Microfluidic DNA sample preparation method and device

DOEpatents

Krulevitch, Peter A.; Miles, Robin R.; Wang, Xiao-Bo; Mariella, Raymond P.; Gascoyne, Peter R. C.; Balch, Joseph W.

2002-01-01

Manipulation of DNA molecules in solution has become an essential aspect of genetic analyses used for biomedical assays, the identification of hazardous bacterial agents, and in decoding the human genome. Currently, most of the steps involved in preparing a DNA sample for analysis are performed manually and are time, labor, and equipment intensive. These steps include extraction of the DNA from spores or cells, separation of the DNA from other particles and molecules in the solution (e.g. dust, smoke, cell/spore debris, and proteins), and separation of the DNA itself into strands of specific lengths. Dielectrophoresis (DEP), a phenomenon whereby polarizable particles move in response to a gradient in electric field, can be used to manipulate and separate DNA in an automated fashion, considerably reducing the time and expense involved in DNA analyses, as well as allowing for the miniaturization of DNA analysis instruments. These applications include direct transport of DNA, trapping of DNA to allow for its separation from other particles or molecules in the solution, and the separation of DNA into strands of varying lengths.

Utility of a Fluorescence Microscopy Imaging System for Analyzing the DNA Ploidy of Pathological Megakaryocytes Including 5q- Syndrome.

PubMed

Nakahara, Takako; Suemori, Shinichiro; Tsujioka, Takayuki; Kataoka, Mikio; Kataoka, Hiromi; Shibakura, Misako; Tohyama, Kaoru

2018-06-01

To investigate megakaryocyte (MK) DNA ploidy in various hematological diseases, fluorescence microscopy imaging system (FMI) can be used to analyze DNA ploidy with cell morphology at the single-cell level by using specialized image-processing software. Here we compared DNA ploidy obtained by FMI measured with that obtained flow cytometry (FCM). With FMI, we could evaluate the DNA ploidy in long-term preserved bone marrow smear samples after staining. We next analyzed the MK DNA ploidy in 42 bone marrow smear samples including 26 myeloid neoplasm cases, and we compared the DNA ploidy and platelet counts in the patients' peripheral blood; the production of platelets was significantly high compared to DNA ploidy in the myeloproliferative neoplasms group. The FMI method revealed that the patients with 5q- syndrome exhibited relatively low DNA ploidy despite high platelet counts, and this result suggested that increased DNA ploidy is not indispensable to abundant platelet production. The FMI method for DNA ploidy will be a useful tool to clarify the relationship between DNA ploidy and platelet production by MKs.

Investigating population continuity with ancient DNA under a spatially explicit simulation framework.

PubMed

Silva, Nuno Miguel; Rio, Jeremy; Currat, Mathias

2017-12-15

Recent advances in sequencing technologies have allowed for the retrieval of ancient DNA data (aDNA) from skeletal remains, providing direct genetic snapshots from diverse periods of human prehistory. Comparing samples taken in the same region but at different times, hereafter called "serial samples", may indicate whether there is continuity in the peopling history of that area or whether an immigration of a genetically different population has occurred between the two sampling times. However, the exploration of genetic relationships between serial samples generally ignores their geographical locations and the spatiotemporal dynamics of populations. Here, we present a new coalescent-based, spatially explicit modelling approach to investigate population continuity using aDNA, which includes two fundamental elements neglected in previous methods: population structure and migration. The approach also considers the extensive temporal and geographical variance that is commonly found in aDNA population samples. We first showed that our spatially explicit approach is more conservative than the previous (panmictic) approach and should be preferred to test for population continuity, especially when small and isolated populations are considered. We then applied our method to two mitochondrial datasets from Germany and France, both including modern and ancient lineages dating from the early Neolithic. The results clearly reject population continuity for the maternal line over the last 7500 years for the German dataset but not for the French dataset, suggesting regional heterogeneity in post-Neolithic migratory processes. Here, we demonstrate the benefits of using a spatially explicit method when investigating population continuity with aDNA. It constitutes an improvement over panmictic methods by considering the spatiotemporal dynamics of genetic lineages and the precise location of ancient samples. The method can be used to investigate population continuity between any pair of serial samples (ancient-ancient or ancient-modern) and to investigate more complex evolutionary scenarios. Although we based our study on mitochondrial DNA sequences, diploid molecular markers of different types (DNA, SNP, STR) can also be simulated with our approach. It thus constitutes a promising tool for the analysis of the numerous aDNA datasets being produced, including genome wide data, in humans but also in many other species.

An optimised protocol for molecular identification of Eimeria from chickens☆

PubMed Central

Kumar, Saroj; Garg, Rajat; Moftah, Abdalgader; Clark, Emily L.; Macdonald, Sarah E.; Chaudhry, Abdul S.; Sparagano, Olivier; Banerjee, Partha S.; Kundu, Krishnendu; Tomley, Fiona M.; Blake, Damer P.

2014-01-01

Molecular approaches supporting identification of Eimeria parasites infecting chickens have been available for more than 20 years, although they have largely failed to replace traditional measures such as microscopy and pathology. Limitations of microscopy-led diagnostics, including a requirement for specialist parasitological expertise and low sample throughput, are yet to be outweighed by the difficulties associated with accessing genomic DNA from environmental Eimeria samples. A key step towards the use of Eimeria species-specific PCR as a sensitive and reproducible discriminatory tool for use in the field is the production of a standardised protocol that includes sample collection and DNA template preparation, as well as primer selection from the numerous PCR assays now published. Such a protocol will facilitate development of valuable epidemiological datasets which may be easily compared between studies and laboratories. The outcome of an optimisation process undertaken in laboratories in India and the UK is described here, identifying four steps. First, samples were collected into a 2% (w/v) potassium dichromate solution. Second, oocysts were enriched by flotation in saturated saline. Third, genomic DNA was extracted using a QIAamp DNA Stool mini kit protocol including a mechanical homogenisation step. Finally, nested PCR was carried out using previously published primers targeting the internal transcribed spacer region 1 (ITS-1). Alternative methods tested included sample processing in the presence of faecal material, DNA extraction using a traditional phenol/chloroform protocol, the use of SCAR multiplex PCR (one tube and two tube versions) and speciation using the morphometric tool COCCIMORPH for the first time with field samples. PMID:24138724

The room temperature preservation of filtered environmental DNA samples and assimilation into a phenol-chloroform-isoamyl alcohol DNA extraction.

PubMed

Renshaw, Mark A; Olds, Brett P; Jerde, Christopher L; McVeigh, Margaret M; Lodge, David M

2015-01-01

Current research targeting filtered macrobial environmental DNA (eDNA) often relies upon cold ambient temperatures at various stages, including the transport of water samples from the field to the laboratory and the storage of water and/or filtered samples in the laboratory. This poses practical limitations for field collections in locations where refrigeration and frozen storage is difficult or where samples must be transported long distances for further processing and screening. This study demonstrates the successful preservation of eDNA at room temperature (20 °C) in two lysis buffers, CTAB and Longmire's, over a 2-week period of time. Moreover, the preserved eDNA samples were seamlessly integrated into a phenol-chloroform-isoamyl alcohol (PCI) DNA extraction protocol. The successful application of the eDNA extraction to multiple filter membrane types suggests the methods evaluated here may be broadly applied in future eDNA research. Our results also suggest that for many kinds of studies recently reported on macrobial eDNA, detection probabilities could have been increased, and at a lower cost, by utilizing the Longmire's preservation buffer with a PCI DNA extraction. © 2014 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.

Comparing efficiency of American Fisheries Society standard snorkeling techniques to environmental DNA sampling techniques

USGS Publications Warehouse

Ulibarri, Roy M.; Bonar, Scott A.; Rees, Christopher B.; Amberg, Jon J.; Ladell, Bridget; Jackson, Craig

2017-01-01

Analysis of environmental DNA (eDNA) is an emerging technique used to detect aquatic species through water sampling and the extraction of biological material for amplification. Our study compared the efficacy of eDNA methodology to American Fisheries Society (AFS) standard snorkeling surveys with regard to detecting the presence of rare fish species. Knowing which method is more efficient at detecting target species will help managers to determine the best way to sample when both traditional sampling methods and eDNA sampling are available. Our study site included three Navajo Nation streams that contained Navajo Nation Genetic Subunit Bluehead Suckers Catostomus discobolus and Zuni Bluehead Suckers C. discobolus yarrowi. We first divided the entire wetted area of streams into consecutive 100-m reaches and then systematically selected 10 reaches/stream for snorkel and eDNA surveys. Surface water samples were taken in 10-m sections within each 100-m reach, while fish presence was noted via snorkeling in each 10-m section. Quantitative PCR was run on each individual water sample in quadruplicate to test for the presence or absence of the target species. With eDNA sampling techniques, we were able to positively detect both species in two out of the three streams. Snorkeling resulted in positive detection of both species in all three streams. In streams where the target species were detected with eDNA sampling, snorkeling detected fish at 11–29 sites/stream, whereas eDNA detected fish at 3–12 sites/stream. Our results suggest that AFS standard snorkeling is more effective than eDNA for detecting target fish species. To improve our eDNA procedures, the amount of water collected and tested should be increased. Additionally, filtering water on-site may improve eDNA techniques for detecting fish. Future research should focus on standardization of eDNA sampling to provide a widely operational sampling tool.

Long-term room temperature preservation of corpse soft tissue: an approach for tissue sample storage

PubMed Central

2011-01-01

Background Disaster victim identification (DVI) represents one of the most difficult challenges in forensic sciences, and subsequent DNA typing is essential. Collected samples for DNA-based human identification are usually stored at low temperature to halt the degradation processes of human remains. We have developed a simple and reliable procedure for soft tissue storage and preservation for DNA extraction. It ensures high quality DNA suitable for PCR-based DNA typing after at least 1 year of room temperature storage. Methods Fragments of human psoas muscle were exposed to three different environmental conditions for diverse time periods at room temperature. Storage conditions included: (a) a preserving medium consisting of solid sodium chloride (salt), (b) no additional substances and (c) garden soil. DNA was extracted with proteinase K/SDS followed by organic solvent treatment and concentration by centrifugal filter devices. Quantification was carried out by real-time PCR using commercial kits. Short tandem repeat (STR) typing profiles were analysed with 'expert software'. Results DNA quantities recovered from samples stored in salt were similar up to the complete storage time and underscored the effectiveness of the preservation method. It was possible to reliably and accurately type different genetic systems including autosomal STRs and mitochondrial and Y-chromosome haplogroups. Autosomal STR typing quality was evaluated by expert software, denoting high quality profiles from DNA samples obtained from corpse tissue stored in salt for up to 365 days. Conclusions The procedure proposed herein is a cost efficient alternative for storage of human remains in challenging environmental areas, such as mass disaster locations, mass graves and exhumations. This technique should be considered as an additional method for sample storage when preservation of DNA integrity is required for PCR-based DNA typing. PMID:21846338

Forensic DNA testing.

PubMed

Butler, John M

2011-12-01

Forensic DNA testing has a number of applications, including parentage testing, identifying human remains from natural or man-made disasters or terrorist attacks, and solving crimes. This article provides background information followed by an overview of the process of forensic DNA testing, including sample collection, DNA extraction, PCR amplification, short tandem repeat (STR) allele separation and sizing, typing and profile interpretation, statistical analysis, and quality assurance. The article concludes with discussions of possible problems with the data and other forensic DNA testing techniques.

eDNAoccupancy: An R package for multi-scale occupancy modeling of environmental DNA data

USGS Publications Warehouse

Dorazio, Robert; Erickson, Richard A.

2017-01-01

In this article we describe eDNAoccupancy, an R package for fitting Bayesian, multi-scale occupancy models. These models are appropriate for occupancy surveys that include three, nested levels of sampling: primary sample units within a study area, secondary sample units collected from each primary unit, and replicates of each secondary sample unit. This design is commonly used in occupancy surveys of environmental DNA (eDNA). eDNAoccupancy allows users to specify and fit multi-scale occupancy models with or without covariates, to estimate posterior summaries of occurrence and detection probabilities, and to compare different models using Bayesian model-selection criteria. We illustrate these features by analyzing two published data sets: eDNA surveys of a fungal pathogen of amphibians and eDNA surveys of an endangered fish species.

Design and use of mouse control DNA for DNA biomarker extraction and PCR detection from urine: application for transrenal Mycobacterium tuberculosis DNA detection

PubMed Central

Bordelon, Hali; Ricks, Keersten M.; Pask, Megan E.; Russ, Patricia K.; Solinas, Francesca; Baglia, Mark L.; Short, Philip A.; Nel, Andrew; Blackburn, Jonathan; Dheda, Keertan; Zamudio, Carlos; Cáceres, Tatiana; Wright, David W.; Haselton, Frederick R.; Pettit, April C.

2017-01-01

Urine samples are increasingly used for diagnosing infections including Escherichia coli, Ebola virus, and Zika virus. However, extraction and concentration of nucleic acid biomarkers from urine is necessary for many molecular detection strategies such as polymerase chain reaction (PCR). Since urine samples typically have large volumes with dilute biomarker concentrations making them prone to false negatives, another impediment for urine-based diagnostics is the establishment of appropriate controls particularly to rule out false negatives. In this study, a mouse glyceraldehyde 3-phosphate dehydrogenase (GAPDH) DNA target was added to retrospectively collected urine samples from tuberculosis (TB)-infected and TB-uninfected patients to indicate extraction of intact DNA and removal of PCR inhibitors from urine samples. We tested this design on surrogate urine samples, retrospective 1 milliliter (mL) urine samples from patients in Lima, Peru and retrospective 5 mL urine samples from patients in Cape Town, South Africa. Extraction/PCR control DNA was detectable in 97% of clinical samples with no statistically significant differences among groups. Despite the inclusion of this control, there was no difference in the amount of TB IS6110 Tr-DNA detected between TB-infected and TB-uninfected groups except for samples from known HIV-infected patients. We found a increase in TB IS6110 Tr-DNA between TB/HIV co-infected patients compared to TB-uninfected/HIV-infected patients (N=18, p=0.037). The inclusion of an extraction/PCR control DNA to indicate successful DNA extraction and removal of PCR inhibitors should be easily adaptable as a sample preparation control for other acellular sample types. PMID:28285168

Design and use of mouse control DNA for DNA biomarker extraction and PCR detection from urine: Application for transrenal Mycobacterium tuberculosis DNA detection.

PubMed

Bordelon, Hali; Ricks, Keersten M; Pask, Megan E; Russ, Patricia K; Solinas, Francesca; Baglia, Mark L; Short, Philip A; Nel, Andrew; Blackburn, Jonathan; Dheda, Keertan; Zamudio, Carlos; Cáceres, Tatiana; Wright, David W; Haselton, Frederick R; Pettit, April C

2017-05-01

Urine samples are increasingly used for diagnosing infections including Escherichia coli, Ebola virus, and Zika virus. However, extraction and concentration of nucleic acid biomarkers from urine is necessary for many molecular detection strategies such as polymerase chain reaction (PCR). Since urine samples typically have large volumes with dilute biomarker concentrations making them prone to false negatives, another impediment for urine-based diagnostics is the establishment of appropriate controls particularly to rule out false negatives. In this study, a mouse glyceraldehyde 3-phosphate dehydrogenase (GAPDH) DNA target was added to retrospectively collected urine samples from tuberculosis (TB)-infected and TB-uninfected patients to indicate extraction of intact DNA and removal of PCR inhibitors from urine samples. We tested this design on surrogate urine samples, retrospective 1milliliter (mL) urine samples from patients in Lima, Peru and retrospective 5mL urine samples from patients in Cape Town, South Africa. Extraction/PCR control DNA was detectable in 97% of clinical samples with no statistically significant differences among groups. Despite the inclusion of this control, there was no difference in the amount of TB IS6110 Tr-DNA detected between TB-infected and TB-uninfected groups except for samples from known HIV-infected patients. We found an increase in TB IS6110 Tr-DNA between TB/HIV co-infected patients compared to TB-uninfected/HIV-infected patients (N=18, p=0.037). The inclusion of an extraction/PCR control DNA to indicate successful DNA extraction and removal of PCR inhibitors should be easily adaptable as a sample preparation control for other acellular sample types. Copyright © 2017 Elsevier B.V. All rights reserved.

DNA banking and DNA databanking by academic and commercial laboratories

DOE Office of Scientific and Technical Information (OSTI.GOV)

McEwen, J.E.; Reilly, P.R.

The advent of DNA-based testing is giving rise to DNA banking (the long-term storage of cells, transformed cell lines, or extracted DNA for subsequent retrieval and analysis) and DNA data banking (the indefinite storage of information derived from DNA analysis). Large scale acquisition and storage of DNA and DNA data has important implications for the privacy rights of individuals. A survey of 148 academically based and commercial DNA diagnostic laboratories was conducted to determine: (1) the extent of their DNA banking activities; (2) their policies and experiences regarding access to DNA samples and data; (3) the quality assurance measures theymore » employ; and (4) whether they have written policies and/or depositor`s agreements addressing specific issues. These issues include: (1) who may have access to DNA samples and data; (2) whether scientists may have access to anonymous samples or data for research use; (3) whether they have plans to contact depositors or retest samples if improved tests for a disorder become available; (4) disposition of samples at the end of the contract period if the laboratory ceases operations, if storage fees are unpaid, or after a death or divorce; (5) the consequence of unauthorized release, loss, or accidental destruction of samples; and (6) whether depositors may share in profits from the commercialization of tests or treatments developed in part from studies of stored DNA. The results suggest that many laboratories are banking DNA, that many have already amassed a large number of samples, and that a significant number plan to further develop DNA banking as a laboratory service over the next two years. Few laboratories have developed written policies governing DNA banking, and fewer still have drafted documents that define the rights and obligations of the parties. There may be a need for increased regulation of DNA banking and DNA data banking and for better defined policies with respect to protecting individual privacy.« less

A single mini-barcode test to screen for Australian mammalian predators from environmental samples

PubMed Central

MacDonald, Anna J; Sarre, Stephen D

2017-01-01

Abstract Identification of species from trace samples is now possible through the comparison of diagnostic DNA fragments against reference DNA sequence databases. DNA detection of animals from non-invasive samples, such as predator faeces (scats) that contain traces of DNA from their species of origin, has proved to be a valuable tool for the management of elusive wildlife. However, application of this approach can be limited by the availability of appropriate genetic markers. Scat DNA is often degraded, meaning that longer DNA sequences, including standard DNA barcoding markers, are difficult to recover. Instead, targeted short diagnostic markers are required to serve as diagnostic mini-barcodes. The mitochondrial genome is a useful source of such trace DNA markers because it provides good resolution at the species level and occurs in high copy numbers per cell. We developed a mini-barcode based on a short (178 bp) fragment of the conserved 12S ribosomal ribonucleic acid mitochondrial gene sequence, with the goal of discriminating amongst the scats of large mammalian predators of Australia. We tested the sensitivity and specificity of our primers and can accurately detect and discriminate amongst quolls, cats, dogs, foxes, and devils from trace DNA samples. Our approach provides a cost-effective, time-efficient, and non-invasive tool that enables identification of all 8 medium-large mammal predators in Australia, including native and introduced species, using a single test. With modification, this approach is likely to be of broad applicability elsewhere. PMID:28810700

Pediatric sample inclusion in an opt-out biorepository linking DNA to de-identified medical records: Pediatric BioVU

PubMed Central

McGregor, Tracy L.; Van Driest, Sara L.; Brothers, Kyle B.; Bowton, Erica A.; Muglia, Louis J.; Roden, Dan M.

2013-01-01

The Vanderbilt DNA repository, BioVU, links DNA from leftover clinical blood samples to de-identified electronic medical records. After initiating adult sample collection, pediatric extension required consideration of ethical concerns specific to pediatrics and implementation of specialized DNA extraction methods. In the first year of pediatric sample collection, over 11,000 samples were included from individuals younger than 18 years. We compared the pediatric BioVU cohort to the overall Vanderbilt University Medical Center pediatric population and found similar demographic characteristics; however, the BioVU cohort has higher rates of select diseases, medication exposures, and laboratory testing, demonstrating enriched representation of severe or chronic disease. This unbalanced sample accumulation may accelerate research of some cohorts, but also may limit study of relatively benign conditions and the accrual of unaffected and unbiased control samples. BioVU represents a feasible model for pediatric DNA biobanking but involves both ethical and practical considerations specific to the pediatric population. PMID:23281421

Results of a collaborative study on DNA identification of aged bone samples

PubMed Central

Vanek, Daniel; Budowle, Bruce; Dubska-Votrubova, Jitka; Ambers, Angie; Frolik, Jan; Pospisek, Martin; Al Afeefi, Ahmed Anwar; Al Hosani, Khalid Ismaeil; Allen, Marie; Al Naimi, Khudooma Saeed; Al Salafi, Dina; Al Tayyari, Wafa Ali Rashid; Arguetaa, Wendy; Bottinelli, Michel; Bus, Magdalena M.; Cemper-Kiesslich, Jan; Cepil, Olivier; De Cock, Greet; Desmyter, Stijn; El Amri, Hamid; El Ossmani, Hicham; Galdies, Ruth; Grün, Sebastian; Guidet, Francois; Hoefges, Anna; Iancu, Cristian Bogdan; Lotz, Petra; Maresca, Alessandro; Nagy, Marion; Novotny, Jindrich; Rachid, Hajar; Rothe, Jessica; Stenersen, Marguerethe; Stephenson, Mishel; Stevanovitch, Alain; Strien, Juliane; Sumita, Denilce R.; Vella, Joanna; Zander, Judith

2017-01-01

Aim A collaborative exercise with several institutes was organized by the Forensic DNA Service (FDNAS) and the Institute of the Legal Medicine, 2nd Faculty of Medicine, Charles University in Prague, Czech Republic, with the aim to test performance of different laboratories carrying out DNA analysis of relatively old bone samples. Methods Eighteen laboratories participating in the collaborative exercise were asked to perform DNA typing of two samples of bone powder. Two bone samples provided by the National Museum and the Institute of Archaelogy in Prague, Czech Republic, came from archeological excavations and were estimated to be approximately 150 and 400 years old. The methods of genetic characterization including autosomal, gonosomal, and mitochondrial markers was selected solely at the discretion of the participating laboratory. Results Although the participating laboratories used different extraction and amplification strategies, concordant results were obtained from the relatively intact 150 years old bone sample. Typing was more problematic with the analysis of the 400 years old bone sample due to poorer quality. Conclusion The laboratories performing identification DNA analysis of bone and teeth samples should regularly test their ability to correctly perform DNA-based identification on bone samples containing degraded DNA and potential inhibitors and demonstrate that risk of contamination is minimized. PMID:28613037

Quantitative analysis of genomic DNA degradation in whole blood under various storage conditions for molecular diagnostic testing.

PubMed

Permenter, Jessalyn; Ishwar, Arjun; Rounsavall, Angie; Smith, Maddie; Faske, Jennifer; Sailey, Charles J; Alfaro, Maria P

2015-12-01

Proper storage of whole blood is crucial for isolating nucleic acids from leukocytes and to ensure adequate performance of downstream assays in the molecular diagnostic laboratory. Short-term and long-term storage recommendations are lacking for successful isolation of genomic DNA (gDNA). Container type (EDTA or heparin), temperature (4 °C and room temperature) and time (1-130 days) were assessed as criterion for sample acceptance policies. The percentage of integrated area (%Ti) between 150 and 10,000 bp from the 2200 TapeStation electropherogram was calculated to measure gDNA degradation. Refrigerated EDTA samples yielded gDNA with low %Ti (high quality). Heparinized samples stored at room temperature yielded gDNA of worst quality. Downstream analysis demonstrated that the quality of the gDNA correlated with the quality of the data; samples with high %Ti generated significantly lower levels of high molecular weight amplicons. Recommendations from these analyses include storing blood samples intended for nucleic acid isolation in EDTA tubes at 4 °C for long term storage (>10 days). gDNA should be extracted within 3 days when blood is stored at room temperature regardless of the container. Finally, refrigerated heparinized samples should not be stored longer than 9 days if expecting high quality gDNA isolates. Laboratories should consider many factors, in addition to the results obtained herein, to update their policies for sample acceptance for gDNA extraction intended for molecular genetic testing. Copyright © 2015 Elsevier Ltd. All rights reserved.

DNA analysis in Disaster Victim Identification.

PubMed

Montelius, Kerstin; Lindblom, Bertil

2012-06-01

DNA profiling and matching is one of the primary methods to identify missing persons in a disaster, as defined by the Interpol Disaster Victim Identification Guide. The process to identify a victim by DNA includes: the collection of the best possible ante-mortem (AM) samples, the choice of post-mortem (PM) samples, DNA-analysis, matching and statistical weighting of the genetic relationship or match. Each disaster has its own scenario, and each scenario defines its own methods for identification of the deceased.

Isothermal amplification of environmental DNA (eDNA) for direct field-based monitoring and laboratory confirmation of Dreissena sp.

PubMed

Williams, Maggie R; Stedtfeld, Robert D; Engle, Cathrine; Salach, Paul; Fakher, Umama; Stedtfeld, Tiffany; Dreelin, Erin; Stevenson, R Jan; Latimore, Jo; Hashsham, Syed A

2017-01-01

Loop-mediated isothermal amplification (LAMP) of aquatic invasive species environmental DNA (AIS eDNA) was used for rapid, sensitive, and specific detection of Dreissena sp. relevant to the Great Lakes (USA) basin. The method was validated for two uses including i) direct amplification of eDNA using a hand filtration system and ii) confirmation of the results after DNA extraction using a conventional thermal cycler run at isothermal temperatures. Direct amplification eliminated the need for DNA extraction and purification and allowed detection of target invasive species in grab or concentrated surface water samples, containing both free DNA as well as larger cells and particulates, such as veligers, eggs, or seeds. The direct amplification method validation was conducted using Dreissena polymorpha and Dreissena bugensis and uses up to 1 L grab water samples for high target abundance (e.g., greater than 10 veligers (larval mussels) per L for Dreissena sp.) or 20 L samples concentrated through 35 μm nylon screens for low target abundance, at less than 10 veligers per liter water. Surface water concentrate samples were collected over a period of three years, mostly from inland lakes in Michigan with the help of a network of volunteers. Field samples collected from 318 surface water locations included i) filtered concentrate for direct amplification validation and ii) 1 L grab water sample for eDNA extraction and confirmation. Though the extraction-based protocol was more sensitive (resulting in more positive detections than direct amplification), direct amplification could be used for rapid screening, allowing for quicker action times. For samples collected between May and August, results of eDNA direct amplification were consistent with known presence/absence of selected invasive species. A cross-platform smartphone application was also developed to disseminate the analyzed results to volunteers. Field tests of the direct amplification protocol using a portable device (Gene-Z) showed the method could be used in the field to obtain results within one hr (from sample to result). Overall, the direct amplification has the potential to simplify the eDNA-based monitoring of multiple aquatic invasive species. Additional studies are warranted to establish quantitative correlation between eDNA copy number, veliger, biomass or organismal abundance in the field.

Isothermal amplification of environmental DNA (eDNA) for direct field-based monitoring and laboratory confirmation of Dreissena sp.

PubMed Central

Stedtfeld, Robert D.; Engle, Cathrine; Salach, Paul; Fakher, Umama; Stedtfeld, Tiffany; Dreelin, Erin; Stevenson, R. Jan; Latimore, Jo; Hashsham, Syed A.

2017-01-01

Loop-mediated isothermal amplification (LAMP) of aquatic invasive species environmental DNA (AIS eDNA) was used for rapid, sensitive, and specific detection of Dreissena sp. relevant to the Great Lakes (USA) basin. The method was validated for two uses including i) direct amplification of eDNA using a hand filtration system and ii) confirmation of the results after DNA extraction using a conventional thermal cycler run at isothermal temperatures. Direct amplification eliminated the need for DNA extraction and purification and allowed detection of target invasive species in grab or concentrated surface water samples, containing both free DNA as well as larger cells and particulates, such as veligers, eggs, or seeds. The direct amplification method validation was conducted using Dreissena polymorpha and Dreissena bugensis and uses up to 1 L grab water samples for high target abundance (e.g., greater than 10 veligers (larval mussels) per L for Dreissena sp.) or 20 L samples concentrated through 35 μm nylon screens for low target abundance, at less than 10 veligers per liter water. Surface water concentrate samples were collected over a period of three years, mostly from inland lakes in Michigan with the help of a network of volunteers. Field samples collected from 318 surface water locations included i) filtered concentrate for direct amplification validation and ii) 1 L grab water sample for eDNA extraction and confirmation. Though the extraction-based protocol was more sensitive (resulting in more positive detections than direct amplification), direct amplification could be used for rapid screening, allowing for quicker action times. For samples collected between May and August, results of eDNA direct amplification were consistent with known presence/absence of selected invasive species. A cross-platform smartphone application was also developed to disseminate the analyzed results to volunteers. Field tests of the direct amplification protocol using a portable device (Gene-Z) showed the method could be used in the field to obtain results within one hr (from sample to result). Overall, the direct amplification has the potential to simplify the eDNA-based monitoring of multiple aquatic invasive species. Additional studies are warranted to establish quantitative correlation between eDNA copy number, veliger, biomass or organismal abundance in the field. PMID:29036210

Sponge-associated actinobacterial diversity: validation of the methods of actinobacterial DNA extraction and optimization of 16S rRNA gene amplification.

PubMed

Yang, Qi; Franco, Christopher M M; Zhang, Wei

2015-10-01

Experiments were designed to validate the two common DNA extraction protocols (CTAB-based method and DNeasy Blood & Tissue Kit) used to effectively recover actinobacterial DNA from sponge samples in order to study the sponge-associated actinobacterial diversity. This was done by artificially spiking sponge samples with actinobacteria (spores, mycelia and a combination of the two). Our results demonstrated that both DNA extraction methods were effective in obtaining DNA from the sponge samples as well as the sponge samples spiked with different amounts of actinobacteria. However, it was noted that in the presence of the sponge, the bacterial 16S rRNA gene could not be amplified unless the combined DNA template was diluted. To test the hypothesis that the extracted sponge DNA contained inhibitors, dilutions of the DNA extracts were tested for six sponge species representing five orders. The results suggested that the inhibitors were co-extracted with the sponge DNA, and a high dilution of this DNA was required for the successful PCR amplification for most of the samples. The optimized PCR conditions, including primer selection, PCR reaction system and program optimization, further improved the PCR performance. However, no single PCR condition was found to be suitable for the diverse sponge samples using various primer sets. These results highlight for the first time that the DNA extraction methods used are effective in obtaining actinobacterial DNA and that the presence of inhibitors in the sponge DNA requires high dilution coupled with fine tuning of the PCR conditions to achieve success in the study of sponge-associated actinobacterial diversity.

Comparison of STR profiling from low template DNA extracts with and without the consensus profiling method

PubMed Central

2012-01-01

Background The consensus profiling method was introduced to overcome the exaggerated stochastic effects associated with low copy number DNA typing. However, little empirical evidence has been provided which shows that a consensus profile, derived from dividing a sample into separate aliquots and including only alleles seen at least twice, gives the most informative profile, compared to a profile obtained by amplifying the entire low template DNA extract in one reaction. Therefore, this study aimed to investigate the quality of consensus profiles compared to profiles obtained using the whole low template extract for amplification. Methods A total of 100 pg and 25 pg DNA samples were amplified with the PowerPlex® ESI 16 Kits using 30 or 34 PCR cycles. A total of 100 pg and 25 pg DNA samples were then divided into three aliquots for a 34-cycle PCR and a consensus profile derived that included alleles that appeared in at least two of the replicates. Profiles from the non-split samples were compared to the consensus profiles focusing on peak heights, allele drop out, locus drop out and allele drop in. Results Performing DNA profiling on non-split extracts produced profiles with a higher percentage of correct loci compared to the consensus profiling technique. Consensus profiling did eliminate any spurious alleles from the final profile. However, there was a notable increase in allele and locus drop out when a LTDNA sample was divided prior to amplification. Conclusions The loss of information that occurs when a sample is split for amplification indicates that consensus profiling may not be producing the most informative DNA profile for samples where the template amount is limited. PMID:22748106

DNA extraction and barcode identification of development stages of forensically important flies in the Czech Republic.

PubMed

Olekšáková, Tereza; Žurovcová, Martina; Klimešová, Vanda; Barták, Miroslav; Šuláková, Hana

2018-04-01

Several methods of DNA extraction, coupled with 'DNA barcoding' species identification, were compared using specimens from early developmental stages of forensically important flies from the Calliphoridae and Sarcophagidae families. DNA was extracted at three immature stages - eggs, the first instar larvae, and empty pupal cases (puparia) - using four different extraction methods, namely, one simple 'homemade' extraction buffer protocol and three commercial kits. The extraction conditions, including the amount of proteinase K and incubation times, were optimized. The simple extraction buffer method was successful for half of the eggs and for the first instar larval samples. The DNA Lego Kit and DEP-25 DNA Extraction Kit were useful for DNA extractions from the first instar larvae samples, and the DNA Lego Kit was also successful regarding the extraction from eggs. The QIAamp DNA mini kit was the most effective; the extraction was successful with regard to all sample types - eggs, larvae, and pupari.

Comparison of strategies for the isolation of PCR-compatible, genomic DNA from a municipal biogas plants.

PubMed

Weiss, Agnes; Jérôme, Valérie; Freitag, Ruth

2007-06-15

The goal of the project was the extraction of PCR-compatible genomic DNA representative of the entire microbial community from municipal biogas plant samples (mash, bioreactor content, process water, liquid fertilizer). For the initial isolation of representative DNA from the respective lysates, methods were used that employed adsorption, extraction, or precipitation to specifically enrich the DNA. Since no dedicated method for biogas plant samples was available, preference was given to kits/methods suited to samples that resembled either the bioreactor feed, e.g. foodstuffs, or those intended for environmental samples including wastewater. None of the methods succeeded in preparing DNA that was directly PCR-compatible. Instead the DNA was found to still contain considerable amounts of difficult-to-remove enzyme inhibitors (presumably humic acids) that hindered the PCR reaction. Based on the isolation method that gave the highest yield/purity for all sample types, subsequent purification was attempted by agarose gel electrophoresis followed by electroelution, spermine precipitation, or dialysis through nitrocellulose membrane. A combination of phenol/chloroform extraction followed by purification via dialysis constituted the most efficient sample treatment. When such DNA preparations were diluted 1:100 they did no longer inhibit PCR reactions, while they still contained sufficient genomic DNA to allow specific amplification of specific target sequences.

An optimised protocol for molecular identification of Eimeria from chickens.

PubMed

Kumar, Saroj; Garg, Rajat; Moftah, Abdalgader; Clark, Emily L; Macdonald, Sarah E; Chaudhry, Abdul S; Sparagano, Olivier; Banerjee, Partha S; Kundu, Krishnendu; Tomley, Fiona M; Blake, Damer P

2014-01-17

Molecular approaches supporting identification of Eimeria parasites infecting chickens have been available for more than 20 years, although they have largely failed to replace traditional measures such as microscopy and pathology. Limitations of microscopy-led diagnostics, including a requirement for specialist parasitological expertise and low sample throughput, are yet to be outweighed by the difficulties associated with accessing genomic DNA from environmental Eimeria samples. A key step towards the use of Eimeria species-specific PCR as a sensitive and reproducible discriminatory tool for use in the field is the production of a standardised protocol that includes sample collection and DNA template preparation, as well as primer selection from the numerous PCR assays now published. Such a protocol will facilitate development of valuable epidemiological datasets which may be easily compared between studies and laboratories. The outcome of an optimisation process undertaken in laboratories in India and the UK is described here, identifying four steps. First, samples were collected into a 2% (w/v) potassium dichromate solution. Second, oocysts were enriched by flotation in saturated saline. Third, genomic DNA was extracted using a QIAamp DNA Stool mini kit protocol including a mechanical homogenisation step. Finally, nested PCR was carried out using previously published primers targeting the internal transcribed spacer region 1 (ITS-1). Alternative methods tested included sample processing in the presence of faecal material, DNA extraction using a traditional phenol/chloroform protocol, the use of SCAR multiplex PCR (one tube and two tube versions) and speciation using the morphometric tool COCCIMORPH for the first time with field samples. Copyright © 2013 Dirk Vulpius The Authors. Published by Elsevier B.V. All rights reserved.

Moving environmental DNA methods from concept to practice for monitoring aquatic macroorganisms

USGS Publications Warehouse

Goldberg, Caren S.; Strickler, Katherine M.; Pilliod, David S.

2015-01-01

The discovery that macroorganisms can be detected from their environmental DNA (eDNA) in aquatic systems has immense potential for the conservation of biological diversity. This special issue contains 11 papers that review and advance the field of eDNA detection of vertebrates and other macroorganisms, including studies of eDNA production, transport, and degradation; sample collection and processing to maximize detection rates; and applications of eDNA for conservation using citizen scientists. This body of work is an important contribution to the ongoing efforts to take eDNA detection of macroorganisms from technical breakthrough to established, reliable method that can be used in survey, monitoring, and research applications worldwide. While the rapid advances in this field are remarkable, important challenges remain, including consensus on best practices for collection and analysis, understanding of eDNA diffusion and transport, and avoidance of inhibition in sample collection and processing. Nonetheless, as demonstrated in this special issue, eDNA techniques for research and monitoring are beginning to realize their potential for contributing to the conservation of biodiversity globally.

Extraction of DNA from human embryos after long-term preservation in formalin and Bouin's solutions.

PubMed

Nagai, Momoko; Minegishi, Katsura; Komada, Munekazu; Tsuchiya, Maiko; Kameda, Tomomi; Yamada, Shigehito

2016-05-01

The "Kyoto Collection of Human Embryos" at Kyoto University was begun in 1961. Although morphological analyses of samples in the Kyoto Collection have been performed, these embryos have been considered difficult to genetically analyze because they have been preserved in formalin or Bouin's solution for 20-50 years. Owing to the recent advances in molecular biology, it has become possible to extract DNA from long-term fixed tissues. The purpose of this study was to extract DNA from wet preparations of human embryo samples after long-term preservation in fixing solution. We optimized the DNA extraction protocol to be suitable for tissues that have been damaged by long-term fixation, including DNA-protein crosslinking damage. Diluting Li2 CO3 with 70% ethanol effectively removed picric acid from samples fixed in Bouin's solution. Additionally, 20.0 mg/mL proteinase was valuable to lyse the long-term fixed samples. The extracted DNA was checked with PCR amplification using several sets of primers and sequence analysis. The PCR products included at least 295- and 838-bp amplicons. These results show that the extracted DNA is applicable for genetic analyses, and indicate that old embryos in the Kyoto Collection should be made available for future studies. The protocol described in this study can successfully extract DNA from old specimens and, with improvements, should be applicable in research aiming to understand the molecular mechanisms of human congenital anomalies. © 2015 Japanese Teratology Society.

Quantitative Field Testing Rotylenchulus reniformis DNA from Metagenomic Samples Isolated Directly from Soil

PubMed Central

Showmaker, Kurt; Lawrence, Gary W.; Lu, Shien; Balbalian, Clarissa; Klink, Vincent P.

2011-01-01

A quantitative PCR procedure targeting the β-tubulin gene determined the number of Rotylenchulus reniformis Linford & Oliveira 1940 in metagenomic DNA samples isolated from soil. Of note, this outcome was in the presence of other soil-dwelling plant parasitic nematodes including its sister genus Helicotylenchus Steiner, 1945. The methodology provides a framework for molecular diagnostics of nematodes from metagenomic DNA isolated directly from soil. PMID:22194958

Genetic polymorphisms in prehistoric Pacific islanders determined by analysis of ancient bone DNA.

PubMed

Hagelberg, E; Clegg, J B

1993-05-22

A previously characterized Asian-specific mitochondrial DNA (mtDNA) length mutation has been detected in DNA isolated from prehistoric human bones from Polynesia, including Hawaii, Chatham Islands and Society Islands. In contrast, the Asian mutation was absent in skeletal samples from the Melanesian archipelagos of New Britain and Vanuatu and in the oldest samples from Fiji, Tonga and Samoa in the central Pacific (2700-1600 years BP) although it was present in a more recent prehistoric sample from Tonga. These results, augmented by informative DNA sequence data from the hypervariable region of mtDNA, fail to support current views that the central Pacific was settled directly by voyagers from island Southeast Asia, the putative ancestors of modern Polynesians. An earlier occupation by peoples from the neighbouring Melanesian archipelagos seems more likely.

DNA Identification of Skeletal Remains from World War II Mass Graves Uncovered in Slovenia

PubMed Central

Marjanović, Damir; Durmić-Pašić, Adaleta; Bakal, Narcisa; Haverić, Sanin; Kalamujić, Belma; Kovačević, Lejla; Ramić, Jasmin; Pojskić, Naris; Škaro, Vedrana; Projić, Petar; Bajrović, Kasim; Hadžiselimović, Rifat; Drobnič, Katja; Huffine, Ed; Davoren, Jon; Primorac, Dragan

2007-01-01

Aim To present the joint effort of three institutions in the identification of human remains from the World War II found in two mass graves in the area of Škofja Loka, Slovenia. Methods The remains of 27 individuals were found in two small and closely located mass graves. The DNA was isolated from bone and teeth samples using either standard phenol/chloroform alcohol extraction or optimized Qiagen DNA extraction procedure. Some recovered samples required the employment of additional DNA purification methods, such as N-buthanol treatment. QuantifilerTM Human DNA Quantification Kit was used for DNA quantification. PowerPlex 16 kit was used to simultaneously amplify 15 short tandem repeat (STR) loci. Matching probabilities were estimated using the DNA View program. Results Out of all processed samples, 15 remains were fully profiled at all 15 STR loci. The other 12 profiles were partial. The least successful profile included 13 loci. Also, 69 referent samples (buccal swabs) from potential living relatives were collected and profiled. Comparison of victims' profile against referent samples database resulted in 4 strong matches. In addition, 5 other profiles were matched to certain referent samples with lower probability. Conclusion Our results show that more than 6 decades after the end of the World War II, DNA analysis may significantly contribute to the identification of the remains from that period. Additional analysis of Y-STRs and mitochondrial DNA (mtDNA) markers will be performed in the second phase of the identification project. PMID:17696306

Molecular barcodes detect redundancy and contamination in hairpin-bisulfite PCR

PubMed Central

Miner, Brooks E.; Stöger, Reinhard J.; Burden, Alice F.; Laird, Charles D.; Hansen, R. Scott

2004-01-01

PCR amplification of limited amounts of DNA template carries an increased risk of product redundancy and contamination. We use molecular barcoding to label each genomic DNA template with an individual sequence tag prior to PCR amplification. In addition, we include molecular ‘batch-stamps’ that effectively label each genomic template with a sample ID and analysis date. This highly sensitive method identifies redundant and contaminant sequences and serves as a reliable method for positive identification of desired sequences; we can therefore capture accurately the genomic template diversity in the sample analyzed. Although our application described here involves the use of hairpin-bisulfite PCR for amplification of double-stranded DNA, the method can readily be adapted to single-strand PCR. Useful applications will include analyses of limited template DNA for biomedical, ancient DNA and forensic purposes. PMID:15459281

Evaluating Protocols for Porcine Faecal Microbiome Recollection, Storage and DNA Extraction: from the Farm to the Lab.

PubMed

Muiños-Bühl, Anixa; González-Recio, Oscar; Muñoz, María; Óvilo, Cristina; García-Casco, Juan; Fernández, Ana I

2018-06-01

There is a growing interest in understanding the role of the gut microbiome on productive and meat quality-related traits in livestock species in order to develop new useful tools for improving pig production systems and industry. Faecal samples are analysed as a proxy of gut microbiota and here the selection of suitable protocols for faecal sampling and DNA isolation is a critical first step in order to obtain reliable results, even more to compare results obtained from different studies. The aim of the current study was to establish in a cost-effective way, using automated ribosomal intergenic spacer analysis technique, a protocol for porcine faecal sampling and storage at farm and slaughterhouse and to determine the most efficient microbiota DNA isolation kit among those most widely used. Operational Taxonomic Unit profiles were compared from Iberian pig faecal samples collected from rectum or ground, stored with liquid N 2 , room temperature or RNAlater, and processed with QIAamp DNA Stool (Qiagen), PowerFecal DNA Isolation (Mobio) or SpeedTools Tissue DNA extraction (Biotools) commercial kits. The results, focused on prokaryote sampling, based on DNA yield and quality, OTU number and Sørensen similarity Indexes, indicate that the recommended protocol for porcine faecal microbiome sampling at farm should include: the collection from porcine rectum to avoid contamination; the storage in liquid N 2 or even at room temperature, but not in RNAlater; and the isolation of microbiota DNA using PowerFecal DNA Isolation kit. These conditions provide more reliable DNA samples for further microbiome analysis.

Comparing different post-mortem human samples as DNA sources for downstream genotyping and identification.

PubMed

Calacal, Gayvelline C; Apaga, Dame Loveliness T; Salvador, Jazelyn M; Jimenez, Joseph Andrew D; Lagat, Ludivino J; Villacorta, Renato Pio F; Lim, Maria Cecilia F; Fortun, Raquel D R; Datar, Francisco A; De Ungria, Maria Corazon A

2015-11-01

The capability of DNA laboratories to perform genotyping procedures from post-mortem remains, including those that had undergone putrefaction, continues to be a challenge in the Philippines, a country characterized by very humid and warm conditions all year round. These environmental conditions accelerate the decomposition of human remains that were recovered after a disaster and those that were left abandoned after a crime. When considerable tissue decomposition of human remains has taken place, there is no other option but to extract DNA from bone and/or teeth samples. Routinely, femur shafts are obtained from recovered bodies for human identification because the calcium matrix protects the DNA contained in the osteocytes. In the Philippines, there is difficulty in collecting femur samples after natural disasters or even human-made disasters, because these events are usually characterized by a large number of fatalities. Identification of casualties is further delayed by limitation in human and material resources. Hence, it is imperative to test other types of biological samples that are easier to collect, transport, process and store. We analyzed DNA that were obtained from body fluid, bone marrow, muscle tissue, clavicle, femur, metatarsal, patella, rib and vertebral samples from five recently deceased untreated male cadavers and seven male human remains that were embalmed, buried for ∼ 1 month and then exhumed. The bodies had undergone different environmental conditions and were in various stages of putrefaction. A DNA extraction method utilizing a detergent-washing step followed by an organic procedure was used. The utility of bone marrow and vitreous fluid including bone marrow and vitreous fluid that was transferred on FTA(®) cards and subjected to autosomal STR and Y-STR DNA typing were also evaluated. DNA yield was measured and the presence or absence of PCR inhibitors in DNA extracts was assessed using Plexor(®)HY. All samples were amplified using PowerPlex(®)21 and PowerPlexY(®)23 systems and analyzed using the AB3500 Genetic Analyzer and the GeneMapper(®) ID-X v.1.2 software. PCR inhibitors were consistently detected in bone marrow, muscle tissue, rib and vertebra samples. Amplifiable DNA was obtained in a majority of the samples analyzed. DNA recovery from 0.1g biological material was adequate for successful genotyping of most of the non-bone and bone samples. Complete DNA profiles were generated from bone marrow, femur, metatarsal and patella with 0.1 ng DNA template. Using 0.5 ng DNA template resulted in increased allele recovery and improved intra- and inter-locus peak balance. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Enhanced DNA Profiling of the Semen Donor in Late Reported Sexual Assaults: Use of Y-Chromosome-Targeted Pre-amplification and Next Generation Y-STR Amplification Systems.

PubMed

Hanson, Erin K; Ballantyne, Jack

2016-01-01

In some cases of sexual assault the victim may not report the assault for several days after the incident due to various factors. The ability to obtain an autosomal STR profile of the semen donor from a living victim rapidly diminishes as the post-coital interval is extended due to the presence of only a small amount of male DNA amidst an overwhelming amount of female DNA. Previously, we have utilized various technological tools to overcome the limitations of male DNA profiling in extended interval post-coital samples including the use of Y-chromosome STR profiling, cervical sample, and post-PCR purification permitting the recovery of Y-STR profiles of the male DNA from samples collected 5-6 days after intercourse. Despite this success, the reproductive biology literature reports the presence of spermatozoa in the human cervix up to 7-10 days post-coitus. Therefore, novel and improved methods for recovery of male profiles in extended interval post-coital samples were required. Here, we describe enhanced strategies, including Y-chromosome-targeted pre-amplification and next generation Y-STR amplification kits, that have resulted in the ability to obtain probative male profiles from samples collected 6-9 days after intercourse.

Modeling the Sensitivity of Field Surveys for Detection of Environmental DNA (eDNA)

PubMed Central

Schultz, Martin T.; Lance, Richard F.

2015-01-01

The environmental DNA (eDNA) method is the practice of collecting environmental samples and analyzing them for the presence of a genetic marker specific to a target species. Little is known about the sensitivity of the eDNA method. Sensitivity is the probability that the target marker will be detected if it is present in the water body. Methods and tools are needed to assess the sensitivity of sampling protocols, design eDNA surveys, and interpret survey results. In this study, the sensitivity of the eDNA method is modeled as a function of ambient target marker concentration. The model accounts for five steps of sample collection and analysis, including: 1) collection of a filtered water sample from the source; 2) extraction of DNA from the filter and isolation in a purified elution; 3) removal of aliquots from the elution for use in the polymerase chain reaction (PCR) assay; 4) PCR; and 5) genetic sequencing. The model is applicable to any target species. For demonstration purposes, the model is parameterized for bighead carp (Hypophthalmichthys nobilis) and silver carp (H. molitrix) assuming sampling protocols used in the Chicago Area Waterway System (CAWS). Simulation results show that eDNA surveys have a high false negative rate at low concentrations of the genetic marker. This is attributed to processing of water samples and division of the extraction elution in preparation for the PCR assay. Increases in field survey sensitivity can be achieved by increasing sample volume, sample number, and PCR replicates. Increasing sample volume yields the greatest increase in sensitivity. It is recommended that investigators estimate and communicate the sensitivity of eDNA surveys to help facilitate interpretation of eDNA survey results. In the absence of such information, it is difficult to evaluate the results of surveys in which no water samples test positive for the target marker. It is also recommended that invasive species managers articulate concentration-based sensitivity objectives for eDNA surveys. In the absence of such information, it is difficult to design appropriate sampling protocols. The model provides insights into how sampling protocols can be designed or modified to achieve these sensitivity objectives. PMID:26509674

Modeling the Sensitivity of Field Surveys for Detection of Environmental DNA (eDNA).

PubMed

Schultz, Martin T; Lance, Richard F

2015-01-01

The environmental DNA (eDNA) method is the practice of collecting environmental samples and analyzing them for the presence of a genetic marker specific to a target species. Little is known about the sensitivity of the eDNA method. Sensitivity is the probability that the target marker will be detected if it is present in the water body. Methods and tools are needed to assess the sensitivity of sampling protocols, design eDNA surveys, and interpret survey results. In this study, the sensitivity of the eDNA method is modeled as a function of ambient target marker concentration. The model accounts for five steps of sample collection and analysis, including: 1) collection of a filtered water sample from the source; 2) extraction of DNA from the filter and isolation in a purified elution; 3) removal of aliquots from the elution for use in the polymerase chain reaction (PCR) assay; 4) PCR; and 5) genetic sequencing. The model is applicable to any target species. For demonstration purposes, the model is parameterized for bighead carp (Hypophthalmichthys nobilis) and silver carp (H. molitrix) assuming sampling protocols used in the Chicago Area Waterway System (CAWS). Simulation results show that eDNA surveys have a high false negative rate at low concentrations of the genetic marker. This is attributed to processing of water samples and division of the extraction elution in preparation for the PCR assay. Increases in field survey sensitivity can be achieved by increasing sample volume, sample number, and PCR replicates. Increasing sample volume yields the greatest increase in sensitivity. It is recommended that investigators estimate and communicate the sensitivity of eDNA surveys to help facilitate interpretation of eDNA survey results. In the absence of such information, it is difficult to evaluate the results of surveys in which no water samples test positive for the target marker. It is also recommended that invasive species managers articulate concentration-based sensitivity objectives for eDNA surveys. In the absence of such information, it is difficult to design appropriate sampling protocols. The model provides insights into how sampling protocols can be designed or modified to achieve these sensitivity objectives.

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

Genomic DNA Methylation Changes in Response to Folic Acid Supplementation in a Population-Based Intervention Study among Women of Reproductive Age

PubMed Central

Berry, Robert J.; Hao, Ling; Li, Zhu; Maneval, David; Yang, Thomas P.; Rasmussen, Sonja A.; Yang, Quanhe; Zhu, Jiang-Hui; Hu, Dale J.; Bailey, Lynn B.

2011-01-01

Folate is a source of one-carbons necessary for DNA methylation, a critical epigenetic modification necessary for genomic structure and function. The use of supplemental folic acid is widespread however; the potential influence on DNA methylation is unclear. We measured global DNA methylation using DNA extracted from samples from a population-based, double-blind randomized trial of folic acid supplementation (100, 400, 4000 µg per day) taken for 6 months; including a 3 month post-supplementation sample. We observed no changes in global DNA methylation in response to up to 4,000 µg/day for 6 months supplementation in DNA extracted from uncoagulated blood (approximates circulating blood). However, when DNA methylation was determined in coagulated samples from the same individuals at the same time, significant time, dose, and MTHFR genotype-dependent changes were observed. The baseline level of DNA methylation was the same for uncoagulated and coagulated samples; marked differences between sample types were observed only after intervention. In DNA from coagulated blood, DNA methylation decreased (−14%; P<0.001) after 1 month of supplementation and 3 months after supplement withdrawal, methylation decreased an additional 23% (P<0.001) with significant variation among individuals (max+17%; min-94%). Decreases in methylation of ≥25% (vs. <25%) after discontinuation of supplementation were strongly associated with genotype: MTHFR CC vs. TT (adjusted odds ratio [aOR] 12.9, 95%CI 6.4, 26.0). The unexpected difference in DNA methylation between DNA extracted from coagulated and uncoagulated samples in response to folic acid supplementation is an important finding for evaluating use of folic acid and investigating the potential effects of folic acid supplementation on coagulation. PMID:22163281

A simple automated instrument for DNA extraction in forensic casework.

PubMed

Montpetit, Shawn A; Fitch, Ian T; O'Donnell, Patrick T

2005-05-01

The Qiagen BioRobot EZ1 is a small, rapid, and reliable automated DNA extraction instrument capable of extracting DNA from up to six samples in as few as 20 min using magnetic bead technology. The San Diego Police Department Crime Laboratory has validated the BioRobot EZ1 for the DNA extraction of evidence and reference samples in forensic casework. The BioRobot EZ1 was evaluated for use on a variety of different evidence sample types including blood, saliva, and semen evidence. The performance of the BioRobot EZ1 with regard to DNA recovery and potential cross-contamination was also assessed. DNA yields obtained with the BioRobot EZ1 were comparable to those from organic extraction. The BioRobot EZ1 was effective at removing PCR inhibitors, which often co-purify with DNA in organic extractions. The incorporation of the BioRobot EZ1 into forensic casework has streamlined the DNA analysis process by reducing the need for labor-intensive phenol-chloroform extractions.

[Evaluation of 3 methods of DNA extraction from paraffin-embedded material for the amplification of genomic DNA using PCR].

PubMed

Mesquita, R A; Anzai, E K; Oliveira, R N; Nunes, F D

2001-01-01

There are several protocols reported in the literature for the extraction of genomic DNA from formalin-fixed paraffin-embedded samples. Genomic DNA is utilized in molecular analyses, including PCR. This study compares three different methods for the extraction of genomic DNA from formalin-fixed paraffin-embedded (inflammatory fibrous hyperplasia) and non-formalin-fixed (normal oral mucosa) samples: phenol with enzymatic digestion, and silica with and without enzymatic digestion. The amplification of DNA by means of the PCR technique was carried out with primers for the exon 7 of human keratin type 14. Amplicons were analyzed by means of electrophoresis in an 8% polyacrylamide gel with 5% glycerol, followed by silver-staining visualization. The phenol/enzymatic digestion and the silica/enzymatic digestion methods provided amplicons from both tissue samples. The method described is a potential aid in the establishment of the histopathologic diagnosis and in retrospective studies with archival paraffin-embedded samples.

Effect of cryopreservation on sperm DNA integrity in patients with teratospermia.

PubMed

Kalthur, Guruprasad; Adiga, Satish Kumar; Upadhya, Dinesh; Rao, Satish; Kumar, Pratap

2008-06-01

To test whether sperm with abnormal head morphology are more likely to undergo DNA damage and/or chromatin modification during the process of freeze-thawing. In this prospective study, the semen samples from forty-four men attending the infertility clinic were included. Samples were divided into aliquots to allow direct comparison of fresh and frozen spermatozoa from the same ejaculate. The sperm morphology and the sperm DNA damage were evaluated before and after cryopreservation. The relationship between sperm head abnormalities and freeze-thaw-induced DNA modification was assessed. University hospital fertility center. Men attending infertility clinic for semen analysis. The normospermic and teratospermic semen samples were evaluated for DNA damage before and after cryopreservation by comet assay and acridine orange bindability test. Elucidation of association between sperm morphologic defect and cryodamage. A threefold increase in the amount of DNA damage was observed in teratospermic samples compared with their normospermic counterparts, indicating a higher susceptibility of morphologically abnormal sperm to cryodamage. The susceptibility of morphologically abnormal sperm to DNA damage/chromatin modification during the freeze-thaw process is significantly higher than that of sperm with normal morphology.

A new human genetic resource: a DNA bank established as part of the Avon longitudinal study of pregnancy and childhood (ALSPAC).

PubMed

Jones, R W; Ring, S; Tyfield, L; Hamvas, R; Simmons, H; Pembrey, M; Golding, J

2000-09-01

We describe a unique human DNA resource forming part of the Avon Longitudinal Study of Pregnancy and Childhood (ALSPAC), a longitudinal cohort study involving 14 000 children and their families living in a geographically defined area of England. The DNA bank will underpin the search for associations between genetic polymorphisms and common health outcomes. The opportunities to collect blood samples suitable for DNA extraction are necessarily limited, and the samples themselves have often been treated in different ways and have varied storage histories. With the need to maximise yields, the choice of DNA extraction method is critical to the success of the bank and we have investigated the suitability of various commercial and in-house methods of DNA extraction. Various steps have been taken to minimise errors in sample address and identification, including the use of a pipetting robot for dilution and transfer of samples between 96-well arrays to provide aliquots suitable for PCR. The robot has been programmed to cope with concentrated viscous DNA solutions.

Assessing DNA recovery from chewing gum.

PubMed

Eychner, Alison M; Schott, Kelly M; Elkins, Kelly M

2017-01-01

The purpose of this study was to evaluate which DNA extraction method yields the highest quantity of DNA from chewing gum. In this study, several popular extraction methods were tested, including Chelex-100, phenol-chloroform-isoamyl alcohol (PCIA), DNA IQ, PrepFiler, and QIAamp Investigator, and the quantity of DNA recovered from chewing gum was determined using real-time polymerase chain reaction with Quantifiler. Chewed gum control samples were submitted by anonymous healthy adult donors, and discarded environmental chewing gum samples simulating forensic evidence were collected from outside public areas (e.g., campus bus stops, streets, and sidewalks). As expected, results indicate that all methods tested yielded sufficient amplifiable human DNA from chewing gum using the wet-swab method. The QIAamp performed best when DNA was extracted from whole pieces of control gum (142.7 ng on average), and the DNA IQ method performed best on the environmental whole gum samples (29.0 ng on average). On average, the QIAamp kit also recovered the most DNA from saliva swabs. The PCIA method demonstrated the highest yield with wet swabs of the environmental gum (26.4 ng of DNA on average). However, this method should be avoided with whole gum samples (no DNA yield) due to the action of the organic reagents in dissolving and softening the gum and inhibiting DNA recovery during the extraction.

Rapid quantification and sex determination of forensic evidence materials.

PubMed

Andréasson, Hanna; Allen, Marie

2003-11-01

DNA quantification of forensic evidence is very valuable for an optimal use of the available biological material. Moreover, sex determination is of great importance as additional information in criminal investigations as well as in identification of missing persons, no suspect cases, and ancient DNA studies. While routine forensic DNA analysis based on short tandem repeat markers includes a marker for sex determination, analysis of samples containing scarce amounts of DNA is often based on mitochondrial DNA, and sex determination is not performed. In order to allow quantification and simultaneous sex determination on minute amounts of DNA, an assay based on real-time PCR analysis of a marker within the human amelogenin gene has been developed. The sex determination is based on melting curve analysis, while an externally standardized kinetic analysis allows quantification of the nuclear DNA copy number in the sample. This real-time DNA quantification assay has proven to be highly sensitive, enabling quantification of single DNA copies. Although certain limitations were apparent, the system is a rapid, cost-effective, and flexible assay for analysis of forensic casework samples.

Successful isolation and PCR amplification of DNA from National Institute of Standards and Technology herbal dietary supplement standard reference material powders and extracts.

PubMed

Cimino, Matthew T

2010-03-01

Twenty-four herbal dietary supplement powder and extract reference standards provided by the National Institute of Standards and Technology (NIST) were investigated using three different commercially available DNA extraction kits to evaluate DNA availability for downstream nucleotide-based applications. The material included samples of Camellia, Citrus, Ephedra, Ginkgo, Hypericum, Serenoa, And Vaccinium. Protocols from Qiagen, MoBio, and Phytopure were used to isolate and purify DNA from the NIST standards. The resulting DNA concentration was quantified using SYBR Green fluorometry. Each of the 24 samples yielded DNA, though the concentration of DNA from each approach was notably different. The Phytopure method consistently yielded more DNA. The average yield ratio was 22 : 3 : 1 (ng/microL; Phytopure : Qiagen : MoBio). Amplification of the internal transcribed spacer II region using PCR was ultimately successful in 22 of the 24 samples. Direct sequencing chromatograms of the amplified material suggested that most of the samples were comprised of mixtures. However, the sequencing chromatograms of 12 of the 24 samples were sufficient to confirm the identity of the target material. The successful extraction, amplification, and sequencing of DNA from these herbal dietary supplement extracts and powders supports a continued effort to explore nucleotide sequence-based tools for the authentication and identification of plants in dietary supplements. (c) Georg Thieme Verlag KG Stuttgart . New York.

Haplotype data for 23 Y-chromosome markers in a reference sample from Bosnia and Herzegovina.

PubMed

Kovačević, Lejla; Fatur-Cerić, Vera; Hadzic, Negra; Čakar, Jasmina; Primorac, Dragan; Marjanović, Damir

2013-06-01

To detect polymorphisms of 23 Y-chromosomal short tandem repeat (STR) loci, including 6 new loci, in a reference database of male population of Bosnia and Herzegovina, as well as to assess the importance of increasing the number of Y-STR loci utilized in forensic DNA analysis. The reference sample consisted of 100 healthy, unrelated men originating from Bosnia and Herzegovina. Sample collection using buccal swabs was performed in all geographical regions of Bosnia and Herzegovina in the period from 2010 to 2011. DNA samples were typed for 23 Y STR loci, including 6 new loci: DYS576, DYS481, DYS549, DYS533, DYS570, and DYS643, which are included in the new PowerPlex® Y 23 amplification kit. The absolute frequency of generated haplotypes was calculated and results showed that 98 samples had unique Y 23 haplotypes, and that only two samples shared the same haplotype. The most polymorphic locus was DYS418, with 14 detected alleles and the least polymorphic loci were DYS389I, DYS391, DYS437, and DYS393. This study showed that by increasing the number of highly polymorphic Y STR markers, to include those tested in our analysis, leads to a reduction of repeating haplotypes, which is very important in the application of forensic DNA analysis.

Low template STR typing: effect of replicate number and consensus method on genotyping reliability and DNA database search results.

PubMed

Benschop, Corina C G; van der Beek, Cornelis P; Meiland, Hugo C; van Gorp, Ankie G M; Westen, Antoinette A; Sijen, Titia

2011-08-01

To analyze DNA samples with very low DNA concentrations, various methods have been developed that sensitize short tandem repeat (STR) typing. Sensitized DNA typing is accompanied by stochastic amplification effects, such as allele drop-outs and drop-ins. Therefore low template (LT) DNA profiles are interpreted with care. One can either try to infer the genotype by a consensus method that uses alleles confirmed in replicate analyses, or one can use a statistical model to evaluate the strength of the evidence in a direct comparison with a known DNA profile. In this study we focused on the first strategy and we show that the procedure by which the consensus profile is assembled will affect genotyping reliability. In order to gain insight in the roles of replicate number and requested level of reproducibility, we generated six independent amplifications of samples of known donors. The LT methods included both increased cycling and enhanced capillary electrophoresis (CE) injection [1]. Consensus profiles were assembled from two to six of the replications using four methods: composite (include all alleles), n-1 (include alleles detected in all but one replicate), n/2 (include alleles detected in at least half of the replicates) and 2× (include alleles detected twice). We compared the consensus DNA profiles with the DNA profile of the known donor, studied the stochastic amplification effects and examined the effect of the consensus procedure on DNA database search results. From all these analyses we conclude that the accuracy of LT DNA typing and the efficiency of database searching improve when the number of replicates is increased and the consensus method is n/2. The most functional number of replicates within this n/2 method is four (although a replicate number of three suffices for samples showing >25% of the alleles in standard STR typing). This approach was also the optimal strategy for the analysis of 2-person mixtures, although modified search strategies may be needed to retrieve the minor component in database searches. From the database searches follows the recommendation to specifically mark LT DNA profiles when entering them into the DNA database. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

A DNA methylation map of human cancer at single base-pair resolution.

PubMed

Vidal, E; Sayols, S; Moran, S; Guillaumet-Adkins, A; Schroeder, M P; Royo, R; Orozco, M; Gut, M; Gut, I; Lopez-Bigas, N; Heyn, H; Esteller, M

2017-10-05

Although single base-pair resolution DNA methylation landscapes for embryonic and different somatic cell types provided important insights into epigenetic dynamics and cell-type specificity, such comprehensive profiling is incomplete across human cancer types. This prompted us to perform genome-wide DNA methylation profiling of 22 samples derived from normal tissues and associated neoplasms, including primary tumors and cancer cell lines. Unlike their invariant normal counterparts, cancer samples exhibited highly variable CpG methylation levels in a large proportion of the genome, involving progressive changes during tumor evolution. The whole-genome sequencing results from selected samples were replicated in a large cohort of 1112 primary tumors of various cancer types using genome-scale DNA methylation analysis. Specifically, we determined DNA hypermethylation of promoters and enhancers regulating tumor-suppressor genes, with potential cancer-driving effects. DNA hypermethylation events showed evidence of positive selection, mutual exclusivity and tissue specificity, suggesting their active participation in neoplastic transformation. Our data highlight the extensive changes in DNA methylation that occur in cancer onset, progression and dissemination.

Comparison of two DNA extraction protocols from leave samples of Cotinus coggygria, Citrus sinensis and Genus juglans.

PubMed

Fallah, F; Minaei Chenar, H; Amiri, H; Omodipour, S; Shirbande Ghods, F; Kahrizi, D; Sohrabi, M; Ghorbani, T; Kazemi, E

2017-02-28

High quality DNA is essential for molecular research. Secondary metabolites can affect the quantity and quality DNA. In current research two DNA isolation methods including CTAB and Delaporta (protocols 1 & 2 respectively) were applied in three leave samples from Cotinus coggygria, Citrus sinensis and Genus juglans that their leaves are rich of secondary metabolites. We successfully isolated DNA from C. coggygria, C. sinensis and Genus Juglans using the two protocols described above. Good quality DNA was isolated from C. coggygria, C. sinensis and Genus Juglans using protocol 1, while protocol 2 failed to produce usable DNA from these sources. The highest amount of DNA (1.3-1.6) was obtained from them using protocol 1. As we discovered, procedure 1 may work better for plants with secondary metabolites.

nrDNA:mtDNA copy number ratios as a comparative metric for evolutionary and conservation genetics.

PubMed

Goodall-Copestake, William Paul

2018-05-12

Identifying genetic cues of functional relevance is key to understanding the drivers of evolution and increasingly important for the conservation of biodiversity. This study introduces nuclear ribosomal DNA (nrDNA) to mitochondrial DNA (mtDNA) copy number ratios as a metric with which to screen for this functional genetic variation prior to more extensive omics analyses. To illustrate the metric, quantitative PCR was used to estimate nrDNA (18S) to mtDNA (16S) copy number ratios in muscle tissue from samples of two zooplankton species: Salpa thompsoni caught near Elephant Island (Southern Ocean) and S. fusiformis sampled off Gough Island (South Atlantic). Average 18S:16S ratios in these samples were 9:1 and 3:1, respectively. nrDNA 45S arrays and mitochondrial genomes were then deep sequenced to uncover the sources of intra-individual genetic variation underlying these 18S:16S copy number differences. The deep sequencing profiles obtained were consistent with genetic changes resulting from adaptive processes, including an expansion of nrDNA and damage to mtDNA in S. thompsoni, potentially in response to the polar environment. Beyond this example from zooplankton, nrDNA:mtDNA copy number ratios offer a promising metric to help identify genetic variation of functional relevance in animals more broadly.

Sources of Pre-Analytical Variations in Yield of DNA Extracted from Blood Samples: Analysis of 50,000 DNA Samples in EPIC

PubMed Central

Caboux, Elodie; Lallemand, Christophe; Ferro, Gilles; Hémon, Bertrand; Mendy, Maimuna; Biessy, Carine; Sims, Matt; Wareham, Nick; Britten, Abigail; Boland, Anne; Hutchinson, Amy; Siddiq, Afshan; Vineis, Paolo; Riboli, Elio; Romieu, Isabelle; Rinaldi, Sabina; Gunter, Marc J.; Peeters, Petra H. M.; van der Schouw, Yvonne T.; Travis, Ruth; Bueno-de-Mesquita, H. Bas; Canzian, Federico; Sánchez, Maria-José; Skeie, Guri; Olsen, Karina Standahl; Lund, Eiliv; Bilbao, Roberto; Sala, Núria; Barricarte, Aurelio; Palli, Domenico; Navarro, Carmen; Panico, Salvatore; Redondo, Maria Luisa; Polidoro, Silvia; Dossus, Laure; Boutron-Ruault, Marie Christine; Clavel-Chapelon, Françoise; Trichopoulou, Antonia; Trichopoulos, Dimitrios; Lagiou, Pagona; Boeing, Heiner; Fisher, Eva; Tumino, Rosario; Agnoli, Claudia; Hainaut, Pierre

2012-01-01

The European Prospective Investigation into Cancer and nutrition (EPIC) is a long-term, multi-centric prospective study in Europe investigating the relationships between cancer and nutrition. This study has served as a basis for a number of Genome-Wide Association Studies (GWAS) and other types of genetic analyses. Over a period of 5 years, 52,256 EPIC DNA samples have been extracted using an automated DNA extraction platform. Here we have evaluated the pre-analytical factors affecting DNA yield, including anthropometric, epidemiological and technical factors such as center of subject recruitment, age, gender, body-mass index, disease case or control status, tobacco consumption, number of aliquots of buffy coat used for DNA extraction, extraction machine or procedure, DNA quantification method, degree of haemolysis and variations in the timing of sample processing. We show that the largest significant variations in DNA yield were observed with degree of haemolysis and with center of subject recruitment. Age, gender, body-mass index, cancer case or control status and tobacco consumption also significantly impacted DNA yield. Feedback from laboratories which have analyzed DNA with different SNP genotyping technologies demonstrate that the vast majority of samples (approximately 88%) performed adequately in different types of assays. To our knowledge this study is the largest to date to evaluate the sources of pre-analytical variations in DNA extracted from peripheral leucocytes. The results provide a strong evidence-based rationale for standardized recommendations on blood collection and processing protocols for large-scale genetic studies. PMID:22808065

Direct PCR amplification of forensic touch and other challenging DNA samples: A review.

PubMed

Cavanaugh, Sarah E; Bathrick, Abigail S

2018-01-01

DNA evidence sample processing typically involves DNA extraction, quantification, and STR amplification; however, DNA loss can occur at both the DNA extraction and quantification steps, which is not ideal for forensic evidence containing low levels of DNA. Direct PCR amplification of forensic unknown samples has been suggested as a means to circumvent extraction and quantification, thereby retaining the DNA typically lost during those procedures. Direct PCR amplification is a method in which a sample is added directly to an amplification reaction without being subjected to prior DNA extraction, purification, or quantification. It allows for maximum quantities of DNA to be targeted, minimizes opportunities for error and contamination, and reduces the time and monetary resources required to process samples, although data analysis may take longer as the increased DNA detection sensitivity of direct PCR may lead to more instances of complex mixtures. ISO 17025 accredited laboratories have successfully implemented direct PCR for limited purposes (e.g., high-throughput databanking analysis), and recent studies indicate that direct PCR can be an effective method for processing low-yield evidence samples. Despite its benefits, direct PCR has yet to be widely implemented across laboratories for the processing of evidentiary items. While forensic DNA laboratories are always interested in new methods that will maximize the quantity and quality of genetic information obtained from evidentiary items, there is often a lag between the advent of useful methodologies and their integration into laboratories. Delayed implementation of direct PCR of evidentiary items can be attributed to a variety of factors, including regulatory guidelines that prevent laboratories from omitting the quantification step when processing forensic unknown samples, as is the case in the United States, and, more broadly, a reluctance to validate a technique that is not widely used for evidence samples. The advantages of direct PCR of forensic evidentiary samples justify a re-examination of the factors that have delayed widespread implementation of this method and of the evidence supporting its use. In this review, the current and potential future uses of direct PCR in forensic DNA laboratories are summarized. Copyright © 2017 Elsevier B.V. All rights reserved.

A magnetic bead-based method for concentrating DNA from human urine for downstream detection.

PubMed

Bordelon, Hali; Russ, Patricia K; Wright, David W; Haselton, Frederick R

2013-01-01

Due to the presence of PCR inhibitors, PCR cannot be used directly on most clinical samples, including human urine, without pre-treatment. A magnetic bead-based strategy is one potential method to collect biomarkers from urine samples and separate the biomarkers from PCR inhibitors. In this report, a 1 mL urine sample was mixed within the bulb of a transfer pipette containing lyophilized nucleic acid-silica adsorption buffer and silica-coated magnetic beads. After mixing, the sample was transferred from the pipette bulb to a small diameter tube, and captured biomarkers were concentrated using magnetic entrainment of beads through pre-arrayed wash solutions separated by small air gaps. Feasibility was tested using synthetic segments of the 140 bp tuberculosis IS6110 DNA sequence spiked into pooled human urine samples. DNA recovery was evaluated by qPCR. Despite the presence of spiked DNA, no DNA was detectable in unextracted urine samples, presumably due to the presence of PCR inhibitors. However, following extraction with the magnetic bead-based method, we found that ∼50% of spiked TB DNA was recovered from human urine containing roughly 5×10(3) to 5×10(8) copies of IS6110 DNA. In addition, the DNA was concentrated approximately ten-fold into water. The final concentration of DNA in the eluate was 5×10(6), 14×10(6), and 8×10(6) copies/µL for 1, 3, and 5 mL urine samples, respectively. Lyophilized and freshly prepared reagents within the transfer pipette produced similar results, suggesting that long-term storage without refrigeration is possible. DNA recovery increased with the length of the spiked DNA segments from 10±0.9% for a 75 bp DNA sequence to 42±4% for a 100 bp segment and 58±9% for a 140 bp segment. The estimated LOD was 77 copies of DNA/µL of urine. The strategy presented here provides a simple means to achieve high nucleic acid recovery from easily obtained urine samples, which does not contain inhibitors of PCR.

A Magnetic Bead-Based Method for Concentrating DNA from Human Urine for Downstream Detection

PubMed Central

Bordelon, Hali; Russ, Patricia K.; Wright, David W.; Haselton, Frederick R.

2013-01-01

Due to the presence of PCR inhibitors, PCR cannot be used directly on most clinical samples, including human urine, without pre-treatment. A magnetic bead-based strategy is one potential method to collect biomarkers from urine samples and separate the biomarkers from PCR inhibitors. In this report, a 1 mL urine sample was mixed within the bulb of a transfer pipette containing lyophilized nucleic acid-silica adsorption buffer and silica-coated magnetic beads. After mixing, the sample was transferred from the pipette bulb to a small diameter tube, and captured biomarkers were concentrated using magnetic entrainment of beads through pre-arrayed wash solutions separated by small air gaps. Feasibility was tested using synthetic segments of the 140 bp tuberculosis IS6110 DNA sequence spiked into pooled human urine samples. DNA recovery was evaluated by qPCR. Despite the presence of spiked DNA, no DNA was detectable in unextracted urine samples, presumably due to the presence of PCR inhibitors. However, following extraction with the magnetic bead-based method, we found that ∼50% of spiked TB DNA was recovered from human urine containing roughly 5×103 to 5×108 copies of IS6110 DNA. In addition, the DNA was concentrated approximately ten-fold into water. The final concentration of DNA in the eluate was 5×106, 14×106, and 8×106 copies/µL for 1, 3, and 5 mL urine samples, respectively. Lyophilized and freshly prepared reagents within the transfer pipette produced similar results, suggesting that long-term storage without refrigeration is possible. DNA recovery increased with the length of the spiked DNA segments from 10±0.9% for a 75 bp DNA sequence to 42±4% for a 100 bp segment and 58±9% for a 140 bp segment. The estimated LOD was 77 copies of DNA/µL of urine. The strategy presented here provides a simple means to achieve high nucleic acid recovery from easily obtained urine samples, which does not contain inhibitors of PCR. PMID:23861895

A simplified field protocol for genetic sampling of birds using buccal swabs

USGS Publications Warehouse

Vilstrup, Julia T.; Mullins, Thomas D.; Miller, Mark P.; McDearman, Will; Walters, Jeffrey R.; Haig, Susan M.

2018-01-01

DNA sampling is an essential prerequisite for conducting population genetic studies. For many years, blood sampling has been the preferred method for obtaining DNA in birds because of their nucleated red blood cells. Nonetheless, use of buccal swabs has been gaining favor because they are less invasive yet still yield adequate amounts of DNA for amplifying mitochondrial and nuclear markers; however, buccal swab protocols often include steps (e.g., extended air-drying and storage under frozen conditions) not easily adapted to field settings. Furthermore, commercial extraction kits and swabs for buccal sampling can be expensive for large population studies. We therefore developed an efficient, cost-effective, and field-friendly protocol for sampling wild birds after comparing DNA yield among 3 inexpensive buccal swab types (2 with foam tips and 1 with a cotton tip). Extraction and amplification success was high (100% and 97.2% respectively) using inexpensive generic swabs. We found foam-tipped swabs provided higher DNA yields than cotton-tipped swabs. We further determined that omitting a drying step and storing swabs in Longmire buffer increased efficiency in the field while still yielding sufficient amounts of DNA for detailed population genetic studies using mitochondrial and nuclear markers. This new field protocol allows time- and cost-effective DNA sampling of juveniles or small-bodied birds for which drawing blood may cause excessive stress to birds and technicians alike.

Developmental validation of the MiSeq FGx Forensic Genomics System for Targeted Next Generation Sequencing in Forensic DNA Casework and Database Laboratories.

PubMed

Jäger, Anne C; Alvarez, Michelle L; Davis, Carey P; Guzmán, Ernesto; Han, Yonmee; Way, Lisa; Walichiewicz, Paulina; Silva, David; Pham, Nguyen; Caves, Glorianna; Bruand, Jocelyne; Schlesinger, Felix; Pond, Stephanie J K; Varlaro, Joe; Stephens, Kathryn M; Holt, Cydne L

2017-05-01

Human DNA profiling using PCR at polymorphic short tandem repeat (STR) loci followed by capillary electrophoresis (CE) size separation and length-based allele typing has been the standard in the forensic community for over 20 years. Over the last decade, Next-Generation Sequencing (NGS) matured rapidly, bringing modern advantages to forensic DNA analysis. The MiSeq FGx™ Forensic Genomics System, comprised of the ForenSeq™ DNA Signature Prep Kit, MiSeq FGx™ Reagent Kit, MiSeq FGx™ instrument and ForenSeq™ Universal Analysis Software, uses PCR to simultaneously amplify up to 231 forensic loci in a single multiplex reaction. Targeted loci include Amelogenin, 27 common, forensic autosomal STRs, 24 Y-STRs, 7 X-STRs and three classes of single nucleotide polymorphisms (SNPs). The ForenSeq™ kit includes two primer sets: Amelogenin, 58 STRs and 94 identity informative SNPs (iiSNPs) are amplified using DNA Primer Set A (DPMA; 153 loci); if a laboratory chooses to generate investigative leads using DNA Primer Set B, amplification is targeted to the 153 loci in DPMA plus 22 phenotypic informative (piSNPs) and 56 biogeographical ancestry SNPs (aiSNPs). High-resolution genotypes, including detection of intra-STR sequence variants, are semi-automatically generated with the ForenSeq™ software. This system was subjected to developmental validation studies according to the 2012 Revised SWGDAM Validation Guidelines. A two-step PCR first amplifies the target forensic STR and SNP loci (PCR1); unique, sample-specific indexed adapters or "barcodes" are attached in PCR2. Approximately 1736 ForenSeq™ reactions were analyzed. Studies include DNA substrate testing (cotton swabs, FTA cards, filter paper), species studies from a range of nonhuman organisms, DNA input sensitivity studies from 1ng down to 7.8pg, two-person human DNA mixture testing with three genotype combinations, stability analysis of partially degraded DNA, and effects of five commonly encountered PCR inhibitors. Calculations from ForenSeq™ STR and SNP repeatability and reproducibility studies (1ng template) indicate 100.0% accuracy of the MiSeq FGx™ System in allele calling relative to CE for STRs (1260 samples), and >99.1% accuracy relative to bead array typing for SNPs (1260 samples for iiSNPs, 310 samples for aiSNPs and piSNPs), with >99.0% and >97.8% precision, respectively. Call rates of >99.0% were observed for all STRs and SNPs amplified with both ForenSeq™ primer mixes. Limitations of the MiSeq FGx™ System are discussed. Results described here demonstrate that the MiSeq FGx™ System meets forensic DNA quality assurance guidelines with robust, reliable, and reproducible performance on samples of various quantities and qualities. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Survey of feline leukemia virus and feline coronaviruses in captive neotropical wild felids from Southern Brazil.

PubMed

Guimaraes, Ana M S; Brandão, Paulo E; de Moraes, Wanderlei; Cubas, Zalmir S; Santos, Leonilda C; Villarreal, Laura Y B; Robes, Rogério R; Coelho, Fabiana M; Resende, Mauricio; Santos, Renata C F; Oliveira, Rosangela C; Yamaguti, Mauricio; Marques, Lucas M; Neto, Renata L; Buzinhani, Melissa; Marques, Regina; Messick, Joanne B; Biondo, Alexander W; Timenetsky, Jorge

2009-06-01

A total of 57 captive neotropical felids (one Leopardus geoffroyi, 14 Leopardus pardalis, 17 Leopardus wiedii, 22 Leopardus tigrinus, and three Puma yagouaroundi) from the Itaipu Binacional Wildlife Research Center (Refúgio Bela Vista, Southern Brazil) were anesthetized for blood collection. Feces samples were available for 44 animals, including one L. geoffroyi, eight L. pardalis, 14 L. wiedii, 20 L. tigrinus, and one P. yagouaroundi. Total DNA and RNA were extracted from blood and feces, respectively, using commercial kits. Blood DNA samples were evaluated by polymerase chain reaction (PCR) for feline leukemia virus (FeLV) proviral DNA, whereas reverse transcriptase-PCR was run on fecal samples for detection of coronavirus RNA. None of the samples were positive for coronaviruses. A male L. pardalis and a female L. tigrinus were positive for FeLV proviral DNA, and identities of PCR products were confirmed by sequencing. This is the first evidence of FeLV proviral DNA in these species in Southern Brazil.

Assessment of the role of DNA repair in damaged forensic samples.

PubMed

Ambers, Angie; Turnbough, Meredith; Benjamin, Robert; King, Jonathan; Budowle, Bruce

2014-11-01

Previous studies on DNA damage and repair have involved in vitro laboratory procedures that induce a single type of lesion in naked templates. Although repair of singular, sequestered types of DNA damage has shown some success, forensic and ancient specimens likely contain a number of different types of lesions. This study sought to (1) develop protocols to damage DNA in its native state, (2) generate a pool of candidate samples for repair that more likely emulate authentic forensic samples, and (3) assess the ability of the PreCR(TM) Repair Mix to repair the resultant lesions. Complexed, native DNA is more difficult to damage than naked DNA. Modified procedures included the use of higher concentrations and longer exposure times. Three types of samples, those that demonstrated damage based on short tandem repeat (STR) profile signals, were selected for repair experiments: environmentally damaged bloodstains, bleach-damaged whole blood, and human skeletal remains. Results showed trends of improved performance of STR profiling of bleach-damaged DNA. However, the repair assay did not improve DNA profiles from environmentally damaged bloodstains or bone, and in some cases resulted in lower RFU values for STR alleles. The extensive spectrum of DNA damage and myriad combinations of lesions that can be present in forensic samples appears to pose a challenge for the in vitro PreCR(TM) assay. The data suggest that the use of PreCR in casework should be considered with caution due to the assay's varied results.

