20. Influence of heavy metal stress on antioxidant status and DNA damage in Urtica dioica.

    PubMed

    Gjorgieva, Darinka; Kadifkova Panovska, Tatjana; Ruskovska, Tatjana; Bačeva, Katerina; Stafilov, Trajče

    2013-01-01

    Heavy metals have the potential to interact and induce several stress responses in the plants; thus, effects of heavy metal stress on DNA damages and total antioxidants level in Urtica dioica leaves and stems were investigated. The samples are sampled from areas with different metal exposition. Metal content was analyzed by Inductively Coupled Plasma-Atomic Emission Spectrometer (ICP-AES), for total antioxidants level assessment the Ferric-Reducing Antioxidant Power (FRAP) assay was used, and genomic DNA isolation from frozen plant samples was performed to obtain DNA fingerprints of investigated plant. It was found that heavy metal contents in stems generally changed synchronously with those in leaves of the plant, and extraneous metals led to imbalance of mineral nutrient elements. DNA damages were investigated by Random Amplified Polymorphic DNA (RAPD) technique, and the results demonstrated that the samples exposed to metals yielded a large number of new fragments (total 12) in comparison with the control sample. This study showed that DNA stability is highly affected by metal pollution which was identified by RAPD markers. Results suggested that heavy metal stress influences antioxidant status and also induces DNA damages in U. dioica which may help to understand the mechanisms of metals genotoxicity.

  1. The RY/Sph element mediates transcriptional repression of maturation genes from late maturation to early seedling growth.

    PubMed

    Guerriero, Gea; Martin, Nathalie; Golovko, Anna; Sundström, Jens F; Rask, Lars; Ezcurra, Ines

    2009-11-01

    In orthodox seeds, the transcriptional activator ABI3 regulates two major stages in embryo maturation: a mid-maturation (MAT) stage leading to accumulation of storage compounds, and a late maturation (LEA) stage leading to quiescence and desiccation tolerance. Our aim was to elucidate mechanisms for transcriptional shutdown of MAT genes during late maturation, to better understand phase transition between MAT and LEA stages. Using transgenic and transient approaches in Nicotiana, we examined activities of two ABI3-dependent reporter genes driven by multimeric RY and abscisic acid response elements (ABREs) from a Brassica napus napin gene, termed RY and ABRE, where the RY reporter requires ABI3 DNA binding. Expression of RY peaks during mid-maturation and drops during late maturation, mimicking the MAT gene program, and in Arabidopsis thaliana RY elements are over-represented in MAT, but not in LEA, genes. The ABI3 transactivation of RY is inhibited by staurosporine, by a PP2C phosphatase, and by a repressor of maturation genes, VAL1/HSI2. The RY element mediates repression of MAT genes, and we propose that transcriptional shutdown of the MAT program during late maturation involves inhibition of ABI3 DNA binding by dephosphorylation. Later, during seedling growth, VAL1/HSI2 family repressors silence MAT genes by binding RY elements.

  2. The p53–Mdm2 feedback loop protects against DNA damage by inhibiting p53 activity but is dispensable for p53 stability, development, and longevity

    PubMed Central

    Pant, Vinod; Xiong, Shunbin; Jackson, James G.; Post, Sean M.; Abbas, Hussein A.; Quintás-Cardama, Alfonso; Hamir, Amirali N.; Lozano, Guillermina

    2013-01-01

    The p53–Mdm2 feedback loop is perceived to be critical for regulating stress-induced p53 activity and levels. However, this has never been tested in vivo. Using a genetically engineered mouse with mutated p53 response elements in the Mdm2 P2 promoter, we show that feedback loop-deficient Mdm2P2/P2 mice are viable and aphenotypic and age normally. p53 degradation kinetics after DNA damage in radiosensitive tissues remains similar to wild-type controls. Nonetheless, DNA damage response is elevated in Mdm2P2/P2 mice. Enhanced p53-dependent apoptosis sensitizes hematopoietic stem cells (HSCs), causing drastic myeloablation and lethality. These results suggest that while basal Mdm2 levels are sufficient to regulate p53 in most tissues under homeostatic conditions, the p53–Mdm2 feedback loop is critical for regulating p53 activity and sustaining HSC function after DNA damage. Therefore, transient disruption of p53–Mdm2 interaction could be explored as a potential adjuvant/therapeutic strategy for targeting stem cells in hematological malignancies. PMID:23973961

  3. p67SRF is a constitutive nuclear protein implicated in the modulation of genes required throughout the G1 period.

    PubMed Central

    Gauthier-Rouvière, C; Cavadore, J C; Blanchard, J M; Lamb, N J; Fernandez, A

    1991-01-01

    Indirect immunofluorescence analysis, using antibodies directed against peptide sequences outside the DNA-binding domain of the 67-kDa serum response factor (p67SRF), revealed a punctuated nuclear staining, constant throughout the cell cycle and in all different cell lines tested. p67SRF was also tightly associated with chromatin through all stages of mitosis. Inhibition of p67SRF activity in vivo, through microinjection of anti-p67SRF antibodies, specifically suppressed DNA synthesis induced after serum addition or ras microinjection, suggesting that these antibodies were effective in preventing expression of serum response element (SRE)-regulated genes. A similar inhibition was also obtained in cells injected with oligonucleotides corresponding to the DNA binding sequence for p67SRF protein, SRE. Moreover, this inhibition of DNA synthesis by anti-p67SRF or SRE injection was still observed in cells injected during late G1, well after c-fos induction. These data imply that genes regulated by p67SRF are continuously involved in the proliferation pathway throughout G1 and that p67SRF forms an integral component of mammalian cell transcriptional control. Images PMID:1782216

  4. Transcriptional targets shared by estrogen receptor- related receptors (ERRs) and estrogen receptor (ER) alpha, but not by ERbeta.

    PubMed Central

    Vanacker, J M; Pettersson, K; Gustafsson, J A; Laudet, V

    1999-01-01

    The physiological activities of estrogens are thought to be mediated by specific nuclear receptors, ERalpha and ERbeta. However, certain tissues, such as the bone, that are highly responsive to estrogens only express a low level of these receptors. Starting from this apparent contradiction, we have evaluated the potentials of two related receptors ERRalpha and ERRbeta to intervene in estrogen signaling. ERalpha, ERRalpha and ERRbeta bind to and activate transcription through both the classical estrogen response element (ERE) and the SF-1 response element (SFRE). In contrast, ERbeta DNA-binding and transcriptional activity is restricted to the ERE. Accordingly, the osteopontin gene promoter is stimulated through SFRE sequences, by ERRalpha as well as by ERalpha, but not by ERbeta. Analysis of the cross-talk within the ER/ERR subgroup of nuclear receptors thus revealed common targets but also functional differences between the two ERs. PMID:10428965

  5. The Saccharomyces cerevisiae zinc finger proteins Msn2p and Msn4p are required for transcriptional induction through the stress response element (STRE).

    PubMed Central

    Martínez-Pastor, M T; Marchler, G; Schüller, C; Marchler-Bauer, A; Ruis, H; Estruch, F

    1996-01-01

    The MSN2 and MSN4 genes encode homologous and functionally redundant Cys2His2 zinc finger proteins. A disruption of both MSN2 and MSN4 genes results in a higher sensitivity to different stresses, including carbon source starvation, heat shock and severe osmotic and oxidative stresses. We show that MSN2 and MSN4 are required for activation of several yeast genes such as CTT1, DDR2 and HSP12, whose induction is mediated through stress-response elements (STREs). Msn2p and Msn4p are important factors for the stress-induced activation of STRE dependent promoters and bind specifically to STRE-containing oligonucleotides. Our results suggest that MSN2 and MSN4 encode a DNA-binding component of the stress responsive system and it is likely that they act as positive transcription factors. Images PMID:8641288

  6. The CpG island encompassing the promoter and first exon of human DNMT3L gene is a PcG/TrX response element (PRE).

    PubMed

    Basu, Amitava; Dasari, Vasanthi; Mishra, Rakesh K; Khosla, Sanjeev

    2014-01-01

    DNMT3L, a member of DNA methyltransferases family, is present only in mammals. As it provides specificity to the action of de novo methyltransferases, DNMT3A and DNMT3B and interacts with histone H3, DNMT3L has been invoked as the molecule that can read the histone code and translate it into DNA methylation. It plays an important role in the initiation of genomic imprints during gametogenesis and in nuclear reprogramming. With important functions attributed to it, it is imperative that the DNMT3L expression is tightly controlled. Previously, we had identified a CpG island within the human DNMT3L promoter and first exon that showed loss of DNA methylation in cancer samples. Here we show that this Differentially Methylated CpG island within DNMT3L (DNMT3L DMC) acts to repress transcription, is a Polycomb/Trithorax Response Element (PRE) and interacts with both PRC1 and PRC2 Polycomb repressive complexes. In addition, it adopts inactive chromatin conformation and is associated with other inactive chromatin-specific proteins like SUV39H1 and HP1. The presence of DNMT3L DMC also influences the adjacent promoter to adopt repressive histone post-translational modifications. Due to its association with multiple layers of repressive epigenetic modifications, we believe that PRE within the DNMT3L DMC is responsible for the tight regulation of DNMT3L expression and the aberrant epigenetic modifications of this region leading to DNMT3L overexpression could be the reason of nuclear programming during carcinogenesis.

  7. Evaluating differential nuclear DNA yield rates and osteocyte numbers among human bone tissue types: A synchrotron radiation micro-CT approach.

    PubMed

    Andronowski, Janna M; Mundorff, Amy Z; Pratt, Isaac V; Davoren, Jon M; Cooper, David M L

    2017-05-01

    Molecular human identification has conventionally focused on DNA sampling from dense, weight-bearing cortical bone tissue, typically from femora or tibiae. A comparison of skeletal elements from three contemporary individuals demonstrated that elements with high quantities of cancellous bone yielded nuclear DNA at the highest rates, suggesting that preferentially sampling cortical bone may be suboptimal (Mundorff & Davoren, 2014). Despite these findings, the reason for the differential DNA yields between cortical and cancellous bone tissues remains unknown. The primary goal of this work is to ascertain whether differences in bone microstructure can be used to explain differential nuclear DNA yield among bone tissue types observed by Mundorff and Davoren (2014), with a focus on osteocytes and the three-dimensional (3D) quantification of their associated lacunae. Osteocytes and other bone cells are recognized to house DNA in bone tissue, thus examining the density of their lacunae may explain why nuclear DNA yield rates differ among bone tissue types. Lacunae were visualized and quantified using synchrotron radiation-based micro-Computed Tomographic imaging (SR micro-CT). Volumes of interest (VOIs) from cortical and cancellous bone tissues (n=129) were comparatively analyzed from the three skeletons sampled for Mundorff and Davoren's (2014) study. Analyses tested the primary hypothesis that the abundance and density of osteocytes (inferred from their lacunar spaces) vary between cortical and cancellous bone tissue types. Results demonstrated that osteocyte lacunar abundance and density vary between cortical and cancellous bone tissue types, with cortical bone VOIs containing a higher lacunar abundance and density. We found that the osteocyte lacunar density values are independent of nuclear DNA yield, suggesting an alternative explanation for the higher nuclear DNA yields from bones with greater quantities of cancellous bone tissue. The use of SR micro-CT allowed for a scale of analysis that revealed a high range of variation in lacunar abundance in both tissue types. Moreover, high-resolution SR micro-CT imaging revealed potential soft tissue remnants within marrow spaces not visible macroscopically. It is hypothesized that soft tissue remnants observed among the trabeculae of skeletal elements with high quantities of cancellous bone tissue are responsible for the high nuclear DNA yields. These findings have significant implications for bone-sample selection for nuclear DNA analysis in a forensic context when skeletal remains are recovered from the ground surface. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia.

    PubMed

    Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W

    2010-08-01

    The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  9. Nucleosome core particles containing a poly(dA.dT) sequence element exhibit a locally distorted DNA structure.

    PubMed

    Bao, Yunhe; White, Cindy L; Luger, Karolin

    2006-08-25

    Poly(dA.dT) DNA sequence elements are thought to promote transcription by either excluding nucleosomes or by altering their structural or dynamic properties. Here, the stability and structure of a defined nucleosome core particle containing a 16 base-pair poly(dA.dT) element (A16 NCP) was investigated. The A16 NCP requires a significantly higher temperature for histone octamer sliding in vitro compared to comparable nucleosomes that do not contain a poly(dA.dT) element. Fluorescence resonance energy transfer showed that the interactions between the nucleosomal DNA ends and the histone octamer were destabilized in A16 NCP. The crystal structure of A16 NCP was determined to a resolution of 3.2 A. The overall structure was maintained except for local deviations in DNA conformation. These results are consistent with previous in vivo and in vitro observations that poly(dA.dT) elements cause only modest changes in DNA accessibility and modest increases in steady-state transcription levels.

  10. DNA cytosine methylation in the bovine leukemia virus promoter is associated with latency in a lymphoma-derived B-cell line: potential involvement of direct inhibition of cAMP-responsive element (CRE)-binding protein/CRE modulator/activation transcription factor binding.

    PubMed

    Pierard, Valérie; Guiguen, Allan; Colin, Laurence; Wijmeersch, Gaëlle; Vanhulle, Caroline; Van Driessche, Benoît; Dekoninck, Ann; Blazkova, Jana; Cardona, Christelle; Merimi, Makram; Vierendeel, Valérie; Calomme, Claire; Nguyên, Thi Liên-Anh; Nuttinck, Michèle; Twizere, Jean-Claude; Kettmann, Richard; Portetelle, Daniel; Burny, Arsène; Hirsch, Ivan; Rohr, Olivier; Van Lint, Carine

    2010-06-18

    Bovine leukemia virus (BLV) proviral latency represents a viral strategy to escape the host immune system and allow tumor development. Besides the previously demonstrated role of histone deacetylation in the epigenetic repression of BLV expression, we showed here that BLV promoter activity was induced by several DNA methylation inhibitors (such as 5-aza-2'-deoxycytidine) and that overexpressed DNMT1 and DNMT3A, but not DNMT3B, down-regulated BLV promoter activity. Importantly, cytosine hypermethylation in the 5'-long terminal repeat (LTR) U3 and R regions was associated with true latency in the lymphoma-derived B-cell line L267 but not with defective latency in YR2 cells. Moreover, the virus-encoded transactivator Tax(BLV) decreased DNA methyltransferase expression levels, which could explain the lower level of cytosine methylation observed in the L267(LTaxSN) 5'-LTR compared with the L267 5'-LTR. Interestingly, DNA methylation inhibitors and Tax(BLV) synergistically activated BLV promoter transcriptional activity in a cAMP-responsive element (CRE)-dependent manner. Mechanistically, methylation at the -154 or -129 CpG position (relative to the transcription start site) impaired in vitro binding of CRE-binding protein (CREB) transcription factors to their respective CRE sites. Methylation at -129 CpG alone was sufficient to decrease BLV promoter-driven reporter gene expression by 2-fold. We demonstrated in vivo the recruitment of CREB/CRE modulator (CREM) and to a lesser extent activating transcription factor-1 (ATF-1) to the hypomethylated CRE region of the YR2 5'-LTR, whereas we detected no CREB/CREM/ATF recruitment to the hypermethylated corresponding region in the L267 cells. Altogether, these findings suggest that site-specific DNA methylation of the BLV promoter represses viral transcription by directly inhibiting transcription factor binding, thereby contributing to true proviral latency.

  11. HDA6 directly interacts with DNA methyltransferase MET1 and maintains transposable element silencing in Arabidopsis.

    PubMed

    Liu, Xuncheng; Yu, Chun-Wei; Duan, Jun; Luo, Ming; Wang, Koching; Tian, Gang; Cui, Yuhai; Wu, Keqiang

    2012-01-01

    The molecular mechanism of how the histone deacetylase HDA6 participates in maintaining transposable element (TE) silencing in Arabidopsis (Arabidopsis thaliana) is not yet defined. In this study, we show that a subset of TEs was transcriptionally reactivated and that TE reactivation was associated with elevated histone H3 and H4 acetylation as well as increased H3K4Me3 and H3K4Me2 in hda6 mutants. Decreased DNA methylation of the TEs was also detected in hda6 mutants, suggesting that HDA6 silences the TEs by regulating histone acetylation and methylation as well as the DNA methylation status of the TEs. Similarly, transcripts of some of these TEs were also increased in the methyltransferase1 (met1) mutant, with decreased DNA methylation. Furthermore, H4 acetylation, H3K4Me3, H3K4Me2, and H3K36Me2 were enriched at the coregulated TEs in the met1 and hda6 met1 mutants. Protein-protein interaction analysis indicated that HDA6 physically interacts with MET1 in vitro and in vivo, and further deletion analysis demonstrated that the carboxyl-terminal region of HDA6 and the bromo-adjacent homology domain of MET1 were responsible for the interaction. These results suggested that HDA6 and MET1 interact directly and act together to silence TEs by modulating DNA methylation, histone acetylation, and histone methylation status.

  12. Foldback intercoil DNA and the mechanism of DNA transposition.

    PubMed

    Kim, Byung-Dong

    2014-09-01

    Foldback intercoil (FBI) DNA is formed by the folding back at one point of a non-helical parallel track of double-stranded DNA at as sharp as 180° and the intertwining of two double helixes within each other's major groove to form an intercoil with a diameter of 2.2 nm. FBI DNA has been suggested to mediate intra-molecular homologous recombination of a deletion and inversion. Inter-molecular homologous recombination, known as site-specific insertion, on the other hand, is mediated by the direct perpendicular approach of the FBI DNA tip, as the attP site, onto the target DNA, as the attB site. Transposition of DNA transposons involves the pairing of terminal inverted repeats and 5-7-bp tandem target duplication. FBI DNA configuration effectively explains simple as well as replicative transposition, along with the involvement of an enhancer element. The majority of diverse retrotransposable elements that employ a target site duplication mechanism is also suggested to follow the FBI DNA-mediated perpendicular insertion of the paired intercoil ends by non-homologous end-joining, together with gap filling. A genome-wide perspective of transposable elements in light of FBI DNA is discussed.

  13. Effects of Ionizing Radiation on DNA Methylation: From Experimental Biology to Clinical Applications

    PubMed Central

    Miousse, Isabelle R.; Kutanzi, Kristy R.; Koturbash, Igor

    2017-01-01

    Purpose Ionizing radiation (IR) is a ubiquitous environmental stressor with genotoxic and epigenotoxic capabilities. Terrestrial IR, predominantly a low-linear energy transfer (LET) radiation, is being widely utilized in medicine, as well as in multiple industrial applications. Additionally, an interest in understanding the effects of high-LET irradiation is emerging due to the potential of exposure during space missions and the growing utilization of LET radiation in medicine. Conclusions In this review, we summarize the current knowledge of the effects of IR on DNA methylation, a key epigenetic mechanism regulating the expression of genetic information. We discuss global, repetitive elements and gene-specific DNA methylation in light of exposure to high and low doses of high- or low-LET IR, fractionated IR exposure, and bystander effects. Finally, we describe the mechanisms of IR-induced alterations to DNA methylation and discuss ways in which that understanding can be applied clinically, including utilization of DNA methylation as a predictor of response to radiotherapy and in the manipulation of DNA methylation patterns for tumor radiosensitization. PMID:28134023

  14. Effects of ionizing radiation on DNA methylation: from experimental biology to clinical applications.

    PubMed

    Miousse, Isabelle R; Kutanzi, Kristy R; Koturbash, Igor

    2017-05-01

    Ionizing radiation (IR) is a ubiquitous environmental stressor with genotoxic and epigenotoxic capabilities. Terrestrial IR, predominantly a low-linear energy transfer (LET) radiation, is being widely utilized in medicine, as well as in multiple industrial applications. Additionally, an interest in understanding the effects of high-LET irradiation is emerging due to the potential of exposure during space missions and the growing utilization of high-LET radiation in medicine. In this review, we summarize the current knowledge of the effects of IR on DNA methylation, a key epigenetic mechanism regulating the expression of genetic information. We discuss global, repetitive elements and gene-specific DNA methylation in light of exposure to high and low doses of high- or low-LET IR, fractionated IR exposure, and bystander effects. Finally, we describe the mechanisms of IR-induced alterations to DNA methylation and discuss ways in which that understanding can be applied clinically, including utilization of DNA methylation as a predictor of response to radiotherapy and in the manipulation of DNA methylation patterns for tumor radiosensitization.

  15. Small RNA-Mediated trans-Nuclear and trans-Element Communications in Tetrahymena DNA Elimination.

    PubMed

    Noto, Tomoko; Mochizuki, Kazufumi

    2018-06-18

    Epigenetic inheritance of acquired traits is widespread among eukaryotes, but how and to what extent such information is transgenerationally inherited is still unclear. The patterns of programmed DNA elimination in ciliates are epigenetically and transgenerationally inherited, and it has been proposed that small RNAs, which shuttle between the germline and the soma, regulate this epigenetic inheritance. In this study, we test the existence and role of such small-RNA-mediated communication by epigenetically disturbing the pattern of DNA elimination in Tetrahymena. We show that the pattern of DNA elimination is, indeed, determined by the selective turnover of small RNAs, which is induced by the interaction between germline-derived small RNAs and the somatic genome. In addition, we show that DNA elimination of an element is regulated by small-RNA-mediated communication with other eliminated elements. By contrast, no evidence obtained thus far supports the notion that transfer of epigenetic information from the soma to the germline, if any, regulates DNA elimination. Our results indicate that small-RNA-mediated trans-nuclear and trans-element communication, in addition to unknown information in the germline genome, contributes to determining the pattern of DNA elimination. Copyright © 2018 Elsevier Ltd. All rights reserved.

  16. Satellite DNA and Transposable Elements in Seabuckthorn (Hippophae rhamnoides), a Dioecious Plant with Small Y and Large X Chromosomes

    PubMed Central

    Puterova, Janka; Razumova, Olga; Martinek, Tomas; Alexandrov, Oleg; Divashuk, Mikhail; Kubat, Zdenek; Hobza, Roman; Karlov, Gennady

    2017-01-01

    Seabuckthorn (Hippophae rhamnoides) is a dioecious shrub commonly used in the pharmaceutical, cosmetic, and environmental industry as a source of oil, minerals and vitamins. In this study, we analyzed the transposable elements and satellites in its genome. We carried out Illumina DNA sequencing and reconstructed the main repetitive DNA sequences. For data analysis, we developed a new bioinformatics approach for advanced satellite DNA analysis and showed that about 25% of the genome consists of satellite DNA and about 24% is formed of transposable elements, dominated by Ty3/Gypsy and Ty1/Copia LTR retrotransposons. FISH mapping revealed X chromosome-accumulated, Y chromosome-specific or both sex chromosomes-accumulated satellites but most satellites were found on autosomes. Transposable elements were located mostly in the subtelomeres of all chromosomes. The 5S rDNA and 45S rDNA were localized on one autosomal locus each. Although we demonstrated the small size of the Y chromosome of the seabuckthorn and accumulated satellite DNA there, we were unable to estimate the age and extent of the Y chromosome degeneration. Analysis of dioecious relatives such as Shepherdia would shed more light on the evolution of these sex chromosomes. PMID:28057732

  17. Regulation of the intronic promoter of rat estrogen receptor alpha gene, responsible for truncated estrogen receptor product-1 expression.

    PubMed

    Schausi, Diane; Tiffoche, Christophe; Thieulant, Marie-Lise

    2003-07-01

    We have characterized the intronic promoter of the rat estrogen receptor (ER) alpha gene, responsible for the lactotrope-specific truncated ER product (TERP)-1 isoform expression. Transcriptional regulation was investigated by transient transfections using 5'-deletion constructs. TERP promoter constructs were highly active in MMQ cells, a pure lactotrope cell line, whereas a low basal activity was detected in alphaT3-1 gonadotrope cells or in COS-7 monkey kidney cells. Serial deletion analysis revealed that 1) a minimal -693-bp region encompassing the TATA box is sufficient to allow lactotrope-specific expression; 2) the promoter contains strong positive cis-acting elements both in the distal and proximal regions, and 3) the region spanning the -1698/-1194 region includes repressor elements. Transient transfection studies, EMSAs, and gel shifts demonstrated that estrogen activates the TERP promoter via an estrogen-responsive element (ERE1) located within the proximal region. Mutation of ERE1 site completely abolishes the estradiol-dependent transcription, indicating that ERE1 site is sufficient to confer estrogen responsiveness to TERP promoter. In addition, ERalpha action was synergized by transfection of the pituitary-specific factor Pit-1. EMSAs showed that a single Pit-1 DNA binding element in the vicinity of the TATA box is sufficient to confer response by the TERP promoter. In conclusion, we demonstrated, for the first time, that TERP promoter regulation involves ERE and Pit-1 cis-elements and corresponding trans-acting factors, which could play a role in the physiological changes that occur in TERP-1 transcription in lactotrope cells.

  18. Robust Translation of the Nucleoid Protein Fis Requires a Remote Upstream AU Element and Is Enhanced by RNA Secondary Structure

    PubMed Central

    Nafissi, Maryam; Chau, Jeannette; Xu, Jimin

    2012-01-01

    Synthesis of the Fis nucleoid protein rapidly increases in response to nutrient upshifts, and Fis is one of the most abundant DNA binding proteins in Escherichia coli under nutrient-rich growth conditions. Previous work has shown that control of Fis synthesis occurs at transcription initiation of the dusB-fis operon. We show here that while translation of the dihydrouridine synthase gene dusB is low, unusual mechanisms operate to enable robust translation of fis. At least two RNA sequence elements located within the dusB coding region are responsible for high fis translation. The most important is an AU element centered 35 nucleotides (nt) upstream of the fis AUG, which may function as a binding site for ribosomal protein S1. In addition, a 44-nt segment located upstream of the AU element and predicted to form a stem-loop secondary structure plays a prominent role in enhancing fis translation. On the other hand, mutations close to the AUG, including over a potential Shine-Dalgarno sequence, have little effect on Fis protein levels. The AU element and stem-loop regions are phylogenetically conserved within dusB-fis operons of representative enteric bacteria. PMID:22389479

  19. ATXR5 and ATXR6 are novel H3K27 monomethyltransferases required for chromatin structure and gene silencing

    PubMed Central

    Jacob, Yannick; Feng, Suhua; LeBlanc, Chantal A.; Bernatavichute, Yana V.; Stroud, Hume; Cokus, Shawn; Johnson, Lianna M.; Pellegrini, Matteo; Jacobsen, Steven E.; Michaels, Scott D.

    2009-01-01

    Constitutive heterochromatin in Arabidopsis thaliana is marked by repressive chromatin modifications including DNA methylation, histone H3 dimethylation at lysine 9 (H3K9me2), and monomethylation at lysine 27 (H3K27me1). The enzymes catalyzing DNA methylation and H3K9me2 have been identified and mutations in these proteins lead to the reactivation of silenced heterochromatic elements. The enzymes responsible for heterochromatic H3K27me1, in contrast, remain unknown. Here we show that the divergent SET-domain proteins ARABIDOPSIS TRITHORAX-RELATED PROTEIN5 (ATXR5) and ATXR6 exhibit H3K27 monomethyltransferase activity and double mutants have reduced H3K27me1 in vivo and show partial heterochromatin decondensation. Mutations in atxr5 and atxr6 also lead to transcriptional activation of repressed heterochromatic elements. Interestingly, H3K9me2 and DNA methylation are unaffected in the double mutant. These results indicate that ATXR5 and ATXR6 form a novel class of H3K27 methyltransferases and that H3K27me1 represents a new pathway required for transcriptional repression in Arabidopsis. PMID:19503079

  20. Alpha-crystallins are involved in specific interactions with the murine gamma D/E/F-crystallin-encoding gene.

    PubMed

    Pietrowski, D; Durante, M J; Liebstein, A; Schmitt-John, T; Werner, T; Graw, J

    1994-07-08

    The promoter of the murine gamma E-crystallin (gamma E-Cry) encoding gene (gamma E-cry) was analyzed for specific interactions with lenticular proteins in a gel-retardation assay. A 21-bp fragment immediately downstream of the transcription initiation site (DOTIS) is demonstrated to be responsible for specific interactions with lens extracts. The DOTIS-binding protein(s) accept only the sense DNA strand as target; anti-sense or double-stranded DNA do not interact with these proteins. The DOTIS sequence element is highly conserved among the murine gamma D-, gamma E- and gamma F-cry and is present at comparable positions in the orthologous rat genes. Only a weak or even no protein-binding activity is observed if a few particular bases are changed, as in the rat gamma A-, gamma C- and gamma E-cry elements. DOTIS-binding proteins were found in commercially available bovine alpha-Cry preparations. The essential participation of alpha-Cry in the DNA-binding protein complex was confirmed using alpha-Cry-specific monoclonal antibody. The results reported here point to a novel function of alpha-Cry besides the structural properties in the lens.

  1. Destruction of a distal hypoxia response element abolishes trans-activation of the PAG1 gene mediated by HIF-independent chromatin looping

    PubMed Central

    Schörg, Alexandra; Santambrogio, Sara; Platt, James L.; Schödel, Johannes; Lindenmeyer, Maja T.; Cohen, Clemens D.; Schrödter, Katrin; Mole, David R.; Wenger, Roland H.; Hoogewijs, David

    2015-01-01

    A crucial step in the cellular adaptation to oxygen deficiency is the binding of hypoxia-inducible factors (HIFs) to hypoxia response elements (HREs) of oxygen-regulated genes. Genome-wide HIF-1α/2α/β DNA-binding studies revealed that the majority of HREs reside distant to the promoter regions, but the function of these distal HREs has only been marginally studied in the genomic context. We used chromatin immunoprecipitation (ChIP), gene editing (TALEN) and chromosome conformation capture (3C) to localize and functionally characterize a 82 kb upstream HRE that solely drives oxygen-regulated expression of the newly identified HIF target gene PAG1. PAG1, a transmembrane adaptor protein involved in Src signalling, was hypoxically induced in various cell lines and mouse tissues. ChIP and reporter gene assays demonstrated that the −82 kb HRE regulates PAG1, but not an equally distant gene further upstream, by direct interaction with HIF. Ablation of the consensus HRE motif abolished the hypoxic induction of PAG1 but not general oxygen signalling. 3C assays revealed that the −82 kb HRE physically associates with the PAG1 promoter region, independent of HIF-DNA interaction. These results demonstrate a constitutive interaction between the −82 kb HRE and the PAG1 promoter, suggesting a physiologically important rapid response to hypoxia. PMID:26007655

  2. Caffeic acid phenethyl ester inhibits 3-MC-induced CYP1A1 expression through induction of hypoxia-inducible factor-1α

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Hyung Gyun; Han, Eun Hee; Im, Ji Hye

    2015-09-25

    Caffeic acid phenethyl ester (CAPE), a natural component of propolis, is reported to have anticarcinogenic properties, although its precise chemopreventive mechanism remains unclear. In this study, we examined the effects of CAPE on 3-methylcholanthrene (3-MC)-induced CYP1A1 expression and activities. CAPE reduced the formation of the benzo[a]pyrene-DNA adduct. Moreover, CAPE inhibited 3-MC-induced CYP1A1 activity, mRNA expression, protein level, and promoter activity. CAPE treatment also decreased 3-MC-inducible xenobiotic-response element (XRE)-linked luciferase, aryl hydrocarbons receptor (AhR) transactivation and nuclear localization. CAPE induced hypoxia inducible factor-1α (HIF-1α) protein level and HIF-1α responsible element (HRE) transcriptional activity. CAPE-mediated HIF-1α reduced 3-MC-inducible CYP1A1 protein expression. Takenmore » together, CAPE decreases 3-MC-mediated CYP1A1 expression, and this inhibitory response is associated with inhibition of AhR and HIF-1α induction. - Highlights: • CAPE reduced the formation of the benzo[a]pyrene-DNA adduct. • CAPE inhibited 3-MC-induced CYP1A1 expression. • CAPE induced HIF-1α induction. • CAPE-mediated HIF-1α reduced 3-MC-inducible CYP1A1 expression.« less

  3. Saccharomyces cerevisiae gene expression changes during rotating wall vessel suspension culture

    NASA Technical Reports Server (NTRS)

    Johanson, Kelly; Allen, Patricia L.; Lewis, Fawn; Cubano, Luis A.; Hyman, Linda E.; Hammond, Timothy G.

    2002-01-01

    This study utilizes Saccharomyces cerevisiae to study genetic responses to suspension culture. The suspension culture system used in this study is the high-aspect-ratio vessel, one type of the rotating wall vessel, that provides a high rate of gas exchange necessary for rapidly dividing cells. Cells were grown in the high-aspect-ratio vessel, and DNA microarray and metabolic analyses were used to determine the resulting changes in yeast gene expression. A significant number of genes were found to be up- or downregulated by at least twofold as a result of rotational growth. By using Gibbs promoter alignment, clusters of genes were examined for promoter elements mediating these genetic changes. Candidate binding motifs similar to the Rap1p binding site and the stress-responsive element were identified in the promoter regions of differentially regulated genes. This study shows that, as in higher order organisms, S. cerevisiae changes gene expression in response to rotational culture and also provides clues for investigations into the signaling pathways involved in gravitational response.

  4. Genome-wide colonization of gene regulatory elements by G4 DNA motifs

    PubMed Central

    Du, Zhuo; Zhao, Yiqiang; Li, Ning

    2009-01-01

    G-quadruplex (or G4 DNA), a stable four-stranded structure found in guanine-rich regions, is implicated in the transcriptional regulation of genes involved in growth and development. Previous studies on the role of G4 DNA in gene regulation mostly focused on genomic regions proximal to transcription start sites (TSSs). To gain a more comprehensive understanding of the regulatory role of G4 DNA, we examined the landscape of potential G4 DNA (PG4Ms) motifs in the human genome and found that G4 motifs, not restricted to those found in the TSS-proximal regions, are bias toward gene-associated regions. Significantly, analyses of G4 motifs in seven types of well-known gene regulatory elements revealed a constitutive enrichment pattern and the clusters of G4 motifs tend to be colocalized with regulatory elements. Considering our analysis from a genome evolutionary perspective, we found evidence that the occurrence and accumulation of certain progenitors and canonical G4 DNA motifs within regulatory regions were progressively favored by natural selection. Our results suggest that G4 DNA motifs are ‘colonized’ in regulatory regions, supporting a likely genome-wide role of G4 DNA in gene regulation. We hypothesize that G4 DNA is a regulatory apparatus situated in regulatory elements, acting as a molecular switch that can modulate the role of the host functional regions, by transition in DNA structure. PMID:19759215

  5. Structural and Mechanistic Basis of Zinc Regulation Across the E. coli Zur Regulon

    PubMed Central

    Gilston, Benjamin A.; Wang, Suning; Marcus, Mason D.; Canalizo-Hernández, Mónica A.; Swindell, Elden P.; Xue, Yi; Mondragón, Alfonso; O'Halloran, Thomas V.

    2014-01-01

    Commensal microbes, whether they are beneficial or pathogenic, are sensitive to host processes that starve or swamp the prokaryote with large fluctuations in local zinc concentration. To understand how microorganisms coordinate a dynamic response to changes in zinc availability at the molecular level, we evaluated the molecular mechanism of the zinc-sensing zinc uptake regulator (Zur) protein at each of the known Zur-regulated genes in Escherichia coli. We solved the structure of zinc-loaded Zur bound to the PznuABC promoter and show that this metalloregulatory protein represses gene expression by a highly cooperative binding of two adjacent dimers to essentially encircle the core element of each of the Zur-regulated promoters. Cooperativity in these protein-DNA interactions requires a pair of asymmetric salt bridges between Arg52 and Asp49′ that connect otherwise independent dimers. Analysis of the protein-DNA interface led to the discovery of a new member of the Zur-regulon: pliG. We demonstrate this gene is directly regulated by Zur in a zinc responsive manner. The pliG promoter forms stable complexes with either one or two Zur dimers with significantly less protein-DNA cooperativity than observed at other Zur regulon promoters. Comparison of the in vitro Zur-DNA binding affinity at each of four Zur-regulon promoters reveals ca. 10,000-fold variation Zur-DNA binding constants. The degree of Zur repression observed in vivo by comparison of transcript copy number in wild-type and Δzur strains parallels this trend spanning a 100-fold difference. We conclude that the number of ferric uptake regulator (Fur)-family dimers that bind within any given promoter varies significantly and that the thermodynamic profile of the Zur-DNA interactions directly correlates with the physiological response at different promoters. PMID:25369000

  6. Estimates of electronic coupling for excess electron transfer in DNA

    NASA Astrophysics Data System (ADS)

    Voityuk, Alexander A.

    2005-07-01

    Electronic coupling Vda is one of the key parameters that determine the rate of charge transfer through DNA. While there have been several computational studies of Vda for hole transfer, estimates of electronic couplings for excess electron transfer (ET) in DNA remain unavailable. In the paper, an efficient strategy is established for calculating the ET matrix elements between base pairs in a π stack. Two approaches are considered. First, we employ the diabatic-state (DS) method in which donor and acceptor are represented with radical anions of the canonical base pairs adenine-thymine (AT) and guanine-cytosine (GC). In this approach, similar values of Vda are obtained with the standard 6-31G* and extended 6-31++G** basis sets. Second, the electronic couplings are derived from lowest unoccupied molecular orbitals (LUMOs) of neutral systems by using the generalized Mulliken-Hush or fragment charge methods. Because the radical-anion states of AT and GC are well reproduced by LUMOs of the neutral base pairs calculated without diffuse functions, the estimated values of Vda are in good agreement with the couplings obtained for radical-anion states using the DS method. However, when the calculation of a neutral stack is carried out with diffuse functions, LUMOs of the system exhibit the dipole-bound character and cannot be used for estimating electronic couplings. Our calculations suggest that the ET matrix elements Vda for models containing intrastrand thymine and cytosine bases are essentially larger than the couplings in complexes with interstrand pyrimidine bases. The matrix elements for excess electron transfer are found to be considerably smaller than the corresponding values for hole transfer and to be very responsive to structural changes in a DNA stack.

  7. Regulation of the yeast RAD2 gene: DNA damage-dependent induction correlates with protein binding to regulatory sequences and their deletion influences survival.

    PubMed

    Siede, W; Friedberg, E C

    1992-03-01

    In the yeast Saccharomyces cerevisiae the RAD2 gene is absolutely required for damage-specific incision of DNA during nucleotide excision repair and is inducible by DNA-damaging agents. In the present study we correlated sensitivity to killing by DNA-damaging agents with the deletion of previously defined specific promoter elements. Deletion of the element DRE2 increased the UV sensitivity of cells in both the G1/early S and S/G2 phases of the cell cycle as well as in stationary phase. On the other hand, increased UV sensitivity associated with deletion of the sequence-related element DRE1 was restricted to cells irradiated in G1/S. Specific binding of protein(s) to the promoter elements DRE1 and DRE2 was observed under non-inducing conditions using gel retardation assays. Exposure of cells to DNA-damaging agents resulted in increased protein binding that was dependent on de novo protein synthesis.

  8. Ski acts as a co-repressor with Smad2 and Smad3 to regulate the response to type β transforming growth factor

    PubMed Central

    Xu, Weidong; Angelis, Konstantina; Danielpour, David; Haddad, Maher M.; Bischof, Oliver; Campisi, Judith; Stavnezer, Ed; Medrano, Estela E.

    2000-01-01

    The c-ski protooncogene encodes a transcription factor that binds DNA only in association with other proteins. To identify co-binding proteins, we performed a yeast two-hybrid screen. The results of the screen and subsequent co-immunoprecipitation studies identified Smad2 and Smad3, two transcriptional activators that mediate the type β transforming growth factor (TGF-β) response, as Ski-interacting proteins. In Ski-transformed cells, all of the Ski protein was found in Smad3-containing complexes that accumulated in the nucleus in the absence of added TGF-β. DNA binding assays showed that Ski, Smad2, Smad3, and Smad4 form a complex with the Smad/Ski binding element GTCTAGAC (SBE). Ski repressed TGF-β-induced expression of 3TP-Lux, the natural plasminogen activator inhibitor 1 promoter and of reporter genes driven by the SBE and the related CAGA element. In addition, Ski repressed a TGF-β-inducible promoter containing AP-1 (TRE) elements activated by a combination of Smads, Fos, and/or Jun proteins. Ski also repressed synergistic activation of promoters by combinations of Smad proteins but failed to repress in the absence of Smad4. Thus, Ski acts in opposition to TGF-β-induced transcriptional activation by functioning as a Smad-dependent co-repressor. The biological relevance of this transcriptional repression was established by showing that overexpression of Ski abolished TGF-β-mediated growth inhibition in a prostate-derived epithelial cell line. PMID:10811875

  9. Ski acts as a co-repressor with Smad2 and Smad3 to regulate the response to type beta transforming growth factor.

    PubMed

    Xu, W; Angelis, K; Danielpour, D; Haddad, M M; Bischof, O; Campisi, J; Stavnezer, E; Medrano, E E

    2000-05-23

    The c-ski protooncogene encodes a transcription factor that binds DNA only in association with other proteins. To identify co-binding proteins, we performed a yeast two-hybrid screen. The results of the screen and subsequent co-immunoprecipitation studies identified Smad2 and Smad3, two transcriptional activators that mediate the type beta transforming growth factor (TGF-beta) response, as Ski-interacting proteins. In Ski-transformed cells, all of the Ski protein was found in Smad3-containing complexes that accumulated in the nucleus in the absence of added TGF-beta. DNA binding assays showed that Ski, Smad2, Smad3, and Smad4 form a complex with the Smad/Ski binding element GTCTAGAC (SBE). Ski repressed TGF-beta-induced expression of 3TP-Lux, the natural plasminogen activator inhibitor 1 promoter and of reporter genes driven by the SBE and the related CAGA element. In addition, Ski repressed a TGF-beta-inducible promoter containing AP-1 (TRE) elements activated by a combination of Smads, Fos, and/or Jun proteins. Ski also repressed synergistic activation of promoters by combinations of Smad proteins but failed to repress in the absence of Smad4. Thus, Ski acts in opposition to TGF-beta-induced transcriptional activation by functioning as a Smad-dependent co-repressor. The biological relevance of this transcriptional repression was established by showing that overexpression of Ski abolished TGF-beta-mediated growth inhibition in a prostate-derived epithelial cell line.

  10. Differential regulation of mnp2, a new manganese peroxidase-encoding gene from the ligninolytic fungus Trametes versicolor PRL 572

    Treesearch

    Tomas Johansson; Per Olof Nyman; Daniel Cullen

    2002-01-01

    A peroxidase-encoding gene, mnp2, and its corresponding cDNA were characterized from the white-rot basidiomycete Trametes versicolor PRL 572. We used quantitative reverse transcriptase-mediated PCR to identify mnp2 transcripts in nutrient-limited stationary cultures. Although mnp2 lacks upstream metal response elements (MREs), addition of MnSO4 to cultures increased...

  11. Ataxia telangiectasia mutated (ATM) modulates long interspersed element-1 (L1) retrotransposition in human neural stem cells

    PubMed Central

    Coufal, Nicole G.; Garcia-Perez, Josè Luis; Peng, Grace E.; Marchetto, Maria C. N.; Muotri, Alysson R.; Mu, Yangling; Carson, Christian T.; Macia, Angela; Moran, John V.; Gage, Fred H.

    2011-01-01

    Long interspersed element-1 (L1) retrotransposons compose ∼20% of the mammalian genome, and ongoing L1 retrotransposition events can impact genetic diversity by various mechanisms. Previous studies have demonstrated that endogenous L1 retrotransposition can occur in the germ line and during early embryonic development. In addition, recent data indicate that engineered human L1s can undergo somatic retrotransposition in human neural progenitor cells and that an increase in human-specific L1 DNA content can be detected in the brains of normal controls, as well as in Rett syndrome patients. Here, we demonstrate an increase in the retrotransposition efficiency of engineered human L1s in cells that lack or contain severely reduced levels of ataxia telangiectasia mutated, a serine/threonine kinase involved in DNA damage signaling and neurodegenerative disease. We demonstrate that the increase in L1 retrotransposition in ataxia telangiectasia mutated-deficient cells most likely occurs by conventional target-site primed reverse transcription and generate either longer, or perhaps more, L1 retrotransposition events per cell. Finally, we provide evidence suggesting an increase in human-specific L1 DNA copy number in postmortem brain tissue derived from ataxia telangiectasia patients compared with healthy controls. Together, these data suggest that cellular proteins involved in the DNA damage response may modulate L1 retrotransposition. PMID:22159035

  12. Expression of MUC17 Is Regulated by HIF1α-Mediated Hypoxic Responses and Requires a Methylation-Free Hypoxia Responsible Element in Pancreatic Cancer

    PubMed Central

    Kitamoto, Sho; Yokoyama, Seiya; Higashi, Michiyo; Yamada, Norishige; Matsubara, Shyuichiro; Takao, Sonshin; Batra, Surinder K.; Yonezawa, Suguru

    2012-01-01

    MUC17 is a type 1 membrane-bound glycoprotein that is mainly expressed in the digestive tract. Recent studies have demonstrated that the aberrant overexpression of MUC17 is correlated with the malignant potential of pancreatic ductal adenocarcinomas (PDACs); however, the exact regulatory mechanism of MUC17 expression has yet to be identified. Here, we provide the first report of the MUC17 regulatory mechanism under hypoxia, an essential feature of the tumor microenvironment and a driving force of cancer progression. Our data revealed that MUC17 was significantly induced by hypoxic stimulation through a hypoxia-inducible factor 1α (HIF1α)-dependent pathway in some pancreatic cancer cells (e.g., AsPC1), whereas other pancreatic cancer cells (e.g., BxPC3) exhibited little response to hypoxia. Interestingly, these low-responsive cells have highly methylated CpG motifs within the hypoxia responsive element (HRE, 5′-RCGTG-3′), a binding site for HIF1α. Thus, we investigated the demethylation effects of CpG at HRE on the hypoxic induction of MUC17. Treatment of low-responsive cells with 5-aza-2′-deoxycytidine followed by additional hypoxic incubation resulted in the restoration of hypoxic MUC17 induction. Furthermore, DNA methylation of HRE in pancreatic tissues from patients with PDACs showed higher hypomethylation status as compared to those from non-cancerous tissues, and hypomethylation was also correlated with MUC17 mRNA expression. Taken together, these findings suggested that the HIF1α-mediated hypoxic signal pathway contributes to MUC17 expression, and DNA methylation of HRE could be a determinant of the hypoxic inducibility of MUC17 in pancreatic cancer cells. PMID:22970168

  13. Functional Analysis of Promoter Region from Eel Cytochrome P450 1A1 Gene in Transgenic Medaka.

    PubMed

    Ogino; Itakura; Kato; Aoki; Sato

    1999-07-01

    : Transcription of the CYP1A1 genes in mammals and fish is stimulated by polyaromatic hydrocarbons. DNA sequencing analysis revealed that CYP1A1 gene in eel (Anguilla japonica) contains two kinds of putative cis-acting regulatory elements, XRE (xenobiotic-responsive element) and ERE (estrogen-responsive element). XRE is known as the enhancer that is responsible for the inducibility of the genes of CYP1A1 and some other drug-metabolizing enzymes. In the eel CYP1A1 gene, XRE motifs are distributed as follows: five times in the region from -2136 to -1125 bp, XRE(-6) to (-2); once in the proximal basal promoter region, XRE(-1); and once in the first intron, XRE(+1). The region between XRE(-2) and XRE(-1) contains three ERE motifs. To investigate the function of the cis-acting regulatory elements in the eel CYP1A1 gene, recombinant plasmids prepared with its 5' upstream sequence and the structural gene for luciferase were microinjected into fertilized eggs of medaka at the one-cell stage. Hatched fry were treated with 3-methylcholanthrene, and the transcription efficiency was assayed using competitive polymerase chain reaction analysis. Deletion of the region containing the five XREs, XRE(-6) to XRE(-2), and the point mutation of XRE(-1) reduced the inducible expressions by 75% and 56%, respectively, showing apparent dependency of the drug induction on the XREs. Constitutive expression, however, was not significantly affected by deletion or disruption of the XREs. When the region between XRE(-2) and XRE(-1) containing no XREs but three ERE motifs was internally deleted, the inducible expression and the constitutive expression were reduced by 88% and 75%, respectively. Replacement of this region with a partial fragment of eel CYP1A1 complementary DNA, with slight alteration of the distance between the five XREs and XRE(-1), reduced the inducible expression and the constitutive expression by 91% and 60%, respectively. These results strongly suggest that not only XRE but also other regulatory elements, possibly ERE, play an important role in induced and constitutive expressions of the eel CYP1A1 gene.

  14. Statins Increase Plasminogen Activator Inhibitor Type 1 Gene Transcription through a Pregnane X Receptor Regulated Element

    PubMed Central

    Stanley, Frederick M.; Linder, Kathryn M.; Cardozo, Timothy J.

    2015-01-01

    Plasminogen activator inhibitor type 1 (PAI-1) is a multifunctional protein that has important roles in inflammation and wound healing. Its aberrant regulation may contribute to many disease processes such as heart disease. The PAI-1 promoter is responsive to multiple inputs including cytokines, growth factors, steroids and oxidative stress. The statin drugs, atorvastatin, mevastatin and rosuvastatin, increased basal and stimulated expression of the PAI-1 promoter 3-fold. A statin-responsive, nuclear hormone response element was previously identified in the PAI-1 promoter, but it was incompletely characterized. We characterized this direct repeat (DR) of AGGTCA with a 3-nucleotide spacer at -269/-255 using deletion and directed mutagenesis. Deletion or mutation of this element increased basal transcription from the promoter suggesting that it repressed PAI-1 transcription in the unliganded state. The half-site spacing and the ligand specificity suggested that this might be a pregnane X receptor (PXR) responsive element. Computational molecular docking showed that atorvastatin, mevastatin and rosuvastatin were structurally compatible with the PXR ligand-binding pocket in its agonist conformation. Experiments with Gal4 DNA binding domain fusion proteins showed that Gal4-PXR was activated by statins while other DR + 3 binding nuclear receptor fusions were not. Overexpression of PXR further enhanced PAI-1 transcription in response to statins. Finally, ChIP experiments using Halo-tagged PXR and RXR demonstrated that both components of the PXR-RXR heterodimer bound to this region of the PAI-1 promoter. PMID:26379245

  15. The orphan receptor hepatic nuclear factor 4 functions as a transcriptional activator for tissue-specific and hypoxia-specific erythropoietin gene expression and is antagonized by EAR3/COUP-TF1.

    PubMed

    Galson, D L; Tsuchiya, T; Tendler, D S; Huang, L E; Ren, Y; Ogura, T; Bunn, H F

    1995-04-01

    The erythropoietin (Epo) gene is regulated by hypoxia-inducible cis-acting elements in the promoter and in a 3' enhancer, both of which contain consensus hexanucleotide hormone receptor response elements which are important for function. A group of 11 orphan nuclear receptors, transcribed and translated in vitro, were screened by the electrophoretic mobility shift assay. Of these, hepatic nuclear factor 4 (HNF-4), TR2-11, ROR alpha 1, and EAR3/COUP-TF1 bound specifically to the response elements in the Epo promoter and enhancer and, except for ROR alpha 1, formed DNA-protein complexes that had mobilities similar to those observed in nuclear extracts of the Epo-producing cell line Hep3B. Moreover, both anti-HNF-4 and anti-COUP antibodies were able to supershift complexes in Hep3B nuclear extracts. Like Epo, HNF-4 is expressed in kidney, liver, and Hep3B cells but not in HeLa cells. Transfection of a plasmid expressing HNF-4 into HeLa cells enabled an eightfold increase in the hypoxic induction of a luciferase reporter construct which contains the minimal Epo enhancer and Epo promoter, provided that the nuclear hormone receptor consensus DNA elements in both the promoter and the enhancer were intact. The augmentation by HNF-4 in HeLa cells could be abrogated by cotransfection with HNF-4 delta C, which retains the DNA binding domain of HNF-4 but lacks the C-terminal activation domain. Moreover, the hypoxia-induced expression of the endogenous Epo gene was significantly inhibited in Hep3B cells stably transfected with HNF-4 delta C. On the other hand, cotransfection of EAR3/COUP-TF1 and the Epo reporter either with HNF-4 into HeLa cells or alone into Hep3B cells suppressed the hypoxia induction of the Epo reporter. These electrophoretic mobility shift assay and functional experiments indicate that HNF-4 plays a critical positive role in the tissue-specific and hypoxia-inducible expression of the Epo gene, whereas the COUP family has a negative modulatory role.

  16. Role of transposon-derived small RNAs in the interplay between genomes and parasitic DNA in rice.

    PubMed

    Nosaka, Misuzu; Itoh, Jun-Ichi; Nagato, Yasuo; Ono, Akemi; Ishiwata, Aiko; Sato, Yutaka

    2012-09-01

    RNA silencing is a defense system against "genomic parasites" such as transposable elements (TE), which are potentially harmful to host genomes. In plants, transcripts from TEs induce production of double-stranded RNAs (dsRNAs) and are processed into small RNAs (small interfering RNAs, siRNAs) that suppress TEs by RNA-directed DNA methylation. Thus, the majority of TEs are epigenetically silenced. On the other hand, most of the eukaryotic genome is composed of TEs and their remnants, suggesting that TEs have evolved countermeasures against host-mediated silencing. Under some circumstances, TEs can become active and increase in copy number. Knowledge is accumulating on the mechanisms of TE silencing by the host; however, the mechanisms by which TEs counteract silencing are poorly understood. Here, we show that a class of TEs in rice produces a microRNA (miRNA) to suppress host silencing. Members of the microRNA820 (miR820) gene family are located within CACTA DNA transposons in rice and target a de novo DNA methyltransferase gene, OsDRM2, one of the components of epigenetic silencing. We confirmed that miR820 negatively regulates the expression of OsDRM2. In addition, we found that expression levels of various TEs are increased quite sensitively in response to decreased OsDRM2 expression and DNA methylation at TE loci. Furthermore, we found that the nucleotide sequence of miR820 and its recognition site within the target gene in some Oryza species have co-evolved to maintain their base-pairing ability. The co-evolution of these sequences provides evidence for the functionality of this regulation. Our results demonstrate how parasitic elements in the genome escape the host's defense machinery. Furthermore, our analysis of the regulation of OsDRM2 by miR820 sheds light on the action of transposon-derived small RNAs, not only as a defense mechanism for host genomes but also as a regulator of interactions between hosts and their parasitic elements.

  17. Microparticles: Facile and High-Throughput Synthesis of Functional Microparticles with Quick Response Codes (Small 24/2016).

    PubMed

    Ramirez, Lisa Marie S; He, Muhan; Mailloux, Shay; George, Justin; Wang, Jun

    2016-06-01

    Microparticles carrying quick response (QR) barcodes are fabricated by J. Wang and co-workers on page 3259, using a massive coding of dissociated elements (MiCODE) technology. Each microparticle can bear a special custom-designed QR code that enables encryption or tagging with unlimited multiplexity, and the QR code can be easily read by cellphone applications. The utility of MiCODE particles in multiplexed DNA detection and microtagging for anti-counterfeiting is explored. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Spontaneous germline excision of Tol1, a DNA-based transposable element naturally occurring in the medaka fish genome.

    PubMed

    Watanabe, Kohei; Koga, Hajime; Nakamura, Kodai; Fujita, Akiko; Hattori, Akimasa; Matsuda, Masaru; Koga, Akihiko

    2014-04-01

    DNA-based transposable elements are ubiquitous constituents of eukaryotic genomes. Vertebrates are, however, exceptional in that most of their DNA-based elements appear to be inactivated. The Tol1 element of the medaka fish, Oryzias latipes, is one of the few elements for which copies containing an undamaged gene have been found. Spontaneous transposition of this element in somatic cells has previously been demonstrated, but there is only indirect evidence for its germline transposition. Here, we show direct evidence of spontaneous excision in the germline. Tyrosinase is the key enzyme in melanin biosynthesis. In an albino laboratory strain of medaka fish, which is homozygous for a mutant tyrosinase gene in which a Tol1 copy is inserted, we identified de novo reversion mutations related to melanin pigmentation. The gamete-based reversion rate was as high as 0.4%. The revertant fish carried the tyrosinase gene from which the Tol1 copy had been excised. We previously reported the germline transposition of Tol2, another DNA-based element that is thought to be a recent invader of the medaka fish genome. Tol1 is an ancient resident of the genome. Our results indicate that even an old element can contribute to genetic variation in the host genome as a natural mutator.

  19. Trace elements are associated with urinary 8-hydroxy-2'-deoxyguanosine level: a case study of college students in Guangzhou, China.

