Science.gov

Sample records for dna restriction fragment

  1. Methods for producing partially digested restriction DNA fragments and for producing a partially modified PCR product

    DOEpatents

    Wong, Kwong-Kwok

    2000-01-01

    The present invention is an improved method of making a partially modified PCR product from a DNA fragment with a polymerase chain reaction (PCR). In a standard PCR process, the DNA fragment is combined with starting deoxynucleoside triphosphates, a primer, a buffer and a DNA polymerase in a PCR mixture. The PCR mixture is then reacted in the PCR producing copies of the DNA fragment. The improvement of the present invention is adding an amount of a modifier at any step prior to completion of the PCR process thereby randomly and partially modifying the copies of the DNA fragment as a partially modified PCR product. The partially modified PCR product may then be digested with an enzyme that cuts the partially modified PCR product at unmodified sites thereby producing an array of DNA restriction fragments.

  2. Nondetectability of restriction fragments and independence of DNA fragment sizes within and between loci in RFLP typing of DNA

    SciTech Connect

    Chakraborty, R.; Zhong, Y.; Jin, L. ); Budowle, B. )

    1994-08-01

    The authors provide experimental evidence showing that, during the restriction-enzyme digestion of DNA samples, some of the HaeIII-digested DNA fragments are small enough to prevent their reliable sizing on a Southern gel. As a result of such nondetectability of DNA fragments, individuals who show a single-band DNA profile at a VNTR locus may not necessarily be true homozygotes. In a population database, when the presence of such nondetectable alleles is ignored, they show that a pseudodependence of alleles within as well as across loci may occur. Using a known statistical method, under the hypothesis of independence of alleles within loci, they derive an efficient estimate of null allele frequency, which may be subsequently used for testing allelic independence within and across loci. The estimates of null allele frequencies, thus derived, are shown to agree with direct experimental data on the frequencies of HaeIII-null alleles. Incorporation of null alleles into the analysis of the forensic VNTR database suggests that the assumptions of allelic independence within and between loci are appropriate. In contrast, a failure to incorporate the occurrence of null alleles would provide a wrong inference regarding the independence of alleles within and between loci. 47 refs., 2 figs., 4 tabs.

  3. Evolution of the genus Leishmania as revealed by comparisons of nuclear DNA restriction fragment patterns.

    PubMed Central

    Beverley, S M; Ismach, R B; Pratt, D M

    1987-01-01

    Restriction endonuclease DNA fragment patterns have been used to examine the relationships among 28 isolates of Leishmania as well as Crithidia, Endotrypanum, and Trypanosoma cruzi. Fragments of nuclear DNA were generated with six restriction enzymes, and blots were hybridized with probes from three loci. Among the major lineages the fragment patterns are essentially completely different, while within the major lineages various degrees of divergence are found. Molecular evolutionary trees were constructed using the method of Nei and Li to estimate the percent nucleotide sequence divergence among strains from the fraction of fragments shared. Defined groups, such as species or subspecies within the major lineages, are also grouped by nuclear DNA comparisons. Within the donovani complex, we find Leishmania donovani chagasi and Leishmania donovani infantum to be as similar as strains within Leishmania donovani donovani, consistent with the proposal by other workers that New World visceral leishmaniasis originated quite recently. Images PMID:3025876

  4. Polycyclic aromatic hydrocarbon-DNA adducts and the CYP1A1 restriction fragment length polymorphism

    SciTech Connect

    Shields, P.G.; Bowman, E.D.; Weston, A.; Harris, C.C.; Sugimura, H.; Caporaso, N.E.; Petruzzelli, S.F. ); Trump, B.F. )

    1992-11-01

    Human cancer risk assessment at a genetic level involves the investigation of carcinogen metabolism and DNA adduct formation. Wide interindividual differences in metabolism result in different DNA adduct levels. For this and other reasons, many laboratories have considered DNA adducts to be a measure of the biologically effective dose of a carcinogen. Techniques for studying DNA adducts using chemically specific assays are becoming available. A modification of the [sup 32]P-postlabeling assay for polycyclic aromatic hydrocarbon DNA adducts described here provides potential improvements in quantification. DNA adducts, however, reflect only recent exposure to carcinogens; in contrast, genetic testing for metabolic capacity indicates the extent to which carcinogens can be activated and exert genotoxic effects. Such studies may reflect both separate and integrated risk factors together with DNA adduct levels. A recently described restriction fragment length polymorphism for the CYP1A1, which codes for the cytochrome P450 enzyme primarily responsible for the metabolic activation of carcinogenic polycyclic aromatic hydrocarbons, has been found to be associated with lung cancer risk in a Japanese population. In a subset of individuals enrolled in a US lung cancer case-control study, no association with lung cancer was found. 17 refs., 3 figs.

  5. High interindividual restriction fragment length and copy number of polymorphism of a TVRI family in moderate human DNA repeats

    SciTech Connect

    Rogaev, E.I.; Shapiro, Yu.A.

    1987-06-01

    The authors describe the selection of cloned human DNA sequences, with a copy number not exceeding 1000 copies per diploid genome, and their testing for interindividual restriction fragment lengths and copy number of polymorphism (RFLCP). As a result of the investigation a DNA clone was found (TVRI-6), about 2.8 kilobase-pairs in size, for which an unusually high level of interindividual RFLCP was discovered. The TVRI-6 sequence was obtained from a bank of Pst I restriction fragments of human placental nuclear DNA cloned in pBR 322. The bank was analyzed by hybridization of colonies with phosphorus 32-labelled human nuclear DNA.

  6. Comparison of DNA restriction fragment length polymorphisms of Nostoc strains in and from cycads.

    PubMed

    Lindblad, P; Haselkorn, R; Bergman, B; Nierzwicki-Bauer, S A

    1989-01-01

    DNA was prepared from cyanobacteria freshly isolated from coralloid roots of natural populations of five cycad species: Ceratozamia mexicana mexicana (Mexico), C. mexicana robusta (Mexico), Dioon spinulosum (Mexico), Zamia furfuraceae (Mexico) and Z. skinneri (Costa Rica). Using the Southern blot technique and cloned Anabaena PCC 7120 nifK and glnA genes as probes, restriction fragment length polymorphisms of these cyanobacterial symbionts were compared. The five cyanobacterial preparations showed differences in the sizes of their DNA fragments hybridizing with both probes, indicating that different cyanobacterial species and/or strains were in the symbiotic associations. On the other hand, a similar comparison of cyanobacteria freshly collected from a single Encephalartos altensteinii coralloid root and from three independently subcultured isolates from the same coralloid root revealed that these were likely to be one and the same organism. Moreover, the complexity of restriction patterns shows that a mixture of Nostoc strains can associate with a single cycad species although a single cyanobacterial strain can predominate in the root of a single cycad plant. Thus, a wide range of Nostoc strains appear to associate with the coralloid roots of cycads.

  7. The accessibility of thiophosphorylated groups in DNA fragments to the enzymatic activity of ligases and restriction endonuclease Bbs I.

    PubMed

    Schenk, J A; Heymann, S; Micheel, B

    1995-08-01

    The aim of this paper was to test the possibility to ligate and hydrolyse DNA sequences containing thiomodified ends and bonds. T4 DNA ligase was shown to ligate DNA fragments regardless of whether it contains phosphorylated or thiophosphorylated 5'-end. But the cleavage of an internally thiomodified phosphodiester bond was found to be totally inhibited when using the non-palindromic restrictase Bbs I. The special properties of this restriction endonuclease should allow the development of an oriented cloning strategy when combined with T4 ligase and a thiophosphorylation of DNA fragments.

  8. Cloning DNA restriction endonuclease fragments with protruding single-stranded ends.

    PubMed

    Wartell, R M; Reznikoff, W S

    1980-05-01

    A new method of in vitro recombination was employed to construct plasmids containing lac promoter fragments 64 bp and 144 bp long. The 64 bp HpaII-HhaI fragment contains the binding site for the catabolite activator protein (CAP). The HpaII-HaeIII 144 bp fragment includes the binding sites for RNA polymerase, the lac repressor and CAP. The method utilizes the ability of T4 DNA polymerase to make flush-ended DNA either by filling in a recessed 3'-end or by exonucleolytic removal of a protruding 3'-end. The treated fragments were then blunt-end ligated to the filled-in EcoRI cloning sites of the plasmids pVH51 and pBR322 using T4 ligase. In this process, the EcoRI sites were regenerated on the fragment ends thus facilitating the subsequent isolation of the fragments from their cloning vectors.

  9. Capillary electrophoretic separation of DNA restriction fragments using dilute polymer solutions

    SciTech Connect

    Braun, B.; Blanch, W.; Prausnitz, J.M.

    1997-02-01

    Because the mechanism of DNA separation in capillary electrophoresis is not well understood, selection of polymers is a {open_quotes}trial-and-error{close_quotes} procedure. We investigated dilute-solution DNA separations by capillary electrophoresis using solutions of four polymers that differ in size, shape and stiffness. Hydroxyethylcellulose of high molecular weight provides excellent separation of large DNA fragments (2027 bp - 23130 bp). Polyvinylpyrrolidone separates DNA from 72 bp to 23 kbp and star-(polyethylene oxide), like linear poly (ethylene oxide), provides separation of fragments up to 1353 bp.

  10. Study on detection of mutation DNA fragment in gastric cancer by restriction endonuclease fingerprinting with capillary electrophoresis.

    PubMed

    Wang, Rong; Xie, Hua; Xu, Yue-Bing; Jia, Zheng-Ping; Meng, Xian-Dong; Zhang, Juan-Hong; Ma, Jun; Wang, Juan; Wang, Xian-Hua

    2012-03-01

    The DNA fragment detection focusing technique has further enhanced the sensitivity and information of DNA targets. The DNA fragment detection method was established by capillary electrophoresis with laser-induced fluorescence detection and restriction endonuclease chromatographic fingerprinting (CE-LIF-REF) in our experiment. The silica capillary column was coated with short linear polyarclarylamide (SLPA) using nongel sieving technology. The excision product of various restricted enzymes of DNA fragments was obtained by REF with the molecular biology software Primer Premier 5. The PBR322/BsuRI DNA marker was used to establish the optimization method. The markers were focused electrophoretically and detected by CE-LIF. The results demonstrate that the CE-LIF-REF with SLPA can improve separation, sensitivity and speed of analysis. This technique may be applied to analysis of the excision product of various restricted enzymes of prokaryotic plasmid (pIRES2), eukaryote plasmid (pcDNA3.1) and the PCR product of codon 248 region of gastric cancer tissue. The results suggest that this method could very sensitively separate the excision products of various restricted enzymes at a much better resolution than the traditional agarose electrophoresis.

  11. Meat speciation by restriction fragment length polymorphism analysis using an α-actin cDNA probe.

    PubMed

    Fairbrother, K S; Hopwood, A J; Lockley, A K; Bardsley, R G

    1998-09-01

    Classical DNA fingerprinting is based on separation of DNA restriction fragments by electrophoresis and hybridisation to nucleic acid probes containing repetitive nucleotide sequences. The use of such mini- or micro-satellite probes tends to yield patterns specific to an individual rather than to a species, hence their value in forensic analysis but general unsuitability for meat speciation. In the present study, a cDNA probe based on conserved sequences contained in members of the actin multigene family has been evaluated for potential application in meat speciation. Genomic DNA was extracted from muscle and digested with BamHI before electrophoresis and hybridisation to a murine α-actin cDNA probe. Beef, pork, lamb, horse, chicken and fish DNA restriction fragments formed characteristic 'fingerprints' which were reproducible and varied sufficiently to allow discrimination even between closely-related species. However no major differences were seen between individuals of the same breed or between different breeds within a species. When DNA obtained from fresh tissue and also from meat heated at 120 °C was analysed, the gel patterns were essentially the same. An attractive feature of this approach is that it employs a single cross-reacting probe and set of conditions, and gives different patterns with all species so far studied. This simplicity suggests applications in meat speciation or related areas of biology.

  12. Studies of the Inheritance of Human Ribosomal DNA Variants Detected in Two-Dimensional Separations of Genomic Restriction Fragments

    PubMed Central

    Kuick, R.; Asakawa, J. I.; Neel, J. V.; Kodaira, M.; Satoh, C.; Thoraval, D.; Gonzalez, I. L.; Hanash, S. M.

    1996-01-01

    We have investigated the variation in human ribosomal DNA repeat units as revealed in two-dimensional electrophoretic separations of genomic restriction fragments that were end-labeled at NotI cleavage sites. The transcribed portion of the ribosomal DNA results in ~20 labeled fragments visible on each gel as multicopy spots. We have mapped these spots to the sequences responsible for their appearance on the gels, based on their migration positions and direct sequencing of spots, and describe several previously unreported sources of variation. By studying mother/father/child families we gained information on how much of the between-repeats variation is due to differences between and within repeat arrays on homologous chromosomes. Two instances in which a child exhibited more copies of a particular fragment than were present in the parents are described and hypothesized to be due to events such as multiple unequal sister-chromatid exchanges or gene conversions. PMID:8878694

  13. The fragment structure of a putative HsdR subunit of a type I restriction enzyme from Vibrio vulnificus YJ016: implications for DNA restriction and translocation activity

    PubMed Central

    Uyen, Nguyen To; Park, Suk-Youl; Choi, Ji-Woo; Lee, Hyun-Ju; Nishi, Kosuke; Kim, Jeong-Sun

    2009-01-01

    Among four types of bacterial restriction enzymes that cleave a foreign DNA depending on its methylation status, type I enzymes composed of three subunits are interesting because of their unique DNA cleavage and translocation mechanisms performed by the restriction subunit (HsdR). The elucidated N-terminal fragment structure of a putative HsdR subunit from Vibrio vulnificus YJ016 reveals three globular domains. The nucleolytic core within an N-terminal nuclease domain (NTD) is composed of one basic and three acidic residues, which include a metal-binding site. An ATP hydrolase (ATPase) site at the interface of two RecA-like domains (RDs) is located close to the probable DNA-binding site for translocation, which is far from the NTD nucleolytic core. Comparison of relative domain arrangements with other functionally related ATP and/or DNA complex structures suggests a possible translocation and restriction mechanism of the HsdR subunit. Furthermore, careful analysis of its sequence and structure implies that a linker helix connecting two RDs and an extended region within the nuclease domain may play a central role in switching the DNA translocation into the restriction activity. PMID:19625490

  14. Microfluidic device for integrated restriction digestion reaction and resulting DNA fragment analysis.

    PubMed

    Xie, Hua; Li, Bowei; Zhong, Runtao; Qin, Jianhua; Zhu, Yisheng; Lin, Bingcheng

    2008-12-01

    A microfluidic system combining temperature-controlled reactor, analyte delivery, chip electrophoresis (CE) separation, and fluorescence detection was developed, in which the heaters, resistance temperature detectors, enzymatic reactors, CE channels, and pneumatic valves/pumps were integrated onto a single glass-PDMS chip. The microdevice was used to perform the digestion reaction, followed by on-line electrophoresis separation and detection of the resulting fragments with endonuclease BamHI and FokI as models. Pneumatic valves/pumps served not only for isolating the reaction region from the separation medium to prevent contamination, but also for delivering and quantitatively diluting the fluid from the reaction chamber to the CE section. Thus enzymatic reaction and electrophoresis separation could be insulated and connected as needed. A dynamic coating procedure with the use of PVP and mannitol was firstly adopted for glass-PDMS hybrid chip-based DNA separations, leading to an improved separation efficiency with reproducible migration time and theoretical plates. The expected 263- and 287-bp digestion products of BamHI and FokI were definitely verified by the size-based electrophoretic separation and detection. The whole integrated reaction-CE system can be manipulated in a simple manner with good reproducibility, which is expected to be applied in other on-line analysis of various biochemical reactions.

  15. Flying squirrel-associated Rickettsia prowazekii (epidemic typhus rickettsiae) characterized by a specific DNA fragment produced by restriction endonuclease digestion.

    PubMed Central

    Regnery, R L; Fu, Z Y; Spruill, C L

    1986-01-01

    The DNA from flying squirrel-associated Rickettsia prowazekii was characterized by using a specific DNA fragment produced by digestion with the enzyme BamHI. The DNA fragment was cloned into a plasmid vector and used to readily distinguish between available human- and flying squirrel-associated R. prowazekii DNAs derived from crude cytoplasmic extracts. Images PMID:3009528

  16. Rapid identification and classification of bacteria by 16S rDNA restriction fragment melting curve analyses (RFMCA).

    PubMed

    Rudi, Knut; Kleiberg, Gro H; Heiberg, Ragnhild; Rosnes, Jan T

    2007-08-01

    The aim of this work was to evaluate restriction fragment melting curve analyses (RFMCA) as a novel approach for rapid classification of bacteria during food production. RFMCA was evaluated for bacteria isolated from sous vide food products, and raw materials used for sous vide production. We identified four major bacterial groups in the material analysed (cluster I-Streptococcus, cluster II-Carnobacterium/Bacillus, cluster III-Staphylococcus and cluster IV-Actinomycetales). The accuracy of RFMCA was evaluated by comparison with 16S rDNA sequencing. The strains satisfying the RFMCA quality filtering criteria (73%, n=57), with both 16S rDNA sequence information and RFMCA data (n=45) gave identical group assignments with the two methods. RFMCA enabled rapid and accurate classification of bacteria that is database compatible. Potential application of RFMCA in the food or pharmaceutical industry will include development of classification models for the bacteria expected in a given product, and then to build an RFMCA database as a part of the product quality control.

  17. Repair of x-ray-induced DNA double-strand breaks in specific Not I restriction fragments in human fibroblasts: joining of correct and incorrect ends

    NASA Technical Reports Server (NTRS)

    Lobrich, M.; Rydberg, B.; Cooper, P. K.; Chatterjee, A. (Principal Investigator)

    1995-01-01

    An assay that allows measurement of absolute induction frequencies for DNA double-strand breaks (dsbs) in defined regions of the genome and that quantitates rejoining of correct DNA ends has been used to study repair of dsbs in normal human fibroblasts after x-irradiation. The approach involves hybridization of single-copy DNA probes to Not I restriction fragments separated according to size by pulsed-field gel electrophoresis. Induction of dsbs is quantitated from the decrease in the intensity of the hybridizing restriction fragment and an accumulation of a smear below the band. Rejoining of dsbs results in reconstitution of the intact restriction fragment only if correct DNA ends are joined. By comparing results from this technique with results from a conventional electrophoresis assay that detects all rejoining events, it is possible to quantitate the misrejoining frequency. Three Not I fragments on the long arm of chromosome 21 were investigated with regard to dsb induction, yielding an identical induction rate of 5.8 X 10(-3) break per megabase pair per Gy. Correct dsb rejoining was measured for two of these Not I fragments after initial doses of 80 and 160 Gy. The misrejoining frequency was about 25% for both fragments and was independent of dose. This result appears to be representative for the whole genome as shown by analysis of the entire Not I fragment distribution. The correct rejoining events primarily occurred within the first 2 h, while the misrejoining kinetics included a much slower component, with about half of the events occurring between 2 and 24 h. These misrejoining kinetics are similar to those previously reported for production of exchange aberrations in interphase chromosomes.

  18. PCR-restriction fragment length polymorphism analysis of a diagnostic 452-base-pair DNA fragment discriminates between Cryptosporidium parvum and C. meleagridis and between C. parvum isolates of human and animal origin.

    PubMed

    Guyot, K; Follet-Dumoulin, A; Recourt, C; Lelièvre, E; Cailliez, J C; Dei-Cas, E

    2002-04-01

    Genomic DNAs from human Cryptosporidium isolates previously typed by analysis of the 18S ribosomal DNA locus (Cryptosporidium parvum bovine genotype, C. parvum human genotype, Cryptosporidium meleagridis, and Cryptosporidium felis) were used to amplify the diagnostic fragment described by Laxer et al. (M. A. Laxer, B. K. Timblin, and R. J. Patel, Am. J. Trop. Med. Hyg., 45:688-694, 1991). The obtained 452-bp amplified fragments were sequenced and aligned with the homologous Cryptosporidium wrairi sequence. Polymorphism was exploited to develop a restriction fragment length polymorphism method able to discriminate Cryptosporidium species and C. parvum genotypes.

  19. Biology of DNA restriction.

    PubMed Central

    Bickle, T A; Krüger, D H

    1993-01-01

    Our understanding of the evolution of DNA restriction and modification systems, the control of the expression of the structural genes for the enzymes, and the importance of DNA restriction in the cellular economy has advanced by leaps and bounds in recent years. This review documents these advances for the three major classes of classical restriction and modification systems, describes the discovery of a new class of restriction systems that specifically cut DNA carrying the modification signature of foreign cells, and deals with the mechanisms developed by phages to avoid the restriction systems of their hosts. PMID:8336674

  20. Intraspecific variation in Radopholus similis isolates assessed with restriction fragment length polymorphism and DNA sequencing of the internal transcribed spacer region of the ribosomal RNA cistron.

    PubMed

    Elbadri, Gamal A A; De Ley, Paul; Waeyenberge, Lieven; Vierstraete, Andy; Moens, Maurice; Vanfleteren, Jacques

    2002-02-01

    Restriction fragment length polymorphism and direct sequencing of the internal transcribed spacer rDNA region of 19 isolates of Radopholus similis yielded significant diversity, both among isolates and within some individuals. Restriction fragment length polymorphism with HaeIII, AluI and Tru9I yielded two sets of patterns. Digestion with RsaI revealed one or two supernumerary bands in single nematodes from five isolates, and sequencing confirmed microheterogeneity in four of these. Phylogenetic analysis grouped most isolates closely together, except for the five isolates with additional bands for RsaI. Our data reveal more population structure than previously found and lend further support to the synonymy of R. similis and 'Radopholus citrophilus'.

  1. Molecular variation analysis of Aspergillus flavus using polymerase chain reaction-restriction fragment length polymorphism of the internal transcribed spacer rDNA region

    PubMed Central

    Zarrin, Majid; Erfaninejad, Maryam

    2016-01-01

    Aspergillus flavus is the second most common disease-causing species of Aspergillus in humans. The fungus is frequently associated with life-threatening infections in immunocompromised hosts. The primary aim of the present study was to analyze the genetic variability among different isolates of A. flavus using polymerase chain reaction (PCR)-based restriction fragment length polymorphism (RFLP). A total of 62 A. flavus isolates were tested in the study. Molecular variability was searched for by analysis of the PCR amplification of the internal transcribed spacer (ITS) regions of ribosomal DNA using restriction enzymes. PCR using primers for ITS1 and ITS4 resulted in a product of ~600 bp. Amplicons were subjected to digestion with restriction endonucleases EcoRI, HaeIII and TaqI. Digestion of the PCR products using these restriction enzymes produced different patterns of fragments among the isolates, with different sizes and numbers of fragments, revealing genetic variability. In conclusion, ITS-RFLP is a useful molecular tool in screening for nucleotide polymorphisms among A. flavus isolates. PMID:27588085

  2. Molecular authentication of 21 Korean artemisia species (Compositae) by polymerase chain reaction-restriction fragment length polymorphism based on trnL-F region of chloroplast DNA.

    PubMed

    Lee, Jeong Hoon; Lee, Jei Wan; Sung, Jung Sook; Bang, Kyong Hwan; Moon, Sung Gi

    2009-11-01

    The present study describes the molecular authentication of 21 Korean Artemisia species using PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) technique based on the trnL-F sequences in chloroplast DNA. Five different banding patterns were generated from 21 Artemisia species using HinfI restriction enzyme. A. apiacea, A. keiskeana and A. sieversiana have specific banding patterns. The remaining 18 species had shared two banding patterns. Phylogenetic analysis based on trnL-F sequence variations showed results similar to PCR-RFLP banding patterns. It suggested that the trnL-F region does not have sufficient variations to identify the 21 Artemisia species. However, the specific banding patterns for A. apiacea, A. keiskeana and A. sieversiana can be utilized as a DNA marker for discriminating them from other Artemisia species. These markers will be also useful for developing A. apiacea, A. keiskeana and A. sieversiana into new medicine and food based on their efficacy.

  3. Physical mapping of the restriction fragments obtained from bacteriophage T4 dC-DNA with the restriction endonucleases SmaI, KpnI and BglII.

    PubMed

    Kiko, H; Niggemann, E; Rüger, W

    1979-01-01

    The cytosine-containing DNA of a mutant of bacteriophage T4 was digested with restriction endonucleases SmaI, KpnI and BglII producing 5, 7 and 13 fragments respectively. Complete physical maps of the T4 genome were constructed with the enzymes SmaI and KpnI and an almost complete map with the enzyme BglII.

  4. Identification of phytophthora isolates to species level using restriction fragment length polymorphism analysis of a polymerase chain reaction-amplified region of mitochondrial DNA.

    PubMed

    Martin, Frank N; Tooley, Paul W

    2004-09-01

    ABSTRACT Polymerase chain reaction primers spanning the mitochondrially encoded coxI and II genes have been identified that were capable of amplifying target DNA from all 152 isolates of 31 species in the genus Phytophthora that were tested. Digestion of the amplicons with restriction enzymes generated species-specific restriction fragment length polymorphism banding profiles that were effective for isolate classification to a species level. Of the 24 species in which multiple isolates were examined, intraspecific polymorphisms were not observed for 16 species, while 5 species exhibited limited intraspecific polymorphism that could be explained by the addition/loss of a single restriction site. Intraspecific polymorphisms were observed for P. megakarya, P. megasperma, and P. syringae; however, these differences may be a reflection of the variation that exists in these species as reported in the literature. Although digestion with AluI alone could differentiate most species tested, single digests with a total of four restriction enzymes were used in this investigation to enhance the accuracy of the technique and minimize the effect of intraspecific variability on correct isolate identification. The use of the computer program BioNumerics simplified data analysis and identification of isolates. Successful template amplification was obtained with DNA recovered from hyphae using a boiling miniprep procedure, thereby reducing the time and materials needed for conducting this analysis.

  5. [Electrophoretic karyotypes and genomic DNA restriction fragment analysis: their usefulness as tools in the epidemiological study of Candid parapsilosis].

    PubMed

    Perrotta, D; Rodero, L; Demkura, H; Canteros, C; Davel, G

    2002-01-01

    During the past decades, several studies have reported an increase in the incidence of nosocomial candidosis. In a prospective study, performed at the Departamento de Micología, INEI, ANLIS Dr. C. G. Malbrán and the Servicio de Neonatología and Microbiología, Hospital de Niños Sor María Ludovica, from October 1995 to December 1996, 167 patients with candidosis were detected. Candida species isolated were C. albicans (53.1%), C. parapsilosis (26.5%) and C. tropicalis (14.8%). The aim of this work was to characterize the clinical C. parapsilosis isolates from pediatric patients hospitalized in two neonatal intensive care units from the same hospital and to evaluate the usefulness of electrophoretic karyotype (EK) and restriction endonuclease analysis of genomic DNA (REAG) using a low frequency digestion enzyme. EK of all isolates disclosed 12 banding patterns and REAG with endonuclease Sfi I showed only 5 groups. However, isolates from the control group could not be separated from the clinical isolates. The isolates within each dendogram group for EK or REAG were apparently unrelated. Our results show that EK yields better results than REAG, but that it falls short of the desired discrimination, which suggests that these techniques do not seem to be useful for studying nosocomial C. parapsilosis outbreaks.

  6. Analysis of the rDNA internal transcribed spacer region of the Fusarium species by polymerase chain reaction-restriction fragment length polymorphism

    PubMed Central

    ZARRIN, MAJID; GANJ, FARZANEH; FARAMARZI, SAMA

    2016-01-01

    The Fusarium species are a widely spread phytopathogen identified in an extensive variety of hosts. The Fusarium genus is one of the most heterogeneous fungi and is difficult to classify. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis is a useful method in detection of DNA polymorphism in objective sequences. The aim of the present study was to identify the phylogenetic associations and usefulness of the internal transcribed spacer (ITS) region as a genetic marker within the most clinically important strain of the Fusarium species. A total of 50 strains of Fusarium spp. were used in the study, including environmental, clinical and reference isolates. The primers ITS1 and ITS4 were used in the study. Two restriction enzymes, HaeIII and SmaI, were assessed for the digestion of PCR products. A PCR product of ~550-base pairs was generated for each Fusarium species. The digested products with HaeIII and SmaI demonstrated that the bands generated for the medically significant Fusarium species, including F. solani, F. oxysporum, F. verticillidea, F. proliferatum and F. fujikuri, have different restriction enzyme patterns. In conclusion, it appears that the PCR-RFLP method used in the present study produces a sufficient restriction profile for differentiation of the most medically significant Fusarium species. PMID:27073635

  7. Stock structure and homing fidelity in Gulf of Mexico sturgeon (Acipenser oxyrinchus desotoi) based on restriction fragment length polymorphism and sequence analyses of mitochondrial DNA.

    PubMed

    Stabile, J; Waldman, J R; Parauka, F; Wirgin, I

    1996-10-01

    Efforts have been proposed worldwide to restore sturgeon populations through the use of hatcheries to supplement natural reproduction and to reintroduce sturgeon where they have become extinct. We examined the population structure and inferred the extent of homing in the anadromous Gulf of Mexico (Gulf) sturgeon (Acipenser oxyrinchus desotoi). Restriction fragment length polymorphism and control region sequence analyses of mitochondrial DNA (mtDNA) were used to identify haplotypes of Gulf sturgeon specimens obtained from eight drainages spanning the subspecies' entire distribution from Louisiana to Florida. Significant differences in haplotype frequencies indicated substantial geographic structuring of populations. A minimum of four regional or river-specific populations were identified (from west to east): (1) Pearl River, LA and Pascagoula River, MS, (2) Escambia and Yellow rivers, FI, (3) Choctawbatchee River, FL and (4) Apalachicola Ochlockonee, and Suwannee rivers, FL. Estimates of maternally mediated gene flow between any pair of the four regional or river-specific stocks ranged between 0.15 to 1.2. Tandem repeats in the mtDNA control region of Gulf sturgeon were not perfectly conserved. This result, together with an absence of heteroplasmy and length variation in Gulf sturgeon mtDNA, indicates that the molecular mechanisms of mtDNA control region sequence evolution differ among acipenserids.

  8. Stock Structure and Homing Fidelity in Gulf of Mexico Sturgeon (Acipenser Oxyrinchus Desotoi) Based on Restriction Fragment Length Polymorphism and Sequence Analyses of Mitochondrial DNA

    PubMed Central

    Stabile, J.; Waldman, J. R.; Parauka, F.; Wirgin, I.

    1996-01-01

    Efforts have been proposed worldwide to restore sturgeon populations through the use of hatcheries to supplement natural reproduction and to reintroduce sturgeon where they have become extinct. We examined the population structure and inferred the extent of homing in the anadromous Gulf of Mexico (Gulf) sturgeon (Acipenser oxyrinchus desotoi). Restriction fragment length polymorphism and control region sequence analyses of mitochondrial DNA (mtDNA) were used to identify haplotypes of Gulf sturgeon specimens obtained from eight drainages spanning the subspecies' entire distribution from Louisiana to Florida. Significant differences in haplotype frequencies indicated substantial geographic structuring of populations. A minimum of four regional or river-specific populations were identified (from west to east): (1) Pearl River, LA and Pascagoula River, MS, (2) Escambia and Yellow rivers, FL, (3) Choctawhatchee River, FL, and (4) Apalachicola, Ochlockonee, and Suwannee rivers, FL. Estimates of maternally mediated gene flow between any pair of the four regional or river-specific stocks ranged between 0.15 to 1.2. Tandem repeats in the mtDNA control region of Gulf sturgeon were not perfectly conserved. This result, together with an absence of heteroplasmy and length variation in Gulf sturgeon mtDNA, indicates that the molecular mechanisms of mtDNA control region sequence evolution differ among acipenserids. PMID:8889537

  9. Evaluation of a novel method based on amplification of DNA fragments surrounding rare restriction sites (ADSRRS fingerprinting) for typing strains of vancomycin-resistant Enterococcus faecium.

    PubMed

    Krawczyk, Beata; Lewandowski, Krzysztof; Bronk, Marek; Samet, Alfred; Myjak, Przemysław; Kur, Józef

    2003-03-01

    In the search for an effective DNA-typing technique for use in hospital epidemiology, the performance and convenience of a novel assay based on the fingerprinting of bacterial genomes by amplification of DNA fragments surrounding rare restriction sites (ADSRRS fingerprinting) was tested. A large number of vancomycin-resistant Enterococcus faecium (VREM) isolates from haematological ward patients of the Clinical Hospital in Gdańsk were examined. We found that ADSRRS fingerprinting analysis is a rapid method that offers good discriminatory power. The method demonstrated also excellent reproducibility. The usefulness of the ADSRRS fingerprinting method for molecular typing was compared with pulsed field gel electrophoresis (PFGE) method, which is currently considered the gold standard for molecular typing of isolates recovered from patients and the environment in the course of investigation and control of nosocomial outbreaks. Clustering of ADSRRS fingerprinting data matched pulsed field gel electrophoresis data. The features of ADSRRS fingerprinting technique is discussed in comparison with conventional methods. Data presented here demonstrate the complexity of the epidemiological situation concerning VREM that may occur in a single medical ward.

  10. Purification of Restriction Fragments Containing Replication Intermediates from Complex Genomes

    PubMed Central

    Mesner, Larry D.; Dijkwel, Pieter A.; Hamlin, Joyce L.

    2010-01-01

    In order to perform 2-D gel analyses on restriction fragments from higher eukaryotic genomes, it is necessary to remove most of the linear, non-replicating, fragments from the starting DNA preparation. This is because the replication intermediates in a single-copy locus constitute such a minute fraction of all of the restriction fragments in a standard DNA preparation - whether isolated from synchronized or asynchronous cultures. Furthermore, the very long linear DNA strands that characterize higher eukaryotic genomes are inordinately subject to branch migration and shear. We have developed a method that results in significant enrichment of replicating fragments that largely maintain their branched intermediates. The method depends upon two important factors: 1) replicating fragments in higher eukaryotic nuclei appear to be attached to the nuclear matrix in a supercoiled fashion, and 2) partially single-stranded fragments (e.g., those containing replication forks) are selectively adsorbed to BND-cellulose in high salt concentrations. By combining matrix-enrichment and BND-cellulose chromatography, it is possible to obtain preparations that are enriched 200–300-fold over the starting genomic DNA, and are thus suitable for analysis on 2-D gels. PMID:19563104

  11. Characterization of primary biogenic aerosol particles in urban, rural, and high-alpine air by DNA sequence and restriction fragment analysis of ribosomal RNA genes

    NASA Astrophysics Data System (ADS)

    Després, V. R.; Nowoisky, J. F.; Klose, M.; Conrad, R.; Andreae, M. O.; Pöschl, U.

    2007-12-01

    This study explores the applicability of DNA analyses for the characterization of primary biogenic aerosol (PBA) particles in the atmosphere. Samples of fine particulate matter (PM2.5) and total suspended particulates (TSP) have been collected on different types of filter materials at urban, rural, and high-alpine locations along an altitude transect in the south of Germany (Munich, Hohenpeissenberg, Mt. Zugspitze). From filter segments loaded with about one milligram of air particulate matter, DNA could be extracted and DNA sequences could be determined for bacteria, fungi, plants and animals. Sequence analyses were used to determine the identity of biological organisms, and terminal restriction fragment length polymorphism analyses (T-RFLP) were applied to estimate diversities and relative abundances of bacteria. Investigations of blank and background samples showed that filter materials have to be decontaminated prior to use, and that the sampling and handling procedures have to be carefully controlled to avoid artifacts in the analyses. Mass fractions of DNA in PM2.5 were found to be around 0.05% in urban, rural, and high-alpine aerosols. The average concentration of DNA determined for urban air was on the order of ~7 ng m-3, indicating that human adults may inhale about one microgram of DNA per day (corresponding to ~108 haploid bacterial genomes or ~105 haploid human genomes, respectively). Most of the bacterial sequences found in PM2.5 were from Proteobacteria (42) and some from Actinobacteria (10) and Firmicutes (1). The fungal sequences were characteristic for Ascomycota (3) and Basidiomycota (1), which are known to actively discharge spores into the atmosphere. The plant sequences could be attributed to green plants (2) and moss spores (2), while animal DNA was found only for one unicellular eukaryote (protist). Over 80% of the 53 bacterial sequences could be matched to one of the 19 T-RF peaks found in the PM2.5 samples, but only 40% of the T-RF peaks

  12. Differentiation of Candida glabrata, C. nivariensis and C. bracarensis based on fragment length polymorphism of ITS1 and ITS2 and restriction fragment length polymorphism of ITS and D1/D2 regions in rDNA.

    PubMed

    Mirhendi, H; Bruun, B; Schønheyder, H C; Christensen, J J; Fuursted, K; Gahrn-Hansen, B; Johansen, H K; Nielsen, L; Knudsen, J D; Arendrup, M C

    2011-11-01

    Different molecular methods for the discrimination of Candida glabrata, C. bracarensis and C. nivariensis were evaluated and the prevalence of these species among Danish blood isolates investigated. Control strains were used to determine fragment length polymorphism in the ITS1, ITS2, ITS1-5.8S-ITS2 regions and in the D1/D2 domain of 26S rDNA using primers designed for this study. A total of 133 blood isolates previously identified as C. glabrata were examined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and the peptide nucleic acid-fluorescent in situ hybridization (PNA-FISH) method. The size of ITS1 allowed differentiation between C. glabrata (483), C. nivariensis (361) and C. bracarensis (385), whereas the ITS2 region was of similar size in C. nivariensis (417) and C. glabrata (418). Sequence analysis of the ITS region suggested that many restriction enzymes were suitable for RFLP differentiation of the species. Enzymatic digestion of the D1/D2 domain with TatI produced unique band sizes for each of the three species. PCR-RFLP and PNA-FISH were in agreement for all of the isolates tested. None of the 133 Danish blood isolates were C. nivariensis or C. bracarensis. Fragment size polymorphism of ITS1 and RFLP of the D1/D2 domain or the ITS region are useful methods for the differentiation of the species within the C. glabrata group. C. bracarensis and C. nivariensis are rare among Danish C. glabrata blood isolates.

  13. Fragmentation of DNA by sonication.

    PubMed

    Sambrook, Joseph; Russell, David W

    2006-09-01

    INTRODUCTIONDNA fragmentation is often necessary prior to library construction or subcloning for DNA sequencing. This protocol describes a method for DNA fragmentation by sonication. During sonication, DNA samples are subjected to hydrodynamic shearing by exposure to brief periods of sonication. DNA that has been sonicated for excessive periods of time is extremely difficult to clone. Most sonicators will not shear DNA to a size of less than 300-500 bp, and it is tempting to continue sonication until the entire DNA population has been reduced in size. However, the yield of subclones is usually greater if sonication is stopped when the fragments of the target DNA first reach a size of ~700 bp.

  14. Mitochondrial DNA Restriction Fragment Length Polymorphism (RFLP) and 18S Small-Subunit Ribosomal DNA PCR-RFLP Analyses of Acanthamoeba Isolated from Contact Lens Storage Cases of Residents in Southwestern Korea

    PubMed Central

    Kong, Hyun-Hee; Shin, Ji-Yeol; Yu, Hak-Sun; Kim, Jin; Hahn, Tae-Won; Hahn, Young-Ho; Chung, Dong-Il

    2002-01-01

    We applied ribosomal DNA PCR-restriction fragment length polymorphism (RFLP) and mitochondrial DNA (mtDNA) RFLP analyses to 43 Acanthamoeba environmental isolates (KA/LH1 to KA/LH43) from contact lens storage cases in southwestern Korea. These isolates were compared to American Type Culture Collection strains and clinical isolates (KA/E1 to KA/E12) from patients with keratitis. Seven riboprint patterns were seen. To identify the species of the isolates, a phylogenetic tree was constructed based on the comparison of riboprint patterns with reference strains. Four types accounted for 39 of the isolates belonging to the A. castellanii complex. The most predominant (48.8%) type was A. castellanii KA/LH2 type, which had identical riboprint and mtDNA RFLP patterns to those of A. castellanii Castellani, KA/E3 and KA/E8. The riboprint and mtDNA RFLP patterns of the KA/LH7 (20.9%) type were identical to those of A. castellanii Ma, a corneal isolate from the United States. The riboprint and mtDNA RFLP patterns of the KA/LH1 (18.6%) type were the same as those of A. lugdunensis L3a, KA/E2, and KA/E12. The prevalent pattern for each type of Acanthamoeba in southwestern Korea was very different from that from southeastern Korea and Seoul, Korea. It is noteworthy that 38 (88.4%) out of 43 isolates from contact lens storage cases of the residents in southwestern Korea revealed mtDNA RFLP and riboprint patterns identical to those found for clinical isolates in our area. This indicates that most isolates from contact lens storage cases in the surveyed area are potential keratopathogens. More attention should be paid to the disinfection of contact lens storage cases to prevent possible amoebic keratitis. PMID:11923331

  15. Mitochondrial DNA restriction fragment length polymorphism (RFLP) and 18S small-subunit ribosomal DNA PCR-RFLP analyses of Acanthamoeba isolated from contact lens storage cases of residents in southwestern Korea.

    PubMed

    Kong, Hyun-Hee; Shin, Ji-Yeol; Yu, Hak-Sun; Kim, Jin; Hahn, Tae-Won; Hahn, Young-Ho; Chung, Dong-Il

    2002-04-01

    We applied ribosomal DNA PCR-restriction fragment length polymorphism (RFLP) and mitochondrial DNA (mtDNA) RFLP analyses to 43 Acanthamoeba environmental isolates (KA/LH1 to KA/LH43) from contact lens storage cases in southwestern Korea. These isolates were compared to American Type Culture Collection strains and clinical isolates (KA/E1 to KA/E12) from patients with keratitis. Seven riboprint patterns were seen. To identify the species of the isolates, a phylogenetic tree was constructed based on the comparison of riboprint patterns with reference strains. Four types accounted for 39 of the isolates belonging to the A. castellanii complex. The most predominant (48.8%) type was A. castellanii KA/LH2 type, which had identical riboprint and mtDNA RFLP patterns to those of A. castellanii Castellani, KA/E3 and KA/E8. The riboprint and mtDNA RFLP patterns of the KA/LH7 (20.9%) type were identical to those of A. castellanii Ma, a corneal isolate from the United States. The riboprint and mtDNA RFLP patterns of the KA/LH1 (18.6%) type were the same as those of A. lugdunensis L3a, KA/E2, and KA/E12. The prevalent pattern for each type of Acanthamoeba in southwestern Korea was very different from that from southeastern Korea and Seoul, Korea. It is noteworthy that 38 (88.4%) out of 43 isolates from contact lens storage cases of the residents in southwestern Korea revealed mtDNA RFLP and riboprint patterns identical to those found for clinical isolates in our area. This indicates that most isolates from contact lens storage cases in the surveyed area are potential keratopathogens. More attention should be paid to the disinfection of contact lens storage cases to prevent possible amoebic keratitis.

  16. A simple method for sequencing small DNAs by introducing precise overlapping ends into restriction digestion fragments.

    PubMed

    Rena, G; Houslay, M D

    1998-08-15

    A method has been devised whereby certain complete restriction digestions can have short overlaps of unique sequence incorporated into the fragments during cloning. Thus one can identify when the DNA fragments are contiguous. Here, this technique is used to produce a contig for a 2.5 kb fragment of genomic DNA. This is a simple approach to ordering digestion fragments without necessarily performing restriction mapping. It is envisaged that this technique will be useful for sequencing cDNAs and small genomic fragments.

  17. Characterization of mucosa-associated bacterial communities of the mouse intestine by terminal restriction fragment length polymorphism: Utility of sampling strategies and methods to reduce single-stranded DNA artifacts.

    PubMed

    Costa, Estela; Puhl, Nathan J; Selinger, L Brent; Inglis, G Douglas

    2009-08-01

    Terminal restriction fragment length polymorphism (T-RFLP) is a molecular technique used for comparative analysis of microbial community structure and dynamics. We evaluated three sampling methods for recovering bacterial community DNA associated with intestinal mucosa of mice (i.e. mechanical agitation with PBS, hand washing with PBS containing Tween 80, and direct DNA extraction from mucosal plugs). In addition, the utility of two methods (i.e. Klenow fragment and mung-bean nuclease) to reduce single-stranded DNA artifacts was tested. T-RFLP analysis indicated that diverse communities of bacteria are associated with mucosa of the ileum, cecum, and descending colon of mice. Although there was no significant difference in bacterial community structure between the mechanical agitation and direct DNA extraction methods regardless of intestinal location, community diversity was reduced for the hand wash method in the colon. The use of Klenow fragment and mung-bean nuclease have been reported to eliminate single-stranded DNA artifacts (i.e. pseudo-T-restriction fragments), but neither method was beneficial for characterizing mucosa-associated bacterial communities of the mouse cecum. Our study showed that the mechanical agitation and direct plug extraction methods yielded equivalent bacterial community DNA from the mucosa of the small and large intestines of mice, but the latter method was superior for logistical reasons. We also applied a combination of different statistical approaches to analyze T-RFLP data, including statistical detection of true peaks, analysis of variance for peak number, and group significance test, which provided a quantitative improvement for the interpretation of the T-RFLP data.

  18. Linkage map for Aedes aegypti using restriction fragment length polymorphisms.

    PubMed

    Severson, D W; Mori, A; Zhang, Y; Christensen, B M

    1993-01-01

    We report construction of a genetic linkage map for the mosquito, Aedes aegypti, based on restriction fragment length polymorphisms (RFLPs). The map consists of 50 DNA markers that identify 53 loci covering 134 map units across three linkage groups. Determination of linkage associations between RFLP markers and several mutant marker loci allowed for partial integration of the RFLP markers with an existing classical genetic linkage map for A. aegypti. The RFLP markers include 42 random cDNA clones, three random genomic DNA clones, and five cDNA clones of known genes. We discuss the influence of autosomal sex determination, characteristic of culicine mosquitoes, in relation to its observed influence on segregation ratios. This has important ramifications for future efforts to identify quantitative trait loci associated with the ability of these mosquitoes to transmit various pathogens and parasites to man and other animals.

  19. Preparation of (32)P-end-labeled DNA fragments for performing DNA-binding experiments.

    PubMed

    Carey, Michael F; Peterson, Craig L; Smale, Stephen T

    2013-05-01

    The generation of a uniquely (32)P-end-labeled DNA fragment is essential for DNA-binding experiments such as DNase I footprinting and ethylation interference. We describe here a protocol for end-labeling a restriction fragment. For a plasmid DNA bearing a region containing the binding site of interest, cleaving with a single restriction endonuclease generates a 5' overhang containing a phosphate. This is generally necessary for both common forms of fragment end-labeling: phosphorylation with polynucleotide kinase and "filling in the end" with DNA polymerases (e.g., Klenow fragment). For the phosphorylation reaction, as described here, the phosphate is removed with calf intestinal phosphatase or bacterial alkaline phosphatase, and the resulting free 5'-OH is phosphorylated with polynucleotide kinase and [γ-(32)P]ATP. This generates a plasmid labeled at each end with γ-(32)P. The molar amount of plasmid DNA must be below the amount of ATP added to the reaction and the ATP must be of sufficiently high specific activity to generate a fragment labeled to the extent necessary for many DNA-binding experiments. To generate a uniquely end-labeled DNA fragment, the labeled plasmid is heat-treated to inactivate any remaining kinase and recleaved with a second endonuclease, releasing a short DNA fragment and a longer vector fragment. The DNA fragment is purified from the labeled vector on a 5%-8% native polyacrylamide gel. The preparation and labeling of DNA restriction fragments typically takes 1-2 d.

  20. Sizing of single fluorescently stained DNA fragments by scanning microscopy

    PubMed Central

    Laib, Stephan; Rankl, Michael; Ruckstuhl, Thomas; Seeger, Stefan

    2003-01-01

    We describe an approach to determine DNA fragment sizes based on the fluorescence detection of single adsorbed fragments on specifically coated glass cover slips. The brightness of single fragments stained with the DNA bisintercalation dye TOTO-1 is determined by scanning the surface with a confocal microscope. The brightness of adsorbed fragments is found to be proportional to the fragment length. The method needs only minute amount of DNA, beyond inexpensive and easily available surface coatings, like poly-l-lysine, 3-aminoproyltriethoxysilane and polyornithine, are utilizable. We performed DNA-sizing of fragment lengths between 2 and 14 kb. Further, we resolved the size distribution before and after an enzymatic restriction digest. At this a separation of buffers or enzymes was unnecessary. DNA sizes were determined within an uncertainty of 7–14%. The proposed method is straightforward and can be applied to standardized microtiter plates. PMID:14602931

  1. Screening of cytoplasmic DNA diversity between and within Lupinus mutabilis Sweet and Lupinus albus sensu lato by restriction fragment length polymorphism (RFLP).

    PubMed

    Olczak, T; Rurek, M; Jańska, H; Augustyniak, H; Sawicka-Sienkiewicz, E J

    2001-01-01

    Seven populations and five mutant lines of the Andean lupin and four species from the section Albus were screened for their mitochondrial and chloroplast polymorphisms. For this purpose the RFLP method with EcoRI as a restriction enzyme was used. Lupinus luteus, Lupinus albus and Phaseolus vulgaris organellar clones as well as amplified fragments were used as probes. We found that mitochondrial probes were more suitable than chloroplast probes for identification of inter- and intra-specific variations within the examined material. Most mitochondrial probes differentiate the two species investigated. A high level of mitochondrial polymorphism was observed among the populations of L. mutabilis in contrast to monomorphism among the species in the section Albus. A limited polymorphism was detected between the mutant lines of L. mutabilis. We conclude from this study that the mitochondrial RFLP analysis is a valuable tool for identification of variability among Andean lupin populations.

  2. [Studies on mtDNA of Ustilago maydis. II. Restriction mapping].

    PubMed

    Feng, G H; Cheng, W; Lu, S Y

    1991-01-01

    A restriction map was constructed for mtDNA of Ustilago maydis. The fragment order for each restriction enzyme was determined by DNA hybridization and fragment overlapping. The restriction sites were located by analysing the secondary digestions of the cloned mtDNA fragments. It was also found that the mtDNA of U. maydis was a circle molecule (60.7 kb), without recognizable repeat sequence.

  3. Detection of single lambda DNA fragments by flow cytometry

    SciTech Connect

    Johnson, M.E.; Goodwin, P.M.; Ambrose, W.P.; Martin, J.C.; Marrone, B.L.; Keller, R.A. )

    1993-01-01

    The authors have demonstrated flow cytometric detection and sizing of single pieces of fluorescently stained lambda DNA (48.5 kb) and individual Kpn I restriction fragments of lambda DNA at 17.05 kb and 29.95 kb. DNA fragments were stained stoichiometrically with an intercalating dye such that the fluorescence from each fragment was directly proportional to fragment length. Laser powers range from 10 to 100 mW and transit times through the focused laser beam were several milliseconds. Measurements were made using time-resolved single photon counting of the detected fluorescence emission from individual stained DNA fragments. Samples were analyzed at rates of about 50 fragments per second. The measured fluorescence intensities are linearly correlated with DNA fragment length over the range measured. Detection sensitivity and resolution needed for analysis of small pieces of DNA are discussed and a comparison of single photon counting measurements of DNA fragments to measurements using more conventional flow cytometers is made. Applications of this methodology to DNA sizing and DNA fingerprinting are discussed.

  4. Restriction enzyme cutting site distribution regularity for DNA looping technology.

    PubMed

    Shang, Ying; Zhang, Nan; Zhu, Pengyu; Luo, Yunbo; Huang, Kunlun; Tian, Wenying; Xu, Wentao

    2014-01-25

    The restriction enzyme cutting site distribution regularity and looping conditions were studied systematically. We obtained the restriction enzyme cutting site distributions of 13 commonly used restriction enzymes in 5 model organism genomes through two novel self-compiled software programs. All of the average distances between two adjacent restriction sites fell sharply with increasing statistic intervals, and most fragments were 0-499 bp. A shorter DNA fragment resulted in a lower looping rate, which was also directly proportional to the DNA concentration. When the length was more than 500 bp, the concentration did not affect the looping rate. Therefore, the best known fragment length was longer than 500 bp, and did not contain the restriction enzyme cutting sites which would be used for digestion. In order to make the looping efficiencies reach nearly 100%, 4-5 single cohesive end systems were recommended to digest the genome separately.

  5. Non-random DNA fragmentation in next-generation sequencing

    NASA Astrophysics Data System (ADS)

    Poptsova, Maria S.; Il'Icheva, Irina A.; Nechipurenko, Dmitry Yu.; Panchenko, Larisa A.; Khodikov, Mingian V.; Oparina, Nina Y.; Polozov, Robert V.; Nechipurenko, Yury D.; Grokhovsky, Sergei L.

    2014-03-01

    Next Generation Sequencing (NGS) technology is based on cutting DNA into small fragments, and their massive parallel sequencing. The multiple overlapping segments termed ``reads'' are assembled into a contiguous sequence. To reduce sequencing errors, every genome region should be sequenced several dozen times. This sequencing approach is based on the assumption that genomic DNA breaks are random and sequence-independent. However, previously we showed that for the sonicated restriction DNA fragments the rates of double-stranded breaks depend on the nucleotide sequence. In this work we analyzed genomic reads from NGS data and discovered that fragmentation methods based on the action of the hydrodynamic forces on DNA, produce similar bias. Consideration of this non-random DNA fragmentation may allow one to unravel what factors and to what extent influence the non-uniform coverage of various genomic regions.

  6. Evaluation of PCR amplification bias by terminal restriction fragment length polymorphism analysis of small-subunit rRNA and mcrA genes by using defined template mixtures of methanogenic pure cultures and soil DNA extracts.

    PubMed

    Lueders, Tillmann; Friedrich, Michael W

    2003-01-01

    Terminal restriction fragment length polymorphism (T-RFLP) analysis is a widely used method for profiling microbial community structure in different habitats by targeting small-subunit (SSU) rRNA and also functional marker genes. It is not known, however, whether relative gene frequencies of individual community members are adequately represented in post-PCR amplicon frequencies as shown by T-RFLP. In this study, precisely defined artificial template mixtures containing genomic DNA of four different methanogens in various ratios were prepared for subsequent T-RFLP analysis. PCR amplicons were generated from defined mixtures targeting not only the SSU rRNA but also the methyl-coenzyme M reductase (mcrA/mrtA) genes of methanogens. Relative amplicon frequencies of microorganisms were quantified by comparing fluorescence intensities of characteristic terminal restriction fragments. SSU ribosomal DNA (rDNA) template ratios in defined template mixtures of the four-membered community were recovered absolutely by PCR-T-RFLP analysis, which demonstrates that the T-RFLP analysis evaluated can give a quantitative view of the template pool. SSU rDNA-targeted T-RFLP analysis of a natural community was found to be highly reproducible, independent of PCR annealing temperature, and unaffected by increasing PCR cycle numbers. Ratios of mcrA-targeted T-RFLP analysis were biased, most likely by PCR selection due to the degeneracy of the primers used. Consequently, for microbial community analyses, each primer system used should be evaluated carefully for possible PCR bias. In fact, such bias can be detected by using T-RFLP analysis as a tool for the precise quantification of the PCR product pool.

  7. Restriction fragment length polymorphisms associated with substance P gene

    SciTech Connect

    de Miguel, C.; Bonner, T.; Detera-Wadleigh, S.

    1987-05-01

    Substance P (SP) is an important neuropepetide detected in a variety of locations in the central nervous system. Variations in SP content or SP receptors in psychiatric disorders have been described. Using SP clones as probes the authors have found three restriction fragment length polymorphisms (RFLPs) in the SP gene. The RFLPs are generated by digestion of genomic DNA with the MspI, and RsaI and NcoI restriction endonucleases. The MspI RFLP is detected by two genomic clones mapping to the 5' end of the gene while the RsaI and NcoI rFLPs are both detected by two genomic clones on the 3' end and also by a full-length cDNA clone of the gene. All three RFLPs are characterized by two alleles. For the MspI RFLP the frequency of both alleles is similar, for the Rsa I and NcoI RFLP one of the alleles is significantly more abundant than the other. These RFLPs are now being used to determine whether any of the alleles correlate with either schizophrenia or affective disorder.

  8. Sizing of DNA fragments by flow cytometry

    SciTech Connect

    Johnson, M.E.; Goodwin, P.M.; Ambrose, W.P.; Martin, J.C.; Marrone, B.L.; Jett, J.H.; Keller, R.A.

    1993-02-01

    Individual, stained DNA fragments were sized using a modified flow cytometer with high sensitivity fluorescence detection. The fluorescent intercalating dye ethidium homodimer was used to stain stoichiometrically lambda phage DNA and a Kpn I digest of lambda DNA. Stained, individual fragments of DNA were passed through a low average power, focused, mode-locked laser beam, and the fluorescence from each fragment was collected and quantified. Time-gated detection was used to discriminate against Raman scattering from the water solvent. The fluorescence burst from each fragment was related directly to its length, thus providing a means to size small quantities of kilobase lengths of DNA quickly. Improvements of several orders of magnitude in analysis time and sample size over current gel electrophoresis techniques were realized. Fragments of 17.1,29.9, and 48.5 thousand base pairs were well resolved, and were sized in 164 seconds. Less than one pg of DNA was required for analysis. We have demonstrated sizing of individual, stained DNA fragments with resolution approaching that of gel electrophoresis for moderately large fragments, but with significant reductions in the analysis time and the amount of sample required. Furthermore, system response is linear with DNA fragment length, in contrast to the logarithmic response in gel electrophoresis. There exists the potential to perform this sizing using relatively simple instrumentation, i.e. a continuous wave laser of low power and current mode detection.

  9. Sizing of DNA fragments by flow cytometry

    SciTech Connect

    Johnson, M.E.; Goodwin, P.M.; Ambrose, W.P.; Martin, J.C.; Marrone, B.L.; Jett, J.H.; Keller, R.A.

    1993-01-01

    Individual, stained DNA fragments were sized using a modified flow cytometer with high sensitivity fluorescence detection. The fluorescent intercalating dye ethidium homodimer was used to stain stoichiometrically lambda phage DNA and a Kpn I digest of lambda DNA. Stained, individual fragments of DNA were passed through a low average power, focused, mode-locked laser beam, and the fluorescence from each fragment was collected and quantified. Time-gated detection was used to discriminate against Raman scattering from the water solvent. The fluorescence burst from each fragment was related directly to its length, thus providing a means to size small quantities of kilobase lengths of DNA quickly. Improvements of several orders of magnitude in analysis time and sample size over current gel electrophoresis techniques were realized. Fragments of 17.1,29.9, and 48.5 thousand base pairs were well resolved, and were sized in 164 seconds. Less than one pg of DNA was required for analysis. We have demonstrated sizing of individual, stained DNA fragments with resolution approaching that of gel electrophoresis for moderately large fragments, but with significant reductions in the analysis time and the amount of sample required. Furthermore, system response is linear with DNA fragment length, in contrast to the logarithmic response in gel electrophoresis. There exists the potential to perform this sizing using relatively simple instrumentation, i.e. a continuous wave laser of low power and current mode detection.

  10. Sheared DNA fragment sizing: comparison of techniques.

    PubMed Central

    Ordahl, C P; Johnson, T R; Caplan, A I

    1976-01-01

    DNA fragmented by conventional French press shearing procedures (30,000 lbs/in2) has a number-average fragment size of 230 base pairs. This is considerably smaller than the 450 base pairs typically reported for DNA sheared by this method. Comparison of 5 sizing techniques indicates that sheared DNA fragment size is overestimated by either measurement of velocity sedimentation or Kleinschmidt Electron Microscopic visualization. Both adsorption grid electron microscopic visualization and gel electrophoresis yield the most reliable estimates of the mean size of small DNA fragment populations. In addition, the assessment of fragment size distribution (not possible from sedimentation analysis) potentially allows more critical evaluation of DNA hybridization and reassociation kinetic and measurement parameters. Images PMID:1034292

  11. DNA sequence from Cretaceous period bone fragments.

    PubMed

    Woodward, S R; Weyand, N J; Bunnell, M

    1994-11-18

    DNA was extracted from 80-million-year-old bone fragments found in strata of the Upper Cretaceous Blackhawk Formation in the roof of an underground coal mine in eastern Utah. This DNA was used as the template in a polymerase chain reaction that amplified and sequenced a portion of the gene encoding mitochondrial cytochrome b. These sequences differ from all other cytochrome b sequences investigated, including those in the GenBank and European Molecular Biology Laboratory databases. DNA isolated from these bone fragments and the resulting gene sequences demonstrate that small fragments of DNA may survive in bone for millions of years.

  12. Fragment Length of Circulating Tumor DNA.

    PubMed

    Underhill, Hunter R; Kitzman, Jacob O; Hellwig, Sabine; Welker, Noah C; Daza, Riza; Baker, Daniel N; Gligorich, Keith M; Rostomily, Robert C; Bronner, Mary P; Shendure, Jay

    2016-07-01

    Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134-144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132-145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA.

  13. Fragment Length of Circulating Tumor DNA

    PubMed Central

    Underhill, Hunter R.; Kitzman, Jacob O.; Hellwig, Sabine; Welker, Noah C.; Daza, Riza; Gligorich, Keith M.; Rostomily, Robert C.; Shendure, Jay

    2016-01-01

    Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134–144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132–145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA. PMID:27428049

  14. Mutant DNA quantification by digital PCR can be confounded by heating during DNA fragmentation.

    PubMed

    Kang, Qing; Parkin, Brian; Giraldez, Maria D; Tewari, Muneesh

    2016-04-01

    Digital PCR (dPCR) is gaining popularity as a DNA mutation quantification method for clinical specimens. Fragmentation prior to dPCR is required for non-fragmented genomic DNA samples; however, the effect of fragmentation on DNA analysis has not been well-studied. Here we evaluated three fragmentation methods for their effects on dPCR point mutation assay performance. Wild-type (WT) human genomic DNA was fragmented by heating, restriction digestion, or acoustic shearing using a Covaris focused-ultrasonicator. dPCR was then used to determine the limit of blank (LoB) by quantifying observed WT and mutant allele counts of the proto-oncogenes KRAS and BRAF in the WT DNA sample. DNA fragmentation by heating to 95°C, while the simplest and least expensive method, produced a high background mutation frequency for certain KRAS mutations relative to the other methods. This was due to heat-induced mutations, specifically affecting dPCR assays designed to interrogate guanine to adenine (G>A) mutations. Moreover, heat-induced fragmentation overestimated gene copy number, potentially due to denaturation and partition of single-stranded DNA into different droplets. Covaris acoustic shearing and restriction enzyme digestion showed similar LoBs and gene copy number estimates to one another. It should be noted that moderate heating, commonly used in genomic DNA extraction protocols, did not significantly increase observed KRAS mutation counts.

  15. An integrated restriction fragment length polymorphism--amplified fragment length polymorphism linkage map for cultivated sunflower.

    PubMed

    Gedil, M A; Wye, C; Berry, S; Segers, B; Peleman, J; Jones, R; Leon, A; Slabaugh, M B; Knapp, S J

    2001-04-01

    Restriction fragment length polymorphism (RFLP) maps have been constructed for cultivated sunflower (Helianthus annuus L.) using three independent sets of RFLP probes. The aim of this research was to integrate RFLP markers from two sets with RFLP markers for resistance gene candidate (RGC) and amplified fragment length polymorphism (AFLP) markers. Genomic DNA samples of HA370 and HA372, the parents of the F2 population used to build the map, were screened for AFLPs using 42 primer combinations and RFLPs using 136 cDNA probes (RFLP analyses were performed on DNA digested with EcoRI, HindIII, EcoRV, or DraI). The AFLP primers produced 446 polymorphic and 1101 monomorphic bands between HA370 and HA372. The integrated map was built by genotyping 296 AFLP and 104 RFLP markers on 180 HA370 x HA372 F2 progeny (the AFLP marker assays were performed using 18 primer combinations). The HA370 x HA372 map comprised 17 linkage groups, presumably corresponding to the 17 haploid chromosomes of sunflower, had a mean density of 3.3 cM, and was 1326 cM long. Six RGC RFLP loci were polymorphic and mapped to three linkage groups (LG8, LG13, and LG15). AFLP markers were densely clustered on several linkage groups, and presumably reside in centromeric regions where recombination is reduced and the ratio of genetic to physical distance is low. Strategies for targeting markers to euchromatic DNA need to be tested in sunflower. The HA370 x HA372 map integrated 14 of 17 linkage groups from two independent RFLP maps. Three linkage groups were devoid of RFLP markers from one of the two maps.

  16. The Molecular Basis of Genetic Diversity among Cytoplasms of TRITICUM and AEGILOPS Species. II. on the Origin of Polyploid Wheat Cytoplasms as Suggested by Chloroplast DNA Restriction Fragment Patterns

    PubMed Central

    Tsunewaki, Koichiro; Ogihara, Yasunari

    1983-01-01

    In attempts to identify the phylogenetic donors of cytoplasm to Emmer-Dinkel and Timopheevi groups of wheat (Triticum), and the Aegilops kotschyi-Ae. variabilis complex, the restriction fragment patterns of chloroplast DNAs of representative species were compared with those of their putative diploid ancestors. The following seven restriction enzymes were used; BamHI, EcoRI, HindIII, KpnI, PstI, SmaI and XhoI. The restriction fragment patterns of an Emmer and a Dinkel (common) wheat were identical with those of Ae. longissima , and different from those of Ae. aucheri, Ae. bicornis, Ae. searsii, Ae. sharonensis, Ae. speltoides, and T. urartu by 4 to 12 fragments. The restriction fragment patterns of a Timopheevi wheat were identical with those of Ae. aucheri, and different from those of all other diploids by four to nine fragments. The restriction fragment patterns of Ae. variabilis were identical to those of Ae. bicornis and Ae. searsii , and different from those of all other species. Thus, we have concluded that Ae. longissima, Ae. aucheri and Ae. bicornis (or Ae. searsii) were the cytoplasm donors to the Emmer-Dinkel and the Timopheevi groups, and the Ae. kotschyi-Ae. variabilis complex, respectively. A diphyletic origin of Emmer and Timopheevi groups is supported by the present results. PMID:17246126

  17. Effects of DNA Extraction Procedures on Bacteroides Profiles in Fecal Samples From Various Animals Determined by Terminal Restriction Fragment Length Polymorphism Analysis

    EPA Science Inventory

    A major assumption in microbial source tracking is that some fecal bacteria are specific to a host animal, and thus provide unique microbial fingerprints that can be used to differentiate hosts. However, the DNA information obtained from a particular sample may be biased dependi...

  18. DNA fragmentation by charged particle tracks

    NASA Astrophysics Data System (ADS)

    Stenerlöw, B.; Höglund, E.; Carlsson, J.

    High-LET (linear energy transfer) charged particles induce DNA double-strand breaks (DSB) in a non-random fashion in mammalian cells. The clustering of DSB, probably determined by track structure as well as chromatin conformation, results in an excess of small- and intermediate-sized DNA fragments. DNA fragmentation in normal human fibroblasts (GM5758) was analyzed by pulsed-field gel electrophoresis after irradiation with photons ( 60Co) or 125 keV/μm nitrogen ions. Compared to conventional DSB analysis, i.e. assays only measuring the fraction of DNA smaller than a single threshold, the relative biological effectiveness (RBE) for DSB induction increased with 100%. Further, the size distribution of DNA fragments showed a significant dependence on radiation quality, with an excess of fragments up to 1 Mbp. Irradiation of naked genomic DNA without histone proteins increased the DSB yields 25 and 13 times for photons and nitrogen ions, respectively. The results suggest possible roles of both track structure and chromatin organization in the distribution of DNA double-strand breaks along the chromosome.

  19. Derivation of a restriction map of bacteriophage T3 DNA and comparison with the map of bacteriophage T7 DNA.

    PubMed Central

    Bailey, J N; Dembinski, D R; McAllister, W T

    1980-01-01

    The DNA of bacteriophage T3 was characterized by cleavage with seven restriction endonucleases. AvaI, XbaI, BglII, and HindIII each cut T3 DNA at 1 site, KpnI cleaved it at 2 sites, MboI cleaved it at 9 sites, and HpaI cleaved it at 17 sites. The sizes of the fragments produced by digestion with these enzymes were determined by using restriction fragments of T7 DNA as molecular weight standards. As a result of this analysis, the size of T3 DNA was estimated to be 38.74 kilobases. The fragments were ordered with respect to each other and to the genetic map to produce a restriction map of T3 DNA. The location and occurrence of the restriction sites in T3 DNA are compared with those in the DNA of the closely related bacteriophage T7. Images PMID:6251266

  20. DNA fragment sizing and sorting by laser-induced fluorescence

    DOEpatents

    Hammond, Mark L.; Jett, James H.; Keller, Richard A.; Marrone, Babetta L.; Martin, John C.

    1996-01-01

    A method is provided for sizing DNA fragments using high speed detection systems, such as flow cytometry to determine unique characteristics of DNA pieces from a sample. In one characterization the DNA piece is fragmented at preselected sites to produce a plurality of DNA fragments. The DNA piece or the resulting DNA fragments are treated with a dye effective to stain stoichiometrically the DNA piece or the DNA fragments. The fluorescence from the dye in the stained fragments is then examined to generate an output functionally related to the number of nucleotides in each one of the DNA fragments. In one embodiment, the intensity of the fluorescence emissions from each fragment is linearly related to the fragment length. The distribution of DNA fragment sizes forms a characterization of the DNA piece for use in forensic and research applications.

  1. A new assay based on terminal restriction fragment length polymorphism of homocitrate synthase gene fragments for Candida species identification.

    PubMed

    Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata

    2017-03-27

    Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.

  2. Restriction fragment length polymorphism (RFLP) analysis and tuberculosis epidemiology.

    PubMed

    Gómez Marín, J E; Rigouts, L; Villegas Londoño, L E; Portaels, F

    1995-09-01

    In order to study polymorphisms of the DNA insertion sequence 6110 (IS6110) in Mycobacterium tuberculosis strains isolated from Colombian patients, together with resistance to antituberculous medications in the Department of Quindío, Colombia, a prospective study was conducted using a consecutive sample of 59 patients with symptomatic pulmonary tuberculosis whose cases had been confirmed by bacilloscopy, both with and without a history of treatment. The patients, who were participating in the Tuberculosis Control Program of the Regional Health Institute of Quindío in Armenia, included all individuals attending local health centers and hospitals between March and July 1993 who were referred to the regional institute. Sputum specimens from each patient were cultured and subjected to drug sensitivity tests. Subsequently, restriction fragment length polymorphisms (RFLP) of IS6110 from 27 patients were analyzed. The patients' treatment histories were used to classify their cases according to WHO criteria. Forty-five cultures were found positive, 44 for M. tuberculosis and 1 for M. africanum. Initial drug resistance was observed in 4 of 42 new cases, or 9.5% (95% CI: 0.6, 18), 2 showing resistance to isoniazid (INH) and 2 to isoniazid plus streptomycin (INH-SM). Acquired resistance was observed in 2 of the 3 chronic cases and relapses, the bacteria being resistant to isoniazid, rifampicin, and streptomycin (INH-RM-SM) in one case and to isoniazid, ethambutol, rifampicin, and streptomycin (INH-EMB-RM-SM) in the other. In those 27 strains subjected to RFLP analysis, the number of copies of IS6110 ranged from 6 to 17. Similarity coefficients revealed five distinct groups of strains. Overall, the RFLP analysis permitted most of the strains to be distinguished from one another, implying that the polymorphisms involved are sufficient to permit effective employment of this technique, which appears to have considerable potential for use in epidemiologic studies and in work

  3. Characterization of Coccidioides immitis isolates by restriction fragment length polymorphisms.

    PubMed Central

    Zimmermann, C R; Snedker, C J; Pappagianis, D

    1994-01-01

    The marked increase in the number of cases of coccidioidomycosis in California in 1992 led to a study of isolates from various patients and environmental sources by restriction fragment length polymorphism (RFLP) analysis. Of 15 different isolates, most of the isolates (13 of 15) from California and 1 from Venezuela yielded one main RFLP pattern with evidence of two subgroups. The other two isolates (both from patients in the San Joaquin Valley of California) yielded a different RFLP pattern. Images PMID:7883896

  4. DNA fragmentation in mouse organs during endotoxic shock.

    PubMed Central

    Bohlinger, I.; Leist, M.; Gantner, F.; Angermüller, S.; Tiegs, G.; Wendel, A.