DNA-PK assay

DOEpatents

Anderson, Carl W.; Connelly, Margery A.

2004-10-12

The present invention provides a method for detecting DNA-activated protein kinase (DNA-PK) activity in a biological sample. The method includes contacting a biological sample with a detectably-labeled phosphate donor and a synthetic peptide substrate defined by the following features to provide specific recognition and phosphorylation by DNA-PK: (1) a phosphate-accepting amino acid pair which may include serine-glutamine (Ser-Gln) (SQ), threonine-glutamine (Thr-Gln) (TQ), glutamine-serine (Gln-Ser) (QS), or glutamine-threonine (Gln-Thr) (QT); (2) enhancer amino acids which may include glutamic acid or glutamine immediately adjacent at the amino- or carboxyl- side of the amino acid pair and forming an amino acid pair-enhancer unit; (3) a first spacer sequence at the amino terminus of the amino acid pair-enhancer unit; (4) a second spacer sequence at the carboxyl terminus of the amino acid pair-enhancer unit, which spacer sequences may include any combination of amino acids that does not provide a phosphorylation site consensus sequence motif; and, (5) a tag moiety, which may be an amino acid sequence or another chemical entity that permits separating the synthetic peptide from the phosphate donor. A compostion and a kit for the detection of DNA-PK activity are also provided. Methods for detecting DNA, protein phosphatases and substances that alter the activity of DNA-PK are also provided. The present invention also provides a method of monitoring protein kinase and DNA-PK activity in living cells. -A composition and a kit for monitoring protein kinase activity in vitro and a composition and a kit for monitoring DNA-PK activities in living cells are also provided. A method for identifying agents that alter protein kinase activity in vitro and a method for identifying agents that alter DNA-PK activity in living cells are also provided.

DNA stable-isotope probing (DNA-SIP).

PubMed

Dunford, Eric A; Neufeld, Josh D

2010-08-02

DNA stable-isotope probing (DNA-SIP) is a powerful technique for identifying active microorganisms that assimilate particular carbon substrates and nutrients into cellular biomass. As such, this cultivation-independent technique has been an important methodology for assigning metabolic function to the diverse communities inhabiting a wide range of terrestrial and aquatic environments. Following the incubation of an environmental sample with stable-isotope labelled compounds, extracted nucleic acid is subjected to density gradient ultracentrifugation and subsequent gradient fractionation to separate nucleic acids of differing densities. Purification of DNA from cesium chloride retrieves labelled and unlabelled DNA for subsequent molecular characterization (e.g. fingerprinting, microarrays, clone libraries, metagenomics). This JoVE video protocol provides visual step-by-step explanations of the protocol for density gradient ultracentrifugation, gradient fractionation and recovery of labelled DNA. The protocol also includes sample SIP data and highlights important tips and cautions that must be considered to ensure a successful DNA-SIP analysis.

HIV-1 and HCV viral load cost models for bDNA: 440 Molecular System versus real-time PCR AmpliPrep/TaqMan test.

PubMed

Elbeik, Tarek; Dalessandro, Ralph; Loftus, Richard A; Beringer, Scott

2007-11-01

Comparative cost models were developed to assess cost-per-reportable result and annual costs for HIV-1 and HCV bDNA and AmpliPrep/TaqMan Test (PCR). Model cost components included kit, disposables, platform and related equipment, equipment service plan, equipment maintenance, equipment footprint, waste and labor. Model assessment was most cost-effective when run by bDNA with 36 or more clinical samples and PCR with 30 or fewer clinical samples. Lower costs are attained with maximum samples (84-168) run daily. Highest cost contributors include kit, platform and PCR proprietary disposables. Understanding component costs and the most economic use of HIV-1 and HCV viral load will aid in attaining lowest costs through selection of the appropriate assay and effective negotiations.

Archaeal Diversity in Waters from Deep South African Gold Mines

PubMed Central

Takai, Ken; Moser, Duane P.; DeFlaun, Mary; Onstott, Tullis C.; Fredrickson, James K.

2001-01-01

A culture-independent molecular analysis of archaeal communities in waters collected from deep South African gold mines was performed by performing a PCR-mediated terminal restriction fragment length polymorphism (T-RFLP) analysis of rRNA genes (rDNA) in conjunction with a sequencing analysis of archaeal rDNA clone libraries. The water samples used represented various environments, including deep fissure water, mine service water, and water from an overlying dolomite aquifer. T-RFLP analysis revealed that the ribotype distribution of archaea varied with the source of water. The archaeal communities in the deep gold mine environments exhibited great phylogenetic diversity; the majority of the members were most closely related to uncultivated species. Some archaeal rDNA clones obtained from mine service water and dolomite aquifer water samples were most closely related to environmental rDNA clones from surface soil (soil clones) and marine environments (marine group I [MGI]). Other clones exhibited intermediate phylogenetic affiliation between soil clones and MGI in the Crenarchaeota. Fissure water samples, derived from active or dormant geothermal environments, yielded archaeal sequences that exhibited novel phylogeny, including a novel lineage of Euryarchaeota. These results suggest that deep South African gold mines harbor novel archaeal communities distinct from those observed in other environments. Based on the phylogenetic analysis of archaeal strains and rDNA clones, including the newly discovered archaeal rDNA clones, the evolutionary relationship and the phylogenetic organization of the domain Archaea are reevaluated. PMID:11722932

Estimation of the Relative Abundance of Different Bacteroides and Prevotella Ribotypes in Gut Samples by Restriction Enzyme Profiling of PCR-Amplified 16S rRNA Gene Sequences

PubMed Central

Wood, Jacqueline; Scott, Karen P.; Avguštin, Gorazd; Newbold, C. James; Flint, Harry J.

1998-01-01

We describe an approach for determining the genetic composition of Bacteroides and Prevotella populations in gut contents based on selective amplification of 16S rRNA gene sequences (rDNA) followed by cleavage of the amplified material with restriction enzymes. The relative contributions of different ribotypes to total Bacteroides and Prevotella 16S rDNA are estimated after end labelling of one of the PCR primers, and the contribution of Bacteroides and Prevotella sequences to total eubacterial 16S rDNA is estimated by measuring the binding of oligonucleotide probes to amplified DNA. Bacteroides and Prevotella 16S rDNA accounted for between 12 and 62% of total eubacterial 16S rDNA in samples of ruminal contents from six sheep and a cow. Ribotypes 4, 5, 6, and 7, which include most cultivated rumen Prevotella strains, together accounted for between 20 and 86% of the total amplified Bacteroides and Prevotella rDNA in these samples. The most abundant Bacteroides or Prevotella ribotype in four animals, however, was ribotype 8, for which there is only one known cultured isolate, while ribotypes 1 and 2, which include many colonic Bacteroides spp., were the most abundant in two animals. This indicates that some abundant Bacteroides and Prevotella groups in the rumen are underrepresented among cultured rumen Prevotella isolates. The approach described here provides a rapid, convenient, and widely applicable method for comparing the genotypic composition of bacterial populations in gut samples. PMID:9758785

A rapid and efficient DNA extraction protocol from fresh and frozen human blood samples.

PubMed

Guha, Pokhraj; Das, Avishek; Dutta, Somit; Chaudhuri, Tapas Kumar

2018-01-01

Different methods available for extraction of human genomic DNA suffer from one or more drawbacks including low yield, compromised quality, cost, time consumption, use of toxic organic solvents, and many more. Herein, we aimed to develop a method to extract DNA from 500 μL of fresh or frozen human blood. Five hundred microliters of fresh and frozen human blood samples were used for standardization of the extraction procedure. Absorbance at 260 and 280 nm, respectively, (A 260 /A 280 ) were estimated to check the quality and quantity of the extracted DNA sample. Qualitative assessment of the extracted DNA was checked by Polymerase Chain reaction and double digestion of the DNA sample. Our protocol resulted in average yield of 22±2.97 μg and 20.5±3.97 μg from 500 μL of fresh and frozen blood, respectively, which were comparable to many reference protocols and kits. Besides yielding bulk amount of DNA, our protocol is rapid, economical, and avoids toxic organic solvents such as Phenol. Due to unaffected quality, the DNA is suitable for downstream applications. The protocol may also be useful for pursuing basic molecular researches in laboratories having limited funds. © 2017 Wiley Periodicals, Inc.

Digital droplet multiple displacement amplification (ddMDA) for whole genome sequencing of limited DNA samples

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rhee, Minsoung; Light, Yooli K.; Meagher, Robert J.

Here, multiple displacement amplification (MDA) is a widely used technique for amplification of DNA from samples containing limited amounts of DNA (e.g., uncultivable microbes or clinical samples) before whole genome sequencing. Despite its advantages of high yield and fidelity, it suffers from high amplification bias and non-specific amplification when amplifying sub-nanogram of template DNA. Here, we present a microfluidic digital droplet MDA (ddMDA) technique where partitioning of the template DNA into thousands of sub-nanoliter droplets, each containing a small number of DNA fragments, greatly reduces the competition among DNA fragments for primers and polymerase thereby greatly reducing amplification bias. Consequently,more » the ddMDA approach enabled a more uniform coverage of amplification over the entire length of the genome, with significantly lower bias and non-specific amplification than conventional MDA. For a sample containing 0.1 pg/μL of E. coli DNA (equivalent of ~3/1000 of an E. coli genome per droplet), ddMDA achieves a 65-fold increase in coverage in de novo assembly, and more than 20-fold increase in specificity (percentage of reads mapping to E. coli) compared to the conventional tube MDA. ddMDA offers a powerful method useful for many applications including medical diagnostics, forensics, and environmental microbiology.« less

Digital droplet multiple displacement amplification (ddMDA) for whole genome sequencing of limited DNA samples

DOE PAGES

Rhee, Minsoung; Light, Yooli K.; Meagher, Robert J.; ...

2016-05-04

Here, multiple displacement amplification (MDA) is a widely used technique for amplification of DNA from samples containing limited amounts of DNA (e.g., uncultivable microbes or clinical samples) before whole genome sequencing. Despite its advantages of high yield and fidelity, it suffers from high amplification bias and non-specific amplification when amplifying sub-nanogram of template DNA. Here, we present a microfluidic digital droplet MDA (ddMDA) technique where partitioning of the template DNA into thousands of sub-nanoliter droplets, each containing a small number of DNA fragments, greatly reduces the competition among DNA fragments for primers and polymerase thereby greatly reducing amplification bias. Consequently,more » the ddMDA approach enabled a more uniform coverage of amplification over the entire length of the genome, with significantly lower bias and non-specific amplification than conventional MDA. For a sample containing 0.1 pg/μL of E. coli DNA (equivalent of ~3/1000 of an E. coli genome per droplet), ddMDA achieves a 65-fold increase in coverage in de novo assembly, and more than 20-fold increase in specificity (percentage of reads mapping to E. coli) compared to the conventional tube MDA. ddMDA offers a powerful method useful for many applications including medical diagnostics, forensics, and environmental microbiology.« less

[Research status and prospects of DNA test on difficult specimens].

PubMed

Dang, Hua-Wei; Mao, Jiong; Wang, Hui; Huang, Jiang-Ping; Bai, Xiao-Gang

2012-02-01

This paper reviews the advances of DNA detection on three types of difficult biological specimens including degraded samples, trace evidences and mixed samples. The source of different samples, processing methods and announcements were analyzed. New methods such as mitochondrial test system, changing the original experimental conditions, low-volume PCR amplification and new technologies such as whole genome amplification techniques, laser capture micro-dissection, and mini-STR technology in recent years are introduced.

[Application of repair enzymes to improve the quality of degraded DNA templates for PCR amplification].

PubMed

Dovgerd, A P; Zharkov, D O

2014-01-01

PCR amplification of severely degraded DNA, including ancient DNA, forensic samples, and preparations from deeply processed foodstuffs, is a serious problem. Living organisms have a set of enzymes to repair lesions in their DNA. In this work, we have developed and characterized model systems of degraded high-molecular-weight DNA with a predominance of different types of damage. It was shown that depurination and oxidation of the model plasmid DNA template led to a decrease in the PCR efficiency. A set of enzymes performing a full cycle of excision repair of some lesions was determined. The treatment of model-damaged substrates with this set of enzymes resulted in an increased PCR product yield as compared with that of the unrepaired samples.

The Rapid-Heat LAMPellet Method: A Potential Diagnostic Method for Human Urogenital Schistosomiasis

PubMed Central

Carranza-Rodríguez, Cristina; Pérez-Arellano, José Luis; Vicente, Belén; López-Abán, Julio; Muro, Antonio

2015-01-01

Background Urogenital schistosomiasis due to Schistosoma haematobium is a serious underestimated public health problem affecting 112 million people - particularly in sub-Saharan Africa. Microscopic examination of urine samples to detect parasite eggs still remains as definitive diagnosis. This work was focussed on developing a novel loop-mediated isothermal amplification (LAMP) assay for detection of S. haematobium DNA in human urine samples as a high-throughput, simple, accurate and affordable diagnostic tool to use in diagnosis of urogenital schistosomiasis. Methodology/Principal Findings A LAMP assay targeting a species specific sequence of S. haematobium ribosomal intergenic spacer was designed. The effectiveness of our LAMP was assessed in a number of patients´ urine samples with microscopy confirmed S. haematobium infection. For potentially large-scale application in field conditions, different DNA extraction methods, including a commercial kit, a modified NaOH extraction method and a rapid heating method were tested using small volumes of urine fractions (whole urine, supernatants and pellets). The heating of pellets from clinical samples was the most efficient method to obtain good-quality DNA detectable by LAMP. The detection limit of our LAMP was 1 fg/µL of S. haematobium DNA in urine samples. When testing all patients´ urine samples included in our study, diagnostic parameters for sensitivity and specificity were calculated for LAMP assay, 100% sensitivity (95% CI: 81.32%-100%) and 86.67% specificity (95% CI: 75.40%-94.05%), and also for microscopy detection of eggs in urine samples, 69.23% sensitivity (95% CI: 48.21% -85.63%) and 100% specificity (95% CI: 93.08%-100%). Conclusions/Significance We have developed and evaluated, for the first time, a LAMP assay for detection of S. haematobium DNA in heated pellets from patients´ urine samples using no complicated requirement procedure for DNA extraction. The procedure has been named the Rapid-Heat LAMPellet method and has the potential to be developed further as a field diagnostic tool for use in urogenital schistosomiasis-endemic areas. PMID:26230990

Diagnosis of becker muscular dystrophy: Results of Re-analysis of DNA samples.

PubMed

Straathof, Chiara S M; Van Heusden, Dave; Ippel, Pieternella F; Post, Jan G; Voermans, Nicol C; De Visser, Marianne; Brusse, Esther; Van Den Bergen, Janneke C; Van Der Kooi, Anneke J; Verschuuren, Jan J G M; Ginjaar, Hendrika B

2016-01-01

The phenotype of Becker muscular dystrophy (BMD) is highly variable, and the disease may be underdiagnosed. We searched for new mutations in the DMD gene in a cohort of previously undiagnosed patients who had been referred in the period 1985-1995. All requests for DNA analysis of the DMD gene in probands with suspected BMD were re-evaluated. If the phenotype was compatible with BMD, and no deletions or duplications were detected, DNA samples were screened for small mutations. In 79 of 185 referrals, no mutation was found. Analysis could be performed on 31 DNA samples. Seven different mutations, including 3 novel ones, were found. Long-term clinical follow-up is described. Refining DNA analysis in previously undiagnosed cases can identify mutations in the DMD gene and provide genetic diagnosis of BMD. A delayed diagnosis can still be valuable for the proband or the relatives of BMD patients. © 2015 Wiley Periodicals, Inc.

Development of a Novel Self-Enclosed Sample Preparation Device for DNA/RNA Isolation in Space

NASA Technical Reports Server (NTRS)

Zhang, Ye; Mehta, Satish K.; Pensinger, Stuart J.; Pickering, Karen D.

2011-01-01

Modern biology techniques present potentials for a wide range of molecular, cellular, and biochemistry applications in space, including detection of infectious pathogens and environmental contaminations, monitoring of drug-resistant microbial and dangerous mutations, identification of new phenotypes of microbial and new life species. However, one of the major technological blockades in enabling these technologies in space is a lack of devices for sample preparation in the space environment. To overcome such an obstacle, we constructed a prototype of a DNA/RNA isolation device based on our novel designs documented in the NASA New Technology Reporting System (MSC-24811-1/3-1). This device is self-enclosed and pipette free, purposely designed for use in the absence of gravity. Our design can also be modified easily for preparing samples in space for other applications, such as flowcytometry, immunostaining, cell separation, sample purification and separation according to its size and charges, sample chemical labeling, and sample purification. The prototype of our DNA/RNA isolation device was tested for efficiencies of DNA and RNA isolation from various cell types for PCR analysis. The purity and integrity of purified DNA and RNA were determined as well. Results showed that our developed DNA/RNA isolation device offers similar efficiency and quality in comparison to the samples prepared using the standard protocol in the laboratory.

ESDA®-Lite collection of DNA from latent fingerprints on documents.

PubMed

Plaza, Dane T; Mealy, Jamia L; Lane, J Nicholas; Parsons, M Neal; Bathrick, Abigail S; Slack, Donia P

2015-05-01

The ability to detect and non-destructively collect biological samples for DNA processing would benefit the forensic community by preserving the physical integrity of evidentiary items for more thorough evaluations by other forensic disciplines. The Electrostatic Detection Apparatus (ESDA®) was systemically evaluated for its ability to non-destructively collect DNA from latent fingerprints deposited on various paper substrates for short tandem repeat (STR) DNA profiling. Fingerprints were deposited on a variety of paper substrates that included resume paper, cotton paper, magazine paper, currency, copy paper, and newspaper. Three DNA collection techniques were performed: ESDA collection, dry swabbing, and substrate cutting. Efficacy of each collection technique was evaluated by the quantity of DNA present in each sample and the percent profile generated by each sample. Both the ESDA and dry swabbing non-destructive sampling techniques outperformed the destructive methodology of substrate cutting. A greater number of full profiles were generated from samples collected with the non-destructive dry swabbing collection technique than were generated from samples collected with the ESDA; however, the ESDA also allowed the user to visualize the area of interest while non-destructively collecting the biological material. The ability to visualize the biological material made sampling straightforward and eliminated the need for numerous, random swabbings/cuttings. Based on these results, the evaluated non-destructive ESDA collection technique has great potential for real-world forensic implementation. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Origin and composition of cell-free DNA in spent medium from human embryo culture during preimplantation development.

PubMed

Vera-Rodriguez, M; Diez-Juan, A; Jimenez-Almazan, J; Martinez, S; Navarro, R; Peinado, V; Mercader, A; Meseguer, M; Blesa, D; Moreno, I; Valbuena, D; Rubio, C; Simon, C

2018-04-01

What is the origin and composition of cell-free DNA in human embryo spent culture media? Cell-free DNA from human embryo spent culture media represents a mix of maternal and embryonic DNA, and the mixture can be more complex for mosaic embryos. In 2016, ~300 000 human embryos were chromosomally and/or genetically analyzed using preimplantation genetic testing for aneuploidies (PGT-A) or monogenic disorders (PGT-M) before transfer into the uterus. While progress in genetic techniques has enabled analysis of the full karyotype in a single cell with high sensitivity and specificity, these approaches still require an embryo biopsy. Thus, non-invasive techniques are sought as an alternative. This study was based on a total of 113 human embryos undergoing trophectoderm biopsy as part of PGT-A analysis. For each embryo, the spent culture media used between Day 3 and Day 5 of development were collected for cell-free DNA analysis. In addition to the 113 spent culture media samples, 28 media drops without embryo contact were cultured in parallel under the same conditions to use as controls. In total, 141 media samples were collected and divided into two groups: one for direct DNA quantification (53 spent culture media and 17 controls), the other for whole-genome amplification (60 spent culture media and 11 controls) and subsequent quantification. Some samples with amplified DNA (N = 56) were used for aneuploidy testing by next-generation sequencing; of those, 35 samples underwent single-nucleotide polymorphism (SNP) sequencing to detect maternal contamination. Finally, from the 35 spent culture media analyzed by SNP sequencing, 12 whole blastocysts were analyzed by fluorescence in situ hybridization (FISH) to determine the level of mosaicism in each embryo, as a possible origin for discordance between sample types. Trophectoderm biopsies and culture media samples (20 μl) underwent whole-genome amplification, then libraries were generated and sequenced for an aneuploidy study. For SNP sequencing, triads including trophectoderm DNA, cell-free DNA, and follicular fluid DNA were analyzed. In total, 124 SNPs were included with 90 SNPs distributed among all autosomes and 34 SNPs located on chromosome Y. Finally, 12 whole blastocysts were fixed and individual cells were analyzed by FISH using telomeric/centromeric probes for the affected chromosomes. We found a higher quantity of cell-free DNA in spent culture media co-cultured with embryos versus control media samples (P ≤ 0.001). The presence of cell-free DNA in the spent culture media enabled a chromosomal diagnosis, although results differed from those of trophectoderm biopsy analysis in most cases (67%). Discordant results were mainly attributable to a high percentage of maternal DNA in the spent culture media, with a median percentage of embryonic DNA estimated at 8%. Finally, from the discordant cases, 91.7% of whole blastocysts analyzed by FISH were mosaic and 75% of the analyzed chromosomes were concordant with the trophectoderm DNA diagnosis instead of the cell-free DNA result. This study was limited by the sample size and the number of cells analyzed by FISH. This is the first study to combine chromosomal analysis of cell-free DNA, SNP sequencing to identify maternal contamination, and whole-blastocyst analysis for detecting mosaicism. Our results provide a better understanding of the origin of cell-free DNA in spent culture media, offering an important step toward developing future non-invasive karyotyping that must rely on the specific identification of DNA released from human embryos. This work was funded by Igenomix S.L. There are no competing interests.

Haplotype data for 23 Y-chromosome markers in a reference sample from Bosnia and Herzegovina

PubMed Central

Kovačević, Lejla; Fatur-Cerić, Vera; Hadžić, Negra; Čakar, Jasmina; Primorac, Dragan; Marjanović, Damir

2013-01-01

Aim To detect polymorphisms of 23 Y-chromosomal short tandem repeat (STR) loci, including 6 new loci, in a reference database of male population of Bosnia and Herzegovina, as well as to assess the importance of increasing the number of Y-STR loci utilized in forensic DNA analysis. Methods The reference sample consisted of 100 healthy, unrelated men originating from Bosnia and Herzegovina. Sample collection using buccal swabs was performed in all geographical regions of Bosnia and Herzegovina in the period from 2010 to 2011. DNA samples were typed for 23 Y STR loci, including 6 new loci: DYS576, DYS481, DYS549, DYS533, DYS570, and DYS643, which are included in the new PowerPlex® Y 23 amplification kit. Results The absolute frequency of generated haplotypes was calculated and results showed that 98 samples had unique Y 23 haplotypes, and that only two samples shared the same haplotype. The most polymorphic locus was DYS418, with 14 detected alleles and the least polymorphic loci were DYS389I, DYS391, DYS437, and DYS393. Conclusion This study showed that by increasing the number of highly polymorphic Y STR markers, to include those tested in our analysis, leads to a reduction of repeating haplotypes, which is very important in the application of forensic DNA analysis. PMID:23771760

Flow cytometry for enrichment and titration in massively parallel DNA sequencing

PubMed Central

Sandberg, Julia; Ståhl, Patrik L.; Ahmadian, Afshin; Bjursell, Magnus K.; Lundeberg, Joakim

2009-01-01

Massively parallel DNA sequencing is revolutionizing genomics research throughout the life sciences. However, the reagent costs and labor requirements in current sequencing protocols are still substantial, although improvements are continuously being made. Here, we demonstrate an effective alternative to existing sample titration protocols for the Roche/454 system using Fluorescence Activated Cell Sorting (FACS) technology to determine the optimal DNA-to-bead ratio prior to large-scale sequencing. Our method, which eliminates the need for the costly pilot sequencing of samples during titration is capable of rapidly providing accurate DNA-to-bead ratios that are not biased by the quantification and sedimentation steps included in current protocols. Moreover, we demonstrate that FACS sorting can be readily used to highly enrich fractions of beads carrying template DNA, with near total elimination of empty beads and no downstream sacrifice of DNA sequencing quality. Automated enrichment by FACS is a simple approach to obtain pure samples for bead-based sequencing systems, and offers an efficient, low-cost alternative to current enrichment protocols. PMID:19304748

Plant and metagenomic DNA extraction of mucilaginous seeds.

PubMed

Ramos, Simone N M; Salazar, Marcela M; Pereira, Gonçalo A G; Efraim, Priscilla

2014-01-01

The pulp surrounding the seeds of some fruits is rich in mucilage, carbohydrates, etc. Some seeds are rich in proteins and polyphenols. Fruit seeds, like cacao (Theobroma cacao) and cupuassu (Theobroma grandiflorum), are subjected to fermentation to develop flavor. During fermentation, ethanol is produced [2-6]. All of these compounds are considered as interfering substances that hinder the DNA extraction [4-8]. Protocols commonly used in the DNA extraction in samples of plant origin were used, but without success. Thus, a protocol for DNA samples under different conditions that can be used for similar samples was developed and applied with success. The protocol initially described for RNA samples by Zeng et al. [9] and with changes proposed by Provost et al. [5] was adapted for extracting DNA samples from those described. However, several modifications have been proposed:•Samples were initially washed with petroleum ether for fat phase removal.•RNAse was added to the extraction buffer, while spermidin was removed.•Additional steps of extraction with 5 M NaCl, saturated NaCl and CTAB (10%) were included and precipitation was carried out with isopropanol, followed by washing with ethanol.

Plant and metagenomic DNA extraction of mucilaginous seeds

PubMed Central

Ramos, Simone N.M.; Salazar, Marcela M.; Pereira, Gonçalo A.G.; Efraim, Priscilla

2014-01-01

The pulp surrounding the seeds of some fruits is rich in mucilage, carbohydrates, etc. Some seeds are rich in proteins and polyphenols. Fruit seeds, like cacao (Theobroma cacao) and cupuassu (Theobroma grandiflorum), are subjected to fermentation to develop flavor. During fermentation, ethanol is produced [2–6]. All of these compounds are considered as interfering substances that hinder the DNA extraction [4–8]. Protocols commonly used in the DNA extraction in samples of plant origin were used, but without success. Thus, a protocol for DNA samples under different conditions that can be used for similar samples was developed and applied with success. The protocol initially described for RNA samples by Zeng et al. [9] and with changes proposed by Provost et al. [5] was adapted for extracting DNA samples from those described. However, several modifications have been proposed:•Samples were initially washed with petroleum ether for fat phase removal.•RNAse was added to the extraction buffer, while spermidin was removed.•Additional steps of extraction with 5 M NaCl, saturated NaCl and CTAB (10%) were included and precipitation was carried out with isopropanol, followed by washing with ethanol. PMID:26150956

Measurement of oxidative DNA damage by gas chromatography-mass spectrometry: ethanethiol prevents artifactual generation of oxidized DNA bases.

PubMed Central

Jenner, A; England, T G; Aruoma, O I; Halliwell, B

1998-01-01

Analysis of oxidative damage to DNA bases by GC-MS enables identification of a range of base oxidation products, but requires a derivatization procedure. However, derivatization at high temperature in the presence of air can cause 'artifactual' oxidation of some undamaged bases, leading to an overestimation of their oxidation products, including 8-hydroxyguanine. Therefore derivatization conditions that could minimize this problem were investigated. Decreasing derivatization temperature to 23 degrees C lowered levels of 8-hydroxyguanine, 8-hydroxyadenine, 5-hydroxycytosine and 5-(hydroxymethyl)uracil measured by GC-MS in hydrolysed calf thymus DNA. Addition of the reducing agent ethanethiol (5%, v/v) to DNA samples during trimethylsilylation at 90 degrees C also decreased levels of these four oxidized DNA bases as well as 5-hydroxyuracil. Removal of guanine from hydrolysed DNA samples by treatment with guanase, prior to derivatization, resulted in 8-hydroxyguanine levels (54-59 pmol/mg of DNA) that were significantly lower than samples not pretreated with guanase, independent of the derivatization conditions used. Only hydrolysed DNA samples that were derivatized at 23 degrees C in the presence of ethanethiol produced 8-hydroxyguanine levels (56+/-8 pmol/mg of DNA) that were as low as those of guanase-pretreated samples. Levels of other oxidized bases were similar to samples derivatized at 23 degrees C without ethanethiol, except for 5-hydroxycytosine and 5-hydroxyuracil, which were further decreased by ethanethiol. Levels of 8-hydroxyguanine, 8-hydroxyadenine and 5-hydroxycytosine measured in hydrolysed calf thymus DNA by the improved procedures described here were comparable with those reported previously by HPLC with electrochemical detection and by GC-MS with prepurification to remove undamaged base. We conclude that artifactual oxidation of DNA bases during derivatization can be prevented by decreasing the temperature to 23 degrees C, removing air from the derivatization reaction and adding ethanethiol. PMID:9531471

DNA transfer-a never ending story. A study on scenarios involving a second person as carrier.

PubMed

Helmus, Janine; Bajanowski, Thomas; Poetsch, Micaela

2016-01-01

The transfer of DNA directly from one item to another has been shown in many studies with elaborate discussions on the nature of the DNA donor as well as material and surface of the items or surrounding features. Every DNA transfer scenario one can imagine seems to be possible. This evokes more and more intricate scenarios proposed by lawyers or attorneys searching for an explanation of the DNA of a certain person on a distinct item with impact on a crime. At court, the forensic genetic scientist has to comment on the probability of these scenarios thus calling for extensive studies on such settings. Here, the possibility of an involvement of a second person as a carrier of the donor's DNA in a variety of different scenarios including three pairs of people and two kinds of items (textiles and plastic bags) was investigated. All transfer settings were executed with and without gloves on the carrier's hands. DNA left on the items was isolated and analyzed using the Powerplex® ESX17 kit. In 21 out of 180 samples, all alleles of the donor DNA could be obtained on the second item (12%), on eight samples, the donor's DNA was dominant compared to all other alleles (38% of samples with complete donor profile). Additionally, 51 samples displayed at least more than half of the donor's alleles (28%). The complete DNA profile of the carrier was found in 47 out of 180 samples (42 partial profiles). In summary, it could be shown that a transfer of donor DNA from epithelial cells through a carrier to a second item is possible, even if the carrier does not wear gloves.

An optimized procedure for obtaining DNA from fired and unfired ammunition.

PubMed

Montpetit, Shawn; O'Donnell, Patrick

2015-07-01

Gun crimes are a significant problem facing law enforcement agencies. Traditional forensic examination of firearms involves comparisons of markings imparted to bullets and cartridge casings during the firing process. DNA testing of casings and cartridges may not be routinely done in crime laboratories due a variety of factors including the typically low amounts of DNA recovered. The San Diego Police Department (SDPD) Crime Laboratory conducted a study to optimize the collection and profiling of DNA from fired and unfired ammunition. The method was optimized to where interpretable DNA results were obtained for 26.1% of the total number of forensic casework evidence samples, and provided some insights into the level of secondary transfer that might be expected from this type of evidence. Briefly detailed are the results from the experimental study and the forensic casework analysis using the optimized process. Mixtures (samples having more DNA types than the loader's known genotype detected or visible at any marker) were obtained in 39.8% of research samples and the likely source of DNA mixtures is discussed. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Challenges and progress in making DNA-based AIS early ...

EPA Pesticide Factsheets

The ability of DNA barcoding to find additional species in hard-to-sample locations or hard-to-identify samples is well established. Nevertheless, adoption of DNA barcoding into regular monitoring programs has been slow, in part due to issues of standardization and interpretation that need resolving. In this presentation, we describe our progress towards incorporating DNA-based identification into broad-spectrum aquatic invasive species early-detection monitoring in the Laurentian Great Lakes. Our work uses community biodiversity information as the basis for evaluating survey performance for various taxonomic groups. Issues we are tackling in bringing DNA-based data to bear on AIS monitoring design include: 1) Standardizing methodology and work flow from field collection and sample handling through bioinformatics post-processing; 2) Determining detection sensitivity and accounting for inter-species differences in DNA amplification and primer affinity; 3) Differentiating sequencing and barcoding errors from legitimate new finds when range and natural history information is limited; and 4) Accounting for the different nature of morphology- vs. DNA-based biodiversity information in subsequent analysis (e.g., via species accumulation curves, multi-metric indices). not applicable

A DNA methylation map of human cancer at single base-pair resolution

PubMed Central

Vidal, E; Sayols, S; Moran, S; Guillaumet-Adkins, A; Schroeder, M P; Royo, R; Orozco, M; Gut, M; Gut, I; Lopez-Bigas, N; Heyn, H; Esteller, M

2017-01-01

Although single base-pair resolution DNA methylation landscapes for embryonic and different somatic cell types provided important insights into epigenetic dynamics and cell-type specificity, such comprehensive profiling is incomplete across human cancer types. This prompted us to perform genome-wide DNA methylation profiling of 22 samples derived from normal tissues and associated neoplasms, including primary tumors and cancer cell lines. Unlike their invariant normal counterparts, cancer samples exhibited highly variable CpG methylation levels in a large proportion of the genome, involving progressive changes during tumor evolution. The whole-genome sequencing results from selected samples were replicated in a large cohort of 1112 primary tumors of various cancer types using genome-scale DNA methylation analysis. Specifically, we determined DNA hypermethylation of promoters and enhancers regulating tumor-suppressor genes, with potential cancer-driving effects. DNA hypermethylation events showed evidence of positive selection, mutual exclusivity and tissue specificity, suggesting their active participation in neoplastic transformation. Our data highlight the extensive changes in DNA methylation that occur in cancer onset, progression and dissemination. PMID:28581523

Protocols for dry DNA storage and shipment at room temperature

PubMed Central

Ivanova, Natalia V; Kuzmina, Masha L

2013-01-01

The globalization of DNA barcoding will require core analytical facilities to develop cost-effective, efficient protocols for the shipment and archival storage of DNA extracts and PCR products. We evaluated three dry-state DNA stabilization systems: commercial Biomatrica® DNAstable® plates, home-made trehalose and polyvinyl alcohol (PVA) plates on 96-well panels of insect DNA stored at 56 °C and at room temperature. Controls included unprotected samples that were stored dry at room temperature and at 56 °C, and diluted samples held at 4 °C and at −20 °C. PCR and selective sequencing were performed over a 4-year interval to test the condition of DNA extracts. Biomatrica® provided better protection of DNA at 56 °C and at room temperature than trehalose and PVA, especially for diluted samples. PVA was the second best protectant after Biomatrica® at room temperature, whereas trehalose was the second best protectant at 56 °C. In spite of lower PCR success, the DNA stored at −20 °C yielded longer sequence reads and stronger signal, indicating that temperature is a crucial factor for DNA quality which has to be considered especially for long-term storage. Although it is premature to advocate a transition to DNA storage at room temperature, dry storage provides an additional layer of security for frozen samples, protecting them from degradation in the event of freezer failure. All three forms of DNA preservation enable shipment of dry DNA and PCR products between barcoding facilities. PMID:23789643

Assessing mycoplasma contamination of cell cultures by qPCR using a set of universal primer pairs targeting a 1.5 kb fragment of 16S rRNA genes

PubMed Central

Jean, Audrey; Tardy, Florence; Allatif, Omran; Grosjean, Isabelle; Blanquier, Bariza

2017-01-01

Mycoplasmas (a generic name for Mollicutes) are a predominant bacterial contaminant of cell culture and cell derived products including viruses. This prokaryote class is characterized by very small size and lack of a cell wall. Consequently, mycoplasmas escape ultrafiltration and visualization under routine microscopic examination, hence the ease with which cells in culture can be contaminated, with routinely more than 10% of cell lines being contaminated. Mycoplasma are a formidable threat both in fundamental research by perverting a whole range of cell properties and functions and in the pharmacological use of cells and cell derived products. Although many methods have been developed, there is still a need for a sensitive, universal assay. Here is reported the development and validation of a quantitative polymerase chain reaction (qPCR) based on the amplification of a 1.5 kb fragment covering the 16S rDNA of the Mollicute class by real-time PCR using universal U1 and U8 degenerate primers. The method includes the addition of a DNA loading probe to each sample to monitor DNA extraction and the absence of PCR inhibitors in the extracted DNA, a positive mycoplasma 16S rDNA traceable reference sample to exclude any accidental contamination of an unknown sample with this reference DNA, an analysis procedure based on the examination of the melting curve and the size of the PCR amplicon, followed by quantification of the number of 16S rDNA copies (with a lower limit of 19 copies) when relevant, and, if useful, the identification of the contaminating prokaryote by sequencing. The method was validated on a collection of mycoplasma strains and by testing over 100 samples of unknown contamination status including stocks of viruses requiring biosafety level 2, 3 or 4 containments. When compared to four established methods, the m16S_qPCR technique exhibits the highest sensitivity in detecting mycoplasma contamination. PMID:28225826

Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens.

PubMed

Saeidi, Saman; McKain, Michael R; Kellogg, Elizabeth A

2018-03-08

Herbaria are an invaluable source of plant material that can be used in a variety of biological studies. The use of herbarium specimens is associated with a number of challenges including sample preservation quality, degraded DNA, and destructive sampling of rare specimens. In order to more effectively use herbarium material in large sequencing projects, a dependable and scalable method of DNA isolation and library preparation is needed. This paper demonstrates a robust, beginning-to-end protocol for DNA isolation and high-throughput library construction from herbarium specimens that does not require modification for individual samples. This protocol is tailored for low quality dried plant material and takes advantage of existing methods by optimizing tissue grinding, modifying library size selection, and introducing an optional reamplification step for low yield libraries. Reamplification of low yield DNA libraries can rescue samples derived from irreplaceable and potentially valuable herbarium specimens, negating the need for additional destructive sampling and without introducing discernible sequencing bias for common phylogenetic applications. The protocol has been tested on hundreds of grass species, but is expected to be adaptable for use in other plant lineages after verification. This protocol can be limited by extremely degraded DNA, where fragments do not exist in the desired size range, and by secondary metabolites present in some plant material that inhibit clean DNA isolation. Overall, this protocol introduces a fast and comprehensive method that allows for DNA isolation and library preparation of 24 samples in less than 13 h, with only 8 h of active hands-on time with minimal modifications.

High-throughput, automated extraction of DNA and RNA from clinical samples using TruTip technology on common liquid handling robots.

PubMed

Holmberg, Rebecca C; Gindlesperger, Alissa; Stokes, Tinsley; Brady, Dane; Thakore, Nitu; Belgrader, Philip; Cooney, Christopher G; Chandler, Darrell P

2013-06-11

TruTip is a simple nucleic acid extraction technology whereby a porous, monolithic binding matrix is inserted into a pipette tip. The geometry of the monolith can be adapted for specific pipette tips ranging in volume from 1.0 to 5.0 ml. The large porosity of the monolith enables viscous or complex samples to readily pass through it with minimal fluidic backpressure. Bi-directional flow maximizes residence time between the monolith and sample, and enables large sample volumes to be processed within a single TruTip. The fundamental steps, irrespective of sample volume or TruTip geometry, include cell lysis, nucleic acid binding to the inner pores of the TruTip monolith, washing away unbound sample components and lysis buffers, and eluting purified and concentrated nucleic acids into an appropriate buffer. The attributes and adaptability of TruTip are demonstrated in three automated clinical sample processing protocols using an Eppendorf epMotion 5070, Hamilton STAR and STARplus liquid handling robots, including RNA isolation from nasopharyngeal aspirate, genomic DNA isolation from whole blood, and fetal DNA extraction and enrichment from large volumes of maternal plasma (respectively).

Temporal fluctuation in North East Baltic Sea region cattle population revealed by mitochondrial and Y-chromosomal DNA analyses.

PubMed

Niemi, Marianna; Bläuer, Auli; Iso-Touru, Terhi; Harjula, Janne; Nyström Edmark, Veronica; Rannamäe, Eve; Lõugas, Lembi; Sajantila, Antti; Lidén, Kerstin; Taavitsainen, Jussi-Pekka

2015-01-01

Ancient DNA analysis offers a way to detect changes in populations over time. To date, most studies of ancient cattle have focused on their domestication in prehistory, while only a limited number of studies have analysed later periods. Conversely, the genetic structure of modern cattle populations is well known given the undertaking of several molecular and population genetic studies. Bones and teeth from ancient cattle populations from the North-East Baltic Sea region dated to the Prehistoric (Late Bronze and Iron Age, 5 samples), Medieval (14), and Post-Medieval (26) periods were investigated by sequencing 667 base pairs (bp) from the mitochondrial DNA (mtDNA) and 155 bp of intron 19 in the Y-chromosomal UTY gene. Comparison of maternal (mtDNA haplotypes) genetic diversity in ancient cattle (45 samples) with modern cattle populations in Europe and Asia (2094 samples) revealed 30 ancient mtDNA haplotypes, 24 of which were shared with modern breeds, while 6 were unique to the ancient samples. Of seven Y-chromosomal sequences determined from ancient samples, six were Y2 and one Y1 haplotype. Combined data including Swedish samples from the same periods (64 samples) was compared with the occurrence of Y-chromosomal haplotypes in modern cattle (1614 samples). The diversity of haplogroups was highest in the Prehistoric samples, where many haplotypes were unique. The Medieval and Post-Medieval samples also show a high diversity with new haplotypes. Some of these haplotypes have become frequent in modern breeds in the Nordic Countries and North-Western Russia while other haplotypes have remained in only a few local breeds or seem to have been lost. A temporal shift in Y-chromosomal haplotypes from Y2 to Y1 was detected that corresponds with the appearance of new mtDNA haplotypes in the Medieval and Post-Medieval period. This suggests a replacement of the Prehistoric mtDNA and Y chromosomal haplotypes by new types of cattle.

Temporal Fluctuation in North East Baltic Sea Region Cattle Population Revealed by Mitochondrial and Y-Chromosomal DNA Analyses

PubMed Central

Niemi, Marianna; Bläuer, Auli; Iso-Touru, Terhi; Harjula, Janne; Nyström Edmark, Veronica; Rannamäe, Eve; Lõugas, Lembi; Sajantila, Antti; Lidén, Kerstin; Taavitsainen, Jussi-Pekka

2015-01-01

Background Ancient DNA analysis offers a way to detect changes in populations over time. To date, most studies of ancient cattle have focused on their domestication in prehistory, while only a limited number of studies have analysed later periods. Conversely, the genetic structure of modern cattle populations is well known given the undertaking of several molecular and population genetic studies. Results Bones and teeth from ancient cattle populations from the North-East Baltic Sea region dated to the Prehistoric (Late Bronze and Iron Age, 5 samples), Medieval (14), and Post-Medieval (26) periods were investigated by sequencing 667 base pairs (bp) from the mitochondrial DNA (mtDNA) and 155 bp of intron 19 in the Y-chromosomal UTY gene. Comparison of maternal (mtDNA haplotypes) genetic diversity in ancient cattle (45 samples) with modern cattle populations in Europe and Asia (2094 samples) revealed 30 ancient mtDNA haplotypes, 24 of which were shared with modern breeds, while 6 were unique to the ancient samples. Of seven Y-chromosomal sequences determined from ancient samples, six were Y2 and one Y1 haplotype. Combined data including Swedish samples from the same periods (64 samples) was compared with the occurrence of Y-chromosomal haplotypes in modern cattle (1614 samples). Conclusions The diversity of haplogroups was highest in the Prehistoric samples, where many haplotypes were unique. The Medieval and Post-Medieval samples also show a high diversity with new haplotypes. Some of these haplotypes have become frequent in modern breeds in the Nordic Countries and North-Western Russia while other haplotypes have remained in only a few local breeds or seem to have been lost. A temporal shift in Y-chromosomal haplotypes from Y2 to Y1 was detected that corresponds with the appearance of new mtDNA haplotypes in the Medieval and Post-Medieval period. This suggests a replacement of the Prehistoric mtDNA and Y chromosomal haplotypes by new types of cattle. PMID:25992976

Predictors of mother and child DNA yields in buccal cell samples collected in pediatric cancer epidemiologic studies: a report from the Children's Oncology group.

PubMed

Poynter, Jenny N; Ross, Julie A; Hooten, Anthony J; Langer, Erica; Blommer, Crystal; Spector, Logan G

2013-08-12

Collection of high-quality DNA is essential for molecular epidemiology studies. Methods have been evaluated for optimal DNA collection in studies of adults; however, DNA collection in young children poses additional challenges. Here, we have evaluated predictors of DNA quantity in buccal cells collected for population-based studies of infant leukemia (N = 489 mothers and 392 children) and hepatoblastoma (HB; N = 446 mothers and 412 children) conducted through the Children's Oncology Group. DNA samples were collected by mail using mouthwash (for mothers and some children) and buccal brush (for children) collection kits and quantified using quantitative real-time PCR. Multivariable linear regression models were used to identify predictors of DNA yield. Median DNA yield was higher for mothers in both studies compared with their children (14 μg vs. <1 μg). Significant predictors of DNA yield in children included case-control status (β = -0.69, 50% reduction, P = 0.01 for case vs. control children), brush collection type, and season of sample collection. Demographic factors were not strong predictors of DNA yield in mothers or children in this analysis. The association with seasonality suggests that conditions during transport may influence DNA yield. The low yields observed in most children in these studies highlight the importance of developing alternative methods for DNA collection in younger age groups.

The ultrastructure of subgingival dental plaque, revealed by high-resolution field emission scanning electron microscopy.

PubMed

Holliday, Richard; Preshaw, Philip M; Bowen, Leon; Jakubovics, Nicholas S

2015-01-01

To explore the ultrastructure of subgingival dental plaque using high-resolution field emission scanning electron microscopy (FE-SEM) and to investigate whether extracellular DNA (eDNA) could be visualised in ex vivo samples. Ten patients were recruited who fulfilled the inclusion criteria (teeth requiring extraction with radiographic horizontal bone loss of over 50% and grade II/III mobility). In total, 12 teeth were extracted using a minimally traumatic technique. Roots were sectioned using a dental air turbine handpiece, under water cooling to produce 21 samples. Standard fixation and dehydration protocols were followed. For some samples, gold-labelled anti-DNA antibodies were applied before visualising biofilms by FE-SEM. High-resolution FE-SEMs of subgingival biofilm were obtained in 90% of the samples. The sectioning technique left dental plaque biofilms undisturbed. Copious amounts of extracellular material were observed in the plaque, which may have been eDNA as they had a similar appearance to labelled eDNA from in vitro studies. There was also evidence of membrane vesicles and open-ended tubular structures. Efforts to label eDNA with immune-gold antibodies were unsuccessful and eDNA was not clearly labelled. High-resolution FE-SEM images were obtained of undisturbed subgingival ex vivo dental plaque biofilms. Important structural features were observed including extracellular polymeric material, vesicles and unusual open tubule structures that may be remnants of lysed cells. The application of an eDNA immune-gold-labelling technique, previously used successfully in in vitro samples, did not clearly identify eDNA in ex vivo samples. Further studies are needed to characterise the molecular composition of the observed extracellular matrix material.

The ultrastructure of subgingival dental plaque, revealed by high-resolution field emission scanning electron microscopy

PubMed Central

Holliday, Richard; Preshaw, Philip M; Bowen, Leon; Jakubovics, Nicholas S

2015-01-01

Objectives/Aims: To explore the ultrastructure of subgingival dental plaque using high-resolution field emission scanning electron microscopy (FE-SEM) and to investigate whether extracellular DNA (eDNA) could be visualised in ex vivo samples. Materials and Methods: Ten patients were recruited who fulfilled the inclusion criteria (teeth requiring extraction with radiographic horizontal bone loss of over 50% and grade II/III mobility). In total, 12 teeth were extracted using a minimally traumatic technique. Roots were sectioned using a dental air turbine handpiece, under water cooling to produce 21 samples. Standard fixation and dehydration protocols were followed. For some samples, gold-labelled anti-DNA antibodies were applied before visualising biofilms by FE-SEM. Results: High-resolution FE-SEMs of subgingival biofilm were obtained in 90% of the samples. The sectioning technique left dental plaque biofilms undisturbed. Copious amounts of extracellular material were observed in the plaque, which may have been eDNA as they had a similar appearance to labelled eDNA from in vitro studies. There was also evidence of membrane vesicles and open-ended tubular structures. Efforts to label eDNA with immune-gold antibodies were unsuccessful and eDNA was not clearly labelled. Conclusions: High-resolution FE-SEM images were obtained of undisturbed subgingival ex vivo dental plaque biofilms. Important structural features were observed including extracellular polymeric material, vesicles and unusual open tubule structures that may be remnants of lysed cells. The application of an eDNA immune-gold-labelling technique, previously used successfully in in vitro samples, did not clearly identify eDNA in ex vivo samples. Further studies are needed to characterise the molecular composition of the observed extracellular matrix material. PMID:29607057

Salmon redd identification using environmental DNA (eDNA)

USGS Publications Warehouse

Pilliod, David S.; Laramie, Matthew B.

2016-06-10

IntroductionThe purpose of this project was to develop a technique to use environmental DNA (eDNA) to distinguish between redds made by Chinook salmon (Oncorhynchus tshawytscha) and redds made by Coho salmon (O. kisutch) and to distinguish utilized redds from test/abandoned redds or scours that have the appearance of redds. The project had two phases:Phase 1. Develop, test, and optimize a molecular assay for detecting and identifying Coho salmon DNA and differentiating it from Chinook salmon DNA.Phase 2. Demonstrate the efficacy of the technique.Collect and preserve water samples from the interstitial spaces of 10 known redds (as identified by expert observers) of each species and 10 gravel patches that do not include a redd of either species.Collect control samples from the water column adjacent to each redd to establish background eDNA levels.Analyze the samples using the developed molecular assays for Coho salmon (phase I) and Chinook salmon (Laramie and others, 2015).Evaluate whether samples collected from Chinook and Coho redds have significantly higher levels of eDNA of the respective species than background levels (that is, from gravel, water column).Evaluate whether samples collected from the interstitial spaces of gravel patches that are not redds are similar to background eDNA levels.The Sandy River is a large tributary of the Columbia River. The Sandy River meets the Columbia River approximately 23 km upstream of Portland, Oregon. The Sandy River Basin provides overlapping spawning habitat for both Chinook and Coho salmon.Samples provided by Portland Water Bureau for analysis were collected from the Bull Run River, Sixes Creek, Still Creek, Arrah Wanna Side Channel, and Side Channel 18.

DNA preservation in skeletal elements from the World Trade Center disaster: recommendations for mass fatality management.

PubMed

Mundorff, Amy Z; Bartelink, Eric J; Mar-Cash, Elaine

2009-07-01

The World Trade Center (WTC) victim identification effort highlights taphonomic influences on the degradation of DNA from victims of mass fatality incidents. This study uses a subset of the WTC-Human Remains Database to evaluate differential preservation of DNA by skeletal element. Recovery location, sex, and victim type (civilian, firefighter, or plane passenger) do not appear to influence DNA preservation. Results indicate that more intact elements, as well as elements encased in soft tissue, produced slightly higher identification rates than more fragmented remains. DNA identification rates by element type conform to previous findings, with higher rates generally found in denser, weight-bearing bones. However, smaller bones including patellae, metatarsals, and foot phalanges yielded rates comparable to both femora and tibiae. These elements can be easily sampled with a disposable scalpel, and thus reduce potential DNA contamination. These findings have implications for DNA sampling guidelines in future mass fatality incidents.

Diverse Applications of Environmental DNA Methods in Parasitology.

PubMed

Bass, David; Stentiford, Grant D; Littlewood, D T J; Hartikainen, Hanna

2015-10-01

Nucleic acid extraction and sequencing of genes from organisms within environmental samples encompasses a variety of techniques collectively referred to as environmental DNA or 'eDNA'. The key advantages of eDNA analysis include the detection of cryptic or otherwise elusive organisms, large-scale sampling with fewer biases than specimen-based methods, and generation of data for molecular systematics. These are particularly relevant for parasitology because parasites can be difficult to locate and are morphologically intractable and genetically divergent. However, parasites have rarely been the focus of eDNA studies. Focusing on eukaryote parasites, we review the increasing diversity of the 'eDNA toolbox'. Combining eDNA methods with complementary tools offers much potential to understand parasite communities, disease risk, and parasite roles in broader ecosystem processes such as food web structuring and community assembly. Crown Copyright © 2015. Published by Elsevier Ltd. All rights reserved.

Study of microtip-based extraction and purification of DNA from human samples for portable devices

NASA Astrophysics Data System (ADS)

Fotouhi, Gareth

DNA sample preparation is essential for genetic analysis. However, rapid and easy-to-use methods are a major challenge to obtaining genetic information. Furthermore, DNA sample preparation technology must follow the growing need for point-of-care (POC) diagnostics. The current use of centrifuges, large robots, and laboratory-intensive protocols has to be minimized to meet the global challenge of limited access healthcare by bringing the lab to patients through POC devices. To address these challenges, a novel extraction method of genomic DNA from human samples is presented by using heat-cured polyethyleneimine-coated microtips generating a high electric field. The microtip extraction method is based on recent work using an electric field and capillary action integrated into an automated device. The main challenges to the method are: (1) to obtain a stable microtip surface for the controlled capture and release of DNA and (2) to improve the recovery of DNA from samples with a high concentration of inhibitors, such as human samples. The present study addresses these challenges by investigating the heat curing of polyethyleneimine (PEI) coated on the surface of the microtip. Heat-cured PEI-coated microtips are shown to control the capture and release of DNA. Protocols are developed for the extraction and purification of DNA from human samples. Heat-cured PEI-coated microtip methods of DNA sample preparation are used to extract genomic DNA from human samples. It is discovered through experiment that heat curing of a PEI layer on a gold-coated surface below 150°C could inhibit the signal of polymerase chain reaction (PCR). Below 150°C, the PEI layer is not completely cured and dissolved off the gold-coated surface. Dissolved PEI binds with DNA to inhibit PCR. Heat curing of a PEI layer above 150°C on a gold-coated surface prevents inhibition to PCR and gel electrophoresis. In comparison to gold-coated microtips, the 225°C-cured PEI-coated microtips improve the recovery of DNA to 45% efficiency. Furthermore, the 225°C-cured PEI-coated microtips recover more DNA than gold-coated microtips when the surface is washed. Heat-cured (225°C) PEI-coated microtips are used for the recovery of human genomic DNA from whole blood. A washing protocol is developed to remove inhibiting particles bound to the PEI-coated microtip surface after DNA extraction. From 1.25 muL of whole blood, an average of 1.83 ng of human genomic DNA is captured, purified, and released using a 225°C-cured PEI-coated microtip in less than 30 minutes. The extracted DNA is profiled by short tandem repeat analysis (STR). For forensic and medical applications, genomic DNA is extracted from dried samples using heat-cured PEI-coated microtips that are integrated into an automated device. DNA extraction from dried samples is critical for forensics. The use of dried samples in the medical field is increasing because dried samples are convenient for storage, biosafety, and contamination. The main challenge is the time required to properly extract DNA in a purified form. Typically, a 1 hour incubation period is required to complete this process. Overnight incubation is sometimes necessary. To address this challenge, a pre-extraction washing step is investigated to remove inhibiting particles from dried blood spots (DBS) before DNA is released from dried form into solution for microtip extraction. The developed protocol is expanded to extract DNA from a variety of dried samples including nasal swabs, buccal swabs, and other forensic samples. In comparison to a commercial kit, the microtip-based extraction reduced the processing time from 1.5 hours to 30 minutes or less with an equivalent concentration of extracted DNA from dried blood spots. The developed assay will benefit genetic studies on newborn screening, forensic investigation, and POC diagnostics.

HBV serum DNA and RNA levels in nucleos(t)ide analogue-treated or untreated patients during chronic and acute infection.

PubMed

Butler, Emily K; Gersch, Jeffrey; McNamara, Anne; Luk, Ka-Cheung; Holzmayer, Vera; de Medina, Maria; Schiff, Eugene; Kuhns, Mary; Cloherty, Gavin A

2018-05-07

Treatment of chronic hepatitis B (CHB) patients with nucleos(t)ide analogues (NA) suppresses HBV DNA synthesis but does not affect synthesis of HBV pregenomic RNA (pgRNA). HBV pgRNA is detectable in the serum during NA treatment and has been proposed as a marker of HBV covalently closed circular DNA (cccDNA) activity within the infected hepatocyte. We developed an automated assay for the quantification of serum HBV pgRNA using a dual-target qRT-PCR approach on the Abbott m2000sp/rt system. We demonstrate accurate detection and quantification of serum HBV RNA. HBV DNA was quantified using the Abbott RealTime HBV viral load assay. We further compared serum nucleic acid levels and kinetics in HBV-positive populations. Samples included: on-therapy CHB samples (N=16), samples (N=89) from 10 treatment naïve CHB subjects receiving 12-weeks of NA treatment with 8-week follow-up, HBsAg-positive blood donor samples (N=102), and 3 seroconversion series from plasmapheresis donors (N=79 samples). During NA treatment of CHB subjects, we observed low correlation of HBV DNA to pgRNA levels; pgRNA concentration was generally higher than HBV DNA concentrations. In contrast, when NA treatment was absent we observed serum pgRNA at concentrations that correlated to HBV DNA and were approximately 2 log lower than HBV DNA. Importantly, we observe this trend in untreated subject samples from both chronic infections and throughout seroconversion during acute infection. Results demonstrate that the presence of pgRNA in serum is part of the HBV lifecycle; constant relative detection of pgRNA and HBV DNA in the serum is suggestive of a linked mechanism for egress for HBV DNA or pgRNA containing virions. This article is protected by copyright. All rights reserved. © 2018 by the American Association for the Study of Liver Diseases.

Enumeration and targeted analysis of KRAS, BRAF and PIK3CA mutations in CTCs captured by a label-free platform: Comparison to ctDNA and tissue in metastatic colorectal cancer.

PubMed

Kidess-Sigal, Evelyn; Liu, Haiyan E; Triboulet, Melanie M; Che, James; Ramani, Vishnu C; Visser, Brendan C; Poultsides, George A; Longacre, Teri A; Marziali, Andre; Vysotskaia, Valentina; Wiggin, Matthew; Heirich, Kyra; Hanft, Violet; Keilholz, Ulrich; Tinhofer, Ingeborg; Norton, Jeffrey A; Lee, Mark; Sollier-Christen, Elodie; Jeffrey, Stefanie S

2016-12-20

Treatment of advanced colorectal cancer (CRC) requires multimodal therapeutic approaches and need for monitoring tumor plasticity. Liquid biopsy biomarkers, including CTCs and ctDNA, hold promise for evaluating treatment response in real-time and guiding therapeutic modifications. From 15 patients with advanced CRC undergoing liver metastasectomy with curative intent, we collected 41 blood samples at different time points before and after surgery for CTC isolation and quantification using label-free Vortex technology. For mutational profiling, KRAS, BRAF, and PIK3CA hotspot mutations were analyzed in CTCs and ctDNA from 23 samples, nine matched liver metastases and three primary tumor samples. Mutational patterns were compared. 80% of patient blood samples were positive for CTCs, using a healthy baseline value as threshold (0.4 CTCs/mL), and 81.4% of captured cells were EpCAM+ CTCs. At least one mutation was detected in 78% of our blood samples. Among 23 matched CTC and ctDNA samples, we found a concordance of 78.2% for KRAS, 73.9% for BRAF and 91.3% for PIK3CA mutations. In several cases, CTCs exhibited a mutation that was not detected in ctDNA, and vice versa. Complementary assessment of both CTCs and ctDNA appears advantageous to assess dynamic tumor profiles.

High-throughput DNA microarray detection of pathogenic bacteria in shallow well groundwater in the Kathmandu Valley, Nepal.

PubMed

Inoue, Daisuke; Hinoura, Takuji; Suzuki, Noriko; Pang, Junqin; Malla, Rabin; Shrestha, Sadhana; Chapagain, Saroj Kumar; Matsuzawa, Hiroaki; Nakamura, Takashi; Tanaka, Yasuhiro; Ike, Michihiko; Nishida, Kei; Sei, Kazunari

2015-01-01

Because of heavy dependence on groundwater for drinking water and other domestic use, microbial contamination of groundwater is a serious problem in the Kathmandu Valley, Nepal. This study investigated comprehensively the occurrence of pathogenic bacteria in shallow well groundwater in the Kathmandu Valley by applying DNA microarray analysis targeting 941 pathogenic bacterial species/groups. Water quality measurements found significant coliform (fecal) contamination in 10 of the 11 investigated groundwater samples and significant nitrogen contamination in some samples. The results of DNA microarray analysis revealed the presence of 1-37 pathogen species/groups, including 1-27 biosafety level 2 ones, in 9 of the 11 groundwater samples. While the detected pathogens included several feces- and animal-related ones, those belonging to Legionella and Arthrobacter, which were considered not to be directly associated with feces, were detected prevalently. This study could provide a rough picture of overall pathogenic bacterial contamination in the Kathmandu Valley, and demonstrated the usefulness of DNA microarray analysis as a comprehensive screening tool of a wide variety of pathogenic bacteria.

Quantitative PCR detection of Batrachochytrium dendrobatidis DNA from sediments and water

USGS Publications Warehouse

Kirshtein, Julie D.; Anderson, Chauncey W.; Wood, J.S.; Longcore, Joyce E.; Voytek, Mary A.

2007-01-01

The fungal pathogen Batrachochytrium dendrobatidis (Bd) causes chytridiomycosis, a disease implicated in amphibian declines on 5 continents. Polymerase chain reaction (PCR) primer sets exist with which amphibians can be tested for this disease, and advances in sampling techniques allow non-invasive testing of animals. We developed filtering and PCR based quantitative methods by modifying existing PCR assays to detect Bd DNA in water and sediments, without the need for testing amphibians; we tested the methods at 4 field sites. The SYBR based assay using Boyle primers (SYBR/Boyle assay) and the Taqman based assay using Wood primers performed similarly with samples generated in the laboratory (Bd spiked filters), but the SYBR/Boyle assay detected Bd DNA in more field samples. We detected Bd DNA in water from 3 of 4 sites tested, including one pond historically negative for chytridiomycosis. Zoospore equivalents in sampled water ranged from 19 to 454 l-1 (nominal detection limit is 10 DNA copies, or about 0.06 zoospore). We did not detect DNA of Bd from sediments collected at any sites. Our filtering and amplification methods provide a new tool to investigate critical aspects of Bd in the environment. ?? Inter-Research 2007.

Pulling out the 1%: Whole-Genome Capture for the Targeted Enrichment of Ancient DNA Sequencing Libraries

PubMed Central

Carpenter, Meredith L.; Buenrostro, Jason D.; Valdiosera, Cristina; Schroeder, Hannes; Allentoft, Morten E.; Sikora, Martin; Rasmussen, Morten; Gravel, Simon; Guillén, Sonia; Nekhrizov, Georgi; Leshtakov, Krasimir; Dimitrova, Diana; Theodossiev, Nikola; Pettener, Davide; Luiselli, Donata; Sandoval, Karla; Moreno-Estrada, Andrés; Li, Yingrui; Wang, Jun; Gilbert, M. Thomas P.; Willerslev, Eske; Greenleaf, William J.; Bustamante, Carlos D.

2013-01-01

Most ancient specimens contain very low levels of endogenous DNA, precluding the shotgun sequencing of many interesting samples because of cost. Ancient DNA (aDNA) libraries often contain <1% endogenous DNA, with the majority of sequencing capacity taken up by environmental DNA. Here we present a capture-based method for enriching the endogenous component of aDNA sequencing libraries. By using biotinylated RNA baits transcribed from genomic DNA libraries, we are able to capture DNA fragments from across the human genome. We demonstrate this method on libraries created from four Iron Age and Bronze Age human teeth from Bulgaria, as well as bone samples from seven Peruvian mummies and a Bronze Age hair sample from Denmark. Prior to capture, shotgun sequencing of these libraries yielded an average of 1.2% of reads mapping to the human genome (including duplicates). After capture, this fraction increased substantially, with up to 59% of reads mapped to human and enrichment ranging from 6- to 159-fold. Furthermore, we maintained coverage of the majority of regions sequenced in the precapture library. Intersection with the 1000 Genomes Project reference panel yielded an average of 50,723 SNPs (range 3,062–147,243) for the postcapture libraries sequenced with 1 million reads, compared with 13,280 SNPs (range 217–73,266) for the precapture libraries, increasing resolution in population genetic analyses. Our whole-genome capture approach makes it less costly to sequence aDNA from specimens containing very low levels of endogenous DNA, enabling the analysis of larger numbers of samples. PMID:24568772

Detection of genetically modified organisms in foods by DNA amplification techniques.

PubMed

García-Cañas, Virginia; Cifuentes, Alejandro; González, Ramón

2004-01-01

In this article, the different DNA amplification techniques that are being used for detecting genetically modified organisms (GMOs) in foods are examined. This study intends to provide an updated overview (including works published till June 2002) on the principal applications of such techniques together with their main advantages and drawbacks in GMO detection in foods. Some relevant facts on sampling, DNA isolation, and DNA amplification methods are discussed. Moreover; these analytical protocols are discuissed from a quantitative point of view, including the newest investigations on multiplex detection of GMOs in foods and validation of methods.

Exploitation of FTA cartridges for the sampling, long-term storage, and DNA-based analyses of plant-parasitic nematodes.

PubMed

Marek, Martin; Zouhar, Miloslav; Douda, Ondřej; Maňasová, Marie; Ryšánek, Pavel

2014-03-01

The use of DNA-based analyses in molecular plant nematology research has dramatically increased over recent decades. Therefore, the development and adaptation of simple, robust, and cost-effective DNA purification procedures are required to address these contemporary challenges. The solid-phase-based approach developed by Flinders Technology Associates (FTA) has been shown to be a powerful technology for the preparation of DNA from different biological materials, including blood, saliva, plant tissues, and various human and plant microbial pathogens. In this work, we demonstrate, for the first time, that this FTA-based technology is a valuable, low-cost, and time-saving approach for the sampling, long-term archiving, and molecular analysis of plant-parasitic nematodes. Despite the complex structure and anatomical organization of the multicellular bodies of nematodes, we report the successful and reliable DNA-based analysis of nematode high-copy and low-copy genes using the FTA technology. This was achieved by applying nematodes to the FTA cards either in the form of a suspension of individuals, as intact or pestle-crushed nematodes, or by the direct mechanical printing of nematode-infested plant tissues. We further demonstrate that the FTA method is also suitable for the so-called "one-nematode-assay", in which the target DNA is typically analyzed from a single individual nematode. More surprisingly, a time-course experiment showed that nematode DNA can be detected specifically in the FTA-captured samples many years after initial sampling occurs. Collectively, our data clearly demonstrate the applicability and the robustness of this FTA-based approach for molecular research and diagnostics concerning phytonematodes; this research includes economically important species such as the stem nematode (Ditylenchus dipsaci), the sugar beet nematode (Heterodera schachtii), and the Northern root-knot nematode (Meloidogyne hapla).

Performance evaluation of a mitogenome capture and Illumina sequencing protocol using non-probative, case-type skeletal samples: Implications for the use of a positive control in a next-generation sequencing procedure.

PubMed

Marshall, Charla; Sturk-Andreaggi, Kimberly; Daniels-Higginbotham, Jennifer; Oliver, Robert Sean; Barritt-Ross, Suzanne; McMahon, Timothy P

2017-11-01

Next-generation ancient DNA technologies have the potential to assist in the analysis of degraded DNA extracted from forensic specimens. Mitochondrial genome (mitogenome) sequencing, specifically, may be of benefit to samples that fail to yield forensically relevant genetic information using conventional PCR-based techniques. This report summarizes the Armed Forces Medical Examiner System's Armed Forces DNA Identification Laboratory's (AFMES-AFDIL) performance evaluation of a Next-Generation Sequencing protocol for degraded and chemically treated past accounting samples. The procedure involves hybridization capture for targeted enrichment of mitochondrial DNA, massively parallel sequencing using Illumina chemistry, and an automated bioinformatic pipeline for forensic mtDNA profile generation. A total of 22 non-probative samples and associated controls were processed in the present study, spanning a range of DNA quantity and quality. Data were generated from over 100 DNA libraries by ten DNA analysts over the course of five months. The results show that the mitogenome sequencing procedure is reliable and robust, sensitive to low template (one ng control DNA) as well as degraded DNA, and specific to the analysis of the human mitogenome. Haplotypes were overall concordant between NGS replicates and with previously generated Sanger control region data. Due to the inherent risk for contamination when working with low-template, degraded DNA, a contamination assessment was performed. The consumables were shown to be void of human DNA contaminants and suitable for forensic use. Reagent blanks and negative controls were analyzed to determine the background signal of the procedure. This background signal was then used to set analytical and reporting thresholds, which were designated at 4.0X (limit of detection) and 10.0X (limit of quantiation) average coverage across the mitogenome, respectively. Nearly all human samples exceeded the reporting threshold, although coverage was reduced in chemically treated samples resulting in a ∼58% passing rate for these poor-quality samples. A concordance assessment demonstrated the reliability of the NGS data when compared to known Sanger profiles. One case sample was shown to be mixed with a co-processed sample and two reagent blanks indicated the presence of DNA above the analytical threshold. This contamination was attributed to sequencing crosstalk from simultaneously sequenced high-quality samples to include the positive control. Overall this study demonstrated that hybridization capture and Illumina sequencing provide a viable method for mitogenome sequencing of degraded and chemically treated skeletal DNA samples, yet may require alternative measures of quality control. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

TriXY-Homogeneous genetic sexing of highly degraded forensic samples including hair shafts.

PubMed

Madel, Maria-Bernadette; Niederstätter, Harald; Parson, Walther

2016-11-01

Sexing of biological evidence is an important aspect in forensic investigations. A routinely used molecular-genetic approach to this endeavour is the amelogenin sex test, which is integrated in most commercially available polymerase chain reaction (PCR) kits for human identification. However, this assay is not entirely effective in respect to highly degraded DNA samples. This study presents a homogeneous PCR assay for robust sex diagnosis, especially for the analysis of severely fragmented DNA. The introduced triplex for the X and Y chromosome (TriXY) is based on real-time PCR amplification of short intergenic sequences (<50bp) on both gonosomes. Subsequent PCR product examination and molecular-genetic sex-assignment rely on high-resolution melting (HRM) curve analysis. TriXY was optimized using commercially available multi-donor human DNA preparations of either male or female origin and successfully evaluated on challenging samples, including 46 ancient DNA specimens from archaeological excavations and a total of 16 DNA samples extracted from different segments of eight hair shafts of male and female donors. Additionally, sensitivity and cross-species amplification were examined to further test the assay's utility in forensic investigations. TriXY's closed-tube format avoids post-PCR sample manipulations and, therefore, distinctly reduces the risk of PCR product carry-over contamination and sample mix-up, while reducing labour and financial expenses at the same time. The method is sensitive down to the DNA content of approximately two diploid cells and has proven highly useful on severely fragmented and low quantity ancient DNA samples. Furthermore, it even allowed for sexing of proximal hair shafts with very good results. In summary, TriXY facilitates highly sensitive, rapid, and costeffective genetic sex-determination. It outperforms existing sexing methods both in terms of sensitivity and minimum required template molecule lengths. Therefore, we feel confident that TriXY will prove to be a reliable addition to the toolbox currently used for sex-typing in forensic genetics and other fields of research. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Methylation-sensitive enrichment of minor DNA alleles using a double-strand DNA-specific nuclease.

PubMed

Liu, Yibin; Song, Chen; Ladas, Ioannis; Fitarelli-Kiehl, Mariana; Makrigiorgos, G Mike

2017-04-07

Aberrant methylation changes, often present in a minor allelic fraction in clinical samples such as plasma-circulating DNA (cfDNA), are potentially powerful prognostic and predictive biomarkers in human disease including cancer. We report on a novel, highly-multiplexed approach to facilitate analysis of clinically useful methylation changes in minor DNA populations. Methylation Specific Nuclease-assisted Minor-allele Enrichment (MS-NaME) employs a double-strand-specific DNA nuclease (DSN) to remove excess DNA with normal methylation patterns. The technique utilizes oligonucleotide-probes that direct DSN activity to multiple targets in bisulfite-treated DNA, simultaneously. Oligonucleotide probes targeting unmethylated sequences generate local double stranded regions resulting to digestion of unmethylated targets, and leaving methylated targets intact; and vice versa. Subsequent amplification of the targeted regions results in enrichment of the targeted methylated or unmethylated minority-epigenetic-alleles. We validate MS-NaME by demonstrating enrichment of RARb2, ATM, MGMT and GSTP1 promoters in multiplexed MS-NaME reactions (177-plex) using dilutions of methylated/unmethylated DNA and in DNA from clinical lung cancer samples and matched normal tissue. MS-NaME is a highly scalable single-step approach performed at the genomic DNA level in solution that combines with most downstream detection technologies including Sanger sequencing, methylation-sensitive-high-resolution melting (MS-HRM) and methylation-specific-Taqman-based-digital-PCR (digital Methylight) to boost detection of low-level aberrant methylation-changes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

DNA extraction for streamlined metagenomics of diverse environmental samples.

PubMed

Marotz, Clarisse; Amir, Amnon; Humphrey, Greg; Gaffney, James; Gogul, Grant; Knight, Rob

2017-06-01

A major bottleneck for metagenomic sequencing is rapid and efficient DNA extraction. Here, we compare the extraction efficiencies of three magnetic bead-based platforms (KingFisher, epMotion, and Tecan) to a standardized column-based extraction platform across a variety of sample types, including feces, oral, skin, soil, and water. Replicate sample plates were extracted and prepared for 16S rRNA gene amplicon sequencing in parallel to assess extraction bias and DNA quality. The data demonstrate that any effect of extraction method on sequencing results was small compared with the variability across samples; however, the KingFisher platform produced the largest number of high-quality reads in the shortest amount of time. Based on these results, we have identified an extraction pipeline that dramatically reduces sample processing time without sacrificing bacterial taxonomic or abundance information.

An efficient, reliable and inexpensive device for the rapid homogenization of multiple tissue samples by centrifugation.

PubMed

Ilyin, S E; Plata-Salamán, C R

2000-02-15

Homogenization of tissue samples is a common first step in the majority of current protocols for RNA, DNA, and protein isolation. This report describes a simple device for centrifugation-mediated homogenization of tissue samples. The method presented is applicable to RNA, DNA, and protein isolation, and we show examples where high quality total cell RNA, DNA, and protein were obtained from brain and other tissue samples. The advantages of the approach presented include: (1) a significant reduction in time investment relative to hand-driven or individual motorized-driven pestle homogenization; (2) easy construction of the device from inexpensive parts available in any laboratory; (3) high replicability in the processing; and (4) the capacity for the parallel processing of multiple tissue samples, thus allowing higher efficiency, reliability, and standardization.

Spatial Representativeness of Environmental DNA Metabarcoding Signal for Fish Biodiversity Assessment in a Natural Freshwater System.

PubMed

Civade, Raphaël; Dejean, Tony; Valentini, Alice; Roset, Nicolas; Raymond, Jean-Claude; Bonin, Aurélie; Taberlet, Pierre; Pont, Didier

2016-01-01

In the last few years, the study of environmental DNA (eDNA) has drawn attention for many reasons, including its advantages for monitoring and conservation purposes. So far, in aquatic environments, most of eDNA research has focused on the detection of single species using species-specific markers. Recently, species inventories based on the analysis of a single generalist marker targeting a larger taxonomic group (eDNA metabarcoding) have proven useful for bony fish and amphibian biodiversity surveys. This approach involves in situ filtering of large volumes of water followed by amplification and sequencing of a short discriminative fragment from the 12S rDNA mitochondrial gene. In this study, we went one step further by investigating the spatial representativeness (i.e. ecological reliability and signal variability in space) of eDNA metabarcoding for large-scale fish biodiversity assessment in a freshwater system including lentic and lotic environments. We tested the ability of this approach to characterize large-scale organization of fish communities along a longitudinal gradient, from a lake to the outflowing river. First, our results confirm that eDNA metabarcoding is more efficient than a single traditional sampling campaign to detect species presence, especially in rivers. Second, the species list obtained using this approach is comparable to the one obtained when cumulating all traditional sampling sessions since 1995 and 1988 for the lake and the river, respectively. In conclusion, eDNA metabarcoding gives a faithful description of local fish biodiversity in the study system, more specifically within a range of a few kilometers along the river in our study conditions, i.e. longer than a traditional fish sampling site.

CD3-negative lymphoproliferative disease of granular lymphocytes containing Epstein-Barr viral DNA.

PubMed

Kawa-Ha, K; Ishihara, S; Ninomiya, T; Yumura-Yagi, K; Hara, J; Murayama, F; Tawa, A; Hirai, K

1989-07-01

Lymphoproliferative disease of granular lymphocytes (LDGL) is a heterogeneous disorder and the pathogenesis is likely to be complex. Some patients with chronic active EBV (CAEBV) infection also have LDGL. To investigate the relationship between EBV infection and the pathogenesis of LDGL, we conducted a survey for EBV DNA sequences by Southern blot analysis of DNA obtained from the peripheral blood of seven patients with LDGL, including one with CAEBV infection. Interestingly, EBV DNA was detected in the sample from the patient with CAEBV infection, and in the samples from four other patients with CD3-LDGL. Moreover, a single band for the joined termini of the EBV genome was demonstrated in two samples, suggesting a clonal disorder of those LDGL. These findings strongly suggest that EBV may play a pathogenic role in some cases of LDGL.

AQME: A forensic mitochondrial DNA analysis tool for next-generation sequencing data.

PubMed

Sturk-Andreaggi, Kimberly; Peck, Michelle A; Boysen, Cecilie; Dekker, Patrick; McMahon, Timothy P; Marshall, Charla K

2017-11-01

The feasibility of generating mitochondrial DNA (mtDNA) data has expanded considerably with the advent of next-generation sequencing (NGS), specifically in the generation of entire mtDNA genome (mitogenome) sequences. However, the analysis of these data has emerged as the greatest challenge to implementation in forensics. To address this need, a custom toolkit for use in the CLC Genomics Workbench (QIAGEN, Hilden, Germany) was developed through a collaborative effort between the Armed Forces Medical Examiner System - Armed Forces DNA Identification Laboratory (AFMES-AFDIL) and QIAGEN Bioinformatics. The AFDIL-QIAGEN mtDNA Expert, or AQME, generates an editable mtDNA profile that employs forensic conventions and includes the interpretation range required for mtDNA data reporting. AQME also integrates an mtDNA haplogroup estimate into the analysis workflow, which provides the analyst with phylogenetic nomenclature guidance and a profile quality check without the use of an external tool. Supplemental AQME outputs such as nucleotide-per-position metrics, configurable export files, and an audit trail are produced to assist the analyst during review. AQME is applied to standard CLC outputs and thus can be incorporated into any mtDNA bioinformatics pipeline within CLC regardless of sample type, library preparation or NGS platform. An evaluation of AQME was performed to demonstrate its functionality and reliability for the analysis of mitogenome NGS data. The study analyzed Illumina mitogenome data from 21 samples (including associated controls) of varying quality and sample preparations with the AQME toolkit. A total of 211 tool edits were automatically applied to 130 of the 698 total variants reported in an effort to adhere to forensic nomenclature. Although additional manual edits were required for three samples, supplemental tools such as mtDNA haplogroup estimation assisted in identifying and guiding these necessary modifications to the AQME-generated profile. Along with profile generation, AQME reported accurate haplogroups for 18 of the 19 samples analyzed. The single errant haplogroup assignment, although phylogenetically close, identified a bug that only affects partial mitogenome data. Future adjustments to AQME's haplogrouping tool will address this bug as well as enhance the overall scoring strategy to better refine and automate haplogroup assignments. As NGS enables broader use of the mtDNA locus in forensics, the availability of AQME and other forensic-focused mtDNA analysis tools will ease the transition and further support mitogenome analysis within routine casework. Toward this end, the AFMES-AFDIL has utilized the AQME toolbox in conjunction with the CLC Genomics Workbench to successfully validate and implement two NGS mitogenome methods. Copyright © 2017 Elsevier B.V. All rights reserved.

An experimentally-informed coarse-grained 3-site-per-nucleotide model of DNA: Structure, thermodynamics, and dynamics of hybridization

PubMed Central

Hinckley, Daniel M.; Freeman, Gordon S.; Whitmer, Jonathan K.; de Pablo, Juan J.

2013-01-01

A new 3-Site-Per-Nucleotide coarse-grained model for DNA is presented. The model includes anisotropic potentials between bases involved in base stacking and base pair interactions that enable the description of relevant structural properties, including the major and minor grooves. In an improvement over available coarse-grained models, the correct persistence length is recovered for both ssDNA and dsDNA, allowing for simulation of non-canonical structures such as hairpins. DNA melting temperatures, measured for duplexes and hairpins by integrating over free energy surfaces generated using metadynamics simulations, are shown to be in quantitative agreement with experiment for a variety of sequences and conditions. Hybridization rate constants, calculated using forward-flux sampling, are also shown to be in good agreement with experiment. The coarse-grained model presented here is suitable for use in biological and engineering applications, including nucleosome positioning and DNA-templated engineering. PMID:24116642

Estimation and quantification of human DNA in dental calculus: A pilot study.

PubMed

Singh, Udita; Goel, Saurabh

2017-01-01

Identification using DNA has proved its accuracy multiple times in the field of forensic investigations. Investigators usually rely on either teeth or bone as the DNA reservoirs. However, there are instances where the skeletal or dental remains are not available or not preserved properly. Moreover, due to religious beliefs, the family members of the dead do not allow the investigating team to damage the remains for the sole purpose of identification. To investigate the presence of human DNA in dental calculus and to quantify the amount, if present. This prospective single-blinded pilot study included twenty subjects selected from the patients visiting a dental college. The samples of dental calculus were collected from the thickest portion of calculus deposited on the lingual surfaces of mandibular incisors. These samples were decontaminated and subjected to gel electrophoresis for DNA extraction. DNA was found in 85% cases. The amount of DNA varied from 21 to 37 μg/ml of dental calculus. Dental calculus is a rich reservoir of human DNA.

Assessment of environmental DNA for detecting presence of imperiled aquatic amphibian species in isolated wetlands

USGS Publications Warehouse

Mckee, Anna; Calhoun, Daniel L.; Barichivich, William J.; Spear, Stephen F.; Goldberg, Caren S.; Glenn, Travis C

2015-01-01

Environmental DNA (eDNA) is an emerging tool that allows low-impact sampling for aquatic species by isolating DNA from water samples and screening for DNA sequences specific to species of interest. However, researchers have not tested this method in naturally acidic wetlands that provide breeding habitat for a number of imperiled species, including the frosted salamander (Ambystoma cingulatum), reticulated flatwoods salamanders (Ambystoma bishopi), striped newt (Notophthalmus perstriatus), and gopher frog (Lithobates capito). Our objectives for this study were to develop and optimize eDNA survey protocols and assays to complement and enhance capture-based survey methods for these amphibian species. We collected three or more water samples, dipnetted or trapped larval and adult amphibians, and conducted visual encounter surveys for egg masses for target species at 40 sites on 12 different longleaf pine (Pinus palustris) tracts. We used quantitative PCRs to screen eDNA from each site for target species presence. We detected flatwoods salamanders at three sites with eDNA but did not detect them during physical surveys. Based on the sample location we assumed these eDNA detections to indicate the presence of frosted flatwoods salamanders. We did not detect reticulated flatwoods salamanders. We detected striped newts with physical and eDNA surveys at two wetlands. We detected gopher frogs at 12 sites total, three with eDNA alone, two with physical surveys alone, and seven with physical and eDNA surveys. We detected our target species with eDNA at 9 of 11 sites where they were present as indicated from traditional surveys and at six sites where they were not detected with traditional surveys. It was, however, critical to use at least three water samples per site for eDNA. Our results demonstrate eDNA surveys can be a useful complement to traditional survey methods for detecting imperiled pond-breeding amphibians. Environmental DNA may be particularly useful in situations where detection probability using traditional survey methods is low or access by trained personnel is limited.

Application of the CometChip platform to assess DNA damage in field-collected blood samples from turtles.

PubMed

Sykora, Peter; Chiari, Ylenia; Heaton, Andrew; Moreno, Nickolas; Glaberman, Scott; Sobol, Robert W

2018-05-01

DNA damage has been linked to genomic instability and the progressive breakdown of cellular and organismal homeostasis, leading to the onset of disease and reduced longevity. Insults to DNA from endogenous sources include base deamination, base hydrolysis, base alkylation, and metabolism-induced oxidative damage that can lead to single-strand and double-strand DNA breaks. Alternatively, exposure to environmental pollutants, radiation or ultra-violet light, can also contribute to exogenously derived DNA damage. We previously validated a novel, high through-put approach to measure levels of DNA damage in cultured mammalian cells. This new CometChip Platform builds on the classical single cell gel electrophoresis or comet methodology used extensively in environmental toxicology and molecular biology. We asked whether the CometChip Platform could be used to measure DNA damage in samples derived from environmental field studies. To this end, we determined that nucleated erythrocytes from multiple species of turtle could be successfully evaluated in the CometChip Platform to quantify levels of DNA damage. In total, we compared levels of DNA damage in 40 animals from two species: the box turtle (Terrapene carolina) and the red-eared slider (Trachemys scripta elegans). Endogenous levels of DNA damage were identical between the two species, yet we did discover some sex-linked differences and changes in DNA damage accumulation. Based on these results, we confirm that the CometChip Platform allows for the measurement of DNA damage in a large number of samples quickly and accurately, and is particularly adaptable to environmental studies using field-collected samples. Environ. Mol. Mutagen. 59:322-333, 2018. © 2018 Wiley Periodicals, Inc. © 2018 Wiley Periodicals, Inc.