    PubMed

    Lu, Shaoyou; Ren, Lu; Fang, Jianzhang; Ji, Jiajia; Liu, Guihua; Zhang, Jianqing; Zhang, Huimin; Luo, Ruorong; Lin, Kai; Fan, Ruifang

    2016-05-01

    Many trace heavy elements are carcinogenic and increase the incidence of cancer. However, a comprehensive study of the correlation between multiple trace elements and DNA oxidative damage is still lacking. The aim of this study is to investigate the relationships between the body burden of multiple trace elements and DNA oxidative stress in college students in Guangzhou, China. Seventeen trace elements in urine samples were determined by inductively coupled plasma-mass spectrometry (ICP-MS). Urinary 8-hydroxy-2'-deoxyguanosine (8-OHdG), a biomarker of DNA oxidative stress, was also measured using liquid chromatography tandem mass spectrometer (LC-MS/MS). The concentrations of six essential elements including manganese (Mn), copper (Cu), nickel (Ni), selenium (Se), strontium (Sr), and molybdenum (Mo), and five non-essential elements including arsenic (As), cadmium (Cd), aluminum (Al), stibium (Sb), and thallium (Tl), were found to be significantly correlated with urinary 8-OHdG levels. Moreover, urinary levels of Ni, Se, Mo, As, Sr, and Tl were strongly significantly correlated with 8-OHdG (P < 0.01) concentration. Environmental exposure and dietary intake of these trace elements may play important roles in DNA oxidative damage in the population of Guangzhou, China.

  20. Movable Genetic Elements: Detection of Changes in Maize DNA at the Shrunken Locus Due to the Intervention of Ds Elements

    DOE R&D Accomplishments Database

    Burr, B.; Burr, F.A.

    1980-05-28

    This report describes our initial attempts at the molecular characterization of a maize controlling element. We have prepared a cDNA probe and used it to detect changes at a locus where Ds elements are found. Evidence of their presence are indicated by changes in the restriction patterns, but there is as yet no information on the physical nature of the controlling elements nor on the kinds of rearrangements they cause.

  1. Light-mediated control of DNA transcription in yeast

    PubMed Central

    Hughes, Robert M.; Bolger, Steven; Tapadia, Hersh; Tucker, Chandra L.

    2012-01-01

    A variety of methods exist for inducible control of DNA transcription in yeast. These include the use of native yeast promoters or regulatory elements that are responsive to small molecules such as galactose, methionine, and copper, or engineered systems that allow regulation by orthogonal small molecules such as estrogen. While chemically regulated systems are easy to use and can yield high levels of protein expression, they often provide imprecise control over protein levels. Moreover, chemically regulated systems can affect many other proteins and pathways in yeast, activating signaling pathways or physiological responses. Here, we describe several methods for light mediated control of DNA transcription in vivo in yeast. We describe methodology for using a red light and phytochrome dependent system to induce transcription of genes under GAL1 promoter control, as well as blue light / cryptochrome dependent systems to control transcription of genes under GAL1 promoter or LexA operator control. Light is dose dependent, inexpensive to apply, easily delivered, and does not interfere with cellular pathways, and thus has significant advantages over chemical systems. PMID:22922268

  2. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  3. FKBP5 DNA methylation does not mediate the association between childhood maltreatment and depression symptom severity in the Detroit Neighborhood Health Study.

    PubMed

    Bustamante, Angela C; Aiello, Allison E; Guffanti, Guia; Galea, Sandro; Wildman, Derek E; Uddin, Monica

    2018-01-01

    Exposure to childhood maltreatment increases the risk of developing mental illness later in life. Childhood maltreatment and depression have both been associated with dysregulation of the hypothalamic-pituitary-adrenal (HPA) axis-a key regulator of the body's stress response. Additionally, HPA axis dysregulation has been implicated in the etiology of a range of mental illnesses. A substantial body of work has shown history of childhood maltreatment alters DNA methylation levels within key HPA axis genes. We therefore investigated whether one of these key genes, FKBP5 mediates the relationship between childhood maltreatment and depression, and assessed FKBP5 DNA methylation and gene expression within 112 adults from the Detroit Neighborhood Health Study (DNHS). DNA methylation was assessed in 4 regions, including the upstream promoter, downstream promoter, and two glucocorticoid response elements (GREs) via pyrosequencing using whole blood derived DNA; Taqman assays measured relative RNA expression from leukocytes. Mediation analyses were conducted using sequential linear regression. Childhood maltreatment was significantly associated with depression symptom severity (FDR < 0.006), but was not a significant predictor of DNA methylation in any of the four loci examined. FKBP5 showed elevated expression levels in participants with vs. without a history of depression (p < 0.001); no significant difference in gene expression levels was observed in relation to childhood maltreatment (p > 0.05). Our results suggest DNA methylation does not mediate the childhood maltreatment-depression association in the DNHS. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Satellite DNA and Transposable Elements in Seabuckthorn (Hippophae rhamnoides), a Dioecious Plant with Small Y and Large X Chromosomes.

    PubMed

    Puterova, Janka; Razumova, Olga; Martinek, Tomas; Alexandrov, Oleg; Divashuk, Mikhail; Kubat, Zdenek; Hobza, Roman; Karlov, Gennady; Kejnovsky, Eduard

    2017-01-01

    Seabuckthorn (Hippophae rhamnoides) is a dioecious shrub commonly used in the pharmaceutical, cosmetic, and environmental industry as a source of oil, minerals and vitamins. In this study, we analyzed the transposable elements and satellites in its genome. We carried out Illumina DNA sequencing and reconstructed the main repetitive DNA sequences. For data analysis, we developed a new bioinformatics approach for advanced satellite DNA analysis and showed that about 25% of the genome consists of satellite DNA and about 24% is formed of transposable elements, dominated by Ty3/Gypsy and Ty1/Copia LTR retrotransposons. FISH mapping revealed X chromosome-accumulated, Y chromosome-specific or both sex chromosomes-accumulated satellites but most satellites were found on autosomes. Transposable elements were located mostly in the subtelomeres of all chromosomes. The 5S rDNA and 45S rDNA were localized on one autosomal locus each. Although we demonstrated the small size of the Y chromosome of the seabuckthorn and accumulated satellite DNA there, we were unable to estimate the age and extent of the Y chromosome degeneration. Analysis of dioecious relatives such as Shepherdia would shed more light on the evolution of these sex chromosomes. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  5. Identification of Genetic Elements Associated with EPSPS Gene Amplification

    PubMed Central

    Gaines, Todd A.; Wright, Alice A.; Molin, William T.; Lorentz, Lothar; Riggins, Chance W.; Tranel, Patrick J.; Beffa, Roland; Westra, Philip; Powles, Stephen B.

    2013-01-01

    Weed populations can have high genetic plasticity and rapid responses to environmental selection pressures. For example, 100-fold amplification of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene evolved in the weed species Amaranthus palmeri to confer resistance to glyphosate, the world’s most important herbicide. However, the gene amplification mechanism is unknown. We sequenced the EPSPS gene and genomic regions flanking EPSPS loci in A. palmeri, and searched for mobile genetic elements or repetitive sequences. The EPSPS gene was 10,229 bp, containing 8 exons and 7 introns. The gene amplification likely proceeded through a DNA-mediated mechanism, as introns exist in the amplified gene copies and the entire amplified sequence is at least 30 kb in length. Our data support the presence of two EPSPS loci in susceptible (S) A. palmeri, and that only one of these was amplified in glyphosate-resistant (R) A. palmeri. The EPSPS gene amplification event likely occurred recently, as no sequence polymorphisms were found within introns of amplified EPSPS copies from R individuals. Sequences with homology to miniature inverted-repeat transposable elements (MITEs) were identified next to EPSPS gene copies only in R individuals. Additionally, a putative Activator (Ac) transposase and a repetitive sequence region were associated with amplified EPSPS genes. The mechanism controlling this DNA-mediated amplification remains unknown. Further investigation is necessary to determine if the gene amplification may have proceeded via DNA transposon-mediated replication, and/or unequal recombination between different genomic regions resulting in replication of the EPSPS gene. PMID:23762434

  6. Thermodynamic and structural insights into CSL-DNA complexes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Friedmann, David R.; Kovall, Rhett A.

    The Notch pathway is an intercellular signaling mechanism that plays important roles in cell fates decisions throughout the developing and adult organism. Extracellular complexation of Notch receptors with ligands ultimately results in changes in gene expression, which is regulated by the nuclear effector of the pathway, CSL (C-promoter binding factor 1 (CBF-1), suppressor of hairless (Su(H)), lin-12 and glp-1 (Lag-1)). CSL is a DNA binding protein that is involved in both repression and activation of transcription from genes that are responsive to Notch signaling. One well-characterized Notch target gene is hairy and enhancer of split-1 (HES-1), which is regulated bymore » a promoter element consisting of two CSL binding sites oriented in a head-to-head arrangement. Although previous studies have identified in vivo and consensus binding sites for CSL, and crystal structures of these complexes have been determined, to date, a quantitative description of the energetics that underlie CSL-DNA binding is unknown. Here, we provide a thermodynamic and structural analysis of the interaction between CSL and the two individual sites that comprise the HES-1 promoter element. Our comprehensive studies that analyze binding as a function of temperature, salt, and pH reveal moderate, but distinct, differences in the affinities of CSL for the two HES-1 binding sites. Similarly, our structural results indicate that overall CSL binds both DNA sites in a similar manner; however, minor changes are observed in both the conformation of CSL and DNA. Taken together, our results provide a quantitative and biophysical basis for understanding how CSL interacts with DNA sites in vivo.« less

  7. Role of UME6 in transcriptional regulation of a DNA repair gene in Saccharomyces cerevisiae.

    PubMed

    Sweet, D H; Jang, Y K; Sancar, G B

    1997-11-01

    In Saccharomyces cerevisiae UV radiation and a variety of chemical DNA-damaging agents induce the transcription of specific genes, including several involved in DNA repair. One of the best characterized of these genes is PHR1, which encodes the apoenzyme for DNA photolyase. Basal-level and damage-induced expression of PHR1 require an upstream activation sequence, UAS(PHR1), which has homology with DRC elements found upstream of at least 19 other DNA repair and DNA metabolism genes in yeast. Here we report the identification of the UME6 gene of S. cerevisiae as a regulator of UAS(PHR1) activity. Multiple copies of UME6 stimulate expression from UAS(PHR1) and the intact PHR1 gene. Surprisingly, the effect of deletion of UME6 is growth phase dependent. In wild-type cells PHR1 is induced in late exponential phase, concomitant with the initiation of glycogen accumulation that precedes the diauxic shift. Deletion of UME6 abolishes this induction, decreases the steady-state concentration of photolyase molecules and PHR1 mRNA, and increases the UV sensitivity of a rad2 mutant. Despite the fact that UAS(PHR1) does not contain the URS1 sequence, which has been previously implicated in UME6-mediated transcriptional regulation, we find that Ume6p binds to UAS(PHR1) with an affinity and a specificity similar to those seen for a URS1 site. Similar binding is also seen for DRC elements from RAD2, RAD7, and RAD53, suggesting that UME6 contributes to the regulated expression of a subset of damage-responsive genes in yeast.

  8. High-Mobility Group Chromatin Proteins 1 and 2 Functionally Interact with Steroid Hormone Receptors To Enhance Their DNA Binding In Vitro and Transcriptional Activity in Mammalian Cells

    PubMed Central

    Boonyaratanakornkit, Viroj; Melvin, Vida; Prendergast, Paul; Altmann, Magda; Ronfani, Lorenza; Bianchi, Marco E.; Taraseviciene, Laima; Nordeen, Steven K.; Allegretto, Elizabeth A.; Edwards, Dean P.

    1998-01-01

    We previously reported that the chromatin high-mobility group protein 1 (HMG-1) enhances the sequence-specific DNA binding activity of progesterone receptor (PR) in vitro, thus providing the first evidence that HMG-1 may have a coregulatory role in steroid receptor-mediated gene transcription. Here we show that HMG-1 and the highly related HMG-2 stimulate DNA binding by other steroid receptors, including estrogen, androgen, and glucocorticoid receptors, but have no effect on DNA binding by several nonsteroid nuclear receptors, including retinoid acid receptor (RAR), retinoic X receptor (RXR), and vitamin D receptor (VDR). As highly purified recombinant full-length proteins, all steroid receptors tested exhibited weak binding affinity for their optimal palindromic hormone response elements (HREs), and the addition of purified HMG-1 or -2 substantially increased their affinity for HREs. Purified RAR, RXR, and VDR also exhibited little to no detectable binding to their cognate direct repeat HREs but, in contrast to results with steroid receptors, the addition of HMG-1 or HMG-2 had no stimulatory effect. Instead, the addition of purified RXR enhanced RAR and VDR DNA binding through a heterodimerization mechanism and HMG-1 or HMG-2 had no further effect on DNA binding by RXR-RAR or RXR-VDR heterodimers. HMG-1 and HMG-2 (HMG-1/-2) themselves do not bind to progesterone response elements, but in the presence of PR they were detected as part of an HMG-PR-DNA ternary complex. HMG-1/-2 can also interact transiently in vitro with PR in the absence of DNA; however, no direct protein interaction was detected with VDR. These results, taken together with the fact that PR can bend its target DNA and that HMG-1/-2 are non-sequence-specific DNA binding proteins that recognize DNA structure, suggest that HMG-1/-2 are recruited to the PR-DNA complex by the combined effect of transient protein interaction and DNA bending. In transient-transfection assays, coexpression of HMG-1 or HMG-2 increased PR-mediated transcription in mammalian cells by as much as 7- to 10-fold without altering the basal promoter activity of target reporter genes. This increase in PR-mediated gene activation by coexpression of HMG-1/-2 was observed in different cell types and with different target promoters, suggesting a generality to the functional interaction between HMG-1/-2 and PR in vivo. Cotransfection of HMG-1 also increased reporter gene activation mediated by other steroid receptors, including glucocorticoid and androgen receptors, but it had a minimal influence on VDR-dependent transcription in vivo. These results support the conclusion that HMG-1/-2 are coregulatory proteins that increase the DNA binding and transcriptional activity of the steroid hormone class of receptors but that do not functionally interact with certain nonsteroid classes of nuclear receptors. PMID:9671457

  9. c-Ski inhibits the TGF-beta signaling pathway through stabilization of inactive Smad complexes on Smad-binding elements.

    PubMed

    Suzuki, Hiroyuki; Yagi, Ken; Kondo, Miki; Kato, Mitsuyasu; Miyazono, Kohei; Miyazawa, Keiji

    2004-06-24

    c-Ski inhibits transforming growth factor-beta (TGF-beta) signaling through interaction with Smad proteins. c-Ski represses Smad-mediated transcriptional activation, probably through its action as a transcriptional co-repressor. c-Ski also inhibits TGF-beta-induced downregulation of genes such as c-myc. However, mechanisms for transcriptional regulation of target genes by c-Ski have not been fully determined. In this study, we examined how c-Ski inhibits both TGF-beta-induced transcriptional activation and repression. DNA-affinity precipitation analysis revealed that c-Ski enhances the binding of Smad2 and 4, and to a lesser extent Smad3, to both CAGA and TGF-beta1 inhibitory element probes. A c-Ski mutant, which is unable to interact with Smad4, failed to enhance the binding of Smad complex on these probes and to inhibit the Smad-responsive promoter. These results suggest that stabilization of inactive Smad complexes on DNA is a critical event in c-Ski-mediated inhibition of TGF-beta signaling.

  10. Transcriptional regulation of hepatic lipogenesis.

    PubMed

    Wang, Yuhui; Viscarra, Jose; Kim, Sun-Joong; Sul, Hei Sook

    2015-11-01

    Fatty acid and fat synthesis in the liver is a highly regulated metabolic pathway that is important for very low-density lipoprotein (VLDL) production and thus energy distribution to other tissues. Having common features at their promoter regions, lipogenic genes are coordinately regulated at the transcriptional level. Transcription factors, such as upstream stimulatory factors (USFs), sterol regulatory element-binding protein 1C (SREBP1C), liver X receptors (LXRs) and carbohydrate-responsive element-binding protein (ChREBP) have crucial roles in this process. Recently, insights have been gained into the signalling pathways that regulate these transcription factors. After feeding, high blood glucose and insulin levels activate lipogenic genes through several pathways, including the DNA-dependent protein kinase (DNA-PK), atypical protein kinase C (aPKC) and AKT-mTOR pathways. These pathways control the post-translational modifications of transcription factors and co-regulators, such as phosphorylation, acetylation or ubiquitylation, that affect their function, stability and/or localization. Dysregulation of lipogenesis can contribute to hepatosteatosis, which is associated with obesity and insulin resistance.

  11. RNA from the 5' end of the R2 retrotransposon controls R2 protein binding to and cleavage of its DNA target site.

    PubMed

    Christensen, Shawn M; Ye, Junqiang; Eickbush, Thomas H

    2006-11-21

    Non-LTR retrotransposons insert into eukaryotic genomes by target-primed reverse transcription (TPRT), a process in which cleaved DNA targets are used to prime reverse transcription of the element's RNA transcript. Many of the steps in the integration pathway of these elements can be characterized in vitro for the R2 element because of the rigid sequence specificity of R2 for both its DNA target and its RNA template. R2 retrotransposition involves identical subunits of the R2 protein bound to different DNA sequences upstream and downstream of the insertion site. The key determinant regulating which DNA-binding conformation the protein adopts was found to be a 320-nt RNA sequence from near the 5' end of the R2 element. In the absence of this 5' RNA the R2 protein binds DNA sequences upstream of the insertion site, cleaves the first DNA strand, and conducts TPRT when RNA containing the 3' untranslated region of the R2 transcript is present. In the presence of the 320-nt 5' RNA, the R2 protein binds DNA sequences downstream of the insertion site. Cleavage of the second DNA strand by the downstream subunit does not appear to occur until after the 5' RNA is removed from this subunit. We postulate that the removal of the 5' RNA normally occurs during reverse transcription, and thus provides a critical temporal link to first- and second-strand DNA cleavage in the R2 retrotransposition reaction.

  12. The long (LINEs) and the short (SINEs) of it: altered methylation as a precursor to toxicity.

    PubMed

    Carnell, Ammie N; Goodman, Jay I

    2003-10-01

    Although once thought of as "junk" DNA, the importance of interspersed elements in the genome has become increasingly appreciated in recent years. In a broad sense these are collectively referred to as transposable elements, which encompass both transposons and retrotransposons. The latter include long interspersed nuclear elements (LINEs) and short interspersed nuclear elements (SINEs). Expression of these elements leads to genetic instability. Therefore, it is important that they remain transcriptionally silenced, and DNA methylation plays a key role in this regard. A framework for understanding the possible interplay between altered DNA methylation, an epigenetic change, and mutational events is presented. A case is made as to how retrotransposable elements, specifically LINEs and SINEs, are likely to emerge as key players in furthering our understanding of mechanisms underlying a variety of toxicities, including carcinogenesis but not limited to this endpoint.

  13. Influence of Heavy Metal Stress on Antioxidant Status and DNA Damage in Urtica dioica

    PubMed Central

    Kadifkova Panovska, Tatjana; Bačeva, Katerina; Stafilov, Trajče

    2013-01-01

    Heavy metals have the potential to interact and induce several stress responses in the plants; thus, effects of heavy metal stress on DNA damages and total antioxidants level in Urtica dioica leaves and stems were investigated. The samples are sampled from areas with different metal exposition. Metal content was analyzed by Inductively Coupled Plasma-Atomic Emission Spectrometer (ICP-AES), for total antioxidants level assessment the Ferric-Reducing Antioxidant Power (FRAP) assay was used, and genomic DNA isolation from frozen plant samples was performed to obtain DNA fingerprints of investigated plant. It was found that heavy metal contents in stems generally changed synchronously with those in leaves of the plant, and extraneous metals led to imbalance of mineral nutrient elements. DNA damages were investigated by Random Amplified Polymorphic DNA (RAPD) technique, and the results demonstrated that the samples exposed to metals yielded a large number of new fragments (total 12) in comparison with the control sample. This study showed that DNA stability is highly affected by metal pollution which was identified by RAPD markers. Results suggested that heavy metal stress influences antioxidant status and also induces DNA damages in U. dioica which may help to understand the mechanisms of metals genotoxicity. PMID:23862140

  14. Synergism between a half-site and an imperfect estrogen-responsive element, and cooperation with COUP-TFI are required for estrogen receptor (ER) to achieve a maximal estrogen-stimulation of rainbow trout ER gene.

    PubMed

    Petit, F G; Métivier, R; Valotaire, Y; Pakdel, F

    1999-01-01

    In all oviparous, liver represents one of the main E2-target tissues where estrogen receptor (ER) constitutes the key mediator of estrogen action. The rainbow trout estrogen receptor (rtER) gene expression is markedly up-regulated by estrogens and the sequences responsible for this autoregulation have been located in a 0.2 kb upstream transcription start site within - 40/- 248 enhancer region. Absence of interference with steroid hormone receptors and tissue-specific factors and a conserved basal transcriptional machinery between yeast and higher eukaryotes, make yeast a simple assay system that will enable determination of important cis-acting regulatory sequences within rtER gene promoter and identification of transcription factors implicated in the regulation of this gene. Deletion analysis allowed to show a synergistic effect between an imperfect estrogen-responsive element (ERE) and a consensus half-ERE to achieve a high hormone-dependent transcriptional activation of the rtER gene promoter in the presence of stably expressed rtER. As in mammalian cells, here we observed a positive regulation of the rtER gene promoter by the chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI) through enhancing autoregulation. Using a point mutation COUP-TFI mutant unable to bind DNA demonstrates that enhancement of rtER gene autoregulation requires the interaction of COUP-TFI to the DNA. Moreover, this enhancement of transcriptional activation by COUP-TFI requires specifically the AF-1 transactivation function of ER and can be observed in the presence of E2 or 4-hydroxytamoxifen but not ICI 164384. Thus, this paper describes the reconstitution of a hormone-responsive transcription unit in yeast in which the regulation of rtER gene promoter could be enhanced by the participation of cis-elements and/or trans-acting factors, such as ER itself or COUP-TF.

  15. Interactions between the R2R3-MYB Transcription Factor, AtMYB61, and Target DNA Binding Sites

    PubMed Central

    Prouse, Michael B.; Campbell, Malcolm M.

    2013-01-01

    Despite the prominent roles played by R2R3-MYB transcription factors in the regulation of plant gene expression, little is known about the details of how these proteins interact with their DNA targets. For example, while Arabidopsis thaliana R2R3-MYB protein AtMYB61 is known to alter transcript abundance of a specific set of target genes, little is known about the specific DNA sequences to which AtMYB61 binds. To address this gap in knowledge, DNA sequences bound by AtMYB61 were identified using cyclic amplification and selection of targets (CASTing). The DNA targets identified using this approach corresponded to AC elements, sequences enriched in adenosine and cytosine nucleotides. The preferred target sequence that bound with the greatest affinity to AtMYB61 recombinant protein was ACCTAC, the AC-I element. Mutational analyses based on the AC-I element showed that ACC nucleotides in the AC-I element served as the core recognition motif, critical for AtMYB61 binding. Molecular modelling predicted interactions between AtMYB61 amino acid residues and corresponding nucleotides in the DNA targets. The affinity between AtMYB61 and specific target DNA sequences did not correlate with AtMYB61-driven transcriptional activation with each of the target sequences. CASTing-selected motifs were found in the regulatory regions of genes previously shown to be regulated by AtMYB61. Taken together, these findings are consistent with the hypothesis that AtMYB61 regulates transcription from specific cis-acting AC elements in vivo. The results shed light on the specifics of DNA binding by an important family of plant-specific transcriptional regulators. PMID:23741471

  16. Isolation and functional characterization of CE1 binding proteins.

    PubMed

    Lee, Sun-ji; Park, Ji Hye; Lee, Mi Hun; Yu, Ji-hyun; Kim, Soo Young

    2010-12-16

    Abscisic acid (ABA) is a plant hormone that controls seed germination, protective responses to various abiotic stresses and seed maturation. The ABA-dependent processes entail changes in gene expression. Numerous genes are regulated by ABA, and promoter analyses of the genes revealed that cis-elements sharing the ACGTGGC consensus sequence are ubiquitous among ABA-regulated gene promoters. The importance of the core sequence, which is generally known as ABA response element (ABRE), has been demonstrated by various experiments, and its cognate transcription factors known as ABFs/AREBs have been identified. Although necessary, ABRE alone is not sufficient, and another cis-element known as "coupling element (CE)" is required for full range ABA-regulation of gene expression. Several CEs are known. However, despite their importance, the cognate transcription factors mediating ABA response via CEs have not been reported to date. Here, we report the isolation of transcription factors that bind one of the coupling elements, CE1. To isolate CE1 binding proteins, we carried out yeast one-hybrid screens. Reporter genes containing a trimer of the CE1 element were prepared and introduced into a yeast strain. The yeast was transformed with library DNA that represents RNA isolated from ABA-treated Arabidopsis seedlings. From the screen of 3.6 million yeast transformants, we isolated 78 positive clones. Analysis of the clones revealed that a group of AP2/ERF domain proteins binds the CE1 element. We investigated their expression patterns and analyzed their overexpression lines to investigate the in vivo functions of the CE element binding factors (CEBFs). Here, we show that one of the CEBFs, AtERF13, confers ABA hypersensitivity in Arabidopsis, whereas two other CEBFs enhance sugar sensitivity. Our results indicate that a group of AP2/ERF superfamily proteins interacts with CE1. Several CEBFs are known to mediate defense or abiotic stress response, but the physiological functions of other CEBFs remain to be determined. Our in vivo functional analysis of several CEBFs suggests that they are likely to be involved in ABA and/or sugar response. Together with previous results reported by others, our current data raise an interesting possibility that the coupling element CE1 may function not only as an ABRE but also as an element mediating biotic and abiotic stress responses.

  17. Ribosome Synthesis and MAPK Activity Modulate Ionizing Radiation-Induced Germ Cell Apoptosis in Caenorhabditis elegans

    PubMed Central

    Eberhard, Ralf; Stergiou, Lilli; Hofmann, E. Randal; Hofmann, Jen; Haenni, Simon; Teo, Youjin; Furger, André; Hengartner, Michael O.

    2013-01-01

    Synthesis of ribosomal RNA by RNA polymerase I (RNA pol I) is an elemental biological process and is key for cellular homeostasis. In a forward genetic screen in C. elegans designed to identify DNA damage-response factors, we isolated a point mutation of RNA pol I, rpoa-2(op259), that leads to altered rRNA synthesis and a concomitant resistance to ionizing radiation (IR)-induced germ cell apoptosis. This weak apoptotic IR response could be phenocopied when interfering with other factors of ribosome synthesis. Surprisingly, despite their resistance to DNA damage, rpoa-2(op259) mutants present a normal CEP-1/p53 response to IR and increased basal CEP-1 activity under normal growth conditions. In parallel, rpoa-2(op259) leads to reduced Ras/MAPK pathway activity, which is required for germ cell progression and physiological germ cell death. Ras/MAPK gain-of-function conditions could rescue the IR response defect in rpoa-2(op259), pointing to a function for Ras/MAPK in modulating DNA damage-induced apoptosis downstream of CEP-1. Our data demonstrate that a single point mutation in an RNA pol I subunit can interfere with multiple key signalling pathways. Ribosome synthesis and growth-factor signalling are perturbed in many cancer cells; such an interplay between basic cellular processes and signalling might be critical for how tumours evolve or respond to treatment. PMID:24278030

  18. Genomic organization of the Neurospora crassa gsn gene: possible involvement of the STRE and HSE elements in the modulation of transcription during heat shock.

    PubMed

    Freitas, F Zanolli; Bertolini, M C

    2004-12-01

    Glycogen synthase, an enzyme involved in glycogen biosynthesis, is regulated by phosphorylation and by the allosteric ligand glucose-6-phosphate (G6P). In addition, enzyme levels can be regulated by changes in gene expression. We recently cloned a cDNA for glycogen synthase ( gsn) from Neurospora crassa, and showed that gsn transcription decreased when cells were exposed to heat shock (shifted from 30 degrees C to 45 degrees C). In order to understand the mechanisms that control gsn expression, we isolated the gene, including its 5' and 3' flanking regions, from the genome of N. crassa. An ORF of approximately 2.4 kb was identified, which is interrupted by four small introns (II-V). Intron I (482 bp) is located in the 5'UTR region. Three putative Transcription Initiation Sites (TISs) were mapped, one of which lies downstream of a canonical TATA-box sequence (5'-TGTATAAA-3'). Analysis of the 5'-flanking region revealed the presence of putative transcription factor-binding sites, including Heat Shock Elements (HSEs) and STress Responsive Elements (STREs). The possible involvement of these motifs in the negative regulation of gsn transcription was investigated using Electrophoretic Mobility Shift Assays (EMSA) with nuclear extracts of N. crassa mycelium obtained before and after heat shock, and DNA fragments encompassing HSE and STRE elements from the 5'-flanking region. While elements within the promoter region are involved in transcription under heat shock, elements in the 5'UTR intron may participate in transcription during vegetative growth. The results thus suggest that N. crassa possesses trans -acting elements that interact with the 5'-flanking region to regulate gsn transcription during heat shock and vegetative growth.

  19. Complementation of a red-light-indifferent cyanobacterial mutant.

    PubMed Central

    Chiang, G G; Schaefer, M R; Grossman, A R

    1992-01-01

    Many cyanobacteria alter their phycobilisome composition in response to changes in light wavelength in a process termed complementary chromatic adaptation. Mutant strains FdR1 and FdR2 of the filamentous cyanobacterium Fremyella diplosiphon are characterized by aberrant chromatic adaptation. Instead of adjusting to different wavelengths of light, FdR1 and FdR2 behave as if they are always in green light; they do not respond to red light. We have previously reported complementation of FdR1 by conjugal transfer of a wild-type genomic library. The complementing DNA has now been localized by genetic analysis to a region on the rescued genomic subclone that contains a gene designated rcaC. This region of DNA is also able to complement FdR2. Southern blot analysis of genomic DNA from FdR1 and FdR2 indicates that these strains harbor DNA insertions within the rcaC sequence that may have resulted from the activity of transposable genetic elements. The predicted amino acid sequence of RcaC shares strong identity to response regulators of bacterial two-component regulatory systems. This relationship is discussed in the context of the signal-transduction pathway mediating regulation of genes encoding phycobilisome polypeptides during chromatic adaptation. Images PMID:1409650

  20. The coactivator CBP stimulates human T-cell lymphotrophic virus type I Tax transactivation in vitro.

    PubMed

    Kashanchi, F; Duvall, J F; Kwok, R P; Lundblad, J R; Goodman, R H; Brady, J N

    1998-12-18

    Tax interacts with the cellular cyclic AMP-responsive element binding protein (CREB) and facilitates the binding of the coactivator CREB binding protein (CBP), forming a multimeric complex on the cyclic AMP-responsive element (CRE)-like sites in the human T-cell lymphotrophic virus type I (HTLV-I) promoter. The trimeric complex is believed to recruit additional regulatory proteins to the HTLV-I long terminal repeat, but there has been no direct evidence that CBP is required for Tax-mediated transactivation. We present evidence that Tax and CBP activate transcription from the HTLV-I 21 base pair repeats on naked DNA templates. Transcriptional activation of the HTLV-I sequences required both Tax and CBP and could be mediated by either the N-terminal activation domain of CBP or the full-length protein. Fluorescence polarization binding assays indicated that CBP does not markedly enhance the affinity of Tax for the trimeric complex. Transcription analyses suggest that CBP activates Tax-dependent transcription by promoting transcriptional initiation and reinitiation. The ability of CBP to activate the HTLV-I promoter does not involve the stabilization of Tax binding, but rather depends upon gene activation properties of the co-activator that function in the context of a naked DNA template.

  1. Co-evolution of plant LTR-retrotransposons and their host genomes.

    PubMed

    Zhao, Meixia; Ma, Jianxin

    2013-07-01

    Transposable elements (TEs), particularly, long terminal repeat retrotransposons (LTR-RTs), are the most abundant DNA components in all plant species that have been investigated, and are largely responsible for plant genome size variation. Although plant genomes have experienced periodic proliferation and/or recent burst of LTR-retrotransposons, the majority of LTR-RTs are inactivated by DNA methylation and small RNA-mediated silencing mechanisms, and/or were deleted/truncated by unequal homologous recombination and illegitimate recombination, as suppression mechanisms that counteract genome expansion caused by LTR-RT amplification. LTR-RT DNA is generally enriched in pericentromeric regions of the host genomes, which appears to be the outcomes of preferential insertions of LTR-RTs in these regions and low effectiveness of selection that purges LTR-RT DNA from these regions relative to chromosomal arms. Potential functions of various TEs in their host genomes remain blurry; nevertheless, LTR-RTs have been recognized to play important roles in maintaining chromatin structures and centromere functions and regulation of gene expressions in their host genomes.

  2. The influence of repressor DNA binding site architecture on transcriptional control.

    PubMed

    Park, Dan M; Kiley, Patricia J

    2014-08-26

    How the architecture of DNA binding sites dictates the extent of repression of promoters is not well understood. Here, we addressed the importance of the number and information content of the three direct repeats (DRs) in the binding and repression of the icdA promoter by the phosphorylated form of the global Escherichia coli repressor ArcA (ArcA-P). We show that decreasing the information content of the two sites with the highest information (DR1 and DR2) eliminated ArcA binding to all three DRs and ArcA repression of icdA. Unexpectedly, we also found that DR3 occupancy functions principally in repression, since mutation of this low-information-content site both eliminated DNA binding to DR3 and significantly weakened icdA repression, despite the fact that binding to DR1 and DR2 was intact. In addition, increasing the information content of any one of the three DRs or addition of a fourth DR increased ArcA-dependent repression but perturbed signal-dependent regulation of repression. Thus, our data show that the information content and number of DR elements are critical architectural features for maintaining a balance between high-affinity binding and signal-dependent regulation of icdA promoter function in response to changes in ArcA-P levels. Optimization of such architectural features may be a common strategy to either dampen or enhance the sensitivity of DNA binding among the members of the large OmpR/PhoB family of regulators as well as other transcription factors. In Escherichia coli, the response regulator ArcA maintains homeostasis of redox carriers under O2-limiting conditions through a comprehensive repression of carbon oxidation pathways that require aerobic respiration to recycle redox carriers. Although a binding site architecture comprised of a variable number of sequence recognition elements has been identified within the promoter regions of ArcA-repressed operons, it is unclear how this variable architecture dictates transcriptional regulation. By dissecting the role of multiple sequence elements within the icdA promoter, we provide insight into the design principles that allow ArcA to repress transcription within diverse promoter contexts. Our data suggest that the arrangement of recognition elements is tailored to achieve sufficient repression of a given promoter while maintaining appropriate signal-dependent regulation of repression, providing insight into how diverse binding site architectures link changes in O2 with the fine-tuning of carbon oxidation pathway levels. Copyright © 2014 Park and Kiley.

  3. Extended HSR/CARD domain mediates AIRE binding to DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maslovskaja, Julia, E-mail: julia.maslovskaja@ut.ee; Saare, Mario; Liiv, Ingrid

    Autoimmune regulator (AIRE) activates the transcription of many genes in an unusual promiscuous and stochastic manner. The mechanism by which AIRE binds to the chromatin and DNA is not fully understood, and the regulatory elements that AIRE target genes possess are not delineated. In the current study, we demonstrate that AIRE activates the expression of transiently transfected luciferase reporters that lack defined promoter regions, as well as intron and poly(A) signal sequences. Our protein-DNA interaction experiments with mutated AIRE reveal that the intact homogeneously staining region/caspase recruitment domain (HSR/CARD) and amino acids R113 and K114 are key elements involved inmore » AIRE binding to DNA. - Highlights: • Promoter and mRNA processing elements are not important for AIRE to activate gene expression from reporter plasmids. • AIRE protein fragment aa 1–138 mediates direct binding to DNA. • Integrity of the HSR/CARD domain is needed for AIRE binding to DNA.« less

  4. Interplay between DNA methylation, histone modification and chromatin remodeling in stem cells and during development.

    PubMed

    Ikegami, Kohta; Ohgane, Jun; Tanaka, Satoshi; Yagi, Shintaro; Shiota, Kunio

    2009-01-01

    Genes constitute only a small proportion of the mammalian genome, the majority of which is composed of non-genic repetitive elements including interspersed repeats and satellites. A unique feature of the mammalian genome is that there are numerous tissue-dependent, differentially methylated regions (T-DMRs) in the non-repetitive sequences, which include genes and their regulatory elements. The epigenetic status of T-DMRs varies from that of repetitive elements and constitutes the DNA methylation profile genome-wide. Since the DNA methylation profile is specific to each cell and tissue type, much like a fingerprint, it can be used as a means of identification. The formation of DNA methylation profiles is the basis for cell differentiation and development in mammals. The epigenetic status of each T-DMR is regulated by the interplay between DNA methyltransferases, histone modification enzymes, histone subtypes, non-histone nuclear proteins and non-coding RNAs. In this review, we will discuss how these epigenetic factors cooperate to establish cell- and tissue-specific DNA methylation profiles.

  5. Selective Amplification of SPR Biosensor Signal for Recognition of rpoB Gene Fragments by Use of Gold Nanoparticles Modified by Thiolated DNA

    NASA Astrophysics Data System (ADS)

    Matsishin, M.; Rachkov, A.; Lopatynskyi, A.; Chegel, V.; Soldatkin, A.; El'skaya, A.

    2017-04-01

    An experimental approach for improving the sensitivity of the surface plasmon resonance (SPR) DNA hybridization sensor using gold nanoparticles (GNPs), modified by specific oligonucleotides, was elaborated. An influence of the ionic strength on the aggregation stability of unmodified GNPs and GNPs modified by the thiolated oligonucleotides was investigated by monitoring a value of light extinction at 520 nm that can be considered as a measure of a quantity of the non-aggregated GNPs. While the unmodified GNPs started to aggregate in 0.2 × saline-sodium citrate (SSC), GNPs modified by the negatively charged oligonucleotides were more stable at increasing ionic strength up to 0.5 × SSC. A bioselective element of the SPR DNA hybridization sensor was formed by immobilization on the gold sensor surface of the thiolated oligonucleotides P2, the sequence of which is a fragment of the rpoB gene of Mycobacterium tuberculosis. The injections into the measuring flow cell of the SPR spectrometer of various concentrations of GNPs modified by the complementary oligonucleotides T2-18m caused the pronounced concentration-dependent sequence-specific sensor responses. The magnitude of the sensor responses was much higher than in the case of the free standing complementary oligonucleotides. According to the obtained experimental data, the usage of GNPs modified by specific oligonucleotides can amplify the sensor response of the SPR DNA hybridization sensor in 1200 times.

  6. Alteration of gene expression in human hepatocellular carcinoma with integrated hepatitis B virus DNA.

    PubMed

    Tamori, Akihiro; Yamanishi, Yoshihiro; Kawashima, Shuichi; Kanehisa, Minoru; Enomoto, Masaru; Tanaka, Hiromu; Kubo, Shoji; Shiomi, Susumu; Nishiguchi, Shuhei

    2005-08-15

    Integration of hepatitis B virus (HBV) DNA into the human genome is one of the most important steps in HBV-related carcinogenesis. This study attempted to find the link between HBV DNA, the adjoining cellular sequence, and altered gene expression in hepatocellular carcinoma (HCC) with integrated HBV DNA. We examined 15 cases of HCC infected with HBV by cassette ligation-mediated PCR. The human DNA adjacent to the integrated HBV DNA was sequenced. Protein coding sequences were searched for in the human sequence. In five cases with HBV DNA integration, from which good quality RNA was extracted, gene expression was examined by cDNA microarray analysis. The human DNA sequence successive to integrated HBV DNA was determined in the 15 HCCs. Eight protein-coding regions were involved: ras-responsive element binding protein 1, calmodulin 1, mixed lineage leukemia 2 (MLL2), FLJ333655, LOC220272, LOC255345, LOC220220, and LOC168991. The MLL2 gene was expressed in three cases with HBV DNA integrated into exon 3 of MLL2 and in one case with HBV DNA integrated into intron 3 of MLL2. Gene expression analysis suggested that two HCCs with HBV integrated into MLL2 had similar patterns of gene expression compared with three HCCs with HBV integrated into other loci of human chromosomes. HBV DNA was integrated at random sites of human DNA, and the MLL2 gene was one of the targets for integration. Our results suggest that HBV DNA might modulate human genes near integration sites, followed by integration site-specific expression of such genes during hepatocarcinogenesis.

  7. Transcriptional and post-transcriptional regulation of the ionizing radiation response by ATM and p53

    PubMed Central

    Venkata Narayanan, Ishwarya; Paulsen, Michelle T.; Bedi, Karan; Berg, Nathan; Ljungman, Emily A.; Francia, Sofia; Veloso, Artur; Magnuson, Brian; di Fagagna, Fabrizio d’Adda; Wilson, Thomas E.; Ljungman, Mats

    2017-01-01

    In response to ionizing radiation (IR), cells activate a DNA damage response (DDR) pathway to re-program gene expression. Previous studies using total cellular RNA analyses have shown that the stress kinase ATM and the transcription factor p53 are integral components required for induction of IR-induced gene expression. These studies did not distinguish between changes in RNA synthesis and RNA turnover and did not address the role of enhancer elements in DDR-mediated transcriptional regulation. To determine the contribution of synthesis and degradation of RNA and monitor the activity of enhancer elements following exposure to IR, we used the recently developed Bru-seq, BruChase-seq and BruUV-seq techniques. Our results show that ATM and p53 regulate both RNA synthesis and stability as well as enhancer element activity following exposure to IR. Importantly, many genes in the p53-signaling pathway were coordinately up-regulated by both increased synthesis and RNA stability while down-regulated genes were suppressed either by reduced synthesis or stability. Our study is the first of its kind that independently assessed the effects of ionizing radiation on transcription and post-transcriptional regulation in normal human cells. PMID:28256581

  8. Mapping the Structural and Dynamical Features of Multiple p53 DNA Binding Domains: Insights into Loop 1 Intrinsic Dynamics

    PubMed Central

    Lukman, Suryani; Lane, David P.; Verma, Chandra S.

    2013-01-01

    The transcription factor p53 regulates cellular integrity in response to stress. p53 is mutated in more than half of cancerous cells, with a majority of the mutations localized to the DNA binding domain (DBD). In order to map the structural and dynamical features of the DBD, we carried out multiple copy molecular dynamics simulations (totaling 0.8 μs). Simulations show the loop 1 to be the most dynamic element among the DNA-contacting loops (loops 1-3). Loop 1 occupies two major conformational states: extended and recessed; the former but not the latter displays correlations in atomic fluctuations with those of loop 2 (~24 Å apart). Since loop 1 binds to the major groove whereas loop 2 binds to the minor groove of DNA, our results begin to provide some insight into the possible mechanism underpinning the cooperative nature of DBD binding to DNA. We propose (1) a novel mechanism underlying the dynamics of loop 1 and the possible tread-milling of p53 on DNA and (2) possible mutations on loop 1 residues to restore the transcriptional activity of an oncogenic mutation at a distant site. PMID:24324553

  9. Whole DNA methylome profiling in mice exposed to secondhand smoke.

    PubMed

    Tommasi, Stella; Zheng, Albert; Yoon, Jae-In; Li, Arthur Xuejun; Wu, Xiwei; Besaratinia, Ahmad

    2012-11-01

    Aberration of DNA methylation is a prime epigenetic mechanism of carcinogenesis. Aberrant DNA methylation occurs frequently in lung cancer, with exposure to secondhand smoke (SHS) being an established risk factor. The causal role of SHS in the genesis of lung cancer, however, remains elusive. To investigate whether SHS can cause aberrant DNA methylation in vivo, we have constructed the whole DNA methylome in mice exposed to SHS for a duration of 4 mo, both after the termination of exposure and at ensuing intervals post-exposure (up to 10 mo). Our genome-wide and gene-specific profiling of DNA methylation in the lung of SHS-exposed mice revealed that all groups of SHS-exposed mice and controls share a similar pattern of DNA methylation. Furthermore, the methylation status of major repetitive DNA elements, including long-interspersed nuclear elements (LINE L1), intracisternal A particle long-terminal repeat retrotransposons (IAP-LTR), and short-interspersed nuclear elements (SINE B1), in the lung of all groups of SHS-exposed mice and controls remains comparable. The absence of locus-specific gain of DNA methylation and global loss of DNA methylation in the lung of SHS-exposed mice within a timeframe that precedes neoplastic-lesion formation underscore the challenges of lung cancer biomarker development. Identifying the initiating events that cause aberrant DNA methylation in lung carcinogenesis may help improve future strategies for prevention, early detection and treatment of this highly lethal disease.

  10. FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements) isolates active regulatory elements from human chromatin

    PubMed Central

    Giresi, Paul G.; Kim, Jonghwan; McDaniell, Ryan M.; Iyer, Vishwanath R.; Lieb, Jason D.

    2007-01-01

    DNA segments that actively regulate transcription in vivo are typically characterized by eviction of nucleosomes from chromatin and are experimentally identified by their hypersensitivity to nucleases. Here we demonstrate a simple procedure for the isolation of nucleosome-depleted DNA from human chromatin, termed FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements). To perform FAIRE, chromatin is crosslinked with formaldehyde in vivo, sheared by sonication, and phenol-chloroform extracted. The DNA recovered in the aqueous phase is fluorescently labeled and hybridized to a DNA microarray. FAIRE performed in human cells strongly enriches DNA coincident with the location of DNaseI hypersensitive sites, transcriptional start sites, and active promoters. Evidence for cell-type–specific patterns of FAIRE enrichment is also presented. FAIRE has utility as a positive selection for genomic regions associated with regulatory activity, including regions traditionally detected by nuclease hypersensitivity assays. PMID:17179217

  11. Structures of apo IRF-3 and IRF-7 DNA binding domains: effect of loop L1 on DNA binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    De Ioannes, Pablo; Escalante, Carlos R.; Aggarwal, Aneel K.

    2013-11-20

    Interferon regulatory factors IRF-3 and IRF-7 are transcription factors essential in the activation of interferon-{beta} (IFN-{beta}) gene in response to viral infections. Although, both proteins recognize the same consensus IRF binding site AANNGAAA, they have distinct DNA binding preferences for sites in vivo. The X-ray structures of IRF-3 and IRF-7 DNA binding domains (DBDs) bound to IFN-{beta} promoter elements revealed flexibility in the loops (L1-L3) and the residues that make contacts with the target sequence. To characterize the conformational changes that occur on DNA binding and how they differ between IRF family members, we have solved the X-ray structures ofmore » IRF-3 and IRF-7 DBDs in the absence of DNA. We found that loop L1, carrying the conserved histidine that interacts with the DNA minor groove, is disordered in apo IRF-3 but is ordered in apo IRF-7. This is reflected in differences in DNA binding affinities when the conserved histidine in loop L1 is mutated to alanine in the two proteins. The stability of loop L1 in IRF-7 derives from a unique combination of hydrophobic residues that pack against the protein core. Together, our data show that differences in flexibility of loop L1 are an important determinant of differential IRF-DNA binding.« less

  12. Destruction of a distal hypoxia response element abolishes trans-activation of the PAG1 gene mediated by HIF-independent chromatin looping.

    PubMed

    Schörg, Alexandra; Santambrogio, Sara; Platt, James L; Schödel, Johannes; Lindenmeyer, Maja T; Cohen, Clemens D; Schrödter, Katrin; Mole, David R; Wenger, Roland H; Hoogewijs, David

    2015-07-13

    A crucial step in the cellular adaptation to oxygen deficiency is the binding of hypoxia-inducible factors (HIFs) to hypoxia response elements (HREs) of oxygen-regulated genes. Genome-wide HIF-1α/2α/β DNA-binding studies revealed that the majority of HREs reside distant to the promoter regions, but the function of these distal HREs has only been marginally studied in the genomic context. We used chromatin immunoprecipitation (ChIP), gene editing (TALEN) and chromosome conformation capture (3C) to localize and functionally characterize a 82 kb upstream HRE that solely drives oxygen-regulated expression of the newly identified HIF target gene PAG1. PAG1, a transmembrane adaptor protein involved in Src signalling, was hypoxically induced in various cell lines and mouse tissues. ChIP and reporter gene assays demonstrated that the -82 kb HRE regulates PAG1, but not an equally distant gene further upstream, by direct interaction with HIF. Ablation of the consensus HRE motif abolished the hypoxic induction of PAG1 but not general oxygen signalling. 3C assays revealed that the -82 kb HRE physically associates with the PAG1 promoter region, independent of HIF-DNA interaction. These results demonstrate a constitutive interaction between the -82 kb HRE and the PAG1 promoter, suggesting a physiologically important rapid response to hypoxia. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Isolation and characterization of a water stress-specific genomic gene, pwsi 18, from rice.

    PubMed

    Joshee, N; Kisaka, H; Kitagawa, Y

    1998-01-01

    One of the water stress-specific cDNA clones of rice characterised previously, wsi18, was selected for further study. The wsi18 gene can be induced by water stress conditions such as mannitol, NaCl, and dryness, but not by ABA, cold, or heat. A genomic clone for wsi18, pwsi18, contained about 1.7 kbp of the 5' upstream sequence, two introns, and the full coding sequence. The 5'-upstream sequence of pwsi18 contained putative cis-acting elements, namely an ABA-responsive element (ABRE), three G-boxes, three E-boxes, a MEF-2 sequence, four direct and two inverted repeats, and four sequences similar to DRE, which is involved in the dehydration response of Arabidopsis genes. The gusA reporter gene under the control of the pwsi18 promoter showed transient expression in response to water stress. Deletion of the downstream DRE-like sequence between the distal G-boxes-2 and -3 resulted in rather low GUS expression.

  14. Continuous in vitro evolution of bacteriophage RNA polymerase promoters

    NASA Technical Reports Server (NTRS)

    Breaker, R. R.; Banerji, A.; Joyce, G. F.

    1994-01-01

    Rapid in vitro evolution of bacteriophage T7, T3, and SP6 RNA polymerase promoters was achieved by a method that allows continuous enrichment of DNAs that contain functional promoter elements. This method exploits the ability of a special class of nucleic acid molecules to replicate continuously in the presence of both a reverse transcriptase and a DNA-dependent RNA polymerase. Replication involves the synthesis of both RNA and cDNA intermediates. The cDNA strand contains an embedded promoter sequence, which becomes converted to a functional double-stranded promoter element, leading to the production of RNA transcripts. Synthetic cDNAs, including those that contain randomized promoter sequences, can be used to initiate the amplification cycle. However, only those cDNAs that contain functional promoter sequences are able to produce RNA transcripts. Furthermore, each RNA transcript encodes the RNA polymerase promoter sequence that was responsible for initiation of its own transcription. Thus, the population of amplifying molecules quickly becomes enriched for those templates that encode functional promoters. Optimal promoter sequences for phage T7, T3, and SP6 RNA polymerase were identified after a 2-h amplification reaction, initiated in each case with a pool of synthetic cDNAs encoding greater than 10(10) promoter sequence variants.

  15. Genome-Wide Analysis of DNA Methylation before-and after Exercise in the Thoroughbred Horse with MeDIP-Seq

    PubMed Central

    Gim, Jeong-An; Hong, Chang Pyo; Kim, Dae-Soo; Moon, Jae-Woo; Choi, Yuri; Eo, Jungwoo; Kwon, Yun-Jeong; Lee, Ja-Rang; Jung, Yi-Deun; Bae, Jin-Han; Choi, Bong-Hwan; Ko, Junsu; Song, Sanghoon; Ahn, Kung; Ha, Hong-Seok; Yang, Young Mok; Lee, Hak-Kyo; Park, Kyung-Do; Do, Kyoung-Tag; Han, Kyudong; Yi, Joo Mi; Cha, Hee-Jae; Ayarpadikannan, Selvam; Cho, Byung-Wook; Bhak, Jong; Kim, Heui-Soo

    2015-01-01

    Athletic performance is an important criteria used for the selection of superior horses. However, little is known about exercise-related epigenetic processes in the horse. DNA methylation is a key mechanism for regulating gene expression in response to environmental changes. We carried out comparative genomic analysis of genome-wide DNA methylation profiles in the blood samples of two different thoroughbred horses before and after exercise by methylated-DNA immunoprecipitation sequencing (MeDIP-Seq). Differentially methylated regions (DMRs) in the pre-and post-exercise blood samples of superior and inferior horses were identified. Exercise altered the methylation patterns. After 30 min of exercise, 596 genes were hypomethylated and 715 genes were hypermethylated in the superior horse, whereas in the inferior horse, 868 genes were hypomethylated and 794 genes were hypermethylated. These genes were analyzed based on gene ontology (GO) annotations and the exercise-related pathway patterns in the two horses were compared. After exercise, gene regions related to cell division and adhesion were hypermethylated in the superior horse, whereas regions related to cell signaling and transport were hypermethylated in the inferior horse. Analysis of the distribution of methylated CpG islands confirmed the hypomethylation in the gene-body methylation regions after exercise. The methylation patterns of transposable elements also changed after exercise. Long interspersed nuclear elements (LINEs) showed abundance of DMRs. Collectively, our results serve as a basis to study exercise-based reprogramming of epigenetic traits. PMID:25666347

  16. Isolation of active regulatory elements from eukaryotic chromatin using FAIRE (Formaldehyde Assisted Isolation of Regulatory Elements)

    PubMed Central

    Giresi, Paul G.; Lieb, Jason D.

    2009-01-01

    The binding of sequence-specific regulatory factors and the recruitment of chromatin remodeling activities cause nucleosomes to be evicted from chromatin in eukaryotic cells. Traditionally, these active sites have been identified experimentally through their sensitivity to nucleases. Here we describe the details of a simple procedure for the genome-wide isolation of nucleosome-depleted DNA from human chromatin, termed FAIRE (Formaldehyde Assisted Isolation of Regulatory Elements). We also provide protocols for different methods of detecting FAIRE-enriched DNA, including use of PCR, DNA microarrays, and next-generation sequencing. FAIRE works on all eukaryotic chromatin tested to date. To perform FAIRE, chromatin is crosslinked with formaldehyde, sheared by sonication, and phenol-chloroform extracted. Most genomic DNA is crosslinked to nucleosomes and is sequestered to the interphase, whereas DNA recovered in the aqueous phase corresponds to nucleosome-depleted regions of the genome. The isolated regions are largely coincident with the location of DNaseI hypersensitive sites, transcriptional start sites, enhancers, insulators, and active promoters. Given its speed and simplicity, FAIRE has utility in establishing chromatin profiles of diverse cell types in health and disease, isolating DNA regulatory elements en masse for further characterization, and as a screening assay for the effects of small molecules on chromatin organization. PMID:19303047

  17. Identification of an estrogen response element in the 3'-flanking region of the murine c-fos protooncogene.

    PubMed

    Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S

    1992-09-05

    We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or the consensus ERE was blunted by the antiestrogen tamoxifen. Based on these studies, we believe the 3'-fos ERE sequence we have identified may be a major cis-acting element involved in the physiological regulation of the gene by estrogens in vivo.

  18. Expression of the genetic suppressor element 24.2 (GSE24.2) decreases DNA damage and oxidative stress in X-linked dyskeratosis congenita cells.

    PubMed

    Manguan-Garcia, Cristina; Pintado-Berninches, Laura; Carrillo, Jaime; Machado-Pinilla, Rosario; Sastre, Leandro; Pérez-Quilis, Carme; Esmoris, Isabel; Gimeno, Amparo; García-Giménez, Jose Luis; Pallardó, Federico V; Perona, Rosario

    2014-01-01

    The predominant X-linked form of Dyskeratosis congenita results from mutations in DKC1, which encodes dyskerin, a protein required for ribosomal RNA modification that is also a component of the telomerase complex. We have previously found that expression of an internal fragment of dyskerin (GSE24.2) rescues telomerase activity in X-linked dyskeratosis congenita (X-DC) patient cells. Here we have found that an increased basal and induced DNA damage response occurred in X-DC cells in comparison with normal cells. DNA damage that is also localized in telomeres results in increased heterochromatin formation and senescence. Expression of a cDNA coding for GSE24.2 rescues both global and telomeric DNA damage. Furthermore, transfection of bacterial purified or a chemically synthesized GSE24.2 peptide is able to rescue basal DNA damage in X-DC cells. We have also observed an increase in oxidative stress in X-DC cells and expression of GSE24.2 was able to diminish it. Altogether our data indicated that supplying GSE24.2, either from a cDNA vector or as a peptide reduces the pathogenic effects of Dkc1 mutations and suggests a novel therapeutic approach.