    1996-01-01

    The systemic inflammatory response syndrome has still an unpredictable outcome, and patients often die of multiple organ failure despite circulatory stabilization therapy. The still incompletely understood pathophysiological mechanisms include organ damage due to direct toxic actions of cytokines elicited by overactivation of the host response. To study this process of organ failure in experimental septic shock, we injected mice with a lethal dose of endotoxin and examined apoptotic and necrotic tissue damage biochemically, histologically, and ultrastructurally. Endotoxin administration caused oligonucleosomal as well as random DNA fragmentation in liver, lung, kidney, and intestine. In the liver, DNA fragmentation was not restricted to hepatocytes but also occurred in nonparenchymal cells. The DNA fragmentation was mediated by tumor necrosis factor and attenuated by endogenous nitric oxide release. Unlike the situation in D-galactosamine-sensitized mice, in which injection or release of tumor necrosis factor causes massive hepatocyte apoptosis, liver failure due to high doses of endotoxin was characterized by single-cell necrosis, a low incidence of apoptosis, and simultaneous damage to nonparenchymal cells. We conclude that, even though endotoxin causes cytokine-mediated DNA fragmentation in several organs including the liver, hepatocyte apoptosis itself seems to be a minor phenomenon in high-dose endotoxic shock in mice. Images Figure 2 Figure 3 Figure 4 Figure 5 PMID:8863685

  5. Susceptibility to multiple sclerosis associated with an immunoglobulin gamma 3 restriction fragment length polymorphism.

    PubMed Central

    Gaiser, C N; Johnson, M J; de Lange, G; Rassenti, L; Cavalli-Sforza, L L; Steinman, L

    1987-01-01

    Susceptibility to multiple sclerosis (MS) has been linked to the immunoglobulin G (Gm) markers as well as HLA-DR genes. We have used a genomic Ig gamma 1 probe which detects polymorphisms in the gamma 1, gamma 2, gamma 3 and pseudogamma genes to identify restriction fragment length polymorphisms associated with MS. A negative association was found between a 5.9-kilobase (kb) Bst EII gamma 3 fragment and MS. Southern blot analysis of genomic DNA revealed the presence of this fragment in 84 of 140 (60.0%) controls, but in only 17 of 59 (28.8%) MS patients. The frequency of the fragment in 47 myasthenia gravis and 16 Graves' disease patients was similar to that in controls, 60.0 and 62.5%, respectively. Images PMID:2878940

  6. Factors affecting SFHR gene correction efficiency with single-stranded DNA fragment

    SciTech Connect

    Tsuchiya, Hiroyuki; Harashima, Hideyoshi; Kamiya, Hiroyuki . E-mail: hirokam@pharm.hokudai.ac.jp

    2005-11-04

    A 606-nt single-stranded (ss) DNA fragment, prepared by restriction enzyme digestion of ss phagemid DNA, improves the gene correction efficiency by 12-fold as compared with a PCR fragment, which is the conventional type of fragment used in the small fragment homologous replacement method [H. Tsuchiya, H. Harashima, H. Kamiya, Increased SFHR gene correction efficiency with sense single-stranded DNA, J. Gene Med. 7 (2005) 486-493]. To reveal the characteristic features of this gene correction with the ss DNA fragment, the effects on the gene correction in CHO-K1 cells of the chain length, 5'-phosphate, adenine methylation, and transcription were studied. Moreover, the possibility that the ss DNA fragment is integrated into the target DNA was examined with a radioactively labeled ss DNA fragment. The presence of methylated adenine, but not the 5'-phosphate, enhanced the gene correction efficiency, and the optimal length of the ss DNA fragment ({approx}600 nt) was determined. Transcription of the target gene did not affect the gene correction efficiency. In addition, the target DNA recovered from the transfected CHO-K1 cells was radioactive. The results obtained in this study indicate that length and adenine methylation were important factors affecting the gene correction efficiency, and that the ss DNA fragment was integrated into the double-stranded target DNA.

  7. Screening of Israeli Holstein-Friesian cattle for restriction fragment length polymorphisms using homologous and heterologous deoxyribonucleic acid probes.

    PubMed

    Hallerman, E M; Nave, A; Soller, M; Beckmann, J S

    1988-12-01

    Genomic DNA of Israeli Holstein-Friesian dairy cattle were screened with a battery of 17 cloned or subcloned DNA probes in an attempt to document restriction fragment length polymorphisms at a number of genetic loci. Restriction fragment length polymorphisms were observed at the chymosin, oxytocin-neurophysin I, lutropin beta, keratin III, keratin VI, keratin VII, prolactin, and dihydrofolate reductase loci. Use of certain genomic DNA fragments as probes produced hybridization patterns indicative of satellite DNA at the respective loci. Means for distinguishing hybridizations to coding sequences for unique genes from those to satellite DNA were developed. Results of this study are discussed in terms of strategy for the systematic development of large numbers of bovine genomic polymorphisms.

  8. A highly bent fragment of Crithidia fasciculata kinetoplast DNA.

    PubMed

    Kitchin, P A; Klein, V A; Ryan, K A; Gann, K L; Rauch, C A; Kang, D S; Wells, R D; Englund, P T

    1986-08-25

    Kinetoplast DNA minicircles from Crithidia fasciculata contain a single major region of bent helix. Restriction fragments containing this bent helix have electrophoretic behavior on polyacrylamide gels which is much more anomalous than that of previously studied bent fragments. Therefore, the C. fasciculata fragments probably have a more extreme curvature. Sequencing part of a cloned minicircle revealed an unusual structure for the bent region. In a sequence of 200 bases, the bent region contains 18 runs of 4-6 As with 16 of these runs in the same strand. In some parts of this sequence the A runs are regularly spaced with a periodicity of about 10 base pairs. This spacing is nearly in phase with the twist of the DNA helix. This same sequence arrangement has been observed in other bent fragments, but the number of A runs is much greater in this C. fasciculata sequence. It is likely that there are small bends associated with each A run which, because of their periodic spacing, add up to produce substantial curvature in this molecule. In addition to having highly anomalous electrophoretic behavior, the fragment has unusual circular dichroism spectra. Its spectrum in the absence of ethanol is that of B DNA, but ethanol in the concentration range of 51-71% (w/w) induces changes to forms which are different from those of any well characterized DNA structure. The C. fasciculata bent helix is neither cleaved by S1 nuclease nor modified by bromoacetaldehyde under conditions in which other unusual DNA structures (such as cruciforms or B-Z junctions) are susceptible to attack by these reagents. Finally, a two-dimensional agarose gel analysis of a family of topoisomers of a plasmid containing the bent helix revealed no supercoil-induced relaxation.

  9. Polymerase chain reaction-restriction fragment length polymorphism authentication of raw meats from game birds.

    PubMed

    Rojas, María; González, Isabel; Fajardo, Violeta; Martín, Irene; Hernández, Pablo E; García, Teresa; Martín, Rosario

    2008-01-01

    Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis has been applied to the identification of meats from quail (Coturnix coturnix), pheasant (Phasianus colchicus), red-legged partridge (Alectoris rufa), guinea fowl (Numida meleagris), capercaillie (Tetrao urogallus), Eurasian woodcock (Scolopax rusticola), woodpigeon (Columba palumbus), and song thrush (Turdus philomelos). PCR amplification was performed using a set of primers flanking a conserved region of approximately 720 base pairs (bp) from the mitochondrial 12S rRNA gene. Restriction site analysis based on sequence data from this DNA fragment permitted the selection of AluI and BfaI endonucleases for species identification. The restriction profiles obtained when amplicons were digested with the chosen enzymes allowed the unequivocal identification of all game bird species analyzed. However, the use of the PCR-RFLP technique described is limited to raw meat authentication. It is not suitable for cooked products because thermal treatment strongly accelerates DNA degradation leading to difficulties in amplifying the 720 bp fragment.

  10. Regional localization of chromosome 3-specific DNA fragments by using a hybrid cell deletion mapping panel.

    PubMed Central

    Gerber, M J; Drabkin, H A; Firnhaber, C; Miller, Y E; Scoggin, C H; Smith, D I

    1988-01-01

    A series of human chromosome 3-specific DNA fragments isolated and characterized from a lamda phage genomic library were regionally localized on human chromosome 3. This was accomplished using filter hybridization blot analysis of a human chromosome 3 hybrid cell deletion mapping panel. Twenty-three new anonymous DNA fragments were assigned to one of four physical regions of chromosome 3. Seventeen DNA fragments were mapped to the long arm of chromosome 3, including one DNA fragment that demonstrated a restriction fragment length polymorphism (RFLP). Five DNA fragments were assigned to 3p14.2----pter, including one highly polymorphic fragment sublocalized at 3p25----pter by in situ hybridization. This DNA fragment is the second reported distal 3p polymorphic probe. One DNA fragment was localized to 3p14----p14.2. In addition, three fragments previously assigned to chromosome 3 were confirmed. Polymorphic DNA probes DNF15S2 (formerly D1S1) and D3S2 were mapped to 3p14.2----pter. The previous 3p25 in situ localization of the c-raf-1 oncogene was supported by deletion panel mapping. The physical localization of these twenty-three new DNA fragments has more than doubled the number of cloned DNA fragments assigned to chromosome 3. These and future regional assignments of DNA fragment probes will facilitate construction of both a physical and genetic linkage map of chromosome 3. They may also be useful in characterizing the chromosomal and molecular aberrations involved in small-cell lung cancer (SCLC), renal cell carcinoma, other malignancies, and the 3p14.2 common fragile site. Images p[446]-a Figure 2 Figure 3 PMID:2902784

  11. Polymerase chain reaction-restriction fragment-length polymorphism method to distinguish Liriomyza huidobrensis from L. Langei (Diptera: Agromyzidae) applied to three recent leafminer invasions.

    PubMed

    Scheffer, S J; Wijesekara, A; Visser, D; Hallett, R H

    2001-10-01

    A molecular method is presented for differentiating the morphologically cryptic leafminers Liriomyza langei Frick and L. huidobrensis (Blanchard). This method requires polymerase chain reaction (PCR) amplification of a 1031-bp region of mitochondrial cytochrome oxidase DNA followed by restriction fragment analysis using the restriction enzymes SpeI and EcoRV. Spel cuts the mitochondrial fragment of L. langei into two fragments, but does not cut the L. huidobrensis fragment. EcoRV cuts the L. huidobrensis fragment into two fragments, but does not cut the L. langei fragment. This PCR-restriction fragment-length polymorphism (RFLP) method is faster and less costly than DNA sequencing,which is currently the only other way to differentiate these two species. We apply the method to samples from recently introduced leafminer populations in Sri Lanka, Canada, and South Africa and find that the invasive leafminer in all three locations is L. huidobrensis.

  12. Ligation-mediated PCR amplification of specific fragments from a class-II restriction endonuclease total digest.

    PubMed Central

    Guilfoyle, R A; Leeck, C L; Kroening, K D; Smith, L M; Guo, Z

    1997-01-01

    A method is described which permits the ligation- mediated PCR amplification of specific fragments from a Class-II restriction endonuclease total digest. Feasibility was tested using Bcl I and phage lambda DNA as a model enzyme and amplicon system, respectively. Bcl I is one of many widely used restriction enzymes which cleave at palindromic recognition sequences and leave 5'-protruding ends of defined sequence. Using a single pair of universal primers, a given fragment can be specifically amplified after joining the fragments to adaptors consisting of a duplex primer region and a 9-nucleotide protruding single-stranded 5'-end containing the sequence complementary to the cleaved restriction site and a 4-nucleotide 'indexing sequence.' The protruding strand anneals to a restriction fragment by displacing its corresponding strand in the same fragment-specific indexing sequence located juxtaposed to the restriction site. The adaptor is covalently linked to the restriction fragment by T4 DNA ligase, and amplification is carried out under conditions for long-distance PCR using the M13 forward and reverse primers. The technique discriminated robustly between mismatches and perfect matches for the 16 indexing sequences tested to allow individual lambda Bcl I fragments to be amplified from their respective adaptor pairs. A strategy is proposed enabling a non-cloning approach to the accession, physical mapping and sequencing of genomic DNA. The method could also have application in high-throughput genetic mapping and fingerprinting and should expand the enzyme base for ligation- mediated indexing technology which has previously been limited to the Class-IIS and IP restriction endonucleases. PMID:9108171

  13. DNA fragment sizing and sorting by laser-induced fluorescence

    SciTech Connect

    Jett, J.H.; Hammond, M.L.; Keller, R.A.; Marrone, B.L.; Martin, J.C.

    1992-12-31

    A method is provided for obtaining DNA fingerprints using high speed detection systems, such as flow cytometry to determine unique characteristics of DNA pieces from a selected sample. In one characterization the DNA piece is fragmented at preselected sites to produce a plurality of DNA fragments. The DNA piece or the resulting DNA fragments are treated with a dye effective to stain stoichiometrically the DNA fragments. The fluorescence from the dye in the stained fragments is then examined to generate an output functionally related to the number of nucleotides in each one of the DNA fragments. In one embodiment, the intensity of the fluorescence emissions from each fragment is directly proportional to the fragment length. Additional dyes can be bound to the DNA piece and DNA fragments to provide information additional to length information. Oligonucleotide specific dyes and/or hybridization probes can be bound to the DNA fragments to provide information on oligonucleotide distribution or probe hybridization to DNA fragments of different sizes.

  14. Optical selection and collection of DNA fragments

    DOEpatents

    Roslaniec, Mary C.; Martin, John C.; Jett, James H.; Cram, L. Scott

    1998-01-01

    Optical selection and collection of DNA fragments. The present invention includes the optical selection and collection of large (>.mu.g) quantities of clonable, chromosome-specific DNA from a sample of chromosomes. Chromosome selection is based on selective, irreversible photoinactivation of unwanted chromosomal DNA. Although more general procedures may be envisioned, the invention is demonstrated by processing chromosomes in a conventional flow cytometry apparatus, but where no droplets are generated. All chromosomes in the sample are first stained with at least one fluorescent analytic dye and bonded to a photochemically active species which can render chromosomal DNA unclonable if activated. After passing through analyzing light beam(s), unwanted chromosomes are irradiated using light which is absorbed by the photochemically active species, thereby causing photoinactivation. As desired chromosomes pass this photoinactivation point, the inactivating light source is deflected by an optical modulator; hence, desired chromosomes are not photoinactivated and remain clonable. The selection and photoinactivation processes take place on a microsecond timescale. By eliminating droplet formation, chromosome selection rates 50 times greater than those possible with conventional chromosome sorters may be obtained. Thus, usable quantities of clonable DNA from any source thereof may be collected.

  15. Effect of ultrasound on the separation of DNA fragments in agarose gel electrophoresis

    SciTech Connect

    Ma, Yinfa; Yeung, E.S. )

    1990-06-01

    Since its first use in 1966 interest in and the applications of electrophoresis of DNA fragments in agarose gel have grown rapidly. Nowadays, agarose gel electrophoresis has become a standard technique with high resolving power for the analysis of DNA structure, for example for the determination of the length of DNA fragments obtained by the action of restriction enzymes. The electrophoretic mobility ({mu}) of DNA fragments is influenced by various parameters-molecular weight, gel concentration, temperature, electric field, and DNA-agarose affinity. A comprehensive study of the influence of these main parameters has been reported. In this paper, the authors investigate a new effect on the electrophoretic mobility of DNA fragments in agarose gels, viz. the influence of ultrasound.

  16. Structural aspects of DNA repair: the role of restricted diffusion.

    PubMed

    Minsky, Abraham

    2003-10-01

    DNA repair and protection processes impose arduous demands upon cellular systems. The high-fidelity recombinational repair pathway entails a rapid genome-wide search for sequence homology. The efficiency of this transaction is intriguing in light of the uniquely adverse diffusion traits of the involved species. DNA protection in cells exposed to continuous stress or prolonged starvation is equally enigmatic, because the ability of such cells to deploy energy-dependent enzymatic repair processes is hampered as a result of progressive perturbation of the intracellular energy balance. DNA repair in radio-resistant bacteria, which involves accurate chromosome reconstruction from multiple fragments, is similarly associated with apparently insurmountable logistical obstacles. The studies reviewed here imply that the mechanisms deployed to overcome these intrinsic hurdles have a basic common denominator. In all these cases, condensed and ordered chromatin assemblies are formed, within which molecular diffusion is restricted and confined. Restricted diffusion thus appears as a general strategy that is exploited by nature to facilitate homologous search, to promote energy-independent DNA protection through physical DNA sequestration and attenuated accessibility to damaging agents, and to enable error-free repair of multiple double-strand DNA breaks.

  17. Optimizing restriction fragment fingerprinting methods for ordering large genomic libraries

    SciTech Connect

    Branscomb, E.; Slezak, T.; Pae, R.; Carrano, A.V. ); Galas, D.; Waterman, M. )

    1990-01-01

    The authors present a statistical analysis of the problem of ordering large genomic cloned libraries through overlap detection based on restriction fingerprinting. Such ordering projects involve a large investment of effort involving many repetitious experiments. Their primary purpose here is to provide methods of maximizing the efficiency of such efforts. To this end, they adopt a statistical approach that uses the likelihood ratio as a statistic to detect overlap. The main advantages of this approach are that (1) it allows the relatively straightforward incorporation of the observed statistical properties of the data; (2) it permits the efficiency of a particular experimental method for detecting overlap to be quantitatively defined so that alternative experimental designs may be compared and optimized; and (3) it yields a direct estimate of the probability that any two library members overlap. This estimate is a critical tool for the accurate, automatic assembly of overlapping sets of fragments into islands called contigs.' These contigs must subsequently be connected by other methods to provide an ordered set of overlapping fragments covering the entire genome.

  18. Identification of infectious agents in onychomycoses by PCR-terminal restriction fragment length polymorphism.

    PubMed

    Verrier, Julie; Pronina, Marina; Peter, Corinne; Bontems, Olympia; Fratti, Marina; Salamin, Karine; Schürch, Stéphanie; Gindro, Katia; Wolfender, Jean-Luc; Harshman, Keith; Monod, Michel

    2012-03-01

    A fast and reliable assay for the identification of dermatophyte fungi and nondermatophyte fungi (NDF) in onychomycosis is essential, since NDF are especially difficult to cure using standard treatment. Diagnosis is usually based on both direct microscopic examination of nail scrapings and macroscopic and microscopic identification of the infectious fungus in culture assays. In the last decade, PCR assays have been developed for the direct detection of fungi in nail samples. In this study, we describe a PCR-terminal restriction fragment length polymorphism (TRFLP) assay to directly and routinely identify the infecting fungi in nails. Fungal DNA was easily extracted using a commercial kit after dissolving nail fragments in an Na(2)S solution. Trichophyton spp., as well as 12 NDF, could be unambiguously identified by the specific restriction fragment size of 5'-end-labeled amplified 28S DNA. This assay enables the distinction of different fungal infectious agents and their identification in mixed infections. Infectious agents could be identified in 74% (162/219) of cases in which the culture results were negative. The PCR-TRFLP assay described here is simple and reliable. Furthermore, it has the possibility to be automated and thus routinely applied to the rapid diagnosis of a large number of clinical specimens in dermatology laboratories.

  19. MULTIPLE ENZYME RESTRICTION FRAGMENT LENGTH POLYMORPHISM ANALYSIS FOR HIGH RESOLUTION DISTINCTION OF PSEUDOMONAS (SENSU STRICTO) 16S RRNA GENES

    EPA Science Inventory

    Pseudomonas specific 16S rDNA PCR amplification and multiple enzyme restriction fragment length polymorphism (MERFLP) analysis using a single digestion mixture of Alu I, Hinf I, Rsa I, and Tru 9I distinguished 150 published sequences and reference strains of authentic Pseudomonas...

  20. Restriction fragment length polymorphism catalog for molecular identification of Japanese Tetranychus spider mites (Acari: Tetranychidae).

    PubMed

    Osakabe, Masahiro; Kotsubo, Yu; Tajima, Ryusen; Hinomoto, Norihide

    2008-08-01

    Species identification is a basic issue in biosecurity. Polymerase chain reaction (PCR) followed by restriction fragment length polymorphism (RFLP) is a useful molecular diagnostic tool for species identification. However, the lack of transferability of data has been a serious shortcoming of this method. A RFLP catalog, i.e., a graph of PCR-RFLP patterns expected from sequence data, was devised as a tool to facilitate PCR-RFLP data sharing among laboratories. Twelve species of Tetranychus spider mites have been recorded in Japan to date. In this study, we analyzed DNA sequences of the internal transcribed spacer (ITS) region in nuclear ribosomal DNA of 11 Tetranychus species. For the species identification using PCR-RFLP, we chose six candidates from 131 restriction endonucleases and developed an RFLP catalog of all known Japanese Tetranychus species except Tetranychus neocaledonicus André. The RFLP catalog revealed that most Tetranychus species had diagnostic restriction fragments. The RFLP catalog is transferable and simple molecular diagnostic tool, and it has the ability to add more species and newly found intraspecific variations. Therefore, we believe that the RFLP catalog will contribute to biosecurity as a practical diagnostic tool for species identification of spider mites.

  1. Large-scale production of palindrome DNA fragments

    SciTech Connect

    Palmer, E.L.; Gewiess, A.; Harp, J.M.

    1995-10-10

    Our structural studies of nucleosomes necessitated the production of over 100 mg of a 146-bp perfect palindrome DNA for use in the reconstitution of perfectly symmetrical nucleosome core particles for detailed X-ray crystallographic analysis. The propagation of palindromic DNA sequences by bacterial culture is hindered by the instability of these sequences during bacterial replication and recombination. While the loss of some palindrome sequences can be elminated by the use of sbcB or sbcC mutants of Escherichia coli, not all palindrome-containing plasmids are faithfully maintained by these strains. The production of large quantities of palindrome DNA can therefore be extremely difficult. After trying several approaches, we were able to develop a reliable procedure for production of large quantities of palindrome DNA that involves production of plasmid containing multiple copies of the repeating unit of the palindrome which are isolated by restriction digestion and ligated in vitro to form the palindrome DNA. The procedure has resulted in the production of over 20 mg of a 146-bp DNA fragment in 2 weeks.

  2. [Comparative restriction analysis of chromosomal DNA of strains of Photobacterium leiognathi].

    PubMed

    Videlets, I Iu; Starodubtseva, L I; Podgornova, G P; Lutskaia, N I; Shenderov, A N

    1988-01-01

    Chromosomal DNA in 5 hereditary variants occurring in Photobacterium leiognathi population was subjected to restriction analysis. The variants differed in the levels and regulation of luminescence and colony morphology. Agarose electrophoresis of DNA fragments isolated after exposure to Hind II, Bam HI, Bgl I and Pst I restriction endonucleases revealed respectively 38, 28, 35 and 29 fragments equally distributed by their molecular weights. Electrophoregrams of the 5 strains were absolutely identical. After exposure of DNA of all the strains to PVu II, Xho II, Sal GI and Eco RI restriction endonucleases there were detected no fragments. The pleoiotropic genetic variation in these strains was not associated with large deletions or amplification of chromosomal DNA regions.

  3. A simple restriction fragment PCR approach for discrimination of humanpathogenic Old World animal Orthopoxvirus species.

    PubMed

    Huemer, Hartwig P; Hönlinger, Bettina; Höpfl, Reinhard

    2008-02-01

    There are reliable polymerase chain reaction assays available for exclusion of Variola virus from other poxviruses. However, the discrimination of humanpathogenic animal Orthopoxviridae is more challenging because of the high genomic conservation. Based on the variability of the A36R gene, we describe a simple 20 min PCR assay followed by a 1 h digest with 3 different restriction enzymes. This assay enables rapid discrimination between Cowpox virus and Monkeypox virus and discrimination of the most prevalent members of the Vaccinia virus and Camelpox virus. The test was orthopoxvirus specificand did not react with parapox (Orf) virus. Moreover, the amplified fragments were also well suited for additional genotyping by direct DNA sequencing.

  4. Generation of competitor DNA fragments for quantitative PCR.

    PubMed

    Uberla, K; Platzer, C; Diamantstein, T; Blankenstein, T

    1991-11-01

    A convenient and generally applicable method for the generation of competitor DNA fragments for quantitative PCR is described. Using mouse-specific primers, fragments are amplified from DNA of an evolutionarily distantly related species under low-stringency annealing conditions. Because these artificially created fragments contain the mouse primer specific ends, they can be used for the quantification of the mouse DNA amplified by these primers. Competitor DNA fragments that differ in size from the corresponding mouse DNA are selected to distinguish both fragments visually by gel electrophoresis. Competitor DNA fragments were generated for mouse beta-actin, interleukin-1, and tumor necrosis factor (TNF). Co-amplification of beta-actin cDNA for adjustment of equal amounts of input cDNA and subsequently TNF cDNA from lipopolysaccharide (LPS)-activated and nonactivated spleen cells with serial dilutions of the respective competitor DNA fragments allowed a semiquantitative comparison of the ratio of TNF mRNA present in both cDNA samples. Under certain conditions, the competitor DNA fragments can be used to determine the approximate molar concentration of a mRNA.

  5. Restriction endonuclease analysis of mitochondrial DNA from grande and genetically characterized cytoplasmic petite clones of Saccharomyces cerevisiae.

    PubMed

    Morimoto, R; Lewin, A; Hsu, H J; Rabinowitz, M; Fukuhara, H

    1975-10-01

    Digestion of grande mitochondrial DNA (mtDNA) BY EcoRI restriction endonuclease gives rise to nine fragments with a total molecular weight of 51.8 x 10(6). HindIII digestion yields six fragments with a similar total molecular weight. Specific restriction fragments can be detected despite the fact that yeast mtDNA consists of a heterogeneous distribution of randomly broken molecules. Digestion patterns of 10 genetically characterized petite clones containing various combinations of five antiobiotic resistance markers indicate that the petite mtDNA predominantly represents deletion of the grande genome. The petite mtDNAs contained up to seven EcoRI restriction fragments which comigrate with grande restriction fragments, and at least one fragment that did not correspond to any in the grande. Some strains contained multiple fragments with mobility different from that of grande; these fragments were usually present in less than molar concentrations. The genetic markers were associated with individual sets of restriction fragments. However, several internal inconsistencies prevent the construction of a definitive genetic fragment map. These anomalies, together with the digestion patterns, provide strong evidence that, in addition to single contiguous deletion, other changes such as multiple deletion and heterogeneity of mtDNA populations are present in some of the petite mtDNAs.

  6. Using Terminal Restriction Fragment Length Polymorphism (T-RFLP) Analysis to Assess Microbial Community Structure in Compost Systems

    NASA Astrophysics Data System (ADS)

    Tiquia, Sonia M.

    Terminal restriction fragment length polymorphism (T-RFLP) analysis of PCR-amplified genes is a widely used fingerprinting technique in composting systems. This analysis is based on the restriction endonuclease digestion of fluorescently end-labeled PCR products. The digested product is mixed with a DNA size standard, itself labeled with a distinct fluorescent dye, and the fragments are then separated by capillary or gel electrophoresis using an automated sequencer. Upon analysis, only the terminal end-labeled restriction fragments are detected. An electropherogram is produced, which shows a profile of compost microbial community as a series of peaks of varying height. This technique has also been effectively used in the exploration of complex microbial environments and in the study of bacterial, archaeal, and eukaryal populations in natural habitats.

  7. Polymerase chain reaction-restriction fragment length polymorphism analysis of a 16S rRNA gene fragment for authentication of four clam species.

    PubMed

    Fernandez, Alicia; García, Teresa; Gonzalez, Isabel; Asensio, Luis; Rodriguez, Miguel Angel; Hernández, Pablo E; Martin, Rosario

    2002-04-01

    Specific identification of four clam species, Ruditapes decussatus (grooved carpet shell), Venerupis pullastra (pullet carpet shell), Ruditapes philippinarum (Japanese carpet shell), and Venerupis rhomboides (yellow carpet shell), was achieved by polymerase chain reaction-restriction fragment length polymorphism analysis of a fragment of the mitochondrial 16S rRNA gene. Amplification of DNA isolated from the foot muscle produced fragments of 511 bp for V. pullastra, 523 bp for R. decussatus, 545 bp for R. philippinarum, and 502 bp for V. rhomboides. The restriction profiles obtained by agarose gel electrophoresis when amplicons were digested with endonucleases BsmAI and BsrI allowed unequivocal identification of the four clam species. This approach would be less costly, simpler, and quicker than conventional sequencing of polymerase chain reaction products followed by detailed comparison of individual sequences, especially when large numbers of samples need to be analyzed.

  8. Cloning and nucleotide sequence of a specific DNA fragment from Paracoccidioides brasiliensis.

    PubMed

    Goldani, L Z; Maia, A L; Sugar, A M

    1995-06-01

    We cloned and sequenced a species-specific 110-bp DNA fragment from Paracoccidioides brasiliensis. The DNA fragment was generated by PCR with primers complementary to the rat beta-actin gene under a low annealing temperature. Comparison of the nucleotide sequence, after excluding the primers, with those in the GenBank database identified approximately 60% homology with an exon of a major surface glycoprotein gene from Pneumocystis carinii and a fragment of unknown function in Saccharomyces cerevisiae chromosome VIII. By Southern hybridization analysis, the 32P-labelled fragment detected 1.0- and 1.9-kb restriction fragments within whole-cell genomic DNA of P. brasiliensis digested with HindIII and PstI, respectively, but failed to hybridize to genomic DNAs from Candida albicans, Blastomyces dermatitidis, Cryptococcus neoformans, Aspergillus fumigatus, Saccharomyces cerevisiae, Pneumocystis carinii, rat tissue, or humans under low-stringency hybridization conditions. Additionally, the specific DNA fragment from three different P. brasiliensis isolates (Pb18, RP18, RP17) was amplified by PCR with primers mostly complementary to nonactin sequences of the 110-bp DNA fragment. In contrast, there were no amplified products from other fungus genomic DNAs previously tested, including Histoplasma capsulatum. To date, this is the first species-specific DNA fragment cloned from P. brasiliensis which might be useful as a diagnostic marker for the identification and classification of different P. brasiliensis isolates.

  9. Cloning and nucleotide sequence of a specific DNA fragment from Paracoccidioides brasiliensis.

    PubMed Central

    Goldani, L Z; Maia, A L; Sugar, A M

    1995-01-01

    We cloned and sequenced a species-specific 110-bp DNA fragment from Paracoccidioides brasiliensis. The DNA fragment was generated by PCR with primers complementary to the rat beta-actin gene under a low annealing temperature. Comparison of the nucleotide sequence, after excluding the primers, with those in the GenBank database identified approximately 60% homology with an exon of a major surface glycoprotein gene from Pneumocystis carinii and a fragment of unknown function in Saccharomyces cerevisiae chromosome VIII. By Southern hybridization analysis, the 32P-labelled fragment detected 1.0- and 1.9-kb restriction fragments within whole-cell genomic DNA of P. brasiliensis digested with HindIII and PstI, respectively, but failed to hybridize to genomic DNAs from Candida albicans, Blastomyces dermatitidis, Cryptococcus neoformans, Aspergillus fumigatus, Saccharomyces cerevisiae, Pneumocystis carinii, rat tissue, or humans under low-stringency hybridization conditions. Additionally, the specific DNA fragment from three different P. brasiliensis isolates (Pb18, RP18, RP17) was amplified by PCR with primers mostly complementary to nonactin sequences of the 110-bp DNA fragment. In contrast, there were no amplified products from other fungus genomic DNAs previously tested, including Histoplasma capsulatum. To date, this is the first species-specific DNA fragment cloned from P. brasiliensis which might be useful as a diagnostic marker for the identification and classification of different P. brasiliensis isolates. PMID:7650207

  10. Use of restriction fragment length polymorphisms to investigate strain variation within Neisseria meningitidis

    SciTech Connect

    Williams, S.D.

    1989-01-01

    Similarity within bacterial populations is difficult to assess due to the limited number of characters available for evaluation and the heterogeneity of bacterial species. Currently, the preferred method used to evaluate the structure of bacterial populations is multilocus enzyme electrophoresis. However, this method is extremely cumbersome and only offers an indirect measure of genetic similarities. The development of a more direct and less cumbersome method for this purpose is warranted. Restriction fragment length polymorphism analysis was evaluated as a tool for use in the study of bacterial population structures and in the epidemiology and surveillance of infectious disease. A collection of Neisseria meningitidis was available for use in the investigation of this technique. Neisseria meningitidis is the causative agent of epidemic cerebrospinal meningitis and septicemia as well as a variety of other clinical manifestations. Each isolate in the collection was defined in terms of serogroup specificity, clinical history, geographic source, and date of isolation. Forty-six strains were chosen for this study. The DNA from each strain was restricted with Pst1 and EcoR1 and electrophoresed on agarose gels. The DNA was transferred to nylon filters and hybridized with P{sup 32} labeled DNA probes. Two randomly generated probes and a gene-specific probe were used to estimate the genetic similarities between and among the strains in the study population. A total of 28 different restriction fragment migration types were detected by the probes used. Data obtained from the RFLP analysis was analyzed by cluster analysis and multivariate statistical methods. A total of 7 clones groups were detected. Two of these appear to be major clones that comprise 35% of the population.

  11. Use of Restriction Fragment Length Polymorphisms to Investigate Strain Variation Within Neisseria Meningitidis.

    NASA Astrophysics Data System (ADS)

    Williams, Shelley Diane

    Similarity within bacterial populations is difficult to assess due to the limited number of characters available for evaluation and the heterogeneity of bacterial species. Currently, the preferred method used to evaluate the structure of bacterial populations is multilocus enzyme electrophoresis. However, this method is extremely cumbersome and only offers an indirect measure of genetic similarities. The development of a more direct and less cumbersome method for this purpose is warranted. Restriction fragment length polymorphism analysis was evaluated as a tool for use in the study of bacterial population structures and in the epidemiology and surveillance of infectious disease. A collection of Neisseria meningitidis was available for use in the investigation of this technique. Neisseria meningitidis is the causative agent of epidemic cerebrospinal meningitis and septicemia as well as a variety of other clinical manifestations. Each isolate in the collection was defined in terms of serogroup specificity, clinical history, geographic source, and date of isolation. Forty -six strains were chosen for this study. The DNA from each strain was restricted with Pst1 and EcoR1 and electrophoresed on agarose gels. The DNA was transferred to nylon filters and hybridized with P ^{32} labeled DNA probes. Two randomly generated probes and a gene-specific probe were used to estimate the genetic similarities between and among the strains in the study population. A total of 28 different restriction fragment migration types were detected by the probes used. Data obtained from the RFLP analysis was analysed by cluster analysis and multivariate statistical methods. A total of 7 clones groups were detected. Two of these appear to be major clones that comprise 35% of the population. This analysis demonstrates the lack of structure within Neisseria meningitidis due primarily to a heterogenous population and the lack of geographic segregation. The potential utility of this technique as a

  12. Identification of cagA tyrosine phosphorylation DNA motifs in Helicobacter pylori isolates from peptic ulcer patients by novel PCR-restriction fragment length polymorphism and real-time fluorescence PCR assays.

    PubMed

    Owen, Robert J; Sharp, Sally I; Chisholm, Stephanie A; Rijpkema, Sjoerd

    2003-07-01

    Cag pathogenicity island-containing Helicobacter pylori (type I) induces signal transduction pathways resulting in tyrosine phosphorylation of proteins adjacent to the site of bacterial adhesion on host gastric epithelial cells. Conventional block PCR-restriction fragment length polymorphism (RFLP) and real-time LightCycler (LC) PCR hybridization assays, validated by direct sequencing, were designed to test for the presence of three nucleotide sequences corresponding to tyrosine phosphorylation motifs (TPMs) A, B, and C in 84 isolates of H. pylori type I from patients in England. Overall, the PCR assays demonstrated that one or more TPMs were present in 62 strains (75%). Motif A was common (71% of strains), whereas motifs B and C were rarer (8% of strains). Strains lacking a TPM were typically vacuolating cytotoxin genotype vacA m2. Motif A was widely distributed in relation to disease severity and was more commonly (but not significantly [P = 0.071]) associated with gastric ulcer than with duodenal ulcer (86 versus 56%). The LC hybridization assay provided a rapid means of detecting all three motifs, but RFLP analysis was more specific for TPM-A. TPMs provide novel additional strain markers for defining cagA variation, including identification of RFLP types within TPM-A. The presence of a particular TPM was not of direct diagnostic value, either singly or in combination, but the higher proportion of TPM-A strains in gastric ulcer patients merits further investigation.

  13. The identification and differentiation of the Candida parapsilosis complex species by polymerase chain reaction-restriction fragment length polymorphism of the internal transcribed spacer region of the rDNA

    PubMed Central

    Barbedo, Leonardo Silva; Figueiredo-Carvalho, Maria Helena Galdino; Muniz, Mauro de Medeiros; Zancopé-Oliveira, Rosely Maria

    2016-01-01

    Currently, it is accepted that there are three species that were formerly grouped under Candida parapsilosis: C. para- psilosis sensu stricto, Candida orthopsilosis, andCandida metapsilosis. In fact, the antifungal susceptibility profiles and distinct virulence attributes demonstrate the differences in these nosocomial pathogens. An accurate, fast, and economical identification of fungal species has been the main goal in mycology. In the present study, we searched sequences that were available in the GenBank database in order to identify the complete sequence for the internal transcribed spacer (ITS)1-5.8S-ITS2 region, which is comprised of the forward and reverse primers ITS1 and ITS4. Subsequently, an in silico polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was performed to differentiate the C. parapsilosis complex species. Ninety-eight clinical isolates from patients with fungaemia were submitted for analysis, where 59 isolates were identified as C. parapsilosis sensu stricto, 37 were identified as C. orthopsilosis, and two were identified as C. metapsilosis. PCR-RFLP quickly and accurately identified C. parapsilosis complex species, making this method an alternative and routine identification system for use in clinical mycology laboratories. PMID:27074256

  14. A method for selective PCR-amplification of genomic DNA fragments (SAGF method)

    SciTech Connect

    Zheleznaya, L.A.; Menzenyuk, O.Y.; Matvienko, N.N.; Matvienko, N.I.

    1995-09-01

    A method is suggested for dividing into individual sets of the complex mixtures of fragments obtained by DNA cleavage with type IIS and IIN restriction endonucleases producing single-stranded termini with different sequences at the DNA fragment ends. The method is based on the ligation of short double-stranded adapters with single-stranded ends complementary to termini of the selected set of fragments followed by PCR-amplification with the primer representing one of the adapter chains. Using endonucleases BcoKI and Bli736I, recognizing sequences CTCTTC and GGTCTC and producing three- and four nucleotide 5{prime}-termini, respectively, it has been shown that amplification of a set of fragments occurs only upon attachment of the adapters to the DNA fragments with DNA-ligase. Several possible applications of the SAGF method are suggested: obtaining individual bands in DNA fingerprinting; reducing the kinetic complexity of DNA in representative difference analysis (RDA method) of complex genomes; cataloging of DNA fragments; construction of physical genome maps. 13 refs., 3 figs., 2 tabs.

  15. Distribution of two DNA restriction fragment length polymorphisms (RFLPs) corresponding to Ag(c/g) and Ag(al/d) of the apo B gene in the Orang Asli (aborigines) of West Malaysia

    SciTech Connect

    Candlish, J.K.; Gajra, B; Saha, N.

    1994-09-01

    One hundred and ninety five subjects of the Semai group of Orang Asli in peninsular Malaysia were examined for the distribution of Ag(c/g) and Ag(al/d) RFLPs of the apoB gene. Regions of apoB gene corresponding to nt 421 and 1981 representing these two Ags were amplified by polymerase chain reaction using primers of published sequences. Thr{sub 71} to Ile (Ag c/g) was detected as an ApaL I RFLP and Val{sub 591} to Ala (Ag al/d) by Alu I RFLP. DNA fragments were separated by 4% agarose gel electrophoresis and photographed over a UV transilluminator. The frequencies of Ag(d) (absence of ApaL I site) and Ag(d) (presence of Alu I site) were found to be 0.13 and 0.14, respectively, in the Orang Asli compared to frequencies of 0.30 and 0.45 in the Caucasian population. Distribution of the genotypes of these two polymorphisms was at Hardy-Weinberg equiilibrium.

  16. Investigating of yeast species in wine fermentation using terminal restriction fragment length polymorphism method.

    PubMed

    Sun, Yue; Liu, Yanlin

    2014-04-01

    The objective of this study was to examine the potential of terminal restriction fragment length polymorphism (T-RFLP) in monitoring yeast communities during wine fermentation and to reveal new information on yeast community of Chinese enology. Firstly, terminal restriction fragment (TRF) lengths database was constructed using 32 pure yeast species. Ten of these species were firstly documented. The species except for Candida vini, Issatchenkia orientalis/Candida krusei, Saccharomyces bayanus, Saccharomyces pastorianus, Saccharomyces cerevisiae, Saccharomyces kudriarzevii and Zygosaccharomyces bisporus could be distinguished by the T-RFLP targeting 5.8S-ITS rDNA. Moreover, the yeast communities in spontaneous fermentation of Chardonnay and Riesling were identified by T-RFLP and traditional methods, including colony morphology on Wallerstein Nutrient (WLN) medium and 5.8S-ITS-RFLP analysis. The result showed that T-RFLP profiles of the yeast community correlated well with that of the results identified by the traditional methods. The TRFs with the highest intensity and present in all the samples corresponded to Saccharomyces sp. Other species detected by both approaches were Hanseniaspora uvarum, Metschnikowia pulcherrima, Pichia minuta var. minuta, Saccharomycodes ludwigii/Torulaspora delbrueckii and Candida zemplinina. This study revealed that T-RFLP technique is a rapid and useful tool for monitoring the composition of yeast species during wine fermentation.

  17. A restriction map of Xenopus laevis mitochondrial DNA.

    PubMed

    Cordonnier, A M; Vannier, P A; Brun, G M

    1982-08-01

    The mitochondrial DNA from Xenopus laevis is a 17.4 x 10(3)-base-pair circular DNA molecule. The mapping of this DNA, using 19 different restriction endonucleases is reported here. The sites are as follows: 1 for BamHI, PstI, SacI, SalI, BalI; 2 for BglII, SacII, EcoRI, ClaI, 3 for XhoI, 4 for AvaI, XbaI, PvuII, 5 for HindIII, 6 for HhaI, BclI, HpaI, 10 for AvaII and 11 for HincII. The same sites (except for one of the two ClaI sites) are observed in the molecule cloned in pBR322 DNA. The fragments corresponding to 62 cleavage sites have all been ordered and precisely located. They provide suitable conditions for further investigations connected with the study of replication and nucleotide sequence determination of this molecule.

  18. Mass Spectrometry Based Ultrasensitive DNA Methylation Profiling Using Target Fragmentation Assay.

    PubMed

    Lin, Xiang-Cheng; Zhang, Ting; Liu, Lan; Tang, Hao; Yu, Ru-Qin; Jiang, Jian-Hui

    2016-01-19

    Efficient tools for profiling DNA methylation in specific genes are essential for epigenetics and clinical diagnostics. Current DNA methylation profiling techniques have been limited by inconvenient implementation, requirements of specific reagents, and inferior accuracy in quantifying methylation degree. We develop a novel mass spectrometry method, target fragmentation assay (TFA), which enable to profile methylation in specific sequences. This method combines selective capture of DNA target from restricted cleavage of genomic DNA using magnetic separation with MS detection of the nonenzymatic hydrolysates of target DNA. This method is shown to be highly sensitive with a detection limit as low as 0.056 amol, allowing direct profiling of methylation using genome DNA without preamplification. Moreover, this method offers a unique advantage in accurately determining DNA methylation level. The clinical applicability was demonstrated by DNA methylation analysis using prostate tissue samples, implying the potential of this method as a useful tool for DNA methylation profiling in early detection of related diseases.

  19. Carrier prediction of cystic fibrosis in 36 families by means of restriction fragment length polymorphism.

    PubMed

    Simon, P; Brocas, H; Baran, D; van Geffel, R; Rodesch, F; Vassart, G

    1988-02-01

    Transmission of cystic fibrosis (CF) was studied in 36 families with at least one affected and one unaffected child. DNA was prepared from peripheral leukocytes and submitted to restriction fragment length polymorphism (RFLP) analysis with two CF probes (pj3.11 and met). Twenty families were shown to be informative so that accurate predictions could be made of the status of the offspring. Sixteen were only partially informative. The allele frequency was similar to that originally reported except for one Msp I site detected with the pj3.11 probe, for which we found a significantly higher heterozygote frequency, making it more informative than expected in our population sample. Pedigree analysis demonstrated no obligate recombinant between CF and the polymorphic markers.

  20. Polymerase chain reaction-restriction fragment length polymorphism analysis: a simple method for species identification in food.

    PubMed

    Meyer, R; Höfelein, C; Lüthy, J; Candrian, U

    1995-01-01

    The polymerase chain reaction (PCR) technique was applied to meat species identification in marinated and heat-treated or fermented products and to the differentiation of closely related species. DNA was isolated from meat samples by using a DNA-binding resin and was subjected to PCR analysis. Primers used were complementary to conserved areas of the vertebrate mitochondrial cytochrome b (cytb) gene and yielded a 359 base-pair (bp) fragment, including a variable 307 bp region. Restriction endonuclease analysis based on sequence data of those fragments was used for differentiation among species. Restriction fragment length polymorphisms (RFLPs) were detected when pig, cattle, wild boar, buffalo, sheep, goat, horse, chicken, and turkey amplicons were cut with AluI, RsaI, TaqI, and HinfI. Analysis of sausages indicates the applicability of this approach to food products containing meat from 3 different species. The PCR-RFLP analytical method detected pork in heated meat mixtures with beef at levels below 1%, and the method was confirmed with porcine- and bovine-specific PCR assays by amplifying fragments of their growth hormone genes. Inter- and intraspecific differences of more than 22 animal species with nearly unknown cytb DNA sequences, including hoofed mammals (ungulates), and poultry were determined with PCR-RFLP typing by using 20 different endonucleases. This typing method allowed the discrimination of game meats, including stag, roe deer, chamois, moose, reindeer, kangaroo, springbok, and other antelopes in marinated and heat-treated products.

  1. DNA fragmentation and sperm head morphometry in cat epididymal spermatozoa.

    PubMed

    Vernocchi, Valentina; Morselli, Maria Giorgia; Lange Consiglio, Anna; Faustini, Massimo; Luvoni, Gaia Cecilia

    2014-10-15

    Sperm DNA fragmentation is an important parameter to assess sperm quality and can be a putative fertility predictor. Because the sperm head consists almost entirely of DNA, subtle differences in sperm head morphometry might be related to DNA status. Several techniques are available to analyze sperm DNA fragmentation, but they are labor-intensive and require expensive instrumentations. Recently, a kit (Sperm-Halomax) based on the sperm chromatin dispersion test and developed for spermatozoa of different species, but not for cat spermatozoa, became commercially available. The first aim of the present study was to verify the suitability of Sperm-Halomax assay, specifically developed for canine semen, for the evaluation of DNA fragmentation of epididymal cat spermatozoa. For this purpose, DNA fragmentation indexes (DFIs) obtained with Sperm-Halomax and terminal deoxynucleotidyl transferase-mediated nick-end labeling (TUNEL) were compared. The second aim was to investigate whether a correlation between DNA status, sperm head morphology, and morphometry assessed by computer-assisted semen analysis exists in cat epididymal spermatozoa. No differences were observed in DFIs obtained with Sperm-Halomax and TUNEL. This result indicates that Sperm-Halomax assay provides a reliable evaluation of DNA fragmentation of epididymal feline spermatozoa. The DFI seems to be independent from all the measured variables of sperm head morphology and morphometry. Thus, the evaluation of the DNA status of spermatozoa could effectively contribute to the completion of the standard analysis of fresh or frozen semen used in assisted reproductive technologies.

  2. Bacterial natural transformation by highly fragmented and damaged DNA.

    PubMed

    Overballe-Petersen, Søren; Harms, Klaus; Orlando, Ludovic A A; Mayar, J Victor Moreno; Rasmussen, Simon; Dahl, Tais W; Rosing, Minik T; Poole, Anthony M; Sicheritz-Ponten, Thomas; Brunak, Søren; Inselmann, Sabrina; de Vries, Johann; Wackernagel, Wilfried; Pybus, Oliver G; Nielsen, Rasmus; Johnsen, Pål Jarle; Nielsen, Kaare Magne; Willerslev, Eske

    2013-12-03

    DNA molecules are continuously released through decomposition of organic matter and are ubiquitous in most environments. Such DNA becomes fragmented and damaged (often <100 bp) and may persist in the environment for more than half a million years. Fragmented DNA is recognized as nutrient source for microbes, but not as potential substrate for bacterial evolution. Here, we show that fragmented DNA molecules (≥ 20 bp) that additionally may contain abasic sites, cross-links, or miscoding lesions are acquired by the environmental bacterium Acinetobacter baylyi through natural transformation. With uptake of DNA from a 43,000-y-old woolly mammoth bone, we further demonstrate that such natural transformation events include ancient DNA molecules. We find that the DNA recombination is RecA recombinase independent and is directly linked to DNA replication. We show that the adjacent nucleotide variations generated by uptake of short DNA fragments escape mismatch repair. Moreover, double-nucleotide polymorphisms appear more common among genomes of transformable than nontransformable bacteria. Our findings reveal that short and damaged, including truly ancient, DNA molecules, which are present in large quantities in the environment, can be acquired by bacteria through natural transformation. Our findings open for the possibility that natural genetic exchange can occur with DNA up to several hundreds of thousands years old.

  3. Very Short Mitochondrial DNA Fragments and Heteroplasmy in Human Plasma

    PubMed Central

    Zhang, Ruoyu; Nakahira, Kiichi; Guo, Xiaoxian; Choi, Augustine M.K.; Gu, Zhenglong

    2016-01-01

    Cell free DNA (cfDNA) has received increasing attention and has been studied in a broad range of clinical conditions. However, few studies have focused on mitochondrial DNA (mtDNA) in the cell free form. We optimized DNA isolation and sequencing library preparation protocols to better retain short DNA fragments from plasma, and applied these optimized methods to plasma samples from patients with sepsis. Our methods can retain substantially shorter DNA, resulting in an average of 11.5 fold increase in short DNA fragments yield (DNA <100bp). We report that cf-mtDNA in plasma is highly enriched in short-size cfDNA (30~60 bp). Motivated by this unique size distribution, we size-selected short cfDNA, which further increased the mtDNA recovery rate by an average of 10.4 fold. We then detected mtDNA heteroplasmy in plasma from 3 patients. In one patient who previously received bone marrow transplantation, different minor allele frequencies were observed between plasma and leukocytes at heteroplasmic sites, consistent with mixed-tissue origin for cfDNA. For the other two patients, the heteroplasmy pattern is also different between plasma and leukocyte. Our study shed new lights into the architecture of the cfDNA, and mtDNA heteroplasmy identified in plasma provides new potential for biomarker discovery. PMID:27811968

  4. A general method for saturation mutagenesis of cloned DNA fragments.

    PubMed

    Myers, R M; Lerman, L S; Maniatis, T

    1985-07-19

    A new procedure for generating and isolating random single-base substitutions in cloned DNA fragments is presented. The mutations are generated by treatment of single-stranded DNA with various chemicals, followed by the synthesis of the complementary strand with reverse transcriptase. Misincorporation frequently occurs when the enzyme encounters a damaged base in the mutagenized template DNA. The resulting duplex DNA fragments containing random single-base substitutions are cloned, amplified as a population, and isolated from wild-type DNA by preparative denaturing gradient gel electrophoresis. The physical separation of mutant DNA fragments makes it possible to isolate and characterize large numbers of site-directed single-base substitutions in the absence of a phenotypic selection. This procedure should be generally applicable to the fine-structure genetic analysis of regulatory and protein-coding sequences.

  5. Evaluation of Microbial Diversity in Wetland through Polymerase Chain Reaction (PCR) and Restriction Fragment Length Polymorphism (RFLP)

    DTIC Science & Technology

    2006-06-01

    MICROBIAL DIVERSITY IN WETLANDS THROUGH POLYMERASE CHAIN REACTION ( PCR ) AND RESTRICTION FRAGMENT LENGTH POLYMORPHISM ( RFLP ) THESIS Presented to the...MICROBIAL DIVERSITY IN WETLANDS THROUGH POLYMERASE CHAIN REACTION ( PCR ) AND RESTRICTION FRAGMENT LENGTH POLYMORPHISM ( RFLP ) Gregory K. Joseph, B.A...AFIT/GES/ENV/06J-02 EVALUATION OF MICROBIAL DIVERSITY IN WETLANDS THROUGH POLYMERASE CHAIN REACTION ( PCR ) AND RESTRICTION FRAGMENT LENGTH

  6. Effect of aging and dietary restriction on DNA repair

    SciTech Connect

    Weraarchakul, N.; Strong, R.; Wood, W.G.; Richardson, A.

    1989-03-01

    DNA repair was studied as a function of age in cells isolated from both the liver and the kidney of male Fischer F344 rats. DNA repair was measured by quantifying unscheduled DNA synthesis induced by UV irradiation. Unscheduled DNA synthesis decreased approximately 50% between the ages of 5 and 30 months in both hepatocytes and kidney cells. The age-related decline in unscheduled DNA synthesis in cells isolated from the liver and kidney was compared in rats fed ad libitum and rats fed a calorie-restricted diet; calorie restriction has been shown to increase the survival of rodents. The level of unscheduled DNA synthesis was significantly higher in hepatocytes and kidney cells isolated from the rats fed the restricted diet. Thus, calorie restriction appears to retard the age-related decline in DNA repair.

  7. Electronic transport in methylated fragments of DNA

    NASA Astrophysics Data System (ADS)

    de Almeida, M. L.; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; de Moura, F. A. B. F.; Lyra, M. L.

    2015-11-01

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

  8. Electronic transport in methylated fragments of DNA

    SciTech Connect

    Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L. Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; Moura, F. A. B. F. de; Lyra, M. L.

    2015-11-16

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

  9. Agarose gel electrophoresis for the separation of DNA fragments.

    PubMed

    Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon

    2012-04-20

    Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate

  10. Selection of Enzymes for Terminal Restriction Fragment Length Polymorphism Analysis of Fungal Internally Transcribed Spacer Sequences▿ †

    PubMed Central

    Alvarado, Pablo; Manjón, Jose L.

    2009-01-01

    Terminal restriction fragment length polymorphism (TRFLP) profiling of the internally transcribed spacer (ITS) ribosomal DNA of unknown fungal communities is currently unsupported by a broad-range enzyme-choosing rationale. An in silico study of terminal fragment size distribution was therefore performed following virtual digestion (by use of a set of commercially available 135 type IIP restriction endonucleases) of all published fungal ITS sequences putatively annealing to primers ITS1 and ITS4. Different diversity measurements were used to rank primer-enzyme pairs according to the richness and evenness that they showed. Top-performing pairs were hierarchically clustered to test for data dependency. The enzyme set composed of MaeII, BfaI, and BstNI returned much better results than randomly chosen enzyme sets in computer simulations and is therefore recommended for in vitro TRFLP profiling of fungal ITSs. PMID:19465521

  11. High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System

    PubMed Central

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C. T.; Shui, Lingling

    2017-01-01

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1–10 Kbp fragment lengths with a yield of 75.30–91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future. PMID:28098208

  12. High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System

    NASA Astrophysics Data System (ADS)

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C. T.; Shui, Lingling

    2017-01-01

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1–10 Kbp fragment lengths with a yield of 75.30–91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.

  13. High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.

    PubMed

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling

    2017-01-18

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.

  14. Advanced microinstrumentation for rapid DNA sequencing and large DNA fragment separation

    SciTech Connect

    Balch, J.; Davidson, J.; Brewer, L.; Gingrich, J.; Koo, J.; Mariella, R.; Carrano, A.

    1995-01-25

    Our efforts to develop novel technology for a rapid DNA sequencer and large fragment analysis system based upon gel electrophoresis are described. We are using microfabrication technology to build dense arrays of high speed micro electrophoresis lanes that will ultimately increase the sequencing rate of DNA by at least 100 times the rate of current sequencers. We have demonstrated high resolution DNA fragment separation needed for sequencing in polyacrylamide microgels formed in glass microchannels. We have built prototype arrays of microchannels having up to 48 channels. Significant progress has also been made in developing a sensitive fluorescence detection system based upon a confocal microscope design that will enable the diagnostics and detection of DNA fragments in ultrathin microchannel gels. Development of a rapid DNA sequencer and fragment analysis system will have a major impact on future DNA instrumentation used in clinical, molecular and forensic analysis of DNA fragments.

  15. DNA Fragments Assembly Based on Nicking Enzyme System

    PubMed Central

    Wang, Rui-Yan; Shi, Zhen-Yu; Guo, Ying-Ying; Chen, Jin-Chun; Chen, Guo-Qiang

    2013-01-01

    A couple of DNA ligation-independent cloning (LIC) methods have been reported to meet various requirements in metabolic engineering and synthetic biology. The principle of LIC is the assembly of multiple overlapping DNA fragments by single-stranded (ss) DNA overlaps annealing. Here we present a method to generate single-stranded DNA overlaps based on Nicking Endonucleases (NEases) for LIC, the method was termed NE-LIC. Factors related to cloning efficiency were optimized in this study. This NE-LIC allows generating 3′-end or 5′-end ss DNA overlaps of various lengths for fragments assembly. We demonstrated that the 10 bp/15 bp overlaps had the highest DNA fragments assembling efficiency, while 5 bp/10 bp overlaps showed the highest efficiency when T4 DNA ligase was added. Its advantage over Sequence and Ligation Independent Cloning (SLIC) and Uracil-Specific Excision Reagent (USER) was obvious. The mechanism can be applied to many other LIC strategies. Finally, the NEases based LIC (NE-LIC) was successfully applied to assemble a pathway of six gene fragments responsible for synthesizing microbial poly-3-hydroxybutyrate (PHB). PMID:23483947

  16. Site-specific DNA transesterification catalyzed by a restriction enzyme

    PubMed Central

    Sasnauskas, Giedrius; Connolly, Bernard A.; Halford, Stephen E.; Siksnys, Virginijus

    2007-01-01

    Most restriction endonucleases use Mg2+ to hydrolyze phosphodiester bonds at specific DNA sites. We show here that BfiI, a metal-independent restriction enzyme from the phospholipase D superfamily, catalyzes both DNA hydrolysis and transesterification reactions at its recognition site. In the presence of alcohols such as ethanol or glycerol, it attaches the alcohol covalently to the 5′ terminus of the cleaved DNA. Under certain conditions, the terminal 3′-OH of one DNA strand can attack the target phosphodiester bond in the other strand to create a DNA hairpin. Transesterification reactions on DNA with phosphorothioate linkages at the target bond proceed with retention of stereoconfiguration at the phosphorus, indicating, uniquely for a restriction enzyme, a two-step mechanism. We propose that BfiI first makes a covalent enzyme–DNA intermediate, and then it resolves it by a nucleophilic attack of water or an alcohol, to yield hydrolysis or transesterification products, respectively. PMID:17267608

  17. Molecularly Imprinted Polymers with DNA Aptamer Fragments as Macromonomers.

    PubMed

    Zhang, Zijie; Liu, Juewen

    2016-03-01

    Molecularly imprinted polymers (MIPs) are produced in the presence of a template molecule. After removing the template, the cavity can selectively rebind the template. MIPs are attractive functional materials with a low cost and high stability, but traditional MIPs often suffer from low binding affinity. This study employs DNA aptamer fragments as macromonomers to improve MIPs. The DNA aptamer for adenosine was first split into two halves, fluorescently labeled, and copolymerized into MIPs. With a fluorescence quenching assay, the importance of imprinting was confirmed. Further studies were carried out using isothermal titration calorimetry (ITC). Compared to the mixture of the free aptamer fragments, their MIPs doubled the binding affinity. Each free aptamer fragment alone cannot bind adenosine, whereas MIPs containing each fragment are effective binders. We further shortened one of the aptamer fragments, and the DNA length was pushed to as short as six nucleotides, yielding MIPs with a dissociation constant of 27 μM adenosine. This study provides a new method for preparing functional MIP materials by combining high-affinity biopolymer fragments with low-cost synthetic monomers, allowing higher binding affinity and providing a method for signaling binding based on DNA chemistry.

  18. Detection and differentiation of filarial parasites by universal primers and polymerase chain reaction-restriction fragment length polymorphism analysis.

    PubMed

    Nuchprayoon, Surang; Junpee, Alisa; Poovorawan, Yong; Scott, Alan L

    2005-11-01

    Filarial nematode parasites are a serious cause of morbidity in humans and animals. Identification of filarial infection using traditional morphologic criteria can be difficult and lead to misdiagnosis. We report on a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP)-based method to detect and differentiate a broad range of filarial species in a single PCR. The first internal transcribed spacer 1 (ITS1) along with the flanking 18S and 5.8S ribosomal DNA (rDNA) were isolated and cloned from Wuchereria bancrofti, Brugia malayi, and Brugia pahangi. Sequence analysis identified conserved sites in the 18S and 5.8S rDNA sequence that could be used as universal priming sites to generate ITS1-distinctive PCR products that were useful for distinguishing filariae at the genus level. The addition of a digestion of the ITS1 PCR product with the restriction endonuclease Ase I generated a fragment profile that allowed differentiation down to the species level for W. bancrofti, B. malayi, B. pahangi, Dirofilaria immitis, and D. repens. The PCR-RFLP of ITS1 rDNA will be useful in diagnosing and differentiating filarial parasites in human, animal reservoir hosts, and mosquito vectors in disease-endemic areas.

  19. PCR-Restriction Fragment Length Polymorphism Assay for Detection of gyrA Mutations Associated with Fluoroquinolone Resistance in Campylobacter coli

    PubMed Central

    Alonso, Rodrigo; Mateo, Estibaliz; Girbau, Cecilia; Churruca, Estibaliz; Martinez, Irati; Fernández-Astorga, Aurora

    2004-01-01

    A fragment of the gyrA gene was sequenced from 34 isolates of Campylobacter coli, including 23 isolates resistant to ciprofloxacin. All ciprofloxacin-resistant isolates examined by DNA sequencing carried a point mutation at position Thr-86 on the gyrA gene product, involving the replacement of Thr-86 by Ile. A combined PCR-restriction fragment length polymorphism technique using RsaI was developed to detect this mutation. PMID:15561873

  20. PCR-restriction fragment length polymorphism assay for detection of gyrA mutations associated with fluoroquinolone resistance in Campylobacter coli.

    PubMed

    Alonso, Rodrigo; Mateo, Estibaliz; Girbau, Cecilia; Churruca, Estibaliz; Martinez, Irati; Fernández-Astorga, Aurora

    2004-12-01

    A fragment of the gyrA gene was sequenced from 34 isolates of Campylobacter coli, including 23 isolates resistant to ciprofloxacin. All ciprofloxacin-resistant isolates examined by DNA sequencing carried a point mutation at position Thr-86 on the gyrA gene product, involving the replacement of Thr-86 by Ile. A combined PCR-restriction fragment length polymorphism technique using RsaI was developed to detect this mutation.

  1. DNA fragment editing of genomes by CRISPR/Cas9.

    PubMed

    Jinhuan, Li; Jia, Shou; Qiang, Wu

    2015-10-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated nuclease 9 (Cas9) system from bacteria and archaea emerged recently as a new powerful technology of genome editing in virtually any organism. Due to its simplicity and cost effectiveness, a revolutionary change of genetics has occurred. Here, we summarize the recent development of DNA fragment editing methods by CRISPR/Cas9 and describe targeted DNA fragment deletions, inversions, duplications, insertions, and translocations. The efficient method of DNA fragment editing provides a powerful tool for studying gene function, regulatory elements, tissue development, and disease progression. Finally, we discuss the prospects of CRISPR/Cas9 system and the potential applications of other types of CRISPR system.

  2. Separation of Three Species of Ditylenchus and Some Host Races of D. dipsaci by Restriction Fragment Length Polymorphism

    PubMed Central

    Wendt, Karen R.; Vrain, Thierry C.; Webster, John M.

    1993-01-01

    This study examined the ribosomal cistron of Ditylenchus destructor, D. myceliophagus and seven host races of D. dipsaci from different geographic locations. The three species showed restriction fragment length polymorphisms (RFLPs) in the ribosomal cistron, the 18S rDNA gene, and the ribosomal internal transcribed spacer (ITS). Southern blot analysis with a 7.5-kb ribosomal cistron probe differentiated the five host races of D. dipsaci examined. Polymerase chain reaction (PCR) amplification of the ITS, followed by digestion with some restriction endonucleases (but not others), produced restriction fragments diagnostic of the giant race. Because the PCR product from D. myceliophagus and the host races of D. dipsaci was about 900 base pairs and the ITS size in D. destructor populations was 1,200 base pairs, mixtures of populations could be detected by PCR amplification. ITS fragments differentiated between D. dipsaci and Aphelenchoides rhyntium in mixed populations. This study establishes the feasibility of differentiation of the host races of D. dipsaci by probing Southern blots with the whole ribosomal cistron. PMID:19279809

  3. Discrimination among individuals using terminal restriction fragment length polymorphism profiling of bacteria derived from forensic evidence.

    PubMed

    Nishi, Eiji; Tashiro, Yukihiro; Sakai, Kenji

    2015-05-01

    DNA typing from forensic evidence is commonly used to identify individuals. However, when the quantity of the forensic evidence is insufficient, successful identification using DNA typing is impossible. Such evidence may also contain DNA from bacteria that occur naturally on the skin. In this study, we aimed to establish a profiling method using terminal restriction fragment length polymorphisms (T-RFLPs) of the amplified bacterial 16S ribosomal RNA (rRNA) gene. First, the extraction and digestion processes were investigated, and the T-RFLP profiling method using the 16S rRNA gene amplicon was optimized. We then used this method to compare the profiles of bacterial flora from the hands of 12 different individuals. We found that the T-RFLP profiles from one person on different days displayed higher similarity than those between individuals. In a principal component analysis (PCA), T-RFLPs from each individual were closely clustered in 11 out of 12 cases. The clusters could be distinguished from each other, even when the samples were collected from different conditions. No major change of the profile was observed after six months except in two cases. When handprints on glass plates were compared, 11 of 12 individuals were assigned to a few clusters including the cluster corresponding to the correct individual. In conclusion, a method for reproducible T-RFLP profiling of bacteria from trace amounts of handprints was established. The profiles were obtained for particular individuals clustered in PCA and were experimentally separable from other individuals in most cases. This technique could provide useful information for narrowing down a suspect in a criminal investigation.

  4. Identification of blood meal sources of Lutzomyia longipalpis using polymerase chain reaction-restriction fragment length polymorphism analysis of the cytochrome B gene.

    PubMed

    Soares, Vítor Yamashiro Rocha; Silva, Jailthon Carlos da; Silva, Kleverton Ribeiro da; Pires e Cruz, Maria do Socorro; Santos, Marcos Pérsio Dantas; Ribolla, Paulo Eduardo Martins; Alonso, Diego Peres; Coelho, Luiz Felipe Leomil; Costa, Dorcas Lamounier; Costa, Carlos Henrique Nery

    2014-06-01

    An analysis of the dietary content of haematophagous insects can provide important information about the transmission networks of certain zoonoses. The present study evaluated the potential of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis of the mitochondrial cytochrome B (cytb) gene to differentiate between vertebrate species that were identified as possible sources of sandfly meals. The complete cytb gene sequences of 11 vertebrate species available in the National Center for Biotechnology Information database were digested with Aci I, Alu I, Hae III and Rsa I restriction enzymes in silico using Restriction Mapper software. The cytb gene fragment (358 bp) was amplified from tissue samples of vertebrate species and the dietary contents of sandflies and digested with restriction enzymes. Vertebrate species presented a restriction fragment profile that differed from that of other species, with the exception of Canis familiaris and Cerdocyon thous. The 358 bp fragment was identified in 76 sandflies. Of these, 10 were evaluated using the restriction enzymes and the food sources were predicted for four: Homo sapiens (1), Bos taurus (1) and Equus caballus (2). Thus, the PCR-RFLP technique could be a potential method for identifying the food sources of arthropods. However, some points must be clarified regarding the applicability of the method, such as the extent of DNA degradation through intestinal digestion, the potential for multiple sources of blood meals and the need for greater knowledge regarding intraspecific variations in mtDNA.

  5. Identification of blood meal sources of Lutzomyia longipalpis using polymerase chain reaction-restriction fragment length polymorphism analysis of the cytochrome B gene

    PubMed Central

    Soares, Vítor Yamashiro Rocha; da Silva, Jailthon Carlos; da Silva, Kleverton Ribeiro; Cruz, Maria do Socorro Pires e; Santos, Marcos Pérsio Dantas; Ribolla, Paulo Eduardo Martins; Alonso, Diego Peres; Coelho, Luiz Felipe Leomil; Costa, Dorcas Lamounier; Costa, Carlos Henrique Nery

    2014-01-01

    An analysis of the dietary content of haematophagous insects can provide important information about the transmission networks of certain zoonoses. The present study evaluated the potential of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis of the mitochondrial cytochrome B (cytb) gene to differentiate between vertebrate species that were identified as possible sources of sandfly meals. The complete cytb gene sequences of 11 vertebrate species available in the National Center for Biotechnology Information database were digested with Aci I, Alu I, Hae III and Rsa I restriction enzymes in silico using Restriction Mapper software. The cytb gene fragment (358 bp) was amplified from tissue samples of vertebrate species and the dietary contents of sandflies and digested with restriction enzymes. Vertebrate species presented a restriction fragment profile that differed from that of other species, with the exception of Canis familiaris and Cerdocyon thous. The 358 bp fragment was identified in 76 sandflies. Of these, 10 were evaluated using the restriction enzymes and the food sources were predicted for four: Homo sapiens (1), Bos taurus (1) and Equus caballus (2). Thus, the PCR-RFLP technique could be a potential method for identifying the food sources of arthropods. However, some points must be clarified regarding the applicability of the method, such as the extent of DNA degradation through intestinal digestion, the potential for multiple sources of blood meals and the need for greater knowledge regarding intraspecific variations in mtDNA. PMID:24821056

  6. Novel separation and detection methods of DNA fragments in electrophoresis

    SciTech Connect

    Chan, K.C.