Protocols for dry DNA storage and shipment at room temperature.

PubMed

Ivanova, Natalia V; Kuzmina, Masha L

2013-09-01

The globalization of DNA barcoding will require core analytical facilities to develop cost-effective, efficient protocols for the shipment and archival storage of DNA extracts and PCR products. We evaluated three dry-state DNA stabilization systems: commercial Biomatrica(®) DNAstable(®) plates, home-made trehalose and polyvinyl alcohol (PVA) plates on 96-well panels of insect DNA stored at 56 °C and at room temperature. Controls included unprotected samples that were stored dry at room temperature and at 56 °C, and diluted samples held at 4 °C and at -20 °C. PCR and selective sequencing were performed over a 4-year interval to test the condition of DNA extracts. Biomatrica(®) provided better protection of DNA at 56 °C and at room temperature than trehalose and PVA, especially for diluted samples. PVA was the second best protectant after Biomatrica(®) at room temperature, whereas trehalose was the second best protectant at 56 °C. In spite of lower PCR success, the DNA stored at -20 °C yielded longer sequence reads and stronger signal, indicating that temperature is a crucial factor for DNA quality which has to be considered especially for long-term storage. Although it is premature to advocate a transition to DNA storage at room temperature, dry storage provides an additional layer of security for frozen samples, protecting them from degradation in the event of freezer failure. All three forms of DNA preservation enable shipment of dry DNA and PCR products between barcoding facilities. © 2013 The Authors. Molecular Ecology Resources published by John Wiley & Sons Ltd.

Application of IS1311 locus 2 PCR-REA assay for the specific detection of 'Bison type' Mycobacterium avium subspecies paratuberculosis isolates of Indian origin.

PubMed

Singh, Ajay Vir; Chauhan, Devendra Singh; Singh, Abhinendra; Singh, Pravin Kumar; Sohal, Jagdip Singh; Singh, Shoor Vir

2015-01-01

Of the three major genotypes of Mycobacterium avium subspecies paratuberculosis (MAP), 'Bison type' is most prevalent genotype in the domestic livestock species of the country, and has also been recovered from patients suffering from Crohn's disease. Recently, a new assay based on IS1311 locus 2 PCR- restriction endonuclease analysis (REA) was designed to distinguish between 'Indian Bison type' and non-Indian genotypes. The present study investigated discriminatory potential of this new assay while screening of a panel of MAP isolates of diverse genotypes and from different geographical regions. A total of 53 mycobacterial isolates (41 MAP and 12 mycobacterium other than MAP), three MAP genomic DNA and 36 MAP positive faecal DNA samples from different livestock species (cattle, buffaloes, goat, sheep and bison) and geographical regions (India, Canada, USA, Spain and Portugal) were included in the study. The extracted DNA samples (n=92) were analyzed for the presence of MAP specific sequences (IS900, ISMav 2 and HspX) using PCR. DNA samples were further subjected to genotype differentiation using IS1311 PCR-REA and IS1311 L2 PCR-REA methods. All the DNA samples (except DNA from non-MAP mycobacterial isolates) were positive for all the three MAP specific sequences based PCRs. IS1311 PCR-REA showed that MAP DNA samples of Indian origin belonged to 'Bison type'. Whereas, of the total 19 non-Indian MAP DNA samples, 2, 15 and 2 were genotyped as 'Bison type', 'Cattle type' and 'Sheep type', respectively. IS1311 L2 PCR-REA method showed different restriction profiles of 'Bison type' genotype as compared to non-Indian DNA samples. IS1311 L2 PCR-REA method successfully discriminated 'Indian Bison type' from other non-Indian genotypes and showed potential to be future epidemiological tool and for genotyping of MAP isolates.

Interlaboratory study of DNA extraction from multiple ground samples, multiplex real-time PCR, and multiplex qualitative PCR for individual kernel detection system of genetically modified maize.

PubMed

Akiyama, Hiroshi; Sakata, Kozue; Makiyma, Daiki; Nakamura, Kosuke; Teshima, Reiko; Nakashima, Akie; Ogawa, Asako; Yamagishi, Toru; Futo, Satoshi; Oguchi, Taichi; Mano, Junichi; Kitta, Kazumi

2011-01-01

In many countries, the labeling of grains, feed, and foodstuff is mandatory if the genetically modified (GM) organism content exceeds a certain level of approved GM varieties. We previously developed an individual kernel detection system consisting of grinding individual kernels, DNA extraction from the individually ground kernels, GM detection using multiplex real-time PCR, and GM event detection using multiplex qualitative PCR to analyze the precise commingling level and varieties of GM maize in real sample grains. We performed the interlaboratory study of the DNA extraction with multiple ground samples, multiplex real-time PCR detection, and multiplex qualitative PCR detection to evaluate its applicability, practicality, and ruggedness for the individual kernel detection system of GM maize. DNA extraction with multiple ground samples, multiplex real-time PCR, and multiplex qualitative PCR were evaluated by five laboratories in Japan, and all results from these laboratories were consistent with the expected results in terms of the commingling level and event analysis. Thus, the DNA extraction with multiple ground samples, multiplex real-time PCR, and multiplex qualitative PCR for the individual kernel detection system is applicable and practicable in a laboratory to regulate the commingling level of GM maize grain for GM samples, including stacked GM maize.

Predictors of mother and child DNA yields in buccal cell samples collected in pediatric cancer epidemiologic studies: a report from the Children’s Oncology group

PubMed Central

2013-01-01

Background Collection of high-quality DNA is essential for molecular epidemiology studies. Methods have been evaluated for optimal DNA collection in studies of adults; however, DNA collection in young children poses additional challenges. Here, we have evaluated predictors of DNA quantity in buccal cells collected for population-based studies of infant leukemia (N = 489 mothers and 392 children) and hepatoblastoma (HB; N = 446 mothers and 412 children) conducted through the Children’s Oncology Group. DNA samples were collected by mail using mouthwash (for mothers and some children) and buccal brush (for children) collection kits and quantified using quantitative real-time PCR. Multivariable linear regression models were used to identify predictors of DNA yield. Results Median DNA yield was higher for mothers in both studies compared with their children (14 μg vs. <1 μg). Significant predictors of DNA yield in children included case–control status (β = −0.69, 50% reduction, P = 0.01 for case vs. control children), brush collection type, and season of sample collection. Demographic factors were not strong predictors of DNA yield in mothers or children in this analysis. Conclusions The association with seasonality suggests that conditions during transport may influence DNA yield. The low yields observed in most children in these studies highlight the importance of developing alternative methods for DNA collection in younger age groups. PMID:23937514

Developmental validation of the HIrisPlex system: DNA-based eye and hair colour prediction for forensic and anthropological usage.

PubMed

Walsh, Susan; Chaitanya, Lakshmi; Clarisse, Lindy; Wirken, Laura; Draus-Barini, Jolanta; Kovatsi, Leda; Maeda, Hitoshi; Ishikawa, Takaki; Sijen, Titia; de Knijff, Peter; Branicki, Wojciech; Liu, Fan; Kayser, Manfred

2014-03-01

Forensic DNA Phenotyping or 'DNA intelligence' tools are expected to aid police investigations and find unknown individuals by providing information on externally visible characteristics of unknown suspects, perpetrators and missing persons from biological samples. This is especially useful in cases where conventional DNA profiling or other means remain non-informative. Recently, we introduced the HIrisPlex system, capable of predicting both eye and hair colour from DNA. In the present developmental validation study, we demonstrate that the HIrisPlex assay performs in full agreement with the Scientific Working Group on DNA Analysis Methods (SWGDAM) guidelines providing an essential prerequisite for future HIrisPlex applications to forensic casework. The HIrisPlex assay produces complete profiles down to only 63 pg of DNA. Species testing revealed human specificity for a complete HIrisPlex profile, while only non-human primates showed the closest full profile at 20 out of the 24 DNA markers, in all animals tested. Rigorous testing of simulated forensic casework samples such as blood, semen, saliva stains, hairs with roots as well as extremely low quantity touch (trace) DNA samples, produced complete profiles in 88% of cases. Concordance testing performed between five independent forensic laboratories displayed consistent reproducible results on varying types of DNA samples. Due to its design, the assay caters for degraded samples, underlined here by results from artificially degraded DNA and from simulated casework samples of degraded DNA. This aspect was also demonstrated previously on DNA samples from human remains up to several hundreds of years old. With this paper, we also introduce enhanced eye and hair colour prediction models based on enlarged underlying databases of HIrisPlex genotypes and eye/hair colour phenotypes (eye colour: N = 9188 and hair colour: N = 1601). Furthermore, we present an online web-based system for individual eye and hair colour prediction from full and partial HIrisPlex DNA profiles. By demonstrating that the HIrisPlex assay is fully compatible with the SWGDAM guidelines, we provide the first forensically validated DNA test system for parallel eye and hair colour prediction now available to forensic laboratories for immediate casework application, including missing person cases. Given the robustness and sensitivity described here and in previous work, the HIrisPlex system is also suitable for analysing old and ancient DNA in anthropological and evolutionary studies. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Developmental validation of the IrisPlex system: determination of blue and brown iris colour for forensic intelligence.

PubMed

Walsh, Susan; Lindenbergh, Alexander; Zuniga, Sofia B; Sijen, Titia; de Knijff, Peter; Kayser, Manfred; Ballantyne, Kaye N

2011-11-01

The IrisPlex system consists of a highly sensitive multiplex genotyping assay together with a statistical prediction model, providing users with the ability to predict blue and brown human eye colour from DNA samples with over 90% precision. This 'DNA intelligence' system is expected to aid police investigations by providing phenotypic information on unknown individuals when conventional DNA profiling is not informative. Falling within the new area of forensic DNA phenotyping, this paper describes the developmental validation of the IrisPlex assay following the Scientific Working Group on DNA Analysis Methods (SWGDAM) guidelines for the application of DNA-based eye colour prediction to forensic casework. The IrisPlex assay produces complete SNP genotypes with only 31pg of DNA, approximately six human diploid cell equivalents, and is therefore more sensitive than commercial STR kits currently used in forensics. Species testing revealed human and primate specificity for a complete SNP profile. The assay is capable of producing accurate results from simulated casework samples such as blood, semen, saliva, hair, and trace DNA samples, including extremely low quantity samples. Due to its design, it can also produce full profiles with highly degraded samples often found in forensic casework. Concordance testing between three independent laboratories displayed reproducible results of consistent levels on varying types of simulated casework samples. With such high levels of sensitivity, specificity, consistency and reliability, this genotyping assay, as a core part of the IrisPlex system, operates in accordance with SWGDAM guidelines. Furthermore, as we demonstrated previously, the IrisPlex eye colour prediction system provides reliable results without the need for knowledge on the bio-geographic ancestry of the sample donor. Hence, the IrisPlex system, with its model-based prediction probability estimation of blue and brown human eye colour, represents a useful tool for immediate application in accredited forensic laboratories, to be used for forensic intelligence in tracing unknown individuals from crime scene samples. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

KRAS detection in colonic tumors by DNA extraction from FTA paper: the molecular touch-prep.

PubMed

Petras, Melissa L; Lefferts, Joel A; Ward, Brian P; Suriawinata, Arief A; Tsongalis, Gregory J

2011-12-01

DNA isolated from formalin-fixed paraffin-embedded (FFPE) tissue is usually more degraded and contains more polymerase chain reaction (PCR) inhibitors than DNA isolated from nonfixed tissue. In addition, the tumor size and cellular heterogeneity found in tissue sections can often impact testing for molecular biomarkers. As a potential remedy to this situation, we evaluated the use of Whatman FTA paper cards for collection of colorectal tumor samples before tissue fixation and for isolation of DNA for use in a real-time PCR-based KRAS mutation assay. Eleven colon tumor samples were collected by making a cut into the fresh tumor and applying the Whatman FTA paper to the cut surface. Matched FFPE tissue blocks from these tumors were also collected for comparison. KRAS mutation analysis was carried out using the Applied Biosystems 7500 Fast Real-time PCR System using 7 independent custom TaqMan PCR assays. Of the 11 colon tumors sampled, 6 were positive for KRAS mutations in both the Whatman FTA paper preparations and corresponding FFPE samples. Whatman FTA paper cards for collection of colorectal tumor samples before tissue fixation and for isolation of DNA have many advantages including ease of use, intrinsic antimicrobial properties, long storage potential (stability of DNA over time), and a faster turnaround time for results. Extracted DNA should be suitable for most molecular diagnostic assays that use PCR techniques. This novel means of DNA preservation from surgical specimens would benefit from additional study and validation as a dependable and practical technique to preserve specimens for molecular testing.

[Genetic diversity of larch at the north of Primorskii Krai and distribution limits of Larix olgensis A. Henry].

PubMed

Polezhaeva, M A; Semerikov, V L; Pimenova, E A

2013-05-01

The genetic diversity of four mtDNA fragments and five microsatellite loci of ctDNA was examined in six larch samples from the territory of the Sikhote-Alin Nature Reserve (northern Primor'e). In order to identify possible species-specific differences between the samples, the latter were collected at transects along the shore of the Sea of Japan and at different distances from the sea. Based on a number of morphological characters, some authors suggest that Olgan larch grows in the shoreline part of the reserve and, moving inland, it is replaced by Gmelin larch. According to the other data, the northern border of the Olgan larch range does not reach the reserve territory. The data obtained were compared to those obtained previously for three samples from the south of Primor'e, including those for the locus classicus of Olgan larch. In the examined larch accessions (186, for mtDNA and 200, for ctDNA), a total of five mitotypes and 52 chlorotypes were recovered. According to the results of the AMOVA test, the proportion of variations accounted for the differences among all Larix samples examined over both types of markers was higher (N(ST) = 0.435, for mtDNA and R(ST) = 0.041, for ctDNA) than that for the differences among the samples within the reserve (N(ST) = 0.079, for mtDNA and R(ST) = 0.005, for ctDNA). No differences were detected between the groups of shoreline and continental populations.

Evaluation of nifurtimox treatment of chronic Chagas disease by means of several parasitological methods.

PubMed

Muñoz, Catalina; Zulantay, Inés; Apt, Werner; Ortiz, Sylvia; Schijman, Alejandro G; Bisio, Margarita; Ferrada, Valentina; Herrera, Cinthya; Martínez, Gabriela; Solari, Aldo

2013-09-01

Currently, evaluation of drug efficacy for Chagas disease remains a controversial issue with no consensus. In this work, we evaluated the parasitological efficacy of Nifurtimox treatment in 21 women with chronic Chagas disease from an area of endemicity in Chile who were treated according to current protocols. Under pre- and posttherapy conditions, blood (B) samples and xenodiagnosis (XD) samples from these patients were subjected to analysis by real-time PCR targeting the nuclear satellite DNA of Trypanosoma cruzi (Sat DNA PCR-B, Sat DNA PCR-XD) and by PCR targeting the minicircle of kinetoplast DNA of T. cruzi (kDNA PCR-B, kDNA PCR-XD) and by T. cruzi genotyping using hybridization minicircle tests in blood and fecal samples of Triatoma infestans feed by XD. In pretherapy, kDNA PCR-B and kDNA PCR-XD detected T. cruzi in 12 (57%) and 18 (86%) cases, respectively, whereas Sat DNA quantitative PCR-B (qPCR-B) and Sat DNA qPCR-XD were positive in 18 cases (86%) each. Regarding T. cruzi genotype analysis, it was possible to observe in pretherapy the combination of TcI, TcII, and TcV lineages, including mixtures of T. cruzi strains in most of the cases. At 13 months posttherapy, T. cruzi DNA was detectable in 6 cases (29.6%) and 4 cases (19.1%) by means of Sat DNA PCR-XD and kDNA PCR-XD, respectively, indicating treatment failure with recovery of live parasites refractory to chemotherapy. In 3 cases, it was possible to identify persistence of the baseline genotypes. The remaining 15 baseline PCR-positive cases gave negative results by all molecular and parasitological methods at 13 months posttreatment, suggesting parasite response. Within this follow-up period, kDNA PCR-XD and Sat DNA qPCR-XD proved to be more sensitive tools for the parasitological evaluation of the efficacy of Nifurtimox treatment than the corresponding PCR methods performed directly from blood samples.

Evaluation of Nifurtimox Treatment of Chronic Chagas Disease by Means of Several Parasitological Methods

PubMed Central

Muñoz, Catalina; Zulantay, Inés; Apt, Werner; Ortiz, Sylvia; Schijman, Alejandro G.; Bisio, Margarita; Ferrada, Valentina; Herrera, Cinthya; Martínez, Gabriela

2013-01-01

Currently, evaluation of drug efficacy for Chagas disease remains a controversial issue with no consensus. In this work, we evaluated the parasitological efficacy of Nifurtimox treatment in 21 women with chronic Chagas disease from an area of endemicity in Chile who were treated according to current protocols. Under pre- and posttherapy conditions, blood (B) samples and xenodiagnosis (XD) samples from these patients were subjected to analysis by real-time PCR targeting the nuclear satellite DNA of Trypanosoma cruzi (Sat DNA PCR-B, Sat DNA PCR-XD) and by PCR targeting the minicircle of kinetoplast DNA of T. cruzi (kDNA PCR-B, kDNA PCR-XD) and by T. cruzi genotyping using hybridization minicircle tests in blood and fecal samples of Triatoma infestans feed by XD. In pretherapy, kDNA PCR-B and kDNA PCR-XD detected T. cruzi in 12 (57%) and 18 (86%) cases, respectively, whereas Sat DNA quantitative PCR-B (qPCR-B) and Sat DNA qPCR-XD were positive in 18 cases (86%) each. Regarding T. cruzi genotype analysis, it was possible to observe in pretherapy the combination of TcI, TcII, and TcV lineages, including mixtures of T. cruzi strains in most of the cases. At 13 months posttherapy, T. cruzi DNA was detectable in 6 cases (29.6%) and 4 cases (19.1%) by means of Sat DNA PCR-XD and kDNA PCR-XD, respectively, indicating treatment failure with recovery of live parasites refractory to chemotherapy. In 3 cases, it was possible to identify persistence of the baseline genotypes. The remaining 15 baseline PCR-positive cases gave negative results by all molecular and parasitological methods at 13 months posttreatment, suggesting parasite response. Within this follow-up period, kDNA PCR-XD and Sat DNA qPCR-XD proved to be more sensitive tools for the parasitological evaluation of the efficacy of Nifurtimox treatment than the corresponding PCR methods performed directly from blood samples. PMID:23836179

Detection of a Diverse Marine Fish Fauna Using Environmental DNA from Seawater Samples

PubMed Central

Iversen, Lars Lønsmann; Møller, Peter Rask; Rasmussen, Morten; Willerslev, Eske

2012-01-01

Marine ecosystems worldwide are under threat with many fish species and populations suffering from human over-exploitation. This is greatly impacting global biodiversity, economy and human health. Intriguingly, marine fish are largely surveyed using selective and invasive methods, which are mostly limited to commercial species, and restricted to particular areas with favourable conditions. Furthermore, misidentification of species represents a major problem. Here, we investigate the potential of using metabarcoding of environmental DNA (eDNA) obtained directly from seawater samples to account for marine fish biodiversity. This eDNA approach has recently been used successfully in freshwater environments, but never in marine settings. We isolate eDNA from ½-litre seawater samples collected in a temperate marine ecosystem in Denmark. Using next-generation DNA sequencing of PCR amplicons, we obtain eDNA from 15 different fish species, including both important consumption species, as well as species rarely or never recorded by conventional monitoring. We also detect eDNA from a rare vagrant species in the area; European pilchard (Sardina pilchardus). Additionally, we detect four bird species. Records in national databases confirmed the occurrence of all detected species. To investigate the efficiency of the eDNA approach, we compared its performance with 9 methods conventionally used in marine fish surveys. Promisingly, eDNA covered the fish diversity better than or equal to any of the applied conventional methods. Our study demonstrates that even small samples of seawater contain eDNA from a wide range of local fish species. Finally, in order to examine the potential dispersal of eDNA in oceans, we performed an experiment addressing eDNA degradation in seawater, which shows that even small (100-bp) eDNA fragments degrades beyond detectability within days. Although further studies are needed to validate the eDNA approach in varying environmental conditions, our findings provide a strong proof-of-concept with great perspectives for future monitoring of marine biodiversity and resources. PMID:22952584

The Relationship between the Distribution of Common Carp and Their Environmental DNA in a Small Lake

PubMed Central

Eichmiller, Jessica J.; Bajer, Przemyslaw G.; Sorensen, Peter W.

2014-01-01

Although environmental DNA (eDNA) has been used to infer the presence of rare aquatic species, many facets of this technique remain unresolved. In particular, the relationship between eDNA and fish distribution is not known. We examined the relationship between the distribution of fish and their eDNA (detection rate and concentration) in a lake. A quantitative PCR (qPCR) assay for a region within the cytochrome b gene of the common carp (Cyprinus carpio or ‘carp’), an ubiquitous invasive fish, was developed and used to measure eDNA in Lake Staring (MN, USA), in which both the density of carp and their distribution have been closely monitored for several years. Surface water, sub-surface water, and sediment were sampled from 22 locations in the lake, including areas frequently used by carp. In water, areas of high carp use had a higher rate of detection and concentration of eDNA, but there was no effect of fish use on sediment eDNA. The detection rate and concentration of eDNA in surface and sub-surface water were not significantly different (p≥0.5), indicating that eDNA did not accumulate in surface water. The detection rate followed the trend: high-use water > low-use water > sediment. The concentration of eDNA in sediment samples that were above the limit of detection were several orders of magnitude greater than water on a per mass basis, but a poor limit of detection led to low detection rates. The patchy distribution of eDNA in the water of our study lake suggests that the mechanisms that remove eDNA from the water column, such as decay and sedimentation, are rapid. Taken together, these results indicate that effective eDNA sampling methods should be informed by fish distribution, as eDNA concentration was shown to vary dramatically between samples taken less than 100 m apart. PMID:25383965

Detection of a diverse marine fish fauna using environmental DNA from seawater samples.

PubMed

Thomsen, Philip Francis; Kielgast, Jos; Iversen, Lars Lønsmann; Møller, Peter Rask; Rasmussen, Morten; Willerslev, Eske

2012-01-01

Marine ecosystems worldwide are under threat with many fish species and populations suffering from human over-exploitation. This is greatly impacting global biodiversity, economy and human health. Intriguingly, marine fish are largely surveyed using selective and invasive methods, which are mostly limited to commercial species, and restricted to particular areas with favourable conditions. Furthermore, misidentification of species represents a major problem. Here, we investigate the potential of using metabarcoding of environmental DNA (eDNA) obtained directly from seawater samples to account for marine fish biodiversity. This eDNA approach has recently been used successfully in freshwater environments, but never in marine settings. We isolate eDNA from ½-litre seawater samples collected in a temperate marine ecosystem in Denmark. Using next-generation DNA sequencing of PCR amplicons, we obtain eDNA from 15 different fish species, including both important consumption species, as well as species rarely or never recorded by conventional monitoring. We also detect eDNA from a rare vagrant species in the area; European pilchard (Sardina pilchardus). Additionally, we detect four bird species. Records in national databases confirmed the occurrence of all detected species. To investigate the efficiency of the eDNA approach, we compared its performance with 9 methods conventionally used in marine fish surveys. Promisingly, eDNA covered the fish diversity better than or equal to any of the applied conventional methods. Our study demonstrates that even small samples of seawater contain eDNA from a wide range of local fish species. Finally, in order to examine the potential dispersal of eDNA in oceans, we performed an experiment addressing eDNA degradation in seawater, which shows that even small (100-bp) eDNA fragments degrades beyond detectability within days. Although further studies are needed to validate the eDNA approach in varying environmental conditions, our findings provide a strong proof-of-concept with great perspectives for future monitoring of marine biodiversity and resources.

The relationship between the distribution of common carp and their environmental DNA in a small lake.

PubMed

Eichmiller, Jessica J; Bajer, Przemyslaw G; Sorensen, Peter W

2014-01-01

Although environmental DNA (eDNA) has been used to infer the presence of rare aquatic species, many facets of this technique remain unresolved. In particular, the relationship between eDNA and fish distribution is not known. We examined the relationship between the distribution of fish and their eDNA (detection rate and concentration) in a lake. A quantitative PCR (qPCR) assay for a region within the cytochrome b gene of the common carp (Cyprinus carpio or 'carp'), an ubiquitous invasive fish, was developed and used to measure eDNA in Lake Staring (MN, USA), in which both the density of carp and their distribution have been closely monitored for several years. Surface water, sub-surface water, and sediment were sampled from 22 locations in the lake, including areas frequently used by carp. In water, areas of high carp use had a higher rate of detection and concentration of eDNA, but there was no effect of fish use on sediment eDNA. The detection rate and concentration of eDNA in surface and sub-surface water were not significantly different (p≥0.5), indicating that eDNA did not accumulate in surface water. The detection rate followed the trend: high-use water > low-use water > sediment. The concentration of eDNA in sediment samples that were above the limit of detection were several orders of magnitude greater than water on a per mass basis, but a poor limit of detection led to low detection rates. The patchy distribution of eDNA in the water of our study lake suggests that the mechanisms that remove eDNA from the water column, such as decay and sedimentation, are rapid. Taken together, these results indicate that effective eDNA sampling methods should be informed by fish distribution, as eDNA concentration was shown to vary dramatically between samples taken less than 100 m apart.

Fully Integrated Microfluidic Device for Direct Sample-to-Answer Genetic Analysis

NASA Astrophysics Data System (ADS)

Liu, Robin H.; Grodzinski, Piotr

Integration of microfluidics technology with DNA microarrays enables building complete sample-to-answer systems that are useful in many applications such as clinic diagnostics. In this chapter, a fully integrated microfluidic device [1] that consists of microfluidic mixers, valves, pumps, channels, chambers, heaters, and a DNA microarray sensor to perform DNA analysis of complex biological sample solutions is present. This device can perform on-chip sample preparation (including magnetic bead-based cell capture, cell preconcentration and purification, and cell lysis) of complex biological sample solutions (such as whole blood), polymerase chain reaction, DNA hybridization, and electrochemical detection. A few novel microfluidic techniques were developed and employed. A micromix-ing technique based on a cavitation microstreaming principle was implemented to enhance target cell capture from whole blood samples using immunomagnetic beads. This technique was also employed to accelerate DNA hybridization reaction. Thermally actuated paraffin-based microvalves were developed to regulate flows. Electrochemical pumps and thermopneumatic pumps were integrated on the chip to provide pumping of liquid solutions. The device is completely self-contained: no external pressure sources, fluid storage, mechanical pumps, or valves are necessary for fluid manipulation, thus eliminating possible sample contamination and simplifying device operation. Pathogenic bacteria detection from ~mL whole blood samples and single-nucleotide polymorphism analysis directly from diluted blood were demonstrated. The device provides a cost-effective solution to direct sample-to-answer genetic analysis, and thus has a potential impact in the fields of point-of-care genetic analysis, environmental testing, and biological warfare agent detection.

Seasonal distribution of Legionella spp. and L. pneumophila in a river in Taiwan evaluated with culture-confirmed and direct DNA extraction methods

NASA Astrophysics Data System (ADS)

Tung, Min-Che; Chang, Tien-Yu; Hsu, Bing-Mu; Shen, Shu-Min; Huang, Jen-Te; Kao, Po-Min; Chiu, Yi-Chou; Fan, Cheng-Wei; Huang, Yu-Li

2013-07-01

In this study, we evaluated the presence and amount of Legionella in along a river in Taiwan, and the relations between seasonal distribution of Legionella spp. and geographic characteristics in the watershed were also evaluated. Water samples were pre-treated and analyzed with culture-confirmed and direct DNA extraction methods. For culture-confirmed method, water samples were cultivated through a series of selective media, and candidate colonies were confirmed by PCR. For direct DNA extraction method, direct DNA extraction was performed from pre-treated water samples. The DNA extracts were analyzed with PCR and DNA sequence analysis for species determination, quantitative PCR (qPCR) was performed to quantify Legionella concentration in the water sample. In all, 150 water samples were included in this study, with 73 (48.6%) water samples detected with Legionella spp., and 17 with L. pneumophila. Over 80% Legionella spp. detections were through direct DNA extraction method, but more than 80% L. pneumophila detections were through culture-confirmed method. While detection of Legionella spp. was done with two methods, positive results were found through only one method. Legionella spp. was detected in all seasons with detection rate ranging between 34.3-58.8% and seasonal average concentration from 1.9 × 102 to 7.1 × 103 CFU/L. Most of the L. pneumophila detections were from samples collected in fall (38.2%) and summer (6.0%), which also coincided with increased cases of Legionellosis reported through Center of Disease Control in Taiwan. The high prevalence and concentration of Legionella spp. and L. pneumophila in the surface waters should be further evaluated for potential health risks.

Applicability of the ParaDNA(®) Screening System to Seminal Samples.

PubMed

Tribble, Nicholas D; Miller, Jamie A D; Dawnay, Nick; Duxbury, Nicola J

2015-05-01

Seminal fluid represents a common biological material recovered from sexual assault crime scenes. Such samples can be prescreened using different techniques to determine cell type and relative amount before submitting for full STR profiling. The ParaDNA(®) Screening System is a novel forensic test which identifies the presence of DNA through amplification and detection of two common STR loci (D16S539 and TH01) and the Amelogenin marker. The detection of the Y allele in samples could provide a useful tool in the triage and submission of sexual assault samples by enforcement authorities. Male template material was detected on a range of common sexual assault evidence items including cotton pillow cases, condoms, swab heads and glass surfaces and shows a detection limit of 1 in 1000 dilution of neat semen. These data indicate this technology has the potential to be a useful tool for the detection of male donor DNA in sexual assault casework. © 2015 American Academy of Forensic Sciences.

Implementation options for DNA-based identification into ecological status assessment under the European Water Framework Directive.

PubMed

Hering, Daniel; Borja, Angel; Jones, J Iwan; Pont, Didier; Boets, Pieter; Bouchez, Agnes; Bruce, Kat; Drakare, Stina; Hänfling, Bernd; Kahlert, Maria; Leese, Florian; Meissner, Kristian; Mergen, Patricia; Reyjol, Yorick; Segurado, Pedro; Vogler, Alfried; Kelly, Martyn

2018-07-01

Assessment of ecological status for the European Water Framework Directive (WFD) is based on "Biological Quality Elements" (BQEs), namely phytoplankton, benthic flora, benthic invertebrates and fish. Morphological identification of these organisms is a time-consuming and expensive procedure. Here, we assess the options for complementing and, perhaps, replacing morphological identification with procedures using eDNA, metabarcoding or similar approaches. We rate the applicability of DNA-based identification for the individual BQEs and water categories (rivers, lakes, transitional and coastal waters) against eleven criteria, summarised under the headlines representativeness (for example suitability of current sampling methods for DNA-based identification, errors from DNA-based species detection), sensitivity (for example capability to detect sensitive taxa, unassigned reads), precision of DNA-based identification (knowledge about uncertainty), comparability with conventional approaches (for example sensitivity of metrics to differences in DNA-based identification), cost effectiveness and environmental impact. Overall, suitability of DNA-based identification is particularly high for fish, as eDNA is a well-suited sampling approach which can replace expensive and potentially harmful methods such as gill-netting, trawling or electrofishing. Furthermore, there are attempts to replace absolute by relative abundance in metric calculations. For invertebrates and phytobenthos, the main challenges include the modification of indices and completing barcode libraries. For phytoplankton, the barcode libraries are even more problematic, due to the high taxonomic diversity in plankton samples. If current assessment concepts are kept, DNA-based identification is least appropriate for macrophytes (rivers, lakes) and angiosperms/macroalgae (transitional and coastal waters), which are surveyed rather than sampled. We discuss general implications of implementing DNA-based identification into standard ecological assessment, in particular considering any adaptations to the WFD that may be required to facilitate the transition to molecular data. Copyright © 2018 Elsevier Ltd. All rights reserved.

Brucella abortus is Prevalent in Both Humans and Animals in Bangladesh.

PubMed

Rahman, A K M A; Saegerman, C; Berkvens, D; Melzer, F; Neubauer, H; Fretin, D; Abatih, E; Dhand, N; Ward, M P

2017-08-01

To determine the role of different Brucella (B.) spp. in Bangladesh, 62 animal samples and 500 human sera were tested. Animal samples from cattle, goats and sheep (including milk, bull semen, vaginal swabs and placentas) were cultured for Brucella spp. Three test-positive human sera and all animal samples were screened by Brucella genus-specific real-time PCR (RT-PCR), and positive samples were then tested by IS711 RT-PCR to detect B. abortus and B. melitensis DNA. Only B. abortus DNA was amplified from 13 human and six animal samples. This is the first report describing B. abortus as the aetiological agent of brucellosis in occupationally exposed humans in Bangladesh. Of note is failure to detect B. melitensis DNA, the species most often associated with human brucellosis worldwide. Further studies are required to explore the occurrence of Brucella melitensis in Bangladesh. © 2017 Blackwell Verlag GmbH.

Isolation of PCR quality microbial community DNA from heavily contaminated environments.

PubMed

Gunawardana, Manjula; Chang, Simon; Jimenez, Abraham; Holland-Moritz, Daniel; Holland-Moritz, Hannah; La Val, Taylor P; Lund, Craig; Mullen, Madeline; Olsen, John; Sztain, Terra A; Yoo, Jennifer; Moss, John A; Baum, Marc M

2014-07-01

Asphalts, biochemically degraded oil, contain persistent, water-soluble compounds that pose a significant challenge to the isolation of PCR quality DNA. The adaptation of existing DNA purification protocols and commercial kits proved unsuccessful at overcoming this hurdle. Treatment of aqueous asphalt extracts with a polyamide resin afforded genomic microbial DNA templates that could readily be amplified by PCR. Physicochemically distinct asphalt samples from five natural oil seeps successfully generated the expected 291 bp amplicons targeting a region of the 16S rRNA gene, illustrating the robustness of the method. DNA recovery yields were in the 50-80% range depending on how the asphalt sample was seeded with exogenous DNA. The scope of the new method was expanded to include soil with high humic acid content. DNA from soil samples spiked with a range of humic acid concentrations was extracted with a commercial kit followed by treatment with the polyamide resin. The additional step significantly improved the purity of the DNA templates, especially at high humic acid concentrations, based on qPCR analysis of the bacterial 16S rRNA genes. The new method has the advantages of being inexpensive, simple, and rapid and should provide a valuable addition to protocols in the field of petroleum and soil microbiology. Copyright © 2014 Elsevier B.V. All rights reserved.

Moving DNA barcoding toward bioassessment application: roadmap of challenges and solutions

EPA Science Inventory

DNA barcoding holds promise for helping to address several challenges associated with taxonomic based bioassessments; these include the time and effort necessary to identify hundreds of specimens per sample location, incomplete or unavailable local taxonomy that limits the abili...

CD3-negative lymphoproliferative disease of granular lymphocytes containing Epstein-Barr viral DNA.

PubMed Central

Kawa-Ha, K; Ishihara, S; Ninomiya, T; Yumura-Yagi, K; Hara, J; Murayama, F; Tawa, A; Hirai, K

1989-01-01

Lymphoproliferative disease of granular lymphocytes (LDGL) is a heterogeneous disorder and the pathogenesis is likely to be complex. Some patients with chronic active EBV (CAEBV) infection also have LDGL. To investigate the relationship between EBV infection and the pathogenesis of LDGL, we conducted a survey for EBV DNA sequences by Southern blot analysis of DNA obtained from the peripheral blood of seven patients with LDGL, including one with CAEBV infection. Interestingly, EBV DNA was detected in the sample from the patient with CAEBV infection, and in the samples from four other patients with CD3-LDGL. Moreover, a single band for the joined termini of the EBV genome was demonstrated in two samples, suggesting a clonal disorder of those LDGL. These findings strongly suggest that EBV may play a pathogenic role in some cases of LDGL. Images PMID:2544630

Extraction of DNA from forensic-type sexual assault specimens using simple, rapid sonication procedures.

PubMed

Crouse, C A; Ban, J D; D'Alessio, J K

1993-10-01

Sonication procedures for the extraction of DNA from forensic-type semen specimens have been developed, which, when compared to currently utilized sperm DNA extraction techniques, are simple, rapid and result in comparable DNA yields. Sperm DNA extraction by sonication was performed on whole semen, seminal stains, buccal swabs and post-coital specimens. Ultrasound disruption of sperm cells and their ultimate release of cellular DNA has been conducted in the presence of sperm wash buffers followed by organic extraction or Chelex 100 with little or no compromise to DNA quality, quantity or amplifiability. Two advantages of sonication over currently used forensic techniques to extract sperm DNA include 1) sperm DNA extraction that occurs within five minutes of sonication compared with an hour or greater for water bath incubations in classic enzyme digestion DNA extractions and 2) one less preparatory step with the Chelex/sonication protocol and three less steps with the sonication/organic protocol compared with other procedures thus eliminating potential sample-to-sample cross-contamination. Sperm DNA extracted by optimum sonication procedures was used for forensic HLA DQ alpha typing and restriction fragment length polymorphisms analysis without any adverse effects on typing results.

Real-Time PCR Assay To Detect Smallpox Virus

PubMed Central

Sofi Ibrahim, M.; Kulesh, David A.; Saleh, Sharron S.; Damon, Inger K.; Esposito, Joseph J.; Schmaljohn, Alan L.; Jahrling, Peter B.

2003-01-01

We developed a highly sensitive and specific assay for the rapid detection of smallpox virus DNA on both the Smart Cycler and LightCycler platforms. The assay is based on TaqMan chemistry with the orthopoxvirus hemagglutinin gene used as the target sequence. With genomic DNA purified from variola virus Bangladesh 1975, the limit of detection was estimated to be approximately 25 copies on both machines. The assay was evaluated in a blinded study with 322 coded samples that included genomic DNA from 48 different isolates of variola virus; 25 different strains and isolates of camelpox, cowpox, ectromelia, gerbilpox, herpes, monkeypox, myxoma, rabbitpox, raccoonpox, skunkpox, vaccinia, and varicella-zoster viruses; and two rickettsial species at concentrations mostly ranging from 100 fg/μl to 1 ng/μl. Contained within those 322 samples were variola virus DNA, obtained from purified viral preparations, at concentrations of 1 fg/μl to 1 ng/μl. On the Smart Cycler platform, 2 samples with false-positive results were detected among the 116 samples not containing variola virus tested; i.e., the overall specificity of the assay was 98.3%. On the LightCycler platform, five samples with false-positive results were detected (overall specificity, 95.7%). Of the 206 samples that contained variola virus DNA ranging in concentrations from 100 fg/μl to 1 ng/μl, 8 samples were considered negative on the Smart Cycler platform and 1 sample was considered negative on the LightCycler platform. Thus, the clinical sensitivities were 96.1% for the Smart Cycler instrument and 99.5% for the LightCycler instrument. The vast majority of these samples were derived from virus-infected cell cultures and variola virus-infected tissues; thus, the DNA material contained both viral DNA and cellular DNA. Of the 43 samples that contained purified variola virus DNA ranging in concentration from 1 fg/μl to 1 ng/μl, the assay correctly detected the virus in all 43 samples on both the Smart Cycler and the LightCycler platforms. The assay may be useful for the early detection of smallpox virus infections should such infections occur as a result of a deliberate or an accidental recurrence. PMID:12904397

Simultaneous Runs of the Bayer VERSANT HIV-1 Version 3.0 and HCV bDNA Version 3.0 Quantitative Assays on the System 340 Platform Provide Reliable Quantitation and Improved Work Flow

PubMed Central

Elbeik, Tarek; Markowitz, Norman; Nassos, Patricia; Kumar, Uday; Beringer, Scott; Haller, Barbara; Ng, Valerie

2004-01-01

Branched DNA (bDNA) assays to quantify human immunodeficiency virus type 1 (HIV-1) and hepatitis C virus (HCV) consist of three distinct steps, including sample processing, hybridization, and detection, and utilize the System 340 platform for plate incubation and washing. Sample processing differs: HIV-1 from 1 ml of plasma is concentrated by high-speed centrifugation, whereas HCV plasma or serum samples are used without concentration. The first step of hybridization involves viral lysis at 63°C: HIV-1 is performed in a heat block, whereas HCV is performed in System 340. The remaining hybridization and detection steps are similar for HIV-1 and HCV and executed on System 340. In the present study, the HIV-1 bDNA assay was adapted for viral lysis in the System 340 platform. The adaptation, test method 2, includes a 20-s vortex of concentrated viral pellet and lysis working solution, transfer of viral lysate to the 96-well capture plate, and transfer to System 340 programmed for HCV assay specifications. With test method 2, specificity and quantification were within assay specifications. HCV bDNA methodology remains unchanged. Hence, an HIV-1 and an HCV bDNA can be run simultaneously on System 340. With simultaneous testing, laboratories can run full plates, as well as combinations of full and partial plates. Also, simultaneous HIV-1 and HCV bDNA permits labor consolidation and improved workflow while maintaining multitasking and rapid patient result turnaround. PMID:15243070

Simultaneous runs of the Bayer VERSANT HIV-1 version 3.0 and HCV bDNA version 3.0 quantitative assays on the system 340 platform provide reliable quantitation and improved work flow.

PubMed

Elbeik, Tarek; Markowitz, Norman; Nassos, Patricia; Kumar, Uday; Beringer, Scott; Haller, Barbara; Ng, Valerie

2004-07-01

Branched DNA (bDNA) assays to quantify human immunodeficiency virus type 1 (HIV-1) and hepatitis C virus (HCV) consist of three distinct steps, including sample processing, hybridization, and detection, and utilize the System 340 platform for plate incubation and washing. Sample processing differs: HIV-1 from 1 ml of plasma is concentrated by high-speed centrifugation, whereas HCV plasma or serum samples are used without concentration. The first step of hybridization involves viral lysis at 63 degrees C: HIV-1 is performed in a heat block, whereas HCV is performed in System 340. The remaining hybridization and detection steps are similar for HIV-1 and HCV and executed on System 340. In the present study, the HIV-1 bDNA assay was adapted for viral lysis in the System 340 platform. The adaptation, test method 2, includes a 20-s vortex of concentrated viral pellet and lysis working solution, transfer of viral lysate to the 96-well capture plate, and transfer to System 340 programmed for HCV assay specifications. With test method 2, specificity and quantification were within assay specifications. HCV bDNA methodology remains unchanged. Hence, an HIV-1 and an HCV bDNA can be run simultaneously on System 340. With simultaneous testing, laboratories can run full plates, as well as combinations of full and partial plates. Also, simultaneous HIV-1 and HCV bDNA permits labor consolidation and improved workflow while maintaining multitasking and rapid patient result turnaround.

A Fast Solution to NGS Library Prep with Low Nanogram DNA Input

PubMed Central

Liu, Pingfang; Lohman, Gregory J.S.; Cantor, Eric; Langhorst, Bradley W.; Yigit, Erbay; Apone, Lynne M.; Munafo, Daniela B.; Stewart, Fiona J.; Evans, Thomas C.; Nichols, Nicole; Dimalanta, Eileen T.; Davis, Theodore B.; Sumner, Christine

2013-01-01

Next Generation Sequencing (NGS) has significantly impacted human genetics, enabling a comprehensive characterization of the human genome as well as a better understanding of many genomic abnormalities. By delivering massive DNA sequences at unprecedented speed and cost, NGS promises to make personalized medicine a reality in the foreseeable future. To date, library construction with clinical samples has been a challenge, primarily due to the limited quantities of sample DNA available. Our objective here was to overcome this challenge by developing NEBNext® Ultra DNA Library Prep Kit, a fast library preparation method. Specifically, we streamlined the workflow utilizing novel NEBNext reagents and adaptors, including a new DNA polymerase that has been optimized to minimize GC bias. As a result of this work, we have developed a simple method for library construction from an amount of DNA as low as 5 ng, which can be used for both intact and fragmented DNA. Moreover, the workflow is compatible with multiple NGS platforms.

Evaluation of single-nucleotide polymorphisms as internal controls in prenatal diagnosis of fetal blood groups.

PubMed

Doescher, Andrea; Petershofen, Eduard K; Wagner, Franz F; Schunter, Markus; Müller, Thomas H

2013-02-01

Determination of fetal blood groups in maternal plasma samples critically depends on adequate amplification of fetal DNA. We evaluated the routine inclusion of 52 single-nucleotide polymorphisms (SNPs) as internal reference in our polymerase chain reaction (PCR) settings to obtain a positive internal control for fetal DNA. DNA from 223 plasma samples of pregnant women was screened for RHD Exons 3, 4, 5, and 7 in a multiplex PCR including 52 SNPs divided into four primer pools. Amplicons were analyzed by single-base extension and the GeneScan method in a genetic analyzer. Results of D screening were compared to standard RHD genotyping of amniotic fluid or real-time PCR of fetal DNA from maternal plasma. The vast majority of all samples (97.8%) demonstrated differences in maternal and fetal SNP patterns when tested with four primer pools. These differences were not observed in less than 2.2% of the samples most probably due to an extraction failure for adequate amounts of fetal DNA. Comparison of the fetal genotypes with independent results did not reveal a single false-negative case among samples (n = 42) with positive internal control and negative fetal RHD typing. Coamplification of 52 SNPs with RHD-specific sequences for fetal blood group determination introduces a valid positive control for the amplification of fetal DNA to avoid false-negative results. This new approach does not require a paternal blood sample. It may also be applicable to other assays for fetal genotyping in maternal blood samples. © 2012 American Association of Blood Banks.

Environmental DNA as a ‘Snapshot’ of Fish Distribution: A Case Study of Japanese Jack Mackerel in Maizuru Bay, Sea of Japan

PubMed Central

Takahashi, Kohji; Sawada, Hideki; Murakami, Hiroaki; Tsuji, Satsuki; Hashizume, Hiroki; Kubonaga, Shou; Horiuchi, Tomoya; Hongo, Masamichi; Nishida, Jo; Okugawa, Yuta; Fujiwara, Ayaka; Fukuda, Miho; Hidaka, Shunsuke; Suzuki, Keita W.; Miya, Masaki; Araki, Hitoshi; Yamanaka, Hiroki; Maruyama, Atsushi; Miyashita, Kazushi; Masuda, Reiji; Minamoto, Toshifumi; Kondoh, Michio

2016-01-01

Recent studies in streams and ponds have demonstrated that the distribution and biomass of aquatic organisms can be estimated by detection and quantification of environmental DNA (eDNA). In more open systems such as seas, it is not evident whether eDNA can represent the distribution and biomass of aquatic organisms because various environmental factors (e.g., water flow) are expected to affect eDNA distribution and concentration. To test the relationships between the distribution of fish and eDNA, we conducted a grid survey in Maizuru Bay, Sea of Japan, and sampled surface and bottom waters while monitoring biomass of the Japanese jack mackerel (Trachurus japonicus) using echo sounder technology. A linear model showed a high R2 value (0.665) without outlier data points, and the association between estimated eDNA concentrations from the surface water samples and echo intensity was significantly positive, suggesting that the estimated spatial variation in eDNA concentration can reflect the local biomass of the jack mackerel. We also found that a best-fit model included echo intensity obtained within 10–150 m from water sampling sites, indicating that the estimated eDNA concentration most likely reflects fish biomass within 150 m in the bay. Although eDNA from a wholesale fish market partially affected eDNA concentration, we conclude that eDNA generally provides a ‘snapshot’ of fish distribution and biomass in a large area. Further studies in which dynamics of eDNA under field conditions (e.g., patterns of release, degradation, and diffusion of eDNA) are taken into account will provide a better estimate of fish distribution and biomass based on eDNA. PMID:26933889

[Current situation and prospect of breast cancer liquid biopsy].

PubMed

Zhou, B; Xin, L; Xu, L; Ye, J M; Liu, Y H

2018-02-01

Liquid biopsy is a diagnostic approach by analyzing body fluid samples. Peripheral blood is the most common sample. Urine, saliva, pleural effusion and ascites are also used. Now liquid biopsy is mainly used in the area of neoplasm diagnosis and treatment. Compared with traditional tissue biopsy, liquid biopsy is minimally invasive, convenient to sample and easy to repeat. Liquid biopsy mainly includes circulating tumor cells and circulating tumor DNA (ctDNA) detection. Detection of ctDNA requires sensitive and accurate methods. The progression of next-generation sequencing (NGS) and digital PCR promote the process of studies in ctDNA. In 2016, Nature published the result of whole-genome sequencing study of breast cancer. The study found 1 628 mutations of 93 protein-coding genes which may be driver mutations of breast cancer. The result of this study provided a new platform for breast cancer ctDNA studies. In recent years, there were many studies using ctDNA detection to monitor therapeutic effect and guide treatment. NGS is a promising technique in accessing genetic information and guiding targeted therapy. It must be emphasized that ctDNA detection using NGS is still at research stage. It is important to standardize ctDNA detection technique and perform prospective clinical researches. The time is not ripe for using ctDNA detection to guide large-scale breast cancer clinical practice at present.

DNA and RNA sequencing by nanoscale reading through programmable electrophoresis and nanoelectrode-gated tunneling and dielectric detection

DOEpatents

Lee, James W.; Thundat, Thomas G.

2005-06-14

An apparatus and method for performing nucleic acid (DNA and/or RNA) sequencing on a single molecule. The genetic sequence information is obtained by probing through a DNA or RNA molecule base by base at nanometer scale as though looking through a strip of movie film. This DNA sequencing nanotechnology has the theoretical capability of performing DNA sequencing at a maximal rate of about 1,000,000 bases per second. This enhanced performance is made possible by a series of innovations including: novel applications of a fine-tuned nanometer gap for passage of a single DNA or RNA molecule; thin layer microfluidics for sample loading and delivery; and programmable electric fields for precise control of DNA or RNA movement. Detection methods include nanoelectrode-gated tunneling current measurements, dielectric molecular characterization, and atomic force microscopy/electrostatic force microscopy (AFM/EFM) probing for nanoscale reading of the nucleic acid sequences.

Introducing automation to the molecular diagnosis of Trypanosoma cruzi infection: A comparative study of sample treatments, DNA extraction methods and real-time PCR assays.

PubMed

Abras, Alba; Ballart, Cristina; Llovet, Teresa; Roig, Carme; Gutiérrez, Cristina; Tebar, Silvia; Berenguer, Pere; Pinazo, María-Jesús; Posada, Elizabeth; Gascón, Joaquim; Schijman, Alejandro G; Gállego, Montserrat; Muñoz, Carmen

2018-01-01

Polymerase chain reaction (PCR) has become a useful tool for the diagnosis of Trypanosoma cruzi infection. The development of automated DNA extraction methodologies and PCR systems is an important step toward the standardization of protocols in routine diagnosis. To date, there are only two commercially available Real-Time PCR assays for the routine laboratory detection of T. cruzi DNA in clinical samples: TCRUZIDNA.CE (Diagnostic Bioprobes Srl) and RealCycler CHAG (Progenie Molecular). Our aim was to evaluate the RealCycler CHAG assay taking into account the whole process. We assessed the usefulness of an automated DNA extraction system based on magnetic particles (EZ1 Virus Mini Kit v2.0, Qiagen) combined with a commercially available Real-Time PCR assay targeting satellite DNA (SatDNA) of T. cruzi (RealCycler CHAG), a methodology used for routine diagnosis in our hospital. It was compared with a well-known strategy combining a commercial DNA isolation kit based on silica columns (High Pure PCR Template Preparation Kit, Roche Diagnostics) with an in-house Real-Time PCR targeting SatDNA. The results of the two methodologies were in almost perfect agreement, indicating they can be used interchangeably. However, when variations in protocol factors were applied (sample treatment, extraction method and Real-Time PCR), the results were less convincing. A comprehensive fine-tuning of the whole procedure is the key to successful results. Guanidine EDTA-blood (GEB) samples are not suitable for DNA extraction based on magnetic particles due to inhibition, at least when samples are not processed immediately. This is the first study to evaluate the RealCycler CHAG assay taking into account the overall process, including three variables (sample treatment, extraction method and Real-Time PCR). Our findings may contribute to the harmonization of protocols between laboratories and to a wider application of Real-Time PCR in molecular diagnostic laboratories associated with health centers.

Accuracy of qPCR for quantifying Leishmania kDNA in different skin layers of patients with American tegumentary leishmaniasis.

PubMed

Sevilha-Santos, L; Dos Santos Júnior, A C M; Medeiros-Silva, V; Bergmann, J O; da Silva, E F; Segato, L F; Arabi, A Y M; de Paula, N A; Sampaio, R N R; Lima, B D; Gomes, C M

2018-05-03

Superficial swab sampling of American tegumentary leishmaniasis (ATL) lesions shows higher amounts of Leishmania than those from biopsy. Subcutaneous involvement is also important in ATL, but parasite quantification according to lesion depth has not been evaluated. We aim to present the best depth at which sampling should be performed for molecular exams of ATL. Patients with a clinical presentation compatible with ATL were allocated to ATL and control groups. Qualitative and quantitative qPCR assays were performed using SYBR Green and primers amplifying the kDNA minicircle of Leishmania spp. in different skin layers, including the epidermis, the superior dermis, the inferior dermis, and the hypodermis. Fifty-nine patients were included in this study, including 40 who had been diagnosed with ATL and 19 controls. The number of parasites was greater in samples of the epidermis and superior dermis (159.1 × 10 6 , range 4.0-781.7, and 75.4 × 10 6 , range 8.0-244.5, mean Leishmania parasite equivalents per μg of tissue DNA, respectively) than those in samples of the inferior dermis and hypodermis (54.6, range 8.0-256.6, and 16.8 × 10 6 , range 8.0-24.1, mean Leishmania parasite equivalents per μg of tissue DNA, respectively). The best diagnostic accuracy was achieved in the superior dermis (77.9%) and was significantly greater than that in the hypodermis (63.3%; p 0.039). We conclude that superficial sampling can retrieve a greater quantity of parasites. Future studies of the role of transepidermal elimination as a mechanism of host defence in ATL must be performed as there is a considerable quantity of Leishmania kDNA in the epidermis. Copyright © 2018 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Development of a real-time PCR assay for detection of planktonic red king crab (Paralithodes camtschaticus (Tilesius 1815)) larvae

USGS Publications Warehouse

Jensen, Pamela C.; Purcell, Maureen K.; Morado, J. Frank; Eckert, Ginny L.

2012-01-01

The Alaskan red king crab (Paralithodes camtschaticus) fishery was once one of the most economically important single-species fisheries in the world, but is currently depressed. This fishery would benefit from improved stock assessment capabilities. Larval crab distribution is patchy temporally and spatially, requiring extensive sampling efforts to locate and track larval dispersal. Large-scale plankton surveys are generally cost prohibitive because of the effort required for collection and the time and taxonomic expertise required to sort samples to identify plankton individually via light microscopy. Here, we report the development of primers and a dual-labeled probe for use in a DNA-based real-time polymerase chain reaction assay targeting the red king crab, mitochondrial gene cytochrome oxidase I for the detection of red king crab larvae DNA in plankton samples. The assay allows identification of plankton samples containing crab larvae DNA and provides an estimate of DNA copy number present in a sample without sorting the plankton sample visually. The assay was tested on DNA extracted from whole red king crab larvae and plankton samples seeded with whole larvae, and it detected DNA copies equivalent to 1/10,000th of a larva and 1 crab larva/5mL sieved plankton, respectively. The real-time polymerase chain reaction assay can be used to screen plankton samples for larvae in a fraction of the time required for traditional microscopial methods, which offers advantages for stock assessment methodologies for red king crab as well as a rapid and reliable method to assess abundance of red king crab larvae as needed to improve the understanding of life history and population processes, including larval population dynamics.

A comprehensive characterization of rare mitochondrial DNA variants in neuroblastoma.

PubMed

Calabrese, Francesco Maria; Clima, Rosanna; Pignataro, Piero; Lasorsa, Vito Alessandro; Hogarty, Michael D; Castellano, Aurora; Conte, Massimo; Tonini, Gian Paolo; Iolascon, Achille; Gasparre, Giuseppe; Capasso, Mario

2016-08-02

Neuroblastoma, a tumor of the developing sympathetic nervous system, is a common childhood neoplasm that is often lethal. Mitochondrial DNA (mtDNA) mutations have been found in most tumors including neuroblastoma. We extracted mtDNA data from a cohort of neuroblastoma samples that had undergone Whole Exome Sequencing (WES) and also used snap-frozen samples in which mtDNA was entirely sequenced by Sanger technology. We next undertook the challenge of determining those mutations that are relevant to, or arisen during tumor development. The bioinformatics pipeline used to extract mitochondrial variants from matched tumor/blood samples was enriched by a set of filters inclusive of heteroplasmic fraction, nucleotide variability, and in silico prediction of pathogenicity. Our in silico multistep workflow applied both on WES and Sanger-sequenced neuroblastoma samples, allowed us to identify a limited burden of somatic and germline mitochondrial mutations with a potential pathogenic impact. The few singleton germline and somatic mitochondrial mutations emerged, according to our in silico analysis, do not appear to impact on the development of neuroblastoma. Our findings are consistent with the hypothesis that most mitochondrial somatic mutations can be considered as 'passengers' and consequently have no discernible effect in this type of cancer.

A transmission imaging spectrograph and microfabricated channel system for DNA analysis.

PubMed

Simpson, J W; Ruiz-Martinez, M C; Mulhern, G T; Berka, J; Latimer, D R; Ball, J A; Rothberg, J M; Went, G T

2000-01-01

In this paper we present the development of a DNA analysis system using a microfabricated channel device and a novel transmission imaging spectrograph which can be efficiently incorporated into a high throughput genomics facility for both sizing and sequencing of DNA fragments. The device contains 48 channels etched on a glass substrate. The channels are sealed with a flat glass plate which also provides a series of apertures for sample loading and contact with buffer reservoirs. Samples can be easily loaded in volumes up to 640 nL without band broadening because of an efficient electrokinetic stacking at the electrophoresis channel entrance. The system uses a dual laser excitation source and a highly sensitive charge-coupled device (CCD) detector allowing for simultaneous detection of many fluorescent dyes. The sieving matrices for the separation of single-stranded DNA fragments are polymerized in situ in denaturing buffer systems. Examples of separation of single-stranded DNA fragments up to 500 bases in length are shown, including accurate sizing of GeneCalling fragments, and sequencing samples prepared with a reduced amount of dye terminators. An increase in sample throughput has been achieved by color multiplexing.

A high-throughput assay for DNA topoisomerases and other enzymes, based on DNA triplex formation.

PubMed

Burrell, Matthew R; Burton, Nicolas P; Maxwell, Anthony

2010-01-01

We have developed a rapid, high-throughput assay for measuring the catalytic activity (DNA supercoiling or relaxation) of topoisomerase enzymes that is also capable of monitoring the activity of other enzymes that alter the topology of DNA. The assay utilises intermolecular triplex formation to resolve supercoiled and relaxed forms of DNA, the principle being the greater efficiency of a negatively supercoiled plasmid to form an intermolecular triplex with an immobilised oligonucleotide than the relaxed form. The assay provides a number of advantages over the standard gel-based methods, including greater speed of analysis, reduced sample handling, better quantitation and improved reliability and accuracy of output data. The assay is performed in microtitre plates and can be adapted to high-throughput screening of libraries of potential inhibitors of topoisomerases including bacterial DNA gyrase.

Evaluation of Methods to Improve the Extraction and Recovery of DNA from Cotton Swabs for Forensic Analysis

PubMed Central

Adamowicz, Michael S.; Stasulli, Dominique M.; Sobestanovich, Emily M.; Bille, Todd W.

2014-01-01

Samples for forensic DNA analysis are often collected from a wide variety of objects using cotton or nylon tipped swabs. Testing has shown that significant quantities of DNA are retained on the swab, however, and subsequently lost. When processing evidentiary samples, the recovery of the maximum amount of available DNA is critical, potentially dictating whether a usable profile can be derived from a piece of evidence or not. The QIAamp DNA Investigator extraction kit was used with its recommended protocol for swabs (one hour incubation at 56°C) as a baseline. Results indicate that over 50% of the recoverable DNA may be retained on the cotton swab tip, or otherwise lost, for both blood and buccal cell samples when using this protocol. The protocol’s incubation time and temperature were altered, as was incubating while shaking or stationary to test for increases in recovery efficiency. An additional step was then tested that included periodic re-suspension of the swab tip in the extraction buffer during incubation. Aliquots of liquid blood or a buccal cell suspension were deposited and dried on cotton swabs and compared with swab-less controls. The concentration of DNA in each extract was quantified and STR analysis was performed to assess the quality of the extracted DNA. Stationary incubations and those performed at 65°C did not result in significant gains in DNA yield. Samples incubated for 24 hours yielded less DNA. Increased yields were observed with three and 18 hour incubation periods. Increases in DNA yields were also observed using a swab re-suspension method for both cell types. The swab re-suspension method yielded an average two-fold increase in recovered DNA yield with buccal cells and an average three-fold increase with blood cells. These findings demonstrate that more of the DNA collected on swabs can be recovered with specific protocol alterations. PMID:25549111

Microfluidic Devices for Forensic DNA Analysis: A Review.

PubMed

Bruijns, Brigitte; van Asten, Arian; Tiggelaar, Roald; Gardeniers, Han

2016-08-05

Microfluidic devices may offer various advantages for forensic DNA analysis, such as reduced risk of contamination, shorter analysis time and direct application at the crime scene. Microfluidic chip technology has already proven to be functional and effective within medical applications, such as for point-of-care use. In the forensic field, one may expect microfluidic technology to become particularly relevant for the analysis of biological traces containing human DNA. This would require a number of consecutive steps, including sample work up, DNA amplification and detection, as well as secure storage of the sample. This article provides an extensive overview of microfluidic devices for cell lysis, DNA extraction and purification, DNA amplification and detection and analysis techniques for DNA. Topics to be discussed are polymerase chain reaction (PCR) on-chip, digital PCR (dPCR), isothermal amplification on-chip, chip materials, integrated devices and commercially available techniques. A critical overview of the opportunities and challenges of the use of chips is discussed, and developments made in forensic DNA analysis over the past 10-20 years with microfluidic systems are described. Areas in which further research is needed are indicated in a future outlook.

Effects of microbial DNA on human DNA profiles generated using the PowerPlex® 16 HS system.

PubMed

Dembinski, Gina M; Picard, Christine J

2017-11-01

Most crime scenes are not sterile and therefore may be contaminated with environmental DNA, especially if a decomposing body is found. Collecting biological evidence from this individual will yield DNA samples mixed with microbial DNA. This also becomes important if postmortem swabs are collected from sexually assaulted victims. Although genotyping kits undergo validation tests, including bacterial screens, they do not account for the diverse microbial load during decomposition. We investigated the effect of spiking human DNA samples with known concentrations of DNA from 17 microbe species associated with decomposition on DNA profiles produced using the Promega PowerPlex ® HS system. Two species, Bacillus subtilis and Mycobacterium smegmatis, produced an extraneous allele at the TPOX locus. When repeated with the PowerPlex ® Fusion kit, the extra allele no longer amplified with these two species. This experiment demonstrates that caution should be exhibited if microbial load is high and the PowerPlex ® 16HS system is used. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

Analytical sensitivity and specificity of a loop-mediated isothermal amplification (LAMP) kit prototype for detection of Trypanosoma cruzi DNA in human blood samples.

PubMed

Besuschio, Susana A; Llano Murcia, Mónica; Benatar, Alejandro F; Monnerat, Severine; Cruz, Israel; Picado, Albert; Curto, María de Los Ángeles; Kubota, Yutaka; Wehrendt, Diana P; Pavia, Paula; Mori, Yasuyoshi; Puerta, Concepción; Ndung'u, Joseph M; Schijman, Alejandro G

2017-07-01

This study aimed to assess analytical parameters of a prototype LAMP kit that was designed for detection of Trypanosoma cruzi DNA in human blood. The prototype is based on the amplification of the highly repetitive satellite sequence of T.cruzi in microtubes containing dried reagents on the inside of the caps. The reaction is carried out at 65°C during 40 minutes. Calcein allows direct detection of amplified products with the naked eye. Inclusivity and selectivity were tested in purified DNA from Trypanosoma cruzi stocks belonging to the six discrete typing units (DTUs), in DNA from other protozoan parasites and in human DNA. Analytical sensitivity was estimated in serial dilutions of DNA samples from Sylvio X10 (Tc I) and CL Brener (Tc VI) stocks, as well as from EDTA-treated or heparinized blood samples spiked with known amounts of cultured epimastigotes (CL Brener). LAMP sensitivity was compared after DNA extraction using commercial fiberglass columns or after "Boil & Spin" rapid preparation. Moreover, the same DNA and EDTA-blood spiked samples were subjected to standardized qPCR based on the satellite DNA sequence for comparative purposes. A panel of peripheral blood specimens belonging to Chagas disease patients, including acute, congenital, chronic and reactivated cases (N = 23), as well as seronegative controls (N = 10) were evaluated by LAMP in comparison to qPCR. LAMP was able to amplify DNAs from T. cruzi stocks representative of the six DTUs, whereas it did not amplify DNAs from Leishmania sp, T. brucei sp, T. rangeli KPN+ and KPN-, P. falciparum and non-infected human DNA. Analytical sensitivity was 1x10-2 fg/μL of both CL Brener and Sylvio X10 DNAs, whereas qPCR detected up to 1x 10-1 fg/μL of CL Brener DNA and 1 fg/μl of Sylvio X10 DNA. LAMP detected 1x10-2 parasite equivalents/mL in spiked EDTA blood and 1x10-1 par.eq/mL in spiked heparinized blood using fiberglass columns for DNA extraction, whereas qPCR detected 1x10-2 par.eq./mL in EDTA blood. Boil & Spin extraction allowed detection of 1x10-2 par.eq /mL in spiked EDTA blood and 1 par.eq/ml in heparinized blood. LAMP was able to detect T.cruzi infection in peripheral blood samples collected from well-characterised seropositive patients, including acute, congenital, chronic and reactivated Chagas disease. To our knowledge, this is the first report of a prototype LAMP kit with appropriate analytical sensitivity for diagnosis of Chagas disease patients, and potentially useful for monitoring treatment response.

Analytical sensitivity and specificity of a loop-mediated isothermal amplification (LAMP) kit prototype for detection of Trypanosoma cruzi DNA in human blood samples

PubMed Central

Besuschio, Susana A.; Llano Murcia, Mónica; Benatar, Alejandro F.; Monnerat, Severine; Cruz, Israel; Picado, Albert; Curto, María de los Ángeles; Kubota, Yutaka; Wehrendt, Diana P.; Pavia, Paula; Mori, Yasuyoshi; Puerta, Concepción; Ndung'u, Joseph M.

2017-01-01

This study aimed to assess analytical parameters of a prototype LAMP kit that was designed for detection of Trypanosoma cruzi DNA in human blood. The prototype is based on the amplification of the highly repetitive satellite sequence of T.cruzi in microtubes containing dried reagents on the inside of the caps. The reaction is carried out at 65°C during 40 minutes. Calcein allows direct detection of amplified products with the naked eye. Inclusivity and selectivity were tested in purified DNA from Trypanosoma cruzi stocks belonging to the six discrete typing units (DTUs), in DNA from other protozoan parasites and in human DNA. Analytical sensitivity was estimated in serial dilutions of DNA samples from Sylvio X10 (Tc I) and CL Brener (Tc VI) stocks, as well as from EDTA-treated or heparinized blood samples spiked with known amounts of cultured epimastigotes (CL Brener). LAMP sensitivity was compared after DNA extraction using commercial fiberglass columns or after “Boil & Spin” rapid preparation. Moreover, the same DNA and EDTA-blood spiked samples were subjected to standardized qPCR based on the satellite DNA sequence for comparative purposes. A panel of peripheral blood specimens belonging to Chagas disease patients, including acute, congenital, chronic and reactivated cases (N = 23), as well as seronegative controls (N = 10) were evaluated by LAMP in comparison to qPCR. LAMP was able to amplify DNAs from T. cruzi stocks representative of the six DTUs, whereas it did not amplify DNAs from Leishmania sp, T. brucei sp, T. rangeli KPN+ and KPN-, P. falciparum and non-infected human DNA. Analytical sensitivity was 1x10-2 fg/μL of both CL Brener and Sylvio X10 DNAs, whereas qPCR detected up to 1x 10−1 fg/μL of CL Brener DNA and 1 fg/μl of Sylvio X10 DNA. LAMP detected 1x10-2 parasite equivalents/mL in spiked EDTA blood and 1x10-1 par.eq/mL in spiked heparinized blood using fiberglass columns for DNA extraction, whereas qPCR detected 1x10-2 par.eq./mL in EDTA blood. Boil & Spin extraction allowed detection of 1x10-2 par.eq /mL in spiked EDTA blood and 1 par.eq/ml in heparinized blood. LAMP was able to detect T.cruzi infection in peripheral blood samples collected from well-characterised seropositive patients, including acute, congenital, chronic and reactivated Chagas disease. To our knowledge, this is the first report of a prototype LAMP kit with appropriate analytical sensitivity for diagnosis of Chagas disease patients, and potentially useful for monitoring treatment response. PMID:28727723

A DNA-based pattern classifier with in vitro learning and associative recall for genomic characterization and biosensing without explicit sequence knowledge.

PubMed

Lee, Ju Seok; Chen, Junghuei; Deaton, Russell; Kim, Jin-Woo

2014-01-01

Genetic material extracted from in situ microbial communities has high promise as an indicator of biological system status. However, the challenge is to access genomic information from all organisms at the population or community scale to monitor the biosystem's state. Hence, there is a need for a better diagnostic tool that provides a holistic view of a biosystem's genomic status. Here, we introduce an in vitro methodology for genomic pattern classification of biological samples that taps large amounts of genetic information from all genes present and uses that information to detect changes in genomic patterns and classify them. We developed a biosensing protocol, termed Biological Memory, that has in vitro computational capabilities to "learn" and "store" genomic sequence information directly from genomic samples without knowledge of their explicit sequences, and that discovers differences in vitro between previously unknown inputs and learned memory molecules. The Memory protocol was designed and optimized based upon (1) common in vitro recombinant DNA operations using 20-base random probes, including polymerization, nuclease digestion, and magnetic bead separation, to capture a snapshot of the genomic state of a biological sample as a DNA memory and (2) the thermal stability of DNA duplexes between new input and the memory to detect similarities and differences. For efficient read out, a microarray was used as an output method. When the microarray-based Memory protocol was implemented to test its capability and sensitivity using genomic DNA from two model bacterial strains, i.e., Escherichia coli K12 and Bacillus subtilis, results indicate that the Memory protocol can "learn" input DNA, "recall" similar DNA, differentiate between dissimilar DNA, and detect relatively small concentration differences in samples. This study demonstrated not only the in vitro information processing capabilities of DNA, but also its promise as a genomic pattern classifier that could access information from all organisms in a biological system without explicit genomic information. The Memory protocol has high potential for many applications, including in situ biomonitoring of ecosystems, screening for diseases, biosensing of pathological features in water and food supplies, and non-biological information processing of memory devices, among many.

DNA methylation profiling for a confirmatory test for blood, saliva, semen, vaginal fluid and menstrual blood.

PubMed

Lee, Hwan Young; Jung, Sang-Eun; Lee, Eun Hee; Yang, Woo Ick; Shin, Kyoung-Jin

2016-09-01

The ability to predict the type of tissues or cells from molecular profiles of crime scene samples has important practical implications in forensics. A previously reported multiplex assay using DNA methylation markers could only discriminate between 4 types of body fluids: blood, saliva, semen, and the body fluid which originates from female reproductive organ. In the present study, we selected 15 menstrual blood-specific CpG marker candidates based on analysis of 12 genome-wide DNA methylation profiles of vaginal fluid and menstrual blood. The menstrual blood-specificity of the candidate markers was confirmed by comparison with HumanMethylation450 BeadChip array data obtained for 58 samples including 12 blood, 12 saliva, 12 semen, 3 vaginal fluid, and 19 skin epidermis samples. Among 15CpG marker candidates, 3 were located in the promoter region of the SLC26A10 gene, and 2 of them (cg09696411 and cg18069290) showed high menstrual blood specificity. DNA methylation at the 2CpG markers was further tested by targeted bisulfite sequencing of 461 additional samples including 49 blood, 52 saliva, 34 semen, 125 vaginal fluid, and 201 menstrual blood. Because the 2 markers showed menstrual blood-specific methylation patterns, we modified our previous multiplex methylation SNaPshot reaction to include these 2 markers. In addition, a blood marker cg01543184 with cross reactivity to semen was replaced with cg08792630, and a semen-specific unmethylation marker cg17621389 was removed. The resultant multiplex methylation SNaPshot allowed positive identification of blood, saliva, semen, vaginal fluid and menstrual blood using the 9CpG markers which show a methylation signal only in the target body fluids. Because of the complexity in cell composition, menstrual bloods produced DNA methylation profiles that vary with menstrual cycle and sample collection methods, which are expected to provide more insight into forensic menstrual blood test. Moreover, because the developed multiplex methylation SNaPshot reaction includes the 4CpG markers of which specificities have been confirmed by multiple studies, it will facilitate confirmatory tests for body fluids that are frequently observed in forensic casework. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Quantitation of DNA adducts by stable isotope dilution mass spectrometry

PubMed Central

Tretyakova, Natalia; Goggin, Melissa; Janis, Gregory

2012-01-01

Exposure to endogenous and exogenous chemicals can lead to the formation of structurally modified DNA bases (DNA adducts). If not repaired, these nucleobase lesions can cause polymerase errors during DNA replication, leading to heritable mutations potentially contributing to the development of cancer. Due to their critical role in cancer initiation, DNA adducts represent mechanism-based biomarkers of carcinogen exposure, and their quantitation is particularly useful for cancer risk assessment. DNA adducts are also valuable in mechanistic studies linking tumorigenic effects of environmental and industrial carcinogens to specific electrophilic species generated from their metabolism. While multiple experimental methodologies have been developed for DNA adduct analysis in biological samples – including immunoassay, HPLC, and 32P-postlabeling – isotope dilution high performance liquid chromatography-electrospray ionization-tandem mass spectrometry (HPLC-ESI-MS/MS) generally has superior selectivity, sensitivity, accuracy, and reproducibility. As typical DNA adducts concentrations in biological samples are between 0.01 – 10 adducts per 108 normal nucleotides, ultrasensitive HPLC-ESI-MS/MS methodologies are required for their analysis. Recent developments in analytical separations and biological mass spectrometry – especially nanoflow HPLC, nanospray ionization MS, chip-MS, and high resolution MS – have pushed the limits of analytical HPLC-ESI-MS/MS methodologies for DNA adducts, allowing researchers to accurately measure their concentrations in biological samples from patients treated with DNA alkylating drugs and in populations exposed to carcinogens from urban air, drinking water, cooked food, alcohol, and cigarette smoke. PMID:22827593

An instrument for automated purification of nucleic acids from contaminated forensic samples

PubMed Central

Broemeling, David J; Pel, Joel; Gunn, Dylan C; Mai, Laura; Thompson, Jason D; Poon, Hiron; Marziali, Andre

2008-01-01

Forensic crime scene sample analysis, by its nature, often deals with samples in which there are low amounts of nucleic acids, on substrates that often lead to inhibition of subsequent enzymatic reactions such as PCR amplification for STR profiling. Common substrates include denim from blue jeans, which yields indigo dye as a PCR inhibitor, and soil, which yields humic substances as inhibitors. These inhibitors frequently co-extract with nucleic acids in standard column or bead-based preps, leading to frequent failure of STR profiling. We present a novel instrument for DNA purification of forensic samples that is capable of highly effective concentration of nucleic acids from soil particulates, fabric, and other complex samples including solid components. The novel concentration process, known as SCODA, is inherently selective for long charged polymers such as DNA, and therefore is able to effectively reject known contaminants. We present an automated sample preparation instrument based on this process, and preliminary results based on mock forensic samples. PMID:18438455

An experimentally-informed coarse-grained 3-site-per-nucleotide model of DNA: Structure, thermodynamics, and dynamics of hybridization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hinckley, Daniel M.; Freeman, Gordon S.; Whitmer, Jonathan K.

2013-10-14

A new 3-Site-Per-Nucleotide coarse-grained model for DNA is presented. The model includes anisotropic potentials between bases involved in base stacking and base pair interactions that enable the description of relevant structural properties, including the major and minor grooves. In an improvement over available coarse-grained models, the correct persistence length is recovered for both ssDNA and dsDNA, allowing for simulation of non-canonical structures such as hairpins. DNA melting temperatures, measured for duplexes and hairpins by integrating over free energy surfaces generated using metadynamics simulations, are shown to be in quantitative agreement with experiment for a variety of sequences and conditions. Hybridizationmore » rate constants, calculated using forward-flux sampling, are also shown to be in good agreement with experiment. The coarse-grained model presented here is suitable for use in biological and engineering applications, including nucleosome positioning and DNA-templated engineering.« less

High throughput, multiplexed pathogen detection authenticates plague waves in medieval Venice, Italy.

PubMed

Tran, Thi-Nguyen-Ny; Signoli, Michel; Fozzati, Luigi; Aboudharam, Gérard; Raoult, Didier; Drancourt, Michel

2011-03-10

Historical records suggest that multiple burial sites from the 14th-16th centuries in Venice, Italy, were used during the Black Death and subsequent plague epidemics. High throughput, multiplexed real-time PCR detected DNA of seven highly transmissible pathogens in 173 dental pulp specimens collected from 46 graves. Bartonella quintana DNA was identified in five (2.9%) samples, including three from the 16th century and two from the 15th century, and Yersinia pestis DNA was detected in three (1.7%) samples, including two from the 14th century and one from the 16th century. Partial glpD gene sequencing indicated that the detected Y. pestis was the Orientalis biotype. These data document for the first time successive plague epidemics in the medieval European city where quarantine was first instituted in the 14th century.

Development of a 20-locus fluorescent multiplex system as a valuable tool for national DNA database.

PubMed

Jiang, Xianhua; Guo, Fei; Jia, Fei; Jin, Ping; Sun, Zhu

2013-02-01

The multiplex system allows the detection of 19 autosomal short tandem repeat (STR) loci [including all Combined DNA Index System (CODIS) STR loci as well as D2S1338, D6S1043, D12S391, D19S433, Penta D and Penta E] plus the sex-determining locus Amelogenin in a single reaction, comprising all STR loci in various commercial kits used in the China national DNA database (NDNAD). Primers are designed so that the amplicons are distributed ranging from 90 base pairs (bp) to 450 bp within a five-dye fluorescent design with the fifth dye reserved for the internal size standard. With 30 cycles, 125 pg to 2 ng DNA template showed optimal profiling result, while robust profiles could also be achieved by adjusting the cycle numbers for the DNA template beyond that optimal DNA input range. Mixture studies showed that 83% and 87% of minor alleles were detected at 9:1 and 1:9 ratios, respectively. When 4 ng of degraded DNA was digested by 2-min DNase and 1 ng undegraded DNA was added to 400 μM haematin, the complete profiles were still observed. Polymerase chain reaction (PCR)-based procedures were examined and optimized including the concentrations of primer set, magnesium and the Taq polymerase as well as volume, cycle number and annealing temperature. In addition, the system has been validated by 3000 bloodstain samples and 35 common case samples in line with the Chinese National Standards and Scientific Working Group on DNA Analysis Methods (SWGDAM) guidelines. The total probability of identity (TPI) can reach to 8×10(-24), where DNA database can be improved at the level of 10 million DNA profiles or more because the number of expected match is far from one person (4×10(-10)) and can be negligible. Further, our system also demonstrates its good performance in case samples and it will be an ideal tool for forensic DNA typing and databasing with potential application. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Validation of Roche LightCycler Epstein-Barr virus quantification reagents in a clinical laboratory setting.

PubMed

Gulley, Margaret L; Fan, Hongxin; Elmore, Sandra H

2006-11-01

Epstein-Barr virus (EBV) is associated with a wide range of benign and malignant diseases, including infectious mononucleosis, lymphoma, posttransplant lymphoproliferative disorder, and nasopharyngeal carcinoma. Measurement of EBV viral load in plasma is increasingly used for rapid assessment of disease status. We evaluated the performance characteristics of an EBV polymerase chain reaction assay that uses commercial reagents and instruments from Roche Diagnostics (Indianapolis, IN). DNA was extracted from plasma using a MagNaPure instrument, and viral load was measured by real-time polymerase chain reaction on a LightCycler. Analyte-specific reagents included primers and hybridization probes targeting the EBV LMP2 gene and a spiked control sequence. Accuracy and reproducibility were established using DNA from three cell lines. The assay was sensitive to approximately 750 copies of EBV DNA per milliliter of plasma and was linear across at least four orders of magnitude. The assay detected EBV DNA in three of five samples from nasopharyngeal carcinoma patients, seven of nine infectious mononucleosis samples, and 34/34 samples from immunosuppressed patients with clinically significant EBV-related disease, whereas EBV DNA was undetectable in plasma from 21 individuals without EBV-related disease. In conclusion, this LightCycler EBV assay is rapid, sensitive, and linear for quantifying EBV viral load. The assay appears to be useful for measuring clinically significant EBV levels in immunodeficient patients.

Microbiological Impact on Carbon Capture and Sequestration: Biotic Processes in Natural CO2 Analogue

EPA Science Inventory

Multiple ground-water based microbial community analyses including membrane lipids assays for phospholipid fatty acid and DNA analysis were performed from hydraulically isolated zones. DGGE results from DNA extracts from vertical profiling of the entire depth of aquifer sampled a...

Exploring microbial diversity in volcanic environments: a review of methods in DNA extraction.

PubMed

Herrera, Aude; Cockell, Charles S

2007-07-01

The last decade has been marked by a large number of studies focused on understanding the distribution of microorganisms in volcanic environments. These studies are motivated by the desire to elucidate how the geochemically extreme conditions of such environments can influence microbial diversity both on the surface and in the subsurface of the Earth. The exploration of microbial community diversity has generally not relied on culture-dependent methods, but has been carried out using environmental DNA extraction. Because of the large diversity of chemically and physically complex samples, extracting DNA from volcanic environments is technically challenging. In view of the emerging literature, and our own experience in the optimisation of methods for DNA extraction from volcanic materials, it is timely to provide a methodological comparison. This review highlights and discusses new insights and methods published on DNA extraction methods from volcanic samples, considering the different volcanic environments. A description of a recent method for DNA extraction from basalt and obsidian glass rock samples from Iceland is included. Finally, we discuss these approaches in the wider context of modern work to understand the microbial diversity of volcanic environments.

Diverse replication-associated protein encoding circular DNA viruses in guano samples of Central-Eastern European bats.

PubMed

Kemenesi, Gábor; Kurucz, Kornélia; Zana, Brigitta; Földes, Fanni; Urbán, Péter; Vlaschenko, Anton; Kravchenko, Kseniia; Budinski, Ivana; Szodoray-Parádi, Farkas; Bücs, Szilárd; Jére, Csaba; Csősz, István; Szodoray-Parádi, Abigél; Estók, Péter; Görföl, Tamás; Boldogh, Sándor; Jakab, Ferenc

2018-03-01

Circular replication-associated protein encoding single-stranded DNA (CRESS DNA) viruses are increasingly recognized worldwide in a variety of samples. Representative members include well-described veterinary pathogens with worldwide distribution, such as porcine circoviruses or beak and feather disease virus. In addition, numerous novel viruses belonging to the family Circoviridae with unverified pathogenic roles have been discovered in different human samples. Viruses of the family Genomoviridae have also been described as being highly abundant in different faecal and environmental samples, with case reports showing them to be suspected pathogens in human infections. In order to investigate the genetic diversity of these viruses in European bat populations, we tested guano samples from Georgia, Hungary, Romania, Serbia and Ukraine. This resulted in the detection of six novel members of the family Circoviridae and two novel members of the family Genomoviridae. Interestingly, a gemini-like virus, namely niminivirus, which was originally found in raw sewage samples in Nigeria, was also detected in our samples. We analyzed the nucleotide composition of members of the family Circoviridae to determine the possible host origins of these viruses. This study provides the first dataset on CRESS DNA viruses of European bats, and members of several novel viral species were discovered.

Protocol for the use of a rapid real-time PCR method for the detection of HIV-1 proviral DNA using double-stranded primer.

PubMed

Pau, Chou-Pong; Wells, Susan K; Granade, Timothy C

2012-01-01

This chapter describes a real-time PCR method for the detection of HIV-1 proviral DNA in whole blood samples using a novel double-stranded primer system. The assay utilizes a simple commercially available DNA extraction method and a rapid and easy-to-perform real-time PCR protocol to consistently detect a minimum of four copies of HIV-1 group M proviral DNA in as little as 90 min after sample (whole blood) collection. Co-amplification of the human RNase P gene serves as an internal control to monitor the efficiency of both the DNA extraction and amplification. Once the assay is validated properly, it may be suitable as an alternative confirmation test for HIV-1 infections in a variety of HIV testing venues including the mother-to-child transmission testing sites, clinics, and diagnostic testing centers.