  19. Single-molecule manipulation reveals supercoiling-dependent modulation of lac repressor-mediated DNA looping

    PubMed Central

    Normanno, Davide; Vanzi, Francesco; Pavone, Francesco Saverio

    2008-01-01

    Gene expression regulation is a fundamental biological process which deploys specific sets of genomic information depending on physiological or environmental conditions. Several transcription factors (including lac repressor, LacI) are present in the cell at very low copy number and increase their local concentration by binding to multiple sites on DNA and looping the intervening sequence. In this work, we employ single-molecule manipulation to experimentally address the role of DNA supercoiling in the dynamics and stability of LacI-mediated DNA looping. We performed measurements over a range of degrees of supercoiling between −0.026 and +0.026, in the absence of axial stretching forces. A supercoiling-dependent modulation of the lifetimes of both the looped and unlooped states was observed. Our experiments also provide evidence for multiple structural conformations of the LacI–DNA complex, depending on torsional constraints. The supercoiling-dependent modulation demonstrated here adds an important element to the model of the lac operon. In fact, the complex network of proteins acting on the DNA in a living cell constantly modifies its topological and mechanical properties: our observations demonstrate the possibility of establishing a signaling pathway from factors affecting DNA supercoiling to transcription factors responsible for the regulation of specific sets of genes. PMID:18310101

  20. The 'dark matter' in the plant genomes: non-coding and unannotated DNA sequences associated with open chromatin.

    PubMed

    Jiang, Jiming

    2015-04-01

    Sequencing of complete plant genomes has become increasingly more routine since the advent of the next-generation sequencing technology. Identification and annotation of large amounts of noncoding but functional DNA sequences, including cis-regulatory DNA elements (CREs), have become a new frontier in plant genome research. Genomic regions containing active CREs bound to regulatory proteins are hypersensitive to DNase I digestion and are called DNase I hypersensitive sites (DHSs). Several recent DHS studies in plants illustrate that DHS datasets produced by DNase I digestion followed by next-generation sequencing (DNase-seq) are highly valuable for the identification and characterization of CREs associated with plant development and responses to environmental cues. DHS-based genomic profiling has opened a door to identify and annotate the 'dark matter' in sequenced plant genomes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Primary analysis of repeat elements of the Asian seabass (Lates calcarifer) transcriptome and genome

    PubMed Central

    Kuznetsova, Inna S.; Thevasagayam, Natascha M.; Sridatta, Prakki S. R.; Komissarov, Aleksey S.; Saju, Jolly M.; Ngoh, Si Y.; Jiang, Junhui; Shen, Xueyan; Orbán, László

    2014-01-01

    As part of our Asian seabass genome project, we are generating an inventory of repeat elements in the genome and transcriptome. The karyotype showed a diploid number of 2n = 24 chromosomes with a variable number of B-chromosomes. The transcriptome and genome of Asian seabass were searched for repetitive elements with experimental and bioinformatics tools. Six different types of repeats constituting 8–14% of the genome were characterized. Repetitive elements were clustered in the pericentromeric heterochromatin of all chromosomes, but some of them were preferentially accumulated in pretelomeric and pericentromeric regions of several chromosomes pairs and have chromosomes specific arrangement. From the dispersed class of fish-specific non-LTR retrotransposon elements Rex1 and MAUI-like repeats were analyzed. They were wide-spread both in the genome and transcriptome, accumulated on the pericentromeric and peritelomeric areas of all chromosomes. Every analyzed repeat was represented in the Asian seabass transcriptome, some showed differential expression between the gonads. The other group of repeats analyzed belongs to the rRNA multigene family. FISH signal for 5S rDNA was located on a single pair of chromosomes, whereas that for 18S rDNA was found on two pairs. A BAC-derived contig containing rDNA was sequenced and assembled into a scaffold containing incomplete fragments of 18S rDNA. Their assembly and chromosomal position revealed that this part of Asian seabass genome is extremely rich in repeats containing evolutionarily conserved and novel sequences. In summary, transcriptome assemblies and cDNA data are suitable for the identification of repetitive DNA from unknown genomes and for comparative investigation of conserved elements between teleosts and other vertebrates. PMID:25120555

  2. Uncoupling of sgRNAs from their associated barcodes during PCR amplification of combinatorial CRISPR screens

    PubMed Central

    2018-01-01

    Many implementations of pooled screens in mammalian cells rely on linking an element of interest to a barcode, with the latter subsequently quantitated by next generation sequencing. However, substantial uncoupling between these paired elements during lentiviral production has been reported, especially as the distance between elements increases. We detail that PCR amplification is another major source of uncoupling, and becomes more pronounced with increased amounts of DNA template molecules and PCR cycles. To lessen uncoupling in systems that use paired elements for detection, we recommend minimizing the distance between elements, using low and equal template DNA inputs for plasmid and genomic DNA during PCR, and minimizing the number of PCR cycles. We also present a vector design for conducting combinatorial CRISPR screens that enables accurate barcode-based detection with a single short sequencing read and minimal uncoupling. PMID:29799876

  3. Nrf1 CNC-bZIP protein promotes cell survival and nucleotide excision repair through maintaining glutathione homeostasis.

    PubMed

    Han, Weinong; Ming, Mei; Zhao, Rui; Pi, Jingbo; Wu, Chunli; He, Yu-Ying

    2012-05-25

    Skin cancer is the most common cancer in the United States. Its major environmental risk factor is UVB radiation in sunlight. In response to UVB damage, epidermal keratinocytes activate a specific repair pathway, i.e. nucleotide excision repair, to remove UVB-induced DNA lesions. However, the regulation of UVB response is not fully understood. Here we show that the long isoform of the nuclear factor erythroid 2-related factor 1 (Nrf1, also called NFE2L1), a cytoprotective transcription factor critical for the expression of multiple antioxidant response element-dependent genes, plays an important role in the response of keratinocytes to UVB. Nrf1 loss sensitized keratinocytes to UVB-induced apoptosis by up-regulating the expression of the proapoptotic Bcl-2 family member Bik through reducing glutathione levels. Knocking down Bik reduced UVB-induced apoptosis in Nrf1-inhibited cells. In UVB-irradiated surviving cells, however, disruption of Nrf1 impaired nucleotide excision repair through suppressing the transcription of xeroderma pigmentosum C (XPC), a factor essential for initiating the global genome nucleotide excision repair by recognizing the DNA lesion and recruiting downstream factors. Nrf1 enhanced XPC expression by increasing glutathione availability but was independent of the transcription repressor of XPC. Adding XPC or glutathione restored the DNA repair capacity in Nrf1-inhibited cells. Finally, we demonstrate that Nrf1 levels are significantly reduced by UVB radiation in mouse skin and are lower in human skin tumors than in normal skin. These results indicate a novel role of Nrf1 in UVB-induced DNA damage repair and suggest Nrf1 as a tumor suppressor in the skin.

  4. The human immunodeficiency virus type 1 long terminal repeat specifies two different transcription complexes, only one of which is regulated by Tat.

    PubMed Central

    Lu, X; Welsh, T M; Peterlin, B M

    1993-01-01

    The human immunodeficiency virus type 1 long terminal repeat sets up two different transcription complexes, which have been called processive and nonprocessive complexes. By mutating and substituting cis-acting sequences, we mapped elements of the human immunodeficiency virus long terminal repeat that are responsible for creating each transcription complex. Whereas processive complexes are efficiently assembled by upstream promoter elements in the absence of the TATA box, nonprocessive complexes absolutely require the TATA box. Moreover, the TATA box alone can set up these nonprocessive complexes, and nonprocessive but not processive complexes are trans activated by Tat. Finally, a strong DNA-binding site between the TATA box and trans-activation-responsive region interferes with either the assembly or movement of these nonprocessive complexes and diminishes the effects of Tat. Thus, Tat affects a critical step in the formation of elongation-competent transcription complexes. Images PMID:8445708

  5. Gene regulatory network of unfolded protein response genes in endoplasmic reticulum stress.

    PubMed

    Takayanagi, Sayuri; Fukuda, Riga; Takeuchi, Yuuki; Tsukada, Sakiko; Yoshida, Kenichi

    2013-01-01

    In the endoplasmic reticulum (ER), secretory and membrane proteins are properly folded and modified, and the failure of these processes leads to ER stress. At the same time, unfolded protein response (UPR) genes are activated to maintain homeostasis. Despite the thorough characterization of the individual gene regulation of UPR genes to date, further investigation of the mutual regulation among UPR genes is required to understand the complex mechanism underlying the ER stress response. In this study, we aimed to reveal a gene regulatory network formed by UPR genes, including immunoglobulin heavy chain-binding protein (BiP), X-box binding protein 1 (XBP1), C/EBP [CCAAT/enhancer-binding protein]-homologous protein (CHOP), PKR-like endoplasmic reticulum kinase (PERK), inositol-requiring 1 (IRE1), activating transcription factor 6 (ATF6), and ATF4. For this purpose, we focused on promoter-luciferase reporters for BiP, XBP1, and CHOP genes, which bear an ER stress response element (ERSE), and p5 × ATF6-GL3, which bears an unfolded protein response element (UPRE). We demonstrated that the luciferase activities of the BiP and CHOP promoters were upregulated by all the UPR genes, whereas those of the XBP1 promoter and p5 × ATF6-GL3 were upregulated by all the UPR genes except for BiP, CHOP, and ATF4 in HeLa cells. Therefore, an ERSE- and UPRE-centered gene regulatory network of UPR genes could be responsible for the robustness of the ER stress response. Finally, we revealed that BiP protein was degraded when cells were treated with DNA-damaging reagents, such as etoposide and doxorubicin; this finding suggests that the expression level of BiP is tightly regulated at the post-translational level, rather than at the transcriptional level, in the presence of DNA damage.

  6. Whole DNA methylome profiling in mice exposed to secondhand smoke

    PubMed Central

    Tommasi, Stella; Zheng, Albert; Yoon, Jae-In; Li, Arthur Xuejun; Wu, Xiwei; Besaratinia, Ahmad

    2012-01-01

    Aberration of DNA methylation is a prime epigenetic mechanism of carcinogenesis. Aberrant DNA methylation occurs frequently in lung cancer, with exposure to secondhand smoke (SHS) being an established risk factor. The causal role of SHS in the genesis of lung cancer, however, remains elusive. To investigate whether SHS can cause aberrant DNA methylation in vivo, we have constructed the whole DNA methylome in mice exposed to SHS for a duration of 4 mo, both after the termination of exposure and at ensuing intervals post-exposure (up to 10 mo). Our genome-wide and gene-specific profiling of DNA methylation in the lung of SHS-exposed mice revealed that all groups of SHS-exposed mice and controls share a similar pattern of DNA methylation. Furthermore, the methylation status of major repetitive DNA elements, including long-interspersed nuclear elements (LINE L1), intracisternal A particle long-terminal repeat retrotransposons (IAP-LTR), and short-interspersed nuclear elements (SINE B1), in the lung of all groups of SHS-exposed mice and controls remains comparable. The absence of locus-specific gain of DNA methylation and global loss of DNA methylation in the lung of SHS-exposed mice within a timeframe that precedes neoplastic-lesion formation underscore the challenges of lung cancer biomarker development. Identifying the initiating events that cause aberrant DNA methylation in lung carcinogenesis may help improve future strategies for prevention, early detection and treatment of this highly lethal disease. PMID:23051858

  7. Structure and conformational dynamics of scaffolded DNA origami nanoparticles

    DTIC Science & Technology

    2017-05-08

    all-atom molecular dynamics and coarse-grained finite element modeling to DX-based nanoparticles to elucidate their fine-scale and global conforma... finite element (FE) modeling approach CanDo is also routinely used to predict the 3D equilibrium conformation of programmed DNA assemblies based on a...model with both experimental cryo-electron microscopy (cryo-EM) data and all-atom modeling. MATERIALS AND METHODS Lattice-free finite element model

  8. Characterisation of a DNA sequence element that directs Dictyostelium stalk cell-specific gene expression.

    PubMed

    Ceccarelli, A; Zhukovskaya, N; Kawata, T; Bozzaro, S; Williams, J

    2000-12-01

    The ecmB gene of Dictyostelium is expressed at culmination both in the prestalk cells that enter the stalk tube and in ancillary stalk cell structures such as the basal disc. Stalk tube-specific expression is regulated by sequence elements within the cap-site proximal part of the promoter, the stalk tube (ST) promoter region. Dd-STATa, a member of the STAT transcription factor family, binds to elements present in the ST promoter-region and represses transcription prior to entry into the stalk tube. We have characterised an activatory DNA sequence element, that lies distal to the repressor elements and that is both necessary and sufficient for expression within the stalk tube. We have mapped this activator to a 28 nucleotide region (the 28-mer) within which we have identified a GA-containing sequence element that is required for efficient gene transcription. The Dd-STATa protein binds to the 28-mer in an in vitro binding assay, and binding is dependent upon the GA-containing sequence. However, the ecmB gene is expressed in a Dd-STATa null mutant, therefore Dd-STATa cannot be responsible for activating the 28-mer in vivo. Instead, we identified a distinct 28-mer binding activity in nuclear extracts from the Dd-STATa null mutant, the activity of this GA binding activity being largely masked in wild type extracts by the high affinity binding of the Dd-STATa protein. We suggest, that in addition to the long range repression exerted by binding to the two known repressor sites, Dd-STATa inhibits transcription by direct competition with this putative activator for binding to the GA sequence.

  9. Immunogenicity of DNA Vaccine against H5N1 Containing Extended Kappa B Site: In Vivo Study in Mice and Chickens

    PubMed Central

    Redkiewicz, Patrycja; Stachyra, Anna; Sawicka, Róz∙a; Bocian, Katarzyna; Góra-Sochacka, Anna; Kosson, Piotr; Sirko, Agnieszka

    2017-01-01

    Influenza is one of the most important illnesses in the modern world, causing great public health losses each year due to the lack of medication and broadly protective, long-lasting vaccines. The development of highly immunogenic and safe vaccines is currently one of the major problems encountered in efficient influenza prevention. DNA vaccines represent a novel and powerful alternative to the conventional vaccine approaches. To improve the efficacy of the DNA vaccine against influenza H5N1, we inserted three repeated kappa B (κB) motifs, separated by a 5-bp nucleotide spacer, upstream of the cytomegalovirus promoter and downstream of the SV40 late polyadenylation signal. The κB motif is a specific DNA element (10pb-long) recognized by one of the most important transcription factors NFκB. NFκB is present in almost all animal cell types and upon cell stimulation under a variety of pathogenic conditions. NFκB is released from IκB and translocates to the nucleus and binds to κB sites, thereby leading to enhanced transcription and expression of downstream genes. We tested the variants of DNA vaccine with κB sites flanking the antigen expression cassette and without such sites in two animal models: chickens (broilers and layers) and mice (BALB/c). In chickens, the variant with κB sites stimulated stronger humoral response against the target antigen. In mice, the differences in humoral response were less apparent. Instead, it was possible to spot several gene expression differences in the spleens isolated from mice immunized with both variants. The results of our study indicate that modification of the sequence outside of the sequence encoding the antigen might enhance the immune response to the target but understanding the mechanisms responsible for this process requires further analysis. PMID:28883819

  10. DEPPDB - DNA electrostatic potential properties database. Electrostatic properties of genome DNA elements.

    PubMed

    Osypov, Alexander A; Krutinin, Gleb G; Krutinina, Eugenia A; Kamzolova, Svetlana G

    2012-04-01

    Electrostatic properties of genome DNA are important to its interactions with different proteins, in particular, related to transcription. DEPPDB - DNA Electrostatic Potential (and other Physical) Properties Database - provides information on the electrostatic and other physical properties of genome DNA combined with its sequence and annotation of biological and structural properties of genomes and their elements. Genomes are organized on taxonomical basis, supporting comparative and evolutionary studies. Currently, DEPPDB contains all completely sequenced bacterial, viral, mitochondrial, and plastids genomes according to the NCBI RefSeq, and some model eukaryotic genomes. Data for promoters, regulation sites, binding proteins, etc., are incorporated from established DBs and literature. The database is complemented by analytical tools. User sequences calculations are available. Case studies discovered electrostatics complementing DNA bending in E.coli plasmid BNT2 promoter functioning, possibly affecting host-environment metabolic switch. Transcription factors binding sites gravitate to high potential regions, confirming the electrostatics universal importance in protein-DNA interactions beyond the classical promoter-RNA polymerase recognition and regulation. Other genome elements, such as terminators, also show electrostatic peculiarities. Most intriguing are gene starts, exhibiting taxonomic correlations. The necessity of the genome electrostatic properties studies is discussed.

  11. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.

    1987-01-01

    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3575113

  12. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.

    1990-01-01

    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2333227

  13. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.

    1988-01-01

    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3368330

  14. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.

    1989-01-01

    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2654889

  15. Characterisation of cytoplasmic DNA complementary to non-retroviral RNA viruses in human cells

    PubMed Central

    Shimizu, Akira; Nakatani, Yoko; Nakamura, Takako; Jinno-Oue, Atsushi; Ishikawa, Osamu; Boeke, Jef D.; Takeuchi, Yasuhiro; Hoshino, Hiroo

    2014-01-01

    The synthesis and subsequent genomic integration of DNA that is complementary to the genomes of non-retroviral RNA viruses are rarely observed. However, upon infection of various human cell lines and primary fibroblasts with the vesicular stomatitis virus (VSV), we detected DNA complementary to the VSV RNA. The VSV DNA was detected in the cytoplasm as single-stranded DNA fully complementary to the viral mRNA from the poly(A) region to the 7-methyl guanosine cap. The formation of this DNA was cell-dependent. Experimentally, we found that the transduction of cells that do not produce VSV DNA with the long interspersed nuclear element 1 and their infection with VSV could lead to the formation of VSV DNA. Viral DNA complementary to other RNA viruses was also detected in the respective infected human cells. Thus, the genetic information of the non-retroviral RNA virus genome can flow into the DNA of mammalian cells expressing LINE-1-like elements. PMID:24875540

  16. Understanding the mechanical properties of DNA origami tiles and controlling the kinetics of their folding and unfolding reconfiguration.

    PubMed

    Chen, Haorong; Weng, Te-Wei; Riccitelli, Molly M; Cui, Yi; Irudayaraj, Joseph; Choi, Jong Hyun

    2014-05-14

    DNA origami represents a class of highly programmable macromolecules that can go through conformational changes in response to external signals. Here we show that a two-dimensional origami rectangle can be effectively folded into a short, cylindrical tube by connecting the two opposite edges through the hybridization of linker strands and that this process can be efficiently reversed via toehold-mediated strand displacement. The reconfiguration kinetics was experimentally studied as a function of incubation temperature, initial origami concentration, missing staples, and origami geometry. A kinetic model was developed by introducing the j factor to describe the reaction rates in the cyclization process. We found that the cyclization efficiency (j factor) increases sharply with temperature and depends strongly on the structural flexibility and geometry. A simple mechanical model was used to correlate the observed cyclization efficiency with origami structure details. The mechanical analysis suggests two sources of the energy barrier for DNA origami folding: overcoming global twisting and bending the structure into a circular conformation. It also provides the first semiquantitative estimation of the rigidity of DNA interhelix crossovers, an essential element in structural DNA nanotechnology. This work demonstrates efficient DNA origami reconfiguration, advances our understanding of the dynamics and mechanical properties of self-assembled DNA structures, and should be valuable to the field of DNA nanotechnology.

  17. Global mapping of DNA conformational flexibility on Saccharomyces cerevisiae.

    PubMed

    Menconi, Giulia; Bedini, Andrea; Barale, Roberto; Sbrana, Isabella

    2015-04-01

    In this study we provide the first comprehensive map of DNA conformational flexibility in Saccharomyces cerevisiae complete genome. Flexibility plays a key role in DNA supercoiling and DNA/protein binding, regulating DNA transcription, replication or repair. Specific interest in flexibility analysis concerns its relationship with human genome instability. Enrichment in flexible sequences has been detected in unstable regions of human genome defined fragile sites, where genes map and carry frequent deletions and rearrangements in cancer. Flexible sequences have been suggested to be the determinants of fragile gene proneness to breakage; however, their actual role and properties remain elusive. Our in silico analysis carried out genome-wide via the StabFlex algorithm, shows the conserved presence of highly flexible regions in budding yeast genome as well as in genomes of other Saccharomyces sensu stricto species. Flexibile peaks in S. cerevisiae identify 175 ORFs mapping on their 3'UTR, a region affecting mRNA translation, localization and stability. (TA)n repeats of different extension shape the central structure of peaks and co-localize with polyadenylation efficiency element (EE) signals. ORFs with flexible peaks share common features. Transcripts are characterized by decreased half-life: this is considered peculiar of genes involved in regulatory systems with high turnover; consistently, their function affects biological processes such as cell cycle regulation or stress response. Our findings support the functional importance of flexibility peaks, suggesting that the flexible sequence may be derived by an expansion of canonical TAYRTA polyadenylation efficiency element. The flexible (TA)n repeat amplification could be the outcome of an evolutionary neofunctionalization leading to a differential 3'-end processing and expression regulation in genes with peculiar function. Our study provides a new support to the functional role of flexibility in genomes and a strategy for its characterization inside human fragile sites.

  18. Global Mapping of DNA Conformational Flexibility on Saccharomyces cerevisiae

    PubMed Central

    Menconi, Giulia; Bedini, Andrea; Barale, Roberto; Sbrana, Isabella

    2015-01-01

    In this study we provide the first comprehensive map of DNA conformational flexibility in Saccharomyces cerevisiae complete genome. Flexibility plays a key role in DNA supercoiling and DNA/protein binding, regulating DNA transcription, replication or repair. Specific interest in flexibility analysis concerns its relationship with human genome instability. Enrichment in flexible sequences has been detected in unstable regions of human genome defined fragile sites, where genes map and carry frequent deletions and rearrangements in cancer. Flexible sequences have been suggested to be the determinants of fragile gene proneness to breakage; however, their actual role and properties remain elusive. Our in silico analysis carried out genome-wide via the StabFlex algorithm, shows the conserved presence of highly flexible regions in budding yeast genome as well as in genomes of other Saccharomyces sensu stricto species. Flexibile peaks in S. cerevisiae identify 175 ORFs mapping on their 3’UTR, a region affecting mRNA translation, localization and stability. (TA)n repeats of different extension shape the central structure of peaks and co-localize with polyadenylation efficiency element (EE) signals. ORFs with flexible peaks share common features. Transcripts are characterized by decreased half-life: this is considered peculiar of genes involved in regulatory systems with high turnover; consistently, their function affects biological processes such as cell cycle regulation or stress response. Our findings support the functional importance of flexibility peaks, suggesting that the flexible sequence may be derived by an expansion of canonical TAYRTA polyadenylation efficiency element. The flexible (TA)n repeat amplification could be the outcome of an evolutionary neofunctionalization leading to a differential 3’-end processing and expression regulation in genes with peculiar function. Our study provides a new support to the functional role of flexibility in genomes and a strategy for its characterization inside human fragile sites. PMID:25860149

  19. Mycobacterium smegmatis strain for detection of Mycobacterium tuberculosis by PCR used as internal control for inhibition of amplification and for quantification of bacteria.

    PubMed Central

    Kolk, A H; Noordhoek, G T; de Leeuw, O; Kuijper, S; van Embden, J D

    1994-01-01

    For the detection of Mycobacterium tuberculosis by PCR, the IS6110 sequence was used. A modified target was constructed by insertion of 56 nucleotides in the IS6110 insertion element of Mycobacterium bovis BCG. This modified insertion sequence was integrated into the genome of Mycobacterium smegmatis, a mycobacterium species which does not contain the IS6110 element. When DNA from the modified M. smegmatis 1008 strain was amplified with IS6110-specific primers INS1 and INS2, a band of 301 bp was seen on agarose gel, whereas the PCR product of M. tuberculosis complex DNA was a 245-bp fragment with these primers. The addition of a small number of M. smegmatis 1008 cells to clinical samples before DNA purification enables the detection of problems which may be due to the loss of DNA in the isolation procedure or to the presence of inhibitors. The presence of inhibitors of the amplification reaction can be confirmed by the addition of M. smegmatis 1008 DNA after the DNA isolation procedure. Furthermore, competition between the different target DNAs of M. smegmatis 1008 DNA and M. tuberculosis complex DNA enables the estimation of the number of IS6110 elements in the clinical sample. Images PMID:8051267

  20. Analysis of the regulation of viral transcription.

    PubMed

    Gloss, Bernd; Kalantari, Mina; Bernard, Hans-Ulrich

    2005-01-01

    Despite the small genomes and number of genes of papillomaviruses, regulation of their transcription is very complex and governed by numerous transcription factors, cis-responsive elements, and epigenetic phenomena. This chapter describes the strategies of how one can approach a systematic analysis of these factors, elements, and mechanisms. From the numerous different techniques useful for studying transcription, we describe in detail three selected protocols of approaches that have been relevant in shaping our knowledge of human papillomavirus transcription. These are DNAse I protection ("footprinting") for location of transcription-factor binding sites, electrophoretic mobility shifts ("gelshifts") for analysis of bound transcription factors, and bisulfite sequencing for analysis of DNA methylation as a prerequisite for epigenetic transcriptional regulation.

  1. Strategies for enhancing bioluminescent bacterial sensor performance by promoter region manipulation

    PubMed Central

    Bilic, Benny; Belkin, Shimshon

    2010-01-01

    Genetically engineered microbial reporter strains are based upon the fusion of an inducible sensing element upstream of a reporting element, so that the construct emits a dose-dependent signal when exposed to the inducing compound(s) or stress factor(s). In this communication1 we described several general approaches undertaken in order to enhance the sensing performance of such promoter::reporter fusions. Significant improvements in detection sensitivity, response kinetics and signal intensity were achieved by modi fication of the length of the promoter-containing DNA fragment, by random or site-directed mutagenesis and by promoter duplication. The general nature of these genetics manipulations makes them applicable to other types of promoter::reporter fusions. PMID:21326942

  2. VEZF1 Elements Mediate Protection from DNA Methylation

    PubMed Central

    Strogantsev, Ruslan; Gaszner, Miklos; Hair, Alan; Felsenfeld, Gary; West, Adam G.

    2010-01-01

    There is growing consensus that genome organization and long-range gene regulation involves partitioning of the genome into domains of distinct epigenetic chromatin states. Chromatin insulator or barrier elements are key components of these processes as they can establish boundaries between chromatin states. The ability of elements such as the paradigm β-globin HS4 insulator to block the range of enhancers or the spread of repressive histone modifications is well established. Here we have addressed the hypothesis that a barrier element in vertebrates should be capable of defending a gene from silencing by DNA methylation. Using an established stable reporter gene system, we find that HS4 acts specifically to protect a gene promoter from de novo DNA methylation. Notably, protection from methylation can occur in the absence of histone acetylation or transcription. There is a division of labor at HS4; the sequences that mediate protection from methylation are separable from those that mediate CTCF-dependent enhancer blocking and USF-dependent histone modification recruitment. The zinc finger protein VEZF1 was purified as the factor that specifically interacts with the methylation protection elements. VEZF1 is a candidate CpG island protection factor as the G-rich sequences bound by VEZF1 are frequently found at CpG island promoters. Indeed, we show that VEZF1 elements are sufficient to mediate demethylation and protection of the APRT CpG island promoter from DNA methylation. We propose that many barrier elements in vertebrates will prevent DNA methylation in addition to blocking the propagation of repressive histone modifications, as either process is sufficient to direct the establishment of an epigenetically stable silent chromatin state. PMID:20062523

  3. AP1 Keeps Chromatin Poised for Action | Center for Cancer Research

    Cancer.gov

    The human genome harbors gene-encoding DNA, the blueprint for building proteins that regulate cellular function. Embedded across the genome, in non-coding regions, are DNA elements to which regulatory factors bind. The interaction of regulatory factors with DNA at these sites modifies gene expression to modulate cell activity. In cells, DNA exists in a complex with proteins called chromatin that compacts the DNA in the nucleus, strongly restricting access to DNA sequences. As a result, regulatory factors only interact with a small subset of their potential binding elements in a given cell to regulate genes. How factors recognize and select sites in chromatin across the genome is not well understood -- but several discoveries in CCR’s Laboratory of Receptor Biology and Gene Expression (LRBGE) have shed light on the mechanisms that direct factors to DNA.

  4. Genotoxicity testing on the international space station: Preparatory work on the SOS-LUX test as part of the space experiment TRIPLE-LUX

    NASA Astrophysics Data System (ADS)

    Stojicic, Nevena; Walrafen, David; Baumstark-Khan, Christa; Rabbow, Elke; Rettberg, Petra; Weisshaar, Maria-Paz; Horneck, Gerda

    Harmful environmental factors - namely ionizing radiation - will continue to influence future manned space missions. The Radiation Biology Unit at the German Aerospace Center (DLR) develops cellular monitoring systems, which include bacterial and mammalian cell systems capable of recognizing DNA damage as a consequence of the presence of genotoxic conditions. Such a bioassay is the SOS-LUX test, which represents the radiobiological part of the German space experiment "Gene, immune and cellular responses to single and combined space flight conditions (TRIPLE-LUX)" which has been selected by the IDI/USRA Peer Review Panel for NASA/ESA to be performed on the International Space Station (ISS). It will supply basic information on the genotoxic response to radiation applied in microgravity. The biological end-point under investigation will depend on the bacterial SOS response brought about by genetically modified bacteria that are transformed with the pSWITCH plasmid (constructed from the plasmids pPLS-1 and pGFPuv). The luminescent/fluorescent bioassay SWITCH (SWITCH: Salmonella Weighting of Induced Toxicity Cyto/GenoTox for Human Health) as successor of the SOS-LUX test for rapid toxicity (genotoxicity and cytotoxicity) testing, makes use of two sensing and reporting systems for the two biological endpoints under investigation: the SOS-LUX test and the LAC- Fluoro test. The SWITCH plasmid carries the promoterless lux operon of Photobacterium leiognathi as reporter element under the control of the DNA-damage-dependent SOS promoter of ColD as sensor element (for genotoxicity testing) and the sequences for a hybrid protein consisting of β-galactosidase and GFPuv of Aequorea victoria as reporter element under the control of the (in Salmonella constitutively active) LAC promoter of Escherichia coli as sensor element (for cytotoxicity testing). The system has worked properly for terrestrial applications during the first experiments. Experiments using X-rays and UV radiation of various qualities (from UVC to UVA) have given insights into cellular mechanisms relevant for estimation of health risks, resulting from exposure of astronauts to the extraordinary radiation environment of space.

  5. The twilight zone of cis element alignments.

    PubMed

    Sebastian, Alvaro; Contreras-Moreira, Bruno

    2013-02-01

    Sequence alignment of proteins and nucleic acids is a routine task in bioinformatics. Although the comparison of complete peptides, genes or genomes can be undertaken with a great variety of tools, the alignment of short DNA sequences and motifs entails pitfalls that have not been fully addressed yet. Here we confront the structural superposition of transcription factors with the sequence alignment of their recognized cis elements. Our goals are (i) to test TFcompare (http://floresta.eead.csic.es/tfcompare), a structural alignment method for protein-DNA complexes; (ii) to benchmark the pairwise alignment of regulatory elements; (iii) to define the confidence limits and the twilight zone of such alignments and (iv) to evaluate the relevance of these thresholds with elements obtained experimentally. We find that the structure of cis elements and protein-DNA interfaces is significantly more conserved than their sequence and measures how this correlates with alignment errors when only sequence information is considered. Our results confirm that DNA motifs in the form of matrices produce better alignments than individual sequences. Finally, we report that empirical and theoretically derived twilight thresholds are useful for estimating the natural plasticity of regulatory sequences, and hence for filtering out unreliable alignments.

  6. The twilight zone of cis element alignments

    PubMed Central

    Sebastian, Alvaro; Contreras-Moreira, Bruno

    2013-01-01

    Sequence alignment of proteins and nucleic acids is a routine task in bioinformatics. Although the comparison of complete peptides, genes or genomes can be undertaken with a great variety of tools, the alignment of short DNA sequences and motifs entails pitfalls that have not been fully addressed yet. Here we confront the structural superposition of transcription factors with the sequence alignment of their recognized cis elements. Our goals are (i) to test TFcompare (http://floresta.eead.csic.es/tfcompare), a structural alignment method for protein–DNA complexes; (ii) to benchmark the pairwise alignment of regulatory elements; (iii) to define the confidence limits and the twilight zone of such alignments and (iv) to evaluate the relevance of these thresholds with elements obtained experimentally. We find that the structure of cis elements and protein–DNA interfaces is significantly more conserved than their sequence and measures how this correlates with alignment errors when only sequence information is considered. Our results confirm that DNA motifs in the form of matrices produce better alignments than individual sequences. Finally, we report that empirical and theoretically derived twilight thresholds are useful for estimating the natural plasticity of regulatory sequences, and hence for filtering out unreliable alignments. PMID:23268451

  7. Evolutionary dynamics of selfish DNA explains the abundance distribution of genomic subsequences

    PubMed Central

    Sheinman, Michael; Ramisch, Anna; Massip, Florian; Arndt, Peter F.

    2016-01-01

    Since the sequencing of large genomes, many statistical features of their sequences have been found. One intriguing feature is that certain subsequences are much more abundant than others. In fact, abundances of subsequences of a given length are distributed with a scale-free power-law tail, resembling properties of human texts, such as Zipf’s law. Despite recent efforts, the understanding of this phenomenon is still lacking. Here we find that selfish DNA elements, such as those belonging to the Alu family of repeats, dominate the power-law tail. Interestingly, for the Alu elements the power-law exponent increases with the length of the considered subsequences. Motivated by these observations, we develop a model of selfish DNA expansion. The predictions of this model qualitatively and quantitatively agree with the empirical observations. This allows us to estimate parameters for the process of selfish DNA spreading in a genome during its evolution. The obtained results shed light on how evolution of selfish DNA elements shapes non-trivial statistical properties of genomes. PMID:27488939

  8. DNA capture elements for rapid detection and identification of biological agents

    NASA Astrophysics Data System (ADS)

    Kiel, Johnathan L.; Parker, Jill E.; Holwitt, Eric A.; Vivekananda, Jeeva

    2004-08-01

    DNA capture elements (DCEs; aptamers) are artificial DNA sequences, from a random pool of sequences, selected for their specific binding to potential biological warfare agents. These sequences were selected by an affinity method using filters to which the target agent was attached and the DNA isolated and amplified by polymerase chain reaction (PCR) in an iterative, increasingly stringent, process. Reporter molecules were attached to the finished sequences. To date, we have made DCEs to Bacillus anthracis spores, Shiga toxin, Venezuelan Equine Encephalitis (VEE) virus, and Francisella tularensis. These DCEs have demonstrated specificity and sensitivity equal to or better than antibody.

  9. DNA methylation dynamics during early plant life.

    PubMed

    Bouyer, Daniel; Kramdi, Amira; Kassam, Mohamed; Heese, Maren; Schnittger, Arp; Roudier, François; Colot, Vincent

    2017-09-25

    Cytosine methylation is crucial for gene regulation and silencing of transposable elements in mammals and plants. While this epigenetic mark is extensively reprogrammed in the germline and early embryos of mammals, the extent to which DNA methylation is reset between generations in plants remains largely unknown. Using Arabidopsis as a model, we uncovered distinct DNA methylation dynamics over transposable element sequences during the early stages of plant development. Specifically, transposable elements and their relics show invariably high methylation at CG sites but increasing methylation at CHG and CHH sites. This non-CG methylation culminates in mature embryos, where it reaches saturation for a large fraction of methylated CHH sites, compared to the typical 10-20% methylation level observed in seedlings or adult plants. Moreover, the increase in CHH methylation during embryogenesis matches the hypomethylated state in the early endosperm. Finally, we show that interfering with the embryo-to-seedling transition results in the persistence of high CHH methylation levels after germination, specifically over sequences that are targeted by the RNA-directed DNA methylation (RdDM) machinery. Our findings indicate the absence of extensive resetting of DNA methylation patterns during early plant life and point instead to an important role of RdDM in reinforcing DNA methylation of transposable element sequences in every cell of the mature embryo. Furthermore, we provide evidence that this elevated RdDM activity is a specific property of embryogenesis.

  10. Identification of the cAMP response element that controls transcriptional activation of the insulin-like growth factor-I gene by prostaglandin E2 in osteoblasts

    NASA Technical Reports Server (NTRS)

    Thomas, M. J.; Umayahara, Y.; Shu, H.; Centrella, M.; Rotwein, P.; McCarthy, T. L.

    1996-01-01

    Insulin-like growth factor-I (IGF-I), a multifunctional growth factor, plays a key role in skeletal growth and can enhance bone cell replication and differentiation. We previously showed that prostaglandin E2 (PGE2) and other agents that increase cAMP activated IGF-I gene transcription in primary rat osteoblast cultures through promoter 1 (P1), the major IGF-I promoter, and found that transcriptional induction was mediated by protein kinase A. We now have identified a short segment of P1 that is essential for full hormonal regulation and have characterized inducible DNA-protein interactions involving this site. Transient transfections of IGF-I P1 reporter genes into primary rat osteoblasts showed that the 328-base pair untranslated region of exon 1 was required for a full 5.3-fold response to PGE2; mutation in a previously footprinted site, HS3D (base pairs +193 to +215), reduced induction by 65%. PGE2 stimulated nuclear protein binding to HS3D. Binding, as determined by gel mobility shift assay, was not seen in nuclear extracts from untreated osteoblast cultures, was detected within 2 h of PGE2 treatment, and was maximal by 4 h. This DNA-protein interaction was not observed in cytoplasmic extracts from PGE2-treated cultures, indicating nuclear localization of the protein kinase A-activated factor(s). Activation of this factor was not blocked by cycloheximide (Chx), and Chx did not impair stimulation of IGF-I gene expression by PGE2. In contrast, binding to a consensus cAMP response element (CRE; 5'-TGACGTCA-3') from the rat somatostatin gene was not modulated by PGE2 or Chx. Competition gel mobility shift analysis using mutated DNA probes identified 5'-CGCAATCG-3' as the minimal sequence needed for inducible binding. All modified IGF-I P1 promoterreporter genes with mutations within this CRE sequence also showed a diminished functional response to PGE2. These results identify the CRE within the 5'-untranslated region of IGF-I exon 1 that is required for hormonal activation of IGF-I gene transcription by cAMP in osteoblasts.

  11. Location analysis for the estrogen receptor-α reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements

    PubMed Central

    Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.

    2010-01-01

    Location analysis for estrogen receptor-α (ERα)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERα-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10–20% nucleotide deviation from the canonical ERE sequence. We demonstrate that ∼50% of all ERα-bound loci do not have a discernable ERE and show that most ERα-bound EREs are not perfect consensus EREs. Approximately one-third of all ERα-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERα-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERα binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers. PMID:20047966

  12. Location analysis for the estrogen receptor-alpha reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements.

    PubMed

    Mason, Christopher E; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M; Kallen, Roland G; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B

    2010-04-01

    Location analysis for estrogen receptor-alpha (ERalpha)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERalpha-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10-20% nucleotide deviation from the canonical ERE sequence. We demonstrate that approximately 50% of all ERalpha-bound loci do not have a discernable ERE and show that most ERalpha-bound EREs are not perfect consensus EREs. Approximately one-third of all ERalpha-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERalpha-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERalpha binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers.

  13. Genome-wide analyses of LINE–LINE-mediated nonallelic homologous recombination

    PubMed Central

    Startek, Michał; Szafranski, Przemyslaw; Gambin, Tomasz; Campbell, Ian M.; Hixson, Patricia; Shaw, Chad A.; Stankiewicz, Paweł; Gambin, Anna

    2015-01-01

    Nonallelic homologous recombination (NAHR), occurring between low-copy repeats (LCRs) >10 kb in size and sharing >97% DNA sequence identity, is responsible for the majority of recurrent genomic rearrangements in the human genome. Recent studies have shown that transposable elements (TEs) can also mediate recurrent deletions and translocations, indicating the features of substrates that mediate NAHR may be significantly less stringent than previously believed. Using >4 kb length and >95% sequence identity criteria, we analyzed of the genome-wide distribution of long interspersed element (LINE) retrotransposon and their potential to mediate NAHR. We identified 17 005 directly oriented LINE pairs located <10 Mbp from each other as potential NAHR substrates, placing 82.8% of the human genome at risk of LINE–LINE-mediated instability. Cross-referencing these regions with CNVs in the Baylor College of Medicine clinical chromosomal microarray database of 36 285 patients, we identified 516 CNVs potentially mediated by LINEs. Using long-range PCR of five different genomic regions in a total of 44 patients, we confirmed that the CNV breakpoints in each patient map within the LINE elements. To additionally assess the scale of LINE–LINE/NAHR phenomenon in the human genome, we tested DNA samples from six healthy individuals on a custom aCGH microarray targeting LINE elements predicted to mediate CNVs and identified 25 LINE–LINE rearrangements. Our data indicate that LINE–LINE-mediated NAHR is widespread and under-recognized, and is an important mechanism of structural rearrangement contributing to human genomic variability. PMID:25613453

  14. Allosteric analysis of glucocorticoid receptor-DNA interface induced by cyclic Py-Im polyamide: a molecular dynamics simulation study.

    PubMed

    Wang, Yaru; Ma, Na; Wang, Yan; Chen, Guangju

    2012-01-01

    It has been extensively developed in recent years that cell-permeable small molecules, such as polyamide, can be programmed to disrupt transcription factor-DNA interfaces and can silence aberrant gene expression. For example, cyclic pyrrole-imidazole polyamide that competes with glucocorticoid receptor (GR) for binding to glucocorticoid response elements could be expected to affect the DNA dependent binding by interfering with the protein-DNA interface. However, how such small molecules affect the transcription factor-DNA interfaces and gene regulatory pathways through DNA structure distortion is not fully understood so far. In the present work, we have constructed some models, especially the ternary model of polyamides+DNA+GR DNA-binding domain (GRDBD) dimer, and carried out molecular dynamics simulations and free energy calculations for them to address how polyamide molecules disrupt the GRDBD and DNA interface when polyamide and protein bind at the same sites on opposite grooves of DNA. We found that the cyclic polyamide binding in minor groove of DNA can induce a large structural perturbation of DNA, i.e. a >4 Å widening of the DNA minor groove and a compression of the major groove by more than 4 Å as compared with the DNA molecule in the GRDBD dimer+DNA complex. Further investigations for the ternary system of polyamides+DNA+GRDBD dimer and the binary system of allosteric DNA+GRDBD dimer revealed that the compression of DNA major groove surface causes GRDBD to move away from the DNA major groove with the initial average distance of ∼4 Å to the final average distance of ∼10 Å during 40 ns simulation course. Therefore, this study straightforward explores how small molecule targeting specific sites in the DNA minor groove disrupts the transcription factor-DNA interface in DNA major groove, and consequently modulates gene expression.

  15. Divergent genome evolution caused by regional variation in DNA gain and loss between human and mouse

    PubMed Central

    Kortschak, R. Daniel

    2018-01-01

    The forces driving the accumulation and removal of non-coding DNA and ultimately the evolution of genome size in complex organisms are intimately linked to genome structure and organisation. Our analysis provides a novel method for capturing the regional variation of lineage-specific DNA gain and loss events in their respective genomic contexts. To further understand this connection we used comparative genomics to identify genome-wide individual DNA gain and loss events in the human and mouse genomes. Focusing on the distribution of DNA gains and losses, relationships to important structural features and potential impact on biological processes, we found that in autosomes, DNA gains and losses both followed separate lineage-specific accumulation patterns. However, in both species chromosome X was particularly enriched for DNA gain, consistent with its high L1 retrotransposon content required for X inactivation. We found that DNA loss was associated with gene-rich open chromatin regions and DNA gain events with gene-poor closed chromatin regions. Additionally, we found that DNA loss events tended to be smaller than DNA gain events suggesting that they were able to accumulate in gene-rich open chromatin regions due to their reduced capacity to interrupt gene regulatory architecture. GO term enrichment showed that mouse loss hotspots were strongly enriched for terms related to developmental processes. However, these genes were also located in regions with a high density of conserved elements, suggesting that despite high levels of DNA loss, gene regulatory architecture remained conserved. This is consistent with a model in which DNA gain and loss results in turnover or “churning” in regulatory element dense regions of open chromatin, where interruption of regulatory elements is selected against. PMID:29677183

  16. Identifying a Mechanism for Crosstalk Between the Estrogen and Glucocorticoid Receptors | Center for Cancer Research

    Cancer.gov

    Estrogen has long been known to play important roles in the development and progression of breast cancer. Its receptor (ER), a member of the steroid receptor family, binds to estrogen response elements (EREs) in DNA and regulates gene transcription. More recently, another steroid receptor family member, the glucocorticoid receptor (GR), has been implicated in breast cancer progression, and ER/GR status is an important predictor of breast cancer outcome.

  17. PML–RARA-RXR Oligomers Mediate Retinoid and Rexinoid/cAMP Cross-Talk in Acute Promyelocytic Leukemia Cell Differentiation

    PubMed Central

    Kamashev, Dmitrii; Vitoux, Dominique; de Thé, Hugues

    2004-01-01

    PML–RARA was proposed to initiate acute promyelocytic leukemia (APL) through PML–RARA homodimer–triggered repression. Here, we examined the nature of the PML–RARA protein complex and of its DNA targets in APL cells. Using a selection/amplification approach, we demonstrate that PML–RARA targets consist of two AGGTCA elements in an astonishing variety of orientations and spacings, pointing to highly relaxed structural constrains for DNA binding and identifying a major gain of function of this oncogene. PML–RARA-specific response elements were identified, which all conveyed a major transcriptional response to RA only in APL cells. In these cells, we demonstrate that PML–RARA oligomers are complexed to RXR. Directly probing PML–RARA function in APL cells, we found that the differentiation enhancer cyclic AMP (cAMP) boosted transcriptional activation by RA. cAMP also reversed the normal silencing (subordination) of the transactivating function of RXR when bound to RARA or PML–RARA, demonstrating that the alternate rexinoid/cAMP-triggered APL differentiation pathway also activates PML–RARA targets. Finally, cAMP restored both RA-triggered differentiation and PML–RARA transcriptional activation in mutant RA-resistant APL cells. Collectively, our findings directly demonstrate that APL cell differentiation parallels transcriptional activation through PML–RARA-RXR oligomers and that those are functionally targeted by cAMP, identifying this agent as another oncogene-targeted therapy. PMID:15096541

  18. Hormonal induction of transfected genes depends on DNA topology.

    PubMed Central

    Piña, B; Haché, R J; Arnemann, J; Chalepakis, G; Slater, E P; Beato, M

    1990-01-01

    Plasmids containing the hormone regulatory element of mouse mammary tumor virus linked to the thymidine kinase promoter of herpes simplex virus and the reporter gene chloramphenicol acetyltransferase of Escherichia coli respond to glucocorticoids and progestins when transfected into appropriate cells. In the human mammary tumor cell line T47D, the response to progestins, but not to glucocorticoids, is highly dependent on the topology of the transfected DNA. Although negatively supercoiled plasmids respond optimally to the synthetic progestin R5020, their linearized counterparts exhibit markedly reduced progestin inducibility. This is not due to changes in the efficiency of DNA transfection, since the amount of DNA incorporated into the cell nucleus is not significantly dependent on the initial topology of the plasmids. In contrast, cotransfection experiments with glucocorticoid receptor cDNA in the same cell line show no significant influence of DNA topology on induction by dexamethasone. A similar result was obtained with fibroblasts that contain endogenous glucocorticoid receptors. When the distance between receptor-binding sites or between the binding sites and the promoter was increased, the dependence of progestin induction on DNA topology was more pronounced. In contrast to the original plasmid, these constructs also revealed a similar topological dependence for induction by glucocorticoids. The differential influence of DNA topology is not due to differences in the affinity of the two hormone receptors for DNA of various topologies, but probably reflects an influence of DNA topology on the interaction between different DNA-bound receptor molecules and between receptors and other transcription factors. Images PMID:2153920

  19. [Nutrigenomics--bioactive dietary components].

    PubMed

    Gętek, Monika; Czech, Natalia; Fizia, Katarzyna; Białek-Dratwa, Agnieszka; Muc-Wierzgoń, Małgorzata; Kokot, Teresa; Nowakowska-Zajdel, Ewa

    2013-04-05

    Nutrigenomics analyzes relations between diet and genes, and identifies mechanisms in which food and nutrition affect health and lifestyles and noncommunicable diseases (R. Chadwick, 2004). Bioactive dietary components are signal molecules that carry information from the external environment and affect in terms of quantity and quality in the process of gene expression. The biological effect of bioactive dietary components depends on various of physiological processes that can occur within a few genes. Polymorphism of genes can change their function and physiological response of the body for nutrients. Bioactive dietary components work on at least two levels of the expression of genes as factors regulating chromatin structure and as factors directly regulate the activity of nuclear receptors. The processes of synthesis and DNA repair are regulated by some of vitamins, macro-and micro-elements. They provide, among others, cofactors of enzymes that catalyze the replication of DNA methylation and its repair. DNA methylation profile may change under the influence of diet, single nucleotide polymorphisms and environmental factors. Bioactive dietary components may directly affect the process of gene expression by acting as ligands for nuclear receptors. Sensitive to dietary group of nuclear receptors are sensory receptors. This group includes, among others receptor PPAR (peroxisome proliferator activated), responsible for energy metabolism and receptors LXR (liver X receptor), FXR (farnesoid X receptor) and RXR, which is responsible for the metabolism of cholesterol.

  20. ΔN-P63α and TA-P63α exhibit intrinsic differences in transactivation specificities that depend on distinct features of DNA target sites

    PubMed Central

    Foggetti, Giorgia; Raimondi, Ivan; Campomenosi, Paola; Menichini, Paola

    2014-01-01

    TP63 is a member of the TP53 gene family that encodes for up to ten different TA and ΔN isoforms through alternative promoter usage and alternative splicing. Besides being a master regulator of gene expression for squamous epithelial proliferation, differentiation and maintenance, P63, through differential expression of its isoforms, plays important roles in tumorigenesis. All P63 isoforms share an immunoglobulin-like folded DNA binding domain responsible for binding to sequence-specific response elements (REs), whose overall consensus sequence is similar to that of the canonical p53 RE. Using a defined assay in yeast, where P63 isoforms and RE sequences are the only variables, and gene expression assays in human cell lines, we demonstrated that human TA- and ΔN-P63α proteins exhibited differences in transactivation specificity not observed with the corresponding P73 or P53 protein isoforms. These differences 1) were dependent on specific features of the RE sequence, 2) could be related to intrinsic differences in their oligomeric state and cooperative DNA binding, and 3) appeared to be conserved in evolution. Since genotoxic stress can change relative ratio of TA- and ΔN-P63α protein levels, the different transactivation specificity of each P63 isoform could potentially influence cellular responses to specific stresses. PMID:24926492

  1. Molecular cloning and preliminary function study of iron responsive element binding protein 1 gene from cypermethrin-resistant Culex pipiens pallens

    PubMed Central

    2011-01-01

    Background Insecticide resistance jeopardizes the control of mosquito populations and mosquito-borne disease control, which creates a major public health concern. Two-dimensional electrophoresis identified one protein segment with high sequence homology to part of Aedes aegypti iron-responsive element binding protein (IRE-BP). Method RT-PCR and RACE (rapid amplification of cDNA end) were used to clone a cDNA encoding full length IRE-BP 1. Real-time quantitative RT-PCR was used to evaluate the transcriptional level changes in the Cr-IRE strain Aedes aegypti compared to the susceptible strain of Cx. pipiens pallens. The expression profile of the gene was established in the mosquito life cycle. Methyl tritiated thymidine (3H-TdR) was used to observe the cypermethrin resistance changes in C6/36 cells containing the stably transfected IRE-BP 1 gene of Cx. pipiens pallens. Results The complete sequence of iron responsive element binding protein 1 (IRE-BP 1) has been cloned from the cypermethrin-resistant strain of Culex pipiens pallens (Cr-IRE strain). Quantitative RT-PCR analysis indicated that the IRE-BP 1 transcription level was 6.7 times higher in the Cr-IRE strain than in the susceptible strain of 4th instar larvae. The IRE-BP 1 expression was also found to be consistently higher throughout the life cycle of the Cr-IRE strain. A protein of predicted size 109.4 kDa has been detected by Western blotting in IRE-BP 1-transfected mosquito C6/36 cells. These IRE-BP 1-transfected cells also showed enhanced cypermethrin resistance compared to null-transfected or plasmid vector-transfected cells as determined by 3H-TdR incorporation. Conclusion IRE-BP 1 is expressed at higher levels in the Cr-IRE strain, and may confer some insecticide resistance in Cx. pipiens pallens. PMID:22075242

  2. Analysis of the giant genomes of Fritillaria (Liliaceae) indicates that a lack of DNA removal characterizes extreme expansions in genome size.

    PubMed

    Kelly, Laura J; Renny-Byfield, Simon; Pellicer, Jaume; Macas, Jiří; Novák, Petr; Neumann, Pavel; Lysak, Martin A; Day, Peter D; Berger, Madeleine; Fay, Michael F; Nichols, Richard A; Leitch, Andrew R; Leitch, Ilia J

    2015-10-01

    Plants exhibit an extraordinary range of genome sizes, varying by > 2000-fold between the smallest and largest recorded values. In the absence of polyploidy, changes in the amount of repetitive DNA (transposable elements and tandem repeats) are primarily responsible for genome size differences between species. However, there is ongoing debate regarding the relative importance of amplification of repetitive DNA versus its deletion in governing genome size. Using data from 454 sequencing, we analysed the most repetitive fraction of some of the largest known genomes for diploid plant species, from members of Fritillaria. We revealed that genomic expansion has not resulted from the recent massive amplification of just a handful of repeat families, as shown in species with smaller genomes. Instead, the bulk of these immense genomes is composed of highly heterogeneous, relatively low-abundance repeat-derived DNA, supporting a scenario where amplified repeats continually accumulate due to infrequent DNA removal. Our results indicate that a lack of deletion and low turnover of repetitive DNA are major contributors to the evolution of extremely large genomes and show that their size cannot simply be accounted for by the activity of a small number of high-abundance repeat families. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  3. Inhibition of hepatitis B virus replication with linear DNA sequences expressing antiviral micro-RNA shuttles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chattopadhyay, Saket; Ely, Abdullah; Bloom, Kristie

    2009-11-20

    RNA interference (RNAi) may be harnessed to inhibit viral gene expression and this approach is being developed to counter chronic infection with hepatitis B virus (HBV). Compared to synthetic RNAi activators, DNA expression cassettes that generate silencing sequences have advantages of sustained efficacy and ease of propagation in plasmid DNA (pDNA). However, the large size of pDNAs and inclusion of sequences conferring antibiotic resistance and immunostimulation limit delivery efficiency and safety. To develop use of alternative DNA templates that may be applied for therapeutic gene silencing, we assessed the usefulness of PCR-generated linear expression cassettes that produce anti-HBV micro-RNA (miR)more » shuttles. We found that silencing of HBV markers of replication was efficient (>75%) in cell culture and in vivo. miR shuttles were processed to form anti-HBV guide strands and there was no evidence of induction of the interferon response. Modification of terminal sequences to include flanking human adenoviral type-5 inverted terminal repeats was easily achieved and did not compromise silencing efficacy. These linear DNA sequences should have utility in the development of gene silencing applications where modifications of terminal elements with elimination of potentially harmful and non-essential sequences are required.« less

  4. Turnover of R1 (Type I) and R2 (Type Ii) Retrotransposable Elements in the Ribosomal DNA of Drosophila Melanogaster

    PubMed Central

    Jakubczak, J. L.; Zenni, M. K.; Woodruff, R. C.; Eickbush, T. H.

    1992-01-01

    R1 and R2 are distantly related non-long terminal repeat retrotransposable elements each of which inserts into a specific site in the 28S rRNA genes of most insects. We have analyzed aspects of R1 and R2 abundance and sequence variation in 27 geographical isolates of Drosophila melanogaster. The fraction of 28S rRNA genes containing these elements varied greatly between strains, 17-67% for R1 elements and 2-28% for R2 elements. The total percentage of the rDNA repeats inserted ranged from 32 to 77%. The fraction of the rDNA repeats that contained both of these elements suggested that R1 and R2 exhibit neither an inhibition of nor preference for insertion into a 28S gene already containing the other type of element. Based on the conservation of restriction sites in the elements of all strains, and sequence analysis of individual elements from three strains, nucleotide divergence is very low for R1 and R2 elements within or between strains (<0.6%). This sequence uniformity is the expected result of the forces of concerted evolution (unequal crossovers and gene conversion) which act on the rRNA genes themselves. Evidence for the role of retrotransposition in the turnover of R1 and R2 was obtained by using naturally occurring 5' length polymorphisms of the elements as markers for independent transposition events. The pattern of these different length 5' truncations of R1 and R2 was found to be diverse and unique to most strains analyzed. Because recombination can only, with time, amplify or eliminate those length variants already present, the diversity found in each strain suggests that retrotransposition has played a critical role in maintaining these elements in the rDNA repeats of D. melanogaster. PMID:1317313

  5. TPA can overcome the requirement for EIa and together act synergistically in stimulating expression of the adenovirus EIII promoter.