    1992-01-01

    A charge-coupled device (CCD) based electrophoresis system was developed. The system allowed non-destructive, sensitive, and on-line detection of native DNA in slab-gel electrophoresis via ultraviolet absorption measurement. The detection limit of double-stranded DNA fragment was 5 ng per band. Since the amount of DNA used in this experiment was typical, the CCD-based system could be readily implemented in molecular biology. Gel-filled and non-gel sieving capillary electrophoresis (CE) was developed for rapid and efficient separation of double-stranded DNA fragments. For the gel-filled CE separation a new gel matrix, the HydroLink gel (HL), was used. The HL capillary gel was easier to cast than the polyacrylamide capillary gel. For the non-gel separation, a GC capillary was used as the separation chamber, and cellulose additive was included in the electrophoresis as the sieving medium. Indirect fluorometry was applied in non-gel and gel electrophoresis for the detection of DNA fragments. This method allowed nondestructive and on-line detection of DNA during electrophoresis. The amount of DNA used with this method was comparable to those obtained with absorption measurement.

  7. Novel separation and detection methods of DNA fragments in electrophoresis

    SciTech Connect

    Chan, King Cheung.

    1993-01-27

    A charge-coupled device (CCD) based electrophoresis system was developed. The system allowed non-destructive, sensitive, and on-line detection of native DNA in slab-gel electrophoresis via ultraviolet absorption measurement. The detection limit of double-stranded DNA fragment was 5 ng per band. Since the amount of DNA used in this experiment was typical, the CCD-based system could be readily implemented in molecular biology. Gel-filled and non-gel sieving capillary electrophoresis was developed for rapid and efficient separation of double-stranded DNA fragments. For the gel-filled CE separation a new gel matrix, the HydroLink gel (HL), was used. The HL capillary gel was easier to cast than the polyacrylamide capillary gel. For the non-gel separation, a GC capillary was used as the separation chamber, and cellulose additive was included in the electrophoresis as the sieving medium. Indirect fluorometry was applied in non-gel and gel electrophoresis for the detection of DNA fragments. This method allowed non-destructive and on-line detection of DNA during electrophoresis. The amount of DNA used with this method was comparable to those obtained with absorption measurement.

  8. PFGE-resolved RFLP analysis and long range restriction mapping of the DNA of Arabidopsis thaliana using whole YAC clones as probes.

    PubMed Central

    Bancroft, I; Westphal, L; Schmidt, R; Dean, C

    1992-01-01

    The cleavage patterns of 23 rare-cutting restriction endonucleases (rcREs) on high molecular weight DNA, isolated from leaves of Arabidopsis thaliana (Arabidopsis), have been analysed using pulsed field gel electrophoresis (PFGE). The DNA digested with rcREs can be used for restriction fragment length polymorphism (RFLP) analysis. We show that RFLPs are more readily identified in restriction fragments that require resolution by PFGE than in smaller restriction fragments. Taking advantage of the low dispersed repetitive DNA content of the Arabidopsis genome, whole yeast artificial chromosomes (YACs) were used as probes to PFGE resolved genomic DNA. This enabled whole YAC clones to be used as RFLP markers and long range restriction maps to be constructed. These techniques should enhance the analysis of regions of the genome of Arabidopsis (and other organisms with low levels of dispersed repetitive DNA) that are the subject of chromosome walking strategies to isolate particular loci. Images PMID:1361981

  9. DNA fragmentation of spermatozoa and assisted reproduction technology.

    PubMed

    Henkel, Ralf; Kierspel, Eva; Hajimohammad, Marjam; Stalf, Thomas; Hoogendijk, Christiaan; Mehnert, Claas; Menkveld, Roelof; Schill, Wolf-Bernhard; Kruger, Thinus F

    2003-01-01

    Despite the ever-increasing knowledge of the fertilization process, there is still a need for better understanding of the causes of sperm DNA fragmentation and its impact on fertilization and pregnancy. For this reason, human sperm DNA fragmentation was investigated by means of the terminal deoxynucleotidyl transferase-mediated dUDP nick-end labelling (TUNEL) assay and the production of reactive oxygen species (ROS) in the ejaculate and in the spermatozoa themselves. These data were correlated with fertilization and pregnancy data from IVF and intracytoplasmic sperm injection (ICSI) patients. Sperm DNA fragmentation did not correlate with fertilization rate, but there was a significantly reduced pregnancy rate in IVF patients inseminated with TUNEL-positive spermatozoa. ICSI patients exhibited the same tendency. This implies that spermatozoa with damaged DNA are able to fertilize an oocyte, but at the time the paternal genome is switched on, further development stops. The determination of ROS in the ejaculate and the percentage of ROS-producing spermatozoa revealed markedly stronger correlations between sperm functions (i.e. motility) and the percentage of ROS-producing spermatozoa. The influence of seminal leukocytes, known to produce large amounts of oxidants, on sperm DNA fragmentation should not be neglected.

  10. DNA Hybridization Probe for Use in Determining Restricted Nodulation among Bradyrhizobium japonicum Serocluster 123 Field Isolates

    PubMed Central

    Sadowsky, Michael J.; Cregan, Perry B.; Keyser, Harold H.

    1990-01-01

    Several soybean plant introduction (PI) genotypes have recently been described which restrict nodulation of Bradyrhizobium japonicum serocluster 123 in an apparently serogroup-specific manner. While PI 371607 restricts nodulation of strains in serogroup 123 and some in serogroup 127, those in serogroup 129 are not restricted. When DNA regions within and around the B. japonicum I-110 common nodulation genes were used as probes to genomic DNA from the serogroup strains USDA 123, USDA 127, and USDA 129, several of the probes differentially hybridized to the nodulation-restricted and -unrestricted strains. One of the gene regions, cloned in plasmid pMJS12, was subsequently shown to hybridize to 4.6-kilobase EcoRI fragments from DNAs from nodulation-restricted strains and to larger fragments in nodulation-unrestricted strains. To determine if the different hybridization patterns could be used to predict nodulation restriction, we hybridized pMJS12 to EcoRI-digested genomic DNAs from uncharacterized serocluster 123 field isolates. Of the 36 strains examined, 15 were found to have single, major, 4.6-kilobase hybridizing EcoRI fragments. When tested for nodulation, 80% (12 of 15) of the strains were correctly predicted to be restricted for nodulation of the PI genotypes. In addition, hybridization patterns obtained with pMJS12 and nodulation phenotypes on PI 371607 indicated that there are at least three types of serogroup 127 strains. Our results suggest that the pMJS12 gene probe may be useful in selecting compatible host-strain combinations and in determining the suitability of field sites for the placement of soybean genotypes containing restrictive nodulation alleles. Images PMID:16348217

  11. Restricted pollen flow of Dieffenbachia seguine populations in fragmented and continuous tropical forest.

    PubMed

    Cuartas-Hernández, S; Núñez-Farfán, J; Smouse, P E

    2010-08-01

    Habitat fragmentation can change the ecological context of populations, rupturing genetic connectivity among them, changing genetic structure, and increasing the loss of genetic diversity. We analyzed mating system and pollen structure in two population fragments and two continuous forest populations of Dieffenbachia seguine (Araceae), an insect-pollinated understory herb in the tropical rain forest of Los Tuxtlas, México, using nine allozyme loci. Mating system analysis indicated almost complete outcrossing but some inbreeding among the adults. Pollen structure analysis indicated highly restricted pollen flow, both within and among populations. We showed that the effective pollination neighborhood was small in all populations, and slightly (though not significantly) smaller in fragments, partially as a consequence of an increase in density of reproductive individuals in those fragments. Using assignment analysis, we showed that all populations were strongly structured, suggesting that pollen and seed flow across the Los Tuxtlas landscape has been spatially restricted, though sufficient to maintain connectedness. Forest fragmentation at Los Tuxtlas has (so far) had limited impact on pollen dynamics, despite the changing ecological context, with reduced pollinator abundance being partially offset by increased flowering density in fragments. Continued outcrossing and limited pollen immigration, coupled with more extensive seed migration, should maintain genetic connectedness in D. seguine, if fragmentation is not further exacerbated by additional deforestation.

  12. Two-step polymerase chain reactions and restriction endonuclease analyses detect and differentiate ompA DNA of Chlamydia spp.

    PubMed Central

    Kaltenboeck, B; Kousoulas, K G; Storz, J

    1992-01-01

    Specific and sensitive amplification of major outer membrane protein (MOMP) gene (ompA) DNA sequences of Chlamydia species with various MOMP genotypes was achieved by a two-step polymerase chain reaction (PCR). Degenerate, inosine-containing oligonucleotide primers homologous to the 5' and 3' ends of the translated regions of all chlamydial MOMP genes were used in a PCR to amplify a DNA fragment of approximately 1,120 bp. A portion of this DNA fragment was amplified in a second genus-specific reaction that yielded a DNA fragment of approximately 930 bp. A pair of degenerate oligonucleotide primers homologous to internal sequences of the primary DNA fragment was used in this PCR. This method detected three cognate chlamydial genomes in a background of 1 microgram of unrelated DNA. MOMP genes of 13 representative chlamydial MOMP genotypes of the species C. trachomatis, C. pneumoniae, and C. psittaci were amplified. In a secondary PCR, group-specific detection was achieved by the simultaneous use of one genus-specific primer and three primers derived from different fingerprint regions of three major groups of chlamydiae. This multiplex PCR differentiated the groups by the length of the amplified DNA fragments and detected the simultaneous presence of DNA sequences of the Chlamydia spp. with different MOMP genotypes. Further differentiation as ompA restriction fragment length polymorphism types among all chlamydial strains with the various MOMP genotypes analyzed here was achieved by restriction endonuclease analysis of the secondary PCR products. DNA sequences corresponding to the ompA restriction fragment length polymorphism type B577 of C. psittaci were detected in two of seven milk samples from cases of bovine mastitis. Images PMID:1349899

  13. DNA Oligonucleotide Fragment Ion Rearrangements Upon Collision-Induced Dissociation

    NASA Astrophysics Data System (ADS)

    Harper, Brett; Neumann, Elizabeth K.; Solouki, Touradj

    2015-08-01

    Collision-induced dissociation (CID) of m/z-isolated w type fragment ions and an intact 5' phosphorylated DNA oligonucleotide generated rearranged product ions. Of the 21 studied w ions of various nucleotide sequences, fragment ion sizes, and charge states, 18 (~86%) generated rearranged product ions upon CID in a Synapt G2-S HDMS (Waters Corporation, Manchester, England, UK) ion mobility-mass spectrometer. Mass spectrometry (MS), ion mobility spectrometry (IMS), and theoretical modeling data suggest that purine bases can attack the free 5' phosphate group in w type ions and 5' phosphorylated DNA to generate sequence permuted [phosphopurine]- fragment ions. We propose and discuss a potential mechanism for generation of rearranged [phosphopurine]- and complementary y-B type product ions.

  14. A general method to modify BACs to generate large recombinant DNA fragments.

    PubMed

    Shen, Wei; Huang, Yue; Tang, Yi; Liu, De-Pei; Liang, Chih-Chuan

    2005-11-01

    Bacterial artificial chromosome (BAC) has the capacity to clone DNA fragments in excess of 300 kb. It also has the considerable advantages of stable propagation and ease of purification. These features make BAC suitable in genetic research, such as library construction, transgenic mice production, and gene targeting constructs. Homologous recombination in Escherichia coli, a process named recombineering, has made the modification of BACs easy and reliable. We report here a modified recombineering method that can efficiently mediate the fusion of large DNA fragments from two or more different BACs. With the introduction of kanamycin-resistant gene and proposed rare-cutting restriction endonuclease (RCRE) sites into two BACs, a 82.6-kb DNA fragment containing the inverted human alpha-globin genes (theta, alpha1, alpha2, and zeta) from BAC191K2 and the locus control region (LCR) of human beta-globin gene locus (from the BAC186D7) was reconstructed. This approach for combining different BAC DNA fragments should facilitate many kinds of genomic experiments.

  15. Meiotic silencing and fragmentation of the male germline restricted chromosome in zebra finch.

    PubMed

    Schoenmakers, Sam; Wassenaar, Evelyne; Laven, Joop S E; Grootegoed, J Anton; Baarends, Willy M

    2010-06-01

    During male meiotic prophase in mammals, X and Y are in a largely unsynapsed configuration, which is thought to trigger meiotic sex chromosome inactivation (MSCI). In avian species, females are ZW, and males ZZ. Although Z and W in chicken oocytes show complete, largely heterologous synapsis, they too undergo MSCI, albeit only transiently. The W chromosome is already inactive in early meiotic prophase, and inactive chromatin marks may spread on to the Z upon synapsis. Mammalian MSCI is considered as a specialised form of the general meiotic silencing mechanism, named meiotic silencing of unsynapsed chromatin (MSUC). Herein, we studied the avian form of MSUC, by analysing the behaviour of the peculiar germline restricted chromosome (GRC) that is present as a single copy in zebra finch spermatocytes. In the female germline, this chromosome is present in two copies, which normally synapse and recombine. In contrast, during male meiosis, the single GRC is always eliminated. We found that the GRC in the male germline is silenced from early leptotene onwards, similar to the W chromosome in avian oocytes. The GRC remains largely unsynapsed throughout meiotic prophase I, although patches of SYCP1 staining indicate that part of the GRC may self-synapse. In addition, the GRC is largely devoid of meiotic double strand breaks. We observed a lack of the inner centromere protein INCENP on the GRC and elimination of the GRC following metaphase I. Subsequently, the GRC forms a micronucleus in which the DNA is fragmented. We conclude that in contrast to MSUC in mammals, meiotic silencing of this single chromosome in the avian germline occurs prior to, and independent of DNA double strand breaks and chromosome pairing, hence we have named this phenomenon meiotic silencing prior to synapsis (MSPS).

  16. Identification of Staphylococcus spp. by PCR-Restriction Fragment Length Polymorphism of gap Gene

    PubMed Central

    Yugueros, Javier; Temprano, Alejandro; Sánchez, María; Luengo, José María; Naharro, Germán

    2001-01-01

    Oligonucleotide primers specific for the Staphylococcus aureus gap gene were previously designed to identify 12 Staphylococcus spp. by PCR. In the present study, AluI digestion of PCR-generated products rendered distinctive restriction fragment length polymorphism patterns that allowed 24 Staphylococcus spp. to be identified with high specificity. PMID:11574593

  17. Alternative Okazaki Fragment Ligation Pathway by DNA Ligase III.

    PubMed

    Arakawa, Hiroshi; Iliakis, George

    2015-06-23

    Higher eukaryotes have three types of DNA ligases: DNA ligase 1 (Lig1), DNA ligase 3 (Lig3) and DNA ligase 4 (Lig4). While Lig1 and Lig4 are present in all eukaryotes from yeast to human, Lig3 appears sporadically in evolution and is uniformly present only in vertebrates. In the classical, textbook view, Lig1 catalyzes Okazaki-fragment ligation at the DNA replication fork and the ligation steps of long-patch base-excision repair (BER), homologous recombination repair (HRR) and nucleotide excision repair (NER). Lig4 is responsible for DNA ligation at DNA double strand breaks (DSBs) by the classical, DNA-PKcs-dependent pathway of non-homologous end joining (C-NHEJ). Lig3 is implicated in a short-patch base excision repair (BER) pathway, in single strand break repair in the nucleus, and in all ligation requirements of the DNA metabolism in mitochondria. In this scenario, Lig1 and Lig4 feature as the major DNA ligases serving the most essential ligation needs of the cell, while Lig3 serves in the cell nucleus only minor repair roles. Notably, recent systematic studies in the chicken B cell line, DT40, involving constitutive and conditional knockouts of all three DNA ligases individually, as well as of combinations thereof, demonstrate that the current view must be revised. Results demonstrate that Lig1 deficient cells proliferate efficiently. Even Lig1/Lig4 double knockout cells show long-term viability and proliferate actively, demonstrating that, at least in DT40, Lig3 can perform all ligation reactions of the cellular DNA metabolism as sole DNA ligase. Indeed, in the absence of Lig1, Lig3 can efficiently support semi-conservative DNA replication via an alternative Okazaki-fragment ligation pathway. In addition, Lig3 can back up NHEJ in the absence of Lig4, and can support NER and HRR in the absence of Lig1. Supporting observations are available in less elaborate genetic models in mouse cells. Collectively, these observations raise Lig3 from a niche-ligase to a

  18. Direct identification of slowly growing Mycobacterium species by analysis of the intergenic 16S-23S rDNA spacer region (ISR) using a GelCompar II database containing sequence based optimization for restriction fragment site polymorphisms (RFLPs) for 12 enzymes.

    PubMed

    Gürtler, Volker; Harford, Cate; Bywater, Judy; Mayall, Barrie C

    2006-02-01

    To obtain Mycobacterium species identification directly from clinical specimens and cultures, the 16S-23S rDNA spacer (ISR) was amplified using previously published primers that detect all Mycobacterium species. The restriction enzyme that could potentially produce the most restriction fragment length polymorphisms (RFLPs) was determined from all available ISR DNA sequences in GenBank to produce a novel data set of RFLPs for 31 slowly growing Mycobacterium species. Subsequently a GelCompar II database was constructed from RFLPs for 10 enzymes that have been used in the literature to differentiate slowly growing Mycobacterium species. The combination of Sau96I and HaeIII were the best choice of enzymes for differentiating clinically relevant slowly growing Mycobacterium species. A total of 392 specimens were studied by PCR with 195 negative and 197 positive specimens. The ISR-PCR product was digested with HaeIII (previously reported) and Sau96I (new to this study) to obtain a Mycobacterium species identification based on the ISR-RFLPs. The species identification obtained by ISR-RFLP was confirmed by DNA sequencing (isolate numbers are shown in parentheses) for M. avium (3), M. intracellulare (4), M. avium complex (1), M. gordonae (2) and M. tuberculosis (1). The total number of specimens (99) identified were from culture (67), Bactectrade mark 12B culture bottles (11), EDTA blood (3), directly from smear positive specimens (13), tissue (4) and urine (1). Direct species identification was obtained from all 13/13 smear positive specimens. The total number of specimens (99) were identified as M. tuberculosis (41), M. avium (7), M. avium complex (11), M. intracellulare MIN-A (20), M. flavescens (2), M. fortuitum (10), M. gordonae (4), M. shimoidei (1), M. ulcerans (1) and M. chelonae (2). This method reduces the time taken for Mycobacterium species identification from 8-10 weeks for culture and biochemical identification; to 4-6 weeks for culture and ISR-RFLP; to 2 days

  19. Detection of Cryptosporidium and Identification to the Species Level by Nested PCR and Restriction Fragment Length Polymorphism

    PubMed Central

    Coupe, Stephane; Sarfati, Claudine; Hamane, Samia; Derouin, Francis

    2005-01-01

    Cryptosporidiosis is an emerging protozoan disease associated with large waterborne outbreaks. Diagnosis relies on microscopic examination of stools, but this method cannot identify the infecting species of Cryptosporidium. We have developed a test based on nested PCR and restriction fragment length polymorphism (RFLP) that offers simple identification of Cryptosporidium hominis, Cryptosporidium parvum, and most other human infective species in stool samples. Purified C. parvum oocysts were used for PCR development. Extracted DNA was amplified by nested PCR targeting a 214-bp fragment of the 18S RNA gene. Enzymatic restriction sites were identified by bioinformatic analysis of all published Cryptosporidium 18S rRNA sequences. Experiments with spiked stool samples gave an estimated PCR detection limit of one oocyst. Specificity was assessed by testing 68 stool samples from patients with microscopically proven cryptosporidiosis and 31 Cryptosporidium-negative stools. Sixty-seven (98.5%) of the 68 stool samples from patients with microscopically proven cryptosporidiosis and 2 of the other stool samples were positive by PCR and could be genotyped. RFLP analysis identified 36 C. hominis, 19 C. parvum, 8 Cryptosporidium meleagridis, and 6 Cryptosporidium felis or Cryptosporidium canis samples. Species determination in 26 PCR-positive cases was in full agreement with DNA sequencing of the 18S rRNA hypervariable region. The excellent sensitivity of PCR, coupled with the accuracy of RFLP for species identification, make this method a suitable tool for routine diagnosis and genotyping of Cryptosporidium in stools. PMID:15750054

  20. DNA Fragmentation in mammalian cells exposed to various light ions

    NASA Astrophysics Data System (ADS)

    Belli, M.; Cherubini, R.; Dalla Vecchia, M.; Dini, V.; Esposito, G.; Moschini, G.; Sapora, O.; Signoretti, C.; Simone, G.; Sorrentino, E.; Tabocchini, M. A.

    Elucidation of how effects of densely ionizing radiation at cellular level are linked to DNA damage is fundamental for a better understanding of the mechanisms leading to genomic damage (especially chromosome aberrations) and developing biophysical models to predict space radiation effects. We have investigated the DNA fragmentation patterns induced in Chinese hamster V79 cells by 31 keV/μm protons, 123 keV/μm helium-4 ions and γ-rays in the size range 0.023-5.7 Mbp, using calibrated Pulsed Field Gel Electrophoresis (PFGE). The frequency distributions of fragments induced by the charged particles were shifted towards smaller sizes with respct to that induced by comparable doses of γ-rays. The DSB yields, evaluated from the fragments induced in the size range studied, were higher for protons and helium ions than for γ-rays by a factor of about 1.9 and 1.2, respectively. However, these ratios do not adequately reflect the RBE observed on the same cells for inactivation and mutation induced by these beams. This is a further indication for the lack of correlation between the effects exerted at cellular level and the initial yield of DSB. The dependence on radiation quality of the fragmentation pattern suggests that it may have a role in damage reparability. We have analyzed these patterns with a "random breakage" model generalized in order to consider the initial non-random distribution of the DNA molecules. Our results suggest that a random breakage mechanism can describe with a reasonable approximation the DNA fragmentation induced by γ-rays, while the approximation is not so good for light ions, likely due to the interplay between ion tracks and chromatin organization at the loop level.

  1. Mega primer-mediated molecular cloning strategy for chimaeragenesis and long DNA fragment insertion.

    PubMed

    Zhang, Hui; Liu, Chang-Jun; Jiang, Hui; Zhou, Lu; Li, Wen-Ying; Zhu, Ling-Yun; Wu, Lei; Meng, Er; Zhang, Dong-Yi

    2017-04-30

    Molecular cloning methods based on primer and overlap-extension PCR are widely used due to their simplicity, reliability, low cost and high efficiency. In this article, an efficient mega primer-mediated (MP) cloning strategy for chimaeragenesis and long DNA fragment insertion is presented. MP cloning is a seamless, restriction/ligation-independent method that requires only three steps: (i) the first PCR for mega primer generation; (ii) the second PCR for exponential amplification mediated by the mega primers and (iii) DpnI digestion and transformation. Most importantly, for chimaeragenesis, genes can be assembled and constructed into the plasmid vector in a single PCR step. By employing this strategy, we successfully inserted four DNA fragments (approximately 500 bp each) into the same vector simultaneously. In conclusion, the strategy proved to be a simple and efficient tool for seamless cloning.

  2. Cloning of a Streptomyces clavuligerus DNA fragment encoding the cephalosporin 7 alpha-hydroxylase and its expression in Streptomyces lividans.

    PubMed Central

    Xiao, X; Hintermann, G; Häusler, A; Barker, P J; Foor, F; Demain, A L; Piret, J

    1993-01-01

    A 26-mer DNA probe was designed from N-terminal sequence data for the cephalosporin 7 alpha-hydroxylase (CH) of Streptomyces clavuligerus NRRL 3585 and used to screen a DNA library from this organism. The library was constructed in the lambda GEM-11 phage system. After plaque purification and reprobing, positive recombinant phages were chosen for further analysis. Characterization of the cloned DNA by restriction mapping and Southern hybridization showed that a 1.5-kb SalI fragment hybridized to the probe. Polymerase chain reaction assays using this fragment as a template and the probe as a primer indicated that the fragment carries the entire putative CH gene (cmcI). This was confirmed through the expression of CH enzymatic activity when the fragment was introduced into Streptomyces lividans. A putative beta-lactamase activity was detected in S. lividans. Images PMID:8431021

  3. Mutagenicity Assessment of Organophosphates using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism Assay

    PubMed Central

    Bhinder, Preety; Chaudhry, Asha

    2013-01-01

    Objectives: In this study we have evaluated the mutagenicity of organophosphate pesticides acephate, chlorpyrifos, and profenofos using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay with the mosquito Culex quinquefasciatus taken as an experimental model. Materials and Methods: Second instar larvae were treated with LC20 of each pesticide for 24 h and mutations induced in the sequence of mitochondrial COII gene (690bp) were studied from restriction patterns generated with AluI, PacI, and PsiI restriction endonucleases. Results: Variations in the number and size of digested fragments were recorded from treated individuals compared with controls showing that the restriction enzymes created a cut at different locations. In addition, sequences of COII gene from control and treated individuals were also used to confirm the RFLP patterns. From the sequence alignment data, it was found that mutations caused the destruction and generation of restriction sites in the gene sequence of treated individuals. Conclusion: This study indicates that all the three pesticides had potential to induce mutations in the normal sequence of COII gene and also advocates the use of PCR-RFLP assay as an efficient, rapid, and sensitive technique to detect mutagenicity of pesticides. PMID:24403735

  4. Biological meaning of ubiquitination and DNA fragmentation in human spermatozoa.

    PubMed

    Muratori, Monica; Marchiani, Sara; Criscuoli, Luciana; Fuzzi, Beatrice; Tamburino, Lara; Dabizzi, Sara; Pucci, Chiara; Evangelisti, Paolo; Forti, Gianni; Noci, Ivo; Baldi, Elisabetta

    2007-01-01

    The ubiquitin-proteasome is an ubiquitous system mainly devoted to protein degradation. The presence of ubiquitinated proteins in male gametes suggests a role for this system also in reproduction. Available evidence indicate that ubiquitin in spermatozoa may have a role in semen quality control, as ubiquitinated defective spermatozoa in the epididymis are subsequently phagocytosed by epididymal epithelial cells. Moreover, a role both in the regulation of mitochondrial inheritance in mammals (paternal mitochondria are eliminated and their ubiquitination appears to be important for this process) and in sperm-oocyte interaction at fertilization (which is inhibited by an inhibitor of proteasome) have been also suggested. We found that both morphologically normal and abnormal human spermatozoa in semen may be ubiquitinated and that the percentage of ubiquitinated sperm in the ejaculate positively correlates with normal morphology and motility, suggesting that sperm ubiquitination may have a positive role in sperm functions. It remains to be defined if and which patterns of ubiquitination of spermatozoa may distinguish between the different biological functions of this system. In an attempt to answer this question, we set up a method to detect simultaneously ubiquitination and DNA fragmentation by FACScan since the latter parameter is related to a poor quality of semen; in particular, abnormal morphology. We found that DNA fragmented human spermatozoa are also ubiquitinated. Studies are in progress to determine the correlation between the fraction of ubiquitinated-non DNA fragmented spermatozoa and parameters of semen analysis.

  5. Visualizing ion relaxation in the transport of short DNA fragments.

    PubMed Central

    Allison, S A; Wang, H; Laue, T M; Wilson, T J; Wooll, J O

    1999-01-01

    Ion relaxation plays an important role in a wide range of phenomena involving the transport of charged biomolecules. Ion relaxation is responsible for reducing sedimentation and diffusion constants, reducing electrophoretic mobilities, increasing intrinsic viscosities, and, for biomolecules that lack a permanent electric dipole moment, provides a mechanism for orienting them in an external electric field. Recently, a numerical boundary element method was developed to solve the coupled Navier-Stokes, Poisson, and ion transport equations for a polyion modeled as a rigid body of arbitrary size, shape, and charge distribution. This method has subsequently been used to compute the electrophoretic mobilities and intrinsic viscosities of a number of model proteins and DNA fragments. The primary purpose of the present work is to examine the effect of ion relaxation on the ion density and fluid velocity fields around short DNA fragments (20 and 40 bp). Contour density as well as vector field diagrams of the various scalar and vector fields are presented and discussed at monovalent salt concentrations of 0.03 and 0.11 M. In addition, the net charge current fluxes in the vicinity of the DNA fragments at low and high salt concentrations are briefly examined and discussed. PMID:10233066

  6. An automated sample preparation system with mini-reactor to isolate and process submegabase fragments of bacterial DNA.

    PubMed

    Mollova, Emilia T; Patil, Vishal A; Protozanova, Ekaterina; Zhang, Meng; Gilmanshin, Rudolf

    2009-08-15

    Existing methods for extraction and processing of large fragments of bacterial genomic DNA are manual, time-consuming, and prone to variability in DNA quality and recovery. To solve these problems, we have designed and built an automated fluidic system with a mini-reactor. Balancing flows through and tangential to the ultrafiltration membrane in the reactor, cells and then released DNA can be immobilized and subjected to a series of consecutive processing steps. The steps may include enzymatic reactions, tag hybridization, buffer exchange, and selective removal of cell debris and by-products of the reactions. The system can produce long DNA fragments (up to 0.5 Mb) of bacterial genome restriction digest and perform DNA tagging with fluorescent sequence-specific probes. The DNA obtained is of high purity and floating free in solution, and it can be directly analyzed by pulsed-field gel electrophoresis (PFGE) or used in applications requiring submegabase DNA fragments. PFGE-ready samples of DNA restriction digests can be produced in as little as 2.1 h and require less than 10(8) cells. All fluidic operations are automated except for the injection of the sample and reagents.

  7. Determination of genotypes of hepatitis C virus in Venezuela by restriction fragment length polymorphism.

    PubMed Central

    Pujol, F H; Loureiro, C L; Devesa, M; Blitz, L; Parra, K; Beker, S; Liprandi, F

    1997-01-01

    Hepatitis C virus genotypes in Venezuela were analyzed by restriction fragment length polymorphism in the 5' noncoding region. The absence of BstUI digestion was found to be a useful marker for genotype 2 specimens. From 122 serum samples, 66, 20, and 2.5% were classified as genotypes 1, 2, and 3, respectively; 0.8% were classified as genotype 4; and 10% appeared to be mixed infections. PMID:9196212

  8. Detection of Irradiated Food: DNA Fragmentation in Grapefruits

    NASA Astrophysics Data System (ADS)

    Delincée, Henry

    1998-06-01

    Employing the simple microgel electrophoresis of single cells - `comet assay' - on grapefruit seeds enabled a rapid identification of irradiated fruits. Fruits were exposed to radiation doses of 0, 0.1, 0.2, 0.3, 0.4 and 0.5 kGy covering the range of potential commercial irradiation for insect disinfestation and quarantine purposes. Seeds were isolated, crushed, and the cells embedded in an agarose layer. After lysis of the cells, they were subjected to microgel electrophoresis for 2.5 minutes, and then stained. Fruits irradiated with 0.2 kGy and higher doses showed typical DNA fragmentation, the DNA fragments stretching or migrating out of the cells forming a tail towards the anode, giving the damaged cells an appearance of a comet. With increasing dose a longer extension of the DNA from the nucleus towards the anode is observed. Undamaged cells will appear as intact nuclei without tails. The DNA comet assay is thus a rapid and inexpensive screening technique to detect irradiated grapefruits. Suspected samples may subsequently be analysed by officially validated methods for detection of irradiated foods.

  9. Taxonomic and ecological discrimination of Fagaceae species based on internal transcribed spacer polymerase chain reaction-restriction fragment length polymorphism.

    PubMed

    Coutinho, João Paulo; Carvalho, Ana; Lima-Brito, José

    2014-11-26

    The internal transcribed spacer (ITS) of ribosomal DNA has been used to confirm taxonomic classifications and define phylogenies in several plant species following sequencing or polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) techniques. In this study, co-dominant ITS PCR-RFLP molecular markers were produced in 30 Fagaceae individuals belonging to the Castanea, Fagus and Quercus genera in order to assess the potential of this technique for taxonomic discrimination and determination of phylogenies. The complete ITS region (ITS1-5.8S rRNA-ITS2) was amplified in most of the Fagaceae individuals as a single fragment of ∼700 bp. The ITS amplified products were digested with nine restriction enzymes, but only four (HaeIII, HpaII, TaqI and Sau96I) produced polymorphic/discriminative patterns. The total expected heterozygosity (HE) was 20.31 % and the gene diversity (I), 32.97 %. The ITS polymorphism was higher within the Quercus genus (85.3 %). The ITS PCR-RFLP markers clustered the Fagaceae species according to genus or infrageneric group (in the case of Quercus sp. individuals). Five oaks did not cluster in line with the adopted infrageneric classification, but three of these were grouped according to their actual ecological distributions. The ITS PCR-RFLP markers indicated their potential for phylogenetic studies since all Fagaceae individuals were discriminated according to genus, and most of the oaks were clustered according to infrageneric group or ecological area.

  10. Taxonomic and ecological discrimination of Fagaceae species based on internal transcribed spacer polymerase chain reaction–restriction fragment length polymorphism

    PubMed Central

    Coutinho, João Paulo; Carvalho, Ana; Lima-Brito, José

    2015-01-01

    The internal transcribed spacer (ITS) of ribosomal DNA has been used to confirm taxonomic classifications and define phylogenies in several plant species following sequencing or polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP) techniques. In this study, co-dominant ITS PCR–RFLP molecular markers were produced in 30 Fagaceae individuals belonging to the Castanea, Fagus and Quercus genera in order to assess the potential of this technique for taxonomic discrimination and determination of phylogenies. The complete ITS region (ITS1-5.8S rRNA-ITS2) was amplified in most of the Fagaceae individuals as a single fragment of ∼700 bp. The ITS amplified products were digested with nine restriction enzymes, but only four (HaeIII, HpaII, TaqI and Sau96I) produced polymorphic/discriminative patterns. The total expected heterozygosity (HE) was 20.31 % and the gene diversity (I), 32.97 %. The ITS polymorphism was higher within the Quercus genus (85.3 %). The ITS PCR–RFLP markers clustered the Fagaceae species according to genus or infrageneric group (in the case of Quercus sp. individuals). Five oaks did not cluster in line with the adopted infrageneric classification, but three of these were grouped according to their actual ecological distributions. The ITS PCR–RFLP markers indicated their potential for phylogenetic studies since all Fagaceae individuals were discriminated according to genus, and most of the oaks were clustered according to infrageneric group or ecological area. PMID:25429047

  11. DNA Flexibility Studied by Covalent Closure of Short Fragments into Circles

    NASA Astrophysics Data System (ADS)

    Shore, David; Langowski, Jorg; Baldwin, Robert L.

    1981-08-01

    The ring closure probability, or j factor, has been measured for DNA restriction fragments of defined sequence bearing EcoRI cohesive ends and ranging in size from 126 to 4361 base pairs (bp). The j factor is defined as the ratio of the equilibrium constants for cyclization and for bimolecular association via the cohesive ends. The end-joining reactions are fast compared to covalent closure of the cohesive ends by T4 DNA ligase. The rate of ligase closure is shown to be proportional to the equilibrium fraction of DNA molecules with joined cohesive ends, both in cyclization and in bimolecular association reactions. The j factor changes by less than 10-fold between 242 and 4361 bp, whereas it decreases by more than 100-fold between 242 and 126 bp as the DNA reaches the size range of the persistence length (150 bp). As regards ring closure, short DNA fragments are surprisingly flexible. These data are in good agreement with predictions by others for the ring closure probability of a wormlike chain.

  12. Microfluidic chip for stacking, separation and extraction of multiple DNA fragments.

    PubMed

    Wu, Ruige; Seah, Y P; Wang, Zhiping

    2016-03-11

    A disposable integrated microfluidic device was developed for rapid sample stacking, separation and extraction of multiple DNA fragments from a relatively large amount of sample. Isotachophoresis hyphenated gel electrophoresis (ITP-GE) was used to pre-concentrate and separate DNA fragments, followed by extraction of pure DNA fragments with electroelution on-chip. DNA fragments of 200bp, 500bp and 1kbp were successfully separated and collected in the extraction chamber within 25min. The extraction efficiency obtained from the chip was 49.9%, 52.1% and 53.7% for 200bp, 500bp and 1kbp DNA fragments, respectively. The extracted DNA fragments exhibited compatibility with downstream enzymatic reactions, for example PCR. The chip was also used to extract DNA fragments with specific size range from sheared genomic DNA and demonstrated similar performance to that using traditional gel cutting method. The whole assay can finish in 32min, 6 times faster than traditional method.

  13. From organic superconductors to DNA: Fragment orbital-based model

    NASA Astrophysics Data System (ADS)

    Castet, Frédéric; Ducasse, Laurent; Fritsch, Alain

    A semi-empirical valence bond/Hartree-Fock (VB/HF) method is developed to calculate one- and two-electron interactions between molecular fragments in conducting supramolecular stacks. This fragment orbital-based formalism allows for consistent extraction of an effective Hamiltonian defined as a "frontier orbital" model. This Hamiltonian quantitatively describes transfer and electrostatic interactions between conducting electrons, while reducing the active space so dramatically that the electronic eigenstates of very large systems may be investigated. The capabilities of the VB/HF method are illustrated on two different supramolecular stacks involving a π-π interacting fragment. In the first part of this study, the framework of the VB/HF method is used to evaluate the relative magnitude of the electronic interactions between conduction electrons in organic conductors and superconductors derived from Bechgaard salts. In the second part of this study, the VB/HF formalism is extended to derive an effective model for conduction holes along doped DNA double strands. Transferable intra- and intersite parameters were first evaluated from VB/HF calculations carried out on nucleoside pairs. From this interaction databank, the effective Hamiltonian of any type of nucleoside sequence can be defined. The thermalized charge distribution for a single hole delocalized along a DNA sequence containing 240 Watson-Crick pairs is then calculated and compared with the experimental yields of damage revealed by photocleavage experiments.

  14. Characterization of Erwinia chrysanthemi by pectinolytic isozyme polymorphism and restriction fragment length polymorphism analysis of PCR-amplified fragments of pel genes.

    PubMed Central

    Nassar, A; Darrasse, A; Lemattre, M; Kotoujansky, A; Dervin, C; Vedel, R; Bertheau, Y

    1996-01-01

    Conserved regions about 420 bp long of the pelADE cluster specific to Erwinia chrysanthemi were amplified by PCR and used to differentiate 78 strains of E. chrysanthemi that were obtained from different hosts and geographical areas. No PCR products were obtained from DNA samples extracted from other pectinolytic and nonpectinolytic species and genera. The pel fragments amplified from the E. chrysanthemi strains studied were compared by performing a restriction fragment length polymorphism (RFLP) analysis. On the basis of similarity coefficients derived from the RFLP analysis, the strains were separated into 16 PCR RFLP patterns grouped in six clusters, These clusters appeared to be correlated with other infraspecific levels of E. chrysanthemi classification, such as pathovar and biovar, and occasionally with geographical origin. Moreover, the clusters correlated well with the polymorphism of pectate lyase and pectin methylesterase isoenzymes. While the pectin methylesterase profiles correlated with host monocot-dicot classification, the pectate lyase polymorphism might reflect the cell wall microdomains of the plants belonging to these classes. PMID:8779560

  15. Taenia saginata: differential diagnosis of human taeniasis by polymerase chain reaction-restriction fragment length polymorphism assay.

    PubMed

    Nunes, Cáris Maroni; Dias, Ana Karina Kerche; Dias, Francisca Elda Ferreira; Aoki, Sérgio Moraes; de Paula, Henrique Borges; Lima, Luis Gustavo Ferraz; Garcia, José Fernando

    2005-08-01

    Speciation of Taenia in human stool is important because of their different clinical and epidemiological features. DNA analysis has recently become possible which overcomes the problems of differentiating human taeniid cestodes morphologically. In the present study, we evaluated PCR coupled to restriction fragment length polymorphism to differentiate Taenia solium from Taenia saginata eggs present in fecal samples from naturally infected patients. A different DraI-RFLP pattern: a two-band pattern (421 and 100 bp) for T. saginata and a three-band pattern (234, 188, and 99 bp) for T. solium was observed allowing the two species to be separated. The lower detection limit of the PCR-RFLP using a non-infected fecal sample prepared with a given number of T. saginata eggs was 34 eggs in 2 g stool sediment. The 521 bp mtDNA fragment was detected in 8 out of 12 Taenia sp. carriers (66.6%). Of these, three showed a T. solium pattern and five a T. saginata pattern.

  16. Ion induced fragmentation cross-sections of DNA constituents

    NASA Astrophysics Data System (ADS)

    Rudek, Benedikt; Arndt, Alexander; Bennett, Daniel; Wang, Mingjie; Rabus, Hans

    2015-10-01

    Proton collision with chemical analogs for the base, the sugar and the phosphor residue of the DNA, namely pyrimidine, tetrahydrofuran and trimethyl phosphate, respectively, has been investigated. The impact energies ranged from 300 keV up to 16 MeV. For the first time, relative fragmentation cross-sections for proton impact are reported for tetrahydrofuran and trimethyl phosphate; previously reported cross sections for pyrimidine are extended for energies beyond 2500 keV. Ionization of tetrahydrofuran leads to a ring break in about 80% of all events, trimethyl phosphate predominantly fragments by bond cleavage to one of the three methyl-groups and for pyrimidine the parent ion has the highest abundance. Such comparison supports earlier findings that the sugar is the weak spot for strand breaks.

  17. Does varicocelectomy affect DNA fragmentation in infertile patients?

    PubMed Central

    Telli, Onur; Sarici, Hasmet; Kabar, Mucahit; Ozgur, Berat Cem; Resorlu, Berkan; Bozkurt, Selen

    2015-01-01

    Introduction: The aims of this study were to investigate the effect of varicocelectomy on DNA fragmentation index and semen parameters in infertile patients before and after surgical repair of varicocele. Materials and Methods: In this prospective study, 72 men with at least 1-year history of infertility, varicocele and oligospermia were examined. Varicocele sperm samples were classified as normal or pathological according to the 2010 World Health Organization guidelines. The acridine orange test was used to assess the DNA fragmentation index (DFI) preoperatively and postoperatively. Results: DFI decreased significantly after varicocelectomy from 34.5% to 28.2% (P = 0.024). In addition all sperm parameters such as mean sperm count, sperm concentration, progressive motility and sperm morphology significantly increased from 19.5 × 106 to 30.7 × 106, 5.4 × 106/ml to 14.3 × 106/ml, and 19.9% to 31.2% (P < 0.001) and 2.6% to 3.1% (P = 0.017). The study was limited by the loss to follow-up of some patients and unrecorded pregnancy outcome due to short follow-up. Conclusion: Varicocele causes DNA-damage in spermatozoa. We suggest that varicocelectomy improves sperm parameters and decreases DFI. PMID:25878412

  18. Distinguishing Heterodera filipjevi and H. avenae using polymerase chain reaction-restriction fragment length polymorphism and cyst morphology.

    PubMed

    Yan, Guiping; Smiley, Richard W

    2010-03-01

    The cereal cyst nematodes Heterodera filipjevi and H. avenae impede wheat production in the Pacific Northwest (PNW). Accurate identification of cyst nematode species and awareness of high population density in affected fields are essential for designing effective control measures. Morphological methods for differentiating these species are laborious. These species were differentiated using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) of internal transcribed spacer (ITS)-ribosomal (r)DNA with up to six restriction endonucleases (TaqI, HinfI, PstI, HaeIII, RsaI, and AluI). The method was validated by inspecting underbridge structures of cyst vulval cones. Grid soil sampling of an Oregon field infested by both species revealed that H. filipjevi was present at most of the infested grid sites but mixtures of H. avenae and H. filipjevi also occurred. These procedures also detected and differentiated H. filipjevi and H. avenae in soil samples from nearby fields in Oregon and H. avenae in samples from Idaho and Washington. Intraspecific polymorphism was not observed within H. filipjevi or PNW H. avenae populations based on the ITS-rDNA. However, intraspecific variation was observed between H. avenae populations occurring in the PNW and France. Methods described here will improve detection and identification efficiencies for cereal cyst nematodes in wheat fields.

  19. Improved Polymerase Chain Reaction-restriction Fragment Length Polymorphism Genotyping of Toxic Pufferfish by Liquid Chromatography/Mass Spectrometry

    PubMed Central

    Miyaguchi, Hajime

    2016-01-01

    An improved version of a polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) method for genotyping toxic pufferfish species by liquid chromatography/electrospray ionization mass spectrometry (LC/ESI-MS) is described. DNA extraction is carried out using a silica membrane-based DNA extraction kit. After the PCR amplification using a detergent-free PCR buffer, restriction enzymes are added to the solution without purifying the reaction solution. A reverse-phase silica monolith column and a Fourier transform high resolution mass spectrometer having a modified Kingdon trap analyzer are employed for separation and detection, respectively. The mobile phase, consisting of 400 mM 1,1,1,3,3,3-hexafluoro-2-propanol, 15 mM triethylamine (pH 7.9) and methanol, is delivered at a flow rate of 0.4 ml/min. The cycle time for LC/ESI-MS analysis is 8 min including equilibration of the column. Deconvolution software having an isotope distribution model of the oligonucleotide is used to calculate the corresponding monoisotopic mass from the mass spectrum. For analysis of oligonucleotides (range 26-79 nucleotides), mass accuracy was 0.62 ± 0.74 ppm (n = 280) and excellent accuracy and precision were sustained for 180 hr without use of a lock mass standard. PMID:27684516

  20. Detection of disease-specific restriction fragment length polymorphisms in pemphigus vulgaris linked to the DQwl and DQw3 alleles of the HLA-D region

    SciTech Connect

    Szafer, F.; Brautbar, C.; Tzfoni, E.; Frankel, G.; Sherman, L.; Cohen, I.; Hacham-Zadeh, S.; Aberer, W.; Tappeiner, G.; Holubar, K.; Steinman, L.

    1987-09-01

    Pemphigus vulgaris in Israeli Ashkenazi and non-Ashkenazi Jews and in Austrian non-Jewish patients is strongly associated with the DR4 and DRw6 alleles of the HLA-D region class II genes. Restriction fragment length polymorphism analysis was undertaken with DQ..beta.., DQ..cap alpha.., and DR..beta.. cDNA probes. Hybridization with the DQ..beta.. probe identifies Pvu II, BamHI, and EcoRV fragments that absolutely discriminate pemphigus vulgaris patients from healthy DR-, DQ-, and ethnic-matched controls. In contrast the DQ..cap alpha.. and DR..beta.. probes failed to identify disease-specific restriction fragment length polymorphism fragments. These studies indicate that DQw1 and DQw3 polymorphisms carried by pemphigus vulgaris patients may be directly involved in predisposition to the disease or may be tightly linked to the susceptibility gene itself. To our knowledge, this is the first example of an HLA restriction fragment length polymorphism that is highly associated with susceptibility to autoimmune disease.

  1. Transformation of rat embryo fibroblasts by cloned polyoma virus DNA fragments containing only part of the early region.

    PubMed Central

    Hassell, J A; Topp, W C; Rifkin, D B; Moreau, P E

    1980-01-01

    Recombinant plasmids containing either the entire polyoma viral genome or one or the other of the two HindIII fragments of polyoma virus DNA were constructed and cloned in Escherichia coli X1776, and their DNAs were individually tested for the capacity to transform an established line of rat cells. The recombinant plasmids containing the entire polyoma genome and those containing the HindIII-1 fragment of polyoma DNA (45-1.4 map units) efficiently transform rat cells, whereas the plasmids containing the HindIII-2 fragment (1.4-45.0 map units) do not. The properties of many independent transformed cell lines established by infection with the cloned HindIII-1 fragment were determined. In contrast to the parent cell line, rat cells transformed with the cloned HindIII-1 fragment grow to high saturation densities, form colonies with high efficiency in dilute agar suspension, produce high levels of plasminogen activator, and display a disorganized arrangement of actin cables. By all criteria examined, these cells transformed by fragments are indistinguishable from cells transformed by whole polyoma viral DNA. Cellular DNA prepared from many HindIII-1 fragment-transformed cell lines was analyzed for the presence and arrangement of polyoma viral sequences by Southern blot-hybridization. In all cases examined, only those viral sequences contained within the HindIII-1 fragment of polyoma DNA were detected. These data establish a strong correlation between polyoma DNA sequences mapping within a restricted portion of the early region and the induction and maintenance of the transformed phenotype. Images PMID:6254006

  2. High-sensitivity capillary electrophoresis of double-stranded DNA fragments using monomeric and dimeric fluorescent intercalating dyes

    SciTech Connect

    Zhu, H.; Clark, S.M.; Benson, S.C.; Rye, H.S.; Glazer, A.N.; Mathies, R.A. )

    1994-07-01

    Fluorescence-detected capillary electrophoresis separations of [phi]X174/HaeIII DNA restriction fragments have been performed using monomeric and dimeric intercalating dyes. Replaceable hydroxyethyl cellulose solutions were used as the separation medium. Confocal fluorescence detection was performed following 488-nm laser excitation. The limits of DNA detection for on-column staining with monomeric dyes (ethidium bromide, two propidium dye derivatives, oxazole yellow, thiazole orange, and a polycationic thiazole orange derivative) were determined. The thiazole orange dyes provide the most sensitive detection with limiting sensitivities of 2-4 amol of DNA base pairs per band, and detection of the 603-bp fragment was successful, injecting from [phi]X174/HaeIII samples containing only 1-2 fg of this fragment per microliter. Separations of preformed DNA-dimeric dye complexes were also performed. The breadth of the bands observed in separations of preformed DNA-dimeric dye complexes is due to the presence of DNA fragments with different numbers of bound dye molecules that can be resolved as closely spaced subbands in many of our separations. The quality of these DNA-dye complex separations can be dramatically improved by performing the electrophoresis with 9-aminoacridine (9AA) in the column and running buffers. 43 refs., 10 figs., 1 tab.

  3. Characterization of human glucocorticoid receptor complexes formed with DNA fragments containing or lacking glucocorticoid response elements

    SciTech Connect

    Tully, D.B.; Cidlowski, J.A. )

    1989-03-07

    Sucrose density gradient shift assays were used to study the interactions of human glucocorticoid receptors (GR) with small DNA fragments either containing or lacking glucocorticoid response element (GRE) DNA consensus sequences. When crude cytoplasmic extracts containing ({sup 3}H)triamcinolone acetonide (({sup 3}H)TA) labeled GR were incubated with unlabeled DNA under conditions of DNA excess, a GRE-containing DNA fragment obtained from the 5' long terminal repeat of mouse mammary tumor virus (MMTV LTR) formed a stable 12-16S complex with activated, but not nonactivated, ({sup 3}H)TA receptor. By contrast, if the cytosols were treated with calf thymus DNA-cellulose to deplete non-GR-DNA-binding proteins prior to heat activation, a smaller 7-10S complex was formed with the MMTV LTR DNA fragment. Activated ({sup 3}H)TA receptor from DNA-cellulose pretreated cytosols also interacted with two similarly sized fragments from pBR322 DNA. Stability of the complexes formed between GR and these three DNA fragments was strongly affected by even moderate alterations in either the salt concentration or the pH of the gradient buffer. Under all conditions tested, the complex formed with the MMTV LTR DNA fragment was more stable than the complexes formed with either of the pBR322 DNA fragments. Together these observations indicate that the formation of stable complexes between activated GR and isolated DNA fragments requires the presence of GRE consensus sequences in the DNA.

  4. Phylogenomics of caspase-activated DNA fragmentation factor

    SciTech Connect

    Eckhart, Leopold . E-mail: leopold.eckhart@meduniwien.ac.at; Fischer, Heinz; Tschachler, Erwin

    2007-04-27

    The degradation of nuclear DNA by DNA fragmentation factor (DFF) is a key step in apoptosis of mammalian cells. Using comparative genomics, we have here determined the evolutionary history of the genes encoding the two DFF subunits, DFFA (also known as ICAD) and DFFB (CAD). Orthologs of DFFA and DFFB were identified in Nematostella vectensis, a representative of the primitive metazoan clade cnidarians, and in various vertebrates and insects, but not in representatives of urochordates, echinoderms, and nematodes. The domains mediating the interaction of DFFA and DFFB, a caspase cleavage site in DFFA, and the amino acid residues critical for endonuclease activity of DFFB were conserved in Nematostella. These findings suggest that DFF has been a part of the primordial apoptosis system of the eumetazoan common ancestor and that the ancient cell death machinery has degenerated in several evolutionary lineages, including the one leading to the prototypical apoptosis model, Caenorhabditis elegans.

  5. Cloning of DNA fragments: ligation reactions in agarose gel.

    PubMed

    Furtado, Agnelo

    2014-01-01

    Ligation reactions to ligate a desired DNA fragment into a vector can be challenging to beginners and especially if the amount of the insert is limiting. Although additives known as crowding agents, such as PEG 8000, added to the ligation mixes can increase the success one has with ligation reactions, in practice the amount of insert used in the ligation can determine the success or the failure of the ligation reaction. The method described here, which uses insert DNA in gel slice added directly into the ligation reaction, has two benefits: (a) using agarose as the crowding agent and (b) reducing steps of insert purification. The use of rapid ligation buffer and incubation of the ligation reaction at room temperature greatly increase the efficiency of the ligation reaction even for blunt-ended ligation.

  6. Molecular cloning of bovine thyroglobulin complementary DNA. Characterization of 2500-base-pair and 1900-base-pair fragments.

    PubMed

    Christophe, D; Brocas, H; Gannon, F; de Martynoff, G; Pays, E; Vassart, G

    1980-10-01

    Double-stranded thyroglobulin complementary DNA (cDNA) was synthesized from purified 33-S bovine thyroglobulin mRNA. This synthetic structural gene has previously been shown to contain three sites for the restriction endonuclease HindIII, yielding two internal fragments of 1900 and 2500 base pairs respectively. Recombinant molecules were prepared by ligating the HindIII-restricted cDNA to the plasmid pBR322 which had been linearized by the same enzyme. When Escherichia coli was transformed with this mixture, it yielded two kinds of colonies each harboring recombinant plasmids containing one of the two cDNA fragments. Both recombinant molecules hybridized specifically to translatable thyroglobulin mRNA. Sequence homology between the two cloned DNAs could not be detected by cross-hybridization experiments; this argues against the existence of internal structural repetition in thyroglobulin subunits. Together, the two cloned DNA fragments represent 55% of the 8000-base-pair double-stranded thyroglobulin DNA.

  7. Rapid identification of filamentous actinomycetes to the genus level using genus-specific 16S rRNA gene restriction fragment patterns.

    PubMed

    Cook, Andrew E; Meyers, Paul R

    2003-11-01

    A rapid method for identifying filamentous actinomycete genera was developed based on 16S rRNA gene restriction fragment patterns. The patterns were generated by using specific restriction endonucleases to perform in silico digestions on the 16S rRNA gene sequences of all validly published filamentous actinomycete species. The method was applied to identifying actinomycete isolates from soil. Amplified 16S rDNA of soil actinomycetes was restricted with selected endonucleases and electrophoresed on agarose gels. The restriction fragment patterns of the unknown isolates were easily compared to the established patterns. Significantly, the genus Streptomyces could be differentiated from all other actinomycete genera by using only four restriction endonucleases, Sau3AI, AsnI, KpnI and SphI. This could be achieved in a time period of as little as a week, following PCR-template DNA isolation by a simple method. The identification method allowed unknown, non-Streptomyces soil isolates to be identified to a genus or small subgroup of genera. The genera in these subgroups could, in some cases, be distinguished by virtue of colony-morphology differences.

  8. Cavitation Enhancing Nanodroplets Mediate Efficient DNA Fragmentation in a Bench Top Ultrasonic Water Bath

    PubMed Central

    Malc, Ewa P.; Jayakody, Chatura N.; Tsuruta, James K.; Mieczkowski, Piotr A.; Janzen, William P.; Dayton, Paul A.

    2015-01-01

    A perfluorocarbon nanodroplet formulation is shown to be an effective cavitation enhancement agent, enabling rapid and consistent fragmentation of genomic DNA in a standard ultrasonic water bath. This nanodroplet-enhanced method produces genomic DNA libraries and next-generation sequencing results indistinguishable from DNA samples fragmented in dedicated commercial acoustic sonication equipment, and with higher throughput. This technique thus enables widespread access to fast bench-top genomic DNA fragmentation. PMID:26186461

  9. Complementary addressed modification and cleavage of a single stranded DNA fragment with alkylating oligonucleotide derivatives.

    PubMed Central

    Vlassov, V V; Zarytova, V F; Kutiavin, I V; Mamaev, S V; Podyminogin, M A

    1986-01-01

    A single stranded DNA fragment was modified with alkylating derivatives of oligonucleotides complementary to a certain nucleotide sequences in the fragment. The derivatives carried aromatic 2-chloroethylamino groups at their 3'- or 5'-terminal nucleotide residues. Some of the derivatives carried both alkylating group and intercalating phenazine group which stabilized complementary complexes. It was found that these oligonucleotide derivatives modify the DNA fragment in a specific way near the target complementary nucleotide sequences, and the DNA fragment can be cleaved at the alkylated nucleotides positions. Alkylating derivatives carrying phenazine groups were found to be the most efficient in reaction with the DNA fragment. Images PMID:3714471

  10. Modified gel preparation for distinct DNA fragment analysis in agarose gel electrophoresis.

    PubMed

    Lee, S V; Bahaman, A R

    2010-08-01

    Agarose gel electrophoresis is the standard method that is used to separate, identify, and purify DNA fragments. However, this method is time-consuming and capable of separating limited range of fragments. A new technique of gel preparation was developed to improve the DNA fragment analysis via electrophoresis.

  11. Physical map and strand polarity of specific fragments of adenovirus-associated virus DNA produced by endonuclease R-EcoRI.

    PubMed Central

    Carter, B J; Khoury, G; Denhardt, D T

    1975-01-01

    Cleavage of adenovirus-associated virus type 2 (AAV2) DNA linear duplex monomers with the restriction endonuclease R-EcoRI yielded three fragments, A, B, and C, having approximate mol wt of 1.6 X 10(6), 1.1 X 10(6), and 1.3 X 10(5), respectively. Radioactive labeling the 5' termini of AAV DNA before cleavage with R-EcoRI showed that A and B were terminal fragments and C was internal. Separation of the complementary strands of fragments A and B showed that A contained the 5' terminus of the minus strand and the 3' terminus of the plus strand, and conversely for fragment B. The physical map of the AAV R-EcoRI fragments can thus be unambiguously determined and is drawn with B at the left-hand and A at the right-hand end. On this map, transcription of stable AAV mRNA from the minus strand proceeds from left to right, beginning in fragment B and terminating in fragment A. The asymmetry in distribution of thymidine between the AAV DNA plus and minus strands is preferentially located in fragment A, which represents the right-hand half of the duplex molecule. These experiments enable preparative separation of all four single-strand termini of AAV DNA and provide a basis for orientation of fragment maps derived by cleavage with other restriction enzymes. PMID:1159894

  12. Dependence on radiation quality of DNA fragmentation spectra

    NASA Astrophysics Data System (ADS)

    Campa, Alessandro; Ottolenghi, Andrea; Alloni, Daniele; Ballarini, Francesca; Belli, Mauro; Esposito, Giuseppe; Facoetti, Angelica; Friedland, Werner; Liotta, Marco; Paretzke, Herwig

    Energy deposition by radiation initially gives rise to cellular critical lesions such as DNA doublestrand breaks (DSB), that later lead to the formation of relevant biological endpoints. Studies on fragment size distributions induced by radiations of various qualities can be of great help in linking the characteristics of radiation to cellular endpoints, providing information for understanding the main mechanisms of cell damage. Here we are concerned with the damage induced by heavy charged particles; this issue is very important in the field of radioprotection of astronauts participating in long term space missions, besides being relevant also in other fields, like hadrontherapy. Galactic Cosmic Rays contain a large component of high-LET particles (HZE), e.g. helium and carbon ions, as well as highcharge particles such as iron ions. These particles are characterized by complex track structures with energy depositions not only along the path of the primary particle, but also at relatively large distance form the path, due to the presence of high energy secondary electrons. In this work we have simulated the irradiation of human fibroblasts with γ-rays, protons, helium, carbon and iron ions at a fixed dose with the biophysical Monte Carlo code PARTRAC,and calculated the induction of DSB. The PARTRAC code includes accurate representation of the chromatin geometry and of the physical and physico-chemical processes associated with the energy deposition by radiation. The results of a first validation of the code have been reported in A. Campa et al. (2005) and D. Alloni et al. (2007a, 2007b). DNA fragment spectra were calculated based on the DSB induction patterns and compared in particular for particles of the same specific energy and for particles of the same LET. Special emphasis has been directed to the calculation of very small fragments (< 1 kbp) that are not detectable by the most common experimental techniques and that can significantly influence the RBE

  13. Restriction fragment length polymorphism (RFLP) of two HLA-B-associated transcripts (BATs) genes in healthy Danes.

    PubMed

    Fugger, L; Morling, N; Ryder, L P; Jakobsen, B K; Svejgaard, A; Spies, T; Strominger, J L

    1990-08-01

    The restriction fragment length polymorphism (RFLP) of the two human HLA-B-associated transcripts (BATs) genes, BAT1 and BAT2, was investigated using 5 different restriction enzymes and two human BAT1 and BAT2 cDNA probes. Two of the enzymes, NcoI and RsaI, revealed polymorphic patterns which were investigated in healthy Danes. The cDNA/restriction enzyme combination BAT1/NcoI identifies polymorphic bands at 12 kb, 8 kb, 2.5 kb, and 1.1 kb, while the BAT2/RsaI combination identifies polymorphic bands at 3.3 kb, 2.7 kb, 2.3 kb, and 0.9 kb. The frequencies of these markers were determined in 90 unrelated Danes. Co-dominant segregation and allelic behavior was seen for the BAT1/NcoI 12 kb and 8 kb bands and the BAT2/RsaI 2.7 kb and 2.3 kb bands, respectively. It is possible that the BAT2/RsaI 3.3 kb band represents a rare allele of the BAT2/RsaI system. The BAT2/RsaI 2.3 kb marker was strongly negatively associated with HLA-B8 and HLA-DR3 while there were no strong associations between the BAT1 and BAT2 markers, but the BAT2/RsaI 2.7 kb marker was strongly positively associated with the TNF alpha/NcoI 5.5 kb marker, which in turn is positively associated with HLA-B8 and HLA-DR3. The negative associations between the BAT2/RsaI 2.3 kb marker and HLA-B8 and HLA-DR3 raise the question as to whether this BAT allele may play a role in protecting against certain autoimmune diseases.

  14. Size-selective separation of DNA fragments by using lysine-functionalized silica particles.

    PubMed

    Liu, Lingling; Guo, Zilong; Huang, Zhenzhen; Zhuang, Jiaqi; Yang, Wensheng

    2016-02-25

    In this work, a facile and efficient approach has been demonstrated for size-selective separation of DNA fragments by using lysine-functionalized silica particles. At a given pH, the environmental ionic strength can be utilized to alter the electrostatic interactions of lysine-functionalized silica particles with DNA fragments and in turn the DNA fragments on the silica particle surfaces, which exhibits a clear dependence on the DNA fragment sizes. By carefully adjusting the environmental pH and salt concentration, therefore, the use of the lysine-functionalized silica particles allows effective separation of binary and ternary DNA mixtures, for example, two different DNA fragments with sizes of 101 and 1073 bp, 101 and 745 bp, 101 and 408 bp, respectively, and three different DNA fragments with sizes of 101, 408 and 1073 bp.

  15. Size-selective separation of DNA fragments by using lysine-functionalized silica particles

    NASA Astrophysics Data System (ADS)

    Liu, Lingling; Guo, Zilong; Huang, Zhenzhen; Zhuang, Jiaqi; Yang, Wensheng

    2016-02-01

    In this work, a facile and efficient approach has been demonstrated for size-selective separation of DNA fragments by using lysine-functionalized silica particles. At a given pH, the environmental ionic strength can be utilized to alter the electrostatic interactions of lysine-functionalized silica particles with DNA fragments and in turn the DNA fragments on the silica particle surfaces, which exhibits a clear dependence on the DNA fragment sizes. By carefully adjusting the environmental pH and salt concentration, therefore, the use of the lysine-functionalized silica particles allows effective separation of binary and ternary DNA mixtures, for example, two different DNA fragments with sizes of 101 and 1073 bp, 101 and 745 bp, 101 and 408 bp, respectively, and three different DNA fragments with sizes of 101, 408 and 1073 bp.

  16. Size-selective separation of DNA fragments by using lysine-functionalized silica particles

    PubMed Central

    Liu, Lingling; Guo, Zilong; Huang, Zhenzhen; Zhuang, Jiaqi; Yang, Wensheng

    2016-01-01

    In this work, a facile and efficient approach has been demonstrated for size-selective separation of DNA fragments by using lysine-functionalized silica particles. At a given pH, the environmental ionic strength can be utilized to alter the electrostatic interactions of lysine-functionalized silica particles with DNA fragments and in turn the DNA fragments on the silica particle surfaces, which exhibits a clear dependence on the DNA fragment sizes. By carefully adjusting the environmental pH and salt concentration, therefore, the use of the lysine-functionalized silica particles allows effective separation of binary and ternary DNA mixtures, for example, two different DNA fragments with sizes of 101 and 1073 bp, 101 and 745 bp, 101 and 408 bp, respectively, and three different DNA fragments with sizes of 101, 408 and 1073 bp. PMID:26911527

  17. Viability and DNA fragmentation in differently sorted boar spermatozoa.

    PubMed

    De Ambrogi, M; Spinaci, M; Galeati, G; Tamanini, C

    2006-11-01

    Sperm cell defense against DNA damage relies on two factors: the tight packaging of chromatin, based on condensation and substitution of histones with protamines, and the antioxidant agents present in seminal plasma. These defenses are extremely important as mature sperm is unable to repair DNA damage and even if a successful fertilization occurs, embryo undergoes apoptosis at the time of genomic activation. Sex-sorting exposes spermatozoa to stress sources such as high pressure, laser beam and electrical charge. The aim of this work was to determine how sorting procedures affect viability and DNA integrity in boar spermatozoa, by using the newly developed Sperm-Sus-Halomax. Four sperm populations were considered: CONTROL (no treatment), REAL (sex-sorted semen), BULK (semen sorted without sex separation) and NO LASER (semen only exposed to the high pressure, but including also cells normally discarded from sex-sorting). A significantly (P=0.019) lower viability in NO LASER (64.71%) than in CONTROL (78.6%) and REAL (80.5%) groups was found; this was accompanied by a significantly (P=0.001) higher DNA fragmentation index (DFI) in NO LASER group (6.86%) respect to CONTROL (3.30%) and REAL (3.42%) groups. BULK group did not show any difference in viability or DFI as compared to the other groups. In conclusion, we may believe that sex-sorting procedure as a whole does not affect either viability or DFI and that shear mechanical forces are a relevant source of DNA damage for sorted semen.

  18. Relationships in Ananas and other related genera using chloroplast DNA restriction site variation.

    PubMed

    Duval, M F; Buso, G S C; Ferreira, F R; Noyer, J L; Coppens d'Eeckenbrugge, G; Hamon, P; Ferreira, M E

    2003-12-01

    Chloroplast DNA (cpDNA) diversity was examined using PCR-RFLP to study phylogenetic relationships in Ananas and related genera. One hundred fifteen accessions representing the seven Ananas species and seven other Bromelioideae including the neighboring monospecific genus Pseudananas, two Pitcairnioideae, and one Tillandsioideae were included in the study. Eight primers designed from cpDNA were used for generating fragments. Restriction by 18 endonucleases generated 255 variable fragments. Dissimilarities were calculated from the resulting matrix using the Sokal and Michener index and the neighbor-joining method was used to reconstruct the diversity tree. Phylogenetic reconstruction was attempted using Wagner parsimony. Phenetic and cladistic analyses gave consistent results. They confirm the basal position of Bromelia in the Bromelioideae. Ananas and Pseudananas form a monophyletic group, with three strongly supported sub-groups, two of which are geographically consistent. The majority of Ananas parguazensis accessions constitute a northern group restricted to the Rio Negro and Orinoco basins in Brazil. The tetraploid Pseudananas sagenarius joins the diploid Ananas fritzmuelleri to constitute a southern group. The third and largest group, which includes all remaining species plus some accessions of A. parguazensis and intermediate phenotypes, is the most widespread and its distribution overlaps those of the northern and southern groups. Ananas ananassoides is dominant in this sub-group and highly variable. Its close relationship to all cultivated species supports the hypothesis that this species is the wild ancestor of the domesticated pineapple. The data indicate that gene flow is common within this group and scarcer with both the first and second groups. Comparison of cpDNA data with published genomic DNA data point to the hybrid origin of Ananas bracteatus and support the autopolyploidy of Pseudananas. The Ananas-Pseudananas group structure and distribution are

  19. Temporal Patterns of Nucleotide Misincorporations and DNA Fragmentation in Ancient DNA

    PubMed Central

    Sawyer, Susanna; Krause, Johannes; Guschanski, Katerina; Savolainen, Vincent; Pääbo, Svante

    2012-01-01

    DNA that survives in museum specimens, bones and other tissues recovered by archaeologists is invariably fragmented and chemically modified. The extent to which such modifications accumulate over time is largely unknown but could potentially be used to differentiate between endogenous old DNA and present-day DNA contaminating specimens and experiments. Here we examine mitochondrial DNA sequences from tissue remains that vary in age between 18 and 60,000 years with respect to three molecular features: fragment length, base composition at strand breaks, and apparent C to T substitutions. We find that fragment length does not decrease consistently over time and that strand breaks occur preferentially before purine residues by what may be at least two different molecular mechanisms that are not yet understood. In contrast, the frequency of apparent C to T substitutions towards the 5′-ends of molecules tends to increase over time. These nucleotide misincorporations are thus a useful tool to distinguish recent from ancient DNA sources in specimens that have not been subjected to unusual or harsh treatments. PMID:22479540

  20. Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis

    PubMed Central

    Erwanto, Yuny; Abidin, Mohammad Zainal; Sugiyono, Eko Yasin Prasetyo Muslim; Rohman, Abdul

    2014-01-01

    This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp). Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment. PMID:25178301

  1. Detection of possible restriction sites for type II restriction enzymes in DNA sequences.

    PubMed

    Gagniuc, P; Cimponeriu, D; Ionescu-Tîrgovişte, C; Mihai, Andrada; Stavarachi, Monica; Mihai, T; Gavrilă, L

    2011-01-01

    In order to make a step forward in the knowledge of the mechanism operating in complex polygenic disorders such as diabetes and obesity, this paper proposes a new algorithm (PRSD -possible restriction site detection) and its implementation in Applied Genetics software. This software can be used for in silico detection of potential (hidden) recognition sites for endonucleases and for nucleotide repeats identification. The recognition sites for endonucleases may result from hidden sequences through deletion or insertion of a specific number of nucleotides. Tests were conducted on DNA sequences downloaded from NCBI servers using specific recognition sites for common type II restriction enzymes introduced in the software database (n = 126). Each possible recognition site indicated by the PRSD algorithm implemented in Applied Genetics was checked and confirmed by NEBcutter V2.0 and Webcutter 2.0 software. In the sequence NG_008724.1 (which includes 63632 nucleotides) we found a high number of potential restriction sites for ECO R1 that may be produced by deletion (n = 43 sites) or insertion (n = 591 sites) of one nucleotide. The second module of Applied Genetics has been designed to find simple repeats sizes with a real future in understanding the role of SNPs (Single Nucleotide Polymorphisms) in the pathogenesis of the complex metabolic disorders. We have tested the presence of simple repetitive sequences in five DNA sequence. The software indicated exact position of each repeats detected in the tested sequences. Future development of Applied Genetics can provide an alternative for powerful tools used to search for restriction sites or repetitive sequences or to improve genotyping methods.