The presence of human papillomavirus in semen does not affect the integrity of sperm DNA.

PubMed

Cortés-Gutiérrez, E I; Dávila-Rodríguez, M I; Fernández, J L; de la O-Pérez, L O; Garza-Flores, M E; Eguren-Garza, R; Gosálvez, J

2017-12-01

It remains unknown whether human papillomaviruses (HPVs) in semen affect sperm DNA integrity. We investigated whether the presence of these viruses in semen was associated with an elevated sperm DNA fragmentation index. Semen samples of 22 normozoospermic patients undergoing infertility treatment, nine fertile donors and seven fertile men with a risk of HPV infection (genital warts or condylomas) were included in the study. The samples were examined by an INNO-LiPA test PCR-based reverse hybridisation array that identifies 28 types of HPVs as simple or multiple infections. Sperm DNA integrity was determined by sperm chromatin dispersion assay (SCD). Our preliminary findings demonstrate an increase in HPV infection in infertile men with respect to fertile men. However, the sperm DNA fragmentation index was not increased in semen containing these viruses. © 2017 Blackwell Verlag GmbH.

Environmental DNA (eDNA) detects the invasive rusty crayfish Orconectes rusticus at low abundances.

PubMed

Dougherty, Matthew M; Larson, Eric R; Renshaw, Mark A; Gantz, Crysta A; Egan, Scott P; Erickson, Daniel M; Lodge, David M

2016-06-01

Early detection is invaluable for the cost-effective control and eradication of invasive species, yet many traditional sampling techniques are ineffective at the low population abundances found at the onset of the invasion process. Environmental DNA (eDNA) is a promising and sensitive tool for early detection of some invasive species, but its efficacy has not yet been evaluated for many taxonomic groups and habitat types.We evaluated the ability of eDNA to detect the invasive rusty crayfish Orconectes rusticus and to reflect patterns of its relative abundance, in upper Midwest, USA, inland lakes. We paired conventional baited trapping as a measure of crayfish relative abundance with water samples for eDNA, which were analysed in the laboratory with a qPCR assay. We modelled detection probability for O. rusticus eDNA using relative abundance and site characteristics as covariates and also tested the relationship between eDNA copy number and O. rusticus relative abundance.We detected O. rusticus eDNA in all lakes where this species was collected by trapping, down to low relative abundances, as well as in two lakes where trap catch was zero. Detection probability of O. rusticus eDNA was well predicted by relative abundance of this species and lake water clarity. However, there was poor correspondence between eDNA copy number and O. rusticus relative abundance estimated by trap catches. Synthesis and applications . Our study demonstrates a field and laboratory protocol for eDNA monitoring of crayfish invasions, with results of statistical models that provide guidance of sampling effort and detection probabilities for researchers in other regions and systems. We propose eDNA be included as a tool in surveillance for invasive or imperilled crayfishes and other benthic arthropods.

Development and evaluation of specific PCR primers targeting the ribosomal DNA-internal transcribed spacer (ITS) region of peritrich ciliates in environmental samples

NASA Astrophysics Data System (ADS)

Su, Lei; Zhang, Qianqian; Gong, Jun

2017-07-01

Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.

The Israel DNA database--the establishment of a rapid, semi-automated analysis system.

PubMed

Zamir, Ashira; Dell'Ariccia-Carmon, Aviva; Zaken, Neomi; Oz, Carla

2012-03-01

The Israel Police DNA database, also known as IPDIS (Israel Police DNA Index System), has been operating since February 2007. During that time more than 135,000 reference samples have been uploaded and more than 2000 hits reported. We have developed an effective semi-automated system that includes two automated punchers, three liquid handler robots and four genetic analyzers. An inhouse LIMS program enables full tracking of every sample through the entire process of registration, pre-PCR handling, analysis of profiles, uploading to the database, hit reports and ultimately storage. The LIMS is also responsible for the future tracking of samples and their profiles to be expunged from the database according to the Israeli DNA legislation. The database is administered by an in-house developed software program, where reference and evidentiary profiles are uploaded, stored, searched and matched. The DNA database has proven to be an effective investigative tool which has gained the confidence of the Israeli public and on which the Israel National Police force has grown to rely. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

The use of environmental DNA in invasive species surveillance of the Great Lakes commercial bait trade.

PubMed

Nathan, Lucas R; Jerde, Christopher L; Budny, Michelle L; Mahon, Andrew R

2015-04-01

Over 180 non-native species have been introduced in the Laurentian Great Lakes region, many posing threats to native species and ecosystem functioning. One potential pathway for introductions is the commercial bait trade; unknowing or unconcerned anglers commonly release unused bait into aquatic systems. Previous surveillance efforts of this pathway relied on visual inspection of bait stocks in retail shops, which can be time and cost prohibitive and requires a trained individual that can rapidly and accurately identify cryptic species. Environmental DNA (eDNA) surveillance, a molecular tool that has been used for surveillance in aquatic environments, can be used to efficiently detect species at low abundances. We collected and analyzed 576 eDNA samples from 525 retail bait shops throughout the Laurentian Great Lake states. We used eDNA techniques to screen samples for multiple aquatic invasive species (AIS) that could be transported in the bait trade, including bighead (Hypophthalmichthys nobilis) and silver carp (H. molitrix), round goby (Neogobius melanostomus), tubenose goby (Proterorhinus marmoratus), Eurasian rudd (Scardinius erythrophthalmus), and goldfish (Carassius auratus). Twenty-seven samples were positive for at least one target species (4.7% of samples), and all target species were found at least once, except bighead carp. Despite current regulations, the bait trade remains a potential pathway for invasive species introductions in the Great Lakes region. Alterations to existing management strategies regarding the collection, transportation, and use of live bait are warranted, including new and updated regulations, to prevent future introductions of invasive species in the Great Lakes via the bait trade. © 2014 Society for Conservation Biology.

Simulated rRNA/DNA Ratios Show Potential To Misclassify Active Populations as Dormant

DOE Office of Scientific and Technical Information (OSTI.GOV)

Steven, Blaire; Hesse, Cedar; Soghigian, John

The use of rRNA/DNA ratios derived from surveys of rRNA sequences in RNA and DNA extracts is an appealing but poorly validated approach to infer the activity status of environmental microbes. To improve the interpretation of rRNA/DNA ratios, we performed simulations to investigate the effects of community structure, rRNA amplification, and sampling depth on the accuracy of rRNA/DNA ratios in classifying bacterial populations as “active” or “dormant.” Community structure was an insignificant factor. In contrast, the extent of rRNA amplification that occurs as cells transition from dormant to growing had a significant effect (P < 0.0001) on classification accuracy, withmore » misclassification errors ranging from 16 to 28%, depending on the rRNA amplification model. The error rate increased to 47% when communities included a mixture of rRNA amplification models, but most of the inflated error was false negatives (i.e., active populations misclassified as dormant). Sampling depth also affected error rates (P < 0.001). Inadequate sampling depth produced various artifacts that are characteristic of rRNA/DNA ratios generated from real communities. These data show important constraints on the use of rRNA/DNA ratios to infer activity status. Whereas classification of populations as active based on rRNA/DNA ratios appears generally valid, classification of populations as dormant is potentially far less accurate.« less

Direct detection of Marek's disease virus in poultry dust by loop-mediated isothermal amplification.

PubMed

Woźniakowski, Grzegorz; Samorek-Salamonowicz, Elżbieta

2014-11-01

Marek's disease virus (MDV) is a serious concern for poultry production and represents a unique herpesvirus model. MDV can be shed by doubly infected chickens despite vaccination. The fully infectious MDV particles are produced in the feather follicle epithelium (FFE), and MDV remains infectious for many months in fine skin particles and feather debris. Molecular biology methods including PCR and real-time PCR have been shown to be valuable for the detection of MDV DNA in farm dust. Recently, loop-mediated isothermal amplification (LAMP) was found to be useful in the detection of MDV in feathers and internal organs of infected chickens. LAMP is also less affected by the inhibitors present in DNA samples. Taking into account the advantages of LAMP, direct detection of MDV DNA in poultry dust has been conducted in this research. The detection of MDV DNA was possible in 11 out of the 12 examined dust samples without DNA extraction. The DNA was retrieved from dust samples by dilution and incubation at 95 °C for 5 min. The direct detection of MDV DNA in the dust was possible within 30 min using a water bath and UV light. The results were confirmed by electrophoresis and melting curve analysis of the LAMP products. Our results show that LAMP may be used to test for the presence of virulent MDV in poultry farm dust without DNA extraction.

Simulated rRNA/DNA Ratios Show Potential To Misclassify Active Populations as Dormant

DOE PAGES

Steven, Blaire; Hesse, Cedar; Soghigian, John; ...

2017-03-31

The use of rRNA/DNA ratios derived from surveys of rRNA sequences in RNA and DNA extracts is an appealing but poorly validated approach to infer the activity status of environmental microbes. To improve the interpretation of rRNA/DNA ratios, we performed simulations to investigate the effects of community structure, rRNA amplification, and sampling depth on the accuracy of rRNA/DNA ratios in classifying bacterial populations as “active” or “dormant.” Community structure was an insignificant factor. In contrast, the extent of rRNA amplification that occurs as cells transition from dormant to growing had a significant effect (P < 0.0001) on classification accuracy, withmore » misclassification errors ranging from 16 to 28%, depending on the rRNA amplification model. The error rate increased to 47% when communities included a mixture of rRNA amplification models, but most of the inflated error was false negatives (i.e., active populations misclassified as dormant). Sampling depth also affected error rates (P < 0.001). Inadequate sampling depth produced various artifacts that are characteristic of rRNA/DNA ratios generated from real communities. These data show important constraints on the use of rRNA/DNA ratios to infer activity status. Whereas classification of populations as active based on rRNA/DNA ratios appears generally valid, classification of populations as dormant is potentially far less accurate.« less

Data in support of the detection of genetically modified organisms (GMOs) in food and feed samples.

PubMed

Alasaad, Noor; Alzubi, Hussein; Kader, Ahmad Abdul

2016-06-01

Food and feed samples were randomly collected from different sources, including local and imported materials from the Syrian local market. These included maize, barley, soybean, fresh food samples and raw material. GMO detection was conducted by PCR and nested PCR-based techniques using specific primers for the most used foreign DNA commonly used in genetic transformation procedures, i.e., 35S promoter, T-nos, epsps, cryIA(b) gene and nptII gene. The results revealed for the first time in Syria the presence of GM foods and feeds with glyphosate-resistant trait of P35S promoter and NOS terminator in the imported soybean samples with high frequency (5 out of the 6 imported soybean samples). While, tests showed negative results for the local samples. Also, tests revealed existence of GMOs in two imported maize samples detecting the presence of 35S promoter and nos terminator. Nested PCR results using two sets of primers confirmed our data. The methods applied in the brief data are based on DNA analysis by Polymerase Chain Reaction (PCR). This technique is specific, practical, reproducible and sensitive enough to detect up to 0.1% GMO in food and/or feedstuffs. Furthermore, all of the techniques mentioned are economic and can be applied in Syria and other developing countries. For all these reasons, the DNA-based analysis methods were chosen and preferred over protein-based analysis.

Assessment of the Authenticity of Herbal Dietary Supplements: Comparison of Chemical and DNA Barcoding Methods.

PubMed

Pawar, Rahul S; Handy, Sara M; Cheng, Raymond; Shyong, Nicole; Grundel, Erich

2017-07-01

About 7 % of the U. S. population reports using botanical dietary supplements. Increased use of such supplements has led to discussions related to their authenticity and quality. Reports of adulteration with substandard materials or pharmaceuticals are of concern because such substitutions, whether inadvertent or deliberate, may reduce the efficacy of specific botanicals or lead to adverse events. Methods for verifying the identity of botanicals include macroscopic and microscopic examinations, chemical analysis, and DNA-based methods including DNA barcoding. Macroscopic and microscopic examinations may fail when a supplement consists of botanicals that have been processed beyond the ability to provide morphological characterizations. Chemical analysis of specific marker compounds encounters problems when these compounds are not distinct to a given species or when purified reference standards are not available. Recent investigations describing DNA barcoding analysis of botanical dietary supplements have raised concerns about the authenticity of the supplements themselves as well as the appropriateness of using DNA barcoding techniques with finished botanical products. We collected 112 market samples of frequently consumed botanical dietary supplements of ginkgo, soy, valerian, yohimbe, and St. John's wort and analyzed each for specific chemical markers (i.e., flavonol glycosides, total isoflavones, total valerenic acids, yohimbine, and hypericins, respectively). We used traditional DNA barcoding techniques targeting the nuclear ITS2 gene and the chloroplast gene psb A- trn H on the same samples to determine the presence of DNA of the labelled ingredient. We compared the results obtained by both methods to assess the contribution of each in determining the identity of the samples. Georg Thieme Verlag KG Stuttgart · New York.

Simple and Reliable Method to Quantify the Hepatitis B Viral Load and Replicative Capacity in Liver Tissue and Blood Leukocytes

PubMed Central

Minosse, Claudia; Coen, Sabrina; Visco Comandini, Ubaldo; Lionetti, Raffaella; Montalbano, Marzia; Cerilli, Stefano; Vincenti, Donatella; Baiocchini, Andrea; Capobianchi, Maria R.; Menzo, Stefano

2016-01-01

Background A functional cure of chronic hepatitis B (CHB) is feasible, but a clear view of the intrahepatic viral dynamics in each patient is needed. Intrahepatic covalently closed circular DNA (cccDNA) is the stable form of the viral genome in infected cells, and represents the ideal marker of parenchymal colonization. Its relationships with easily accessible peripheral parameters need to be elucidated in order to avoid invasive procedures in patients. Objectives The goal of this study was to design, set up, and validate a reliable and straightforward method for the quantification of the cccDNA and total DNA of the hepatitis B virus (HBV) in a variety of clinical samples. Patients and Methods Clinical samples from a cohort of CHB patients, including liver biopsies in some, were collected for the analysis of intracellular HBV molecular markers using novel molecular assays. Results A plasmid construct, including sequences from the HBV genome and from the human gene hTERT, was generated as an isomolar multi-standard for HBV quantitation and normalization to the cellular contents. The specificity of the real-time assay for the cccDNA was assessed using Dane particles isolated on a density gradient. A comparison of liver tissue from 6 untreated and 6 treated patients showed that the treatment deeply reduced the replicative capacity (total DNA/cccDNA), but had limited impact on the parenchymal colonization. The peripheral blood mononuclear cells (PBMCs) and granulocytes from the treated and untreated patients were also analyzed. Conclusions A straightforward method for the quantification of intracellular HBV molecular parameters in clinical samples was developed and validated. The widespread use of such versatile assays could better define the prognosis of CHB, and allow a more rational approach to time-limited tailored treatment strategies. PMID:27882060

The effect of swim-up and gradient sperm preparation techniques on deoxyribonucleic acid (DNA) fragmentation in subfertile patients.

PubMed

Oguz, Yuksel; Guler, Ismail; Erdem, Ahmet; Mutlu, Mehmet Firat; Gumuslu, Seyhan; Oktem, Mesut; Bozkurt, Nuray; Erdem, Mehmet

2018-03-23

To compare the effect of two different sperm preparation techniques, including swim-up and gradient methods on sperm deoxyribonucleic acid (DNA) fragmentation status of semen samples from unexplained and mild male factor subfertile patients undergoing intrauterine insemination (IUI). A prospective randomized study was conducted in 65 subfertile patients, including 34 unexplained and 31 male factor infertility to compare basal and post-procedure DNA fragmentation rates in swim-up and gradient techniques. Sperm DNA fragmentation rates were evaluated by a sperm chromatin dispersion (SCD) test in two portions of each sample of semen that was prepared with either swim-up or gradient techniques. Sperm motility and morphology were also assessed based on WHO 2010 criteria. Swim-up but not gradient method yielded a statistically significant reduction in the DNA fragmented sperm rate after preparation as compared to basal rates, in the semen samples of both unexplained (41.85 ± 22.04 vs. 28.58 ± 21.93, p < 0.001 for swim-up; and 41.85 ± 22.04 vs. 38.79 ± 22.30, p = 0.160 for gradient) and mild male factor (46.61 ± 19.38 vs. 30.32 ± 18.20, p < 0.001 for swim-up and 46.61 ± 19.38 vs. 44.03 ± 20.87, p = 0.470 for gradient) subgroups. Swim-up method significantly reduces sperm DNA fragmentation rates and may have some prognostic value on intrauterine insemination in patients with decreased sperm DNA integrity.

Integrating DNA-based data into bioassessments improves ...

EPA Pesticide Factsheets

The integration of DNA-based identification methods into bioassessments could result in more accurate representations of species distributions and species-habitat relationships. DNA-based approaches may be particularly informative for tracking the distributions of rare and/or invasive species that can comprise a small proportion of samples or are difficult to identify morphologically. In 2012 and 2013, we used a combination of morphological and DNA-based methods (meta-barcoding) to identify fish eggs and larvae collected in the St. Louis River estuary area, Minnesota. We found a large proportion of cases where a lack of agreement occurred between species identified at a site using morphological versus DNA identification, prompting a discussion of how to best reconcile these differences. Choices made during sampling collection, DNA amplification/extraction, and bioinformatics processing influence the DNA-morphology match. The distribution of some species (including several invasives) and their relationships to habitat changed after DNA-data was incorporated. Results highlight how incorporating of DNA-data may get us closer to the “truth”, which has large ramifications in the search for rare species and when understanding the environmental drivers of species distributions is important for management. not applicable

How-to-Do-It. An Exercise in Gene Mapping.

ERIC Educational Resources Information Center

Seidel-Rogol, Bonnie L.

1990-01-01

Described is a laboratory exercise designed to introduce students to the theory and practice of gene mapping including RNA extraction, sucrose density gradient centrifugation, labelling of nucleic acids in vitro, DNA extraction, digestion of DNA with restriction enzymes, and the southern hybridization analysis. Procedures and sample results are…

28 CFR 28.12 - Collection of DNA samples.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Collection of DNA samples. 28.12 Section 28.12 Judicial Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM DNA Sample Collection, Analysis, and Indexing § 28.12 Collection of DNA samples. (a) The Bureau of Prisons shall collect a DNA...

28 CFR 28.12 - Collection of DNA samples.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 28 Judicial Administration 1 2011-07-01 2011-07-01 false Collection of DNA samples. 28.12 Section 28.12 Judicial Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM DNA Sample Collection, Analysis, and Indexing § 28.12 Collection of DNA samples. (a) The Bureau of Prisons shall collect a DNA...

28 CFR 28.12 - Collection of DNA samples.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 28 Judicial Administration 1 2012-07-01 2012-07-01 false Collection of DNA samples. 28.12 Section 28.12 Judicial Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM DNA Sample Collection, Analysis, and Indexing § 28.12 Collection of DNA samples. (a) The Bureau of Prisons shall collect a DNA...

28 CFR 28.12 - Collection of DNA samples.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 28 Judicial Administration 1 2014-07-01 2014-07-01 false Collection of DNA samples. 28.12 Section 28.12 Judicial Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM DNA Sample Collection, Analysis, and Indexing § 28.12 Collection of DNA samples. (a) The Bureau of Prisons shall collect a DNA...

28 CFR 28.12 - Collection of DNA samples.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 28 Judicial Administration 1 2013-07-01 2013-07-01 false Collection of DNA samples. 28.12 Section 28.12 Judicial Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM DNA Sample Collection, Analysis, and Indexing § 28.12 Collection of DNA samples. (a) The Bureau of Prisons shall collect a DNA...

No impact of strongylid infections on the detection of Plasmodium spp. in faeces of western lowland gorillas and eastern chimpanzees.

PubMed

Mapua, Mwanahamisi I; Pafčo, Barbora; Burgunder, Jade; Profousová-Pšenková, Ilona; Todd, Angelique; Hashimoto, Chie; Qablan, Moneeb A; Modrý, David; Petrželková, Klára J

2017-04-26

Although a high genetic diversity of Plasmodium spp. circulating in great apes has been revealed recently due to non-invasive methods enabling detection in faecal samples, little is known about the actual mechanisms underlying the presence of Plasmodium DNA in faeces. Great apes are commonly infected by strongylid nematodes, including hookworms, which cause intestinal bleeding. The impact of strongylid infections on the detection of Plasmodium DNA in faeces was assessed in wild, western, lowland gorillas from Dzanga Sangha Protected Areas, Central African Republic and eastern chimpanzees from Kalinzu Forest Reserve, Uganda. Fifty-one faecal samples from 22 habituated gorillas and 74 samples from 15 habituated chimpanzees were analysed using Cytochrome-b PCR assay and coprological methods. Overall, 26.4% of the analysed samples were positive for both Plasmodium spp. and strongylids. However, the results showed no significant impact of intensity of infections of strongylids on detection of Plasmodium DNA in gorilla and chimpanzee faeces. Bleeding caused by strongylid nematode Necator spp. cannot explain the presence of Plasmodium DNA in ape faeces.

Evaluating sampling strategy for DNA barcoding study of coastal and inland halo-tolerant Poaceae and Chenopodiaceae: A case study for increased sample size

PubMed Central

Yao, Peng-Cheng; Gao, Hai-Yan; Wei, Ya-Nan; Zhang, Jian-Hang; Chen, Xiao-Yong

2017-01-01

Environmental conditions in coastal salt marsh habitats have led to the development of specialist genetic adaptations. We evaluated six DNA barcode loci of the 53 species of Poaceae and 15 species of Chenopodiaceae from China's coastal salt marsh area and inland area. Our results indicate that the optimum DNA barcode was ITS for coastal salt-tolerant Poaceae and matK for the Chenopodiaceae. Sampling strategies for ten common species of Poaceae and Chenopodiaceae were analyzed according to optimum barcode. We found that by increasing the number of samples collected from the coastal salt marsh area on the basis of inland samples, the number of haplotypes of Arundinella hirta, Digitaria ciliaris, Eleusine indica, Imperata cylindrica, Setaria viridis, and Chenopodium glaucum increased, with a principal coordinate plot clearly showing increased distribution points. The results of a Mann-Whitney test showed that for Digitaria ciliaris, Eleusine indica, Imperata cylindrica, and Setaria viridis, the distribution of intraspecific genetic distances was significantly different when samples from the coastal salt marsh area were included (P < 0.01). These results suggest that increasing the sample size in specialist habitats can improve measurements of intraspecific genetic diversity, and will have a positive effect on the application of the DNA barcodes in widely distributed species. The results of random sampling showed that when sample size reached 11 for Chloris virgata, Chenopodium glaucum, and Dysphania ambrosioides, 13 for Setaria viridis, and 15 for Eleusine indica, Imperata cylindrica and Chenopodium album, average intraspecific distance tended to reach stability. These results indicate that the sample size for DNA barcode of globally distributed species should be increased to 11–15. PMID:28934362

Evaluating sampling strategy for DNA barcoding study of coastal and inland halo-tolerant Poaceae and Chenopodiaceae: A case study for increased sample size.

PubMed

Yao, Peng-Cheng; Gao, Hai-Yan; Wei, Ya-Nan; Zhang, Jian-Hang; Chen, Xiao-Yong; Li, Hong-Qing

2017-01-01

Environmental conditions in coastal salt marsh habitats have led to the development of specialist genetic adaptations. We evaluated six DNA barcode loci of the 53 species of Poaceae and 15 species of Chenopodiaceae from China's coastal salt marsh area and inland area. Our results indicate that the optimum DNA barcode was ITS for coastal salt-tolerant Poaceae and matK for the Chenopodiaceae. Sampling strategies for ten common species of Poaceae and Chenopodiaceae were analyzed according to optimum barcode. We found that by increasing the number of samples collected from the coastal salt marsh area on the basis of inland samples, the number of haplotypes of Arundinella hirta, Digitaria ciliaris, Eleusine indica, Imperata cylindrica, Setaria viridis, and Chenopodium glaucum increased, with a principal coordinate plot clearly showing increased distribution points. The results of a Mann-Whitney test showed that for Digitaria ciliaris, Eleusine indica, Imperata cylindrica, and Setaria viridis, the distribution of intraspecific genetic distances was significantly different when samples from the coastal salt marsh area were included (P < 0.01). These results suggest that increasing the sample size in specialist habitats can improve measurements of intraspecific genetic diversity, and will have a positive effect on the application of the DNA barcodes in widely distributed species. The results of random sampling showed that when sample size reached 11 for Chloris virgata, Chenopodium glaucum, and Dysphania ambrosioides, 13 for Setaria viridis, and 15 for Eleusine indica, Imperata cylindrica and Chenopodium album, average intraspecific distance tended to reach stability. These results indicate that the sample size for DNA barcode of globally distributed species should be increased to 11-15.

Genotyping of Plant and Animal Samples without Prior DNA Purification

PubMed Central

Chum, Pak Y.; Haimes, Josh D.; André, Chas P.; Kuusisto, Pia K.; Kelley, Melissa L.

2012-01-01

The Direct PCR approach facilitates PCR amplification directly from small amounts of unpurified samples, and is demonstrated here for several plant and animal tissues (Figure 1). Direct PCR is based on specially engineered Thermo Scientific Phusion and Phire DNA Polymerases, which include a double-stranded DNA binding domain that gives them unique properties such as high tolerance of inhibitors. PCR-based target DNA detection has numerous applications in plant research, including plant genotype analysis and verification of transgenes. PCR from plant tissues traditionally involves an initial DNA isolation step, which may require expensive or toxic reagents. The process is time consuming and increases the risk of cross contamination1, 2. Conversely, by using Thermo Scientific Phire Plant Direct PCR Kit the target DNA can be easily detected, without prior DNA extraction. In the model demonstrated here, an example of derived cleaved amplified polymorphic sequence analysis (dCAPS)3,4 is performed directly from Arabidopsis plant leaves. dCAPS genotyping assays can be used to identify single nucleotide polymorphisms (SNPs) by SNP allele-specific restriction endonuclease digestion3. Some plant samples tend to be more challenging when using Direct PCR methods as they contain components that interfere with PCR, such as phenolic compounds. In these cases, an additional step to remove the compounds is traditionally required2,5. Here, this problem is overcome by using a quick and easy dilution protocol followed by Direct PCR amplification (Figure 1). Fifteen year-old oak leaves are used as a model for challenging plants as the specimen contains high amounts of phenolic compounds including tannins. Gene transfer into mice is broadly used to study the roles of genes in development, physiology and human disease. The use of these animals requires screening for the presence of the transgene, usually with PCR. Traditionally, this involves a time consuming DNA isolation step, during which DNA for PCR analysis is purified from ear, tail or toe tissues6,7. However, with the Thermo Scientific Phire Animal Tissue Direct PCR Kit transgenic mice can be genotyped without prior DNA purification. In this protocol transgenic mouse genotyping is achieved directly from mouse ear tissues, as demonstrated here for a challenging example where only one primer set is used for amplification of two fragments differing greatly in size. PMID:23051689

Forensic DNA typing from teeth using demineralized root tips.

PubMed

Corrêa, Heitor Simões Dutra; Pedro, Fabio Luis Miranda; Volpato, Luiz Evaristo Ricci; Pereira, Thiago Machado; Siebert Filho, Gilberto; Borges, Álvaro Henrique

2017-11-01

Teeth are widely used samples in forensic human genetic identification due to their persistence and practical sampling and processing. Their processing, however, has changed very little in the last 20 years, usually including powdering or pulverization of the tooth. The objective of this study was to present demineralized root tips as DNA sources while, at the same time, not involving powdering the samples or expensive equipment for teeth processing. One to five teeth from each of 20 unidentified human bodies recovered from midwest Brazil were analyzed. Whole teeth were demineralized in EDTA solution with daily solution change. After a maximum of approximately seven days, the final millimeters of the root tip was excised. This portion of the sample was used for DNA extraction through a conventional organic protocol. DNA quantification and STR amplification were performed using commercial kits followed by capillary electrophoresis on 3130 or 3500 genetic analyzers. For 60% of the unidentified bodies (12 of 20), a full genetic profile was obtained from the extraction of the first root tip. By the end of the analyses, full genetic profiles were obtained for 85% of the individuals studied, of which 80% were positively identified. This alternative low-tech approach for postmortem teeth processing is capable of extracting DNA in sufficient quantity and quality for forensic casework, showing that root tips are viable nuclear DNA sources even after demineralization. Copyright © 2017 Elsevier B.V. All rights reserved.

DNA extraction protocols cause differences in 16S rRNA amplicon sequencing efficiency but not in community profile composition or structure

DOE PAGES

None

2014-12-01

The recent development of methods applying next-generation sequencing to microbial community characterization has led to the proliferation of these studies in a wide variety of sample types. Yet, variation in the physical properties of environmental samples demands that optimal DNA extraction techniques be explored for each new environment. The microbiota associated with many species of insects offer an extraction challenge as they are frequently surrounded by an armored exoskeleton, inhibiting disruption of the tissues within. In this study, we examine the efficacy of several commonly used protocols for extracting bacterial DNA from ants. While bacterial community composition recovered using Illuminamore » 16S rRNA amplicon sequencing was not detectably biased by any method, the quantity of bacterial DNA varied drastically, reducing the number of samples that could be amplified and sequenced. These results indicate that the concentration necessary for dependable sequencing is around 10,000 copies of target DNA per microliter. Exoskeletal pulverization and tissue digestion increased the reliability of extractions, suggesting that these steps should be included in any study of insect-associated microorganisms that relies on obtaining microbial DNA from intact body segments. Although laboratory and analysis techniques should be standardized across diverse sample types as much as possible, minimal modifications such as these will increase the number of environments in which bacterial communities can be successfully studied.« less

Analysis of DNA methylation in FFPE tissues using the MethyLight technology.

PubMed

Dallol, Ashraf; Al-Ali, Waleed; Al-Shaibani, Amina; Al-Mulla, Fahd

2011-01-01

Novel biomarkers are sought after by mining DNA extracted from formalin-fixed, paraffin-embedded (FFPE) tissues. Such tissues offer the great advantage of often having complete clinical data (including survival), as well as the tissues are amenable for laser microdissection targeting specific tissue areas. Downstream analysis of such DNA includes mutational screens and methylation profiling. Screening for mutations by sequencing requires a significant amount of DNA for PCR and cycle sequencing. This is self-inhibitory if the gene screened has a large number of exons. Profiling DNA methylation using the MethyLight technology circumvents this problem and allows for the mining of several biomarkers from DNA extracted from a single microscope slide of the tissue of interest. We describe in this chapter a detailed protocol for MethyLight and its use in the determination of CpG Island Methylator Phenotype status in FFPE colorectal cancer samples.

Novel approach for the simultaneous detection of DNA from different fish species based on a nuclear target: quantification potential.

PubMed

Prado, Marta; Boix, Ana; von Holst, Christoph

2012-07-01

The development of DNA-based methods for the identification and quantification of fish in food and feed samples is frequently focused on a specific fish species and/or on the detection of mitochondrial DNA of fish origin. However, a quantitative method for the most common fish species used by the food and feed industry is needed for official control purposes, and such a method should rely on the use of a single-copy nuclear DNA target owing to its more stable copy number in different tissues. In this article, we report on the development of a real-time PCR method based on the use of a nuclear gene as a target for the simultaneous detection of fish DNA from different species and on the evaluation of its quantification potential. The method was tested in 22 different fish species, including those most commonly used by the food and feed industry, and in negative control samples, which included 15 animal species and nine feed ingredients. The results show that the method reported here complies with the requirements concerning specificity and with the criteria required for real-time PCR methods with high sensitivity.

Microfluidic integration of parallel solid-phase liquid chromatography.

PubMed

Huft, Jens; Haynes, Charles A; Hansen, Carl L

2013-03-05

We report the development of a fully integrated microfluidic chromatography system based on a recently developed column geometry that allows for robust packing of high-performance separation columns in poly(dimethylsiloxane) microfluidic devices having integrated valves made by multilayer soft lithography (MSL). The combination of parallel high-performance separation columns and on-chip plumbing was used to achieve a fully integrated system for on-chip chromatography, including all steps of automated sample loading, programmable gradient generation, separation, fluorescent detection, and sample recovery. We demonstrate this system in the separation of fluorescently labeled DNA and parallel purification of reverse transcription polymerase chain reaction (RT-PCR) amplified variable regions of mouse immunoglobulin genes using a strong anion exchange (AEX) resin. Parallel sample recovery in an immiscible oil stream offers the advantage of low sample dilution and high recovery rates. The ability to perform nucleic acid size selection and recovery on subnanogram samples of DNA holds promise for on-chip genomics applications including sequencing library preparation, cloning, and sample fractionation for diagnostics.

Molecular species identification with rich floristic sampling: DNA barcoding the pteridophyte flora of Japan.

PubMed

Ebihara, Atsushi; Nitta, Joel H; Ito, Motomi

2010-12-08

DNA barcoding is expected to be an effective identification tool for organisms with heteromorphic generations such as pteridophytes, which possess a morphologically simple gametophyte generation. Although a reference data set including complete coverage of the target local flora/fauna is necessary for accurate identification, DNA barcode studies including such rich taxonomic sampling on a countrywide scale are lacking. The Japanese pteridophyte flora (733 taxa including subspecies and varieties) was used to test the utility of two plastid DNA barcode regions (rbcL and trnH-psbA) with the intention of developing an identification system for native gametophytes. DNA sequences were obtained from each of 689 (94.0%) taxa for rbcL and 617 (84.2%) taxa for trnH-psbA. Mean interspecific divergence values across all taxon pairs (K2P genetic distances) did not reveal a significant difference in rate between trnH-psbA and rbcL, but mean K2P distances of each genus showed significant heterogeneity according to systematic position. The minimum fail rate of taxon discrimination in an identification test using BLAST (12.52%) was obtained when rbcL and trnH-psbA were combined, and became lower in datasets excluding infraspecific taxa or apogamous taxa, or including sexual diploids only. This study demonstrates the overall effectiveness of DNA barcodes for species identification in the Japanese pteridophyte flora. Although this flora is characterized by a high occurrence of apogamous taxa that pose a serious challenge to identification using DNA barcodes, such taxa are limited to a small number of genera, and only minimally detract from the overall success rate. In the case that a query sequence is matched to a known apogamous genus, routine species identification may not be possible. Otherwise, DNA barcoding is a practical tool for identification of most Japanese pteridophytes, and is especially anticipated to be helpful for identification of non-hybridizing gametophytes.

A survey of DNA diagnostic laboratories regarding DNA banking.

PubMed Central

McEwen, J E; Reilly, P R

1995-01-01

This article reports the findings of a survey of 148 academically based and commercial DNA diagnostic labs regarding DNA banking (defined as the storage of individual DNA samples in some form with identifiers for later retrieval). The population surveyed consisted of all laboratories listed with HELIX, a national directory of DNA diagnostic labs that includes a fairly comprehensive listing of clinical service labs as well as a large number of research labs. The survey was concerned primarily with the legal and ethical issues that the long-term storage of DNA may raise. The survey inquired into the respondents' policies and procedures concerning (1) the extent of DNA banking and of interest in developing DNA banking in academia and industry and (2) the degree to which DNA banks had developed written internal policies and/or a written depositor's agreement (a signed document defining the rights and obligations of the person from whom the sample was taken and the bank) designed to anticipate or prevent some of the ethical and legal problems that can arise from the long-term retention of DNA. Our research suggests that (1) the activity of DNA banking is growing, particularly in the academic setting, and (2) most academically based DNA banks lack written internal policies, written depositor's agreements, or other relevant documentation regarding important aspects of this activity. PMID:7762571

Forensic genetic SNP typing of low-template DNA and highly degraded DNA from crime case samples.

PubMed

Børsting, Claus; Mogensen, Helle Smidt; Morling, Niels

2013-05-01

Heterozygote imbalances leading to allele drop-outs and disproportionally large stutters leading to allele drop-ins are known stochastic phenomena related to STR typing of low-template DNA (LtDNA). The large stutters and the many drop-ins in typical STR stutter positions are artifacts from the PCR amplification of tandem repeats. These artifacts may be avoided by typing bi-allelic markers instead of STRs. In this work, the SNPforID multiplex assay was used to type LtDNA. A sensitized SNP typing protocol was introduced, that increased signal strengths without increasing noise and without affecting the heterozygote balance. Allele drop-ins were only observed in experiments with 25 pg of DNA and not in experiments with 50 and 100 pg of DNA. The allele drop-in rate in the 25 pg experiments was 0.06% or 100 times lower than what was previously reported for STR typing of LtDNA. A composite model and two different consensus models were used to interpret the SNP data. Correct profiles with 42-49 SNPs were generated from the 50 and 100 pg experiments, whereas a few incorrect genotypes were included in the generated profiles from the 25 pg experiments. With the strict consensus model, between 35 and 48 SNPs were correctly typed in the 25 pg experiments and only one allele drop-out (error rate: 0.07%) was observed in the consensus profiles. A total of 28 crime case samples were selected for typing with the sensitized SNPforID protocol. The samples were previously typed with old STR kits during the crime case investigation and only partial profiles (0-6 STRs) were obtained. Eleven of the samples could not be quantified with the Quantifiler™ Human DNA Quantification kit because of partial or complete inhibition of the PCR. For eight of these samples, SNP typing was only possible when the buffer and DNA polymerase used in the original protocol was replaced with the AmpFℓSTR(®) SEfiler Plus™ Master Mix, which was developed specifically for challenging forensic samples. All the crime case samples were successfully typed with the SNPforID multiplex assay and the match probabilities ranged from 1.1×10(-15) to 7.9×10(-23). In comparison, four of the samples could not be typed with the AmpFℓSTR(®) SEfiler Plus™ kit and the match probabilities were higher than 10(-7) for another six samples. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

A pneumatic device for rapid loading of DNA sequencing gels.

PubMed

Panussis, D A; Cook, M W; Rifkin, L L; Snider, J E; Strong, J T; McGrane, R M; Wilson, R K; Mardis, E R

1998-05-01

This work describes the design and construction of a device that facilitates the loading of DNA samples onto polyacrylamide gels for detection in the Perkin Elmer/Applied Biosystems (PE/ABI) 373 and 377 DNA sequencing instruments. The device is mounted onto the existing gel cassettes and makes the process of loading high-density gels less cumbersome while the associated time and errors are reduced. The principle of operation includes the simultaneous transfer of the entire batch of samples, in which a spring-loaded air cylinder generates positive pressure and flexible silica capillaries transfer the samples. A retractable capillary array carrier allows the delivery ends of the capillaries to be held up clear of the gel during loader attachment on the gel plates, while enabling their insertion in the gel wells once the device is securely mounted. Gel-loading devices capable of simultaneously transferring 72 samples onto the PE/ABI 373 and 377 are currently being used in our production sequencing groups while a 96-sample transfer prototype undergoes testing.

Developmental validation of the DNAscan™ Rapid DNA Analysis™ instrument and expert system for reference sample processing.

PubMed

Della Manna, Angelo; Nye, Jeffrey V; Carney, Christopher; Hammons, Jennifer S; Mann, Michael; Al Shamali, Farida; Vallone, Peter M; Romsos, Erica L; Marne, Beth Ann; Tan, Eugene; Turingan, Rosemary S; Hogan, Catherine; Selden, Richard F; French, Julie L

2016-11-01

Since the implementation of forensic DNA typing in labs more than 20 years ago, the analysis procedures and data interpretation have always been conducted in a laboratory by highly trained and qualified scientific personnel. Rapid DNA technology has the potential to expand testing capabilities within forensic laboratories and to allow forensic STR analysis to be performed outside the physical boundaries of the traditional laboratory. The developmental validation of the DNAscan/ANDE Rapid DNA Analysis System was completed using a BioChipSet™ Cassette consumable designed for high DNA content samples, such as single source buccal swabs. A total of eight laboratories participated in the testing which totaled over 2300 swabs, and included nearly 1400 unique individuals. The goal of this extensive study was to obtain, document, analyze, and assess DNAscan and its internal Expert System to reliably genotype reference samples in a manner compliant with the FBI's Quality Assurance Standards (QAS) and the NDIS Operational Procedures. The DNAscan System provided high quality, concordant results for reference buccal swabs, including automated data analysis with an integrated Expert System. Seven external laboratories and NetBio, the developer of the technology, participated in the validation testing demonstrating the reproducibility and reliability of the system and its successful use in a variety of settings by numerous operators. The DNAscan System demonstrated limited cross reactivity with other species, was resilient in the presence of numerous inhibitors, and provided reproducible results for both buccal and purified DNA samples with sensitivity at a level appropriate for buccal swabs. The precision and resolution of the system met industry standards for detection of micro-variants and displayed single base resolution. PCR-based studies provided confidence that the system was robust and that the amplification reaction had been optimized to provide high quality results. The DNAscan integrated Expert System was examined as part of the Developmental Validation and successfully interpreted the over 2000 samples tested with over 99.998% concordant alleles. The system appropriately flagged samples for human review and failed both mixed samples and samples with insufficient genetic information. These results demonstrated the integrated Expert System makes correct allele calls without human intervention. Copyright © 2016 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

Importance of the efficiency of double-stranded DNA formation in cDNA synthesis for the imprecision of microarray expression analysis.

PubMed

Thormar, Hans G; Gudmundsson, Bjarki; Eiriksdottir, Freyja; Kil, Siyoen; Gunnarsson, Gudmundur H; Magnusson, Magnus Karl; Hsu, Jason C; Jonsson, Jon J

2013-04-01

The causes of imprecision in microarray expression analysis are poorly understood, limiting the use of this technology in molecular diagnostics. Two-dimensional strandness-dependent electrophoresis (2D-SDE) separates nucleic acid molecules on the basis of length and strandness, i.e., double-stranded DNA (dsDNA), single-stranded DNA (ssDNA), and RNA·DNA hybrids. We used 2D-SDE to measure the efficiency of cDNA synthesis and its importance for the imprecision of an in vitro transcription-based microarray expression analysis. The relative amount of double-stranded cDNA formed in replicate experiments that used the same RNA sample template was highly variable, ranging between 0% and 72% of the total DNA. Microarray experiments showed an inverse relationship between the difference between sample pairs in probe variance and the relative amount of dsDNA. Approximately 15% of probes showed between-sample variation (P < 0.05) when the dsDNA percentage was between 12% and 35%. In contrast, only 3% of probes showed between-sample variation when the dsDNA percentage was 69% and 72%. Replication experiments of the 35% dsDNA and 72% dsDNA samples were used to separate sample variation from probe replication variation. The estimated SD of the sample-to-sample variation and of the probe replicates was lower in 72% dsDNA samples than in 35% dsDNA samples. Variation in the relative amount of double-stranded cDNA synthesized can be an important component of the imprecision in T7 RNA polymerase-based microarray expression analysis. © 2013 American Association for Clinical Chemistry

An Optimized Centrifugal Method for Separation of Semen from Superabsorbent Polymers for Forensic Analysis.

PubMed

Camarena, Lucy R; Glasscock, Bailey K; Daniels, Demi; Ackley, Nicolle; Sciarretta, Marybeth; Seashols-Williams, Sarah J

2017-03-01

Connection of a perpetrator to a sexual assault is best performed through the confirmed presence of semen, thereby proving sexual contact. Evidentiary items can include sanitary napkins or diapers containing superabsorbent polymers (SAPs), complicating spermatozoa visualization and DNA analysis. In this report, we evaluated the impact of SAPS on the current forensic DNA workflow, developing an efficient centrifugal protocol for separating spermatozoa from SAP material. The optimized filtration method was compared to common practices of excising the top layer only, resulting in significantly higher sperm yields when a core sample of the substrate was taken. Direct isolation of the SAP-containing materials without filtering resulted in 20% sample failure; additionally, SAP material was observed in the final eluted DNA samples, causing physical interference. Thus, use of the described centrifugal-filtering method is a simple preliminary step that improves spermatozoa visualization and enables more consistent DNA yields, while also avoiding SAP interference. © 2016 American Academy of Forensic Sciences.

Developmental Validation of Short Tandem Repeat Reagent Kit for Forensic DNA Profiling of Canine Biological Materials

PubMed Central

Dayton, Melody; Koskinen, Mikko T; Tom, Bradley K; Mattila, Anna-Maria; Johnston, Eric; Halverson, Joy; Fantin, Dennis; DeNise, Sue; Budowle, Bruce; Smith, David Glenn; Kanthaswamy, Sree

2009-01-01

Aim To develop a reagent kit that enables multiplex polymerase chain reaction (PCR) amplification of 18 short tandem repeats (STR) and the canine sex-determining Zinc Finger marker. Methods Validation studies to determine the robustness and reliability in forensic DNA typing of this multiplex assay included sensitivity testing, reproducibility studies, intra- and inter-locus color balance studies, annealing temperature and cycle number studies, peak height ratio determination, characterization of artifacts such as stutter percentages and dye blobs, mixture analyses, species-specificity, case type samples analyses and population studies. Results The kit robustly amplified domesticated dog samples and consistently generated full 19-locus profiles from as little as 125 pg of dog DNA. In addition, wolf DNA samples could be analyzed with the kit. Conclusion The kit, which produces robust, reliable, and reproducible results, will be made available for the forensic research community after modifications based on this study’s evaluation to comply with the quality standards expected for forensic casework. PMID:19480022

An efficient and sensitive method for preparing cDNA libraries from scarce biological samples

PubMed Central

Sterling, Catherine H.; Veksler-Lublinsky, Isana; Ambros, Victor

2015-01-01

The preparation and high-throughput sequencing of cDNA libraries from samples of small RNA is a powerful tool to quantify known small RNAs (such as microRNAs) and to discover novel RNA species. Interest in identifying the small RNA repertoire present in tissues and in biofluids has grown substantially with the findings that small RNAs can serve as indicators of biological conditions and disease states. Here we describe a novel and straightforward method to clone cDNA libraries from small quantities of input RNA. This method permits the generation of cDNA libraries from sub-picogram quantities of RNA robustly, efficiently and reproducibly. We demonstrate that the method provides a significant improvement in sensitivity compared to previous cloning methods while maintaining reproducible identification of diverse small RNA species. This method should have widespread applications in a variety of contexts, including biomarker discovery from scarce samples of human tissue or body fluids. PMID:25056322

Broad Surveys of DNA Viral Diversity Obtained through Viral Metagenomics of Mosquitoes

PubMed Central

Ng, Terry Fei Fan; Willner, Dana L.; Lim, Yan Wei; Schmieder, Robert; Chau, Betty; Nilsson, Christina; Anthony, Simon; Ruan, Yijun; Rohwer, Forest; Breitbart, Mya

2011-01-01

Viruses are the most abundant and diverse genetic entities on Earth; however, broad surveys of viral diversity are hindered by the lack of a universal assay for viruses and the inability to sample a sufficient number of individual hosts. This study utilized vector-enabled metagenomics (VEM) to provide a snapshot of the diversity of DNA viruses present in three mosquito samples from San Diego, California. The majority of the sequences were novel, suggesting that the viral community in mosquitoes, as well as the animal and plant hosts they feed on, is highly diverse and largely uncharacterized. Each mosquito sample contained a distinct viral community. The mosquito viromes contained sequences related to a broad range of animal, plant, insect and bacterial viruses. Animal viruses identified included anelloviruses, circoviruses, herpesviruses, poxviruses, and papillomaviruses, which mosquitoes may have obtained from vertebrate hosts during blood feeding. Notably, sequences related to human papillomaviruses were identified in one of the mosquito samples. Sequences similar to plant viruses were identified in all mosquito viromes, which were potentially acquired through feeding on plant nectar. Numerous bacteriophages and insect viruses were also detected, including a novel densovirus likely infecting Culex erythrothorax. Through sampling insect vectors, VEM enables broad survey of viral diversity and has significantly increased our knowledge of the DNA viruses present in mosquitoes. PMID:21674005

Direct and long-term detection of gene doping in conventional blood samples.

PubMed

Beiter, T; Zimmermann, M; Fragasso, A; Hudemann, J; Niess, A M; Bitzer, M; Lauer, U M; Simon, P

2011-03-01

The misuse of somatic gene therapy for the purpose of enhancing athletic performance is perceived as a coming threat to the world of sports and categorized as 'gene doping'. This article describes a direct detection approach for gene doping that gives a clear yes-or-no answer based on the presence or absence of transgenic DNA in peripheral blood samples. By exploiting a priming strategy to specifically amplify intronless DNA sequences, we developed PCR protocols allowing the detection of very small amounts of transgenic DNA in genomic DNA samples to screen for six prime candidate genes. Our detection strategy was verified in a mouse model, giving positive signals from minute amounts (20 μl) of blood samples for up to 56 days following intramuscular adeno-associated virus-mediated gene transfer, one of the most likely candidate vector systems to be misused for gene doping. To make our detection strategy amenable for routine testing, we implemented a robust sample preparation and processing protocol that allows cost-efficient analysis of small human blood volumes (200 μl) with high specificity and reproducibility. The practicability and reliability of our detection strategy was validated by a screening approach including 327 blood samples taken from professional and recreational athletes under field conditions.

Genome-wide patterns of selection in 230 ancient Eurasians

PubMed Central

Mathieson, Iain; Lazaridis, Iosif; Rohland, Nadin; Mallick, Swapan; Patterson, Nick; Roodenberg, Songül Alpaslan; Harney, Eadaoin; Stewardson, Kristin; Fernandes, Daniel; Novak, Mario; Sirak, Kendra; Gamba, Cristina; Jones, Eppie R.; Llamas, Bastien; Dryomov, Stanislav; Pickrel, Joseph; Arsuaga, Juan Luís; de Castro, José María Bermúdez; Carbonell, Eudald; Gerritsen, Fokke; Khokhlov, Aleksandr; Kuznetsov, Pavel; Lozano, Marina; Meller, Harald; Mochalov, Oleg; Moiseyev, Vayacheslav; Rojo Guerra, Manuel A.; Roodenberg, Jacob; Vergès, Josep Maria; Krause, Johannes; Cooper, Alan; Alt, Kurt W.; Brown, Dorcas; Anthony, David; Lalueza-Fox, Carles; Haak, Wolfgang; Pinhasi, Ron; Reich, David

2016-01-01

Ancient DNA makes it possible to directly witness natural selection by analyzing samples from populations before, during and after adaptation events. Here we report the first scan for selection using ancient DNA, capitalizing on the largest genome-wide dataset yet assembled: 230 West Eurasians dating to between 6500 and 1000 BCE, including 163 with newly reported data. The new samples include the first genome-wide data from the Anatolian Neolithic culture whose genetic material we extracted from the DNA-rich petrous bone and who we show were members of the population that was the source of Europe’s first farmers. We also report a complete transect of the steppe region in Samara between 5500 and 1200 BCE that allows us to recognize admixture from at least two external sources into steppe populations during this period. We detect selection at loci associated with diet, pigmentation and immunity, and two independent episodes of selection on height. PMID:26595274

High Throughput, Multiplexed Pathogen Detection Authenticates Plague Waves in Medieval Venice, Italy

PubMed Central

Tran, Thi-Nguyen-Ny; Signoli, Michel; Fozzati, Luigi; Aboudharam, Gérard; Raoult, Didier; Drancourt, Michel

2011-01-01

Background Historical records suggest that multiple burial sites from the 14th–16th centuries in Venice, Italy, were used during the Black Death and subsequent plague epidemics. Methodology/Principal Findings High throughput, multiplexed real-time PCR detected DNA of seven highly transmissible pathogens in 173 dental pulp specimens collected from 46 graves. Bartonella quintana DNA was identified in five (2.9%) samples, including three from the 16th century and two from the 15th century, and Yersinia pestis DNA was detected in three (1.7%) samples, including two from the 14th century and one from the 16th century. Partial glpD gene sequencing indicated that the detected Y. pestis was the Orientalis biotype. Conclusions These data document for the first time successive plague epidemics in the medieval European city where quarantine was first instituted in the 14th century. PMID:21423736

28 CFR 28.11 - Definitions.

Code of Federal Regulations, 2010 CFR

2010-07-01

... Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM DNA Sample Collection, Analysis, and Indexing § 28.11 Definitions. DNA analysis means analysis of the deoxyribonucleic acid (DNA) identification information in a bodily sample. DNA sample means a tissue, fluid, or other bodily sample of an individual on...

28 CFR 28.11 - Definitions.

Code of Federal Regulations, 2011 CFR

2011-07-01

... Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM DNA Sample Collection, Analysis, and Indexing § 28.11 Definitions. DNA analysis means analysis of the deoxyribonucleic acid (DNA) identification information in a bodily sample. DNA sample means a tissue, fluid, or other bodily sample of an individual on...

28 CFR 28.11 - Definitions.

Code of Federal Regulations, 2013 CFR

2013-07-01

... Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM DNA Sample Collection, Analysis, and Indexing § 28.11 Definitions. DNA analysis means analysis of the deoxyribonucleic acid (DNA) identification information in a bodily sample. DNA sample means a tissue, fluid, or other bodily sample of an individual on...

28 CFR 28.11 - Definitions.

Code of Federal Regulations, 2012 CFR

2012-07-01

... Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM DNA Sample Collection, Analysis, and Indexing § 28.11 Definitions. DNA analysis means analysis of the deoxyribonucleic acid (DNA) identification information in a bodily sample. DNA sample means a tissue, fluid, or other bodily sample of an individual on...

28 CFR 28.11 - Definitions.

Code of Federal Regulations, 2014 CFR

2014-07-01

... Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM DNA Sample Collection, Analysis, and Indexing § 28.11 Definitions. DNA analysis means analysis of the deoxyribonucleic acid (DNA) identification information in a bodily sample. DNA sample means a tissue, fluid, or other bodily sample of an individual on...

Development and validation of a multi-locus DNA metabarcoding method to identify endangered species in complex samples

PubMed Central

Arulandhu, Alfred J.; Staats, Martijn; Hagelaar, Rico; Voorhuijzen, Marleen M.; Prins, Theo W.; Scholtens, Ingrid; Costessi, Adalberto; Duijsings, Danny; Rechenmann, François; Gaspar, Frédéric B.; Barreto Crespo, Maria Teresa; Holst-Jensen, Arne; Birck, Matthew; Burns, Malcolm; Haynes, Edward; Hochegger, Rupert; Klingl, Alexander; Lundberg, Lisa; Natale, Chiara; Niekamp, Hauke; Perri, Elena; Barbante, Alessandra; Rosec, Jean-Philippe; Seyfarth, Ralf; Sovová, Tereza; Van Moorleghem, Christoff; van Ruth, Saskia; Peelen, Tamara

2017-01-01

Abstract DNA metabarcoding provides great potential for species identification in complex samples such as food supplements and traditional medicines. Such a method would aid Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) enforcement officers to combat wildlife crime by preventing illegal trade of endangered plant and animal species. The objective of this research was to develop a multi-locus DNA metabarcoding method for forensic wildlife species identification and to evaluate the applicability and reproducibility of this approach across different laboratories. A DNA metabarcoding method was developed that makes use of 12 DNA barcode markers that have demonstrated universal applicability across a wide range of plant and animal taxa and that facilitate the identification of species in samples containing degraded DNA. The DNA metabarcoding method was developed based on Illumina MiSeq amplicon sequencing of well-defined experimental mixtures, for which a bioinformatics pipeline with user-friendly web-interface was developed. The performance of the DNA metabarcoding method was assessed in an international validation trial by 16 laboratories, in which the method was found to be highly reproducible and sensitive enough to identify species present in a mixture at 1% dry weight content. The advanced multi-locus DNA metabarcoding method assessed in this study provides reliable and detailed data on the composition of complex food products, including information on the presence of CITES-listed species. The method can provide improved resolution for species identification, while verifying species with multiple DNA barcodes contributes to an enhanced quality assurance. PMID:29020743

Development and validation of a multi-locus DNA metabarcoding method to identify endangered species in complex samples.

PubMed

Arulandhu, Alfred J; Staats, Martijn; Hagelaar, Rico; Voorhuijzen, Marleen M; Prins, Theo W; Scholtens, Ingrid; Costessi, Adalberto; Duijsings, Danny; Rechenmann, François; Gaspar, Frédéric B; Barreto Crespo, Maria Teresa; Holst-Jensen, Arne; Birck, Matthew; Burns, Malcolm; Haynes, Edward; Hochegger, Rupert; Klingl, Alexander; Lundberg, Lisa; Natale, Chiara; Niekamp, Hauke; Perri, Elena; Barbante, Alessandra; Rosec, Jean-Philippe; Seyfarth, Ralf; Sovová, Tereza; Van Moorleghem, Christoff; van Ruth, Saskia; Peelen, Tamara; Kok, Esther

2017-10-01

DNA metabarcoding provides great potential for species identification in complex samples such as food supplements and traditional medicines. Such a method would aid Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) enforcement officers to combat wildlife crime by preventing illegal trade of endangered plant and animal species. The objective of this research was to develop a multi-locus DNA metabarcoding method for forensic wildlife species identification and to evaluate the applicability and reproducibility of this approach across different laboratories. A DNA metabarcoding method was developed that makes use of 12 DNA barcode markers that have demonstrated universal applicability across a wide range of plant and animal taxa and that facilitate the identification of species in samples containing degraded DNA. The DNA metabarcoding method was developed based on Illumina MiSeq amplicon sequencing of well-defined experimental mixtures, for which a bioinformatics pipeline with user-friendly web-interface was developed. The performance of the DNA metabarcoding method was assessed in an international validation trial by 16 laboratories, in which the method was found to be highly reproducible and sensitive enough to identify species present in a mixture at 1% dry weight content. The advanced multi-locus DNA metabarcoding method assessed in this study provides reliable and detailed data on the composition of complex food products, including information on the presence of CITES-listed species. The method can provide improved resolution for species identification, while verifying species with multiple DNA barcodes contributes to an enhanced quality assurance. © The Authors 2017. Published by Oxford University Press.

Analysis of Bacterial and Fungal Nucleic Acid in Canine Sterile Granulomatous and Pyogranulomatous Dermatitis and Panniculitis.

PubMed

Rosa, Fabio B; Older, Caitlin E; Meason-Smith, Courtney; Suchodolski, Jan S; Lingsweiler, Sonia; Mansell, Joanne E; Hoffmann, Aline Rodrigues

2018-01-01

Next generation sequencing (NGS) studies are revealing a diverse microbiota on the skin of dogs. The skin microbiota of canine sterile granulomatous and pyogranulomatous dermatitis (SGPD) has yet to be investigated using NGS techniques. NGS targeting the 16S rRNA and ITS-1 region of bacterial and fungal DNA, respectively, were used to investigate if bacterial and fungal DNA were associated with skin lesions in cases of canine SGPD. The study included 20 formalin-fixed paraffin-embedded (FFPE) skin samples and 12 fresh samples from SGPD-affected dogs, and 10 FFPE and 10 fresh samples from healthy dogs. DNA was extracted from deep dermis and panniculus, and microbial DNA was amplified using primers targeting the bacterial 16S rRNA V1-V3 and fungal ITS-1 regions. The amplified DNA was utilized for NGS on an Illumina MiSeq instrument. The sequences were processed using QIIME. No differences in fungal or bacterial alpha diversity were observed between the SGPD and control samples. Beta diversity analysis demonstrated differences in the bacterial communities between SGPD and control, but not in the fungal communities. Compared to controls, the family Erysipelotrichaceae and genus Staphylococcus were significantly more abundant in the SGPD FFPE samples, and genus Corynebacterium were more abundant in fresh samples. The bacteria found to be more abundant in SGPD are common inhabitants of skin surfaces, and likely secondary contaminants in SGPD cases. This study provides additional evidence that SGPD lesions are likely sterile.

Development of a Multiplex Single Base Extension Assay for Mitochondrial DNA Haplogroup Typing

PubMed Central

Nelson, Tahnee M.; Just, Rebecca S.; Loreille, Odile; Schanfield, Moses S.; Podini, Daniele

2007-01-01

Aim To provide a screening tool to reduce time and sample consumption when attempting mtDNA haplogroup typing. Methods A single base primer extension assay was developed to enable typing, in a single reaction, of twelve mtDNA haplogroup specific polymorphisms. For validation purposes a total of 147 samples were tested including 73 samples successfully haplogroup typed using mtDNA control region (CR) sequence data, 21 samples inconclusively haplogroup typed by CR data, 20 samples previously haplogroup typed using restriction fragment length polymorphism (RFLP) analysis, and 31 samples of known ancestral origin without previous haplogroup typing. Additionally, two highly degraded human bones embalmed and buried in the early 1950s were analyzed using the single nucleotide polymorphisms (SNP) multiplex. Results When the SNP multiplex was used to type the 96 previously CR sequenced specimens, an increase in haplogroup or macrohaplogroup assignment relative to conventional CR sequence analysis was observed. The single base extension assay was also successfully used to assign a haplogroup to decades-old, embalmed skeletal remains dating to World War II. Conclusion The SNP multiplex was successfully used to obtain haplogroup status of highly degraded human bones, and demonstrated the ability to eliminate possible contributors. The SNP multiplex provides a low-cost, high throughput method for typing of mtDNA haplogroups A, B, C, D, E, F, G, H, L1/L2, L3, M, and N that could be useful for screening purposes for human identification efforts and anthropological studies. PMID:17696300

A simple quantitative diagnostic alternative for MGMT DNA-methylation testing on RCL2 fixed paraffin embedded tumors using restriction coupled qPCR.

PubMed

Pulverer, Walter; Hofner, Manuela; Preusser, Matthias; Dirnberger, Elisabeth; Hainfellner, Johannes A; Weinhaeusel, Andreas

2014-01-01

MGMT promoter methylation is associated with favorable prognosis and chemosensitivity in glioblastoma multiforme (GBM), especially in elderly patients. We aimed to develop a simple methylation-sensitive restriction enzyme (MSRE)-based quantitative PCR (qPCR) assay, allowing the quantification of MGMT promoter methylation. DNA was extracted from non-neoplastic brain (n = 24) and GBM samples (n = 20) upon 3 different sample conservation conditions (-80 °C, formalin-fixed and paraffin-embedded (FFPE); RCL2-fixed). We evaluated the suitability of each fixation method with respect to the MSRE-coupled qPCR methylation analyses. Methylation data were validated by MALDITOF. qPCR was used for evaluation of alternative tissue conservation procedures. DNA from FFPE tissue failed reliable testing; DNA from both RCL2-fixed and fresh frozen tissues performed equally well and was further used for validation of the quantitative MGMT methylation assay (limit of detection (LOD): 19.58 pg), using individual's undigested sample DNA for calibration. MGMT methylation analysis in non-neoplastic brain identified a background methylation of 0.10 ± 11% which we used for defining a cut-off of 0.32% for patient stratification. Of GBM patients 9 were MGMT methylationpositive (range: 0.56 - 91.95%), and 11 tested negative. MALDI-TOF measurements resulted in a concordant classification of 94% of GBM samples in comparison to qPCR. The presented methodology allows quantitative MGMT promoter methylation analyses. An amount of 200 ng DNA is sufficient for triplicate analyses including control reactions and individual calibration curves, thus excluding any DNA qualityderived bias. The combination of RCL2-fixation and quantitative methylation analyses improves pathological routine examination when histological and molecular analyses on limited amounts of tumor samples are necessary for patient stratification.

Fish assemblages

USGS Publications Warehouse

McGarvey, Daniel J.; Falke, Jeffrey A.; Li, Hiram W.; Li, Judith; Hauer, F. Richard; Lamberti, G.A.

2017-01-01

Methods to sample fishes in stream ecosystems and to analyze the raw data, focusing primarily on assemblage-level (all fish species combined) analyses, are presented in this chapter. We begin with guidance on sample site selection, permitting for fish collection, and information-gathering steps to be completed prior to conducting fieldwork. Basic sampling methods (visual surveying, electrofishing, and seining) are presented with specific instructions for estimating population sizes via visual, capture-recapture, and depletion surveys, in addition to new guidance on environmental DNA (eDNA) methods. Steps to process fish specimens in the field including the use of anesthesia and preservation of whole specimens or tissue samples (for genetic or stable isotope analysis) are also presented. Data analysis methods include characterization of size-structure within populations, estimation of species richness and diversity, and application of fish functional traits. We conclude with three advanced topics in assemblage-level analysis: multidimensional scaling (MDS), ecological networks, and loop analysis.

Whole exome sequencing for determination of tumor mutation load in liquid biopsy from advanced cancer patients.

PubMed

Koeppel, Florence; Blanchard, Steven; Jovelet, Cécile; Genin, Bérengère; Marcaillou, Charles; Martin, Emmanuel; Rouleau, Etienne; Solary, Eric; Soria, Jean-Charles; André, Fabrice; Lacroix, Ludovic

2017-01-01

Tumor mutation load (TML) has been proposed as a biomarker of patient response to immunotherapy in several studies. TML is usually determined by tumor biopsy DNA (tDNA) whole exome sequencing (WES), therefore TML evaluation is limited by informative biopsy availability. Circulating cell free DNA (cfDNA) provided by liquid biopsy is a surrogate specimen to biopsy for molecular profiling. Nevertheless performing WES on DNA from plasma is technically challenging and the ability to determine tumor mutation load from liquid biopsies remains to be demonstrated. In the current study, WES was performed on cfDNA from 32 metastatic patients of various cancer types included into MOSCATO 01 (NCT01566019) and/or MATCHR (NCT02517892) molecular triage trials. Results from targeted gene sequencing (TGS) and WES performed on cfDNA were compared to results from tumor tissue biopsy. In cfDNA samples, WES mutation detection sensitivity was 92% compared to targeted sequencing (TGS). When comparing cfDNA-WES to tDNA-WES, mutation detection sensitivity was 53%, consistent with previously published prospective study comparing cfDNA-TGS to tDNA-TGS. For samples in which presence of tumor DNA was confirmed in cfDNA, tumor mutation load from liquid biopsy was correlated with tumor biopsy. Taken together, this study demonstrated that liquid biopsy may be applied to determine tumor mutation load. Qualification of liquid biopsy for interpretation is a crucial point to use cfDNA for mutational load estimation.

Whole exome sequencing for determination of tumor mutation load in liquid biopsy from advanced cancer patients

PubMed Central

Blanchard, Steven; Jovelet, Cécile; Genin, Bérengère; Marcaillou, Charles; Martin, Emmanuel; Rouleau, Etienne; Solary, Eric; Soria, Jean-Charles; André, Fabrice; Lacroix, Ludovic

2017-01-01

Tumor mutation load (TML) has been proposed as a biomarker of patient response to immunotherapy in several studies. TML is usually determined by tumor biopsy DNA (tDNA) whole exome sequencing (WES), therefore TML evaluation is limited by informative biopsy availability. Circulating cell free DNA (cfDNA) provided by liquid biopsy is a surrogate specimen to biopsy for molecular profiling. Nevertheless performing WES on DNA from plasma is technically challenging and the ability to determine tumor mutation load from liquid biopsies remains to be demonstrated. In the current study, WES was performed on cfDNA from 32 metastatic patients of various cancer types included into MOSCATO 01 (NCT01566019) and/or MATCHR (NCT02517892) molecular triage trials. Results from targeted gene sequencing (TGS) and WES performed on cfDNA were compared to results from tumor tissue biopsy. In cfDNA samples, WES mutation detection sensitivity was 92% compared to targeted sequencing (TGS). When comparing cfDNA-WES to tDNA-WES, mutation detection sensitivity was 53%, consistent with previously published prospective study comparing cfDNA-TGS to tDNA-TGS. For samples in which presence of tumor DNA was confirmed in cfDNA, tumor mutation load from liquid biopsy was correlated with tumor biopsy. Taken together, this study demonstrated that liquid biopsy may be applied to determine tumor mutation load. Qualification of liquid biopsy for interpretation is a crucial point to use cfDNA for mutational load estimation. PMID:29161279

Human papillomavirus type 2 associated with pyogenic granuloma in patients without clinical evidence of warts.

PubMed

Vázquez-Martínez, Osvaldo T; González-Betancourt, Anajulia; Barboza-Cerda, María Carmen; González-González, Sergio E; Lugo-Trampe, Ángel; Welsh, Oliverio; Rojas-Martínez, Augusto; Martínez-Rodríguez, Herminia G; Ocampo-Candiani, Jorge; Ortiz-López, Rocío

2016-07-01

Pyogenic granuloma is a non-neoplastic lesion that frequently occurs in the skin and mucous membranes of children and pregnant women. The anatomical sites of pyogenic granulomas overlap with those of wart infections caused by the human papillomavirus (HPV). This study assessed the presence of HPV DNA in pyogenic granuloma samples by polymerase chain reaction. Eighteen pyogenic granuloma biopsies from patients without a clinical history or evidence of verruca in the studied area were tested for the presence of the HPV genome. The presence of HPV DNA was screened by three independent polymerase chain reaction reactions using standard consensus primer sets targeted to the L1 or E1 consensus regions of HPV genome. The HPV DNA-positive samples were genotyped using methodologies enabling the identification of up to 30 HPVs, including oncogenic, nononcogenic, and cutaneous viral types. The HPV DNA was detected in 44.4% (eight of 18) of the samples, with HPV-2 being the only type in the eight HPV DNA-positive samples. Contamination with HPV-2 sequences throughout the entire process was reliably eliminated. This report is the first to suggest an association between HPV-2 and pyogenic granuloma. This relationship is similar to that observed between HPV-2 and nongenital warts. © 2015 The International Society of Dermatology.

A comprehensive characterization of rare mitochondrial DNA variants in neuroblastoma

PubMed Central

Pignataro, Piero; Lasorsa, Vito Alessandro; Hogarty, Michael D.; Castellano, Aurora; Conte, Massimo; Tonini, Gian Paolo; Iolascon, Achille; Gasparre, Giuseppe; Capasso, Mario

2016-01-01

Background Neuroblastoma, a tumor of the developing sympathetic nervous system, is a common childhood neoplasm that is often lethal. Mitochondrial DNA (mtDNA) mutations have been found in most tumors including neuroblastoma. We extracted mtDNA data from a cohort of neuroblastoma samples that had undergone Whole Exome Sequencing (WES) and also used snap-frozen samples in which mtDNA was entirely sequenced by Sanger technology. We next undertook the challenge of determining those mutations that are relevant to, or arisen during tumor development. The bioinformatics pipeline used to extract mitochondrial variants from matched tumor/blood samples was enriched by a set of filters inclusive of heteroplasmic fraction, nucleotide variability, and in silico prediction of pathogenicity. Results Our in silico multistep workflow applied both on WES and Sanger-sequenced neuroblastoma samples, allowed us to identify a limited burden of somatic and germline mitochondrial mutations with a potential pathogenic impact. Conclusions The few singleton germline and somatic mitochondrial mutations emerged, according to our in silico analysis, do not appear to impact on the development of neuroblastoma. Our findings are consistent with the hypothesis that most mitochondrial somatic mutations can be considered as ‘passengers’ and consequently have no discernible effect in this type of cancer. PMID:27351283

Poly (ADP-ribose) polymerase inhibitor CEP-8983 synergizes with bendamustine in chronic lymphocytic leukemia cells in vitro

PubMed Central

Dilley, Robert L.; Poh, Weijie; Gladstone, Douglas E.; Herman, James G.; Showel, Margaret M.; Karp, Judith E.; McDevitt, Michael A.; Pratz, Keith W.

2014-01-01

DNA repair aberrations and associated chromosomal instability is a feature of chronic lymphocytic leukemia (CLL). To evaluate if DNA repair insufficiencies are related to methylation changes, we examined the methylation of nine promoter regions of DNA repair proteins by bisulfide sequencing in 26 CLL primary samples and performed quantitative PCR on a subset of samples to examine BRCA1 expression. We also investigated if changes in cytogenetic or expression level of DNA repair proteins led to changes in sensitivity to a novel PARP inhibitor, CEP-8983, alone and in combination with bendamustine. No changes in promoter methylation were identified in BRCA1, BRCA2, FANC-C, FANC-F, FANC-L, ATM, MGMT, hMLH1 and H2AX except for two cases of minor BRCA1 hypermethylation. CLL samples appeared to have reduced BRCA1 mRNA expression uniformly in comparison to non-malignant lymphocytes irrespective of promoter hypermethylation. CEP-8983 displayed single agent cytotoxicity and the combination with bendamustine demonstrated synergistic cytotoxicity in the majority of CLL samples. These results were consistent across cytogenetic subgroups, including 17p deleted and previously treated patients. Our results provide rationale for further exploration of the combination of a PARP inhibitor and DNA damaging agents as a novel therapeutic strategy in CLL. PMID:24439051

Microfluidic Devices for Forensic DNA Analysis: A Review

PubMed Central

Bruijns, Brigitte; van Asten, Arian; Tiggelaar, Roald; Gardeniers, Han

2016-01-01

Microfluidic devices may offer various advantages for forensic DNA analysis, such as reduced risk of contamination, shorter analysis time and direct application at the crime scene. Microfluidic chip technology has already proven to be functional and effective within medical applications, such as for point-of-care use. In the forensic field, one may expect microfluidic technology to become particularly relevant for the analysis of biological traces containing human DNA. This would require a number of consecutive steps, including sample work up, DNA amplification and detection, as well as secure storage of the sample. This article provides an extensive overview of microfluidic devices for cell lysis, DNA extraction and purification, DNA amplification and detection and analysis techniques for DNA. Topics to be discussed are polymerase chain reaction (PCR) on-chip, digital PCR (dPCR), isothermal amplification on-chip, chip materials, integrated devices and commercially available techniques. A critical overview of the opportunities and challenges of the use of chips is discussed, and developments made in forensic DNA analysis over the past 10–20 years with microfluidic systems are described. Areas in which further research is needed are indicated in a future outlook. PMID:27527231

Improving efficiency of a small forensic DNA laboratory: validation of robotic assays and evaluation of microcapillary array device.

PubMed

Crouse, Cecelia A; Yeung, Stephanie; Greenspoon, Susan; McGuckian, Amy; Sikorsky, Julie; Ban, Jeff; Mathies, Richard

2005-08-01

To present validation studies performed for the implementation of existing and new technologies to increase the efficiency in the forensic DNA Section of the Palm Beach County Sheriff's Office (PBSO) Crime Laboratory. Using federally funded grants, internal support, and an external Process Mapping Team, the PBSO collaborated with forensic vendors, universities, and other forensic laboratories to enhance DNA testing procedures, including validation of the DNA IQ magnetic bead extraction system, robotic DNA extraction using the BioMek2000, the ABI7000 Sequence Detection System, and is currently evaluating a micro Capillary Array Electrophoresis device. The PBSO successfully validated and implemented both manual and automated Promega DNA IQ magnetic bead extractions system, which have increased DNA profile results from samples with low DNA template concentrations. The Beckman BioMek2000 DNA robotic workstation has been validated for blood, tissue, bone, hair, epithelial cells (touch evidence), and mixed stains such as semen. There has been a dramatic increase in the number of samples tested per case since implementation of the robotic extraction protocols. The validation of the ABI7000 real-time quantitative polymerase chain reaction (qPCR) technology and the single multiplex short tandem repeat (STR) PowerPlex16 BIO amplification system has provided both a time and a financial benefit. In addition, the qPCR system allows more accurate DNA concentration data and the PowerPlex 16 BIO multiplex generates DNA profiles data in half the time when compared to PowerPlex1.1 and PowerPlex2.1 STR systems. The PBSO's future efficiency requirements are being addressed through collaboration with the University of California at Berkeley and the Virginia Division of Forensic Science to validate microcapillary array electrophoresis instrumentation. Initial data demonstrated the electrophoresis of 96 samples in less than twenty minutes. The PBSO demonstrated, through the validation of more efficient extraction and quantification technology, an increase in the number of evidence samples tested using robotic/DNA IQ magnetic bead DNA extraction, a decrease in the number of negative samples amplified due to qPCR and implementation of a single multiplex amplification system. In addition, initial studies show the microcapillary array electrophoresis device (microCAE) evaluation results provide greater sensitivity and faster STR analysis output than current platforms.

[The future of forensic DNA analysis for criminal justice].

PubMed

Laurent, François-Xavier; Vibrac, Geoffrey; Rubio, Aurélien; Thévenot, Marie-Thérèse; Pène, Laurent

2017-11-01

In the criminal framework, the analysis of approximately 20 DNA microsatellites enables the establishment of a genetic profile with a high statistical power of discrimination. This technique gives us the possibility to establish or exclude a match between a biological trace detected at a crime scene and a suspect whose DNA was collected via an oral swab. However, conventional techniques do tend to complexify the interpretation of complex DNA samples, such as degraded DNA and mixture DNA. The aim of this review is to highlight the powerness of new forensic DNA methods (including high-throughput sequencing or single-cell sequencing) to facilitate the interpretation of the expert with full compliance with existing french legislation. © 2017 médecine/sciences – Inserm.

Evaluation of DNA extraction methods for Bacillus anthracis spores isolated from spiked food samples.

PubMed

Thomas, M C; Shields, M J; Hahn, K R; Janzen, T W; Goji, N; Amoako, K K

2013-07-01

Nine commercial DNA extraction kits were evaluated for the isolation of DNA from 10-fold serial dilutions of Bacillus anthracis spores using quantitative real-time PCR (qPCR). The three kits determined by qPCR to yield the most sensitive and consistent detection (Epicenter MasterPure Gram Positive; MoBio PowerFood; ABI PrepSeq) were subsequently tested for their ability to isolate DNA from trace amounts of B. anthracis spores (approx. 6·5 × 10(1) and 1·3 × 10(2)  CFU in 25 ml or 50 g of food sample) spiked into complex food samples including apple juice, ham, whole milk and bagged salad and recovered with immunomagnetic separation (IMS). The MasterPure kit effectively and consistently isolated DNA from low amounts of B. anthracis spores captured from food samples. Detection was achieved from apple juice, ham, whole milk and bagged salad from as few as 65 ± 14, 68 ± 8, 66 ± 4 and 52 ± 16 CFU, respectively, and IMS samples were demonstrated to be free of PCR inhibitors. Detection of B. anthracis spores isolated from food by IMS differs substantially between commercial DNA extraction kits; however, sensitive results can be obtained with the MasterPure Gram Positive kit. The extraction protocol identified herein combined with IMS is novel for B. anthracis and allows detection of low levels of B. anthracis spores from contaminated food samples. © Her Majesty the Queen in Right of Canada [2013]. Reproduced with the permission of the Canadian Food Inspection Agency.

Characterization of 107 Genomic DNA Reference Materials for CYP2D6, CYP2C19, CYP2C9, VKORC1, and UGT1A1

PubMed Central

Pratt, Victoria M.; Zehnbauer, Barbara; Wilson, Jean Amos; Baak, Ruth; Babic, Nikolina; Bettinotti, Maria; Buller, Arlene; Butz, Ken; Campbell, Matthew; Civalier, Chris; El-Badry, Abdalla; Farkas, Daniel H.; Lyon, Elaine; Mandal, Saptarshi; McKinney, Jason; Muralidharan, Kasinathan; Noll, LeAnne; Sander, Tara; Shabbeer, Junaid; Smith, Chingying; Telatar, Milhan; Toji, Lorraine; Vairavan, Anand; Vance, Carlos; Weck, Karen E.; Wu, Alan H.B.; Yeo, Kiang-Teck J.; Zeller, Markus; Kalman, Lisa

2010-01-01

Pharmacogenetic testing is becoming more common; however, very few quality control and other reference materials that cover alleles commonly included in such assays are currently available. To address these needs, the Centers for Disease Control and Prevention's Genetic Testing Reference Material Coordination Program, in collaboration with members of the pharmacogenetic testing community and the Coriell Cell Repositories, have characterized a panel of 107 genomic DNA reference materials for five loci (CYP2D6, CYP2C19, CYP2C9, VKORC1, and UGT1A1) that are commonly included in pharmacogenetic testing panels and proficiency testing surveys. Genomic DNA from publicly available cell lines was sent to volunteer laboratories for genotyping. Each sample was tested in three to six laboratories using a variety of commercially available or laboratory-developed platforms. The results were consistent among laboratories, with differences in allele assignments largely related to the manufacturer's assay design and variable nomenclature, especially for CYP2D6. The alleles included in the assay platforms varied, but most were identified in the set of 107 DNA samples. Nine additional pharmacogenetic loci (CYP4F2, EPHX1, ABCB1, HLAB, KIF6, CYP3A4, CYP3A5, TPMT, and DPD) were also tested. These samples are publicly available from Coriell and will be useful for quality assurance, proficiency testing, test development, and research. PMID:20889555

Young people's awareness on biobanking and DNA profiling: results of a questionnaire administered to Italian university students.

PubMed

Tozzo, Pamela; Fassina, Antonio; Caenazzo, Luciana

2017-12-01

Current policy approaches to social and ethical issues surrounding biobanks manifest lack of public information given by researchers and government, despite the evidence that Italian citizens are well informed about technical and other public perspectives of biotechnologies. For this reason, the focus of our survey was to interview our University's students on these aspects. The sample consisted of Padua University students (N = 959), who were administered a questionnaire comprising eight questions covering their knowledge about biobanks, their perception of the related benefits and risks, their willingness to donate samples to a biobank for research purposes, their attitude to having their own DNA profile included in a forensic DNA database, and the reasons behind their answers. The vast majority of the students invited to take part in the survey completed the questionnaire, and the number of participants sufficed to be considered representative of the target population. Despite the respondents' unfamiliarity with the topics explored, suggested by the huge group of respondents answering "I don't know" to the questions regarding Itaian regulation and reality, their answers demonstrate a general agreement to participate in a biobanking scheme for research purposes, as expressed by the 91% of respondents who were reportedly willing to donate their samples. As for the idea of a forensic DNA database, 35% of respondents said they would agree to having their profile included in such a database, even if they were not fully aware of the benefits and risks of such action.This study shows that Italian people with a higher education take a generally positive attitude to the idea of donating biological samples. It contributes to empirical evidence of what Italy's citizens understand about biobanking, and of their willingness to donate samples for research purposes, and also to have their genetic profiles included in a national forensic DNA database. Our findings may have clear implications for the policy discussion on biobanks in Italy, in particular it is important to take into account the Italian population's poor consciousness of forensic DNA database, in order to ensure a better interaction between policy makers and citizens and to make them more aware of the need to balance the individual's rights and the security of society.

Examples of kinship analysis where Profiler Plus™ was not discriminatory enough for the identification of victims using DNA identification.

PubMed

Hartman, D; Benton, L; Morenos, L; Beyer, J; Spiden, M; Stock, A

2011-02-25

The identification of the victims of the 2009 Victorian bushfires disaster, as in other mass disasters, relied on a number of scientific disciplines - including DNA analysis. As part of the DVI response, DNA analysis was performed to assist in the identification of victims through kinship (familial matching to relatives) or direct (self source of sample) matching of DNA profiles. The majority of the DNA identifications made (82%) were achieved through kinship matching of familial reference samples to post mortem (PM) samples obtained from the victims. Although each location affected by the bushfires could be treated as a mini-disaster (having a small closed-set of victims), with many such sites spread over vast areas, DNA analysis requires that the short tandem repeat (STR) system used be able to afford enough discrimination between all the DVI cases to assign a match. This publication highlights that although a 9-loci multiplex was sufficient for a DVI of this nature, there were instances that brought to light the short comings of using a 9-loci multiplex for kinship matching--particularly where multiple family members are victims. Moreso it serves to reinforce the recommendation that a minimum of 12 autosomal STR markers (plus Amelogenin) be used for DNA identification of victims which relies heavily on kinship matching. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

Detection of Invasive Mosquito Vectors Using Environmental DNA (eDNA) from Water Samples

PubMed Central

Schneider, Judith; Valentini, Alice; Dejean, Tony; Montarsi, Fabrizio; Taberlet, Pierre

2016-01-01

Repeated introductions and spread of invasive mosquito species (IMS) have been recorded on a large scale these last decades worldwide. In this context, members of the mosquito genus Aedes can present serious risks to public health as they have or may develop vector competence for various viral diseases. While the Tiger mosquito (Aedes albopictus) is a well-known vector for e.g. dengue and chikungunya viruses, the Asian bush mosquito (Ae. j. japonicus) and Ae. koreicus have shown vector competence in the field and the laboratory for a number of viruses including dengue, West Nile fever and Japanese encephalitis. Early detection and identification is therefore crucial for successful eradication or control strategies. Traditional specific identification and monitoring of different and/or cryptic life stages of the invasive Aedes species based on morphological grounds may lead to misidentifications, and are problematic when extensive surveillance is needed. In this study, we developed, tested and applied an environmental DNA (eDNA) approach for the detection of three IMS, based on water samples collected in the field in several European countries. We compared real-time quantitative PCR (qPCR) assays specific for these three species and an eDNA metabarcoding approach with traditional sampling, and discussed the advantages and limitations of these methods. Detection probabilities for eDNA-based approaches were in most of the specific comparisons higher than for traditional survey and the results were congruent between both molecular methods, confirming the reliability and efficiency of alternative eDNA-based techniques for the early and unambiguous detection and surveillance of invasive mosquito vectors. The ease of water sampling procedures in the eDNA approach tested here allows the development of large-scale monitoring and surveillance programs of IMS, especially using citizen science projects. PMID:27626642

Detection of Invasive Mosquito Vectors Using Environmental DNA (eDNA) from Water Samples.