    PubMed Central

    Buckbinder, L; Miralles, V J; Reinberg, D

    1989-01-01

    We have examined the control of gene expression from the adenovirus early region III (Ad-EIII) promoter, which contains two previously defined elements, the AP1 and ATF sites. We found that the AP1 element is capable of mediating activation by the adenovirus immediate early (EIa) gene products. Consistent with studies demonstrating that the AP1 site mediates signal transduction in response to 12-O-tetradecanoylphorbol 13-acetate (TPA) we have shown that TPA can activate Ad-EIII expression and overcome the requirement for EIa. Together TPA and EIa elicited a synergistic response in expression from the Ad-EIII promoter during both transient expression assays and viral infections. This synergistic effect required the AP1 element. An EIII promoter construct, in which sequences upstream of the TATA box had been replaced with four AP1 sites, was responsive to TPA and EIa and in combination promoted the synergistic effect. The analysis of specific factors involved in transcription from the Ad-EIII indicated that proteins recognizing the ATF and AP1 sites were important in expression from this promoter in vitro. Purification of protein factors that specifically stimulated EIII expression resulted in the isolation of a set of factors of the AP1 family. Affinity purified AP1 recognized and activated transcription through both the AP1 and ATF elements. In addition, a protein fraction was identified with DNA binding activity specific for the ATF element. This fraction was dependent on the ATF site for transcriptional activity. Images PMID:2531661

  6. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice

    PubMed Central

    Gómez-Porras, Judith L; Riaño-Pachón, Diego Mauricio; Dreyer, Ingo; Mayer, Jorge E; Mueller-Roeber, Bernd

    2007-01-01

    Background In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs), ABRE and CE3, in thale cress (Arabidopsis thaliana) and rice (Oryza sativa). Results Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE) associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs) in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Conclusion Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of interacting with transcription factors. Further studies will be needed to test whether the observed differences are extrapolatable to monocots and dicots in general, and to understand how they contribute to the fine-tuning of the hormonal response. The outcome of our investigation can now be used to direct future experimentation designed to further dissect the ABA-dependent regulatory networks. PMID:17672917

  7. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice.

    PubMed

    Gómez-Porras, Judith L; Riaño-Pachón, Diego Mauricio; Dreyer, Ingo; Mayer, Jorge E; Mueller-Roeber, Bernd

    2007-08-01

    In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs), ABRE and CE3, in thale cress (Arabidopsis thaliana) and rice (Oryza sativa). Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE) associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs) in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of interacting with transcription factors. Further studies will be needed to test whether the observed differences are extrapolatable to monocots and dicots in general, and to understand how they contribute to the fine-tuning of the hormonal response. The outcome of our investigation can now be used to direct future experimentation designed to further dissect the ABA-dependent regulatory networks.

  8. Acetylation of TAF(I)68, a subunit of TIF-IB/SL1, activates RNA polymerase I transcription.

    PubMed

    Muth, V; Nadaud, S; Grummt, I; Voit, R

    2001-03-15

    Mammalian rRNA genes are preceded by a terminator element that is recognized by the transcription termination factor TTF-I. In exploring the functional significance of the promoter-proximal terminator, we found that TTF-I associates with the p300/CBP-associated factor PCAF, suggesting that TTF-I may target histone acetyltransferase to the rDNA promoter. We demonstrate that PCAF acetylates TAF(I)68, the second largest subunit of the TATA box-binding protein (TBP)-containing factor TIF-IB/SL1, and acetylation enhances binding of TAF(I)68 to the rDNA promoter. Moreover, PCAF stimulates RNA polymerase I (Pol I) transcription in a reconstituted in vitro system. Consistent with acetylation of TIF-IB/SL1 being required for rDNA transcription, the NAD(+)-dependent histone deacetylase mSir2a deacetylates TAF(I)68 and represses Pol I transcription. The results demonstrate that acetylation of the basal Pol I transcription machinery has functional consequences and suggest that reversible acetylation of TIF-IB/SL1 may be an effective means to regulate rDNA transcription in response to external signals.

  9. Characterization of a hypoxia-response element in the Epo locus of the pufferfish, Takifugu rubripes.

    PubMed

    Kulkarni, Rashmi P; Tohari, Sumanty; Ho, Adrian; Brenner, Sydney; Venkatesh, Byrappa

    2010-06-01

    Animals respond to hypoxia by increasing synthesis of the glycoprotein hormone erythropoietin (Epo) which in turn stimulates the production of red blood cells. The gene encoding Epo has been recently cloned in teleost fishes such as the pufferfish Takifugu rubripes (fugu) and zebrafish (Danio rerio). It has been shown that the transcription levels of Epo in teleost fishes increase in response to anemia or hypoxia in a manner similar to its human ortholog. However, the cis-regulatory element(s) mediating the hypoxia response of Epo gene in fishes has not been identified. In the present study, using the human hepatoma cell line (Hep3B), we have identified and characterized a hypoxia response element (HRE) in the fugu Epo locus. The sequence of the fugu HRE (ACGTGCTG) is identical to that of the HRE in the human EPO locus. However, unlike the HRE in the mammalian Epo locus, which is located in the 3' region of the gene, the fugu HRE is located in the 5' flanking region and on the opposite strand of DNA. This HRE is conserved in other teleosts such as Tetraodon and zebrafish in a similar location. A 365-bp fragment containing the fugu HRE was able to drive GFP expression in the liver of transgenic zebrafish. However, we could not ascertain if the expression of transgene is induced by hypoxia in vivo due to the low and variable levels of GFP expression in transgenic zebrafish. Our investigations also revealed that the Epo locus has experienced extensive rearrangements during vertebrate evolution. Copyright © 2010 Elsevier B.V. All rights reserved.

  10. Regulation of HIV-Gag Expression and Targeting to the Endolysosomal/Secretory Pathway by the Luminal Domain of Lysosomal-Associated Membrane Protein (LAMP-1) Enhance Gag-Specific Immune Response

    PubMed Central

    Lucas, Carolina Gonçalves de Oliveira; Rigato, Paula Ordonhez; Gonçalves, Jorge Luiz Santos; Sato, Maria Notomi; Maciel, Milton; Peçanha, Ligia Maria Torres; August, J. Thomas; de Azevedo Marques, Ernesto Torres; de Arruda, Luciana Barros

    2014-01-01

    We have previously demonstrated that a DNA vaccine encoding HIV-p55gag in association with the lysosomal associated membrane protein-1 (LAMP-1) elicited a greater Gag-specific immune response, in comparison to a DNA encoding the native gag. In vitro studies have also demonstrated that LAMP/Gag was highly expressed and was present in MHCII containing compartments in transfected cells. In this study, the mechanisms involved in these processes and the relative contributions of the increased expression and altered traffic for the enhanced immune response were addressed. Cells transfected with plasmid DNA constructs containing p55gag attached to truncated sequences of LAMP-1 showed that the increased expression of gag mRNA required p55gag in frame with at least 741 bp of the LAMP-1 luminal domain. LAMP luminal domain also showed to be essential for Gag traffic through lysosomes and, in this case, the whole sequence was required. Further analysis of the trafficking pathway of the intact LAMP/Gag chimera demonstrated that it was secreted, at least in part, associated with exosome-like vesicles. Immunization of mice with LAMP/gag chimeric plasmids demonstrated that high expression level alone can induce a substantial transient antibody response, but targeting of the antigen to the endolysosomal/secretory pathways was required for establishment of cellular and memory response. The intact LAMP/gag construct induced polyfunctional CD4+ T cell response, which presence at the time of immunization was required for CD8+ T cell priming. LAMP-mediated targeting to endolysosomal/secretory pathway is an important new mechanistic element in LAMP-mediated enhanced immunity with applications to the development of novel anti-HIV vaccines and to general vaccinology field. PMID:24932692

  11. A new family of polymerases related to superfamily A DNA polymerases and T7-like DNA-dependent RNA polymerases.

    PubMed

    Iyer, Lakshminarayan M; Abhiman, Saraswathi; Aravind, L

    2008-10-04

    Using sequence profile methods and structural comparisons we characterize a previously unknown family of nucleic acid polymerases in a group of mobile elements from genomes of diverse bacteria, an algal plastid and certain DNA viruses, including the recently reported Sputnik virus. Using contextual information from domain architectures and gene-neighborhoods we present evidence that they are likely to possess both primase and DNA polymerase activity, comparable to the previously reported prim-pol proteins. These newly identified polymerases help in defining the minimal functional core of superfamily A DNA polymerases and related RNA polymerases. Thus, they provide a framework to understand the emergence of both DNA and RNA polymerization activity in this class of enzymes. They also provide evidence that enigmatic DNA viruses, such as Sputnik, might have emerged from mobile elements coding these polymerases.

  12. A new family of polymerases related to superfamily A DNA polymerases and T7-like DNA-dependent RNA polymerases

    PubMed Central

    Iyer, Lakshminarayan M; Abhiman, Saraswathi; Aravind, L

    2008-01-01

    Using sequence profile methods and structural comparisons we characterize a previously unknown family of nucleic acid polymerases in a group of mobile elements from genomes of diverse bacteria, an algal plastid and certain DNA viruses, including the recently reported Sputnik virus. Using contextual information from domain architectures and gene-neighborhoods we present evidence that they are likely to possess both primase and DNA polymerase activity, comparable to the previously reported prim-pol proteins. These newly identified polymerases help in defining the minimal functional core of superfamily A DNA polymerases and related RNA polymerases. Thus, they provide a framework to understand the emergence of both DNA and RNA polymerization activity in this class of enzymes. They also provide evidence that enigmatic DNA viruses, such as Sputnik, might have emerged from mobile elements coding these polymerases. This article was reviewed by Eugene Koonin and Mark Ragan. PMID:18834537

  13. H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element.

    PubMed

    Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K

    1989-11-01

    Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, but not to other MHC cis-acting sequences or to mutant region II sequences, similar to the naturally occurring region II factor in mouse cells. The deduced amino acid sequence of H-2RIIBP revealed two putative zinc fingers homologous to the DNA-binding domain of steroid/thyroid hormone receptors. Although sequence similarity in other regions was minimal, H-2RIIBP has apparent modular domains characteristic of the nuclear hormone receptors. Further analyses showed that both H-2RIIBP and the natural region II factor bind to the estrogen response element (ERE) of the vitellogenin A2 gene. The ERE is composed of a palindrome, and half of this palindrome resembles the region II binding site of the MHC CRE. These results indicate that H-2RIIBP (i) is a member of the superfamily of nuclear hormone receptors and (ii) may regulate not only MHC class I genes but also genes containing the ERE and related sequences. Sequences homologous to the H-2RIIBP gene are widely conserved in the animal kingdom. H-2RIIBP mRNA is expressed in many mouse tissues, in agreement with the distribution of the natural region II factor.

  14. Transactivation of a cellular promoter by the NS1 protein of the parvovirus minute virus of mice through a putative hormone-responsive element.

    PubMed Central

    Vanacker, J M; Corbau, R; Adelmant, G; Perros, M; Laudet, V; Rommelaere, J

    1996-01-01

    The promoter of the thyroid hormone receptor alpha gene (c-erbA-1) is activated by the nonstructural protein 1 (NS1) of parvovirus minute virus of mice (prototype strain [MVMp]) in ras-transformed FREJ4 cells that are permissive for lytic MVMp replication. This stimulation may be related to the sensitivity of host cells to MVMp, as it does not take place in parental FR3T3 cells, which are resistant to the parvovirus killing effect. The analysis of a series of deletion and point mutants of the c-erbA-1 promoter led to the identification of an upstream region that is necessary for NS1-driven transactivation. This sequence harbors a putative hormone-responsive element and is sufficient to render a minimal promoter NS1 inducible in FREJ4 but not in FR3T3 cells, and it is involved in distinct interactions with proteins from the respective cell lines. The NS1-responsive element of the c-erbA-1 promoter bears no homology with sequences that were previously reported to be necessary for NS1 DNA binding and transactivation. Altogether, our data point to a novel, cell-specific mechanism of promoter activation by NS1. PMID:8642664

  15. The cis-regulatory element CCACGTGG is involved in ABA and water-stress responses of the maize gene rab28.

    PubMed

    Pla, M; Vilardell, J; Guiltinan, M J; Marcotte, W R; Niogret, M F; Quatrano, R S; Pagès, M

    1993-01-01

    The maize gene rab28 has been identified as ABA-inducible in embryos and vegetative tissues. It is also induced by water stress in young leaves. The proximal promoter region contains the conserved cis-acting element CCACGTGG (ABRE) reported for ABA induction in other plant genes. Transient expression assays in rice protoplasts indicate that a 134 bp fragment (-194 to -60 containing the ABRE) fused to a truncated cauliflower mosaic virus promoter (35S) is sufficient to confer ABA-responsiveness upon the GUS reporter gene. Gel retardation experiments indicate that nuclear proteins from tissues in which the rab28 gene is expressed can interact specifically with this 134 bp DNA fragment. Nuclear protein extracts from embryo and water-stressed leaves generate specific complexes of different electrophoretic mobility which are stable in the presence of detergent and high salt. However, by DMS footprinting the same guanine-specific contacts with the ABRE in both the embryo and leaf binding activities were detected. These results indicate that the rab28 promoter sequence CCACGTGG is a functional ABA-responsive element, and suggest that distinct regulatory factors with apparent similar affinity for the ABRE sequence may be involved in the hormone action during embryo development and in vegetative tissues subjected to osmotic stress.

  16. Structure, replication efficiency and fragility of yeast ARS elements.

    PubMed

    Dhar, Manoj K; Sehgal, Shelly; Kaul, Sanjana

    2012-05-01

    DNA replication in eukaryotes initiates at specific sites known as origins of replication, or replicators. These replication origins occur throughout the genome, though the propensity of their occurrence depends on the type of organism. In eukaryotes, zones of initiation of replication spanning from about 100 to 50,000 base pairs have been reported. The characteristics of eukaryotic replication origins are best understood in the budding yeast Saccharomyces cerevisiae, where some autonomously replicating sequences, or ARS elements, confer origin activity. ARS elements are short DNA sequences of a few hundred base pairs, identified by their efficiency at initiating a replication event when cloned in a plasmid. ARS elements, although structurally diverse, maintain a basic structure composed of three domains, A, B and C. Domain A is comprised of a consensus sequence designated ACS (ARS consensus sequence), while the B domain has the DNA unwinding element and the C domain is important for DNA-protein interactions. Although there are ∼400 ARS elements in the yeast genome, not all of them are active origins of replication. Different groups within the genus Saccharomyces have ARS elements as components of replication origin. The present paper provides a comprehensive review of various aspects of ARSs, starting from their structural conservation to sequence thermodynamics. All significant and conserved functional sequence motifs within different types of ARS elements have been extensively described. Issues like silencing at ARSs, their inherent fragility and factors governing their replication efficiency have also been addressed. Progress in understanding crucial components associated with the replication machinery and timing at these ARS elements is discussed in the section entitled "The replicon revisited". Copyright © 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  17. Interactions between the cytomegalovirus promoter and the estrogen response element: implications for design of estrogen-responsive reporter plasmids.

    PubMed

    Derecka, K; Wang, C K; Flint, A P F

    2006-07-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)ERE) was not estrogen responsive. Inhibition of ERE function was not due to an effect in trans or due to lack of estrogen receptor. It was not due to an interaction between the cmv promoter and the SeAP gene. cmv promoter function was dependent on NF-kappaB, and mutagenesis in the NF-kappaB sites reduced basal reporter expression without imparting responsiveness to estrogen. A mutation in the TATA box also failed to impart estrogen responsiveness. Modeling of DNA accessibility indicated the ERE was inserted at a site accessible to transcription factors. We conclude that the cmv promoter inhibits ERE function in cis when the two sequences are located in the same construct, and that this effect does not involve an interaction between cmv and reporter gene, NF-kappaB sites or the TATA box, or DNA inaccessibility.

  18. Tomato ASR1 abrogates the response to abscisic acid and glucose in Arabidopsis by competing with ABI4 for DNA binding.

    PubMed

    Shkolnik, Doron; Bar-Zvi, Dudy

    2008-05-01

    The manipulation of transacting factors is commonly used to achieve a wide change in the expression of a large number of genes in transgenic plants as a result of a change in the expression of a single gene product. This is mostly achieved by the overexpression of transactivator or repressor proteins. In this study, it is demonstrated that the overexpression of an exogenous DNA-binding protein can be used to compete with the expression of an endogenous transcription factor sharing the same DNA-binding sequence. Arabidopsis was transformed with cDNA encoding tomato abscisic acid stress ripening 1 (ASR1), a sequence-specific DNA protein that has no orthologues in the Arabidopsis genome. ASR1-overexpressing (ASR1-OE) plants display an abscisic acid-insensitive 4 (abi4) phenotype: seed germination is not sensitive to inhibition by abscisic acid (ABA), glucose, NaCl and paclobutrazol. ASR1 binds coupling element 1 (CE1), a cis-acting element bound by the ABI4 transcription factor, located in the ABI4-regulated promoters, including that of the ABI4 gene. Chromatin immunoprecipitation demonstrates that ASR1 is bound in vivo to the promoter of the ABI4 gene in ASR1-OE plants, but not to promoters of genes known to be regulated by the transcription factors ABI3 or ABI5. Real-time polymerase chain reaction (PCR) analysis confirmed that the expression of ABI4 and ABI4-regulated genes is markedly reduced in ASR1-OE plants. Therefore, it is concluded that the abi4 phenotype of ASR1-OE plants is the result of competition between the foreign ASR1 and the endogenous ABI4 on specific promoter DNA sequences. The biotechnological advantage of using this approach in crop plants from the Brassicaceae family to reduce the transactivation activity of ABI4 is discussed.

  19. Iron triggers λSo prophage induction and release of extracellular DNA in Shewanella oneidensis MR-1 biofilms.

    PubMed

    Binnenkade, Lucas; Teichmann, Laura; Thormann, Kai M

    2014-09-01

    Prophages are ubiquitous elements within bacterial chromosomes and affect host physiology and ecology in multiple ways. We have previously demonstrated that phage-induced lysis is required for extracellular DNA (eDNA) release and normal biofilm formation in Shewanella oneidensis MR-1. Here, we investigated the regulatory mechanisms of prophage λSo spatiotemporal induction in biofilms. To this end, we used a functional fluorescence fusion to monitor λSo activation in various mutant backgrounds and in response to different physiological conditions. λSo induction occurred mainly in a subpopulation of filamentous cells in a strictly RecA-dependent manner, implicating oxidative stress-induced DNA damage as the major trigger. Accordingly, mutants affected in the oxidative stress response (ΔoxyR) or iron homeostasis (Δfur) displayed drastically increased levels of phage induction and abnormal biofilm formation, while planktonic cells were not or only marginally affected. To further investigate the role of oxidative stress, we performed a mutant screen and identified two independent amino acid substitutions in OxyR (T104N and L197P) that suppress induction of λSo by hydrogen peroxide (H2O2). However, λSo induction was not suppressed in biofilms formed by both mutants, suggesting a minor role of intracellular H2O2 in this process. In contrast, addition of iron to biofilms strongly enhanced λSo induction and eDNA release, while both processes were significantly suppressed at low iron levels, strongly indicating that iron is the limiting factor. We conclude that uptake of iron during biofilm formation triggers λSo-mediated lysis of a subpopulation of cells, likely by an increase in iron-mediated DNA damage sensed by RecA. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  20. Transcriptional activation of short interspersed elements by DNA-damaging agents.

    PubMed

    Rudin, C M; Thompson, C B

    2001-01-01

    Short interspersed elements (SINEs), typified by the human Alu repeat, are RNA polymerase III (pol III)-transcribed sequences that replicate within the genome through an RNA intermediate. Replication of SINEs has been extensive in mammalian evolution: an estimated 5% of the human genome consists of Alu repeats. The mechanisms regulating transcription, reverse transcription, and reinsertion of SINE elements in genomic DNA are poorly understood. Here we report that expression of murine SINE transcripts of both the B1 and B2 classes is strongly upregulated after prolonged exposure to cisplatin, etoposide, or gamma radiation. A similar induction of Alu transcripts in human cells occurs under these conditions. This induction is not due to a general upregulation of pol III activity in either species. Genotoxic treatment of murine cells containing an exogenous human Alu element induced Alu transcription. Concomitant with the increased expression of SINEs, an increase in cellular reverse transcriptase was observed after exposure to these same DNA-damaging agents. These findings suggest that genomic damage may be an important activator of SINEs, and that SINE mobility may contribute to secondary malignancy after exposure to DNA-damaging chemotherapy.

  1. Functional characterization of piggyBat from the bat Myotis lucifugus unveils an active mammalian DNA transposon.

    PubMed

    Mitra, Rupak; Li, Xianghong; Kapusta, Aurélie; Mayhew, David; Mitra, Robi D; Feschotte, Cédric; Craig, Nancy L

    2013-01-02

    A revelation of the genomic age has been the contributions of the mobile DNA segments called transposable elements to chromosome structure, function, and evolution in virtually all organisms. Substantial fractions of vertebrate genomes derive from transposable elements, being dominated by retroelements that move via RNA intermediates. Although many of these elements have been inactivated by mutation, several active retroelements remain. Vertebrate genomes also contain substantial quantities and a high diversity of cut-and-paste DNA transposons, but no active representative of this class has been identified in mammals. Here we show that a cut-and-paste element called piggyBat, which has recently invaded the genome of the little brown bat (Myotis lucifugus) and is a member of the piggyBac superfamily, is active in its native form in transposition assays in bat and human cultured cells, as well as in the yeast Saccharomyces cerevisiae. Our study suggests that some DNA transposons are still actively shaping some mammalian genomes and reveals an unprecedented opportunity to study the mechanism, regulation, and genomic impact of cut-and-paste transposition in a natural mammalian host.

  2. Complex structure of knob DNA on maize chromosome 9. Retrotransposon invasion into heterochromatin.

    PubMed Central

    Ananiev, E V; Phillips, R L; Rines, H W

    1998-01-01

    The recovery of maize (Zea mays L.) chromosome addition lines of oat (Avena sativa L.) from oat x maize crosses enables us to analyze the structure and composition of specific regions, such as knobs, of individual maize chromosomes. A DNA hybridization blot panel of eight individual maize chromosome addition lines revealed that 180-bp repeats found in knobs are present in each of these maize chromosomes, but the copy number varies from approximately 100 to 25, 000. Cosmid clones with knob DNA segments were isolated from a genomic library of an oat-maize chromosome 9 addition line with the help of the 180-bp knob-associated repeated DNA sequence used as a probe. Cloned knob DNA segments revealed a complex organization in which blocks of tandemly arranged 180-bp repeating units are interrupted by insertions of other repeated DNA sequences, mostly represented by individual full size copies of retrotransposable elements. There is an obvious preference for the integration of retrotransposable elements into certain sites (hot spots) of the 180-bp repeat. Sequence microheterogeneity including point mutations and duplications was found in copies of 180-bp repeats. The 180-bp repeats within an array all had the same polarity. Restriction maps constructed for 23 cloned knob DNA fragments revealed the positions of polymorphic sites and sites of integration of insertion elements. Discovery of the interspersion of retrotransposable elements among blocks of tandem repeats in maize and some other organisms suggests that this pattern may be basic to heterochromatin organization for eukaryotes. PMID:9691055

  3. Pivotal Impacts of Retrotransposon Based Invasive RNAs on Evolution.

    PubMed

    Habibi, Laleh; Salmani, Hamzeh

    2017-01-01

    RNAs have long been described as the mediators of gene expression; they play a vital role in the structure and function of cellular complexes. Although the role of RNAs in the prokaryotes is mainly confined to these basic functions, the effects of these molecules in regulating the gene expression and enzymatic activities have been discovered in eukaryotes. Recently, a high-resolution analysis of the DNA obtained from different organisms has revealed a fundamental impact of the RNAs in shaping the genomes, heterochromatin formation, and gene creation. Deep sequencing of the human genome revealed that about half of our DNA is comprised of repetitive sequences (remnants of transposable element movements) expanded mostly through RNA-mediated processes. ORF2 encoded by L1 retrotransposons is a cellular reverse transcriptase which is mainly responsible for RNA invasion of various transposable elements (L1s, Alus, and SVAs) and cellular mRNAs in to the genomic DNA. In addition to increasing retroelements copy number; genomic expansion in association with centromere, telomere, and heterochromatin formation as well as pseudogene creation are the evolutionary consequences of this RNA-based activity. Threatening DNA integrity by disrupting the genes and forming excessive double strand breaks is another effect of this invasion. Therefore, repressive mechanisms have been evolved to control the activities of these invasive intracellular RNAs. All these mechanisms now have essential roles in the complex cellular functions. Therefore, it can be concluded that without direct action of RNA networks in shaping the genome and in the development of different cellular mechanisms, the evolution of higher eukaryotes would not be possible.

  4. Pivotal Impacts of Retrotransposon Based Invasive RNAs on Evolution

    PubMed Central

    Habibi, Laleh; Salmani, Hamzeh

    2017-01-01

    RNAs have long been described as the mediators of gene expression; they play a vital role in the structure and function of cellular complexes. Although the role of RNAs in the prokaryotes is mainly confined to these basic functions, the effects of these molecules in regulating the gene expression and enzymatic activities have been discovered in eukaryotes. Recently, a high-resolution analysis of the DNA obtained from different organisms has revealed a fundamental impact of the RNAs in shaping the genomes, heterochromatin formation, and gene creation. Deep sequencing of the human genome revealed that about half of our DNA is comprised of repetitive sequences (remnants of transposable element movements) expanded mostly through RNA-mediated processes. ORF2 encoded by L1 retrotransposons is a cellular reverse transcriptase which is mainly responsible for RNA invasion of various transposable elements (L1s, Alus, and SVAs) and cellular mRNAs in to the genomic DNA. In addition to increasing retroelements copy number; genomic expansion in association with centromere, telomere, and heterochromatin formation as well as pseudogene creation are the evolutionary consequences of this RNA-based activity. Threatening DNA integrity by disrupting the genes and forming excessive double strand breaks is another effect of this invasion. Therefore, repressive mechanisms have been evolved to control the activities of these invasive intracellular RNAs. All these mechanisms now have essential roles in the complex cellular functions. Therefore, it can be concluded that without direct action of RNA networks in shaping the genome and in the development of different cellular mechanisms, the evolution of higher eukaryotes would not be possible. PMID:29067016

  5. SINE sequences detect DNA fingerprints in salmonid fishes.

    PubMed

    Spruell, P; Thorgaard, G H

    1996-04-01

    DNA probes homologous to two previously described salmonid short interspersed nuclear elements (SINEs) detected DNA fingerprint patterns in 14 species of salmonid fishes. The probes showed more homology to some species than to others and little homology to three nonsalmonid fishes. The DNA fingerprint patterns derived from the SINE probes are individual-specific and inherited in a Mendelian manner. Probes derived from different regions of the same SINE detect only partially overlapping banding patterns, reflecting a more complex SINE structure than has been previously reported. Like the human Alu sequence, the SINEs found in salmonids could provide useful genetic markers and primer sites for PCR-based techniques. These elements may be more desirable for some applications than traditional DNA fingerprinting probes that detect tandemly repeated arrays.

  6. Evolutionary Dynamics of 5S rDNA and Recurrent Association of Transposable Elements in Electric Fish of the Family Gymnotidae (Gymnotiformes): The Case of Gymnotus mamiraua.

    PubMed

    da Silva, Maelin; Barbosa, Patricia; Artoni, Roberto F; Feldberg, Eliana

    2016-01-01

    Gymnotidae is a family of electric fish endemic to the Neotropics consisting of 2 genera: Electrophorus and Gymnotus. The genus Gymnotus is widely distributed and is found in all of the major Brazilian river systems. Physical and molecular mapping data for the ribosomal DNA (rDNA) in this genus are still scarce, with its chromosomal location known in only 11 species. As other species of Gymnotus with 2n = 54 chromosomes from the Paraná-Paraguay basin, G. mamiraua was found to have a large number of 5S rDNA sites. Isolation and cloning of the 5S rDNA sequences from G. mamiraua identified a fragment of a transposable element similar to the Tc1/mariner transposon associated with a non-transcribed spacer. Double fluorescence in situ hybridization analysis of this element and the 5S rDNA showed that they were colocalized on several chromosomes, in addition to acting as nonsyntenic markers on others. Our data show the association between these sequences and suggest that the Tc1 retrotransposon may be the agent that drives the spread of these 5S rDNA-like sequences in the G. mamiraua genome. © 2016 S. Karger AG, Basel.

  7. Is junk DNA bunk? A critique of ENCODE.

    PubMed

    Doolittle, W Ford

    2013-04-02

    Do data from the Encyclopedia Of DNA Elements (ENCODE) project render the notion of junk DNA obsolete? Here, I review older arguments for junk grounded in the C-value paradox and propose a thought experiment to challenge ENCODE's ontology. Specifically, what would we expect for the number of functional elements (as ENCODE defines them) in genomes much larger than our own genome? If the number were to stay more or less constant, it would seem sensible to consider the rest of the DNA of larger genomes to be junk or, at least, assign it a different sort of role (structural rather than informational). If, however, the number of functional elements were to rise significantly with C-value then, (i) organisms with genomes larger than our genome are more complex phenotypically than we are, (ii) ENCODE's definition of functional element identifies many sites that would not be considered functional or phenotype-determining by standard uses in biology, or (iii) the same phenotypic functions are often determined in a more diffuse fashion in larger-genomed organisms. Good cases can be made for propositions ii and iii. A larger theoretical framework, embracing informational and structural roles for DNA, neutral as well as adaptive causes of complexity, and selection as a multilevel phenomenon, is needed.

  8. Is junk DNA bunk? A critique of ENCODE

    PubMed Central

    Doolittle, W. Ford

    2013-01-01

    Do data from the Encyclopedia Of DNA Elements (ENCODE) project render the notion of junk DNA obsolete? Here, I review older arguments for junk grounded in the C-value paradox and propose a thought experiment to challenge ENCODE’s ontology. Specifically, what would we expect for the number of functional elements (as ENCODE defines them) in genomes much larger than our own genome? If the number were to stay more or less constant, it would seem sensible to consider the rest of the DNA of larger genomes to be junk or, at least, assign it a different sort of role (structural rather than informational). If, however, the number of functional elements were to rise significantly with C-value then, (i) organisms with genomes larger than our genome are more complex phenotypically than we are, (ii) ENCODE’s definition of functional element identifies many sites that would not be considered functional or phenotype-determining by standard uses in biology, or (iii) the same phenotypic functions are often determined in a more diffuse fashion in larger-genomed organisms. Good cases can be made for propositions ii and iii. A larger theoretical framework, embracing informational and structural roles for DNA, neutral as well as adaptive causes of complexity, and selection as a multilevel phenomenon, is needed. PMID:23479647

  9. Enhancement of the Initial Rate of Ethanol Fermentation Due to Dysfunction of Yeast Stress Response Components Msn2p and/or Msn4p▿ †

    PubMed Central

    Watanabe, Daisuke; Wu, Hong; Noguchi, Chiemi; Zhou, Yan; Akao, Takeshi; Shimoi, Hitoshi

    2011-01-01

    Sake yeasts (strains of Saccharomyces cerevisiae) produce high concentrations of ethanol in sake fermentation. To investigate the molecular mechanisms underlying this brewing property, we compared gene expression of sake and laboratory yeasts in sake mash. DNA microarray and reporter gene analyses revealed defects of sake yeasts in environmental stress responses mediated by transcription factors Msn2p and/or Msn4p (Msn2/4p) and stress response elements (STRE). Furthermore, we found that dysfunction of MSN2 and/or MSN4 contributes to the higher initial rate of ethanol fermentation in both sake and laboratory yeasts. These results provide novel insights into yeast stress responses as major impediments of effective ethanol fermentation. PMID:21131516

  10. Identification and characterization of TF1(phox), a DNA-binding protein that increases expression of gp91(phox) in PLB985 myeloid leukemia cells.

    PubMed

    Eklund, E A; Kakar, R

    1997-04-04

    The CYBB gene encodes gp91(phox), the heavy chain of the phagocyte-specific NADPH oxidase. CYBB is transcriptionally inactive until the promyelocyte stage of myelopoiesis, and in mature phagocytes, expression of gp91(phox) is further increased by interferon-gamma (IFN-gamma) and other inflammatory mediators. The CYBB promoter region contains several lineage-specific cis-elements involved in the IFN-gamma response. We screened a leukocyte cDNA expression library for proteins able to bind to one of these cis-elements (-214 to -262 base pairs) and identified TF1(phox), a protein with sequence-specific binding to the CYBB promoter. Electrophoretic mobility shift assay with nuclear proteins from a variety of cell lines demonstrated binding of a protein to the CYBB promoter that was cross-immunoreactive with TF1(phox). DNA binding of this protein was increased by IFN-gamma treatment in the myeloid cell line PLB985, but not in the non-myeloid cell line HeLa. Overexpression of recombinant TF1(phox) in PLB985 cells increased endogenous gp91(phox) message abundance, but did not lead to cellular differentiation. Overexpression of TF1(phox) in myeloid leukemia cell lines increased reporter gene expression from artificial promoter constructs containing CYBB promoter sequence. These data suggested that TF1(phox) increased expression of gp91(phox).

  11. Single-Stranded DNA Aptamers against Pathogens and Toxins: Identification and Biosensing Applications

    PubMed Central

    Hong, Ka Lok

    2015-01-01

    Molecular recognition elements (MREs) can be short sequences of single-stranded DNA, RNA, small peptides, or antibody fragments. They can bind to user-defined targets with high affinity and specificity. There has been an increasing interest in the identification and application of nucleic acid molecular recognition elements, commonly known as aptamers, since they were first described in 1990 by the Gold and Szostak laboratories. A large number of target specific nucleic acids MREs and their applications are currently in the literature. This review first describes the general methodologies used in identifying single-stranded DNA (ssDNA) aptamers. It then summarizes advancements in the identification and biosensing application of ssDNA aptamers specific for bacteria, viruses, their associated molecules, and selected chemical toxins. Lastly, an overview of the basic principles of ssDNA aptamer-based biosensors is discussed. PMID:26199940

  12. The pregnane X receptor regulates gene expression in a ligand- and promoter-selective fashion.

    PubMed

    Masuyama, Hisashi; Suwaki, Naoko; Tateishi, Yoko; Nakatsukasa, Hideki; Segawa, Tomonori; Hiramatsu, Yuji

    2005-05-01

    Recent studies have revealed that pregnane X receptor (PXR) can function as a master regulator to control the expression of phase I and phase II drug-metabolizing enzymes, as well as members of the drug transporter family, including multiple drug resistance (MDR) 1, which has a major role in multidrug resistance. Previously, we have demonstrated that steroid/xenobiotics metabolism by tumor tissue through the PXR-cytochrome P-450 3A (CYP3A) pathway might play an important role in endometrial cancer. In this study, we examined which endocrine-disrupting chemicals (EDCs) and anticancer agents might be ligands for PXR and whether these chemicals enhanced PXR-mediated transcription through two different PXR-responsive elements (PXREs), CYP3A4 and MDR1, in endometrial cancer cell lines. Some steroids/EDCs strongly activated PXR-mediated transcription through the CYP3A4-responsive element compared with the MDR1-responsive element, whereas these steroids/EDCs also enhanced the CYP3A4 expression compared with the MDR1 expression. In contrast, the anticancer agents, cisplatin and paclitaxel, strongly activated PXR-mediated transcription through the MDR1-responsive element compared with the CYP3A4-responsive element, whereas these drugs also enhanced the MDR1 expression compared with the CYP3A4 expression. We also analyzed how these ligands regulated PXR-mediated transcription through two different PXREs. In the presence of PXR ligands, there was no difference in the DNA binding affinity of the PXR/retinoid X receptor heterodimer to each PXRE, but there were different interactions of the coactivator to each PXR/PXRE complex. These data suggested that PXR ligands enhanced PXR-mediated transcription in a ligand- and promoter-dependent fashion, which in turn differentially regulated the expression of individual PXR targets, especially CYP3A4 and MDR1.

  13. Added value of stress related gene inductions in HepG2 cells as effect measurement in monitoring of air pollution

    NASA Astrophysics Data System (ADS)

    Nobels, Ingrid; Vanparys, Caroline; Van den Heuvel, Rosette; Vercauteren, Jordy; Blust, Ronny

    2012-08-01

    In this study we studied the effects of particulate matter samples (PM) through gene expression analysis in a routine air quality monitoring campaign by the Flemish Environment Agency (VMM, Belgium). We selected a human hepatoma (HepG2) multiple endpoint reporter assay for targeted stress related endpoint screening. Organic extracts of air samples (total suspended particles, TSP) were collected during one year in an industrial, urban and background location in Flanders, Belgium. Simultaneously, meteorological conditions (temperature, wind speed and precipitation) and particulate matter size ≤ 10 μM (PM10), organic (OC), elemental (EC) and total (TC) carbon were monitored and air samples were collected for chemical analysis (11 PAHs). Correlations between the induction of the different stress genes and the chemical pollutants were analysed. Exposure of HepG2 cells to daily air equivalents (20 m3) of organic TSP extracts revealed the dominant induction of the xenobiotic response element (Xre) and phase I (Cyp1A1) and phase II (GstYa) biotransformation enzymes. Additional effects were the induction of c-Fos, a proto-oncogen and Gadd45, a marker for cell cycle disturbance and responsive to genotoxic compounds. Inductions of other relevant pathways, such as sequestration of heavy metals, retinoids response, protein misfolding and increased cAMP levels were measured occasionally. A significant correlation was found between the genes Cyp1A1 (a typical marker for presence of PAHs and dioxin like compounds), c-Fos, Gadd45, (responsive to DNA damaging compounds) and the amount of PM10 and elemental carbon (EC) whereas no correlation was found between these genes and total PAHs content. This may suggest that the observed induction of Cyp1A1 and DNA damage related genes was provoked (partially) by other particle bound compounds (e.g. pesticides, PCBs, brominated flame retardants, dioxins, …), than PAHs. The contribution of particle bound compounds, other than PAHs might be important to take into account in risk evaluation of air pollution.

  14. Heart rate variability and DNA methylation levels are altered after short-term metal fume exposure among occupational welders: a repeated-measures panel study.

    PubMed

    Fan, Tianteng; Fang, Shona C; Cavallari, Jennifer M; Barnett, Ian J; Wang, Zhaoxi; Su, Li; Byun, Hyang-Min; Lin, Xihong; Baccarelli, Andrea A; Christiani, David C

    2014-12-16

    In occupational settings, boilermakers are exposed to high levels of metallic fine particulate matter (PM2.5) generated during the welding process. The effect of welding PM2.5 on heart rate variability (HRV) has been described, but the relationship between PM2.5, DNA methylation, and HRV is not known. In this repeated-measures panel study, we recorded resting HRV and measured DNA methylation levels in transposable elements Alu and long interspersed nuclear element-1 (LINE-1) in peripheral blood leukocytes under ambient conditions (pre-shift) and right after a welding task (post-shift) among 66 welders. We also monitored personal PM2.5 level in the ambient environment and during the welding procedure. The concentration of welding PM2.5 was significantly higher than background levels in the union hall (0.43 mg/m3 vs. 0.11 mg/m3, p < 0.0001). The natural log of transformed power in the high frequency range (ln HF) had a significantly negative association with PM2.5 exposure (β = -0.76, p = 0.035). pNN10 and pNN20 also had a negative association with PM2.5 exposure (β = -0.16%, p = 0.006 and β = -0.13%, p = 0.030, respectively). PM2.5 was positively associated with LINE-1 methylation [β = 0.79%, 5-methylcytosince (%mC), p = 0.013]; adjusted for covariates. LINE-1 methylation did not show an independent association with HRV. Acute decline of HRV was observed following exposure to welding PM2.5 and evidence for an epigenetic response of transposable elements to short-term exposure to high-level metal-rich particulates was reported.

  15. The putative Agrobacterium transcriptional activator-like virulence protein VirD5 may target T-complex to prevent the degradation of coat proteins in the plant cell nucleus.

    PubMed

    Wang, Yafei; Peng, Wei; Zhou, Xu; Huang, Fei; Shao, Lingyun; Luo, Meizhong

    2014-09-01

    Agrobacterium exports at least five virulence proteins (VirE2, VirE3, VirF, VirD2, VirD5) into host cells and hijacks some host plant factors to facilitate its transformation process. Random DNA binding selection assays (RDSAs), electrophoretic mobility shift assays (EMSAs) and yeast one-hybrid systems were used to identify protein-bound DNA elements. Bimolecular fluorescence complementation, glutathione S-transferase pull-down and yeast two-hybrid assays were used to detect protein interactions. Protoplast transformation, coprecipitation, competitive binding and cell-free degradation assays were used to analyze the relationships among proteins. We found that Agrobacterium VirD5 exhibits transcriptional activation activity in yeast, is located in the plant cell nucleus, and forms homodimers. A specific VirD5-bound DNA element designated D5RE (VirD5 response element) was identified. VirD5 interacted directly with Arabidopsis VirE2 Interacting Protein 1 (AtVIP1). However, the ternary complex of VirD5-AtVIP1-VirE2 could be detected, whereas that of VirD5-AtVIP1-VBF (AtVIP1 Binding F-box protein) could not. We demonstrated that VirD5 competes with VBF for binding to AtVIP1 and stabilizes AtVIP1 and VirE2 in the cell-free degradation system. Our results indicated that VirD5 may act as both a transcriptional activator-like effector to regulate host gene expression and a protector preventing the coat proteins of the T-complex from being quickly degraded by the host's ubiquitin proteasome system (UPS). © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

  16. A calmodulin-binding/CGCG box DNA-binding protein family involved in multiple signaling pathways in plants

    NASA Technical Reports Server (NTRS)

    Yang, Tianbao; Poovaiah, B. W.

    2002-01-01

    We reported earlier that the tobacco early ethylene-responsive gene NtER1 encodes a calmodulin-binding protein (Yang, T., and Poovaiah, B. W. (2000) J. Biol. Chem. 275, 38467-38473). Here we demonstrate that there is one NtER1 homolog as well as five related genes in Arabidopsis. These six genes are rapidly and differentially induced by environmental signals such as temperature extremes, UVB, salt, and wounding; hormones such as ethylene and abscisic acid; and signal molecules such as methyl jasmonate, H(2)O(2), and salicylic acid. Hence, they were designated as AtSR1-6 (Arabidopsis thaliana signal-responsive genes). Ca(2+)/calmodulin binds to all AtSRs, and their calmodulin-binding regions are located on a conserved basic amphiphilic alpha-helical motif in the C terminus. AtSR1 targets the nucleus and specifically recognizes a novel 6-bp CGCG box (A/C/G)CGCG(G/T/C). The multiple CGCG cis-elements are found in promoters of genes such as those involved in ethylene signaling, abscisic acid signaling, and light signal perception. The DNA-binding domain in AtSR1 is located on the N-terminal 146 bp where all AtSR1-related proteins share high similarity but have no similarity to other known DNA-binding proteins. The calmodulin-binding nuclear proteins isolated from wounded leaves exhibit specific CGCG box DNA binding activities. These results suggest that the AtSR gene family encodes a family of calmodulin-binding/DNA-binding proteins involved in multiple signal transduction pathways in plants.

  17. Natural mutagenesis of human genomes by endogenous retrotransposons.

    PubMed

    Iskow, Rebecca C; McCabe, Michael T; Mills, Ryan E; Torene, Spencer; Pittard, W Stephen; Neuwald, Andrew F; Van Meir, Erwin G; Vertino, Paula M; Devine, Scott E

    2010-06-25

    Two abundant classes of mobile elements, namely Alu and L1 elements, continue to generate new retrotransposon insertions in human genomes. Estimates suggest that these elements have generated millions of new germline insertions in individual human genomes worldwide. Unfortunately, current technologies are not capable of detecting most of these young insertions, and the true extent of germline mutagenesis by endogenous human retrotransposons has been difficult to examine. Here, we describe technologies for detecting these young retrotransposon insertions and demonstrate that such insertions indeed are abundant in human populations. We also found that new somatic L1 insertions occur at high frequencies in human lung cancer genomes. Genome-wide analysis suggests that altered DNA methylation may be responsible for the high levels of L1 mobilization observed in these tumors. Our data indicate that transposon-mediated mutagenesis is extensive in human genomes and is likely to have a major impact on human biology and diseases.

  18. Nuclear microscopy of sperm cell elemental structure

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bench, G.S.; Balhorn, R.; Friz, A.M.

    1994-09-28

    Theories suggest there is a link between protamine concentrations in individual sperm and male fertility. Previously, biochemical analyses have used pooled samples containing millions of sperm to determine protamine concentrations. These methods have not been able to determine what percentage of morphologically normal sperm are biochemically defective and potentially infertile. Nuclear microscopy has been utilized to measure elemental profiles at the single sperm level. By measuring the amount of phosphorus and sulfur, the total DNA and protamine content in individual sperm from fertile bull and mouse semen have been determined. These values agree with results obtained from other biochemical analyses.more » Nuclear microscopy shows promise for measuring elemental profiles in the chromatin of individual sperm. The technique may be able to resolve theories regarding the importance of protamines to male fertility and identify biochemical defects responsible for certain types of male infertility.« less

  19. On-Chip Synthesis of Protein Microarrays from DNA Microarrays Via Coupled In Vitro Transcription and Translation for Surface Plasmon Resonance Imaging Biosensor Applications

    PubMed Central

    Seefeld, Ting H.; Halpern, Aaron R.; Corn, Robert M.

    2012-01-01

    Protein microarrays are fabricated from double-stranded DNA (dsDNA) microarrays by a one-step, multiplexed enzymatic synthesis in an on-chip microfluidic format and then employed for antibody biosensing measurements with surface plasmon resonance imaging (SPRI). A microarray of dsDNA elements (denoted as generator elements) that encode either a His-tagged green fluorescent protein (GFP) or a His-tagged luciferase protein is utilized to create multiple copies of messenger RNA (mRNA) in a surface RNA polymerase reaction; the mRNA transcripts are then translated into proteins by cell-free protein synthesis in a microfluidic format. The His-tagged proteins diffuse to adjacent Cu(II)-NTA microarray elements (denoted as detector elements) and are specifically adsorbed. The net result is the on-chip, cell-free synthesis of a protein microarray that can be used immediately for SPRI protein biosensing. The dual element format greatly reduces any interference from the nonspecific adsorption of enzyme or proteins. SPRI measurements for the detection of the antibodies anti-GFP and anti-luciferase were used to verify the formation of the protein microarray. This convenient on-chip protein microarray fabrication method can be implemented for multiplexed SPRI biosensing measurements in both clinical and research applications. PMID:22793370

  20. Promoter Recognition by Extracytoplasmic Function σ Factors: Analyzing DNA and Protein Interaction Motifs

    PubMed Central

    Guzina, Jelena

    2016-01-01

    ABSTRACT Extracytoplasmic function (ECF) σ factors are the largest and the most diverse group of alternative σ factors, but their mechanisms of transcription are poorly studied. This subfamily is considered to exhibit a rigid promoter structure and an absence of mixing and matching; both −35 and −10 elements are considered necessary for initiating transcription. This paradigm, however, is based on very limited data, which bias the analysis of diverse ECF σ subgroups. Here we investigate DNA and protein recognition motifs involved in ECF σ factor transcription by a computational analysis of canonical ECF subfamily members, much less studied ECF σ subgroups, and the group outliers, obtained from recently sequenced bacteriophages. The analysis identifies an extended −10 element in promoters for phage ECF σ factors; a comparison with bacterial σ factors points to a putative 6-amino-acid motif just C-terminal of domain σ2, which is responsible for the interaction with the identified extension of the −10 element. Interestingly, a similar protein motif is found C-terminal of domain σ2 in canonical ECF σ factors, at a position where it is expected to interact with a conserved motif further upstream of the −10 element. Moreover, the phiEco32 ECF σ factor lacks a recognizable −35 element and σ4 domain, which we identify in a homologous phage, 7-11, indicating that the extended −10 element can compensate for the lack of −35 element interactions. Overall, the results reveal greater flexibility in promoter recognition by ECF σ factors than previously recognized and raise the possibility that mixing and matching also apply to this group, a notion that remains to be biochemically tested. IMPORTANCE ECF σ factors are the most numerous group of alternative σ factors but have been little studied. Their promoter recognition mechanisms are obscured by the large diversity within the ECF σ factor group and the limited similarity with the well-studied housekeeping σ factors. Here we extensively compare bacterial and bacteriophage ECF σ factors and their promoters in order to infer DNA and protein recognition motifs involved in transcription initiation. We predict a more flexible promoter structure than is recognized by the current paradigm, which assumes rigidness, and propose that ECF σ promoter elements may complement (mix and match with) each other's strengths. These results warrant the refocusing of research efforts from the well-studied housekeeping σ factors toward the physiologically highly important, but insufficiently understood, alternative σ factors. PMID:27137497

  1. Arabidopsis DNA polymerase lambda mutant is mildly sensitive to DNA double strand breaks but defective in integration of a transgene

    PubMed Central

    Furukawa, Tomoyuki; Angelis, Karel J.; Britt, Anne B.

    2015-01-01

    The DNA double-strand break (DSB) is a critical type of damage, and can be induced by both endogenous sources (e.g., errors of oxidative metabolism, transposable elements, programmed meiotic breaks, or perturbation of the DNA replication fork) and exogenous sources (e.g., ionizing radiation or radiomimetic chemicals). Although higher plants, like mammals, are thought to preferentially repair DSBs via nonhomologous end joining (NHEJ), much remains unclear about plant DSB repair pathways. Our reverse genetic approach suggests that DNA polymerase λ is involved in DSB repair in Arabidopsis. The Arabidopsis T-DNA insertion mutant (atpolλ-1) displayed sensitivity to both gamma-irradiation and treatment with radiomimetic reagents, but not to other DNA damaging treatments. The atpolλ-1 mutant showed a moderate sensitivity to DSBs, while Arabidopsis Ku70 and DNA ligase 4 mutants (atku70-3 and atlig4-2), both of which play critical roles in NHEJ, exhibited a hypersensitivity to these treatments. The atpolλ-1/atlig4-2 double mutant exhibited a higher sensitivity to DSBs than each single mutant, but the atku70/atpolλ-1 showed similar sensitivity to the atku70-3 mutant. We showed that transcription of the DNA ligase 1, DNA ligase 6, and Wee1 genes was quickly induced by BLM in several NHEJ deficient mutants in contrast to wild-type. Finally, the T-DNA transformation efficiency dropped in NHEJ deficient mutants and the lowest transformation efficiency was scored in the atpolλ-1/atlig4-2 double mutant. These results imply that AtPolλ is involved in both DSB repair and DNA damage response pathway. PMID:26074930

  2. Characterization of the Pathological and Biochemical Markers that Correlate to the Clinical Features of Autism

    DTIC Science & Technology

    2012-10-01

    critical role of glutathione in maintenance of the mitochondrial genome . Free Radic Biol Med 49:1956–1968 54. Ji L, Chauhan A, Brown WT, Chauhan V (2009...studies in Drosophila have demonstrated the role of PKA in memory formation [25–29]. Mutations in the rutabaga gene, which encodes adenylate cyclase...certain DNA sequences (cAMP response elements), thereby stimulating the transcription of downstream genes and the synthesis of proteins. The CREB

  3. Who and How: Comprehensive RNA-Based BodyfluID Assay to Provide Context to a Recovered DNA Profile

    DTIC Science & Technology

    2015-08-25

    5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 5c. PROGRAM ELEMENT NUMBER 5b. GRANT NUMBER 5a. CONTRACT NUMBER Form Approved OMB NO...summarizes the work performed for the full project period. The views, opinions and/or findings contained in this report are those of the author(s) and...OF RESPONSIBLE PERSON 19b. TELEPHONE NUMBER Jack Ballantyne Jack Ballantyne, Erin Hanson c. THIS PAGE The public reporting burden for this

  4. Three Groups of Transposable Elements with Contrasting Copy Number Dynamics and Host Responses in the Maize (Zea mays ssp. mays) Genome

    PubMed Central

    Diez, Concepcion M.; Meca, Esteban; Tenaillon, Maud I.; Gaut, Brandon S.

    2014-01-01

    Most angiosperm nuclear DNA is repetitive and derived from silenced transposable elements (TEs). TE silencing requires substantial resources from the plant host, including the production of small interfering RNAs (siRNAs). Thus, the interaction between TEs and siRNAs is a critical aspect of both the function and the evolution of plant genomes. Yet the co-evolutionary dynamics between these two entities remain poorly characterized. Here we studied the organization of TEs within the maize (Zea mays ssp mays) genome, documenting that TEs fall within three groups based on the class and copy numbers. These groups included DNA elements, low copy RNA elements and higher copy RNA elements. The three groups varied statistically in characteristics that included length, location, age, siRNA expression and 24∶22 nucleotide (nt) siRNA targeting ratios. In addition, the low copy retroelements encompassed a set of TEs that had previously been shown to decrease expression within a 24 nt siRNA biogenesis mutant (mop1). To investigate the evolutionary dynamics of the three groups, we estimated their abundance in two landraces, one with a genome similar in size to that of the maize reference and the other with a 30% larger genome. For all three accessions, we assessed TE abundance as well as 22 nt and 24 nt siRNA content within leaves. The high copy number retroelements are under targeted similarly by siRNAs among accessions, appear to be born of a rapid bust of activity, and may be currently transpositionally dead or limited. In contrast, the lower copy number group of retrolements are targeted more dynamically and have had a long and ongoing history of transposition in the maize genome. PMID:24743518

  5. Nanoparticle-labeled DNA capture elements for detection and identification of biological agents

    NASA Astrophysics Data System (ADS)

    Kiel, Johnathan L.; Holwitt, Eric A.; Parker, Jill E.; Vivekananda, Jeevalatha; Franz, Veronica

    2004-12-01

    Aptamers, synthetic DNA capture elements (DCEs), can be made chemically or in genetically engineered bacteria. DNA capture elements are artificial DNA sequences, from a random pool of sequences, selected for their specific binding to potential biological warfare or terrorism agents. These sequences were selected by an affinity method using filters to which the target agent was attached and the DNA isolated and amplified by polymerase chain reaction (PCR) in an iterative, increasingly stringent, process. The probes can then be conjugated to Quantum Dots and super paramagnetic nanoparticles. The former provide intense, bleach-resistant fluorescent detection of bioagent and the latter provide a means to collect the bioagents with a magnet. The fluorescence can be detected in a flow cytometer, in a fluorescence plate reader, or with a fluorescence microscope. To date, we have made DCEs to Bacillus anthracis spores, Shiga toxin, Venezuelan Equine Encephalitis (VEE) virus, and Francisella tularensis. DCEs can easily distinguish Bacillus anthracis from its nearest relatives, Bacillus cereus and Bacillus thuringiensis. Development of a high through-put process is currently being investigated.