  2. Limits of a rapid identification of common Mediterranean sandflies using polymerase chain reaction-restriction fragment length polymorphism

    PubMed Central

    Bounamous, Azzedine; Lehrter, Véronique; Hadj-Henni, Leila; Delecolle, Jean-Claude; Depaquit, Jérôme

    2014-01-01

    A total of 131 phlebotomine Algerian sandflies have been processed in the present study. They belong to the species Phlebotomus bergeroti, Phlebotomus alexandri, Phlebotomus sergenti, Phlebotomus chabaudi, Phlebotomus riouxi, Phlebotomus perniciosus, Phlebotomus longicuspis, Phlebotomus perfiliewi, Phlebotomus ariasi, Phlebotomus chadlii, Sergentomyia fallax, Sergentomyia minuta, Sergentomyia antennata, Sergentomyia schwetzi, Sergentomyia clydei, Sergentomyia christophersi and Grassomyia dreyfussi. They have been characterised by sequencing of a part of the cytochrome b (cyt b), t RNA serine and NADH1 on the one hand and of the cytochrome C oxidase I of the mitochondrial DNA (mtDNA) on the other hand. Our study highlights two sympatric populations within P. sergenti in the area of its type-locality and new haplotypes of P. perniciosus and P. longicuspis without recording the specimens called lcx previously found in North Africa. We tried to use a polymerase chain reaction-restriction fragment length polymorphism method based on a combined double digestion of each marker. These method is not interesting to identify sandflies all over the Mediterranean Basin. PMID:24936911

  3. Photochemistry of DNA fragments via semiclassical nonadiabatic dynamics.

    PubMed

    Alexandrova, Anastassia N; Tully, John C; Granucci, Giovanni

    2010-09-23

    Forming upon absorption of a UV photon, excited states of DNA are subject to nonadiabatic evolution, via either internal conversion (IC) back to the ground state or mutagenesis. Nonadiabatic processes following the formation of the first singlet excited states, S1, in 10 different small DNA fragments--4 single 4'H-nucleosides, 2 Watson-Crick base pairs, and 4 nucleotide quartets--have been investigated. Simulations were done via the nonadiabatic direct trajectory surface hopping semiclassical dynamics. The electronic wave function was obtained with configuration interaction, based on the semiempirical AM1 and PM3 Hamiltonians with fractional orbital occupation numbers. The evolution of the electronic wave function was governed by the time-dependent Schrödinger equation with a locally diabatic representation, intrinsically stable near surface crossings. The nuclei evolved on adiabatic potential energy surfaces, as prescribed by classical Newtonian dynamics, with sudden hops between potential energy surfaces to account for nonadiabatic transitions. The "fewest switches" surface hopping algorithm coupled the quantum and classical parts of the system. The dynamics simulations revealed several routes of nonadiabatic relaxation in these systems, which were not reported previously, and also recovered known routes of IC.

  4. Genotyping of the fish rhabdovirus, viral haemorrhagic septicaemia virus, by restriction fragment length polymorphisms

    USGS Publications Warehouse

    Einer-Jensen, Katja; Winton, James R.; Lorenzen, Niels

    2005-01-01

    The aim of this study was to develop a standardized molecular assay that used limited resources and equipment for routine genotyping of isolates of the fish rhabdovirus, viral haemorrhagic septicaemia virus (VHSV). Computer generated restriction maps, based on 62 unique full-length (1524 nt) sequences of the VHSV glycoprotein (G) gene, were used to predict restriction fragment length polymorphism (RFLP) patterns that were subsequently grouped and compared with a phylogenetic analysis of the G-gene sequences of the same set of isolates. Digestion of PCR amplicons from the full-lengthG-gene by a set of three restriction enzymes was predicted to accurately enable the assignment of the VHSV isolates into the four major genotypes discovered to date. Further sub-typing of the isolates into the recently described sub-lineages of genotype I was possible by applying three additional enzymes. Experimental evaluation of the method consisted of three steps: (i) RT-PCR amplification of the G-gene of VHSV isolates using purified viral RNA as template, (ii) digestion of the PCR products with a panel of restriction endonucleases and (iii) interpretation of the resulting RFLP profiles. The RFLP analysis was shown to approximate the level of genetic discrimination obtained by other, more labour-intensive, molecular techniques such as the ribonuclease protection assay or sequence analysis. In addition, 37 previously uncharacterised isolates from diverse sources were assigned to specific genotypes. While the assay was able to distinguish between marine and continental isolates of VHSV, the differences did not correlate with the pathogenicity of the isolates.

  5. Molecular epidemiology of Escherichia coli O157:H7 by restriction fragment length polymorphism using Shiga-like toxin genes.

    PubMed Central

    Samadpour, M

    1995-01-01

    The purpose of this study was to assess a simplified method for interstrain differentiation of Escherichia coli O157:H7 and other Shiga-like toxin-producing E. coli (SLTEC) strains. A method based on the use of nucleic acid probes from Shiga-like toxin (SLT) I and II structural genes was used to generate restriction fragment length polymorphism (RFLP) patterns of SLTEC strains, (SLT-RFLP patterns) resulting from digestion of isolated genomic DNA with four different restriction enzymes (BamHI, EcoRI, HindIII, and PvuII) used separately. A total of 165 SLTEC strains from clinical, food, and environmental sources, including O157:H7 isolates from four food-borne outbreaks in Canada and the United States, were analyzed in the study. SLT-RFLP demonstrated that E. coli O157:H7 strains from each food-borne outbreak had the same unique SLT-RFLP pattern. Fifty-two SLT-RFLP types were found among 96 E. coli O157:H7 isolates from sporadic cases of hemorrhagic colitis and hemolytic uremic syndrome in Washington state. The use of the SLT probes proved to be a very powerful method for interstrain differentiation of SLTEC strains. Although the use of each of the enzymes alone did not give enough differentiative power to be used in epidemiological studies, the combination of patterns generated by two restriction enzymes (EcoRI and PvuII, used separately) provided the desired sensitivity for such studies. The results clearly demonstrate the usefulness of the method for studying the molecular epidemiology of E. coli O157:H7. The method is also suitable for establishing an epidemiological database, in terms of both sensitivity and ease of compilation and interpretation of results. PMID:7559966

  6. Purified glucocorticoid receptors bind selectively in vitro to a cloned DNA fragment whose transcription is regulated by glucocorticoids in vivo.

    PubMed

    Payvar, F; Wrange, O; Carlstedt-Duke, J; Okret, S; Gustafsson, J A; Yamamoto, K R

    1981-11-01

    Activated glucocorticoid receptor protein, purified to 40-60% homogeneity from rat liver extracts, binds selectively in vitro to a cloned fragment of murine mammary tumor virus (MTV) DNA. The DNA fragment tested contains about half of the sequences present in intact MTV DNA, and its rate of transcription, like that of the intact viral element, is strongly stimulated by glucocorticoids when it is introduced into the genome of a receptor-containing cell. In contrast, the receptor fails to bind selectively to DNA restriction fragments from E. coli plasmids pBR322 and RSF2124 or from bacteriophages lambda and T4. Preliminary experiments to localize regions within MTV DNA responsible for selective binding have revealed thus far one subfragment that fails to bind the receptor and one selectively bound subfragment that maps far downstream from the 5' terminus of the normal RNA transcript. These studies are consistent with the notion that steroid receptors may modulate rates of transcription by recognizing specific DNA sequences within or near the regulated genes.

  7. Clusters of DNA damage induced by ionizing radiation: formation of short DNA fragments. II. Experimental detection

    NASA Technical Reports Server (NTRS)

    Rydberg, B.; Chatterjee, A. (Principal Investigator)

    1996-01-01

    The basic 30-nm chromatin fiber in the mammalian cell consists of an unknown (possibly helical) arrangement of nucleosomes, with about 1.2 kb of DNA per 10-nm length of fiber. Track-structure considerations suggest that interactions of single delta rays or high-LET particles with the chromatin fiber might result in the formation of multiple lesions spread over a few kilobases of DNA (see the accompanying paper: W.R. Holley and A. Chatterjee, Radiat. Res. 145, 188-199, 1996). In particular, multiple DNA double-strand breaks and single-strand breaks may form. To test this experimentally, primary human fibroblasts were labeled with [3H]thymidine and exposed at 0 degrees C to X rays or accelerated nitrogen or iron ions in the LET range of 97-440 keV/microns. DNA was isolated inside agarose plugs and subjected to agarose gel electrophoresis under conditions that allowed good separation of 0.1-2 kb size DNA. The bulk of DNA remained in the well or migrated only a small distance into the gel. It was found that DNA fragments in the expected size range were formed linearly with dose with an efficiency that increased with LET. A comparison of the yield of such fragments with the yield of total DNA double-strand breaks suggests that for the high-LET ions a substantial proportion (20-90%) of DNA double-strand breaks are accompanied within 0.1-2 kb by at least one additional DNA double-strand break. It is shown that these results are in good agreement with theoretical calculations based on treating the 30-nm chromatin fiber as the target for ionizing particles. Theoretical considerations also predict that the clusters will contain numerous single-strand breaks and base damages. It is proposed that such clusters be designated "regionally multiply damaged sites." Postirradiation incubation at 37 degrees C resulted in a decline in the number of short DNA fragments, suggesting a repair activity. The biological significance of regionally multiply damaged sites is presently unknown.

  8. Clusters of DNA damage induced by ionizing radiation: Formation of short DNA fragments. II. Experimental detection

    SciTech Connect

    Rydberg, B.

    1996-02-01

    The basic 30-nm chromatin fiber in the mammalian cell consists of an unknown (possibly helical) arrangement of nucleosomes, with about 1.2 kb of DNA per 10-nm length of fiber. Track-structure considerations suggest that interactions of single {delta} rays or high-LET particles with the chromatin fiber might result in the formation of multiple lesions spread over a few kilobases of DNA. In particular, multiple DNA double-strand breaks and single-strand breaks may form. To test this experimentally, primary human fibroblasts were labeled with [{sup 3}H]thymidine and exposed at 0{degrees}C to X rays or accelerated nitrogen or iron ions in the LET range of 97-440 keV/pm. DNA was isolated inside agarose plugs and subjected to agarose gel electrophoresis under conditions that allowed good separation of 0.1-2 kb size DNA. The bulk of DNA remained in the well or migrated only a small distance into the gel. It was found that DNA fragments in the expected size range were formed linearly with dose with an efficiency that increased with LET. A comparison of the yield of such fragments with the yield of total DNA double-strand breaks suggests that for the high-LET ions a substantial proportion (20-90%) of DNA double-strand breaks are accompanied within 0.1-2 kb by at least one additional DNA double-strand break. It is shown that these results are in good agreement with theoretical calculations based on treating the 30-nm chromatin fiber as the target for ionizing particles. Theoretical considerations also predict that the clusters will contain numerous single-strand breaks and base damages. It is proposed that such clusters be designated {open_quotes}regionally multiply damaged sites.{close_quotes} Postirradiation incubation at 37{degrees}C resulted in a decline in the number of short DNA fragments, suggesting a repair activity. The biological significance of regionally multiply damaged sites is presently unknown. 34 refs., 6 figs., 1 tab.

  9. Sliding sleeves of XRCC4-XLF bridge DNA and connect fragments of broken DNA.

    PubMed

    Brouwer, Ineke; Sitters, Gerrit; Candelli, Andrea; Heerema, Stephanie J; Heller, Iddo; de Melo, Abinadabe J; Zhang, Hongshan; Normanno, Davide; Modesti, Mauro; Peterman, Erwin J G; Wuite, Gijs J L

    2016-07-28

    Non-homologous end joining (NHEJ) is the primary pathway for repairing DNA double-strand breaks (DSBs) in mammalian cells. Such breaks are formed, for example, during gene-segment rearrangements in the adaptive immune system or by cancer therapeutic agents. Although the core components of the NHEJ machinery are known, it has remained difficult to assess the specific roles of these components and the dynamics of bringing and holding the fragments of broken DNA together. The structurally similar XRCC4 and XLF proteins are proposed to assemble as highly dynamic filaments at (or near) DSBs. Here we show, using dual- and quadruple-trap optical tweezers combined with fluorescence microscopy, how human XRCC4, XLF and XRCC4-XLF complexes interact with DNA in real time. We find that XLF stimulates the binding of XRCC4 to DNA, forming heteromeric complexes that diffuse swiftly along the DNA. Moreover, we find that XRCC4-XLF complexes robustly bridge two independent DNA molecules and that these bridges are able to slide along the DNA. These observations suggest that XRCC4-XLF complexes form mobile sleeve-like structures around DNA that can reconnect the broken ends very rapidly and hold them together. Understanding the dynamics and regulation of this mechanism will lead to clarification of how NHEJ proteins are involved in generating chromosomal translocations.

  10. A Mini-Library of Sequenced Human DNA Fragments: Linking Bench Experiments with Informatics

    ERIC Educational Resources Information Center

    Dalgleish, Raymond; Shanks, Morag E.; Monger, Karen; Butler, Nicola J.

    2012-01-01

    We describe the development of a mini-library of human DNA fragments for use in an enquiry-based learning (EBL) undergraduate practical incorporating "wet-lab" and bioinformatics tasks. In spite of the widespread emergence of the polymerase chain reaction (PCR), the cloning and analysis of DNA fragments in "Escherichia coli"…

  11. The assessment of sperm DNA fragmentation in the saltwater crocodile (Crocodylus porosus).

    PubMed

    Johnston, S D; López-Fernández, C; Arroyo, F; Fernández, J L; Gosálvez, J

    2015-10-14

    Herein we report a method of assessing DNA fragmentation in the saltwater crocodile using the sperm chromatin dispersion test (SCDt) after including frozen-thawed spermatozoa in a microgel (Halomax; Halotech DNA, Madrid, Spain). Following controlled protein depletion, which included a reducing agent, sperm nuclei with fragmented DNA showed a homogeneous and larger halo of chromatin dispersion with a corresponding reduced nucleoid core compared with sperm with non-fragmented DNA. The presence of DNA damage was confirmed directly by incorporation of modified nucleotides using in situ nick translation (ISNT) and indirectly by studying the correlation of the SCDt with the results of DNA damage visualisation using a two-tailed comet assay (r = 0.90; P = 0.037). Results of the SCDt immediately following thawing and after 5 h incubation at 37°C in order to induce a range of DNA damage revealed individual crocodile differences in both the baseline level of DNA damage and DNA longevity.

  12. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    SciTech Connect

    Jackson, Christopher B.; Gallati, Sabina; Schaller, Andre

    2012-07-06

    Highlights: Black-Right-Pointing-Pointer Serial qPCR accurately determines fragmentation state of any given DNA sample. Black-Right-Pointing-Pointer Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. Black-Right-Pointing-Pointer Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. Black-Right-Pointing-Pointer Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze-thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA ({lambda}{sub nDNA}) and mtDNA ({lambda}{sub mtDNA}) we present an approach to possibly correct measurements in

  13. Clusters of DNA induced by ionizing radiation: formation of short DNA fragments. I. Theoretical modeling

    NASA Technical Reports Server (NTRS)

    Holley, W. R.; Chatterjee, A.

    1996-01-01

    We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber comprised of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and delta rays due to knock-on collisions involving energy transfers >100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of OH, H, eaq, etc.; (2) OH attack on sugar molecules leading to strand breaks: (3) OH attack on bases; (4) direct ionization of the sugar molecules leading to strand breaks; (5) direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 bp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. The shapes of the spectra of DNA fragment lengths depend on the symmetries or approximate symmetries of the chromatin structure. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper (B. Rydberg, Radiat, Res. 145, 200-209, 1996) after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the

  14. Relative stability of transgene DNA fragments from GM rapeseed in mixed ruminal cultures.

    PubMed

    Sharma, Ranjana; Alexander, Trevor W; John, S Jacob; Forster, Robert J; McAllister, Tim A

    2004-05-01

    The use of transgenic crops as feeds for ruminant animals has prompted study of the possible uptake of transgene fragments by ruminal micro-organisms and/or intestinal absorption of fragments surviving passage through the rumen. The persistence in buffered ruminal contents of seven different recombinant DNA fragments from GM rapeseed expressing the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) transgene was tracked using PCR. Parental and transgenic (i.e. glyphosphate-tolerant; Roundup Ready, Monsanto Company, St Louis, MO, USA) rapeseed were incubated for 0, 2, 4, 8, 12, 24 and 48 h as whole seeds, cracked seeds, rapeseed meal, and as pelleted, barley-based diets containing 65 g rapeseed meal/kg. The seven transgene fragments ranged from 179 to 527 bp and spanned the entire 1363 bp EPSPS transgene. A 180 bp ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) small subunit fragment and a 466 bp 16S rDNA fragment were used as controls for endogenous rapeseed DNA and bacterial DNA respectively. The limit of detection of the PCR assay, established using negative controls spiked with known quantities of DNA, was 12.5 pg. Production of gas and NH3 was monitored throughout the incubation and confirmed active in vitro fermentation. Bacterial DNA was detected in all sample types at all time points. Persistence patterns of endogenous (Rubisco) and recombinant (EPSPS) rapeseed DNA were inversely related to substrate digestibility (amplifiable for 48, 8 and 4 h in whole or cracked seeds, meal and diets respectively), but did not differ between parental and GM rapeseed, nor among fragments. Detection of fragments was representative of persistence of the whole transgene. No EPSPS fragments were amplifiable in microbial DNA, suggesting that transformation had not occurred during the 48 h incubation. Uptake of transgenic DNA fragments by ruminal bacteria is probably precluded or time-limited by rapid degradation of plant DNA upon plant cell lysis.

  15. The Saccharomyces cerevisiae Dna2 can function as a sole nuclease in the processing of Okazaki fragments in DNA replication.

    PubMed

    Levikova, Maryna; Cejka, Petr

    2015-09-18

    During DNA replication, synthesis of the lagging strand occurs in stretches termed Okazaki fragments. Before adjacent fragments are ligated, any flaps resulting from the displacement of the 5' DNA end of the Okazaki fragment must be cleaved. Previously, Dna2 was implicated to function upstream of flap endonuclease 1 (Fen1 or Rad27) in the processing of long flaps bound by the replication protein A (RPA). Here we show that Dna2 efficiently cleaves long DNA flaps exactly at or directly adjacent to the base. A fraction of the flaps cleaved by Dna2 can be immediately ligated. When coupled with DNA replication, the flap processing activity of Dna2 leads to a nearly complete Okazaki fragment maturation at sub-nanomolar Dna2 concentrations. Our results indicate that a subsequent nucleolytic activity of Fen1 is not required in most cases. In contrast Dna2 is completely incapable to cleave short flaps. We show that also Dna2, like Fen1, interacts with proliferating cell nuclear antigen (PCNA). We propose a model where Dna2 alone is responsible for cleaving of RPA-bound long flaps, while Fen1 or exonuclease 1 (Exo1) cleave short flaps. Our results argue that Dna2 can function in a separate, rather than in a Fen1-dependent pathway.

  16. Solving large double digestion problems for DNA restriction mapping by using branch-and-bound integer linear programming.

    PubMed

    Wu, Z; Zhang, Y

    2008-01-01

    The double digestion problem for DNA restriction mapping has been proved to be NP-complete and intractable if the numbers of the DNA fragments become large. Several approaches to the problem have been tested and proved to be effective only for small problems. In this paper, we formulate the problem as a mixed-integer linear program (MIP) by following (Waterman, 1995) in a slightly different form. With this formulation and using state-of-the-art integer programming techniques, we can solve randomly generated problems whose search space sizes are many-magnitude larger than previously reported testing sizes.

  17. Analysis of mer Gene Subclasses within Bacterial Communities in Soils and Sediments Resolved by Fluorescent-PCR-Restriction Fragment Length Polymorphism Profiling

    PubMed Central

    Bruce, K. D.

    1997-01-01

    Bacterial mer (mercury resistance) gene subclasses in mercury-polluted and pristine natural environments have been profiled by Fluorescent-PCR-restriction fragment length polymorphism (FluRFLP). For FluRFLP, PCR products were amplified from individual mer operons in mercury-resistant bacteria and from DNA isolated directly from bacteria in soil and sediment samples. The primers used to amplify DNA were designed from consensus sequences of the major subclasses of archetypal gram-negative mer operons within Tn501, Tn21, pDU1358, and pKLH2. Two independent PCRs were used to amplify two regions of different lengths (merRT(Delta)P [ca. 1 kb] and merR [ca. 0.4 kb]) starting at the same position in merR. The oligonucleotide primer common to both reactions (FluRX) was labelled at the 5(prm1) end with green (TET) fluorescent dye. Analysis of the mer sequences within databases indicated that the major subclasses could be differentiated on the basis of the length from FluRX to the first FokI restriction endonuclease site. The amplified PCR products were digested with FokI restriction endonuclease, with the restriction digest fragments resolved on an automated DNA sequencing machine which detected only those bands labelled with the fluorescent dye. For each of the individual mer operon sources examined, this single peak (in bases) position was observed in separate digests of either amplified region. These peak positions were as predicted on the basis of DNA sequence. mer PCR products amplified from DNA extracted directly from soil and sediment bacteria were studied in order to determine the profiles of the major mer subclasses present in each natural environment. In addition to peaks of the expected sizes, extra peaks were observed which were not predicted on the basis of DNA sequence. Those appearing in the restriction endonuclease digests of both study regions were presumed to be novel mer types. Genetic heterogeneity within and between mercury-polluted and pristine sites

  18. Genetic Diversity among Rhizobium leguminosarum bv. Trifolii Strains Revealed by Allozyme and Restriction Fragment Length Polymorphism Analyses

    PubMed Central

    Demezas, David H.; Reardon, Terry B.; Watson, John M.; Gibson, Alan H.

    1991-01-01

    Allozyme electrophoresis and restriction fragment length polymorphism (RFLP) analyses were used to examine the genetic diversity of a collection of 18 Rhizobium leguminosarum bv. trifolii, 1 R. leguminosarum bv. viciae, and 2 R. meliloti strains. Allozyme analysis at 28 loci revealed 16 electrophoretic types. The mean genetic distance between electrophoretic types of R. leguminosarum and R. meliloti was 0.83. Within R. leguminosarum, the single strain of bv. viciae differed at an average of 0.65 from strains of bv. trifolii, while electrophoretic types of bv. trifolii differed at a range of 0.23 to 0.62. Analysis of RFLPs around two chromosomal DNA probes also delineated 16 unique RFLP patterns and yielded genetic diversity similar to that revealed by the allozyme data. Analysis of RFLPs around three Sym (symbiotic) plasmid-derived probes demonstrated that the Sym plasmids reflect genetic divergence similar to that of their bacterial hosts. The large genetic distances between many strains precluded reliable estimates of their genetic relationships. PMID:16348600

  19. Haplotyping the human T-cell receptor. beta. -chain gene complex by use of restriction fragment length polymorphisms

    SciTech Connect

    Charmley, P.; Chao, A.; Gatti, R.A. ); Concannon, P. ); Hood, L. )

    1990-06-01

    The authors have studied the genetic segregation of human T-cell receptor {beta}-chain (TCR{beta}) genes on chromosome 7q in 40 CEPH (Centre d'Etude du Polymorphisme Humain) families by using restriction fragment length polymorphisms (RFLPs). They constructed haplotypes from eight RFLPs by using variable- and constant-region cDNA probes, which detect polymorphisms that span more than 600 kilobases of the TCR{beta} gene complex. Analysis of allele distributions between TCR{beta} genes revealed significant linkage disequilibrium between only 6 of the 28 different pairs of RFLPs. This linkage disequilibrium strongly influences the most efficient order to proceed for typing of these RFLPs in order to achieve maximum genetic informativeness, which in this study revealed a 97.3% level of heterozygosity within the TCR{beta} gene complex. The results should provide new insight into recent reports of disease associations with the TCR{beta} gene complex and should assist in designing future experiments to detect or confirm the existence of disease-susceptibility loci in this region of the human genome.

  20. Comparison of bacterial communities in the throat swabs from healthy subjects and pharyngitis patients by terminal restriction fragment length polymorphism.

    PubMed

    Balaji, Kannan; Thenmozhi, Ramalingam; Sundaravadivel, Marimuthu; Pandian, Shunmugiah Karutha

    2012-07-01

    Terminal restriction fragment length polymorphism (T-RFLP) analysis was applied to characterize bacterial flora present in the throats of healthy subjects and pharyngitis patients. The 16S rRNA genes of bacteria present in throat metagenome were amplified by PCR with 6-carboxy-fluorescein (6-FAM)-labeled universal forward primer (27 F) and a universal reverse primer (1513R). The 16S rDNAs were digested with restriction enzymes with 4-bp recognition sites (MspI or RsaI) and analyzed by using an automated DNA sequencer. T-RFLP patterns were numerically analyzed using computer programs. From analysis of the throat bacterial community, patterns derived from MspI and RsaI digested samples of healthy subjects and pharyngitis patients were grouped into different clusters, though RsaI digested samples showed some uncertainty. Pharyngitis throats generated an average species richness of 9 [±2.1 (SD)] and 10 (±2.9) for MspI and RsaI digests, respectively, whereas healthy throats generated 6.3 (±1.2) and 6.1 (±1.5) in MspI and RsaI digests, respectively. These results suggest that samples from pharyngitis patients contain an unexpected diversity of causative bacteria. The pharyngitis throats were colonized with a rich diversity of bacterial species than that of healthy throats. Using T-RFLP, we are able to detect a model bacterium, Streptococcus pyogenes SF370, and T-RF patterns were consistent with the Streptococcal T-RFLP patterns. Our study indicates that T-RFLP analysis is useful for the assessment of diversity of throat bacterial flora and rapid comparison of the community structure between subjects with and without pharyngitis.

  1. Genotypic lineages and restriction fragment length polymorphism of canine distemper virus isolates in Thailand.

    PubMed

    Radtanakatikanon, Araya; Keawcharoen, Juthatip; Charoenvisal, Na Taya; Poovorawan, Yong; Prompetchara, Eakachai; Yamaguchi, Ryoji; Techangamsuwan, Somporn

    2013-09-27

    Canine distemper virus (CDV) is known to cause multisystemic disease in all families of terrestrial carnivores. Attenuated live vaccines have been used to control CDV in a variety of species for many decades, yet a number of CDV infections in vaccinated dogs are still observed. The aims of this study were to investigate the genetic diversity of CDV lineages based on phosphoprotein (P), hemagglutinin (H) and fusion protein (F) genes and to develop the restriction fragment length polymorphism (RFLP) technique for effective differentiation among individual wild-type and vaccine lineages in Thailand. Four commercial vaccine products, thirteen conjunctival swabs and various tissues from 9 necropsied dogs suspected of having CDV infections were included. Virus isolation was performed using Vero cell expressing canine signaling lymphocyte activation molecules (Vero-DST cells). Reverse-transcription polymerase chain reaction (RT-PCR) on 3 gene regions from the dog derived specimens and the vaccines were carried out, then RFLP analysis upon F-gene amplified fragments was developed. Nucleotide sequence and phylogenetic analysis were compared with other CDV lineages in Genbank. Phylogenetic relationships revealed that CDV field isolates were separated from the vaccine lineage and could be divided into two clusters; one of which belonged to the Asia-1 lineage and another, not related to any previous recognized lineages was proposed as 'Asia-4'. RFLP patterns demonstrating concordance with phylogenetic trees of the distemper virus allowed for differentiation between the Asia-1, Asia-4 and vaccine lineages. Thus, RFLP technique is able to effectively distinguish individual wild-type canine distemper virus from vaccine lineages in Thailand.

  2. Chloroplast DNA restriction site variation and phylogeny of the Berberidaceae.

    PubMed

    Kim, Y D; Jansen, R K

    1998-12-01

    Comparative restriction site mapping of the chloroplast genome was performed to examine phylogenetic relationships among 27 species representing 16 genera of the Berberidaceae and two outgroups. Chloroplast genomes of the species included in this study showed no major structural rearrangements (i.e., they are collinear to tobacco cpDNA) except for the extension of the inverted repeat in species of Berberis and Mahonia. Excluding several regions that exhibited severe length variation, a total of 501 phylogenetically informative sites was mapped for ten restriction enzymes. The strict consensus tree of 14 equally parsimonious trees indicated that some berberidaceous genera (Berberis, Mahonia, Diphylleia) are not monophyletic. To explore phylogenetic utility of different parsimony methods phylogenetic trees were generated using Wagner, Dollo, and weighted parsimony for a reduced data set that included 18 species. One of the most significant results was the recognition of the four chromosomal groups, which were strongly supported regardless of the parsimony method used. The most notable difference among the trees produced by the three parsimony methods was the relationships among the four chromosomal groups. The cpDNA trees also strongly supported a close relationship of several generic pairs (e.g., Berberis-Mahonia, Epimedium-Vancouveria, etc.). Maximum likelihood values were computed for the four different tree topologies of the chromosomal groups, two Wagner, one Dollo, and one weighted topology. The results indicate that the weighted tree has the highest likelihood value. The lowest likelihood value was obtained for the Dollo tree, which had the highest bootstrap and decay values. Separate analyses using only the Inverted Repeat (IR) region resulted in a tree that is identical to the weighted tree. Poor resolution and/or support for the relationships among the four chromosomal lineages of the Berberidaceae indicate that they may have radiated from an ancestral

  3. [Molecular dynamics of immune complex of photoadduct-containing DNA with Fab-Anti-DNA antibody fragment].

    PubMed

    Akberova, N I; Zhmurov, A A; Nevzorova, T A; Litvinov, R I

    2016-01-01

    Antibodies to DNA play an important role in the pathogenesis of autoimmune diseases. The elucidation of structural mechanisms of both the antigen recognition and the interaction of anti-DNA antibodies with DNA will help to understand the role of DNA-containing immune complexes in various pathologies and can provide a basis for new treatment modalities. Moreover, the DNA-antibody complex is an analog of specific intracellular DNA-protein interactions. In this work, we used in silico molecular dynamic simulations of bimolecular complexes of the dsDNA segment containing the Fab fragment of an anti-DNA antibody to obtain the detailed thermodynamic and structural characteristics of dynamic intermolecular interactions. Using computationally modified crystal structure of the Fab-DNA complex (PDB ID: 3VW3), we studied the equilibrium molecular dynamics of the 64M-5 antibody Fab fragment associated with the dsDNA fragment containing the thymine dimer, the product of DNA photodamage. Amino acid residues that constitute paratopes and the complementary nucleotide epitopes for the Fab-DNA construct were identified. Stacking and electrostatic interactions were found to play the main role in mediating the most specific antibody-dsDNA contacts, while hydrogen bonds were less significant. These findings may shed light on the formation and properties of pathogenic anti-DNA antibodies in autoimmune diseases, such as systemic lupus erythematosus associated with skin photosensitivity and DNA photodamage.

  4. Restriction fragment length polymorphism within the class I gene loci of the equine major histocompatibility complex

    SciTech Connect

    Alexander, A.J.; Bailey, E.; Woodward, J.G.

    1986-03-05

    Fourteen standard bred horses were serotyped as homozygous for 1 of 6 Equine Leukocyte Antigen (ELA) specificities. DNA was purified from peripheral leukocytes and digested with Hind III or Pvu II. Southern blot hybridization analysis was carried out using a /sup 32/P-labeled mouse cDNA probe (PH2IIa) specific for class I MHC genes. Both enzymes generated blots that contained a large number of bands (23 to 30) per horse. Significant polymorphism existed among most fragment sizes, while a dozen highly conserved band sizes suggested the presence of Qa/tla - like genes. Only 2 animals (both W6's) showed identical band patterns. Polymorphism was greatest between horses of different serotypes and was significantly decreased within serotypes. Unique bands were present on both blots for both W1's and W6's and may account for the serologic specificity seen in ELA W1 and W6 horses. This study is consistent with the findings in other higher vertebrates and implies that the MHC of the horse includes a highly polymorphic class I multigene family.

  5. Molecular epidemiology of Escherichia coli O157:H7 strains by bacteriophage lambda restriction fragment length polymorphism analysis: application to a multistate foodborne outbreak and a day-care center cluster.

    PubMed Central

    Samadpour, M; Grimm, L M; Desai, B; Alfi, D; Ongerth, J E; Tarr, P I

    1993-01-01

    Genomic DNAs prepared from 168 isolates of Escherichia coli O157:H7 were analyzed for restriction fragment length polymorphisms on Southern blots probed with bacteriophage lambda DNA. The isolates analyzed included strains from a recent large multistate outbreak of E. coli O157:H7 infection associated with consumption of poorly cooked beef in restaurants, a day-care center cluster, and temporally and geographically unrelated isolates. E. coli O157:H7 isolates recovered from the incriminated meat and from 61 (96.8%) of 63 patients from Washington and Nevada possessed identical lambda restriction fragment length patterns. The lambda restriction fragment length polymorphisms observed in 11 (91.7%) of 12 day-care center patients were identical, but they differed from that of the strain associated with the multistate outbreak. E. coli O157:H7 from 42 patients temporally or geographically unrelated to either cluster of infection possessed unique and different lambda restriction fragment length patterns, except for paired isolates from three separate clusters of infection. These data demonstrate that the hybridization of DNA digests of E. coli O157:H7 with radiolabelled bacteriophage lambda DNA can be a useful, stable, and discriminatory epidemiologic tool for analyzing the linkage between strains of E. coli O157:H7. Images PMID:7905882

  6. Dynamics of sperm DNA fragmentation in the swine: ejaculate and temperature effects.

    PubMed

    Pérez-Llano, B; López-Fernández, C; García-Casado, P; Arroyo, F; Gosalbez, A; Sala, R; Gosálvez, J

    2010-06-01

    The dynamics of sperm DNA fragmentation was examined in 16 boar ejaculates using the sperm chromatin dispersion (SCD) test and a two-tail comet assay. The net sperm rich fraction was preserved at two different temperatures (Trial 1: 15 degrees C, n=10; Trial 2: 37 degrees C, n=6) and sub-samples were taken every day until a sperm motility of zero. Significant differences in the dynamics of DNA fragmentation were observed among the different ejaculates and also according to the storage temperature. After analyzing the dynamic response of the sperm DNA damage, when the sperm samples are incubated at 15 or 37 degrees C, each ejaculate could be classified and a considerable variation among individuals for an increase in DNA damage was observed. Thus, while in some ejaculates no rise in DNA fragmentation was observed, in others, the sperm DNA fragmentation process was triggered during the initial days of the experiment. In general, sperm incubation at 37 degrees C diminished sperm DNA quality. The two-tail comet assay indicated that at time zero existing DNA damage mainly consisted of double stranded DNA breakage. During storage, DNA damage affected one of the DNA strands until a second wave of DNA damage, in which there was both single and double stranded DNA damage.

  7. The sperm chromatin dispersion test: a simple method for the determination of sperm DNA fragmentation.

    PubMed

    Fernández, Jose Luis; Muriel, Lourdes; Rivero, Maria Teresa; Goyanes, Vicente; Vazquez, Rosana; Alvarez, Juan G

    2003-01-01

    Sperm DNA fragmentation is being increasingly recognized as an important cause of infertility. We herein describe the Sperm Chromatin Dispersion (SCD) test, a novel assay for sperm DNA fragmentation in semen. The SCD test is based on the principle that sperm with fragmented DNA fail to produce the characteristic halo of dispersed DNA loops that is observed in sperm with non-fragmented DNA, following acid denaturation and removal of nuclear proteins. This was confirmed by the analysis of DNA fragmentation using the specific DNA Breakage Detection-Fluorescence In Situ Hybridization (DBD-FISH) assay, which allows the detection of DNA breaks in lysed sperm nuclei. Sperm suspensions either prepared from semen or isolated from semen by gradient centrifugation were embedded in an agarose microgel on slides and treated with 0.08 N HCl and lysing solutions containing 0.8 M dithiothreitol (DTT), 1% sodium dodecyl sulfate (SDS), and 2 M NaCl. Then, the slides were sequentially stained with DAPI (4',6-diamidino-2-phenylindole) and/or the Diff-Quik reagent, and the percentages of sperm with nondispersed and dispersed chromatin loops were monitored by fluorescence and brightfield microscopy, respectively. The results indicate that all sperm with nondispersed chromatin displayed DNA fragmentation, as measured by DBD-FISH. Conversely, all sperm with dispersed chromatin had very low to undetectable DBD-FISH labeling. SCD test values were significantly higher in patients being screened for infertility than in normozoospermic sperm donors who had participated in a donor insemination program. The coefficient of variation obtained using 2 different observers, either by digital image analysis (DIA) or by brightfield microscopy scoring, was less than 3%. In conclusion, the SCD test is a simple, accurate, highly reproducible, and inexpensive method for the analysis of sperm DNA fragmentation in semen and processed sperm. Therefore, the SCD test could potentially be used as a routine test

  8. Optical mapping of site-directed cleavages on single DNA molecules by the RecA-assisted restriction endonuclease technique.

    PubMed Central

    Wang, Y K; Huff, E J; Schwartz, D C

    1995-01-01

    Fluorescence in situ hybridization (FISH) resolution has advanced because newer techniques use increasingly decondensed chromatin. FISH cannot analyze restriction enzyme cutting sites due to limitations of the hybridization and detection technologies. The RecA-assisted restriction endonuclease (RARE) technique cleaves chromosomal DNA at a single EcoRI site within a given gene or selected sequence. We recently described a mapping technique, optical mapping, which uses fluorescence microscopy to produce high-resolution restriction maps rapidly by directly imaging restriction digestion cleavage events occurring on single deproteinized DNA molecules. Ordered maps are then constructed by noting fragment order and size, using several optically based techniques. Since we also wanted to map arbitrary sequences and gene locations, we combined RARE with optical mapping to produce site-specific visible EcoRI restriction cleavage sites on single DNA molecules. Here we describe this combined method, named optical RARE, and its initial application to mapping gene locations on yeast chromosomes. Images Fig. 2 Fig. 3 PMID:7816810

  9. Amplification of a single-locus variable-number direct repeats with restriction fragment length polymorphism (DR-PCR/RFLP) for genetic typing of Acinetobacter baumannii strains.

    PubMed

    Nowak-Zaleska, Alicja; Krawczyk, Beata; Kotłowski, Roman; Mikucka, Agnieszka; Gospodarek, Eugenia

    2008-01-01

    In search of an effective DNA typing technique for Acinetobacter baumannii strains for hospital epidemiology use, the performance and convenience of a new target sequence was evaluated. Using known genomic sequences of Acinetobacter baumannii strains AR 319754 and ATCC 17978, we developed single-locus variable-number direct-repeat analysis using polymerase chain reaction-restriction fragment length polymorphism (DR-PCR/RFLP) method. A total of 90 Acinetobacter baumannii strains isolated from patients of the Clinical Hospital in Bydgoszcz, Poland, were examined. Initially, all strains were typed using macrorestriction analysis of the chromosomal DNA by pulsed-field gel electrophoresis (REA-PFGE). Digestion of the chromosomal DNA with the ApaI endonuclease and separation of the fragments by PFGE revealed 21 unique types. Application of DR-PCR/RFLP resulted in recognition of 12 clusters. The results showed that the DR-PCR/RFLP method is less discriminatory than REA-PFGE, however, the novel genotyping method can be used as an alternative technique for generating DNA profiles in epidemiological studies of intra-species genetic relatedness of Acinetobacter baumannii strains.

  10. Quantification of DNA fragmentation in processed foods using real-time PCR.

    PubMed

    Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi

    2017-07-01

    DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection.

  11. Presence of an allelic EcoRI restriction fragment of the c-mos locus in leukocyte and tumor cell DNAs of breast cancer patients.

    PubMed Central

    Lidereau, R; Mathieu-Mahul, D; Theillet, C; Renaud, M; Mauchauffé, M; Gest, J; Larsen, C J

    1985-01-01

    Structure of the human c-mos protooncogene in DNAs from breast tumors, leukemic cells, and lymphocytes from normal individuals was analyzed by restriction enzyme digestion and Southern blot. In 6 of 75 breast tumor DNAs, we found an EcoRI 5-kilobase extra band hybridizing with a human c-mos probe containing all of the sequences homologous to v-mos oncogene. This band was also found in lymphocyte DNA from 3 of these patients, indicating a restriction fragment length polymorphism. This polymorphism was not found in a series of 69 lymphocyte DNAs from the unaffected population. Moreover, 1 of 73 leukemic cell DNAs exhibited the 5-kilobase band. These results indicate that this rare polymorphism is significantly more frequently found in patients with breast cancer than in the rest of the population (P less than 0.05, by a chi 2 test with Yates correction. Images PMID:2996003

  12. Polymerase chain reaction-restriction fragment length polymorphism method to distinguish three mealybug groups within the Planococcus citri-P. minor species complex (Hemiptera: Coccoidea: Pseudococcidae).

    PubMed

    Rung, A; Miller, D R; Scheffer, S J

    2009-02-01

    The mealybug species Planococcus citri (Risso) and Planococcus minor (Maskell) (Hemiptera: Coccoidea: Pseudococcidae) have special significance to U.S. quarantine and U.S. agriculture. Commonly intercepted at U.S. ports-of-entry, they are difficult to identify based on morphological characters. This study presents a molecular method for distinguishing P. citri, P. minor, and a genetically distinct group that is morphologically identical to P. citri, from Hawaii. This method uses polymerase chain reaction (PCR) followed by restriction fragment polymorphism analysis (RFLP) using the restriction enzymes BspH1, BsmH1, and HpH1. The resulting band patterns can be visualized in a 2% agarose gel and are sufficient to differentiate between the three entities mentioned above. PCR-RFLP diagnostics can be used for all life stages and is cheaper and faster than DNA sequencing.

  13. GB Virus C/Hepatitis G Virus Groups and Subgroups: Classification by a Restriction Fragment Length Polymorphism Method Based on Phylogenetic Analysis of the 5′ Untranslated Region

    PubMed Central

    Quarleri, J. F.; Mathet, V. L.; Feld, M.; Ferrario, D.; della Latta, M. P.; Verdun, R.; Sánchez, D. O.; Oubiña, J. R.

    1999-01-01

    A phylogenetic tree based on 150 5′ untranslated region sequences deposited in GenBank database allowed segregation of the sequences into three major groups, including two subgroups, i.e., 1, 2a, 2b, and 3, supported by bootstrap analysis. Restriction site analysis of these sequences predicted that HinfI and either AatII or AciI could be used for genomic typing with 99.4% accuracy. cDNA sequencing and subsequent alignment of 21 Argentine GB virus C/hepatitis G virus strains confirmed restriction fragment length polymorphism patterns theoretically predicted. This method may be useful for a rapid screening of samples when either epidemiological or transmission studies of this agent are carried out. PMID:10203483

  14. An innovative platform for quick and flexible joining of assorted DNA fragments

    PubMed Central

    De Paoli, Henrique Cestari; Tuskan, Gerald A.; Yang, Xiaohan

    2016-01-01

    Successful synthetic biology efforts rely on conceptual and experimental designs in combination with testing of multi-gene constructs. Despite recent progresses, several limitations still hinder the ability to flexibly assemble and collectively share different types of DNA segments. Here, we describe an advanced system for joining DNA fragments from a universal library that automatically maintains open reading frames (ORFs) and does not require linkers, adaptors, sequence homology, amplification or mutation (domestication) of fragments in order to work properly. This system, which is enhanced by a unique buffer formulation, provides unforeseen capabilities for testing, and sharing, complex multi-gene circuitry assembled from different DNA fragments. PMID:26758940

  15. An innovative platform for quick and flexible joining of assorted DNA fragments

    SciTech Connect

    De Paoli, Henrique Cestari; Tuskan, Gerald A.; Yang, Xiaohan

    2016-01-13

    Successful synthetic biology efforts rely on conceptual and experimental designs in combination with testing of multi-gene constructs. Despite recent progresses, several limitations still hinder the ability to flexibly assemble and collectively share different types of DNA segments. We describe an advanced system for joining DNA fragments from a universal library that automatically maintains open reading frames (ORFs) and does not require linkers, adaptors, sequence homology, amplification or mutation (domestication) of fragments in order to work properly. Moreover, we find that this system, which is enhanced by a unique buffer formulation, provides unforeseen capabilities for testing, and sharing, complex multi-gene circuitry assembled from different DNA fragments.

  16. Use of PCR-restriction fragment length polymorphism analysis for identification of yeast species isolated from bovine intramammary infection.

    PubMed

    Fadda, M E; Pisano, M B; Scaccabarozzi, L; Mossa, V; Deplano, M; Moroni, P; Liciardi, M; Cosentino, S

    2013-01-01

    This study reports a rapid PCR-based technique using a one-enzyme RFLP for discrimination of yeasts isolated from bovine clinical and subclinical mastitis milk samples. We analyzed a total of 1,486 milk samples collected over 1 yr in south Sardinia and northern Italy, and 142 yeast strains were preliminarily grouped based on their cultural morphology and physiological characteristics. Assimilation tests were conducted using the identification kit API ID 32C and APILAB Plus software (bioMérieux, Marcy l'Etoile, France). For PCR-RFLP analysis, the 18S-ITS1-5.8S ribosomal(r)DNA region was amplified and then digested with HaeIII, and dendrogram analysis of RFLP fragments was carried out. Furthermore, within each of the groups identified by the API or PCR-RFLP methods, the identification of isolates was confirmed by sequencing of the D1/D2 region using an ABI Prism 310 automatic sequencer (Applied Biosystems, Foster City, CA). The combined phenotypic and molecular approach enabled the identification of 17 yeast species belonging to the genera Candida (47.9%), Cryptococcus (21.1%), Trichosporon (19.7%), Geotrichum (7.1%), and Rhodotorula (4.2%). All Candida species were correctly identified by the API test and their identification confirmed by sequencing. All strains identified with the API system as Geotrichum candidum, Cryptococcus uniguttulatus, and Rhodotorula glutinis also produced characteristic restriction patterns and were confirmed as Galactomyces geotrichum (a teleomorph of G. candidum), Filobasidium uniguttulatum (teleomorph of Crypt. uniguttulatus), and R. glutinis, respectively, by D1/D2 rDNA sequencing. With regard to the genus Trichosporon, preliminary identification by API was problematic, whereas the RFLP technique used in this study gave characteristic restriction profiles for each species. Moreover, sequencing of the D1/D2 region allowed not only successful identification of Trichosporon gracile where API could not, but also correct identification of

  17. Identification of Cryptosporidium spp. Oocysts in United Kingdom Noncarbonated Natural Mineral Waters and Drinking Waters by Using a Modified Nested PCR-Restriction Fragment Length Polymorphism Assay

    PubMed Central

    Nichols, R. A. B.; Campbell, B. M.; Smith, H. V.

    2003-01-01

    We describe a nested PCR-restriction fragment length polymorphism (RFLP) method for detecting low densities of Cryptosporidium spp. oocysts in natural mineral waters and drinking waters. Oocysts were recovered from seeded 1-liter volumes of mineral water by filtration through polycarbonate membranes and from drinking waters by filtration, immunomagnetizable separation, and filter entrapment, followed by direct extraction of DNA. The DNA was released from polycarbonate filter-entrapped oocysts by disruption in lysis buffer by using 15 cycles of freeze-thawing (1 min in liquid nitrogen and 1 min at 65°C), followed by proteinase K digestion. Amplicons were readily detected from two to five intact oocysts on ethidium bromide-stained gels. DNA extracted from Cryptosporidium parvum oocysts, C. muris (RN 66), C. baileyi (Belgium strain, LB 19), human-derived C. meleagridis, C. felis (DNA from oocysts isolated from a cat), and C. andersoni was used to demonstrate species identity by PCR-RFLP after simultaneous digestion with the restriction enzymes DraI and VspI. Discrimination between C. andersoni and C. muris isolates was confirmed by a separate, subsequent digestion with DdeI. Of 14 drinking water samples tested, 12 were found to be positive by microscopy, 8 were found to be positive by direct PCR, and 14 were found to be positive by using a nested PCR. The Cryptosporidium species detected in these finished water samples was C. parvum genotype 1. This method consistently and routinely detected >5 oocysts per sample. PMID:12839797

  18. A Time-Efficient and User-Friendly Method for Plasmid DNA Restriction Analysis.

    ERIC Educational Resources Information Center

    LaBanca, Frank; Berg, Claire M.

    1998-01-01

    Describes an experiment in which plasmid DNA is digested with restriction enzymes that cleave the plasmid either once or twice. The DNA is stained, loaded on a gel, electrophoresed, and viewed under normal laboratory conditions during electrophoresis. (DDR)

  19. Effect of site-specific modification on restriction endonucleases and DNA modification methyltransferases.

    PubMed Central

    McClelland, M; Nelson, M; Raschke, E

    1994-01-01

    Restriction endonucleases have site-specific interactions with DNA that can often be inhibited by site-specific DNA methylation and other site-specific DNA modifications. However, such inhibition cannot generally be predicted. The empirically acquired data on these effects are tabulated for over 320 restriction endonucleases. In addition, a table of known site-specific DNA modification methyltransferases and their specificities is presented along with EMBL database accession numbers for cloned genes. PMID:7937074

  20. Linear mtDNA fragments and unusual mtDNA rearrangements associated with pathological deficiency of MGME1 exonuclease

    PubMed Central

    Nicholls, Thomas J.; Zsurka, Gábor; Peeva, Viktoriya; Schöler, Susanne; Szczesny, Roman J.; Cysewski, Dominik; Reyes, Aurelio; Kornblum, Cornelia; Sciacco, Monica; Moggio, Maurizio; Dziembowski, Andrzej; Kunz, Wolfram S.; Minczuk, Michal

    2014-01-01

    MGME1, also known as Ddk1 or C20orf72, is a mitochondrial exonuclease found to be involved in the processing of mitochondrial DNA (mtDNA) during replication. Here, we present detailed insights on the role of MGME1 in mtDNA maintenance. Upon loss of MGME1, elongated 7S DNA species accumulate owing to incomplete processing of 5′ ends. Moreover, an 11-kb linear mtDNA fragment spanning the entire major arc of the mitochondrial genome is generated. In contrast to control cells, where linear mtDNA molecules are detectable only after nuclease S1 treatment, the 11-kb fragment persists in MGME1-deficient cells. In parallel, we observed characteristic mtDNA duplications in the absence of MGME1. The fact that the breakpoints of these mtDNA rearrangements do not correspond to either classical deletions or the ends of the linear 11-kb fragment points to a role of MGME1 in processing mtDNA ends, possibly enabling their repair by homologous recombination. In agreement with its functional involvement in mtDNA maintenance, we show that MGME1 interacts with the mitochondrial replicase PolgA, suggesting that it is a constituent of the mitochondrial replisome, to which it provides an additional exonuclease activity. Thus, our results support the viewpoint that MGME1-mediated mtDNA processing is essential for faithful mitochondrial genome replication and might be required for intramolecular recombination of mtDNA. PMID:24986917

  1. DNA fragmentation in leukocytes following repeated low dose sarin exposure in guinea pigs.

    PubMed

    Dave, J R; Connors, R A; Genovese, R F; Whipple, R A; Chen, R W; DeFord, S M; Moran, A V; Tortella, E C

    2007-11-01

    The objective of this study was to determine levels of DNA fragmentation in blood leukocytes and parietal cortex from guinea pigs following repeated low-level exposure to the chemical warfare nerve agent (CWNA) sarin. Guinea pigs were injected (s.c.) once a day for 10 days with saline, or 0.1, 0.2, or 0.4 LD50 (50% mean lethal dose) sarin dissolved in sterile physiological saline. Blood and parietal cortex was collected after injection at 0, 3, and 17 days recovery and evaluated for DNA fragmentation using single-cell gel electrophoresis (Comet assay). Cells were imaged using comet analysis software and three parameters of DNA fragmentation measured: tail length, percent DNA in the tail, and tail moment arm. Repeated low-dose exposure to sarin produced a dose-dependent response in leukocytes at 0 and 3 days post-exposure. There was a significant increase in all measures of DNA fragmentation at 0.2 and 0.4 LD50, but not at 0.1 LD50. There was no significant increase in DNA fragmentation in any of the groups at 17 days post-exposure. Sarin did not produce a systematic dose-dependent response in parietal cortex at any of the time points. However, significant increases in DNA fragmentation at 0.1 and 0.4 LD50 were observed at 0 and 3 days post-exposure. All measures of DNA fragmentation in both leukocytes and neurons returned to control levels by 17 days post-exposure, indicating a small and non-persistent increase in DNA fragmentation following repeated low-level exposure to sarin.

  2. PCR-based restriction fragment length polymorphism and haplotype of the most common mutation L176F in the beta-glucuronidase gene.

    PubMed

    Islam, M Rafiq; Shah, Gul N; Sly, William S

    2007-01-01

    Mucopolysaccharidosis type VII or Sly syndrome is an autosomal recessive disorder of glycosaminoglycan storage leading to variable clinical symptoms, such as hepatosplenomegaly, bone deformities, hearing loss, corneal opacities, mental retardation, and hydrops fetalis in affected individuals. The disease is caused by approximately 40 different mutations in the beta-glucuronidase gene. Detection of the most common mutation L176F by single-strand conformation polymorphism (SSCP) was not always successful. Although DNA sequencing followed by PCR amplification can easily detect this mutation, accessibility to a DNA sequencer or useful reagents in the sequencing procedure is not readily available in many countries. A PCR-based restriction fragment length polymorphism (RFLP) developed in this report would allow rapid and easier detection of this mutation for screening new patients or neonates of heterozygous parents. Analysis of intragenic polymorphic sites in the L176F patients identified two distinct alleles; the predominant one probably originated in Spain.

  3. Use of Restriction Fragment Length Polymorphism to Rapidly Identify Dermatophyte Species Related to Dermatophytosis

    PubMed Central

    Mohammadi, Rasoul; Abastabar, Mahdi; Mirhendi, Hossein; Badali, Hamid; Shadzi, Shahla; Chadeganipour, Mustafa; Pourfathi, Parinaz; Jalalizand, Niloufar; Haghani, Iman

    2015-01-01

    Background: Dermatophytes are a group of keratinophilic fungi worldwide, which can infect the skin, hair and nails of humans and animals. This genus includes several species that present different features of dermatophytosis. Although, laboratory diagnosis of dermatophytes is based on direct microscopy, biochemical tests and culture, these manners are expensive, time consuming and need skilled staff. Therefore, molecular methods like PCR-RFLP are the beneficial tools for identification, which are rapid and sensitive. Thus, dermatophyte species are able to generate characteristic band patterns on agarose gel electrophoresis using PCR-RFLP technique, which leads to successful identification at the species level within a 5-hour period. Objectives: The purpose of this study was to study inter- and intraspecific genomic variations for identification of clinically important dermatophyte species obtained from clinical specimens in Isfahan, Iran using PCR-RFLP. Materials and Methods: From March 2011 to August 2012, 135 clinical isolates were collected from infected patients at Isfahan, Iran. ITS1-5.8S-ITS2 region of rDNA was amplified using universal fungal primers. Subsequently, amplified products were digested by the MvaI restriction enzyme. Using discriminating band profiles on agarose gel, dermatophyte species were identified. However, DNA sequencing was used for unidentifiable strains. Results: The specimens were obtained from skin scrapings (70.3%), nail (24.4%) and hair (5.1%) clippings. Most patients were between 21 - 30 years and the ratio of male to female was 93/42. Trichophyton interdigitale was the commonest isolate (52.5%) in our findings, followed by Epidermophyton floccosum (24.4%), T. rubrum (16.2%), Microsporum canis (2.2%), T. erinacei (1.4%), T. violaceum (1.4%), T. tonsurans (0.7%) and M. gypseum (0.7%) based on PCR-RFLP. Conclusions: Combination of traditional methods and molecular techniques considerably improves identification of dermatophytes in

  4. Clusters of DNA damage induced by ionizing radiation: Formation of short DNA fragments. I. Theoretical modeling

    SciTech Connect

    Holley, W.R.; Chatterjee, A.

    1996-02-01

    We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber composed of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and {delta} rays due to knock-on collisions involving energy transfers > 100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of {circ}OH, {circ}H, e{sub aq}, etc.; {circ}OH attack on sugar molecules leading to strand breaks; {circ}OH attack on bases; direct ionization of the sugar molecules leading to strand breaks; direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 hp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the chromatin fibers in mammalian DNA. 27 refs., 7 figs.

  5. A Restriction Fragment Length Polymorphism Map and Electrophoretic Karyotype of the Fungal Maize Pathogen Cochliobolus Heterostrophus

    PubMed Central

    Tzeng, T. H.; Lyngholm, L. K.; Ford, C. F.; Bronson, C. R.

    1992-01-01

    A restriction fragment length polymorphism (RFLP) map has been constructed of the nuclear genome of the plant pathogenic ascomycete Cochliobolus heterostrophus. The segregation of 128 RFLP and 4 phenotypic markers was analyzed among 91 random progeny of a single cross; linkages were detected among 126 of the markers. The intact chromosomal DNAs of the parents and certain progeny were separated using pulsed field gel electrophoresis and hybridized with probes used to detect the RFLPs. In this way, 125 markers were assigned to specific chromosomes and linkages among 120 of the markers were confirmed. These linkages totalled 941 centimorgans (cM). Several RFLPs and a reciprocal translocation were identified tightly linked to Tox1, a locus controlling host-specific virulence. Other differences in chromosome arrangement between the parents were also detected. Fourteen gaps of at least 40 cM were identified between linkage groups on the same chromosomes; the total map length was therefore estimated to be, at a minimum, 1501 cM. Fifteen A chromosomes ranging from about 1.3 megabases (Mb) to about 3.7 Mb were identified; one of the strains also has an apparent B chromosome. This chromosome appears to be completely dispensable; in some progeny, all of 15 markers that mapped to this chromosome were absent. The total genome size was estimated to be roughly 35 Mb. Based on these estimates of map length and physical genome size, the average kb/cM ratio in this cross was calculated to be approximately 23. This low ratio of physical to map distance should make this RFLP map a useful tool for cloning genes. PMID:1346261

  6. Comparison of DNA fragmentation and color thresholding for objective quantitation of apoptotic cells

    NASA Technical Reports Server (NTRS)

    Plymale, D. R.; Ng Tang, D. S.; Fermin, C. D.; Lewis, D. E.; Martin, D. S.; Garry, R. F.

    1995-01-01

    Apoptosis is a process of cell death characterized by distinctive morphological changes and fragmentation of cellular DNA. Using video imaging and color thresholding techniques, we objectively quantitated the number of cultured CD4+ T-lymphoblastoid cells (HUT78 cells, RH9 subclone) displaying morphological signs of apoptosis before and after exposure to gamma-irradiation. The numbers of apoptotic cells measured by objective video imaging techniques were compared to numbers of apoptotic cells measured in the same samples by sensitive apoptotic assays that quantitate DNA fragmentation. DNA fragmentation assays gave consistently higher values compared with the video imaging assays that measured morphological changes associated with apoptosis. These results suggest that substantial DNA fragmentation can precede or occur in the absence of the morphological changes which are associated with apoptosis in gamma-irradiated RH9 cells.

  7. Fork rotation and DNA precatenation are restricted during DNA replication to prevent chromosomal instability.

    PubMed

    Schalbetter, Stephanie A; Mansoubi, Sahar; Chambers, Anna L; Downs, Jessica A; Baxter, Jonathan

    2015-08-18

    Faithful genome duplication and inheritance require the complete resolution of all intertwines within the parental DNA duplex. This is achieved by topoisomerase action ahead of the replication fork or by fork rotation and subsequent resolution of the DNA precatenation formed. Although fork rotation predominates at replication termination, in vitro studies have suggested that it also occurs frequently during elongation. However, the factors that influence fork rotation and how rotation and precatenation may influence other replication-associated processes are unknown. Here we analyze the causes and consequences of fork rotation in budding yeast. We find that fork rotation and precatenation preferentially occur in contexts that inhibit topoisomerase action ahead of the fork, including stable protein-DNA fragile sites and termination. However, generally, fork rotation and precatenation are actively inhibited by Timeless/Tof1 and Tipin/Csm3. In the absence of Tof1/Timeless, excessive fork rotation and precatenation cause extensive DNA damage following DNA replication. With Tof1, damage related to precatenation is focused on the fragile protein-DNA sites where fork rotation is induced. We conclude that although fork rotation and precatenation facilitate unwinding in hard-to-replicate contexts, they intrinsically disrupt normal chromosome duplication and are therefore restricted by Timeless/Tipin.

  8. Fragment-based discovery of 6-azaindazoles as inhibitors of bacterial DNA ligase.

    PubMed

    Howard, Steven; Amin, Nader; Benowitz, Andrew B; Chiarparin, Elisabetta; Cui, Haifeng; Deng, Xiaodong; Heightman, Tom D; Holmes, David J; Hopkins, Anna; Huang, Jianzhong; Jin, Qi; Kreatsoulas, Constantine; Martin, Agnes C L; Massey, Frances; McCloskey, Lynn; Mortenson, Paul N; Pathuri, Puja; Tisi, Dominic; Williams, Pamela A

    2013-12-12

    Herein we describe the application of fragment-based drug design to bacterial DNA ligase. X-ray crystallography was used to guide structure-based optimization of a fragment-screening hit to give novel, nanomolar, AMP-competitive inhibitors. The lead compound 13 showed antibacterial activity across a range of pathogens. Data to demonstrate mode of action was provided using a strain of S. aureus, engineered to overexpress DNA ligase.

  9. [Cloning and insertion mutagenesis of DNA fragment coding for the luminescent system of Photobacterium leiognathi].

    PubMed

    Ptitsyn, L R; Gurevich, V B; Barsanova, T G; Shenderov, A N; Khaĭkinson, M Ia

    1988-10-01

    Fragments of DNA, obtained from the luminescent bacterium Photobacterium leiognathi and inserted into the plasmid pBR322, were found to code for the luminescence expressed in E. coli cells. The genetic functions necessary for light production in E. coli are localized on a DNA fragment of about 7 kbp. The insertion mutagenesis was used to define the luminescence functions encoded by the hybrid plasmid.

  10. Molecular identification of a recent type of canine distemper virus in Japan by restriction fragment length polymorphism.

    PubMed

    Ohashi, K; Iwatsuki, K; Nakamura, K; Mikami, T; Kai, C

    1998-11-01

    Restriction fragment length polymorphism analysis was used to differentiate recent field viruses of canine distemper virus (CDU) from vaccine strains. Virus genomes were amplified by using reverse transcriptase-polymerase chain reaction in part of the haemagglutinin gene. After digestion with EcoRV, the PCR products of recent field isolates were cut into two fragments that differ from the uncut form of old strains including all of vaccine strains. This method could be applied to fresh or stored brains, spleens and peripheral blood mononuclear cells of infected dogs. This molecular approach is useful for determining the causative agent of postvaccinated CDV infection.

  11. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) for rapid diagnosis of neonatal sepsis

    PubMed Central

    Rohit, Anusha; Maiti, Biswajit; Shenoy, Shalini; Karunasagar, Indrani

    2016-01-01

    Background & objectives: The difficulties in diagnosis of neonatal sepsis are due to varied clinical presentation, low sensitivity of blood culture which is considered the gold standard and empirical antibiotic usage affecting the outcome of results. Though polymerase chain reaction (PCR) based detection of bacterial 16S rRNA gene has been reported earlier, this does not provide identification of the causative agent. In this study, we used restriction fragment length polymorphism (RFLP) of amplified 16S rRNA gene to identify the organisms involved in neonatal sepsis and compared the findings with blood culture. Methods: Blood samples from 97 neonates were evaluated for diagnosis of neonatal sepsis using BacT/Alert (automated blood culture) and PCR-RFLP. Results: Bacterial DNA was detected by 16S rRNA gene PCR in 55 cases, while BacT/Alert culture was positive in 34 cases. Staphylococcus aureus was the most common organism detected with both methods. Klebsiella spp. was isolated from four samples by culture but was detected by PCR-RFLP in five cases while Acinetobacter spp. was isolated from one case but detected in eight cases by PCR-RFLP. The sensitivity of PCR was found to be 82.3 per cent with a negative predictive value of 85.7 per cent. Eighty of the 97 neonates had prior exposure to antibiotics. Interpretation & conclusions: The results of our study demonstrate that PCR-RFLP having a rapid turnaround time may be useful for the early diagnosis of culture negative neonatal sepsis. PMID:26997017

  12. Map of restriction sites on bacteriophage T4 cytosine-containing DNA for endonucleases bamHI, BglII, KpnI, PvuI, SalI, and XbaI.

    PubMed Central

    Marsh, R C; Hepburn, M L

    1981-01-01

    A complete map of the cleavage sites of restriction endonucleases BamHI, BglII, KpnI, PvuI, SalI, and XbaI was determined for the cytosine-containing DNA of a bacteriophage T4 alc mutant. The 56 sequence-specific sites were assigned map coordinates based on a least-squares analysis of measured fragment lengths. Altogether, the lengths of 118 fragments from single and double enzyme digestions were measured by electrophoresis of the fragments in agarose gels. DNA fragments of known sequence or DNA fragments calibrated with fragments of known sequence were used as standards. The greatest deviation between an experimentally measured fragment length and its computed map coordinates was 3.0%; the average deviation was 0.8%. The total length of the wild-type T4 genome was calculated to be 166,200 base pairs. Images PMID:6264096

  13. Effects of presumptive test reagents on the ability to obtain restriction fragment length polymorphism (RFLP) patterns from human blood and semen stains.

    PubMed

    Hochmeister, M N; Budowle, B; Baechtel, F S

    1991-05-01

    Some of the commonly used presumptive test reagents for identification of blood and semen could potentially affect the recovery of intact high-molecular-weight deoxyribonucleic acid (DNA) from evidentiary samples. Thus, the capability of performing restriction fragment length polymorphism (RFLP) analysis on evidentiary samples could be compromised. In order to investigate the potential effects of presumptive test reagents on the DNA present in these samples, bloodstains on cotton and glass were exposed directly to luminol, benzidine, phenolphthalein, o-tolidine, and leucomalachite green, while semen stains and vaginal swabs containing semen were exposed directly to bromochloroindolyl phosphate (BCIP) and sodium thymolphthalein monophosphate (STMP) reagents. The yield gels for DNA quality and quantity and RFLP results indicated that bloodstains exposed to luminol, benzidine dissolved in ethanol, and phenolphthalein, as well as semen stains and vaginal swabs exposed to BCIP and STMP yield RFLP patterns consistent with that of the uncontaminated control. Except for the phenolphthalein treatment, the quantity of extractable, high-molecular-weight DNA obtained was comparable with that of untreated stains. Therefore, evidentiary material purposely or inadvertently contaminated with these reagents can be successfully typed. However, stains exposed to benzidine dissolved in glacial acetic acid, leucomalachite green, and o-tolidine failed to yield high-molecular-weight DNA or to produce any RFLP patterns.

  14. Processes involved in assisted reproduction technologies significantly increase sperm DNA fragmentation and phosphatidylserine translocation.

    PubMed

    Balasuriya, A; Serhal, P; Doshi, A; Harper, J C

    2014-03-01

    Sperm preparation techniques in assisted reproduction technologies (ART) are potential generators of exogenous stresses that cause additional DNA damage. DNA fragmentation tests, such as the sperm chromatin structure assay, involve freezing sperm samples in the absence of cryoprotectant. Thermal, oxidative stress (OS) and freezing are detrimental to sperm DNA fragmentation and phosphatidylserine (PS) translocation. The primary aim of this study was to subject mature sperm to environmental insults that normally occur during ART. We tested the hypotheses that OS, thermal stress and freeze-thawing caused sperm nuclear and membrane damage and that a positive correlation exists between PS translocation and DNA fragmentation. Sperm DNA integrity deteriorates in semen samples from men with advancing age and a sperm concentration of <15 m ml(-1) . The significant increase in sperm DNA fragmentation at 37 °C after merely 1 h is important clinically as semen liquefaction and short-term sperm storage in an ART cycle involve incubating samples at this temperature. Freezing without a cryoprotectant significantly increases the level of sperm nuclear damage, so it is important not to freeze neat semen prior to DNA fragmentation testing. This study highlights the importance of minimising the production of exogenous stresses during sperm preparation in ART.

  15. Accurate phylogenetic classification of variable-length DNA fragments.

    PubMed

    McHardy, Alice Carolyn; Martín, Héctor García; Tsirigos, Aristotelis; Hugenholtz, Philip; Rigoutsos, Isidore

    2007-01-01

    Metagenome studies have retrieved vast amounts of sequence data from a variety of environments leading to new discoveries and insights into the uncultured microbial world. Except for very simple communities, the encountered diversity has made fragment assembly and the subsequent analysis a challenging problem. A taxonomic characterization of metagenomic fragments is required for a deeper understanding of shotgun-sequenced microbial communities, but success has mostly been limited to sequences containing phylogenetic marker genes. Here we present PhyloPythia, a composition-based classifier that combines higher-level generic clades from a set of 340 completed genomes with sample-derived population models. Extensive analyses on synthetic and real metagenome data sets showed that PhyloPythia allows the accurate classification of most sequence fragments across all considered taxonomic ranks, even for unknown organisms. The method requires no more than 100 kb of training sequence for the creation of accurate models of sample-specific populations and can assign fragments >or=1 kb with high specificity.

  16. Cerebral ischemia produces laddered DNA fragments distinct from cardiac ischemia and archetypal apoptosis.

    PubMed

    MacManus, J P; Fliss, H; Preston, E; Rasquinha, I; Tuor, U

    1999-05-01

    The electrophoretic pattern of laddered DNA fragments which has been observed after cerebral ischemia is considered to indicate that neurons are dying by apoptosis. Herein the authors directly demonstrate using ligation-mediated polymerase chain reaction methods that 99% of the DNA fragments produced after either global or focal ischemia in adult rats, or produced after hypoxia-ischemia in neonatal rats, have staggered ends with a 3' recess of approximately 8 to 10 nucleotides. This is in contrast to archetypal apoptosis in which the DNA fragments are blunt ended as seen during developmental programmed cell death in dying cortical neurons, neuroblastoma, or thymic lymphocytes. It is not simply ischemia that results in staggered ends in DNA fragments because ischemic myocardium is similar to archetypal apoptosis with a vast majority of blunt-ended fragments. It is concluded that the endonucleases that produce this staggered fragmentation of the DNA backbone in ischemic brain must be different than those of classic or type I apoptosis.

  17. Rapid identification of bacteria from positive blood cultures by terminal restriction fragment length polymorphism profile analysis of the 16S rRNA gene.