PubMed

Schneider, Judith; Valentini, Alice; Dejean, Tony; Montarsi, Fabrizio; Taberlet, Pierre; Glaizot, Olivier; Fumagalli, Luca

2016-01-01

Repeated introductions and spread of invasive mosquito species (IMS) have been recorded on a large scale these last decades worldwide. In this context, members of the mosquito genus Aedes can present serious risks to public health as they have or may develop vector competence for various viral diseases. While the Tiger mosquito (Aedes albopictus) is a well-known vector for e.g. dengue and chikungunya viruses, the Asian bush mosquito (Ae. j. japonicus) and Ae. koreicus have shown vector competence in the field and the laboratory for a number of viruses including dengue, West Nile fever and Japanese encephalitis. Early detection and identification is therefore crucial for successful eradication or control strategies. Traditional specific identification and monitoring of different and/or cryptic life stages of the invasive Aedes species based on morphological grounds may lead to misidentifications, and are problematic when extensive surveillance is needed. In this study, we developed, tested and applied an environmental DNA (eDNA) approach for the detection of three IMS, based on water samples collected in the field in several European countries. We compared real-time quantitative PCR (qPCR) assays specific for these three species and an eDNA metabarcoding approach with traditional sampling, and discussed the advantages and limitations of these methods. Detection probabilities for eDNA-based approaches were in most of the specific comparisons higher than for traditional survey and the results were congruent between both molecular methods, confirming the reliability and efficiency of alternative eDNA-based techniques for the early and unambiguous detection and surveillance of invasive mosquito vectors. The ease of water sampling procedures in the eDNA approach tested here allows the development of large-scale monitoring and surveillance programs of IMS, especially using citizen science projects.

Efficient Genome-Wide Sequencing and Low-Coverage Pedigree Analysis from Noninvasively Collected Samples

PubMed Central

Snyder-Mackler, Noah; Majoros, William H.; Yuan, Michael L.; Shaver, Amanda O.; Gordon, Jacob B.; Kopp, Gisela H.; Schlebusch, Stephen A.; Wall, Jeffrey D.; Alberts, Susan C.; Mukherjee, Sayan; Zhou, Xiang; Tung, Jenny

2016-01-01

Research on the genetics of natural populations was revolutionized in the 1990s by methods for genotyping noninvasively collected samples. However, these methods have remained largely unchanged for the past 20 years and lag far behind the genomics era. To close this gap, here we report an optimized laboratory protocol for genome-wide capture of endogenous DNA from noninvasively collected samples, coupled with a novel computational approach to reconstruct pedigree links from the resulting low-coverage data. We validated both methods using fecal samples from 62 wild baboons, including 48 from an independently constructed extended pedigree. We enriched fecal-derived DNA samples up to 40-fold for endogenous baboon DNA and reconstructed near-perfect pedigree relationships even with extremely low-coverage sequencing. We anticipate that these methods will be broadly applicable to the many research systems for which only noninvasive samples are available. The lab protocol and software (“WHODAD”) are freely available at www.tung-lab.org/protocols-and-software.html and www.xzlab.org/software.html, respectively. PMID:27098910

[Quality of DNA from archival pathological samples of gallbladder cancer].

PubMed

Roa, Iván; de Toro, Gonzalo; Sánchez, Tamara; Slater, Jeannie; Ziegler, Anne Marie; Game, Anakaren; Arellano, Leonardo; Schalper, Kurt; de Aretxabala, Xabier

2013-12-01

The quality of the archival samples stored at pathology services could be a limiting factor for molecular biology studies. To determine the quality of DNA extracted from gallbladder cancer samples at different institutions. One hundred ninety four samples coming from five medical centers in Chile, were analyzed. DNA extraction was quantified determining genomic DNA concentration. The integrity of DNA was determined by polymerase chain reaction amplification of different length fragments of a constitutive gene (β-globin products of 110, 268 and 501 base pairs). The mean DNA concentration obtained in 194 gallbladder cancer samples was 48 ± 43.1 ng/µl. In 22% of samples, no amplification was achieved despite obtaining a mean DNA concentration of 58.3 ng/ul. In 81, 67 and 22% of samples, a DNA amplification of at least 110, 268 or 501 base pairs was obtained, respectively. No differences in DNA concentration according to the source of the samples were demonstrated. However, there were marked differences in DNA integrity among participating centers. Samples from public hospitals were of lower quality than those from private clinics. Despite some limitations, in 80% of cases, the integrity of DNA in archival samples from pathology services in our country would allow the use of molecular biology techniques.

Characterizing DNA preservation in degraded specimens of Amara alpina (Carabidae: Coleoptera).

PubMed

Heintzman, Peter D; Elias, Scott A; Moore, Karen; Paszkiewicz, Konrad; Barnes, Ian

2014-05-01

DNA preserved in degraded beetle (Coleoptera) specimens, including those derived from dry-stored museum and ancient permafrost-preserved environments, could provide a valuable resource for researchers interested in species and population histories over timescales from decades to millenia. However, the potential of these samples as genetic resources is currently unassessed. Here, using Sanger and Illumina shotgun sequence data, we explored DNA preservation in specimens of the ground beetle Amara alpina, from both museum and ancient environments. Nearly all museum specimens had amplifiable DNA, with the maximum amplifiable fragment length decreasing with age. Amplification of DNA was only possible in 45% of ancient specimens. Preserved mitochondrial DNA fragments were significantly longer than those of nuclear DNA in both museum and ancient specimens. Metagenomic characterization of extracted DNA demonstrated that parasite-derived sequences, including Wolbachia and Spiroplasma, are recoverable from museum beetle specimens. Ancient DNA extracts contained beetle DNA in amounts comparable to museum specimens. Overall, our data demonstrate that there is great potential for both museum and ancient specimens of beetles in future genetic studies, and we see no reason why this would not be the case for other orders of insect. © 2013 John Wiley & Sons Ltd.

Evaluation of Toxoplasma ELITe MGB Real-Time PCR Assay for Diagnosis of Toxoplasmosis

PubMed Central

Brenier-Pinchart, Marie-Pierre; Yera, Hélène; Belaz, Sorya; Varlet-Marie, Emmanuelle; Bastien, Patrick

2017-01-01

ABSTRACT Molecular diagnosis of congenital toxoplasmosis or disseminated toxoplasmosis is based mainly on PCR. The repeated DNA element rep529 has become the main DNA target used in most PCR methods, whether laboratory developed or commercial. In this multicenter study, we evaluated the Toxoplasma ELITe MGB (Elitech) commercial kit by comparison with three reference quantitative PCR assays (RAs) used routinely in three proficient laboratories of the French National Reference Center for Toxoplasmosis network, using Toxoplasma calibrated suspensions diluted to obtain a range of concentrations from 0.1 to 10,000 parasites/ml. These suspensions were extracted with either the DNA extraction kit (EXTRAblood; Elitech) recommended by the manufacturer or the QIAamp DNA minikit (Qiagen). The Toxoplasma ELITe MGB assay was also evaluated on a panel of 128 clinical samples, including 56 amniotic fluid samples, 55 placenta samples, and various other samples, of which 95 originated from patients with proven toxoplasmosis. The ELITe MGB assay amplified low-concentration replicates (<10 parasites/ml) of calibrated suspensions less frequently than the RAs of 2/3 laboratories. Additionally, the combination of EXTRAblood and Toxoplasma ELITe MGB yielded poorer sensitivity than the combination of QIAamp DNA minikit and ELITe MGB for low parasite concentrations (P < 0.001 for 1 parasite/ml). On clinical samples, the sensitivity and the specificity of the commercial assay were 89% and 100%, respectively. The sensitivity ranged from 79% (placenta samples) to 100% (amniotic fluid samples). Overall, this study shows that the Toxoplasma ELITe MGB assay is suitable for the diagnosis of toxoplasmosis from non-cell-rich or non-hemoglobin-rich samples and that the EXTRAblood kit is not optimal. PMID:28202794

Effect of preservation method on spider monkey (Ateles geoffroyi) fecal microbiota over 8 weeks.

PubMed

Hale, Vanessa L; Tan, Chia L; Knight, Rob; Amato, Katherine R

2015-06-01

Studies of the gut microbiome have become increasingly common with recent technological advances. Gut microbes play an important role in human and animal health, and gut microbiome analysis holds great potential for evaluating health in wildlife, as microbiota can be assessed from non-invasively collected fecal samples. However, many common fecal preservation protocols (e.g. freezing at -80 °C) are not suitable for field conditions, or have not been tested for long-term (greater than 2 weeks) storage. In this study, we collected fresh fecal samples from captive spider monkeys (Ateles geoffroyi) at the Columbian Park Zoo (Lafayette, IN, USA). The samples were pooled, homogenized, and preserved for up to 8 weeks prior to DNA extraction and sequencing. Preservation methods included: freezing at -20 °C, freezing at -80 °C, immersion in 100% ethanol, application to FTA cards, and immersion in RNAlater. At 0 (fresh), 1, 2, 4, and 8 weeks from fecal collection, DNA was extracted and microbial DNA was amplified and sequenced. DNA concentration, purity, microbial diversity, and microbial composition were compared across all methods and time points. DNA concentration and purity did not correlate with microbial diversity or composition. Microbial composition of frozen and ethanol samples were most similar to fresh samples. FTA card and RNAlater-preserved samples had the least similar microbial composition and abundance compared to fresh samples. Microbial composition and diversity were relatively stable over time within each preservation method. Based on these results, if freezers are not available, we recommend preserving fecal samples in ethanol (for up to 8weeks) prior to microbial extraction and analysis. Copyright © 2015 Elsevier B.V. All rights reserved.

Evaluation of Toxoplasma ELITe MGB Real-Time PCR Assay for Diagnosis of Toxoplasmosis.

PubMed

Robert-Gangneux, Florence; Brenier-Pinchart, Marie-Pierre; Yera, Hélène; Belaz, Sorya; Varlet-Marie, Emmanuelle; Bastien, Patrick

2017-05-01

Molecular diagnosis of congenital toxoplasmosis or disseminated toxoplasmosis is based mainly on PCR. The repeated DNA element rep529 has become the main DNA target used in most PCR methods, whether laboratory developed or commercial. In this multicenter study, we evaluated the Toxoplasma ELITe MGB (Elitech) commercial kit by comparison with three reference quantitative PCR assays (RAs) used routinely in three proficient laboratories of the French National Reference Center for Toxoplasmosis network, using Toxoplasma calibrated suspensions diluted to obtain a range of concentrations from 0.1 to 10,000 parasites/ml. These suspensions were extracted with either the DNA extraction kit (EXTRAblood; Elitech) recommended by the manufacturer or the QIAamp DNA minikit (Qiagen). The Toxoplasma ELITe MGB assay was also evaluated on a panel of 128 clinical samples, including 56 amniotic fluid samples, 55 placenta samples, and various other samples, of which 95 originated from patients with proven toxoplasmosis. The ELITe MGB assay amplified low-concentration replicates (<10 parasites/ml) of calibrated suspensions less frequently than the RAs of 2/3 laboratories. Additionally, the combination of EXTRAblood and Toxoplasma ELITe MGB yielded poorer sensitivity than the combination of QIAamp DNA minikit and ELITe MGB for low parasite concentrations ( P < 0.001 for 1 parasite/ml). On clinical samples, the sensitivity and the specificity of the commercial assay were 89% and 100%, respectively. The sensitivity ranged from 79% (placenta samples) to 100% (amniotic fluid samples). Overall, this study shows that the Toxoplasma ELITe MGB assay is suitable for the diagnosis of toxoplasmosis from non-cell-rich or non-hemoglobin-rich samples and that the EXTRAblood kit is not optimal. Copyright © 2017 American Society for Microbiology.

Ancient DNA from 8400 Year-Old Çatalhöyük Wheat: Implications for the Origin of Neolithic Agriculture

PubMed Central

Bilgic, Hatice; Hakki, Erdogan E.; Akkaya, Mahinur S.

2016-01-01

Human history was transformed with the advent of agriculture in the Fertile Crescent with wheat as one of the founding crops. Although the Fertile Crescent is renowned as the center of wheat domestication, archaeological studies have shown the crucial involvement of Çatalhöyük in this process. This site first gained attention during the 1961–65 excavations due to the recovery of primitive hexaploid wheat. However, despite the seeds being well preserved, a detailed archaeobotanical description of the samples is missing. In this article, we report on the DNA isolation, amplification and sequencing of ancient DNA of charred wheat grains from Çatalhöyük and other Turkish archaeological sites and the comparison of these wheat grains with contemporary wheat species including T. monococcum, T. dicoccum, T. dicoccoides, T. durum and T. aestivum at HMW glutenin protein loci. These ancient samples represent the oldest wheat sample sequenced to date and the first ancient wheat sample from the Middle East. Remarkably, the sequence analysis of the short DNA fragments preserved in seeds that are approximately 8400 years old showed that the Çatalhöyük wheat stock contained hexaploid wheat, which is similar to contemporary hexaploid wheat species including both naked (T. aestivum) and hulled (T. spelta) wheat. This suggests an early transitory state of hexaploid wheat agriculture from the Fertile Crescent towards Europe spanning present-day Turkey. PMID:26998604

DNA-PCR analysis of bloodstains sampled by the polyvinyl-alcohol method.

PubMed

Schyma, C; Huckenbeck, W; Bonte, W

1999-01-01

Among the usual techniques of sampling gunshot residues (GSR), the polyvinyl-alcohol method (PVAL) includes the advantage of embedding all particles, foreign bodies and stains on the surface of the shooter's hand in exact and reproducible topographic localization. The aim of the present study on ten persons killed by firearms was to check the possibility of DNA-PCR typing of blood traces embedded in the PVAL gloves in a second step following GSR analysis. The results of these examinations verify that the PVAL technique does not include factors that inhibit successful PCR typing. Thus the PVAL method can be recommended as a combination technique to secure and preserve inorganic and biological traces at the same time.

Sequencing historical specimens: successful preparation of small specimens with low amounts of degraded DNA.

PubMed

Sproul, John S; Maddison, David R

2017-11-01

Despite advances that allow DNA sequencing of old museum specimens, sequencing small-bodied, historical specimens can be challenging and unreliable as many contain only small amounts of fragmented DNA. Dependable methods to sequence such specimens are especially critical if the specimens are unique. We attempt to sequence small-bodied (3-6 mm) historical specimens (including nomenclatural types) of beetles that have been housed, dried, in museums for 58-159 years, and for which few or no suitable replacement specimens exist. To better understand ideal approaches of sample preparation and produce preparation guidelines, we compared different library preparation protocols using low amounts of input DNA (1-10 ng). We also explored low-cost optimizations designed to improve library preparation efficiency and sequencing success of historical specimens with minimal DNA, such as enzymatic repair of DNA. We report successful sample preparation and sequencing for all historical specimens despite our low-input DNA approach. We provide a list of guidelines related to DNA repair, bead handling, reducing adapter dimers and library amplification. We present these guidelines to facilitate more economical use of valuable DNA and enable more consistent results in projects that aim to sequence challenging, irreplaceable historical specimens. © 2017 John Wiley & Sons Ltd.

28 CFR 28.13 - Analysis and indexing of DNA samples.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 28 Judicial Administration 1 2011-07-01 2011-07-01 false Analysis and indexing of DNA samples. 28.13 Section 28.13 Judicial Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM DNA Sample Collection, Analysis, and Indexing § 28.13 Analysis and indexing of DNA samples. (a) The Federal Bureau of...

28 CFR 28.13 - Analysis and indexing of DNA samples.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Analysis and indexing of DNA samples. 28.13 Section 28.13 Judicial Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM DNA Sample Collection, Analysis, and Indexing § 28.13 Analysis and indexing of DNA samples. (a) The Federal Bureau of...

28 CFR 28.13 - Analysis and indexing of DNA samples.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 28 Judicial Administration 1 2012-07-01 2012-07-01 false Analysis and indexing of DNA samples. 28.13 Section 28.13 Judicial Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM DNA Sample Collection, Analysis, and Indexing § 28.13 Analysis and indexing of DNA samples. (a) The Federal Bureau of...

28 CFR 28.13 - Analysis and indexing of DNA samples.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 28 Judicial Administration 1 2014-07-01 2014-07-01 false Analysis and indexing of DNA samples. 28.13 Section 28.13 Judicial Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM DNA Sample Collection, Analysis, and Indexing § 28.13 Analysis and indexing of DNA samples. (a) The Federal Bureau of...

28 CFR 28.13 - Analysis and indexing of DNA samples.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 28 Judicial Administration 1 2013-07-01 2013-07-01 false Analysis and indexing of DNA samples. 28.13 Section 28.13 Judicial Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM DNA Sample Collection, Analysis, and Indexing § 28.13 Analysis and indexing of DNA samples. (a) The Federal Bureau of...

Potential of DNA sequences to identify zoanthids (Cnidaria: Zoantharia).

PubMed

Sinniger, Frederic; Reimer, James D; Pawlowski, Jan

2008-12-01

The order Zoantharia is known for its chaotic taxonomy and difficult morphological identification. One method that potentially could help for examining such troublesome taxa is DNA barcoding, which identifies species using standard molecular markers. The mitochondrial cytochrome oxidase subunit I (COI) has been utilized to great success in groups such as birds and insects; however, its applicability in many other groups is controversial. Recently, some studies have suggested that barcoding is not applicable to anthozoans. Here, we examine the use of COI and mitochondrial 16S ribosomal DNA for zoanthid identification. Despite the absence of a clear barcoding gap, our results show that for most of 54 zoanthid samples, both markers could separate samples to the species, or species group, level, particularly when easily accessible ecological or distributional data were included. Additionally, we have used the short V5 region of mt 16S rDNA to identify eight old (13 to 50 years old) museum samples. We discuss advantages and disadvantages of COI and mt 16S rDNA as barcodes for Zoantharia, and recommend that either one or both of these markers be considered for zoanthid identification in the future.

Sequencing degraded DNA from non-destructively sampled museum specimens for RAD-tagging and low-coverage shotgun phylogenetics.

PubMed

Tin, Mandy Man-Ying; Economo, Evan Philip; Mikheyev, Alexander Sergeyevich

2014-01-01

Ancient and archival DNA samples are valuable resources for the study of diverse historical processes. In particular, museum specimens provide access to biotas distant in time and space, and can provide insights into ecological and evolutionary changes over time. However, archival specimens are difficult to handle; they are often fragile and irreplaceable, and typically contain only short segments of denatured DNA. Here we present a set of tools for processing such samples for state-of-the-art genetic analysis. First, we report a protocol for minimally destructive DNA extraction of insect museum specimens, which produced sequenceable DNA from all of the samples assayed. The 11 specimens analyzed had fragmented DNA, rarely exceeding 100 bp in length, and could not be amplified by conventional PCR targeting the mitochondrial cytochrome oxidase I gene. Our approach made these samples amenable to analysis with commonly used next-generation sequencing-based molecular analytic tools, including RAD-tagging and shotgun genome re-sequencing. First, we used museum ant specimens from three species, each with its own reference genome, for RAD-tag mapping. Were able to use the degraded DNA sequences, which were sequenced in full, to identify duplicate reads and filter them prior to base calling. Second, we re-sequenced six Hawaiian Drosophila species, with millions of years of divergence, but with only a single available reference genome. Despite a shallow coverage of 0.37 ± 0.42 per base, we could recover a sufficient number of overlapping SNPs to fully resolve the species tree, which was consistent with earlier karyotypic studies, and previous molecular studies, at least in the regions of the tree that these studies could resolve. Although developed for use with degraded DNA, all of these techniques are readily applicable to more recent tissue, and are suitable for liquid handling automation.

Target capture enrichment of nuclear SNP markers for massively parallel sequencing of degraded and mixed samples.

PubMed

Bose, Nikhil; Carlberg, Katie; Sensabaugh, George; Erlich, Henry; Calloway, Cassandra

2018-05-01

DNA from biological forensic samples can be highly fragmented and present in limited quantity. When DNA is highly fragmented, conventional PCR based Short Tandem Repeat (STR) analysis may fail as primer binding sites may not be present on a single template molecule. Single Nucleotide Polymorphisms (SNPs) can serve as an alternative type of genetic marker for analysis of degraded samples because the targeted variation is a single base. However, conventional PCR based SNP analysis methods still require intact primer binding sites for target amplification. Recently, probe capture methods for targeted enrichment have shown success in recovering degraded DNA as well as DNA from ancient bone samples using next-generation sequencing (NGS) technologies. The goal of this study was to design and test a probe capture assay targeting forensically relevant nuclear SNP markers for clonal and massively parallel sequencing (MPS) of degraded and limited DNA samples as well as mixtures. A set of 411 polymorphic markers totaling 451 nuclear SNPs (375 SNPs and 36 microhaplotype markers) was selected for the custom probe capture panel. The SNP markers were selected for a broad range of forensic applications including human individual identification, kinship, and lineage analysis as well as for mixture analysis. Performance of the custom SNP probe capture NGS assay was characterized by analyzing read depth and heterozygote allele balance across 15 samples at 25 ng input DNA. Performance thresholds were established based on read depth ≥500X and heterozygote allele balance within ±10% deviation from 50:50, which was observed for 426 out of 451 SNPs. These 426 SNPs were analyzed in size selected samples (at ≤75 bp, ≤100 bp, ≤150 bp, ≤200 bp, and ≤250 bp) as well as mock degraded samples fragmented to an average of 150 bp. Samples selected for ≤75 bp exhibited 99-100% reportable SNPs across varied DNA amounts and as low as 0.5 ng. Mock degraded samples at 1 ng and 10 ng exhibited >90% reportable SNPs. Finally, two-person male-male mixtures were tested at 10 ng in contributor varying ratios. Overall, 85-100% of alleles unique to the minor contributor were observed at all mixture ratios. Results from these studies using the SNP probe capture NGS system demonstrates proof of concept for application to forensically relevant degraded and mixed DNA samples. Copyright © 2018 Elsevier B.V. All rights reserved.

Detection of Circulating Mucorales DNA in Critically Ill Burn Patients: Preliminary Report of a Screening Strategy for Early Diagnosis and Treatment.

PubMed

Legrand, Matthieu; Gits-Muselli, Maud; Boutin, Louis; Garcia-Hermoso, Dea; Maurel, Véronique; Soussi, Sabri; Benyamina, Mourad; Ferry, Axelle; Chaussard, Maïté; Hamane, Samia; Denis, Blandine; Touratier, Sophie; Guigue, Nicolas; Fréalle, Emilie; Jeanne, Mathieu; Shaal, Jean-Vivien; Soler, Charles; Mimoun, Maurice; Chaouat, Marc; Lafaurie, Matthieu; Mebazaa, Alexandre; Bretagne, Stéphane; Alanio, Alexandre

2016-11-15

 Invasive wound mucormycosis (IWM) is associated with an extremely poor outcome among critically ill burn patients. We describe the detection of circulating Mucorales DNA (cmDNA) for the early diagnosis of IWM in those patients and report the potential value of detecting cmDNA for treatment guidance.  Severely ill burn patients admitted to our tertiary referral center between October 2013 and February 2016 were included. Retrospective plasma samples were tested for the presence of cmDNA by quantitative real-time polymerase chain reaction (qPCR). Patients were then prospectively screened twice a week, and liposomal amphotericin-B therapy initiated based on a positive qPCR. The primary endpoint was the time between cmDNA detection and standard diagnosis. Secondary endpoints were the time from cmDNA detection and treatment initiation and mortality.  Seventy-seven patients (418 samples) were included. The average age was 46 (28-60) years, abbreviated burn severity index was 8 (7-10), and simplified acute physiology score was 33 (23-46). The total body surface area was 33% (22%-52%). cmDNA was detected 11 (4.5-15) days before standard diagnosis. The in-hospital mortality was 62% for patients with IWM and 24% for those without (P = .03). The mortality due to IWM was 80% during period A and 33% during period B (P = .46).  This study suggests that the detection of cmDNA allows earlier diagnosis of IWM in severely ill burn patients and earlier initiation of treatment. Further studies are needed to confirm the impact of earlier treatment initiation on patient outcome. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

Early detection monitoring for aquatic non-indigenous species: Optimizing surveillance, incorporating advanced technologies, and identifying research needs.

PubMed

Trebitz, Anett S; Hoffman, Joel C; Darling, John A; Pilgrim, Erik M; Kelly, John R; Brown, Emily A; Chadderton, W Lindsay; Egan, Scott P; Grey, Erin K; Hashsham, Syed A; Klymus, Katy E; Mahon, Andrew R; Ram, Jeffrey L; Schultz, Martin T; Stepien, Carol A; Schardt, James C

2017-11-01

Following decades of ecologic and economic impacts from a growing list of nonindigenous and invasive species, government and management entities are committing to systematic early- detection monitoring (EDM). This has reinvigorated investment in the science underpinning such monitoring, as well as the need to convey that science in practical terms to those tasked with EDM implementation. Using the context of nonindigenous species in the North American Great Lakes, this article summarizes the current scientific tools and knowledge - including limitations, research needs, and likely future developments - relevant to various aspects of planning and conducting comprehensive EDM. We begin with the scope of the effort, contrasting target-species with broad-spectrum monitoring, reviewing information to support prioritization based on species and locations, and exploring the challenge of moving beyond individual surveys towards a coordinated monitoring network. Next, we discuss survey design, including effort to expend and its allocation over space and time. A section on sample collection and analysis overviews the merits of collecting actual organisms versus shed DNA, reviews the capabilities and limitations of identification by morphology, DNA target markers, or DNA barcoding, and examines best practices for sample handling and data verification. We end with a section addressing the analysis of monitoring data, including methods to evaluate survey performance and characterize and communicate uncertainty. Although the body of science supporting EDM implementation is already substantial, research and information needs (many already actively being addressed) include: better data to support risk assessments that guide choice of taxa and locations to monitor; improved understanding of spatiotemporal scales for sample collection; further development of DNA target markers, reference barcodes, genomic workflows, and synergies between DNA-based and morphology-based taxonomy; and tools and information management systems for better evaluating and communicating survey outcomes and uncertainty. Published by Elsevier Ltd.

Surface Modification of Silicon Pillar Arrays To Enhance Fluorescence Detection of Uranium and DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lincoln, Danielle R.; Charlton, Jennifer J.; Hatab, Nahla A.

There is an ever-growing need for detection methods that are both sensitive and efficient, such that reagent and sample consumption is minimized. Nanopillar arrays offer an attractive option to fill this need by virtue of their small scale in conjunction with their field enhancement intensity gains. This work investigates the use of nanopillar substrates for the detection of the uranyl ion and DNA, two analytes unalike but for their low quantum efficiencies combined with the need for high-throughput analyses. Here in this paper, the adaptability of these platforms was explored, as methods for the successful surface immobilization of both analytesmore » were developed and compared, resulting in a limit of detection for the uranyl ion of less than 1 ppm with a 0.2 μL sample volume. Moreover, differentiation between single-stranded and double-stranded DNA was possible, including qualitative identification between double-stranded DNA and DNA of the same sequence, but with a 10-base-pair mismatch.« less

Surface Modification of Silicon Pillar Arrays To Enhance Fluorescence Detection of Uranium and DNA

DOE PAGES

Lincoln, Danielle R.; Charlton, Jennifer J.; Hatab, Nahla A.; ...

2017-10-27

There is an ever-growing need for detection methods that are both sensitive and efficient, such that reagent and sample consumption is minimized. Nanopillar arrays offer an attractive option to fill this need by virtue of their small scale in conjunction with their field enhancement intensity gains. This work investigates the use of nanopillar substrates for the detection of the uranyl ion and DNA, two analytes unalike but for their low quantum efficiencies combined with the need for high-throughput analyses. Here in this paper, the adaptability of these platforms was explored, as methods for the successful surface immobilization of both analytesmore » were developed and compared, resulting in a limit of detection for the uranyl ion of less than 1 ppm with a 0.2 μL sample volume. Moreover, differentiation between single-stranded and double-stranded DNA was possible, including qualitative identification between double-stranded DNA and DNA of the same sequence, but with a 10-base-pair mismatch.« less

Pearson marrow pancreas syndrome in patients suspected to have Diamond-Blackfan anemia.

PubMed

Gagne, Katelyn E; Ghazvinian, Roxanne; Yuan, Daniel; Zon, Rebecca L; Storm, Kelsie; Mazur-Popinska, Magdalena; Andolina, Laura; Bubala, Halina; Golebiowska, Sydonia; Higman, Meghan A; Kalwak, Krzysztof; Kurre, Peter; Matysiak, Michal; Niewiadomska, Edyta; Pels, Salley; Petruzzi, Mary Jane; Pobudejska-Pieniazek, Aneta; Szczepanski, Tomasz; Fleming, Mark D; Gazda, Hanna T; Agarwal, Suneet

2014-07-17

Pearson marrow pancreas syndrome (PS) is a multisystem disorder caused by mitochondrial DNA (mtDNA) deletions. Diamond-Blackfan anemia (DBA) is a congenital hypoproliferative anemia in which mutations in ribosomal protein genes and GATA1 have been implicated. Both syndromes share several features including early onset of severe anemia, variable nonhematologic manifestations, sporadic genetic occurrence, and occasional spontaneous hematologic improvement. Because of the overlapping features and relative rarity of PS, we hypothesized that some patients in whom the leading clinical diagnosis is DBA actually have PS. Here, we evaluated patient DNA samples submitted for DBA genetic studies and found that 8 (4.6%) of 173 genetically uncharacterized patients contained large mtDNA deletions. Only 2 (25%) of the patients had been diagnosed with PS on clinical grounds subsequent to sample submission. We conclude that PS can be overlooked, and that mtDNA deletion testing should be performed in the diagnostic evaluation of patients with congenital anemia. © 2014 by The American Society of Hematology.

Early detection of marine invasive species, Bugula neritina (Bryozoa: Cheilostomatida), using species-specific primers and environmental DNA analysis in Korea.

PubMed

Kim, Philjae; Kim, Donghwan; Yoon, Tae Joong; Shin, Sook

2018-08-01

The bryozoan, Bugula neritina, is one of the most widespread sessile marine invasive species. Since its first discovery in Korea in 1978, the gradual increase in the distribution and abundance of this species resulted in a significant damage to growth of aquaculture. Environmental DNA (eDNA) is a potentially useful tool for species detection including rare, invasive and threatened native species. In this study, species-specific primers and probe were designed to amplify a 185-bp region based on mitochondrial COI of B. neritina for monitoring, and tested on environmental samples from 35 harbors of Korea in 2017. Among 35 sites monitored, B. neritina colonies were detected in 27 sites during field survey. However, B. neritina DNA was detected in all examined eDNA isolated from seawater. These results suggested that eDNA-based methods coupled with simple seawater sampling could be suitable for determining the distribution and abundance of B. neritina as complementary traditional monitoring. Copyright © 2018 Elsevier Ltd. All rights reserved.

Polyethyleneimine-iron phosphate nanocomposite as a promising adsorbent for the isolation of DNA.

PubMed

Hu, Lin-Lin; Hu, Bo; Shen, Li-Ming; Zhang, Dan-Dan; Chen, Xu-Wei; Wang, Jian-Hua

2015-01-01

A polyethyleneimine (PEI)-iron phosphate (FePO4) nanocomposite is prepared by immobilization of PEI onto the surface of FePO4 nanoparticles via electrostatic interaction. The obtained PEI-FePO4 nanocomposites are spherical with a size centered in ca. 100 nm. They provide a novel adsorbent for the solid-phase extraction of DNA from complex sample matrices. At pH 4, 50 μg mL(-1) of DNA (salmon sperm DNA sodium salt) in 1.0 mL aqueous solution are quantitatively adsorbed (100%) by 2mg of the PEI-FePO4 nanocomposites, and meanwhile the coexisting albumin at a same concentration level is not retained, demonstrating the favorable selectivity of the nanocomposites to DNA against proteins. The adsorption behaviors of DNA onto the PEI-FePO4 nanocomposites fit Langmuir model, corresponding to an adsorption capacity of 61.88 mg g(-1). The adsorbed DNA could be readily recovered by using a 0.04 mol L(-1) Britton-Robinson (BR) buffer at pH 10, resulting in a recovery of 85%. The nanocomposites have been further used for the isolation of DNA from a series of real sample matrices, including synthetic λ-DNA sample, human whole blood and Escherichia coli cell lysate. The extraction efficiency and the purity of the recovered DNA are at least comparable to those achieved by using the reported sorbent materials or commercial kits. In addition, the DNAs isolated from human whole blood and E. coli cell lysate are of high quality, which have been further demonstrated by using them as templates for successful PCR amplifications. Copyright © 2014 Elsevier B.V. All rights reserved.

Parvovirus B19V DNA contamination in Chinese plasma and plasma derivatives

PubMed Central

2012-01-01

Background To ensure the safety of plasma derivatives, screening for human parvovirus B19V genomic DNA in donated plasma using a pooling strategy is performed in some countries. We investigated the prevalence of B19V DNA and anti-B19V antibodies in Chinese plasma pools, plasma derivatives and plasma donations to evaluate the risk posed by B19V. Methods Using a Q-PCR assay developed in-house, we tested for B19V genomic DNA in 142 plasma pools collected between January 2009 and June 2011 from two Chinese blood products manufacturers. Plasma derivatives collected between 1993–1995 (10 batches of albumin, 155 batches of intravenous immunoglobulin, IVIG) and 2009–2011 (50 batches of albumin, 54 batches of IVIG, 35 batches of factor VIII, 7 batches of fibrinogen, and 17 batches of prothrombin complex concentrate, PCC) were also tested for B19V contamination. In addition, B19V genome prevalence in minipools(including 90 individual donations) of 49680 individual plasma samples collected between August 2011 and March 2012 by a single Chinese manufacturer was investigated. IgM/IgG was also investigated in plasma pools/derivatives and in minipools with B19V-DNA titers above 1x104 and 1x106 geq/mL using B19 ELISA IgM/IgG assay(Virion-Serion, Würzburg, Germany), respectively. Results B19V-DNA was detected in 54.2% of plasma pools from two Chinese blood product manufacturers; among recently produced blood products, B19V was detected in 21/54 IVIG samples, 19/35 factor VIII samples, 6/7 fibrinogen samples, and 12/17 PCC samples, but not in albumin samples. The levels of B19V-DNA in these samples varied from 102-107 geq/mL. In samples with >104 geq/mL genome DNA, B19V-specific IgG was also found in all corresponding plasma pools and IVIG, whereas none was detected in the majority of other plasma derivatives. Screening of plasma donations indicated that most minipools were contaminated with B19V-DNA (102-108 geq/mL) and one donation had 1.09 × 1010 geq/mL B19V genomic DNA along with a non-classical IgG/IgM profile. Conclusions Despite the implementation of some inactivation/removal methods designed to prevent viral contamination, B19V DNA was detectable in Chinese plasma pools and plasma derivatives. Thus, the introduction of B19V screening and discard donation with high viramic concentration for Chinese plasma donors would be desirable. PMID:22978673

Detection of Pneumocystis jirovecii by nested PCR in HIV-negative patients with pulmonary disease.

PubMed

Santos, Cristina Rodrigues; de Assis, Ângela M; Luz, Edson A; Lyra, Luzia; Toro, Ivan F; Seabra, José Claudio C; Daldin, Dira H; Marcalto, Tathiane U; Galasso, Marcos T; Macedo, Ronaldo F; Schreiber, Angélica Z; Aoki, Francisco H

Nested PCR can be used to determine the status of Pneumocystis jirovecii infection in other lung diseases. This study sought to detect a target DNA fragment (mitochondrial large subunit rRNA or mtL SUrRNA) of P. jirovecii in patients with lung disease who underwent bronchoscopy with collection of bronchoalveolar lavage (BAL). The results from toluidine blue staining were compared with those obtained using molecular methods that included an "in house" DNA extraction procedure, PCR and nested PCR. Fifty-five BAL samples from patients with atypical chest X-rays were screened for P. jirovecii. None of the samples was positive for P. jirovecii using toluidine blue staining. In contrast, P. jirovecii DNA was detected by nested PCR in BAL samples from 36 of 55 patients (65.5%). The lung diseases in the patients included cancer, pneumonia, tuberculosis, and chronic obstructive pulmonary disease (COPD). Other chronic problems in the patients included hypertension, diabetes, smoking, and alcoholism. Nested PCR showed high sensitivity for detecting P. jirovecii, especially when compared with toluidine blue staining. Using this method, P. jirovecii infection was detected in HIV-negative patients with lung disease. Copyright © 2016 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.

Using mitochondrial DNA to test the hypothesis of a European post-glacial human recolonization from the Franco-Cantabrian refuge.

PubMed

García, O; Fregel, R; Larruga, J M; Álvarez, V; Yurrebaso, I; Cabrera, V M; González, A M

2011-01-01

It has been proposed that the distribution patterns and coalescence ages found in Europeans for mitochondrial DNA (mtDNA) haplogroups V, H1 and H3 are the result of a post-glacial expansion from a Franco-Cantabrian refuge that recolonized central and northern areas. In contrast, in this refined mtDNA study of the Cantabrian Cornice that contributes 413 partial and 9 complete new mtDNA sequences, including a large Basque sample and a sample of Asturians, no experimental evidence was found to support the human refuge-expansion theory. In fact, all measures of gene diversity point to the Cantabrian Cornice in general and the Basques in particular, as less polymorphic for V, H1 and H3 than other southern regions in Iberia or in Central Europe. Genetic distances show the Cantabrian Cornice is a very heterogeneous region with significant local differences. The analysis of several minor subhaplogroups, based on complete sequences, also suggests different focal expansions over a local and peninsular range that did not affect continental Europe. Furthermore, all detected clinal trends show stronger longitudinal than latitudinal profiles. In Northern Iberia, it seems that the highest diversity values for some haplogroups with Mesolithic coalescence ages are centred on the Mediterranean side, including Catalonia and South-eastern France.

Microsatellite markers for northern red oak (Fagaceae: Quercus rubra)

Treesearch

Preston R. Aldrich; Charles H. Michler; Weilin Sun; Jeanne Romero-Severson

2002-01-01

We provide primer sequences for 14 (GA)n microsatellite loci developed from northern red oak, an important timber species. We screened loci using two sets of samples. A parent-offspring set included DNA from seven acorns collected from one mother tree along with maternal DNA, to determine that all progeny carried a maternal allele at each locus....

Evaluation of milk sample fractions for characterization of milk microbiota from healthy and clinical mastitis cows

PubMed Central

Lima, Svetlana Ferreira; Bicalho, Marcela Lucas de Souza

2018-01-01

Amplicon sequencing technique has been increasingly applied to the clinical setting as a sensitive diagnostic tool. Therefore, it is of great importance to develop a DNA extraction method that accurate isolates DNA from complex host-associated microbiota. Given the multifactorial etiology of clinical mastitis and the diversified lifestyle of bacterial species harboring in milk, here four distinct milk sample fractions: raw whole milk, milk fat, casein-pellet, and casein-pellet + fat from healthy cows and cows with clinical mastitis, were subjected to bead-beating DNA extraction, followed by high-throughput sequencing. We aimed to identify the best approach for characterization of the milk microbiota and detection of mastitis pathogens (Klebsiella spp., Streptococcus spp. and Escherichia coli). DNA from each milk fraction tested was extracted by two commercial kits, which include physical, mechanical and chemical lysis; in total 280 DNA samples from 35 cows were analyzed. Milk-health-status were categorized into four groups (healthy group; E. coli-mastitis group; Klebsiella spp.-mastitis group; and Streptococcus spp.–mastitis group). Bacterial phyla and families were described for each milk-health-status group across milk sample fractions and DNA extraction kits. For the mastitis groups the relative abundance of f__Enterobacteriaceae and f__Streptococcaceae were compared to determine the efficacy of procedures in detecting the mastitis pathogens. The four milk fractions used allowed efficiently and uniformly detection of the causative agent of mastitis. Only 27% of the families detected in healthy milk were shared among the samples extracted from all fractions of milk samples; followed by 3, 4, and 12% for the samples from E. coli-mastitis, Klebsiella spp.-mastitis and Streptococcus spp-mastitis, respectively. However, the shared families comprised a mean relative abundance greater than 85%, regardless of milk-health-status, milk fraction and DNA isolation method. Taxonomic data at the family level showed that sequences from mastitis milk samples cultured positive for E. coli and Klebsiella spp. were predominantly affiliated with f__Enterobacteriaceae, while for Streptococcus spp. were dominated by f__Streptococcacea, followed by f__Pseudomonadaceae and f__Enterococcaceae. Microbial community analysis revealed that most of the microbial community composition corresponded to milk bacterial species irrespective of the DNA isolation method and milk fraction evaluated. PMID:29561873

Microbial Communities in Pre-Columbian Coprolites

PubMed Central

Santiago-Rodriguez, Tasha M.; Narganes-Storde, Yvonne M.; Chanlatte, Luis; Crespo-Torres, Edwin; Toranzos, Gary A.; Jimenez-Flores, Rafael; Hamrick, Alice; Cano, Raul J.

2013-01-01

The study of coprolites from earlier cultures represents a great opportunity to study an “unaltered” composition of the intestinal microbiota. To test this, pre-Columbian coprolites from two cultures, the Huecoid and Saladoid, were evaluated for the presence of DNA, proteins and lipids by cytochemical staining, human and/or dog-specific Bacteroides spp. by PCR, as well as bacteria, fungi and archaea using Terminal Restriction Fragment analyses. DNA, proteins and lipids, and human-specific Bacteroides DNA were detected in all coprolites. Multidimensional scaling analyses resulted in spatial arrangements of microbial profiles by culture, further supported by cluster analysis and ANOSIM. Differences between the microbial communities were positively correlated with culture, and SIMPER analysis indicated 68.8% dissimilarity between the Huecoid and Saladoid. Proteobacteria, Bacteroidetes and methanogens were found in all coprolite samples. Propionebacteria, Shewanella and lactic acid bacteria dominated in the Huecoid samples, while Acidobacteria, and peptococci were dominant in Saladoid samples. Yeasts, including Candida albicans and Crypotococcus spp. were found in all samples. Basidiomycetes were the most notable fungi in Huecoid samples while Ascomycetes predominated in Saladoid samples, suggesting differences in dietary habits. Our study provides an approach for the study of the microbial communities of coprolite samples from various cultures. PMID:23755194

Application of rDNA-PCR amplification and DGGE fingerprinting for detection of microbial diversity in a Malaysian crude oil.

PubMed

Liew, Pauline Woanying; Jong, Bor Chyan

2008-05-01

Two culture-independent methods, namely ribosomal DNA libraries and denaturing gradient gel electrophoresis (DGGE), were adopted to examine the microbial community of a Malaysian light crude oil. In this study, both 16S and 18S rDNAs were PCR-amplified from bulk DNA of crude oil samples, cloned, and sequenced. Analyses of restriction fragment length polymorphism (RFLP) and phylogenetics clustered the 16S and 18S rDNA sequences into seven and six groups, respectively. The ribosomal DNA sequences obtained showed sequence similarity between 90 to 100% to those available in the GenBank database. The closest relatives documented for the 16S rDNAs include member species of Thermoincola and Rhodopseudomonas, whereas the closest fungal relatives include Acremonium, Ceriporiopsis, Xeromyces, Lecythophora, and Candida. Others were affiliated to uncultured bacteria and uncultured ascomycete. The 16S rDNA library demonstrated predomination by a single uncultured bacterial type by >80% relative abundance. The predomination was confirmed by DGGE analysis.

Digital PCR methods improve detection sensitivity and measurement precision of low abundance mtDNA deletions.

PubMed

Belmonte, Frances R; Martin, James L; Frescura, Kristin; Damas, Joana; Pereira, Filipe; Tarnopolsky, Mark A; Kaufman, Brett A

2016-04-28

Mitochondrial DNA (mtDNA) mutations are a common cause of primary mitochondrial disorders, and have also been implicated in a broad collection of conditions, including aging, neurodegeneration, and cancer. Prevalent among these pathogenic variants are mtDNA deletions, which show a strong bias for the loss of sequence in the major arc between, but not including, the heavy and light strand origins of replication. Because individual mtDNA deletions can accumulate focally, occur with multiple mixed breakpoints, and in the presence of normal mtDNA sequences, methods that detect broad-spectrum mutations with enhanced sensitivity and limited costs have both research and clinical applications. In this study, we evaluated semi-quantitative and digital PCR-based methods of mtDNA deletion detection using double-stranded reference templates or biological samples. Our aim was to describe key experimental assay parameters that will enable the analysis of low levels or small differences in mtDNA deletion load during disease progression, with limited false-positive detection. We determined that the digital PCR method significantly improved mtDNA deletion detection sensitivity through absolute quantitation, improved precision and reduced assay standard error.

Membrane vesicles in sea water: heterogeneous DNA content and implications for viral abundance estimates

PubMed Central

Biller, Steven J; McDaniel, Lauren D; Breitbart, Mya; Rogers, Everett; Paul, John H; Chisholm, Sallie W

2017-01-01

Diverse microbes release membrane-bound extracellular vesicles from their outer surfaces into the surrounding environment. Vesicles are found in numerous habitats including the oceans, where they likely have a variety of functional roles in microbial ecosystems. Extracellular vesicles are known to contain a range of biomolecules including DNA, but the frequency with which DNA is packaged in vesicles is unknown. Here, we examine the quantity and distribution of DNA associated with vesicles released from five different bacteria. The average quantity of double-stranded DNA and size distribution of DNA fragments released within vesicles varies among different taxa. Although some vesicles contain sufficient DNA to be visible following staining with the SYBR fluorescent DNA dyes typically used to enumerate viruses, this represents only a small proportion (<0.01–1%) of vesicles. Thus DNA is packaged heterogeneously within vesicle populations, and it appears that vesicles are likely to be a minor component of SYBR-visible particles in natural sea water compared with viruses. Consistent with this hypothesis, chloroform treatment of coastal and offshore seawater samples reveals that vesicles increase epifluorescence-based particle (viral) counts by less than an order of magnitude and their impact is variable in space and time. PMID:27824343

Digital PCR methods improve detection sensitivity and measurement precision of low abundance mtDNA deletions

PubMed Central

Belmonte, Frances R.; Martin, James L.; Frescura, Kristin; Damas, Joana; Pereira, Filipe; Tarnopolsky, Mark A.; Kaufman, Brett A.

2016-01-01

Mitochondrial DNA (mtDNA) mutations are a common cause of primary mitochondrial disorders, and have also been implicated in a broad collection of conditions, including aging, neurodegeneration, and cancer. Prevalent among these pathogenic variants are mtDNA deletions, which show a strong bias for the loss of sequence in the major arc between, but not including, the heavy and light strand origins of replication. Because individual mtDNA deletions can accumulate focally, occur with multiple mixed breakpoints, and in the presence of normal mtDNA sequences, methods that detect broad-spectrum mutations with enhanced sensitivity and limited costs have both research and clinical applications. In this study, we evaluated semi-quantitative and digital PCR-based methods of mtDNA deletion detection using double-stranded reference templates or biological samples. Our aim was to describe key experimental assay parameters that will enable the analysis of low levels or small differences in mtDNA deletion load during disease progression, with limited false-positive detection. We determined that the digital PCR method significantly improved mtDNA deletion detection sensitivity through absolute quantitation, improved precision and reduced assay standard error. PMID:27122135

Qualitative and quantitative assessment of Illumina's forensic STR and SNP kits on MiSeq FGx™.

PubMed

Sharma, Vishakha; Chow, Hoi Yan; Siegel, Donald; Wurmbach, Elisa

2017-01-01

Massively parallel sequencing (MPS) is a powerful tool transforming DNA analysis in multiple fields ranging from medicine, to environmental science, to evolutionary biology. In forensic applications, MPS offers the ability to significantly increase the discriminatory power of human identification as well as aid in mixture deconvolution. However, before the benefits of any new technology can be employed, a thorough evaluation of its quality, consistency, sensitivity, and specificity must be rigorously evaluated in order to gain a detailed understanding of the technique including sources of error, error rates, and other restrictions/limitations. This extensive study assessed the performance of Illumina's MiSeq FGx MPS system and ForenSeq™ kit in nine experimental runs including 314 reaction samples. In-depth data analysis evaluated the consequences of different assay conditions on test results. Variables included: sample numbers per run, targets per run, DNA input per sample, and replications. Results are presented as heat maps revealing patterns for each locus. Data analysis focused on read numbers (allele coverage), drop-outs, drop-ins, and sequence analysis. The study revealed that loci with high read numbers performed better and resulted in fewer drop-outs and well balanced heterozygous alleles. Several loci were prone to drop-outs which led to falsely typed homozygotes and therefore to genotype errors. Sequence analysis of allele drop-in typically revealed a single nucleotide change (deletion, insertion, or substitution). Analyses of sequences, no template controls, and spurious alleles suggest no contamination during library preparation, pooling, and sequencing, but indicate that sequencing or PCR errors may have occurred due to DNA polymerase infidelities. Finally, we found utilizing Illumina's FGx System at recommended conditions does not guarantee 100% outcomes for all samples tested, including the positive control, and required manual editing due to low read numbers and/or allele drop-in. These findings are important for progressing towards implementation of MPS in forensic DNA testing.

Ethanol and sodium acetate as a preservation method to delay degradation of environmental DNA

USGS Publications Warehouse

Ladell, Bridget A.; Walleser, Liza R.; McCalla, S. Grace; Erickson, Richard A.; Amberg, Jon J.

2018-01-01

Environmental DNA (eDNA) samples that are collected from remote locations depend on rapid stabilization of the DNA. The degradation of eDNA in water samples is minimized when samples are stored at ≤ 4 °C. Developing a preservation technique to maintain eDNA integrity at room temperature would allow a wider range of locations to be sampled. We evaluated an ethanol and sodium acetate solution to maintain the integrity of the DNA samples for the time between collection and lab testing. For this evaluation, replicate water samples taken from a tank housing Asian carp were placed on ice or held at room temperature. At both temperatures, water samples were left untreated or were preserved with an ethanol and sodium acetate solution (EtOH–NaAc). Every day for 6 days following collection, a subset of the samples was removed from each preservation method and DNA was extracted and nuclear and mitochondrial markers were assayed with qPCR. Results showed comparable persistence of DNA between iced samples without the EtOH–NaAc treatment and samples that received EtOH–NaAc treatment that were kept at room temperature. We found that DNA can be amplified from preserved samples using an EtOH–NaAc solution after up to 7 days at room temperature.

A protocol for collecting environmental DNA samples from streams

Treesearch

Kellie J. Carim; Kevin S. McKelvey; Michael K. Young; Taylor M. Wilcox; Michael K. Schwartz

2016-01-01

Environmental DNA (eDNA) is DNA that has been released by an organism into its environment, such that the DNA can be found in air, water, or soil. In aquatic systems, eDNA has been shown to provide a sampling approach that is more sensitive for detecting target organisms faster, and less expensively than previous approaches. However, eDNA needs to be sampled in a...

Developmental validation of the PowerPlex(®) Fusion 6C System.

PubMed

Ensenberger, Martin G; Lenz, Kristy A; Matthies, Learden K; Hadinoto, Gregory M; Schienman, John E; Przech, Angela J; Morganti, Michael W; Renstrom, Daniel T; Baker, Victoria M; Gawrys, Kori M; Hoogendoorn, Marlijn; Steffen, Carolyn R; Martín, Pablo; Alonso, Antonio; Olson, Hope R; Sprecher, Cynthia J; Storts, Douglas R

2016-03-01

The PowerPlex(®) Fusion 6C System is a 27-locus, six-dye, multiplex that includes all markers in the expanded CODIS core loci and increases overlap with STR database standards throughout the world. Additionally, it contains two, rapidly mutating, Y-STRs and is capable of both casework and database workflows, including direct amplification. A multi-laboratory developmental validation study was performed on the PowerPlex(®) Fusion 6C System. Here, we report the results of that study which followed SWGDAM guidelines and includes data for: species specificity, sensitivity, stability, precision, reproducibility and repeatability, case-type samples, concordance, stutter, DNA mixtures, and PCR-based procedures. Where appropriate we report data from both extracted DNA samples and direct amplification samples from various substrates and collection devices. Samples from all studies were separated on both Applied Biosystems 3500 series and 6-dye capable 3130 series Genetic Analyzers and data is reported for each. Together, the data validate the design and demonstrate the performance of the PowerPlex(®) Fusion 6C System. Copyright © 2015 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

Does a DNA-less cellular organism exist on Earth?

PubMed

Hiyoshi, Akira; Miyahara, Kohji; Kato, Chiaki; Ohshima, Yasumi

2011-12-01

All the self-reproducing cellular organisms so far examined have DNA as the genome. However, a DNA-less organism carrying an RNA genome is suggested by the fact that many RNA viruses exist and the widespread view that an RNA world existed before the present DNA world. Such a possibility is most plausible in the microbial world where biological diversity is enormous and most organisms have not been identified. We have developed experimental methodology to search DNA-less microorganisms, which is based on cultivation with drugs that inhibit replication or expression of DNA, detection of DNA in colonies with a fluorescent dye and double staining for DNA and RNA at a cellular level. These methods have been applied for about 100 microbial samples from various waters including hot springs, soils including deep sea sediments, and organisms. We found many colonies and cells which apparently looked DNA-less and examined them further. So far, all such colonies that reformed colonies on isolation were identified to be DNA-positive. However, considering the difficulty in cultivation, we think it possible for DNA-less microorganisms to live around us. We believe that our ideas and results will be of interest and useful to discover one in the future. © 2011 The Authors. Journal compilation © 2011 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.

Authenticated DNA from Ancient Wood Remains

PubMed Central

LIEPELT, SASCHA; SPERISEN, CHRISTOPH; DEGUILLOUX, MARIE-FRANCE; PETIT, REMY J.; KISSLING, ROY; SPENCER, MATTHEW; DE BEAULIEU, JACQUES-LOUIS; TABERLET, PIERRE; GIELLY, LUDOVIC; ZIEGENHAGEN, BIRGIT

2006-01-01

• Background The reconstruction of biological processes and human activities during the last glacial cycle relies mainly on data from biological remains. Highly abundant tissues, such as wood, are candidates for a genetic analysis of past populations. While well-authenticated DNA has now been recovered from various fossil remains, the final ‘proof’ is still missing for wood, despite some promising studies. • Scope The goal of this study was to determine if ancient wood can be analysed routinely in studies of archaeology and palaeogenetics. An experiment was designed which included blind testing, independent replicates, extensive contamination controls and rigorous statistical tests. Ten samples of ancient wood from major European forest tree genera were analysed with plastid DNA markers. • Conclusions Authentic DNA was retrieved from wood samples up to 1000 years of age. A new tool for real-time vegetation history and archaeology is ready to use. PMID:16987920

Data Release: DNA barcodes of plant species collected for the Global Genome Initiative for Gardens Program, National Museum of Natural History, Smithsonian Institution

PubMed Central

Zúñiga, Jose D.; Gostel, Morgan R.; Mulcahy, Daniel G.; Barker, Katharine; Asia Hill; Sedaghatpour, Maryam; Vo, Samantha Q.; Funk, Vicki A.; Coddington, Jonathan A.

2017-01-01

Abstract The Global Genome Initiative has sequenced and released 1961 DNA barcodes for genetic samples obtained as part of the Global Genome Initiative for Gardens Program. The dataset includes barcodes for 29 plant families and 309 genera that did not have sequences flagged as barcodes in GenBank and sequences from officially recognized barcoding genetic markers meet the data standard of the Consortium for the Barcode of Life. The genetic samples were deposited in the Smithsonian Institution’s National Museum of Natural History Biorepository and their records were made public through the Global Genome Biodiversity Network’s portal. The DNA barcodes are now available on GenBank. PMID:29118648

Optimization of HPV DNA detection in urine by improving collection, storage, and extraction.

PubMed

Vorsters, A; Van den Bergh, J; Micalessi, I; Biesmans, S; Bogers, J; Hens, A; De Coster, I; Ieven, M; Van Damme, P

2014-11-01

The benefits of using urine for the detection of human papillomavirus (HPV) DNA have been evaluated in disease surveillance, epidemiological studies, and screening for cervical cancers in specific subgroups. HPV DNA testing in urine is being considered for important purposes, notably the monitoring of HPV vaccination in adolescent girls and young women who do not wish to have a vaginal examination. The need to optimize and standardize sampling, storage, and processing has been reported.In this paper, we examined the impact of a DNA-conservation buffer, the extraction method, and urine sampling on the detection of HPV DNA and human DNA in urine provided by 44 women with a cytologically normal but HPV DNA-positive cervical sample. Ten women provided first-void and midstream urine samples. DNA analysis was performed using real-time PCR to allow quantification of HPV and human DNA.The results showed that an optimized method for HPV DNA detection in urine should (a) prevent DNA degradation during extraction and storage, (b) recover cell-free HPV DNA in addition to cell-associated DNA, (c) process a sufficient volume of urine, and (d) use a first-void sample.In addition, we found that detectable human DNA in urine may not be a good internal control for sample validity. HPV prevalence data that are based on urine samples collected, stored, and/or processed under suboptimal conditions may underestimate infection rates.

DNA methylation profiling of genomic DNA isolated from urine in diabetic chronic kidney disease: A pilot study

PubMed Central

Sexton-Oates, Alexandra; Carmody, Jake; Ekinci, Elif I.; Dwyer, Karen M.; Saffery, Richard

2018-01-01

Aim To characterise the genomic DNA (gDNA) yield from urine and quality of derived methylation data generated from the widely used Illuminia Infinium MethylationEPIC (HM850K) platform and compare this with buffy coat samples. Background DNA methylation is the most widely studied epigenetic mark and variations in DNA methylation profile have been implicated in diabetes which affects approximately 415 million people worldwide. Methods QIAamp Viral RNA Mini Kit and QIAamp DNA micro kit were used to extract DNA from frozen and fresh urine samples as well as increasing volumes of fresh urine. Matched buffy coats to the frozen urine were also obtained and DNA was extracted from the buffy coats using the QIAamp DNA Mini Kit. Genomic DNA of greater concentration than 20μg/ml were used for methylation analysis using the HM850K array. Results Irrespective of extraction technique or the use of fresh versus frozen urine samples, limited genomic DNA was obtained using a starting sample volume of 5ml (0–0.86μg/mL). In order to optimize the yield, we increased starting volumes to 50ml fresh urine, which yielded only 0–9.66μg/mL A different kit, QIAamp DNA Micro Kit, was trialled in six fresh urine samples and ten frozen urine samples with inadequate DNA yields from 0–17.7μg/mL and 0–1.6μg/mL respectively. Sufficient genomic DNA was obtained from only 4 of the initial 41 frozen urine samples (10%) for DNA methylation profiling. In comparison, all four buffy coat samples (100%) provided sufficient genomic DNA. Conclusion High quality data can be obtained provided a sufficient yield of genomic DNA is isolated. Despite optimizing various extraction methodologies, the modest amount of genomic DNA derived from urine, may limit the generalisability of this approach for the identification of DNA methylation biomarkers of chronic diabetic kidney disease. PMID:29462136

DNA methylation profiling of genomic DNA isolated from urine in diabetic chronic kidney disease: A pilot study.

PubMed

Lecamwasam, Ashani; Sexton-Oates, Alexandra; Carmody, Jake; Ekinci, Elif I; Dwyer, Karen M; Saffery, Richard

2018-01-01

To characterise the genomic DNA (gDNA) yield from urine and quality of derived methylation data generated from the widely used Illuminia Infinium MethylationEPIC (HM850K) platform and compare this with buffy coat samples. DNA methylation is the most widely studied epigenetic mark and variations in DNA methylation profile have been implicated in diabetes which affects approximately 415 million people worldwide. QIAamp Viral RNA Mini Kit and QIAamp DNA micro kit were used to extract DNA from frozen and fresh urine samples as well as increasing volumes of fresh urine. Matched buffy coats to the frozen urine were also obtained and DNA was extracted from the buffy coats using the QIAamp DNA Mini Kit. Genomic DNA of greater concentration than 20μg/ml were used for methylation analysis using the HM850K array. Irrespective of extraction technique or the use of fresh versus frozen urine samples, limited genomic DNA was obtained using a starting sample volume of 5ml (0-0.86μg/mL). In order to optimize the yield, we increased starting volumes to 50ml fresh urine, which yielded only 0-9.66μg/mL A different kit, QIAamp DNA Micro Kit, was trialled in six fresh urine samples and ten frozen urine samples with inadequate DNA yields from 0-17.7μg/mL and 0-1.6μg/mL respectively. Sufficient genomic DNA was obtained from only 4 of the initial 41 frozen urine samples (10%) for DNA methylation profiling. In comparison, all four buffy coat samples (100%) provided sufficient genomic DNA. High quality data can be obtained provided a sufficient yield of genomic DNA is isolated. Despite optimizing various extraction methodologies, the modest amount of genomic DNA derived from urine, may limit the generalisability of this approach for the identification of DNA methylation biomarkers of chronic diabetic kidney disease.

Detection of Toxoplasma gondii oocysts in different water resources by Loop Mediated Isothermal Amplification (LAMP).

PubMed

Gallas-Lindemann, Carmen; Sotiriadou, Isaia; Mahmoodi, Mohammad Reza; Karanis, Panagiotis

2013-02-01

Human toxoplasmosis is potentially contracted due to consumption of contaminated drinking water and represents an increasing public health risk worldwide. Toxoplasma gondii oocysts can be resistant to standard disinfection processes, including UV radiation. Increased awareness of the risk of waterborne toxoplasmosis outbreaks has led to an increase in research interest in the detection of oocysts in environmental water systems. Ninety-five environmental water samples from the Lower Rhine area in Germany have been included in the study and examined for the presence of Toxoplasma. Water samples were filtered or flocculated by aluminum sulfate and purified by sucrose density gradient. DNA was then extracted, and the DNA samples were then examined by LAMP analysis. T. gondii DNA was detected in eight out of 83 (9.6%) influent and effluent samples obtained from wastewater treatment plants. All samples (n=12) from the surface, ground, raw and tap waters tested negative. The purpose of this work was to investigate the occurrence and distribution of Toxoplasma oocysts on the Lower Rhine in Germany. Our study provides evidence that the assay is a sensitive, specific, rapid and cost effective method for the detection of T. gondii and is useful for both the investigations of cases of waterborne outbreaks and for identifying the source of contamination. Copyright © 2012 Elsevier B.V. All rights reserved.

Use of swabs for sampling epithelial cells for molecular genetics analyses in Enteroctopus

USGS Publications Warehouse

Hollenback, Nathan; Scheel, David; Gravley, Megan C.; Sage, George K.; Toussaint, Rebecca K.; Talbot, Sandra L.

2017-01-01

We evaluated the efficacy of using swabs to collect cells from the epidermis of octopus as a non-invasive DNA source for classical genetic studies, and demonstrated value of the technique by incorporating it into an effort to determine, within a day, the lineage of captured, live Enteroctopus (E. dofleini or a cryptic lineage). The cryptic lineage was targeted for captive behavioral and morphological studies, while once genetically identified, the non-target lineage could be more rapidly released back to the wild. We used commercially available sterile foamtipped swabs and a high-salt preservation buffer to collect and store paired swab and muscle (arm tip) tissue sampled from live Enteroctopus collected from Prince William Sound, Alaska. We performed a one-day extraction of DNA from epithelial swab samples and amplification of two diagnostic microsatellite loci to determine the lineage of each of the 21 individuals. Following this rapid lineage assessment, which allowed us to release non-target individuals within a day of laboratory work, we compared paired swab and muscle tissue samples from each individual to assess quantity of DNA yields and consistency of genotyping results, followed by assessment of locus-by-locus reliability of DNA extracts from swabs. Epithelial swabs yielded, on average, lower quantities of DNA (170.32 ± 74.72 (SD) ng/μL) relative to DNA obtained from tissues collected using invasive or destructive techniques (310.95 ± 147.37 (SD) ng/μL. We observed some decrease in yields of DNA from extractions of swab samples conducted 19 and 31 months after initial extractions when samples were stored at room temperature in lysis buffer. All extractions yielded quantities of DNA sufficient to amplify and score all loci, which included fragment data from 10 microsatellite loci (nine polymorphic loci and monomorphic locus EdoμA106), and nucleotide sequence data from a 528 base pair portion of the nuclear octopine dehydrogenase gene. All results from genotyping and sequencing using paired swab and muscle tissue extracts were concordant, and experimental reliability levels for multilocus genotypes generated from swab samples exceeded 97%. This technique is useful for studies in which invasive sampling is not optimal, and in remote field situations since samples can be stored at ambient temperatures for at least 31 months. The use of epithelial swabs is thus a noninvasive technique appropriate for sampling genetic material from live octopuses for use in classical genetic studies as well as supporting experimental and behavioral studies.

Epidemiology of pertussis in Casablanca (Morocco): contribution of conventional and molecular diagnosis tools.

PubMed

Katfy, Khalid; Guiso, Nicole; Diawara, Idrissa; Zerouali, Khalid; Slaoui, Bouchra; Jouhadi, Zineb; Zineddine, Abdelhadi; Belabbes, Houria; Elmdaghri, Naima

2017-05-16

Pertussis, a vaccine preventable disease, is still responsible of significant morbidity and mortality around the world, mostly in newborns. The aim of the present study was (1) to introduce pertussis surveillance in the major pediatric hospital of Casablanca (2) to analyze the prevalence of pertussis among children under 14 years of age and their entourage in Casablanca, Morocco. This is a prospective and non-case controlled study, including children suspected of Pertussis admitted at the Abderrahim Harouchi Pediatric Hospital in Casablanca, from January 2013 to June 2015. Nasopharyngeal samples were obtained for Bordetella spp. culture and Real time PCR detection (RT-PCR) with specific primers of Bordetella spp., B. pertussis, B. parapertussis and B. holmesii. The detection of Bordetella spp. was also performed in some household contacts of the children suspected of pertussis. During the 2.5-years period, a total of 282 samples were collected from hospitalized children (156) and in some of their contacts (126). Among 156 samples from the children (from whom 57% were under 2 month of age), Bordetella DNA was detected in 61% (96/156) by RT-PCR. Among these positive samples, 91.7% (88/96) corresponded to B. pertussis DNA. Furthermore, in 39.5% (38/96) of the Bordetella positive samples, B. holmesii DNA was also detected. B. parapertussis DNA was detected in only one sample (1/156). Out of the 156 samples collected from the hospitalized children, only 48 were tested by culture, and 4 B. pertussis were isolated (8.3%). Among the 126 samples from the contacts of the children, mostly mothers (115 cases), Bordetella DNA was detected in 47% (59/126), 90% (53/59) being B. pertussis DNA. Moreover, B. holmesii DNA was also detected in 18.6% (11/59) of the Bordetella positive samples, and coexistence of B. pertussis and B. holmesii DNA in 36.5% (35/96). Two B. pertussis were isolated by culture performed on 43 samples of the contacts of the children (4.6%). This study highlights the circulation of B. pertussis but also of B. holmesii in Casablanca-Morocco with a high proportion of co-infections B. holmesii/B. pertussis in infants and their mothers, indicate that infection of non-vaccinated infants could be more associated with young parents. Moreover, the RT- PCR provides a sensitive and specific diagnosis of B. pertussis infections and distinguishes it from other Bordetella species, and is therefore suitable for implementation in the diagnostic laboratory.

Poly(ADP-ribose) polymerase inhibitor CEP-8983 synergizes with bendamustine in chronic lymphocytic leukemia cells in vitro.

PubMed

Dilley, Robert L; Poh, Weijie; Gladstone, Douglas E; Herman, James G; Showel, Margaret M; Karp, Judith E; McDevitt, Michael A; Pratz, Keith W

2014-03-01

DNA repair aberrations and associated chromosomal instability is a feature of chronic lymphocytic leukemia (CLL). To evaluate if DNA repair insufficiencies are related to methylation changes, we examined the methylation of nine promoter regions of DNA repair proteins by bisulfide sequencing in 26 CLL primary samples and performed quantitative PCR on a subset of samples to examine BRCA1 expression. We also investigated if changes in cytogenetic or expression level of DNA repair proteins led to changes in sensitivity to a novel PARP inhibitor, CEP-8983, alone and in combination with bendamustine. No changes in promoter methylation were identified in BRCA1, BRCA2, FANC-C, FANC-F, FANC-L, ATM, MGMT, hMLH1 and H2AX except for two cases of minor BRCA1 hypermethylation. CLL samples appeared to have reduced BRCA1 mRNA expression uniformly in comparison to non-malignant lymphocytes irrespective of promoter hypermethylation. CEP-8983 displayed single agent cytotoxicity and the combination with bendamustine demonstrated synergistic cytotoxicity in the majority of CLL samples. These results were consistent across cytogenetic subgroups, including 17p deleted and previously treated patients. Our results provide rationale for further exploration of the combination of a PARP inhibitor and DNA damaging agents as a novel therapeutic strategy in CLL. Copyright © 2013 Elsevier Ltd. All rights reserved.

Amplification of Mycoplasma haemofelis DNA by a PCR for point-of-care use.

PubMed

Hawley, Jennifer; Yaaran, Tal; Maurice, Sarah; Lappin, Michael R

2018-01-01

We compared a qualitative in-clinic (IC)-PCR for the detection of Mycoplasma haemofelis DNA with the results of a commercial qualitative laboratory-based, conventional (c)PCR. In order to determine the specificity of both tests, Bartonella spp. samples were included. Forty-three previously tested blood samples with known PCR results for hemoplasmas and Bartonella spp. were selected. The samples were split between 2 laboratories. At the first laboratory, DNA was purified and run on 2 cPCR assays for the detection of hemoplasmas and Bartonella spp. At the second laboratory, DNA was purified using 2 purification protocols and both run in the IC-PCR assay. The cPCR results confirmed that 18 samples were positive for M. haemofelis, 5 for ' Candidatus M. haemominutum', 8 for Bartonella henselae, 2 for Bartonella clarridgeiae, and 10 were negative for both genera. No mixed infections were observed. The IC-PCR assay for the detection of M. haemofelis had a sensitivity of 94.4% and specificity of 96%, when using the same DNA purification method as the first laboratory. Using the second purification method, the sensitivity of the IC-PCR assay was 77.8% and specificity was 96%. Bartonella species were not detected by the IC-PCR M. haemofelis assay. The IC-PCR assay decreased the amount of time to final result compared to a cPCR assay.

Post-Fragmentation Whole Genome Amplification-Based Method

NASA Technical Reports Server (NTRS)

Benardini, James; LaDuc, Myron T.; Langmore, John

2011-01-01

This innovation is derived from a proprietary amplification scheme that is based upon random fragmentation of the genome into a series of short, overlapping templates. The resulting shorter DNA strands (<400 bp) constitute a library of DNA fragments with defined 3 and 5 termini. Specific primers to these termini are then used to isothermally amplify this library into potentially unlimited quantities that can be used immediately for multiple downstream applications including gel eletrophoresis, quantitative polymerase chain reaction (QPCR), comparative genomic hybridization microarray, SNP analysis, and sequencing. The standard reaction can be performed with minimal hands-on time, and can produce amplified DNA in as little as three hours. Post-fragmentation whole genome amplification-based technology provides a robust and accurate method of amplifying femtogram levels of starting material into microgram yields with no detectable allele bias. The amplified DNA also facilitates the preservation of samples (spacecraft samples) by amplifying scarce amounts of template DNA into microgram concentrations in just a few hours. Based on further optimization of this technology, this could be a feasible technology to use in sample preservation for potential future sample return missions. The research and technology development described here can be pivotal in dealing with backward/forward biological contamination from planetary missions. Such efforts rely heavily on an increasing understanding of the burden and diversity of microorganisms present on spacecraft surfaces throughout assembly and testing. The development and implementation of these technologies could significantly improve the comprehensiveness and resolving power of spacecraft-associated microbial population censuses, and are important to the continued evolution and advancement of planetary protection capabilities. Current molecular procedures for assaying spacecraft-associated microbial burden and diversity have inherent sample loss issues at practically every step, particularly nucleic acid extraction. In engineering a molecular means of amplifying nucleic acids directly from single cells in their native state within the sample matrix, this innovation has circumvented entirely the need for DNA extraction regimes in the sample processing scheme.

Rapid Detection and Identification of a Pathogen's DNA Using Phi29 DNA Polymerase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Y.; Dunn, J.; Gao, S.

2008-10-31

Zoonotic pathogens including those transmitted by insect vectors are some of the most deadly of all infectious diseases known to mankind. A number of these agents have been further weaponized and are widely recognized as being potentially significant biothreat agents. We describe a novel method based on multiply-primed rolling circle in vitro amplification for profiling genomic DNAs to permit rapid, cultivation-free differential detection and identification of circular plasmids in infectious agents. Using Phi29 DNA polymerase and a two-step priming reaction we could reproducibly detect and characterize by DNA sequencing circular DNA from Borrelia burgdorferi B31 in DNA samples containing asmore » little as 25 pg of Borrelia DNA amongst a vast excess of human DNA. This simple technology can ultimately be adapted as a sensitive method to detect specific DNA from both known and unknown pathogens in a wide variety of complex environments.« less

Evaluation of Skin Surface as an Alternative Source of Reference DNA Samples: A Pilot Study.

PubMed

Albujja, Mohammed H; Bin Dukhyil, Abdul Aziz; Chaudhary, Abdul Rauf; Kassab, Ahmed Ch; Refaat, Ahmed M; Babu, Saranya Ramesh; Okla, Mohammad K; Kumar, Sachil

2018-01-01

An acceptable area for collecting DNA reference sample is a part of the forensic DNA analysis development. The aim of this study was to evaluate skin surface cells (SSC) as an alternate source of reference DNA sample. From each volunteer (n = 10), six samples from skin surface areas (forearm and fingertips) and two traditional samples (blood and buccal cells) were collected. Genomic DNA was extracted and quantified then genotyped using standard techniques. The highest DNA concentration of SSC samples was collected using the tape/forearm method of collection (2.1 ng/μL). Cotton swabs moistened with ethanol yielded higher quantities of DNA than swabs moistened with salicylic acid, and it gave the highest percentage of full STR profiles (97%). This study supports the use of SSC as a noninvasive sampling technique and as a extremely useful source of DNA reference samples among certain cultures where the use of buccal swabs can be considered socially unacceptable. © 2017 American Academy of Forensic Sciences.

Rapid Identification of a Cooling Tower-Associated Legionnaires' Disease Outbreak Supported by Polymerase Chain Reaction Testing of Environmental Samples, New York City, 2014-2015.

PubMed

Benowitz, Isaac; Fitzhenry, Robert; Boyd, Christopher; Dickinson, Michelle; Levy, Michael; Lin, Ying; Nazarian, Elizabeth; Ostrowsky, Belinda; Passaretti, Teresa; Rakeman, Jennifer; Saylors, Amy; Shamoonian, Elena; Smith, Terry-Ann; Balter, Sharon

2018-04-01

We investigated an outbreak of eight Legionnaires' disease cases among persons living in an urban residential community of 60,000 people. Possible environmental sources included two active cooling towers (air-conditioning units for large buildings) <1 km from patient residences, a market misting system, a community-wide water system used for heating and cooling, and potable water. To support a timely public health response, we used real-time polymerase chain reaction (PCR) to identify Legionella DNA in environmental samples within hours of specimen collection. We detected L. pneumophila serogroup 1 DNA only at a power plant cooling tower, supporting the decision to order remediation before culture results were available. An isolate from a power plant cooling tower sample was indistinguishable from a patient isolate by pulsed-field gel electrophoresis, suggesting the cooling tower was the outbreak source. PCR results were available <1 day after sample collection, and culture results were available as early as 5 days after plating. PCR is a valuable tool for identifying Legionella DNA in environmental samples in outbreak settings.

Diagnosis of duck plague in waterfowl by polymerase chain reaction

USGS Publications Warehouse

Hansen, W.R.; Nashold, S.W.; Docherty, D.E.; Brown, S.E.; Knudson, D.L.

2000-01-01

A recently developed polymerase chain reaction (PCR) assay was used for diagnosis of duck plague in waterfowl tissues from past and current cases of waterfowl mortality and to identify duck plague virus in combined cloacal/oral-pharyngeal swab samples from healthy mallards (Anas platyrhynchos) after a disease outbreak. The PCR was able to detect viral DNA from all the individual or pooled tissues assayed from 10 waterfowl, including liver and spleen samples from three Muscovy ducks (Cairina moschata domesticus) that did not yield virus isolates. The strong staining intensity of the PCR products from the waterfowl tissues indicated that large amounts of virus were present, even when virus was not isolated. Duck plague DNA was also detected in a cloacal swab sample from a wood duck (Aix sponsa) carcass submitted for diagnosis. The PCR assay identified duck plague DNA in 13 swab samples that produced virus isolates from carrier mallards sampled in 1981 after a duck plague die-off. The duck plague PCR clearly demonstrated the ability to quickly diagnose duck plague in suspect mortality cases and to detect virus shed by carrier waterfowl.

CryoEM and image sorting for flexible protein/DNA complexes.

PubMed

Villarreal, Seth A; Stewart, Phoebe L

2014-07-01

Intrinsically disordered regions of proteins and conformational flexibility within complexes can be critical for biological function. However, disorder, flexibility, and heterogeneity often hinder structural analyses. CryoEM and single particle image processing techniques offer the possibility of imaging samples with significant flexibility. Division of particle images into more homogenous subsets after data acquisition can help compensate for heterogeneity within the sample. We present the utility of an eigenimage sorting analysis for examining two protein/DNA complexes with significant conformational flexibility and heterogeneity. These complexes are integral to the non-homologous end joining pathway, and are involved in the repair of double strand breaks of DNA. Both complexes include the DNA-dependent protein kinase catalytic subunit (DNA-PKcs) and biotinylated DNA with bound streptavidin, with one complex containing the Ku heterodimer. Initial 3D reconstructions of the two DNA-PKcs complexes resembled a cryoEM structure of uncomplexed DNA-PKcs without additional density clearly attributable to the remaining components. Application of eigenimage sorting allowed division of the DNA-PKcs complex datasets into more homogeneous subsets. This led to visualization of density near the base of the DNA-PKcs that can be attributed to DNA, streptavidin, and Ku. However, comparison of projections of the subset structures with 2D class averages indicated that a significant level of heterogeneity remained within each subset. In summary, image sorting methods allowed visualization of extra density near the base of DNA-PKcs, suggesting that DNA binds in the vicinity of the base of the molecule and potentially to a flexible region of DNA-PKcs. Copyright © 2013 Elsevier Inc. All rights reserved.

Internal validation of the GlobalFiler™ Express PCR Amplification Kit for the direct amplification of reference DNA samples on a high-throughput automated workflow.

PubMed

Flores, Shahida; Sun, Jie; King, Jonathan; Budowle, Bruce

2014-05-01

The GlobalFiler™ Express PCR Amplification Kit uses 6-dye fluorescent chemistry to enable multiplexing of 21 autosomal STRs, 1 Y-STR, 1 Y-indel and the sex-determining marker amelogenin. The kit is specifically designed for processing reference DNA samples in a high throughput manner. Validation studies were conducted to assess the performance and define the limitations of this direct amplification kit for typing blood and buccal reference DNA samples on various punchable collection media. Studies included thermal cycling sensitivity, reproducibility, precision, sensitivity of detection, minimum detection threshold, system contamination, stochastic threshold and concordance. Results showed that optimal amplification and injection parameters for a 1.2mm punch from blood and buccal samples were 27 and 28 cycles, respectively, combined with a 12s injection on an ABI 3500xL Genetic Analyzer. Minimum detection thresholds were set at 100 and 120RFUs for 27 and 28 cycles, respectively, and it was suggested that data from positive amplification controls provided a better threshold representation. Stochastic thresholds were set at 250 and 400RFUs for 27 and 28 cycles, respectively, as stochastic effects increased with cycle number. The minimum amount of input DNA resulting in a full profile was 0.5ng, however, the optimum range determined was 2.5-10ng. Profile quality from the GlobalFiler™ Express Kit and the previously validated AmpFlSTR(®) Identifiler(®) Direct Kit was comparable. The validation data support that reliable DNA typing results from reference DNA samples can be obtained using the GlobalFiler™ Express PCR Amplification Kit. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Irish study of high-density Schizophrenia families: Field methods and power to detect linkage

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kendler, K.S.; Straub, R.E.; MacLean, C.J.

Large samples of multiplex pedigrees will probably be needed to detect susceptibility loci for schizophrenia by linkage analysis. Standardized ascertainment of such pedigrees from culturally and ethnically homogeneous populations may improve the probability of detection and replication of linkage. The Irish Study of High-Density Schizophrenia Families (ISHDSF) was formed from standardized ascertainment of multiplex schizophrenia families in 39 psychiatric facilities covering over 90% of the population in Ireland and Northern Ireland. We here describe a phenotypic sample and a subset thereof, the linkage sample. Individuals were included in the phenotypic sample if adequate diagnostic information, based on personal interview and/ormore » hospital record, was available. Only individuals with available DNA were included in the linkage sample. Inclusion of a pedigree into the phenotypic sample required at least two first, second, or third degree relatives with non-affective psychosis (NAP), one of whom had schizophrenia (S) or poor-outcome schizoaffective disorder (PO-SAD). Entry into the linkage sample required DNA samples on at least two individuals with NAP, of whom at least one had S or PO-SAD. Affection was defined by narrow, intermediate, and broad criteria. 75 refs., 6 tabs.« less

Preanalytical blood sample workup for cell-free DNA analysis using Droplet Digital PCR for future molecular cancer diagnostics.

PubMed

van Ginkel, Joost H; van den Broek, Daan A; van Kuik, Joyce; Linders, Dorothé; de Weger, Roel; Willems, Stefan M; Huibers, Manon M H

2017-10-01

In current molecular cancer diagnostics, using blood samples of cancer patients for the detection of genetic alterations in plasma (cell-free) circulating tumor DNA (ctDNA) is an emerging practice. Since ctDNA levels in blood are low, highly sensitive Droplet Digital PCR (ddPCR) can be used for detecting rare mutational targets. In order to perform ddPCR on blood samples, a standardized procedure for processing and analyzing blood samples is necessary to facilitate implementation into clinical practice. Therefore, we assessed the technical sample workup procedure for ddPCR on blood plasma samples. Blood samples from healthy individuals, as well as lung cancer patients were analyzed. We compared different methods and protocols for sample collection, storage, centrifugation, isolation, and quantification. Cell-free DNA (cfDNA) concentrations of several wild-type targets and BRAF and EGFR-mutant ctDNA concentrations quantified by ddPCR were primary outcome measurements. Highest cfDNA concentrations were measured in blood collected in serum tubes. No significant differences in cfDNA concentrations were detected between various time points of up to 24 h until centrifugation. Highest cfDNA concentrations were detected after DNA isolation with the Quick cfDNA Serum & Plasma Kit, while plasma isolation using the QIAamp Circulating Nucleic Acid Kit yielded the most consistent results. DdPCR results on cfDNA are highly dependent on multiple factors during preanalytical sample workup, which need to be addressed during the development of this diagnostic tool for cancer diagnostics in the future. © 2017 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

DNA Methylation Biomarkers: Cancer and Beyond

PubMed Central

Mikeska, Thomas; Craig, Jeffrey M.

2014-01-01

Biomarkers are naturally-occurring characteristics by which a particular pathological process or disease can be identified or monitored. They can reflect past environmental exposures, predict disease onset or course, or determine a patient’s response to therapy. Epigenetic changes are such characteristics, with most epigenetic biomarkers discovered to date based on the epigenetic mark of DNA methylation. Many tissue types are suitable for the discovery of DNA methylation biomarkers including cell-based samples such as blood and tumor material and cell-free DNA samples such as plasma. DNA methylation biomarkers with diagnostic, prognostic and predictive power are already in clinical trials or in a clinical setting for cancer. Outside cancer, strong evidence that complex disease originates in early life is opening up exciting new avenues for the detection of DNA methylation biomarkers for adverse early life environment and for estimation of future disease risk. However, there are a number of limitations to overcome before such biomarkers reach the clinic. Nevertheless, DNA methylation biomarkers have great potential to contribute to personalized medicine throughout life. We review the current state of play for DNA methylation biomarkers, discuss the barriers that must be crossed on the way to implementation in a clinical setting, and predict their future use for human disease. PMID:25229548

Statistical and population genetics issues of two Hungarian datasets from the aspect of DNA evidence interpretation.

PubMed

Szabolcsi, Zoltán; Farkas, Zsuzsa; Borbély, Andrea; Bárány, Gusztáv; Varga, Dániel; Heinrich, Attila; Völgyi, Antónia; Pamjav, Horolma

2015-11-01

When the DNA profile from a crime-scene matches that of a suspect, the weight of DNA evidence depends on the unbiased estimation of the match probability of the profiles. For this reason, it is required to establish and expand the databases that reflect the actual allele frequencies in the population applied. 21,473 complete DNA profiles from Databank samples were used to establish the allele frequency database to represent the population of Hungarian suspects. We used fifteen STR loci (PowerPlex ESI16) including five, new ESS loci. The aim was to calculate the statistical, forensic efficiency parameters for the Databank samples and compare the newly detected data to the earlier report. The population substructure caused by relatedness may influence the frequency of profiles estimated. As our Databank profiles were considered non-random samples, possible relationships between the suspects can be assumed. Therefore, population inbreeding effect was estimated using the FIS calculation. The overall inbreeding parameter was found to be 0.0106. Furthermore, we tested the impact of the two allele frequency datasets on 101 randomly chosen STR profiles, including full and partial profiles. The 95% confidence interval estimates for the profile frequencies (pM) resulted in a tighter range when we used the new dataset compared to the previously published ones. We found that the FIS had less effect on frequency values in the 21,473 samples than the application of minimum allele frequency. No genetic substructure was detected by STRUCTURE analysis. Due to the low level of inbreeding effect and the high number of samples, the new dataset provides unbiased and precise estimates of LR for statistical interpretation of forensic casework and allows us to use lower allele frequencies. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

DNA book.