  6. New insights into replication origin characteristics in metazoans

    PubMed Central

    Puy, Aurore; Rialle, Stéphanie; Kaplan, Noam; Segal, Eran

    2012-01-01

    We recently reported the identification and characterization of DNA replication origins (Oris) in metazoan cell lines. Here, we describe additional bioinformatic analyses showing that the previously identified GC-rich sequence elements form origin G-rich repeated elements (OGREs) that are present in 67% to 90% of the DNA replication origins from Drosophila to human cells, respectively. Our analyses also show that initiation of DNA synthesis takes place precisely at 160 bp (Drosophila) and 280 bp (mouse) from the OGRE. We also found that in most CpG islands, an OGRE is positioned in opposite orientation on each of the two DNA strands and detected two sites of initiation of DNA synthesis upstream or downstream of each OGRE. Conversely, Oris not associated with CpG islands have a single initiation site. OGRE density along chromosomes correlated with previously published replication timing data. Ori sequences centered on the OGRE are also predicted to have high intrinsic nucleosome occupancy. Finally, OGREs predict G-quadruplex structures at Oris that might be structural elements controlling the choice or activation of replication origins. PMID:22373526

  7. The fission yeast CENP-B protein Abp1 prevents pervasive transcription of repetitive DNA elements.

    PubMed

    Daulny, Anne; Mejía-Ramírez, Eva; Reina, Oscar; Rosado-Lugo, Jesus; Aguilar-Arnal, Lorena; Auer, Herbert; Zaratiegui, Mikel; Azorin, Fernando

    2016-10-01

    It is well established that eukaryotic genomes are pervasively transcribed producing cryptic unstable transcripts (CUTs). However, the mechanisms regulating pervasive transcription are not well understood. Here, we report that the fission yeast CENP-B homolog Abp1 plays an important role in preventing pervasive transcription. We show that loss of abp1 results in the accumulation of CUTs, which are targeted for degradation by the exosome pathway. These CUTs originate from different types of genomic features, but the highest increase corresponds to Tf2 retrotransposons and rDNA repeats, where they map along the entire elements. In the absence of abp1, increased RNAPII-Ser5P occupancy is observed throughout the Tf2 coding region and, unexpectedly, RNAPII-Ser5P is enriched at rDNA repeats. Loss of abp1 also results in Tf2 derepression and increased nucleolus size. Altogether these results suggest that Abp1 prevents pervasive RNAPII transcription of repetitive DNA elements (i.e., Tf2 and rDNA repeats) from internal cryptic sites. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Amplification of a specific repetitive DNA sequence for Trypanosoma rangeli identification and its potential application in epidemiological investigations.

    PubMed

    Vargas, N; Souto, R P; Carranza, J C; Vallejo, G A; Zingales, B

    2000-11-01

    Trypanosoma rangeli can infect humans as well as the same domestic and wild animals and triatomine vectors infected by Trypanosoma cruzi in Central and South America. This overlapping distribution complicates the epidemiology of American trypanosomiasis due to the cross-reactivity between T. rangeli and T. cruzi antigens and the presence of conserved DNA sequences in these parasites. We have isolated a T. rangeli-specific DNA repetitive element which is represented in approximately 103 copies per parasite genome and is distributed in several chromosomal bands. The 542-bp nucleotide sequence of this element, named P542, was determined and a PCR assay was standardized for its amplification. The sensitivity of the assay is high, allowing the detection of one tenth of the DNA content of a single parasite. The presence of the P542 element was confirmed in 11 T. rangeli isolates from mammalian hosts and insect vectors originating from several countries in Latin America. Negative amplification was observed with different T. cruzi strains and other trypanosomatids. The potential field application of the P542 PCR assay was investigated in simulated samples containing T. rangeli and/or T. cruzi and intestinal tract and feces of Rhodnius prolixus. Epidemiological studies were conducted in DNA preparations obtained from the digestive tracts of 12 Rhodnius colombiensis insects collected in a sylvatic area in Colombia. Positive amplification of the P542 element was obtained in 9/12 insects. We have also compared in the same samples the diagnostic performance of two PCR assays for the amplification of the variable domain of minicircle kinetoplast DNA (kDNA) and of the large subunit (LSU) of the ribosomal RNA gene of T. cruzi and T. rangeli. Data indicate that the kDNA PCR assay does not allow diagnosis of mixed infections in most insects. On the other hand, the PCR assay of the LSU RNA gene showed lower sensitivity in the detection of T. rangeli than the PCR assay of the P542 element. It is predicted that the use of sensitive detection techniques will indicate that the actual distribution of T. rangeli in America is wider than presumed. Copyright 2000 Academic Press.

  9. Increased methylation of repetitive elements and DNA repair genes is associated with higher DNA oxidation in children in an urbanized, industrial environment.

    PubMed

    Alvarado-Cruz, Isabel; Sánchez-Guerra, Marco; Hernández-Cadena, Leticia; De Vizcaya-Ruiz, Andrea; Mugica, Violeta; Pelallo-Martínez, Nadia Azenet; Solís-Heredia, María de Jesús; Byun, Hyang-Min; Baccarelli, Andrea; Quintanilla-Vega, Betzabet

    2017-01-01

    DNA methylation in DNA repair genes participates in the DNA damage regulation. Particulate matter (PM), which has metals and polycyclic aromatic hydrocarbons (PAHs) adsorbed, among others has been linked to adverse health outcomes and may modify DNA methylation. To evaluate PM exposure impact on repetitive elements and gene-specific DNA methylation and DNA damage, we conducted a cross-sectional study in 150 schoolchildren (7-10 years old) from an urbanized, industrial area of the metropolitan area of Mexico City (MAMC), which frequently exhibits PM concentrations above safety standards. Methylation (5mC) of long interspersed nuclear element-1 (LINE1) and DNA repair gene (OGG1, APEX, and PARP1) was assessed by pyrosequencing in peripheral mononuclear cells, DNA damage by comet assay and DNA oxidation by 8-OHdG content. PAH and metal contents in PM 10 (≤10μm aerodynamic diameter) were determined by HPLC-MS and ICP-AES, respectively. Multiple regression analysis between DNA methylation, DNA damage, and PM 10 exposure showed that PM 10 was significantly associated with oxidative DNA damage; a 1% increase in 5mC at all CpG sites in PARP1 promoter was associated with a 35% increase in 8-OHdG, while a 1% increase at 1, 2, and 3 CpG sites resulted in 38, 9, and 56% increments, respectively. An increase of 10pg/m 3 in benzo[b]fluoranthene content of PM 10 was associated with a 6% increase in LINE1 methylation. Acenaphthene, indene [1,2,3-cd] pyrene, and pyrene concentrations correlated with higher dinucleotide methylation in OGG1, APEX and PARP1 genes, respectively. Vanadium concentration correlated with increased methylation at selected APEX and PARP1 CpG sites. DNA repair gene methylation was significantly correlated with DNA damage and with specific PM 10 -associated PAHs and Vanadium. Data suggest that exposure to PM and its components are associated with differences in DNA methylation of repair genes in children, which may contribute to DNA damage. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. The increasing diversity of functions attributed to the SAFB family of RNA-/DNA-binding proteins.

    PubMed

    Norman, Michael; Rivers, Caroline; Lee, Youn-Bok; Idris, Jalilah; Uney, James

    2016-12-01

    RNA-binding proteins play a central role in cellular metabolism by orchestrating the complex interactions of coding, structural and regulatory RNA species. The SAFB (scaffold attachment factor B) proteins (SAFB1, SAFB2 and SAFB-like transcriptional modulator, SLTM), which are highly conserved evolutionarily, were first identified on the basis of their ability to bind scaffold attachment region DNA elements, but attention has subsequently shifted to their RNA-binding and protein-protein interactions. Initial studies identified the involvement of these proteins in the cellular stress response and other aspects of gene regulation. More recently, the multifunctional capabilities of SAFB proteins have shown that they play crucial roles in DNA repair, processing of mRNA and regulatory RNA, as well as in interaction with chromatin-modifying complexes. With the advent of new techniques for identifying RNA-binding sites, enumeration of individual RNA targets has now begun. This review aims to summarise what is currently known about the functions of SAFB proteins. © 2016 The Author(s).

  11. The contribution of alu elements to mutagenic DNA double-strand break repair.

    PubMed

    Morales, Maria E; White, Travis B; Streva, Vincent A; DeFreece, Cecily B; Hedges, Dale J; Deininger, Prescott L

    2015-03-01

    Alu elements make up the largest family of human mobile elements, numbering 1.1 million copies and comprising 11% of the human genome. As a consequence of evolution and genetic drift, Alu elements of various sequence divergence exist throughout the human genome. Alu/Alu recombination has been shown to cause approximately 0.5% of new human genetic diseases and contribute to extensive genomic structural variation. To begin understanding the molecular mechanisms leading to these rearrangements in mammalian cells, we constructed Alu/Alu recombination reporter cell lines containing Alu elements ranging in sequence divergence from 0%-30% that allow detection of both Alu/Alu recombination and large non-homologous end joining (NHEJ) deletions that range from 1.0 to 1.9 kb in size. Introduction of as little as 0.7% sequence divergence between Alu elements resulted in a significant reduction in recombination, which indicates even small degrees of sequence divergence reduce the efficiency of homology-directed DNA double-strand break (DSB) repair. Further reduction in recombination was observed in a sequence divergence-dependent manner for diverged Alu/Alu recombination constructs with up to 10% sequence divergence. With greater levels of sequence divergence (15%-30%), we observed a significant increase in DSB repair due to a shift from Alu/Alu recombination to variable-length NHEJ which removes sequence between the two Alu elements. This increase in NHEJ deletions depends on the presence of Alu sequence homeology (similar but not identical sequences). Analysis of recombination products revealed that Alu/Alu recombination junctions occur more frequently in the first 100 bp of the Alu element within our reporter assay, just as they do in genomic Alu/Alu recombination events. This is the first extensive study characterizing the influence of Alu element sequence divergence on DNA repair, which will inform predictions regarding the effect of Alu element sequence divergence on both the rate and nature of DNA repair events.

  12. A novel Alu-based real-time PCR method for the quantitative detection of plasma circulating cell-free DNA: Sensitivity and specificity for the diagnosis of myocardial infarction

    PubMed Central

    LOU, XIAOLI; HOU, YANQIANG; LIANG, DONGYU; PENG, LIANG; CHEN, HONGWEI; MA, SHANYUAN; ZHANG, LURONG

    2015-01-01

    In the present study, we aimed to develop and validate a rapid and sensitive, Alu-based real-time PCR method for the detection of circulating cell-free DNA (cfDNA). This method targeted repetitive elements of the Alu reduplicative elements in the human genome, followed by signal amplification using fluorescence quantification. Standard Alu-puc57 vectors were constructed and 5 pairs of specific primers were designed. Valuation was conducted concerning linearity, variation and recovery. We found 5 linear responses (R1–5=0.998–0.999). The average intra- and inter-assay coefficients of variance were 12.98 and 10.75%, respectively. The recovery was 82.33–114.01%, with a mean recovery index of 101.26%. This Alu-based assay was reliable, accurate and sensitive for the quantitative detection of cfDNA. Plasma from normal controls and patients with myocardial infarction (MI) were analyzed, and the baseline levels of cfDNA were higher in the MI group. The area under the receiver operating characteristic (ROC) curve for Alu1, Alu2, Alu3, Alu4, Alu5 and Alu (Alu1 + Alu2 + Alu3 + Alu4 + Alu5) was 0.887, 0.758, 0.857, 0.940, 0.968 and 0.933, respectively. The optimal cut-off value for Alu1, Alu2, Alu3, Alu4, Alu5 and Alu to predict MI was 3.71, 1.93, 0.22, 3.73, 6.13 and 6.40 log copies/ml. We demonstrate that this new method is a reliable, accurate and sensitive method for the quantitative detection of cfDNA and that it is useful for studying the regulation of cfDNA in certain pathological conditions. Alu4, Alu5 and Alu showed better sensitivity and specificity for the diagnosis of MI compared with cardiac troponin I (cTnI), creatine kinase MB (CK-MB) isoenzyme and lactate dehydrogenase (LDH). Alu5 had the best prognostic ability. PMID:25374065

  13. LINE-1 Elements in Structural Variation and Disease

    PubMed Central

    Beck, Christine R.; Garcia-Perez, José Luis; Badge, Richard M.; Moran, John V.

    2014-01-01

    The completion of the human genome reference sequence ushered in a new era for the study and discovery of human transposable elements. It now is undeniable that transposable elements, historically dismissed as junk DNA, have had an instrumental role in sculpting the structure and function of our genomes. In particular, long interspersed element-1 (LINE-1 or L1) and short interspersed elements (SINEs) continue to affect our genome, and their movement can lead to sporadic cases of disease. Here, we briefly review the types of transposable elements present in the human genome and their mechanisms of mobility. We next highlight how advances in DNA sequencing and genomic technologies have enabled the discovery of novel retrotransposons in individual genomes. Finally, we discuss how L1-mediated retrotransposition events impact human genomes. PMID:21801021

  14. The effect of inflammation-related lifestyle exposures and interactions with gene variants on long interspersed nuclear element-1 DNA methylation.

    PubMed

    Gogna, Priyanka; O'Sullivan, Dylan E; King, Will D

    2018-06-11

    To examine the relationship between inflammation-related lifestyle factors and long interspersed nuclear element-1 (LINE-1) DNA methylation, and test for interaction by gene variants involved in one-carbon metabolism. The study population consisted of 280 individuals undergoing colonoscopy screening. Multivariable linear regression was employed to examine associations of physical activity, BMI and NSAID use with LINE-1 DNA methylation and interactions with MTR and MTHFR gene variants. The highest quartile of physical activity compared with the lowest was associated with higher LINE-1 DNA methylation (p = 0.005). Long-term NSAID use and a normal BMI were associated with increased LINE-1 DNA methylation among individuals with the variant MTR allele (p = 0.02; p = 0.03). This study provides evidence that inflammation-related exposures may influence LINE-1 DNA methylation.

  15. Sequence of retrovirus provirus resembles that of bacterial transposable elements

    NASA Astrophysics Data System (ADS)

    Shimotohno, Kunitada; Mizutani, Satoshi; Temin, Howard M.

    1980-06-01

    The nucleotide sequences of the terminal regions of an infectious integrated retrovirus cloned in the modified λ phage cloning vector Charon 4A have been elucidated. There is a 569-base pair direct repeat at both ends of the viral DNA. The cell-virus junctions at each end consist of a 5-base pair direct repeat of cell DNA next to a 3-base pair inverted repeat of viral DNA. This structure resembles that of a transposable element and is consistent with the protovirus hypothesis that retroviruses evolved from the cell genome.

  16. BDNF and exercise enhance neuronal DNA repair by stimulating CREB-mediated production of apurinic/apyrimidinic endonuclease 1.

    PubMed

    Yang, Jenq-Lin; Lin, Yu-Ting; Chuang, Pei-Chin; Bohr, Vilhelm A; Mattson, Mark P

    2014-03-01

    Brain-derived neurotrophic factor (BDNF) promotes the survival and growth of neurons during brain development and mediates activity-dependent synaptic plasticity and associated learning and memory in the adult. BDNF levels are reduced in brain regions affected in Alzheimer's, Parkinson's, and Huntington's diseases, and elevation of BDNF levels can ameliorate neuronal dysfunction and degeneration in experimental models of these diseases. Because neurons accumulate oxidative lesions in their DNA during normal activity and in neurodegenerative disorders, we determined whether and how BDNF affects the ability of neurons to cope with oxidative DNA damage. We found that BDNF protects cerebral cortical neurons against oxidative DNA damage-induced death by a mechanism involving enhanced DNA repair. BDNF stimulates DNA repair by activating cyclic AMP response element-binding protein (CREB), which, in turn, induces the expression of apurinic/apyrimidinic endonuclease 1 (APE1), a key enzyme in the base excision DNA repair pathway. Suppression of either APE1 or TrkB by RNA interference abolishes the ability of BDNF to protect neurons against oxidized DNA damage-induced death. The ability of BDNF to activate CREB and upregulate APE1 expression is abolished by shRNA of TrkB as well as inhibitors of TrkB, PI3 kinase, and Akt kinase. Voluntary running wheel exercise significantly increases levels of BDNF, activates CREB, and upregulates APE1 in the cerebral cortex and hippocampus of mice, suggesting a novel mechanism whereby exercise may protect neurons from oxidative DNA damage. Our findings reveal a previously unknown ability of BDNF to enhance DNA repair by inducing the expression of the DNA repair enzyme APE1.

  17. Whole blood genome-wide expression profiling and network analysis suggest MELAS master regulators.

    PubMed

    Mende, Susanne; Royer, Loic; Herr, Alexander; Schmiedel, Janet; Deschauer, Marcus; Klopstock, Thomas; Kostic, Vladimir S; Schroeder, Michael; Reichmann, Heinz; Storch, Alexander

    2011-07-01

    The heteroplasmic mitochondrial DNA (mtDNA) mutation A3243G causes the mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome as one of the most frequent mitochondrial diseases. The process of reconfiguration of nuclear gene expression profile to accommodate cellular processes to the functional status of mitochondria might be a key to MELAS disease manifestation and could contribute to its diverse phenotypic presentation. To determine master regulatory protein networks and disease-modifying genes in MELAS syndrome. Analyses of whole blood transcriptomes from 10 MELAS patients using a novel strategy by combining classic Affymetrix oligonucleotide microarray profiling with regulatory and protein interaction network analyses. Hierarchical cluster analysis elucidated that the relative abundance of mutant mtDNA molecules is decisive for the nuclear gene expression response. Further analyses confirmed not only transcription factors already known to be involved in mitochondrial diseases (such as TFAM), but also detected the hypoxia-inducible factor 1 complex, nuclear factor Y and cAMP responsive element-binding protein-related transcription factors as novel master regulators for reconfiguration of nuclear gene expression in response to the MELAS mutation. Correlation analyses of gene alterations and clinico-genetic data detected significant correlations between A3243G-induced nuclear gene expression changes and mutant mtDNA load as well as disease characteristics. These potential disease-modifying genes influencing the expression of the MELAS phenotype are mainly related to clusters primarily unrelated to cellular energy metabolism, but important for nucleic acid and protein metabolism, and signal transduction. Our data thus provide a framework to search for new pathogenetic concepts and potential therapeutic approaches to treat the MELAS syndrome.

  18. The Specificity of Innate Immune Responses Is Enforced by Repression of Interferon Response Elements by NF-κB p50

    PubMed Central

    Cheng, Christine S.; Feldman, Kristyn E.; Lee, James; Verma, Shilpi; Huang, De-Bin; Huynh, Kim; Chang, Mikyoung; Ponomarenko, Julia V.; Sun, Shao-Cong; Benedict, Chris A.; Ghosh, Gourisankar; Hoffmann, Alexander

    2011-01-01

    The specific binding of transcription factors to cognate sequence elements is thought to be critical for the generation of specific gene expression programs. Members of the nuclear factor κB (NF-κB) and interferon (IFN) regulatory factor (IRF) transcription factor families bind to the κB site and the IFN response element (IRE), respectively, of target genes, and they are activated in macrophages after exposure to pathogens. However, how these factors produce pathogen-specific inflammatory and immune responses remains poorly understood. Combining top-down and bottom-up systems biology approaches, we have identified the NF-κB p50 homodimer as a regulator of IRF responses. Unbiased genome-wide expression and biochemical and structural analyses revealed that the p50 homodimer repressed a subset of IFN-inducible genes through a previously uncharacterized subclass of guanine-rich IRE (G-IRE) sequences. Mathematical modeling predicted that the p50 homodimer might enforce the stimulus specificity of composite promoters. Indeed, the production of the antiviral regulator IFN-β was rendered stimulus-specific by the binding of the p50 homodimer to the G-IRE–containing IFNβ enhancer to suppress cytotoxic IFN signaling. Specifically, a deficiency in p50 resulted in the inappropriate production of IFN-β in response to bacterial DNA sensed by Toll-like receptor 9. This role for the NF-κB p50 homodimer in enforcing the specificity of the cellular response to pathogens by binding to a subset of IRE sequences alters our understanding of how the NF-κB and IRF signaling systems cooperate to regulate antimicrobial immunity. PMID:21343618

  19. Control of DEMETER DNA demethylase gene transcription in male and female gamete companion cells in Arabidopsis thaliana.

    PubMed

    Park, Jin-Sup; Frost, Jennifer M; Park, Kyunghyuk; Ohr, Hyonhwa; Park, Guen Tae; Kim, Seohyun; Eom, Hyunjoo; Lee, Ilha; Brooks, Janie S; Fischer, Robert L; Choi, Yeonhee

    2017-02-21

    The DEMETER (DME) DNA glycosylase initiates active DNA demethylation via the base-excision repair pathway and is vital for reproduction in Arabidopsis thaliana DME-mediated DNA demethylation is preferentially targeted to small, AT-rich, and nucleosome-depleted euchromatic transposable elements, influencing expression of adjacent genes and leading to imprinting in the endosperm. In the female gametophyte, DME expression and subsequent genome-wide DNA demethylation are confined to the companion cell of the egg, the central cell. Here, we show that, in the male gametophyte, DME expression is limited to the companion cell of sperm, the vegetative cell, and to a narrow window of time: immediately after separation of the companion cell lineage from the germline. We define transcriptional regulatory elements of DME using reporter genes, showing that a small region, which surprisingly lies within the DME gene, controls its expression in male and female companion cells. DME expression from this minimal promoter is sufficient to rescue seed abortion and the aberrant DNA methylome associated with the null dme-2 mutation. Within this minimal promoter, we found short, conserved enhancer sequences necessary for the transcriptional activities of DME and combined predicted binding motifs with published transcription factor binding coordinates to produce a list of candidate upstream pathway members in the genetic circuitry controlling DNA demethylation in gamete companion cells. These data show how DNA demethylation is regulated to facilitate endosperm gene imprinting and potential transgenerational epigenetic regulation, without subjecting the germline to potentially deleterious transposable element demethylation.

  20. Electronic Properties of DNA-Based Schottky Barrier Diodes in Response to Alpha Particles.

    PubMed

    Al-Ta'ii, Hassan Maktuff Jaber; Periasamy, Vengadesh; Amin, Yusoff Mohd

    2015-05-21

    Detection of nuclear radiation such as alpha particles has become an important field of research in recent history due to nuclear threats and accidents. In this context; deoxyribonucleic acid (DNA) acting as an organic semiconducting material could be utilized in a metal/semiconductor Schottky junction for detecting alpha particles. In this work we demonstrate for the first time the effect of alpha irradiation on an Al/DNA/p-Si/Al Schottky diode by investigating its current-voltage characteristics. The diodes were exposed for different periods (0-20 min) of irradiation. Various diode parameters such as ideality factor, barrier height, series resistance, Richardson constant and saturation current were then determined using conventional, Cheung and Cheung's and Norde methods. Generally, ideality factor or n values were observed to be greater than unity, which indicates the influence of some other current transport mechanism besides thermionic processes. Results indicated ideality factor variation between 9.97 and 9.57 for irradiation times between the ranges 0 to 20 min. Increase in the series resistance with increase in irradiation time was also observed when calculated using conventional and Cheung and Cheung's methods. These responses demonstrate that changes in the electrical characteristics of the metal-semiconductor-metal diode could be further utilized as sensing elements to detect alpha particles.

  1. Stress and transcriptional regulation of tick ferritin HC.

    PubMed

    Mulenga, A; Simser, J A; Macaluso, K R; Azad, A F

    2004-08-01

    We previously identified a partial Dermacentor variabilis cDNA encoding ferritin HC (HC) subunit homolog (DVFER) that was differentially upregulated in Rickettsia montanensis infected ticks (Mulenga et al., 2003a). We have used rapid amplification of cDNA ends to clone full-length DVFER cDNA and its apparent ortholog from the wood tick, D. andersoni (DAFER), both of which show high sequence similarity to vertebrate than insect ferritin. Both DVFER and DAFER contain the stem-loop structure of a putative iron responsive element in the 5' untranslated region (nucleotide positions, 16-42) and the feroxidase centre loop typical for vertebrate ferritin HC subunits. Quantitative Western and Northern blotting analyses of protein and RNA from unfed and partially fed whole tick as well as dissected tick tissues demonstrated that DVFER is constitutively and ubiquitously expressed. Based on densitometric analysis of detected protein and mRNA bands, DVFER is predominantly expressed in the midgut, and to a lesser extent in the salivary glands, ovary and fatbody. Sham treatment (mechanical injury) and Escherichia coli challenge of D. variabilis ticks stimulated statistically significant (approximately 1.5- and approximately 3.0-fold, respectively) increases in DVFER mRNA abundance over time point matched naive control ticks. These data suggest that DVFER mRNA is nonspecifically up regulated in response to mechanical injury or bacterial infection induced stress.

  2. Facile and High-Throughput Synthesis of Functional Microparticles with Quick Response Codes.

    PubMed

    Ramirez, Lisa Marie S; He, Muhan; Mailloux, Shay; George, Justin; Wang, Jun

    2016-06-01

    Encoded microparticles are high demand in multiplexed assays and labeling. However, the current methods for the synthesis and coding of microparticles either lack robustness and reliability, or possess limited coding capacity. Here, a massive coding of dissociated elements (MiCODE) technology based on innovation of a chemically reactive off-stoichimetry thiol-allyl photocurable polymer and standard lithography to produce a large number of quick response (QR) code microparticles is introduced. The coding process is performed by photobleaching the QR code patterns on microparticles when fluorophores are incorporated into the prepolymer formulation. The fabricated encoded microparticles can be released from a substrate without changing their features. Excess thiol functionality on the microparticle surface allows for grafting of amine groups and further DNA probes. A multiplexed assay is demonstrated using the DNA-grafted QR code microparticles. The MiCODE technology is further characterized by showing the incorporation of BODIPY-maleimide (BDP-M) and Nile Red fluorophores for coding and the use of microcontact printing for immobilizing DNA probes on microparticle surfaces. This versatile technology leverages mature lithography facilities for fabrication and thus is amenable to scale-up in the future, with potential applications in bioassays and in labeling consumer products. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. In situ gene expression profiling of the thermoacidophilic alga Cyanidioschyzon in relation to visible and ultraviolet irradiance.

    PubMed

    Skorupa, Dana J; Castenholz, Richard W; Mazurie, Aurélien; Carey, Charles; Rosenzweig, Frank; McDermott, Timothy R

    2014-06-01

    Ultraviolet and high-intensity visible radiation generate reactive intermediates that damage phototrophic microorganisms. In Yellowstone National Park, the thermoacidophilic alga Cyanidioschyzon exhibits an annual seasonal biomass fluctuation referred to as 'mat decline', where algal viability decreases as ultraviolet and visible irradiances increase during summer. We examined the role irradiance might play in mat decline using irradiance filters that uncouple ultraviolet and visible effects along with custom microarrays to study gene expression in situ. Of the 6507 genes, 88% showed no response to ultraviolet or visible, implying that at the biomolecular level, these algae inhabit a chemostat-like environment and is consistent with the near constant aqueous chemistry measured. The remaining genes exhibited expression changes linked to ultraviolet exposure, to increased visible radiation, or to the apparent combined effects of ultraviolet and visible. Expression of DNA repetitive elements was synchronized, being repressed by visible but also influenced by ultraviolet. At highest irradiance levels, these algae reduced transcription of genes encoding functions involved with DNA replication, photosynthesis and cell cycle progression but exhibited an uptick in activities related to repairing DNA damage. This corroborates known physiological responses to ultraviolet and visible radiation, and leads us to provisionally conclude that mat decline is linked to photoinhibition. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.

  4. Identification of two novel functional p53 responsive elements in the Herpes Simplex Virus-1 genome

    PubMed Central

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R.; Boehmer, Paul E.

    2014-01-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. PMID:25010269

  5. Evidence of pervasive biologically functional secondary structures within the genomes of eukaryotic single-stranded DNA viruses.

    PubMed

    Muhire, Brejnev Muhizi; Golden, Michael; Murrell, Ben; Lefeuvre, Pierre; Lett, Jean-Michel; Gray, Alistair; Poon, Art Y F; Ngandu, Nobubelo Kwanele; Semegni, Yves; Tanov, Emil Pavlov; Monjane, Adérito Luis; Harkins, Gordon William; Varsani, Arvind; Shepherd, Dionne Natalie; Martin, Darren Patrick

    2014-02-01

    Single-stranded DNA (ssDNA) viruses have genomes that are potentially capable of forming complex secondary structures through Watson-Crick base pairing between their constituent nucleotides. A few of the structural elements formed by such base pairings are, in fact, known to have important functions during the replication of many ssDNA viruses. Unknown, however, are (i) whether numerous additional ssDNA virus genomic structural elements predicted to exist by computational DNA folding methods actually exist and (ii) whether those structures that do exist have any biological relevance. We therefore computationally inferred lists of the most evolutionarily conserved structures within a diverse selection of animal- and plant-infecting ssDNA viruses drawn from the families Circoviridae, Anelloviridae, Parvoviridae, Nanoviridae, and Geminiviridae and analyzed these for evidence of natural selection favoring the maintenance of these structures. While we find evidence that is consistent with purifying selection being stronger at nucleotide sites that are predicted to be base paired than at sites predicted to be unpaired, we also find strong associations between sites that are predicted to pair with one another and site pairs that are apparently coevolving in a complementary fashion. Collectively, these results indicate that natural selection actively preserves much of the pervasive secondary structure that is evident within eukaryote-infecting ssDNA virus genomes and, therefore, that much of this structure is biologically functional. Lastly, we provide examples of various highly conserved but completely uncharacterized structural elements that likely have important functions within some of the ssDNA virus genomes analyzed here.

  6. Evidence of Pervasive Biologically Functional Secondary Structures within the Genomes of Eukaryotic Single-Stranded DNA Viruses

    PubMed Central

    Muhire, Brejnev Muhizi; Golden, Michael; Murrell, Ben; Lefeuvre, Pierre; Lett, Jean-Michel; Gray, Alistair; Poon, Art Y. F.; Ngandu, Nobubelo Kwanele; Semegni, Yves; Tanov, Emil Pavlov; Monjane, Adérito Luis; Harkins, Gordon William; Varsani, Arvind; Shepherd, Dionne Natalie

    2014-01-01

    Single-stranded DNA (ssDNA) viruses have genomes that are potentially capable of forming complex secondary structures through Watson-Crick base pairing between their constituent nucleotides. A few of the structural elements formed by such base pairings are, in fact, known to have important functions during the replication of many ssDNA viruses. Unknown, however, are (i) whether numerous additional ssDNA virus genomic structural elements predicted to exist by computational DNA folding methods actually exist and (ii) whether those structures that do exist have any biological relevance. We therefore computationally inferred lists of the most evolutionarily conserved structures within a diverse selection of animal- and plant-infecting ssDNA viruses drawn from the families Circoviridae, Anelloviridae, Parvoviridae, Nanoviridae, and Geminiviridae and analyzed these for evidence of natural selection favoring the maintenance of these structures. While we find evidence that is consistent with purifying selection being stronger at nucleotide sites that are predicted to be base paired than at sites predicted to be unpaired, we also find strong associations between sites that are predicted to pair with one another and site pairs that are apparently coevolving in a complementary fashion. Collectively, these results indicate that natural selection actively preserves much of the pervasive secondary structure that is evident within eukaryote-infecting ssDNA virus genomes and, therefore, that much of this structure is biologically functional. Lastly, we provide examples of various highly conserved but completely uncharacterized structural elements that likely have important functions within some of the ssDNA virus genomes analyzed here. PMID:24284329

  7. Reduced Mutation Rate and Increased Transformability of Transposon-Free Acinetobacter baylyi ADP1-ISx

    PubMed Central

    Suárez, Gabriel A.; Renda, Brian A.; Dasgupta, Aurko

    2017-01-01

    ABSTRACT The genomes of most bacteria contain mobile DNA elements that can contribute to undesirable genetic instability in engineered cells. In particular, transposable insertion sequence (IS) elements can rapidly inactivate genes that are important for a designed function. We deleted all six copies of IS1236 from the genome of the naturally transformable bacterium Acinetobacter baylyi ADP1. The natural competence of ADP1 made it possible to rapidly repair deleterious point mutations that arose during strain construction. In the resulting ADP1-ISx strain, the rates of mutations inactivating a reporter gene were reduced by 7- to 21-fold. This reduction was higher than expected from the incidence of new IS1236 insertions found during a 300-day mutation accumulation experiment with wild-type ADP1 that was used to estimate spontaneous mutation rates in the strain. The extra improvement appears to be due in part to eliminating large deletions caused by IS1236 activity, as the point mutation rate was unchanged in ADP1-ISx. Deletion of an error-prone polymerase (dinP) and a DNA damage response regulator (umuDAb [the umuD gene of A. baylyi]) from the ADP1-ISx genome did not further reduce mutation rates. Surprisingly, ADP1-ISx exhibited increased transformability. This improvement may be due to less autolysis and aggregation of the engineered cells than of the wild type. Thus, deleting IS elements from the ADP1 genome led to a greater than expected increase in evolutionary reliability and unexpectedly enhanced other key strain properties, as has been observed for other clean-genome bacterial strains. ADP1-ISx is an improved chassis for metabolic engineering and other applications. IMPORTANCE Acinetobacter baylyi ADP1 has been proposed as a next-generation bacterial host for synthetic biology and genome engineering due to its ability to efficiently take up DNA from its environment during normal growth. We deleted transposable elements that are capable of copying themselves, inserting into other genes, and thereby inactivating them from the ADP1 genome. The resulting “clean-genome” ADP1-ISx strain exhibited larger reductions in the rates of inactivating mutations than expected from spontaneous mutation rates measured via whole-genome sequencing of lineages evolved under relaxed selection. Surprisingly, we also found that IS element activity reduces transformability and is a major cause of cell aggregation and death in wild-type ADP1 grown under normal laboratory conditions. More generally, our results demonstrate that domesticating a bacterial genome by removing mobile DNA elements that have accumulated during evolution in the wild can have unanticipated benefits. PMID:28667117

  8. Reduced Mutation Rate and Increased Transformability of Transposon-Free Acinetobacter baylyi ADP1-ISx.

    PubMed

    Suárez, Gabriel A; Renda, Brian A; Dasgupta, Aurko; Barrick, Jeffrey E

    2017-09-01

    The genomes of most bacteria contain mobile DNA elements that can contribute to undesirable genetic instability in engineered cells. In particular, transposable insertion sequence (IS) elements can rapidly inactivate genes that are important for a designed function. We deleted all six copies of IS 1236 from the genome of the naturally transformable bacterium Acinetobacter baylyi ADP1. The natural competence of ADP1 made it possible to rapidly repair deleterious point mutations that arose during strain construction. In the resulting ADP1-ISx strain, the rates of mutations inactivating a reporter gene were reduced by 7- to 21-fold. This reduction was higher than expected from the incidence of new IS 1236 insertions found during a 300-day mutation accumulation experiment with wild-type ADP1 that was used to estimate spontaneous mutation rates in the strain. The extra improvement appears to be due in part to eliminating large deletions caused by IS 1236 activity, as the point mutation rate was unchanged in ADP1-ISx. Deletion of an error-prone polymerase ( dinP ) and a DNA damage response regulator ( umuD Ab [the umuD gene of A. baylyi ]) from the ADP1-ISx genome did not further reduce mutation rates. Surprisingly, ADP1-ISx exhibited increased transformability. This improvement may be due to less autolysis and aggregation of the engineered cells than of the wild type. Thus, deleting IS elements from the ADP1 genome led to a greater than expected increase in evolutionary reliability and unexpectedly enhanced other key strain properties, as has been observed for other clean-genome bacterial strains. ADP1-ISx is an improved chassis for metabolic engineering and other applications. IMPORTANCE Acinetobacter baylyi ADP1 has been proposed as a next-generation bacterial host for synthetic biology and genome engineering due to its ability to efficiently take up DNA from its environment during normal growth. We deleted transposable elements that are capable of copying themselves, inserting into other genes, and thereby inactivating them from the ADP1 genome. The resulting "clean-genome" ADP1-ISx strain exhibited larger reductions in the rates of inactivating mutations than expected from spontaneous mutation rates measured via whole-genome sequencing of lineages evolved under relaxed selection. Surprisingly, we also found that IS element activity reduces transformability and is a major cause of cell aggregation and death in wild-type ADP1 grown under normal laboratory conditions. More generally, our results demonstrate that domesticating a bacterial genome by removing mobile DNA elements that have accumulated during evolution in the wild can have unanticipated benefits. Copyright © 2017 American Society for Microbiology.

  9. Hsmar1 Transposition Is Sensitive to the Topology of the Transposon Donor and the Target

    PubMed Central

    Claeys Bouuaert, Corentin; Chalmers, Ronald

    2013-01-01

    Hsmar1 is a member of the Tc1-mariner superfamily of DNA transposons. These elements mobilize within the genome of their host by a cut-and-paste mechanism. We have exploited the in vitro reaction provided by Hsmar1 to investigate the effect of DNA supercoiling on transposon integration. We found that the topology of both the transposon and the target affect integration. Relaxed transposons have an integration defect that can be partially restored in the presence of elevated levels of negatively supercoiled target DNA. Negatively supercoiled DNA is a better target than nicked or positively supercoiled DNA, suggesting that underwinding of the DNA helix promotes target interactions. Like other Tc1-mariner elements, Hsmar1 integrates into 5′-TA dinucleotides. The direct vicinity of the target TA provides little sequence specificity for target interactions. However, transposition within a plasmid substrate was not random and some TA dinucleotides were targeted preferentially. The distribution of intramolecular target sites was not affected by DNA topology. PMID:23341977

  10. Structure of a bacterial RNA polymerase holoenzyme open promoter complex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bae, Brian; Feklistov, Andrey; Lass-Napiorkowska, Agnieszka

    2015-09-08

    Initiation of transcription is a primary means for controlling gene expression. In bacteria, the RNA polymerase (RNAP) holoenzyme binds and unwinds promoter DNA, forming the transcription bubble of the open promoter complex (RPo). We have determined crystal structures, refined to 4.14 Å-resolution, of RPo containing Thermus aquaticus RNAP holoenzyme and promoter DNA that includes the full transcription bubble. The structures, combined with biochemical analyses, reveal key features supporting the formation and maintenance of the double-strand/single-strand DNA junction at the upstream edge of the -10 element where bubble formation initiates. The results also reveal RNAP interactions with duplex DNA just upstreammore » of the -10 element and potential protein/DNA interactions that direct the DNA template strand into the RNAP active site. Addition of an RNA primer to yield a 4 base-pair post-translocated RNA:DNA hybrid mimics an initially transcribing complex at the point where steric clash initiates abortive initiation and σA dissociation.« less

  11. Structure of a bacterial RNA polymerase holoenzyme open promoter complex

    DOE PAGES

    Bae, Brian; Feklistov, Andrey; Lass-Napiorkowska, Agnieszka; ...

    2015-09-08

    Initiation of transcription is a primary means for controlling gene expression. In bacteria, the RNA polymerase (RNAP) holoenzyme binds and unwinds promoter DNA, forming the transcription bubble of the open promoter complex (RPo). We have determined crystal structures, refined to 4.14 Å-resolution, of RPo containing Thermus aquaticus RNAP holoenzyme and promoter DNA that includes the full transcription bubble. The structures, combined with biochemical analyses, reveal key features supporting the formation and maintenance of the double-strand/single-strand DNA junction at the upstream edge of the -10 element where bubble formation initiates. The results also reveal RNAP interactions with duplex DNA just upstreammore » of the -10 element and potential protein/DNA interactions that direct the DNA template strand into the RNAP active site. Additionally a RNA primer to yield a 4 base-pair post-translocated RNA:DNA hybrid mimics an initially transcribing complex at the point where steric clash initiates abortive initiation and σ A dissociation.« less

  12. Cut-and-Paste Transposons in Fungi with Diverse Lifestyles

    PubMed Central

    Steczkiewicz, Kamil; Ginalski, Krzysztof

    2017-01-01

    Abstract Transposable elements (TEs) shape genomes via recombination and transposition, lead to chromosomal rearrangements, create new gene neighborhoods, and alter gene expression. They play key roles in adaptation either to symbiosis in Amanita genus or to pathogenicity in Pyrenophora tritici-repentis. Despite growing evidence of their importance, the abundance and distribution of mobile elements replicating in a “cut-and-paste” fashion is barely described so far. In order to improve our knowledge on this old and ubiquitous class of transposable elements, 1,730 fungal genomes were scanned using both de novo and homology-based approaches. DNA TEs have been identified across the whole data set and display uneven distribution from both DNA TE classification and fungal taxonomy perspectives. DNA TE content correlates with genome size, which confirms that many transposon families proliferate simultaneously. In contrast, it is independent from intron density, average gene distance and GC content. TE count is associated with species’ lifestyle and tends to be elevated in plant symbionts and decreased in animal parasites. Lastly, we found that fungi with both RIP and RNAi systems have more total DNA TE sequences but less elements retaining a functional transposase, what reflects stringent control over transposition. PMID:29228286

  13. A role for neuronal cAMP responsive-element binding (CREB)-1 in brain responses to calorie restriction

    PubMed Central

    Fusco, Salvatore; Ripoli, Cristian; Podda, Maria Vittoria; Ranieri, Sofia Chiatamone; Leone, Lucia; Toietta, Gabriele; McBurney, Michael W.; Schütz, Günther; Riccio, Antonella; Grassi, Claudio; Galeotti, Tommaso; Pani, Giovambattista

    2012-01-01

    Calorie restriction delays brain senescence and prevents neurodegeneration, but critical regulators of these beneficial responses other than the NAD+-dependent histone deacetylase Sirtuin-1 (Sirt-1) are unknown. We report that effects of calorie restriction on neuronal plasticity, memory and social behavior are abolished in mice lacking cAMP responsive-element binding (CREB)-1 in the forebrain. Moreover, CREB deficiency drastically reduces the expression of Sirt-1 and the induction of genes relevant to neuronal metabolism and survival in the cortex and hippocampus of dietary-restricted animals. Biochemical studies reveal a complex interplay between CREB and Sirt-1: CREB directly regulates the transcription of the sirtuin in neuronal cells by binding to Sirt-1 chromatin; Sirt-1, in turn, is recruited by CREB to DNA and promotes CREB-dependent expression of target gene peroxisome proliferator-activated receptor-γ coactivator-1α and neuronal NO Synthase. Accordingly, expression of these CREB targets is markedly reduced in the brain of Sirt KO mice that are, like CREB-deficient mice, poorly responsive to calorie restriction. Thus, the above circuitry, modulated by nutrient availability, links energy metabolism with neurotrophin signaling, participates in brain adaptation to nutrient restriction, and is potentially relevant to accelerated brain aging by overnutrition and diabetes. PMID:22190495

  14. iPBS: a universal method for DNA fingerprinting and retrotransposon isolation.

    PubMed

    Kalendar, Ruslan; Antonius, Kristiina; Smýkal, Petr; Schulman, Alan H

    2010-11-01

    Molecular markers are essential in plant and animal breeding and biodiversity applications, in human forensics, and for map-based cloning of genes. The long terminal repeat (LTR) retrotransposons are well suited as molecular markers. As dispersed and ubiquitous transposable elements, their "copy and paste" life cycle of replicative transposition leads to new genome insertions without excision of the original element. Both the overall structure of retrotransposons and the domains responsible for the various phases of their replication are highly conserved in all eukaryotes. Nevertheless, up to a year has been required to develop a retrotransposon marker system in a new species, involving cloning and sequencing steps as well as the development of custom primers. Here, we describe a novel PCR-based method useful both as a marker system in its own right and for the rapid isolation of retrotransposon termini and full-length elements, making it ideal for "orphan crops" and other species with underdeveloped marker systems. The method, iPBS amplification, is based on the virtually universal presence of a tRNA complement as a reverse transcriptase primer binding site (PBS) in LTR retrotransposons. The method differs from earlier retrotransposon isolation methods because it is applicable not only to endogenous retroviruses and retroviruses, but also to both Gypsy and Copia LTR retrotransposons, as well as to non-autonomous LARD and TRIM elements, throughout the plant kingdom and to animals. Furthermore, the inter-PBS amplification technique as such has proved to be a powerful DNA fingerprinting technology without the need for prior sequence knowledge.

  15. Primer-Independent DNA Synthesis by a Family B DNA Polymerase from Self-Replicating Mobile Genetic Elements.

    PubMed

    Redrejo-Rodríguez, Modesto; Ordóñez, Carlos D; Berjón-Otero, Mónica; Moreno-González, Juan; Aparicio-Maldonado, Cristian; Forterre, Patrick; Salas, Margarita; Krupovic, Mart

    2017-11-07

    Family B DNA polymerases (PolBs) play a central role during replication of viral and cellular chromosomes. Here, we report the discovery of a third major group of PolBs, which we denote primer-independent PolB (piPolB), that might be a link between the previously known protein-primed and RNA/DNA-primed PolBs. PiPolBs are encoded by highly diverse mobile genetic elements, pipolins, integrated in the genomes of diverse bacteria and also present as circular plasmids in mitochondria. Biochemical characterization showed that piPolB displays efficient DNA polymerization activity that can use undamaged and damaged templates and is endowed with proofreading and strand displacement capacities. Remarkably, the protein is also capable of template-dependent de novo DNA synthesis, i.e., DNA-priming activity, thereby breaking the long-standing dogma that replicative DNA polymerases require a pre-existing primer for DNA synthesis. We suggest that piPolBs are involved in self-replication of pipolins and may also contribute to bacterial DNA damage tolerance. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  16. Structural and functional analysis of an enhancer GPEI having a phorbol 12-O-tetradecanoate 13-acetate responsive element-like sequence found in the rat glutathione transferase P gene.

    PubMed

    Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M

    1989-10-05

    We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.

  17. Rapid Microarray Detection of DNA and Proteins in Microliter Volumes with SPR Imaging Measurements

    PubMed Central

    Seefeld, Ting Hu; Zhou, Wen-Juan; Corn, Robert M.

    2011-01-01

    A four chamber microfluidic biochip is fabricated for the rapid detection of multiple proteins and nucleic acids from microliter volume samples with the technique of surface plasmon resonance imaging (SPRI). The 18 mm × 18 mm biochip consists of four 3 μL microfluidic chambers attached to an SF10 glass substrate, each of which contains three individually addressable SPRI gold thin film microarray elements. The twelve element (4 × 3) SPRI microarray consists of gold thin film spots (1 mm2 area; 45 nm thickness) each in individually addressable 0.5 μL volume microchannels. Microarrays of single-stranded DNA and RNA (ssDNA and ssRNA respectively) are fabricated by either chemical and/or enzymatic attachment reactions in these microchannels; the SPRI microarrays are then used to detect femtomole amounts (nanomolar concentrations) of DNA and proteins (single stranded DNA binding protein and thrombin via aptamer-protein bioaffinity interactions). Microarrays of ssRNA microarray elements were also used for the ultrasensitive detection of zeptomole amounts (femtomolar concentrations) of DNA via the technique of RNase H-amplified SPRI. Enzymatic removal of ssRNA from the surface due to the hybridization adsorption of target ssDNA is detected as a reflectivity decrease in the SPR imaging measurements. The observed reflectivity loss was proportional to the log of the target ssDNA concentration with a detection limit of 10 fM or 30 zeptomoles (18,000 molecules). This enzymatic amplified ssDNA detection method is not limited by diffusion of ssDNA to the interface, and thus is extremely fast, requiring only 200 seconds in the microliter volume format. PMID:21488682

  18. The transcription factor MTF-1 is essential for basal and heavy metal-induced metallothionein gene expression.

    PubMed

    Heuchel, R; Radtke, F; Georgiev, O; Stark, G; Aguet, M; Schaffner, W

    1994-06-15

    We have described and cloned previously a factor (MTF-1) that binds specifically to heavy metal-responsive DNA sequence elements in the enhancer/promoter region of metallothionein genes. MTF-1 is a protein of 72.5 kDa that contains six zinc fingers and multiple domains for transcriptional activation. Here we report the disruption of both alleles of the MTF-1 gene in mouse embryonic stem cells by homologous recombination. The resulting null mutant cell line fails to produce detectable amounts of MTF-1. Moreover, due to the loss of MTF-1, the endogenous metallothionein I and II genes are silent, indicating that MTF-1 is required for both their basal and zinc-induced transcription. In addition to zinc, other heavy metals, including cadmium, copper, nickel and lead, also fail to activate metal-responsive promoters in null mutant cells. However, cotransfection of an MTF-1 expression vector and metal-responsive reporter genes yields strong basal transcription that can be further boosted by zinc treatment of cells. These results demonstrate that MTF-1 is essential for metallothionein gene regulation. Finally, we present evidence that MTF-1 itself is a zinc sensor, which exhibits increased DNA binding activity upon zinc treatment.

  19. Thyroid Hormone Receptor β (TRβ) and Liver X Receptor (LXR) Regulate Carbohydrate-response Element-binding Protein (ChREBP) Expression in a Tissue-selective Manner*

    PubMed Central

    Gauthier, Karine; Billon, Cyrielle; Bissler, Marie; Beylot, Michel; Lobaccaro, Jean-Marc; Vanacker, Jean-Marc; Samarut, Jacques

    2010-01-01

    Thyroid hormone (TR) and liver X (LXR) receptors are transcription factors involved in lipogenesis. Both receptors recognize the same consensus DNA-response element in vitro. It was previously shown that their signaling pathways interact in the control of cholesterol elimination in the liver. In the present study, carbohydrate-response element-binding protein (ChREBP), a major transcription factor controlling the activation of glucose-induced lipogenesis in liver, is characterized as a direct target of thyroid hormones (TH) in liver and white adipose tissue (WAT), the two main lipogenic tissues in mice. Using genetic and molecular approaches, ChREBP is shown to be specifically regulated by TRβ but not by TRα in vivo, even in WAT where both TR isoforms are expressed. However, this isotype specificity is not found in vitro. This TRβ specific regulation correlates with the loss of TH-induced lipogenesis in TRβ−/− mice. Fasting/refeeding experiments show that TRβ is not required for the activation of ChREBP expression particularly marked in WAT following refeeding. However, TH can stimulate ChREBP expression in WAT even under fasting conditions, suggesting completely independent pathways. Because ChREBP has been described as an LXR target, the interaction of LXR and TRβ in ChREBP regulation was assayed both in vitro and in vivo. Each receptor recognizes a different response element on the ChREBP promoter, located only 8 bp apart. There is a cross-talk between LXR and TRβ signaling on the ChREBP promoter in liver but not in WAT where LXR does not regulate ChREBP expression. The molecular basis for this cross-talk has been determined in in vitro systems. PMID:20615868

  20. Structural and Thermodynamic Consequences of the Replacement of Zinc with Environmental Metals on ERα-DNA Interactions

    PubMed Central

    Deegan, Brian J.; Bona, Anna M.; Bhat, Vikas; Mikles, David C.; McDonald, Caleb B.; Seldeen, Kenneth L.; Farooq, Amjad

    2011-01-01

    Estrogen receptor α (ERα) acts as a transcription factor by virtue of the ability of its DNA-binding (DB) domain, comprised of a tandem pair of zinc fingers, to recognize the estrogen response element (ERE) within the promoters of target genes. Herein, using an array of biophysical methods, we probe structural consequences of the replacement of zinc within the DB domain of ERα with various environmental metals and their effects on the thermodynamics of binding to DNA. Our data reveal that while the DB domain reconstituted with divalent ions of zinc, cadmium, mercury and cobalt binds to DNA with affinities in the nanomolar range, divalent ions of barium, copper, iron, lead, manganese, nickel and tin are unable to regenerate DB domain with DNA-binding potential though they can compete with zinc for coordinating the cysteine ligands within the zinc fingers. We also show that the metal-free DB domain is a homodimer in solution and that the binding of various metals only results in subtle secondary and tertiary structural changes, implying that metal-coordination may only be essential for DNA-binding. Collectively, our findings provide mechanistic insights into how environmental metals may modulate the physiological function of a key nuclear receptor involved in mediating a plethora of cellular functions central to human health and disease. PMID:22038807

  1. Sexual dimorphic floral development in dioecious plants revealed by transcriptome, phytohormone, and DNA methylation analysis in Populus tomentosa.

    PubMed

    Song, Yuepeng; Ma, Kaifeng; Ci, Dong; Chen, Qingqing; Tian, Jiaxing; Zhang, Deqiang

    2013-12-01

    Dioecious plants have evolved sex-specific floral development mechanisms. However, the precise gene expression patterns in dioecious plant flower development remain unclear. Here, we used andromonoecious poplar, an exceptional model system, to eliminate the confounding effects of genetic background of dioecious plants. Comparative transcriptome and physiological analysis allowed us to characterize sex-specific development of female and male flowers. Transcriptome analysis identified genes significantly differentially expressed between the sexes, including genes related to floral development, phytohormone synthesis and metabolism, and DNA methylation. Correlation analysis revealed a significant correlation between phytohormone signaling and gene expression, identifying specific phytohormone-responsive genes and their cis-regulatory elements. Two genes related to DNA methylation, METHYLTRANSFERASE1 (MET1) and DECREASED DNA METHYLATION 1 (DDM1), which are located in the sex determination region of Chromosome XIX, have differential expression between female and male flowers. A time-course analysis revealed that MET1 and DDM1 expression may produce different DNA methylation levels in female and male flowers. Understanding the interactions of phytohormone signaling, DNA methylation and target gene expression should lead to a better understanding of sexual differences in floral development. Thus, this study identifies a set of candidate genes for further studies of poplar sexual dimorphism and relates sex-specific floral development to physiological and epigenetic changes.

  2. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element against the Pesticide Fipronil and Sensitive Detection in River Water

    PubMed Central

    Sooter, Letha J.

    2017-01-01

    Fipronil is a commonly used insecticide that has been shown to have environmental and human health risks. The current standard methods of detection for fipronil and its metabolites, such as GC-MS, are time consuming and labor intensive. In this study, a variant of systematic evolution of ligands by exponential enrichment (SELEX), was utilized to identify the first single-stranded DNA (ssDNA) molecular recognition element (MRE) that binds to fipronil with high affinity (Kd = 48 ± 8 nM). The selected MRE displayed low cross binding activity on various environmentally relevant, structurally unrelated herbicides and pesticides, in addition to broad-spectrum binding activity on major metabolites of fipronil and a structurally similar pesticide in prepared river samples. Additionally, a proof-of-principle fluorescent detection assay was developed by using the selected ssDNA MRE as a signal-reporting element, with a limit of detection of 105 nM in a prepared river water sample. PMID:29283416

  3. DNA extraction techniques compared for accurate detection of genetically modified organisms (GMOs) in maize food and feed products.

    PubMed

    Turkec, Aydin; Kazan, Hande; Karacanli, Burçin; Lucas, Stuart J

    2015-08-01

    In this paper, DNA extraction methods have been evaluated to detect the presence of genetically modified organisms (GMOs) in maize food and feed products commercialised in Turkey. All the extraction methods tested performed well for the majority of maize foods and feed products analysed. However, the highest DNA content was achieved by the Wizard, Genespin or the CTAB method, all of which produced optimal DNA yield and purity for different maize food and feed products. The samples were then screened for the presence of GM elements, along with certified reference materials. Of the food and feed samples, 8 % tested positive for the presence of one GM element (NOS terminator), of which half (4 % of the total) also contained a second element (the Cauliflower Mosaic Virus 35S promoter). The results obtained herein clearly demonstrate the presence of GM maize in the Turkish market, and that the Foodproof GMO Screening Kit provides reliable screening of maize food and feed products.

  4. Tyrosine Recombinase Retrotransposons and Transposons.

    PubMed

    Poulter, Russell T M; Butler, Margi I

    2015-04-01

    Retrotransposons carrying tyrosine recombinases (YR) are widespread in eukaryotes. The first described tyrosine recombinase mobile element, DIRS1, is a retroelement from the slime mold Dictyostelium discoideum. The YR elements are bordered by terminal repeats related to their replication via free circular dsDNA intermediates. Site-specific recombination is believed to integrate the circle without creating duplications of the target sites. Recently a large number of YR retrotransposons have been described, including elements from fungi (mucorales and basidiomycetes), plants (green algae) and a wide range of animals including nematodes, insects, sea urchins, fish, amphibia and reptiles. YR retrotransposons can be divided into three major groups: the DIRS elements, PAT-like and the Ngaro elements. The three groups form distinct clades on phylogenetic trees based on alignments of reverse transcriptase/ribonuclease H (RT/RH) and YR sequences, and also having some structural distinctions. A group of eukaryote DNA transposons, cryptons, also carry tyrosine recombinases. These DNA transposons do not encode a reverse transcriptase. They have been detected in several pathogenic fungi and oomycetes. Sequence comparisons suggest that the crypton YRs are related to those of the YR retrotransposons. We suggest that the YR retrotransposons arose from the combination of a crypton-like YR DNA transposon and the RT/RH encoding sequence of a retrotransposon. This acquisition must have occurred at a very early point in the evolution of eukaryotes.