    PubMed

    Christensen, Jeffrey E; Stencil, Jennifer A; Reed, Kurt D

    2003-08-01

    Bacteremia results in significant morbidity and mortality, especially among patient populations that are immunocompromised. Broad-spectrum antibiotics are administered to patients suspected to have bloodstream infections that are awaiting diagnosis that depends on blood culture analysis. Significant delays in identification of pathogens can result, primarily due to the dependence on growth-based identification systems. To address these limitations, we took advantage of terminal restriction fragment (TRF) length polymorphisms (T-RFLP) due to 16S ribosomal DNA (rDNA) sequence diversity to rapidly identify bacterial pathogens directly from positive blood culture. TRF profiles for each organism were determined by sizing fragments from restriction digests of PCR products derived from two sets of 16S rDNA-specific fluorescent dye-labeled primers. In addition, we created a TRF profile database (TRFPD) with 5899 predicted TRF profiles from sequence information representing 2860 different bacterial species. TRF profiles were experimentally determined for 69 reference organisms and 32 clinical isolates and then compared against the predicted profiles in the TRFPD. The predictive value of the profiles was found to be accurate to the species level with most organisms tested. In addition, identification of 10 different genera was possible with profiles comprising two or three TRFs. Although it was possible to identify Enterobacteriaceae by using a profile of three TRFs, the similarity of the TRF profiles of these organisms makes differentiation of species less reliable with the current method. The ability to rapidly (i.e., within approximately 8 h) identify bacteria from blood cultures has potential for reducing unnecessary use of broad-spectrum antibiotics and promoting more timely prescription of appropriate antibiotics.

  18. Sperm DNA fragmentation and its role in wildlife conservation.

    PubMed

    Gosálvez, Jaime; Holt, William V; Johnston, Stephen D

    2014-01-01

    Until about 20 years ago, sperm assessment in the laboratory was focused on motility, morphology and acrosomal integrity. Then came the gradual realisation that, because the main objective of a spermatozoon is to deliver an intact genetic payload of DNA to the egg, being able to check DNA quality of spermatozoa would be equally important, if not more so. Research over the last two decades has therefore led to the development of several techniques for reliably detecting DNA strand breaks, and the more recent focus has been directed towards understanding the fertility implications of DNA damage. It is now clear that evolutionary history has played an important role in determining the stability of sperm DNA under stressful conditions, and that the nature of the DNA-protein interactions also influence the extent to which fertility is affected by both technical procedures involved in sperm preservation and the basic biology of the species concerned. Here we present an overview of the principles involved in DNA assessment and also provide some cases studies that illustrate the influences of species diversity.

  19. Differential pre-amplification of STR loci for fragmented forensic DNA profiling.

    PubMed

    Ham, Seon-Kyu; Kim, Se-Yong; Seo, Bo Young; Woo, Kwang-Man; Lee, Seung-Hwan; Choi, Cheol Yong

    2016-11-01

    DNA profiling of short tandem repeats (STR) has been successfully used for the identification of individuals in forensic samples, accidents and natural disasters. However, STR profiling of DNA isolated from old crime scenes and damaged biological samples is difficult due to DNA degradation and fragmentation. Here, we show that pre-amplification of STR loci using biotinylated primers for the STR loci is an efficient strategy to obtain STR profiling results from fragmented forensic samples. Analysis of STR loci with longer amplicon sizes is generally hampered, since these relatively long loci are vulnerable to DNA fragmentation. This problem was overcome by using reduced or increased primer concentrations for loci with shorter or longer amplicon sizes, respectively, in our pre-amplification strategy. In addition, pre-amplification of STR loci into two groups of short or long amplicon size increases the efficiency of STR profiling from highly fragmented forensic DNA samples. Therefore, differential pre-amplification of STR loci is an effective way to obtain DNA profiling results from fragmented forensic samples.

  20. Species determination within Staphylococcus genus by extended PCR-restriction fragment length polymorphism of saoC gene.

    PubMed

    Bukowski, Michal; Polakowska, Klaudia; Ilczyszyn, Weronika M; Sitarska, Agnieszka; Nytko, Kinga; Kosecka, Maja; Miedzobrodzki, Jacek; Dubin, Adam; Wladyka, Benedykt

    2015-01-01

    Genetic methods based on PCR-restriction fragment length polymorphism (RFLP) are widely used for microbial species determination. In this study, we present the application of saoC gene as an effective tool for species determination and within-species diversity analysis for Staphylococcus genus. The unique sequence diversity of saoC allows us to apply four restriction enzymes to obtain RFLP patterns, which appear highly distinctive even among closely related species as well as atypical isolates of environmental origin. Such patterns were successfully obtained for 26 species belonging to Staphylococcus genus. What is more, tracing polymorphisms detected by different restriction enzymes allowed for basic phylogeny analysis for Staphylococcus aureus, which is potentially applicable for other staphylococcal species.

  1. Development of a polymerase chain reaction-restriction fragment length polymorphism method for identification of the Fusarium genus using the transcription elongation factor-1α gene.

    PubMed

    Zarrin, Majid; Ganj, Farzaneh; Faramarzi, Sama

    2016-12-01

    Fusarium species are well-known plant pathogens and food contaminants that have also appeared as one of the most important groups of medically significant fungi. The sequences of the translation elongation factor (TEF)-1α gene have been broadly employed for species detection. A total of 50 strains of Fusarium spp., including environmental, clinical and reference isolates were used for the current study. The primer sets, Fu3f and Fu3r, were used to amplify an ~420-bp DNA fragment of the TEF-1α gene. Double digestion with two restriction enzymes, XhoI and SduI was used for discrimination of the Fusarium species in the TEF-1α gene fragment. Double digestion of the TEF-1α gene fragment from five clinically important Fusarium species were clearly differentiated from each other: The F. solani species complex, F. oxysporum species complex, F. verticillioides, F. proliferatum and F. fujikuroi. This method facilitates detection and enables verification of the Fusarium genus; therefore, it may be applied for disease control.

  2. Development of a polymerase chain reaction-restriction fragment length polymorphism method for identification of the Fusarium genus using the transcription elongation factor-1α gene

    PubMed Central

    Zarrin, Majid; Ganj, Farzaneh; Faramarzi, Sama

    2016-01-01

    Fusarium species are well-known plant pathogens and food contaminants that have also appeared as one of the most important groups of medically significant fungi. The sequences of the translation elongation factor (TEF)-1α gene have been broadly employed for species detection. A total of 50 strains of Fusarium spp., including environmental, clinical and reference isolates were used for the current study. The primer sets, Fu3f and Fu3r, were used to amplify an ~420-bp DNA fragment of the TEF-1α gene. Double digestion with two restriction enzymes, XhoI and SduI was used for discrimination of the Fusarium species in the TEF-1α gene fragment. Double digestion of the TEF-1α gene fragment from five clinically important Fusarium species were clearly differentiated from each other: The F. solani species complex, F. oxysporum species complex, F. verticillioides, F. proliferatum and F. fujikuroi. This method facilitates detection and enables verification of the Fusarium genus; therefore, it may be applied for disease control. PMID:28105337

  3. Detection and Identification of Decay Fungi in Spruce Wood by Restriction Fragment Length Polymorphism Analysis of Amplified Genes Encoding rRNA†

    PubMed Central

    Jasalavich, Claudia A.; Ostrofsky, Andrea; Jellison, Jody

    2000-01-01

    We have developed a DNA-based assay to reliably detect brown rot and white rot fungi in wood at different stages of decay. DNA, isolated by a series of CTAB (cetyltrimethylammonium bromide) and organic extractions, was amplified by the PCR using published universal primers and basidiomycete-specific primers derived from ribosomal DNA sequences. We surveyed 14 species of wood-decaying basidiomycetes (brown-rot and white-rot fungi), as well as 25 species of wood-inhabiting ascomycetes (pathogens, endophytes, and saprophytes). DNA was isolated from pure cultures of these fungi and also from spruce wood blocks colonized by individual isolates of wood decay basidiomycetes or wood-inhabiting ascomycetes. The primer pair ITS1-F (specific for higher fungi) and ITS4 (universal primer) amplified the internal transcribed spacer region from both ascomycetes and basidiomycetes from both pure culture and wood, as expected. The primer pair ITS1-F (specific for higher fungi) and ITS4-B (specific for basidiomycetes) was shown to reliably detect the presence of wood decay basidiomycetes in both pure culture and wood; ascomycetes were not detected by this primer pair. We detected the presence of decay fungi in wood by PCR before measurable weight loss had occurred to the wood. Basidiomycetes were identified to the species level by restriction fragment length polymorphisms of the internal transcribed spacer region. PMID:11055916

  4. Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy

    NASA Astrophysics Data System (ADS)

    Chao, J.; Zhang, P.; Wang, Q.; Wu, N.; Zhang, F.; Hu, J.; Fan, C. H.; Li, B.

    2016-03-01

    We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06544e

  5. Pst I restriction fragment length polymorphism of human placental alkaline phosphatase gene: Mendelian in segregation and localization of mutation site in the gene

    SciTech Connect

    Tsavaler, L.; Penhallow, R.C.; Sussman, H.H. )

    1988-10-01

    The pattern of inheritance of a Pst I restriction fragment length polymorphism (RFLP) of the human placental alkaline phosphatase gene was studied in nine nuclear families by Southern blot hybridization analysis of genomic DNA. The dimorphic RFLP is defined by the presence of allelic fragments 1.0 kilobase and 0.8 kilobase long. The results of this study show that the two alleles of the Pst I RFLP of the placental alkaline phosphatase gene segregate as codominant traits according to Mendelian expectations. For a polymorphism to be useful as a genetic marker the probability that an offspring is informative (PIC) must be at least 0.15. The allelic frequency of the 1.0-kilobase allele is 0.21, which correlates to a probability that an offspring is informative of 0.275 and is indicative of a useful polymorphism. By using probes derived from different regions of the placental alkaline phosphatase cDNA, the mutated Pst I site causing the RFLP was located in the penultimate intron 2497 base pairs downstream from the transcriptional initiation site.

  6. Soil pretreatment and fast cell lysis for direct polymerase chain reaction from forest soils for terminal restriction fragment length polymorphism analysis of fungal communities.

    PubMed

    Cheng, Fei; Hou, Lin; Woeste, Keith; Shang, Zhengchun; Peng, Xiaobang; Zhao, Peng; Zhang, Shuoxin

    Humic substances in soil DNA samples can influence the assessment of microbial diversity and community composition. Using multiple steps during or after cell lysis adds expenses, is time-consuming, and causes DNA loss. A pretreatment of soil samples and a single step DNA extraction may improve experimental results. In order to optimize a protocol for obtaining high purity DNA from soil microbiota, five prewashing agents were compared in terms of their efficiency and effectiveness in removing soil contaminants. Residual contaminants were precipitated by adding 0.6mL of 0.5M CaCl2. Four cell lysis methods were applied to test their compatibility with the pretreatment (prewashing+Ca(2+) flocculation) and to ultimately identify the optimal cell lysis method for analyzing fungal communities in forest soils. The results showed that pretreatment with TNP+Triton X-100+skim milk (100mM Tris, 100mM Na4P2O7, 1% polyvinylpyrrolidone, 100mM NaCl, 0.05% Triton X-100, 4% skim milk, pH 10.0) removed most soil humic contaminants. When the pretreatment was combined with Ca(2+) flocculation, the purity of all soil DNA samples was further improved. DNA samples obtained by the fast glass bead-beating method (MethodFGB) had the highest purity. The resulting DNA was successfully used, without further purification steps, as a template for polymerase chain reaction targeting fungal internal transcribed spacer regions. The results obtained by terminal restriction fragment length polymorphism analysis indicated that the MethodFGB revealed greater fungal diversity and more distinctive community structure compared with the other methods tested. Our study provides a protocol for fungal cell lysis in soil, which is fast, convenient, and effective for analyzing fungal communities in forest soils.

  7. [THE OPTIMAL CONDITIONS OF STORAGE OF SPERMATOZOA FOR ANALYSIS OF DNA FRAGMENTATION].

    PubMed

    Tataru, D A; Markova, E V; Osadchuk, L V; Sheina, E V; Svetlakov, A V

    2015-04-01

    The analysis of fragmentation of DNA of spermatozoons using technique of flow cytometry to evaluate male fertility more and more often begins to be applied in clinical diagnostic. However, development of optimal protocol of storage and preparation of spermatozoons for analysis still is at the stage of experimental elaboration. The studv was carried out to analyse effect of different conditions of preparation of ejaculate for adequate evaluation of index of fragmentation of DNA of spermatozoons using sperm chromatin structure assay technique. The sampling consisted of 20 patients of the Krasnoyarsk center of reproductive medicine. The sperm chromatin structure assay technique was applied to evaluate index of fragmentation of DNA of spermatozoons in fresh native ejaculate and after storage of spermatozoons under different temperature (37, 25 and 4 degrees C) and duration (1-2 and 1-3 days) and conditions of storage (-20 or -70 degrees C) of frozen spermatozoons (as native ejaculate or in TNE-buffer). It is demonstrated that index of fragmentation of DNA of spermatozoons has no significant alterations in ejaculate stored under 4 degrees C during 48 hours. In case of storage of ejaculate under 25 or 37 degrees C index of fragmentation of DNA of spermatozoons significantly increases already after first day of storage. The incubation of ejaculate under 37 degrees C results in increasing of index of fragmentation of DNA of spermatozoons already after first hour. The individual differences are established related to degree of increasing of index of fragmentation of DNA of spermatozoons because of impact of studied temperatures of ejaculate incubation. The storage of spermatozoons under temperature of - 20 and -70 degrees C in native ejaculate or in TNE-buffer has no effect of index of fragmentation of DNA of spermatozoons with measurement during 1-2 hours. Therefore, storage and transportation of native ejaculate under 4 degrees C during 1-2 days or in frozen condition

  8. Apoptotic DNA fragmentation can be revealed in situ: an ultrastructural approach.

    PubMed

    Burattini, Sabrina; Ferri, Paola; Battistelli, Michela; D'Emilio, Alessandra; Biagiotti, Laura; Sestili, Piero; Rocchi, Marco B L; Falcieri, Elisabetta

    2009-12-01

    A common pattern of apoptotic death is DNA cleavage, initially producing large fragments (50 kbp), followed by the production of nucleosomic/oligonucleosomic fragments. Nevertheless, apoptosis without DNA fragmentation, at least of the nucleosomic type, has been reported. To investigate the spatial relationship between DNA cleavage and chromatin condensation, we applied the TUNEL technique to the ultrastructural analysis of apoptotic cells. A modified method, utilizing a gold-conjugated antidigoxigenin antibody, was carried out on U937 versus Molt-4 cells, both exposed to UVB radiation or staurosporine treatment. Gold particle density in the different domains of apoptotic cells was evaluated by a four-way ANOVA test. Gold labelling was more strongly localised in condensed chromatin than in the diffuse chromatin. U937 cells, which evidenced in vitro oligonucleosomic fragmentation after both UVB and staurosporine treatments, revealed a significantly higher gold particle density, when compared with Molt-4, which did not show, on the other hand, oligonucleosomic cleavage even in the presence of < or = 50 kbp cleavage. Thus, a correlation between DNA fragment sizes and gold particle density appears. TUNEL applied to electron microscopy is an effective approach to study the relationship between apoptotic chromatin condensation and DNA cleavage. Both these events indeed appear in the apoptotic nucleus, but their reciprocal correlation is still greatly unknown. Microsc. Res. Tech. 2009. (c) 2009 Wiley-Liss, Inc.

  9. Molecular identification of nine commercial flaffish species by polymerase chain reaction-restriction fragment length polymorphism analysis of a segment of the cytochrome b region.

    PubMed

    Sanjuan, Andrés; Comesaña, Angel S

    2002-06-01

    Commercial refrigerated or frozen flatfish fillets are sometimes mislabeled, and identification of these mislabeled products is necessary to prevent fraudulent substitution. Identification of nine commercial flatfish species (order Pleuronectiformes), Hippoglossus hippoglossus (halibut), Lepidorhombus boscii (four-spotted scaldfish), Lepidorhombus whiffiagonis (megrin), Platichthys flesus (flounder), Pleuronectes platessa (European plaice), Reinhardtius hippoglossoides (Greenland halibut), Scophthalmus maximus (turbot), Scophthalmus rhombus (brill), and Solea vulgaris (=Solea solea) (sole), was carried out on the basis of the amplification of a 486-bp segment of the mitochondrial genome (tRNA(Glu)/cytochrome b) by using the polymerase chain reaction (PCR) and universal primers. Sequences of PCR-amplified DNA from the flatfish species were used to select eight restriction enzymes (REs). The PCR products were cut with each RE, resulting in species-specific restriction fragment length polymorphism. Seven species groups could be identified by application of the single RE DdeI and six species groups by using HaeIII, HinfI, MaeI, or MboI. Different combinations of only a couple of these REs could unambiguously identify the nine flatfish species. Genetic polymorphisms of the target sequence were examined by comparison with previously published DNA sequences, and the results of this comparison confirmed the usefulness of this technique in distinguishing and genetically characterizing refrigerated or frozen pieces of these nine flatfish species.

  10. A semester-long project for teaching basic techniques in molecular biology such as restriction fragment length polymorphism analysis to undergraduate and graduate students.

    PubMed

    DiBartolomeis, Susan M

    2011-01-01

    Several reports on science education suggest that students at all levels learn better if they are immersed in a project that is long term, yielding results that require analysis and interpretation. I describe a 12-wk laboratory project suitable for upper-level undergraduates and first-year graduate students, in which the students molecularly locate and map a gene from Drosophila melanogaster called dusky and one of dusky's mutant alleles. The mapping strategy uses restriction fragment length polymorphism analysis; hence, students perform most of the basic techniques of molecular biology (DNA isolation, restriction enzyme digestion and mapping, plasmid vector subcloning, agarose and polyacrylamide gel electrophoresis, DNA labeling, and Southern hybridization) toward the single goal of characterizing dusky and the mutant allele dusky(73). Students work as individuals, pairs, or in groups of up to four students. Some exercises require multitasking and collaboration between groups. Finally, results from everyone in the class are required for the final analysis. Results of pre- and postquizzes and surveys indicate that student knowledge of appropriate topics and skills increased significantly, students felt more confident in the laboratory, and students found the laboratory project interesting and challenging. Former students report that the lab was useful in their careers.

  11. A Semester-Long Project for Teaching Basic Techniques in Molecular Biology Such as Restriction Fragment Length Polymorphism Analysis to Undergraduate and Graduate Students

    PubMed Central

    DiBartolomeis, Susan M.

    2011-01-01

    Several reports on science education suggest that students at all levels learn better if they are immersed in a project that is long term, yielding results that require analysis and interpretation. I describe a 12-wk laboratory project suitable for upper-level undergraduates and first-year graduate students, in which the students molecularly locate and map a gene from Drosophila melanogaster called dusky and one of dusky's mutant alleles. The mapping strategy uses restriction fragment length polymorphism analysis; hence, students perform most of the basic techniques of molecular biology (DNA isolation, restriction enzyme digestion and mapping, plasmid vector subcloning, agarose and polyacrylamide gel electrophoresis, DNA labeling, and Southern hybridization) toward the single goal of characterizing dusky and the mutant allele dusky73. Students work as individuals, pairs, or in groups of up to four students. Some exercises require multitasking and collaboration between groups. Finally, results from everyone in the class are required for the final analysis. Results of pre- and postquizzes and surveys indicate that student knowledge of appropriate topics and skills increased significantly, students felt more confident in the laboratory, and students found the laboratory project interesting and challenging. Former students report that the lab was useful in their careers. PMID:21364104

  12. Clinical value of DNA fragmentation evaluation tests under ART treatments.

    PubMed

    Tavukçuoğlu, Ilkay Şafak; Al-Azawi, Tahani; Khaki, Amir Afshin; Khaki, Arash; Khalil, Ahmed; Al-Hasani, Safaa

    2012-01-01

    Male reproductive health has been under scrutiny recently. Many studies in the literature have concluded that semen quality is declining and that the incidence of testicular cancers is increasing. The reason for this change has been attributed to damage in sperm chromatin. During in vivo reproduction, the natural selection process ensures that only a spermatozoon with normal genomic material can fertilize an oocyte. However, the assisted reproduction technique (ART) is our selection process, leading to the possibility that abnormal spermatozoa could be used to fertilize an oocyte. We could avoid this by quantifying the amount and type of genomic damage in sperm using well-accepted laboratory methods. The sperm deoxyribonucleic acid (DNA) integrity is important for success of natural or assisted fertilization as well as normal development of the embryo, fetus and child. Intra cytoplasmic sperm injection (ICSI) is bypassing natural sperm selection mechanisms, which increases the risk of transmitting damaged DNA. The significance of required investigations and multiple techniques is that they could evaluate DNA defects in human spermatozoa. The ability of these techniques to accurately estimate sperm DNA damage depends on many technical and biological aspects. The aim of this review is to evaluate the most commonly used methods.

  13. Accurate phylogenetic classification of DNA fragments based onsequence composition

    SciTech Connect

    McHardy, Alice C.; Garcia Martin, Hector; Tsirigos, Aristotelis; Hugenholtz, Philip; Rigoutsos, Isidore

    2006-05-01

    Metagenome studies have retrieved vast amounts of sequenceout of a variety of environments, leading to novel discoveries and greatinsights into the uncultured microbial world. Except for very simplecommunities, diversity makes sequence assembly and analysis a verychallenging problem. To understand the structure a 5 nd function ofmicrobial communities, a taxonomic characterization of the obtainedsequence fragments is highly desirable, yet currently limited mostly tothose sequences that contain phylogenetic marker genes. We show that forclades at the rank of domain down to genus, sequence composition allowsthe very accurate phylogenetic 10 characterization of genomic sequence.We developed a composition-based classifier, PhyloPythia, for de novophylogenetic sequence characterization and have trained it on adata setof 340 genomes. By extensive evaluation experiments we show that themethodis accurate across all taxonomic ranks considered, even forsequences that originate fromnovel organisms and are as short as 1kb.Application to two metagenome datasets 15 obtained from samples ofphosphorus-removing sludge showed that the method allows the accurateclassification at genus level of most sequence fragments from thedominant populations, while at the same time correctly characterizingeven larger parts of the samples at higher taxonomic levels.

  14. Polymerization behavior of Klenow fragment and Taq DNA polymerase in short primer extension reactions.

    PubMed

    Zhao, Guojie; Guan, Yifu

    2010-10-01

    DNA polymerases amplify DNA fragments through primer extension reactions. However, polymerization behavior of short primers in the primer extension process has not been systematically explored. In this study, we examined the minimal primer length required for primer extension, and the effect of primer length, mismatches and other conditions on DNA polymerization using a non-radioactive method. Under the condition we conducted, the shortest primers polymerized by Klenow fragment (KF) and Taq DNA polymerase in our experiments were respectively heptamer and octamer. The extension efficiency was also affected by the up-stream overhanging structure of the primer-template complex. We hypothesized a simple model to interpret these observations based on the polymerase structures. Furthermore, it was found that the longer the primer, the more efficient is the primer extension. These polymerization behavior of short primers lay foundation about DNA polymerization mechanism and development of novel nucleic acid detection assays.

  15. TNF-α is involved in activating DNA fragmentation in skeletal muscle

    PubMed Central

    Carbó, N; Busquets, S; van Royen, M; Alvarez, B; López-Soriano, F J; Argilés, J M

    2002-01-01

    Intraperitoneal administration of 100 μg kg−1 (body weight) of tumour necrosis factor-α to rats for 8 consecutive days resulted in a significant decrease in protein content, which was concomitant with a reduction in DNA content. Interestingly, the protein/DNA ratio was unchanged in the skeletal muscle of the tumour necrosis factor-α-treated animals as compared with the non-treated controls. Analysis of muscle DNA fragmentation clearly showed enhanced laddering in the skeletal muscle of tumour necrosis factor-α-treated animals, suggesting an apoptotic phenomenon. In a different set of experiments, mice bearing a cachexia-inducing tumour (the Lewis lung carcinoma) showed an increase in muscle DNA fragmentation (9.8-fold) as compared with their non-tumour-bearing control counterparts as previously described. When gene-deficient mice for tumour necrosis factor-α receptor protein I were inoculated with Lewis lung carcinoma, they were also affected by DNA fragmentation; however the increase was only 2.1-fold. These results suggest that tumour necrosis factor-α partly mediates DNA fragmentation during experimental cancer-associated cachexia. British Journal of Cancer (2002) 86, 1012–1016. DOI: 10.1038/sj/bjc/6600167 www.bjcancer.com © 2002 Cancer Research UK PMID:11953838

  16. An innovative platform for quick and flexible joining of assorted DNA fragments

    DOE PAGES

    De Paoli, Henrique Cestari; Tuskan, Gerald A.; Yang, Xiaohan

    2016-01-13

    Successful synthetic biology efforts rely on conceptual and experimental designs in combination with testing of multi-gene constructs. Despite recent progresses, several limitations still hinder the ability to flexibly assemble and collectively share different types of DNA segments. We describe an advanced system for joining DNA fragments from a universal library that automatically maintains open reading frames (ORFs) and does not require linkers, adaptors, sequence homology, amplification or mutation (domestication) of fragments in order to work properly. Moreover, we find that this system, which is enhanced by a unique buffer formulation, provides unforeseen capabilities for testing, and sharing, complex multi-gene circuitrymore » assembled from different DNA fragments.« less

  17. Synthesis and NMR of {sup 15}N-labeled DNA fragments

    SciTech Connect

    Jones, R.A.

    1994-12-01

    DNA fragments labeled with {sup 15}N at the ring nitrogens and at the exocyclic amino groups can be used to obtain novel insight into interactions such as base pairing, hydration, drug binding, and protein binding. A number of synthetic routes to {sup 15}N-labeled pyrimidine nucleosides, purines, and purine nucleosides have been reported. Moreover, many of these labeled bases or monomers have been incorporated into nucleic acids, either by chemical synthesis or by biosynthetic procedures. The focus of this chapter will be on the preparation of {sup 15}N-labeled purine 2{prime}-deoxynucleosides, their incorporation into DNA fragments by chemical synthesis, and the results of NMR studies using these labeled DNA fragments.

  18. Optimizing selection of restriction enzymes in the search for DNA variants.

    PubMed Central

    Wijsman, E M

    1984-01-01

    A model is developed for predicting the relative efficiencies of different enzymes for detecting DNA variants when such variants are the result of single base-pair changes. 71 enzymes are analyzed for this ability in human DNA. Their relative ranked efficiencies are influenced by the sizes of the probes used, and the size of the smallest detectable fragment produced. PMID:6096823

  19. DNA translocation blockage, a general mechanism of cleavage site selection by type I restriction enzymes.

    PubMed Central

    Janscak, P; MacWilliams, M P; Sandmeier, U; Nagaraja, V; Bickle, T A

    1999-01-01

    Type I restriction enzymes bind to a specific DNA sequence and subsequently translocate DNA past the complex to reach a non-specific cleavage site. We have examined several potential blocks to DNA translocation, such as positive supercoiling or a Holliday junction, for their ability to trigger DNA cleavage by type I restriction enzymes. Introduction of positive supercoiling into plasmid DNA did not have a significant effect on the rate of DNA cleavage by EcoAI endonuclease nor on the enzyme's ability to select cleavage sites randomly throughout the DNA molecule. Thus, positive supercoiling does not prevent DNA translocation. EcoR124II endonuclease cleaved DNA at Holliday junctions present on both linear and negatively supercoiled substrates. The latter substrate was cleaved by a single enzyme molecule at two sites, one on either side of the junction, consistent with a bi-directional translocation model. Linear DNA molecules with two recognition sites for endonucleases from different type I families were cut between the sites when both enzymes were added simultaneously but not when a single enzyme was added. We propose that type I restriction enzymes can track along a DNA substrate irrespective of its topology and cleave DNA at any barrier that is able to halt the translocation process. PMID:10228175

  20. Restriction site heteroplasmy in the mitochondrial DNA of the marine fish Sciaenops ocellatus (L.).

    PubMed

    Gold, J R; Richardson, L R

    1990-01-01

    Restriction site heteroplasmy involving the enzymes NcoI and XbaI was detected in the mitochondrial DNAs of two individuals of the marine fish Sciaenops ocellatus. This represents only the sixth documented example of mitochondrial DNA restriction site heteroplasmy in animals. Two heteroplasmic individuals were found in a survey of nearly 750 individuals, suggesting that in most studies the incidence of mitochondrial DNA site heteroplasmy may be too low to be routinely detected.

  1. RESTRICTION FRAGMENT LENGTH POLYMORPHISM ANALYSIS OF PCR-AMPLIFIED NIFH SEQUENCES FROM WETLAND PLANT RHIZOSPHERE COMMUNITIES

    EPA Science Inventory

    We describe a method to assess the community structure of N2-fixing bacteria in the rhizosphere. Total DNA was extracted from Spartina alterniflora and Sesbania macrocarpa root zones by bead-beating and purified by CsCl-EtBr gradient centrifugation. The average DNA yield was 5.5 ...

  2. Development of procedures for the identification of human papilloma virus DNA fragments in laser plume

    NASA Astrophysics Data System (ADS)

    Woellmer, Wolfgang; Meder, Tom; Jappe, Uta; Gross, Gerd; Riethdorf, Sabine; Riethdorf, Lutz; Kuhler-Obbarius, Christina; Loening, Thomas

    1996-01-01

    For the investigation of laser plume for the existence of HPV DNA fragments, which possibly occur during laser treatment of virus infected tissue, human papillomas and condylomas were treated in vitro with the CO2-laser. For the sampling of the laser plume a new method for the trapping of the material was developed by use of water-soluble gelatine filters. These samples were analyzed with the polymerase chain reaction (PCR) technique, which was optimized in regard of the gelatine filters and the specific primers. Positive PCR results for HPV DNA fragments up to the size of a complete oncogene were obtained and are discussed regarding infectiousity.

  3. Differentiation of mixed biological traces in sexual assaults using DNA fragment analysis

    PubMed Central

    Apostolov, Аleksandar

    2014-01-01

    During the investigation of sexual abuse, it is not rare that mixed genetic material from two or more persons is detected. In such cases, successful profiling can be achieved using DNA fragment analysis, resulting in individual genetic profiles of offenders and their victims. This has led to an increase in the percentage of identified perpetrators of sexual offenses. The classic and modified genetic models used, allowed us to refine and implement appropriate extraction, polymerase chain reaction and electrophoretic procedures with individual assessment and approach to conducting research. Testing mixed biological traces using DNA fragment analysis appears to be the only opportunity for identifying perpetrators in gang rapes. PMID:26019514

  4. Hydrodynamics-based transfer of PCR-amplified DNA fragments into rat liver.

    PubMed

    Kameda, S; Maruyama, H; Higuchi, N; Nakamura, G; Iino, N; Nishikawa, Y; Miyazaki, J; Gejyo, F

    2003-10-03

    A high level of plasmid DNA expression in rat liver can be achieved by the rapid injection of a large volume of a naked DNA solution into the tail vein, called the 'hydrodynamics-based procedure.' The preparation of PCR-amplified DNA fragments is easier than that of naked DNA. In this paper we evaluated the effects of expressing the erythropoietin (Epo) gene in the rat liver by injecting fCAGGS-Epo, an Epo-expressing PCR-amplified DNA fragment, via the tail vein. After injection of 5 pmol fCAGGS-Epo (10 microg) or pCAGGS-Epo (18.4 microg), plasmid DNA, the serum Epo levels peaked at week 1, then persisted for at least 12 weeks. Transgene-derived Epo secretion resulted in significant erythropoiesis. These results demonstrated that transfer of PCR-amplified DNA fragments into the rat liver via rapid tail vein injection can be achieved. This method may provide a useful means for studying the physiologic function of a putative gene.

  5. Increased aneuploidy rate in sperm with fragmented DNA as determined by the sperm chromatin dispersion (SCD) test and FISH analysis.

    PubMed

    Muriel, Lourdes; Goyanes, Vicente; Segrelles, Enrique; Gosálvez, Jaime; Alvarez, Juan G; Fernández, José Luis

    2007-01-01

    Previous studies suggest that sperm DNA fragmentation may be associated with aneuploidy. However, currently available tests have not made it possible to simultaneously perform DNA fragmentation and chromosomal analyses on the same sperm cell. The recently introduced sperm chromatin dispersion (SCD) test allows users to determine this relationship. Semen samples from 16 males, including 4 fertile donors, 7 normozoospermic, 3 teratozoospermic, 1 asthenozoospermic, and 1 oligoasthenoteratozoospermic, were processed for DNA fragmentation analysis by the SCD test using the Halosperm kit. Three-color fluorescence in situ hybridization (FISH) was performed on SCD-processed slides to determine aneuploidy for chromosomes X, Y, and 18. Spermatozoa with DNA fragmentation showed a 4.4 +/- 1.9-fold increase in diploidy rate and a 5.9 +/- 3.5-fold increase in disomy rate compared to spermatozoa without DNA fragmentation. The overall aneuploidy rate was 4.6 +/- 2.0-fold higher in sperm with fragmented DNA (Wilcoxon rank test: P < .001 in the 3 comparisons). A higher frequency of DNA fragmentation was found in sperm cells containing sex chromosome aneuploidies originated in both first and second meiotic divisions. The observed increase in aneuploidy rate in sperm with fragmented DNA may suggest that the occurrence of aneuploidy during sperm maturation may lead to sperm DNA fragmentation as part of a genomic screening mechanism developed to genetically inactivate sperm with a defective genomic makeup.

  6. A simple DNA extraction method for marijuana samples used in amplified fragment length polymorphism (AFLP) analysis.

    PubMed

    Miller Coyle, Heather; Shutler, Gary; Abrams, Sharon; Hanniman, Janet; Neylon, Suzanne; Ladd, Carll; Palmbach, Timothy; Lee, Henry C

    2003-03-01

    As a first step in developing a molecular method for the individualization of marijuana samples, we evaluated a plant DNA extraction kit. The QIAGEN plant DNeasy method uses a spin column format for recovery of DNA and is effective for obtaining high molecular weight DNA from leaf, flower (bud), and seed samples of marijuana. The average DNA yield was 125-500 ng per 100 milligrams of fresh plant tissue. The recovered DNA was of polymerase chain reaction (PCR) quality as measured by the ability to generate reproducible amplified fragment length polymorphism (AFLP) profiles. AFLP is a technique used to create a DNA profile for plant varieties and is being applied to marijuana samples by the authors to link growers and distributors of clonal material. The QIAGEN plant DNeasy method was simple, efficient, and reproducible for processing small quantities of marijuana into DNA.

  7. In vitro incubation of human spermatozoa promotes reactive oxygen species generation and DNA fragmentation.

    PubMed

    Cicaré, J; Caille, A; Zumoffen, C; Ghersevich, S; Bahamondes, L; Munuce, M J

    2015-10-01

    The aim of this study was to investigate the oxidative process associated with sperm capacitation and its impact on DNA fragmentation and sperm function. Redox activity and lipid peroxidation were analysed in human spermatozoa after 3, 6 and 22 h of incubation in Ham's F10 medium plus bovine albumin at 37° and 5% CO2 for capacitation. DNA status, tyrosine phosphorylation pattern and induced acrosome reaction were evaluated after capacitating conditions. At 22 h of incubation, there was a significant (P < 0.05) increase in oxygen-free radicals and lipid peroxidation, with no effect on sperm viability. There also was a significant (P < 0.001) increase in fragmented DNA in capacitated spermatozoa compared to semen values with higher rates being found after the occurrence of the induced acrosome reaction. Protein tyrosine phosphorylation pattern confirms that capacitation took place in parallel with the occurrence of DNA fragmentation. These results indicate that when spermatozoa are incubated for several hours (22 h), a common practice in assisted reproductive techniques, an increase in oxidative sperm metabolism and in the proportion of fragmented DNA should be expected. However, there was no effect on any of the other functional parameters associated with sperm fertilising capacity.

  8. Molecular phylogenetic relationships of puffer fish inferred from partial sequences of cytochrome b gene and restriction fragment length polymorphism analysis.

    PubMed

    Hsieh, Yu-Wen; Hwang, Deng-Fwu

    2004-06-30

    Phylogenetic relationships among puffer fish were investigated by comparing cytochrome b gene sequences and restriction endonuclease assays of 16 species from Taiwan. DNA was prepared for sequencing by PCR. No variation in sequences was detected among individuals within each species. Direct estimates of mitochondrial cytochrome b gene sequence divergence among 16 puffer fish were from 3.41 to 31.78%. Different restriction patterns were found among 16 puffer fish with 10 restriction endonucleases, whereas no variation in patterns was detected among individuals within each species. The polymorphisms obtained by RFLP have provided a new set of genetic markers for the accurate identification of sibling puffer species. It is the first molecularly based study of puffer diversity and sheds light on the evolution and taxonomy of this major puffer fish family.

  9. Sequence preferences of DNA interstrand crosslinking agents: quantitation of interstrand crosslink locations in DNA duplex fragments containing multiple crosslinkable sites.

    PubMed Central

    Millard, J T; Weidner, M F; Kirchner, J J; Ribeiro, S; Hopkins, P B

    1991-01-01

    A general approach to the quantitative study of the sequence specificity of DNA interstrand crosslinking agents in synthetic duplex DNA fragments is described. In the first step, a DNA fragment previously treated with an interstrand crosslinking agent is subjected to denaturing PAGE. Not only does this distinguish crosslinked from native or monoadducted DNA, it is shown herein that isomeric crosslinked DNAs differing in position of the crosslink can in some cases be separated. In the second stage, the now fractionated crosslinked DNAs isolated from denaturing PAGE are subjected to fragmentation using iron(II)/EDTA. For those fractions which are structurally homogeneous, analysis of the resulting fragment distribution has previously been shown to reveal the crosslink position at nucleotide resolution. It is shown herein that in fractions which are structurally heterogeneous due to differences in position of crosslink, this analysis quantifies the relative extent of crosslinking at distinct sites. Using this method it is shown that reductively activated mitomycin C crosslinks the duplex sequences 5'-GCGC and 5'-TCGA with 3 +/- 1:1 relative efficiency. Images PMID:1903204

  10. In vivo assembly of DNA-fragments in the moss, Physcomitrella patens.

    PubMed

    King, Brian Christopher; Vavitsas, Konstantinos; Ikram, Nur Kusaira Binti Khairul; Schrøder, Josephine; Scharff, Lars B; Hamberger, Björn; Jensen, Poul Erik; Simonsen, Henrik Toft

    2016-04-29

    Direct assembly of multiple linear DNA fragments via homologous recombination, a phenomenon known as in vivo assembly or transformation associated recombination, is used in biotechnology to assemble DNA constructs ranging in size from a few kilobases to full synthetic microbial genomes. It has also enabled the complete replacement of eukaryotic chromosomes with heterologous DNA. The moss Physcomitrella patens, a non-vascular and spore producing land plant (Bryophyte), has a well-established capacity for homologous recombination. Here, we demonstrate the in vivo assembly of multiple DNA fragments in P. patens with three examples of effective genome editing: we (i) efficiently deleted a genomic locus for diterpenoid metabolism yielding a biosynthetic knockout, (ii) introduced a salt inducible promoter, and (iii) re-routed endogenous metabolism into the formation of amorphadiene, a precursor of high-value therapeutics. These proof-of-principle experiments pave the way for more complex and increasingly flexible approaches for large-scale metabolic engineering in plant biotechnology.

  11. Restricted diet delays accelerated ageing and genomic stress in DNA-repair-deficient mice.

    PubMed

    Vermeij, W P; Dollé, M E T; Reiling, E; Jaarsma, D; Payan-Gomez, C; Bombardieri, C R; Wu, H; Roks, A J M; Botter, S M; van der Eerden, B C; Youssef, S A; Kuiper, R V; Nagarajah, B; van Oostrom, C T; Brandt, R M C; Barnhoorn, S; Imholz, S; Pennings, J L A; de Bruin, A; Gyenis, Á; Pothof, J; Vijg, J; van Steeg, H; Hoeijmakers, J H J

    2016-09-15

    Mice deficient in the DNA excision-repair gene Ercc1 (Ercc1(∆/-)) show numerous accelerated ageing features that limit their lifespan to 4-6 months. They also exhibit a 'survival response', which suppresses growth and enhances cellular maintenance. Such a response resembles the anti-ageing response induced by dietary restriction (also known as caloric restriction). Here we report that a dietary restriction of 30% tripled the median and maximal remaining lifespans of these progeroid mice, strongly retarding numerous aspects of accelerated ageing. Mice undergoing dietary restriction retained 50% more neurons and maintained full motor function far beyond the lifespan of mice fed ad libitum. Other DNA-repair-deficient, progeroid Xpg(-/-) (also known as Ercc5(-/-)) mice, a model of Cockayne syndrome, responded similarly. The dietary restriction response in Ercc1(∆/-) mice closely resembled the effects of dietary restriction in wild-type animals. Notably, liver tissue from Ercc1(∆/-) mice fed ad libitum showed preferential extinction of the expression of long genes, a phenomenon we also observed in several tissues ageing normally. This is consistent with the accumulation of stochastic, transcription-blocking lesions that affect long genes more than short ones. Dietary restriction largely prevented this declining transcriptional output and reduced the number of γH2AX DNA damage foci, indicating that dietary restriction preserves genome function by alleviating DNA damage. Our findings establish the Ercc1(∆/-) mouse as a powerful model organism for health-sustaining interventions, reveal potential for reducing endogenous DNA damage, facilitate a better understanding of the molecular mechanism of dietary restriction and suggest a role for counterintuitive dietary-restriction-like therapy for human progeroid genome instability syndromes and possibly neurodegeneration in general.

  12. A large fragment approach to DNA synthesis: total synthesis of a gene for the protease inhibitor eglin c from the leech Hirudo medicinalis and its expression in E. coli.

    PubMed Central

    Rink, H; Liersch, M; Sieber, P; Meyer, F

    1984-01-01

    A DNA containing the coding sequence for the proteinase inhibitor protein, eglin c, from the leech Hirudo medicinalis has been obtained by enzymatic assembly of chemically synthesized DNA fragments. The synthetic gene consists of a 232 base-pair fragment containing initiation and termination codon signals with restriction enzyme recognition sites conveniently placed for cloning into a plasmid vector. Only six oligonucleotides from 34 to 61 bases in length, sharing pairwise stretches of complementary regions at their 3'-termini, were prepared by phosphotriester solid-phase synthesis. The oligomers were annealed pairwise and converted into double stranded DNA fragments by DNA polymerase I mediated repair synthesis. The fragments were assembled by ligation, and the synthetic gene was expressed in high yield in E. coli under the transcriptional control of the E. coli tryptophan promoter. The expression product was purified to homogeneity and was shown to have similar physicochemical and identical biological properties as the authentic protein isolated from the leech. Images PMID:6382168

  13. Helicobacter pylori DprA alleviates restriction barrier for incoming DNA

    PubMed Central

    Dwivedi, Gajendradhar R.; Sharma, Eshita; Rao, Desirazu N.

    2013-01-01

    Helicobacter pylori is a Gram-negative bacterium that colonizes human stomach and causes gastric inflammation. The species is naturally competent and displays remarkable diversity. The presence of a large number of restriction–modification (R–M) systems in this bacterium creates a barrier against natural transformation by foreign DNA. Yet, mechanisms that protect incoming double-stranded DNA (dsDNA) from restriction enzymes are not well understood. A DNA-binding protein, DNA Processing Protein A (DprA) has been shown to facilitate natural transformation of several Gram-positive and Gram-negative bacteria by protecting incoming single-stranded DNA (ssDNA) and promoting RecA loading on it. However, in this study, we report that H. pylori DprA (HpDprA) binds not only ssDNA but also dsDNA thereby conferring protection to both from various exonucleases and Type II restriction enzymes. Here, we observed a stimulatory role of HpDprA in DNA methylation through physical interaction with methyltransferases. Thus, HpDprA displayed dual functional interaction with H. pylori R–M systems by not only inhibiting the restriction enzymes but also stimulating methyltransferases. These results indicate that HpDprA could be one of the factors that modulate the R–M barrier during inter-strain natural transformation in H. pylori. PMID:23355610

  14. A Monte Carlo study of the radiation quality dependence of DNA fragmentation spectra.

    PubMed

    Alloni, D; Campa, A; Belli, M; Esposito, G; Facoetti, A; Friedland, W; Liotta, M; Mariotti, L; Paretzke, H G; Ottolenghi, A

    2010-03-01

    We simulated the irradiation of human fibroblasts with gamma rays, protons and helium, carbon and iron ions at a fixed dose of 5 Gy. The simulations were performed with the biophysical Monte Carlo code PARTRAC. From the output of the code, containing in particular the genomic positions of the radiation-induced DNA double-strand breaks (DSBs), we obtained the DNA fragmentation spectra. Very small fragments, in particular those related to "complex lesions" (few tens of base pairs), are probably very important for the late cellular consequences, but their detection is not possible with the common experimental techniques. We paid special attention to the differences among the various ions in the production of these very small fragments; in particular, we compared the fragmentation spectra for ions of the same specific energy and for ions of the same LET (linear energy transfer). As found previously for iron ions, we found that the RBE (relative biological effectiveness) for DSB production was considerably higher than 1 for all high-LET radiations considered. This is at variance with the results obtainable from experimental data, and it is due to the ability to count the contribution of small fragments. It should be noted that for a given LET this RBE decreases with increasing ion charge, due mainly to the increasing mean energy of secondary electrons. A precise quantification of the DNA initial damage can be of great importance for both radiation protection, particularly in open-space long-term manned missions, and hadrontherapy.

  15. A simple modification to the luminometric methylation assay to control for the effects of DNA fragmentation.

    PubMed

    Duman, Elif Aysimi; Kriaucionis, Skirmantas; Dunn, John J; Hatchwell, Eli

    2015-05-01

    Variations in DNA methylation have been implicated in a number of disorders. Changes in global DNA methylation levels have long been associated with various types of cancer. One of the recently described methods for determining global DNA methylation levels is the LUminometric Methylation Assay (LUMA), which utilizes methylation sensitive and insensitive restriction endonucleases and pyrosequencing technology for quantification. Here we provide evidence suggesting that the global methylation level reported by LUMA is affected by the integrity of the DNA being analyzed. The less intact the DNA, the lower the global methylation levels reported by LUMA. In order to overcome this problem, we propose the use of undigested DNA alongside digested samples. Finally, we demonstrate that this results in a more accurate assessment of global DNA methylation levels.

  16. Polymerase chain reaction-restriction fragment length polymorphism assays to distinguish Liriomyza huidobrensis (Diptera: Agromyzidae) from associated species on lettuce cropping systems in Italy.

    PubMed

    Masetti, Antonio; Luchetti, Andrea; Mantovani, Barbara; Burgio, Giovanni

    2006-08-01

    The pea leafminer, Liriomyza huidobrensis (Blanchard) (Diptera: Agromyzidae), is a serious insect pest infesting open field lettuce plantings in northern Italy. In these cropping systems, it coexists with several other agromyzid species that have negligible economic importance on open field vegetables. The rapid detection of L. huidobrensis is crucial for effective management strategies, but the identification of agromyzids to species can be very difficult at adult as well at immature stages. In this study, a polymerase chain reaction (PCR)-restriction fragment length polymorphism assay is proposed to separate L. huidobrensis from Liriomyza bryoniae (Kaltenbach), Liriomyza trifolii (Burgess), and Chromatomyia horticola (Goureau), which usually occur in the same lettuce plantings. An approximately 1,031-bp region of the mitochondrial genome encompassing the 3' region of cytochrome oxidase I, the whole leucine tRNA, and all of the cytochrome oxidase II was amplified by PCR and digested using the enzymes PvuII and SnaBI separately. Both endonucleases cut the amplicons of L. huidobrensis in two fragments, whereas the original band was not cleaved in the other analyzed species. The presence of Dacnusa spp. DNA does not bias the assay, because the PCR conditions and the primer set here described do not amplify any tract of this endoparasitic wasp genome.

  17. Sedimentation properties in density gradients correspond with levels of sperm DNA fragmentation, chromatin compaction and binding affinity to hyaluronic acid.

    PubMed

    Torabi, Forough; Binduraihem, Adel; Miller, David

    2017-03-01

    Mature spermatozoa bind hyaluronic acid in the extracellular matrix via hyaladherins. Immature spermatozoa may be unable to interact because they do not express the appropriate hyaladherins on their surface. Fresh human semen samples were fractionated using differential density gradient centrifugation (DDGC) and the ability of these fractions to bind hyaluronic acid was evaluated. The presence of sperm hyaladherins was also assessed. CD44 was located mainly on the acrosome and equatorial segment and became more restricted to the equatorial segment in capacitated spermatozoa. Hyaluronic acid-TRITC (hyaluronic acid conjugated with tetramethylrhodamine isothiocyanante), a generic hyaluronic-acid-binding reagent, labelled the membrane and the neck region, particularly after capacitation. Sperm populations obtained after DDGC or after interaction with hyaluronic acid were assessed for DNA fragmentation and chromatin maturity. Strong relationships between both measures and sperm sedimentation and hyaluronic-acid-binding profiles were revealed. Capacitation enhanced hyaluronic acid binding of both DDGC-pelleted sperm and sperm washed free of seminal fluid. In conclusion, hyaladherins were detected on human sperm and a higher capacity for sperm hyaluronic-acid-binding was shown to correspond with their DDGC sedimentation profiles and with lower levels of DNA fragmentation and better chromatin maturity. Capacitation induced changes in the distribution and presence of hyaladherins may enhance hyaluronic-acid-binding.

  18. Single nucleotide polymorphisms in chum salmon (Oncorhynchus keta) mitochondrial DNA derived from restriction site haplotype information.

    PubMed

    Garvin, M R; Saitoh, K; Churikov, D Y; Brykov, V A; Gharrett, A J

    2010-07-01

    Single nucleotide polymorphisms (SNPs) are useful genetic markers for the management and conservation of commercially important species such as salmon. Informative markers can be derived from data obtained for other purposes. We used restriction endonuclease data from earlier work to identify potentially useful restriction sites in chum salmon (Oncorhynchus keta). With the aid of a newly generated complete mitochondrial DNA sequence (accession number AP010773), we identified the SNP responsible for each restriction site variant, designed rapid genotyping assays, and surveyed the SNPs in more than 400 individuals. The restriction site analysis and the SNP genotyping assays were almost perfectly concordant. Some reasons for the non-concordance were identified and discussed.

  19. Genetic analysis of an aphid endosymbiont DNA fragment homologous to the rnpA-rpmH-dnaA-dnaN-gyrB region of eubacteria.

    PubMed

    Lai, C Y; Baumann, P

    1992-04-15

    Buchnera aphidicola is a Gram- eubacterium with a DNA G+C content of 28-30 mol%. This organism is an obligate intracellular symbiont of aphids. To determine its similarity to or difference from other eubacteria, a 4.9-kb DNA fragment from B. aphidicola containing the gene homologous to Escherichia coli dnaA (a gene involved in the initiation of chromosome replication) was cloned into E. coli and sequenced. The order of genes on this fragment, 60K-10K-rnpA-rpmH-dnaA-dnaN-gyrB, was similar to that found in other eubacteria. The sole difference was the absence of recF between dnaN and gyrB. The deduced amino acid sequence of these proteins resembled those of E. coli by a 41 to 83% identity. Except for E. coli, in all the eubacteria so far examined, dnaA is preceded by multiple 9-nucleotide repeats known as a DnaA boxes. No DnaA boxes were detected in the endosymbiont DNA. The possibility that this observation is a consequence of the low G+C content of this DNA fragment (14 mol% G+C) is unlikely since in Mycoplasma capricolum this fragment (19 mol% G+C) has eight DnaA boxes (Fujita et al., 1992). The presence of the sequence, GATC, recognized by the Dam methyl-transferase system, only within six regions coding for proteins suggests that methylation is not a factor in the regulation of the initiation of endosymbiont chromosome replication.

  20. Fragment-based discovery of DNA gyrase inhibitors targeting the ATPase subunit of GyrB.

    PubMed

    Mesleh, Michael F; Cross, Jason B; Zhang, Jing; Kahmann, Jan; Andersen, Ole A; Barker, John; Cheng, Robert K; Felicetti, Brunella; Wood, Michael; Hadfield, Andrea T; Scheich, Christoph; Moy, Terence I; Yang, Qingyi; Shotwell, Joseph; Nguyen, Kien; Lippa, Blaise; Dolle, Roland; Ryan, M Dominic

    2016-02-15

    Inhibitors of the ATPase function of bacterial DNA gyrase, located in the GyrB subunit and its related ParE subunit in topoisomerase IV, have demonstrated antibacterial activity. In this study we describe an NMR fragment-based screening effort targeting Staphylococcus aureus GyrB that identified several attractive and novel starting points with good ligand efficiency. Fragment hits were further characterized using NMR binding studies against full-length S. aureus GyrB and Escherichia coli ParE. X-ray co-crystal structures of select fragment hits confirmed binding and suggested a path for medicinal chemistry optimization. The identification, characterization, and elaboration of one of these fragment series to a 0.265 μM inhibitor is described herein.

  1. The distribution of serotype-specific plasmids among different subgroups of strains of Salmonella enterica serotype Enteritidis: characterization of molecular variants by restriction enzyme fragmentation patterns.

    PubMed Central

    Rankin, S. C.; Benson, C. E.; Platt, D. J.

    1995-01-01

    Four hundred and thirty-four isolates of Salmonella enterica serotype Enteritidis were studied. They were grouped into five subsets defined by either the collection criteria or the parameter which formed the basis for subsequent analysis. Seventy-seven per cent harboured the serotype-specific plasmid (SSP). In 55% of the isolates this was the sole plasmid. Molecular variation in the SSP was detected in 17 (5%) of the isolates on the basis of restriction enzyme fragmentation pattern (REFP) analysis using Pst I and Sma I. The SSP variants were further characterized using additional restriction enzymes chosen to optimize the information content and analysed using a coefficient of similarity. A variant SSP designated pOG690 showed greater resemblance to the SSP of Salmonella enterica serotype Typhimurium than Enteritidis; 89% and 68% respectively for Pst I and 79% and 55% respectively for Sma I. In respect of the Pst I data pOG690 shared at least 55 kb of DNA with the Typhimurium SSP and 37 kb with the SSP of Enteritidis. This variant was associated with poultry (duck, goose, chicken) and all isolates belonged to phage type 9b. Other variants were associated with phage types 4, 6, 6a, 9a, 11, 15 and 24. The epidemiological implications of these results are discussed. Images Fig. 1 PMID:7867741

  2. Chromosomal Localization and Restriction Fragment Length Polymorphism Analysis of Annexins III, IV, and V

    DTIC Science & Technology

    1990-08-01

    Huntington’s disease and cystic fibrosis have been localized by this type of linkage analysis (Gusella et al., 1983; Tsui et al., 1985; White et al...linked to Huntington’s disease . Nature 1983;306:234-238. Grundmann U, Amann E, Abel K-J, Kupper HA. Isolation and expression of cDNA coding for a new

  3. Exogenous DNA internalisation by sperm cells is improved by combining lipofection and restriction enzyme mediated integration.

    PubMed

    Churchil, R R; Gupta, J; Singh, A; Sharma, D

    2011-06-01

    1. Three types of exogenous DNA inserts, i.e. complete linearised pVIVO2-GFP/LacZ vector (9620 bp), the LacZ gene (5317 bp) and the GFP gene (2152 bp) were used to transfect chicken spermatozoa through simple incubation of sperm cells with insert. 2. PCR assay, Dot Blot hybridisation and Southern hybridisation showed the successful internalisation of exogenous DNA by chicken sperm cells. 3. Lipofection and Restriction Enzyme Mediated Integration (REMI) were used to improve the rate of internalisation of exogenous DNA by sperm cells. 4. Results from dot blot as well as Southern hybridisation were semi-quantified and improved exogenous DNA uptake by sperm cells through lipofection and REMI. Stronger signals were observed from hybridisation of LacZ as well as GFP specific probe with the DNA from lipofected exogenous DNA transfected sperm DNA in comparison with those transfected with nude exogenous DNA.

  4. Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments.

    PubMed

    Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias

    2013-09-24

    Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp.

  5. Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments

    PubMed Central

    Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias

    2013-01-01

    Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp. PMID:24019490

  6. Replication of origin containing adenovirus DNA fragments that do not carry the terminal protein.

    PubMed Central

    van Bergen, B G; van der Ley, P A; van Driel, W; van Mansfeld, A D; van der Vliet, P C

    1983-01-01

    Nuclear extracts from adenovirus type 5 (Ad5) infected HeLa cells were used to study the template requirements for adenovirus DNA replication in vitro. When XbaI digested Ad5 DNA, containing the parental terminal protein (TP), was used as a template preferential synthesis of the terminal fragments was observed. The newly synthesized DNA was covalently bound to the 82 kD preterminal protein (pTP). Plasmid DNAs containing the Ad2 origin sequence or the Ad12 origin sequence with small deletions were analyzed for their capacity to support pTP-primed DNA replication. Circular plasmid DNAs were inactive. When plasmids were linearized to expose the adenovirus origin, both Ad2 and Ad12 TP-free fragments could support initiation and elongation similarly as Ad5 DNA-TP, although with lower efficiency. These observations indicate that the parental terminal protein is dispensable for initiation in vitro. The presence of 29 nucleotides ahead of the molecular end or a deletion of 14 base pairs extending into the conserved sequence (9-22) destroyed the template activity. DNA with a large deletion within the first 8 base pairs could still support replication while a small deletion could not. The results suggest that only G residues at a distance of 4-8 nucleotides from the start of the conserved sequence can be used as template during initiation of DNA replication. Images PMID:6300787

  7. Giardia duodenalis in Damascus, Syria: Identification of Giardia genotypes in a sample of human fecal isolates using polymerase chain reaction and restriction fragment length polymorphism analyzing method.

    PubMed

    Skhal, Dania; Aboualchamat, Ghalia; Al Nahhas, Samar

    2016-02-01

    Giardia duodenalis is a common gastrointestinal parasite that infects humans and many other mammals. It is most prevalent in many developing and industrialized countries. G. duodenalis is considered to be a complex species. While no morphological distinction among different assemblages exist, it can be genetically differentiated into eight major assemblages: A to H. The aim of this study was to determine the genetic heterogeneity of G. duodenalis in human isolates (a study conducted for the first time in Syria). 40 fecal samples were collected from three different hospitals during the hot summer season of 2014. Extraction of genomic DNA from all Giardia positive samples (based on a microscopic examination) was performed using QIAamp DNA Stool Mini Kit. β-giardin gene was used to differentiate between different Giardia assemblages. The 514 bp fragment was amplified using the Polymerase Chain Reaction method, followed by digestion in HaeIII restriction enzyme. Our result showed that genotype A was more frequent than genotype B, 27/40 (67.5%); 4/40 (10%) respectively. A mixed genotype of A+B was only detected in 9 isolates (22.5%). This is the first molecular study performed on G. duodenalis isolates in Syria in order to discriminate among the different genotypes. Further expanded studies using more genes are needed to detect and identify the Giardia parasite at the level of assemblage and sub-assemblage.

  8. Analysis of the bacterial diversity existing on animal hide and wool: development of a preliminary PCR-restriction fragment length polymorphism fingerprint database for identifying isolates.

    PubMed

    Chen, Yu; Gao, Hongwei; Zhang, Yanming; Deng, Mingjun; Wu, Zhenxing; Zhu, Laihua; Duan, Qing; Xu, Biao; Liang, Chengzhu; Yue, Zhiqin; Xiao, Xizhi

    2012-01-01

    Twenty-one bacterial strains were isolated from imported cattle hide and rabbit wool using two types of media, nutrient broth, and nutrient broth with serum. The bacteria identified were Brevibacillus laterosporus, Leclercia adecarboxylata, Peptococcus niger, Bacillus circulans, Raoultella ornithinolytica, Bacillus subtilis, Bacillus cereus, Bacillus thermobacillus, Bacillus choshinensis, Bacillus sphaericus, Acinetobacter haemolyticus, Sphingomonas paucimobilis, Bacillus thuringiensis, Staphylococcus intermedius, Mycobacteria, Moraxella, Klebsiella pneumoniae, Ralstonia pickettii, Staphylococcus chromogenes, Comamonas testosteroni, and Cupriavidus pauculus. The 16s rDNA gene of each bacterium was amplified using the universal primers 27f and 1492r. The amplicons were digested with AvaI, BamHI, BgII, DraI, EcoRI, EcoRV, HindIII, HinfI, HpaI, PstI, SmaI, TaqII, XbaI, XmaI, AluI, XhoI, and PvuI individually. A specific fingerprint from the PCR-restriction fragment length polymorphism method based on 16s rDNA was obtained for each bacterium. The results showed that the method developed was useful not only for bacterial identification but also for the etiological investigation of pathogens in imported animal hair and wool.

  9. Sensitive PCR analysis of animal tissue samples for fragments of endogenous and transgenic plant DNA.

    PubMed

    Nemeth, Anne; Wurz, Andreas; Artim, Lori; Charlton, Stacy; Dana, Greg; Glenn, Kevin; Hunst, Penny; Jennings, James; Shilito, Ray; Song, Ping

    2004-10-06

    An optimized DNA extraction protocol for animal tissues coupled with sensitive PCR methods was used to determine whether trace levels of feed-derived DNA fragments, plant and/or transgenic, are detectable in animal tissue samples including dairy milk and samples of muscle (meat) from chickens, swine, and beef steers. Assays were developed to detect DNA fragments of both the high copy number chloroplast-encoded maize rubisco gene (rbcL) and single copy nuclear-encoded transgenic elements (p35S and a MON 810-specific gene fragment). The specificities of the two rbcL PCR assays and two transgenic DNA PCR assays were established by testing against a range of conventional plant species and genetically modified maize crops. The sensitivities of the two rbcL PCR assays (resulting in 173 and 500 bp amplicons) were similar, detecting as little as 0.08 and 0.02 genomic equivalents, respectively. The sensitivities of the p35S and MON 810 PCR assays were approximately 5 and 10 genomic equivalents for 123 bp and 149 bp amplicons, respectively, which were considerably less than the sensitivity of the rbcL assays in terms of plant cell equivalents, but approximately similar when the higher numbers of copies of the chloroplast genome per cell are taken into account. The 173 bp rbcL assay detected the target plant chloroplast DNA fragment in 5%, 15%, and 53% of the muscle samples from beef steers, broiler chickens, and swine, respectively, and in 86% of the milk samples from dairy cows. Reanalysis of new aliquots of 31 of the pork samples that were positive in the 173 bp rbcL PCR showed that 58% of these samples were reproducibly positive in this same PCR assay. The 500 bp rbcL assay detected DNA fragments in 43% of the swine muscle samples and 79% of the milk samples. By comparison, no statistically significant detections of transgenic DNA fragments by the p35S PCR assay occurred with any of these animal tissue samples.

  10. Modelization of DNA fragmentation induced in human fibroblasts by Fe-56 ions

    NASA Astrophysics Data System (ADS)

    Ballarini, F.; Belli, M.; Campa, A.; Esposito, G.; Friedland, W.; Ottolenghi, A.; Paretzke, H.

    DNA double-strand breaks DSB are widely recognized as cellular critical lesions in the pathways leading from initial energy deposition by radiation to the formation of relevant biological endpoints such as gene mutations chromosome aberrations and cell death Chromatin conformation and radiation track structure are expected to have a strong influence on the spatial modulation of DSB induction at the scale of the nucleosome i e 100 base pairs bp and of the low-level chromatin fiber organization i e 1 kbp At larger scales the DNA fragmentation pattern induced by sparsely ionizing radiation approaches a scenario resulting from a random distribution of DSB However the pattern induced by high-LET irradiation can lead to deviation from randomness also at these scales This feature can have important biological consequences since spatial correlation of DSB is thought to affect their reparability Therefore studies on fragment size distributions induced by radiations of various qualities can help to link the physical characteristics of radiation with the cellular endpoints This is an important issue for understanding the main mechanisms of cell damage induced by HZE particles In this work we have compared the pattern of DNA fragmentation in the range 1-5700 kbp induced in human fibroblasts by gamma -rays with that induced by high-energy Fe-ions which have biological significance for radiation protection issues during long term astronauts travels The study has taken into account the comparison of the experimental fragmentation spectra

  11. In vitro selection of bispecific diabody fragments using covalent bicistronic DNA display.

    PubMed

    Nakayama, Masanao; Komiya, Shoko; Fujiwara, Kei; Horisawa, Kenichi; Doi, Nobuhide

    2016-09-16

    Bispecific antibodies with two different antigen-binding sites have been widely used for a variety of medical applications. The activity and stability of antibody fragments can be improved by in vitro evolution. Although the affinity and stability of small bispecific antibody fragments such as diabodies can be further optimized by in vitro display technologies, cell-free display of bispecific antibody fragments has not been reported. In this study, we applied a covalent bicistronic DNA display for the in vitro selection of heterodimeric diabodies. First, we confirmed the antigen-binding activities of a diabody synthesized by an in vitro transcription and translation system. However, when we performed DNA-display selection of a model diabody library in a proof-of-principle experiment, no enrichment of the diabody gene was observed, likely due to a low yield of the diabody heterodimer. To overcome this issue, we introduced cysteine residues at the VH-VL interface of the diabody heterodimer. Using the disulfide-stabilized diabodies, we successfully enriched the diabody gene from a model library. Our results indicate that the covalent bicistronic DNA display technique could be useful for improving the stability and affinity of bispecific diabody fragments.

  12. Two methods that facilitate autoradiography of small /sup 32/P-labeled DNA fragments following electrophoresis in agarose gels

    SciTech Connect

    Cockerill, P.N.

    1988-02-01

    Two methods which permit detection by autoradiography of small /sup 32/P-labeled DNA fragments resolved by agarose gel electrophoresis are described. Agarose gel electrophoresis poses problems for autoradiography as (i) the gels are normally too thick to allow autoradiography without being dried first, and (ii) fragments of DNA of 1000 bp or less in length are readily lost during drying. In this study DNA fragments as small as 121 bp have been retained in agarose gels upon drying. This has been achieved by either (i) first fixing the DNA with the cationic detergent cetyltrimethylammonium bromide, or (ii) drying the agarose gels onto Zeta-Probe charge-modified membranes.

  13. Development of a Multiplexed Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Assay to Identify Common Members of the Subgenera Culex (Culex) and Culex (Phenacomyia) in Guatemala

    PubMed Central

    Kent, Rebekah J.; Deus, Stephen; Williams, Martin; Savage, Harry M.

    2010-01-01

    Morphological differentiation of mosquitoes in the subgenera Culex (Culex) and Culex (Phenacomyia) in Guatemala is difficult, with reliable identification ensured only through examination of larval skins from individually reared specimens and associated male genitalia. We developed a multiplexed polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay to identify common Cx. (Cux.) and Cx. (Phc.). Culex (Cux.) chidesteri, Cx. (Cux.) coronator, Cx. (Cux.) interrogator, Cx. (Cux.) quinquefasciatus, Cx. (Cux.) nigripalpus/Cx. (Cux.) thriambus, and Cx. (Phc.) lactator were identified directly with a multiplexed primer cocktail comprising a conserved forward primer and specific reverse primers targeting ribosomal DNA (rDNA). Culex nigripalpus and Cx. thriambus were differentiated by restriction digest of homologous amplicons. The assay was developed and optimized using well-characterized specimens from Guatemala and the United States and field tested with unknown material from Guatemala. This assay will be a valuable tool for mosquito identification in entomological and arbovirus ecology studies in Guatemala. PMID:20682869

  14. Highlights of the DNA cutters: a short history of the restriction enzymes.

    PubMed

    Loenen, Wil A M; Dryden, David T F; Raleigh, Elisabeth A; Wilson, Geoffrey G; Murray, Noreen E

    2014-01-01

    In the early 1950's, 'host-controlled variation in bacterial viruses' was reported as a non-hereditary phenomenon: one cycle of viral growth on certain bacterial hosts affected the ability of progeny virus to grow on other hosts by either restricting or enlarging their host range. Unlike mutation, this change was reversible, and one cycle of growth in the previous host returned the virus to its original form. These simple observations heralded the discovery of the endonuclease and methyltransferase activities of what are now termed Type I, II, III and IV DNA restriction-modification systems. The Type II restriction enzymes (e.g. EcoRI) gave rise to recombinant DNA technology that has transformed molecular biology and medicine. This review traces the discovery of restriction enzymes and their continuing impact on molecular biology and medicine.

  15. Highlights of the DNA cutters: a short history of the restriction enzymes

    PubMed Central

    Loenen, Wil A. M.; Dryden, David T. F.; Raleigh, Elisabeth A.; Wilson, Geoffrey G.; Murray, Noreen E.

    2014-01-01

    In the early 1950’s, ‘host-controlled variation in bacterial viruses’ was reported as a non-hereditary phenomenon: one cycle of viral growth on certain bacterial hosts affected the ability of progeny virus to grow on other hosts by either restricting or enlarging their host range. Unlike mutation, this change was reversible, and one cycle of growth in the previous host returned the virus to its original form. These simple observations heralded the discovery of the endonuclease and methyltransferase activities of what are now termed Type I, II, III and IV DNA restriction-modification systems. The Type II restriction enzymes (e.g. EcoRI) gave rise to recombinant DNA technology that has transformed molecular biology and medicine. This review traces the discovery of restriction enzymes and their continuing impact on molecular biology and medicine. PMID:24141096

  16. Separation of DNA fragments for fast diagnosis by microchip electrophoresis using programmed field strength gradient.

    PubMed

    Kang, Seong Ho; Park, Mira; Cho, Keunchang

    2005-08-01

    We evaluated a novel strategy for fast diagnosis by microchip electrophoresis (ME), using programmed field strength gradients (PFSG) in a conventional glass double-T microfluidic chip. The ME-PFSG allows for the ultrafast separation and enhanced resolving power for target DNA fragments. These results are based on electric field strength gradients (FSG) that use an ME separation step in a sieving gel matrix poly-(ethylene oxide). The gradient can develop staircase or programmed shapes FSG over the time. The PFSG method could be easily used to increase separation efficiency and resolution in ME separation of specific size DNA fragments. Compared to ME that uses a conventional and constantly applied electric field (isoelectrostatic) method, the ME-PFSG achieved about 15-fold faster analysis time during the separation of 100 bp DNA ladder. The ME-PFSG was also applied to the fast analysis of the PCR products, 591 and 1191 bp DNA fragments from the 18S rRNA of Babesia gibsoni and Babesia caballi.

  17. Identification of the Bacterial Community of Maple Sap by Using Amplified Ribosomal DNA (rDNA) Restriction Analysis and rDNA Sequencing

    PubMed Central

    Lagacé, L.; Pitre, M.; Jacques, M.; Roy, D.

    2004-01-01

    The bacterial community of maple sap was characterized by analysis of samples obtained at the taphole of maple trees for the 2001 and 2002 seasons. Among the 190 bacterial isolates, 32 groups were formed according to the similarity of the banding patterns obtained by amplified ribosomal DNA restriction analysis (ARDRA). A subset of representative isolates for each ARDRA group was identified by 16S rRNA gene fragment sequencing. Results showed a wide variety of organisms, with 22 different genera encountered. Pseudomonas and Ralstonia, of the γ- and β-Proteobacteria, respectively, were the most frequently encountered genera. Gram-positive bacteria were also observed, and Staphylococcus, Plantibacter, and Bacillus were the most highly represented genera. The sampling period corresponding to 50% of the cumulative sap flow percentage presented the greatest bacterial diversity according to its Shannon diversity index value (1.1). γ-Proteobacteria were found to be dominant almost from the beginning of the season to the end. These results are providing interesting insights on maple sap microflora that will be useful for further investigation related to microbial contamination and quality of maple products and also for guiding new strategies on taphole contamination control. PMID:15066796

  18. Identification of Mycobacterium avium Genotypes with Distinctive Traits by Combination of IS1245-Based Restriction Fragment Length Polymorphism and Restriction Analysis of hsp65

    PubMed Central

    Oliveira, R. S.; Sircili, M. P.; Oliveira, E. M. D.; Balian, S. C.; Ferreira-Neto, J. S.; Leão, S. C.