PubMed

Kawai, Jun; Hayashizaki, Yoshihide

2003-06-01

We propose herein a new method of DNA distribution, whereby DNA clones or PCR products are printed directly onto the pages of books and delivered to users along with relevant scientific information. DNA sheets, comprising water-soluble paper onto which DNA is spotted, can be bound into books. Readers can easily extract the DNA fragments from DNA sheets and amplify them using PCR. We show that DNA sheets can withstand various conditions that may be experienced during bookbinding and delivery, such as high temperatures and humidity. Almost all genes (95%-100% of randomly selected RIKEN mouse cDNA clones) were recovered successfully by use of PCR. Readers can start their experiments after a 2-h PCR amplification without waiting for the delivery of DNA clones. The DNA Book thus provides a novel method for delivering DNA in a timely and cost-effective manner. A sample DNA sheet (carrying RIKEN mouse cDNA clones encoding genes of enzymes for the TCA cycle) is included in this issue for field-testing. We would greatly appreciate it if readers could attempt to extract DNA and report the results and whether the DNA sheet was shipped to readers in good condition.

Combination Antiangiogenic and Immunomodulatory Gene Therapy for Breast Cancer

DTIC Science & Technology

2002-06-01

Flk-1 and endoglin cDNA. Specific primers for G3PDH housekeeping gene were included in each reaction as a positive control. The samples were run on a...cultured cells and specific primers for Flk-1 and endoglin cDNA. Specific primers for G3PDH housekeeping gene were included in each reaction as a...positive control. Arrows indicate the 500 bp, 410 bp and 109 bp amplified products of Flk-1, endoglin and G3PDH , respectively. Fig 3. Viral replication

CIDR

Science.gov Websites

* Minimum # Experimental Samples DNA Volume (ul) Genomic DNA Concentration (ng/ul) Low Input DNA Volume (ul . **Please inquire about additional cost for low input option. Genotyping Minimum # Experimental Samples DNA sample quality. If you do submit WGA samples, you should anticipate a higher non-random missing data rate

Effect of DNA extraction and sample preservation method on rumen bacterial population.

PubMed

Fliegerova, Katerina; Tapio, Ilma; Bonin, Aurelie; Mrazek, Jakub; Callegari, Maria Luisa; Bani, Paolo; Bayat, Alireza; Vilkki, Johanna; Kopečný, Jan; Shingfield, Kevin J; Boyer, Frederic; Coissac, Eric; Taberlet, Pierre; Wallace, R John

2014-10-01

The comparison of the bacterial profile of intracellular (iDNA) and extracellular DNA (eDNA) isolated from cow rumen content stored under different conditions was conducted. The influence of rumen fluid treatment (cheesecloth squeezed, centrifuged, filtered), storage temperature (RT, -80 °C) and cryoprotectants (PBS-glycerol, ethanol) on quality and quantity parameters of extracted DNA was evaluated by bacterial DGGE analysis, real-time PCR quantification and metabarcoding approach using high-throughput sequencing. Samples clustered according to the type of extracted DNA due to considerable differences between iDNA and eDNA bacterial profiles, while storage temperature and cryoprotectants additives had little effect on sample clustering. The numbers of Firmicutes and Bacteroidetes were lower (P < 0.01) in eDNA samples. The qPCR indicated significantly higher amount of Firmicutes in iDNA sample frozen with glycerol (P < 0.01). Deep sequencing analysis of iDNA samples revealed the prevalence of Bacteroidetes and similarity of samples frozen with and without cryoprotectants, which differed from sample stored with ethanol at room temperature. Centrifugation and consequent filtration of rumen fluid subjected to the eDNA isolation procedure considerably changed the ratio of molecular operational taxonomic units (MOTUs) of Bacteroidetes and Firmicutes. Intracellular DNA extraction using bead-beating method from cheesecloth sieved rumen content mixed with PBS-glycerol and stored at -80 °C was found as the optimal method to study ruminal bacterial profile. Copyright © 2013 Elsevier Ltd. All rights reserved.

Newborn screening for cystic fibrosis in Wisconsin: comparison of biochemical and molecular methods.

PubMed

Gregg, R G; Simantel, A; Farrell, P M; Koscik, R; Kosorok, M R; Laxova, A; Laessig, R; Hoffman, G; Hassemer, D; Mischler, E H; Splaingard, M

1997-06-01

To evaluate neonatal screening for cystic fibrosis (CF), including study of the screening procedures and characteristics of false-positive infants, over the past 10 years in Wisconsin. An important objective evolving from the original design has been to compare use of a single-tier immunoreactive trypsinogen (IRT) screening method with that of a two-tier method using IRT and analyses of samples for the most common cystic fibrosis transmembrane regulator (CFTR) (DeltaF508) mutation. We also examined the benefit of including up to 10 additional CFTR mutations in the screening protocol. From 1985 to 1994, using either the IRT or IRT/DNA protocol, 220 862 and 104 308 neonates, respectively, were screened for CF. For the IRT protocol, neonates with an IRT >/=180 ng/mL were considered positive, and the standard sweat chloride test was administered to determine CF status. For the IRT/DNA protocol, samples from the original dried-blood specimen on the Guthrie card of neonates with an IRT >/=110 ng/mL were tested for the presence of the DeltaF508 CFTR allele, and if the DNA test revealed one or two DeltaF508 alleles, a sweat test was obtained. Both screening procedures had very high specificity. The sensitivity tended to be higher with the IRT/DNA protocol, but the differences were not statistically significant. The positive predictive value of the IRT/DNA screening protocol was 15.2% compared with 6.4% if the same samples had been screened by the IRT method. Assessment of the false-positive IRT/DNA population revealed that the two-tier method eliminates the disproportionate number of infants with low Apgar scores and also the high prevalence of African-Americans identified previously in our study of newborns with high IRT levels. We found that 55% of DNA-positive CF infants were homozygous for DeltaF508 and 40% had one DeltaF508 allele. Adding analyses for 10 more CFTR mutations has only a small effect on the sensitivity but is likely to add significantly to the cost of screening. Advantages of the IRT/DNA protocol over IRT analysis include improved positive predictive value, reduction of false-positive infants, and more rapid diagnosis with elimination of recall specimens.

Evaluating ethanol-based sample preservation to facilitate use of DNA barcoding in routine freshwater biomonitoring programs using benthic macroinvertebrates.

PubMed

Stein, Eric D; White, Bryan P; Mazor, Raphael D; Miller, Peter E; Pilgrim, Erik M

2013-01-01

Molecular methods, such as DNA barcoding, have the potential to enhance biomonitoring programs worldwide. Altering routinely used sample preservation methods to protect DNA from degradation may pose a potential impediment to application of DNA barcoding and metagenomics for biomonitoring using benthic macroinvertebrates. Using higher volumes or concentrations of ethanol, requirements for shorter holding times, or the need to include additional filtering may increase cost and logistical constraints to existing biomonitoring programs. To address this issue we evaluated the efficacy of various ethanol-based sample preservation methods at maintaining DNA integrity. We evaluated a series of methods that were minimally modified from typical field protocols in order to identify an approach that can be readily incorporated into existing monitoring programs. Benthic macroinvertebrates were collected from a minimally disturbed stream in southern California, USA and subjected to one of six preservation treatments. Ten individuals from five taxa were selected from each treatment and processed to produce DNA barcodes from the mitochondrial gene cytochrome c oxidase I (COI). On average, we obtained successful COI sequences (i.e. either full or partial barcodes) for between 93-99% of all specimens across all six treatments. As long as samples were initially preserved in 95% ethanol, successful sequencing of COI barcodes was not affected by a low dilution ratio of 2∶1, transfer to 70% ethanol, presence of abundant organic matter, or holding times of up to six months. Barcoding success varied by taxa, with Leptohyphidae (Ephemeroptera) producing the lowest barcode success rate, most likely due to poor PCR primer efficiency. Differential barcoding success rates have the potential to introduce spurious results. However, routine preservation methods can largely be used without adverse effects on DNA integrity.

Evaluating Ethanol-based Sample Preservation to Facilitate Use of DNA Barcoding in Routine Freshwater Biomonitoring Programs Using Benthic Macroinvertebrates

PubMed Central

Stein, Eric D.; White, Bryan P.; Mazor, Raphael D.; Miller, Peter E.; Pilgrim, Erik M.

2013-01-01

Molecular methods, such as DNA barcoding, have the potential to enhance biomonitoring programs worldwide. Altering routinely used sample preservation methods to protect DNA from degradation may pose a potential impediment to application of DNA barcoding and metagenomics for biomonitoring using benthic macroinvertebrates. Using higher volumes or concentrations of ethanol, requirements for shorter holding times, or the need to include additional filtering may increase cost and logistical constraints to existing biomonitoring programs. To address this issue we evaluated the efficacy of various ethanol-based sample preservation methods at maintaining DNA integrity. We evaluated a series of methods that were minimally modified from typical field protocols in order to identify an approach that can be readily incorporated into existing monitoring programs. Benthic macroinvertebrates were collected from a minimally disturbed stream in southern California, USA and subjected to one of six preservation treatments. Ten individuals from five taxa were selected from each treatment and processed to produce DNA barcodes from the mitochondrial gene cytochrome c oxidase I (COI). On average, we obtained successful COI sequences (i.e. either full or partial barcodes) for between 93–99% of all specimens across all six treatments. As long as samples were initially preserved in 95% ethanol, successful sequencing of COI barcodes was not affected by a low dilution ratio of 2∶1, transfer to 70% ethanol, presence of abundant organic matter, or holding times of up to six months. Barcoding success varied by taxa, with Leptohyphidae (Ephemeroptera) producing the lowest barcode success rate, most likely due to poor PCR primer efficiency. Differential barcoding success rates have the potential to introduce spurious results. However, routine preservation methods can largely be used without adverse effects on DNA integrity. PMID:23308097

Vaginal microbial flora analysis by next generation sequencing and microarrays; can microbes indicate vaginal origin in a forensic context?

PubMed

Benschop, Corina C G; Quaak, Frederike C A; Boon, Mathilde E; Sijen, Titia; Kuiper, Irene

2012-03-01

Forensic analysis of biological traces generally encompasses the investigation of both the person who contributed to the trace and the body site(s) from which the trace originates. For instance, for sexual assault cases, it can be beneficial to distinguish vaginal samples from skin or saliva samples. In this study, we explored the use of microbial flora to indicate vaginal origin. First, we explored the vaginal microbiome for a large set of clinical vaginal samples (n = 240) by next generation sequencing (n = 338,184 sequence reads) and found 1,619 different sequences. Next, we selected 389 candidate probes targeting genera or species and designed a microarray, with which we analysed a diverse set of samples; 43 DNA extracts from vaginal samples and 25 DNA extracts from samples from other body sites, including sites in close proximity of or in contact with the vagina. Finally, we used the microarray results and next generation sequencing dataset to assess the potential for a future approach that uses microbial markers to indicate vaginal origin. Since no candidate genera/species were found to positively identify all vaginal DNA extracts on their own, while excluding all non-vaginal DNA extracts, we deduce that a reliable statement about the cellular origin of a biological trace should be based on the detection of multiple species within various genera. Microarray analysis of a sample will then render a microbial flora pattern that is probably best analysed in a probabilistic approach.

Methodological considerations for detection of terrestrial small-body salamander eDNA and implications for biodiversity conservation

USGS Publications Warehouse

Walker, Donald M.; Leys, Jacob E.; Dunham, Kelly E.; Oliver, Joshua C.; Schiller, Emily E.; Stephenson, Kelsey S.; Kimrey, John T.; Wooten, Jessica; Rogers, Mark W.

2017-01-01

Environmental DNA (eDNA) can be used as an assessment tool to detect populations of threatened species and provide fine-scale data required to make management decisions. The objectives of this project were to use quantitative PCR (qPCR) to: (i) detect spiked salamander DNA in soil, (ii) quantify eDNA degradation over time, (iii) determine detectability of salamander eDNA in a terrestrial environment using soil, faeces, and skin swabs, (iv) detect salamander eDNA in a mesocosm experiment. Salamander eDNA was positively detected in 100% of skin swabs and 66% of faecal samples and concentrations did not differ between the two sources. However, eDNA was not detected in soil samples collected from directly underneath wild-caught living salamanders. Salamander genomic DNA (gDNA) was detected in all qPCR reactions when spiked into soil at 10.0, 5.0, and 1.0 ng/g soil and spike concentration had a significant effect on detected concentrations. Only 33% of samples showed recoverable eDNA when spiked with 0.25 ng/g soil, which was the low end of eDNA detection. To determine the rate of eDNA degradation, gDNA (1 ng/g soil) was spiked into soil and quantified over seven days. Salamander eDNA concentrations decreased across days, but eDNA was still amplifiable at day 7. Salamander eDNA was detected in two of 182 mesocosm soil samples over 12 weeks (n = 52 control samples; n = 65 presence samples; n = 65 eviction samples). The discrepancy in detection success between experiments indicates the potential challenges for this method to be used as a monitoring technique for small-bodied wild terrestrial salamander populations.

Methodological considerations for detection of terrestrial small-body salamander eDNA and implications for biodiversity conservation.

PubMed

Walker, Donald M; Leys, Jacob E; Dunham, Kelly E; Oliver, Joshua C; Schiller, Emily E; Stephenson, Kelsey S; Kimrey, John T; Wooten, Jessica; Rogers, Mark W

2017-11-01

Environmental DNA (eDNA) can be used as an assessment tool to detect populations of threatened species and provide fine-scale data required to make management decisions. The objectives of this project were to use quantitative PCR (qPCR) to: (i) detect spiked salamander DNA in soil, (ii) quantify eDNA degradation over time, (iii) determine detectability of salamander eDNA in a terrestrial environment using soil, faeces, and skin swabs, (iv) detect salamander eDNA in a mesocosm experiment. Salamander eDNA was positively detected in 100% of skin swabs and 66% of faecal samples and concentrations did not differ between the two sources. However, eDNA was not detected in soil samples collected from directly underneath wild-caught living salamanders. Salamander genomic DNA (gDNA) was detected in all qPCR reactions when spiked into soil at 10.0, 5.0, and 1.0 ng/g soil and spike concentration had a significant effect on detected concentrations. Only 33% of samples showed recoverable eDNA when spiked with 0.25 ng/g soil, which was the low end of eDNA detection. To determine the rate of eDNA degradation, gDNA (1 ng/g soil) was spiked into soil and quantified over seven days. Salamander eDNA concentrations decreased across days, but eDNA was still amplifiable at day 7. Salamander eDNA was detected in two of 182 mesocosm soil samples over 12 weeks (n = 52 control samples; n = 65 presence samples; n = 65 eviction samples). The discrepancy in detection success between experiments indicates the potential challenges for this method to be used as a monitoring technique for small-bodied wild terrestrial salamander populations. © 2017 John Wiley & Sons Ltd.

Comparison of DNA extraction methods used to detect bacterial and yeast DNA from spiked whole blood by real-time PCR.

PubMed

Dalla-Costa, Libera M; Morello, Luis G; Conte, Danieli; Pereira, Luciane A; Palmeiro, Jussara K; Ambrosio, Altair; Cardozo, Dayane; Krieger, Marco A; Raboni, Sonia M

2017-09-01

Sepsis is the leading cause of death in intensive care units (ICUs) worldwide and its diagnosis remains a challenge. Blood culturing is the gold standard technique for blood stream infection (BSI) identification. Molecular tests to detect pathogens in whole blood enable early use of antimicrobials and affect clinical outcomes. Here, using real-time PCR, we evaluated DNA extraction using seven manual and three automated commercially available systems with whole blood samples artificially contaminated with Escherichia coli, Staphylococcus aureus, and Candida albicans, microorganisms commonly associated with BSI. Overall, the commercial kits evaluated presented several technical limitations including long turnaround time and low DNA yield and purity. The performance of the kits was comparable for detection of high microorganism loads (10 6 CFU/mL). However, the detection of lower concentrations was variable, despite the addition of pre-processing treatment to kits without such steps. Of the evaluated kits, the UMD-Universal CE IVD kit generated a higher quantity of DNA with greater nucleic acid purity and afforded the detection of the lowest microbial load in the samples. The inclusion of pre-processing steps with the kit seems to be critical for the detection of microorganism DNA directly from whole blood. In conclusion, future application of molecular techniques will require overcoming major challenges such as the detection of low levels of microorganism nucleic acids amidst the large quantity of human DNA present in samples or differences in the cellular structures of etiological agents that can also prevent high-quality DNA yields. Copyright © 2017 Elsevier B.V. All rights reserved.

Coupling Spore Traps and Quantitative PCR Assays for Detection of the Downy Mildew Pathogens of Spinach (Peronospora effusa) and Beet (P. schachtii)

PubMed Central

Klosterman, Steven J.; Anchieta, Amy; McRoberts, Neil; Koike, Steven T.; Subbarao, Krishna V.; Voglmayr, Hermann; Choi, Young-Joon; Thines, Marco; Martin, Frank N.

2016-01-01

Downy mildew of spinach (Spinacia oleracea), caused by Peronospora effusa, is a production constraint on production worldwide, including in California, where the majority of U.S. spinach is grown. The aim of this study was to develop a real-time quantitative polymerase chain reaction (qPCR) assay for detection of airborne inoculum of P. effusa in California. Among oomycete ribosomal DNA (rDNA) sequences examined for assay development, the highest nucleotide sequence identity was observed between rDNA sequences of P. effusa and P. schachtii, the cause of downy mildew on sugar beet and Swiss chard in the leaf beet group (Beta vulgaris subsp. vulgaris). Single-nucleotide polymorphisms were detected between P. effusa and P. schachtii in the 18S rDNA regions for design of P. effusa- and P. schachtii-specific TaqMan probes and reverse primers. An allele-specific probe and primer amplification method was applied to determine the frequency of both P. effusa and P. schachtii rDNA target sequences in pooled DNA samples, enabling quantification of rDNA of P. effusa from impaction spore trap samples collected from spinach production fields. The rDNA copy numbers of P. effusa were, on average, ≈3,300-fold higher from trap samples collected near an infected field compared with those levels recorded at a site without a nearby spinach field. In combination with disease-conducive weather forecasting, application of the assays may be helpful to time fungicide applications for disease management. PMID:24964150

Simulated radioactive decontamination of biological samples using a portable DNA extraction instrument for rapid DNA profiling.

PubMed

Frégeau, Chantal J; Dalpé, Claude

2016-02-01

A portable DNA extraction instrument was evaluated for its ability to decontaminate blood and saliva samples deposited on different surfaces (metal, plastic and glass) contaminated with stable isotopes of cobalt (Co), cesium (Cs), and strontium (Sr) as equivalents to their radiogenic (60)Co, (137)Cs, and (90)Sr isotopes, respectively, that could be released during a nuclear weapon accident or a radiological dispersal device (RDD) detonation. Despite the very high contamination levels tested in this study, successful removal of greater than 99.996% of the Co, Cs, Sr contaminants was achieved based on inductively coupled plasma-mass spectrometry (ICP-MS) and neutron activation analyses carried out on all liquids (including DNA eluates) and solid waste produced during automated DNA extraction. The remaining amounts of Co, Cs and Sr in the DNA eluates, when converted to dose rates (corresponding to (60)Co, (137)Cs and (90)Sr), were determined to be below the recommended dose limits for the general public in most of the scenarios tested. The presence of Co, Cs and Sr contaminants in the cell lysates had no adverse impact on the binding of DNA onto the magnetic DNA IQ™ beads. DNA yields were similar to uncontaminated controls. The remaining Co, Cs and Sr in the DNA eluates did not interfere with real-time PCR DNA quantification. In addition, the quality of the AmpFlSTR(®) Identifiler(®) profiles derived in 26min using an accelerated protocol was very good and comparable to controls. This study emphasizes the use of an accelerated process involving a portable DNA extraction instrument to significantly reduce radioactive dose rates to allow contaminated samples to be processed safely in a forensic mobile laboratory to expedite the identification of individuals potentially involved in the dispersal of nuclear or other radioactive materials. Crown Copyright © 2016. Published by Elsevier Ireland Ltd. All rights reserved.

Increased recovery of touch DNA evidence using FTA paper compared to conventional collection methods.

PubMed

Kirgiz, Irina A; Calloway, Cassandra

2017-04-01

Tape lifting and FTA paper scraping methods were directly compared to traditional double swabbing for collecting touch DNA from car steering wheels (n = 70 cars). Touch DNA was collected from the left or right side of each steering wheel (randomized) using two sterile cotton swabs, while the other side was sampled using water-soluble tape or FTA paper cards. DNA was extracted and quantified in duplicate using qPCR. Quantifiable amounts of DNA were detected for 100% of the samples (n = 140) collected independent of the method. However, the DNA collection yield was dependent on the collection method. A statistically significant difference in DNA yield was observed between FTA scraping and double swabbing methods (p = 0.0051), with FTA paper collecting a two-fold higher amount. Statistical analysis showed no significant difference in DNA yields between the double swabbing and tape lifting techniques (p = 0.21). Based on the DNA concentration required for 1 ng input, 47% of the samples collected using FTA paper would be expected to yield a short tandem repeat (STR) profile compared to 30% and 23% using double swabbing or tape, respectively. Further, 55% and 77% of the samples collected using double swabbing or tape, respectively, did not yield a high enough DNA concentration for the 0.5 ng of DNA input recommended for conventional STR kits and would be expected to result in a partial or no profile compared to 35% of the samples collected using FTA paper. STR analysis was conducted for a subset of the higher concentrated samples to confirm that the DNA collected from the steering wheel was from the driver. 32 samples were selected with DNA amounts of at least 1 ng total DNA (100 pg/μl when concentrated if required). A mixed STR profile was observed for 26 samples (88%) and the last driver was the major DNA contributor for 29 samples (94%). For one sample, the last driver was the minor DNA contributor. A full STR profile of the last driver was observed for 21 samples (69%) and a partial profile was observed for nine samples (25%); STR analysis failed for two samples collected using tape (6%). In conclusion, we show that the FTA paper scraping method has the potential to collect higher DNA yields from touch DNA evidence deposited on non-porous surfaces often encountered in criminal cases compared to conventional methods. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

Rapid detection of Cyprinid herpesvirus-3 (CyHV-3) using a gold nanoparticle-based hybridization assay.

PubMed

Saleh, Mona; El-Matbouli, Mansour

2015-06-01

Cyprinid herpesvirus-3 (CyHV-3) is a highly infectious pathogen that causes fatal disease in common and koi carp Cyprinus carpio L. CyHV-3 detection is usually based on virus propagation or amplification of the viral DNA using the PCR or LAMP techniques. However, due to the limited susceptibility of cells used for propagation, it is not always possible to successfully isolate CyHV-3 even from tissue samples that have high virus titres. All previously described detection methods including PCR-based assays are time consuming, laborious and require specialized equipment. To overcome these limitations, gold nanoparticles (AuNPs) have been explored for direct and sensitive detection of DNA. In this study, a label-free colorimetric nanodiagnostic method for direct detection of unamplified CyHV-3 DNA using gold nanoparticles is introduced. Under appropriate conditions, DNA probes hybridize with their complementary target sequences in the sample DNA, which results in aggregation of the gold nanoparticles and a concomitant colour change from red to blue, whereas test samples with non complementary DNA sequences remain red. In this study, gold nanoparticles were used to develop and evaluate a specific and sensitive hybridization assay for direct and rapid detection of the highly infectious pathogen termed Cyprinid herpesvirus-3. Copyright © 2015 Elsevier B.V. All rights reserved.

Human prenatal diagnosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Filkins, K.; Russo, R.J.

The multiauthor text is written as a ''guide to rationalize and clarify certain aspects of diagnosis, general counseling and intervention'' for ''health professionals who provide care to pregnant women.'' The text is not aimed at the ultrasonographer but rather at the physicians who are clinically responsible for patient management. Chapters of relevance to radiologists include an overview of prenatal screening and counseling, diagnosis of neural tube defects, ultrasonographic (US) scanning of fetal disorders in the first and second trimesters of pregnancy, US scanning in the third trimester, multiple gestation and selective termination, fetal echo and Doppler studies, and fetal therapy.more » Also included are overviews of virtually all currently utilized prenatal diagnostic techniques including amniocentesis, fetal blood sampling, fetoscopy, recombinant DNA detection of hemoglobinopathies, chorionic villus sampling, embryoscopy, legal issues, and diagnosis of Mendelian disorders by DNA analysis.« less

Genotyping of 25 leukemia-associated genes in a single work flow by next-generation sequencing technology with low amounts of input template DNA.

PubMed

Rinke, Jenny; Schäfer, Vivien; Schmidt, Mathias; Ziermann, Janine; Kohlmann, Alexander; Hochhaus, Andreas; Ernst, Thomas

2013-08-01

We sought to establish a convenient, sensitive next-generation sequencing (NGS) method for genotyping the 26 most commonly mutated leukemia-associated genes in a single work flow and to optimize this method for low amounts of input template DNA. We designed 184 PCR amplicons that cover all of the candidate genes. NGS was performed with genomic DNA (gDNA) from a cohort of 10 individuals with chronic myelomonocytic leukemia. The results were compared with NGS data obtained from sequencing of DNA generated by whole-genome amplification (WGA) of 20 ng template gDNA. Differences between gDNA and WGA samples in variant frequencies were determined for 2 different WGA kits. For gDNA samples, 25 of 26 genes were successfully sequenced with a sensitivity of 5%, which was achieved by a median coverage of 492 reads (range, 308-636 reads) per amplicon. We identified 24 distinct mutations in 11 genes. With WGA samples, we reliably detected all mutations above 5% sensitivity with a median coverage of 506 reads (range, 256-653 reads) per amplicon. With all variants included in the analysis, WGA amplification by the 2 kits tested yielded differences in variant frequencies that ranged from -28.19% to +9.94% [mean (SD) difference, -0.2% (4.08%)] and from -35.03% to +18.67% [mean difference, -0.75% (5.12%)]. Our method permits simultaneous analysis of a wide range of leukemia-associated target genes in a single sequencing run. NGS can be performed after WGA of template DNA for reliable detection of variants without introducing appreciable bias.

Persistence of DNA on clothes after exposure to water for different time periods-a study on bathtub, pond, and river.

PubMed

Helmus, Janine; Zorell, Sarah; Bajanowski, Thomas; Poetsch, Micaela

2018-01-01

DNA traces on clothes of drowned bodies can provide important evidence for police investigations, especially in cases of suspected suicides or homicides. However, it is generally assumed that the water "erodes" a large part of the DNA depending especially on the exposure time. In forensic casework, DNA of suspects could be found frequently on clothes of drowned bodies after hours, sometimes days of exposure to water. This study was conducted to attempt a general statement about the conditions under which sufficient DNA remains can be expected for molecular genetic analysis. For this purpose, different scenarios were designed including DNA from three to five people, different types of waters (tap, pond, bathtub and river) for various time periods, with higher water pressure, different temperature, and soapy water (bathtub). Epithelial cells and blood cells were mounted on cotton cloths, and the DNA left after exposure was analyzed using the Powerplex® ESX17fast kit. In the indoor experiments, complete profiles could be seen even after 10 min rinsing of clothes under the tap and after 1 week in the bathtub. Outdoors, the results differed considerably between summer and winter as well as between pond and river. The longest exposure time still resulting in a complete profile was 2 weeks for a sample with skin cells in the pond during winter. In summer, the time period for erasing the bulk of DNA was 4 hours regarding epithelial samples and more than 1 day for blood samples in pond and river environments. All in all, the results demonstrate that DNA could still be recovered from clothes exposed to water for more than 1 week.

Is "dried stool spots on filter paper method (DSSFP)" more sensitive and effective for detecting Blastocystis spp. and their subtypes by PCR and sequencing?

PubMed

Seyer, Ayse; Karasartova, Djursun; Ruh, Emrah; Güreser, Ayse Semra; Imir, Turgut; Taylan-Ozkan, Aysegul

2016-12-01

PCR and DNA sequencing are currently the diagnostic methods of choice for detection of Blastocystis spp. and their suptypes. Fresh or frozen stool samples have disadvantages in terms of several aspects such as transportation, storage, and existence of PCR inhibitors. Filter paper technology may provide a solution to these issues. The aim of the present study was to detect Blastocystis spp. and their subtypes by employing two different preservation methods: conventional frozen stool (FS) and dried stool spots on filter paper (DSSFP). Concentration and purity of DNA, sensitivity of PCR, and DNA sequencing results obtained from the two methods were also compared. A total of 230 fecal samples were included and separated into two parts: one part of the fecal samples were directly frozen and stored at -20 °C. The remaining portion of the specimens were homogenized with saline and spread onto the filter papers as thin layer with a diameter of approximately 3 cm. After air-dried, the filter papers were stored at room temperature. DSSFP samples were collected by scraping from the filter papers. DNA were extracted by EURx Stool DNA Extraction Kit from both samples. Concentration and purity were measured with Nano-Drop, then PCR and sequencing were conducted for detection of Blastocystis spp. and its genotypes. Pure DNA was obtained with a A260/A280 ratio of 1.7-2.2 in both methods. DNA yield from FS was 25-405 ng/μl and average DNA concentration was 151 ng/μl, while these were 7-339 and 122 ng/μl for DSSFP, respectively. No PCR inhibition was observed in two methods. DNA from DSSFP were found to be stable and PCR were reproducible for at least 1 year. FS-PCR- and DSSFP-PCR-positive samples were 49 (21.3 %) and 58 (25.3 %), respectively (p = 0.078). The 43 specimens were concordantly positive by both FS-PCR and DSSFP-PCR. When the microscopy was taken as the gold standard, sensitivity of DSSFP-PCR and FS-PCR was 95.5 and 86.4 %, while specificity of both tests was 99.4 and 98.3 %, respectively. DNA sequencing results of 19 microscopically confirmed cases were strictly identical (concordance 100 %) in both methods, and ST2:6, ST3:8, ST4:3, and ST6:2 were the detected subtypes. Among the 230 fecal samples, the most predominant subtypes were ST3, ST2, ST4, and ST1 by both FS and DSSFP methods. Concordance of DNA sequencing results obtained from the two methods was noted to be 90.7 %. To our knowledge, this is the first study that demonstrates DNA extraction from DSSFP is more sensitive and effective than the FS method for diagnosis of Blastocystis spp. and their subtypes by PCR and DNA sequencing.

Nucleic Acid-Based Cross-Linking Assay for Detection and Quantification of Hepatitis B Virus DNA

PubMed Central

Lai, Vicky C. H.; Guan, Richard; Wood, Michael L.; Lo, Su Kong; Yuen, Man-Fung; Lai, Ching-Lung

1999-01-01

A nucleic acid photo-cross-linking technology was used to develop a direct assay for the quantification of hepatitis B virus (HBV) DNA levels in serum. Cross-linker-modified DNA probes complementary to the viral genomes of the major HBV subtypes were synthesized and used in an assay that could be completed in less than 6 h. The quantification range of the assay, as determined by testing serial dilutions of Eurohep HBV reference standards and cloned HBV DNA, was 5 × 105 to 3 × 109 molecules of HBV DNA/ml of serum. Within-run and between-run coefficients of variation (CVs) for the assay were 4.3 and 4.0%, respectively. The assay was used to determine HBV DNA levels in 302 serum samples, and the results were compared to those obtained after testing the same samples with the Chiron branched-DNA (bDNA) assay for HBV DNA. Of the samples tested, 218 were positive for HBV DNA by both assays and 72 gave results below the cutoff for both assays. Of the remaining 12 samples, 10 were positive for HBV DNA by the cross-linking assay only; the 2 other samples were positive by the bDNA assay only. Twenty-eight samples had to be retested by the bDNA assay (CV, >20% between the results obtained from the testing of each sample in duplicate), whereas only three samples required retesting by the cross-linking assay. The correlation between the HBV DNA levels, as measured by the two tests, was very high (r = 0.902; P = 0.01). We conclude that the cross-linking assay is a sensitive and reproducible method for the detection and quantification of HBV DNA levels in serum. PMID:9854083

Changes in Liver Cell DNA Methylation Status in Diabetic Mice Affect Its FT-IR Characteristics

PubMed Central

Vidal, Benedicto de Campos; Ghiraldini, Flávia Gerelli; Mello, Maria Luiza S.

2014-01-01

Background Lower levels of cytosine methylation have been found in the liver cell DNA from non-obese diabetic (NOD) mice under hyperglycemic conditions. Because the Fourier transform-infrared (FT-IR) profiles of dry DNA samples are differently affected by DNA base composition, single-stranded form and histone binding, it is expected that the methylation status in the DNA could also affect its FT-IR profile. Methodology/Principal Findings The DNA FT-IR signatures obtained from the liver cell nuclei of hyperglycemic and normoglycemic NOD mice of the same age were compared. Dried DNA samples were examined in an IR microspectroscope equipped with an all-reflecting objective (ARO) and adequate software. Conclusions/Significance Changes in DNA cytosine methylation levels induced by hyperglycemia in mouse liver cells produced changes in the respective DNA FT-IR profiles, revealing modifications to the vibrational intensities and frequencies of several chemical markers, including νas –CH3 stretching vibrations in the 5-methylcytosine methyl group. A smaller band area reflecting lower energy absorbed in the DNA was found in the hyperglycemic mice and assumed to be related to the lower levels of –CH3 groups. Other spectral differences were found at 1700–1500 cm−1 and in the fingerprint region, and a slight change in the DNA conformation at the lower DNA methylation levels was suggested for the hyperglycemic mice. The changes that affect cytosine methylation levels certainly affect the DNA-protein interactions and, consequently, gene expression in liver cells from the hyperglycemic NOD mice. PMID:25019512

Improved multiple displacement amplification (iMDA) and ultraclean reagents.

PubMed

Motley, S Timothy; Picuri, John M; Crowder, Chris D; Minich, Jeremiah J; Hofstadler, Steven A; Eshoo, Mark W

2014-06-06

Next-generation sequencing sample preparation requires nanogram to microgram quantities of DNA; however, many relevant samples are comprised of only a few cells. Genomic analysis of these samples requires a whole genome amplification method that is unbiased and free of exogenous DNA contamination. To address these challenges we have developed protocols for the production of DNA-free consumables including reagents and have improved upon multiple displacement amplification (iMDA). A specialized ethylene oxide treatment was developed that renders free DNA and DNA present within Gram positive bacterial cells undetectable by qPCR. To reduce DNA contamination in amplification reagents, a combination of ion exchange chromatography, filtration, and lot testing protocols were developed. Our multiple displacement amplification protocol employs a second strand-displacing DNA polymerase, improved buffers, improved reaction conditions and DNA free reagents. The iMDA protocol, when used in combination with DNA-free laboratory consumables and reagents, significantly improved efficiency and accuracy of amplification and sequencing of specimens with moderate to low levels of DNA. The sensitivity and specificity of sequencing of amplified DNA prepared using iMDA was compared to that of DNA obtained with two commercial whole genome amplification kits using 10 fg (~1-2 bacterial cells worth) of bacterial genomic DNA as a template. Analysis showed >99% of the iMDA reads mapped to the template organism whereas only 0.02% of the reads from the commercial kits mapped to the template. To assess the ability of iMDA to achieve balanced genomic coverage, a non-stochastic amount of bacterial genomic DNA (1 pg) was amplified and sequenced, and data obtained were compared to sequencing data obtained directly from genomic DNA. The iMDA DNA and genomic DNA sequencing had comparable coverage 99.98% of the reference genome at ≥1X coverage and 99.9% at ≥5X coverage while maintaining both balance and representation of the genome. The iMDA protocol in combination with DNA-free laboratory consumables, significantly improved the ability to sequence specimens with low levels of DNA. iMDA has broad utility in metagenomics, diagnostics, ancient DNA analysis, pre-implantation embryo screening, single-cell genomics, whole genome sequencing of unculturable organisms, and forensic applications for both human and microbial targets.

Developmental validation of the PowerPlex(®) ESI 16 and PowerPlex(®) ESI 17 Systems: STR multiplexes for the new European standard.

PubMed

Tucker, Valerie C; Hopwood, Andrew J; Sprecher, Cynthia J; McLaren, Robert S; Rabbach, Dawn R; Ensenberger, Martin G; Thompson, Jonelle M; Storts, Douglas R

2011-11-01

In response to the ENFSI and EDNAP groups' call for new STR multiplexes for Europe, Promega(®) developed a suite of four new DNA profiling kits. This paper describes the developmental validation study performed on the PowerPlex(®) ESI 16 (European Standard Investigator 16) and the PowerPlex(®) ESI 17 Systems. The PowerPlex(®) ESI 16 System combines the 11 loci compatible with the UK National DNA Database(®), contained within the AmpFlSTR(®) SGM Plus(®) PCR Amplification Kit, with five additional loci: D2S441, D10S1248, D22S1045, D1S1656 and D12S391. The multiplex was designed to reduce the amplicon size of the loci found in the AmpFlSTR(®) SGM Plus(®) kit. This design facilitates increased robustness and amplification success for the loci used in the national DNA databases created in many countries, when analyzing degraded DNA samples. The PowerPlex(®) ESI 17 System amplifies the same loci as the PowerPlex(®) ESI 16 System, but with the addition of a primer pair for the SE33 locus. Tests were designed to address the developmental validation guidelines issued by the Scientific Working Group on DNA Analysis Methods (SWGDAM), and those of the DNA Advisory Board (DAB). Samples processed include DNA mixtures, PCR reactions spiked with inhibitors, a sensitivity series, and 306 United Kingdom donor samples to determine concordance with data generated with the AmpFlSTR(®) SGM Plus(®) kit. Allele frequencies from 242 white Caucasian samples collected in the United Kingdom are also presented. The PowerPlex(®) ESI 16 and ESI 17 Systems are robust and sensitive tools, suitable for the analysis of forensic DNA samples. Full profiles were routinely observed with 62.5pg of a fully heterozygous single source DNA template. This high level of sensitivity was found to impact on mixture analyses, where 54-86% of unique minor contributor alleles were routinely observed in a 1:19 mixture ratio. Improved sensitivity combined with the robustness afforded by smaller amplicons has substantially improved the quantity of data obtained from degraded samples, and the improved chemistry confers exceptional tolerance to high levels of laboratory prepared inhibitors. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

Phylogeography of the antilopine wallaroo (Macropus antilopinus) across tropical northern Australia.

PubMed

Wadley, Jessica J; Fordham, Damien A; Thomson, Vicki A; Ritchie, Euan G; Austin, Jeremy J

2016-11-01

The distribution of antilopine wallaroo, Macropus antilopinus , is marked by a break in the species' range between Queensland and the Northern Territory, coinciding with the Carpentarian barrier. Previous work on M. antilopinus revealed limited genetic differentiation between the Northern Territory and Queensland M. antilopinus populations across this barrier. The study also identified a number of divergent lineages in the Northern Territory, but was unable to elucidate any geographic structure. Here, we re-examine these results to (1) determine phylogeographic patterns across the range of M. antilopinus and (2) infer the biogeographic barriers associated with these patterns. The tropical savannahs of northern Australia: from the Cape York Peninsula in the east, to the Kimberley in the west. We examined phylogeographic patterns in M. antilopinus using a larger number of samples and three mtDNA genes: NADH dehydrogenase subunit 2, cytochrome b, and the control region. Two datasets were generated and analyzed: (1) a subset of samples with all three mtDNA regions concatenated together and (2) all samples for just control region sequences that included samples from the previous study. Analysis included generating phylogenetic trees based on Bayesian analysis and intraspecific median-joining networks. The contemporary spatial structure of M. antilopinus mtDNA lineages revealed five shallow clades and a sixth, divergent lineage. The genetic differences that we found between Queensland and Northern Territory M. antilopinus samples confirmed the split in the geographic distribution of the species. We also found weak genetic differentiation between Northern Territory samples and those from the Kimberley region of Western Australia, possibly due to the Kimberley Plateau-Arnhem Land barrier. Within the Northern Territory, two clades appear to be parapatric in the west, while another two clades are broadly sympatric across the Northern Territory. MtDNA diversity of M. antilopinus revealed an unexpectedly complex evolutionary history involving multiple sympatric and parapatric mtDNA clades across northern Australia. These phylogeographic patterns highlight the importance of investigating genetic variation across distributions of species and integrating this information into biodiversity conservation.

The Qiagen Investigator® Quantiplex HYres as an alternative kit for DNA quantification.

PubMed

Frégeau, Chantal J; Laurin, Nancy

2015-05-01

The Investigator® Quantiplex HYres kit was evaluated as a potential replacement for dual DNA quantification of casework samples. This kit was determined to be highly sensitive with a limit of quantification and limit of detection of 0.0049ng/μL and 0.0003ng/μL, respectively, for both human and male DNA, using full or half reaction volumes. It was also accurate in assessing the amount of male DNA present in 96 mock and actual casework male:female mixtures (various ratios) processed in this exercise. The close correlation between the male/human DNA ratios expressed in percentages derived from the Investigator® Quantiplex HYres quantification results and the male DNA proportion calculated in mixed AmpFlSTR® Profiler® Plus or AmpFlSTR® Identifiler® Plus profiles, using the Amelogenin Y peak and STR loci, allowed guidelines to be developed to facilitate decisions regarding when to submit samples to Y-STR rather than autosomal STR profiling. The internal control (IC) target was shown to be more sensitive to inhibitors compared to the human and male DNA targets included in the Investigator® Quantiplex HYres kit serving as a good quality assessor of DNA extracts. The new kit met our criteria of enhanced sensitivity, accuracy, consistency, reliability and robustness for casework DNA quantification. Crown Copyright © 2015. Published by Elsevier Ireland Ltd. All rights reserved.

Qualitative assessment of study materials and communication strategies used in studies that include DNA collection.

PubMed

Jenkins, Mary M; Reed-Gross, Erika; Barfield, Wanda D; Prue, Christine E; Gallagher, Margaret L; Rasmussen, Sonja A; Honein, Margaret A

2011-11-01

To understand motivations and barriers to participation in studies that include DNA collection, focus group discussions were held with mothers who had participated in a case-control study of birth defects. Recruited mothers had completed an interview and had received a mailed kit containing cytobrushes to collect buccal cells for DNA from herself, her infant, and her infant's father. Six moderator-led focus groups were attended by a total of 38 women residing in Atlanta, Georgia. Focus groups were segmented by DNA collection status (biologics participants or nonparticipants), infant case-control status, infant birthweight, and maternal race and ethnicity. This report assesses maternal attitudes toward study materials and communication strategies. Across groups, respondents expressed concern about how their contact information was obtained. Study materials were described as clear and professional by most women, although some respondents reported confusion about disclosure of individual genetic results. Respondents generally reported that monetary incentives were not a motivation to participate, but increased perceived study legitimacy. Biologics nonparticipants expressed concerns about kit component sterility; government involvement; and DNA sample use, storage, and disposal. Respondents suggested that investigators provide feedback on whether sample collection was performed correctly and provide materials targeted to fathers to help alleviate paternal skepticism. Participation in DNA collection might be improved by strengthening study materials and communication strategies. Published 2011 Wiley Periodicals, Inc. This article is a U.S. Government work and is in the public domain in the USA.

Improved Y-STR typing for disaster victim identification, missing persons investigations, and historical human skeletal remains.

PubMed

Ambers, Angie; Votrubova, Jitka; Vanek, Daniel; Sajantila, Antti; Budowle, Bruce

2018-02-23

Bones are a valuable source of DNA in forensic, anthropological, and archaeological investigations. There are a number of scenarios in which the only samples available for testing are highly degraded and/or skeletonized. Often it is necessary to perform more than one type of marker analysis on such samples in order to compile sufficient data for identification. Lineage markers, such as Y-STRs and mitochondrial DNA (mtDNA), represent important systems to complement autosomal DNA markers and anthropological metadata in making associations between unidentified remains and living relatives or for characterization of the remains for historical and archaeological studies. In this comparative study, Y-STR typing with both Yfiler™ and Yfiler™ Plus (Thermo Fisher Scientific, Waltham, MA, USA) was performed on a variety of human skeletal remains, including samples from the American Civil War (1861-1865), the late nineteenth century gold rush era in Deadwood, SD, USA (1874-1877), the Seven Years' War (1756-1763), a seventeenth-century archaeological site in Raspenava, Bohemia (Czech Republic), and World War II (1939-1945). The skeletal remains used for this study were recovered from a wide range of environmental conditions and were extracted using several common methods. Regardless of the DNA extraction method used and the age/condition of the remains, 22 out of 24 bone samples yielded a greater number of alleles using the Yfiler™ Plus kit compared to the Yfiler™ kit using the same quantity of input DNA. There was no discernable correlation with the degradation index values for these samples. Overall, the efficacy of the Yfiler™ Plus assay was demonstrated on degraded DNA from skeletal remains. Yfiler™ Plus increases the discriminatory power over the previous generation multiplex due to the larger set of Y-STR markers available for analysis and buffer modifications with the newer version kit. Increased haplotype resolution is provided to infer or refute putative genetic relationships.

Direct qPCR quantification using the Quantifiler(®) Trio DNA quantification kit.

PubMed

Liu, Jason Yingjie

2014-11-01

The effectiveness of a direct quantification assay is essential to the adoption of the combined direct quantification/direct STR workflow. In this paper, the feasibility of using the Quantifiler(®) Trio DNA quantification kit for the direct quantification of forensic casework samples was investigated. Both low-level touch DNA samples and blood samples were collected on PE swabs and quantified directly. The increased sensitivity of the Quantifiler(®) Trio kit enabled the detection of less than 10pg of DNA in unprocessed touch samples and also minimizes the stochastic effect experienced by different targets in the same sample. The DNA quantity information obtained from a direct quantification assay using the Quantifiler(®) Trio kit can also be used to accurately estimate the optimal input DNA quantity for a direct STR amplification reaction. The correlation between the direct quantification results (Quantifiler(®) Trio kit) and the direct STR results (GlobalFiler™ PCR amplification kit(*)) for low-level touch DNA samples indicates that direct quantification using the Quantifiler(®) Trio DNA quantification kit is more reliable than the Quantifiler(®) Duo DNA quantification kit for predicting the STR results of unprocessed touch DNA samples containing less than 10pg of DNA. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Automated extraction of DNA from biological stains on fabric from crime cases. A comparison of a manual and three automated methods.

PubMed

Stangegaard, Michael; Hjort, Benjamin B; Hansen, Thomas N; Hoflund, Anders; Mogensen, Helle S; Hansen, Anders J; Morling, Niels

2013-05-01

The presence of PCR inhibitors in extracted DNA may interfere with the subsequent quantification and short tandem repeat (STR) reactions used in forensic genetic DNA typing. DNA extraction from fabric for forensic genetic purposes may be challenging due to the occasional presence of PCR inhibitors that may be co-extracted with the DNA. Using 120 forensic trace evidence samples consisting of various types of fabric, we compared three automated DNA extraction methods based on magnetic beads (PrepFiler Express Forensic DNA Extraction Kit on an AutoMate Express, QIAsyphony DNA Investigator kit either with the sample pre-treatment recommended by Qiagen or an in-house optimized sample pre-treatment on a QIAsymphony SP) and one manual method (Chelex) with the aim of reducing the amount of PCR inhibitors in the DNA extracts and increasing the proportion of reportable STR-profiles. A total of 480 samples were processed. The highest DNA recovery was obtained with the PrepFiler Express kit on an AutoMate Express while the lowest DNA recovery was obtained using a QIAsymphony SP with the sample pre-treatment recommended by Qiagen. Extraction using a QIAsymphony SP with the sample pre-treatment recommended by Qiagen resulted in the lowest percentage of PCR inhibition (0%) while extraction using manual Chelex resulted in the highest percentage of PCR inhibition (51%). The largest number of reportable STR-profiles was obtained with DNA from samples extracted with the PrepFiler Express kit (75%) while the lowest number was obtained with DNA from samples extracted using a QIAsymphony SP with the sample pre-treatment recommended by Qiagen (41%). Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

DNase I and Proteinase K eliminate DNA from injured or dead bacteria but not from living bacteria in microbial reference systems and natural drinking water biofilms for subsequent molecular biology analyses.

PubMed

Villarreal, Jessica Varela; Jungfer, Christina; Obst, Ursula; Schwartz, Thomas

2013-09-01

Molecular techniques, such as polymerase chain reaction (PCR) and quantitative PCR (qPCR), are very sensitive, but may detect total DNA present in a sample, including extracellular DNA (eDNA) and DNA coming from live and dead cells. DNase I is an endonuclease that non-specifically cleaves single- and double-stranded DNA. This enzyme was tested in this study to analyze its capacity of digesting DNA coming from dead cells with damaged cell membranes, leaving DNA from living cells with intact cell membranes available for DNA-based methods. For this purpose, an optimized DNase I/Proteinase K (DNase/PK) protocol was developed. Intact Staphylococcus aureus cells, heat-killed Pseudomonas aeruginosa cells, free genomic DNA of Salmonella enterica, and a mixture of these targets were treated according to the developed DNase/PK protocol. In parallel, these samples were treated with propidium monoazide (PMA) as an already described assay for live-dead discrimination. Quantitative PCR and PCR-DGGE of the eubacterial 16S rDNA fragment were used to test the ability of the DNase/PK and PMA treatments to distinguish DNA coming from cells with intact cell membranes in the presence of DNA from dead cells and free genomic DNA. The methods were applied to three months old autochthonous drinking water biofilms from a pilot facility built at a German waterworks. Shifts in the DNA patterns observed after DGGE analysis demonstrated the applicability of DNase/PK as well as of the PMA treatment for natural biofilm investigation. However, the DNase/PK treatment demonstrated some practical advantages in comparison with the PMA treatment for live/dead discrimination of bacterial targets in drinking water systems. © 2013 Elsevier B.V. All rights reserved.

Extraction of genomic DNA from yeasts for PCR-based applications.

PubMed

Lõoke, Marko; Kristjuhan, Kersti; Kristjuhan, Arnold

2011-05-01

We have developed a quick and low-cost genomic DNA extraction protocol from yeast cells for PCR-based applications. This method does not require any enzymes, hazardous chemicals, or extreme temperatures, and is especially powerful for simultaneous analysis of a large number of samples. DNA can be efficiently extracted from different yeast species (Kluyveromyces lactis, Hansenula polymorpha, Schizosaccharomyces pombe, Candida albicans, Pichia pastoris, and Saccharomyces cerevisiae). The protocol involves lysis of yeast colonies or cells from liquid culture in a lithium acetate (LiOAc)-SDS solution and subsequent precipitation of DNA with ethanol. Approximately 100 nanograms of total genomic DNA can be extracted from 1 × 10(7) cells. DNA extracted by this method is suitable for a variety of PCR-based applications (including colony PCR, real-time qPCR, and DNA sequencing) for amplification of DNA fragments of ≤ 3500 bp.

Whole genome amplification and real-time PCR in forensic casework

PubMed Central

Giardina, Emiliano; Pietrangeli, Ilenia; Martone, Claudia; Zampatti, Stefania; Marsala, Patrizio; Gabriele, Luciano; Ricci, Omero; Solla, Gianluca; Asili, Paola; Arcudi, Giovanni; Spinella, Aldo; Novelli, Giuseppe

2009-01-01

Background WGA (Whole Genome Amplification) in forensic genetics can eliminate the technical limitations arising from low amounts of genomic DNA (gDNA). However, it has not been used to date because any amplification bias generated may complicate the interpretation of results. Our aim in this paper was to assess the applicability of MDA to forensic SNP genotyping by performing a comparative analysis of genomic and amplified DNA samples. A 26-SNPs TaqMan panel specifically designed for low copy number (LCN) and/or severely degraded genomic DNA was typed on 100 genomic as well as amplified DNA samples. Results Aliquots containing 1, 0.1 and 0.01 ng each of 100 DNA samples were typed for a 26-SNPs panel. Similar aliquots of the same DNA samples underwent multiple displacement amplification (MDA) before being typed for the same panel. Genomic DNA samples showed 0% PCR failure rate for all three dilutions, whilst the PCR failure rate of the amplified DNA samples was 0% for the 1 ng and 0.1 ng dilutions and 0.077% for the 0.01 ng dilution. The genotyping results of both the amplified and genomic DNA samples were also compared with reference genotypes of the same samples obtained by direct sequencing. The genomic DNA samples showed genotype concordance rates of 100% for all three dilutions while the concordance rates of the amplified DNA samples were 100% for the 1 ng and 0.1 ng dilutions and 99.923% for the 0.01 ng dilution. Moreover, ten artificially-degraded DNA samples, which gave no results when analyzed by current forensic methods, were also amplified by MDA and genotyped with 100% concordance. Conclusion We investigated the suitability of MDA material for forensic SNP typing. Comparative analysis of amplified and genomic DNA samples showed that a large number of SNPs could be accurately typed starting from just 0.01 ng of template. We found that the MDA genotyping call and accuracy rates were only slightly lower than those for genomic DNA. Indeed, when 10 pg of input DNA was used in MDA, we obtained 99.923% concordance, indicating a genotyping error rate of 1/1299 (7.7 × 10-4). This is quite similar to the genotyping error rate of STRs used in current forensic analysis. Such efficiency and accuracy of SNP typing of amplified DNA suggest that MDA can also generate large amounts of genome-equivalent DNA from a minimal amount of input DNA. These results show for the first time that MDA material is suitable for SNP-based forensic protocols and in general when samples fail to give interpretable STR results. PMID:19366436

Wanted dead or alive? Using metabarcoding of environmental DNA and RNA to distinguish living assemblages for biosecurity applications

PubMed Central

Zaiko, Anastasija; Fletcher, Lauren M.; Laroche, Olivier; Wood, Susanna A.

2017-01-01

High-throughput sequencing metabarcoding studies in marine biosecurity have largely focused on targeting environmental DNA (eDNA). DNA can persist extracellularly in the environment, making discrimination of living organisms difficult. In this study, bilge water samples (i.e., water accumulating on-board a vessel during transit) were collected from 15 small recreational and commercial vessels. eDNA and eRNA molecules were co-extracted and the V4 region of the 18S ribosomal RNA gene targeted for metabarcoding. In total, 62.7% of the Operational Taxonomic Units (OTUs) were identified at least once in the corresponding eDNA and eRNA reads, with 19.5% unique to eDNA and 17.7% to eRNA. There were substantial differences in diversity between molecular compartments; 57% of sequences from eDNA-only OTUs belonged to fungi, likely originating from legacy DNA. In contrast, there was a higher percentage of metazoan (50.2%) and ciliate (31.7%) sequences in the eRNA-only OTUs. Our data suggest that the presence of eRNA-only OTUs could be due to increased cellular activities of some rare taxa that were not identified in the eDNA datasets, unusually high numbers of rRNA transcripts in ciliates, and/or artefacts produced during the reverse transcriptase, PCR and sequencing steps. The proportions of eDNA/eRNA shared and unshared OTUs were highly heterogeneous within individual bilge water samples. Multiple factors including boat type and the activities performed on-board, such as washing of scientific equipment, may play a major role in contributing to this variability. For some marine biosecurity applications analysis, eDNA-only data may be sufficient, however there are an increasing number of instances where distinguishing the living portion of a community is essential. For these circumstances, we suggest only including OTUs that are present in both eDNA and eRNA data. OTUs found only in the eRNA data need to be interpreted with caution until further research provides conclusive evidence for their origin. PMID:29095959

Wanted dead or alive? Using metabarcoding of environmental DNA and RNA to distinguish living assemblages for biosecurity applications.

PubMed

Pochon, Xavier; Zaiko, Anastasija; Fletcher, Lauren M; Laroche, Olivier; Wood, Susanna A

2017-01-01

High-throughput sequencing metabarcoding studies in marine biosecurity have largely focused on targeting environmental DNA (eDNA). DNA can persist extracellularly in the environment, making discrimination of living organisms difficult. In this study, bilge water samples (i.e., water accumulating on-board a vessel during transit) were collected from 15 small recreational and commercial vessels. eDNA and eRNA molecules were co-extracted and the V4 region of the 18S ribosomal RNA gene targeted for metabarcoding. In total, 62.7% of the Operational Taxonomic Units (OTUs) were identified at least once in the corresponding eDNA and eRNA reads, with 19.5% unique to eDNA and 17.7% to eRNA. There were substantial differences in diversity between molecular compartments; 57% of sequences from eDNA-only OTUs belonged to fungi, likely originating from legacy DNA. In contrast, there was a higher percentage of metazoan (50.2%) and ciliate (31.7%) sequences in the eRNA-only OTUs. Our data suggest that the presence of eRNA-only OTUs could be due to increased cellular activities of some rare taxa that were not identified in the eDNA datasets, unusually high numbers of rRNA transcripts in ciliates, and/or artefacts produced during the reverse transcriptase, PCR and sequencing steps. The proportions of eDNA/eRNA shared and unshared OTUs were highly heterogeneous within individual bilge water samples. Multiple factors including boat type and the activities performed on-board, such as washing of scientific equipment, may play a major role in contributing to this variability. For some marine biosecurity applications analysis, eDNA-only data may be sufficient, however there are an increasing number of instances where distinguishing the living portion of a community is essential. For these circumstances, we suggest only including OTUs that are present in both eDNA and eRNA data. OTUs found only in the eRNA data need to be interpreted with caution until further research provides conclusive evidence for their origin.

Dielectrophoretic Isolation and Detection of cfc-DNA Nanoparticulate Biomarkers and Virus from Blood

PubMed Central

Sonnenberg, Avery; Marciniak, Jennifer Y.; McCanna, James; Krishnan, Rajaram; Rassenti, Laura; Kipps, Thomas J.; Heller, Michael J.

2015-01-01

Dielectrophoretic (DEP) microarray devices allow important cellular nanoparticulate biomarkers and virus to be rapidly isolated, concentrated and detected directly from clinical and biological samples. A variety of sub-micron nanoparticulate entities including cell free circulating (cfc) DNA, mitochondria and virus can be isolated into DEP high-field areas on microelectrodes, while blood cells and other micron-size entities become isolated into DEP low-field areas between the microelectrodes. The nanoparticulate entities are held in the DEP high-field areas while cells are washed away along with proteins and other small molecules which are not affected by the DEP electric fields. DEP carried out on 20 µL of whole blood obtained from Chronic Lymphocytic Leukemia (CLL) patients showed a considerable amount of SYBR Green stained DNA fluorescent material concentrated in the DEP high-field regions. Whole blood obtained from healthy individuals showed little or no fluorescent DNA materials in the DEP high-field regions. Fluorescent T7 bacteriophage virus could be isolated directly from blood samples, and fluorescently stained mitochondria could be isolated from biological buffer samples. Using newer DEP microarray devices, high molecular weight (hmw) DNA could be isolated from serum and detected at levels as low as 8–16 ng/mL. PMID:23436471

Cellular chromosome DNA interferes with fluorescence quantitative real-time PCR detection of HBV DNA in culture medium.

PubMed

Pan, Xiao-Ben; Wei, Lai; Han, Jin-Chao; Gao, Yan

2008-01-01

Fluorescence quantitative real-time PCR (FQ-PCR) is a recently developed technique increasingly used for clinical diagnosis by detection of hepatitis B virus (HBV) DNA in serum. FQ-PCR is also used in scientific research for detection of HBV DNA in cell culture. Understanding potential FQ-PCR interference factors can improve the accuracy of HBV DNA quantification in cell culture medium. HBV positive serum was diluted with culture medium to produce three test groups with HBV DNA levels of 5 x 10(7) copies/ml (high), 5 x 10(5) copies/ml (medium), and 5 x 10(3) copies/ml (low). Chromosome DNA was extracted from HepG2 cells and then added to high, medium, and low group samples at final concentrations of 0, 12.5, 25, 50, and 100 microg/ml. The samples were quantified by FQ-PCR and data were evaluated using statistical software. No marked changes were seen in the quantitative curves for high level HBV DNA samples when the samples were supplemented with 0-100 microg/ml of chromosome DNA. Interference was observed in medium level samples when 50 and 100 microg/ml of chromosome DNA was added. Interference was also observed in low level HBV DNA samples when the concentration of added chromosome DNA was greater than 25 microg/ml. The interference was eliminated when samples were digested by DNase I prior to PCR detection. In Conclusions, the presence of cellular chromosome DNA can interfere with the detection of HBV DNA by FQ-PCR. Removal of cellular chromosome DNA from culture media prior to FQ-PCR is necessary for reliable HBV DNA quantitative detection. (c) 2007 Wiley-Liss, Inc.

High and uneven levels of 45S rDNA site-number variation across wild populations of a diploid plant genus (Anacyclus, Asteraceae)

PubMed Central

Rosato, Marcela; Álvarez, Inés; Nieto Feliner, Gonzalo

2017-01-01

The nuclear genome harbours hundreds to several thousand copies of ribosomal DNA. Despite their essential role in cellular ribogenesis few studies have addressed intrapopulation, interpopulation and interspecific levels of rDNA variability in wild plants. Some studies have assessed the extent of rDNA variation at the sequence and copy-number level with large sampling in several species. However, comparable studies on rDNA site number variation in plants, assessed with extensive hierarchical sampling at several levels (individuals, populations, species) are lacking. In exploring the possible causes for ribosomal loci dynamism, we have used the diploid genus Anacyclus (Asteraceae) as a suitable system to examine the evolution of ribosomal loci. To this end, the number and chromosomal position of 45S rDNA sites have been determined in 196 individuals from 47 populations in all Anacyclus species using FISH. The 45S rDNA site-number has been assessed in a significant sample of seed plants, which usually exhibit rather consistent features, except for polyploid plants. In contrast, the level of rDNA site-number variation detected in Anacyclus is outstanding in the context of angiosperms particularly regarding populations of the same species. The number of 45S rDNA sites ranged from four to 11, accounting for 14 karyological ribosomal phenotypes. Our results are not even across species and geographical areas, and show that there is no clear association between the number of 45S rDNA loci and the life cycle in Anacyclus. A single rDNA phenotype was detected in several species, but a more complex pattern that included intra-specific and intra-population polymorphisms was recorded in A. homogamos, A. clavatus and A. valentinus, three weedy species showing large and overlapping distribution ranges. It is likely that part of the cytogenetic changes and inferred dynamism found in these species have been triggered by genomic rearrangements resulting from contemporary hybridisation. PMID:29088249

High and uneven levels of 45S rDNA site-number variation across wild populations of a diploid plant genus (Anacyclus, Asteraceae).

PubMed

Rosato, Marcela; Álvarez, Inés; Nieto Feliner, Gonzalo; Rosselló, Josep A

2017-01-01

The nuclear genome harbours hundreds to several thousand copies of ribosomal DNA. Despite their essential role in cellular ribogenesis few studies have addressed intrapopulation, interpopulation and interspecific levels of rDNA variability in wild plants. Some studies have assessed the extent of rDNA variation at the sequence and copy-number level with large sampling in several species. However, comparable studies on rDNA site number variation in plants, assessed with extensive hierarchical sampling at several levels (individuals, populations, species) are lacking. In exploring the possible causes for ribosomal loci dynamism, we have used the diploid genus Anacyclus (Asteraceae) as a suitable system to examine the evolution of ribosomal loci. To this end, the number and chromosomal position of 45S rDNA sites have been determined in 196 individuals from 47 populations in all Anacyclus species using FISH. The 45S rDNA site-number has been assessed in a significant sample of seed plants, which usually exhibit rather consistent features, except for polyploid plants. In contrast, the level of rDNA site-number variation detected in Anacyclus is outstanding in the context of angiosperms particularly regarding populations of the same species. The number of 45S rDNA sites ranged from four to 11, accounting for 14 karyological ribosomal phenotypes. Our results are not even across species and geographical areas, and show that there is no clear association between the number of 45S rDNA loci and the life cycle in Anacyclus. A single rDNA phenotype was detected in several species, but a more complex pattern that included intra-specific and intra-population polymorphisms was recorded in A. homogamos, A. clavatus and A. valentinus, three weedy species showing large and overlapping distribution ranges. It is likely that part of the cytogenetic changes and inferred dynamism found in these species have been triggered by genomic rearrangements resulting from contemporary hybridisation.

Prostate cancer molecular detection in plasma samples by glutathione S-transferase P1 (GSTP1) methylation analysis.

PubMed

Dumache, Raluca; Puiu, Maria; Motoc, Marilena; Vernic, Corina; Dumitrascu, Victor

2014-01-01

Prostate cancer (PCa) represents the most commonly diagnosed type of malignancy among men in Western European countries and the second cause of cancer-related deaths among men worldwide. Methylation of the CpG island has an important role in prostate carcinogenesis and progression. The purpose of the study was to analyse the diagnostic value of aberrant promoter hypermethylation of the gene for glutathione S-transferase P1 (GSTP1) in plasma DNA to discriminate between prostate cancer (PCa) and benign prostatic hyperplasia (BPH) patients by minimally invasive methods. Aberrant promoter hypermethylation was investigated in DNA isolated from plasma samples of 31 patients with diagnostic of PCa and 44 cancer-free males (control subjects). Extracted genomic DNA was bisulfite treated and analyzed using methylation-specific polymerase chain reaction (MS-PCR) technique. Hypermethylation of the GSTP1 gene was detected in plasma samples from 27 of 31 (92.86%) patients with PCa. Genomic DNA from plasma samples from the 44 controls without genitourinary cancer revealed promoter hypermethylation of GSTP1 gene in 3 (10.6%) of the 44 patients. Receiver operating curve (ROC) included clinico-pathological parameters such as: serum PSA levels, pathological stage, Gleason score, hypermethylation status of GSTP1 gene, and it gave a predictive accuracy of 93% with a sensitivity and specificity of 95% and 87%, respectively. In this study, we have evaluated the ability of GSTP1 gene to discriminate between PCa and BPH patients in genomic DNA from plasma samples by non-invasive methods.

Mitochondrial and nuclear DNA analysis revealed a cryptic species and genetic introgression in Littorina sitkana (Mollusca, Gastropoda).

PubMed

Azuma, Noriko; Yamazaki, Tomoyasu; Chiba, Susumu

2011-12-01

We investigated mitochondrial and nuclear DNA genotypes in nominal Littorina sitkana samples from 2 localities in Eastern Hokkaido, northern Japan. Our results indicated the existence of cryptic species. In the analysis of partial mitochondrial Cytchrome b gene sequences, haplotypes of L. sitkana samples were monophyletic in a phylogenetic tree with orthologous sequences from other Littorina species, but were apparently separated in 2 clades. One included typical L. sitkana (CBa clade) samples, which formed a clade with an allopatric species, L. horikawai. The other, CBb, was independent from CBa and L. horikawai. Haplotypes of the mitochondrial 16S rRNA gene also separated into 2 clades. We additionally examined intron sequence of the heat shock cognate 70 (HSC70) nuclear gene and identified 17 haplotypes. These were also separated into 2 clades, HSCa and HSCb. Among the examined Hokkaido samples, 60% of individuals were heterozygotes. However, each heterozygote consisted of haplotypes from the same clade, HSCa or HSCb, and no admixture of HSCa and HSCb haplotypes was observed. These results indicate reproductive isolation between the 2 clades. Among the genotyped Hokkaido samples, 93% of individuals had CBa + HSCa or CBb + HSCb genotypes, and 7% had CBb + HSCa genotypes. The discrepancy between the mtDNA and nuclear DNA haplotypes in a few individuals may have been caused by genetic introgression due to past hybridization.

Investigation of Antarctic Marine Metazoan Biodiversity Through Metagenomic Analysis of Environmental DNA

NASA Astrophysics Data System (ADS)

Cowart, D. A.; Cheng, C. C.; Murphy, K.

2016-02-01

Environmental DNA (eDNA), or DNA extracted from environmental collections, is frequently used to gauge biodiversity and identify the presence of rare or invasive species within a habitat. Previous studies have demonstrated that compared to traditional surveying methods, high-throughput sequencing of eDNA can provide increased detection sensitivity of aquatic taxa, holding promise for various conservation applications. To determine the potential of eDNA for assessing biodiversity of Antarctic marine metazoan communities, we have extracted eDNA from seawater sampled from four regions near Palmer Station in West Antarctic Peninsula. Metagenomic sequencing of the eDNA was performed on Illumina HiSeq2500, and produced 325 million quality-processed reads. Preliminary read mapping for two regions, Gerlache Strait and Bismarck Strait, identified approximately 4% of reads mapping to eukaryotes for each region, with >50% of the those reads mapping to metazoan animals. Key groups investigated include the nototheniidae family of Antarctic fishes, to which 0.2 and 0.8 % of the metazoan reads were assigned for each region respectively. The presence of the recently invading lithodidae king crabs was also detected at both regions. Additionally, to estimate the persistence of eDNA in polar seawater, a rate of eDNA decay will be quantified from seawater samples collected over 20 days from Antarctic fish holding tanks and held at ambient Antarctic water temperatures. The ability to detect animal signatures from eDNA, as well as the quantification of eDNA decay over time, could provide another method for reliable monitoring of polar habitats at various spatial and temporal scales.

Bovine fetal DNA in the maternal circulation: Applications and implications.

PubMed

Lemos, D C; Takeuchi, P L; Rios, A F L; Araújo, A; Lemos, H C; Ramos, E S

2011-11-01

The main aim of the present study was to detect bovine fetal DNA in the maternal circulation, a relatively unexplored subject in the literature. DNA was extracted from blood of 84 primipara cows (Bos indicus) at different gestational ages (30-270 days) and from 100 adult animals (50 males and 50 non-pregnant cows). The samples were analyzed using PCR with primers for TSPY gene. Molecular results matched the fetal phenotypic gender in all 47 male and 37 female fetuses, including early pregnancy, and in control animals. These results evidence a bovine transplacental fetal DNA passage. Copyright © 2011 Elsevier Ltd. All rights reserved.

DNA-encoded chemistry: enabling the deeper sampling of chemical space.

PubMed

Goodnow, Robert A; Dumelin, Christoph E; Keefe, Anthony D

2017-02-01

DNA-encoded chemical library technologies are increasingly being adopted in drug discovery for hit and lead generation. DNA-encoded chemistry enables the exploration of chemical spaces four to five orders of magnitude more deeply than is achievable by traditional high-throughput screening methods. Operation of this technology requires developing a range of capabilities including aqueous synthetic chemistry, building block acquisition, oligonucleotide conjugation, large-scale molecular biological transformations, selection methodologies, PCR, sequencing, sequence data analysis and the analysis of large chemistry spaces. This Review provides an overview of the development and applications of DNA-encoded chemistry, highlighting the challenges and future directions for the use of this technology.

Base-Calling Algorithm with Vocabulary (BCV) Method for Analyzing Population Sequencing Chromatograms

PubMed Central

Fantin, Yuri S.; Neverov, Alexey D.; Favorov, Alexander V.; Alvarez-Figueroa, Maria V.; Braslavskaya, Svetlana I.; Gordukova, Maria A.; Karandashova, Inga V.; Kuleshov, Konstantin V.; Myznikova, Anna I.; Polishchuk, Maya S.; Reshetov, Denis A.; Voiciehovskaya, Yana A.; Mironov, Andrei A.; Chulanov, Vladimir P.

2013-01-01

Sanger sequencing is a common method of reading DNA sequences. It is less expensive than high-throughput methods, and it is appropriate for numerous applications including molecular diagnostics. However, sequencing mixtures of similar DNA of pathogens with this method is challenging. This is important because most clinical samples contain such mixtures, rather than pure single strains. The traditional solution is to sequence selected clones of PCR products, a complicated, time-consuming, and expensive procedure. Here, we propose the base-calling with vocabulary (BCV) method that computationally deciphers Sanger chromatograms obtained from mixed DNA samples. The inputs to the BCV algorithm are a chromatogram and a dictionary of sequences that are similar to those we expect to obtain. We apply the base-calling function on a test dataset of chromatograms without ambiguous positions, as well as one with 3–14% sequence degeneracy. Furthermore, we use BCV to assemble a consensus sequence for an HIV genome fragment in a sample containing a mixture of viral DNA variants and to determine the positions of the indels. Finally, we detect drug-resistant Mycobacterium tuberculosis strains carrying frameshift mutations mixed with wild-type bacteria in the pncA gene, and roughly characterize bacterial communities in clinical samples by direct 16S rRNA sequencing. PMID:23382983

Potential Noncutaneous Sites of Chelonid Herpesvirus 5 Persistence and Shedding in Green Sea Turtles Chelonia mydas.

PubMed

Page-Karjian, Annie; Gottdenker, Nicole L; Whitfield, Jordyn; Herbst, Lawrence; Norton, Terry M; Ritchie, Branson

2017-09-01

Chelonid herpesvirus 5 (ChHV5), the likely etiologic agent of sea turtle fibropapillomatosis (FP), is predicted to be unevenly distributed within an infected turtle, in which productive virus replication and virion shedding occurs in cutaneous tumor keratinocytes. In this study, we measured and compared ChHV5 DNA quantities in tumors, skin, urine, major organs, and nervous tissue samples from green turtles Chelonia mydas. These samples were taken from the carcasses of 10 juvenile green turtles with and without clinical signs of FP that stranded in Florida during 2014. Quantitative PCR for ChHV5 UL30 was used to identify ChHV5 DNA in tumors, skin, heart, kidney, nerves, and urine sampled from five out of five FP-positive and three out of five FP-free turtles. The most frequently co-occurring sites were cutaneous tumor and kidney (n = 4). Novel data presented here include the identification of ChHV5 DNA in kidney, heart, and nerve samples from three FP-free turtles. These data support candidate nontumored anatomic sites of ChHV5 DNA localization and mobilization during two different disease states that may be involved in the ChHV5 infection cycle. Received September 8, 2016; accepted April 17, 2017.

Non-invasive fetal RHD genotyping for RhD negative women stratified into RHD gene deletion or variant groups: comparative accuracy using two blood collection tube types.

PubMed

Hyland, Catherine A; Millard, Glenda M; O'Brien, Helen; Schoeman, Elizna M; Lopez, Genghis H; McGowan, Eunike C; Tremellen, Anne; Puddephatt, Rachel; Gaerty, Kirsten; Flower, Robert L; Hyett, Jonathan A; Gardener, Glenn J

2017-12-01

Non-invasive fetal RHD genotyping in Australia to reduce anti-D usage will need to accommodate both prolonged sample transport times and a diverse population demographic harbouring a range of RHD blood group gene variants. We compared RHD genotyping accuracy using two blood sample collection tube types for RhD negative women stratified into deleted RHD gene haplotype and RHD gene variant cohorts. Maternal blood samples were collected into EDTA and cell-free (cf)DNA stabilising (BCT) tubes from two sites, one interstate. Automated DNA extraction and polymerase chain reaction (PCR) were used to amplify RHD exons 5 and 10 and CCR5. Automated analysis flagged maternal RHD variants, which were classified by genotyping. Time between sample collection and processing ranged from 2.9 to 187.5 hours. cfDNA levels increased with time for EDTA (range 0.03-138 ng/μL) but not BCT samples (0.01-3.24 ng/μL). For the 'deleted' cohort (n=647) all fetal RHD genotyping outcomes were concordant, excepting for one unexplained false negative EDTA sample. Matched against cord RhD serology, negative predictive values using BCT and EDTA tubes were 100% and 99.6%, respectively. Positive predictive values were 99.7% for both types. Overall 37.2% of subjects carried an RhD negative baby. The 'variant' cohort (n=15) included one novel RHD and eight hybrid or African pseudogene variants. Review for fetal RHD specific signals, based on one exon, showed three EDTA samples discordant to BCT, attributed to high maternal cfDNA levels arising from prolonged transport times. For the deleted haplotype cohort, fetal RHD genotyping accuracy was comparable for samples collected in EDTA and BCT tubes despite higher cfDNA levels in the EDTA tubes. Capacity to predict fetal RHD genotype for maternal carriers of hybrid or pseudogene RHD variants requires stringent control of cfDNA levels. We conclude that fetal RHD genotyping is feasible in the Australian environment to avoid unnecessary anti-D immunoglobulin prophylaxis. Copyright © 2017. Published by Elsevier B.V.

The collection of Bathynellacea specimens of MNCN (CSIC) Madrid: microscope slices and DNA extract

PubMed Central

Camacho, Ana I.; Dorda, Beatriz A.; Chillón, Begoña Sánchez; Rey, Isabel

2017-01-01

Abstract This is the first published database of a Bathynellacea Chappuis, 1915 collection of slices and DNA extracts. It includes all data of bathynellaceans (Crustacea: Syncarida) collected in the last 48 years (1968 to 2016) on the Iberian Peninsula and Balearic Islands, studied since 1984. It also includes specimens studied across many countries of Europe (Portugal, Romania, France, Italy, Slovenia, Bulgaria, and England), as well as some specimens obtained from samples of North America (Montana, Washington, Alaska and Texas), South America (Brazil, Chile and Argentina), Asia (China, Thailand, Vietnam, Mongolia and India), Africa (Morocco and Chad) and Australia (New South Wales –NSW- and Queensland). The samples come from groundwater (caves, springs, wells and hyporrheic habitat associated with rivers) obtained from both, sampling campaigns and occasional sampling efforts. The data set includes 3399 records (2657 slices and 742 DNA extracts) corresponding to three families (Parabathynellidae Noodt, 1965, Leptobathynellidae Noodt, 1965 and Bathynellidae Grobben, 1905) of the order Bathynellacea; the existence of three families is accepted, but this is a controversial issue and here is not the appropriate context to address this problem; 52 genera and 92 species formally described, in addition to 30 taxa under study and, thus, still unpublished. This represents more than half of all the genera known worldwide (80) and almost one third of the species currently known in the world (329, which increases every year). This dataset contains especially relevant collection that includes holotypes and type series of 43 new species of Bathynellacea (33 from the Parabathynellidae and ten from the Bathynellidae) described by Ana I. Camacho (AIC hereinafter); eleven of these are the type species for new genera described from all around the world, ten belonging to the Parabathynellidae and one from the Bathynellidae. As previously mentioned, these new species come from all continents, although 26 of them are from the Iberian Peninsula. The most important feature of this collection is that it has been created and reviewed by a specialist of the group (AIC), and each specimen, regardless of its shape (either permanent slices or DNA extracts), includes taxonomic, geographical and authorship information. The specialist has been involved in all stages of the process, from field sampling to the digitization of the results we are now presenting, and has worked in close collaboration with the curators responsible for the different collections involved in this project. PMID:28769695

Optical selection and collection of DNA fragments

DOEpatents

Roslaniec, Mary C.; Martin, John C.; Jett, James H.; Cram, L. Scott

1998-01-01

Optical selection and collection of DNA fragments. The present invention includes the optical selection and collection of large (>.mu.g) quantities of clonable, chromosome-specific DNA from a sample of chromosomes. Chromosome selection is based on selective, irreversible photoinactivation of unwanted chromosomal DNA. Although more general procedures may be envisioned, the invention is demonstrated by processing chromosomes in a conventional flow cytometry apparatus, but where no droplets are generated. All chromosomes in the sample are first stained with at least one fluorescent analytic dye and bonded to a photochemically active species which can render chromosomal DNA unclonable if activated. After passing through analyzing light beam(s), unwanted chromosomes are irradiated using light which is absorbed by the photochemically active species, thereby causing photoinactivation. As desired chromosomes pass this photoinactivation point, the inactivating light source is deflected by an optical modulator; hence, desired chromosomes are not photoinactivated and remain clonable. The selection and photoinactivation processes take place on a microsecond timescale. By eliminating droplet formation, chromosome selection rates 50 times greater than those possible with conventional chromosome sorters may be obtained. Thus, usable quantities of clonable DNA from any source thereof may be collected.

Rapid non-enzymatic extraction method for isolating PCR-quality camelpox virus DNA from skin.

PubMed

Yousif, A Ausama; Al-Naeem, A Abdelmohsen; Al-Ali, M Ahmad

2010-10-01

Molecular diagnostic investigations of orthopoxvirus (OPV) infections are performed using a variety of clinical samples including skin lesions, tissues from internal organs, blood and secretions. Skin samples are particularly convenient for rapid diagnosis and molecular epidemiological investigations of camelpox virus (CMLV). Classical extraction procedures and commercial spin-column-based kits are time consuming, relatively expensive, and require multiple extraction and purification steps in addition to proteinase K digestion. A rapid non-enzymatic procedure for extracting CMLV DNA from dried scabs or pox lesions was developed to overcome some of the limitations of the available DNA extraction techniques. The procedure requires as little as 10mg of tissue and produces highly purified DNA [OD(260)/OD(280) ratios between 1.47 and 1.79] with concentrations ranging from 6.5 to 16 microg/ml. The extracted CMLV DNA was proven suitable for virus-specific qualitative and, semi-quantitative PCR applications. Compared to spin-column and conventional viral DNA extraction techniques, the two-step extraction procedure saves money and time, and retains the potential for automation without compromising CMLV PCR sensitivity. Copyright (c) 2010 Elsevier B.V. All rights reserved.

Testicular Spermatozoa Are of Better Quality Than Epididymal Spermatozoa in Patients With Obstructive Azoospermia.

PubMed

Hammoud, Ibrahim; Bailly, Marc; Bergere, Marianne; Wainer, Robert; Izard, Vincent; Vialard, François; Selva, Jacqueline; Boitrelle, Florence

2017-05-01

To assess sperm quality as a function of the sampling site (testis or epididymis) in obstructive azoospermia (OA). DNA fragmentation rates in spermatozoa sampled from the testis and epididymis (from patients with different etiologies of OA) were assessed in a dUTP nick-end labeling assay. Twenty-one OA patients were included: 5 had congenital bilateral absence of the vas deferens, 8 had genital tract infections, and 8 had idiopathic OA. A total of 8506 spermatozoa sampled from the testis, 18,358 sampled from the caput epididymis, and 18,881 sampled from the corpus/cauda epididymis were assessed. For each patient, spermatozoa from the testis had a lower overall DNA fragmentation rate (6.71% ± 0.75 in average) than epididymal spermatozoa from the caput (14.86% ± 1.89 in average; P = .0007) or the corpus/cauda (32.61% ± 3.11 in average; P < .0001). The DNA fragmentation rates did not differ significantly as a function of the etiology of OA. In this small series, all deliveries were obtained with sperm samples with a low DNA fragmentation rate and delivery rates tended to be higher when testicular sperm (rather than epididymal sperm) was used (35.7% vs 12.1%, respectively; P = .06). Our data argue in favor of using testicular sperm (rather than epididymal sperm) for patients with obstructive azoospermia. Copyright © 2016 Elsevier Inc. All rights reserved.

[DNA quantification of blood samples pre-treated with pyramidon].

PubMed

Zhu, Chuan-Hong; Zheng, Dao-Li; Ni, Rao-Zhi; Wang, Hai-Sheng; Ning, Ping; Fang, Hui; Liu, Yan

2014-06-01

To study DNA quantification and STR typing of samples pre-treated with pyramidon. The blood samples of ten unrelated individuals were anticoagulated in EDTA. The blood stains were made on the filter paper. The experimental groups were divided into six groups in accordance with the storage time, 30 min, 1 h, 3 h, 6 h, 12 h and 24h after pre-treated with pyramidon. DNA was extracted by three methods: magnetic bead-based extraction, QIAcube DNA purification method and Chelex-100 method. The quantification of DNA was made by fluorescent quantitative PCR. STR typing was detected by PCR-STR fluorescent technology. In the same DNA extraction method, the sample DNA decreased gradually with times after pre-treatment with pyramidon. In the same storage time, the DNA quantification in different extraction methods had significant differences. Sixteen loci DNA typing were detected in 90.56% of samples. Pyramidon pre-treatment could cause DNA degradation, but effective STR typing can be achieved within 24 h. The magnetic bead-based extraction is the best method for STR profiling and DNA extraction.

Evaluation of DNA extraction methods for the analysis of microbial community in biological activated carbon.

PubMed

Zheng, Lu; Gao, Naiyun; Deng, Yang

2012-01-01

It is difficult to isolate DNA from biological activated carbon (BAC) samples used in water treatment plants, owing to the scarcity of microorganisms in BAC samples. The aim of this study was to identify DNA extraction methods suitable for a long-term, comprehensive ecological analysis of BAC microbial communities. To identify a procedure that can produce high molecular weight DNA, maximizes detectable diversity and is relatively free from contaminants, the microwave extraction method, the cetyltrimethylammonium bromide (CTAB) extraction method, a commercial DNA extraction kit, and the ultrasonic extraction method were used for the extraction of DNA from BAC samples. Spectrophotometry, agarose gel electrophoresis and polymerase chain reaction (PCR)-restriction fragment length polymorphisms (RFLP) analysis were conducted to compare the yield and quality of DNA obtained using these methods. The results showed that the CTAB method produce the highest yield and genetic diversity of DNA from BAC samples, but DNA purity was slightly less than that obtained with the DNA extraction-kit method. This study provides a theoretical basis for establishing and selecting DNA extraction methods for BAC samples.