  5. Specific interaction of mutant p53 with regions of matrix attachment region DNA elements (MARs) with a high potential for base-unpairing

    PubMed Central

    Will, Katrin; Warnecke, Gabriele; Wiesmüller, Lisa; Deppert, Wolfgang

    1998-01-01

    Mutant, but not wild-type p53 binds with high affinity to a variety of MAR-DNA elements (MARs), suggesting that MAR-binding of mutant p53 relates to the dominant-oncogenic activities proposed for mutant p53. MARs recognized by mutant p53 share AT richness and contain variations of an AATATATTT “DNA-unwinding motif,” which enhances the structural dynamics of chromatin and promotes regional DNA base-unpairing. Mutant p53 specifically interacted with MAR-derived oligonucleotides carrying such unwinding motifs, catalyzing DNA strand separation when this motif was located within a structurally labile sequence environment. Addition of GC-clamps to the respective MAR-oligonucleotides or introducing mutations into the unwinding motif strongly reduced DNA strand separation, but supported the formation of tight complexes between mutant p53 and such oligonucleotides. We conclude that the specific interaction of mutant p53 with regions of MAR-DNA with a high potential for base-unpairing provides the basis for the high-affinity binding of mutant p53 to MAR-DNA. PMID:9811860

  6. The hormone response element mimic sequence of GAS5 lncRNA is sufficient to induce apoptosis in breast cancer cells

    PubMed Central

    Pickard, Mark R.; Williams, Gwyn T.

    2016-01-01

    Growth arrest-specific 5 (GAS5) lncRNA promotes apoptosis, and its expression is down-regulated in breast cancer. GAS5 lncRNA is a decoy of glucocorticoid/related receptors; a stem-loop sequence constitutes the GAS5 hormone response element mimic (HREM), which is essential for the regulation of breast cancer cell apoptosis. This preclinical study aimed to determine if the GAS5 HREM sequence alone promotes the apoptosis of breast cancer cells. Nucleofection of hormone-sensitive and –insensitive breast cancer cell lines with a GAS5 HREM DNA oligonucleotide increased both basal and ultraviolet-C-induced apoptosis, and decreased culture viability and clonogenic growth, similar to GAS5 lncRNA. The HREM oligonucleotide demonstrated similar sequence specificity to the native HREM for its functional activity and had no effect on endogenous GAS5 lncRNA levels. Certain chemically modified HREM oligonucleotides, notably DNA and RNA phosphorothioates, retained pro-apoptotic. activity. Crucially the HREM oligonucleotide could overcome apoptosis resistance secondary to deficient endogenous GAS5 lncRNA levels. Thus, the GAS5 lncRNA HREM sequence alone is sufficient to induce apoptosis in breast cancer cells, including triple-negative breast cancer cells. These findings further suggest that emerging knowledge of structure/function relationships in the field of lncRNA biology can be exploited for the development of entirely novel, oligonucleotide mimic-based, cancer therapies. PMID:26862727

  7. Role of the human cytomegalovirus major immediate-early promoter's 19-base-pair-repeat cyclic AMP-response element in acutely infected cells.

    PubMed

    Keller, M J; Wheeler, D G; Cooper, E; Meier, J L

    2003-06-01

    Prior studies have suggested a role of the five copies of the 19-bp-repeat cyclic AMP (cAMP)-response element (CRE) in major immediate-early (MIE) promoter activation, the rate-limiting step in human cytomegalovirus (HCMV) replication. We used two different HCMV genome modification strategies to test this hypothesis in acutely infected cells. We report the following: (i) the CREs do not govern basal levels of MIE promoter activity at a high or low multiplicity of infection (MOI) in human foreskin fibroblast (HFF)- or NTera2-derived neuronal cells; (ii) serum and virion components markedly increase MIE promoter-dependent transcription at a low multiplicity of infection (MOI), but this increase is not mediated by the CREs; (iii) forskolin stimulation of the cAMP signaling pathway induces a two- to threefold increase in MIE RNA levels in a CRE-specific manner at a low MOI in both HFF- and NTera2-derived neuronal cells; and (iv) the CREs do not regulate basal levels of HCMV DNA replication at a high or low MOI in HFF. Their presence does impart a forskolin-induced increase in viral DNA replication at a low MOI but only when basal levels of MIE promoter activity are experimentally diminished. In conclusion, the 19-bp-repeat CREs add to the robust MIE promoter activity that occurs in the acutely infected stimulated cells, although the CREs' greater role may be in other settings.

  8. Bacterial DNA-induced NK cell IFN-gamma production is dependent on macrophage secretion of IL-12.

    PubMed

    Chace, J H; Hooker, N A; Mildenstein, K L; Krieg, A M; Cowdery, J S

    1997-08-01

    Bacterial DNA (bDNA) activates B cells and macrophages and can augment inflammatory responses by inducing release of proinflammatory cytokines. We found that bDNA stimulation of mouse spleen cells induced NK cell IFN-gamma production that was dependent upon the presence of unmethylated CpG motifs, and oligonucleotides with internal CpG motifs could also induce splenocytes to secrete IFN-gamma. The bDNA-induced IFN-gamma response was strictly macrophages dependent. While splenocytes from SCID mice secreted IFN-gamma in response to bDNA, depletion of macrophages eliminated this response. Additionally, purified NK cells did not respond to bDNA; however, addition of macrophages restored the NK cell IFN-gamma response. Coculture of NK cells with preactivated macrophages further increased bDNA-induced NK cell IFN-gamma production. Anti-IL-12 or IL-10 inhibited bDNA-induced IFN-gamma response. Treatment of purified macrophages with bDNA resulted in IL-12 secretion accompanied by an increase in IL-12 p40 mRNA level. Although isolated NK cells did not make IFN-gamma in response to bDNA, NK cells costimulated with IL-12 gained the ability to respond to bDNA. These experiments show that bDNA induces macrophage IL-12 production which, in turn, stimulates NK cell IFN-gamma production. Macrophage-derived IL-12 renders NK cells responsive to bDNA permitting an even greater IFN-gamma response to bDNA.

  9. Maize DRE-binding proteins DBF1 and DBF2 are involved in rab17 regulation through the drought-responsive element in an ABA-dependent pathway.

    PubMed

    Kizis, Dimosthenis; Pagès, Montserrat

    2002-06-01

    The abscisic acid-responsive gene rab17 of maize is expressed during late embryogenesis, and is induced by ABA and desiccation in embryo and vegetative tissues. ABRE and DRE cis-elements are involved in regulation of the gene by ABA and drought. Using yeast one-hybrid screening, we isolated two cDNAs encoding two new DRE-binding proteins, designated DBF1 and DBF2, that are members of the AP2/EREBP transcription factor family. Analysis of mRNA accumulation profiles showed that DBF1 is induced during maize embryogenesis and after desiccation, NaCl and ABA treatments in plant seedlings, whereas the DBF2 mRNA is not induced. DNA-binding preferences of DBFs were analysed by electrophoretic mobility shift assays, and showed that both DBF1 and DBF2 bound to the wild-type DRE2 element, but not to the DRE2 mutant or to the DRE1 element which differs only in a single nucleotide. Transactivation activity using particle bombardment showed that DBF1 functioned as activator of DRE2-dependent transcription of rab17 promoter by ABA, whereas DBF2 overexpression had a repression action downregulating not only the basal promoter activity, but also the ABA effect. These results show that ABA plays a role in the regulation of DBF activity, and suggests the existence of an ABA-dependent pathway for the regulation of genes through the C-repeat/DRE element.

  10. Does a role for selenium in DNA damage repair explain apparent controversies in its use in chemoprevention?

    PubMed Central

    Diamond, Alan M.

    2013-01-01

    The trace element selenium is an essential micronutrient that has received considerable attention for its potential use in the prevention of cancer. In spite of this interest, the mechanism(s) by which selenium might function as a chemopreventive remain to be determined. Considerable experimental evidence indicates that one possible mechanism by which selenium supplementation may exert its benefits is by enhancing the DNA damage repair response, and this includes data obtained using cultured cells, animal models as well as in human clinical studies. In these studies, selenium supplementation has been shown to be beneficial in reducing the frequency of DNA adducts and chromosome breaks, consequentially reducing the likelihood of detrimental mutations that ultimately contribute to carcinogenesis. The benefits of selenium can be envisioned as being due, at least in part, to it being a critical constituent of selenoproteins such as glutathione peroxidases and thioredoxin reductases, proteins that play important roles in antioxidant defence and maintaining the cellular reducing environment. Selenium, therefore, may be protective by preventing DNA damage from occurring as well as by increasing the activity of repair enzymes such as DNA glycosylases and DNA damage repair pathways that involve p53, BRCA1 and Gadd45. An improved understanding of the mechanism of selenium’s impact on DNA repair processes may help to resolve the apparently contradicting data obtained from decades of animal work, human epidemiology and more recently, clinical supplementation studies. PMID:23204505

  11. DNA-mediated strand displacement facilitates sensitive electronic detection of antibodies in human serums.

    PubMed

    Dou, Baoting; Yang, Jianmei; Shi, Kai; Yuan, Ruo; Xiang, Yun

    2016-09-15

    We describe here the development of a sensitive and convenient electronic sensor for the detection of antibodies in human serums. The sensor is constructed by self-assembly formation of a mixed monolayer containing the small molecule epitope conjugated double stranded DNA probes on gold electrode. The target antibody binds the epitope on the dsDNA probe and lowers the melting temperature of the duplex, which facilitates the displacement of the antibody-linked strand of the duplex probe by an invading methylene blue-tagged single stranded DNA (MB-ssDNA) through the strand displacement reaction and leads to the capture of many MB-ssDNA on the sensor surface. Subsequent electrochemical oxidation of the methylene blue labels results in amplified current response for sensitive monitoring of the antibodies. The antibody assay conditions are optimized and the sensor exhibits a linear range between 1.0 and 25.0nM with a detection limit of 0.67nM for the target antibody. The sensor is also selective and can be employed to detect the target antibodies in human serum samples. With the advantages of using small molecule epitope as the antibody recognition element over traditional antigen, the versatile manipulability of the DNA probes and the unique properties of the electrochemical transduction technique, the developed sensor thus hold great potential for simple and sensitive detection of different antibodies and other proteins in real samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. DNA-Demethylase Regulated Genes Show Methylation-Independent Spatiotemporal Expression Patterns

    PubMed Central

    Schumann, Ulrike; Lee, Joanne; Kazan, Kemal; Ayliffe, Michael; Wang, Ming-Bo

    2017-01-01

    Recent research has indicated that a subset of defense-related genes is downregulated in the Arabidopsis DNA demethylase triple mutant rdd (ros1 dml2 dml3) resulting in increased susceptibility to the fungal pathogen Fusarium oxysporum. In rdd plants these downregulated genes contain hypermethylated transposable element sequences (TE) in their promoters, suggesting that this methylation represses gene expression in the mutant and that these sequences are actively demethylated in wild-type plants to maintain gene expression. In this study, the tissue-specific and pathogen-inducible expression patterns of rdd-downregulated genes were investigated and the individual role of ROS1, DML2, and DML3 demethylases in these spatiotemporal regulation patterns was determined. Large differences in defense gene expression were observed between pathogen-infected and uninfected tissues and between root and shoot tissues in both WT and rdd plants, however, only subtle changes in promoter TE methylation patterns occurred. Therefore, while TE hypermethylation caused decreased gene expression in rdd plants it did not dramatically effect spatiotemporal gene regulation, suggesting that this latter regulation is largely methylation independent. Analysis of ros1-3, dml2-1, and dml3-1 single gene mutant lines showed that promoter TE hypermethylation and defense-related gene repression was predominantly, but not exclusively, due to loss of ROS1 activity. These data demonstrate that DNA demethylation of TE sequences, largely by ROS1, promotes defense-related gene expression but does not control spatiotemporal expression in Arabidopsis. Summary: Ros1-mediated DNA demethylation of promoter transposable elements is essential for activation of defense-related gene expression in response to fungal infection in Arabidopsis thaliana. PMID:28894455

  13. Modulation of Estrogen Response Element-Driven Gene Expressions and Cellular Proliferation with Polar Directions by Designer Transcription Regulators

    PubMed Central

    Muyan, Mesut; Güpür, Gizem; Yaşar, Pelin; Ayaz, Gamze; User, Sırma Damla; Kazan, Hasan Hüseyin; Huang, Yanfang

    2015-01-01

    Estrogen receptor α (ERα), as a ligand-dependent transcription factor, mediates 17β-estradiol (E2) effects. ERα is a modular protein containing a DNA binding domain (DBD) and transcription activation domains (AD) located at the amino- and carboxyl-termini. The interaction of the E2-activated ERα dimer with estrogen response elements (EREs) of genes constitutes the initial step in the ERE-dependent signaling pathway necessary for alterations of cellular features. We previously constructed monomeric transcription activators, or monotransactivators, assembled from an engineered ERE-binding module (EBM) using the ERα-DBD and constitutively active ADs from other transcription factors. Monotransactivators modulated cell proliferation by activating and repressing ERE-driven gene expressions that simulate responses observed with E2-ERα. We reasoned here that integration of potent heterologous repression domains (RDs) into EBM could generate monotransrepressors that alter ERE-bearing gene expressions and cellular proliferation in directions opposite to those observed with E2-ERα or monotransactivators. Consistent with this, monotransrepressors suppressed reporter gene expressions that emulate the ERE-dependent signaling pathway. Moreover, a model monotransrepressor regulated DNA synthesis, cell cycle progression and proliferation of recombinant adenovirus infected ER-negative cells through decreasing as well as increasing gene expressions with polar directions compared with E2-ERα or monotransactivator. Our results indicate that an ‘activator’ or a ‘repressor’ possesses both transcription activating/enhancing and repressing/decreasing abilities within a chromatin context. Offering a protein engineering platform to alter signal pathway-specific gene expressions and cell growth, our approach could also be used for the development of tools for epigenetic modifications and for clinical interventions wherein multigenic de-regulations are an issue. PMID:26295471

  14. Omega-3 polyunsaturated fatty acids augment the muscle protein anabolic response to hyperinsulinaemia-hyperaminoacidaemia in healthy young and middle-aged men and women.

    PubMed

    Smith, Gordon I; Atherton, Philip; Reeds, Dominic N; Mohammed, B Selma; Rankin, Debbie; Rennie, Michael J; Mittendorfer, Bettina

    2011-09-01

    Increased dietary LCn-3PUFA (long-chain n-3 polyunsaturated fatty acid) intake stimulates muscle protein anabolism in individuals who experience muscle loss due to aging or cancer cachexia. However, it is not known whether LCn-3PUFAs elicit similar anabolic effects in healthy individuals. To answer this question, we evaluated the effect of 8 weeks of LCn-3PUFA supplementation (4 g of Lovaza®/day) in nine 25-45-year-old healthy subjects on the rate of muscle protein synthesis (by using stable isotope-labelled tracer techniques) and the activation (phosphorylation) of elements of the mTOR (mammalian target of rapamycin)/p70S6K (p70 S6 kinase) signalling pathway during basal post-absorptive conditions and during a hyperinsulinaemic-hyperaminoacidaemic clamp. We also measured the concentrations of protein, RNA and DNA in muscle to obtain indices of the protein synthetic capacity, translational efficiency and cell size. Neither the basal muscle protein fractional synthesis rate nor basal signalling element phosphorylation changed in response to LCn-3PUFA supplementation, but the anabolic response to insulin and amino acid infusion was greater after LCn-3PUFA [i.e. the muscle protein fractional synthesis rate during insulin and amino acid infusion increased from 0.062±0.004 to 0.083±0.007%/h and the phospho-mTOR (Ser2448) and phospho-p70S6K (Thr389) levels increased by ∼50%; all P<0.05]. In addition, the muscle protein concentration and the protein/DNA ratio (i.e. muscle cell size) were both greater (P<0.05) after LCn-3PUFA supplementation. We conclude that LCn-3PUFAs have anabolic properties in healthy young and middle-aged adults.

  15. A DNase encoded by integrated element CJIE1 inhibits natural transformation of Campylobacter jejuni.

    PubMed

    Gaasbeek, Esther J; Wagenaar, Jaap A; Guilhabert, Magalie R; Wösten, Marc M S M; van Putten, Jos P M; van der Graaf-van Bloois, Linda; Parker, Craig T; van der Wal, Fimme J

    2009-04-01

    The species Campylobacter jejuni is considered naturally competent for DNA uptake and displays strong genetic diversity. Nevertheless, nonnaturally transformable strains and several relatively stable clonal lineages exist. In the present study, the molecular mechanism responsible for the nonnatural transformability of a subset of C. jejuni strains was investigated. Comparative genome hybridization indicated that C. jejuni Mu-like prophage integrated element 1 (CJIE1) was more abundant in nonnaturally transformable C. jejuni strains than in naturally transformable strains. Analysis of CJIE1 indicated the presence of dns (CJE0256), which is annotated as a gene encoding an extracellular DNase. DNase assays using a defined dns mutant and a dns-negative strain expressing Dns from a plasmid indicated that Dns is an endogenous DNase. The DNA-hydrolyzing activity directly correlated with the natural transformability of the knockout mutant and the dns-negative strain expressing Dns from a plasmid. Analysis of a broader set of strains indicated that the majority of nonnaturally transformable strains expressed DNase activity, while all naturally competent strains lacked this activity. The inhibition of natural transformation in C. jejuni via endogenous DNase activity may contribute to the formation of stable lineages in the C. jejuni population.

  16. Identification of a peroxisome proliferator-responsive element upstream of the gene encoding rat peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase.

    PubMed Central

    Zhang, B; Marcus, S L; Sajjadi, F G; Alvares, K; Reddy, J K; Subramani, S; Rachubinski, R A; Capone, J P

    1992-01-01

    Ciprofibrate, a hypolipidemic drug that acts as a peroxisome proliferator, induces the transcription of genes encoding peroxisomal beta-oxidation enzymes. To identify cis-acting promoter elements involved in this induction, 5.8 kilobase pairs of promoter sequence from the gene encoding rat peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase (EC 4.2.1.17/EC 1.1.1.35) was inserted upstream of a luciferase reporter gene. Transfection of this expression vector into rat hepatoma H4IIEC3 cells in the presence of ciprofibrate resulted in a 5- to 10-fold, cell type-specific increase in luciferase activity as compared to cells transfected in the absence of drug. A peroxisome proliferator-responsive element (PPRE) was localized to a 196-nucleotide region centered at position -2943 from the transcription start site. This PPRE conferred ciprofibrate responsiveness on a heterologous promoter and functioned independently of orientation or position. Gel retardation analysis with nuclear extracts demonstrated that ciprofibrate-treated or untreated H4IIEC3 cells, but not HeLa cells or monkey kidney cells, contained sequence-specific DNA binding factors that interact with the PPRE. These results have implications for understanding the mechanisms of coordinated transcriptional induction of genes encoding peroxisomal proteins by hypolipidemic agents and other peroxisome proliferators. Images PMID:1502166

  17. The Role of the Transcriptional Response to DNA Replication Stress

    PubMed Central

    Herlihy, Anna E.; de Bruin, Robertus A.M.

    2017-01-01

    During DNA replication many factors can result in DNA replication stress. The DNA replication stress checkpoint prevents the accumulation of replication stress-induced DNA damage and the potential ensuing genome instability. A critical role for post-translational modifications, such as phosphorylation, in the replication stress checkpoint response has been well established. However, recent work has revealed an important role for transcription in the cellular response to DNA replication stress. In this review, we will provide an overview of current knowledge of the cellular response to DNA replication stress with a specific focus on the DNA replication stress checkpoint transcriptional response and its role in the prevention of replication stress-induced DNA damage. PMID:28257104

  18. The Role of the Transcriptional Response to DNA Replication Stress.

    PubMed

    Herlihy, Anna E; de Bruin, Robertus A M

    2017-03-02

    During DNA replication many factors can result in DNA replication stress. The DNA replication stress checkpoint prevents the accumulation of replication stress-induced DNA damage and the potential ensuing genome instability. A critical role for post-translational modifications, such as phosphorylation, in the replication stress checkpoint response has been well established. However, recent work has revealed an important role for transcription in the cellular response to DNA replication stress. In this review, we will provide an overview of current knowledge of the cellular response to DNA replication stress with a specific focus on the DNA replication stress checkpoint transcriptional response and its role in the prevention of replication stress-induced DNA damage.

  19. Crystal Structure of a Histidine Kinase Sensor Domain with Similarity to Periplasmic Binding Proteins

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cheung, J.; Le-Khac, M; Hendrickson, W

    2009-01-01

    Histidine kinase receptors are elements of the two-component signal transduction systems commonly found in bacteria and lower eukaryotes, where they are crucial for environmental adaption through the coupling of extracellular changes to intracellular responses. The typical two-component system consists of a membrane-spanning histidine kinase sensor and a cytoplasmic response regulator. In the calssic system, extracellular signals such as small molecule ligands and ions are detected by the periplasmic sensor domain of the histidine kinase receptor, which modulates the catalytic activity of the cytoplasmic histidine kinase domain and promotes ATP-dependent autophosphorylation of a conserved histidine residue. G. sulfurreducens genomic DNA wasmore » used.« less

  20. Integrated in silico and biological validation of the blocking effect of Cot-1 DNA on Microarray-CGH.

    PubMed

    Kang, Seung-Hui; Park, Chan Hee; Jeung, Hei Cheul; Kim, Ki-Yeol; Rha, Sun Young; Chung, Hyun Cheol

    2007-06-01

    In array-CGH, various factors may act as variables influencing the result of experiments. Among them, Cot-1 DNA, which has been used as a repetitive sequence-blocking agent, may become an artifact-inducing factor in BAC array-CGH. To identify the effect of Cot-1 DNA on Microarray-CGH experiments, Cot-1 DNA was labeled directly and Microarray-CGH experiments were performed. The results confirmed that probes which hybridized more completely with Cot-1 DNA had a higher sequence similarity to the Alu element. Further, in the sex-mismatched Microarray-CGH experiments, the variation and intensity in the fluorescent signal were reduced in the high intensity probe group in which probes were better hybridized with Cot-1 DNA. Otherwise, those of the low intensity probe group showed no alterations regardless of Cot-1 DNA. These results confirmed by in silico methods that Cot-1 DNA could block repetitive sequences in gDNA and probes. In addition, it was confirmed biologically that the blocking effect of Cot-1 DNA could be presented via its repetitive sequences, especially Alu elements. Thus, in contrast to BAC-array CGH, the use of Cot-1 DNA is advantageous in controlling experimental variation in Microarray-CGH.

  1. Identification of a DNA Segment Exhibiting Rearrangement Modifying Effects upon Transgenic δ-deleting Elements

    PubMed Central

    Janowski, Karen M.; Ledbetter, Stephanie; Mayo, Matthew S.; Hockett, Richard D.

    1997-01-01

    Control of the rearrangement and expression of the T cell receptor α and δ chains is critical for determining T cell type. The process of δ deletion is a candidate mechanism for maintaining separation of the α and δ loci. Mice harboring a transgenic reporter δ deletion construct show α/β T cell lineage–specific use of the transgenic elements. A 48-basepair segment of DNA, termed HPS1A, when deleted from this reporter construct, loses tight lineage-specific rearrangement control of transgenic elements, with abundant rearrangements of transgenic δ-deleting elements now in γ/δ T cells. Furthermore, HPS1A augments recombination frequency of extrachromosomal substrates in an in vitro recombination assay. DNA binding proteins recognizing HPS1A have been identified and are restricted to early B and T cells, during the time of active rearrangement of endogenous TCR and immunoglobulin loci. These data are consistent with δ deletion playing an important role in maintaining separate TCR α and δ loci. PMID:9207011

  2. rep-PCR-Mediated Genomic Fingerprinting: A Rapid and Effective Method to Identify Clavibacter michiganensis.

    PubMed

    Louws, F J; Bell, J; Medina-Mora, C M; Smart, C D; Opgenorth, D; Ishimaru, C A; Hausbeck, M K; de Bruijn, F J; Fulbright, D W

    1998-08-01

    ABSTRACT The genomic DNA fingerprinting technique known as repetitive-sequence-based polymerase chain reaction (rep-PCR) was evaluated as a tool to differentiate subspecies of Clavibacter michiganensis, with special emphasis on C. michiganensis subsp. michiganensis, the pathogen responsible for bacterial canker of tomato. DNA primers (REP, ERIC, and BOX), corresponding to conserved repetitive element motifs in the genomes of diverse bacterial species, were used to generate genomic fingerprints of C. michiganensis subsp. michiganensis, C. michiganensis subsp. sepedonicus, C. michiganensis subsp. nebraskensis, C. michiganensis subsp. tessellarius, and C. michiganensis subsp. insidiosum. The rep-PCR-generated patterns of DNA fragments observed after agarose gel electrophoresis support the current division of C. michiganensis into five subspecies. In addition, the rep-PCR fingerprints identified at least four types (A, B, C, and D) within C. michiganensis subsp. michiganensis based on limited DNA polymorphisms; the ability to differentiate individual strains may be of potential use in studies on the epidemiology and host-pathogen interactions of this organism. In addition, we have recovered from diseased tomato plants a relatively large number of naturally occurring avirulent C. michiganensis subsp. michiganensis strains with rep-PCR fingerprints identical to those of virulent C. michiganensis subsp. michiganensis strains.

  3. Destabilization of the MutSα's protein-protein interface due to binding to the DNA adduct induced by anticancer agent carboplatin via molecular dynamics simulations.

    PubMed

    Negureanu, Lacramioara; Salsbury, Freddie R

    2013-11-01

    DNA mismatch repair (MMR) proteins maintain genetic integrity in all organisms by recognizing and repairing DNA errors. Such alteration of hereditary information can lead to various diseases, including cancer. Besides their role in DNA repair, MMR proteins detect and initiate cellular responses to certain type of DNA damage. Its response to the damaged DNA has made the human MMR pathway a useful target for anticancer agents such as carboplatin. This study indicates that strong, specific interactions at the interface of MutSα in response to the mismatched DNA recognition are replaced by weak, non-specific interactions in response to the damaged DNA recognition. Data suggest a severe impairment of the dimerization of MutSα in response to the damaged DNA recognition. While the core of MutSα is preserved in response to the damaged DNA recognition, the loss of contact surface and the rearrangement of contacts at the protein interface suggest a different packing in response to the damaged DNA recognition. Coupled in response to the mismatched DNA recognition, interaction energies, hydrogen bonds, salt bridges, and solvent accessible surface areas at the interface of MutSα and within the subunits are uncoupled or asynchronously coupled in response to the damaged DNA recognition. These pieces of evidence suggest that the loss of a synchronous mode of response in the MutSα's surveillance for DNA errors would possibly be one of the mechanism(s) of signaling the MMR-dependent programed cell death much wanted in anticancer therapies. The analysis was drawn from dynamics simulations.

  4. Final Report - Epigenetics of low dose radiation effects in an animal model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kovalchuk, Olga

    This project sought mechanistic understanding of the epigenetic response of tissues as well as the consequences of those responses, when induced by low dose irradiation in a well-established model system (mouse). Based on solid and extensive preliminary data we investigated the molecular epigenetic mechanisms of in vivo radiation responses, particularly – effects of low, occupationally relevant radiation exposures on the genome stability and adaptive response in mammalian tissues and organisms. We accumulated evidence that low dose irradiation altered epigenetic profiles and impacted radiation target organs of the exposed animals. The main long-term goal was to dissect the epigenetic basis ofmore » induction of the low dose radiation-induced genome instability and adaptive response and the specific fundamental roles of epigenetic changes (i.e. DNA methylation, histone modifications and miRNAs) in their generation. We hypothesized that changes in global and regional DNA methylation, global histone modifications and regulatory microRNAs played pivotal roles in the generation and maintenance low-dose radiation-induced genome instability and adaptive response. We predicted that epigenetic changes influenced the levels of genetic rearrangements (transposone reactivation). We hypothesized that epigenetic responses from low dose irradiation were dependent on exposure regimes, and would be greatest when organisms are exposed in a protracted/fractionated manner: fractionated exposures > acute exposures. We anticipated that the epigenetic responses were correlated with the gene expression levels. Our immediate objectives were: • To investigate the exact nature of the global and locus-specific DNA methylation changes in the LDR exposed cells and tissues and dissect their roles in adaptive response • To investigate the roles of histone modifications in the low dose radiation effects and adaptive response • To dissect the roles of regulatory microRNAs and their targets in low dose radiation effects and adaptive response • To correlate the levels of epigenetic changes with genetic rearrangement levels and gene expression patterns. In sum, we determined the precise global and locus-specific DNA methylation patterns in the LDR-exposed cells and tissues of mice, and to correlated DNA methylation changes with the gene expression patterns and manifestations of genome instability. We also determined the alterations of global histone modification pattern in the LDR exposed tissues. Additionally, we established the nature of microRNAome changes in the LDR exposed tissue. In this study we for the first time found that LDR exposure caused profound tissue-specific epigenetic changes in the exposed tissues. We established that LDR exposure affect methylation of repetitive elements in the murine genome, causes changes in histone methylation, acetylation and phosphorylation. Importantly, we found that LDR causes profound and persistent effects on small RNA profiles and gene expression, and that miRNAs are excellent biomarkers of LDR exposure. Furthermore, we extended our analysis and studied LDR effects in rat tissues and human tissues and cell lines. There we also analyzed LDR-induced gene expression, DNA methylation and miRNA changes. Our datasets laid foundation for several new research projects aimed to understand molecular underpinnings of low dose radiation responses, and biological repercussions of low dose radiation effects and radiation carcinogenesis.« less

  5. Mavericks, a novel class of giant transposable elements widespread in eukaryotes and related to DNA viruses.

    PubMed

    Pritham, Ellen J; Putliwala, Tasneem; Feschotte, Cédric

    2007-04-01

    We previously identified a group of atypical mobile elements designated Mavericks from the nematodes Caenorhabditis elegans and C. briggsae and the zebrafish Danio rerio. Here we present the results of comprehensive database searches of the genome sequences available, which reveal that Mavericks are widespread in invertebrates and non-mammalian vertebrates but show a patchy distribution in non-animal species, being present in the fungi Glomus intraradices and Phakopsora pachyrhizi and in several single-celled eukaryotes such as the ciliate Tetrahymena thermophila, the stramenopile Phytophthora infestans and the trichomonad Trichomonas vaginalis, but not detectable in plants. This distribution, together with comparative and phylogenetic analyses of Maverick-encoded proteins, is suggestive of an ancient origin of these elements in eukaryotes followed by lineage-specific losses and/or recurrent episodes of horizontal transmission. In addition, we report that Maverick elements have amplified recently to high copy numbers in T. vaginalis where they now occupy as much as 30% of the genome. Sequence analysis confirms that most Mavericks encode a retroviral-like integrase, but lack other open reading frames typically found in retroelements. Nevertheless, the length and conservation of the target site duplication created upon Maverick insertion (5- or 6-bp) is consistent with a role of the integrase-like protein in the integration of a double-stranded DNA transposition intermediate. Mavericks also display long terminal-inverted repeats but do not contain ORFs similar to proteins encoded by DNA transposons. Instead, Mavericks encode a conserved set of 5 to 9 genes (in addition to the integrase) that are predicted to encode proteins with homology to replication and packaging proteins of some bacteriophages and diverse eukaryotic double-stranded DNA viruses, including a DNA polymerase B homolog and putative capsid proteins. Based on these and other structural similarities, we speculate that Mavericks represent an evolutionary missing link between seemingly disparate invasive DNA elements that include bacteriophages, adenoviruses and eukaryotic linear plasmids.

  6. The molecular basis of conformational instability of the ecdysone receptor DNA binding domain studied by in silico and in vitro experiments.

    PubMed

    Szamborska-Gbur, Agnieszka; Rymarczyk, Grzegorz; Orłowski, Marek; Kuzynowski, Tomasz; Jakób, Michał; Dziedzic-Letka, Agnieszka; Górecki, Andrzej; Dobryszycki, Piotr; Ożyhar, Andrzej

    2014-01-01

    The heterodimer of the ecdysone receptor (EcR) and ultraspiracle (Usp), members of the nuclear receptors superfamily, regulates gene expression associated with molting and metamorphosis in insects. The DNA binding domains (DBDs) of the Usp and EcR play an important role in their DNA-dependent heterodimerization. Analysis of the crystal structure of the UspDBD/EcRDBD heterocomplex from Drosophila melanogaster on the hsp27 gene response element, suggested an appreciable similarity between both DBDs. However, the chemical denaturation experiments showed a categorically lower stability for the EcRDBD in contrast to the UspDBD. The aim of our study was an elucidation of the molecular basis of this intriguing instability. Toward this end, we mapped the EcRDBD amino acid sequence positions which have an impact on the stability of the EcRDBD. The computational protein design and in vitro analyses of the EcRDBD mutants indicate that non-conserved residues within the α-helix 2, forming the EcRDBD hydrophobic core, represent a specific structural element that contributes to instability. In particular, the L58 appears to be a key residue which differentiates the hydrophobic cores of UspDBD and EcRDBD and is the main reason for the low stability of the EcRDBD. Our results might serve as a benchmark for further studies of the intricate nature of the EcR molecule.

  7. Biocompatible hydrogel membranes for the protection of RNA aptamer-based electrochemical sensors

    NASA Astrophysics Data System (ADS)

    Schoukroun-Barnes, Lauren R.; Wagan, Samiullah; Liu, Juan; Leach, Jennie B.; White, Ryan J.

    2013-05-01

    Electrochemical-aptamer based (E-AB) sensors represent a universal specific, selective, and sensitive sensing platform for the detection of small molecule targets. Their specific detection abilities are afforded by oligonucleotide (RNA or DNA) aptamers employed as electrode-bound biorecognition elements. Sensor signaling is predicated on bindinginduced changes in conformation and/or flexibility of the aptamer that is readily measurable electrochemically. While sensors fabricated using DNA aptamers can achieve specific and selective detection even in unadulterated sample matrices, such as blood serum, RNA-based sensors fail when challenged in the same sample matrix without significant sample pretreatment. This failure is at least partially a result of enzymatic degradation of the RNA sensing element. This degradation destroys the sensing aptamer inhibiting the quantitative measurement of the target analyte and thus limits the application of E-AB sensors constructed with RNA aptamer. To circumvent this, we demonstrate that a biocompatible hydrogel membrane protects the RNA aptamer sensor surface from enzymatic degradation for at least 3 hours - a remarkable improvement over the rapid (~minutes) degradation of unprotected sensors. To demonstrate this, we characterize the response of sensors fabricated with representative DNA and RNA aptamers directed against the aminoglycoside antibiotic, tobramycin in blood serum both protected and unprotected by a polyacrylamide membrane. Furthermore, we find encapsulation of the sensor surface with the hydrogel does not significantly impede the detection ability of aptamer-based sensors. This hydrogel-aptamer interface will thus likely prove useful for the long-term monitoring of therapeutics in complex biological media.

  8. Control of DEMETER DNA demethylase gene transcription in male and female gamete companion cells in Arabidopsis thaliana

    PubMed Central

    Park, Jin-Sup; Frost, Jennifer M.; Park, Kyunghyuk; Ohr, Hyonhwa; Park, Guen Tae; Kim, Seohyun; Eom, Hyunjoo; Lee, Ilha; Brooks, Janie S.; Fischer, Robert L.; Choi, Yeonhee

    2017-01-01

    The DEMETER (DME) DNA glycosylase initiates active DNA demethylation via the base-excision repair pathway and is vital for reproduction in Arabidopsis thaliana. DME-mediated DNA demethylation is preferentially targeted to small, AT-rich, and nucleosome-depleted euchromatic transposable elements, influencing expression of adjacent genes and leading to imprinting in the endosperm. In the female gametophyte, DME expression and subsequent genome-wide DNA demethylation are confined to the companion cell of the egg, the central cell. Here, we show that, in the male gametophyte, DME expression is limited to the companion cell of sperm, the vegetative cell, and to a narrow window of time: immediately after separation of the companion cell lineage from the germline. We define transcriptional regulatory elements of DME using reporter genes, showing that a small region, which surprisingly lies within the DME gene, controls its expression in male and female companion cells. DME expression from this minimal promoter is sufficient to rescue seed abortion and the aberrant DNA methylome associated with the null dme-2 mutation. Within this minimal promoter, we found short, conserved enhancer sequences necessary for the transcriptional activities of DME and combined predicted binding motifs with published transcription factor binding coordinates to produce a list of candidate upstream pathway members in the genetic circuitry controlling DNA demethylation in gamete companion cells. These data show how DNA demethylation is regulated to facilitate endosperm gene imprinting and potential transgenerational epigenetic regulation, without subjecting the germline to potentially deleterious transposable element demethylation. PMID:28130550

  9. A methodology to annotate systems biology markup language models with the synthetic biology open language.

    PubMed

    Roehner, Nicholas; Myers, Chris J

    2014-02-21

    Recently, we have begun to witness the potential of synthetic biology, noted here in the form of bacteria and yeast that have been genetically engineered to produce biofuels, manufacture drug precursors, and even invade tumor cells. The success of these projects, however, has often failed in translation and application to new projects, a problem exacerbated by a lack of engineering standards that combine descriptions of the structure and function of DNA. To address this need, this paper describes a methodology to connect the systems biology markup language (SBML) to the synthetic biology open language (SBOL), existing standards that describe biochemical models and DNA components, respectively. Our methodology involves first annotating SBML model elements such as species and reactions with SBOL DNA components. A graph is then constructed from the model, with vertices corresponding to elements within the model and edges corresponding to the cause-and-effect relationships between these elements. Lastly, the graph is traversed to assemble the annotating DNA components into a composite DNA component, which is used to annotate the model itself and can be referenced by other composite models and DNA components. In this way, our methodology can be used to build up a hierarchical library of models annotated with DNA components. Such a library is a useful input to any future genetic technology mapping algorithm that would automate the process of composing DNA components to satisfy a behavioral specification. Our methodology for SBML-to-SBOL annotation is implemented in the latest version of our genetic design automation (GDA) software tool, iBioSim.

  10. Determination of the Optimal Chromosomal Location(s) for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach.

    PubMed

    Frimodt-Møller, Jakob; Charbon, Godefroid; Krogfelt, Karen A; Løbner-Olesen, Anders

    2017-09-11

    The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In bacteria, the impact of the genetic context on the function of a genetic element can be difficult to assess. Several mechanisms, including topological effects, transcriptional interference from neighboring genes, and/or replication-associated gene dosage, may affect the function of a given genetic element. Here, we describe a method that permits the random integration of a DNA element into the chromosome of Escherichia coli and select the most favorable locations using a simple growth competition experiment. The method takes advantage of a well-described transposon-based system of random insertion, coupled with a selection of the fittest clone(s) by growth advantage, a procedure that is easily adjustable to experimental needs. The nature of the fittest clone(s) can be determined by whole-genome sequencing on a complex multi-clonal population or by easy gene walking for the rapid identification of selected clones. Here, the non-coding DNA region DARS2, which controls the initiation of chromosome replication in E. coli, was used as an example. The function of DARS2 is known to be affected by replication-associated gene dosage; the closer DARS2 gets to the origin of DNA replication, the more active it becomes. DARS2 was randomly inserted into the chromosome of a DARS2-deleted strain. The resultant clones containing individual insertions were pooled and competed against one another for hundreds of generations. Finally, the fittest clones were characterized and found to contain DARS2 inserted in close proximity to the original DARS2 location.

  11. Evolution of double-stranded DNA viruses of eukaryotes: from bacteriophages to transposons to giant viruses

    PubMed Central

    Koonin, Eugene V; Krupovic, Mart; Yutin, Natalya

    2015-01-01

    Diverse eukaryotes including animals and protists are hosts to a broad variety of viruses with double-stranded (ds) DNA genomes, from the largest known viruses, such as pandoraviruses and mimiviruses, to tiny polyomaviruses. Recent comparative genomic analyses have revealed many evolutionary connections between dsDNA viruses of eukaryotes, bacteriophages, transposable elements, and linear DNA plasmids. These findings provide an evolutionary scenario that derives several major groups of eukaryotic dsDNA viruses, including the proposed order “Megavirales,” adenoviruses, and virophages from a group of large virus-like transposons known as Polintons (Mavericks). The Polintons have been recently shown to encode two capsid proteins, suggesting that these elements lead a dual lifestyle with both a transposon and a viral phase and should perhaps more appropriately be named polintoviruses. Here, we describe the recently identified evolutionary relationships between bacteriophages of the family Tectiviridae, polintoviruses, adenoviruses, virophages, large and giant DNA viruses of eukaryotes of the proposed order “Megavirales,” and linear mitochondrial and cytoplasmic plasmids. We outline an evolutionary scenario under which the polintoviruses were the first group of eukaryotic dsDNA viruses that evolved from bacteriophages and became the ancestors of most large DNA viruses of eukaryotes and a variety of other selfish elements. Distinct lines of origin are detectable only for herpesviruses (from a different bacteriophage root) and polyoma/papillomaviruses (from single-stranded DNA viruses and ultimately from plasmids). Phylogenomic analysis of giant viruses provides compelling evidence of their independent origins from smaller members of the putative order “Megavirales,” refuting the speculations on the evolution of these viruses from an extinct fourth domain of cellular life. PMID:25727355

  12. Unrepaired DNA damage in macrophages causes elevation of particulate matter- induced airway inflammatory response.

    PubMed

    Luo, Man; Bao, Zhengqiang; Xu, Feng; Wang, Xiaohui; Li, Fei; Li, Wen; Chen, Zhihua; Ying, Songmin; Shen, Huahao

    2018-04-14

    The inflammatory cascade can be initiated with the recognition of damaged DNA. Macrophages play an essential role in particulate matter (PM)-induced airway inflammation. In this study, we aim to explore the PM induced DNA damage response of macrophages and its function in airway inflammation. The DNA damage response and inflammatory response were assessed using bone marrow-derived macrophages following PM treatment and mouse model instilled intratracheally with PM. We found that PM induced significant DNA damage both in vitro and in vivo and simultaneously triggered a rapid DNA damage response, represented by nuclear RPA, 53BP1 and γH2AX foci formation. Genetic ablation or chemical inhibition of the DNA damage response sensor amplified the production of cytokines including Cxcl1, Cxcl2 and Ifn-γ after PM stimulation in bone marrow-derived macrophages. Similar to that seen in vitro , mice with myeloid-specific deletion of RAD50 showed higher levels of airway inflammation in response to the PM challenge, suggesting a protective role of DNA damage sensor during inflammation. These data demonstrate that PM exposure induces DNA damage and activation of DNA damage response sensor MRN complex in macrophages. Disruption of MRN complex lead to persistent, unrepaired DNA damage that causes elevated inflammatory response.

  13. Cellular responses to environmental DNA damage

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    This volume contains the proceedings of the conference entitled Cellular Responses to Environmental DNA Damage held in Banff,Alberta December 1--6, 1991. The conference addresses various aspects of DNA repair in sessions titled DNA repair; Basic Mechanisms; Lesions; Systems; Inducible Responses; Mutagenesis; Human Population Response Heterogeneity; Intragenomic DNA Repair Heterogeneity; DNA Repair Gene Cloning; Aging; Human Genetic Disease; and Carcinogenesis. Individual papers are represented as abstracts of about one page in length.

  14. A User's Guide to the Encyclopedia of DNA Elements (ENCODE)

    PubMed Central

    2011-01-01

    The mission of the Encyclopedia of DNA Elements (ENCODE) Project is to enable the scientific and medical communities to interpret the human genome sequence and apply it to understand human biology and improve health. The ENCODE Consortium is integrating multiple technologies and approaches in a collective effort to discover and define the functional elements encoded in the human genome, including genes, transcripts, and transcriptional regulatory regions, together with their attendant chromatin states and DNA methylation patterns. In the process, standards to ensure high-quality data have been implemented, and novel algorithms have been developed to facilitate analysis. Data and derived results are made available through a freely accessible database. Here we provide an overview of the project and the resources it is generating and illustrate the application of ENCODE data to interpret the human genome. PMID:21526222

  15. In vivo and in vitro characterization of σ70 constitutive promoters by real-time PCR and fluorescent measurements.

    PubMed

    Chappell, James; Freemont, Paul

    2013-01-01

    The characterization of DNA regulatory elements such as ribosome binding sites and transcriptional promoters is a fundamental aim of synthetic biology. Characterization of such DNA regulatory elements by monitoring the synthesis of fluorescent proteins is a commonly used technique to resolve the relative or absolute strengths. These measurements can be used in combination with mathematical models and computer simulation to rapidly assess performance of DNA regulatory elements both in isolation and in combination, to assist predictable and efficient engineering of complex novel biological devices and systems. Here we describe the construction and relative characterization of Escherichia coli (E. coli) σ(70) transcriptional promoters by monitoring the synthesis of green fluorescent protein (GFP) both in vivo in E. coli and in vitro in a E. coli cell-free transcription and translation reaction.

  16. Genome-wide DNA methylation patterns in LSH mutant reveals de-repression of repeat elements and redundant epigenetic silencing pathways

    PubMed Central

    Yu, Weishi; McIntosh, Carl; Lister, Ryan; Zhu, Iris; Han, Yixing; Ren, Jianke; Landsman, David; Lee, Eunice; Briones, Victorino; Terashima, Minoru; Leighty, Robert; Ecker, Joseph R.

    2014-01-01

    Cytosine methylation is critical in mammalian development and plays a role in diverse biologic processes such as genomic imprinting, X chromosome inactivation, and silencing of repeat elements. Several factors regulate DNA methylation in early embryogenesis, but their precise role in the establishment of DNA methylation at a given site remains unclear. We have generated a comprehensive methylation map in fibroblasts derived from the murine DNA methylation mutant Hells−/− (helicase, lymphoid specific, also known as LSH). It has been previously shown that HELLS can influence de novo methylation of retroviral sequences and endogenous genes. Here, we describe that HELLS controls cytosine methylation in a nuclear compartment that is in part defined by lamin B1 attachment regions. Despite widespread loss of cytosine methylation at regulatory sequences, including promoter regions of protein-coding genes and noncoding RNA genes, overall relative transcript abundance levels in the absence of HELLS are similar to those in wild-type cells. A subset of promoter regions shows increases of the histone modification H3K27me3, suggesting redundancy of epigenetic silencing mechanisms. Furthermore, HELLS modulates CG methylation at all classes of repeat elements and is critical for repression of a subset of repeat elements. Overall, we provide a detailed analysis of gene expression changes in relation to DNA methylation alterations, which contributes to our understanding of the biological role of cytosine methylation. PMID:25170028

  17. Thrombopoietin protects hematopoietic stem cells from retrotransposon-mediated damage by promoting an antiviral response.

    PubMed

    Barbieri, Daniela; Elvira-Matelot, Emilie; Pelinski, Yanis; Genève, Laetitia; de Laval, Bérengère; Yogarajah, Gayathri; Pecquet, Christian; Constantinescu, Stefan N; Porteu, Françoise

    2018-05-07

    Maintenance of genomic integrity is crucial for the preservation of hematopoietic stem cell (HSC) potential. Retrotransposons, spreading in the genome through an RNA intermediate, have been associated with loss of self-renewal, aging, and DNA damage. However, their role in HSCs has not been addressed. Here, we show that mouse HSCs express various retroelements (REs), including long interspersed element-1 (L1) recent family members that further increase upon irradiation. Using mice expressing an engineered human L1 retrotransposition reporter cassette and reverse transcription inhibitors, we demonstrate that L1 retransposition occurs in vivo and is involved in irradiation-induced persistent γH2AX foci and HSC loss of function. Thus, RE represents an important intrinsic HSC threat. Furthermore, we show that RE activity is restrained by thrombopoietin, a critical HSC maintenance factor, through its ability to promote a potent interferon-like, antiviral gene response in HSCs. This uncovers a novel mechanism allowing HSCs to minimize irradiation-induced injury and reinforces the links between DNA damage, REs, and antiviral immunity. © 2018 Barbieri et al.

  18. Flow cytometry sorting of nuclei enables the first global characterization of Paramecium germline DNA and transposable elements.

    PubMed

    Guérin, Frédéric; Arnaiz, Olivier; Boggetto, Nicole; Denby Wilkes, Cyril; Meyer, Eric; Sperling, Linda; Duharcourt, Sandra

    2017-04-26

    DNA elimination is developmentally programmed in a wide variety of eukaryotes, including unicellular ciliates, and leads to the generation of distinct germline and somatic genomes. The ciliate Paramecium tetraurelia harbors two types of nuclei with different functions and genome structures. The transcriptionally inactive micronucleus contains the complete germline genome, while the somatic macronucleus contains a reduced genome streamlined for gene expression. During development of the somatic macronucleus, the germline genome undergoes massive and reproducible DNA elimination events. Availability of both the somatic and germline genomes is essential to examine the genome changes that occur during programmed DNA elimination and ultimately decipher the mechanisms underlying the specific removal of germline-limited sequences. We developed a novel experimental approach that uses flow cell imaging and flow cytometry to sort subpopulations of nuclei to high purity. We sorted vegetative micronuclei and macronuclei during development of P. tetraurelia. We validated the method by flow cell imaging and by high throughput DNA sequencing. Our work establishes the proof of principle that developing somatic macronuclei can be sorted from a complex biological sample to high purity based on their size, shape and DNA content. This method enabled us to sequence, for the first time, the germline DNA from pure micronuclei and to identify novel transposable elements. Sequencing the germline DNA confirms that the Pgm domesticated transposase is required for the excision of all ~45,000 Internal Eliminated Sequences. Comparison of the germline DNA and unrearranged DNA obtained from PGM-silenced cells reveals that the latter does not provide a faithful representation of the germline genome. We developed a flow cytometry-based method to purify P. tetraurelia nuclei to high purity and provided quality control with flow cell imaging and high throughput DNA sequencing. We identified 61 germline transposable elements including the first Paramecium retrotransposons. This approach paves the way to sequence the germline genomes of P. aurelia sibling species for future comparative genomic studies.

  19. Cloning and functional analysis of 5'-upstream region of the Pokemon gene.

    PubMed

    Yang, Yutao; Zhou, Xiaowei; Zhu, Xudong; Zhang, Chuanfu; Yang, Zhixin; Xu, Long; Huang, Peitang

    2008-04-01

    Pokemon, the POK erythroid myeloid ontogenic factor, not only regulates the expression of many genes, but also plays an important role in cell tumorigenesis. To investigate the molecular mechanism regulating expression of the Pokemon gene in humans, its 5'-upstream region was cloned and analyzed. Transient analysis revealed that the Pokemon promoter is constitutive. Deletion analysis and a DNA decoy assay indicated that the NEG-U and NEG-D elements were involved in negative regulation of the Pokemon promoter, whereas the POS-D element was mainly responsible for its strong activity. Electrophoretic mobility shift assays suggested that the NEG-U, NEG-D and POS-D elements were specifically bound by the nuclear extract from A549 cells in vitro. Mutation analysis demonstrated that cooperation of the NEG-U and NEG-D elements led to negative regulation of the Pokemon promoter. Moreover, the NEG-U and NEG-D elements needed to be an appropriate distance apart in the Pokemon promoter in order to cooperate. Taken together, our results elucidate the mechanism underlying the regulation of Pokemon gene transcription, and also define a novel regulatory sequence that may be used to decrease expression of the Pokemon gene in cancer gene therapy.

  20. The STAT3 HIES mutation is a gain-of-function mutation that activates genes via AGG-element carrying promoters.

    PubMed

    Xu, Li; Ji, Jin-Jun; Le, Wangping; Xu, Yan S; Dou, Dandan; Pan, Jieli; Jiao, Yifeng; Zhong, Tianfei; Wu, Dehong; Wang, Yumei; Wen, Chengping; Xie, Guan-Qun; Yao, Feng; Zhao, Heng; Fan, Yong-Sheng; Chin, Y Eugene

    2015-10-15

    Cytokine or growth factor activated STAT3 undergoes multiple post-translational modifications, dimerization and translocation into nuclei, where it binds to serum-inducible element (SIE, 'TTC(N3)GAA')-bearing promoters to activate transcription. The STAT3 DNA binding domain (DBD, 320-494) mutation in hyper immunoglobulin E syndrome (HIES), called the HIES mutation (R382Q, R382W or V463Δ), which elevates IgE synthesis, inhibits SIE binding activity and sensitizes genes such as TNF-α for expression. However, the mechanism by which the HIES mutation sensitizes STAT3 in gene induction remains elusive. Here, we report that STAT3 binds directly to the AGG-element with the consensus sequence 'AGG(N3)AGG'. Surprisingly, the helical N-terminal region (1-355), rather than the canonical STAT3 DBD, is responsible for AGG-element binding. The HIES mutation markedly enhances STAT3 AGG-element binding and AGG-promoter activation activity. Thus, STAT3 is a dual specificity transcription factor that promotes gene expression not only via SIE- but also AGG-promoter activity. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Binding and thermodynamics of REV peptide-ctDNA interaction.

    PubMed

    Upadhyay, Santosh Kumar

    2017-03-01

    The thermodynamics of DNA-ligand binding is important as it provides useful information to understand the details of binding processes. HIV-1 REV response element (RRE) located in the env coding region of the viral genome is reported to be well conserved across different HIV-1 isolates. In this study, the binding characteristics of Calf thymus DNA (ctDNA) and REV peptide from HIV-1 were investigated using spectroscopic (UV-visible, fluorescence, and circular dichroism (CD)) and isothermal titration calorimetric (ITC) techniques. Thermal stability and ligand binding properties of the ctDNA revealed that native ctDNA had a T m of 75.5 °C, whereas the ctDNA-REV peptide complex exhibited an incremental shift in the T m by 8 °C, indicating thermal stability of the complex. CD data indicated increased ellipticity due to large conformational changes in ctDNA molecule upon binding with REV peptide and two binding stoichiometric modes are apparent. The ctDNA experienced condensation due to large conformational changes in the presence of REV peptide and positive B→Ψ transition was observed at higher molar charge ratios. Fluorescence studies performed at several ligand concentrations revealed a gradual decrease in the fluorescence intensity of EtBr-bound ctDNA in response to increasing ligand concentrations. The fluorescence data further confirmed two stoichiometric modes of binding for ctDNA-REV peptide complex as previously observed with CD studies. The binding enthalpies were determined using ITC in the temperature range of 293 K-308 K. The ITC binding isotherm was exothermic at all temperatures examined, with low ΔH values indicating that the ctDNA-REV peptide interaction is driven largely by entropy. The heat capacity change (ΔC p ) was insignificant, an unusual finding in the area of DNA-peptide interaction studies. The variation in the values obtained for ΔH, ΔS, and ΔG with temperature further suggests that ctDNA-REV peptide interaction is entropically driven. ITC based analysis of salt dependence of binding constant gave a charge value (Z) = +4.01, as determined for the δlnK/δln[Na + ] parameter, suggesting the participation of only 3-4 Arg out of 11 Arg charge from REV peptide. The stoichiometry observed for the complex was three molar charge of REV peptide binding per molar charge of ctDNA. ITC based analysis further confirmed that the binding between ctDNA and REV peptide is governed by electrostatic interaction. Molecular interactions including H-bonding, van der Waals forces, and solvent molecules rearrangement, underlie the binding of REV peptide to ctDNA. © 2016 Wiley Periodicals, Inc.

  2. Destabilization of the MutSα’s protein-protein interface due to binding to the DNA adduct induced by anticancer agent Carboplatin via molecular dynamics simulations

    PubMed Central

    Negureanu, Lacramioara; Salsbury, Freddie R

    2013-01-01

    DNA mismatch repair (MMR) proteins maintain genetic integrity in all organisms by recognizing and repairing DNA errors. Such alteration of hereditary information can lead to various diseases, including cancer. Besides their role in DNA repair, MMR proteins detect and initiate cellular responses to certain type of DNA damage. Its response to the damaged DNA has made the human MMR pathway a useful target for anticancer agents such as carboplatin. This study indicates that strong, specific interactions at the interface of MutSα in response to the mismatched DNA recognition are replaced by weak, non-specific interactions in response to the damaged DNA recognition. Data suggest a severe impairment of the dimerization of MutSα in response to the damaged DNA recognition. While the core of MutSα is preserved in response to the damaged DNA recognition, the loss of contact surface and the rearrangement of contacts at the protein interface suggest a different packing in response to the damaged DNA recognition. Coupled in response to the mismatched DNA recognition, interaction energies, hydrogen bonds, salt bridges, and solvent accessible surface areas at the interface of MutSα and within the subunits are uncoupled or asynchronously coupled in response to the damaged DNA recognition. These pieces of evidence suggest that the loss of a synchronous mode of response in the MutSα’s surveillance for DNA errors would possible be one of the mechanism(s) of signaling the MMR-dependent programed cell death much wanted in anticancer therapies. The analysis was drawn from dynamics simulations. PMID:24061854

  3. Identification of transactivation-responsive DNA-binding protein 43 (TARDBP43; TDP-43) as a novel factor for TNF-α expression upon lipopolysaccharide stimulation in human monocytes.