    2003-01-01

    One-hundred eight Mycobacterium avium isolates from pigs, humans, birds, and bovines were typed by the IS1245-based restriction fragment length polymorphism (RFLP) method and PCR-restriction enzyme analysis (PRA) of hsp65. Nine clusters of isolates showing more than 80% similarity in their RFLP profiles were detected. The largest cluster (cluster B) included 32 of 79 pig isolates (40.5%), 3 of 25 human isolates (12%), and 1 of 2 bovine isolates, comprising 33% of all isolates. The second largest cluster (cluster A) included 18 pig isolates (22.8%) and 6 human isolates (24%). Six smaller clusters included six pig isolates (clusters C and D), four and two human isolates (clusters E and F, respectively), two pig isolates (cluster I), and two pig isolates plus one bovine isolate and the avian purified protein derivative strain (cluster H). Cluster G represented the “bird-type” profile and included the bird isolate in this series, one pig isolate, plus reference strain R13. PRA revealed four allelic variants. Seventy-seven isolates were identified as M. avium PRA variant I, 24 were identified as M. avium PRA variant II, 6 were identified as M. avium PRA variant III, and 1 was identified as M. avium PRA variant IV. Except for three isolates from cluster B, each of the RFLP clusters was associated with a single PRA pattern. Isolates with unique (nonclustered) RFLP profiles were distributed between PRA variants I and II, and there was one unique isolate of PRA variant IV. These observations are consistent with divergent evolution within M. avium, resulting in the emergence of distinct lineages with particular competence to infect animals and humans. PMID:12517823

  19. Analysis of DNA fragmentation in mouse embryos exposed to an extremely low-frequency electromagnetic field.

    PubMed

    Borhani, Nasim; Rajaei, Farzad; Salehi, Zivar; Javadi, Amir

    2011-12-01

    Effects of extremely low-frequency electromagnetic fields (ELF-EMFs) on DNA damage in biological systems are still a matter of dispute. The aim of the present study was to investigate the possible effect of electromagnetic field exposure on DNA fragmentation in cells (blastomers) of mouse blastocysts. Eighty female NMRI mice were randomly divided into 2 groups of 40 animals each. The control group was left unexposed whereas the animals in the EMF-group were exposed to a 50-Hz EMF at 0.5 mT 4 h per day, 6 days a week for a duration of 2 weeks. After the 8(th) day of exposure, the female mice in both groups were superovulated (with injections of pregnant mare serum gonadotropin and human chorionic gonadotropin) and then mated overnight. At approximately 4 days after mating (102 h after the human chorionic gonadotropin treatment), blastocysts were obtained by flushing the uterus horns. The mean numbers of pregnant mice, blastocysts after flushing, blastomers within the blastocysts, and the DNA fragmentation index following staining in both groups were compared using statistical methods (SPSS, the Chi-square test, the Student's t-test and the Mann-Whitney U-test, P < 0.05). The results showed that the mean number of blastocysts after flushing was significantly decreased in the EMF-group compared to that of the control group (P < 0.03). The DNA fragmentation index was significantly increased in the EMF-group compared to control (10.53% vs. 7.14%; P < 0.001). However, there was no significant difference in the mean numbers of blastomers and numbers of pregnant mice between the EMF-exposed and control group. Our findings indicate that the EMF exposure in preimplantation stage could have detrimental effects on female mouse fertility and embryo development by decreasing the number of blastocysts and increasing the blastocysts DNA fragmentation.

  20. Size-selective separation and overall-amplification of cell-free fetal DNA fragments using PCR-based enrichment

    PubMed Central

    Yang, Qiwei; Du, Zhenwu; Song, Yang; Gao, Sujie; Yu, Shan; Zhu, He; Ren, Ming; Zhang, Guizhen

    2017-01-01

    This study aimed to establish a method for the selective amplification of cell-free fetal DNA (cffDNA) in maternal plasma and preserve the integrity of DNA fragments during amplification, thereby providing a sufficient amount of cffDNA to meet the requirement of routine non-invasive prenatal testing. We amplified DNA molecules in a one-reaction system without considering their particular sequences and lengths (overall amplification) by using PCR-based enrichment. We then modified PCR conditions to verify the effect of denaturation temperature on DNA amplification on various lengths of DNA (selective overall amplification). Finally, we used an optimum temperature range to amplify cffDNA selectively. Amplification results were validated by electrophoresis and real-time quantitative PCR. Our PCR-based enrichment efficiently amplified all DNA fragments with differing lengths within a single reaction system, as well as preserving the integrity of the DNA fragments. cffDNA was significantly amplified along with the selective amplification of small fragment maternal plasma DNA in an appropriate range of denaturation temperatures. We have established a PCR-based method for the simultaneous enrichment and amplification of cffDNA in order to meet the requirements of high cffDNA quantity for routine non-invasive prenatal testing. PMID:28102322

  1. Size-selective separation and overall-amplification of cell-free fetal DNA fragments using PCR-based enrichment.

    PubMed

    Yang, Qiwei; Du, Zhenwu; Song, Yang; Gao, Sujie; Yu, Shan; Zhu, He; Ren, Ming; Zhang, Guizhen

    2017-01-19

    This study aimed to establish a method for the selective amplification of cell-free fetal DNA (cffDNA) in maternal plasma and preserve the integrity of DNA fragments during amplification, thereby providing a sufficient amount of cffDNA to meet the requirement of routine non-invasive prenatal testing. We amplified DNA molecules in a one-reaction system without considering their particular sequences and lengths (overall amplification) by using PCR-based enrichment. We then modified PCR conditions to verify the effect of denaturation temperature on DNA amplification on various lengths of DNA (selective overall amplification). Finally, we used an optimum temperature range to amplify cffDNA selectively. Amplification results were validated by electrophoresis and real-time quantitative PCR. Our PCR-based enrichment efficiently amplified all DNA fragments with differing lengths within a single reaction system, as well as preserving the integrity of the DNA fragments. cffDNA was significantly amplified along with the selective amplification of small fragment maternal plasma DNA in an appropriate range of denaturation temperatures. We have established a PCR-based method for the simultaneous enrichment and amplification of cffDNA in order to meet the requirements of high cffDNA quantity for routine non-invasive prenatal testing.

  2. Polyphosphate present in DNA preparations from fungal species of Collectotrichum inhibits restriction endonucleases and other enzymes

    USGS Publications Warehouse

    Rodriguez, R.J.

    1993-01-01

    During the development of a procedure for the isolation of total genomic DNA from filamentous fungi (Rodriguez, R. J., and Yoder, 0. C., Exp. Mycol. 15, 232-242, 1991) a cell fraction was isolated which inhibited the digestion of DNA by restriction enzymes. After elimination of DNA, RNA, proteins, and lipids, the active compound was purified by gel filtration to yield a single fraction capable of complete inhibition of restriction enzyme activity. The inhibitor did not absorb uv light above 220 nm, and was resistant to alkali and acid at 25°C and to temperatures as high as 100°C. More extensive analyses demonstrated that the inhibitor was also capable of inhibiting T4 DNA ligase and TaqI DNA polymerase, but not DNase or RNase. Chemical analyses indicated that the inhibitor was devoid of carbohydrates, proteins, lipids, and nucleic acids but rich in phosphorus. A combination of nuclear magnetic resonance, metachromatic shift of toluidine blue, and gel filtration indicated that the inhibitor was a polyphosphate (polyP) containing approximately 60 phosphate molecules. The mechanism of inhibition appeared to involve complexing of polyP to the enzymatic proteins. All species of Colletotrichum analyzed produced polyP equivalent in chain length and concentration. A modification to the original DNA extraction procedure is described which eliminates polyP and reduces the time necessary to obtain DNA of sufficient purity for restriction enzyme digestion and TaqI polymerase amplification.

  3. Chromosomal assignment of human genomic NotI restriction fragments in a two-dimensional electrophoresis profile

    SciTech Connect

    Yoshikawa, Hirohide; Nagai, Hisaki; Matsubara, Kenichi

    1996-01-01

    Using DNA from sorted human chromosomes and two-dimensional gel electrophoresis, we assigned 2295 NotI sites, 43% of the total, to specific chromosomes and designated the procedure CA-RLGS (chromosome-assigned restriction landmark genomic scanning). Although the NotI enzyme is sensitive to DNA methylation, our results suggested that the majority of the spots did not seem to be affected by this modification. The NotI sites were distributed at higher levels in chromosomes 17, 19, and 22, suggesting higher gene content in these chromosomes. Most spots were assigned to unique chromosomes, but some spots were found on two or more chromosomes. Quantitative analysis revealed the intensity of the DNA spots on the sex chromosomes to be haploid and that of the chromosome 21 spots in DNA from a male with Down syndrome to be trisomic, although there were exceptions. We report here the first-generation CA-RLGS map of the human genome. 23 refs., 4 figs.

  4. Globin gene-associated restriction-fragment-length polymorphisms in southern African peoples.

    PubMed Central

    Ramsay, M; Jenkins, T

    1987-01-01

    The combination of polymorphic restriction-enzyme sites in the 3' region of the beta-globin gene cluster shows very little variation in southern-African Bantu-speaking black and Kalahari !Kung San populations. The sites of the 5' region, on the other hand, show marked variation, and two common haplotypes are present--the "Negro" type (- - - - +) and the "San" type (- + - - +)--in frequencies of .404 and .106, respectively, in the Bantu-speakers and .262 and .405, respectively, in the San. Twenty of 23 beta s-associated haplotypes in southern-African Bantu-speaking black subjects were the same as that found commonly in the Central African Republic (CAR)--i.e., the "Bantu" type--a finding providing the first convincing biological evidence for the common ancestry of geographically widely separated speakers of languages belonging to the Bantu family. The (-alpha) haplotype has a frequency of .21 in the Venda, .07 in both the Sotho-Tswana and the Nguni, and .06 among the !Kung San. These data are interpreted in the light of Plasmodium falciparum malaria selection and population movements in the African subcontinent. PMID:2891298

  5. Selective propagation of functional mitochondrial DNA during oogenesis restricts the transmission of a deleterious mitochondrial variant.

    PubMed

    Hill, Jahda H; Chen, Zhe; Xu, Hong

    2014-04-01

    Although mitochondrial DNA (mtDNA) is prone to mutation and few mtDNA repair mechanisms exist, crippling mitochondrial mutations are exceedingly rare. Recent studies have demonstrated strong purifying selection in the mouse female germline. However, the mechanisms underlying positive selection of healthy mitochondria remain to be elucidated. We visualized mtDNA replication during Drosophila melanogaster oogenesis, finding that mtDNA replication commenced before oocyte determination during the late germarium stage and was dependent on mitochondrial fitness. We isolated a temperature-sensitive lethal mtDNA allele, mt:CoI(T300I), which resulted in reduced mtDNA replication in the germarium at the restrictive temperature. Additionally, the frequency of the mt:CoI(T300I) allele in heteroplasmic flies was decreased, both during oogenesis and over multiple generations, at the restrictive temperature. Furthermore, we determined that selection against mt:CoI(T300I) overlaps with the timing of selective replication of mtDNA in the germarium. These findings establish a previously uncharacterized developmental mechanism for the selective amplification of wild-type mtDNA, which may be evolutionarily conserved to limit the transmission of deleterious mutations.

  6. Genetic divergence between Mexican Opuntia accessions inferred by polymerase chain reaction-restriction fragment length polymorphism analysis.

    PubMed

    Samah, S; Valadez-Moctezuma, E; Peláez-Luna, K S; Morales-Manzano, S; Meza-Carrera, P; Cid-Contreras, R C

    2016-06-03

    Molecular methods are powerful tools in characterizing and determining relationships between plants. The aim of this study was to study genetic divergence between 103 accessions of Mexican Opuntia. To accomplish this, polymerase chain reaction (PCR)-restriction fragment length polymorphism analysis of three chloroplast intergenic spacers (atpB-rbcL, trnL-trnF, and psbA-trnH), one chloroplast gene (ycf1), two nuclear genes (ppc and PhyC), and one mitochondrial gene (cox3) was conducted. The amplified products from all the samples had very similar molecular sizes, and there were only very small differences between the undigested PCR amplicons for all regions, with the exception of ppc. We obtained 5850 bp from the seven regions, and 136 fragments were detected with eight enzymes, 37 of which (27.2%) were polymorphic. We found that 40% of the fragments from the chloroplast regions were polymorphic, 9.8% of the bands detected in the nuclear genes were polymorphic, and 20% of the bands in the mitochondrial locus were polymorphic. trnL-trnF and psbA-trnH were the most variable regions. The Nei and Li/Dice distance was very short, and ranged from 0 to 0.12; indeed, 77 of the 103 genotypes had the same genetic profile. All the xoconostle accessions (acidic fruits) were grouped together without being separated from three genotypes of prickly pear (sweet fruits). We assume that the genetic divergence between prickly pears and xoconostles is very low, and question the number of Opuntia species currently considered in Mexico.

  7. Comparative typing of Pseudomonas aeruginosa by random amplification of polymorphic DNA or pulsed-field gel electrophoresis of DNA macrorestriction fragments.

    PubMed Central

    Renders, N; Römling, Y; Verbrugh, H; van Belkum, A

    1996-01-01

    Eighty-seven strains of Pseudomonas aeruginosa were typed by random amplification of polymorphic DNA (RAPD) and pulsed-field gel electrophoresis (PFGE) of macrorestriction fragments. Stains were clustered on the basis of interpretative criteria as presented previously for the PFGE analysis. Clusters of strains were also defined on the basis of epidemiological data and subsequently reanalyzed by RAPD. It was found that in an RAPD assay employing the enterobacterial repetitive intergenic consensus sequence ERIC2 as a primer, single band differences can be ignored; in this case, clonally related strains could be grouped as effectively and reliably as with PFGE. These data could be corroborated by the use of other primer species. However, some primers either showed reduced resolution or, in contrast, identified DNA polymorphisms beyond epidemiologically and PFGE-defined limits. Apparently, different primers define different windows of genetic variation. It is suggested that criteria for interpretation of the ERIC2 PCR fingerprints can be simple and straightforward: when single band differences are ignored, RAPD-determined grouping of P. aeruginosa is congruent with that obtained by PFGE. Consequently, this implies that RAPD can be used with trust as a first screen in epidemiological characterization of P. aeruginosa. The ability to measure the rate of molecular evolution of the P. aeruginosa genome clearly depends on the choice of restriction enzyme or primer when RAPD or PFGE, respectively, is applied for the detection of DNA polymorphisms. PMID:8940470

  8. An efficient algorithm for DNA fragment assembly in MapReduce.

    PubMed

    Xu, Baomin; Gao, Jin; Li, Chunyan

    2012-09-28

    Fragment assembly is one of the most important problems of sequence assembly. Algorithms for DNA fragment assembly using de Bruijn graph have been widely used. These algorithms require a large amount of memory and running time to build the de Bruijn graph. Another drawback of the conventional de Bruijn approach is the loss of information. To overcome these shortcomings, this paper proposes a parallel strategy to construct de Bruijin graph. Its main characteristic is to avoid the division of de Bruijin graph. A novel fragment assembly algorithm based on our parallel strategy is implemented in the MapReduce framework. The experimental results show that the parallel strategy can effectively improve the computational efficiency and remove the memory limitations of the assembly algorithm based on Euler superpath. This paper provides a useful attempt to the assembly of large-scale genome sequence using Cloud Computing.

  9. Practical identification of human originated Lactobacillus species by amplified ribosomal DNA restriction analysis (ARDRA) for probiotic use.

    PubMed

    Öztürk, Mehmet; Meterelliyöz, Merve

    2015-08-01

    Probiotics are gaining popularity and increasing the importance of their accurate speciation. Lactobacillus species are commonly used as probiotic strains mostly of clinical importance. Present knowledge indicates that at least 14 Lactobacillus species are associated with the human intestinal tract. Currently, researchers are interested in developing efficient techniques for screening and selecting probiotics bacteria, but unfortunately most of these methods are time-consuming, labor-intensive and costly. The aim of this study is to develop reliable, rapid and accurate method to identify 14 references Lactobacillus species that could have been found in the human alimentary tract by 16S ribosomal DNA restriction analysis. In this study, to develop an effective method for the genotype-based identification of the reference Lactobacillus species, 1.5 kb of 16S rRNA nucleotide sequences of 14 Lactobacillus were collected from the Gene Bank aligned, in silico restricted and analyzed in respect to their 16S-rRNA restriction fragment polymorphism. In silico restriction profiles of 16S-rRNA indicated that FspBI, HinfI and DraI restriction enzymes (RE) are convenient for differentiation of 14 Lactobacillus species in human intestinal tract except Lb. casei and Lb. paracasei. The patterns of our experimental findings obtained from 16S PCR-ARDRA completely confirmed our in silico patterns. The present work demonstrated that 16S PCR-ARDRA method with FspBI, HinfI and DraI RE is a rapid, accurate and reliable method for the identification of Lactobacillus species from human alimentary tract, especially during the identification of large numbers of isolates and any laboratory equipped with a thermo cycler for probiotic use.

  10. Three dimensional imaging of DNA fragments during electrophoresis using a confocal detector

    SciTech Connect

    Brewer, L.R.; Davidson, C.; Balch, J.; Carrano, A.

    1995-01-30

    We have measured the three dimensional distribution of DNA fragments within an electrophoretic band. The measurements were made using a confocal microscope and a photon counting photomultiplier detector. A DNA sequencing standard was loaded into glass microchannel plates containing polyacrylamide gel. The measurements were made by scanning the plates in three dimensions using a mechanical stage under computer control, while electrophoresis was taking place. We found that the distribution of DNA was the same for all the bands measured in the sequencing ladder with an approximate Gaussian distribution along all three axes. These measurements are important to understand what physical forces shape electrophoretic bands confined by a channel and also to aid in the design of high throughput DNA sequencers.

  11. DNA fragmentation induced by Fe ions in human cells: shielding influence on spatially correlated damage

    NASA Technical Reports Server (NTRS)

    Antonelli, F.; Belli, M.; Campa, A.; Chatterjee, A.; Dini, V.; Esposito, G.; Rydberg, B.; Simone, G.; Tabocchini, M. A.

    2004-01-01

    Outside the magnetic field of the Earth, high energy heavy ions constitute a relevant part of the biologically significant dose to astronauts during the very long travels through space. The typical pattern of energy deposition in the matter by heavy ions on the microscopic scale is believed to produce spatially correlated damage in the DNA which is critical for radiobiological effects. We have investigated the influence of a lucite shielding on the initial production of very small DNA fragments in human fibroblasts irradiated with 1 GeV/u iron (Fe) ions. We also used gamma rays as reference radiation. Our results show: (1) a lower effect per incident ion when the shielding is used; (2) an higher DNA Double Strand Breaks (DSB) induction by Fe ions than by gamma rays in the size range 1-23 kbp; (3) a non-random DNA DSB induction by Fe ions. c2004 COSPAR. Published by Elsevier Ltd. All rights reserved.

  12. Distribution of mitochondrial DNA fragments in the nuclear genome of the honeybee.

    PubMed

    Du, W X; Qin, Y C

    2015-10-27

    Nuclear mitochondrial pseudogenes (numts), which originated from mitochondrial DNA (mtDNA) insertions in the nuclear genome, have been detected in many species. The distribution of numts in the honeybee nuclear genome has not yet been fully reported. By referring to the whole honeybee mtDNA sequence and to the recent version of the honeybee nuclear genome, 236 reference sequences were identified by BLAST, with 90 unmapped. The size of the numts ranged from 219 to 3788 bp, and the homologous identity between numts and their corresponding mtDNA fragments varied from 71 to 93%. Furthermore, identified honeybee numts covered nearly all mitochondrial genes and were distributed over all chromosomes. This study provides useful information for further research related to mitochondrial genes and the evolution of the honeybee.

  13. Efficacy of DNA vaccines expressing the type F botulinum toxin Hc fragment using different promoters.

    PubMed

    Jathoul, Amit P; Holley, Jane L; Garmory, Helen S

    2004-09-28

    DNA vaccines which expressed the Hc fragment of the Clostridium botulinum type F neurotoxin (BoNT/F Hc) fused to a signal peptide downstream of four different eukaryotic promoters were prepared. Subsequently, the immunogenicity of the DNA vaccines and protection afforded in mice against challenge with 10(4) MLD of type F botulinum toxin was evaluated. The DNA vaccine containing the human ubiquitin gene (UbC) promoter induced the highest BoNT/F Hc-specific antibody concentration following two intramuscular immunisations and afforded 90% protection against challenge. The results from this study indicate that the selection of promoter used in DNA vaccination studies may be of importance in designing optimised vaccines.

  14. DNA fragmentation induced by fe ions in human cells: shielding influence on spatially correlated damage

    SciTech Connect

    Antonelli, F.; Belli, M.; Campa, A.; Chatterjee, A.; Dini, V.; Esposito, G.; Rydberg, B.; Simone, G.; Tabocchini, M.A.

    2003-11-19

    Outside the magnetic field of the Earth, high energy heavy ions constitute a relevant part of the biologically significant dose to astronauts during the very long travels through space. The typical pattern of energy deposition in the matter by heavy ions on the microscopic scale is believed to produce spatially correlated damage in the DNA which is critical for radiobiological effects. We have investigated the influence of a lucite shielding on the initial production of very small DNA fragments in human fibroblasts irradiated with 1 GeV/u iron (Fe) ions. We also used small gamma, Greek-rays as reference radiation. Our results show: (1) a lower effect per incident ion when the shielding is used; (2) an higher DNA Double Strand Breaks (DSB) induction by Fe ions than by small gamma, Greek-rays in the size range 123 kbp; (3) a non-random DNA DSB induction by Fe ions.

  15. Preliminary characterization of microbial communities in high altitude wetlands of northwestern Argentina by determining terminal restriction fragment length polymorphisms.

    PubMed

    Ferrero, Marcela; Farías, María E; Siñeriz, Faustino

    2004-01-01

    Laguna de Pozuelos is an extensive wetland in Morthwestern Argentina at 3,600 m above sea level in the Argentinean Andes. The principal lake, placed in the central depression of endorheic basin, is rich in minerals like Cu, As, Fe, etc. It collects water from underground courses and from two main tributaries, namely Santa Catalina River to the north and Cincel River to the south. Following the dry and rainy seasons, the surface of the lake is subject to an annual contraction-expansion cycle, with increasing of salinity during evaporation period. Prokaryotes inhabitants these particular environments have been not described and a few of such places have been surveyed for microbial diversity studies. To systematically explore the underlying communities of Bacteria from the water lake of Laguna de Pozuelos wetland and Cincel River, bacterial 16S rRNA genes (rDNAs) were PCR amplified and analyzed by terminal restriction fragment length polymorphism (T-RFLP) analysis. Analysis of the microbial community with T-RFLP identified a minimum of 19 operational taxonomic units (OTU). T-RF patterns derived from multiple-enzyme digestion with RsaI, HaeIII and HhaI were analyzed in order to provide a preliminary picture of the relative diversity of this complex microbial community. By the combined use of the three restriction endonucleases bacterial populations of this particular place were identified.

  16. Genetic diversity among elite Sorghum lines revealed by restriction fragment length polymorphisms and random amplified polymorphic DNAs.

    PubMed

    Vierling, R A; Xiang, Z; Joshi, C P; Gilbert, M L; Nguyen, H T

    1994-02-01

    The genetic diversity of sorghum, as compared to corn, is less well characterized at the genetic and molecular levels despite its worldwide economic importance. The objectives of this study were to: (1) investigate genetic diversity for restriction fragment length polymorphism (RFLPs) and random amplified polymorphic DNAs (RAPDs) in elite sorghum lines, (2) compare similarities based on molecular markers with pedigree relationships, and (3) examine the potential of RFLPs and RAPDs for assigning sorghum lines to the A/B (sterile) and R (restorer) groups. Using four restriction enzymes, polymorphism was detected with 61% of the RFLP probes used, compared to 77% of the random primers. One hundred and sixteen (64%) probe-enzyme combinations yielded multiple-band profiles compared to 98% of the random primers. RFLP profiles generated 290 polymorphic bands compared to 177 polymorphic RAPDs. Pair-wise comparisons of polymorphic RFLPs and RAPDs were used to calculate Nei and Jaccard coefficients. These were employed to generate phenograms using UPGMA and neighborjoining clustering methods. Analysis of RFLP data with Jaccard's coefficient and neighbor-joining clustering produced the phenogram with the closest topology to the known pedigree.

  17. Synthesis, integration, and restriction and modification of mycoplasma virus L2 DNA

    SciTech Connect

    Dybvig, K.

    1981-01-01

    Mycoplasma virus L2 is an enveloped, nonlytic virus containing double-stranded, superhelical DNA. The L2 virion contains about 7 to 8 major proteins identified by SDS-polyacrylamide gel electrophoresis, but the virion has no discernible capsid structure. It has been suggested that the L2 virion is a DNA-protein condensation surrounded by a lipid-protein membrane. The host for mycoplasma virus L2 is Acholeplasma laidlawii. A. laidlawii has no cell wall and contains a small genome, 1 x 10/sup 9/ daltons, which is two to three times smaller than that of most bacteria. Infection of A. laidlawii by L2 is nonlytic. The studies in this thesis show that L2 DNA synthesis begins at about 1 hour of infection and lasts throughout the infection. Viral DNA synthesis is inhibited by chloramphenicol, streptomycin, and novobiocin. Packaging of L2 DNA into progeny virus is also inhibited by chloramphenicol and novobiocin. It is concluded that protein synthesis and probably DNA gyrase activity are required for L2 DNA synthesis, and for packaging of L2 DNA into progeny virus. DNA-DNA hybridization studies demonstrate that L2 DNA integrates into the host cell during infection, and subsequent to infection the cells are mycoplasma virus L2 lysogens. The viral site of integration has been roughly mapped. L2 virus is restricted and modified by A. laidlawii strains JA1 and K2. The nature of the modification in strain K2 has been elucidated. Two L2 variants containing insertions in the viral DNA were identified in these studies. Restriction endonuclease cleavage maps of these variants have been determined. DNA from L2 and another isolate of L2, MV-Lg-L 172, are compared in these studies. 74 references, 33 figures, 6 tables. (ACR)

  18. Evidence that the DNA mismatch repair system removes 1-nucleotide Okazaki fragment flaps.

    PubMed

    Kadyrova, Lyudmila Y; Dahal, Basanta K; Kadyrov, Farid A

    2015-10-02

    The DNA mismatch repair (MMR) system plays a major role in promoting genome stability and suppressing carcinogenesis. In this work, we investigated whether the MMR system is involved in Okazaki fragment maturation. We found that in the yeast Saccharomyces cerevisiae, the MMR system and the flap endonuclease Rad27 act in overlapping pathways that protect the nuclear genome from 1-bp insertions. In addition, we determined that purified yeast and human MutSα proteins recognize 1-nucleotide DNA and RNA flaps. In reconstituted human systems, MutSα, proliferating cell nuclear antigen, and replication factor C activate MutLα endonuclease to remove the flaps. ATPase and endonuclease mutants of MutLα are defective in the flap removal. These results suggest that the MMR system contributes to the removal of 1-nucleotide Okazaki fragment flaps.

  19. Identification of DNA primase inhibitors via a combined fragment-based and virtual screening

    NASA Astrophysics Data System (ADS)

    Ilic, Stefan; Akabayov, Sabine R.; Arthanari, Haribabu; Wagner, Gerhard; Richardson, Charles C.; Akabayov, Barak

    2016-11-01

    The structural differences between bacterial and human primases render the former an excellent target for drug design. Here we describe a technique for selecting small molecule inhibitors of the activity of T7 DNA primase, an ideal model for bacterial primases due to their common structural and functional features. Using NMR screening, fragment molecules that bind T7 primase were identified and then exploited in virtual filtration to select larger molecules from the ZINC database. The molecules were docked to the primase active site using the available primase crystal structure and ranked based on their predicted binding energies to identify the best candidates for functional and structural investigations. Biochemical assays revealed that some of the molecules inhibit T7 primase-dependent DNA replication. The binding mechanism was delineated via NMR spectroscopy. Our approach, which combines fragment based and virtual screening, is rapid and cost effective and can be applied to other targets.

  20. Identification of DNA primase inhibitors via a combined fragment-based and virtual screening

    PubMed Central

    Ilic, Stefan; Akabayov, Sabine R.; Arthanari, Haribabu; Wagner, Gerhard; Richardson, Charles C.; Akabayov, Barak

    2016-01-01

    The structural differences between bacterial and human primases render the former an excellent target for drug design. Here we describe a technique for selecting small molecule inhibitors of the activity of T7 DNA primase, an ideal model for bacterial primases due to their common structural and functional features. Using NMR screening, fragment molecules that bind T7 primase were identified and then exploited in virtual filtration to select larger molecules from the ZINC database. The molecules were docked to the primase active site using the available primase crystal structure and ranked based on their predicted binding energies to identify the best candidates for functional and structural investigations. Biochemical assays revealed that some of the molecules inhibit T7 primase-dependent DNA replication. The binding mechanism was delineated via NMR spectroscopy. Our approach, which combines fragment based and virtual screening, is rapid and cost effective and can be applied to other targets. PMID:27805033

  1. Tetrameric structure of the restriction DNA glycosylase R.PabI in complex with nonspecific double-stranded DNA

    PubMed Central

    Wang, Delong; Miyazono, Ken-ichi; Tanokura, Masaru

    2016-01-01

    R.PabI is a type II restriction enzyme that recognizes the 5′-GTAC-3′ sequence and belongs to the HALFPIPE superfamily. Although most restriction enzymes cleave phosphodiester bonds at specific sites by hydrolysis, R.PabI flips the guanine and adenine bases of the recognition sequence out of the DNA helix and hydrolyzes the N-glycosidic bond of the flipped adenine in a similar manner to DNA glycosylases. In this study, we determined the structure of R.PabI in complex with double-stranded DNA without the R.PabI recognition sequence by X-ray crystallography. The 1.9 Å resolution structure of the complex showed that R.PabI forms a tetrameric structure to sandwich the double-stranded DNA and the tetrameric structure is stabilized by four salt bridges. DNA binding and DNA glycosylase assays of the R.PabI mutants showed that the residues that form the salt bridges (R70 and D71) are essential for R.PabI to find the recognition sequence from the sea of nonspecific sequences. R.PabI is predicted to utilize the tetrameric structure to bind nonspecific double-stranded DNA weakly and slide along it to find the recognition sequence. PMID:27731370

  2. DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure.

    PubMed

    Focke, Frauke; Schuermann, David; Kuster, Niels; Schär, Primo

    2010-01-05

    Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.

  3. Transfer of Large Contiguous DNA Fragments onto a Low Copy Plasmid or into the Bacterial Chromosome

    PubMed Central

    Reeves, Analise Z; Lesser, Cammie F

    2017-01-01

    Bacterial pathogenicity islands and other contiguous operons can be difficult to clone using conventional methods due to their large size. Here we describe a robust 3-step method to transfer large defined fragments of DNA from virulence plasmids or cosmids onto smaller autonomously replicating plasmids or directly into defined sites in the bacterial chromosome that incorporates endogenous yeast and λ Red homologous recombination systems. This methodology has been successfully used to isolate and integrate at least 31 kb of contiguous DNA and can be readily adapted for the recombineering of E. coli and its close relatives. PMID:28203614

  4. IS1311 and IS1245 Restriction Fragment Length Polymorphism Analyses, Serotypes, and Drug Susceptibilities of Mycobacterium avium Complex Isolates Obtained from a Human Immunodeficiency Virus-Negative Patient

    PubMed Central

    Dvorska, Lenka; Bartos, Milan; Ostadal, Oldrich; Kaustova, Jarmila; Matlova, Ludmila; Pavlik, Ivo

    2002-01-01

    Six isolates of Mycobacterium avium of genotype dnaJ+ IS901− IS1311+ IS1245+ and serotypes 6 (n = 1), 6/9, (n = 2), and 9 (n = 3) were obtained within a 5-month period from a human immunodeficiency virus-negative patient treated for tuberculosis. The isolates were identified with PvuII restriction fragment length polymorphism (RFLP) analysis as a single IS1311 RFLP type and six different IS1245 RFLP types. Six separate colonies/clones obtained by subculture from each of the six isolates were tested for MICs of a set of 10 drugs. This report documents the appearance of isolates that are resistant to antimycobacterial drugs as the duration of therapy increases. Because isolates recovered from the patient following longer duration of treatment were more likely to be resistant to more antimycobacterial drugs, we would conclude that there was selection for antimycobacterial drug-resistant isolates. Analyses of all 36 clones identified three IS1311 and 22 IS1245 types forming three clusters. Tests of 105 environmental samples collected in the home and the work place of the patient yielded 16 mycobacterial isolates, of which one M. avium from soil was of genotype dnaJ+ IS901+ IS1311+ IS1245+ and serotype 2, and the second M. avium from a vacuum cleaner was of genotype dnaJ+ IS901− IS1311+ IS1245+ and serotype 9. Overall analyses of the results did not reveal any relation between serotype, RFLP type, and drug susceptibility. Based on the course of the disease in the patient and different serotypes, IS1311 and IS1245 RFLP types of isolates of M. avium we suppose represent polyclonal infection. PMID:12354870

  5. DNA fragmentation in morphologically normal spermatozoa: how much should we be concerned in the ICSI era?

    PubMed

    Avendaño, Conrado; Oehninger, Sergio

    2011-01-01

    Intracytoplasmic sperm injection (ICSI) has revolutionized the treatment of male infertility. However, there are still unanswered questions about the safety of this technique. During ICSI, only morphologically normal and motile spermatozoa are typically used to fertilize an oocyte. We recently reported that in infertile men, spermatozoa with apparently normal morphology may have DNA fragmentation. This finding consequently raised the possibility that spermatozoa with normal-shaped appearance but with DNA fragmentation could be mistakenly selected to fertilize oocytes during ICSI. This concern became more clinically significant following the subsequent finding that the presence of an increased proportion of normal spermatozoa with damaged DNA was negatively associated with embryo quality and pregnancy outcome after ICSI. Herein, we propose and discuss the hypothesis that the examination of DNA integrity in the subpopulation of highly motile (hence viable) and morphologically normal cells (and not in the total sperm population) may provide optimized information in prediction of ICSI success. More importantly, this new way of evaluation may provide reassurance about genomic normalcy and minimal risk of transmission of genetic disease and guide the development of improved methods of selection of spermatozoa with intact DNA to be used in assisted reproduction.

  6. A method for recovering strand-specific probes from nick-translated DNA fragments.

    PubMed

    Dutton, F L; Chovnick, A

    1984-07-01

    A method of preparing strand-specific probes for DNA X DNA or DNA X RNA hybridizations is described. Double-stranded DNA fragments are first isolated from any recombinant DNA clone containing the desired sequence, and then labeled in vitro by nick-translation (T. Maniatis, A. Jeffrey, and D. G. Kleid (1975) Proc. Natl. Acad. Sci. USA 72, 1184-1188; P. W. J. Rigby, M. Dieckmann, C. Rhodes, and P. Berg (1977) J. Mol. Biol. 113, 237-251). Sequences homologous to the desired strand are captured by annealing the denatured nick-translate to viral strands of an appropriate M13 clone, and recovered by elution of the resulting hybrids from a column of agarose A50M (Bio-Rad). By this method, separate probes with specificity to either strand, as well as the double-stranded probe, may conveniently be prepared from a single nick-translation reaction. Probes may be obtained which are homologous either to the full length of the cloned region or to selected portions thereof by selecting appropriate M13 clones for annealing. The probe is recovered as a population of fragments several hundred bases or less in length, which have been found ideal for saturating liquid hybridizations, and should be similarly well suited for in situ hybridizations to cytological preparations.

  7. Unusual Structures Are Present in DNA Fragments Containing Super-Long Huntingtin CAG Repeats

    PubMed Central

    Duzdevich, Daniel; Li, Jinliang; Whang, Jhoon; Takahashi, Hirohide; Takeyasu, Kunio; Dryden, David T. F.; Morton, A. Jennifer; Edwardson, J. Michael

    2011-01-01

    Background In the R6/2 mouse model of Huntington's disease (HD), expansion of the CAG trinucleotide repeat length beyond about 300 repeats induces a novel phenotype associated with a reduction in transcription of the transgene. Methodology/Principal Findings We analysed the structure of polymerase chain reaction (PCR)-generated DNA containing up to 585 CAG repeats using atomic force microscopy (AFM). As the number of CAG repeats increased, an increasing proportion of the DNA molecules exhibited unusual structural features, including convolutions and multiple protrusions. At least some of these features are hairpin loops, as judged by cross-sectional analysis and sensitivity to cleavage by mung bean nuclease. Single-molecule force measurements showed that the convoluted DNA was very resistant to untangling. In vitro replication by PCR was markedly reduced, and TseI restriction enzyme digestion was also hindered by the abnormal DNA structures. However, significantly, the DNA gained sensitivity to cleavage by the Type III restriction-modification enzyme, EcoP15I. Conclusions/Significance “Super-long” CAG repeats are found in a number of neurological diseases and may also appear through CAG repeat instability. We suggest that unusual DNA structures associated with super-long CAG repeats decrease transcriptional efficiency in vitro. We also raise the possibility that if these structures occur in vivo, they may play a role in the aetiology of CAG repeat diseases such as HD. PMID:21347256

  8. Microinjection of cloned DNA fragments into fertilized one-cell mouse eggs: I. Manual injection.

    PubMed

    Murphy, D

    1993-01-01

    Central to the process of making transgenic mice is the physical introduction of cloned DNA fragments into fertilized one-cell mouse eggs. First described 10 years ago by a number of investigators, microinjection remains the most popular and successful of the methods currently available for generating transgenic animals. Microinjection continues to be the method of choice, because the advantages of speed and reliability far outweigh the demands placed on the investigator for precise technical skill and expensive equipment.

  9. Efficient DNA Fingerprinting of Clostridium botulinum Types A, B, E, and F by Amplified Fragment Length Polymorphism Analysis

    PubMed Central

    Keto-Timonen, Riikka; Nevas, Mari; Korkeala, Hannu

    2005-01-01

    Amplified fragment length polymorphism (AFLP) analysis was applied to characterize 33 group I and 37 group II Clostridium botulinum strains. Four restriction enzyme and 30 primer combinations were screened to tailor the AFLP technique for optimal characterization of C. botulinum. The enzyme combination HindIII and HpyCH4IV, with primers having one selective nucleotide apiece (Hind-C and Hpy-A), was selected. AFLP clearly differentiated between C. botulinum groups I and II; group-specific clusters showed <10% similarity between proteolytic and nonproteolytic C. botulinum strains. In addition, group-specific fragments were detected in both groups. All strains studied were typeable by AFLP, and a total of 42 AFLP types were identified. Extensive diversity was observed among strains of C. botulinum type E, whereas group I had lower genetic biodiversity. These results indicate that AFLP is a fast, highly discriminating, and reproducible DNA fingerprinting method with excellent typeability, which, in addition to its suitability for typing at strain level, can be used for C. botulinum group identification. PMID:15746312

  10. Efficient DNA fingerprinting of Clostridium botulinum types A, B, E, and F by amplified fragment length polymorphism analysis.

    PubMed

    Keto-Timonen, Riikka; Nevas, Mari; Korkeala, Hannu

    2005-03-01

    Amplified fragment length polymorphism (AFLP) analysis was applied to characterize 33 group I and 37 group II Clostridium botulinum strains. Four restriction enzyme and 30 primer combinations were screened to tailor the AFLP technique for optimal characterization of C. botulinum. The enzyme combination HindIII and HpyCH4IV, with primers having one selective nucleotide apiece (Hind-C and Hpy-A), was selected. AFLP clearly differentiated between C. botulinum groups I and II; group-specific clusters showed <10% similarity between proteolytic and nonproteolytic C. botulinum strains. In addition, group-specific fragments were detected in both groups. All strains studied were typeable by AFLP, and a total of 42 AFLP types were identified. Extensive diversity was observed among strains of C. botulinum type E, whereas group I had lower genetic biodiversity. These results indicate that AFLP is a fast, highly discriminating, and reproducible DNA fingerprinting method with excellent typeability, which, in addition to its suitability for typing at strain level, can be used for C. botulinum group identification.

  11. Mapping of the X-linked agammaglobulinemia locus by use of restriction fragment-length polymorphism.

    PubMed Central

    Kwan, S P; Kunkel, L; Bruns, G; Wedgwood, R J; Latt, S; Rosen, F S

    1986-01-01

    A molecular linkage analysis in 11 families with X-linked agammaglobulinemia (XLA) localized the XLA gene to the proximal part of the long arm of the human X chromosome. Significant linkage was detected between XLA and loci defined by two polymorphic DNA probes called 19-2 for the DXS3 locus and S21 for the DXS17 locus. Both localize to the region Xq21.3-Xq22. Most likely recombination distances (theta) and associated logarithm of the odds (lod) scores for the XLA-DXS3 and XLA-DXS17 pairs were theta = 0.04 morgans (lod, 3.65) and theta = 0 (lod, 2.17), respectively. Tight linkage between XLA and the locus DXS43 defined by the X short arm probe D2 (localized to Xp22-Xp21) was strongly excluded and we obtained no evidence for significant linkage between XLA and any other X short arm probe. The probe pair 19-2 and S21 should be informative for molecular linkage-based analysis of XLA segregation in the majority of families afflicted with this disorder. Images PMID:3003164

  12. Carrier detection and early diagnosis of Wilson's disease by restriction fragment length polymorphism analysis.

    PubMed Central

    Figus, A; Lampis, R; Devoto, M; Ristaldi, M S; Ideo, A; de Virgilis, S; Nurchi, A M; Corrias, A; Corda, R; Lai, M E

    1989-01-01

    Wilson's disease, a rare autosomal recessive disorder, has been recently mapped to the long arm of chromosome 13 (q14.1). In this study, we carried out linkage analysis between three chromosome 13 DNA markers, D13S1, D13S10, D13S2, the locus for the red cell enzyme esterase D (ESD), and the Wilson's disease locus (WND) in 17 Wilson's disease families of Italian descent, mostly from Sardinia. We confirmed a tight linkage [theta = 0.00, Z (theta) = 4.07] between the WND and ESD loci, and provided suggestive evidence for linkage [theta = 0.00, Z(theta) = 1.85] of the WND locus with D13S10. Multipoint linkage analysis indicated the following order: centromere-D13S1-D13S10-WND-ESD-D13S2. RFLP analysis at these two loci in our families allowed us either to define the carrier status (50%) or to exclude the homozygous state (25%) in the great majority of unaffected sibs. PMID:2563776

  13. Genomic-Based Restriction Enzyme Selection for Specific Detection of Piscirickettsia salmonis by 16S rDNA PCR-RFLP

    PubMed Central

    Mandakovic, Dinka; Glasner, Benjamín; Maldonado, Jonathan; Aravena, Pamela; González, Mauricio; Cambiazo, Verónica; Pulgar, Rodrigo

    2016-01-01

    The gram negative facultative bacterium P. salmonis is the etiological agent of Salmonid Rickettsial Septicaemia (SRS), a severe disease that causes important economic losses in the global salmon farmer industry. Despite efforts to control this disease, the high frequency of new epizootic events indicate that the vaccine and antibiotics treatments have limited effectiveness, therefore the preventive and diagnostic approaches must be improved. A comparison of several methodologies for SRS diagnostic indicate differences in their specificity and its capacity to detect other bacteria coexisting with P. salmonis in culture media (contamination) and fish samples (coinfection), aspects relevant for research, vaccine development and clinical diagnostic. By computer-simulation analyses, we identified a group of restriction enzymes that generate unique P. salmonis 16S rDNA band patterns, distinguishable from all other bacteria. From this information, we designed and developed a PCR-RFLP (Polymerase Chain Reaction—Restriction Fragment Length Polymorphism) assay, which was validated using 16S rDNA universal primers and restriction enzyme PmaCI for the amplification and digestion, respectively. Experimental validation was performed by comparing the restriction pattern of P. salmonis with the restriction patterns generated by bacteria that cohabit with P. salmonis (fish bacterial isolates and culture media contaminants). Our results indicate that the restriction enzyme selection pipeline was suitable to design a more specific, sensible, faster and cheaper assay than the currently used P. salmonis detection methodologies. PMID:27242682

  14. Genomic-Based Restriction Enzyme Selection for Specific Detection of Piscirickettsia salmonis by 16S rDNA PCR-RFLP.

    PubMed

    Mandakovic, Dinka; Glasner, Benjamín; Maldonado, Jonathan; Aravena, Pamela; González, Mauricio; Cambiazo, Verónica; Pulgar, Rodrigo

    2016-01-01

    The gram negative facultative bacterium P. salmonis is the etiological agent of Salmonid Rickettsial Septicaemia (SRS), a severe disease that causes important economic losses in the global salmon farmer industry. Despite efforts to control this disease, the high frequency of new epizootic events indicate that the vaccine and antibiotics treatments have limited effectiveness, therefore the preventive and diagnostic approaches must be improved. A comparison of several methodologies for SRS diagnostic indicate differences in their specificity and its capacity to detect other bacteria coexisting with P. salmonis in culture media (contamination) and fish samples (coinfection), aspects relevant for research, vaccine development and clinical diagnostic. By computer-simulation analyses, we identified a group of restriction enzymes that generate unique P. salmonis 16S rDNA band patterns, distinguishable from all other bacteria. From this information, we designed and developed a PCR-RFLP (Polymerase Chain Reaction-Restriction Fragment Length Polymorphism) assay, which was validated using 16S rDNA universal primers and restriction enzyme PmaCI for the amplification and digestion, respectively. Experimental validation was performed by comparing the restriction pattern of P. salmonis with the restriction patterns generated by bacteria that cohabit with P. salmonis (fish bacterial isolates and culture media contaminants). Our results indicate that the restriction enzyme selection pipeline was suitable to design a more specific, sensible, faster and cheaper assay than the currently used P. salmonis detection methodologies.

  15. [An efficient genetic knockout system based on linear DNA fragment homologous recombination for halophilic archaea].

    PubMed

    Xiaoli, Wang; Chuang, Jiang; Jianhua, Liu; Xipeng, Liu

    2015-04-01

    With the development of functional genomics, gene-knockout is becoming an important tool to elucidate gene functions in vivo. As a good model strain for archaeal genetics, Haloferax volcanii has received more attention. Although several genetic manipulation systems have been developed for some halophilic archaea, it is time-consuming because of the low percentage of positive clones during the second-recombination selection. These classical gene knockout methods are based on DNA recombination between the genomic homologous sequence and the circular suicide plasmid, which carries a pyrE selection marker and two DNA fragments homologous to the upstream and downstream fragments of the target gene. Many wild-type clones are obtained through a reverse recombination between the plasmid and genome in the classic gene knockout method. Therefore, it is necessary to develop an efficient gene knockout system to increase the positive clone percentage. Here we report an improved gene knockout method using a linear DNA cassette consisting of upstream and downstream homologous fragments, and the pyrE marker. Gene deletions were subsequently detected by colony PCR analysis. We determined the efficiency of our knockout method by deleting the xpb2 gene from the H. volcanii genome, with the percentage of positive clones higher than 50%. Our method provides an efficient gene knockout strategy for halophilic archaea.

  16. Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

    SciTech Connect

    Tee, Thiam-Tsui; Cheah, Yew-Hoong; Meenakshii, Nallappan; Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie

    2012-04-20

    Highlights: Black-Right-Pointing-Pointer We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. Black-Right-Pointing-Pointer Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. Black-Right-Pointing-Pointer Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. Black-Right-Pointing-Pointer DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. Black-Right-Pointing-Pointer DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X{sub L} expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

  17. Mannitol influence on the separation of DNA fragments by capillary electrophoresis in entangled polymer solutions.

    PubMed

    Han, F; Xue, J; Lin, B

    1998-08-01

    A new kind of sieving matrix is presented in this paper to allow satisfactory separation of DNA fragments in a relatively low viscous solution. When a certain amount of mannitol was added to cellulose solution not concentrated enough to separate PGEM-3Zf(+)/HaeIII standards well, a polymer solution with low viscosity but with very good separation effects was obtained. The separation result of this sieving buffer was comparable with those using highly concentrated cellulose solutions. The sieving ability of solutions with different cellulose concentrations and different amounts of mannitol has been investigated. It was proved that 0.5% was the minimum hydroxypropylmethylcellulose (HPMC) concentration that could be used to separate DNA fragments satisfactorily. HPMC solutions with a concentration of less than 0.5% could not separate the standard DNA fragments even in the presence of mannitol. It was found that 6% was the optimized mannitol concentration because either more or less mannitol will lead a decrease of resolution. The principle of the positive influence of mannitol has also been discussed.

  18. Nuclear DNA fragmentation during cell death of short-lived ray tracheids in the conifer Pinus densiflora.

    PubMed

    Nakaba, Satoshi; Kubo, Takafumi; Funada, Ryo

    2011-05-01

    One key event in the programmed cell death is nuclear DNA fragmentation. We investigated the timing of nuclear DNA fragmentation during the cell death of short-lived ray tracheids in Pinus densiflora using the terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) assay. Fluorescence due to TUNEL was detected only in deformed nuclei that lacked obvious chromatin in ray tracheids that were adjacent to ray tracheids that no longer contained nuclei. Our observations revealed that nuclear DNA fragmentation occurred only at the final stage of cell death in ray tracheids in situ.

  19. The proteolytic YB-1 fragment interacts with DNA repair machinery and enhances survival during DNA damaging stress

    PubMed Central

    Kim, Ekaterina R; Selyutina, Anastasia A; Buldakov, Ilya A; Evdokimova, Valentina; Ovchinnikov, Lev P; Sorokin, Alexey V

    2013-01-01

    The Y-box binding protein 1 (YB-1) is a DNA/RNA-binding nucleocytoplasmic shuttling protein whose regulatory effect on many DNA and RNA-dependent events is determined by its localization in the cell. We have shown previously that YB-1 is cleaved by 20S proteasome between E219 and G220, and the truncated N-terminal YB-1 fragment accumulates in the nuclei of cells treated with DNA damaging drugs. We proposed that appearance of truncated YB-1 in the nucleus may predict multiple drug resistance. Here, we compared functional activities of the full-length and truncated YB-1 proteins and showed that the truncated form was more efficient in protecting cells against doxorubicin treatment. Both forms of YB-1 induced changes in expression of various genes without affecting those responsible for drug resistance. Interestingly, although YB-1 cleavage did not significantly affect its DNA binding properties, truncated YB-1 was detected in complexes with Mre11 and Rad50 under genotoxic stress conditions. We conclude that both full-length and truncated YB-1 are capable of protecting cells against DNA damaging agents, and the truncated form may have an additional function in DNA repair. PMID:24107631

  20. A polymerase chain reaction-restriction fragment length polymorphism method for screening ZNF804A gene polymorphism (rs1344706) in patients with schizophrenia: a significant association.

    PubMed

    Sazci, Ali; Ozel, Mavi Deniz; Ergul, Emel; Yildiz, Mustafa

    2012-03-01

    The original ZNF804A rs1344706 risk variant was identified through genome-wide association studies as a risk factor for schizophrenia. Follow-up studies involving meta-analysis have confirmed that rs1344706 is a risk factor for schizophrenia as well as bipolar disorders. We describe here a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method to genotype ZNF804A rs1344706 variant in patients with schizophrenia. We generated a 220 bp fragment through PCR and subsequently cleaved it by the restriction endonuclease BsaBI, creating two fragments of 114 and 106 bp. Upon change in the nucleotide from T to G, the 106 bp fragment is further cleaved by BsaBI, thus creating two fragments of 87 and 19 bp. As a result, when the 220 bp fragment is cleaved by BsaBI restriction endonuclease, the TT genotype yields two fragments of 114 and 106 bp, and TG genotype four fragments of 114, 106, 87, and 19 bp, and the GG genotype three fragments of 114, 87, and 19 bp. Thus, this is a simple, fast, and cost-effective method to genotype the ZNF804A rs1344706 risk variant. Using this method, we were able to replicate an association between ZNF804A rs1344706 variant and schizophrenia in a Turkish population. Stratification analysis of the population according to the gender showed an association that was statistically significant among overall schizophrenia and male schizophrenia and the risk T allele and TT genotype of the ZNF804A gene.

  1. In vivo assembly of DNA-fragments in the moss, Physcomitrella patens

    PubMed Central

    King, Brian Christopher; Vavitsas, Konstantinos; Ikram, Nur Kusaira Binti Khairul; Schrøder, Josephine; Scharff, Lars B.; Hamberger, Björn; Jensen, Poul Erik; Simonsen, Henrik Toft

    2016-01-01

    Direct assembly of multiple linear DNA fragments via homologous recombination, a phenomenon known as in vivo assembly or transformation associated recombination, is used in biotechnology to assemble DNA constructs ranging in size from a few kilobases to full synthetic microbial genomes. It has also enabled the complete replacement of eukaryotic chromosomes with heterologous DNA. The moss Physcomitrella patens, a non-vascular and spore producing land plant (Bryophyte), has a well-established capacity for homologous recombination. Here, we demonstrate the in vivo assembly of multiple DNA fragments in P. patens with three examples of effective genome editing: we (i) efficiently deleted a genomic locus for diterpenoid metabolism yielding a biosynthetic knockout, (ii) introduced a salt inducible promoter, and (iii) re-routed endogenous metabolism into the formation of amorphadiene, a precursor of high-value therapeutics. These proof-of-principle experiments pave the way for more complex and increasingly flexible approaches for large-scale metabolic engineering in plant biotechnology. PMID:27126800

  2. Induced lipid peroxidation in ram sperm: semen profile, DNA fragmentation and antioxidant status.

    PubMed

    Hamilton, Thais Rose dos Santos; de Castro, Letícia Signori; Delgado, Juliana de Carvalho; de Assis, Patrícia Monken; Siqueira, Adriano Felipe Perez; Mendes, Camilla Mota; Goissis, Marcelo Demarchi; Muiño-Blanco, Teresa; Cebrián-Pérez, José Álvaro; Nichi, Marcílio; Visintin, José Antonio; D'Ávila Assumpção, Mayra Elena Ortiz

    2016-04-01

    Action of reactive oxygen species, protamination failures and apoptosis are considered the most important etiologies of sperm DNA fragmentation. This study evaluated the effects of induced lipid peroxidation susceptibility on native semen profile and identified the mechanisms involved in sperm DNA fragmentation and testicular antioxidant defense on Santa Ines ram sperm samples. Semen was collected from 12 adult rams (Ovis aries) performed weekly over a 9-week period. Sperm analysis (motility, mass motility, abnormalities, membrane and acrosome status, mitochondrial potential, DNA fragmentation, lipid peroxidation and intracellular free radicals production); protamine deficiency; PRM1, TNP1 and TNP2 gene expression; and determination of glutathione peroxidase (GPx), glutathione reductase, catalase (CAT) and superoxide dismutase activity and immunodetection in seminal plasma were performed. Samples were distributed into four groups according to the sperm susceptibility to lipid peroxidation after induction with ascorbate and ferrous sulfate (low, medium, high and very high). The results were analyzed by GLM test and post hoc least significant difference. We observed an increase in native GPx activity and CAT immunodetection in groups with high susceptibility to induced lipid peroxidation. We also found an increase in total sperm defects, acrosome and membrane damages in the group with the highest susceptibility to induced lipid peroxidation. Additionally, the low mitochondrial membrane potential, susceptible to chromatin fragmentation and the PRM1 mRNA were increased in the group showing higher susceptibility to lipid peroxidation. Ram sperm susceptibility to lipid peroxidation may compromise sperm quality and interfere with the oxidative homeostasis by oxidative stress, which may be the main cause of chromatin damage in ram sperm.

  3. Modification-dependent restriction endonuclease, MspJI, flips 5-methylcytosine out of the DNA helix

    SciTech Connect

    Horton, J. R.; Wang, H.; Mabuchi, M. Y.; Zhang, X.; Roberts, R. J.; Zheng, Y.; Wilson, G. G.; Cheng, X.

    2014-09-27

    MspJI belongs to a family of restriction enzymes that cleave DNA containing 5-methylcytosine (5mC) or 5-hydroxymethylcytosine (5hmC). MspJI is specific for the sequence 5(h)mC-N-N-G or A and cleaves with some variability 9/13 nucleotides downstream. Earlier, we reported the crystal structure of MspJI without DNA and proposed how it might recognize this sequence and catalyze cleavage. Here we report its co-crystal structure with a 27-base pair oligonucleotide containing 5mC. This structure confirms that MspJI acts as a homotetramer and that the modified cytosine is flipped from the DNA helix into an SRA-like-binding pocket. We expected the structure to reveal two DNA molecules bound specifically to the tetramer and engaged with the enzyme's two DNA-cleavage sites. A coincidence of crystal packing precluded this organization, however. We found that each DNA molecule interacted with two adjacent tetramers, binding one specifically and the other non-specifically. The latter interaction, which prevented cleavage-site engagement, also involved base flipping and might represent the sequence-interrogation phase that precedes specific recognition. MspJI is unusual in that DNA molecules are recognized and cleaved by different subunits. Such interchange of function might explain how other complex multimeric restriction enzymes act.

  4. Ultrasensitive electrochemical biosensing for DNA using quantum dots combined with restriction endonuclease.

    PubMed

    Zhang, Can; Lou, Jing; Tu, Wenwen; Bao, Jianchun; Dai, Zhihui

    2015-01-21

    A universal and sensitive electrochemical biosensing platform for the detection and identification of DNA using CdSe quantum dots (CdSe QDs) as signal markers was designed. The detection mechanism was based on the specific recognition of MspI endonuclease combined with the signal amplification of gold nanoparticles (AuNPs). MspI endonuclease could recognize its specific sequence in the double-strand DNA (dsDNA) and cleave the dsDNA fragments linked with CdSe QDs from the electrode. The remaining attached CdSe QDs can be easily read out by square-wave voltammetry using an electrodeposited bismuth (Bi) film-modified glass carbon electrode. The concentrations of target DNA could be simultaneously detected by the signal of metal markers. Using mycobacterium tuberculosis (Mtb) DNA as a model, under the optimal conditions, the proposed biosensor could detect Mtb DNA down to 8.7 × 10(-15) M with a linear range of 5 orders of magnitude (from 1.0 × 10(-14) to 1.0 × 10(-9) M) and discriminate mismatched DNA with high selectivity. This strategy presented a universal and convenient biosensing platform for DNA assay, and its satisfactory performances make it a potential candidate for the early diagnosis of gene-related diseases.

  5. A simple and rapid nested polymerase chain reaction-restriction fragment length polymorphism technique for differentiation of pathogenic and nonpathogenic Leptospira spp.

    PubMed

    Djadid, Navid Dinparast; Ganji, Zahra Faghanzadeh; Gouya, Mohammad Mehdi; Rezvani, Mahmood; Zakeri, Sedigheh

    2009-03-01

    A rapid and specific nested polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) has been developed to detect and differentiate pathogenic and nonpathogenic Leptospira spp. Leptospiral genomic DNA was extracted from suspected human sera using an improved method of standard phenol-chloroform, and specific primers have been used to amplify 16S ribosomal RNA from all pathogenic and nonpathogenic Leptospira spp. The PCR products of all nonpathogenic species were digested with ApoI enzyme, but not pathogenic. To evaluate this assay, we analyzed 283 serum samples collected from suspected patients with leptospirosis. Nested PCR assay confirmed that 42 (14.8%) of 283 samples harbored Leptospira infection, and RFLP assay confirmed 38 (90.5%) of 42 and 4 (9.5%) of 42 positive cases had pathogenic and nonpathogenic Leptospira spp., respectively. Based on sequencing results, Leptospira interrogans, Leptospira kirschneri, and Leptospira wolffii and nonpathogenic Leptospira biflexa and Leptospira genomospecies 3 have been detected among analyzed samples. The nested PCR-RFLP assay developed in this study fulfills this requirement in the early stage of infection.

  6. Phylogenetic congruence of Sarcocystis neurona Dubey et al., 1991 (Apicomplexa: Sarcocystidae) in the United States based on sequence analysis and restriction fragment length polymorphism (RFLP).

    PubMed

    Elsheikha, Hany M; Murphy, Alice J; Mansfield, Linda S

    2005-07-01

    The objectives of the present study were to assess the genetic diversity, phylogeny and phylogeographical relationships of available Sarcocystis neurona isolates from different localities in the United States. All 13 Sarcocystis isolates from different hosts were subjected to polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) analyses using two published DNA markers (25/396 and 33/54). The 334 bp sequence of the 25/396 marker of these isolates and Besnoitia darlingi, B. bennetti, Toxoplasma gondii and Neospora caninum were sequenced and compared. Phylogenetic analysis was performed using neighbour-joining (NJ), maximum parsimony (MP) and minimum evolution (ME) methods based on the sequences of the 25/396 marker of the 13 Sarcocystis isolates obtained in this study and sequences of 10 related isolates from GenBank. Phylogenetic trees revealed a close relatedness among S. neurona isolates in the US (nucleotide sequence diversity <5.0%). US isolates formed a monophyletic group and appeared more closely related to each other than to the South American isolates, which formed a separate lineage. NJ and ME trees with Kimura 2-parameter model separated S. neurona into two separate groups: a northern US group and a Southern US group. These findings suggest a correlation between grouping of the isolates and geographical segregation and were consistent with a genetic bottleneck hypothesis during opossum colonisation of North America. These data do not support either the view of S. neurona as a single super-species or its division into multiple subspecies.

  7. Genotyping Clostridium botulinum toxinotype A isolates from patients using amplified rDNA restriction analysis.

    PubMed

    Pourshafie, M; Vahdani, P; Popoff, M

    2005-10-01

    In this study, the application of amplified rDNA restriction analysis (ARDRA) for characterizing Clostridium botulinum toxinotype A strains isolated from individuals with botulism was evaluated. Ten restriction enzymes were tested for their suitability in ARDRA as a typing method and HhaI was selected for the best outcome. Analysis of HhaI restriction profiles of the amplified products divided C. botulinum isolates into three clusters. Non-toxigenic Clostridium sporogenes strains showed an ARDRA restriction pattern that was distinct from those observed for C. botulinum. The successful use of ARDRA for subdivision of C. botulinum in this study confirmed that this technique is a powerful method for typing of C. botulinum toxinotype A clonal diversity. In addition, it is rapid, sensitive and simple.

  8. Cell-Free DNA Provides a Good Representation of the Tumor Genome Despite Its Biased Fragmentation Patterns

    PubMed Central

    Zhu, Liangjun; Wu, Xue; Bao, Hua; Wang, Xiaonan; Chang, Zhili; Wang, Zhenxin

    2017-01-01

    Cell-free DNA (cfDNA) is short, extracellular, fragmented double-stranded DNA found in plasma. Plasma of patients with solid tumor has been found to show significantly increased quantities of cfDNA. Although currently poorly understood, the mechanism of cfDNA generation is speculated to be a product of genomic DNA fragmentation during cellular apoptosis and necrosis. Sequencing of cfDNA with tumor origin has identified tumor biomarkers, elucidating molecular pathology and assisting in accurate diagnosis. In this study, we performed whole-genome sequencing ofcfDNA samples with matching tumor and whole blood samples from five patients diagnosed with stage IV gastric or lung cancer. We analyzed the coverage spectrum of the human genome in our cfDNA samples. cfDNA exhibited no large regions with significant under-coverage, although we observed unbalanced coverage depth in cfDNA at transcription start sites and exon boundaries as a consequence of biased fragmentation due to ordered nucleosome positioning. We also analyzed the copy number variant status based on the whole-genome sequencing results and found high similarity between copy number profile constructed from tumor samples and cfDNA samples. Overall, we conclude that cfDNA comprises a good representation of the tumor genome in late stage gastric and lung cancer. PMID:28046008

  9. FSH treatment in infertile males candidate to assisted reproduction improved sperm DNA fragmentation and pregnancy rate.

    PubMed

    Garolla, Andrea; Ghezzi, Marco; Cosci, Ilaria; Sartini, Barbara; Bottacin, Alberto; Engl, Bruno; Di Nisio, Andrea; Foresta, Carlo

    2016-07-27

    The purpose of this study is to evaluate whether follicle-stimulating hormone treatment improves sperm DNA parameters and pregnancy outcome in infertile male candidates to in-vitro fertilization.Observational study in 166 infertile male partners of couples undergoing in-vitro fertilization. Eighty-four patients were receiving follicle-stimulating hormone treatment (cases) and 82 refused treatment (controls). Semen parameters, sexual hormones, and sperm nucleus (fluorescence in-situ hybridization, acridine orange, TUNEL, and γH2AX) were evaluated at baseline (T0) and after 3 months (T1), when all subjects underwent assisted reproduction techniques. Statistical analysis was performed by analysis of variance.Compared to baseline, cases showed significant improvements in seminal parameters and DNA fragmentation indexes after follicle-stimulating hormone therapy (all P < 0.05), whereas no changes were observed in controls. Within cases, follicle-stimulating hormone treatment allowed to perform intrauterine insemination in 35 patients with a pregnancy rate of 23.2 %. Intracytoplasmic sperm injection was performed in all controls and in 49 patients from cases, with pregnancy rates of 23.2 and 40.8 %, respectively (P < 0.05). After 3 months (T0 vs. T1) of follicle-stimulating hormone therapy, cases with positive outcome had reduced DNA fragmentation index and lower double strand breaks (P < 0.05 and P < 0.001 vs. negative outcome, respectively).In this observational study, we showed that follicle-stimulating hormone treatment improves sperm DNA fragmentation, which in turn leads to increased pregnancy rates in infertile males undergoing in-vitro fertilization. In particular, double strand breaks (measured with γH2AX test) emerged as the most sensible parameter to follicle-stimulating hormone treatment in predicting reproductive outcome.

  10. Terminal Restriction Fragment Length Polymorphism for the Identification of Spirorchiid Ova in Tissues from the Green Sea Turtle, Chelonia mydas

    PubMed Central

    Chapman, Phoebe A.; Traub, Rebecca J.; Kyaw-Tanner, Myat T.; Owen, Helen; Flint, Mark; Cribb, Thomas H.; Mills, Paul C.

    2016-01-01

    Blood flukes are among the most common disease causing pathogens infecting vertebrates, including humans and some of the world's most globally endangered fauna. Spirorchiid blood flukes are parasites of marine turtles, and are associated with pathology, strandings and mortalities worldwide. Their ova embolize in tissues and incite significant inflammatory responses, however attempts to draw correlations between species and lesions are frustrated by difficulties in identifying ova beyond the genus level. In this study, a newly developed terminal restriction fragment length polymorphism (T-RFLP) method was validated as a tool for differentiating between mixed spirorchiid ova in turtle tissue. Initially, a multiplex PCR was used to differentiate between the five genera of spirorchiid flukes. Following this, PCR was performed using genus/genera-specific fluorescently tagged primer pairs and PCR products digested analysis using restriction endonucleases. Using capillary electrophoresis, this T-RFLP method could differentiate between twelve species and genotypes of spirorchiid flukes in turtles. It was applied to 151 tissue samples and successfully identified the spirorchiid species present. It was found to be more sensitive than visual diagnosis, detecting infections in 28 of 32 tissues that were negative on histology. Spirorchiids were present in 96.7% of tissues tested, with Neospirorchis genotype 2 being the most prevalent, present in 93% of samples. Mixed infections were common, being present in 60.7% of samples tested. The method described here is, to our knowledge, the first use of the T-RFLP technique on host tissues or in an animal ecology context, and describes a significant advancement in the clinical capacity to diagnose a common cause of illness in our environment. It is proven as a sensitive, specific and cost-efficient means of identifying spirorchiid flukes and ova in turtles, with the potential to contribute valuable information to epidemiological and

  11. Terminal Restriction Fragment Length Polymorphism Analysis of Soil Bacterial Communities under Different Vegetation Types in Subtropical Area.

    PubMed

    Wu, Zeyan; Lin, Wenxiong; Li, Bailian; Wu, Linkun; Fang, Changxun; Zhang, Zhixing

    2015-01-01

    Soil microbes are active players in energy flow and material exchange of the forest ecosystems, but the research on the relationship between the microbial diversity and the vegetation types is less conducted, especially in the subtropical area of China. In this present study, the rhizosphere soils of evergreen broad-leaf forest (EBF), coniferous forest (CF), subalpine dwarf forest (SDF) and alpine meadow (AM) were chosen as test sites. Terminal-restriction fragment length polymorphisms (T-RFLP) analysis was used to detect the composition and diversity of soil bacterial communities under different vegetation types in the National Natural Reserve of Wuyi Mountains. Our results revealed distinct differences in soil microbial composition under different vegetation types. Total 73 microbes were identified in soil samples of the four vegetation types, and 56, 49, 46 and 36 clones were obtained from the soils of EBF, CF, SDF and AM, respectively, and subsequently sequenced. The Actinobacteria, Fusobacterium, Bacteroidetes and Proteobacteria were the most predominant in all soil samples. The order of Shannon-Wiener index (H) of all soil samples was in the order of EBF>CF>SDF>AM, whereas bacterial species richness as estimated by four restriction enzymes indicated no significant difference. Principal component analysis (PCA) revealed that the soil bacterial communities' structures of EBF, CF, SDF and AM were clearly separated along the first and second principal components, which explained 62.17% and 31.58% of the total variance, respectively. The soil physical-chemical properties such as total organic carbon (TOC), total nitrogen (TN), total phosphorus (TP) and total potassium (TK) were positively correlated with the diversity of bacterial communities.

  12. Terminal Restriction Fragment Length Polymorphism Analysis of Soil Bacterial Communities under Different Vegetation Types in Subtropical Area

    PubMed Central

    Wu, Zeyan; Lin, Wenxiong; Li, Bailian; Wu, Linkun; Fang, Changxun; Zhang, Zhixing

    2015-01-01

    Soil microbes are active players in energy flow and material exchange of the forest ecosystems, but the research on the relationship between the microbial diversity and the vegetation types is less conducted, especially in the subtropical area of China. In this present study, the rhizosphere soils of evergreen broad-leaf forest (EBF), coniferous forest (CF), subalpine dwarf forest (SDF) and alpine meadow (AM) were chosen as test sites. Terminal-restriction fragment length polymorphisms (T-RFLP) analysis was used to detect the composition and diversity of soil bacterial communities under different vegetation types in the National Natural Reserve of Wuyi Mountains. Our results revealed distinct differences in soil microbial composition under different vegetation types. Total 73 microbes were identified in soil samples of the four vegetation types, and 56, 49, 46 and 36 clones were obtained from the soils of EBF, CF, SDF and AM, respectively, and subsequently sequenced. The Actinobacteria, Fusobacterium, Bacteroidetes and Proteobacteria were the most predominant in all soil samples. The order of Shannon-Wiener index (H) of all soil samples was in the order of EBF>CF>SDF>AM, whereas bacterial species richness as estimated by four restriction enzymes indicated no significant difference. Principal component analysis (PCA) revealed that the soil bacterial communities’ structures of EBF, CF, SDF and AM were clearly separated along the first and second principal components, which explained 62.17% and 31.58% of the total variance, respectively. The soil physical-chemical properties such as total organic carbon (TOC), total nitrogen (TN), total phosphorus (TP) and total potassium (TK) were positively correlated with the diversity of bacterial communities. PMID:26098851

  13. Terminal Restriction Fragment Length Polymorphism for the Identification of Spirorchiid Ova in Tissues from the Green Sea Turtle, Chelonia mydas.