Comparison of Three Different Sensitive Assays for Hepatitis B Virus DNA in Monitoring of Responses to Antiviral Therapy

PubMed Central

Chan, Henry L. Y.; Leung, Nancy W. Y.; Lau, Tracy C. M.; Wong, May L.; Sung, Joseph J. Y.

2000-01-01

The aim of our study was to compare the performances of two new hepatitis B virus (HBV) DNA assays, a cross-linking assay (NAXCOR) and a hybrid-capture amplification assay (Digene), versus the widely used branched-DNA (bDNA) assay (Chiron) in the monitoring of HBV DNA levels during antiviral treatment. Serial serum samples from 12 chronically HBV infected patients undergoing a phase II trial of an antiviral drug, 2′,3′-dideoxy-5-fluoro-3′-thiacytidine (FTC), were studied. A total of 96 serum samples were tested for HBV DNA using the cross-linking, hybrid-capture amplification, and bDNA assays. In the comparison of the cross-linking and bDNA assays, concordant results were found in 77 (80.3%) samples, no significant difference was found between the median log10 HBV DNA levels (6.66 versus 7.17 meq/ml), and the results of the two assays were closely correlated (r = 0.95). In the comparison of the hybrid-capture amplification and bDNA assays, concordant results were found in 79 (82.3%) samples, no significant difference was found between the median log10 HBV DNA levels (6.98 versus 6.99 meq/ml), and the results of the two assays were closely correlated (r = 0.99). Six (6.3%) samples by the cross-linking assay and 10 (10.4%) samples by the bDNA assay required retesting because of unacceptably high within-run coefficients of variance. No sample required retesting in the hybrid-capture amplification assay according to the internal validation. In conclusion, the cross-linking and hybrid-capture amplification assays were as sensitive as the bDNA assay for HBV DNA detection and can be recommended for monitoring of HBV DNA levels during antiviral treatment. PMID:10970358

DNA DAMAGE QUANTITATION BY ALKALINE GEL ELECTROPHORESIS.

DOE Office of Scientific and Technical Information (OSTI.GOV)

SUTHERLAND,B.M.; BENNETT,P.V.; SUTHERLAND, J.C.

2004-03-24

Physical and chemical agents in the environment, those used in clinical applications, or encountered during recreational exposures to sunlight, induce damages in DNA. Understanding the biological impact of these agents requires quantitation of the levels of such damages in laboratory test systems as well as in field or clinical samples. Alkaline gel electrophoresis provides a sensitive (down to {approx} a few lesions/5Mb), rapid method of direct quantitation of a wide variety of DNA damages in nanogram quantities of non-radioactive DNAs from laboratory, field, or clinical specimens, including higher plants and animals. This method stems from velocity sedimentation studies of DNAmore » populations, and from the simple methods of agarose gel electrophoresis. Our laboratories have developed quantitative agarose gel methods, analytical descriptions of DNA migration during electrophoresis on agarose gels (1-6), and electronic imaging for accurate determinations of DNA mass (7-9). Although all these components improve sensitivity and throughput of large numbers of samples (7,8,10), a simple version using only standard molecular biology equipment allows routine analysis of DNA damages at moderate frequencies. We present here a description of the methods, as well as a brief description of the underlying principles, required for a simplified approach to quantitation of DNA damages by alkaline gel electrophoresis.« less

DNA quality and quantity from up to 16 years old post-mortem blood stored on FTA cards.

PubMed

Rahikainen, Anna-Liina; Palo, Jukka U; de Leeuw, Wiljo; Budowle, Bruce; Sajantila, Antti

2016-04-01

Blood samples preserved on FTA cards offer unique opportunities for genetic research. DNA recovered from these cards should be stable for long periods of time. However, it is not well established as how well the DNA stored on FTA card for substantial time periods meets the demands of forensic or genomic DNA analyses and especially so for from post-mortem (PM) samples in which the quality can vary upon initial collection. The aim of this study was to evaluate the time-dependent degradation on DNA quality and quantity extracted from up to 16 years old post-mortem bloodstained FTA cards. Four random FTA samples from eight time points spanning 1998 to 2013 (n=32) were collected and extracted in triplicate. The quantity and quality of the extracted DNA samples were determined with Quantifiler(®) Human Plus (HP) Quantification kit. Internal sample and sample-to-sample variation were evaluated by comparing recovered DNA yields. The DNA from the triplicate samplings were subsequently combined and normalized for further analysis. The practical effect of degradation on DNA quality was evaluated from normalized samples both with forensic and pharmacogenetic target markers. Our results suggest that (1) a PM change, e.g. blood clotting prior to sampling, affects the recovered DNA yield, creating both internal and sample-to-sample variation; (2) a negative correlation between the FTA card storage time and DNA quantity (r=-0.836 at the 0.01 level) was observed; (3) a positive correlation (r=0.738 at the level 0.01) was found between FTA card storage time and degradation levels. However, no inhibition was observed with the method used. The effect of degradation was manifested clearly with functional applications. Although complete STR-profiles were obtained for all samples, there was evidence of degradation manifested as decreased peak heights in the larger-sized amplicons. Lower amplification success was notable with the large 5.1 kb CYP2D6 gene fragment which strongly supports degradation of the stored samples. According to our results, DNA stored on FTA cards is rather stable over a long time period. DNA extracted from this storage medium can be used as human identification purposes as the method used is sufficiently sensitive and amplicon sizes tend to be <400 bp. However, DNA integrity was affected during storage. This effect should be taken into account depending on the intended application especially if high quality DNA and long PCR amplicons are required. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Wells provide a distorted view of life in the aquifer: implications for sampling, monitoring and assessment of groundwater ecosystems

PubMed Central

Korbel, Kathryn; Chariton, Anthony; Stephenson, Sarah; Greenfield, Paul; Hose, Grant C.

2017-01-01

When compared to surface ecosystems, groundwater sampling has unique constraints, including limited access to ecosystems through wells. In order to monitor groundwater, a detailed understanding of groundwater biota and what biological sampling of wells truly reflects, is paramount. This study aims to address this uncertainty, comparing the composition of biota in groundwater wells prior to and after purging, with samples collected prior to purging reflecting a potentially artificial environment and samples collected after purging representing the surrounding aquifer. This study uses DNA community profiling (metabarcoding) of 16S rDNA and 18S rDNA, combined with traditional stygofauna sampling methods, to characterise groundwater biota from four catchments within eastern Australia. Aquifer waters were dominated by Archaea and bacteria (e.g. Nitrosopumilales) that are often associated with nitrification processes, and contained a greater proportion of bacteria (e.g. Anaerolineales) associated with fermenting processes compared to well waters. In contrast, unpurged wells contained greater proportions of pathogenic bacteria and bacteria often associated with denitrification processes. In terms of eukaryotes, the abundances of copepods, syncarids and oligochaetes and total abundances of stygofauna were greater in wells than aquifers. These findings highlight the need to consider sampling requirements when completing groundwater ecology surveys. PMID:28102290

I Environmental DNA sampling is more sensitive than a traditional survey technique for detecting an aquatic invader.

PubMed

Smart, Adam S; Tingley, Reid; Weeks, Andrew R; van Rooyen, Anthony R; McCarthy, Michael A

2015-10-01

Effective management of alien species requires detecting populations in the early stages of invasion. Environmental DNA (eDNA) sampling can detect aquatic species at relatively low densities, but few studies have directly compared detection probabilities of eDNA sampling with those of traditional sampling methods. We compare the ability of a traditional sampling technique (bottle trapping) and eDNA to detect a recently established invader, the smooth newt Lissotriton vulgaris vulgaris, at seven field sites in Melbourne, Australia. Over a four-month period, per-trap detection probabilities ranged from 0.01 to 0.26 among sites where L. v. vulgaris was detected, whereas per-sample eDNA estimates were much higher (0.29-1.0). Detection probabilities of both methods varied temporally (across days and months), but temporal variation appeared to be uncorrelated between methods. Only estimates of spatial variation were strongly correlated across the two sampling techniques. Environmental variables (water depth, rainfall, ambient temperature) were not clearly correlated with detection probabilities estimated via trapping, whereas eDNA detection probabilities were negatively correlated with water depth, possibly reflecting higher eDNA concentrations at lower water levels. Our findings demonstrate that eDNA sampling can be an order of magnitude more sensitive than traditional methods, and illustrate that traditional- and eDNA-based surveys can provide independent information on species distributions when occupancy surveys are conducted over short timescales.

Ancient DNA Reveals Matrilineal Continuity in Present-Day Poland over the Last Two Millennia

PubMed Central

Juras, Anna; Dabert, Miroslawa; Kushniarevich, Alena; Malmström, Helena; Raghavan, Maanasa; Kosicki, Jakub Z.; Metspalu, Ene; Willerslev, Eske; Piontek, Janusz

2014-01-01

While numerous ancient human DNA datasets from across Europe have been published till date, modern-day Poland in particular, remains uninvestigated. Besides application in the reconstruction of continent-wide human history, data from this region would also contribute towards our understanding of the history of the Slavs, whose origin is hypothesized to be in East or Central Europe. Here, we present the first population-scale ancient human DNA study from the region of modern-day Poland by establishing mitochondrial DNA profiles for 23 samples dated to 200 BC – 500 AD (Roman Iron Age) and for 20 samples dated to 1000–1400 AD (Medieval Age). Our results show that mitochondrial DNA sequences from both periods belong to haplogroups that are characteristic of contemporary West Eurasia. Haplotype sharing analysis indicates that majority of the ancient haplotypes are widespread in some modern Europeans, including Poles. Notably, the Roman Iron Age samples share more rare haplotypes with Central and Northeast Europeans, whereas the Medieval Age samples share more rare haplotypes with East-Central and South-East Europeans, primarily Slavic populations. Our data demonstrates genetic continuity of certain matrilineages (H5a1 and N1a1a2) in the area of present-day Poland from at least the Roman Iron Age until present. As such, the maternal gene pool of present-day Poles, Czechs and Slovaks, categorized as Western Slavs, is likely to have descended from inhabitants of East-Central Europe during the Roman Iron Age. PMID:25337992

Performance of NucliSens HIV-1 EasyQ Version 2.0 compared with six commercially available quantitative nucleic acid assays for detection of HIV-1 in China.

PubMed

Xu, Sihong; Song, Aijing; Nie, Jianhui; Li, Xiuhua; Wang, Youchun

2010-10-01

Six HIV-1 viral load assays have been widely used in China. These include the Cobas Amplicor HIV-1 Monitor Version 1.5 ('Amplicor'), Cobas AmpliPrep/Cobas TaqMan HIV-1 test Version 1.0 ('CAP/CTM'), Versant HIV-1 RNA Version 3.0 (branched DNA [bDNA]-based assay; 'Versant bDNA'), Abbott RealTime HIV-1 assay ('Abbott RealTime'), NucliSens HIV-1 QT (nucleic acid sequence-based amplification assay; 'NucliSens NASBA'), and NucliSens EasyQ HIV-1 Version 1.1 ('EasyQ V1.1'). Recently, an updated version of EasyQ V1.1, NucliSens EasyQ HIV-1 Version 2.0 ('EasyQ V2.0') was introduced into China. It is important to evaluate the impact of HIV-1 genotypes on the updated assay compared with the other commercial available assays in China. A total of 175 plasma samples with different HIV-1 clades prevalent in China were collected from treatment-naïve patients. The viral loads of those samples were determined with the seven HIV-1 viral load assays, and the quantitative differences between them were evaluated. Overall, EasyQ V2.0 exhibited a significant correlation (R = 0.769-0.850, p ≤ 0.001) and high agreement (94.77-97.13%, using the Bland-Altman model) with the other six assays. Although no significant differences between EasyQ V2.0 and the other six assays were observed when quantifying clade B' samples, there were statistically significant differences between EasyQ V2.0 and the Amplicor, Versant bDNA, and Abbott RealTime assays when quantifying clade BC samples, and between EasyQ V2.0 and the Versant bDNA and Abbott RealTime assays when quantifying clade AE samples. For clade BC samples, the quantitative differences between EasyQ V2.0 and the Amplicor, Versant bDNA, and Abbott RealTime assays exceeded 0.5 log(10) IU/mL in approximately 50% of samples and exceeded 1 log(10) IU/mL in approximately 15% of samples. For clade AE samples, the quantitative differences between EasyQ V2.0 and the CAP/CTM, Versant bDNA, and Abbott RealTime assays exceeded 0.5 log(10) IU/mL in approximately 50% of samples, and the differences between EasyQ V2.0 and CAP/CTM exceeded 1 log(10) IU/mL in approximately 15% of samples. Genotypes may affect the quantification of HIV-1 RNA, especially in clade BC samples with respect to EasyQ V2.0 and the Amplicor, Versant bDNA, or Abbott RealTime assays, and in clade AE samples with respect to EasyQ V2.0 and the Versant bDNA or Abbott RealTime assays. It is therefore strongly suggested that, where possible, the HIV-1 viral load in infected patients be quantified at follow-up by the same version of the same assay that was used initially.

Elimination of bioweapons agents from forensic samples during extraction of human DNA.

PubMed

Timbers, Jason; Wilkinson, Della; Hause, Christine C; Smith, Myron L; Zaidi, Mohsin A; Laframboise, Denis; Wright, Kathryn E

2014-11-01

Collection of DNA for genetic profiling is a powerful means for the identification of individuals responsible for crimes and terrorist acts. Biologic hazards, such as bacteria, endospores, toxins, and viruses, could contaminate sites of terrorist activities and thus could be present in samples collected for profiling. The fate of these hazards during DNA isolation has not been thoroughly examined. Our goals were to determine whether the DNA extraction process used by the Royal Canadian Mounted Police eliminates or neutralizes these agents and if not, to establish methods that render samples safe without compromising the human DNA. Our results show that bacteria, viruses, and toxins were reduced to undetectable levels during DNA extraction, but endospores remained viable. Filtration of samples after DNA isolation eliminated viable spores from the samples but left DNA intact. We also demonstrated that contamination of samples with some bacteria, endospores, and toxins for longer than 1 h compromised the ability to complete genetic profiling. © 2014 American Academy of Forensic Sciences.

Potential of environmental DNA to evaluate Northern pike (Esox lucius) eradication efforts: An experimental test and case study

USGS Publications Warehouse

Dunker, Kristine J.; Sepulveda, Adam; Massengill, Robert L.; Olsen, Jeffrey B.; Russ, Ora L.; Wenburg, John K.; Antonovich, Anton

2016-01-01

Determining the success of invasive species eradication efforts is challenging because populations at very low abundance are difficult to detect. Environmental DNA (eDNA) sampling has recently emerged as a powerful tool for detecting rare aquatic animals; however, detectable fragments of DNA can persist over time despite absence of the targeted taxa and can therefore complicate eDNA sampling after an eradication event. This complication is a large concern for fish eradication efforts in lakes since killed fish can sink to the bottom and slowly decay. DNA released from these carcasses may remain detectable for long periods. Here, we evaluated the efficacy of eDNA sampling to detect invasive Northern pike (Esox lucius) following piscicide eradication efforts in southcentral Alaskan lakes. We used field observations and experiments to test the sensitivity of our Northern pike eDNA assay and to evaluate the persistence of detectable DNA emitted from Northern pike carcasses. We then used eDNA sampling and traditional sampling (i.e., gillnets) to test for presence of Northern pike in four lakes subjected to a piscicide-treatment designed to eradicate this species. We found that our assay could detect an abundant, free-roaming population of Northern pike and could also detect low-densities of Northern pike held in cages. For these caged Northern pike, probability of detection decreased with distance from the cage. We then stocked three lakes with Northern pike carcasses and collected eDNA samples 7, 35 and 70 days post-stocking. We detected DNA at 7 and 35 days, but not at 70 days. Finally, we collected eDNA samples ~ 230 days after four lakes were subjected to piscicide-treatments and detected Northern pike DNA in 3 of 179 samples, with a single detection at each of three lakes, though we did not catch any Northern pike in gillnets. Taken together, we found that eDNA can help to inform eradication efforts if used in conjunction with multiple lines of inquiry and sampling is delayed long enough to allow full degradation of DNA in the water.

Potential of Environmental DNA to Evaluate Northern Pike (Esox lucius) Eradication Efforts: An Experimental Test and Case Study.

PubMed

Dunker, Kristine J; Sepulveda, Adam J; Massengill, Robert L; Olsen, Jeffrey B; Russ, Ora L; Wenburg, John K; Antonovich, Anton

2016-01-01

Determining the success of invasive species eradication efforts is challenging because populations at very low abundance are difficult to detect. Environmental DNA (eDNA) sampling has recently emerged as a powerful tool for detecting rare aquatic animals; however, detectable fragments of DNA can persist over time despite absence of the targeted taxa and can therefore complicate eDNA sampling after an eradication event. This complication is a large concern for fish eradication efforts in lakes since killed fish can sink to the bottom and slowly decay. DNA released from these carcasses may remain detectable for long periods. Here, we evaluated the efficacy of eDNA sampling to detect invasive Northern pike (Esox lucius) following piscicide eradication efforts in southcentral Alaskan lakes. We used field observations and experiments to test the sensitivity of our Northern pike eDNA assay and to evaluate the persistence of detectable DNA emitted from Northern pike carcasses. We then used eDNA sampling and traditional sampling (i.e., gillnets) to test for presence of Northern pike in four lakes subjected to a piscicide-treatment designed to eradicate this species. We found that our assay could detect an abundant, free-roaming population of Northern pike and could also detect low-densities of Northern pike held in cages. For these caged Northern pike, probability of detection decreased with distance from the cage. We then stocked three lakes with Northern pike carcasses and collected eDNA samples 7, 35 and 70 days post-stocking. We detected DNA at 7 and 35 days, but not at 70 days. Finally, we collected eDNA samples ~ 230 days after four lakes were subjected to piscicide-treatments and detected Northern pike DNA in 3 of 179 samples, with a single detection at each of three lakes, though we did not catch any Northern pike in gillnets. Taken together, we found that eDNA can help to inform eradication efforts if used in conjunction with multiple lines of inquiry and sampling is delayed long enough to allow full degradation of DNA in the water.

Potential of Environmental DNA to Evaluate Northern Pike (Esox lucius) Eradication Efforts: An Experimental Test and Case Study

PubMed Central

Dunker, Kristine J.; Sepulveda, Adam J.; Massengill, Robert L.; Olsen, Jeffrey B.; Russ, Ora L.; Wenburg, John K.; Antonovich, Anton

2016-01-01

Determining the success of invasive species eradication efforts is challenging because populations at very low abundance are difficult to detect. Environmental DNA (eDNA) sampling has recently emerged as a powerful tool for detecting rare aquatic animals; however, detectable fragments of DNA can persist over time despite absence of the targeted taxa and can therefore complicate eDNA sampling after an eradication event. This complication is a large concern for fish eradication efforts in lakes since killed fish can sink to the bottom and slowly decay. DNA released from these carcasses may remain detectable for long periods. Here, we evaluated the efficacy of eDNA sampling to detect invasive Northern pike (Esox lucius) following piscicide eradication efforts in southcentral Alaskan lakes. We used field observations and experiments to test the sensitivity of our Northern pike eDNA assay and to evaluate the persistence of detectable DNA emitted from Northern pike carcasses. We then used eDNA sampling and traditional sampling (i.e., gillnets) to test for presence of Northern pike in four lakes subjected to a piscicide-treatment designed to eradicate this species. We found that our assay could detect an abundant, free-roaming population of Northern pike and could also detect low-densities of Northern pike held in cages. For these caged Northern pike, probability of detection decreased with distance from the cage. We then stocked three lakes with Northern pike carcasses and collected eDNA samples 7, 35 and 70 days post-stocking. We detected DNA at 7 and 35 days, but not at 70 days. Finally, we collected eDNA samples ~ 230 days after four lakes were subjected to piscicide-treatments and detected Northern pike DNA in 3 of 179 samples, with a single detection at each of three lakes, though we did not catch any Northern pike in gillnets. Taken together, we found that eDNA can help to inform eradication efforts if used in conjunction with multiple lines of inquiry and sampling is delayed long enough to allow full degradation of DNA in the water. PMID:27626271

Basic quantitative polymerase chain reaction using real-time fluorescence measurements.

PubMed

Ares, Manuel

2014-10-01

This protocol uses quantitative polymerase chain reaction (qPCR) to measure the number of DNA molecules containing a specific contiguous sequence in a sample of interest (e.g., genomic DNA or cDNA generated by reverse transcription). The sample is subjected to fluorescence-based PCR amplification and, theoretically, during each cycle, two new duplex DNA molecules are produced for each duplex DNA molecule present in the sample. The progress of the reaction during PCR is evaluated by measuring the fluorescence of dsDNA-dye complexes in real time. In the early cycles, DNA duplication is not detected because inadequate amounts of DNA are made. At a certain threshold cycle, DNA-dye complexes double each cycle for 8-10 cycles, until the DNA concentration becomes so high and the primer concentration so low that the reassociation of the product strands blocks efficient synthesis of new DNA and the reaction plateaus. There are two types of measurements: (1) the relative change of the target sequence compared to a reference sequence and (2) the determination of molecule number in the starting sample. The first requires a reference sequence, and the second requires a sample of the target sequence with known numbers of the molecules of sequence to generate a standard curve. By identifying the threshold cycle at which a sample first begins to accumulate DNA-dye complexes exponentially, an estimation of the numbers of starting molecules in the sample can be extrapolated. © 2014 Cold Spring Harbor Laboratory Press.

Understanding environmental DNA detection probabilities: A case study using a stream-dwelling char Salvelinus fontinalis

Treesearch

Taylor M. Wilcox; Kevin S. McKelvey; Michael K. Young; Adam J. Sepulveda; Bradley B. Shepard; Stephen F. Jane; Andrew R. Whiteley; Winsor H. Lowe; Michael K. Schwartz

2016-01-01

Environmental DNA sampling (eDNA) has emerged as a powerful tool for detecting aquatic animals. Previous research suggests that eDNA methods are substantially more sensitive than traditional sampling. However, the factors influencing eDNA detection and the resulting sampling costs are still not well understood. Here we use multiple experiments to derive...

LTR real-time PCR for HIV-1 DNA quantitation in blood cells for early diagnosis in infants born to seropositive mothers treated in HAART area (ANRS CO 01).

PubMed

Avettand-Fènoël, Véronique; Chaix, Marie-Laure; Blanche, Stéphane; Burgard, Marianne; Floch, Corinne; Toure, Kadidia; Allemon, Marie-Christine; Warszawski, Josiane; Rouzioux, Christine

2009-02-01

HIV-1 diagnosis in babies born to seropositive mothers is one of the challenges of HIV epidemics in children. A simple, rapid protocol was developed for quantifying HIV-1 DNA in whole blood samples and was used in the ANRS French pediatric cohort in conditions of prevention of mother-to-child transmission. A quantitative HIV-1 DNA protocol (LTR real-time PCR) requiring small blood volumes was developed. First, analytical reproducibility was evaluated on 172 samples. Results obtained on blood cell pellets and Ficoll-Hypaque separated mononuclear cells were compared in 48 adult HIV-1 samples. Second, the protocol was applied to HIV-1 diagnosis in infants in parallel with plasma HIV-RNA quantitation. This prospective study was performed in children born between May 2005 and April 2007 included in the ANRS cohort. The assay showed good reproducibility. The 95% detection cut-off value was 6 copies/PCR, that is, 40 copies/10(6) leukocytes. HIV-DNA levels in whole blood were highly correlated with those obtained after Ficoll-Hypaque separation (r = 0.900, P < 0.0001). A total of 3,002 specimens from 1,135 infants were tested. The specificity of HIV-DNA and HIV-RNA assays was 100%. HIV-1 infection was diagnosed in nine infants before age 60 days. HIV-DNA levels were low, underlining the need for sensitive assays when highly active antiretroviral therapy (HAART) has been given. The performances of this HIV-DNA assay showed that it is adapted to early diagnosis in children. The results were equivalent to those of HIV-RNA assay. HIV-DNA may be used even in masked primary infection in newborns whose mothers have received HAART. (c) 2008 Wiley-Liss, Inc.

Back to basics: an evaluation of NaOH and alternative rapid DNA extraction protocols for DNA barcoding, genotyping, and disease diagnostics from fungal and oomycete samples.

PubMed

Osmundson, Todd W; Eyre, Catherine A; Hayden, Katherine M; Dhillon, Jaskirn; Garbelotto, Matteo M

2013-01-01

The ubiquity, high diversity and often-cryptic manifestations of fungi and oomycetes frequently necessitate molecular tools for detecting and identifying them in the environment. In applications including DNA barcoding, pathogen detection from plant samples, and genotyping for population genetics and epidemiology, rapid and dependable DNA extraction methods scalable from one to hundreds of samples are desirable. We evaluated several rapid extraction methods (NaOH, Rapid one-step extraction (ROSE), Chelex 100, proteinase K) for their ability to obtain DNA of quantity and quality suitable for the following applications: PCR amplification of the multicopy barcoding locus ITS1/5.8S/ITS2 from various fungal cultures and sporocarps; single-copy microsatellite amplification from cultures of the phytopathogenic oomycete Phytophthora ramorum; probe-based P. ramorum detection from leaves. Several methods were effective for most of the applications, with NaOH extraction favored in terms of success rate, cost, speed and simplicity. Frozen dilutions of ROSE and NaOH extracts maintained PCR viability for over 32 months. DNA from rapid extractions performed poorly compared to CTAB/phenol-chloroform extracts for TaqMan diagnostics from tanoak leaves, suggesting that incomplete removal of PCR inhibitors is an issue for sensitive diagnostic procedures, especially from plants with recalcitrant leaf chemistry. NaOH extracts exhibited lower yield and size than CTAB/phenol-chloroform extracts; however, NaOH extraction facilitated obtaining clean sequence data from sporocarps contaminated by other fungi, perhaps due to dilution resulting from low DNA yield. We conclude that conventional extractions are often unnecessary for routine DNA sequencing or genotyping of fungi and oomycetes, and recommend simpler strategies where source materials and intended applications warrant such use. © 2012 Blackwell Publishing Ltd.

Evolution of helotialean fungi (Leotiomycetes, Pezizomycotina): a nuclear rDNA phylogeny.

PubMed

Wang, Zheng; Binder, Manfred; Schoch, Conrad L; Johnston, Peter R; Spatafora, Joseph W; Hibbett, David S

2006-11-01

The highly divergent characters of morphology, ecology, and biology in the Helotiales make it one of the most problematic groups in traditional classification and molecular phylogeny. Sequences of three rDNA regions, SSU, LSU, and 5.8S rDNA, were generated for 50 helotialean fungi, representing 11 out of 13 families in the current classification. Data sets with different compositions were assembled, and parsimony and Bayesian analyses were performed. The phylogenetic distribution of lifestyle and ecological factors was assessed. Plant endophytism is distributed across multiple clades in the Leotiomycetes. Our results suggest that (1) the inclusion of LSU rDNA and a wider taxon sampling greatly improves resolution of the Helotiales phylogeny, however, the usefulness of rDNA in resolving the deep relationships within the Leotiomycetes is limited; (2) a new class Geoglossomycetes, including Geoglossum, Trichoglossum, and Sarcoleotia, is the basal lineage of the Leotiomyceta; (3) the Leotiomycetes, including the Helotiales, Erysiphales, Cyttariales, Rhytismatales, and Myxotrichaceae, is monophyletic; and (4) nine clades can be recognized within the Helotiales.

Selection response to DNA testing for canine ceroid lipofuscinosis in Tibetan terriers.

PubMed

Kluth, Susanne; Eckardt, Judith; Distl, Ottmar

2014-09-01

A late onset form of canine ceroid lipofuscinosis (CCL) is prevalent in Tibetan terriers. The disease is inherited as a monogenic recessive trait caused by aberrant exon skipping in ATP13A2. The aim of the present study was to analyse the frequencies of this mutation in Tibetan terriers registered with the German club for Tibetan dog breeds (Internationaler Klub für Tibetische Hunderassen, KTR) from 1987 to 2012 and to determine responses to selection following the introduction of DNA testing in 2010. The study included DNA extracted from blood samples from 1120/1240 (90.3%) Tibetan terriers registered with the KTR, including 405/420 (96.4%) registered breeding dogs. Mutant allele frequencies before the introduction of DNA testing were 0.20-0.28 in the registered and breeding dog populations, respectively, decreasing to 0.09 and 0.14, respectively, following the introduction of DNA testing. Copyright © 2014 Elsevier Ltd. All rights reserved.

Forensic trace DNA: a review

PubMed Central

2010-01-01

DNA analysis is frequently used to acquire information from biological material to aid enquiries associated with criminal offences, disaster victim identification and missing persons investigations. As the relevance and value of DNA profiling to forensic investigations has increased, so too has the desire to generate this information from smaller amounts of DNA. Trace DNA samples may be defined as any sample which falls below recommended thresholds at any stage of the analysis, from sample detection through to profile interpretation, and can not be defined by a precise picogram amount. Here we review aspects associated with the collection, DNA extraction, amplification, profiling and interpretation of trace DNA samples. Contamination and transfer issues are also briefly discussed within the context of trace DNA analysis. Whilst several methodological changes have facilitated profiling from trace samples in recent years it is also clear that many opportunities exist for further improvements. PMID:21122102

DNA Book

PubMed Central

Kawai, Jun; Hayashizaki, Yoshihide

2003-01-01

We propose herein a new method of DNA distribution, whereby DNA clones or PCR products are printed directly onto the pages of books and delivered to users along with relevant scientific information. DNA sheets, comprising water-soluble paper onto which DNA is spotted, can be bound into books. Readers can easily extract the DNA fragments from DNA sheets and amplify them using PCR. We show that DNA sheets can withstand various conditions that may be experienced during bookbinding and delivery, such as high temperatures and humidity. Almost all genes (95%–100% of randomly selected RIKEN mouse cDNA clones) were recovered successfully by use of PCR. Readers can start their experiments after a 2-h PCR amplification without waiting for the delivery of DNA clones. The DNA Book thus provides a novel method for delivering DNA in a timely and cost-effective manner. A sample DNA sheet (carrying RIKEN mouse cDNA clones encoding genes of enzymes for the TCA cycle) is included in this issue for field-testing. We would greatly appreciate it if readers could attempt to extract DNA and report the results and whether the DNA sheet was shipped to readers in good condition. PMID:12819147

DNA decontamination methods for internal quality management in clinical PCR laboratories.

PubMed

Wu, Yingping; Wu, Jianyong; Zhang, Zhihui; Cheng, Chen

2018-03-01

The polymerase chain reaction (PCR) technique, one of the most commonly applied methods in diagnostic and molecular biology, has a frustrating downside: the occurrence of false-positive signals due to contamination. In previous research, various DNA decontamination methods have been developed to overcome this limitation. Unfortunately, the use of random or poorly focused sampling methods for monitoring air and/or object surfaces leads to the incomplete elimination during decontamination procedures. We herein attempted to develop a novel DNA decontamination method (environmental surveillance, including surface and air sampling) and quality management program for clinical molecular diagnostic laboratories (or clinical PCR laboratories). Here, we performed a step-by-step evaluation of current DNA decontamination methods and developed an effective procedure for assessing the presence of decontaminating DNA via PCR analysis. Performing targeted environmental surveillance by sampling, which reached optimal performance over 2 weeks, and the decontamination process had been verified as reliable. Additionally, the process was validated to not affect PCR amplification efficiency based on a comparative study. In this study, effective guidelines for DNA decontamination were developed. The method employed ensured that surface DNA contamination could be effectively identified and eliminated. Furthermore, our study highlighted the importance of overall quality assurance and good clinical laboratory practices for preventing contamination, which are key factors for compliance with regulatory or accreditation requirements. Taken together, we provided the evidence that the presented scheme ranged from troubleshooting to the elimination of surface contamination, could serve as critical foundation for developing regular environmental surveillance guidelines for PCR laboratories. © 2017 Wiley Periodicals, Inc.

Genome-wide measures of DNA methylation in peripheral blood and the risk of urothelial cell carcinoma: a prospective nested case–control study

PubMed Central

Dugué, Pierre-Antoine; Brinkman, Maree T; Milne, Roger L; Wong, Ee Ming; FitzGerald, Liesel M; Bassett, Julie K; Joo, Jihoon E; Jung, Chol-Hee; Makalic, Enes; Schmidt, Daniel F; Park, Daniel J; Chung, Jessica; Ta, Anthony D; Bolton, Damien M; Lonie, Andrew; Longano, Anthony; Hopper, John L; Severi, Gianluca; Saffery, Richard; English, Dallas R; Southey, Melissa C; Giles, Graham G

2016-01-01

Background: Global DNA methylation has been reported to be associated with urothelial cell carcinoma (UCC) by studies using blood samples collected at diagnosis. Using the Illumina HumanMethylation450 assay, we derived genome-wide measures of blood DNA methylation and assessed them for their prospective association with UCC risk. Methods: We used 439 case–control pairs from the Melbourne Collaborative Cohort Study matched on age, sex, country of birth, DNA sample type, and collection period. Conditional logistic regression was used to compute odds ratios (OR) of UCC risk per s.d. of each genome-wide measure of DNA methylation and 95% confidence intervals (CIs), adjusted for potential confounders. We also investigated associations by disease subtype, sex, smoking, and time since blood collection. Results: The risk of superficial UCC was decreased for individuals with higher levels of our genome-wide DNA methylation measure (OR=0.71, 95% CI: 0.54–0.94; P=0.02). This association was particularly strong for current smokers at sample collection (OR=0.47, 95% CI: 0.27–0.83). Intermediate levels of our genome-wide measure were associated with decreased risk of invasive UCC. Some variation was observed between UCC subtypes and the location and regulatory function of the CpGs included in the genome-wide measures of methylation. Conclusions: Higher levels of our genome-wide DNA methylation measure were associated with decreased risk of superficial UCC and intermediate levels were associated with reduced risk of invasive disease. These findings require replication by other prospective studies. PMID:27490804

Genome-wide measures of DNA methylation in peripheral blood and the risk of urothelial cell carcinoma: a prospective nested case-control study.

PubMed

Dugué, Pierre-Antoine; Brinkman, Maree T; Milne, Roger L; Wong, Ee Ming; FitzGerald, Liesel M; Bassett, Julie K; Joo, Jihoon E; Jung, Chol-Hee; Makalic, Enes; Schmidt, Daniel F; Park, Daniel J; Chung, Jessica; Ta, Anthony D; Bolton, Damien M; Lonie, Andrew; Longano, Anthony; Hopper, John L; Severi, Gianluca; Saffery, Richard; English, Dallas R; Southey, Melissa C; Giles, Graham G

2016-09-06

Global DNA methylation has been reported to be associated with urothelial cell carcinoma (UCC) by studies using blood samples collected at diagnosis. Using the Illumina HumanMethylation450 assay, we derived genome-wide measures of blood DNA methylation and assessed them for their prospective association with UCC risk. We used 439 case-control pairs from the Melbourne Collaborative Cohort Study matched on age, sex, country of birth, DNA sample type, and collection period. Conditional logistic regression was used to compute odds ratios (OR) of UCC risk per s.d. of each genome-wide measure of DNA methylation and 95% confidence intervals (CIs), adjusted for potential confounders. We also investigated associations by disease subtype, sex, smoking, and time since blood collection. The risk of superficial UCC was decreased for individuals with higher levels of our genome-wide DNA methylation measure (OR=0.71, 95% CI: 0.54-0.94; P=0.02). This association was particularly strong for current smokers at sample collection (OR=0.47, 95% CI: 0.27-0.83). Intermediate levels of our genome-wide measure were associated with decreased risk of invasive UCC. Some variation was observed between UCC subtypes and the location and regulatory function of the CpGs included in the genome-wide measures of methylation. Higher levels of our genome-wide DNA methylation measure were associated with decreased risk of superficial UCC and intermediate levels were associated with reduced risk of invasive disease. These findings require replication by other prospective studies.

The importance of sound methodology in environmental DNA sampling

Treesearch

T. M. Wilcox; K. J. Carim; M. K. Young; K. S. McKelvey; T. W. Franklin; M. K. Schwartz

2018-01-01

Environmental DNA (eDNA) sampling - which enables inferences of species’ presence from genetic material in the environment - is a powerful tool for sampling rare fishes. Numerous studies have demonstrated that eDNA sampling generally provides greater probabilities of detection than traditional techniques (e.g., Thomsen et al. 2012; McKelvey et al. 2016; Valentini et al...

Evaluation of the efficacy of constitutional array-based comparative genomic hybridization in the diagnosis of aneuploidy using genomic and amplified DNA.

PubMed

Tan, Niap H; Palmer, Rodger; Wang, Rubin

2010-02-01

Array-based comparative genomic hybridization (array CGH) is a new molecular technique that has the potential to revolutionize cytogenetics. However, use of high resolution array CGH in the clinical setting is plagued by the problem of widespread copy number variations (CNV) in the human genome. Constitutional microarray, containing only clones that interrogate regions of known constitutional syndromes, may circumvent the dilemma of detecting CNV of unknown clinical significance. The present study investigated the efficacy of constitutional microarray in the diagnosis of trisomy. Test samples included genomic DNA from trisomic cell lines, amplification products of 50 ng of genomic DNA and whole genome amplification products of single cells. DNA amplification was achieved by means of multiple displacement amplification (MDA) over 16 h. The trisomic and sex chromosomes copy number imbalances in the genomic DNA were correctly identified by the constitutional microarrays. However, there was a failure to detect the trisomy in the amplification products of 50 ng of genomic DNA and whole genome amplification products of single cells. Using carefully selected clones, Spectral Genomics constitutional microarray was able to detect the chromosomal copy number imbalances in genomic DNA without the confounding effects of CNV. The diagnostic failure in amplified DNA samples could be attributed to the amplification process. The MDA duration of 16 h generated excessive amount of biases and shortening the duration might minimize the problem.

Leprosy Associated with Atypical Cutaneous Leishmaniasis in Nicaragua and Honduras.

PubMed

Soto, Lucrecia Acosta; Caballero, Nelson; Fuentes, Lesny Ruth; Muñoz, Pedro Torres; Gómez Echevarría, Jose Ramón; López, Montserrat Pérez; Bornay Llinares, Fernando Jorge; Stanford, John L; Stanford, Cynthia A; Donoghue, Helen D

2017-10-01

In Central America, few cases of leprosy have been reported, but the disease may be unrecognized. Diagnosis is based on clinical criteria and histology. Preliminary field work in Nicaragua and Honduras found patients, including many children, with skin lesions clinically suggestive of atypical cutaneous leishmaniasis or indeterminate leprosy. Histology could not distinguish these diseases although acid-fast organisms were visible in a few biopsies. Lesions healed after standard antimicrobial therapy for leprosy. In the present study, patients, family members, and other community members were skin-tested and provided nasal swabs and blood samples. Biopsies were taken from a subgroup of patients with clinical signs of infection. Two laboratories analyzed samples, using local in-house techniques. Mycobacterium leprae , Leishmania spp. and Leishmania infantum were detected using polymerase chain reactions. Mycobacterium leprae DNA was detected in blood samples and nasal swabs, including some cases where leprosy was not clinically suspected. Leishmania spp. were also detected in blood and nasal swabs. Most biopsies contained Leishmania DNA and coinfection of Leishmania spp. with M. leprae occurred in 33% of cases. Mycobacterium leprae DNA was also detected and sequenced from Nicaraguan and Honduran environmental samples. In conclusion, leprosy and leishmaniasis are present in both regions, and leprosy appears to be widespread. The nature of any relationship between these two pathogens and the epidemiology of these infections need to be elucidated.

The effect of dilution and the use of a post-extraction nucleic acid purification column on the accuracy, precision, and inhibition of environmental DNA samples

USGS Publications Warehouse

Mckee, Anna M.; Spear, Stephen F.; Pierson, Todd W.

2015-01-01

Isolation of environmental DNA (eDNA) is an increasingly common method for detecting presence and assessing relative abundance of rare or elusive species in aquatic systems via the isolation of DNA from environmental samples and the amplification of species-specific sequences using quantitative PCR (qPCR). Co-extracted substances that inhibit qPCR can lead to inaccurate results and subsequent misinterpretation about a species’ status in the tested system. We tested three treatments (5-fold and 10-fold dilutions, and spin-column purification) for reducing qPCR inhibition from 21 partially and fully inhibited eDNA samples collected from coastal plain wetlands and mountain headwater streams in the southeastern USA. All treatments reduced the concentration of DNA in the samples. However, column purified samples retained the greatest sensitivity. For stream samples, all three treatments effectively reduced qPCR inhibition. However, for wetland samples, the 5-fold dilution was less effective than other treatments. Quantitative PCR results for column purified samples were more precise than the 5-fold and 10-fold dilutions by 2.2× and 3.7×, respectively. Column purified samples consistently underestimated qPCR-based DNA concentrations by approximately 25%, whereas the directional bias in qPCR-based DNA concentration estimates differed between stream and wetland samples for both dilution treatments. While the directional bias of qPCR-based DNA concentration estimates differed among treatments and locations, the magnitude of inaccuracy did not. Our results suggest that 10-fold dilution and column purification effectively reduce qPCR inhibition in mountain headwater stream and coastal plain wetland eDNA samples, and if applied to all samples in a study, column purification may provide the most accurate relative qPCR-based DNA concentrations estimates while retaining the greatest assay sensitivity.

Diversity of Bacterial Communities in Container Habitats of Mosquitoes

PubMed Central

Ponnusamy, Loganathan; Xu, Ning; Stav, Gil; Wesson, Dawn M.; Schal, Coby

2010-01-01

We investigated the bacterial diversity of microbial communities in water-filled, human-made and natural container habitats of the mosquitoes Aedes aegypti and Aedes albopictus in suburban landscapes of New Orleans, Louisiana in 2003. We collected water samples from three classes of containers, including tires (n=12), cemetery urns (n=23), and miscellaneous containers that included two tree holes (n=19). Total genomic DNA was extracted from water samples, and 16S ribosomal DNA fragments (operational taxonomic units, OTUs) were amplified by PCR and separated by denaturing gradient gel electrophoresis (DGGE). The bacterial communities in containers represented diverse DGGE-DNA banding patterns that were not related to the class of container or to the local spatial distribution of containers. Mean richness and evenness of OTUs were highest in water samples from tires. Bacterial phylotypes were identified by comparative sequence analysis of 90 16S rDNA DGGE band amplicons. The majority of sequences were placed in five major taxa: Alpha-, Beta- and Gammaproteobacteria, Actinobacteria, Bacteroidetes, Cyanobacteria, Firmicutes, and an unclassified group; Proteobacteria and Bacteroidetes were the predominant heterotrophic bacteria in containers. The bacterial communities in human-made containers consisted mainly of undescribed species, and a phylogenetic analysis based on 16S rRNA sequences suggested that species composition was independent of both container type and the spatial distribution of containers. Comparative PCR-based, cultivation-independent rRNA surveys of microbial communities associated with mosquito habitats can provide significant insight into community organization and dynamics of bacterial species. PMID:18373113

Tobacco exposure-related alterations in DNA methylation and gene expression in human monocytes: the Multi-Ethnic Study of Atherosclerosis (MESA)

PubMed Central

Reynolds, Lindsay M.; Lohman, Kurt; Pittman, Gary S.; Barr, R. Graham; Chi, Gloria C.; Kaufman, Joel; Wan, Ma; Bell, Douglas A.; Blaha, Michael J.; Rodriguez, Carlos J.; Liu, Yongmei

2017-01-01

ABSTRACT Alterations in DNA methylation and gene expression in blood leukocytes are potential biomarkers of harm and mediators of the deleterious effects of tobacco exposure. However, methodological issues, including the use of self-reported smoking status and mixed cell types have made previously identified alterations in DNA methylation and gene expression difficult to interpret. In this study, we examined associations of tobacco exposure with DNA methylation and gene expression, utilizing a biomarker of tobacco exposure (urine cotinine) and CD14+ purified monocyte samples from 934 participants of the community-based Multi-Ethnic Study of Atherosclerosis (MESA). Urine cotinine levels were measured using an immunoassay. DNA methylation and gene expression were measured with microarrays. Multivariate linear regression was used to test for associations adjusting for age, sex, race/ethnicity, education, and study site. Urine cotinine levels were associated with methylation of 176 CpGs [false discovery rate (FDR)<0.01]. Four CpGs not previously identified by studies of non-purified blood samples nominally replicated (P value<0.05) with plasma cotinine-associated methylation in 128 independent monocyte samples. Urine cotinine levels associated with expression of 12 genes (FDR<0.01), including increased expression of P2RY6 (Beta ± standard error = 0.078 ± 0.008, P = 1.99 × 10−22), a gene previously identified to be involved in the release of pro-inflammatory cytokines. No cotinine-associated (FDR<0.01) methylation profiles significantly (FDR<0.01) correlated with cotinine-associated (FDR<0.01) gene expression profiles. In conclusion, our findings i) identify potential monocyte-specific smoking-associated methylation patterns and ii) suggest that alterations in methylation may not be a main mechanism regulating gene expression in monocytes in response to cigarette smoking. PMID:29166816

Leveraging increased cytoplasmic nucleoside kinase activity to target mtDNA and oxidative phosphorylation in AML.

PubMed

Liyanage, Sanduni U; Hurren, Rose; Voisin, Veronique; Bridon, Gaëlle; Wang, Xiaoming; Xu, ChangJiang; MacLean, Neil; Siriwardena, Thirushi P; Gronda, Marcela; Yehudai, Dana; Sriskanthadevan, Shrivani; Avizonis, Daina; Shamas-Din, Aisha; Minden, Mark D; Bader, Gary D; Laposa, Rebecca; Schimmer, Aaron D

2017-05-11

Mitochondrial DNA (mtDNA) biosynthesis requires replication factors and adequate nucleotide pools from the mitochondria and cytoplasm. We performed gene expression profiling analysis of 542 human acute myeloid leukemia (AML) samples and identified 55% with upregulated mtDNA biosynthesis pathway expression compared with normal hematopoietic cells. Genes that support mitochondrial nucleotide pools, including mitochondrial nucleotide transporters and a subset of cytoplasmic nucleoside kinases, were also increased in AML compared with normal hematopoietic samples. Knockdown of cytoplasmic nucleoside kinases reduced mtDNA levels in AML cells, demonstrating their contribution in maintaining mtDNA. To assess cytoplasmic nucleoside kinase pathway activity, we used a nucleoside analog 2'3'-dideoxycytidine (ddC), which is phosphorylated to the activated antimetabolite, 2'3'-dideoxycytidine triphosphate by cytoplasmic nucleoside kinases. ddC is a selective inhibitor of the mitochondrial DNA polymerase γ. ddC was preferentially activated in AML cells compared with normal hematopoietic progenitor cells. ddC treatment inhibited mtDNA replication, oxidative phosphorylation, and induced cytotoxicity in a panel of AML cell lines. Furthermore, ddC preferentially inhibited mtDNA replication in a subset of primary human leukemia cells and selectively targeted leukemia cells while sparing normal progenitor cells. In animal models of human AML, treatment with ddC decreased mtDNA, electron transport chain proteins, and induced tumor regression without toxicity. ddC also targeted leukemic stem cells in secondary AML xenotransplantation assays. Thus, AML cells have increased cytidine nucleoside kinase activity that regulates mtDNA biogenesis and can be leveraged to selectively target oxidative phosphorylation in AML. © 2017 by The American Society of Hematology.

Leveraging increased cytoplasmic nucleoside kinase activity to target mtDNA and oxidative phosphorylation in AML

PubMed Central

Liyanage, Sanduni U.; Hurren, Rose; Voisin, Veronique; Bridon, Gaëlle; Wang, Xiaoming; Xu, ChangJiang; MacLean, Neil; Siriwardena, Thirushi P.; Gronda, Marcela; Yehudai, Dana; Sriskanthadevan, Shrivani; Avizonis, Daina; Shamas-Din, Aisha; Minden, Mark D.; Bader, Gary D.; Laposa, Rebecca

2017-01-01

Mitochondrial DNA (mtDNA) biosynthesis requires replication factors and adequate nucleotide pools from the mitochondria and cytoplasm. We performed gene expression profiling analysis of 542 human acute myeloid leukemia (AML) samples and identified 55% with upregulated mtDNA biosynthesis pathway expression compared with normal hematopoietic cells. Genes that support mitochondrial nucleotide pools, including mitochondrial nucleotide transporters and a subset of cytoplasmic nucleoside kinases, were also increased in AML compared with normal hematopoietic samples. Knockdown of cytoplasmic nucleoside kinases reduced mtDNA levels in AML cells, demonstrating their contribution in maintaining mtDNA. To assess cytoplasmic nucleoside kinase pathway activity, we used a nucleoside analog 2′3′-dideoxycytidine (ddC), which is phosphorylated to the activated antimetabolite, 2′3′-dideoxycytidine triphosphate by cytoplasmic nucleoside kinases. ddC is a selective inhibitor of the mitochondrial DNA polymerase γ. ddC was preferentially activated in AML cells compared with normal hematopoietic progenitor cells. ddC treatment inhibited mtDNA replication, oxidative phosphorylation, and induced cytotoxicity in a panel of AML cell lines. Furthermore, ddC preferentially inhibited mtDNA replication in a subset of primary human leukemia cells and selectively targeted leukemia cells while sparing normal progenitor cells. In animal models of human AML, treatment with ddC decreased mtDNA, electron transport chain proteins, and induced tumor regression without toxicity. ddC also targeted leukemic stem cells in secondary AML xenotransplantation assays. Thus, AML cells have increased cytidine nucleoside kinase activity that regulates mtDNA biogenesis and can be leveraged to selectively target oxidative phosphorylation in AML. PMID:28283480

Guide to detecting epidermal growth factor receptor (EGFR) mutations in ctDNA of patients with advanced non-small-cell lung cancer

PubMed Central

Normanno, Nicola; Denis, Marc G.; Thress, Kenneth S.; Ratcliffe, Marianne; Reck, Martin

2017-01-01

Cancer treatment is evolving towards therapies targeted at specific molecular abnormalities that drive tumor growth. Consequently, to determine which patients are eligible, accurate assessment of molecular aberrations within tumors is required. Obtaining sufficient tumor tissue for molecular testing can present challenges; therefore, circulating free tumor-derived DNA (ctDNA) found in blood plasma has been proposed as an alternative source of tumor DNA. The diagnostic utility of ctDNA for the detection of epidermal growth factor receptor (EGFR) mutations harbored in tumors of patients with advanced non-small-cell lung cancer (NSCLC) is supported by the results of several large studies/meta-analyses. However, recent real-world studies suggest that the performance of ctDNA testing varies between geographic regions/laboratories, demonstrating the need for standardized guidance. In this review, we outline recommendations for obtaining an accurate result using ctDNA, relating to pre-analytical plasma processing, ctDNA extraction, and appropriate EGFR mutation detection methods, based on clinical trial results. We conclude that there are several advantages associated with ctDNA, including the potential for repeated sampling particularly following progression after first-line tyrosine kinase inhibitor (TKI) therapy, as TKIs targeting resistance mutations (eg T790M) are now approved for use in the USA/EU/Japan (at time of writing). However, evidence suggests that ctDNA does not allow detection of EGFR mutations in all patients with known mutation-positive NSCLC. Therefore, although tumor tissue should be the first sample choice for EGFR testing at diagnosis, ctDNA is a promising alternative diagnostic approach. PMID:27980215

Clinical forensic sample collection techniques following consensual intercourse in volunteers - cervical canal brush compared to conventional swabs.

PubMed

Joki-Erkkilä, Minna; Tuomisto, Sari; Seppänen, Mervi; Huhtala, Heini; Ahola, Arja; Rainio, Juha; Karhunen, Pekka J

2014-10-01

The purpose of the research was to evaluate gynecological evidence collection techniques; the benefit of cervical canal brush sample compared to vaginal fornix and cervical swab samples and the time frame for detecting Y-chromosomal material QiAmp DNA Mini Kit(®) and Quantifiler Y Human Male DNA Quantification Kit(®) in adult volunteers following consensual intercourse. Eighty-four adult female volunteers following consensual intercourse were recruited for the study. By combining all sample collecting techniques, 81.0% of the volunteers were Y-DNA positive. Up to 60 h the conventional swab sampling techniques detected more Y-DNA positive samples when compared to the brush technique. However, after 60 h, the cervical canal brush sample technique showed its benefit by detecting 27.3% (6/22) of Y-DNA positive samples, which were Y-DNA negative in both conventional swab sampling techniques. By combining swab and brush techniques, 75% of the volunteers were still Y-DNA positive in 72-144 post-coital hours. The rate of measurable Y-DNA decreased approximately 3% per hour. Despite reported consensual intercourse, 6.8% (3/44) of volunteers were Y-DNA negative within 48 h. Y-DNA was not detected after 144 post-coital hours (6 days). In conclusion, the brush as a forensic evidence collection method may provide additional biological trace evidence from the cervical canal, although the best biological trace evidence collection can be obtained by combining all three sampling techniques. The time frame for gynecological forensic evidence sample collection should be considered to be at least a week if sexual violence is suspected. Copyright © 2014 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

Detection of maternal DNA in placental/umbilical cord blood by locus-specific amplification of the noninherited maternal HLA gene.

PubMed

Scaradavou, A; Carrier, C; Mollen, N; Stevens, C; Rubinstein, P

1996-08-15

A critical issue regarding the broader utilization of placental/ umbilical cord blood (PCB) in unrelated bone marrow restoration is the possibility of contamination with maternal lymphocytes capable of immunological reactivity against the eventual recipient. On transplantation, such maternal cells might lead to graft-versus-host disease (GVHD) even if the intended donor's neonatal lymphocytes were unresponsive. We measured the proportion of PCB samples that were contaminated with maternal cells. Placental-maternal sample pairs were selected so that the mother was heterozygous for the DR53 haplotype, whereas the placental sample was DR53-negative. The PCB samples were investigated for the presence of the noninherited maternal gene DRB4, exclusive to the DR53 haplotypes. Locus-specific polymerase chain reaction amplification with DRB4 sequence-specific primers was followed by either gel electrophoresis or blotting and hybridization to an internal sequence DRB4 probe. Polymerase chain reaction products from DNA mixtures containing as low as 0.5 ng of a DRB4-positive DNA control in 1.0 microgram of a DRB4-negative DNA sample (1:2 x 10(3) dilution) showed a visible DRB4 band in agarose gels stained with ethidium bromide. Locus-specific hybridization increased the detection sensitivity to 1:10(5) (0.01 ng of the DRB4-positive DNA control). Control mixtures of known amounts of DRB4-positive and -negative DNA were included in all experiments. Comparison of the thickness of DRB4 bands after electrophoresis and the intensity of the DRB4-specific hybridization signals to the concentration controls allowed a rough estimation of the amount of maternal DNA in the placental blood specimens. A total of 213 PCB samples were tested. By gel electrophoresis, DRB4-specific bands were observed to be as strong or stronger in 23 (10.8%) samples as those in the 1:2 x 10(3) control, and 153 (17.8%) samples were negative in this test. The remaining 37 (17.3%) samples disclosed weaker DRB4 bands, suggesting the presence of maternal genetic material. By hybridization, 81 (38%) samples were positive and 132 were negative for the noninherited maternal gene. Review of the clinical characteristics of the mothers (demographics and labor and delivery information), the newborns (birth weight, sex, and gestational age), and PCB collections (placental weight, white blood cell count, and collected volume) failed to show any significant differences between the units testing positive or negative for the noninherited maternal gene. Thus, transplantable PCB units carry a high probability of having maternal DNA in detectable amounts. Whether this DNA comes from potentially graft-versus-host disease-inducing maternal lymphocytes or whether the putatively transplacentally-acquired maternal cells are immunologically dysfunctional, as in most infants with severe combined immunodeficiency disease, remains to be shown.

Epigenetic profiling of cutaneous T-cell lymphoma: promoter hypermethylation of multiple tumor suppressor genes including BCL7a, PTPRG, and p73.

PubMed

van Doorn, Remco; Zoutman, Willem H; Dijkman, Remco; de Menezes, Renee X; Commandeur, Suzan; Mulder, Aat A; van der Velden, Pieter A; Vermeer, Maarten H; Willemze, Rein; Yan, Pearlly S; Huang, Tim H; Tensen, Cornelis P

2005-06-10

To analyze the occurrence of promoter hypermethylation in primary cutaneous T-cell lymphoma (CTCL) on a genome-wide scale, focusing on epigenetic alterations with pathogenetic significance. DNA isolated from biopsy specimens of 28 patients with CTCL, including aggressive CTCL entities (transformed mycosis fungoides and CD30-negative large T-cell lymphoma) and an indolent entity (CD30-positive large T-cell lymphoma), were investigated. For genome-wide DNA methylation screening, differential methylation hybridization using CpG island microarrays was applied, which allows simultaneous detection of the methylation status of 8640 CpG islands. Bisulfite sequence analysis was applied for confirmation and detection of hypermethylation of eight selected tumor suppressor genes. The DNA methylation patterns of CTCLs emerging from differential methylation hybridization analysis included 35 CpG islands hypermethylated in at least four of the 28 studied CTCL samples when compared with benign T-cell samples. Hypermethylation of the putative tumor suppressor genes BCL7a (in 48% of CTCL samples), PTPRG (27%), and thrombospondin 4 (52%) was confirmed and demonstrated to be associated with transcriptional downregulation. BCL7a was hypermethylated at a higher frequency in aggressive (64%) than in indolent (14%) CTCL entities. In addition, the promoters of the selected tumor suppressor genes p73 (48%), p16 (33%), CHFR (19%), p15 (10%), and TMS1 (10%) were hypermethylated in CTCL. Malignant T cells of patients with CTCL display widespread promoter hypermethylation associated with inactivation of several tumor suppressor genes involved in DNA repair, cell cycle, and apoptosis signaling pathways. In view of this, CTCL may be amenable to treatment with demethylating agents.

Fast, Accurate and Automatic Ancient Nucleosome and Methylation Maps with epiPALEOMIX.

PubMed

Hanghøj, Kristian; Seguin-Orlando, Andaine; Schubert, Mikkel; Madsen, Tobias; Pedersen, Jakob Skou; Willerslev, Eske; Orlando, Ludovic

2016-12-01

The first epigenomes from archaic hominins (AH) and ancient anatomically modern humans (AMH) have recently been characterized, based, however, on a limited number of samples. The extent to which ancient genome-wide epigenetic landscapes can be reconstructed thus remains contentious. Here, we present epiPALEOMIX, an open-source and user-friendly pipeline that exploits post-mortem DNA degradation patterns to reconstruct ancient methylomes and nucleosome maps from shotgun and/or capture-enrichment data. Applying epiPALEOMIX to the sequence data underlying 35 ancient genomes including AMH, AH, equids and aurochs, we investigate the temporal, geographical and preservation range of ancient epigenetic signatures. We first assess the quality of inferred ancient epigenetic signatures within well-characterized genomic regions. We find that tissue-specific methylation signatures can be obtained across a wider range of DNA preparation types than previously thought, including when no particular experimental procedures have been used to remove deaminated cytosines prior to sequencing. We identify a large subset of samples for which DNA associated with nucleosomes is protected from post-mortem degradation, and nucleosome positioning patterns can be reconstructed. Finally, we describe parameters and conditions such as DNA damage levels and sequencing depth that limit the preservation of epigenetic signatures in ancient samples. When such conditions are met, we propose that epigenetic profiles of CTCF binding regions can be used to help data authentication. Our work, including epiPALEOMIX, opens for further investigations of ancient epigenomes through time especially aimed at tracking possible epigenetic changes during major evolutionary, environmental, socioeconomic, and cultural shifts. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Determination of the Biological Form of Human Cytomegalovirus DNA in the Plasma of Solid-Organ Transplant Recipients.

PubMed

Tong, Yupin; Pang, Xiaoli L; Mabilangan, Curtis; Preiksaitis, Jutta K

2017-04-01

Whether cytomegalovirus (CMV) DNA exists in plasma as virion-associated or free DNA is uncertain. An assay combining DNase I digestion and CMV quantitative polymerase chain reaction (DNase-CMV-qPCR) was developed to differentiate free naked DNA from virion DNA. One hundred three frozen and 10 fresh CMV DNA-positive plasma samples from solid-organ transplant recipients (SOTRs) were tested. Three sets of paired qPCR (P-qPCR) assays with amplicons of variable length were used to study CMV DNA fragmentation in 20 SOTR plasma samples, viral stocks (Towne, Merlin, AD169) and the first World Health Organization (WHO) international standard (IS) for CMV DNA. In all plasma samples, 98.8%-100% of CMV DNA was free DNA; this was the only form in 93 of 103 (90.3%) frozen and all 10 fresh samples tested using DNase-CMV-qPCR. Low levels of virion CMV DNA were found in 10 of 103 (9.7%) samples with higher total DNA load. Cytomegalovirus DNA results were highly reproducible for 3 CMV virus stocks and WHO IS (P > .80), tested by three sets of paired q-PCR. However, for the 20 SOTR plasma samples, the smaller amplicon assay result was 2.6-fold, 3.4-fold, and 6.5-fold higher than the longer amplicion result (P < .001). Cytomegalovirus DNA in SOTR plasma is almost exclusively free DNA, highly fragmented, and not virion associated. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

Legionella prevalence and risk of legionellosis in Japanese households.

PubMed

Kuroki, T; Watanabe, Y; Teranishi, H; Izumiyama, S; Amemura-Maekawa, J; Kura, F

2017-05-01

This study determined the occurrence of legionellae in private houses for which there were no available data on aquatic environments other than the water supply system. From June 2013 to November 2014, we collected 138 water and 90 swab samples from aquatic environments in 19 houses. Legionella DNA was detected via a loop-mediated isothermal amplification assay in 66 (47·8%) water and 17 (18·9%) swab samples. High Legionella DNA detection rates were observed in water samples from washing machines and aquariums. Legionella spp. was isolated from 9 (6·5%) water and 3 (3·3%) swab samples. Legionella pneumophila SG 1 was detected from the outlet water of a bathtub spout and a bath sponge. Use of amoebic co-culture effectively increased legionellae and Legionella DNA detection rates from all sample types. A logistic regression analysis revealed that the heterotrophic plate count was significantly related to Legionella contamination. Our findings indicate that there is a risk of legionellosis from exposure to Legionella spp. in a variety of aquatic environments in residential houses. Control measures for legionellae in houses should include frequent cleaning and disinfecting to reduce heterotrophic bacteria in water and, where possible, preventing aerosolization from aquatic environments.

Rapid Identification of a Cooling Tower-Associated Legionnaires’ Disease Outbreak Supported by Polymerase Chain Reaction Testing of Environmental Samples, New York City, 2014–2015

PubMed Central

Benowitz, Isaac; Fitzhenry, Robert; Boyd, Christopher; Dickinson, Michelle; Levy, Michael; Lin, Ying; Nazarian, Elizabeth; Ostrowsky, Belinda; Passaretti, Teresa; Rakeman, Jennifer; Saylors, Amy; Shamoonian, Elena; Smith, Terry-Ann; Balter, Sharon

2018-01-01

We investigated an outbreak of eight Legionnaires’ disease cases among persons living in an urban residential community of 60,000 people. Possible environmental sources included two active cooling towers (air-conditioning units for large buildings) <1 km from patient residences, a market misting system, a community-wide water system used for heating and cooling, and potable water. To support a timely public health response, we used real-time polymerase chain reaction (PCR) to identify Legionella DNA in environmental samples within hours of specimen collection. We detected L. pneumophila serogroup 1 DNA only at a power plant cooling tower, supporting the decision to order remediation before culture results were available. An isolate from a power plant cooling tower sample was indistinguishable from a patient isolate by pulsed-field gel electrophoresis, suggesting the cooling tower was the outbreak source. PCR results were available <1 day after sample collection, and culture results were available as early as 5 days after plating. PCR is a valuable tool for identifying Legionella DNA in environmental samples in outbreak settings. PMID:29780175

Cisplatin enhances the formation of DNA single- and double-strand breaks by hydrated electrons and hydroxyl radicals.

PubMed

Rezaee, Mohammad; Sanche, Léon; Hunting, Darel J

2013-03-01

The synergistic interaction of cisplatin with ionizing radiation is the clinical rationale for the treatment of several cancers including head and neck, cervical and lung cancer. The underlying molecular mechanism of the synergy has not yet been identified, although both DNA damage and repair processes are likely involved. Here, we investigate the indirect effect of γ rays on strand break formation in a supercoiled plasmid DNA (pGEM-3Zf-) covalently modified by cisplatin. The yields of single- and double-strand breaks were determined by irradiation of DNA and cisplatin/DNA samples with (60)Co γ rays under four different scavenging conditions to examine the involvement of hydrated electrons and hydroxyl radicals in inducing the DNA damage. At 5 mM tris in an N2 atmosphere, the presence of an average of two cisplatins per plasmid increased the yields of single- and double-strand breaks by factors of 1.9 and 2.2, respectively, relative to the irradiated unmodified DNA samples. Given that each plasmid of 3,200 base pairs contained an average of two cisplatins, this represents an increase in radiosensitivity of 3,200-fold on a per base pair basis. When hydrated electrons were scavenged by saturating the samples with N2O, these enhancement factors decreased to 1.5 and 1.2, respectively, for single- and double-strand breaks. When hydroxyl radicals were scavenged using 200 mM tris, the respective enhancement factors were 1.2 and 1.6 for single- and double-strand breaks, respectively. Furthermore, no enhancement in DNA damage by cisplatin was observed after scavenging both hydroxyl radicals and hydrated electrons. These findings show that hydrated electrons can induce both single- and double-strand breaks in the platinated DNA, but not in unmodified DNA. In addition, cisplatin modification is clearly an extremely efficient means of increasing the formation of both single- and double-strand breaks by the hydrated electrons and hydroxyl radicals created by ionizing radiation.

No filters, no fridges: a method for preservation of water samples for eDNA analysis.

PubMed

Williams, Kelly E; Huyvaert, Kathryn P; Piaggio, Antoinette J

2016-06-08

Advancements in the detection of environmental DNA (eDNA) for detecting species of interest will likely allow for expanded use of these techniques in the field. One obstacle that continues to hinder applications in the field is the requirement of a cold chain of storage for water samples containing eDNA. While eDNA has been successfully preserved using Longmire's lysis buffer applied to filters, it has yet to be tried with freshwater samples collected for eDNA detection of an invasive species. We tested the utility of Longmire's solution (100 mM Tris, 100 mM EDTA, 10 mM NaCl, 0.5 % SDS, 0.2 % sodium azide) as an additive to freshwater samples for preservation of eDNA. Environmental DNA was effectively preserved in 15 mL water samples with Longmire's solution added; eDNA positive detection was comparable to freezing the samples at -80 °C and occurred out to 56 days at the highest concentration (5 mL Longmire's solution: 15 mL sample water). Medium and low concentrations of Longmire's solution added to 15 mL of sample water generally preserved eDNA out to 56 days but not as well as did freezing or application of the highest concentration of Longmire's lysis buffer. Treatment and degradation time had a significant effect on average DNA concentration of samples, although not the interaction of treatment and time. Perfect detection occurred out to 56 days with the high Longmire's treatment group but DNA concentration was significantly lower at this time point compared to 28 days. We conclude that Longmire's lysis buffer is a viable alternative to cold chain storage that can simplify the collection of eDNA by eliminating the need for filtering and allow more time for sample collection when added at our highest concentration (1 part Longmire's:3 parts water sample), which could translate to an increase in the chances of detecting a rare or elusive species.

The impact of different DNA extraction kits and laboratories upon the assessment of human gut microbiota composition by 16S rRNA gene sequencing.

PubMed

Kennedy, Nicholas A; Walker, Alan W; Berry, Susan H; Duncan, Sylvia H; Farquarson, Freda M; Louis, Petra; Thomson, John M; Satsangi, Jack; Flint, Harry J; Parkhill, Julian; Lees, Charlie W; Hold, Georgina L

2014-01-01

Determining bacterial community structure in fecal samples through DNA sequencing is an important facet of intestinal health research. The impact of different commercially available DNA extraction kits upon bacterial community structures has received relatively little attention. The aim of this study was to analyze bacterial communities in volunteer and inflammatory bowel disease (IBD) patient fecal samples extracted using widely used DNA extraction kits in established gastrointestinal research laboratories. Fecal samples from two healthy volunteers (H3 and H4) and two relapsing IBD patients (I1 and I2) were investigated. DNA extraction was undertaken using MoBio Powersoil and MP Biomedicals FastDNA SPIN Kit for Soil DNA extraction kits. PCR amplification for pyrosequencing of bacterial 16S rRNA genes was performed in both laboratories on all samples. Hierarchical clustering of sequencing data was done using the Yue and Clayton similarity coefficient. DNA extracted using the FastDNA kit and the MoBio kit gave median DNA concentrations of 475 (interquartile range 228-561) and 22 (IQR 9-36) ng/µL respectively (p<0.0001). Hierarchical clustering of sequence data by Yue and Clayton coefficient revealed four clusters. Samples from individuals H3 and I2 clustered by patient; however, samples from patient I1 extracted with the MoBio kit clustered with samples from patient H4 rather than the other I1 samples. Linear modelling on relative abundance of common bacterial families revealed significant differences between kits; samples extracted with MoBio Powersoil showed significantly increased Bacteroidaceae, Ruminococcaceae and Porphyromonadaceae, and lower Enterobacteriaceae, Lachnospiraceae, Clostridiaceae, and Erysipelotrichaceae (p<0.05). This study demonstrates significant differences in DNA yield and bacterial DNA composition when comparing DNA extracted from the same fecal sample with different extraction kits. This highlights the importance of ensuring that samples in a study are prepared with the same method, and the need for caution when cross-comparing studies that use different methods.

Identifications of captive and wild tilapia species existing in Hawaii by mitochondrial DNA control region sequence.

PubMed

Wu, Liang; Yang, Jinzeng

2012-01-01

The tilapia family of the Cichlidae includes many fish species, which live in freshwater and saltwater environments. Several species, such as O. niloticus, O. aureus, and O. mossambicus, are excellent for aquaculture because these fish are easily reproduced and readily adapt to diverse environments. Historically, tilapia species, including O. mossambicus, S. melanotheron, and O. aureus, were introduced to Hawaii many decades ago, and the state of Hawaii uses the import permit policy to prevent O. niloticus from coming into the islands. However, hybrids produced from O. niloticus may already be present in the freshwater and marine environments of the islands. The purpose of this study was to identify tilapia species that exist in Hawaii using mitochondrial DNA analysis. In this study, we analyzed 382 samples collected from 13 farm (captive) and wild tilapia populations in Oahu and the Hawaii Islands. Comparison of intraspecies variation between the mitochondrial DNA control region (mtDNA CR) and cytochrome c oxidase I (COI) gene from five populations indicated that mtDNA CR had higher nucleotide diversity than COI. A phylogenetic tree of all sampled tilapia was generated using mtDNA CR sequences. The neighbor-joining tree analysis identified seven distinctive tilapia species: O. aureus, O. mossambicus, O. niloticus, S. melanotheron, O. urolepies, T. redalli, and a hybrid of O. massambicus and O. niloticus. Of all the populations examined, 10 populations consisting of O. aureus, O. mossambicus, O. urolepis, and O. niloticus from the farmed sites were relatively pure, whereas three wild populations showed some degree of introgression and hybridization. This DNA-based tilapia species identification is the first report that confirmed tilapia species identities in the wild and captive populations in Hawaii. The DNA sequence comparisons of mtDNA CR appear to be a valid method for tilapia species identification. The suspected tilapia hybrids that consist of O. niloticus are present in captive and wild populations in Hawaii.

Identifications of Captive and Wild Tilapia Species Existing in Hawaii by Mitochondrial DNA Control Region Sequence

PubMed Central

Wu, Liang; Yang, Jinzeng

2012-01-01

Background The tilapia family of the Cichlidae includes many fish species, which live in freshwater and saltwater environments. Several species, such as O. niloticus, O. aureus, and O. mossambicus, are excellent for aquaculture because these fish are easily reproduced and readily adapt to diverse environments. Historically, tilapia species, including O. mossambicus, S. melanotheron, and O. aureus, were introduced to Hawaii many decades ago, and the state of Hawaii uses the import permit policy to prevent O. niloticus from coming into the islands. However, hybrids produced from O. niloticus may already be present in the freshwater and marine environments of the islands. The purpose of this study was to identify tilapia species that exist in Hawaii using mitochondrial DNA analysis. Methodology/Principal Findings In this study, we analyzed 382 samples collected from 13 farm (captive) and wild tilapia populations in Oahu and the Hawaii Islands. Comparison of intraspecies variation between the mitochondrial DNA control region (mtDNA CR) and cytochrome c oxidase I (COI) gene from five populations indicated that mtDNA CR had higher nucleotide diversity than COI. A phylogenetic tree of all sampled tilapia was generated using mtDNA CR sequences. The neighbor-joining tree analysis identified seven distinctive tilapia species: O. aureus, O. mossambicus, O. niloticus, S. melanotheron, O. urolepies, T. redalli, and a hybrid of O. massambicus and O. niloticus. Of all the populations examined, 10 populations consisting of O. aureus, O. mossambicus, O. urolepis, and O. niloticus from the farmed sites were relatively pure, whereas three wild populations showed some degree of introgression and hybridization. Conclusions/Significance This DNA-based tilapia species identification is the first report that confirmed tilapia species identities in the wild and captive populations in Hawaii. The DNA sequence comparisons of mtDNA CR appear to be a valid method for tilapia species identification. The suspected tilapia hybrids that consist of O. niloticus are present in captive and wild populations in Hawaii. PMID:23251613

[Variation of mini- and microsatellite DNA markers in populations of parthenogenetic rock lizard Darevskia rostombekovi].

PubMed

Martirosian, I A; Ryskov, A P; Petrosian, V G; Arakelian, M S; Aslanian, A V; Danielian, F D; Darevskiĭ, I S; Tokarskaia, O N

2002-06-01

Variation and clonal diversity in populations of the parthenogenetic rock lizard Darevskia rostombekovi was examined by means of multilocus DNA fingerprinting using mini- and microsatellite DNA markers M13, (GATA)4, and (TCC)50). The animals examined were shown to exhibit a clonally inherited, species-specific pattern of DNA markers (fingerprint profile) that is different from the species-specific patterns of parthenogenetic species D. dahli, D. armeniaca, and D. unisexualis. The mean intraspecific similarity index S was 0.950 (0.003) for a sample of 19 animals from three isolated populations of North Armenia. This significantly differed from the estimate of this parameter for a sample of 21 animals including two individuals from mountainous, relict population from the vicinity of the Sevan Lake, which was equal to 0.875 (0.001). A comparison of DNA fingerprints showed differences between 21 individuals attaining 79 DNA fragments of 1801 mini- and microsatellite markers included in the analysis. The results obtained show that intraspecific variation in D. rostombekovi is higher than that in the previously studied parthenogenetic species D. dahli (S = 0.962) and D. unisexualis (S = 0.950) (P < 0.001). Taking into account that D. rostombekovi is considered monoclonal on the basis of allozyme data, the problem of clonal variability is discussed with regard to the evidence on nuclear DNA markers. It is suggested that the hybrid karyotype of D. rostombekovi, which is more unstable than that of D. dahli and D. unisexualis, generates a series of chromosomal rearrangements (mutations). This may lead to the appearance of a geographically isolated chromosomal race (clone) in the population inhabiting the southeastern coast of the Sevan Lake.

[Validation of Differential Extraction Kit in forensic sexual assault cases].

PubMed

Wu, Dan; Cao, Yu; Xu, Yan; He, Bai-Fang; Bi, Gang; Zhou, Huai-Gu

2009-12-01

To evaluate the validity of Differential Extraction Kit in isolating spermatozoa and epithelial cell DNA from mixture samples. Selective lysis of spermatid and epithelial cells combined with paramagnetic particle method were applied to extract the DNA from the mock samples under controlled conditions and forensic case samples, and template DNA were analyzed by STR genotype method. This Differential Extraction Kit is efficient to obtain high quality spermatid and epithelial cell DNA from the mixture samples with different proportion of sperm to epithelial cell. The Differential Extraction Kit can be applied in DNA extraction for mixed stain from forensic sexual assault samples.

Specific detection of Neospora caninum oocysts in fecal samples from experimentally-infected dogs using the polymerase chain reaction.

PubMed

Hill, D E; Liddell, S; Jenkins, M C; Dubey, J P

2001-04-01

Neospora caninum oocysts, passed in the feces of a definitive host (dog), were isolated, and genomic DNA was extracted. A polymerase cahin reaction (PCR) targeting the N. caninum-specific Nc 5 genomic sequence was performed using the isolated DNA. A synthesized competitor molecule containing part of the Nc 5 sequence was included in the assay as a check against false-negative PCR results and to quantify N. caninum oocyst DNA in fecal samples. A standard curve of the ratio of fluorescence intensity of PCR-amplified competitor to that of oocyst DNA was constructed to compare oocyst equivalents from fecal samples containing unknown numbers of N. caninum oocysts and to assess the sensitivity of the assay. The specificity of the assay was determined using the Nc 5-specific primers in PCR assays against other parasites likely to be found in canine feces. Genomic DNA sequences from the canine coccidians Hammondia heydorni, Cryptosporidium parvum, Sarcocystis cruzi, S. tenella, and Isospora ohioensis and the canine helminth parasites Strongyloides stercoralis, Toxocara canis, Dipylidium caninum, and Ancylostoma caninum were not amplified. In addition, genomic DNA sequences from oocysts of coccidian parasites that might contaminate dog feces, such as Hammondia hammondi, Toxoplasma gondii, or Eimeria tenella, were not amplified in the PCR assay. The assay should be useful in epidemiological surveys of both domestic and wild canine hosts and in investigations of oocyst biology in experimental infections.

Detection of Leptospira interrogans DNA and antigen in fixed equine eyes affected with end-stage equine recurrent uveitis.

PubMed

Pearce, Jacqueline W; Galle, Laurence E; Kleiboeker, Steve B; Turk, James R; Schommer, Susan K; Dubielizig, Richard R; Mitchell, William J; Moore, Cecil P; Giuliano, Elizabeth A

2007-11-01

Equine recurrent uveitis (ERU) is the most frequent cause of blindness in horses worldwide. Leptospira has been implicated as an etiologic agent in some cases of ERU and has been detected in fresh ocular tissues of affected horses. The objective of this study was to determine the presence of Leptospira antigen and DNA in fixed equine ocular tissues affected with end-stage ERU. Sections of eyes from 30 horses were obtained. Controls included 1) 10 normal equine eyes and 2) 10 equine eyes with a nonrecurrent form of uveitis. The experimental group consisted of 10 eyes diagnosed with ERU based on clinical signs and histologic lesions. Sections were subjected to immunohistochemical staining with an array of rabbit anti-Leptospira polyclonal antibodies. DNA extractions were performed by using a commercial kit designed for fixed tissue. Real-time PCR analysis was completed on extracted DNA. The target sequence for PCR was designed from alignments of available Leptospira 16S rDNA partial sequences obtained from GenBank. Two of 10 test samples were positive for Leptospira antigen by immunohistochemical assay. Zero of 20 controls were positive for Leptospira antigen. All test samples and controls were negative for Leptospira DNA by real-time PCR analysis. Leptospira was detected at a lower frequency than that previously reported for fresh ERU-affected aqueous humor and vitreous samples. Leptospira is not frequently detectable in fixed ocular tissues of horses affected with ERU when using traditional immunohistochemical and real-time PCR techniques.

Rectal swab screening assays of public health importance in molecular diagnostics: Sample adequacy control.

PubMed

Glisovic, Sanja; Eintracht, Shaun; Longtin, Yves; Oughton, Matthew; Brukner, Ivan

Rectal swabs are routinely used by public health authorities to screen for multi-drug resistant enteric bacteria including vancomycin-resistant enterococci (VRE) and carbapenem-resistant enterobacteriaceae (CRE). Screening sensitivity can be influenced by the quality of the swabbing, whether performed by the patient (self-swabbing) or a healthcare practitioner. One common exclusion criterion for rectal swabs is absence of "visible soiling" from fecal matter. In our institution, this criterion excludes almost 10% of rectal swabs received in the microbiology laboratory. Furthermore, over 30% of patients in whom rectal swabs are cancelled will not be re-screened within the next 48h, resulting in delays in removing infection prevention measures. We describe two quantitative polymerase chain reaction (qPCR)-based assays, human RNAse P and eubacterial 16S rDNA, which might serve as suitable controls for sampling adequacy. However, lower amounts of amplifiable human DNA make the 16s rDNA assay a better candidate for sample adequacy control. Copyright © 2017. Published by Elsevier Ltd.

Blood-Based Analyses of Cancer: Circulating Tumor Cells and Circulating Tumor DNA

PubMed Central

Haber, Daniel A.; Velculescu, Victor E.

2015-01-01

The ability to study nonhematologic cancers through noninvasive sampling of blood is one of the most exciting and rapidly advancing fields in cancer diagnostics. This has been driven both by major technologic advances, including the isolation of intact cancer cells and the analysis of cancer cell–derived DNA from blood samples, and by the increasing application of molecularly driven therapeutics, which rely on such accurate and timely measurements of critical biomarkers. Moreover, the dramatic efficacy of these potent cancer therapies drives the selection for additional genetic changes as tumors acquire drug resistance, necessitating repeated sampling of cancer cells to adjust therapy in response to tumor evolution. Together, these advanced noninvasive diagnostic capabilities and their applications in guiding precision cancer therapies are poised to change the ways in which we select and monitor cancer treatments. Significance Recent advances in technologies to analyze circulating tumor cells and circulating tumor DNA are setting the stage for real-time, noninvasive monitoring of cancer and providing novel insights into cancer evolution, invasion, and metastasis. PMID:24801577

First report of Echinococcus shiquicus in dogs from eastern Qinghai-Tibet plateau region, China.

PubMed

Boufana, Belgees; Qiu, Jiamin; Chen, Xinwang; Budke, Christine M; Campos-Ponce, Maiza; Craig, Philip S

2013-07-01

Echinococcus shiquicus was discovered in foxes and pika wildlife hosts in Sichuan Province, China in 2005. Faecal samples from dogs collected in a previous echinococcosis purgation survey from Shiqu County, Ganzi Tibetan Autonomous Prefecture (Sichuan) were screened by coproPCR to investigate the possible occurrence of E. shiquicus. In addition, coproDNA extracted from 8 necropsied Tibetan foxes (Vulpes ferrilata), the natural host of E. shiquicus, were also included. Thirty (6/20) percent of faecal samples from dogs were positive for E. shiquicus DNA after PCR amplification of a fragment within the ND1 mitochondrial gene. Echinococcus shiquicus was confirmed by sequencing in four dogs and 3 of the 6 dogs were concurrently infected with E. multilocularis. These were also verified by sequencing. Faecal samples from two Tibetan foxes were shown by PCR to harbour both E. multilocularis and E. shiquicus DNA. One of these dual E. multilocularis and E. shiquicus infections in a Tibetan fox was confirmed by sequencing. Copyright © 2013 Elsevier B.V. All rights reserved.

No evidence of Bartonella quintana but detection of Acinetobacter baumannii in head lice from elementary schoolchildren in Paris.

PubMed

Bouvresse, Sophie; Socolovshi, Cristina; Berdjane, Zohra; Durand, Rémy; Izri, Arezki; Raoult, Didier; Chosidow, Olivier; Brouqui, Philippe

2011-12-01

The human body louse is the only known vector of Bartonella quintana. However, the presence of this bacterium has recently been detected in the head lice of homeless individuals and Nepalese slum children. Previous studies have reported the isolation of Acinetobacter baumannii from the body lice of homeless individuals. An epidemiological survey including 74 schools was conducted between 2008 and 2009 in Paris. After a first visual examination, the hair of children with suspected pediculosis was combed with a fine-tooth comb to collect live adult head lice. Molecular studies were performed on randomly selected DNA samples to detect B. quintana and A. baumannii by specific quantitative real-time PCR. Among a collection of 288 DNA samples, B. quintana was not detected, but A. baumannii was detected in 95 DNA samples (33%). Further study is needed to determine the significance of the finding of A. baumannii in head lice. 2011. Published by Elsevier Ltd. All rights reserved.

A sensitive method to quantify human cell-free circulating DNA in blood: relevance to myocardial infarction screening.

PubMed

Jing, Rong-Rong; Wang, Hui-Min; Cui, Ming; Fang, Meng-Kang; Qiu, Xiao-Jun; Wu, Xin-Hua; Qi, Jin; Wang, Yue-Guo; Zhang, Lu-Rong; Zhu, Jian-Hua; Ju, Shao-Qing

2011-09-01

Human cell-free circulating DNA (cf-DNA) derived mainly from cell apoptosis and necrosis can be measured by a variety of laboratory techniques, but almost all of these methods require sample preparation. We have developed a branched DNA (bDNA)-based Alu assay for quantifying cf-DNA in myocardial infarction (MI) patients. A total of 82 individuals were included in the study; 22 MI and 60 normal controls. cf-DNA was quantified using a bDNA-based Alu assay. cf-DNA was higher in serum compared to plasma and there was a difference between genders. cf-DNA was significantly higher in MI patients compared to the controls. There was no correlation between cf-DNA and creatine kinase-MB (CK-MB), troponin I (cTnI) or myoglobin (MYO). In serial specimens, cf-DNA was sensitive and peaked earlier than cTnI. The bDNA-based Alu assay is a novel method for quantifying human cf-DNA. Increased cf-DNA in MI patients might complement cTnI, CK-MB and MYO in a multiple marker format. Copyright © 2011 The Canadian Society of Clinical Chemists. All rights reserved.