    PubMed

    Murata, H; Hattori, T; Maeda, H; Takashiba, S; Takigawa, M; Kido, J; Nagata, T

    2015-08-01

    Tumor necrosis factor alpha (TNF-α) is a major cytokine implicated in various inflammatory diseases. The nature of the nuclear factors associated with human TNF-α gene regulation is not well elucidated. We previously identified a novel region located from -550 to -487 in human TNF-α promoter that did not contain the reported binding sites for nuclear factor kappa B (NF-κB) but showed lipopolysaccharide (LPS)-induced transcriptional activity. The purpose of this study is to identify novel factors that bind to the promoter region and regulate TNF-α expression. To identify DNA-binding proteins that bound to the target region of TNF-α promoter, a cDNA library from LPS-stimulated human monocytic cell line THP-1 was screened using a yeast one-hybrid system. Cellular localizations of the DNA-binding protein in the cells were examined by subcellular immunocytochemistry. Nuclear amounts of the protein in LPS-stimulated THP-1 cells were identified by western blot analysis. Expression of mRNA of the protein in the cells was quantified by real-time polymerase chain reaction. Electrophoretic mobility shift assays were performed to confirm the DNA-binding profile. Overexpression of the protein and knockdown of the gene were also performed to investigate the role for TNF-α expression. Several candidates were identified from the cDNA library and transactivation-responsive DNA-binding protein 43 (TARDBP43; TDP-43) was focused on. Western blot analysis revealed that nuclear TDP-43 protein was increased in the LPS-stimulated THP-1 cells. Expression of TDP-43 mRNA was already enhanced before TNF-α induction by LPS. Electrophoretic mobility shift assay analysis showed that nuclear extracts obtained by overexpressing FLAG-tagged TDP-43 bound to the -550 to -487 TNF-α promoter fragments. Overexpression of TDP-43 in THP-1 cells resulted in an increase of TNF-α expression. Knockdown of TDP-43 in THP-1 cells downregulated TNF-α expression. We identified TDP-43 as one of the novel TNF-α factors and found that it bound to the LPS-responsive element in the TNF-α promoter to increase TNF-α expression. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  4. Analysis of Chromatin Regulators Reveals Specific Features of Rice DNA Methylation Pathways.

    PubMed

    Tan, Feng; Zhou, Chao; Zhou, Qiangwei; Zhou, Shaoli; Yang, Wenjing; Zhao, Yu; Li, Guoliang; Zhou, Dao-Xiu

    2016-07-01

    Plant DNA methylation that occurs at CG, CHG, and CHH sites (H = A, C, or T) is a hallmark of the repression of repetitive sequences and transposable elements (TEs). The rice (Oryza sativa) genome contains about 40% repetitive sequence and TEs and displays specific patterns of genome-wide DNA methylation. The mechanism responsible for the specific methylation patterns is unclear. Here, we analyzed the function of OsDDM1 (Deficient in DNA Methylation 1) and OsDRM2 (Deficient in DNA Methylation 1) in genome-wide DNA methylation, TE repression, small RNA accumulation, and gene expression. We show that OsDDM1 is essential for high levels of methylation at CHG and, to a lesser extent, CG sites in heterochromatic regions and also is required for CHH methylation that mainly locates in the genic regions of the genome. In addition to a large member of TEs, loss of OsDDM1 leads to hypomethylation and up-regulation of many protein-coding genes, producing very severe growth phenotypes at the initial generation. Importantly, we show that OsDRM2 mutation results in a nearly complete loss of CHH methylation and derepression of mainly small TE-associated genes and that OsDDM1 is involved in facilitating OsDRM2-mediated CHH methylation. Thus, the function of OsDDM1 and OsDRM2 defines distinct DNA methylation pathways in the bulk of DNA methylation of the genome, which is possibly related to the dispersed heterochromatin across chromosomes in rice and suggests that DNA methylation mechanisms may vary among different plant species. © 2016 American Society of Plant Biologists. All Rights Reserved.

  5. DNA is structured as a linear "jigsaw puzzle" in the genomes of Arabidopsis, rice, and budding yeast.

    PubMed

    Liu, Yun-Hua; Zhang, Meiping; Wu, Chengcang; Huang, James J; Zhang, Hong-Bin

    2014-01-01

    Knowledge of how a genome is structured and organized from its constituent elements is crucial to understanding its biology and evolution. Here, we report the genome structuring and organization pattern as revealed by systems analysis of the sequences of three model species, Arabidopsis, rice and yeast, at the whole-genome and chromosome levels. We found that all fundamental function elements (FFE) constituting the genomes, including genes (GEN), DNA transposable elements (DTE), retrotransposable elements (RTE), simple sequence repeats (SSR), and (or) low complexity repeats (LCR), are structured in a nonrandom and correlative manner, thus leading to a hypothesis that the DNA of the species is structured as a linear "jigsaw puzzle". Furthermore, we showed that different FFE differ in their importance in the formation and evolution of the DNA jigsaw puzzle structure between species. DTE and RTE play more important roles than GEN, LCR, and SSR in Arabidopsis, whereas GEN and RTE play more important roles than LCR, SSR, and DTE in rice. The genes having multiple recognized functions play more important roles than those having single functions. These results provide useful knowledge necessary for better understanding genome biology and evolution of the species and for effective molecular breeding of rice.

  6. [Genome-scale sequence data processing and epigenetic analysis of DNA methylation].

    PubMed

    Wang, Ting-Zhang; Shan, Gao; Xu, Jian-Hong; Xue, Qing-Zhong

    2013-06-01

    A new approach recently developed for detecting cytosine DNA methylation (mC) and analyzing the genome-scale DNA methylation profiling, is called BS-Seq which is based on bisulfite conversion of genomic DNA combined with next-generation sequencing. The method can not only provide an insight into the difference of genome-scale DNA methylation among different organisms, but also reveal the conservation of DNA methylation in all contexts and nucleotide preference for different genomic regions, including genes, exons, and repetitive DNA sequences. It will be helpful to under-stand the epigenetic impacts of cytosine DNA methylation on the regulation of gene expression and maintaining silence of repetitive sequences, such as transposable elements. In this paper, we introduce the preprocessing steps of DNA methylation data, by which cytosine (C) and guanine (G) in the reference sequence are transferred to thymine (T) and adenine (A), and cytosine in reads is transferred to thymine, respectively. We also comprehensively review the main content of the DNA methylation analysis on the genomic scale: (1) the cytosine methylation under the context of different sequences; (2) the distribution of genomic methylcytosine; (3) DNA methylation context and the preference for the nucleotides; (4) DNA- protein interaction sites of DNA methylation; (5) degree of methylation of cytosine in the different structural elements of genes. DNA methylation analysis technique provides a powerful tool for the epigenome study in human and other species, and genes and environment interaction, and founds the theoretical basis for further development of disease diagnostics and therapeutics in human.

  7. Cellular corepressor TLE2 inhibits replication-and-transcription- activator-mediated transactivation and lytic reactivation of Kaposi's sarcoma-associated herpesvirus.

    PubMed

    He, Zhiheng; Liu, Yunhua; Liang, Deguang; Wang, Zhuo; Robertson, Erle S; Lan, Ke

    2010-02-01

    Replication and transcription activator (RTA) encoded by open reading frame 50 (ORF50) of Kaposi's sarcoma-associated herpesvirus (KSHV) is essential and sufficient to initiate lytic reactivation. RTA activates its target genes through direct binding with high affinity to its responsive elements or by interaction with cellular factors, such as RBP-Jkappa, Ap-1, C/EBP-alpha, and Oct-1. In this study, we identified transducin-like enhancer of split 2 (TLE2) as a novel RTA binding protein by using yeast two-hybrid screening of a human spleen cDNA library. The interaction between TLE2 and RTA was confirmed by glutathione S-transferase (GST) binding and coimmunoprecipitation assays. Immunofluorescence analysis showed that TLE2 and RTA were colocalized in the same nuclear compartment in KSHV-infected cells. This interaction recruited TLE2 to RTA bound to its recognition sites on DNA and repressed RTA auto-activation and transactivation activity. Moreover, TLE2 also inhibited the induction of lytic replication and virion production driven by RTA. We further showed that the Q (Gln-rich), SP (Ser-Pro-rich), and WDR (Trp-Asp repeat) domains of TLE2 and the Pro-rich domain of RTA were essential for this interaction. RBP-Jkappa has been shown previously to bind to the same Pro-rich domain of RTA, and this binding can be subject to competition by TLE2. In addition, TLE2 can form a complex with RTA to access the cognate DNA sequence of the RTA-responsive element at different promoters. Intriguingly, the transcription level of TLE2 could be upregulated by RTA during the lytic reactivation process. In conclusion, we identified a new RTA binding protein, TLE2, and demonstrated that TLE2 inhibited replication and transactivation mediated by RTA. This provides another potentially important mechanism for maintenance of KSHV viral latency through interaction with a host protein.

  8. DNA topoisomerase 1α promotes transcriptional silencing of transposable elements through DNA methylation and histone lysine 9 dimethylation in Arabidopsis.

    PubMed

    Dinh, Thanh Theresa; Gao, Lei; Liu, Xigang; Li, Dongming; Li, Shengben; Zhao, Yuanyuan; O'Leary, Michael; Le, Brandon; Schmitz, Robert J; Manavella, Pablo A; Manavella, Pablo; Li, Shaofang; Weigel, Detlef; Pontes, Olga; Ecker, Joseph R; Chen, Xuemei

    2014-07-01

    RNA-directed DNA methylation (RdDM) and histone H3 lysine 9 dimethylation (H3K9me2) are related transcriptional silencing mechanisms that target transposable elements (TEs) and repeats to maintain genome stability in plants. RdDM is mediated by small and long noncoding RNAs produced by the plant-specific RNA polymerases Pol IV and Pol V, respectively. Through a chemical genetics screen with a luciferase-based DNA methylation reporter, LUCL, we found that camptothecin, a compound with anti-cancer properties that targets DNA topoisomerase 1α (TOP1α) was able to de-repress LUCL by reducing its DNA methylation and H3K9me2 levels. Further studies with Arabidopsis top1α mutants showed that TOP1α silences endogenous RdDM loci by facilitating the production of Pol V-dependent long non-coding RNAs, AGONAUTE4 recruitment and H3K9me2 deposition at TEs and repeats. This study assigned a new role in epigenetic silencing to an enzyme that affects DNA topology.

  9. Cryo-EM Structures Reveal Mechanism and Inhibition of DNA Targeting by a CRISPR-Cas Surveillance Complex.

    PubMed

    Guo, Tai Wei; Bartesaghi, Alberto; Yang, Hui; Falconieri, Veronica; Rao, Prashant; Merk, Alan; Eng, Edward T; Raczkowski, Ashleigh M; Fox, Tara; Earl, Lesley A; Patel, Dinshaw J; Subramaniam, Sriram

    2017-10-05

    Prokaryotic cells possess CRISPR-mediated adaptive immune systems that protect them from foreign genetic elements, such as invading viruses. A central element of this immune system is an RNA-guided surveillance complex capable of targeting non-self DNA or RNA for degradation in a sequence- and site-specific manner analogous to RNA interference. Although the complexes display considerable diversity in their composition and architecture, many basic mechanisms underlying target recognition and cleavage are highly conserved. Using cryoelectron microscopy (cryo-EM), we show that the binding of target double-stranded DNA (dsDNA) to a type I-F CRISPR system yersinia (Csy) surveillance complex leads to large quaternary and tertiary structural changes in the complex that are likely necessary in the pathway leading to target dsDNA degradation by a trans-acting helicase-nuclease. Comparison of the structure of the surveillance complex before and after dsDNA binding, or in complex with three virally encoded anti-CRISPR suppressors that inhibit dsDNA binding, reveals mechanistic details underlying target recognition and inhibition. Published by Elsevier Inc.

  10. Dead Element Replicating: Degenerate R2 Element Replication and rDNA Genomic Turnover in the Bacillus rossius Stick Insect (Insecta: Phasmida)

    PubMed Central

    Martoni, Francesco; Eickbush, Danna G.; Scavariello, Claudia; Luchetti, Andrea; Mantovani, Barbara

    2015-01-01

    R2 is an extensively investigated non-LTR retrotransposon that specifically inserts into the 28S rRNA gene sequences of a wide range of metazoans, disrupting its functionality. During R2 integration, first strand synthesis can be incomplete so that 5’ end deleted copies are occasionally inserted. While active R2 copies repopulate the locus by retrotransposing, the non-functional truncated elements should frequently be eliminated by molecular drive processes leading to the concerted evolution of the rDNA array(s). Although, multiple R2 lineages have been discovered in the genome of many animals, the rDNA of the stick insect Bacillus rossius exhibits a peculiar situation: it harbors both a canonical, functional R2 element (R2Brfun) as well as a full-length but degenerate element (R2Brdeg). An intensive sequencing survey in the present study reveals that all truncated variants in stick insects are present in multiple copies suggesting they were duplicated by unequal recombination. Sequencing results also demonstrate that all R2Brdeg copies are full-length, i. e. they have no associated 5' end deletions, and functional assays indicate they have lost the active ribozyme necessary for R2 RNA maturation. Although it cannot be completely ruled out, it seems unlikely that the degenerate elements replicate via reverse transcription, exploiting the R2Brfun element enzymatic machinery, but rather via genomic amplification of inserted 28S by unequal recombination. That inactive copies (both R2Brdeg or 5'-truncated elements) are not eliminated in a short term in stick insects contrasts with findings for the Drosophila R2, suggesting a widely different management of rDNA loci and a lower efficiency of the molecular drive while achieving the concerted evolution. PMID:25799008

  11. Development and validation of an integrated DNA walking strategy to detect GMO expressing cry genes.

    PubMed

    Fraiture, Marie-Alice; Vandamme, Julie; Herman, Philippe; Roosens, Nancy H C

    2018-06-27

    Recently, an integrated DNA walking strategy has been proposed to prove the presence of GMO via the characterisation of sequences of interest, including their transgene flanking regions and the unnatural associations of elements in their transgenic cassettes. To this end, the p35S, tNOS and t35S pCAMBIA elements have been selected as key targets, allowing the coverage of most of GMO, EU authorized or not. In the present study, a bidirectional DNA walking method anchored on the CryAb/c genes is proposed with the aim to cover additional GMO and additional sequences of interest. The performance of the proposed bidirectional DNA walking method anchored on the CryAb/c genes has been evaluated in a first time for its feasibility using several GM events possessing these CryAb/c genes. Afterwards, its sensitivity has been investigated through low concentrations of targets (as low as 20 HGE). In addition, to illustrate its applicability, the entire workflow has been tested on a sample mimicking food/feed matrices analysed in GMO routine analysis. Given the successful assessment of its performance, the present bidirectional DNA walking method anchored on the CryAb/c genes can easily be implemented in GMO routine analysis by the enforcement laboratories and allows completing the entire DNA walking strategy in targeting an additional transgenic element frequently found in GMO.

  12. Ectopic recombination between Ty elements in Saccharomyces cerevisiae is not induced by DNA damage.

    PubMed

    Parket, A; Kupiec, M

    1992-10-01

    Mitotic recombination is increased when cells are treated with a variety of physical and chemical agents that cause damage to their DNA. We show here, using Saccharomyces cerevisiae strains that carry marked Ty elements, that recombination between members of this family of retrotransposons is not increased by UV irradiation or by treatment with the radiomimetic drug methyl methanesulfonate. Both ectopic recombination and mutation events were elevated by these agents for non-Ty sequences in the same strain. We discuss possible mechanisms that can prevent the induction of recombination between Ty elements.

  13. DNA transposons have colonized the genome of the giant virus Pandoravirus salinus.

    PubMed

    Sun, Cheng; Feschotte, Cédric; Wu, Zhiqiang; Mueller, Rachel Lockridge

    2015-06-12

    Transposable elements are mobile DNA sequences that are widely distributed in prokaryotic and eukaryotic genomes, where they represent a major force in genome evolution. However, transposable elements have rarely been documented in viruses, and their contribution to viral genome evolution remains largely unexplored. Pandoraviruses are recently described DNA viruses with genome sizes that exceed those of some prokaryotes, rivaling parasitic eukaryotes. These large genomes appear to include substantial noncoding intergenic spaces, which provide potential locations for transposable element insertions. However, no mobile genetic elements have yet been reported in pandoravirus genomes. Here, we report a family of miniature inverted-repeat transposable elements (MITEs) in the Pandoravirus salinus genome, representing the first description of a virus populated with a canonical transposable element family that proliferated by transposition within the viral genome. The MITE family, which we name Submariner, includes 30 copies with all the hallmarks of MITEs: short length, terminal inverted repeats, TA target site duplication, and no coding capacity. Submariner elements show signs of transposition and are undetectable in the genome of Pandoravirus dulcis, the closest known relative Pandoravirus salinus. We identified a DNA transposon related to Submariner in the genome of Acanthamoeba castellanii, a species thought to host pandoraviruses, which contains remnants of coding sequence for a Tc1/mariner transposase. These observations suggest that the Submariner MITEs of P. salinus belong to the widespread Tc1/mariner superfamily and may have been mobilized by an amoebozoan host. Ten of the 30 MITEs in the P. salinus genome are located within coding regions of predicted genes, while others are close to genes, suggesting that these transposons may have contributed to viral genetic novelty. Our discovery highlights the remarkable ability of DNA transposons to colonize and shape genomes from all domains of life, as well as giant viruses. Our findings continue to blur the division between viral and cellular genomes, adhering to the emerging view that the content, dynamics, and evolution of the genomes of giant viruses do not substantially differ from those of cellular organisms.

  14. Overexpression of the OsIMP Gene Increases the Accumulation of Inositol and Confers Enhanced Cold Tolerance in Tobacco through Modulation of the Antioxidant Enzymes' Activities.

    PubMed

    Zhang, Rong-Xiang; Qin, Li-Jun; Zhao, De-Gang

    2017-07-20

    Inositol is a cyclic polyol that is involved in various physiological processes, including signal transduction and stress adaptation in plants. l- myo -inositol monophosphatase (IMPase) is one of the metal-dependent phosphatase family members and catalyzes the last reaction step of biosynthesis of inositol. Although increased IMPase activity induced by abiotic stress has been reported in chickpea plants, the role and regulation of the IMP gene in rice ( Oryza sativa L.) remains poorly understood. In the present work, we obtained a full-length cDNA sequence coding IMPase in the cold tolerant rice landraces in Gaogonggui, which is named as OsIMP . Multiple alignment results have displayed that this sequence has characteristic signature motifs and conserved enzyme active sites of the phosphatase super family. Phylogenetic analysis showed that IMPase is most closely related to that of the wild rice Oryza brachyantha , while transcript analysis revealed that the expression of the OsIMP is significantly induced by cold stress and exogenous abscisic acid (ABA) treatment. Meanwhile, we cloned the 5' flanking promoter sequence of the OsIMP gene and identified several important cis -acting elements, such as LTR (low-temperature responsiveness), TCA-element (salicylic acid responsiveness), ABRE-element (abscisic acid responsiveness), GARE-motif (gibberellin responsive), MBS (MYB Binding Site) and other cis -acting elements related to defense and stress responsiveness. To further investigate the potential function of the OsIMP gene, we generated transgenic tobacco plants overexpressing the OsIMP gene and the cold tolerance test indicated that these transgenic tobacco plants exhibit improved cold tolerance. Furthermore, transgenic tobacco plants have a lower level of hydrogen peroxide (H₂O₂) and malondialdehyde (MDA), and a higher content of total chlorophyll as well as increased antioxidant enzyme activities of superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD), when compared to wild type (WT) tobacco plants under normal and cold stress conditions.

  15. The site-specific ribosomal DNA insertion element R1Bm belongs to a class of non-long-terminal-repeat retrotransposons.

    PubMed Central

    Xiong, Y; Eickbush, T H

    1988-01-01

    Two types of insertion elements, R1 and R2 (previously called type I and type II), are known to interrupt the 28S ribosomal genes of several insect species. In the silkmoth, Bombyx mori, each element occupies approximately 10% of the estimated 240 ribosomal DNA units, while at most only a few copies are located outside the ribosomal DNA units. We present here the complete nucleotide sequence of an R1 insertion from B. mori (R1Bm). This 5.1-kilobase element contains two overlapping open reading frames (ORFs) which together occupy 88% of its length. ORF1 is 461 amino acids in length and exhibits characteristics of retroviral gag genes. ORF2 is 1,051 amino acids in length and contains homology to reverse transcriptase-like enzymes. The analysis of 3' and 5' ends of independent isolates from the ribosomal locus supports the suggestion that R1 is still functioning as a transposable element. The precise location of the element within the genome implies that its transposition must occur with remarkable insertion sequence specificity. Comparison of the deduced amino acid sequences from six retrotransposons, R1 and R2 of B. mori, I factor and F element of Drosophila melanogaster, L1 of Mus domesticus, and Ingi of Trypanosoma brucei, reveals a relatively high level of sequence homology in the reverse transcriptase region. Like R1, these elements lack long terminal repeats. We have therefore named this class of related elements the non-long-terminal-repeat (non-LTR) retrotransposons. Images PMID:2447482

  16. Flavonoids and DNA Repair in Prostate Cancer

    DTIC Science & Technology

    2005-12-01

    1-0114 TITLE: Flavonoids and DNA Repair in Prostate Cancer...SUBTITLE Flavonoids and DNA Repair in Prostate Cancer 5a. CONTRACT NUMBER 5b. GRANT NUMBER W81XWH-04-1-0114 5c. PROGRAM ELEMENT NUMBER...test the hypothesis that natural products such as flavonoids are able to stimulate the repair of oxidative DNA damage. For this purpose LNCaP

  17. AP1 Keeps Chromatin Poised for Action | Center for Cancer Research

    Cancer.gov

    The human genome harbors gene-encoding DNA, the blueprint for building proteins that regulate cellular function. Embedded across the genome, in non-coding regions, are DNA elements to which regulatory factors bind. The interaction of regulatory factors with DNA at these sites modifies gene expression to modulate cell activity. In cells, DNA exists in a complex with proteins

  18. Identification of multiple binding sites for the THAP domain of the Galileo transposase in the long terminal inverted-repeats☆

    PubMed Central

    Marzo, Mar; Liu, Danxu; Ruiz, Alfredo; Chalmers, Ronald

    2013-01-01

    Galileo is a DNA transposon responsible for the generation of several chromosomal inversions in Drosophila. In contrast to other members of the P-element superfamily, it has unusually long terminal inverted-repeats (TIRs) that resemble those of Foldback elements. To investigate the function of the long TIRs we derived consensus and ancestral sequences for the Galileo transposase in three species of Drosophilids. Following gene synthesis, we expressed and purified their constituent THAP domains and tested their binding activity towards the respective Galileo TIRs. DNase I footprinting located the most proximal DNA binding site about 70 bp from the transposon end. Using this sequence we identified further binding sites in the tandem repeats that are found within the long TIRs. This suggests that the synaptic complex between Galileo ends may be a complicated structure containing higher-order multimers of the transposase. We also attempted to reconstitute Galileo transposition in Drosophila embryos but no events were detected. Thus, although the limited numbers of Galileo copies in each genome were sufficient to provide functional consensus sequences for the THAP domains, they do not specify a fully active transposase. Since the THAP recognition sequence is short, and will occur many times in a large genome, it seems likely that the multiple binding sites within the long, internally repetitive, TIRs of Galileo and other Foldback-like elements may provide the transposase with its binding specificity. PMID:23648487

  19. Identification of multiple binding sites for the THAP domain of the Galileo transposase in the long terminal inverted-repeats.

    PubMed

    Marzo, Mar; Liu, Danxu; Ruiz, Alfredo; Chalmers, Ronald

    2013-08-01

    Galileo is a DNA transposon responsible for the generation of several chromosomal inversions in Drosophila. In contrast to other members of the P-element superfamily, it has unusually long terminal inverted-repeats (TIRs) that resemble those of Foldback elements. To investigate the function of the long TIRs we derived consensus and ancestral sequences for the Galileo transposase in three species of Drosophilids. Following gene synthesis, we expressed and purified their constituent THAP domains and tested their binding activity towards the respective Galileo TIRs. DNase I footprinting located the most proximal DNA binding site about 70 bp from the transposon end. Using this sequence we identified further binding sites in the tandem repeats that are found within the long TIRs. This suggests that the synaptic complex between Galileo ends may be a complicated structure containing higher-order multimers of the transposase. We also attempted to reconstitute Galileo transposition in Drosophila embryos but no events were detected. Thus, although the limited numbers of Galileo copies in each genome were sufficient to provide functional consensus sequences for the THAP domains, they do not specify a fully active transposase. Since the THAP recognition sequence is short, and will occur many times in a large genome, it seems likely that the multiple binding sites within the long, internally repetitive, TIRs of Galileo and other Foldback-like elements may provide the transposase with its binding specificity. Copyright © 2013 The Authors. Published by Elsevier B.V. All rights reserved.

  20. Spaceflight induces both transient and heritable alterations in DNA methylation and gene expression in rice (Oryza sativa L.).

    PubMed

    Ou, Xiufang; Long, Likun; Zhang, Yunhong; Xue, Yiqun; Liu, Jingchun; Lin, Xiuyun; Liu, Bao

    2009-03-09

    Spaceflight represents a complex environmental condition in which several interacting factors such as cosmic radiation, microgravity and space magnetic fields are involved, which may provoke stress responses and jeopardize genome integrity. Given the inherent property of epigenetic modifications to respond to intrinsic as well as external perturbations, it is conceivable that epigenetic markers like DNA methylation may undergo alterations in response to spaceflight. We report here that extensive alteration in both DNA methylation and gene expression occurred in rice plants subjected to a spaceflight, as revealed by a set of characterized sequences including 6 transposable elements (TEs) and 11 cellular genes. We found that several features characterize the alterations: (1) All detected alterations are hypermethylation events; (2) whereas alteration in both CG and CNG methylation occurred in the TEs, only alteration in CNG methylation occurred in the cellular genes; (3) alteration in expression includes both up- and down-regulations, which did not show a general correlation with alteration in methylation; (4) altered methylation patterns in both TEs and cellular genes are heritable to progenies at variable frequencies; however, stochastic reversion to wild-type patterns and further de novo changes in progenies are also apparent; and (5) the altered expression states in both TEs and cellular genes are also heritable to selfed progenies but with markedly lower transmission frequencies than altered DNA methylation states. Furthermore, we found that a set of genes encoding for the various putative DNA methyltransferases, 5-methylcytosine DNA glycosylases, the SWI/SNF chromatin remodeller (DDM1) and siRNA-related proteins are extremely sensitive to perturbation by spaceflight, which might be an underlying cause for the altered methylation patterns in the space-flown plants. We discuss implications of spaceflight-induced epigenetic variations with regard to health safety issues of spaceship crews and potentiality of spaceflight as a means for mutagenesis in crop breeding.

  1. DNA methylation induced changes in chromatin conformation of the promoter of the vitellogenin II gene of Japanese quail during aging.

    PubMed

    Gupta, Sanjay; Pathak, Rashmi U; Kanungo, Madhu S

    2006-08-01

    One approach to the understanding of the molecular basis of aging in higher organisms may be to use genes whose timing and rate of expression during the life span run parallel with specific functions that can be monitored. The genes for egg proteins, such as vitellogenin (VTG), which is expressed in the liver, and ovalbumin, lysozyme etc. that are expressed in the oviduct of birds, meet these requirements. Egg laying function is dependent on the production of these proteins, which, in turn, depends on the expression of their genes. In this communication we present the age-related studies on the VTG II gene of the bird, Japanese quail. The gene is expressed only in the liver and its expression is considerably lower in old birds that do not lay eggs. Comparison of the promoter region of the gene carrying the two important cis-acting elements, estrogen responsive element (ERE) and progesterone responsive element (PRE), shows it to be 100% homologous to the corresponding region of the chicken VTG II gene. Methylation of DNA and conformation of chromatin of this region were studied, as they are known to be important for regulation of expression of genes. Our studies show that in the liver of adult female quails which lay eggs, a -CCGG- sequence located in this region is hypomethylated, and the chromatin encompassing this region of the gene is relaxed. In the old, the -CCGG- sequence is hypermethylated and the chromatin is compact. This is correlated with a decrease in the expression of the gene and decrease in egg production. Further, electrophoretic mobility shift assay (EMSA) shows that the levels/affinity of specific trans-acting factors that bind to ERE and PRE present in the region, are not different in adult and old birds. Hence the methylation status of the -CCGG- sequence that is located in-between the ERE and the PRE may be crucial for the conformation of chromatin and availability of these two important cis-acting elements for the binding of the trans-acting factors. This, in turn, may downregulate the expression of the gene in old birds.

  2. Staphylococcal SCCmec elements encode an active MCM-like helicase and thus may be replicative

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mir-Sanchis, Ignacio; Roman, Christina A.; Misiura, Agnieszka

    2016-08-29

    Methicillin-resistant Staphylococcus aureus (MRSA) is a public-health threat worldwide. Although the mobile genomic island responsible for this phenotype, staphylococcal cassette chromosome (SCC), has been thought to be nonreplicative, we predicted DNA-replication-related functions for some of the conserved proteins encoded by SCC. We show that one of these, Cch, is homologous to the self-loading initiator helicases of an unrelated family of genomic islands, that it is an active 3'-to-5' helicase and that the adjacent ORF encodes a single-stranded DNA–binding protein. Our 2.9-Å crystal structure of intact Cch shows that it forms a hexameric ring. Cch, like the archaeal and eukaryotic MCM-familymore » replicative helicases, belongs to the pre–sensor II insert clade of AAA+ ATPases. Additionally, we found that SCC elements are part of a broader family of mobile elements, all of which encode a replication initiator upstream of their recombinases. Replication after excision would enhance the efficiency of horizontal gene transfer.« less

  3. A cDNA from a mouse pancreatic beta cell encoding a putative transcription factor of the insulin gene.

    PubMed Central

    Walker, M D; Park, C W; Rosen, A; Aronheim, A

    1990-01-01

    Cell specific expression of the insulin gene is achieved through transcriptional mechanisms operating on multiple DNA sequence elements located in the 5' flanking region of the gene. Of particular importance in the rat insulin I gene are two closely similar 9 bp sequences (IEB1 and IEB2): mutation of either of these leads to 5-10 fold reduction in transcriptional activity. We have screened an expression cDNA library derived from mouse pancreatic endocrine beta cells with a radioactive DNA probe containing multiple copies of the IEB1 sequence. A cDNA clone (A1) isolated by this procedure encodes a protein which shows efficient binding to the IEB1 probe, but much weaker binding to either an unrelated DNA probe or to a probe bearing a single base pair insertion within the recognition sequence. DNA sequence analysis indicates a protein belonging to the helix-loop-helix family of DNA-binding proteins. The ability of the protein encoded by clone A1 to recognize a number of wild type and mutant DNA sequences correlates closely with the ability of each sequence element to support transcription in vivo in the context of the insulin 5' flanking DNA. We conclude that the isolated cDNA may encode a transcription factor that participates in control of insulin gene expression. Images PMID:2181401

  4. Characterization of noncoding regulatory DNA in the human genome.

    PubMed

    Elkon, Ran; Agami, Reuven

    2017-08-08

    Genetic variants associated with common diseases are usually located in noncoding parts of the human genome. Delineation of the full repertoire of functional noncoding elements, together with efficient methods for probing their biological roles, is therefore of crucial importance. Over the past decade, DNA accessibility and various epigenetic modifications have been associated with regulatory functions. Mapping these features across the genome has enabled researchers to begin to document the full complement of putative regulatory elements. High-throughput reporter assays to probe the functions of regulatory regions have also been developed but these methods separate putative regulatory elements from the chromosome so that any effects of chromatin context and long-range regulatory interactions are lost. Definitive assignment of function(s) to putative cis-regulatory elements requires perturbation of these elements. Genome-editing technologies are now transforming our ability to perturb regulatory elements across entire genomes. Interpretation of high-throughput genetic screens that incorporate genome editors might enable the construction of an unbiased map of functional noncoding elements in the human genome.

  5. Long interspersed nuclear element-1 retroelements are expressed in patients with systemic autoimmune disease and induce type I interferon

    PubMed Central

    Mavragani, Clio P.; Sagalovskiy, Irina; Guo, Qiu; Nezos, Adrianos; Kapsogeorgou, Efstathia K.; Lu, Pin; Zhou, Jun Liang; Kirou, Kyriakos A.; Seshan, Surya V.; Moutsopoulos, Haralampos M.; Crow, Mary K.

    2016-01-01

    Objective Increased type I interferon (IFN-I) and a broad signature of IFN-I-induced gene transcripts are observed in patients with SLE and other systemic autoimmune diseases. To identify disease-relevant triggers of the IFN-I pathway we investigated whether endogenous virus-like genomic repeat elements, normally silent, might be expressed in patients with systemic autoimmune disease, activate an innate immune response and induce IFN-I. Methods Expression of IFN-I and long interspersed nuclear element-1 (LINE-1; L1) was studied in kidney tissue from lupus patients and minor salivary gland (MSG) tissue from patients with primary Sjogren’s syndrome (SS) by PCR, western blot and immunohistochemistry. Induction of IFN-I by L1 was investigated by transfection of plasmacytoid dendritic cells (pDCs) or monocytes with an L1-encoding plasmid or L1 RNA. Involvement of innate immune pathways and altered L1 methylation were assessed. Results L1 mRNA transcripts were increased in lupus nephritis kidneys and in MSG from SS patients and correlated with IFN-I expression and L1 DNA demethylation. L1 open reading frame 1/p40 protein and IFNβ were expressed in MSG ductal epithelial cells and in lupus kidneys, and IFNα was detected in infiltrating pDCs. Transfection of pDCs or monocytes with L1-encoding DNA or RNA induced IFN-I. Inhibition of TLR7/8 reduced L1 induction of IFNα in pDCs and an inhibitor of IKKε/TBK1 abrogated induction of IFN-I by L1 RNA in monocytes. Conclusion L1 genomic repeat elements represent endogenous nucleic acid triggers of the IFN-I pathway in SLE and SS and may contribute to initiation or amplification of autoimmune disease. PMID:27338297

  6. History of retinoic acid receptors.

    PubMed

    Benbrook, Doris M; Chambon, Pierre; Rochette-Egly, Cécile; Asson-Batres, Mary Ann

    2014-01-01

    The discovery of retinoic acid receptors arose from research into how vitamins are essential for life. Early studies indicated that Vitamin A was metabolized into an active factor, retinoic acid (RA), which regulates RNA and protein expression in cells. Each step forward in our understanding of retinoic acid in human health was accomplished by the development and application of new technologies. Development cDNA cloning techniques and discovery of nuclear receptors for steroid hormones provided the basis for identification of two classes of retinoic acid receptors, RARs and RXRs, each of which has three isoforms, α, β and ɣ. DNA manipulation and crystallographic studies revealed that the receptors contain discrete functional domains responsible for binding to DNA, ligands and cofactors. Ligand binding was shown to induce conformational changes in the receptors that cause release of corepressors and recruitment of coactivators to create functional complexes that are bound to consensus promoter DNA sequences called retinoic acid response elements (RAREs) and that cause opening of chromatin and transcription of adjacent genes. Homologous recombination technology allowed the development of mice lacking expression of retinoic acid receptors, individually or in various combinations, which demonstrated that the receptors exhibit vital, but redundant, functions in fetal development and in vision, reproduction, and other functions required for maintenance of adult life. More recent advancements in sequencing and proteomic technologies reveal the complexity of retinoic acid receptor involvement in cellular function through regulation of gene expression and kinase activity. Future directions will require systems biology approaches to decipher how these integrated networks affect human stem cells, health, and disease.

  7. Suppression of antitumour protective cytotoxic T lymphocyte responses to a human papillomavirus 16 E7 DNA vaccine by coinjection of interleukin-12 complementary DNA: involvement of nitric oxide in immune suppression

    PubMed Central

    Sin, Jeong-Im

    2009-01-01

    Interleukin-12 (IL-12) has been shown to enhance cellular immunity in vitro and in vivo. The beneficial roles of IL-12 as a DNA vaccine adjuvant have been commonly observed. Here the impact of IL-12 complementary DNA (cDNA) as an adjuvant for a human papillomavirus (HPV) type 16 E7 DNA vaccine is investigated in a mouse tumour model. Coinjection of E7 DNA vaccine with IL-12 cDNA completely suppressed antigen-specific cytotoxic T-lymphocyte (CTL) responses, leading to a complete loss of antitumour protection from a tumour cell challenge. In addition, antigen-specific antibody and T helper cell proliferative responses were also suppressed by IL-12 cDNA coinjection. This inhibition was observed over different IL-12 cDNA doses. Furthermore, separate leg injections of IL-12 and E7 cDNAs suppressed antigen-specific CTL and tumour protective responses, but not antibody and T helper cell proliferative responses, suggesting different pathways for suppression of these two separate responses. Further knockout animal studies demonstrated that interferon-γ and nitric oxide are not directly associated with suppression of antigen-specific antibody responses by IL-12 cDNA coinjection. However, nitric oxide was found to be involved in suppression of antigen-specific CTL and tumour protective responses by IL-12 cDNA coinjection. These data suggest that coinjection of IL-12 cDNA results in suppression of E7-specific CTL responses through nitric oxide, leading to a loss of antitumour resistance in this DNA vaccine model. This study further shows that the adjuvant effect of IL-12 is dependent on the antigen types tested. PMID:19740332

  8. Suppression of antitumour protective cytotoxic T lymphocyte responses to a human papillomavirus 16 E7 DNA vaccine by coinjection of interleukin-12 complementary DNA: involvement of nitric oxide in immune suppression.

    PubMed

    Sin, Jeong-Im

    2009-09-01

    Interleukin-12 (IL-12) has been shown to enhance cellular immunity in vitro and in vivo. The beneficial roles of IL-12 as a DNA vaccine adjuvant have been commonly observed. Here the impact of IL-12 complementary DNA (cDNA) as an adjuvant for a human papillomavirus (HPV) type 16 E7 DNA vaccine is investigated in a mouse tumour model. Coinjection of E7 DNA vaccine with IL-12 cDNA completely suppressed antigen-specific cytotoxic T-lymphocyte (CTL) responses, leading to a complete loss of antitumour protection from a tumour cell challenge. In addition, antigen-specific antibody and T helper cell proliferative responses were also suppressed by IL-12 cDNA coinjection. This inhibition was observed over different IL-12 cDNA doses. Furthermore, separate leg injections of IL-12 and E7 cDNAs suppressed antigen-specific CTL and tumour protective responses, but not antibody and T helper cell proliferative responses, suggesting different pathways for suppression of these two separate responses. Further knockout animal studies demonstrated that interferon-gamma and nitric oxide are not directly associated with suppression of antigen-specific antibody responses by IL-12 cDNA coinjection. However, nitric oxide was found to be involved in suppression of antigen-specific CTL and tumour protective responses by IL-12 cDNA coinjection. These data suggest that coinjection of IL-12 cDNA results in suppression of E7-specific CTL responses through nitric oxide, leading to a loss of antitumour resistance in this DNA vaccine model. This study further shows that the adjuvant effect of IL-12 is dependent on the antigen types tested.

  9. The Human L1 Element Causes DNA Double-Strand Breaks in Breast Cancer

    DTIC Science & Technology

    2006-08-01

    cancer is complex. However, defects in DNA repair genes in the double-strand break repair pathway are cancer predisposing. My lab has characterized...a new potentially important source of double-strand breaks (DSBs) in human cells and are interested in characterizing which DNA repair genes act on...this particular source of DNA damage. Selfish DNA accounts for 45% of the human genome. We have recently demonstrated that one particular selfish

  10. The Alarmin Properties of DNA and DNA-associated Nuclear Proteins.

    PubMed

    Magna, Melinda; Pisetsky, David S

    2016-05-01

    The communication of cell injury and death is a critical element in host defense. Although immune cells can serve this function by elaborating cytokines and chemokines, somatic cells can repurpose nuclear macromolecules to function as damage-associated molecular patterns (DAMPs) or alarmins to exert similar activity. Among these molecules, DNA, high-mobility group box-1, and histone proteins can all act as DAMPs once they are in an extracellular location. This review describes current information on the role of the nuclear DAMPs, their translocation to the outside of cells, and pathways of activation after uptake into the inside of immune cells. MEDLINE and PubMed databases were searched for citations (1990-2016) in English related to the following terms: DAMPs, high-mobility group box-1, DNA, histones, cell death, danger, and immune activation. Selected articles with the most relevant studies were included for a more detailed consideration. Although nuclear molecules have important structural and genetic regulatory roles inside the cell nucleus, when released into the extracellular space during cell death, these molecules can acquire immune activity and serve as alarmins or DAMPs. Although apoptosis is generally considered the source of extracellular nuclear material, other cell death pathways such as necroptosis, NETosis, and pyroptosis can contribute to the release of nuclear molecules. Importantly, the release of nuclear DAMPs occurs with both soluble and particulate forms of these molecules. The activity of nuclear molecules may depend on posttranslational modifications, redox changes, and the binding of other molecules. Once in an extracellular location, nuclear DAMPs can engage the same pattern recognition receptors as do pathogen-associated molecular patterns. These interactions can activate immune cells and lead to cytokine and chemokine production. Among these receptors, internal receptors for DNA are key to the response to this molecule; the likely function of these internal sensors is the recognition of DNA from intracellular infection by bacteria or viruses. Activation of these receptors requires translocation of extracellular DNA into specialized compartments. In addition to nuclear DNA, mitochondrial DNA can also serve as a DAMP. The communication of cell injury and death is a critical element in host defense and involves the repurposing of nuclear molecules as immune triggers. As such, the presence of extracellular nuclear material can serve as novel biomarkers for conditions involving cell injury and death. Targeting of these molecules may also represent an important new approach to therapy. Published by Elsevier Inc.

  11. Antimicrobial activity-specific to Gram-negative bacteria and immune modulation-mediated NF-kappaB and Sp1 of a medaka beta-defensin.

    PubMed

    Zhao, Jiu-Gang; Zhou, Li; Jin, Jun-Yan; Zhao, Zhe; Lan, Jing; Zhang, Yi-Bin; Zhang, Qi-Ya; Gui, Jian-Fang

    2009-04-01

    Defensins are a group of cationic antimicrobial peptides which play an important role in the innate immune system by exerting their antimicrobial activity against pathogens. In this study, we cloned a novel beta-defensin cDNA from medaka (Oryzias latipes) by rapid amplification of cDNA ends (RACE) technique. The full-length cDNA consists of 480 bp, and the open reading frame (ORF) of 189 bp encodes a polypeptide of 63 amino acids (aa) with a predicted molecular weight of 7.44 kDa. Its genomic organization was analyzed, and Southern blot detection confirmed that only one copy of beta-defensin exists in the medaka HNI strain. RT-PCR, Western blot and immunohistochemistry detections showed that the beta-defensin transcript and protein could be detected in eyes, liver, kidney, blood, spleen and gill, and obviously prevalent expression was found in eyes. Antimicrobial activity of the medaka beta-defensin was evaluated, and the antibacterial activity-specific to Gram-negative bacteria was revealed. Furthermore, the lipopolysaccharide (LPS), a major component of the outer membrane of Gram-negative bacteria, was demonstrated to be able to induce about 13-fold up-regulation of the beta-defensin within first 12h. In addition, promoter and promoter mutagenesis analysis were performed in the medaka beta-defensin. A proximal 100 base pair (bp) sequence (+26 to -73) and the next 1700 bp sequence (-73 to -1755) were demonstrated to be responsible for the basal promoter activity and for the transcription regulation. Three nuclear factor kappa B (NF-kappaB) cis-elements and a Sp1 cis-element were revealed by mutagenesis analysis to exist in the 5' flanking sequence, and they were confirmed to be responsible for the up-regulation of medaka beta-defensin stimulated by LPS. And, the Sp1 cis-element was further revealed to be related to the basal promoter activity, and transcriptional factor II D (TFIID) was found to be in charge of the gene transcription initiation. All the obtained data suggested that the novel medaka beta-defensin should have antimicrobial activity-specific to Gram-negative bacteria, and the antibacterial immune function should be modulated by NF-kappaB and Sp1.

  12. [Molecular-genetic analysis of wheat (T. aestivum L.) genome with introgression of Ae. cylindrica Host genetic elements].

    PubMed

    Galaev, A V; Sivolap, Iu M

    2005-01-01

    Wheat-aegilops hybrid plants Triticum aestivum L. (2n = 42) x Aegilops cylindrica Host (2n = 28) were investigated with using microsatellite markers. In two BC1F9 lines some genome modifications connected with losing DNA fragments of initial variety or appearing of Aegilops genome elements were detected. In some investigated hybrids new amplicons lacking in parental plants were found. Substitution of wheat chromosomes for aegilops chromosomes was not revealed. Analysis of microsatellite loci in BC2F5 plants showed stable introgression of aegilops genetic elements into wheat; elimination of some transferred aegilops DNA fragments in the course of backcrossing; decreasing size of introgressive elements after backcrossing. Introgressive lines were classified according to genome changes.

  13. Extrachromosomal circular DNA-based amplification and transmission of herbicide resistance in crop weed Amaranthus palmeri

    PubMed Central

    Koo, Dal-Hoe; Molin, William T.; Saski, Christopher A.; Jiang, Jiming; Putta, Karthik; Friebe, Bernd; Gill, Bikram S.

    2018-01-01

    Gene amplification has been observed in many bacteria and eukaryotes as a response to various selective pressures, such as antibiotics, cytotoxic drugs, pesticides, herbicides, and other stressful environmental conditions. An increase in gene copy number is often found as extrachromosomal elements that usually contain autonomously replicating extrachromosomal circular DNA molecules (eccDNAs). Amaranthus palmeri, a crop weed, can develop herbicide resistance to glyphosate [N-(phosphonomethyl) glycine] by amplification of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene, the molecular target of glyphosate. However, biological questions regarding the source of the amplified EPSPS, the nature of the amplified DNA structures, and mechanisms responsible for maintaining this gene amplification in cells and their inheritance remain unknown. Here, we report that amplified EPSPS copies in glyphosate-resistant (GR) A. palmeri are present in the form of eccDNAs with various conformations. The eccDNAs are transmitted during cell division in mitosis and meiosis to the soma and germ cells and the progeny by an as yet unknown mechanism of tethering to mitotic and meiotic chromosomes. We propose that eccDNAs are one of the components of McClintock’s postulated innate systems [McClintock B (1978) Stadler Genetics Symposium] that can rapidly produce soma variation, amplify EPSPS genes in the sporophyte that are transmitted to germ cells, and modulate rapid glyphosate resistance through genome plasticity and adaptive evolution. PMID:29531028

  14. Isolation and sequencing of the gene encoding Sp23, a structural protein of spermatophore of the mealworm beetle, Tenebrio molitor.

    PubMed

    Feng, X; Happ, G M

    1996-11-14

    The cDNA for Sp23, a structural protein of the spermatophore of Tenebrio molitor, had been previously cloned and characterized (Paesen, G.C., Schwartz, M.B., Peferoen, M., Weyda, F. and Happ, G.M. (1992a) Amino acid sequence of Sp23, a structure protein of the spermatophore of the mealworm beetle, Tenebrio molitor. J. Biol. Chem. 257, 18852-18857). Using the labeled cDNA for Sp23 as a probe to screen a library of genomic DNA from Tenebrio molitor, we isolated a genomic clone for Sp23. A 5373-base pair (bp) restriction fragment containing the Sp23 gene was sequenced. The coding region is separated by a 55-bp intron which is located close to the translation start site. Three putative ecdysone response elements (EcRE) are identified in the 5' flanking region of the Sp23 gene. Comparison of the flanking regions of the Sp23 gene with those of the D-protein gene expressed in the accessory glands of Tenebrio reveals similar sequences present in the flanking regions of the two genes. The genomic organization of the coding region of the Sp23 gene shares similarities with that of the D-protein gene, three Drosophila accessory gland genes and two Drosophila 20-OH ecdysone-responsive genes.

  15. A transcriptional serenAID: the role of noncoding RNAs in class switch recombination

    PubMed Central

    Yewdell, William T.; Chaudhuri, Jayanta

    2017-01-01

    Abstract During an immune response, activated B cells may undergo class switch recombination (CSR), a molecular rearrangement that allows B cells to switch from expressing IgM and IgD to a secondary antibody heavy chain isotype such as IgG, IgA or IgE. Secondary antibody isotypes provide the adaptive immune system with distinct effector functions to optimally combat various pathogens. CSR occurs between repetitive DNA elements within the immunoglobulin heavy chain (Igh) locus, termed switch (S) regions and requires the DNA-modifying enzyme activation-induced cytidine deaminase (AID). AID-mediated DNA deamination within S regions initiates the formation of DNA double-strand breaks, which serve as biochemical beacons for downstream DNA repair pathways that coordinate the ligation of DNA breaks. Myriad factors contribute to optimal AID targeting; however, many of these factors also localize to genomic regions outside of the Igh locus. Thus, a current challenge is to explain the specific targeting of AID to the Igh locus. Recent studies have implicated noncoding RNAs in CSR, suggesting a provocative mechanism that incorporates Igh-specific factors to enable precise AID targeting. Here, we chronologically recount the rich history of noncoding RNAs functioning in CSR to provide a comprehensive context for recent and future discoveries. We present a model for the RNA-guided targeting of AID that attempts to integrate historical and recent findings, and highlight potential caveats. Lastly, we discuss testable hypotheses ripe for current experimentation, and explore promising ideas for future investigations. PMID:28535205

  16. Identification of distal silencing elements in the murine interferon-A11 gene promoter.

    PubMed

    Roffet, P; Lopez, S; Navarro, S; Bandu, M T; Coulombel, C; Vignal, M; Doly, J; Vodjdani, G

    1996-08-01

    The murine interferon-A11 (Mu IFN-A11) gene is a member of the IFN-A multigenic family. In mouse L929 cells, the weak response of the gene's promoter to viral induction is due to a combination of both a point mutation in the virus responsive element (VRE) and the presence of negatively regulating sequences surrounding the VRE. In the distal part of the promoter, the negatively acting E1E2 sequence was delimited. This sequence displays an inhibitory effect in either orientation or position on the inducibility of a virus-responsive heterologous promoter. It selectively represses VRE-dependent transcription but is not able to reduce the transcriptional activity of a VRE-lacking promoter. In a transient transfection assay, an E1E2-containing DNA competitor was able to derepress the native Mu IFN-A11 promoter. Specific nuclear factors bind to this sequence; thus the binding of trans-regulators participates in the repression of the Mu IFN-A11 gene. The E1E2 sequence contains an IFN regulatory factor (IRF)-binding site. Recombinant IRF2 binds this sequence and anti-IRF2 antibodies supershift a major complex formed with nuclear extracts. The protein composing the complex is 50 kDa in size, indicating the presence of IRF2 or antigenically related proteins in the complex. The Mu IFN-A11 gene is the first example within the murine IFN-A family, in which a distal promoter element has been identified that can negatively modulate the transcriptional response to viral induction.

  17. Altruistic functions for selfish DNA.

    PubMed

    Faulkner, Geoffrey J; Carninci, Piero

    2009-09-15

    Mammalian genomes are comprised of 30-50% transposed elements (TEs). The vast majority of these TEs are truncated and mutated fragments of retrotransposons that are no longer capable of transposition. Although initially regarded as important factors in the evolution of gene regulatory networks, TEs are now commonly perceived as neutrally evolving and non-functional genomic elements. In a major development, recent works have strongly contradicted this "selfish DNA" or "junk DNA" dogma by demonstrating that TEs use a host of novel promoters to generate RNA on a massive scale across most eukaryotic cells. This transcription frequently functions to control the expression of protein-coding genes via alternative promoters, cis regulatory non protein-coding RNAs and the formation of double stranded short RNAs. If considered in sum, these findings challenge the designation of TEs as selfish and neutrally evolving genomic elements. Here, we will expand upon these themes and discuss challenges in establishing novel TE functions in vivo.

  18. Effects of Particulate Matter on Genomic DNA Methylation Content and iNOS Promoter Methylation

    PubMed Central

    Tarantini, Letizia; Bonzini, Matteo; Apostoli, Pietro; Pegoraro, Valeria; Bollati, Valentina; Marinelli, Barbara; Cantone, Laura; Rizzo, Giovanna; Hou, Lifang; Schwartz, Joel; Bertazzi, Pier Alberto; Baccarelli, Andrea

    2009-01-01

    Background Altered patterns of gene expression mediate the effects of particulate matter (PM) on human health, but mechanisms through which PM modifies gene expression are largely undetermined. Objectives We aimed at identifying short- and long-term effects of PM exposure on DNA methylation, a major genomic mechanism of gene expression control, in workers in an electric furnace steel plant with well-characterized exposure to PM with aerodynamic diameters < 10 μm (PM10). Methods We measured global genomic DNA methylation content estimated in Alu and long interspersed nuclear element-1 (LINE-1) repeated elements, and promoter DNA methylation of iNOS (inducible nitric oxide synthase), a gene suppressed by DNA methylation and induced by PM exposure in blood leukocytes. Quantitative DNA methylation analysis was performed through bisulfite PCR pyrosequencing on blood DNA obtained from 63 workers on the first day of a work week (baseline, after 2 days off work) and after 3 days of work (postexposure). Individual PM10 exposure was between 73.4 and 1,220 μg/m3. Results Global methylation content estimated in Alu and LINE-1 repeated elements did not show changes in postexposure measures compared with baseline. PM10 exposure levels were negatively associated with methylation in both Alu [β = −0.19 %5-methylcytosine (%5mC); p = 0.04] and LINE-1 [β = −0.34 %5mC; p = 0.04], likely reflecting long-term PM10 effects. iNOS promoter DNA methylation was significantly lower in postexposure blood samples compared with baseline (difference = −0.61 %5mC; p = 0.02). Conclusions We observed changes in global and gene specific methylation that should be further characterized in future investigations on the effects of PM. PMID:19270791

  19. Resveratrol upregulates Egr-1 expression and activity involving extracellular signal-regulated protein kinase and ternary complex factors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rössler, Oliver G.; Glatzel, Daniel; Thiel, Gerald, E-mail: gerald.thiel@uks.eu

    2015-03-01

    Many intracellular functions have been attributed to resveratrol, a polyphenolic phytoalexin found in grapes and in other plants. Here, we show that resveratrol induces the expression of the transcription factor Egr-1 in human embryonic kidney cells. Using a chromosomally embedded Egr-1-responsive reporter gene, we show that the Egr-1 activity was significantly elevated in resveratrol-treated cells, indicating that the newly synthesized Egr-1 protein was biologically active. Stimulus-transcription coupling leading to the resveratrol-induced upregulation of Egr-1 expression and activity requires the protein kinases Raf and extracellular signal-regulated protein kinase ERK, while MAP kinase phosphatase-1 functions as a nuclear shut-off device that interruptsmore » the signaling cascade connecting resveratrol stimulation with enhanced Egr-1 expression. On the transcriptional level, Elk-1, a key transcriptional regulator of serum response element-driven gene transcription, connects the intracellular signaling cascade elicited by resveratrol with transcription of the Egr-1 gene. These data were corroborated by the observation that stimulation of the cells with resveratrol increased the transcriptional activation potential of Elk-1. The SRE as well as the GC-rich DNA binding site of Egr-1 function as resveratrol-responsive elements. Thus, resveratrol regulates gene transcription via activation of the stimulus-regulated protein kinases Raf and ERK and the stimulus-responsive transcription factors TCF and Egr-1. - Highlights: • The plant polyphenol resveratrol upregulates Egr-1 expression and activity. • The stimulation of Egr-1 requires the protein kinases ERK and Raf. • Resveratrol treatment upregulates the transcriptional activation potential of Elk-1. • Resveratrol-induced stimulation of Egr-1 requires ternary complex factors. • Two distinct resveratrol-responsive elements were identified.« less

  20. Inhibition of estrogen-responsive gene activation by the retinoid X receptor beta: evidence for multiple inhibitory pathways.