    PubMed

    Chapman, Phoebe A; Traub, Rebecca J; Kyaw-Tanner, Myat T; Owen, Helen; Flint, Mark; Cribb, Thomas H; Mills, Paul C

    2016-01-01

    Blood flukes are among the most common disease causing pathogens infecting vertebrates, including humans and some of the world's most globally endangered fauna. Spirorchiid blood flukes are parasites of marine turtles, and are associated with pathology, strandings and mortalities worldwide. Their ova embolize in tissues and incite significant inflammatory responses, however attempts to draw correlations between species and lesions are frustrated by difficulties in identifying ova beyond the genus level. In this study, a newly developed terminal restriction fragment length polymorphism (T-RFLP) method was validated as a tool for differentiating between mixed spirorchiid ova in turtle tissue. Initially, a multiplex PCR was used to differentiate between the five genera of spirorchiid flukes. Following this, PCR was performed using genus/genera-specific fluorescently tagged primer pairs and PCR products digested analysis using restriction endonucleases. Using capillary electrophoresis, this T-RFLP method could differentiate between twelve species and genotypes of spirorchiid flukes in turtles. It was applied to 151 tissue samples and successfully identified the spirorchiid species present. It was found to be more sensitive than visual diagnosis, detecting infections in 28 of 32 tissues that were negative on histology. Spirorchiids were present in 96.7% of tissues tested, with Neospirorchis genotype 2 being the most prevalent, present in 93% of samples. Mixed infections were common, being present in 60.7% of samples tested. The method described here is, to our knowledge, the first use of the T-RFLP technique on host tissues or in an animal ecology context, and describes a significant advancement in the clinical capacity to diagnose a common cause of illness in our environment. It is proven as a sensitive, specific and cost-efficient means of identifying spirorchiid flukes and ova in turtles, with the potential to contribute valuable information to epidemiological and

  14. Structures of minimal catalytic fragments of topoisomerase V reveals conformational changes relevant for DNA binding.

    PubMed

    Rajan, Rakhi; Taneja, Bhupesh; Mondragón, Alfonso

    2010-07-14

    Topoisomerase V is an archaeal type I topoisomerase that is unique among topoisomerases due to presence of both topoisomerase and DNA repair activities in the same protein. It is organized as an N-terminal topoisomerase domain followed by 24 tandem helix-hairpin-helix (HhH) motifs. Structural studies have shown that the active site is buried by the (HhH) motifs. Here we show that the N-terminal domain can relax DNA in the absence of any HhH motifs and that the HhH motifs are required for stable protein-DNA complex formation. Crystal structures of various topoisomerase V fragments show changes in the relative orientation of the domains mediated by a long bent linker helix, and these movements are essential for the DNA to enter the active site. Phosphate ions bound to the protein near the active site helped model DNA in the topoisomerase domain and show how topoisomerase V may interact with DNA.

  15. Structures of Minimal Catalytic Fragments of Topoisomerase V Reveals Conformational Changes Relevant for DNA Binding

    SciTech Connect

    Rajan, Rakhi; Taneja, Bhupesh; Mondragón, Alfonso

    2010-12-03

    Topoisomerase V is an archaeal type I topoisomerase that is unique among topoisomerases due to presence of both topoisomerase and DNA repair activities in the same protein. It is organized as an N-terminal topoisomerase domain followed by 24 tandem helix-hairpin-helix (HhH) motifs. Structural studies have shown that the active site is buried by the (HhH) motifs. Here we show that the N-terminal domain can relax DNA in the absence of any HhH motifs and that the HhH motifs are required for stable protein-DNA complex formation. Crystal structures of various topoisomerase V fragments show changes in the relative orientation of the domains mediated by a long bent linker helix, and these movements are essential for the DNA to enter the active site. Phosphate ions bound to the protein near the active site helped model DNA in the topoisomerase domain and show how topoisomerase V may interact with DNA.

  16. Fragmentation of extracellular DNA by long-term exposure to radiation from uranium in aquatic environments.

    PubMed

    Arruda-Neto, J D T; Nieto, L; Righi, H; Cotta, M A; Carrer, H; Rodrigues, T E; Genofre, G C

    2012-08-01

    Persistent harmful scenarios associated with disposal of radioactive waste, high-background radiation areas and severe nuclear accidents are of great concern regarding consequences to both human health and the environment. Of particular concern is the extracellular DNA in aquatic environments contaminated by radiological substances. Strand breaks induced by radiation promote decrease in the transformation efficiency for extracellular DNA. The focus of this study is the quantification of DNA damage following long-term exposure (over one year) to low doses of natural uranium (an alpha particle emitter) to simulate natural conditions, since nothing is known about alpha radiation induced damage to extracellular DNA. A high-resolution Atomic Force Microscope was used to evaluate DNA fragments. Double-stranded plasmid pBS as a model for extracellular DNA was exposed to different amounts of natural uranium. It was demonstrated that low concentrations of U in water (50 to 150 ppm) produce appreciable numbers of double strand breaks, scaling with the square of the average doses. The importance of these findings for environment monitoring of radiological pollution is addressed.

  17. Pyrrolamide DNA gyrase inhibitors: fragment-based nuclear magnetic resonance screening to identify antibacterial agents.

    PubMed

    Eakin, Ann E; Green, Oluyinka; Hales, Neil; Walkup, Grant K; Bist, Shanta; Singh, Alok; Mullen, George; Bryant, Joanna; Embrey, Kevin; Gao, Ning; Breeze, Alex; Timms, Dave; Andrews, Beth; Uria-Nickelsen, Maria; Demeritt, Julie; Loch, James T; Hull, Ken; Blodgett, April; Illingworth, Ruth N; Prince, Bryan; Boriack-Sjodin, P Ann; Hauck, Sheila; MacPherson, Lawrence J; Ni, Haihong; Sherer, Brian

    2012-03-01

    DNA gyrase is an essential enzyme in bacteria, and its inhibition results in the disruption of DNA synthesis and, subsequently, cell death. The pyrrolamides are a novel class of antibacterial agents targeting DNA gyrase. These compounds were identified by a fragment-based lead generation (FBLG) approach using nuclear magnetic resonance (NMR) screening to identify low-molecular-weight compounds that bind to the ATP pocket of DNA gyrase. A pyrrole hit with a binding constant of 1 mM formed the basis of the design and synthesis of a focused library of compounds that resulted in the rapid identification of a lead compound that inhibited DNA gyrase with a 50% inhibitory concentration (IC(50)) of 3 μM. The potency of the lead compound was further optimized by utilizing iterative X-ray crystallography to yield DNA gyrase inhibitors that also displayed antibacterial activity. Spontaneous mutants were isolated in Staphylococcus aureus by plating on agar plates containing pyrrolamide 4 at the MIC. The resistant variants displayed 4- to 8-fold-increased MIC values relative to the parent strain. DNA sequencing revealed two independent point mutations in the pyrrolamide binding region of the gyrB genes from these variants, supporting the hypothesis that the mode of action of these compounds was inhibition of DNA gyrase. Efficacy of a representative pyrrolamide was demonstrated against Streptococcus pneumoniae in a mouse lung infection model. These data demonstrate that the pyrrolamides are a novel class of DNA gyrase inhibitors with the potential to deliver future antibacterial agents targeting multiple clinical indications.

  18. Pyrrolamide DNA Gyrase Inhibitors: Fragment-Based Nuclear Magnetic Resonance Screening To Identify Antibacterial Agents

    PubMed Central

    Green, Oluyinka; Hales, Neil; Walkup, Grant K.; Bist, Shanta; Singh, Alok; Mullen, George; Bryant, Joanna; Embrey, Kevin; Gao, Ning; Breeze, Alex; Timms, Dave; Andrews, Beth; Uria-Nickelsen, Maria; Demeritt, Julie; Loch, James T.; Hull, Ken; Blodgett, April; Illingworth, Ruth N.; Prince, Bryan; Boriack-Sjodin, P. Ann; Hauck, Sheila; MacPherson, Lawrence J.; Ni, Haihong; Sherer, Brian

    2012-01-01

    DNA gyrase is an essential enzyme in bacteria, and its inhibition results in the disruption of DNA synthesis and, subsequently, cell death. The pyrrolamides are a novel class of antibacterial agents targeting DNA gyrase. These compounds were identified by a fragment-based lead generation (FBLG) approach using nuclear magnetic resonance (NMR) screening to identify low-molecular-weight compounds that bind to the ATP pocket of DNA gyrase. A pyrrole hit with a binding constant of 1 mM formed the basis of the design and synthesis of a focused library of compounds that resulted in the rapid identification of a lead compound that inhibited DNA gyrase with a 50% inhibitory concentration (IC50) of 3 μM. The potency of the lead compound was further optimized by utilizing iterative X-ray crystallography to yield DNA gyrase inhibitors that also displayed antibacterial activity. Spontaneous mutants were isolated in Staphylococcus aureus by plating on agar plates containing pyrrolamide 4 at the MIC. The resistant variants displayed 4- to 8-fold-increased MIC values relative to the parent strain. DNA sequencing revealed two independent point mutations in the pyrrolamide binding region of the gyrB genes from these variants, supporting the hypothesis that the mode of action of these compounds was inhibition of DNA gyrase. Efficacy of a representative pyrrolamide was demonstrated against Streptococcus pneumoniae in a mouse lung infection model. These data demonstrate that the pyrrolamides are a novel class of DNA gyrase inhibitors with the potential to deliver future antibacterial agents targeting multiple clinical indications. PMID:22183167

  19. EndoG Links Bnip3-Induced Mitochondrial Damage and Caspase-Independent DNA Fragmentation in Ischemic Cardiomyocytes

    PubMed Central

    Zhang, Jisheng; Ye, Junmei; Altafaj, Albert; Cardona, Maria; Bahi, Núria; Llovera, Marta; Cañas, Xavier; Cook, Stuart A.; Comella, Joan X.; Sanchis, Daniel

    2011-01-01

    Mitochondrial dysfunction, caspase activation and caspase-dependent DNA fragmentation are involved in cell damage in many tissues. However, differentiated cardiomyocytes repress the expression of the canonical apoptotic pathway and their death during ischemia is caspase-independent. The atypical BH3-only protein Bnip3 is involved in the process leading to caspase-independent DNA fragmentation in cardiomyocytes. However, the pathway by which DNA degradation ensues following Bnip3 activation is not resolved. To identify the mechanism involved, we analyzed the interdependence of Bnip3, Nix and EndoG in mitochondrial damage and DNA fragmentation during experimental ischemia in neonatal rat ventricular cardiomyocytes. Our results show that the expression of EndoG and Bnip3 increases in the heart throughout development, while the caspase-dependent machinery is silenced. TUNEL-positive DNA damage, which depends on caspase activity in other cells, is caspase-independent in ischemic cardiomyocytes and ischemia-induced DNA high and low molecular weight fragmentation is blocked by repressing EndoG expression. Ischemia-induced EndoG translocation and DNA degradation are prevented by silencing the expression of Bnip3, but not Nix, or by overexpressing Bcl-xL. These data establish a link between Bnip3 and EndoG-dependent, TUNEL-positive, DNA fragmentation in ischemic cardiomyocytes in the absence of caspases, defining an alternative cell death pathway in postmitotic cells. PMID:21437288

  20. Environmental toxicants cause sperm DNA fragmentation as detected by the Sperm Chromatin Structure Assay (SCSA[reg])

    SciTech Connect

    Evenson, Donald P. . E-mail: scsa@brookings.net; Wixon, Regina

    2005-09-01

    Studies over the past two decades have clearly shown that reproductive toxicants cause sperm DNA fragmentation. This DNA fragmentation can usually be detected prior to observing alterations of metaphase chromosomes in embryos. Thus, Sperm Chromatin Structure Assay (SCSA)-detected DNA damage is viewed as the molecular precursor to later gross chromosome damage observed under the light microscope. SCSA measurements of animal or human sperm consist of first obtaining a fresh or flash frozen neat semen sample in LN2 or dry ice. Samples are then sent to a SCSA diagnostic laboratory where the samples are thawed, diluted to {approx}1-2 x 106 sperm/ml, treated for 30 s with a pH 1.2 detergent buffer and then stained with acridine orange (AO). The low pH partially denatures DNA at the sites of DNA strand breaks and the AO-ssDNA fluoresces red while the AO-dsDNA fluoresces green. Flow cytometry measurements of 5000 sperm/sample provide statistically robust data on the ratio of red to green sperm, the extent of the DNA fragmentation and the standard deviations of measures. Numerous experiments on rodents treated with reproductive toxicants clearly showed that SCSA measures are highly dose responsive and have a very low CV. Different agents that act on germ cells at various stages of development usually showed sperm DNA fragmentation when that germ cell fraction arrived in the epididymis or ejaculate. Some of these treated samples were capable of successful in vitro fertilization but with frequent embryo failure. A 2-year longitudinal study of men living a valley town with a reported abnormal level of infertility and spontaneous miscarriages and also a seasonal atmospheric smog pollution, showed, for the first time, that SCSA measurements of human sperm DNA fragmentation were detectable and correlated with dosage of air pollution while the classical semen measures were not correlated. Also, young men spraying pesticides without protective gear are at an increased risk for

  1. Evaluation of antiviral resistant hepatitis B virus subpopulations in patients with chronic hepatitis B by using terminal restriction fragment length polymorphism.

    PubMed

    Şahin, Ergin

    2015-12-01

    Antiviral therapies with nucleotide analogues (NA) is crucial in the treatment of chronic hepatitis B as it substantially protects patients from the complications of the disease . However in most of the available NA therapies, resistance emerges in the patients' HBV populations. Therefore, detection of antiviral resistance as early as possible by means of genotypically monitoring the patients' HBV pool during NA therapy is critical to manage treatment regime. In this research study we have investigated the sensitivity and specificity of the terminal restriction fragment length polymorphism (T-RFLP) method in detecting HBV subpopulations carrying antiviral resistance mutations. For this aim, differentiation of mutant strains from wild type strains was demonstrated by PCR-RFLP method. With using recombinant plasmids containing mutant and wild type HBV genomes, we constructed artificial HBV genome populations in order to determine the sensitivity of PCR-T-RFLP method in detecting antiviral resistant minor HBV populations. Finally by comparing with the DNA sequencing method, we demonstrated the specificity of T-RFLP method in genotyping HBV populations. As a result we showed that T-RFLP is able to detect HBV subpopulations representing as low as 1 % of the whole viral population. Additionally T-RFLP showed 100 % concordance with the DNA sequencing method in genotyping HBV populations. As a conclusion, considering the other genotyping methods used in evaluating HBV populations, T-RFLP showed high sensitivity and specificity profiles in detecting antiviral resistant HBV subpopulations. Therefore T-RFLP method can be easily employed in genotypic evaluation of patients' HBV populations during the course of antiviral treatment.

  2. Modification-dependent restriction endonuclease, MspJI, flips 5-methylcytosine out of the DNA helix

    DOE PAGES

    Horton, J. R.; Wang, H.; Mabuchi, M. Y.; ...

    2014-09-27

    MspJI belongs to a family of restriction enzymes that cleave DNA containing 5-methylcytosine (5mC) or 5-hydroxymethylcytosine (5hmC). MspJI is specific for the sequence 5(h)mC-N-N-G or A and cleaves with some variability 9/13 nucleotides downstream. Earlier, we reported the crystal structure of MspJI without DNA and proposed how it might recognize this sequence and catalyze cleavage. Here we report its co-crystal structure with a 27-base pair oligonucleotide containing 5mC. This structure confirms that MspJI acts as a homotetramer and that the modified cytosine is flipped from the DNA helix into an SRA-like-binding pocket. We expected the structure to reveal two DNAmore » molecules bound specifically to the tetramer and engaged with the enzyme's two DNA-cleavage sites. A coincidence of crystal packing precluded this organization, however. We found that each DNA molecule interacted with two adjacent tetramers, binding one specifically and the other non-specifically. The latter interaction, which prevented cleavage-site engagement, also involved base flipping and might represent the sequence-interrogation phase that precedes specific recognition. MspJI is unusual in that DNA molecules are recognized and cleaved by different subunits. Such interchange of function might explain how other complex multimeric restriction enzymes act.« less

  3. Restriction fragment length polymorphism mapping of quantitative trait loci for malaria parasite susceptibility in the mosquito Aedes aegypti

    SciTech Connect

    Severson, D.W.; Thathy, V.; Mori, A.

    1995-04-01

    Susceptibility of the mosquito Aedes aegypti to the malarial parasite Plasmodium gallinaceum was investigated as a quantitative trait using restriction fragment length polymorphisms (RFLP). Two F{sub 2} populations of mosquitoes were independently prepared from pairwise matings between a highly susceptible and a refractory strain of A. aegypti. RFLP were tested for association with oocyst development on the mosquito midgut. Two putative quantitative trait loci (QTL) were identified that significantly affect susceptibility. One QTL, pgs [2,LF98], is located on chromosome 2 and accounted for 65 and 49% of the observed phenotypic variance in the two populations, respectively. A second QTL, pgs[3,MalI], is located on chromosome 3 and accounted for 14 and 10% of the observed phenotypic variance in the two populations, respectively. Both QTL exhibit a partial dominance effect on susceptibility, wherein the dominance effect is derived from the refractory parent. No indication of epistasis between these QTL was detected. Evidence suggests that either a tightly linked cluster of independent genes or a single locus affecting susceptibility to various mosquito-borne parasites and pathogens has evolved near the LF98 locus; in addition to P. gallinaceum susceptibility, this general genome region has previously been implicated in susceptibility to the filaria nematode Brugia malayi and the yellow fever virus. 35 refs., 2 figs., 3 tabs.

  4. Resolution of quantitative traits into Mendelian factors by using a complete linkage map of restriction fragment length polymorphisms.

    PubMed

    Paterson, A H; Lander, E S; Hewitt, J D; Peterson, S; Lincoln, S E; Tanksley, S D

    1988-10-20

    The conflict between the Mendelian theory of particulate inheritance and the observation of continuous variation for most traits in nature was resolved in the early 1900s by the concept that quantitative traits can result from segregation of multiple genes, modified by environmental effects. Although pioneering experiments showed that linkage could occasionally be detected to such quantitative trait loci (QTLs), accurate and systematic mapping of QTLs has not been possible because the inheritance of an entire genome could not be studied with genetic markers. The use of restriction fragment length polymorphisms (RFLPs) has made such investigations possible, at least in principle. Here, we report the first use of a complete RFLP linkage map to resolve quantitative traits into discrete Mendelian factors, in an interspecific back-cross of tomato. Applying new analytical methods, we mapped at least six QTLs controlling fruit mass, four QTLs for the concentration of soluble solids and five QTLs for fruit pH. This approach is broadly applicable to the genetic dissection of quantitative inheritance of physiological, morphological and behavioural traits in any higher plant or animal.

  5. Assessment of microbial dynamics in the Pearl River Estuary by 16S rRNA terminal restriction fragment analysis

    NASA Astrophysics Data System (ADS)

    Wu, Madeline; Song, Liansheng; Ren, Jianping; Kan, Jianjun; Qian, Pei-Yuan

    2004-10-01

    We have evaluated the feasibility of using the terminal restriction fragment length polymorphism (T-RFLP) pattern of polymerase chain reaction (PCR) amplified 16S rRNA sequences to track the changes of the free-living bacterial community for the Pearl River Estuary surface waters. The suitability of specific PCR primers, PCR bias induced by thermal cycles, and field-sampling volumes were critically evaluated in laboratory tests. We established a workable protocol and obtained TRF patterns that reflected the changes in the bacterial population. The temporal dynamics over a 24 h period were examined at one anchored station, as well as the spatial distribution pattern of the bacterial community at several stations, covering the transects along the river discharge direction and across the river plume. The TRF pattern revealed 9 dominant bacterial groups. Changes in their relative abundance reflecting the changes in the bacterial community composition were documented. Many culturable species were isolated from each field sample and a portion of the 16S rRNA gene for each species was sequenced. The species was identified based on sequence data comparison. In this region, the dominant species belong to the γ-subdivision of proteobacteria and the Bacillus/Clostridium group of Firmicutes. We also detected the wide spread distribution of Acinetobacter spp.; many of these species are known nosocomial pathogen for humans.

  6. Diversity analysis of bacterial community compositions in sediments of urban lakes by terminal restriction fragment length polymorphism (T-RFLP).

    PubMed

    Zhao, Dayong; Huang, Rui; Zeng, Jin; Yan, Wenming; Wang, Jianqun; Ma, Ting; Wang, Meng; Wu, Qinglong L

    2012-11-01

    Bacteria are crucial components in lake sediments and play important role in various environmental processes. Urban lakes in the densely populated cities are often small, shallow, highly artificial and hypereutrophic compared to rural and natural lakes and have been overlooked for a long time. In the present study, bacterial community compositions in surface sediments of three urban lakes (Lake Mochou, Lake Qianhu and Lake Zixia) in Nanjing City, China, were investigated using the terminal restriction fragment length polymorphism (T-RFLP) of PCR-amplified 16S rRNA gene and clone libraries. Remarkable differences in the T-RFLP patterns were observed in different lakes or different sampling stations of the same lake. Canonical correspondence analysis indicated that total nitrogen (TN) had significant effects on bacterial community structure in the lake sediments. Chloroflexi were the most dominant bacterial group in the clone library from Lake Mochou (21.7 % of the total clones) which was partly associated with its higher TN and organic matters concentrations. However, Bacteroidetes appeared to be dominated colonizers in the sediments of Lake Zixia (20.4 % of the total clones). Our study gives a comprehensive insight into the structure of bacterial community of urban lake sediments, indicating that the environmental factors played a key role in influencing the bacterial community composition in the freshwater ecosystems.

  7. An Improved PCR-Restriction Fragment Length Polymorphism (RFLP) Method for the Identification of cry1-Type Genes

    PubMed Central

    Shu, Changlong; Liu, Dongming; Zhou, Zishan; Cai, Jilin; Peng, Qi; Gao, Jiguo; Song, Fuping

    2013-01-01

    The cry1-type genes of Bacillus thuringiensis represent the largest cry gene family, which contains 50 distinct holotypes. It is becoming more and more difficult to identify cry1-type genes using current methods because of the increasing number of cry1-type genes. In the present study, an improved PCR-restriction fragment length polymorphism (PCR-RFLP) method which can distinguish 41 holotypes of cry1-type genes was developed. This improved method was used to identify cry1-type genes in 20 B. thuringiensis strains that are toxic to lepidoptera. The results showed that the improved method can efficiently identify single and clustered cry1-type genes and can be used to evaluate cry1-type genes in novel strain collections of B. thuringiensis. Among the detected cry1-type genes, we identified four novel genes, cry1Ai, cry1Bb, cry1Ja, and cry1La. The bioassay results from the expressed products of the four novel cry genes showed that Cry1Ai2, Cry1Bb2, and Cry1Ja2 were highly toxic against Plutella xylostella, whereas Cry1La2 exhibited no activity. Moreover, Cry1Ai2 had good lethal activity against Ostrinia furnacalis, Hyphantria cunea, Chilo suppressalis, and Bombyx mori larvae and considerable weight loss activity against Helicoverpa armigera. PMID:23995930

  8. Molecular Epidemiology of Leptospirosis in Northern Iran by Nested Polymerase Chain Reaction/Restriction Fragment Length Polymorphism and Sequencing Methods

    PubMed Central

    Zakeri, Sedigheh; Sepahian, Neda; Afsharpad, Mandana; Esfandiari, Behzad; Ziapour, Peyman; Djadid, Navid D.

    2010-01-01

    This study was conducted to investigate the prevalence of Leptospira species in Mazandaran Province of Iran by using nested polymerase chain reaction (PCR)/restriction fragment length polymorphism (RFLP) methods and sequencing analysis. Blood samples (n = 119) were collected from humans suspected of having leptospirosis from different parts of the province in 2007. By using an indirect immunofluorescent antibody test (IFAT), we determined that 35 (29.4%) of 119 suspected cases had leptospiral antibody titers ≥ 1:80, which confirmed the diagnosis of leptospirosis. Nested PCR assay also determined that 60 (50.4%) of 119 samples showed Leptospira infection. Furthermore, 44 (73.3%) of 60 confirmed leptospirosis amplified products were subjected to sequencing analysis. Sequence alignment identified L. interrogans, L. kirschneri, and L. wolffii species. All positive cases diagnosed by IFAT or PCR were in patients who reported contact with animals, high-risk occupational activities, and exposure to contaminated water. Therefore, it is important to increase attention about this disease among physicians and to strengthen laboratory capacity for its diagnosis in infected patients in Iran. PMID:20439973

  9. IS1245 restriction fragment length polymorphism typing of Mycobacterium avium from patients admitted to a reference hospital in Campinas, Brazil.

    PubMed

    Panunto, A C; Villares, M C B; Ramos, M C

    2003-10-01

    Mycobacterium avium is an important pathogen among immunodeficient patients, especially patients with AIDS. The natural history of this disease is unclear. Several environmental sources have been implicated as the origin of this infection. Polyclonal infection with this species is observed, challenging the understanding of its pathogenesis and treatment. In the present study 45 M. avium strains were recovered from 39 patients admitted to a reference hospital between 1996 and 1998. Species identification was performed using a species-specific nucleic acid hybridization test (AccuProbe) from Gen-Probe. Strains were genotyped using IS1245 restriction fragment length polymorphism typing. Blood was the main source of the organism. In one patient with disseminated disease, M. avium could be recovered more than once from potentially sterile sites. Strains isolated from this patient had different genotypes, indicating that the infection was polyclonal. Four patient clones were characterized in this population, the largest clone being detected in eight patients. This finding points to a common-source transmission of the organism.

  10. Proliferation, DNA ploidy, p53 overexpression and nuclear DNA fragmentation in six equine melanocytic tumours.

    PubMed

    Roels, S; Tilmant, K; Van Daele, A; Van Marck, E; Ducatelle, R

    2000-09-01

    Melanocytic tumours are a well-known clinical and pathological entity in horses, but further phenotypic characterization of these tumours is lacking. Six melanocytic tumours from five horses (two metastatic and four benign) were examined by Ki67, PCNA and p53 immunostaining, DNA nick end labelling (Tunel) and Feulgen staining. The stainings were evaluated using quantitative image analysis. The resulting parameters of growth fraction (Ki67), S-phase index (PCNA), p53 index, apoptotic index, DNA index, nuclear diameter, ploidy balance, proliferation index (Feulgen) and hyperploidy were analysed. The metastatic melanomas showed overexpression of p53 in a large portion of the cells. Apoptosis was also found in the metastatic melanomas. No differences were found in growth fraction, S-phase index (PCNA) nor in DNA configuration between the metastatic and the benign tumours. No immunohistochemical evidence of mutant p53 could be found in the tumours. In conclusion, melanocytic tumours in horses seem to have different phenotypic characteristics in comparison with melanocytic tumours in dogs, cats and humans, especially with respect to proliferative activity of the benign tumours. Therefore, markers put forward in these other species for predicting the clinical behaviour of the melanomas seem to be of no value in the horse. Moreover, quantitative DNA changes or p53 mutations do not seem to be involved in tumourogenesis in these cases.

  11. Low energy electron induced fragmentation and reactions of DNA and its molecular components

    NASA Astrophysics Data System (ADS)

    Bass, Andrew

    2005-05-01

    Much research has been stimulated by the recognition that ionizing radiation can, in condensed matter, generate large numbers of secondary electrons with energies less than 20 eV [1] and by the experimental demonstration that such electrons may induce both single and double strand breaks in plasmid DNA [2]. Identifying the underlying mechanisms involves several research methodologies, from further experiments with DNA to studies of the electron interaction with the component `sub-units' of DNA in both the gas and condensed phases [3]. In particular, understanding electron-induced strand break damage, the type of damage most difficult for organisms to repair, necessitates study of the sub-units of DNA back-bone, and here Tetrahyrofuran (THF) and its derivatives, provide a useful model for the furyl ring at the centre of the deoxyribose sugar. In this contribution, we review with particular reference to DNA and related molecules, the use of electron spectroscopy and mass spectrometry to study electron-induced fragmentation and reactions in thin molecular solids. We describe a newly completed instrument that combines laser post-ionization with a time-of-flight mass analyzer for highly sensitive ion and neutral detection. Use of the instrument is illustrated with results for THF and derivatives. Anion desorption measurements reveal the role of transient negative ions (TNI) and Dissociative Electron Attachment in significant molecular fragmentation and permit effective cross sections for this electron-induced damage to be obtained. The neutral yield functions also illustrate the importance of TNI, mirroring features seen in recently measured cross sections for electron induced aldehyde production in THF [4]. 1. J. A. Laverne and S. M. Pimblott, Radiat. Res. 141, 208 (1995) 2. B. Boudaiffa, et al, Science 287, 1658 (2000) 3. L. Sanche. Physica Scripta. 68, C108, (2003) 4. S.-P. Breton, et al.,J. Chem. Phys. 121, 11240 (2004)

  12. Influence of bovine sperm DNA fragmentation and oxidative stress on early embryo in vitro development outcome.

    PubMed

    Simões, Renata; Feitosa, Weber Beringui; Siqueira, Adriano Felipe Perez; Nichi, Marcilio; Paula-Lopes, Fabíola Freitas; Marques, Mariana Groke; Peres, Maria Angélica; Barnabe, Valquíria Hyppolito; Visintin, José Antônio; Assumpção, Mayra Elena Ortiz

    2013-01-01

    Sperm chromatin fragmentation may be caused by a number of factors, the most significant of which is reactive oxygen species. However, little is known about the effect of sperm oxidative stress (OS) on DNA integrity, fertilization, and embryonic development in cattle. Therefore, the goal of this study was to evaluate the influence of sperm OS susceptibility on the DNA fragmentation rate and in vitro embryo production (IVP) in a population of bulls. Groups of cryopreserved sperm samples were divided into four groups, based on their susceptibility to OS (G1, low OS; G2, average OS; G3, high OS; and G4, highest OS). Our results demonstrated that the sperm DNA integrity was compromised in response to increased OS susceptibility. Furthermore, semen samples with lower susceptibility to OS were also less susceptible to DNA damage (G1, 4.06%; G2, 6.09%; G3, 6.19%; and G4, 6.20%). In addition, embryo IVP provided evidence that the embryo cleavage rate decreased as the OS increased (G1, 70.18%; G2, 62.24%; G3, 55.85%; and G4, 50.93%), but no significant difference in the blastocyst rate or the number of blastomeres was observed among the groups. The groups with greater sensitivity to OS were also associated with a greater percentage of apoptotic cells (G1, 2.6%; G2, 2.76%; G3, 5.59%; and G4, 4.49%). In conclusion, we demonstrated that an increased susceptibility to OS compromises sperm DNA integrity and consequently reduces embryo quality.

  13. Evaluation of DNA fragmentation in llama (Lama glama) sperm using the sperm chromatin dispersion test.

    PubMed

    Carretero, M I; Lombardo, D; Arraztoa, C C; Giuliano, S M; Gambarotta, M C; Neild, D M

    2012-03-01

    The integrity of sperm chromatin is now viewed as an important factor in male fertility and in early embryonic development. The objectives of this study were: (1) adapt the simple and inexpensive sperm chromatin dispersion (SCD) test to evaluate DNA fragmentation in llama sperm and establish the halo patterns observed in this species, (2) determine an effective and reliable positive control for this technique and (3) evaluate correlation between the SCD test and the toluidine blue (TB) stain. To adapt the SCD test, three different mercaptoethanol (ME) concentrations were assayed (2.5%, 5% and 10% ME). To determine an effective positive control, three treatments (incubation at 100 °C for 30 min, incubation with 0.3 M NaOH for 30 min at room temperature and exposure to UV light for 2h) were assayed. The concentration selected to use in the SCD test was 5% ME, because it produced the largest halo while still conserving the structure of the core. Four DNA dispersion patterns were clearly observed: (I) nuclei with large DNA dispersion halos; (II) nuclei with medium halos; (III) nuclei with very small halos and (IV) nuclei with no halo. All treatments used as positive controls were effective in producing DNA fragmentation. A high correlation (r=0.84, P=0.03) was observed between spermatozoa without halos and TB positive cells. To conclude, SCD patterns in llama sperm have been established as well as a repeatable positive control for the assay. The SCD test and TB stain are simple and inexpensive techniques that can be used to evaluate DNA damage in llama sperm.

  14. DNA fragmentation and nuclear phenotype in tendons exposed to low-intensity infrared laser

    NASA Astrophysics Data System (ADS)

    de Paoli, Flavia; Ramos Cerqueira, Larissa; Martins Ramos, Mayara; Campos, Vera M.; Ferreira-Machado, Samara C.; Geller, Mauro; de Souza da Fonseca, Adenilson

    2015-03-01

    Clinical protocols are recommended in device guidelines outlined for treating many diseases on empirical basis. However, effects of low-intensity infrared lasers at fluences used in clinical protocols on DNA are controversial. Excitation of endogenous chromophores in tissues and free radicals generation could be described as a consequence of laser used. DNA lesions induced by free radicals cause changes in DNA structure, chromatin organization, ploidy degrees and cell death. In this work, we investigated whether low-intensity infrared laser therapy could alter the fibroblasts nuclei characteristics and induce DNA fragmentation. Tendons of Wistar rats were exposed to low-intensity infrared laser (830 nm), at different fluences (1, 5 and 10 J/cm2), in continuous wave (power output of 10mW, power density of 79.6 mW/cm2). Different frequencies were analyzed for the higher fluence (10 J/cm2), at pulsed emission mode (2.5, 250 and 2500 Hz), with the laser source at surface of skin. Geometric, densitometric and textural parameters obtained for Feulgen-stained nuclei by image analysis were used to define nuclear phenotypes. Significant differences were observed on the nuclear phenotype of tendons after exposure to laser, as well as, high cell death percentages was observed for all fluences and frequencies analyzed here, exception 1 J/cm2 fluence. Our results indicate that low-intensity infrared laser can alter geometric, densitometric and textural parameters in tendon fibroblasts nuclei. Laser can also induce DNA fragmentation, chromatin lost and consequently cell death, using fluences, frequencies and emission modes took out from clinical protocols.

  15. Multiple Determinations of Sperm DNA Fragmentation Show That Varicocelectomy Is Not Indicated for Infertile Patients with Subclinical Varicocele

    PubMed Central

    García-Peiró, Agustín; Ribas-Maynou, Jordi; Oliver-Bonet, María; Navarro, Joaquima; Checa, Miguel A.; Nikolaou, Alexandros; Amengual, María J.; Abad, Carlos; Benet, Jordi

    2014-01-01

    Varicocele is one of the most common causes of low semen quality, which is reflected in high percentages of sperm cells with fragmented DNA. While varicocelectomy is usually performed to ameliorate a patient's fertility, its impact on sperm DNA integrity in the case of subclinical varicocele is poorly documented. In this study, multiple DNA fragmentation analyses (TUNEL, SCD, and SCSA) were performed on semen samples from sixty infertile patients with varicocele (15 clinical varicoceles, 19 clinical varicoceles after surgical treatment, 16 subclinical varicoceles, and 10 subclinical varicoceles after surgical treatment). TUNEL, SCD, and SCSA assays all showed substantial sperm DNA fragmentation levels that were comparable between subclinical and clinical varicocele patients. Importantly, varicocelectomy did improve sperm quality in patients with clinical varicocele; however, this was not the case in patients with subclinical varicocele. In summary, although infertile patients with clinical and subclinical varicocele have similar sperm DNA quality, varicocelectomy should only be advised for patients with clinical varicocele. PMID:24967335

  16. Caspase-3 activation and DNA fragmentation in primary hippocampal neurons following glutamate excitotoxicity.

    PubMed

    Brecht, S; Gelderblom, M; Srinivasan, A; Mielke, K; Dityateva, G; Herdegen, T

    2001-10-19

    Excitotoxic glutamate CNS stimulation can result in neuronal cell death. Contributing mechanisms and markers of cell death are the activation of caspase-3 and DNA fragmentation. It remains to be resolved to which extent both cellular reactions overlap and/or indicate different processes of neurodegeneration. In this study, mixed neuronal cultures from newborn mice pubs (0-24 h) were stimulated with glutamate, and the co-localization of active caspase-3 and DNA fragmentation was investigated by immunocytochemistry and the TUNEL nick-end labelling. In untreated cultures, 8% scattered neurons (marked by MAP-2) displayed activated caspase-3 at different morphological stages of degeneration. TUNEL staining was detected in 5% of cell nuclei including GFAP-positive astrocytes. However, co-localization of active caspase-3 with TUNEL was less than 2%. After glutamate stimulation (125 microM), the majority of neurons was dying between 12 and 24 h. The absolute number of active caspase-3 neurons increased only moderately but in relation of surviving neurons after 24 h from 8 to 36% (125 microM), to 53% (250 microM) or to 32% (500 microM). TUNEL staining also increased after 24 h following glutamate treatment to 37% but the co-localization with active caspase-3 remained at the basal low level of 2%. In our system, glutamate-mediated excitotoxicity effects the DNA fragmentation and caspase-3 activation. Co-localization of both parameters, however, is very poor. Active caspase-3 in the absence of TUNEL indicates a dynamic degenerative process, whereas TUNEL marks the end stage of severe irreversible cell damage regardless to the origin of the cell.

  17. Sequence context effects on 8-methoxypsoralen photobinding to defined DNA fragments

    SciTech Connect

    Sage, E.; Moustacchi, E.

    1987-06-16

    The photoreaction of 8-methoxypsoralen (8-MOP) with DNA fragments of defined sequence was studied. The authors took advantage of the blockage by bulky adducts of the 3'-5'-exonuclease activity associated with the T4 DNA polymerase. The action of the exonuclease is stopped by biadducts as well as by monoadducts. The termination products were analyzed on sequencing gels. A strong sequence specificity was observed in the DNA photobinding of 8-MOP. The exonuclease terminates its digestion near thymine residues, mainly at potentially cross-linkable sites. There is an increasing reactivity of thymine residues in the order T < TT << TTT in a GC environment. For thymine residues in cross-linkable sites, the reactivity follows the order AT << TA approx. TAT << ATA < ATAT < ATATAA. Repeated A-T sequences are hot spots for the photochemical reaction of 8-MOP with DNA. Both monoadducts and interstrand cross-links are formed preferentially in 5'-TpA sites. The results highlight the role of the sequence and consequently of the conformation around a potential site in the photobinding of 8-MOP to DNA.

  18. Correlation between sperm DNA fragmentation index and CMA3 positive spermatozoa in globozoospermic patients.

    PubMed

    Hosseinifar, H; Yazdanikhah, S; Modarresi, T; Totonchi, M; Sadighi Gilani, M A; Sabbaghian, M

    2015-05-01

    The absence of the acrosome causes the situation which is called globozoospermia. There are a few studies, mostly as case reports, about correlation between levels of sperm DNA damage in patients with total round-headed spermatozoa. We investigated this correlation as well as CMA3 positive spermatozoa in 20 globozoospermic men (with more than 90% round-headed spermatozoa) attending to Royan Institute. Semen samples divided into three parts to semen analysis, to measure DNA fragmentation index (DFI) using sperm chromatin structure assay (SCSA) and to detect CMA3(+) sperm cells by chromomycin A3 staining and fluorescent microscopy. Our results showed that there were significant differences in sperm concentration, total sperm motility, and normal morphology between patients and controls group (p < 0.001). Moreover, the average of DFI and CMA3 positive spermatozoa in patients group significantly increases compared with control group (p < 0.001). A significant correlation between DFI and CMA3(+) in total population was also detected in patients group (r = 0.45, p = 0.046). To our knowledge, this is the largest study about correlation between DNA damage levels and CMA3 positive spermatozoa with round head sperm cells in total globozoospermic men. It seems that the increase in DNA damage may be because of defective sperm DNA compaction, as we detected CMA3 positive sperm cells in these patients.

  19. The use of biphasic linear ramped pulsed field gel electrophoresis to quantify DNA damage based on fragment size distribution

    SciTech Connect

    Lawrence, T.S.; Normolle, D.P.; Davis, M.A.; Maybaum, J.

    1993-10-20

    The development of biphasic linear pulse ramping gel electrophoresis has permitted resolution of DNA fragments from 200 Kbp to 6 Mbp in a single gel. We used this technique to measure radiation-induced DNA damage based on fragment size. Human colon cancer cells (HT29 and LS174T) and Chinese hamster ovary cells were embedded in agarose, deproteinized, irradiated with 5-80 Gy, and assessed for DNA double strand breakage using pulsed field gel electrophoresis. The frequency of DNA double strand breakage determined using a previously published method was compared to the breakage frequency calculated using the fragment size distribution. Both methods produced similar estimates for breakage frequency of approximately 5 {times} 10{sup {minus}9} breaks Gy{sup {minus}1} bp{sup {minus}1}. These findings suggest that biphasic linear pulse ramping gel electrophoresis can yield a quantitative estimate of DNA fragment distribution resulting from irradiation. The ability to quantify the distribution of DNA fragment sizes produced by irradiation should yield information concerning the mechanisms of both DNA double strand break induction and repair. 16 refs., 5 figs.

  20. Melting profiles may affect detection of residual HPV L1 gene DNA fragments in Gardasil®.

    PubMed

    Lee, Sin Hang

    2014-03-01

    Gardasil® is a quadrivalent human papillomavirus (HPV) protein-based vaccine containing genotype-specific L1 capsid proteins of HPV-16, HPV-18, HPV-6 and HPV-11 in the form of virus-like-particles (VLPs) as the active ingredient. The VLPs are produced by a DNA recombinant technology. It is uncertain if the residual HPV L1 gene DNA fragments in the vaccine products are considered contaminants or excipients of the Gardasil® vaccine. Because naked viral DNA fragments, if present in the vaccine, may bind to the insoluble amorphous aluminum hydroxyphosphate sulfate (AAHS) adjuvant which may help deliver the foreign DNA into macrophages, causing unintended pathophysiologic effects, experiments were undertaken to develop tests for HPV L1 gene DNA fragments in the final products of Gardasil® by polymerase chain reaction (PCR) and direct DNA sequencing. The results showed that while the HPV-11 and HPV-18 L1 gene DNA fragments in Gardasil® were readily amplified by the common GP6/MY11 degenerate consensus primers, the HPV-16 L1 gene DNA may need specially designed non-degenerate PCR primers for amplification at different regions of the L1 gene and different stringency conditions for detection. These variable melting profiles of HPV DNA in the insoluble fraction of the Gardasil® vaccine suggest that the HPV DNA fragments are firmly bound to the aluminum AAHS adjuvant. All methods developed for detecting residual HPV DNA in the vaccine Gardasil® for quality assurance must take into consideration the variable melting profiles of the DNA to avoid false negative results.

  1. Overcoming restriction as a barrier to DNA transformation in Caldicellulosiruptor species results in efficient marker replacement

    PubMed Central

    2013-01-01

    Background Thermophilic microorganisms have special advantages for the conversion of plant biomass to fuels and chemicals. Members of the genus Caldicellulosiruptor are the most thermophilic cellulolytic bacteria known. They have the ability to grow on a variety of non-pretreated biomass substrates at or near ~80°C and hold promise for converting biomass to bioproducts in a single step. As for all such relatively uncharacterized organisms with desirable traits, the ability to genetically manipulate them is a prerequisite for making them useful. Metabolic engineering of pathways for product synthesis is relatively simple compared to engineering the ability to utilize non-pretreated biomass. Results Here we report the construction of a deletion of cbeI (Cbes2438), which encodes a restriction endonuclease that is as a major barrier to DNA transformation of C. bescii. This is the first example of a targeted chromosomal deletion generated by homologous recombination in this genus and the resulting mutant, JWCB018 (ΔpyrFA ΔcbeI), is readily transformed by DNA isolated from E. coli without in vitro methylation. PCR amplification and sequencing suggested that this deletion left the adjacent methyltransferase (Cbes2437) intact. This was confirmed by the fact that DNA isolated from JWCB018 was protected from digestion by CbeI and HaeIII. Plasmid DNA isolated from C. hydrothermalis transformants were readily transformed into C. bescii. Digestion analysis of chromosomal DNA isolated from seven Caldicellulosiruptor species by using nine different restriction endonucleases was also performed to identify the functional restriction-modification activities in this genus. Conclusion Deletion of the cbeI gene removes a substantial barrier to routine DNA transformation and chromosomal modification of C. bescii. This will facilitate the functional analyses of genes as well as metabolic engineering for the production of biofuels and bioproducts from biomass. An analysis of

  2. Identification of column edges of DNA fragments by using K-means clustering and mean algorithm on lane histograms of DNA agarose gel electrophoresis images

    NASA Astrophysics Data System (ADS)

    Turan, Muhammed K.; Sehirli, Eftal; Elen, Abdullah; Karas, Ismail R.

    2015-07-01

    Gel electrophoresis (GE) is one of the most used method to separate DNA, RNA, protein molecules according to size, weight and quantity parameters in many areas such as genetics, molecular biology, biochemistry, microbiology. The main way to separate each molecule is to find borders of each molecule fragment. This paper presents a software application that show columns edges of DNA fragments in 3 steps. In the first step the application obtains lane histograms of agarose gel electrophoresis images by doing projection based on x-axis. In the second step, it utilizes k-means clustering algorithm to classify point values of lane histogram such as left side values, right side values and undesired values. In the third step, column edges of DNA fragments is shown by using mean algorithm and mathematical processes to separate DNA fragments from the background in a fully automated way. In addition to this, the application presents locations of DNA fragments and how many DNA fragments exist on images captured by a scientific camera.

  3. Analysis of DNA from post-blast pipe bomb fragments for identification and determination of ancestry.

    PubMed

    Tasker, Esiri; LaRue, Bobby; Beherec, Charity; Gangitano, David; Hughes-Stamm, Sheree

    2017-05-01

    Improvised explosive devices (IEDs) such as pipe bombs are weapons used to detrimentally affect people and communities. A readily accessible brand of exploding targets called Tannerite® has been identified as a potential material for abuse as an explosive in pipe bombs. The ability to recover and genotype DNA from such weapons may be vital in the effort to identify suspects associated with these devices. While it is possible to recover DNA from post-blast fragments using short tandem repeat markers (STRs), genotyping success can be negatively affected by low quantities of DNA, degradation, and/or PCR inhibitors. Alternative markers such as insertion/null (INNULs) and single nucleotide polymorphisms (SNPs) are bi-allelic genetic markers that are shorter genomic targets than STRs for amplification, which are more likely to resist degradation. In this study, we constructed pipe bombs that were spiked with known amounts of biological material to: 1) recover "touch" DNA from the surface of the device, and 2) recover traces of blood from the ends of wires (simulated finger prick). The bombs were detonated with the binary explosive Tannerite® using double-base smokeless powder to initiate the reaction. DNA extracted from the post-blast fragments was quantified with the Quantifiler® Trio DNA Quantification Kit. STR analysis was conducted using the GlobalFiler® Amplification Kit, INNULs were amplified using an early-access version of the InnoTyper™ 21 Kit, and SNP analysis via massively parallel sequencing (MPS) was performed using the HID-Ion Ampliseq™ Identity and Ancestry panels using the Ion Chef and Ion PGM sequencing system. The results of this study showed that INNUL markers resulted in the most complete genetic profiles when compared to STR and SNP profiles. The random match probabilities calculated for samples using INNULs were lower than with STRs when less than 14 STR alleles were reported. These results suggest that INNUL analysis may be well suited for

  4. PyroTRF-ID: a novel bioinformatics methodology for the affiliation of terminal-restriction fragments using 16S rRNA gene pyrosequencing data

    PubMed Central

    2012-01-01

    Background In molecular microbial ecology, massive sequencing is gradually replacing classical fingerprinting techniques such as terminal-restriction fragment length polymorphism (T-RFLP) combined with cloning-sequencing for the characterization of microbiomes. Here, a bioinformatics methodology for pyrosequencing-based T-RF identification (PyroTRF-ID) was developed to combine pyrosequencing and T-RFLP approaches for the description of microbial communities. The strength of this methodology relies on the identification of T-RFs by comparison of experimental and digital T-RFLP profiles obtained from the same samples. DNA extracts were subjected to amplification of the 16S rRNA gene pool, T-RFLP with the HaeIII restriction enzyme, 454 tag encoded FLX amplicon pyrosequencing, and PyroTRF-ID analysis. Digital T-RFLP profiles were generated from the denoised full pyrosequencing datasets, and the sequences contributing to each digital T-RF were classified to taxonomic bins using the Greengenes reference database. The method was tested both on bacterial communities found in chloroethene-contaminated groundwater samples and in aerobic granular sludge biofilms originating from wastewater treatment systems. Results PyroTRF-ID was efficient for high-throughput mapping and digital T-RFLP profiling of pyrosequencing datasets. After denoising, a dataset comprising ca. 10′000 reads of 300 to 500 bp was typically processed within ca. 20 minutes on a high-performance computing cluster, running on a Linux-related CentOS 5.5 operating system, enabling parallel processing of multiple samples. Both digital and experimental T-RFLP profiles were aligned with maximum cross-correlation coefficients of 0.71 and 0.92 for high- and low-complexity environments, respectively. On average, 63±18% of all experimental T-RFs (30 to 93 peaks per sample) were affiliated to phylotypes. Conclusions PyroTRF-ID profits from complementary advantages of pyrosequencing and T-RFLP and is particularly

  5. Novel extraction method of genomic DNA suitable for long-fragment amplification from small amounts of milk.

    PubMed

    Liu, Y F; Gao, J L; Yang, Y F; Ku, T; Zan, L S

    2014-11-01

    Isolation of genomic DNA is a prerequisite for assessment of milk quality. As a source of genomic DNA, milk somatic cells from milking ruminants are practical, animal friendly, and cost-effective sources. Extracting DNA from milk can avoid the stress response caused by blood and tissue sampling of cows. In this study, we optimized a novel DNA extraction method for amplifying long (>1,000 bp) DNA fragments and used it to evaluate the isolation of DNA from small amounts of milk. The techniques used for the separation of milk somatic cell were explored and combined with a sodium dodecyl sulfate (SDS)-phenol method for optimizing DNA extraction from milk. Spectrophotometry was used to determine the concentration and purity of the extracted DNA. Gel electrophoresis and DNA amplification technologies were used for to determine DNA size and quality. The DNA of 112 cows was obtained from milk (samples of 13 ± 1 mL) and the corresponding optical density ratios at 260:280 nm were between 1.65 and 1.75. Concentrations were between 12 and 45 μg/μL and DNA size and quality were acceptable. The specific PCR amplification of 1,019- and 729-bp bovine DNA fragments was successfully carried out. This novel method can be used as a practical, fast, and economical mean for long genomic DNA extraction from a small amount of milk.

  6. DNA fragmentation pattern in human fibroblasts after irradiation with iron ions

    NASA Astrophysics Data System (ADS)

    Campa, Alessandro

    and M. A. Tabocchini. DNA fragmentation induced in human fibroblasts by accelerated 56 Fe ions of differing energies. Radiat. Res. 165, 713-720 (2006). A. Campa, F. Ballarini, M. Belli, R. Cherubini, V. Dini, G. Esposito, W. Friedland, S. Gerardi, S. Molinelli, A. Ottolenghi, H. G. Paretzke, G. Simone and M. A. Tabocchini. DNA DSB induced in human cells by charged particles and gamma rays: experimental results and theoretical approaches. Int. J. Radiat. Biol. 81, 841-854 (2005). W. Friedland, P. Jacob, H. G. Paretzke, A. Ottolenghi, F. Ballarini and M. Liotta. Simulation of light ion induced DNA damge patterns. Radiat. Prot. Dosim. 122, 116-120 (2006).

  7. Programmed protection of foreign DNA from restriction allows pathogenicity island exchange during pneumococcal transformation.

    PubMed

    Johnston, Calum; Martin, Bernard; Granadel, Chantal; Polard, Patrice; Claverys, Jean-Pierre

    2013-02-01

    In bacteria, transformation and restriction-modification (R-M) systems play potentially antagonistic roles. While the former, proposed as a form of sexuality, relies on internalized foreign DNA to create genetic diversity, the latter degrade foreign DNA to protect from bacteriophage attack. The human pathogen Streptococcus pneumoniae is transformable and possesses either of two R-M systems, DpnI and DpnII, which respectively restrict methylated or unmethylated double-stranded (ds) DNA. S. pneumoniae DpnII strains possess DpnM, which methylates dsDNA to protect it from DpnII restriction, and a second methylase, DpnA, which is induced during competence for genetic transformation and is unusual in that it methylates single-stranded (ss) DNA. DpnA was tentatively ascribed the role of protecting internalized plasmids from DpnII restriction, but this seems unlikely in light of recent results establishing that pneumococcal transformation was not evolved to favor plasmid exchange. Here we validate an alternative hypothesis, showing that DpnA plays a crucial role in the protection of internalized foreign DNA, enabling exchange of pathogenicity islands and more generally of variable regions between pneumococcal isolates. We show that transformation of a 21.7 kb heterologous region is reduced by more than 4 logs in dpnA mutant cells and provide evidence that the specific induction of dpnA during competence is critical for full protection. We suggest that the integration of a restrictase/ssDNA-methylase couplet into the competence regulon maintains protection from bacteriophage attack whilst simultaneously enabling exchange of pathogenicicy islands. This protective role of DpnA is likely to be of particular importance for pneumococcal virulence by allowing free variation of capsule serotype in DpnII strains via integration of DpnI capsule loci, contributing to the documented escape of pneumococci from capsule-based vaccines. Generally, this finding is the first evidence for a

  8. The roles of family B and D DNA polymerases in Thermococcus species 9°N Okazaki fragment maturation.

    PubMed

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F

    2015-05-15

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed.

  9. The Roles of Family B and D DNA Polymerases in Thermococcus Species 9°N Okazaki Fragment Maturation*

    PubMed Central

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F.

    2015-01-01

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. PMID:25814667

  10. [Cloning of cDNA fragments related to adventitious root formation from mango cotyledon section].

    PubMed

    Xiao, Jie-Ning; Huang, Xue-Lin; Zhang, Yi-Shun; Li, Yin; Li, Xiao-Ju

    2004-04-01

    Two cut surfaces of mango cotyledon (distal and proximal cut surfaces) showed different capability of adventitious root formation, only proximal cut surface could be induced to form the roots and the distal cut surface did not. cDNA fragments related to adventitious root formation from the cut sections were isolated with suppressive subtractive hybridization. The forward substracted cDNA library was constructed using the cDNAs of distal (non-rooting) cut surface as driver and the cDNAs of proximal (rooting) cut surface as tester. Six positive clones were obtained by Virtual Northern blots. In this study, the putative up-regulated genes showed by sequence analysis were reported in mango for the first time, the deduced proteins among the positive clones were homologous to transporters, transcriptional regulators and enzymes.

  11. Characterization of the heterochromatin of the darkling beetle Misolampus goudoti: cloning of two satellite DNA families and digestion of chromosomes with restriction enzymes.

    PubMed

    Pons, J; Petitpierre, E; Juan, C

    1993-01-01

    The darkling beetle Misolampus goudoti Er. has 58% of C-banded chromosome material. In this paper we deal with the study of the heterochromatin of this insect both by molecular and cytogenetical methods. Two different satellite DNA families have been characterized in Misolampus goudoti by agarose gel electrophoresis of EcoRI and PstI restriction fragments, respectively. The EcoRI family is composed of a monomeric unit of 196 bp (64.3% A-T rich) DNA sequence, representing about 120,000 copies per haploid genome. The presence of frequent intermediate-size satellite variants and an internal direct repetition of 61 bp in the EcoRI repetitive main monomer suggest that the evolution of this satellite proceeded by unequal crossing-over, occurring both within and between the 196 bp unit. Another highly repetitive sequence, defined by digestion of genomic DNA with PstI, has a more complex unit of 1.2 kb with about 70,000 copies per haploid genome. In situ digestion of M. goudoti chromosomes with restriction enzymes shows a non-specific chromosome DNA extraction from pericentromeric positions with EcoRI and chromosome specific extraction of DNA with PstI and HinfI. This is discussed in relation to the chromosomal location of both satellites.

  12. Structure of the EndoMS-DNA Complex as Mismatch Restriction Endonuclease.

    PubMed

    Nakae, Setsu; Hijikata, Atsushi; Tsuji, Toshiyuki; Yonezawa, Kouki; Kouyama, Ken-Ichi; Mayanagi, Kouta; Ishino, Sonoko; Ishino, Yoshizumi; Shirai, Tsuyoshi

    2016-11-01

    Archaeal NucS nuclease was thought to degrade the single-stranded region of branched DNA, which contains flapped and splayed DNA. However, recent findings indicated that EndoMS, the orthologous enzyme of NucS, specifically cleaves double-stranded DNA (dsDNA) containing mismatched bases. In this study, we determined the structure of the EndoMS-DNA complex. The complex structure of the EndoMS dimer with dsDNA unexpectedly revealed that the mismatched bases were flipped out into binding sites, and the overall architecture most resembled that of restriction enzymes. The structure of the apo form was similar to the reported structure of Pyrococcus abyssi NucS, indicating that movement of the C-terminal domain from the resting state was required for activity. In addition, a model of the EndoMS-PCNA-DNA complex was preliminarily verified with electron microscopy. The structures strongly support the idea that EndoMS acts in a mismatch repair pathway.

  13. Sex determination in highly fragmented human DNA by high-resolution melting (HRM) analysis.

    PubMed

    Álvarez-Sandoval, Brenda A; Manzanilla, Linda R; Montiel, Rafael

    2014-01-01

    Sex identification in ancient human remains is a common problem especially if the skeletons are sub-adult, incomplete or damaged. In this paper we propose a new method to identify sex, based on real-time PCR amplification of small fragments (61 and 64 bp) of the third exon within the amelogenin gene covering a 3-bp deletion on the AMELX-allele, followed by a High Resolution Melting analysis (HRM). HRM is based on the melting curves of amplified fragments. The amelogenin gene is located on both chromosomes X and Y, showing dimorphism in length. This molecular tool is rapid, sensitive and reduces the risk of contamination from exogenous genetic material when used for ancient DNA studies. The accuracy of the new method described here has been corroborated by using control samples of known sex and by contrasting our results with those obtained with other methods. Our method has proven to be useful even in heavily degraded samples, where other previously published methods failed. Stochastic problems such as the random allele drop-out phenomenon are expected to occur in a less severe form, due to the smaller fragment size to be amplified. Thus, their negative effect could be easier to overcome by a proper experimental design.

  14. Sex Determination in Highly Fragmented Human DNA by High-Resolution Melting (HRM) Analysis

    PubMed Central

    Álvarez-Sandoval, Brenda A.; Manzanilla, Linda R.; Montiel, Rafael

    2014-01-01

    Sex identification in ancient human remains is a common problem especially if the skeletons are sub-adult, incomplete or damaged. In this paper we propose a new method to identify sex, based on real-time PCR amplification of small fragments (61 and 64 bp) of the third exon within the amelogenin gene covering a 3-bp deletion on the AMELX-allele, followed by a High Resolution Melting analysis (HRM). HRM is based on the melting curves of amplified fragments. The amelogenin gene is located on both chromosomes X and Y, showing dimorphism in length. This molecular tool is rapid, sensitive and reduces the risk of contamination from exogenous genetic material when used for ancient DNA studies. The accuracy of the new method described here has been corroborated by using control samples of known sex and by contrasting our results with those obtained with other methods. Our method has proven to be useful even in heavily degraded samples, where other previously published methods failed. Stochastic problems such as the random allele drop-out phenomenon are expected to occur in a less severe form, due to the smaller fragment size to be amplified. Thus, their negative effect could be easier to overcome by a proper experimental design. PMID:25098828

  15. Recognition of a Nocardia transvalensis complex by resistance to aminoglycosides, including amikacin, and PCR-restriction fragment length polymorphism analysis.

    PubMed

    Wilson, R W; Steingrube, V A; Brown, B A; Blacklock, Z; Jost, K C; McNabb, A; Colby, W D; Biehle, J R; Gibson, J L; Wallace, R J

    1997-09-01

    Amikacin resistance, rare among nocardiae, was observed in 58 clinical isolates of nocardiae. All of these isolates hydrolyzed hypoxanthine, and 75 to 100% utilized citrate, D-galactose, and D-trehalose as sole carbon sources. Based on utilization of I-erythritol, D-glucitol, i-myo-inositol, D-mannitol, and ribitol and susceptibility to amoxicillin-clavulanic acid, the 58 isolates were separable into four groups. One group was negative for I-erythritol and ribitol and included all the isolates belonging to Nocardia asteroides complex antibiogram type IV. The remaining three groups were positive for I-erythritol and ribitol and were grouped within Nocardia transvalensis. The group that included the type strain was designated N. transvalensis sensu stricto, and the other two groups were designated new taxons 1 and 2. PCR-restriction fragment length polymorphism (RFLP) analysis of a 439-bp segment of the 65-kDa heat shock protein gene with XhoI and HinfI produced identical patterns for 53 (91%) and 58 (100%) isolates, respectively, and differentiated them from all other Nocardia taxa. NarI- and HaeIII-derived RFLP patterns clearly differentiated each of the four biochemically defined taxa. These four groups were also distinguishable by using the chromogenic substrates in Dade MicroScan test panels. By high-performance liquid chromatography, these isolates exhibited the same unique mycolic acid-ester elution patterns that differed from those of all other clinically significant nocardiae. Gas-liquid chromatographic analysis of fatty acids also produced similar patterns for all isolates that distinguished them from all other Nocardia taxa, but did not differentiate the four taxa within the complex. We propose the designation N. transvalensis complex for these four groups of nocardiae, pending further genetic evaluation.

  16. Epidemiologic import of tuberculosis cases whose isolates have similar but not identical IS6110 restriction fragment length polymorphism patterns.

    PubMed

    Cave, M D; Yang, Z H; Stefanova, R; Fomukong, N; Ijaz, K; Bates, J; Eisenach, K D

    2005-03-01

    Isolates of Mycobacterium tuberculosis from patients with epidemiologic links frequently demonstrate identical IS6110 restriction fragment length polymorphism (RFLP) patterns (i.e., RFLP clustering) because they are infected with the same strain. Uncertainty arises with isolates that differ from one another by a few IS6110 hybridizing bands. During the period from 1 January 1996 to 31 December 1999, isolates from 585 tuberculosis (TB) cases were analyzed by RFLP, representing 98.2% of the 596 culture-positive TB cases reported in Arkansas during the study period. Of the 585 cases for which RFLP was available, 419 (71.6%) had an RFLP pattern with more than five copies of IS6110. Of the total 74 clusters, 48 comprised isolates with more than five copies of IS6110 and included 164 cases. Sixty-nine isolates with more than five copies of IS6110 comprising 16 clusters and 60 unique isolates were found to be similar to at least 1 other isolate (differing from it by one or two hybridizing bands). Among the 129 cases whose isolates were similar to other clustered or unique isolates, 16 cases were discovered with epidemiologic links: 14 (15.2%) were among the 92 cases with IS6110 RFLP patterns similar to those in clusters, and 2 (5.2%) were among the 37 unique cases that were similar to another unique case. The isolates from the epidemiologically linked patients shared common spoligotypes; all except one case shared common polymorphic GC-rich sequence (PGRS) patterns. Of the 129 patients whose isolates differed from another by one or two hybridizing IS6110 bands, 101 (78.3%) shared common spoligotypes and 87 (67.4%) shared common PGRS RFLP patterns.

  17. Monte Carlo predictions of DNA fragment-size distributions for large sizes after HZE particle irradiation

    NASA Technical Reports Server (NTRS)

    Ponomarev, A. L.; Cucinotta, F. A.; Sachs, R. K.; Brenner, D. J.

    2001-01-01

    DSBs (double-strand breaks) produced by densely ionizing space radiation are not located randomly in the genome: recent data indicate DSB clustering along chromosomes. DSB clustering at large scales, from >100 Mbp down to approximately 2 kbp, is modeled using a Monte-Carlo algorithm. A random-walk model of chromatin is combined with a track model, that predicts the radial distribution of energy from an ion, and the RLC (randomly-located-clusters) formalism, in software called DNAbreak. This model generalizes the random-breakage model, whose broken-stick fragment-size distribution is applicable to low-LET radiation. DSB induction due to track interaction with the DNA volume depends on the radiation quality parameter Q. This dose-independent parameter depends only weakly on LET. Multi-track, high-dose effects depend on the cluster intensity parameter lambda, proportional to fluence as defined by the RLC formalism. After lambda is determined by a numerical experiment, the model reduces to one adjustable parameter Q. The best numerical fits to the experimental data, determining Q, are obtained. The knowledge of lambda and Q allows us to give biophysically based extrapolations of high-dose DNA fragment-size data to low doses or to high LETs.

  18. Preparation of next-generation sequencing libraries using Nextera™ technology: simultaneous DNA fragmentation and adaptor tagging by in vitro transposition.

    PubMed

    Caruccio, Nicholas

    2011-01-01

    DNA library preparation is a common entry point and bottleneck for next-generation sequencing. Current methods generally consist of distinct steps that often involve significant sample loss and hands-on time: DNA fragmentation, end-polishing, and adaptor-ligation. In vitro transposition with Nextera™ Transposomes simultaneously fragments and covalently tags the target DNA, thereby combining these three distinct steps into a single reaction. Platform-specific sequencing adaptors can be added, and the sample can be enriched and bar-coded using limited-cycle PCR to prepare di-tagged DNA fragment libraries. Nextera technology offers a streamlined, efficient, and high-throughput method for generating bar-coded libraries compatible with multiple next-generation sequencing platforms.

  19. Short DNA Fragments Are a Hallmark of Heavy Charged-Particle Irradiation and May Underlie Their Greater Therapeutic Efficacy

    PubMed Central

    Pang, Dalong; Chasovskikh, Sergey; Rodgers, James E.; Dritschilo, Anatoly

    2016-01-01

    Growing interest in proton and heavy ion therapy has reinvigorated research into the fundamental biological mechanisms underlying the therapeutic efficacy of charged-particle radiation. To improve our understanding of the greater biological effectiveness of high-LET radiations, we have investigated DNA double-strand breaks (DSBs) following exposure of plasmid DNA to low-LET Co-60 gamma photon and electron irradiation and to high-LET Beryllium and Argon ions with atomic force microscopy. The sizes of DNA fragments following radiation exposure were individually measured to construct fragment size distributions from which the DSB per DNA molecule and DSB spatial distributions were derived. We report that heavy charged particles induce a significantly larger proportion of short DNA fragments in irradiated DNA molecules, reflecting densely and clustered damage patterns of high-LET energy depositions. We attribute the enhanced short DNA fragmentation following high-LET radiations as an important determinant of the observed, enhanced biological effectiveness of high-LET irradiations. PMID:27376024

  20. Cleavage of DNA containing 5-fluorocytosine or 5-fluorouracil by type II restriction endonucleases.

    PubMed

    Olszewska, Agata; Dadová, Jitka; Mačková, Michaela; Hocek, Michal

    2015-11-01

    A systematic study of the cleavage of DNA sequences containing 5-fluorocytosine or 5-fluorouracil by type II restriction endonucleases (REs) was performed and the results compared with the same sequences containing natural pyrimidine bases, uracil or 5-methylcytosine. The results show that some REs recognize fluorine as a hydrogen on cytosine and cleave the corresponding sequences where the presence of m5dC leads to blocking of the cleavage. However, on uracil, the same REs recognize the F as a methyl surrogate and cleave the sequences which are not cleaved if uracil is incorporated instead of thymine. These results are interesting for understanding the recognition of DNA sequences by REs and for manipulation of the specific DNA cutting.

  1. Detection and Resolution of Cryptosporidium Species and Species Mixtures by Genus-Specific Nested PCR-Restriction Fragment Length Polymorphism Analysis, Direct Sequencing, and Cloning ▿

    PubMed Central

    Ruecker, Norma J.; Hoffman, Rebecca M.; Chalmers, Rachel M.; Neumann, Norman F.

    2011-01-01

    Molecular methods incorporating nested PCR-restriction fragment length polymorphism (RFLP) analysis of the 18S rRNA gene of Cryptosporidium species were validated to assess performance based on limit of detection (LoD) and for detecting and resolving mixtures of species and genotypes within a single sample. The 95% LoD was determined for seven species (Cryptosporidium hominis, C. parvum, C. felis, C. meleagridis, C. ubiquitum, C. muris, and C. andersoni) and ranged from 7 to 11 plasmid template copies with overlapping 95% confidence limits. The LoD values for genomic DNA from oocysts on microscope slides were 7 and 10 template copies for C. andersoni and C. parvum, respectively. The repetitive nested PCR-RFLP slide protocol had an LoD of 4 oocysts per slide. When templates of two species were mixed in equal ratios in the nested PCR-RFLP reaction mixture, there was no amplification bias toward one species over another. At high ratios of template mixtures (>1:10), there was a reduction or loss of detection of the less abundant species by RFLP analysis, most likely due to heteroduplex formation in the later cycles of the PCR. Replicate nested PCR was successful at resolving many mixtures of Cryptosporidium at template concentrations near or below the LoD. The cloning of nested PCR products resulted in 17% of the cloned sequences being recombinants of the two original templates. Limiting-dilution nested PCR followed by the sequencing of PCR products resulted in no sequence anomalies, suggesting that this method is an effective and accurate way to study the species diversity of Cryptosporidium, particularly for environmental water samples, in which mixtures of parasites are common. PMID:21498746

  2. Qualitative analysis of sequence specific binding of flavones to DNA using restriction endonuclease activity assays.

    PubMed

    Duran, Elizabeth; Ramsauer, Victoria P; Ballester, Maria; Torrenegra, Ruben D; Rodriguez, Oscar E; Winkle, Stephen A

    2013-08-01

    Flavones, found in nature as secondary plant metabolites, have shown efficacy as anti-cancer agents. We have examined the binding of two flavones, 5,7-dihydroxy-3,6,8-trimethoxy-2-phenyl-4H-chromen-4-one (5,7-dihydroxy-3,6,8-trimethoxy flavone; FlavA) and 3,5-dihydroxy-6,7,8-trimethoxy-2-phenyl-4H-chromen-4-one (3,5-dihydroxy-6,7,8-trimethoxy flavone; FlavB), to phiX174 RF DNA using restriction enzyme activity assays employing the restriction enzymes Alw44, AvaII, BssHII, DraI, MluI, NarI, NciI, NruI, PstI, and XhoI. These enzymes possess differing target and flanking sequences allowing for observation of sequence specificity analysis. Using restriction enzymes that cleave once with a mixture of supercoiled and relaxed DNA substrates provides for observation of topological effects on binding. FlavA and FlavB show differing sequence specificities in their respective binding to phiX. For example, with relaxed DNA, FlavA shows inhibition of cleavage with DraI (reaction site (5') TTTAAA) but not BssHII ((5') GCGCGC) while FlavB shows the opposite results. Evidence for tolological specificity is also observed, Molecular modeling and conformational analysis of the flavones suggests that the phenyl ring of FlavB is coplanar with the flavonoid ring while the phenyl ring of FlavA is at an angle relative to the flavonoid ring. This may account for aspects of the observed sequence and topological specificities in the effects on restriction enzyme activity.

  3. Translocation-coupled DNA cleavage by the Type ISP restriction-modification enzymes

    PubMed Central

    Chand, Mahesh Kumar; Nirwan, Neha; Diffin, Fiona M.; van Aelst, Kara; Kulkarni, Manasi; Pernstich, Christian; Szczelkun, Mark D.; Saikrishnan, Kayarat

    2015-01-01

    Endonucleolytic double-strand DNA break production requires separate strand cleavage events. Although catalytic mechanisms for simple dimeric endonucleases are available, there are many complex nuclease machines which are poorly understood in comparison. Here we studied the single polypeptide Type ISP restriction-modification (RM) enzymes, which cleave random DNA between distant target sites when two enzymes collide following convergent ATP-driven translocation. We report the 2.7 Angstroms resolution X-ray crystal structure of a Type ISP enzyme-DNA complex, revealing that both the helicase-like ATPase and nuclease are unexpectedly located upstream of the direction of translocation, inconsistent with simple nuclease domain-dimerization. Using single-molecule and biochemical techniques, we demonstrate that each ATPase remodels its DNA-protein complex and translocates along DNA without looping it, leading to a collision complex where the nuclease domains are distal. Sequencing of single cleavage events suggests a previously undescribed endonuclease model, where multiple, stochastic strand nicking events combine to produce DNA scission. PMID:26389736

  4. Smoking influence on sperm vitality, DNA fragmentation, reactive oxygen species and zinc in oligoasthenoteratozoospermic men with varicocele.

    PubMed

    Taha, E A; Ezz-Aldin, A M; Sayed, S K; Ghandour, N M; Mostafa, T

    2014-08-01

    This study aimed to assess the influence of smoking duration and intensity on sperm vitality, sperm DNA fragmentation, reactive oxygen species (ROS) and zinc (Zn) levels in oligoasthenoteratozoospermic (OAT) men with varicocele (Vx). A total of 246 men were investigated who were divided into OAT nonsmokers, OAT smokers, OAT nonsmokers and OAT smokers with Vx. They were subjected to history taking, clinical examination and semen analysis. In their semen, sperm hypo-osmotic swelling (HOS) test, sperm DNA fragmentation test, seminal ROS and seminal Zn were assessed. The results demonstrated significantly decreased HOS test, seminal Zn level and significantly increased sperm DNA fragmentation, seminal ROS levels in OAT smokers with Vx more than OAT smokers compared with OAT nonsmokers. Smoking intensity, smoking duration and Vx grade demonstrated significant negative correlations with sperm motility, HOS test percentage and significant positive correlations with sperm DNA fragmentation, seminal ROS level. It is concluded that smoking has a negative impact on sperm progressive motility, HOS test, seminal Zn and positive impact on sperm DNA fragmentation, semen ROS level that are exaggerated if Vx is associated being correlated with smoking intensity, smoking duration and Vx grade.

  5. Chromosomal aberrations, Yq microdeletion, and sperm DNA fragmentation in infertile men opting for assisted reproduction.

    PubMed

    Shamsi, Monis B; Kumar, Rajeev; Malhotra, Neena; Singh, Nita; Mittal, Suneeta; Upadhyay, Ashish D; Dada, Rima

    2012-09-01

    Male infertility is a multi-factorial disorder, and identification of its etiology in an individual is critical for treatment. Systematically elucidating the underlying genetic causes (chromosomal and Yq microdeletion) and factors, such as reactive oxygen species (ROS) levels and total antioxidant capacity (TAC), which contribute to sperm DNA damage, may help to reduce the number of men with idiopathic infertility and provide them with the most suitable therapeutics and counseling. This study was done to comprehensively investigate genetic and oxidative stress factors that might be the etiology of a large percentage of men with idiopathic infertility. One hundred twelve infertile men and 76 fertile controls were screened for chromosomal aberrations and Yq microdeletions. ROS, TAC, and sperm DNA damage were assessed in cytogenetically normal, non-azoospermic men with intact Y chromosome (n = 93). ROS was assessed in neat and washed semen by chemiluminescence; seminal TAC with a commercially available kit; and sperm DNA damage by the comet assay. Two men had cytogenetic abnormalities and seven men harbored Yq microdeletions. ROS levels in neat and washed semen of infertile men were significantly higher (P < 0.01) than controls. Infertile men had significantly lower (P < 0.01) TAC levels (1.79 mM), whereas sperm DNA fragmentation in infertile men was significantly higher (P < 0.01) than controls. Genetic factors and oxidative stress cumulatively account for large number of idiopathic infertile cases. Unlike, genetic causes, which cannot be cured, timely identification and management of oxidative stress may help to reverse/reduce the effects on induced DNA damage, and improve the outcomes for infertile males.

  6. Bulky DNA adducts in human sperm associated with semen parameters and sperm DNA fragmentation in infertile men: a cross-sectional study

    PubMed Central

    2013-01-01

    Background DNA adducts are widely used marker of DNA damage induced by environmental pollutants. The present study was designed to explore whether sperm polycyclic aromatic hydrocarbon-DNA adducts were associated with sperm DNA integrity and semen quality. Methods A total of 433 Han Chinese men were recruited from an infertility clinic. Immunofluorescence was applied to analyze sperm PAH-DNA adducts. Sperm DNA fragmentation was detected by terminal deoxynucleotidyl transferase (Tdt)-mediated dUTP nick end labelling (TUNEL) assay. Results After adjustment for potential confounders using linear regression, sperm PAH-DNA adducts were negatively associated with sperm concentration, total sperm count, sperm motility, and curvilinear velocity (VCL). In addition, a positive relationship between sperm PAH-DNA adducts and sperm DNA fragmentation was found. Conclusions Our findings suggested an inverse association between sperm PAH-DNA adducts and semen quality, and provided the first epidemiologic evidence of an adverse effect of PAH-DNA adducts on sperm DNA integrity. PMID:24073787

  7. DNA Fingerprinting of Mycobacterium leprae Strains Using Variable Number Tandem Repeat (VNTR) - Fragment Length Analysis (FLA)

    PubMed Central

    Jensen, Ronald W.; Rivest, Jason; Li, Wei; Vissa, Varalakshmi

    2011-01-01

    gel electrophoresis to verify the presence of the desired DNA segments, and then submitted for fluorescent fragment length analysis (FLA) using capillary electrophoresis. DNA from armadillo passaged bacteria with a known number of repeat copies for each locus is used as a positive control. The FLA chromatograms are then examined using Peak Scanner software and fragment length is converted to number of VNTR copies (allele). Finally, the VNTR haplotypes are analyzed for patterns, and when combined with patient clinical data can be used to track distribution of strain types. PMID:21775969

  8. DNA fingerprinting of Mycobacterium leprae strains using variable number tandem repeat (VNTR) - fragment length analysis (FLA).

    PubMed

    Jensen, Ronald W; Rivest, Jason; Li, Wei; Vissa, Varalakshmi

    2011-07-15

    presence of the desired DNA segments, and then submitted for fluorescent fragment length analysis (FLA) using capillary electrophoresis. DNA from armadillo passaged bacteria with a known number of repeat copies for each locus is used as a positive control. The FLA chromatograms are then examined using Peak Scanner software and fragment length is converted to number of VNTR copies (allele). Finally, the VNTR haplotypes are analyzed for patterns, and when combined with patient clinical data can be used to track distribution of strain types.

  9. [Conformational polymorphysm of G-rich fragments of DNA ALU-repeats. I. Potential noncanonical structures].

    PubMed

    Sekridova, A V; Varizhuk, A M; Tatarinova, O N; Severov, V V; Barinov, N A; Smirnov, I P; Lazarev, V N; Klinov, D V; Pozmogova, G E

    2016-07-01

    In this paper, we report results of systematic studies of conformational polymorphism of G-rich DNA fragments from Alu repeats. Alu retrotransposones are primate-specific short interspersed elements. Using the Alu sequence from the prooncogen bcl2 intron and the consensus AluSx sequence as representative examples, we determined characteristic Alu sites that are capable of adopting G-quadruplex (GQ) conformations (i.e., potential quadruplex sites - PQSAlu), and demonstrated by bioinformatics methods that those sites are Alu-specific in the human genome. Genomic frequencies of PQSAlu were assessed (~1/10000 b.p.). The sites were found to be characteristic of young (active) Alu families (Alu-Y). A recombinant DNA sequence bearing the Alu element from the human bcl2 gene (304 b.p.) and its PQS-mutant (Alu-PQS) were constructed. The formation of noncanonical structures in Alubcl2 dsDNA and the absence of such structures in the case of Alu-PQS were shown using DMS-footprinting and AFM microscopy. Expression vectors bearing wild-type and mutant Alu insertions in the promoter regions were obtained, and the effects of these insertions on the expression of the reporter gene in НЕК293 and HeLa cell lines were compared. Our findings on the spatial organization of Alu repeats may provide insight into the mechanisms of genomic rearrangements which underlie many oncological and neurodegenerative diseases.

  10. Characterization of highly and moderately repetitive 500 bp Eco RI fragments from Xenopus laevis DNA.

    PubMed Central

    Hummel, S; Meyerhof, W; Korge, E; Knöchel, W

    1984-01-01

    Three different types of repetitive Eco RI fragments, which comigrate within a visible band of approximately 500 bp at gel electrophoresis of Xenopus laevis DNA Eco RI digests have been cloned and sequenced. These sequences are designated as Repetitive Eco RI Monomers: REM 1, REM 2 and REM 3. The sequences contain direct repeats, inverted repeats and palindromic elements. Genomic organization of the most abundant sequence (REM 1; 0.4% of total DNA) is that of an interspersed sequence. REM 2 (0.08%) is partly organized as an interspersed element and partly found in tandem arrangement, whereas REM 3 (0.02%) represents the tandemly repeated monomeric unit of a satellite DNA. In situ hybridization has shown that REM 1 and REM 2 sequences are found on most chromosomes, REM 1 being preferentially located on specific chromosomal loci. REM 3 is located near the centromere region of only one chromosome pair (presumably number 1). Hybridization of Northern blots from RNAs of different developmental stages revealed that REM 1, REM 2 and REM 3 sequences are transcribed and that transcription is under developmental control. Images PMID:6330690

  11. Flexible bent rod model with a saturating induced dipole moment to study the electric linear dichroism of DNA fragments

    NASA Astrophysics Data System (ADS)

    Bertolotto, Jorge A.; Umazano, Juan P.

    2016-06-01

    In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.

  12. A prediction of the amino acids and structures involved in DNA recognition by type I DNA restriction and modification enzymes.

    PubMed Central

    Sturrock, S S; Dryden, D T

    1997-01-01

    The S subunits of type I DNA restriction/modification enzymes are responsible for recognising the DNA target sequence for the enzyme. They contain two domains of approximately 150 amino acids, each of which is responsible for recognising one half of the bipartite asymmetric target. In the absence of any known tertiary structure for type I enzymes or recognisable DNA recognition motifs in the highly variable amino acid sequences of the S subunits, it has previously not been possible to predict which amino acids are responsible for sequence recognition. Using a combination of sequence alignment and secondary structure prediction methods to analyse the sequences of S subunits, we predict that all of the 51 known target recognition domains (TRDs) have the same tertiary structure. Furthermore, this structure is similar to the structure of the TRD of the C5-cytosine methyltransferase, Hha I, which recognises its DNA target via interactions with two short polypeptide loops and a beta strand. Our results predict the location of these sequence recognition structures within the TRDs of all type I S subunits. PMID:9254696

  13. Sequence-specific interactions of minor groove binders with restriction fragments of cDNAs for H tau 40 protein and MAP kinase 2. A qualitative and quantitative footprinting study.

    PubMed

    Kittler, L; Baguley, B C; Löber, G; Waring, M J

    1999-01-01

    A series of DNA minor groove binders comprising netropsin, distamycin, the bisquaternary ammonium heterocycles SN 6999 and SN 6570, cis-diammine platinum(II)-bridged bis-netropsin, cis-diammine platinum(II)-bridged bis-distamycin and bis-glycine-linked bis-distamycin were investigated for sequence-specific interactions. The oligonucleotides used were the 154 base pair HindIII-RsaI restriction fragment of cDNA of h tau 40 protein and the 113 base pair NcoI-PvuII restriction fragment of cDNA of MAP kinase 2. Both proteins are believed to be involved in the pathology of Alzheimer's disease. For all these ligands, binding sites were localised at positions 1134-1139 (5'AATCTT3'), 1152-1156 (5'ATATT3') and 1178-1194 (5'TTTCAATCTTTTTATTT3') for the former and 720-726 (5'TATTCTT3'), 751-771 (5'AATTGTATAATAAATTTAAAA3') and 781-785 (5'TATTT3') for the latter. The AT-preference of ligand binding was obvious and footprint titration experiments were applied to estimate binding constants (Ka) for each individual binding site mentioned above. The binding strength decreases in the order netropsin > distamycin > SN 6999 approximately SN 6570>platinum-bridged netropsin or distamycin approximately bis-glycine-bridged distamycin and was found independently of the binding sites examined. GC-base pairs interspersed in short AT-tracts reduced the Ka-values by as much as two orders of magnitudes. The dependence of extended bidentate as well as of monodentate binding of netropsin and distamycin derivatives on the length of AT-stretches has been discussed.

  14. Electrochemical biosensor modified with dsDNA monolayer for restriction enzyme activity determination.

    PubMed

    Zajda, Joanna; Górski, Łukasz; Malinowska, Elżbieta

    2016-06-01

    A simple and cost effective method for the determination of restriction endonuclease activity is presented. dsDNA immobilized at a gold electrode surface is used as the enzymatic substrate, and an external cationic redox probe is employed in voltammetric measurements for analytical signal generation. The assessment of enzyme activity is based on a decrease of a current signal derived from reduction of methylene blue which is present in the sample solution. For this reason, the covalent attachment of the label molecule is not required which significantly reduces costs of the analysis and simplifies the entire determination procedure. The influence of buffer components on utilized dsDNA/MCH monolayer stability and integrity is also verified. Electrochemical impedance spectroscopy measurements reveal that due to pinhole formation during enzyme activity measurement the presence of any surfactants should be avoided. Additionally, it is shown that the sensitivity of the electrochemical biosensor can be tuned by changing the restriction site location along the DNA length. Under optimal conditions the proposed biosensor exhibits a linear response toward PvuII activity within a range from 0.25 to 1.50 U/μL.

  15. DNA Methylation Pattern in Overweight Women under an Energy-Restricted Diet Supplemented with Fish Oil

    PubMed Central

    do Amaral, Cátia Lira; Milagro, Fermín I.; Curi, Rui; Martínez, J. Alfredo

    2014-01-01

    Dietary factors modulate gene expression and are able to alter epigenetic signatures in peripheral blood mononuclear cells (PBMC). However, there are limited studies about the effects of omega-3 polyunsaturated fatty acids (n-3 PUFA) on the epigenetic mechanisms that regulate gene expression. This research investigates the effects of n-3-rich fish oil supplementation on DNA methylation profile of several genes whose expression has been reported to be downregulated by n-3 PUFA in PBMC: CD36, FFAR3, CD14, PDK4, and FADS1. Young overweight women were supplemented with fish oil or control in a randomized 8-week intervention trial following a balanced diet with 30% energy restriction. Fatty acid receptor CD36 decreased DNA methylation at CpG +477 due to energy restriction. Hypocaloric diet-induced weight loss also reduced the methylation percentages of CpG sites located in CD14, PDK4, and FADS1. The methylation patterns of these genes were only slightly affected by the fish oil supplementation, being the most relevant to the attenuation of the weight loss-induced decrease in CD36 methylation after adjusting by baseline body weight. These results suggest that the n-3 PUFA-induced changes in the expression of these genes in PBMC are not mediated by DNA methylation, although other epigenetic mechanisms cannot be discarded. PMID:24579084

  16. DNA methylation pattern in overweight women under an energy-restricted diet supplemented with fish oil.

    PubMed

    do Amaral, Cátia Lira; Milagro, Fermín I; Curi, Rui; Martínez, J Alfredo

    2014-01-01

    Dietary factors modulate gene expression and are able to alter epigenetic signatures in peripheral blood mononuclear cells (PBMC). However, there are limited studies about the effects of omega-3 polyunsaturated fatty acids (n-3 PUFA) on the epigenetic mechanisms that regulate gene expression. This research investigates the effects of n-3-rich fish oil supplementation on DNA methylation profile of several genes whose expression has been reported to be downregulated by n-3 PUFA in PBMC: CD36, FFAR3, CD14, PDK4, and FADS1. Young overweight women were supplemented with fish oil or control in a randomized 8-week intervention trial following a balanced diet with 30% energy restriction. Fatty acid receptor CD36 decreased DNA methylation at CpG +477 due to energy restriction. Hypocaloric diet-induced weight loss also reduced the methylation percentages of CpG sites located in CD14, PDK4, and FADS1. The methylation patterns of these genes were only slightly affected by the fish oil supplementation, being the most relevant to the attenuation of the weight loss-induced decrease in CD36 methylation after adjusting by baseline body weight. These results suggest that the n-3 PUFA-induced changes in the expression of these genes in PBMC are not mediated by DNA methylation, although other epigenetic mechanisms cannot be discarded.

  17. How quantum entanglement in DNA synchronizes double-strand breakage by type II restriction endonucleases.

    PubMed

    Kurian, P; Dunston, G; Lindesay, J

    2016-02-21

    Macroscopic quantum effects in living systems have been studied widely in pursuit of fundamental explanations for biological energy transport and sensing. While it is known that type II endonucleases, the largest class of restriction enzymes, induce DNA double-strand breaks by attacking phosphodiester bonds, the mechanism by which simultaneous cutting is coordinated between the catalytic centers remains unclear. We propose a quantum mechanical model for collective electronic behavior in the DNA helix, where dipole-dipole oscillations are quantized through boundary conditions imposed by the enzyme. Zero-point modes of coherent oscillations would provide the energy required for double-strand breakage. Such quanta may be preserved in the presence of thermal noise by the enzyme's displacement of water surrounding the DNA recognition sequence. The enzyme thus serves as a decoherence shield. Palindromic mirror symmetry of the enzyme-DNA complex should conserve parity, because symmetric bond-breaking ceases when the symmetry of the complex is violated or when physiological parameters are perturbed from optima. Persistent correlations in DNA across longer spatial separations-a possible signature of quantum entanglement-may be explained by such a mechanism.

  18. Electronic cigarette aerosols and copper nanoparticles induce mitochondrial stress and promote DNA fragmentation in lung fibroblasts.

    PubMed

    Lerner, Chad A; Rutagarama, Pierrot; Ahmad, Tanveer; Sundar, Isaac K; Elder, Alison; Rahman, Irfan

    2016-09-02

    Oxidants or nanoparticles have recently been identified as constituents of aerosols released from various styles of electronic cigarettes (E-cigs). Cells in the lung may be directly exposed to these constituents and harbor reactive properties capable of incurring acute cell injury. Our results show mitochondria are sensitive to both E-cig aerosols and aerosol containing copper nanoparticles when exposed to human lung fibroblasts (HFL-1) using an Air-Liquid Interface culture system, evident by elevated levels of mitochondrial ROS (mtROS). Increased mtROS after aerosol exposure is associated with reduced stability of OxPhos electron transport chain (ETC) complex IV subunit and nuclear DNA fragmentation. Increased levels of IL-8 and IL-6 in HFL-1 conditioned media were also observed. These findings reveal both mitochondrial, genotoxic, and inflammatory stresses are features of direct cell exposure to E-cig aerosols which are ensued by inflammatory duress, raising a concern on deleterious effect of vaping.

  19. Cryopreservation method affects DNA fragmentation in trophectoderm and the speed of re-expansion in bovine blastocysts.

    PubMed

    Inaba, Yasushi; Miyashita, Satoshi; Somfai, Tamás; Geshi, Masaya; Matoba, Satoko; Dochi, Osamu; Nagai, Takashi

    2016-04-01

    This study investigated re-expansion dynamics during culture of bovine blastocysts cryopreserved either by slow-freezing or vitrification. Also, the extent and localization of membrane damage and DNA fragmentation in re-expanded embryos were studied. Frozen-thawed embryos showed a significantly lower re-expansion rate during 24 h of post-thawing culture compared to vitrified embryos. Vitrified embryos reached the maximum level of re-expansion rate by 12 h of culture whereas frozen embryos showed a gradual increase in re-expansion rate by 24 h of culture. When assayed by Hoechst/propidium iodide staining there was no difference in the numbers and ratio of membrane damaged cells between re-expanded frozen and vitrified embryos; however, the extent of membrane damage in blastomeres was significantly higher in both groups compared with non-cryopreserved embryos (control). TUNEL assay combined with differential ICM and TE staining revealed a significantly higher number and ratio of TE cells showing DNA-fragmentation in frozen-thawed re-expanded blastocysts compared to vitrified ones; however, vitrification also resulted in an increased extent of DNA fragmentation in TE cells compared with control blastocysts. In frozen-thawed blastocysts increased extent of DNA fragmentation was associated with reduced numbers and proportion of TE cells compared with vitrified and control embryos. The number and ratio of ICM cells and the extent of DNA fragmentation in ICM did not differ among control, frozen and vitrified groups. In conclusion, compared with vitrified embryos, blastocysts preserved by slow-freezing showed a delayed timing of re-expansion which was associated with an increased frequency of DNA fragmentation in TE cells.

  20. Rapid and efficient method for cloning of blunt-ended DNA fragments.

    PubMed

    Upcroft, P; Healey, A

    1987-01-01

    We describe a system to generate cDNA or genomic libraries from DNA segments that have blunt termini. Background and rearrangement levels are low, but efficiencies are high and the procedural times very short. T4 ligase in the presence of polyethylene glycol produces high Mr oligomers of vector and insert. These concatemers are reduced to vector-insert monomers at a high frequency by subsequent cleavage with a restriction endonuclease, which recognises the insert rarely, if at all, and the vector once. The monomers are recircularised under standard ligation conditions prior to transformation. Thus insertion conditions are optimised independently of those for recircularisation. All reading frames for expression libraries are generated by short BAL 31 cleavage followed by the blunt-end cloning procedure. Similarly, genomic expression libraries can be made by BAL 31 or mung-bean nuclease treatment after cleavage with DNase I is the presence of Mn2+. The technique is suitable for any DNA segment that is blunt-ended or can be made so. When the vector is treated with alkaline phosphatase, recombinants are generated at a frequency greater than 90% and have single inserts. Yields are 3-5 X 10(6) colony-forming units per micrograms of insert.

  1. Characterization of HIFU ablation using DNA fragmentation labeling as apoptosis stain

    NASA Astrophysics Data System (ADS)

    Anquez, Jeremie; Corréas, Jean-Michel; Pau, Bernard; Lacoste, François; Yon, Sylvain

    2012-11-01

    The goal of this work was to compare modalities to precisely quantify the extent of thermally induced lesions: gross pathology vs. histopathology vs. devascularization. Liver areas of 14 rabbits were targeted with HIFU and RF ablations in an acute study. Contrast enhanced computorized tomography (CE-CT) scan images were acquired two hours after HIFU and RF treatment to obtain the devascularized volumes of the livers. The animals were then euthanized and deep frozen. The livers were sliced and each slice was photographed and stacked yielding a volume of gross pathology. The volume VGP of the HIFU lesions were derived. The area AGP of the lesions were computed on a particular slice. The lesions were segmented as hypo intense (devascularized) regions on CE-CT images and their volumes VC were computed. The ratios VC/VGP were computed for all the HIFU lesions on all the 14 subjects with a mean value of 1.2. Histology was performed on the livers using Hematoxyline Eosine Staining (HES) and DNA Fragmentation labeling (TUNEL® technology) which characterizes apoptosis. Apoptotic regions of area AT were segmented on the images stained by TUNEL®. No necrosis was identified on the HES data. While TUNEL® did not mark the cores of the RF lesions as apoptotic, the periphery of HIFU and RF lesions was always recognized with TUNEL® as apoptotic. The ratio AGP/AT was computed. The mean value was 0.95 and 0.25 for HIFU and RF lesions respectively. These findings show that the devascularized territory seen on CE-CT scan coincide with the coagulated territories seen with gross pathology. Those actually correspond to cells in apoptosis. It is confirmed that HES stain does not show necrosis 2 hours after thermal ablation. TUNEL® technology for DNA fragmentation labeling appears as a useful marker for thermally induced acute lesions in the liver.

  2. Mechanism of DNA Recognition by the Restriction Enzyme EcoRV

    SciTech Connect

    Zahran, Mai; Daidone, Isabella; Smith, Jeremy C; Imhof, Petra

    2010-08-01

    EcoRV, a restriction enzyme in Escherichia coli, destroys invading foreign DNA by cleaving it at the center step of a GATATC sequence. In the EcoRV-cognate DNA crystallographic complex, a sharp kink of 50 degrees has been found at the center base-pair step (TA). Here, we examine the interplay between the intrinsic propensity of the cognate sequence to kink and the induction by the enzyme by performing all-atom molecular dynamics simulations of EcoRV unbound and interacting with three DNA sequences: the cognate sequence, GATATC (TA); the non-cognate sequence, GAATTC (AT); and with the cognate sequence methylated on the first adenine GA(CH(3))TATC (TA-CH(3)). In the unbound EcoRV, the cleft between the two C-terminal subdomains is found to be open. Binding to AT narrows the cleft and forms a partially bound state. However, the intrinsic bending propensity of AT is insufficient to allow tight binding. In contrast, the cognate TA sequence is easier to bend, allowing specific, high-occupancy hydrogen bonds to form in the complex. The absence of cleavage for this methylated sequence is found to arise from the loss of specific hydrogen bonds between the first adenine of the recognition sequence and Asn185. On the basis of the results, we suggest a three-step recognition mechanism. In the first step, EcoRV, in an open conformation, binds to the DNA at a random sequence and slides along it. In the second step, when the two outer base pairs, GAxxTC, are recognized, the R loops of the protein become more ordered, forming strong hydrogen-bonding interactions, resulting in a partially bound EcoRV-DNA complex. In the third step, the flexibility of the center base pair is probed, and in the case of the full cognate sequence the DNA bends, the complex strengthens and the protein and DNA interact more closely, allowing cleavage.

  3. Measuring Sperm DNA Fragmentation and Clinical Outcomes of Medically Assisted Reproduction: A Systematic Review and Meta-Analysis.

    PubMed

    Cissen, Maartje; Wely, Madelon van; Scholten, Irma; Mansell, Steven; Bruin, Jan Peter de; Mol, Ben Willem; Braat, Didi; Repping, Sjoerd; Hamer, Geert

    2016-01-01

    Sperm DNA fragmentation has been associated with reduced fertilization rates, embryo quality, pregnancy rates and increased miscarriage rates. Various methods exist to test sperm DNA fragmentation such as the sperm chromatin structure assay (SCSA), the sperm chromatin dispersion (SCD) test, the terminal deoxynucleotidyl transferase mediated deoxyuridine triphosphate nick end labelling (TUNEL) assay and the single cell gel electrophoresis (Comet) assay. We performed a systematic review and meta-analysis to assess the value of measuring sperm DNA fragmentation in predicting chance of ongoing pregnancy with IVF or ICSI. Out of 658 unique studies, 30 had extractable data and were thus included in the meta-analysis. Overall, the sperm DNA fragmentation tests had a reasonable to good sensitivity. A wide variety of other factors may also affect the IVF/ICSI outcome, reflected by limited to very low specificity. The constructed hierarchical summary receiver operating characteristic (HSROC) curve indicated a fair discriminatory capacity of the TUNEL assay (area under the curve (AUC) of 0.71; 95% CI 0.66 to 0.74) and Comet assay (AUC of 0.73; 95% CI 0.19 to 0.97). The SCSA and the SCD test had poor predictive capacity. Importantly, for the TUNEL assay, SCD test and Comet assay, meta-regression showed no differences in predictive value between IVF and ICSI. For the SCSA meta-regression indicated the predictive values for IVF and ICSI were different. The present review suggests that current sperm DNA fragmentation tests have limited capacity to predict the chance of pregnancy in the context of MAR. Furthermore, sperm DNA fragmentation tests have little or no difference in predictive value between IVF and ICSI. At this moment, there is insufficient evidence to recommend the routine use of sperm DNA fragmentation tests in couples undergoing MAR both for the prediction of pregnancy and for the choice of treatment. Given the significant limitations of the evidence and the

  4. Measuring Sperm DNA Fragmentation and Clinical Outcomes of Medically Assisted Reproduction: A Systematic Review and Meta-Analysis

    PubMed Central

    Cissen, Maartje; van Wely, Madelon; Scholten, Irma; Mansell, Steven; de Bruin, Jan Peter; Mol, Ben Willem; Braat, Didi; Repping, Sjoerd; Hamer, Geert

    2016-01-01

    Sperm DNA fragmentation has been associated with reduced fertilization rates, embryo quality, pregnancy rates and increased miscarriage rates. Various methods exist to test sperm DNA fragmentation such as the sperm chromatin structure assay (SCSA), the sperm chromatin dispersion (SCD) test, the terminal deoxynucleotidyl transferase mediated deoxyuridine triphosphate nick end labelling (TUNEL) assay and the single cell gel electrophoresis (Comet) assay. We performed a systematic review and meta-analysis to assess the value of measuring sperm DNA fragmentation in predicting chance of ongoing pregnancy with IVF or ICSI. Out of 658 unique studies, 30 had extractable data and were thus included in the meta-analysis. Overall, the sperm DNA fragmentation tests had a reasonable to good sensitivity. A wide variety of other factors may also affect the IVF/ICSI outcome, reflected by limited to very low specificity. The constructed hierarchical summary receiver operating characteristic (HSROC) curve indicated a fair discriminatory capacity of the TUNEL assay (area under the curve (AUC) of 0.71; 95% CI 0.66 to 0.74) and Comet assay (AUC of 0.73; 95% CI 0.19 to 0.97). The SCSA and the SCD test had poor predictive capacity. Importantly, for the TUNEL assay, SCD test and Comet assay, meta-regression showed no differences in predictive value between IVF and ICSI. For the SCSA meta-regression indicated the predictive values for IVF and ICSI were different. The present review suggests that current sperm DNA fragmentation tests have limited capacity to predict the chance of pregnancy in the context of MAR. Furthermore, sperm DNA fragmentation tests have little or no difference in predictive value between IVF and ICSI. At this moment, there is insufficient evidence to recommend the routine use of sperm DNA fragmentation tests in couples undergoing MAR both for the prediction of pregnancy and for the choice of treatment. Given the significant limitations of the evidence and the

  5. On-channel base stacking in microchip capillary gel electrophoresis for high-sensitivity DNA fragment analysis.

    PubMed

    Kim, Dae-Kwang; Kang, Seong Ho

    2005-01-28

    We evaluated a novel strategy for high-sensitivity DNA fragment analysis in a conventional glass double-T microfluidic chip. The microchip allows for a DNA on-channel concentration based on base stacking (BS) with a microchip capillary gel electrophoretic (MCGE) separation step in a poly(vinylpyrrolidone) (PVP) sieving matrix. Depending if low conductivity caused a neutralization reaction between the hydroxide ions and the run buffer component Tris+, the stacking of DNA fragments were processed in the microchip. Compared to a conventional MCGE separation with a normal electrokinetic injection, the peak heights of 50-2650-base pair (bp) DNA fragments on the MCGE-BS separation were increased 3.9-8.0-fold. When we applied the MCGE-BS method to the analysis of a clinical sample of bovine theileria after PCR reaction, the peak height intensity of the amplified 816-bp DNA fragment from the 18S rRNA of T. buffeli was enhanced 7.0-fold compared to that of the normal injection method.

  6. Restriction endonuclease fingerprinting of genomic DNA of Staphylococcus species of bovine origin.

    PubMed Central

    Matthews, K. R.; Jayarao, B. M.; Oliver, S. P.

    1992-01-01

    Fifty-one staphylococcal isolates from mammary secretions of cows with subclinical mastitis were examined by antibiograms and DNA restriction endonuclease fingerprinting (REF). DNA REF differentiated closely related strains of each species isolated from mammary secretions of different mammary glands of the same cow and from the same mammary gland at different periods of the lactation cycle. In addition, REF analysis provided evidence concerning persistence of infection in the same or different mammary gland over different periods of the lactation cycle, and occurrence of infection with similar and dissimilar strains of each Staphylococcus species. Antibiograms were of limited value in differentiating closely related strains. The ease by which REF analysis can be performed together with the reproducibility and clarity of REF patterns suggest that this technique is useful for differentiating closely related and unrelated strains of Staphylococcus species isolated from bovine mammary secretions. Images Fig. 1 PMID:1499673

  7. Restoration by T4 ligase of DNA sequences sensitive to "flush" cleaving restriction enzyme.

    PubMed

    Mottes, M; Morandi, C; Cremaschi, S; Sgaramella, V

    1977-07-01

    Fouteen "flush"-ended segments originate from the action of the restriction endonuclease Hae III of Haemophilus aegiptius on the DNA of the colicinogenic factor ColE 1 (A. Oka and M. Takanami, Nature, 264, 191, 1976). They are joined by the T4 polynucleotide ligase. The reaction can be monitored by gel electrophoresis, electron microscopy and resistance to phosphatase of the 5'-32P labelled ends. The joined products are a random recombination of the original segments, and can be cleaved by the same Hae III endonuclease to restore the exact electrophoretic pattern of the Hae III-cut ColE 1 DNA. In a properly diluted mixture of 5'-32P segments treated with T4 ligase, the level of phosphatase resistance is very close to the frequency of circle-formation as determined by electron microscopy: thus, the joining of the "flush"-ends involves the formation of circular structures covalently closed in both strands.

  8. The metabolic enhancer piracetam attenuates mitochondrion-specific endonuclease G translocation and oxidative DNA fragmentation.

    PubMed

    Gupta, Sonam; Verma, Dinesh Kumar; Biswas, Joyshree; Rama Raju, K Siva; Joshi, Neeraj; Wahajuddin; Singh, Sarika

    2014-08-01

    This study was performed to investigate the involvement of mitochondrion-specific endonuclease G in piracetam (P)-induced protective mechanisms. Studies have shown the antiapoptotic effects of piracetam but the mechanism of action of piracetam is still an enigma. To assess the involvement of endonuclease G in piracetam-induced protective effects, astrocyte glial cells were treated with lipopolysaccharide (LPS) and piracetam. LPS treatment caused significantly decreased viability, mitochondrial activity, oxidative stress, chromatin condensation, and DNA fragmentation, which were attenuated by piracetam cotreatment. Cotreatment of astrocytes with piracetam showed its significantly time-dependent absorption as observed with high-performance liquid chromatography. Astrocytes treated with piracetam alone showed enhanced mitochondrial membrane potential (MMP) in comparison to control astrocytes. However, in LPS-treated cells no significant alteration in MMP was observed in comparison to control cells. Protein and mRNA levels of the terminal executor of the caspase-mediated pathway, caspase-3, were not altered significantly in LPS or LPS + piracetam-treated astrocytes, whereas endonuclease G was significantly translocated to the nucleus in LPS-treated astrocytes. Piracetam cotreatment attenuated the LPS-induced endonuclease G translocation. In conclusion this study indicates that LPS treatment of astrocytes caused decreased viability, oxidative stress, mitochondrial dysfunction, chromatin condensation, DNA damage, and translocation of endonuclease G to the nucleus, which was inhibited by piracetam cotreatment, confirming that the mitochondrion-specific endonuclease G is one of the factors involved in piracetam-induced protective mechanisms.

  9. Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation

    PubMed Central

    1992-01-01

    Programmed cell death (PCD) plays a key role in developmental biology and in maintenance of the steady state in continuously renewing tissues. Currently, its existence is inferred mainly from gel electrophoresis of a pooled DNA extract as PCD was shown to be associated with DNA fragmentation. Based on this observation, we describe here the development of a method for the in situ visualization of PCD at the single-cell level, while preserving tissue architecture. Conventional histological sections, pretreated with protease, were nick end labeled with biotinylated poly dU, introduced by terminal deoxy- transferase, and then stained using avidin-conjugated peroxidase. The reaction is specific, only nuclei located at positions where PCD is expected are stained. The initial screening includes: small and large intestine, epidermis, lymphoid tissues, ovary, and other organs. A detailed analysis revealed that the process is initiated at the nuclear periphery, it is relatively short (1-3 h from initiation to cell elimination) and that PCD appears in tissues in clusters. The extent of tissue-PCD revealed by this method is considerably greater than apoptosis detected by nuclear morphology, and thus opens the way for a variety of studies. PMID:1400587

  10. Clinical utility of sperm DNA fragmentation testing: practice recommendations based on clinical scenarios

    PubMed Central

    Majzoub, Ahmad; Esteves, Sandro C.; Ko, Edmund; Ramasamy, Ranjith; Zini, Armand

    2016-01-01

    Sperm DNA fragmentation (SDF) has been generally acknowledged as a valuable tool for male fertility evaluation. While its detrimental implications on sperm function were extensively investigated, little is known about the actual indications for performing SDF analysis. This review delivers practice based recommendations on commonly encountered scenarios in the clinic. An illustrative description of the different SDF measurement techniques is presented. SDF testing is recommended in patients with clinical varicocele and borderline to normal semen parameters as it can better select varicocelectomy candidates. High SDF is also linked with recurrent spontaneous abortion (RSA) and can influence outcomes of different assisted reproductive techniques. Several studies have shown some benefit in using testicular sperm rather than ejaculated sperm in men with high SDF, oligozoospermia or recurrent in vitro fertilization (IVF) failure. Infertile men with evidence of exposure to pollutants can benefit from sperm DNA testing as it can help reinforce the importance of lifestyle modification (e.g., cessation of cigarette smoking, antioxidant therapy), predict fertility and monitor the patient’s response to intervention. PMID:28078226

  11. Cloning and characterization of some rep20 DNA fragments from the genome of the human malaria pathogen Plasmodium falciparum.

    PubMed

    Ghoneim, Ahmad M

    2009-08-01

    Chromosomes of the human malaria parasite Plasmodiumfalciparum contain long subtelomeric repeat sequences and little is known about them. In this study, we have cloned 10 fragments of the non-coding rep20 sequence from the genome of Plasmodium falciparum 3D7 and HB3 strains. Analysis of these fragments showed that they represent 4 different 3D7 fragments and 2 different HB3 ones. Blasting the sequence of these fragments to the PlasmoDB revealed a varying degree of identity to the released rep20 sequence. One of these fragments was found to contain 27 degenerate repeats and show the highest consistency with the rep20 consensus sequence. This fragment was. inserted into a plasmid construct containing the green fluorescence gene and a stably transfected plasmodium cell line was established. Our data show that this rep20 fragment enhances the establishment of drug-resistant parasite populations after transfection; however it restricts the expression of the green fluorescence transgene. These results attract attention to an in-depth study of the role that some rep20 sequences may play between the telomeres and the differentially expressed virulence-related genes.

  12. Random rapid amplification of cDNA ends (RRACE) allows for cloning of multiple novel human cDNA fragments containing (CAG)n repeats.

    PubMed

    Carney, J P; McKnight, C; VanEpps, S; Kelley, M R

    1995-04-03

    We describe a new technique for isolating cDNA fragments in which (i) either a partial sequence of the cDNA is known or (ii) a repeat sequence is utilized. We have used this technique, termed random rapid amplification of cDNA ends (random RACE), to isolate a number of trinucleotide repeat (CAG)n-containing genes. Using the random RACE (RRACE) technique, we have isolated over a hundred (CAG)n-containing genes. The results of our initial analysis of ten clones indicate that three are identical to previously cloned (CAG)n-containing genes. Three of our clones matched with expressed sequence tags, one of which contained a CA repeat. The remaining four clones did not match with any sequence in GenBank. These results indicate that this approach provides a rapid and efficient method for isolating trinucleotide repeat-containing cDNA fragments. Finally, this technique may be used for purposes other than cloning repeat-containing cDNA fragments. If only a partial sequence of a gene is known, our system, described here, provides a rapid and efficient method for isolating a fragment of the gene of interest.

  13. Structure of 5-hydroxymethylcytosine-specific restriction enzyme, AbaSI, in complex with DNA

    SciTech Connect

    Horton, John R.; Borgaro, Janine G.; Griggs, Rose M.; Quimby, Aine; Guan, Shengxi; Zhang, Xing; Wilson, Geoffrey G.; Zheng, Yu; Zhu, Zhenyu; Cheng, Xiaodong

    2014-07-03

    AbaSI, a member of the PvuRts1I-family of modification-dependent restriction endonucleases, cleaves DNA containing 5-hydroxymethylctosine (5hmC) and glucosylated 5hmC (g5hmC), but not DNA containing unmodified cytosine. AbaSI has been used as a tool for mapping the genomic locations of 5hmC, an important epigenetic modification in the DNA of higher organisms. Here we report the crystal structures of AbaSI in the presence and absence of DNA. These structures provide considerable, although incomplete, insight into how this enzyme acts. AbaSI appears to be mainly a homodimer in solution, but interacts with DNA in our structures as a homotetramer. Each AbaSI subunit comprises an N-terminal, Vsr-like, cleavage domain containing a single catalytic site, and a C-terminal, SRA-like, 5hmC-binding domain. Two N-terminal helices mediate most of the homodimer interface. Dimerization brings together the two catalytic sites required for double-strand cleavage, and separates the 5hmC binding-domains by ~ 70 Å, consistent with the known activity of AbaSI which cleaves DNA optimally between symmetrically modified cytosines ~ 22 bp apart. The eukaryotic SET and RING-associated (SRA) domains bind to DNA containing 5-methylcytosine (5mC) in the hemi-methylated CpG sequence. They make contacts in both the major and minor DNA grooves, and flip the modified cytosine out of the helix into a conserved binding pocket. In contrast, the SRA-like domain of AbaSI, which has no sequence specificity, contacts only the minor DNA groove, and in our current structures the 5hmC remains intra-helical. A conserved, binding pocket is nevertheless present in this domain, suitable for accommodating 5hmC and g5hmC. We consider it likely, therefore, that base-flipping is part of the recognition and cleavage mechanism of AbaSI, but that our structures represent an earlier, pre-flipped stage, prior to actual recognition.

  14. Creation of chimeric human/rabbit APOBEC1 with HIV-1 restriction and DNA mutation activities

    NASA Astrophysics Data System (ADS)

    Ikeda, Terumasa; Ong, Eugene Boon Beng; Watanabe, Nobumoto; Sakaguchi, Nobuo; Maeda, Kazuhiko; Koito, Atsushi

    2016-01-01

    APOBEC1 (A1) proteins from lagomorphs and rodents have deaminase-dependent restriction activity against HIV-1, whereas human A1 exerts a negligible effect. To investigate these differences in the restriction of HIV-1 by A1 proteins, a series of chimeric proteins combining rabbit and human A1s was constructed. Homology models of the A1s indicated that their activities derive from functional domains that likely act in tandem through a dimeric interface. The C-terminal region containing the leucine-rich motif and the dimerization domains of rabbit A1 is important for its anti-HIV-1 activity. The A1 chimeras with strong anti-HIV-1 activity were incorporated into virions more efficiently than those without anti-HIV-1 activity, and exhibited potent DNA-mutator activity. Therefore, the C-terminal region of rabbit A1 is involved in both its packaging into the HIV-1 virion and its deamination activity against both viral cDNA and genomic RNA. This study identifies the novel molecular mechanism underlying the target specificity of A1.

  15. DNA restriction-site polymorphisms associated with the alpha 1-antitrypsin gene.

    PubMed Central

    Cox, D W; Billingsley, G D; Mansfield, T

    1987-01-01

    Restriction-site variation in and around the alpha 1-antitrypsin gene has been studied using two genomic probes. With use of restriction enzymes SstI, MspI, and AvaII, three polymorphic sites have been described with a 4.6-kb probe in the 5' portion of the gene. With use of a 6.5-kb probe, polymorphisms in the coding and 3' regions of the gene have been detected with AvaII, MaeIII, and TaqI. All of these polymorphisms are of sufficiently high frequency to be useful in genetic mapping studies. The polymorphisms with AvaII and MaeIII (6.5-kb probe) are particularly useful for prenatal diagnosis. PI types and M subtypes tend to be associated with specific DNA haplotypes; there are two different types of DNA haplotypes associated with PI M1. The extent of linkage disequilibrium differs throughout the region of the alpha 1-antitrypsin gene. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:2890296

  16. DamID-seq: Genome-wide Mapping of Protein-DNA Interactions by High Throughput Sequencing of Adenine-methylated DNA Fragments.

    PubMed

    Wu, Feinan; Olson, Brennan G; Yao, Jie

    2016-01-27

    The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is an alternative approach to chromatin immunoprecipitation (ChIP). An expressed fusion protein consisting of the protein of interest and the E. coli DNA adenine methyltransferase can methylate the adenine base in GATC motifs near the sites of protein-DNA interactions. Adenine-methylated DNA fragments can then be specifically amplified and detected. The original DamID assay detects the genomic locations of methylated DNA fragments by hybridization to DNA microarrays, which is limited by the availability of microarrays and the density of predetermined probes. In this paper, we report the detailed protocol of integrating high throughput DNA sequencing into DamID (DamID-seq). The large number of short reads generated from DamID-seq enables detecting and localizing protein-DNA interactions genome-wide with high precision and sensitivity. We have used the DamID-seq assay to study genome-nuclear lamina (NL) interactions in mammalian cells, and have noticed that DamID-seq provides a high resolution and a wide dynamic range in detecting genome-NL interactions. The DamID-seq approach enables probing NL associations within gene structures and allows comparing genome-NL interaction maps with other functional genomic data, such as ChIP-seq and RNA-seq.

  17. Comparison of Mycoplasma arthritidis strains by enzyme-linked immunosorbent assay, immunoblotting, and DNA restriction analysis.

    PubMed Central

    Washburn, L R; Voelker, L L; Ehle, L J; Hirsch, S; Dutenhofer, C; Olson, K; Beck, B

    1995-01-01

    Twenty Mycoplasma arthritidis strains or isolates were compared by a combination of enzyme-linked immunosorbent assay by an antiserum adsorption technique, Western immunoblotting, and restriction analysis of chromosomal DNA. Antigenic markers that defined strains related to strains 158p10p9, PG6, and H606 were identified. In addition, restriction analysis allowed all 20 strains to be divided into six groups. Results of restriction analysis corresponded generally with antigenic similarities, although the former did not allow grouping with as fine a precision as the latter. However, intrastrain antigenic variability, which is common among many Mycoplasma species, including M. arthritidis, introduced a complicating factor into our attempts at antigenic analysis. While serologic and antigenic analyses remain useful, we recommend that they be used with caution and in combination with other techniques for identifying and characterizing new isolates and newly acquired strains. Combinations of these techniques have proven to be useful in our laboratory for quality control and for uncovering interesting relationships among strains subjected to animal passage and their less virulent antecedents and among strains originally classified as the same but obtained from different sources and maintained, sometimes for decades, in different laboratories. PMID:7494014

  18. Comparison of subsurface and surface soil bacterial communities in California grassland as assessed by terminal restriction fragment length polymorphisms of PCR-amplified 16S rRNA genes.

    PubMed

    LaMontagne, M G; Schimel, J P; Holden, P A

    2003-08-01

    The integrated biomass beneath the surface horizon in unsaturated soils is large and potentially important in nutrient and carbon cycling. Compared to surface soils, the ecology of these subsurface soils is weakly understood, particularly in terms of the composition of bacterial communities. We compared soil bacterial communities along two vertical transects by terminal restriction fragment length polymorphisms (TRFLPs) of PCR-amplified 16S rRNA genes to determine how surface and deep bacterial communities differ. DNA yield from soils collected from two Mediterranean grassland transects decreased exponentially from the surface to 4 m deep. Richness, as assessed by the number of peaks obtained after restriction with HhaI, MspI, RsaI, or HaeIII, and diversity, as assessed by the Shannon diversity indices, were lowest in the deepest sample. Lower diversity at depth is consistent with species-energy theory, which would predict relatively low diversity in the low organic matter horizons. Principal components analysis suggested that, in terms of HhaI and HaeIII generated TRFLPs, bacterial communities differed between depths. The most abundant amplicons cloned from the deepest sample contained sequences with restriction sites consistent with the largest peaks observed in TRFLPs generated from deep samples. These more abundant operational taxonomic units (OTUs) appeared related to Pseudomonas and Variovorax. Several OTUs were more related to each other than any previously described ribotypes. These OTUs showed similarity to bacteria from the divisions Actinobacteria and Firmicutes.

  19. Polymerase chain reaction-restriction fragment length polymorphism of the rpoB gene for identification of Mycobacterium avium subsp. paratuberculosis and differentiation of Mycobacterium avium subspecies.

    PubMed

    Whang, Jake; Lee, Byung Soo; Choi, Go-Eun; Cho, Sang-Nae; Kil, Park Young; Collins, Michael T; Shin, Sung Jae

    2011-05-01

    Mycobacterial speciation by polymerase chain reaction (PCR)-restriction fragment length polymorphism analysis (PRA) of the rpoB gene was evaluated for identification of Mycobacterium avium subsp. paratuberculosis (MAP) and other Mycobacterium avium complex (MAC) members to the species or subspecies level by comparison with conventional methods including hsp65 sequencing, high-performance liquid chromatography, and PCR for accepted species- or subspecies-specific genomic targets. A total of 185 type and clinical mycobacterial strains from humans, animals, and environments were tested. A 360-bp PCR product was subsequently digested with MspI, HaeIII, and SmaI restriction enzymes. The PRA using SmaI restriction showed a unique digestion pattern for MAP distinguishing it from other MAC members and other Mycobacterium spp. Moreover, HaeIII and MspI restriction of the rpoB gene enabled MAC-species and -subspecies discrimination. The rpoB-PRA using SmaI or MspI and HaeIII restriction of the rpoB gene is a simple, convenient, and reliable confirmatory assay for simultaneous identification of MAP and other MAC members.

  20. Sperm DNA Fragmentation Index and Hyaluronan Binding Ability in Men from Infertile Couples and Men with Testicular Germ Cell Tumor.

    PubMed

    Marchlewska, Katarzyna; Filipiak, Eliza; Walczak-Jedrzejowska, Renata; Oszukowska, Elzbieta; Sobkiewicz, Slawomir; Wojt, Malgorzata; Chmiel, Jacek; Kula, Krzysztof; Slowikowska-Hilczer, Jolanta

    2016-01-01

    Objective. To investigate sperm DNA fragmentation and sperm functional maturity in men from infertile couples (IC) and men with testicular germ cell tumor (TGCT). Materials and Methods. Semen samples were collected from 312 IC men and 23 men with TGCT before unilateral orchiectomy and oncological treatment. The sperm chromatin dispersion test was performed to determine DNA fragmentation index (DFI) and the ability of sperm to bind with hyaluronan (HA) was assessed. Results. In comparison with the IC men, the men with TGCT had a higher percentage of sperm with fragmented DNA (median 28% versus 21%; p < 0.01) and a lower percentage of HA-bound sperm (24% versus 66%; p < 0.001). Normal results of both analyses were observed in 24% of IC men and 4% of men with TGCT. Negative Spearman's correlations were found between DFI and the percentage of HA-bound sperm in the whole group and in IC subjects and those with TGCT analyzed separately. Conclusions. Approximately 76% of IC men and 96% with TGCT awaiting orchiectomy demonstrated DNA fragmentation and/or sperm immaturity. We therefore recommend sperm banking after unilateral orchiectomy, but before irradiation and chemotherapy; the use of such a deposit appears to be a better strategy to obtain functionally efficient sperms.

  1. Effect of sperm DNA fragmentation on clinical outcome of frozen-thawed embryo transfer and on blastocyst formation.

    PubMed

    Ni, Wuhua; Xiao, Shiquan; Qiu, Xiufang; Jin, Jianyuan; Pan, Chengshuang; Li, Yan; Fei, Qianjin; Yang, Xu; Zhang, Liya; Huang, Xuefeng

    2014-01-01

    During the last decades, many studies have shown the possible influence of sperm DNA fragmentation on assisted reproductive technique outcomes. However, little is known about the impact of sperm DNA fragmentation on the clinical outcome of frozen-thawed embryo transfer (FET) from cycles of conventional in vitro fertilization (IVF) and intra-cytoplasmic sperm injection (ICSI). In the present study, the relationship between sperm DNA fragmentation (SDF) and FET clinical outcomes in IVF and ICSI cycles was analyzed. A total of 1082 FET cycles with cleavage stage embryos (C-FET) (855 from IVF and 227 from ICSI) and 653 frozen-thawed blastocyst transfer cycles (B-FET) (525 from IVF and 128 from ICSI) were included. There was no significant change in clinical pregnancy, biochemical pregnancy and miscarriage rates in the group with a SDF >30% compared with the group with a SDF ≤30% in IVF and ICSI cycles with C-FET or B-FET. Also, there was no significant impact on the FET clinic outcome in IVF and ICSI when different values of SDF (such as 10%, 20%, 25%, 35%, and 40%) were taken as proposed threshold levels. However, the blastulation rates were significantly higher in the SDF ≤30% group in ICSI cycle. Taken together, our data show that sperm DNA fragmentation measured by Sperm Chromatin Dispersion (SCD) test is not associated with clinical outcome of FET in IVF and ICSI. Nonetheless, SDF is related to the blastocyst formation in ICSI cycles.

  2. Sperm DNA Fragmentation Index and Hyaluronan Binding Ability in Men from Infertile Couples and Men with Testicular Germ Cell Tumor

    PubMed Central

    Filipiak, Eliza; Walczak-Jedrzejowska, Renata; Oszukowska, Elzbieta; Sobkiewicz, Slawomir; Wojt, Malgorzata; Chmiel, Jacek; Kula, Krzysztof; Slowikowska-Hilczer, Jolanta

    2016-01-01

    Objective. To investigate sperm DNA fragmentation and sperm functional maturity in men from infertile couples (IC) and men with testicular germ cell tumor (TGCT). Materials and Methods. Semen samples were collected from 312 IC men and 23 men with TGCT before unilateral orchiectomy and oncological treatment. The sperm chromatin dispersion test was performed to determine DNA fragmentation index (DFI) and the ability of sperm to bind with hyaluronan (HA) was assessed. Results. In comparison with the IC men, the men with TGCT had a higher percentage of sperm with fragmented DNA (median 28% versus 21%; p < 0.01) and a lower percentage of HA-bound sperm (24% versus 66%; p < 0.001). Normal results of both analyses were observed in 24% of IC men and 4% of men with TGCT. Negative Spearman's correlations were found between DFI and the percentage of HA-bound sperm in the whole group and in IC subjects and those with TGCT analyzed separately. Conclusions. Approximately 76% of IC men and 96% with TGCT awaiting orchiectomy demonstrated DNA fragmentation and/or sperm immaturity. We therefore recommend sperm banking after unilateral orchiectomy, but before irradiation and chemotherapy; the use of such a deposit appears to be a better strategy to obtain functionally efficient sperms. PMID:27999814

  3. Single-stranded DNA fragments of insect-specific nuclear polyhedrosis virus act as selective DNA insecticides for gypsy moth control.

    PubMed

    Oberemok, Volodymyr V; Skorokhod, Oleksii A

    2014-07-01

    This paper focuses on the DNA insecticides as a novel preparation against gypsy moth (Lymantria dispar) based on DNA fragments of the anti-apoptotic gene of its nuclear polyhedrosis virus. It was found that the external application of a solution with two single-stranded DNA fragments from BIR and RING domains of LdMNPV (L.dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene induces a significantly higher mortality of gypsy moth caterpillars in comparison with the application of the control solutions. This effect does not depend on the infection of caterpillars with LdMNPV. The results also show that DNA insecticides based on LdMNPV IAP-3 gene fragments can be selective in action, and at least are not harmful to tobacco hornworm (Manduca sexta) and black cutworm (Agrotis ipsilon). Part of the gypsy moth genome cloned with the fragments of BIR and RING domains of LdMNPV IAP-3 gene as primers, has an overlap with the corresponding part of the LdMNPV IAP-3 gene and L.dispar IAP-1 mRNA for an inhibitor of apoptosis protein with the high cover by query, allows assuming that we cloned a part of gypsy moth anti-apoptosis gene. This finding gives the grounding that proposed here DNA insecticides might act through the blocking of the mechanisms involved in post transcriptional expression of insect anti-apoptosis genes. The results show the insecticidal potential of the viral genome fragments that can be used to create safe and relatively fast-acting DNA insecticides to control the quantity of gypsy moth populations, important task for forestry and agriculture.

  4. Towards standardisation of cell-free DNA measurement in plasma: controls for extraction efficiency, fragment size bias and quantification.

    PubMed

    Devonshire, Alison S; Whale, Alexandra S; Gutteridge, Alice; Jones, Gerwyn; Cowen, Simon; Foy, Carole A; Huggett, Jim F

    2014-10-01

    Circulating cell-free DNA (cfDNA) is becoming an important clinical analyte for prenatal testing, cancer diagnosis and cancer monitoring. The extraction stage is critical in ensuring clinical sensitivity of analytical methods measuring minority nucleic acid fractions, such as foetal-derived sequences in predominantly maternal cfDNA. Consequently, quality controls are required for measurement of extraction efficiency, fragment size bias and yield for validation of cfDNA methods. We evaluated the utility of an external DNA spike for monitoring these parameters in a study comparing three specific cfDNA extraction methods [QIAamp circulating nucleic acid (CNA) kit, NucleoSpin Plasma XS (NS) kit and FitAmp plasma/serum DNA isolation (FA) kit] with the commonly used QIAamp DNA blood mini (DBM) kit. We found that the extraction efficiencies of the kits ranked in the order CNA kit > DBM kit > NS kit > FA kit, and the CNA and NS kits gave a better representation of smaller DNA fragments in the extract than the DBM kit. We investigated means of improved reporting of cfDNA yield by comparing quantitative PCR measurements of seven different reference gene assays in plasma samples and validating these with digital PCR. We noted that the cfDNA quantities based on measurement of some target genes (e.g. TERT) were, on average, more than twofold higher than those of other assays (e.g. ERV3). We conclude that analysis and averaging of multiple reference genes using a GeNorm approach gives a more reliable estimate of total cfDNA quantity.

  5. Identification of Clinical Isolates of Actinomyces Species by Amplified 16S Ribosomal DNA Restriction Analysis

    PubMed Central

    Hall, Val; Talbot, P. R.; Stubbs, S. L.; Duerden, B. I.

    2001-01-01

    Amplified 16S ribosomal DNA (rDNA) restriction analysis (ARDRA), using enzymes HaeIII and HpaII, was applied to 176 fresh and 299 stored clinical isolates of putative Actinomyces spp. referred to the Anaerobe Reference Unit of the Public Health Laboratory Service for confirmation of identity. Results were compared with ARDRA results obtained previously for reference strains and with conventional phenotypic reactions. Identities of some strains were confirmed by analysis of partial 16S rDNA sequences. Of the 475 isolates, 331 (70%) were clearly assigned to recognized Actinomyces species, including 94 isolates assigned to six recently described species. A further 52 isolates in 12 ARDRA profiles were designated as apparently resembling recognized species, and 44 isolates, in 18 novel profiles, were confirmed as members of genera other than Actinomyces. The identities of 48 isolates in nine profiles remain uncertain, and they may represent novel species of Actinomyces. For the majority of species, phenotypic results, published reactions for the species, and ARDRA profiles concurred. However, of 113 stored isolates originally identified as A. meyeri or resembling A. meyeri by phenotypic tests, only 21 were confirmed as A. meyeri by ARDRA; 63 were reassigned as A. turicensis, 7 as other recognized species, and 22 as unidentified actinomycetes. Analyses of incidence and clinical associations of Actinomyces spp. add to the currently sparse knowledge of some recently described species. PMID:11574572

  6. The Role of DNA Restriction-Modification Systems in the Biology of Bacillus anthracis

    PubMed Central

    Sitaraman, Ramakrishnan

    2016-01-01

    Restriction–modification (R–M) systems are widespread among prokaryotes and, depending on their type, may be viewed as selfish genetic elements that persist as toxin–antitoxin modules, or as cellular defense systems against phage infection that confer a selective advantage to the host bacterium. Studies in the last decade have made it amply clear that these two options do not exhaust the list of possible biological roles for R–M systems. Their presence in a cell may also have a bearing on other processes such as horizontal gene transfer and gene regulation. From genome sequencing and experimental data, we know that Bacillus anthracis encodes at least three methylation-dependent (typeIV) restriction endonucleases (RE), and an orphan DNA methyltransferase. In this article, we first present an outline of our current knowledge of R–M systems in B. anthracis. Based on available DNA sequence data, and on our current understanding of the functions of similar genes in other systems, we conclude with hypotheses on the possible roles of the three REs and the orphan DNA methyltransferase. PMID:26834729

  7. Elevated dietary intake of Zn-methionate is associated with increased sperm DNA fragmentation in the boar.

    PubMed

    García-Contreras, Adelfa; De Loera, Yasmin; García-Artiga, Carlos; Palomo, Antonio; Guevara, Jesús A; Herrera-Haro, José; López-Fernández, Carmen; Johnston, Steve; Gosálvez, Jaime

    2011-05-01

    Boars fed on ration of 200 ppm Zn methionate showed a significant increase (P < 0.001) in sperm DNA fragmentation when compared to animals fed on non-supplemented and rations containing 150 ppm Zn methionate. There was a positive correlation (R2 = 0.207; P = 0.002) between % sperm DNA fragmentation (SDF) and the concentration of Zn in spermatozoa. Increased Zn in the diet also resulted in a non-proportional increase in Zn concentration in the testis and spermatozoa but not in the epididymis; Zn in sperm accumulated at levels up to 50 times higher than that found in the seminal plasma and 10-13 times that found in the epididymis and testis, respectively. These results show that supplementation of dietary Zn at a concentration of 200 ppm had an adverse effect on boar sperm DNA quality and may be related to the ability of spermatozoa to accumulate Zn during spermiogenesis.

  8. Cloning Should Be Simple: Escherichia coli DH5α-Mediated Assembly of Multiple DNA Fragments with Short End Homologies.

    PubMed

    Kostylev, Maxim; Otwell, Anne E; Richardson, Ruth E; Suzuki, Yo

    2015-01-01

    Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six double-stranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processes associated with most common applications of DNA assembly. We demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work.

  9. Cloning should be simple: Escherichia coli DH5α-mediated assembly of multiple DNA fragments with short end homologies

    DOE PAGES

    Kostylev, Maxim; Otwell, Anne E.; Richardson, Ruth E.; ...

    2015-09-08

    Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six doublestranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processesmore » associated with most common applications of DNA assembly. In addition, we demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work.« less

  10. DNA fragmentation and apoptosis induced by safranal in human prostate cancer cell line

    PubMed Central

    Samarghandian, Saeed; Shabestari, Mahmoud M

    2013-01-01

    Objectives: Apoptosis, an important mechanism that contributes to cell growth reduction, is reported to be induced by Crocus sativus (Saffron) in different cancer types. However, limited effort has been made to correlate these effects to the active ingredients of saffron. The present study was designed to elucidate cytotoxic and apoptosis induction by safranal, the major coloring compound in saffron, in a human prostate cancer cell line (PC-3). Materials and Methods: PC-3 and human fetal lung fibroblast (MRC-5) cells were cultured and exposed to safranal (5, 10, 15, and 20 μg/ml). The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was performed to assess cytotoxicity. DNA fragmentation was assessed by gel electrophoresis. Cells were incubated with different concentrations of safranal, and cell morphologic changes and apoptosis were determined by the normal inverted microscope, Annexin V, and propidium iodide, followed by flow cytometric analysis, respectively. Results: MTT assay revealed a remarkable and concentration-dependent cytotoxic effect of safranal on PC-3 cells in comparison with non-malignant cell line. The morphologic alterations of the cells confirmed the MTT results. The IC50 values against PC-3 cells were found to be 13.0 ΁ 0.07 and 6.4 ΁ 0.09 μg/ml at 48 and 72 h, respectively. Safranal induced an early and late apoptosis in the flow cytometry histogram of treated cells, indicating apoptosis is involved in this toxicity. DNA analysis revealed typical ladders as early as 48 and 72 h after treatment, indicative of apoptosis. Conclusions: Our preclinical study demonstrated a prostate cancer cell line to be highly sensitive to safranal-mediated growth inhibition and apoptotic cell death. Although the molecular mechanisms of safranal action are not clearly understood, it appears to have potential as a therapeutic agent. PMID:24082436

  11. Discrimination of seven Anopheles species from San Pedro de Uraba, Antioquia, Colombia, by polymerase chain reaction-restriction fragment length polymorphism analysis of its sequences.

    PubMed

    Zapata, Mario A; Cienfuegos, Astrid V; Quirós, Oscar I; Quiñones, Martha L; Luckhart, Shirley; Correa, Margarita M

    2007-07-01

    Accurate identification of anopheline species is essential for vector incrimination and implementation of appropriate control strategies. Several anopheline species are considered important malaria vectors in Colombia; however, species determination is complicated by cryptic morphology and intra-individual variation. We describe polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) of internal transcribed spacer 2 (ITS2) sequences for differentiation of seven Anopheles species collected in a locality in Antioquia, Colombia, with high levels of malaria transmission. Each of these seven species can be identified by unique AluI PCR-RFLP restriction patterns. Comparisons of morphologic identification with molecular identification of voucher specimens confirmed species designation for 886 wild-caught anophelines. This new method can be used as a diagnostic tool for discrimination of anopheline species of medical importance in this region, some of which have overlapping morphologic characters and for conducting complementary studies where rapid and accurate identification of large numbers of specimens is needed.

  12. Cellular uptake and fate of fibroin microspheres loaded with randomly fragmented DNA in 3T3 cells.

    PubMed

    Lee, Jin Sil; Hur, Won

    2016-01-01

    Purified fibroin protein can be obtained in large quantities from silk fibers and processed to form microscopic particles as delivery vehicles for therapeutic agents. In this study, we demonstrated that fibroin microspheres were taken up by 3T3 cells, localized in the nonlysosomal compartment, and secreted from the cytoplasm after medium replenishment. DNA-loaded microspheres were taken up by >95% of 3T3 cells. DNA cargo had no influence on the intracellular trafficking of microspheres, while fluorescently labeled cargo DNA was observed in the lysosomal compartment and in the microspheres. These results indicate that fibroin microspheres can travel through 3T3 cells without making any contact with the lysosomal compartments. The amount of DNA loaded in the microspheres taken up by 3T3 cells was estimated up to 831.0 pg/cell. Thus, fibroin microspheres can deliver a large amount of randomly fragmented DNA (<10 kb) into the cytoplasmic compartment of 3T3 cells.

  13. Effect of bromodeoxyuridine on radiation-induced DNA damage and repair based on DNA fragment size using pulsed-field gel electrophoresis

    SciTech Connect

    Lawrence, T.S.; Davis, M.A.; Normolle, D.P.

    1995-12-01

    We have used biphasic linear ramping pulsed-field gel electrophoresis (PFGE) to understand the effect of incorporation of bromodeoxyuridine (BrdUrd) on radiation-induced DNA damage and repair. This technique permits a determination of the fragment size distribution produced immediately after irradiation as well as during the repair period. We found that incorporation of BrdUrd increased the induction and decreased the repair of radiation damage. The fragment size distribution was consistent with a random breakage model. When we found that significantly more damage was detected after irradiation of deproteinized DNA compared to intact cells, we studied the effects of BrdUrd incorporation on the radiation response of cells or DNA at various phases of preparation for electrophoresis: cells adherent to the culture dish (A), trypsinized cells (B), agarose-embedded cells (C) and deproteinized DNA (D). Although there was a general tendency to detect more damage when irradiation was performed later in the preparation process, steps B and C were the only successive steps which were significantly different. These findings demonstrate that incorporation of BrdUrd randomly increases the induction of radiation damage and decreases its repair at the level of 200 kbp to 5 Mbp fragments. Furthermore, they confirm that the amount of damage detected depends upon the conditions of the cells or DNA at the time of irradiation. 34 refs., 5 figs., 2 tabs.

  14. A versatile bacterial expression vector designed for single-step cloning of multiple DNA fragments using homologous recombination.

    PubMed

    Holmberg, Mats A; Gowda, Naveen Kumar Chandappa; Andréasson, Claes

    2014-06-01

    Production of recombinant proteins is the starting point for biochemical and biophysical analyses and requires methodology to efficiently proceed from gene sequence to purified protein. While optimized strategies for the efficient cloning of single-gene fragments for bacterial expression is available, efficient multiple DNA fragment cloning still presents a challenge. To facilitate this step, we have developed an efficient cloning strategy based on yeast homologous recombination cloning (YHRC) into the new pET-based bacterial expression vector pSUMO-YHRC. The vector supports cloning for untagged expression as well as fusions to His6-SUMO or His6 tags. We demonstrate that YHRC from single PCR products of 6 independent genes into the vector results in virtually no background. Importantly, in a quantitative assay for functional expression we find that single-step YHRC of 7 DNA fragments can be performed with very high cloning efficiencies. The method and reagents described in this paper significantly simplifies the construction of expression plasmids from multiple DNA fragments, including complex gene fusions, chimeric genes and polycistronic constructs.

  15. Genotypic characterization of Indian isolates of infectious bursal disease virus strains by reverse transcription-polymerase chain reaction combined with restriction fragment length polymorphism analysis.

    PubMed

    Priyadharsini, C V; Senthilkumar, T M A; Raja, P; Kumanan, K

    2016-03-01

    The reverse transcription PCR (RT-PCR) combined with restriction fragment length polymorphism (RFLP) is used for the differentiation of classical virulent (cv), virulent (v) and very virulent (vv) strains of infectious bursal disease virus (IBDV) isolates from chicken bursal tissues in southern states of India. In the present study, six different isolates (MB11, HY12, PY12, BGE14, VCN14 and NKL14) of IBDV strains were subjected for genotyping along with vaccine virus (Georgia, intermediate strain) using RT-PCR for amplification of a 743 bp sequence in the hypervariable region of VP2 gene followed by restriction enzyme digestion with 5 different restriction enzymes (BspMI, SacI, HhaI, StuI and SspI). The RT-PCR products obtained from vvIBDV strains were digested by SspI enzyme except PY12, BGE14 and MB11 isolates. The SacI digested the isolate MB11, PY12 and the vaccine strain, but it did not cleave the very virulent isolates of IBDV. HhaI cleaved all the isolates with different restriction profile patterns. StuI digested all the vvIBDV isolates and BspMI was not able to differentiate field isolates from vaccine strain. Though RT-PCR combined with RFLP is a genotypic method, further confirmation of serotypes to distinguish the vvIBDV from cvIBDV has to be carried out using pathogenicity studies.

  16. Restriction fragment length polymorphism analysis of rotavirus VP7-encoding gene from humans and animals of Northeast India: a relative study of Indian and global isolates.

    PubMed

    Chakraborty, P; Barman, N N; Sharma, I