    PubMed

    Segars, J H; Marks, M S; Hirschfeld, S; Driggers, P H; Martinez, E; Grippo, J F; Brown, M; Wahli, W; Ozato, K

    1993-04-01

    The retinoid X receptor beta (RXR beta; H-2RIIBP) forms heterodimers with various nuclear hormone receptors and binds multiple hormone response elements, including the estrogen response element (ERE). In this report, we show that endogenous RXR beta contributes to ERE binding activity in nuclear extracts of the human breast cancer cell line MCF-7. To define a possible regulatory role of RXR beta regarding estrogen-responsive transcription in breast cancer cells, RXR beta and a reporter gene driven by the vitellogenin A2 ERE were transfected into estrogen-treated MCF-7 cells. RXR beta inhibited ERE-driven reporter activity in a dose-dependent and element-specific fashion. This inhibition occurred in the absence of the RXR ligand 9-cis retinoic acid. The RXR beta-induced inhibition was specific for estrogen receptor (ER)-mediated ERE activation because inhibition was observed in ER-negative MDA-MB-231 cells only following transfection of the estrogen-activated ER. No inhibition of the basal reporter activity was observed. The inhibition was not caused by simple competition of RXR beta with the ER for ERE binding, since deletion mutants retaining DNA binding activity but lacking the N-terminal or C-terminal domain failed to inhibit reporter activity. In addition, cross-linking studies indicated the presence of an auxiliary nuclear factor present in MCF-7 cells that contributed to RXR beta binding of the ERE. Studies using known heterodimerization partners of RXR beta confirmed that RXR beta/triiodothyronine receptor alpha heterodimers avidly bind the ERE but revealed the existence of another triiodothyronine-independent pathway of ERE inhibition. These results indicate that estrogen-responsive genes may be negatively regulated by RXR beta through two distinct pathways.

  1. Characterization of Nrf2 activation and heme oxygenase-1 expression in NIH3T3 cells exposed to aqueous extracts of cigarette smoke.

    PubMed

    Knörr-Wittmann, Constanze; Hengstermann, Arnd; Gebel, Stephan; Alam, Jawed; Müller, Thomas

    2005-12-01

    Cigarette smoke (CS) is a complex chemical mixture estimated to be composed of up to 5000 different chemicals, many of which are prooxidant. Here we show that, at least in vitro, the cellular response designed to combat oxidative stress resulting from CS exposure is primarily controlled by the transcription factor Nrf2, a principal inducer of antioxidant and phase II-related genes. The prominent role of Nrf2 in the cellular response to CS is substantiated by the following observations: In NIH3T3 cells exposed to aqueous extracts of CS (i) Nrf2 is strongly stabilized and becomes detectable in nuclear extracts. (ii) Nuclear localization of Nrf2 coincides with increased DNA binding of a putative Nrf2/MafK heterodimer to its cognate cis-regulatory site, i.e., the antioxidant-responsive element (ARE). (iii) Studies on the regulatory elements of the oxidative stress-inducible gene heme oxygenase-1 (hmox1) using various hmox1 promoter/luciferase reporter constructs revealed that the strong CS-dependent expression of this gene is primarily governed by the distal enhancers 1 ("E1") and 2 ("E2"), which both contain three canonical ARE-like stress-responsive elements (StREs). Notably, depletion of Nrf2 levels caused by RNA interference significantly compromised CS-induced hmox1 promoter activation, based on the distinct Nrf2 sensitivity exhibited by E1 and E2. Finally, (iv) siRNA-dependent knock-down of Nrf2 completely abrogated CS-induced expression of phase II-related genes. Taken together, these results confirm the outstanding role of Nrf2 both in sensing (oxidant) stress and in orchestrating an efficient transcriptional response aimed at resolving the stressing conditions.

  2. Molecular Control of the Induction of Alcohol Dehydrogenase by Ethanol in Drosophila Melanogaster Larvae

    PubMed Central

    Kapoun, A. M.; Geer, B. W.; Heinstra, PWH.; Corbin, V.; McKechnie, S. W.

    1990-01-01

    The activity of alcohol dehydrogenase (ADH:EC 1.1.1.1), the initial enzyme in the major pathway for ethanol degradation, is induced in Drosophila melanogaster larvae by low concentrations of dietary ethanol. Two lines of evidence indicate that the metabolic products of the ADH pathway for ethanol degradation are not directly involved in the induction of Adh. First, the accumulation of the proximal transcript in Adh(n2) larvae was increased when the intracellular level of ethanol was elevated. In addition, the ADH activity, the proximal Adh mRNA, and the intracellular concentration of ethanol were elevated coordinately in wild-type larvae fed hexadeuterated-ethanol, which is metabolized more slowly than normal ethanol. An examination of P element transformant lines with specific deletions in the 5' regulatory DNA of the Adh gene showed that the DNA sequence between +604 and +634 of the start site of transcription from the distal promoter was essential for this induction. The DNA sequence between -660 and about -5000 of the distal transcript start site was important for the down-regulation of the induction response. PMID:2157627

  3. A Predictive Approach to Network Reverse-Engineering

    NASA Astrophysics Data System (ADS)

    Wiggins, Chris

    2005-03-01

    A central challenge of systems biology is the ``reverse engineering" of transcriptional networks: inferring which genes exert regulatory control over which other genes. Attempting such inference at the genomic scale has only recently become feasible, via data-intensive biological innovations such as DNA microrrays (``DNA chips") and the sequencing of whole genomes. In this talk we present a predictive approach to network reverse-engineering, in which we integrate DNA chip data and sequence data to build a model of the transcriptional network of the yeast S. cerevisiae capable of predicting the response of genes in unseen experiments. The technique can also be used to extract ``motifs,'' sequence elements which act as binding sites for regulatory proteins. We validate by a number of approaches and present comparison of theoretical prediction vs. experimental data, along with biological interpretations of the resulting model. En route, we will illustrate some basic notions in statistical learning theory (fitting vs. over-fitting; cross- validation; assessing statistical significance), highlighting ways in which physicists can make a unique contribution in data- driven approaches to reverse engineering.

  4. Label-free fluorescent aptasensor for potassium ion using structure-switching aptamers and berberine

    NASA Astrophysics Data System (ADS)

    Guo, Yanqing; Chen, Yanxia; Wei, Yanli; Li, Huanhuan; Dong, Chuan

    2015-02-01

    A simple, rapid and label-free fluorescent aptasensor was fabricated for the detection of potassium ion (K+ ion) in aqueous solution using K+ ion-stabilized single stranded DNA (ssDNA) with G-rich sequence as the recognition element and a fluorescent dye, berberine, as the fluorescence probe. In the presence of K+ ion, the G-rich ssDNA is promoted to form the aptamer-target complex with a G-quadruplex conformation, and berberine binding to the G-quadruplex structure results in the enhancement of its fluorescence. The fluorescence intensity of the sensing system displayed a calibration response for K+ ion in the range of 0-1600 μM with a detection limit of 31 nM (S/N = 3) and a relative standard deviation (RSD) of 0.45%. This label-free fluorescence aptasensor is conveniently and effectively applicable for analysis of K+ ion in blood serum samples with the recovery range of 81.7-105.3%. The assay for detection of potassium ion is easy, economical, robust, and stable in rough conditions.

  5. Dynamic changes in methylome and transcriptome patterns in response to methyltransferase inhibitor 5-azacytidine treatment in citrus

    PubMed Central

    Xu, Jidi; Wang, Xia; Cao, Hongbo; Xu, Haidan; Xu, Qiang

    2017-01-01

    Abstract DNA methylation is known to play an important role in various developmental processes in plants. However, there is a general lack of understanding about the possible functions of DNA methylation in fruit trees. Using callus as a model, methylome, transcriptome and metabolite changes were assessed after treatment with the DNA methyltransferase inhibitor 5-azacytidine (5azaC). Genome-wide methylome analysis revealed the demethylation of a diverse of genes, including many genes encoding transcription factors (TFs), genes involved in biological processes, and the up-regulation of a wide range of transposable elements (TEs). Combined with the RNA-seq data, we observed no obvious genome-wide correlation between the changes in methylation status and expression levels. Furthermore, 5azaC treatment induced carotenoid degradation along with strong activation of carotenoid cleavage dioxygenases 1 (CpCCD1). Functional complementation analysis in bacterial system showed that CpCCD1 exhibited strong catalytic activities toward zeaxanthin, β-carotene and lycopene. In summary, 5azaC treatments induced carotenoid degradation by CpCCD1 activation and led to a genome-wide demethylation effect. PMID:28575160

  6. Transposon-like properties of the major, long repetitive sequence family in the genome of Physarum polycephalum

    PubMed Central

    Pearston, Douglas H.; Gordon, Mairi; Hardman, Norman

    1985-01-01

    A family of long, highly-repetitive sequences, referred to previously as `HpaII-repeats', dominates the genome of the eukaryotic slime mould Physarum polycephalum. These sequences are found exclusively in scrambled clusters. They account for about one-half of the total complement of repetitive DNA in Physarum, and represent the major sequence component found in hypermethylated, 20-50 kb segments of Physarum genomic DNA that fail to be cleaved using the restriction endonuclease HpaII. The structure of this abundant repetitive element was investigated by analysing cloned segments derived from the hypermethylated genomic DNA compartment. We show that the `HpaII-repeat' forms part of a larger repetitive DNA structure, ∼8.6 kb in length, with several structural features in common with recognised eukaryotic transposable genetic elements. Scrambled clusters of the sequence probably arise as a result of transposition-like events, during which the element preferentially recombines in either orientation with target sites located in other copies of the same repeated sequence. The target sites for transposition/recombination are not related in sequence but in all cases studied they are potentially capable of promoting the formation of small `cruciforms' or `Z-DNA' structures which might be recognised during the recombination process. ImagesFig. 3.Fig. 4. PMID:16453652

  7. A model for genesis of transcription systems.

    PubMed

    Burton, Zachary F; Opron, Kristopher; Wei, Guowei; Geiger, James H

    2016-01-01

    Repeating sequences generated from RNA gene fusions/ligations dominate ancient life, indicating central importance of building structural complexity in evolving biological systems. A simple and coherent story of life on earth is told from tracking repeating motifs that generate α/β proteins, 2-double-Ψ-β-barrel (DPBB) type RNA polymerases (RNAPs), general transcription factors (GTFs), and promoters. A general rule that emerges is that biological complexity that arises through generation of repeats is often bounded by solubility and closure (i.e., to form a pseudo-dimer or a barrel). Because the first DNA genomes were replicated by DNA template-dependent RNA synthesis followed by RNA template-dependent DNA synthesis via reverse transcriptase, the first DNA replication origins were initially 2-DPBB type RNAP promoters. A simplifying model for evolution of promoters/replication origins via repetition of core promoter elements is proposed. The model can explain why Pribnow boxes in bacterial transcription (i.e., (-12)TATAATG(-6)) so closely resemble TATA boxes (i.e., (-31)TATAAAAG(-24)) in archaeal/eukaryotic transcription. The evolution of anchor DNA sequences in bacterial (i.e., (-35)TTGACA(-30)) and archaeal (BRE(up); BRE for TFB recognition element) promoters is potentially explained. The evolution of BRE(down) elements of archaeal promoters is potentially explained.

  8. Azadirachtin interacts with retinoic acid receptors and inhibits retinoic acid-mediated biological responses.

    PubMed

    Thoh, Maikho; Babajan, Banaganapalli; Raghavendra, Pongali B; Sureshkumar, Chitta; Manna, Sunil K

    2011-02-11

    Considering the role of retinoids in regulation of more than 500 genes involved in cell cycle and growth arrest, a detailed understanding of the mechanism and its regulation is useful for therapy. The extract of the medicinal plant Neem (Azadirachta indica) is used against several ailments especially for anti-inflammatory, anti-itching, spermicidal, anticancer, and insecticidal activities. In this report we prove the detailed mechanism on the regulation of retinoic acid-mediated cell signaling by azadirachtin, active components of neem extract. Azadirachtin repressed all trans-retinoic acid (ATRA)-mediated nuclear transcription factor κB (NF-κB) activation, not the DNA binding but the NF-κB-dependent gene expression. It did not inhibit IκBα degradation, IκBα kinase activity, or p65 phosphorylation and its nuclear translocation but inhibited NF-κB-dependent reporter gene expression. Azadirachtin inhibited TRAF6-mediated, but not TRAF2-mediated NF-κB activation. It inhibited ATRA-induced Sp1 and CREB (cAMP-response element-binding protein) DNA binding. Azadirachtin inhibited ATRA binding with retinoid receptors, which is supported by biochemical and in silico evidences. Azadirachtin showed strong interaction with retinoid receptors. It suppressed ATRA-mediated removal of retinoid receptors, bound with DNA by inhibiting ATRA binding to its receptors. Overall, our data suggest that azadirachtin interacts with retinoic acid receptors and suppresses ATRA binding, inhibits falling off the receptors, and activates transcription factors like CREB, Sp1, NF-κB, etc. Thus, azadirachtin exerts anti-inflammatory and anti-metastatic responses by a novel pathway that would be beneficial for further anti-inflammatory and anti-cancer therapies.

  9. Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

    PubMed

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

    2014-07-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Multiple independent regulatory pathways control UBI4 expression after heat shock in Saccharomyces cerevisiae.

    PubMed

    Simon, J R; Treger, J M; McEntee, K

    1999-02-01

    Transcription of the polyubiquitin gene UBI4 of Saccharomyces cerevisiae is strongly induced by a variety of environmental stresses, such as heat shock, nutrient depletion and exposure to DNA-damaging agents. This transcriptional response of UBI4 is likely to be the primary mechanism for increasing the pool of ubiquitin for degradation of stress-damaged proteins. Deletion and promoter fusion studies of the 5' regulatory sequences indicated that two different elements, heat shock elements (HSEs) and stress response element (STREs), contributed independently to heat shock regulation of the UBI4 gene. In the absence of HSEs, STRE sequences localized to the intervals -264 to -238 and -215 to -183 were needed for stress control of transcription after heat shock. Site-directed mutagenesis of the STRE (AG4) at -252 to -248 abolished heat shock induction of UBI4 transcription. Northern analysis demonstrated that cells containing either a temperature-sensitive HSF or non-functional Msn2p/Msn4p transcription factors induced high levels of UBI4 transcripts after heat shock. In cells deficient in both heat stress pathways, heat-induced UBI4 transcript levels were considerably lower but not abolished, suggesting a role for another factor(s) in stress control of its expression.

  11. UV-C-Induced alleviation of transcriptional gene silencing through plant-plant communication: Key roles of jasmonic acid and salicylic acid pathways.

    PubMed

    Xu, Wei; Wang, Ting; Xu, Shaoxin; Li, Fanghua; Deng, Chenguang; Wu, Lijun; Wu, Yuejin; Bian, Po

    2016-08-01

    Plant stress responses at the epigenetic level are expected to allow more permanent changes of gene expression and potentially long-term adaptation. While it has been reported that plants subjected to adverse environments initiate various stress responses in their neighboring plants, little is known regarding epigenetic responses to external stresses mediated by plant-plant communication. In this study, we show that DNA repetitive elements of Arabidopsis thaliana, whose expression is inhibited epigenetically by transcriptional gene silencing (TGS) mechanism, are activated by UV-C irradiation through airborne plant-plant and plant-plant-plant communications, accompanied by DNA demethylation at CHH sites. Moreover, the TGS is alleviated by direct treatments with exogenous methyl jasmonate (MeJA) and methyl salicylate (MeSA). Further, the plant-plant and plant-plant-plant communications are blocked by mutations in the biosynthesis or signaling of jasmonic acid (JA) or salicylic acid (SA), indicating that JA and SA pathways are involved in the interplant communication for epigenetic responses. For the plant-plant-plant communication, stress cues are relayed to the last set of receiver plants by promoting the production of JA and SA signals in relaying plants, which exhibit upregulated expression of genes for JA and SA biosynthesis and enhanced emanation of MeJA and MeSA. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. The Autographa californica Multiple Nucleopolyhedrovirus ac83 Gene Contains a cis-Acting Element That Is Essential for Nucleocapsid Assembly.

    PubMed

    Huang, Zhihong; Pan, Mengjia; Zhu, Silei; Zhang, Hao; Wu, Wenbi; Yuan, Meijin; Yang, Kai

    2017-03-01

    Baculoviridae is a family of insect-specific viruses that have a circular double-stranded DNA genome packaged within a rod-shaped capsid. The mechanism of baculovirus nucleocapsid assembly remains unclear. Previous studies have shown that deletion of the ac83 gene of Autographa californica multiple nucleopolyhedrovirus (AcMNPV) blocks viral nucleocapsid assembly. Interestingly, the ac83 -encoded protein Ac83 is not a component of the nucleocapsid, implying a particular role for ac83 in nucleocapsid assembly that may be independent of its protein product. To examine this possibility, Ac83 synthesis was disrupted by insertion of a chloramphenicol resistance gene into its coding sequence or by deleting its promoter and translation start codon. Both mutants produced progeny viruses normally, indicating that the Ac83 protein is not required for nucleocapsid assembly. Subsequently, complementation assays showed that the production of progeny viruses required the presence of ac83 in the AcMNPV genome instead of its presence in trans Therefore, we reasoned that ac83 is involved in nucleocapsid assembly via an internal cis -acting element, which we named the nucleocapsid assembly-essential element (NAE). The NAE was identified to lie within nucleotides 1651 to 1850 of ac83 and had 8 conserved A/T-rich regions. Sequences homologous to the NAE were found only in alphabaculoviruses and have a conserved positional relationship with another essential cis -acting element that was recently identified. The identification of the NAE may help to connect the data of viral cis -acting elements and related proteins in the baculovirus nucleocapsid assembly, which is important for elucidating DNA-protein interaction events during this process. IMPORTANCE Virus nucleocapsid assembly usually requires specific cis -acting elements in the viral genome for various processes, such as the selection of the viral genome from the cellular nucleic acids, the cleavage of concatemeric viral genome replication intermediates, and the encapsidation of the viral genome into procapsids. In linear DNA viruses, such elements generally locate at the ends of the viral genome; however, most of these elements remain unidentified in circular DNA viruses (including baculovirus) due to their circular genomic conformation. Here, we identified a nucleocapsid assembly-essential element in the AcMNPV (the archetype of baculovirus) genome. This finding provides an important reference for studies of nucleocapsid assembly-related elements in baculoviruses and other circular DNA viruses. Moreover, as most of the previous studies of baculovirus nucleocapsid assembly have been focused on viral proteins, our study provides a novel entry point to investigate this mechanism via cis -acting elements in the viral genome. Copyright © 2017 American Society for Microbiology.

  13. As solid as a rock-comparison of CE- and MPS-based analyses of the petrosal bone as a source of DNA for forensic identification of challenging cranial bones.

    PubMed

    Kulstein, Galina; Hadrys, Thorsten; Wiegand, Peter

    2018-01-01

    Short tandem repeat (STR) typing from skeletal remains can be a difficult task. Dependent on the environmental conditions of the provenance of the bones, DNA can be degraded and STR typing inhibited. Generally, dense and compact bones are known to preserve DNA better. Several studies already proved that femora and teeth have high DNA typing success rates. Unfortunately, these elements are not present in all cases involving skeletal remains. Processing partial or singular skeletal elements, it is favorable to select bone areas where DNA preservation is comparably higher. Especially, cranial bones are often accidentally discovered during criminal investigations. The cranial bone is composed of multiple parts. In this examination, we evaluated the potential of the petrous bone for human identification of skeletal remains in forensic case work. Material from different sections of eight unknown cranial bones and-where available-additionally other skeletal elements, collected at the DNA department of the Institute of Legal Medicine in Ulm, Germany, from 2010 to 2017, were processed with an optimized DNA extraction and STR typing strategy. The results highlight that STR typing from the petrous bones leads to reportable profiles in all individuals, even in cases where the analysis of the parietal bone failed. Moreover, the comparison of capillary electrophorese (CE) typing to massively parallel sequencing (MPS) analysis shows that MPS has the potential to analyze degraded human remains and is even capable to provide additional information about phenotype and ancestry of unknown individuals.

  14. Germ line insertion of mtDNA at the breakpoint junction of a reciprocal constitutional translocation.

    PubMed

    Willett-Brozick, J E; Savul, S A; Richey, L E; Baysal, B E

    2001-08-01

    Constitutional chromosomal translocations are relatively common causes of human morbidity, yet the DNA double-strand break (DSB) repair mechanisms that generate them are incompletely understood. We cloned, sequenced and analyzed the breakpoint junctions of a familial constitutional reciprocal translocation t(9;11)(p24;q23). Within the 10-kb region flanking the breakpoints, chromosome 11 had 25% repeat elements, whereas chromosome 9 had 98% repeats, 95% of which were L1-type LINE elements. The breakpoints occurred within an L1-type repeat element at 9p24 and at the 3'-end of an Alu sequence at 11q23. At the breakpoint junction of derivative chromosome 9, we discovered an unusually large 41-bp insertion, which showed 100% identity to 12S mitochondrial DNA (mtDNA) between nucleotides 896 and 936 of the mtDNA sequence. Analysis of the human genome failed to show the preexistence of the inserted sequence at normal chromosomes 9 and 11 breakpoint junctions or elsewhere in the genome, strongly suggesting that the insertion was derived from human mtDNA and captured into the junction during the DSB repair process. To our knowledge, these findings represent the first observation of spontaneous germ line insertion of modern human mtDNA sequences and suggest that DSB repair may play a role in inter-organellar gene transfer in vivo. Our findings also provide evidence for a previously unrecognized insertional mechanism in human, by which non-mobile extra-chromosomal fragments can be inserted into the genome at DSB repair junctions.

  15. Differential DNA methylation at conserved non-genic elements and evidence for transgenerational inheritance following developmental exposure to mono(2-ethylhexyl) phthalate and 5-azacytidine in zebrafish.

    PubMed

    Kamstra, Jorke H; Sales, Liana Bastos; Aleström, Peter; Legler, Juliette

    2017-01-01

    Exposure to environmental stressors during development may lead to latent and transgenerational adverse health effects. To understand the role of DNA methylation in these effects, we used zebrafish as a vertebrate model to investigate heritable changes in DNA methylation following chemical-induced stress during early development. We exposed zebrafish embryos to non-embryotoxic concentrations of the biologically active phthalate metabolite mono(2-ethylhexyl) phthalate (MEHP, 30 µM) and the DNA methyltransferase 1 inhibitor 5-azacytidine (5AC, 10 µM). Direct, latent and transgenerational effects on DNA methylation were assessed using global, genome-wide and locus-specific DNA methylation analyses. Following direct exposure in zebrafish embryos from 0 to 6 days post-fertilization, genome-wide analysis revealed a multitude of differentially methylated regions, strongly enriched at conserved non-genic elements for both compounds. Pathways involved in adipogenesis were enriched with the putative obesogenic compound MEHP. Exposure to 5AC resulted in enrichment of pathways involved in embryonic development and transgenerational effects on larval body length. Locus-specific methylation analysis of 10 differentially methylated sites revealed six of these loci differentially methylated in sperm sampled from adult zebrafish exposed during development to 5AC, and in first and second generation larvae. With MEHP, consistent changes were found at 2 specific loci in first and second generation larvae. Our results suggest a functional role for DNA methylation on cis-regulatory conserved elements following developmental exposure to compounds. Effects on these regions are potentially transferred to subsequent generations.

  16. Changes in DNA methylation induced by multi-walled carbon nanotube exposure in the workplace.

    PubMed

    Ghosh, Manosij; Öner, Deniz; Poels, Katrien; Tabish, Ali M; Vlaanderen, Jelle; Pronk, Anjoeka; Kuijpers, Eelco; Lan, Qing; Vermeulen, Roel; Bekaert, Bram; Hoet, Peter Hm; Godderis, Lode

    This study was designed to assess the epigenetic alterations in blood cells, induced by occupational exposure to multi-wall carbon nanotubes (MWCNT). The study population comprised of MWCNT-exposed workers (n=24) and unexposed controls (n=43) from the same workplace. We measured global DNA methylation/hydroxymethylation levels on the 5th cytosine residues using a validated liquid chromatography tandem-mass spectrometry (LC-MS/MS) method. Sequence-specific methylation of LINE1 retrotransposable element 1 (L1RE1) elements, and promoter regions of functionally important genes associated with epigenetic regulation [DNA methyltransferase-1 (DNMT1) and histone deacetylase 4 (HDAC4)], DNA damage/repair and cell cycle pathways [nuclear protein, coactivator of histone transcription/ATM serine/threonine kinase (NPAT/ATM)], and a potential transforming growth factor beta (TGF-β) repressor [SKI proto-oncogene (SKI)] were studied using bisulfite pyrosequencing. Analysis of global DNA methylation levels and hydroxymethylation did not reveal significant difference between the MWCNT-exposed and control groups. No significant changes in Cytosine-phosphate-Guanine (CpG) site methylation were observed for the LINE1 (L1RE1) elements. Further analysis of gene-specific DNA methylation showed a significant change in methylation for DNMT1, ATM, SKI, and HDAC4 promoter CpGs in MWCNT-exposed workers. Since DNA methylation plays an important role in silencing/regulation of the genes, and many of these genes have been associated with occupational and smoking-induced diseases and cancer (risk), aberrant methylation of these genes might have a potential effect in MWCNT-exposed workers.

  17. Microneedle-mediated transcutaneous immunization with plasmid DNA coated on cationic PLGA nanoparticles

    PubMed Central

    Kumar, Amit; Wonganan, Piyanuch; Sandoval, Michael A.; Li, Xinran; Zhu, Saijie; Cui, Zhengrong

    2012-01-01

    Previously, it was shown that microneedle-mediated transcutaneous immunization with plasmid DNA can potentially induce a stronger immune response than intramuscular injection of the same plasmid DNA. In the present study, we showed that the immune responses induced by transcutaneous immunization by applying plasmid DNA onto a skin area pretreated with solid microneedles were significantly enhanced by coating the plasmid DNA on the surface of cationic nanoparticles. In addition, the net surface charge of the DNA-coated nanoparticles significantly affected their in vitro skin permeation and their ability to induce immune responses in vivo. Transcutaneous immunization with plasmid DNA-coated net positively charged anoparticles elicited a stronger immune response than with plasmid DNA-coated net negatively charged nanoparticles or by intramuscular immunization with plasmid DNA alone. Transcutaneous immunization with plasmid DNA-coated net positively charged nanoparticles induced comparable immune responses as intramuscular injection of them, but transcutaneous immunization was able to induce specific mucosal immunity and a more balanced T helper type 1 and type 2 response. The ability of the net positively charged DNA-coated nanoparticles to induce a strong immune response through microneedle-mediated transcutaneous immunization may be attributed to their ability to increase the expression of the antigen gene encoded by the plasmid and to more effectively stimulate the maturation of antigen-presenting cells. PMID:22921518

  18. Interaction of the alpha-subunit of Escherichia coli RNA polymerase with DNA: rigid body nature of the protein-DNA contact.

    PubMed

    Heyduk, E; Baichoo, N; Heyduk, T

    2001-11-30

    The alpha-subunit of Escherichia coli RNA polymerase plays an important role in the activity of many promoters by providing a direct protein-DNA contact with a specific sequence (UP element) located upstream of the core promoter sequence. To obtain insight into the nature of thermodynamic forces involved in the formation of this protein-DNA contact, the binding of the alpha-subunit of E. coli RNA polymerase to a fluorochrome-labeled DNA fragment containing the rrnB P1 promoter UP element sequence was quantitatively studied using fluorescence polarization. The alpha dimer and DNA formed a 1:1 complex in solution. Complex formation at 25 degrees C was enthalpy-driven, the binding was accompanied by a net release of 1-2 ions, and no significant specific ion effects were observed. The van't Hoff plot of temperature dependence of binding was linear suggesting that the heat capacity change (Deltac(p)) was close to zero. Protein footprinting with hydroxyradicals showed that the protein did not change its conformation upon protein-DNA contact formation. No conformational changes in the DNA molecule were detected by CD spectroscopy upon protein-DNA complex formation. The thermodynamic characteristics of the binding together with the lack of significant conformational changes in the protein and in the DNA suggested that the alpha-subunit formed a rigid body-like contact with the DNA in which a tight complementary recognition interface between alpha-subunit and DNA was not formed.

  19. Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

    PubMed

    Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

    2011-11-01

    Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S rRNA gene copies are discussed. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. USP7S-dependent inactivation of Mule regulates DNA damage signalling and repair.

    PubMed

    Khoronenkova, Svetlana V; Dianov, Grigory L

    2013-02-01

    The E3 ubiquitin ligase Mule/ARF-BP1 plays an important role in the cellular DNA damage response by controlling base excision repair and p53 protein levels. However, how the activity of Mule is regulated in response to DNA damage is currently unknown. Here, we report that the Ser18-containing isoform of the USP7 deubiquitylation enzyme (USP7S) controls Mule stability by preventing its self-ubiquitylation and subsequent proteasomal degradation. We find that in response to DNA damage, downregulation of USP7S leads to self-ubiquitylation and proteasomal degradation of Mule, which eventually leads to p53 accumulation. Cells that are unable to downregulate Mule show reduced ability to upregulate p53 levels in response to DNA damage. We also find that, as Mule inactivation is required for stabilization of base excision repair enzymes, the failure of cells to downregulate Mule after DNA damage results in deficient DNA repair. Our data describe a novel mechanism by which Mule is regulated in response to DNA damage and coordinates cellular DNA damage responses and DNA repair.

  1. Krüppel-like factors are effectors of nuclear receptor signaling

    PubMed Central

    Knoedler, Joseph R.; Denver, Robert J.

    2015-01-01

    Binding of steroid and thyroid hormones to their cognate nuclear receptors (NRs) impacts virtually every aspect of postembryonic development, physiology and behavior, and inappropriate signaling by NRs may contribute to disease. While NRs regulate genes by direct binding to hormone response elements in the genome, their actions may depend on the activity of other transcription factors (TFs) that may or may not bind DNA. The Krüppel-like family of transcription factors (KLF) is an evolutionarily conserved class of DNA-binding proteins that influence many aspects of development and physiology. Several members of this family have been shown to play diverse roles in NR signaling. For example, KLFs 1) act as accessory transcription factors for NR actions, 2) regulate expression of NR genes, and 3) as gene products of primary NR response genes function as key players in NR-dependent transcriptional networks. In mouse models, deletion of different KLFs leads to aberrant transcriptional and physiological responses to hormones, underscoring the importance of these proteins in the regulation of hormonal signaling. Understanding the functional relationships between NRs and KLFs will yield important insights into mechanisms of NR signaling. In this review we present a conceptual framework for understanding how KLFs participate in NR signaling, and we provide examples of how these proteins function to effect hormone action. PMID:24642391

  2. Trimeric association of Hox and TALE homeodomain proteins mediates Hoxb2 hindbrain enhancer activity.

    PubMed

    Jacobs, Y; Schnabel, C A; Cleary, M L

    1999-07-01

    Pbx/exd proteins modulate the DNA binding affinities and specificities of Hox proteins and contribute to the execution of Hox-dependent developmental programs in arthropods and vertebrates. Pbx proteins also stably heterodimerize and bind DNA with Meis and Pknox1-Prep1, additional members of the TALE (three-amino-acid loop extension) superclass of homeodomain proteins that function on common genetic pathways with a subset of Hox proteins. In this study, we demonstrated that Pbx and Meis bind DNA as heterotrimeric complexes with Hoxb1 on a genetically defined Hoxb2 enhancer, r4, that mediates the cross-regulatory transcriptional effects of Hoxb1 in vivo. The DNA binding specificity of the heterotrimeric complex for r4 is mediated by a Pbx-Hox site in conjunction with a distal Meis site, which we showed to be required for ternary complex formation and Meis-enhanced transcription. Formation of heterotrimeric complexes in which all three homeodomains bind their cognate DNA sites is topologically facilitated by the ability of Pbx and Meis to interact through their amino termini and bind DNA without stringent half-site orientation and spacing requirements. Furthermore, Meis site mutation in the Hoxb2 enhancer phenocopies Pbx-Hox site mutation to abrogate enhancer-directed expression of a reporter transgene in the murine embryonic hindbrain, demonstrating that DNA binding by all three proteins is required for trimer function in vivo. Our data provide in vitro and in vivo evidence for the combinatorial regulation of Hox and TALE protein functions that are mediated, in part, by their interdependent DNA binding activities as ternary complexes. As a consequence, Hoxb1 employs Pbx and Meis-related proteins, as a pair of essential cofactors in a higher-order molecular complex, to mediate its transcriptional effects on an endogenous Hox response element.

  3. A novel species-specific tandem repeat DNA family from Sinapis arvensis: detection of telomere-like sequences.

    PubMed

    Kapila, R; Das, S; Srivastava, P S; Lakshmikumaran, M

    1996-08-01

    DNA sequences representing a tandemly repeated DNA family of the Sinapis arvensis genome were cloned and characterized. The 700-bp tandem repeat family is represented by two clones, pSA35 and pSA52, which are 697 and 709 bp in length, respectively. Dot matrix analysis of the sequences indicates the presence of repeated elements within each monomeric unit. Sequence analysis of the repetitive region of clones pSA35 and pSA52 shows that there are several copies of a 7-bp repeat element organized in tandem. The consensus sequence of this repeat element is 5'-TTTAGGG-3'. These elements are highly mutated and the difference in length between the two clones is due to different copy numbers of these elements. The repetitive region of clone pSA35 has 26 copies of the element TTTAGGG, whereas clone pSA52 has 28 copies. The repetitive region in both clones is flanked on either side by inverted repeats that may be footprints of a transposition event. Sequence comparison indicates that the element TTTAGGG is identical to telomeric repeats present in Arabidopsis, maize, tomato, and other plants. However, Bal31 digestion kinetics indicates non-telomeric localization of the 700-bp tandem repeats. The clones represent a novel repeat family as (i) they contain telomere-like motifs as subrepeats within each unit; and (ii) they do not hybridize to related crucifers and are species-specific in nature.

  4. Interactions of trans-acting factor(s) with the estradiol response element and nuclear factor 1 of the vitellogenin II gene of Japanese quail.

    PubMed

    Gupta, S; Upadhayay, R; Kanungo, M S

    1996-08-01

    This study was directed at achieving an understanding of the mechanisms by which steroid hormones control the synthesis of vitellogenin (VTG) protein in the liver of the Japanese quail. Northern hybridization shows that administration of estradiol alone or with progesterone stimulates the synthesis of VTG mRNA. Gel mobility shift assay of DNA fragments containing the ERE and NF 1 shows that estradiol alone or with progesterone increases the levels of nuclear proteins that bind to these cis-acting elements of the promoter of the VTG gene. The cooperative effect of the two hormones seen at the level of expression of the VTG gene may be due to protein-protein interactions of trans-acting factors that bind to ERE and NF 1.

  5. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging themore » ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.« less

  6. Drosophila I-R hybrid dysgenesis is associated with catastrophic meiosis and abnormal zygote formation.

    PubMed

    Orsi, Guillermo A; Joyce, Eric F; Couble, Pierre; McKim, Kim S; Loppin, Benjamin

    2010-10-15

    The Drosophila I-R type of hybrid dysgenesis is a sterility syndrome (SF sterility) associated with the mobilization of the I retrotransposon in female germ cells. SF sterility results from a maternal-effect embryonic lethality whose origin has remained unclear since its discovery about 40 years ago. Here, we show that meiotic divisions in SF oocytes are catastrophic and systematically fail to produce a functional female pronucleus at fertilization. As a consequence, most embryos from SF females rapidly arrest their development with aneuploid or damaged nuclei, whereas others develop as non-viable, androgenetic haploid embryos. Finally, we show that, in contrast to mutants affecting the biogenesis of piRNAs, SF egg chambers do not accumulate persistent DNA double-strand breaks, suggesting that I-element activity might perturb the functional organization of meiotic chromosomes without triggering an early DNA damage response.

  7. A novel regulatory element (E77) isolated from CHO-K1 genomic DNA enhances stable gene expression in Chinese hamster ovary cells.

    PubMed

    Kang, Shin-Young; Kim, Yeon-Gu; Kang, Seunghee; Lee, Hong Weon; Lee, Eun Gyo

    2016-05-01

    Vectors flanked by regulatory DNA elements have been used to generate stable cell lines with high productivity and transgene stability; however, regulatory elements in Chinese hamster ovary (CHO) cells, which are the most widely used mammalian cells in biopharmaceutical production, are still poorly understood. We isolated a novel gene regulatory element from CHO-K1 cells, designated E77, which was found to enhance the stable expression of a transgene. A genomic library was constructed by combining CHO-K1 genomic DNA fragments with a CMV promoter-driven GFP expression vector, and the E77 element was isolated by screening. The incorporation of the E77 regulatory element resulted in the generation of an increased number of clones with high expression, thereby enhancing the expression level of the transgene in the stable transfectant cell pool. Interestingly, the E77 element was found to consist of two distinct fragments derived from different locations in the CHO genome shotgun sequence. High and stable transgene expression was obtained in transfected CHO cells by combining these fragments. Additionally, the function of E77 was found to be dependent on its site of insertion and specific orientation in the vector construct. Our findings demonstrate that stable gene expression mediated by the CMV promoter in CHO cells may be improved by the isolated novel gene regulatory element E77 identified in the present study. © 2016 The Authors. Biotechnology Journal published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Billions of basepairs of recently expanded, repetitive sequences are eliminated from the somatic genome during copepod development.

    PubMed

    Sun, Cheng; Wyngaard, Grace; Walton, D Brian; Wichman, Holly A; Mueller, Rachel Lockridge

    2014-03-11

    Chromatin diminution is the programmed deletion of DNA from presomatic cell or nuclear lineages during development, producing single organisms that contain two different nuclear genomes. Phylogenetically diverse taxa undergo chromatin diminution--some ciliates, nematodes, copepods, and vertebrates. In cyclopoid copepods, chromatin diminution occurs in taxa with massively expanded germline genomes; depending on species, germline genome sizes range from 15 - 75 Gb, 12-74 Gb of which are lost from pre-somatic cell lineages at germline--soma differentiation. This is more than an order of magnitude more sequence than is lost from other taxa. To date, the sequences excised from copepods have not been analyzed using large-scale genomic datasets, and the processes underlying germline genomic gigantism in this clade, as well as the functional significance of chromatin diminution, have remained unknown. Here, we used high-throughput genomic sequencing and qPCR to characterize the germline and somatic genomes of Mesocyclops edax, a freshwater cyclopoid copepod with a germline genome of ~15 Gb and a somatic genome of ~3 Gb. We show that most of the excised DNA consists of repetitive sequences that are either 1) verifiable transposable elements (TEs), or 2) non-simple repeats of likely TE origin. Repeat elements in both genomes are skewed towards younger (i.e. less divergent) elements. Excised DNA is a non-random sample of the germline repeat element landscape; younger elements, and high frequency DNA transposons and LINEs, are disproportionately eliminated from the somatic genome. Our results suggest that germline genome expansion in M. edax reflects explosive repeat element proliferation, and that billions of base pairs of such repeats are deleted from the somatic genome every generation. Thus, we hypothesize that chromatin diminution is a mechanism that controls repeat element load, and that this load can evolve to be divergent between tissue types within single organisms.

  9. Billions of basepairs of recently expanded, repetitive sequences are eliminated from the somatic genome during copepod development

    PubMed Central

    2014-01-01

    Background Chromatin diminution is the programmed deletion of DNA from presomatic cell or nuclear lineages during development, producing single organisms that contain two different nuclear genomes. Phylogenetically diverse taxa undergo chromatin diminution — some ciliates, nematodes, copepods, and vertebrates. In cyclopoid copepods, chromatin diminution occurs in taxa with massively expanded germline genomes; depending on species, germline genome sizes range from 15 – 75 Gb, 12–74 Gb of which are lost from pre-somatic cell lineages at germline – soma differentiation. This is more than an order of magnitude more sequence than is lost from other taxa. To date, the sequences excised from copepods have not been analyzed using large-scale genomic datasets, and the processes underlying germline genomic gigantism in this clade, as well as the functional significance of chromatin diminution, have remained unknown. Results Here, we used high-throughput genomic sequencing and qPCR to characterize the germline and somatic genomes of Mesocyclops edax, a freshwater cyclopoid copepod with a germline genome of ~15 Gb and a somatic genome of ~3 Gb. We show that most of the excised DNA consists of repetitive sequences that are either 1) verifiable transposable elements (TEs), or 2) non-simple repeats of likely TE origin. Repeat elements in both genomes are skewed towards younger (i.e. less divergent) elements. Excised DNA is a non-random sample of the germline repeat element landscape; younger elements, and high frequency DNA transposons and LINEs, are disproportionately eliminated from the somatic genome. Conclusions Our results suggest that germline genome expansion in M. edax reflects explosive repeat element proliferation, and that billions of base pairs of such repeats are deleted from the somatic genome every generation. Thus, we hypothesize that chromatin diminution is a mechanism that controls repeat element load, and that this load can evolve to be divergent between tissue types within single organisms. PMID:24618421

  10. ERalpha and AP-1 interact in vivo with a specific sequence of the F promoter of the human ERalpha gene in osteoblasts.

    PubMed

    Lambertini, Elisabetta; Tavanti, Elisa; Torreggiani, Elena; Penolazzi, Letizia; Gambari, Roberto; Piva, Roberta

    2008-07-01

    Estrogen-responsive genes often have an estrogen response element (ERE) positioned next to activator protein-1 (AP-1) binding sites. Considering that the interaction between ERE and AP-1 elements has been described for the modulation of bone-specific genes, we investigated the 17-beta-estradiol responsiveness and the role of these cis-elements present in the F promoter of the human estrogen receptor alpha (ERalpha) gene. The F promoter, containing the sequence analyzed here, is one of the multiple promoters of the human ERalpha gene and is the only active promoter in bone tissue. Through electrophoretic mobility shift (EMSA), chromatin immunoprecipitation (ChIP), and re-ChIP assays, we investigated the binding of ERalpha and four members of the AP-1 family (c-Jun, c-fos, Fra-2, and ATF2) to a region located approximately 800 bp upstream of the transcriptional start site of exon F of the human ERalpha gene in SaOS-2 osteoblast-like cells. Reporter gene assay experiments in combination with DNA binding assays demonstrated that F promoter activity is under the control of upstream cis-acting elements which are recognized by specific combinations of ERalpha, c-Jun, c-fos, and ATF2 homo- and heterodimers. Moreover, ChIP and re-ChIP experiments showed that these nuclear factors bind the F promoter in vivo with a simultaneous occupancy stimulated by 17-beta-estradiol. Taken together, our findings support a model in which ERalpha/AP-1 complexes modulate F promoter activity under conditions of 17-beta-estradiol stimulation. (c) 2008 Wiley-Liss, Inc.

  11. Ribosomal DNA Organization Before and After Magnification in Drosophila melanogaster

    PubMed Central

    Bianciardi, Alessio; Boschi, Manuela; Swanson, Ellen E.; Belloni, Massimo; Robbins, Leonard G.

    2012-01-01

    In all eukaryotes, the ribosomal RNA genes are stably inherited redundant elements. In Drosophila melanogaster, the presence of a Ybb− chromosome in males, or the maternal presence of the Ribosomal exchange (Rex) element, induces magnification: a heritable increase of rDNA copy number. To date, several alternative classes of mechanisms have been proposed for magnification: in situ replication or extra-chromosomal replication, either of which might act on short or extended strings of rDNA units, or unequal sister chromatid exchange. To eliminate some of these hypotheses, none of which has been clearly proven, we examined molecular-variant composition and compared genetic maps of the rDNA in the bb2 mutant and in some magnified bb+ alleles. The genetic markers used are molecular-length variants of IGS sequences and of R1 and R2 mobile elements present in many 28S sequences. Direct comparison of PCR products does not reveal any particularly intensified electrophoretic bands in magnified alleles compared to the nonmagnified bb2 allele. Hence, the increase of rDNA copy number is diluted among multiple variants. We can therefore reject mechanisms of magnification based on multiple rounds of replication of short strings. Moreover, we find no changes of marker order when pre- and postmagnification maps are compared. Thus, we can further restrict the possible mechanisms to two: replication in situ of an extended string of rDNA units or unequal exchange between sister chromatids. PMID:22505623

  12. Scanning sequences after Gibbs sampling to find multiple occurrences of functional elements

    PubMed Central

    Tharakaraman, Kannan; Mariño-Ramírez, Leonardo; Sheetlin, Sergey L; Landsman, David; Spouge, John L

    2006-01-01

    Background Many DNA regulatory elements occur as multiple instances within a target promoter. Gibbs sampling programs for finding DNA regulatory elements de novo can be prohibitively slow in locating all instances of such an element in a sequence set. Results We describe an improvement to the A-GLAM computer program, which predicts regulatory elements within DNA sequences with Gibbs sampling. The improvement adds an optional "scanning step" after Gibbs sampling. Gibbs sampling produces a position specific scoring matrix (PSSM). The new scanning step resembles an iterative PSI-BLAST search based on the PSSM. First, it assigns an "individual score" to each subsequence of appropriate length within the input sequences using the initial PSSM. Second, it computes an E-value from each individual score, to assess the agreement between the corresponding subsequence and the PSSM. Third, it permits subsequences with E-values falling below a threshold to contribute to the underlying PSSM, which is then updated using the Bayesian calculus. A-GLAM iterates its scanning step to convergence, at which point no new subsequences contribute to the PSSM. After convergence, A-GLAM reports predicted regulatory elements within each sequence in order of increasing E-values, so users have a statistical evaluation of the predicted elements in a convenient presentation. Thus, although the Gibbs sampling step in A-GLAM finds at most one regulatory element per input sequence, the scanning step can now rapidly locate further instances of the element in each sequence. Conclusion Datasets from experiments determining the binding sites of transcription factors were used to evaluate the improvement to A-GLAM. Typically, the datasets included several sequences containing multiple instances of a regulatory motif. The improvements to A-GLAM permitted it to predict the multiple instances. PMID:16961919

  13. Applications of the rep-PCR DNA fingerprinting technique to study microbial diversity, ecology and evolution.

    PubMed

    Ishii, Satoshi; Sadowsky, Michael J

    2009-04-01

    A large number of repetitive DNA sequences are found in multiple sites in the genomes of numerous bacteria, archaea and eukarya. While the functions of many of these repetitive sequence elements are unknown, they have proven to be useful as the basis of several powerful tools for use in molecular diagnostics, medical microbiology, epidemiological analyses and environmental microbiology. The repetitive sequence-based PCR or rep-PCR DNA fingerprint technique uses primers targeting several of these repetitive elements and PCR to generate unique DNA profiles or 'fingerprints' of individual microbial strains. Although this technique has been extensively used to examine diversity among variety of prokaryotic microorganisms, rep-PCR DNA fingerprinting can also be applied to microbial ecology and microbial evolution studies since it has the power to distinguish microbes at the strain or isolate level. Recent advancement in rep-PCR methodology has resulted in increased accuracy, reproducibility and throughput. In this minireview, we summarize recent improvements in rep-PCR DNA fingerprinting methodology, and discuss its applications to address fundamentally important questions in microbial ecology and evolution.

  14. Tetris Is a Foldback Transposon that Provided the Building Blocks for an Emerging Satellite DNA of Drosophila virilis

    PubMed Central

    Dias, Guilherme B.; Svartman, Marta; Delprat, Alejandra; Ruiz, Alfredo; Kuhn, Gustavo C.S.

    2014-01-01

    Transposable elements (TEs) and satellite DNAs (satDNAs) are abundant components of most eukaryotic genomes studied so far and their impact on evolution has been the focus of several studies. A number of studies linked TEs with satDNAs, but the nature of their evolutionary relationships remains unclear. During in silico analyses of the Drosophila virilis assembled genome, we found a novel DNA transposon we named Tetris based on its modular structure and diversity of rearranged forms. We aimed to characterize Tetris and investigate its role in generating satDNAs. Data mining and sequence analysis showed that Tetris is apparently nonautonomous, with a structure similar to foldback elements, and present in D. virilis and D. americana. Herein, we show that Tetris shares the final portions of its terminal inverted repeats (TIRs) with DAIBAM, a previously described miniature inverted transposable element implicated in the generation of chromosome inversions. Both elements are likely to be mobilized by the same autonomous TE. Tetris TIRs contain approximately 220-bp internal tandem repeats that we have named TIR-220. We also found TIR-220 repeats making up longer (kb-size) satDNA-like arrays. Using bioinformatic, phylogenetic and cytogenomic tools, we demonstrated that Tetris has contributed to shaping the genomes of D. virilis and D. americana, providing internal tandem repeats that served as building blocks for the amplification of satDNA arrays. The β-heterochromatic genomic environment seemed to have favored such amplification. Our results imply for the first time a role for foldback elements in generating satDNAs. PMID:24858539

  15. Atomically precise arrays of fluorescent silver clusters: a modular approach for metal cluster photonics on DNA nanostructures.

    PubMed

    Copp, Stacy M; Schultz, Danielle E; Swasey, Steven; Gwinn, Elisabeth G

    2015-03-24

    The remarkable precision that DNA scaffolds provide for arraying nanoscale optical elements enables optical phenomena that arise from interactions of metal nanoparticles, dye molecules, and quantum dots placed at nanoscale separations. However, control of ensemble optical properties has been limited by the difficulty of achieving uniform particle sizes and shapes. Ligand-stabilized metal clusters offer a route to atomically precise arrays that combine desirable attributes of both metals and molecules. Exploiting the unique advantages of the cluster regime requires techniques to realize controlled nanoscale placement of select cluster structures. Here we show that atomically monodisperse arrays of fluorescent, DNA-stabilized silver clusters can be realized on a prototypical scaffold, a DNA nanotube, with attachment sites separated by <10 nm. Cluster attachment is mediated by designed DNA linkers that enable isolation of specific clusters prior to assembly on nanotubes and preserve cluster structure and spectral purity after assembly. The modularity of this approach generalizes to silver clusters of diverse sizes and DNA scaffolds of many types. Thus, these silver cluster nano-optical elements, which themselves have colors selected by their particular DNA templating oligomer, bring unique dimensions of control and flexibility to the rapidly expanding field of nano-optics.

  16. Determining the Specificity of Cascade Binding, Interference, and Primed Adaptation In Vivo in the Escherichia coli Type I-E CRISPR-Cas System.

    PubMed

    Cooper, Lauren A; Stringer, Anne M; Wade, Joseph T

    2018-04-17

    In clustered regularly interspaced short palindromic repeat (CRISPR)-Cas (CRISPR-associated) immunity systems, short CRISPR RNAs (crRNAs) are bound by Cas proteins, and these complexes target invading nucleic acid molecules for degradation in a process known as interference. In type I CRISPR-Cas systems, the Cas protein complex that binds DNA is known as Cascade. Association of Cascade with target DNA can also lead to acquisition of new immunity elements in a process known as primed adaptation. Here, we assess the specificity determinants for Cascade-DNA interaction, interference, and primed adaptation in vivo , for the type I-E system of Escherichia coli Remarkably, as few as 5 bp of crRNA-DNA are sufficient for association of Cascade with a DNA target. Consequently, a single crRNA promotes Cascade association with numerous off-target sites, and the endogenous E. coli crRNAs direct Cascade binding to >100 chromosomal sites. In contrast to the low specificity of Cascade-DNA interactions, >18 bp are required for both interference and primed adaptation. Hence, Cascade binding to suboptimal, off-target sites is inert. Our data support a model in which the initial Cascade association with DNA targets requires only limited sequence complementarity at the crRNA 5' end whereas recruitment and/or activation of the Cas3 nuclease, a prerequisite for interference and primed adaptation, requires extensive base pairing. IMPORTANCE Many bacterial and archaeal species encode CRISPR-Cas immunity systems that protect against invasion by foreign DNA. In the Escherichia coli CRISPR-Cas system, a protein complex, Cascade, binds 61-nucleotide (nt) CRISPR RNAs (crRNAs). The Cascade complex is directed to invading DNA molecules through base pairing between the crRNA and target DNA. This leads to recruitment of the Cas3 nuclease, which destroys the invading DNA molecule and promotes acquisition of new immunity elements. We made the first in vivo measurements of Cascade binding to DNA targets. Thus, we show that Cascade binding to DNA is highly promiscuous; endogenous E. coli crRNAs can direct Cascade binding to >100 chromosomal locations. In contrast, we show that targeted degradation and acquisition of new immunity elements require highly specific association of Cascade with DNA, limiting CRISPR-Cas function to the appropriate targets. Copyright © 2018 Cooper et al.

  17. Characterization of Short Range DNA Looping in Endotoxin-mediated Transcription of the Murine Inducible Nitric-oxide Synthase (iNOS) Gene*

    PubMed Central

    Guo, Hongtao; Mi, Zhiyong; Kuo, Paul C.

    2008-01-01

    The local structural properties and spatial conformations of chromosomes are intimately associated with gene expression. The spatial associations of critical genomic elements in inducible nitric-oxide synthase (iNOS) transcription have not been previously examined. In this regard, the murine iNOS promoter contains 2 NF-κB binding sites (nt –86 and nt –972) that are essential for maximal transactivation of iNOS by LPS. Although AP-1 is commonly listed as an essential transcription factor for LPS-mediated iNOS transactivation, the relationship between AP-1 and NF-κB in this setting is not well studied. In this study using a model of LPS-stimulated ANA-1 murine macrophages, we demonstrate that short range DNA looping occurs at the iNOS promoter. This looping requires the presence of AP-1, c-Jun, NF-κB p65, and p300-associated acetyltransferase activity. The distal AP-1 binding site interacts via p300 with the proximal NF-κB binding site to create this DNA loop to participate in iNOS transcription. Other geographically distant AP-1 and NF-κB sites are certainly occupied, but selected sites are critical for iNOS transcription and the formation of the c-Jun, p65, and p300 transcriptional complex. In this “simplified” model of murine iNOS promoter, numerous transcription factors recognize and bind to various response elements, but these locales do not equally contribute to iNOS gene transcription. PMID:18596035

  18. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    PubMed

    Wang, Cheng; Yu, Jie; Kallen, Caleb B

    2008-01-01

    The proliferating cell nuclear antigen (PCNA) is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE) sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2) enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  19. Changes in DnaA-dependent gene expression contribute to the transcriptional and developmental response of Bacillus subtilis to manganese limitation in Luria-Bertani medium.

    PubMed

    Hoover, Sharon E; Xu, Weihong; Xiao, Wenzhong; Burkholder, William F

    2010-08-01

    The SOS response to DNA damage in bacteria is a well-known component of the complex transcriptional responses to genotoxic environmental stresses such as exposure to reactive oxygen species, alkylating agents, and many of the antibiotics targeting DNA replication. However, bacteria such as Bacillus subtilis also respond to conditions that perturb DNA replication via a transcriptional response mediated by the replication initiation protein DnaA. In addition to regulating the initiation of DNA replication, DnaA directly regulates the transcription of specific genes. Conditions that perturb DNA replication can trigger the accumulation of active DnaA, activating or repressing the transcription of genes in the DnaA regulon. We report here that simply growing B. subtilis in LB medium altered DnaA-dependent gene expression in a manner consistent with the accumulation of active DnaA and that this was part of a general transcriptional response to manganese limitation. The SOS response to DNA damage was not induced under these conditions. One of the genes positively regulated by DnaA in Bacillus subtilis encodes a protein that inhibits the initiation of sporulation, Sda. Sda expression was induced as cells entered stationary phase in LB medium but not in LB medium supplemented with manganese, and the induction of Sda inhibited sporulation-specific gene expression and the onset of spore morphogenesis. In the absence of Sda, manganese-limited cells initiated spore development but failed to form mature spores. These data highlight that DnaA-dependent gene expression may influence the response of bacteria to a range of environmental conditions, including conditions that are not obviously associated with genotoxic stress.

  20. Changes in DnaA-Dependent Gene Expression Contribute to the Transcriptional and Developmental Response of Bacillus subtilis to Manganese Limitation in Luria-Bertani Medium▿ †

    PubMed Central

    Hoover, Sharon E.; Xu, Weihong; Xiao, Wenzhong; Burkholder, William F.

    2010-01-01

    The SOS response to DNA damage in bacteria is a well-known component of the complex transcriptional responses to genotoxic environmental stresses such as exposure to reactive oxygen species, alkylating agents, and many of the antibiotics targeting DNA replication. However, bacteria such as Bacillus subtilis also respond to conditions that perturb DNA replication via a transcriptional response mediated by the replication initiation protein DnaA. In addition to regulating the initiation of DNA replication, DnaA directly regulates the transcription of specific genes. Conditions that perturb DNA replication can trigger the accumulation of active DnaA, activating or repressing the transcription of genes in the DnaA regulon. We report here that simply growing B. subtilis in LB medium altered DnaA-dependent gene expression in a manner consistent with the accumulation of active DnaA and that this was part of a general transcriptional response to manganese limitation. The SOS response to DNA damage was not induced under these conditions. One of the genes positively regulated by DnaA in Bacillus subtilis encodes a protein that inhibits the initiation of sporulation, Sda. Sda expression was induced as cells entered stationary phase in LB medium but not in LB medium supplemented with manganese, and the induction of Sda inhibited sporulation-specific gene expression and the onset of spore morphogenesis. In the absence of Sda, manganese-limited cells initiated spore development but failed to form mature spores. These data highlight that DnaA-dependent gene expression may influence the response of bacteria to a range of environmental conditions, including conditions that are not obviously associated with genotoxic stress. PMID:20511500

Top