[Comparison of the CMV antigenemia test and CMV-DNA PCR results in solid organ transplant recipients].

PubMed

Özkarata, Emre; Özkarataş, Emre; Özbek, Ö Alpay; Avkan Oğuz, Vildan; Sayıner, A Arzu

2016-01-01

Cytomegalovirus (CMV) infection is among the most common important viral infections in solid organ transplant (SOT) recipients. Diagnostic tests for detecting CMV replication are widely used for this group of patients, however there is no clear agreement on the cut-off levels for interpretation of clinical decisions especially when the low level of viral load is detected. In this study, CMV pp65 antigenemia test results were compared with plasma CMV-DNA levels detected by quantitative real-time polymerase chain reaction (qPCR) in samples of kidney and liver transplant recipients in the Central Laboratory of Dokuz Eylul University Hospital between 2011 and 2013, and the correlation between these two tests and viral load equivalent to antigenemia positivity were determined. In the study, pp65 antigenemia and CMV-DNA qPCR results were evaluated retrospectively. The samples from the same patients were included if the time between antigenemia and CMV-DNA qPCR tests were less than 48 hours. SPSS v15.0 was used for correlation, regression and ROC curve analysis. The results of the 217 samples collected from 100 patients (59 male, 41 female; age range: 16-71, mean age: 46 ± 13 years), 36 liver and 64 kidney recipients were evaluated in the study. Of the patients 80% were CMV IgM negative, IgG positive; 1% was CMV IgG and IgM positive; 2% were CMV IgM and IgG negative, while for 17 patients serological results could not be reached. CMV pp65 antigenemia and CMV-DNA were both negative in 102 (47%) samples, while both were positive in 37 (17%) samples. The single sample from a case with CMV IgM and IgG positivity yielded negative results for both antigenemia and CMV-DNA tests. In 78 samples antigenemia were negative and CMV-DNA qPCR were positive, while there were no samples with antigenemia positive and qPCR negative. Mean values of antigenemia and qPCR tests were 23 positive cells/200.000 leukocytes (range: 1 to 230 positive cells) and 12.595 copies/ml (range: 180 to 106.311 copies/ml), respectively. There was a significant correlation between antigenemia and qPCR results among the samples that were positive by both assays (r= 0.785). ROC curve analysis showed that CMV viral load of 205 copies/ml in plasma corresponds to ≥ 1 pp65 antigen positive cells per 200.000 leukocytes (sensitivity: 91.7%, specificity: 90.3%). Higher analytical sensitivity of qPCR test can be explained by the results of CMV-DNA PCR positive and antigenemia negative samples. Non-existence of samples with antigen positive and PCR negative results supported this finding. ROC analysis showed that any sample with CMV-DNA qPCR result less than 205 copies/ml, could be accepted as pp65 antigenemia negative. This viral load value is valid only for the studied patient group and assays, therefore could be changed according to study population and tests.

Forensic identification of Indian snakeroot (Rauvolfia serpentina Benth. ex Kurz) using DNA barcoding.

PubMed

Eurlings, Marcel C M; Lens, Frederic; Pakusza, Csilla; Peelen, Tamara; Wieringa, Jan J; Gravendeel, Barbara

2013-05-01

Indian snakeroot (Rauvolfia serpentina) is a valuable forest product, root extracts of which are used as an antihypertensive drug. Increasing demand led to overharvesting in the wild. Control of international trade is hampered by the inability to identify root samples to the species level. We therefore evaluated the potential of molecular identification by searching for species-specific DNA polymorphisms. We found two species-specific indels in the rps16 intron region for R. serpentina. Our DNA barcoding method was tested for its specificity, reproducibility, sensitivity and stability. We included samples of various tissues and ages, which had been treated differently for preservation. DNA extractions were tested in a range of amplification settings and dilutions. Species-specific rps16 intron sequences were obtained from 79 herbarium accessions and one confiscated root, encompassing 39 different species. Our results demonstrate that molecular analysis provides new perspectives for forensic identification of Indian snakeroot. © 2013 American Academy of Forensic Sciences.

Intraplaque hemorrhage, a potential consequence of periodontal bacteria gathering in human carotid atherothrombosis.

PubMed

Brun, Adrian; Rangé, Hélène; Prouvost, Bastien; Meilhac, Olivier; Mazighi, Mikael; Amarenco, Pierre; Lesèche, Guy; Bouchard, Philippe; Michel, Jean-Baptiste

2016-06-28

Periodontal diseases are multifactorial inflammatory diseases, caused by a bacterial biofilm involving both innate and adaptative immunity, characterized by the destruction of tooth-supporting tissues. In the context of periodontitis, the spread of weak pathogenic bacteria into the bloodstream has been described. These bacteria will preferentially localize to existing clot within the circulation. Atherothrombosis of the carotid arteries is a local pathology and a common cause of cerebral infarction. Intraplaque hemorrhages render the lesion more prone to clinical complications such as stroke. The main objective of this study is to explore the biological relationship between carotid intraplaque hemorrhage and periodontal diseases. This study included consecutive patients with symptomatic or asymptomatic carotid stenosis, admitted for endarterectomy surgical procedure (n=41). In conditioned media of the carotid samples collected, markers of neutrophil activation (myeloperoxidase or MPO, DNA-MPO complexes) and hemoglobin were quantified. To investigate the presence of DNA from periodontal bacteria in atherosclerotic plaque, PCR analysis using specific primers was performed. Our preliminary results indicate an association between neutrophil activation and intraplaque hemorrhages, reflected by the release of MPO (p<0,01) and MPO-DNA complexes (p<0,05). Presence of DNA from periodontitis-associated bacteria was found in 32/41 (78%) atheromatous plaque samples. More specifically, DNA from Pg, Tf, Pi, Aa was found in 46%, 24%, 34% and 68% of the samples, respectively. Hemoglobin levels were higher in conditioned media in carotid samples where the bacteria were found, but this was not statistically significant. Our data confirm the relationship between intraplaque hemorrhage and neutrophil activation. In addition, the presence of periodontal bacteria DNA in carotid atheromatous plaque, may contribute to this activation. Further analysis is needed to fully explore the raw data and specimens.

PIMS sequencing extension: a laboratory information management system for DNA sequencing facilities.

PubMed

Troshin, Peter V; Postis, Vincent Lg; Ashworth, Denise; Baldwin, Stephen A; McPherson, Michael J; Barton, Geoffrey J

2011-03-07

Facilities that provide a service for DNA sequencing typically support large numbers of users and experiment types. The cost of services is often reduced by the use of liquid handling robots but the efficiency of such facilities is hampered because the software for such robots does not usually integrate well with the systems that run the sequencing machines. Accordingly, there is a need for software systems capable of integrating different robotic systems and managing sample information for DNA sequencing services. In this paper, we describe an extension to the Protein Information Management System (PIMS) that is designed for DNA sequencing facilities. The new version of PIMS has a user-friendly web interface and integrates all aspects of the sequencing process, including sample submission, handling and tracking, together with capture and management of the data. The PIMS sequencing extension has been in production since July 2009 at the University of Leeds DNA Sequencing Facility. It has completely replaced manual data handling and simplified the tasks of data management and user communication. Samples from 45 groups have been processed with an average throughput of 10000 samples per month. The current version of the PIMS sequencing extension works with Applied Biosystems 3130XL 96-well plate sequencer and MWG 4204 or Aviso Theonyx liquid handling robots, but is readily adaptable for use with other combinations of robots. PIMS has been extended to provide a user-friendly and integrated data management solution for DNA sequencing facilities that is accessed through a normal web browser and allows simultaneous access by multiple users as well as facility managers. The system integrates sequencing and liquid handling robots, manages the data flow, and provides remote access to the sequencing results. The software is freely available, for academic users, from http://www.pims-lims.org/.

Neandertal and Denisovan DNA from Pleistocene sediments.

PubMed

Slon, Viviane; Hopfe, Charlotte; Weiß, Clemens L; Mafessoni, Fabrizio; de la Rasilla, Marco; Lalueza-Fox, Carles; Rosas, Antonio; Soressi, Marie; Knul, Monika V; Miller, Rebecca; Stewart, John R; Derevianko, Anatoly P; Jacobs, Zenobia; Li, Bo; Roberts, Richard G; Shunkov, Michael V; de Lumley, Henry; Perrenoud, Christian; Gušić, Ivan; Kućan, Željko; Rudan, Pavao; Aximu-Petri, Ayinuer; Essel, Elena; Nagel, Sarah; Nickel, Birgit; Schmidt, Anna; Prüfer, Kay; Kelso, Janet; Burbano, Hernán A; Pääbo, Svante; Meyer, Matthias

2017-05-12

Although a rich record of Pleistocene human-associated archaeological assemblages exists, the scarcity of hominin fossils often impedes the understanding of which hominins occupied a site. Using targeted enrichment of mitochondrial DNA, we show that cave sediments represent a rich source of ancient mammalian DNA that often includes traces of hominin DNA, even at sites and in layers where no hominin remains have been discovered. By automation-assisted screening of numerous sediment samples, we detected Neandertal DNA in eight archaeological layers from four caves in Eurasia. In Denisova Cave, we retrieved Denisovan DNA in a Middle Pleistocene layer near the bottom of the stratigraphy. Our work opens the possibility of detecting the presence of hominin groups at sites and in areas where no skeletal remains are found. Copyright © 2017, American Association for the Advancement of Science.

[Whole Genome Sequencing of Human mtDNA Based on Ion Torrent PGM™ Platform].

PubMed

Cao, Y; Zou, K N; Huang, J P; Ma, K; Ping, Y

2017-08-01

To analyze and detect the whole genome sequence of human mitochondrial DNA （mtDNA） by Ion Torrent PGM™ platform and to study the differences of mtDNA sequence in different tissues. Samples were collected from 6 unrelated individuals by forensic postmortem examination, including chest blood, hair, costicartilage, nail, skeletal muscle and oral epithelium. Amplification of whole genome sequence of mtDNA was performed by 4 pairs of primer. Libraries were constructed with Ion Shear™ Plus Reagents kit and Ion Plus Fragment Library kit. Whole genome sequencing of mtDNA was performed using Ion Torrent PGM™ platform. Sanger sequencing was used to determine the heteroplasmy positions and the mutation positions on HVⅠ region. The whole genome sequence of mtDNA from all samples were amplified successfully. Six unrelated individuals belonged to 6 different haplotypes. Different tissues in one individual had heteroplasmy difference. The heteroplasmy positions and the mutation positions on HVⅠ region were verified by Sanger sequencing. After a consistency check by the Kappa method, it was found that the results of mtDNA sequence had a high consistency in different tissues. The testing method used in present study for sequencing the whole genome sequence of human mtDNA can detect the heteroplasmy difference in different tissues, which have good consistency. The results provide guidance for the further applications of mtDNA in forensic science. Copyright© by the Editorial Department of Journal of Forensic Medicine

The common occurrence of epistasis in the determination of human pigmentation and its impact on DNA-based pigmentation phenotype prediction.

PubMed

Pośpiech, Ewelina; Wojas-Pelc, Anna; Walsh, Susan; Liu, Fan; Maeda, Hitoshi; Ishikawa, Takaki; Skowron, Małgorzata; Kayser, Manfred; Branicki, Wojciech

2014-07-01

The role of epistatic effects in the determination of complex traits is often underlined but its significance in the prediction of pigmentation phenotypes has not been evaluated so far. The prediction of pigmentation from genetic data can be useful in forensic science to describe the physical appearance of an unknown offender, victim, or missing person who cannot be identified via conventional DNA profiling. Available forensic DNA prediction systems enable the reliable prediction of several eye and hair colour categories. However, there is still space for improvement. Here we verified the association of 38 candidate DNA polymorphisms from 13 genes and explored the extent to which interactions between them may be involved in human pigmentation and their impact on forensic DNA prediction in particular. The model-building set included 718 Polish samples and the model-verification set included 307 independent Polish samples and additional 72 samples from Japan. In total, 29 significant SNP-SNP interactions were found with 5 of them showing an effect on phenotype prediction. For predicting green eye colour, interactions between HERC2 rs12913832 and OCA2 rs1800407 as well as TYRP1 rs1408799 raised the prediction accuracy expressed by AUC from 0.667 to 0.697 and increased the prediction sensitivity by >3%. Interaction between MC1R 'R' variants and VDR rs731236 increased the sensitivity for light skin by >1% and by almost 3% for dark skin colour prediction. Interactions between VDR rs1544410 and TYR rs1042602 as well as between MC1R 'R' variants and HERC2 rs12913832 provided an increase in red/non-red hair prediction accuracy from an AUC of 0.902-0.930. Our results thus underline epistasis as a common phenomenon in human pigmentation genetics and demonstrate that considering SNP-SNP interactions in forensic DNA phenotyping has little impact on eye, hair and skin colour prediction. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

An evaluation of long-term preservation methods for brown bear (Ursus arctos) faecal DNA samples

USGS Publications Warehouse

Murphy, M.A.; Waits, L.P.; Kendall, K.C.; Wasser, S.K.; Higbee, J.A.; Bogden, R.

2002-01-01

Relatively few large-scale faecal DNA studies have been initiated due to difficulties in amplifying low quality and quantity DNA template. To improve brown bear faecal DNA PCR amplification success rates and to determine post collection sample longevity, five preservation methods were evaluated: 90% ethanol, DETs buffer, silica-dried, oven-dried stored at room temperature, and oven-dried stored at -20??C. Preservation effectiveness was evaluated for 50 faecal samples by PCR amplification of a mitochondrial DNA (mtDNA) locus (???146 bp) and a nuclear DNA (nDNA) locus (???200 bp) at time points of one week, one month, three months and six months. Preservation method and storage time significantly impacted mtDNA and nDNA amplification success rates. For mtDNA, all preservation methods had ??? 75% success at one week, but storage time had a significant impact on the effectiveness of the silica preservation method. Ethanol preserved samples had the highest success rates for both mtDNA (86.5%) and nDNA (84%). Nuclear DNA amplification success rates ranged from 26-88%, and storage time had a significant impact on all methods but ethanol. Preservation method and storage time should be important considerations for researchers planning projects utilizing faecal DNA. We recommend preservation of faecal samples in 90% ethanol when feasible, although when collecting in remote field conditions or for both DNA and hormone assays a dry collection method may be advantageous.

[Immunofluorescence assay with Crithidia luciliae for the detection of anti-DNA antibodies. Atypical images and their relationship with Chagas' disease and leishmaniasis].

PubMed

Griemberg, Gloria; Ferrarotti, Nidia F; Svibel, Graciela; Ravelli, Maria R; Taranto, Nestor J; Malchiodi, Emilio L; Pizzimenti, Maria C

2006-01-01

Anti-native DNA antibodies can be detected by indirect immunofluorescence assay with Crithidia luciliae, displaying an annular image due to a kinetoplast containing double stranded DNA. Other structures such as membrane, flagellum and basal corpuscle can be stained as well, showing what is called atypical fluorescent images. As C. luciliae belongs to the Trypanosomatidae family, which include the human pathogens Trypanosoma cruzi and Leishmania spp., it was considered that these atypical images could be caused by cross-reactions. Serological studies for Chagas' disease were performed in 105 serum samples displaying atypical images. Sixty four percent of the samples from non endemic and 78.3% from endemic areas for Chagas' disease showed fluorescence in both, membrane and flagellum (joint image). Fifty samples from normal blood donors and 57 samples from patients with conective tissue diseases were tested with C. luciliae. None of them presented the joint image except for two patients with lupus who were also chagasic. In addition, 54 samples from chagasic patients were studied and all of them presented the joint image. We also studied 46 samples from patients with leishmaniasis from whom 28 were coinfected with T. cruzi. The joint image was observed in 88.0% of the samples with leishmaniasis and in 89.3% of the co-infected samples. The results suggest that C. luciliae could be used as an economical, and of low risk, alternative substrate for the serological diagnosis of Chagas' disease, even though it does not discriminate for Leishmania spp. infection. This study also suggests that whenever atypical images are observed in C. luciliae during the search for anti-DNA antibodies, it would be convenient to submit the patient to clinical and serological tests for the diagnosis of leishmaniosis and Chagas' disease.

Development and Validation of Environmental DNA (eDNA) Markers for Detection of Freshwater Turtles.

PubMed

Davy, Christina M; Kidd, Anne G; Wilson, Chris C

2015-01-01

Environmental DNA (eDNA) is a potentially powerful tool for detection and monitoring of rare species, including threatened native species and recently arrived invasive species. Here, we develop DNA primers for a suite of nine sympatric freshwater turtles, and use it to test whether turtle eDNA can be successfully detected in samples from aquaria and an outdoor pond. We also conduct a cost comparison between eDNA detection and detection through traditional survey methods, using data from field surveys at two sites in our target area. We find that eDNA from turtles can be detected using both conventional polymerase chain reaction (PCR) and quantitative PCR (qPCR), and that the cost of detection through traditional survey methods is 2-10X higher than eDNA detection for the species in our study range. We summarize necessary future steps for application of eDNA surveys to turtle monitoring and conservation and propose specific cases in which the application of eDNA could further the conservation of threatened turtle species.

Development and Validation of Environmental DNA (eDNA) Markers for Detection of Freshwater Turtles

PubMed Central

Davy, Christina M.; Kidd, Anne G.; Wilson, Chris C.

2015-01-01

Environmental DNA (eDNA) is a potentially powerful tool for detection and monitoring of rare species, including threatened native species and recently arrived invasive species. Here, we develop DNA primers for a suite of nine sympatric freshwater turtles, and use it to test whether turtle eDNA can be successfully detected in samples from aquaria and an outdoor pond. We also conduct a cost comparison between eDNA detection and detection through traditional survey methods, using data from field surveys at two sites in our target area. We find that eDNA from turtles can be detected using both conventional polymerase chain reaction (PCR) and quantitative PCR (qPCR), and that the cost of detection through traditional survey methods is 2–10X higher than eDNA detection for the species in our study range. We summarize necessary future steps for application of eDNA surveys to turtle monitoring and conservation and propose specific cases in which the application of eDNA could further the conservation of threatened turtle species. PMID:26200348

LAMPhimerus: A novel LAMP assay for detecting Amphimerus sp. DNA in human stool samples

PubMed Central

Calvopiña, Manuel; Fontecha-Cuenca, Cristina; Sugiyama, Hiromu; Sato, Megumi; López Abán, Julio; Vicente, Belén; Muro, Antonio

2017-01-01

Background Amphimeriasis is a fish-borne disease caused by the liver fluke Amphimerus spp. that has recently been reported as endemic in the tropical Pacific side of Ecuador with a high prevalence in humans and domestic animals. The diagnosis is based on the stool examination to identify parasite eggs, but it lacks sensitivity. Additionally, the morphology of the eggs may be confounded with other liver and intestinal flukes. No immunological or molecular methods have been developed to date. New diagnostic techniques for specific and sensitive detection of Amphimerus spp. DNA in clinical samples are needed. Methodology/Principal findings A LAMP targeting a sequence of the Amphimerus sp. internal transcribed spacer 2 region was designed. Amphimerus sp. DNA was obtained from adult worms recovered from animals and used to optimize the molecular assays. Conventional PCR was performed using outer primers F3-B3 to verify the proper amplification of the Amphimerus sp. DNA target sequence. LAMP was optimized using different reaction mixtures and temperatures, and it was finally set up as LAMPhimerus. The specificity and sensitivity of both PCR and LAMP were evaluated. The detection limit was 1 pg of genomic DNA. Field testing was done using 44 human stool samples collected from localities where fluke is endemic. Twenty-five samples were microscopy positive for Amphimerus sp. eggs detection. In molecular testing, PCR F3-B3 was ineffective when DNA from fecal samples was used. When testing all human stool samples included in our study, the diagnostic parameters for the sensitivity and specificity were calculated for our LAMPhimerus assay, which were 76.67% and 80.77%, respectively. Conclusions/Significance We have developed and evaluated, for the first time, a specific and sensitive LAMP assay for detecting Amphimerus sp. in human stool samples. The procedure has been named LAMPhimerus method and has the potential to be adapted for field diagnosis and disease surveillance in amphimeriasis-endemic areas. Future large-scale studies will assess the applicability of this novel LAMP assay. PMID:28628614

Evaluation of pre-analytical conditions and comparison of the performance of several digital PCR assays for the detection of major EGFR mutations in circulating DNA from non-small cell lung cancers: the CIRCAN_0 study

PubMed Central

Garcia, Jessica; Dusserre, Eric; Cheynet, Valérie; Bringuier, Pierre Paul; Brengle-Pesce, Karen; Wozny, Anne-Sophie; Rodriguez-Lafrasse, Claire; Freyer, Gilles; Brevet, Marie; Payen, Léa; Couraud, Sébastien

2017-01-01

Non invasive somatic detection assays are suitable for repetitive tumor characterization or for detecting the appearance of somatic resistance during lung cancer. Molecular diagnosis based on circulating free DNA (cfDNA) offers the opportunity to track the genomic evolution of the tumor, and was chosen to assess the molecular profile of several EGFR alterations, including deletions in exon 19 (delEX19), the L858R substitution on exon 21 and the EGFR resistance mutation T790M on exon 20. Our study aimed at determining optimal pre-analytical conditions and EGFR mutation detection assays for analyzing cfDNA using the picoliter-droplet digital polymerase chain reaction (ddPCR) assay. Within the framework of the CIRCAN project set-up at the Lyon University Hospital, plasma samples were collected to establish a pre-analytical and analytical workflow of cfDNA analysis. We evaluated all of the steps from blood sampling to mutation detection output, including shipping conditions (4H versus 24H in EDTA tubes), the reproducibility of cfDNA extraction, the specificity/sensitivity of ddPCR (using external controls), and the comparison of different PCR assays for the detection of the three most important EGFR hotspots, which highlighted the increased sensitivity of our in-house primers/probes. Hence, we have described a new protocol facilitating the molecular detection of somatic mutations in cancer patients from liquid biopsies, improving their diagnosis and introducing a less traumatic monitoring system during tumor progression. PMID:29152135

Whole blood and tissue fungal DNA quantification in the diagnosis of canine sino-nasal aspergillosis.

PubMed

Peeters, Dominique; Peters, Iain R; Helps, Chris R; Dehard, Sandrine; Day, Michael J; Clercx, Cécile

2008-04-01

Various combinations of tests are used to confirm the diagnosis of canine sino-nasal aspergillosis (SNA) because false-positive and false-negative results can occur with each test. Therefore, the aim of this study was to evaluate whether detection of fungal DNA in blood and nasal tissue samples was of value in the clinical diagnosis of this disease. Four groups were included in the study (dogs with SNA, lymphoplasmacytic rhinitis or nasal neoplasia, and control animals). Real-time PCR assays detecting DNA from all Penicillium and Aspergillus species (PenAsp assay) or species-specific DNA from A. fumigatus, A. terreus, A. flavus and A. niger were applied to whole blood and nasal tissue samples. Results obtained by PCR were compared between the groups. Sensitivity, specificity, positive and negative predictive values (PPV and NPV) for fungal DNA detection were compared with those for alternative diagnostic procedures including histopathology, serology and fungal culture. Significantly more fungal DNA was detected by the PenAsp assay in tissue biopsies from dogs with SNA than in the three other groups. Sensitivity, specificity, PPV and NPV for this method were 1.00, 0.06, 0.32 and 1.00. A. fumigatus DNA was detected in seven tissue biopsies from dogs with SNA and in one biopsy from a dog with a nasal tumour. Sensitivity, specificity, PPV and NPV for this diagnostic test were 0.50, 0.97, 0.87 and 0.82. No significant difference was found between the groups with respect to the amount of DNA detected in blood by the PenAsp assay. Sensitivity, specificity, PPV and NPV for this method were 0.71, 0.24, 0.31 and 0.64. A. fumigatus DNA was detected in the blood of three dogs with SNA and sixteen dogs without SNA. Sensitivity, specificity, PPV and NPV for this diagnostic tool were 0.21, 0.45, 0.15 and 0.54. Detection of A. fumigatus DNA in nasal tissue had the highest specificity, PPV and NPV but sensitivity of this method was low. Detection of fungal DNA in whole blood was of no value in the diagnosis of SNA.

Investigation of ancient DNA from Western Siberia and the Sargat culture.

PubMed

Bennett, Casey C; Kaestle, Frederika A

2010-04-01

Mitochondrial DNA from 14 archaeological samples at the Ural State University in Yekaterinburg, Russia, was extracted to test the feasibility of ancient DNA work on their collection. These samples come from a number of sites that fall into two groupings. Seven samples are from three sites, dating to the 8th-12th century AD, that belong to a northern group of what are thought to be Ugrians, who lived along the Ural Mountains in northwestern Siberia. The remaining seven samples are from two sites that belong to a southern group representing the Sargat culture, dating between roughly the 5th century BC and the 5th century AD, from southwestern Siberia near the Ural Mountains and the present-day Kazakhstan border. The samples are derived from several burial types, including kurgan burials. They also represent a number of different skeletal elements and a range of observed preservation. The northern sites repeatedly failed to amplify after multiple extraction and amplification attempts, but the samples from the southern sites were successfully extracted and amplified. The sequences obtained from the southern sites support the hypothesis that the Sargat culture was a potential zone of intermixture between native Ugrian and/or Siberian populations and steppe peoples from the south, possibly early Iranian or Indo-Iranian, which has been previously suggested by archaeological analysis.

A combined method for DNA analysis and radiocarbon dating from a single sample.

PubMed

Korlević, Petra; Talamo, Sahra; Meyer, Matthias

2018-03-07

Current protocols for ancient DNA and radiocarbon analysis of ancient bones and teeth call for multiple destructive samplings of a given specimen, thereby increasing the extent of undesirable damage to precious archaeological material. Here we present a method that makes it possible to obtain both ancient DNA sequences and radiocarbon dates from the same sample material. This is achieved by releasing DNA from the bone matrix through incubation with either EDTA or phosphate buffer prior to complete demineralization and collagen extraction utilizing the acid-base-acid-gelatinization and ultrafiltration procedure established in most radiocarbon dating laboratories. Using a set of 12 bones of different ages and preservation conditions we demonstrate that on average 89% of the DNA can be released from sample powder with minimal, or 38% without any, detectable collagen loss. We also detect no skews in radiocarbon dates compared to untreated samples. Given the different material demands for radiocarbon dating (500 mg of bone/dentine) and DNA analysis (10-100 mg), combined DNA and collagen extraction not only streamlines the sampling process but also drastically increases the amount of DNA that can be recovered from limited sample material.

A modular method for the extraction of DNA and RNA, and the separation of DNA pools from diverse environmental sample types

PubMed Central

Lever, Mark A.; Torti, Andrea; Eickenbusch, Philip; Michaud, Alexander B.; Šantl-Temkiv, Tina; Jørgensen, Bo Barker

2015-01-01

A method for the extraction of nucleic acids from a wide range of environmental samples was developed. This method consists of several modules, which can be individually modified to maximize yields in extractions of DNA and RNA or separations of DNA pools. Modules were designed based on elaborate tests, in which permutations of all nucleic acid extraction steps were compared. The final modular protocol is suitable for extractions from igneous rock, air, water, and sediments. Sediments range from high-biomass, organic rich coastal samples to samples from the most oligotrophic region of the world's oceans and the deepest borehole ever studied by scientific ocean drilling. Extraction yields of DNA and RNA are higher than with widely used commercial kits, indicating an advantage to optimizing extraction procedures to match specific sample characteristics. The ability to separate soluble extracellular DNA pools without cell lysis from intracellular and particle-complexed DNA pools may enable new insights into the cycling and preservation of DNA in environmental samples in the future. A general protocol is outlined, along with recommendations for optimizing this general protocol for specific sample types and research goals. PMID:26042110

Diagnosis of amphimeriasis by LAMPhimerus assay in human stool samples long-term storage onto filter paper

PubMed Central

Calvopiña, Manuel; Buendía-Sánchez, María; López-Abán, Julio; Vicente, Belén; Muro, Antonio

2018-01-01

Amphimeriasis, a fish-borne zoonotic disease caused by the liver fluke Amphimerus spp., has recently been reported as an emerging disease affecting an indigenous Ameridian group, the Chachi, living in Ecuador. The only method for diagnosing amphimeriasis was the microscopic detection of eggs from the parasite in patients' stool samples with very low sensitivity. Our group developed an ELISA technique for detection of anti-Amphimerus IgG in human sera and a molecular method based on LAMP technology (named LAMPhimerus) for specific and sensitive parasite DNA detection. The LAMPhimerus method showed to be much more sensitive than classical parasitological methods for amphimeriasis diagnosis using human stool samples for analysis. The objective of this work is to demonstrate the feasibility of using dried stool samples on filter paper as source of DNA in combination with the effectiveness of our previously designed LAMPhimerus assay for successfully Amphimerus sp. detection in clinical stool samples. A total of 102 untreated and undiluted stool samples collected from Chachi population were spread as thin layer onto common filter paper for easily transportation to our laboratory and stored at room temperature for one year until DNA extraction. When LAMPhimerus method was applied for Amphimerus sp. DNA detection, a higher number of positive results was detected (61/102; 59.80%) in comparison to parasitological methods (38/102; 37.25%), including 28/61 (45.90%) microscopy-confirmed Amphimerus sp. infections. The diagnostic parameters for the sensitivity and specificity werecalculated for our LAMPhimerus assay, which were 79.17% and 65.98%, respectively. We demonstrate, for the first time, that common filter paper is useful for easy collection and long-term storage of human stool samples for later DNA extraction and molecular analysis of human-parasitic trematode eggs. This simple, economic and easily handling method combined with the specific and sensible LAMPhimerus assay has the potential to beused as an effective molecular large-scale screening test for amphimeriasis-endemic areas. PMID:29444135

Rapid detection of Opisthorchis viverrini and Strongyloides stercoralis in human fecal samples using a duplex real-time PCR and melting curve analysis.

PubMed

Janwan, Penchom; Intapan, Pewpan M; Thanchomnang, Tongjit; Lulitanond, Viraphong; Anamnart, Witthaya; Maleewong, Wanchai

2011-12-01

Human opisthorchiasis caused by the liver fluke Opisthorchis viverrini is an endemic disease in Southeast Asian countries including the Lao People's Democratic Republic, Cambodia, Vietnam, and Thailand. Infection with the soil-transmitted roundworm Strongyloides stercoralis is an important problem worldwide. In some areas, both parasitic infections are reported as co-infections. A duplex real-time fluorescence resonance energy transfer (FRET) PCR merged with melting curve analysis was developed for the rapid detection of O. viverrini and S. stercoralis in human fecal samples. Duplex real-time FRET PCR is based on fluorescence melting curve analysis of a hybrid of amplicons generated from two genera of DNA elements: the 162 bp pOV-A6 DNA sequence specific to O. viverrini and the 244 bp 18S rRNA sequence specific to S. stercoralis, and two pairs of specific fluorophore-labeled probes. Both O. viverrini and S. stercoralis can be differentially detected in infected human fecal samples by this process through their different fluorescence channels and melting temperatures. Detection limit of the method was as little as two O. viverrini eggs and four S. stercoralis larvae in 100 mg of fecal sample. The assay could distinguish the DNA of both parasites from the DNA of negative fecal samples and fecal samples with other parasite materials, as well as from the DNA of human leukocytes and other control parasites. The technique showed 100% sensitivity and specificity. The introduced duplex real-time FRET PCR can reduce labor time and reagent costs and is not prone to carry over contamination. The method is important for simultaneous detection especially in areas where both parasites overlap incidence and is useful as the screening tool in the returning travelers and immigrants to industrialized countries where number of samples in the diagnostic units will become increasing.

The forensiX evidence collection tube and its impact on DNA preservation and recovery.

PubMed

Garvin, Alex M; Holzinger, Ralf; Berner, Florian; Krebs, Walter; Hostettler, Bernhard; Lardi, Elges; Hertli, Christian; Quartermaine, Roy; Stamm, Christoph

2013-01-01

Biological samples are vulnerable to degradation from the time they are collected until they are analysed at the laboratory. Biological contaminants, such as bacteria, fungi, and enzymes, as well as environmental factors, such as sunlight, heat, and humidity, can increase the rate of DNA degradation. Currently, DNA samples are normally dried or frozen to limit their degradation prior to their arrival at the laboratory. In this study, the effect of the sample drying rate on DNA preservation was investigated, as well as a comparison between drying and freezing methods. The drying performances of two commercially available DNA collection tools (swab and drying tube) with different drying rates were evaluated. The swabs were used to collect human saliva, placed into the drying tubes, and stored in a controlled environment at 25°C and 60% relative humidity, or frozen at -20°C, for 2 weeks. Swabs that were stored in fast sample drying tubes yielded 95% recoverable DNA, whereas swabs stored in tubes with slower sample drying rates yielded only 12% recoverable DNA; saliva stored in a microtube at -20°C was used as a control. Thus, DNA sampling tools that offer rapid drying can significantly improve the preservation of DNA collected on a swab, increasing the quantity of DNA available for subsequent analysis.

The DNA isolation method has effect on allele drop-out and on the results of fluorescent PCR and DNA fragment analysis.

PubMed

Nagy, Bálint; Bán, Zoltán; Papp, Zoltán

2005-10-01

The quality and the quantity of isolated DNA have an effect on PCR amplifications. The authors studied three DNA isolation protocols (resin binding method using fresh and frozen amniotic fluid samples, and silica adsorption method using fresh samples) on the quantity and on the quality of the isolated DNA. Amniotic fluid samples were obtained from 20 pregnant women. The isolated DNA concentrations were determined by real-time fluorimeter using SYBRGreen I method. Each sample was studied for the presence of 8 STR markers. The authors compared the number of the detected alleles, electrophoretograms and peak areas. There was a significant difference between the concentration of the obtained DNA and in the peak areas between the three isolation protocols. The numbers of detected alleles were different, we observed the most allele drop outs in the resin type DNA isolation protocol from the fresh sample (detected allele numbers 182), followed by resin binding protocol from the frozen samples (detected allele number 243) and by the silica adsorption method (detected allele number 264). The authors demonstrated that the DNA isolation method has an effect on the quantity and quality of the isolated DNA, and on further PCR amplifications.

Estimating occupancy and abundance of stream amphibians using environmental DNA from filtered water samples

USGS Publications Warehouse

Pilliod, David S.; Goldberg, Caren S.; Arkle, Robert S.; Waits, Lisette P.

2013-01-01

Environmental DNA (eDNA) methods for detecting aquatic species are advancing rapidly, but with little evaluation of field protocols or precision of resulting estimates. We compared sampling results from traditional field methods with eDNA methods for two amphibians in 13 streams in central Idaho, USA. We also evaluated three water collection protocols and the influence of sampling location, time of day, and distance from animals on eDNA concentration in the water. We found no difference in detection or amount of eDNA among water collection protocols. eDNA methods had slightly higher detection rates than traditional field methods, particularly when species occurred at low densities. eDNA concentration was positively related to field-measured density, biomass, and proportion of transects occupied. Precision of eDNA-based abundance estimates increased with the amount of eDNA in the water and the number of replicate subsamples collected. eDNA concentration did not vary significantly with sample location in the stream, time of day, or distance downstream from animals. Our results further advance the implementation of eDNA methods for monitoring aquatic vertebrates in stream habitats.

Viability and Burden of Leishmania in Extralesional Sites during Human Dermal Leishmaniasis

PubMed Central

Romero, Ibeth; Téllez, Jair; Suárez, Yazmín; Cardona, Maria; Figueroa, Roger; Zelazny, Adrian; Gore Saravia, Nancy

2010-01-01

Background The clinical and epidemiological significance of Leishmania DNA in extralesional sites is obscured by uncertainty of whether the DNA derives from viable parasites. To examine dissemination of Leishmania during active disease and the potential participation of human infection in transmission, Leishmania 7SLRNA was exploited to establish viability and estimate parasite burden in extralesional sites of dermal leishmaniasis patients. Methods The feasibility of discriminating parasite viability by PCR of Leishmania 7SLRNA was evaluated in relation with luciferase activity of luc transfected intracellular amastigotes in dose-response assays of Glucantime cytotoxicity. Monocytes, tonsil swabs, aspirates of normal skin and lesions of 28 cutaneous and 2 mucocutaneous leishmaniasis patients were screened by kDNA amplification/Southern blot. Positive samples were analyzed by quantitative PCR of Leishmania 7SLRNA genes and transcripts. Results 7SLRNA amplification coincided with luciferase activity, confirming discrimination of parasite viability. Of 22 patients presenting kDNA in extralesional samples, Leishmania 7SLRNA genes or transcripts were detected in one or more kDNA positive samples in 100% and 73% of patients, respectively. Gene and transcript copy number amplified from extralesional tissues were comparable to lesions. 7SLRNA transcripts were detected in 13/19 (68%) monocyte samples, 5/12 (42%) tonsil swabs, 4/11 (36%) normal skin aspirates, and 22/25 (88%) lesions; genes were quantifiable in 15/19 (79%) monocyte samples, 12/13 (92%) tonsil swabs, 8/11 (73%) normal skin aspirates. Conclusion Viable parasites are present in extralesional sites, including blood monocytes, tonsils and normal skin of dermal leishmaniasis patients. Leishmania 7SLRNA is an informative target for clinical and epidemiologic investigations of human leishmaniasis. PMID:20856851

Periodontal bacteria DNA findings in human cardiac tissue - Is there a link of periodontitis to heart valve disease?

PubMed

Ziebolz, D; Jahn, C; Pegel, J; Semper-Pinnecke, E; Mausberg, R F; Waldmann-Beushausen, R; Schöndube, F A; Danner, B C

2018-01-15

The aim of the study was to detect periodontal pathogens DNA in atrial and myocardial tissue, and to investigate periodontal status and their connection to cardiac tissue inflammation. In 30 patients, biopsy samples were taken from the atrium (A) and the ventricle myocardium (M) during aortic valve surgery. The dental examination included the dental and periodontal status (PS) and a collection of a microbiological sample. The detection of 11 periodontal pathogens DNA in oral and heart samples was carried out using PCR. The heart samples were prepared for detecting the LPS-binding protein (LBP), and for inflammation scoring on immunohistochemistry (IHC), comprising macrophages (CD68), LPS-binding protein receptor (CD14), and LBP (big42). 28 (93%) patients showed moderate to severe periodontitis. The periodontal pathogens in the oral samples of all patients revealed a similar distribution (3-93%). To a lesser extent and with a different distribution, these bacteria DNA were also detected in atrium and myocardium (3-27%). The LBP was detected in higher amount in atrium (0.22±0.16) versus myocardium (0.13±0.13, p=0.001). IHC showed a higher inflammation score in atrial than myocardial tissue as well as for CD14, CD68 and for LBP. Additional, periodontal findings showed a significant correlation to CD14 and CD68. The results provide evidence of the occurrence of oral bacteria DNA at the cardiac tissue, with a different impact on atrial and myocardial tissue inflammation. Influence of periodontal findings was identified, but their relevance is not yet distinct. Therefore further clinical investigations with long term implication are warranted. Copyright © 2017 Elsevier B.V. All rights reserved.

Individualized Mutation Detection in Circulating Tumor DNA for Monitoring Colorectal Tumor Burden Using a Cancer-Associated Gene Sequencing Panel.

PubMed

Sato, Kei A; Hachiya, Tsuyoshi; Iwaya, Takeshi; Kume, Kohei; Matsuo, Teppei; Kawasaki, Keisuke; Abiko, Yukito; Akasaka, Risaburo; Matsumoto, Takayuki; Otsuka, Koki; Nishizuka, Satoshi S

2016-01-01

Circulating tumor DNA (ctDNA) carries information on tumor burden. However, the mutation spectrum is different among tumors. This study was designed to examine the utility of ctDNA for monitoring tumor burden based on an individual mutation profile. DNA was extracted from a total of 176 samples, including pre- and post-operational plasma, primary tumors, and peripheral blood mononuclear cells (PBMC), from 44 individuals with colorectal tumor who underwent curative resection of colorectal tumors, as well as nine healthy individuals. Using a panel of 50 cancer-associated genes, tumor-unique mutations were identified by comparing the single nucleotide variants (SNVs) from tumors and PBMCs with an Ion PGM sequencer. A group of the tumor-unique mutations from individual tumors were designated as individual marker mutations (MMs) to trace tumor burden by ctDNA using droplet digital PCR (ddPCR). From these experiments, three major objectives were assessed: (a) Tumor-unique mutations; (b) mutation spectrum of a tumor; and (c) changes in allele frequency of the MMs in ctDNA after curative resection of the tumor. A total of 128 gene point mutations were identified in 27 colorectal tumors. Twenty-six genes were mutated in at least 1 sample, while 14 genes were found to be mutated in only 1 sample, respectively. An average of 2.7 genes were mutated per tumor. Subsequently, 24 MMs were selected from SNVs for tumor burden monitoring. Among the MMs found by ddPCR with > 0.1% variant allele frequency in plasma DNA, 100% (8 out of 8) exhibited a decrease in post-operation ctDNA, whereas none of the 16 MMs found by ddPCR with < 0.1% variant allele frequency in plasma DNA showed a decrease. This panel of 50 cancer-associated genes appeared to be sufficient to identify individual, tumor-unique, mutated ctDNA markers in cancer patients. The MMs showed the clinical utility in monitoring curatively-treated colorectal tumor burden if the allele frequency of MMs in plasma DNA is above 0.1%.

Highly Sensitive GMO Detection Using Real-Time PCR with a Large Amount of DNA Template: Single-Laboratory Validation.

PubMed

Mano, Junichi; Hatano, Shuko; Nagatomi, Yasuaki; Futo, Satoshi; Takabatake, Reona; Kitta, Kazumi

2018-03-01

Current genetically modified organism (GMO) detection methods allow for sensitive detection. However, a further increase in sensitivity will enable more efficient testing for large grain samples and reliable testing for processed foods. In this study, we investigated real-time PCR-based GMO detection methods using a large amount of DNA template. We selected target sequences that are commonly introduced into many kinds of GM crops, i.e., 35S promoter and nopaline synthase (NOS) terminator. This makes the newly developed method applicable to a wide range of GMOs, including some unauthorized ones. The estimated LOD of the new method was 0.005% of GM maize events; to the best of our knowledge, this method is the most sensitive among the GM maize detection methods for which the LOD was evaluated in terms of GMO content. A 10-fold increase in the DNA amount as compared with the amount used under common testing conditions gave an approximately 10-fold reduction in the LOD without PCR inhibition. Our method is applicable to various analytical samples, including processed foods. The use of other primers and fluorescence probes would permit highly sensitive detection of various recombinant DNA sequences besides the 35S promoter and NOS terminator.

Usage of DNA Fingerprinting Technology for Quality Control in Molecular Lab Bench Work.

PubMed

McIntosh, Linda Y; Lal, Janella E; Qin, Dahui

2018-01-01

One of the major quality assurance (QA) goals in many molecular laboratories is to avoid sample pipetting errors on the lab bench; especially when pipetting into multiwell plates. A pipetting error can cause a switch in patient samples, which can lead to recording the wrong results for the patient samples involved. Such pipetting errors are difficult to identify when it happens in lab bench work. DNA fingerprinting is a powerful tool in determining sample identities. Our laboratory has explored the usage of this technology in our QA process and successfully established that DNA fingerprinting can be used to monitor possible sample switch in gene rearrangement lab bench work. We use florescent light to quench the florescence in the gene rearrangement polymerase chain reaction products. After that, DNA fingerprinting technology is used to identify the sample DNA in the gene rearrangement polymerase chain reaction plate. The result is compared with the corresponding patient's blood sample DNA to determine whether there is a sample switch during the lab bench work.

Screening Test for Shed Skin Cells by Measuring the Ratio of Human DNA to Staphylococcus epidermidis DNA.

PubMed

Nakanishi, Hiroaki; Ohmori, Takeshi; Hara, Masaaki; Takahashi, Shirushi; Kurosu, Akira; Takada, Aya; Saito, Kazuyuki

2016-05-01

A novel screening method for shed skin cells by detecting Staphylococcus epidermidis (S. epidermidis), which is a resident bacterium on skin, was developed. Staphylococcus epidermidis was detected using real-time PCR. Staphylococcus epidermidis was detected in all 20 human skin surface samples. Although not present in blood and urine samples, S. epidermidis was detected in 6 of 20 saliva samples, and 5 of 18 semen samples. The ratio of human DNA to S. epidermidisDNA was significantly smaller in human skin surface samples than in saliva and semen samples in which S. epidermidis was detected. Therefore, although skin cells could not be identified by detecting only S. epidermidis, they could be distinguished by measuring the S. epidermidis to human DNA ratio. This method could be applied to casework touch samples, which suggests that it is useful for screening whether skin cells and human DNA are present on potential evidentiary touch samples. © 2016 American Academy of Forensic Sciences.

Phylogenetic analysis of bacterial isolates from man-made high-pH, high-salt environments and identification of gene-cassette-associated open reading frames.

PubMed

Ghauri, Muhammad A; Khalid, Ahmad M; Grant, Susan; Grant, William D; Heaphy, Shaun

2006-06-01

Environmental samples were collected from high-pH sites in Pakistan, including a uranium heap set up for carbonate leaching, the lime unit of a tannery, and the Khewra salt mine. Another sample was collected from a hot spring on the shore of the soda lake, Magadi, in Kenya. Microbial cultures were enriched from Pakistani samples. Phylogenetic analysis of isolates was carried out by sequencing 16S rRNA genes. Genomic DNA was amplified by polymerase chain reaction using integron gene-cassette-specific primers. Different gene-cassette-linked genes were recovered from the cultured strains related to Halomonas magadiensis, Virgibacillus halodenitrificans, and Yania flava and from the uncultured environmental DNA sample. The usefulness of this technique as a tool for gene mining is indicated.

Functional DNA quantification guides accurate next-generation sequencing mutation detection in formalin-fixed, paraffin-embedded tumor biopsies

PubMed Central

2013-01-01

The formalin-fixed, paraffin-embedded (FFPE) biopsy is a challenging sample for molecular assays such as targeted next-generation sequencing (NGS). We compared three methods for FFPE DNA quantification, including a novel PCR assay (‘QFI-PCR’) that measures the absolute copy number of amplifiable DNA, across 165 residual clinical specimens. The results reveal the limitations of commonly used approaches, and demonstrate the value of an integrated workflow using QFI-PCR to improve the accuracy of NGS mutation detection and guide changes in input that can rescue low quality FFPE DNA. These findings address a growing need for improved quality measures in NGS-based patient testing. PMID:24001039

Isolation of DNA from small amounts of elephant ivory: Sampling the cementum with total demineralization extraction.

PubMed

Winters, M; Torkelson, A; Booth, R; Mailand, C; Hoareau, Y; Tucker, S; Wasser, S K

2018-07-01

Genotyping ivory samples can determine the geographic origin of poached ivory as well as the legality of ivory being sold in ivory markets. We conducted a series of experiments to determine where the DNA is most concentrated in ivory samples and how best to increase DNA yield from groups of samples likely to vary in DNA concentration. We examined variation in DNA amplification success from: the layer(s) of the tusk (cementum and/or dentine) being extracted, demineralization temperature and time, and the concentration of eluates. Since demineralization of the pulverized sample produces a pellet and supernatant, we also assessed DNA amplification success from the pellet, the supernatant, their combination, as well as variation in the respective amounts used for extraction. Our results show that the outer cementum layer of the tusk contains the highest concentration of DNA and should be separated and used exclusively as the source material of ivory processed for extraction, when available. Utilizing the combined demineralized lysate improves extraction efficiency, as does increasing demineralization time to 3 or more days, conducted at 4°C. The most significant improvements occurred for low template DNA ivory samples followed by medium quality samples. Amplification success of high quality samples was not affected by these changes. Application of this optimized method to 3068 ivory samples resulted in 81.2% of samples being confirmed for both alleles at a minimum of 10 out of 16 microsatellite loci, which is our threshold for inclusion in DNA assignment analyses. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

UGT2B17 and SULT1A1 gene copy number variation (CNV) detection by LabChip microfluidic technology.

PubMed

Gaedigk, Andrea; Gaedigk, Roger; Leeder, J Steven

2010-05-01

Gene copy number variations (CNVs) are increasingly recognized to play important roles in the expression of genes and hence on their respective enzymatic activities. This has been demonstrated for a number of drug metabolizing genes, such as UDP-glucuronosyltransferases 2B17 (UGT2B17) and sulfotransferase 1A1 (SULT1A1), which are subject to genetic heterogeneity, including CNV. Quantitative assays to assess gene copy number are therefore becoming an integral part of accurate genotype assessment and phenotype prediction. In this study, we evaluated a microfluidics-based system, the Bio-Rad Experion system, to determine the power and utility of this platform to detect UGT2B17 and SULT1A1 CNV in DNA samples derived from blood and tissue. UGT2B17 is known to present with 0, 1 or 2 and SULT1A1 with up to 5 gene copies. Distinct clustering (p<0.001) into copy number groups was achieved for both genes. DNA samples derived from blood exhibited less inter-run variability compared to DNA samples obtained from liver tissue. This variability may be caused by tissue-specific PCR inhibitors as it could be overcome by using DNA from another tissue, or after the DNA had undergone whole genome amplification. This method produced results comparable to those reported for other quantitative test platforms.

Automated PCR setup for forensic casework samples using the Normalization Wizard and PCR Setup robotic methods.

PubMed

Greenspoon, S A; Sykes, K L V; Ban, J D; Pollard, A; Baisden, M; Farr, M; Graham, N; Collins, B L; Green, M M; Christenson, C C

2006-12-20

Human genome, pharmaceutical and research laboratories have long enjoyed the application of robotics to performing repetitive laboratory tasks. However, the utilization of robotics in forensic laboratories for processing casework samples is relatively new and poses particular challenges. Since the quantity and quality (a mixture versus a single source sample, the level of degradation, the presence of PCR inhibitors) of the DNA contained within a casework sample is unknown, particular attention must be paid to procedural susceptibility to contamination, as well as DNA yield, especially as it pertains to samples with little biological material. The Virginia Department of Forensic Science (VDFS) has successfully automated forensic casework DNA extraction utilizing the DNA IQ(trade mark) System in conjunction with the Biomek 2000 Automation Workstation. Human DNA quantitation is also performed in a near complete automated fashion utilizing the AluQuant Human DNA Quantitation System and the Biomek 2000 Automation Workstation. Recently, the PCR setup for casework samples has been automated, employing the Biomek 2000 Automation Workstation and Normalization Wizard, Genetic Identity version, which utilizes the quantitation data, imported into the software, to create a customized automated method for DNA dilution, unique to that plate of DNA samples. The PCR Setup software method, used in conjunction with the Normalization Wizard method and written for the Biomek 2000, functions to mix the diluted DNA samples, transfer the PCR master mix, and transfer the diluted DNA samples to PCR amplification tubes. Once the process is complete, the DNA extracts, still on the deck of the robot in PCR amplification strip tubes, are transferred to pre-labeled 1.5 mL tubes for long-term storage using an automated method. The automation of these steps in the process of forensic DNA casework analysis has been accomplished by performing extensive optimization, validation and testing of the software methods.

Privacy rules for DNA databanks. Protecting coded 'future diaries'.

PubMed

Annas, G J

1993-11-17

In privacy terms, genetic information is like medical information. But the information contained in the DNA molecule itself is more sensitive because it contains an individual's probabilistic "future diary," is written in a code that has only partially been broken, and contains information about an individual's parents, siblings, and children. Current rules for protecting the privacy of medical information cannot protect either genetic information or identifiable DNA samples stored in DNA databanks. A review of the legal and public policy rationales for protecting genetic privacy suggests that specific enforceable privacy rules for DNA databanks are needed. Four preliminary rules are proposed to govern the creation of DNA databanks, the collection of DNA samples for storage, limits on the use of information derived from the samples, and continuing obligations to those whose DNA samples are in the databanks.

Analysis of 4-hydroxy-1-(-3-pyridyl)-1-butanone (HPB)-releasing DNA adducts in human exfoliated oral mucosa cells by liquid chromatography-electrospray ionization-tandem mass spectrometry

PubMed Central

Stepanov, Irina; Muzic, John; Le, Chap T.; Sebero, Erin; Villalta, Peter; Ma, Bin; Jensen, Joni; Hatsukami, Dorothy; Hecht, Stephen S.

2013-01-01

Quantitation of DNA adducts could provide critical information on the relationship between exposure to tobacco smoke and cancer risk in smokers. In this study, we developed a robust and sensitive liquid chromatography-tandem mass spectrometry method for the analysis of 4-hydroxy-1-(3-pyridyl)-1-butanone (HPB1)-releasing DNA adducts in human oral cells, a non-invasive source of DNA for biomarker studies. Isolated DNA undergoes acid hydrolysis, after which samples are purified by solid-phase extraction and analyzed by LC-ESI-MS/MS. The developed method was applied for analysis of samples obtained via collection with a commercial mouthwash from 30 smokers and 15 nonsmokers. In smokers, the levels of HPB-releasing DNA adducts averaged 12.0 pmol HPB/mg DNA (detected in 20 out of 28 samples with quantifiable DNA yield) and in nonsmokers, the levels of adducts averaged 0.23 pmol/mg DNA (detected in 3 out of 15 samples). For the 30 smoking subjects, matching buccal brushings were also analyzed and HPB-releasing DNA adducts were detected in 24 out of 27 samples with quantifiable DNA yield, averaging 44.7 pmol HPB/mg DNA. The levels of adducts in buccal brushings correlated with those in mouthwash samples of smokers (R = 0.73, p < 0.0001). Potentially the method can be applied in studies of individual susceptibility to tobacco-induced cancers in humans. PMID:23252610

Using environmental DNA (eDNA) to determine Hellbender distribution : interim report.

DOT National Transportation Integrated Search

2017-03-10

Environmental DNA (eDNA) methods are non-invasive genetic sampling in which DNA from organisms is detected via sampling of water or soil, typically for the purposes of determining the presence or absence of an organism. In this project, we have evalu...

Fluorometric determination of the DNA concentration in municipal drinking water.

PubMed Central

McCoy, W F; Olson, B H

1985-01-01

DNA concentrations in municipal drinking water samples were measured by fluorometry, using Hoechst 33258 fluorochrome. The concentration, extraction, and detection methods used were adapted from existing techniques. The method is reproducible, fast, accurate, and simple. The amounts of DNA per cell for five different bacterial isolates obtained from drinking water samples were determined by measuring DNA concentration and total cell concentration (acridine orange epifluorescence direct cell counting) in stationary pure cultures. The relationship between DNA concentration and epifluorescence total direct cell concentration in 11 different drinking water samples was linear and positive; the amounts of DNA per cell in these samples did not differ significantly from the amounts in pure culture isolates. We found significant linear correlations between DNA concentration and colony-forming unit concentration, as well as between epifluorescence direct cell counts and colony-forming unit concentration. DNA concentration measurements of municipal drinking water samples appear to monitor changes in bacteriological quality at least as well as total heterotrophic plate counting and epifluorescence direct cell counting. PMID:3890737

DNA Profiling Success Rates from Degraded Skeletal Remains in Guatemala.

PubMed

Johnston, Emma; Stephenson, Mishel

2016-07-01

No data are available regarding the success of DNA Short Tandem Repeat (STR) profiling from degraded skeletal remains in Guatemala. Therefore, DNA profiling success rates relating to 2595 skeletons from eleven cases at the Forensic Anthropology Foundation of Guatemala (FAFG) are presented. The typical postmortem interval was 30 years. DNA was extracted from bone powder and amplified using Identifiler and Minifler. DNA profiling success rates differed between cases, ranging from 50.8% to 7.0%, the overall success rate for samples was 36.3%. The best DNA profiling success rates were obtained from femur (36.2%) and tooth (33.7%) samples. DNA profiles were significantly better from lower body bones than upper body bones (p = <0.0001). Bone samples from males gave significantly better profiles than samples from females (p = <0.0001). These results are believed to be related to bone density. The findings are important for designing forensic DNA sampling strategies in future victim recovery investigations. © 2016 American Academy of Forensic Sciences.

A collaborative exercise on DNA methylation based body fluid typing.

PubMed

Jung, Sang-Eun; Cho, Sohee; Antunes, Joana; Gomes, Iva; Uchimoto, Mari L; Oh, Yu Na; Di Giacomo, Lisa; Schneider, Peter M; Park, Min Sun; van der Meer, Dieudonne; Williams, Graham; McCord, Bruce; Ahn, Hee-Jung; Choi, Dong Ho; Lee, Yang Han; Lee, Soong Deok; Lee, Hwan Young

2016-10-01

A collaborative exercise on DNA methylation based body fluid identification was conducted by seven laboratories. For this project, a multiplex methylation SNaPshot reaction composed of seven CpG markers was used for the identification of four body fluids, including blood, saliva, semen, and vaginal fluid. A total of 30 specimens were prepared and distributed to participating laboratories after thorough testing. The required experiments included four increasingly complex tasks: (1) CE of a purified single-base extension reaction product, (2) multiplex PCR and multiplex single-base extension reaction of bisulfite-modified DNA, (3) bisulfite conversion of genomic DNA, and (4) extraction of genomic DNA from body fluid samples. In tasks 2, 3 and 4, one or more mixtures were analyzed, and specimens containing both known and unknown body fluid sources were used. Six of the laboratories generated consistent body fluid typing results for specimens of bisulfite-converted DNA and genomic DNA. One laboratory failed to set up appropriate conditions for capillary analysis of reference single-base extension products. In general, variation in the values obtained for DNA methylation analysis between laboratories increased with the complexity of the required experiments. However, all laboratories concurred on the interpretation of the DNA methylation profiles produced. Although the establishment of interpretational guidelines on DNA methylation based body fluid identification has yet to be performed, this study supports the addition of DNA methylation profiling to forensic body fluid typing. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Comparison of Versant HBV DNA 3.0 and COBAS AmpliPrep-COBAS TaqMan assays for hepatitis B DNA quantitation: Possible clinical implications.

PubMed

Garbuglia, A R; Angeletti, C; Lauria, F N; Zaccaro, P; Cocca, A M; Pisciotta, M; Solmone, M; Capobianchi, M R

2007-12-01

We compared two commercial assays for HBV DNA quantitation, Versant HBV 3.0, System 340 (bDNA; Bayer Diagnostics) and COBAS AmpliPrep-COBAS TaqMan HBV Test (TaqMan; Roche Diagnostics). Analytical sensitivity, calculated on WHO International Standard, predicted 95% detection rate at 11.4 and 520.2IU/ml for TaqMan and bDNA, respectively. Specificity, established on 50 blood donor samples, was 100% and 84% for TaqMan and bDNA, respectively. When using clinical samples, HBV DNA was detected by TaqMan in 21/55 samples negative to bDNA. Mean values of HBV DNA obtained with bDNA were higher than those obtained with TaqMan (4.09log(10)+/-1.90 versus 3.39log(10)+/-2.41, p<0.001), and 24.4% of samples showed differences in viral load values >0.5log(10), without association with HBV genotype. There was a good correlation for HBV DNA concentrations measured by the two assays (r=0.94; p<0.001) within the overlapping range, and the distribution of results with respect to relevant clinical threshold recently confirmed (20,000 and 2000IU/ml) was similar. Approximately 50% of samples with low HBV DNA, appreciated by TaqMan but not by bDNA, were successfully sequenced in pol region, where drug resistance mutations are located.

Using long ssDNA polynucleotides to amplify STRs loci in degraded DNA samples

PubMed Central

Pérez Santángelo, Agustín; Corti Bielsa, Rodrigo M.; Sala, Andrea; Ginart, Santiago; Corach, Daniel

2017-01-01

Obtaining informative short tandem repeat (STR) profiles from degraded DNA samples is a challenging task usually undermined by locus or allele dropouts and peak-high imbalances observed in capillary electrophoresis (CE) electropherograms, especially for those markers with large amplicon sizes. We hereby show that the current STR assays may be greatly improved for the detection of genetic markers in degraded DNA samples by using long single stranded DNA polynucleotides (ssDNA polynucleotides) as surrogates for PCR primers. These long primers allow a closer annealing to the repeat sequences, thereby reducing the length of the template required for the amplification in fragmented DNA samples, while at the same time rendering amplicons of larger sizes suitable for multiplex assays. We also demonstrate that the annealing of long ssDNA polynucleotides does not need to be fully complementary in the 5’ region of the primers, thus allowing for the design of practically any long primer sequence for developing new multiplex assays. Furthermore, genotyping of intact DNA samples could also benefit from utilizing long primers since their close annealing to the target STR sequences may overcome wrong profiling generated by insertions/deletions present between the STR region and the annealing site of the primers. Additionally, long ssDNA polynucleotides might be utilized in multiplex PCR assays for other types of degraded or fragmented DNA, e.g. circulating, cell-free DNA (ccfDNA). PMID:29099837

Effect of DNA Extraction Methods and Sampling Techniques on the Apparent Structure of Cow and Sheep Rumen Microbial Communities

PubMed Central

Henderson, Gemma; Cox, Faith; Kittelmann, Sandra; Miri, Vahideh Heidarian; Zethof, Michael; Noel, Samantha J.; Waghorn, Garry C.; Janssen, Peter H.

2013-01-01

Molecular microbial ecology techniques are widely used to study the composition of the rumen microbiota and to increase understanding of the roles they play. Therefore, sampling and DNA extraction methods that result in adequate yields of microbial DNA that also accurately represents the microbial community are crucial. Fifteen different methods were used to extract DNA from cow and sheep rumen samples. The DNA yield and quality, and its suitability for downstream PCR amplifications varied considerably, depending on the DNA extraction method used. DNA extracts from nine extraction methods that passed these first quality criteria were evaluated further by quantitative PCR enumeration of microbial marker loci. Absolute microbial numbers, determined on the same rumen samples, differed by more than 100-fold, depending on the DNA extraction method used. The apparent compositions of the archaeal, bacterial, ciliate protozoal, and fungal communities in identical rumen samples were assessed using 454 Titanium pyrosequencing. Significant differences in microbial community composition were observed between extraction methods, for example in the relative abundances of members of the phyla Bacteroidetes and Firmicutes. Microbial communities in parallel samples collected from cows by oral stomach-tubing or through a rumen fistula, and in liquid and solid rumen digesta fractions, were compared using one of the DNA extraction methods. Community representations were generally similar, regardless of the rumen sampling technique used, but significant differences in the abundances of some microbial taxa such as the Clostridiales and the Methanobrevibacter ruminantium clade were observed. The apparent microbial community composition differed between rumen sample fractions, and Prevotellaceae were most abundant in the liquid fraction. DNA extraction methods that involved phenol-chloroform extraction and mechanical lysis steps tended to be more comparable. However, comparison of data from studies in which different sampling techniques, different rumen sample fractions or different DNA extraction methods were used should be avoided. PMID:24040342

Effect of DNA extraction methods and sampling techniques on the apparent structure of cow and sheep rumen microbial communities.

PubMed

Henderson, Gemma; Cox, Faith; Kittelmann, Sandra; Miri, Vahideh Heidarian; Zethof, Michael; Noel, Samantha J; Waghorn, Garry C; Janssen, Peter H

2013-01-01

Molecular microbial ecology techniques are widely used to study the composition of the rumen microbiota and to increase understanding of the roles they play. Therefore, sampling and DNA extraction methods that result in adequate yields of microbial DNA that also accurately represents the microbial community are crucial. Fifteen different methods were used to extract DNA from cow and sheep rumen samples. The DNA yield and quality, and its suitability for downstream PCR amplifications varied considerably, depending on the DNA extraction method used. DNA extracts from nine extraction methods that passed these first quality criteria were evaluated further by quantitative PCR enumeration of microbial marker loci. Absolute microbial numbers, determined on the same rumen samples, differed by more than 100-fold, depending on the DNA extraction method used. The apparent compositions of the archaeal, bacterial, ciliate protozoal, and fungal communities in identical rumen samples were assessed using 454 Titanium pyrosequencing. Significant differences in microbial community composition were observed between extraction methods, for example in the relative abundances of members of the phyla Bacteroidetes and Firmicutes. Microbial communities in parallel samples collected from cows by oral stomach-tubing or through a rumen fistula, and in liquid and solid rumen digesta fractions, were compared using one of the DNA extraction methods. Community representations were generally similar, regardless of the rumen sampling technique used, but significant differences in the abundances of some microbial taxa such as the Clostridiales and the Methanobrevibacter ruminantium clade were observed. The apparent microbial community composition differed between rumen sample fractions, and Prevotellaceae were most abundant in the liquid fraction. DNA extraction methods that involved phenol-chloroform extraction and mechanical lysis steps tended to be more comparable. However, comparison of data from studies in which different sampling techniques, different rumen sample fractions or different DNA extraction methods were used should be avoided.

MethHC: a database of DNA methylation and gene expression in human cancer.

PubMed

Huang, Wei-Yun; Hsu, Sheng-Da; Huang, Hsi-Yuan; Sun, Yi-Ming; Chou, Chih-Hung; Weng, Shun-Long; Huang, Hsien-Da

2015-01-01

We present MethHC (http://MethHC.mbc.nctu.edu.tw), a database comprising a systematic integration of a large collection of DNA methylation data and mRNA/microRNA expression profiles in human cancer. DNA methylation is an important epigenetic regulator of gene transcription, and genes with high levels of DNA methylation in their promoter regions are transcriptionally silent. Increasing numbers of DNA methylation and mRNA/microRNA expression profiles are being published in different public repositories. These data can help researchers to identify epigenetic patterns that are important for carcinogenesis. MethHC integrates data such as DNA methylation, mRNA expression, DNA methylation of microRNA gene and microRNA expression to identify correlations between DNA methylation and mRNA/microRNA expression from TCGA (The Cancer Genome Atlas), which includes 18 human cancers in more than 6000 samples, 6548 microarrays and 12 567 RNA sequencing data. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Detection of Streptococcus mutans Genomic DNA in Human DNA Samples Extracted from Saliva and Blood

PubMed Central

Vieira, Alexandre R.; Deeley, Kathleen B.; Callahan, Nicholas F.; Noel, Jacqueline B.; Anjomshoaa, Ida; Carricato, Wendy M.; Schulhof, Louise P.; DeSensi, Rebecca S.; Gandhi, Pooja; Resick, Judith M.; Brandon, Carla A.; Rozhon, Christopher; Patir, Asli; Yildirim, Mine; Poletta, Fernando A.; Mereb, Juan C.; Letra, Ariadne; Menezes, Renato; Wendell, Steven; Lopez-Camelo, Jorge S.; Castilla, Eduardo E.; Orioli, Iêda M.; Seymen, Figen; Weyant, Robert J.; Crout, Richard; McNeil, Daniel W.; Modesto, Adriana; Marazita, Mary L.

2011-01-01

Caries is a multifactorial disease, and studies aiming to unravel the factors modulating its etiology must consider all known predisposing factors. One major factor is bacterial colonization, and Streptococcus mutans is the main microorganism associated with the initiation of the disease. In our studies, we have access to DNA samples extracted from human saliva and blood. In this report, we tested a real-time PCR assay developed to detect copies of genomic DNA from Streptococcus mutans in 1,424 DNA samples from humans. Our results suggest that we can determine the presence of genomic DNA copies of Streptococcus mutans in both DNA samples from caries-free and caries-affected individuals. However, we were not able to detect the presence of genomic DNA copies of Streptococcus mutans in any DNA samples extracted from peripheral blood, which suggests the assay may not be sensitive enough for this goal. Values of the threshold cycle of the real-time PCR reaction correlate with higher levels of caries experience in children, but this correlation could not be detected for adults. PMID:21731912

Detection of equine herpesvirus in horses with idiopathic keratoconjunctivitis and comparison of three sampling techniques.

PubMed

Hollingsworth, Steven R; Pusterla, Nicola; Kass, Philip H; Good, Kathryn L; Brault, Stephanie A; Maggs, David J

2015-09-01

To determine the role of equine herpesvirus (EHV) in idiopathic keratoconjunctivitis in horses and to determine whether sample collection method affects detection of EHV DNA by quantitative polymerase chain reaction (qPCR). Twelve horses with idiopathic keratoconjunctivitis and six horses without signs of ophthalmic disease. Conjunctival swabs, corneal scrapings, and conjunctival biopsies were collected from 18 horses: 12 clinical cases with idiopathic keratoconjunctivitis and six euthanized controls. In horses with both eyes involved, the samples were taken from the eye judged to be more severely affected. Samples were tested with qPCR for EHV-1, EHV-2, EHV-4, and EHV-5 DNA. Quantity of EHV DNA and viral replicative activity were compared between the two populations and among the different sampling techniques; relative sensitivities of the sampling techniques were determined. Prevalence of EHV DNA as assessed by qPCR did not differ significantly between control horses and those with idiopathic keratoconjunctivitis. Sampling by conjunctival swab was more likely to yield viral DNA as assessed by qPCR than was conjunctival biopsy. EHV-1 and EHV-4 DNA were not detected in either normal or IKC-affected horses; EHV-2 DNA was detected in two of 12 affected horses but not in normal horses. EHV-5 DNA was commonly found in ophthalmically normal horses and horses with idiopathic keratoconjunctivitis. Because EHV-5 DNA was commonly found in control horses and in horses with idiopathic keratoconjunctivitis, qPCR was not useful for the etiological diagnosis of equine keratoconjunctivitis. Conjunctival swabs were significantly better at obtaining viral DNA samples than conjunctival biopsy in horses in which EHV-5 DNA was found. © 2015 American College of Veterinary Ophthalmologists.

Nuclear and Mitochondrial DNA Analyses of Golden Eagles (Aquila chrysaetos canadensis) from Three Areas in Western North America; Initial Results and Conservation Implications

PubMed Central

Craig, Erica H.; Adams, Jennifer R.; Waits, Lisette P.; Fuller, Mark R.; Whittington, Diana M.

2016-01-01

Understanding the genetics of a population is a critical component of developing conservation strategies. We used archived tissue samples from golden eagles (Aquila chrysaetos canadensis) in three geographic regions of western North America to conduct a preliminary study of the genetics of the North American subspecies, and to provide data for United States Fish and Wildlife Service (USFWS) decision-making for golden eagle management. We used a combination of mitochondrial DNA (mtDNA) D-loop sequences and 16 nuclear DNA (nDNA) microsatellite loci to investigate the extent of gene flow among our sampling areas in Idaho, California and Alaska and to determine if we could distinguish birds from the different geographic regions based on their genetic profiles. Our results indicate high genetic diversity, low genetic structure and high connectivity. Nuclear DNA Fst values between Idaho and California were low but significantly different from zero (0.026). Bayesian clustering methods indicated a single population, and we were unable to distinguish summer breeding residents from different regions. Results of the mtDNA AMOVA showed that most of the haplotype variation (97%) was within the geographic populations while 3% variation was partitioned among them. One haplotype was common to all three areas. One region-specific haplotype was detected in California and one in Idaho, but additional sampling is required to determine if these haplotypes are unique to those geographic areas or a sampling artifact. We discuss potential sources of the high gene flow for this species including natal and breeding dispersal, floaters, and changes in migratory behavior as a result of environmental factors such as climate change and habitat alteration. Our preliminary findings can help inform the USFWS in development of golden eagle management strategies and provide a basis for additional research into the complex dynamics of the North American subspecies. PMID:27783687

Nuclear and Mitochondrial DNA Analyses of Golden Eagles (Aquila chrysaetos canadensis) from Three Areas in Western North America; Initial Results and Conservation Implications.

PubMed

Craig, Erica H; Adams, Jennifer R; Waits, Lisette P; Fuller, Mark R; Whittington, Diana M

2016-01-01

Understanding the genetics of a population is a critical component of developing conservation strategies. We used archived tissue samples from golden eagles (Aquila chrysaetos canadensis) in three geographic regions of western North America to conduct a preliminary study of the genetics of the North American subspecies, and to provide data for United States Fish and Wildlife Service (USFWS) decision-making for golden eagle management. We used a combination of mitochondrial DNA (mtDNA) D-loop sequences and 16 nuclear DNA (nDNA) microsatellite loci to investigate the extent of gene flow among our sampling areas in Idaho, California and Alaska and to determine if we could distinguish birds from the different geographic regions based on their genetic profiles. Our results indicate high genetic diversity, low genetic structure and high connectivity. Nuclear DNA Fst values between Idaho and California were low but significantly different from zero (0.026). Bayesian clustering methods indicated a single population, and we were unable to distinguish summer breeding residents from different regions. Results of the mtDNA AMOVA showed that most of the haplotype variation (97%) was within the geographic populations while 3% variation was partitioned among them. One haplotype was common to all three areas. One region-specific haplotype was detected in California and one in Idaho, but additional sampling is required to determine if these haplotypes are unique to those geographic areas or a sampling artifact. We discuss potential sources of the high gene flow for this species including natal and breeding dispersal, floaters, and changes in migratory behavior as a result of environmental factors such as climate change and habitat alteration. Our preliminary findings can help inform the USFWS in development of golden eagle management strategies and provide a basis for additional research into the complex dynamics of the North American subspecies.

Nuclear and mitochondrial DNA analyses of golden eagles (Aquila chrysaetos canadensis) from three areas in western North America; initial results and conservation implications

USGS Publications Warehouse

Craig, Erica H; Adams, Jennifer R.; Waits, Lisette P.; Fuller, Mark R.; Whittington, Diana M.

2016-01-01

Understanding the genetics of a population is a critical component of developing conservation strategies. We used archived tissue samples from golden eagles (Aquila chrysaetos canadensis) in three geographic regions of western North America to conduct a preliminary study of the genetics of the North American subspecies, and to provide data for United States Fish and Wildlife Service (USFWS) decision-making for golden eagle management. We used a combination of mitochondrial DNA (mtDNA) D-loop sequences and 16 nuclear DNA (nDNA) microsatellite loci to investigate the extent of gene flow among our sampling areas in Idaho, California and Alaska and to determine if we could distinguish birds from the different geographic regions based on their genetic profiles. Our results indicate high genetic diversity, low genetic structure and high connectivity. Nuclear DNA Fst values between Idaho and California were low but significantly different from zero (0.026). Bayesian clustering methods indicated a single population, and we were unable to distinguish summer breeding residents from different regions. Results of the mtDNA AMOVA showed that most of the haplotype variation (97%) was within the geographic populations while 3% variation was partitioned among them. One haplotype was common to all three areas. One region-specific haplotype was detected in California and one in Idaho, but additional sampling is required to determine if these haplotypes are unique to those geographic areas or a sampling artifact. We discuss potential sources of the high gene flow for this species including natal and breeding dispersal, floaters, and changes in migratory behavior as a result of environmental factors such as climate change and habitat alteration. Our preliminary findings can help inform the USFWS in development of golden eagle management strategies and provide a basis for additional research into the complex dynamics of the North American subspecies.

First large-scale DNA barcoding assessment of reptiles in the biodiversity hotspot of Madagascar, based on newly designed COI primers.

PubMed

Nagy, Zoltán T; Sonet, Gontran; Glaw, Frank; Vences, Miguel

2012-01-01

DNA barcoding of non-avian reptiles based on the cytochrome oxidase subunit I (COI) gene is still in a very early stage, mainly due to technical problems. Using a newly developed set of reptile-specific primers for COI we present the first comprehensive study targeting the entire reptile fauna of the fourth-largest island in the world, the biodiversity hotspot of Madagascar. Representatives of the majority of Madagascan non-avian reptile species (including Squamata and Testudines) were sampled and successfully DNA barcoded. The new primer pair achieved a constantly high success rate (72.7-100%) for most squamates. More than 250 species of reptiles (out of the 393 described ones; representing around 64% of the known diversity of species) were barcoded. The average interspecific genetic distance within families ranged from a low of 13.4% in the Boidae to a high of 29.8% in the Gekkonidae. Using the average genetic divergence between sister species as a threshold, 41-48 new candidate (undescribed) species were identified. Simulations were used to evaluate the performance of DNA barcoding as a function of completeness of taxon sampling and fragment length. Compared with available multi-gene phylogenies, DNA barcoding correctly assigned most samples to species, genus and family with high confidence and the analysis of fewer taxa resulted in an increased number of well supported lineages. Shorter marker-lengths generally decreased the number of well supported nodes, but even mini-barcodes of 100 bp correctly assigned many samples to genus and family. The new protocols might help to promote DNA barcoding of reptiles and the established library of reference DNA barcodes will facilitate the molecular identification of Madagascan reptiles. Our results might be useful to easily recognize undescribed diversity (i.e. novel taxa), to resolve taxonomic problems, and to monitor the international pet trade without specialized expert knowledge.

First Large-Scale DNA Barcoding Assessment of Reptiles in the Biodiversity Hotspot of Madagascar, Based on Newly Designed COI Primers

PubMed Central

Nagy, Zoltán T.; Sonet, Gontran; Glaw, Frank; Vences, Miguel

2012-01-01

Background DNA barcoding of non-avian reptiles based on the cytochrome oxidase subunit I (COI) gene is still in a very early stage, mainly due to technical problems. Using a newly developed set of reptile-specific primers for COI we present the first comprehensive study targeting the entire reptile fauna of the fourth-largest island in the world, the biodiversity hotspot of Madagascar. Methodology/Principal Findings Representatives of the majority of Madagascan non-avian reptile species (including Squamata and Testudines) were sampled and successfully DNA barcoded. The new primer pair achieved a constantly high success rate (72.7–100%) for most squamates. More than 250 species of reptiles (out of the 393 described ones; representing around 64% of the known diversity of species) were barcoded. The average interspecific genetic distance within families ranged from a low of 13.4% in the Boidae to a high of 29.8% in the Gekkonidae. Using the average genetic divergence between sister species as a threshold, 41–48 new candidate (undescribed) species were identified. Simulations were used to evaluate the performance of DNA barcoding as a function of completeness of taxon sampling and fragment length. Compared with available multi-gene phylogenies, DNA barcoding correctly assigned most samples to species, genus and family with high confidence and the analysis of fewer taxa resulted in an increased number of well supported lineages. Shorter marker-lengths generally decreased the number of well supported nodes, but even mini-barcodes of 100 bp correctly assigned many samples to genus and family. Conclusions/Significance The new protocols might help to promote DNA barcoding of reptiles and the established library of reference DNA barcodes will facilitate the molecular identification of Madagascan reptiles. Our results might be useful to easily recognize undescribed diversity (i.e. novel taxa), to resolve taxonomic problems, and to monitor the international pet trade without specialized expert knowledge. PMID:22479636

Genetic determinants of freckle occurrence in the Spanish population: Towards ephelides prediction from human DNA samples.

PubMed

Hernando, Barbara; Ibañez, Maria Victoria; Deserio-Cuesta, Julio Alberto; Soria-Navarro, Raquel; Vilar-Sastre, Inca; Martinez-Cadenas, Conrado

2018-03-01

Prediction of human pigmentation traits, one of the most differentiable externally visible characteristics among individuals, from biological samples represents a useful tool in the field of forensic DNA phenotyping. In spite of freckling being a relatively common pigmentation characteristic in Europeans, little is known about the genetic basis of this largely genetically determined phenotype in southern European populations. In this work, we explored the predictive capacity of eight freckle and sunlight sensitivity-related genes in 458 individuals (266 non-freckled controls and 192 freckled cases) from Spain. Four loci were associated with freckling (MC1R, IRF4, ASIP and BNC2), and female sex was also found to be a predictive factor for having a freckling phenotype in our population. After identifying the most informative genetic variants responsible for human ephelides occurrence in our sample set, we developed a DNA-based freckle prediction model using a multivariate regression approach. Once developed, the capabilities of the prediction model were tested by a repeated 10-fold cross-validation approach. The proportion of correctly predicted individuals using the DNA-based freckle prediction model was 74.13%. The implementation of sex into the DNA-based freckle prediction model slightly improved the overall prediction accuracy by 2.19% (76.32%). Further evaluation of the newly-generated prediction model was performed by assessing the model's performance in a new cohort of 212 Spanish individuals, reaching a classification success rate of 74.61%. Validation of this prediction model may be carried out in larger populations, including samples from different European populations. Further research to validate and improve this newly-generated freckle prediction model will be needed before its forensic application. Together with DNA tests already validated for eye and hair colour prediction, this freckle prediction model may lead to a substantially more detailed physical description of unknown individuals from DNA found at the crime scene. Copyright © 2017 Elsevier B.V. All rights reserved.

The impact of time and field conditions on brown bear (Ursus arctos) faecal DNA amplification

USGS Publications Warehouse

Murphy, M.A.; Kendall, K.C.; Robinson, A.; Waits, L.P.

2007-01-01

To establish longevity of faecal DNA samples under varying summer field conditions, we collected 53 faeces from captive brown bears (Ursus arctos) on a restricted vegetation diet. Each faeces was divided, and one half was placed on a warm, dry field site while the other half was placed on a cool, wet field site on Moscow Mountain, Idaho, USA. Temperature, relative humidity, and dew point data were collected on each site, and faeces were sampled for DNA extraction at <1, 3, 6, 14, 30, 45, and 60 days. Faecal DNA sample viability was assessed by attempting PCR amplification of a mitochondrial DNA (mtDNA) locus (???150 bp) and a nuclear DNA (nDNA) microsatellite locus (180-200 bp). Time in the field, temperature, and dew point impacted mtDNA and nDNA amplification success with the greatest drop in success rates occurring between 1 and 3 days. In addition, genotyping errors significantly increased over time at both field sites. Based on these results, we recommend collecting samples at frequent transect intervals and focusing sampling efforts during drier portions of the year when possible. ?? 2007 Springer Science+Business Media, Inc.

Digital DNA detection based on a compact optofluidic laser with ultra-low sample consumption.

PubMed

Lee, Wonsuk; Chen, Qiushu; Fan, Xudong; Yoon, Dong Ki

2016-11-29

DNA lasers self-amplify optical signals from a DNA analyte as well as thermodynamic differences between sequences, allowing quasi-digital DNA detection. However, these systems have drawbacks, such as relatively large sample consumption and complicated dye labelling. Moreover, although the lasing signal can detect the target DNA, it is superimposed on an unintended fluorescence background, which persists for non-target DNA samples as well. From an optical point of view, it is thus not truly digital detection and requires spectral analysis to identify the target. In this work, we propose and demonstrate an optofluidic laser that has a single layer of DNA molecules as the gain material. A target DNA produces intensive laser emission comparable to existing DNA lasers, while any unnecessary fluorescence background is successfully suppressed. As a result, the target DNA can be detected with a single laser pulse, in a truly digital manner. Since the DNA molecules cover only a single layer on the surface of the laser microcavity, the DNA sample consumption is a few orders of magnitude lower than that of existing DNA lasers. Furthermore, the DNA molecules are stained by simply immersing the microcavity in the intercalating dye solution, and thus the proposed DNA laser is free of any complex dye-labelling process prior to analysis.

Method of quantitating dsDNA

DOEpatents

Stark, Peter C.; Kuske, Cheryl R.; Mullen, Kenneth I.

2002-01-01

A method for quantitating dsDNA in an aqueous sample solution containing an unknown amount of dsDNA. A first aqueous test solution containing a known amount of a fluorescent dye-dsDNA complex and at least one fluorescence-attenutating contaminant is prepared. The fluorescence intensity of the test solution is measured. The first test solution is diluted by a known amount to provide a second test solution having a known concentration of dsDNA. The fluorescence intensity of the second test solution is measured. Additional diluted test solutions are similarly prepared until a sufficiently dilute test solution having a known amount of dsDNA is prepared that has a fluorescence intensity that is not attenuated upon further dilution. The value of the maximum absorbance of this solution between 200-900 nanometers (nm), referred to herein as the threshold absorbance, is measured. A sample solution having an unknown amount of dsDNA and an absorbance identical to that of the sufficiently dilute test solution at the same chosen wavelength is prepared. Dye is then added to the sample solution to form the fluorescent dye-dsDNA-complex, after which the fluorescence intensity of the sample solution is measured and the quantity of dsDNA in the sample solution is determined. Once the threshold absorbance of a sample solution obtained from a particular environment has been determined, any similarly prepared sample solution taken from a similar environment and having the same value for the threshold absorbance can be quantified for dsDNA by adding a large excess of dye to the sample solution and measuring its fluorescence intensity.

A sensitive and accurate quantification method for the detection of hepatitis B virus covalently closed circular DNA by the application of a droplet digital polymerase chain reaction amplification system.

PubMed

Mu, Di; Yan, Liang; Tang, Hui; Liao, Yong

2015-10-01

To develop a sensitive and accurate assay system for the quantification of covalently closed circular HBV DNA (cccDNA) for future clinical monitoring of cccDNA fluctuation during antiviral therapy in the liver of infected patients. A droplet digital PCR (ddPCR)-based assay system detected template DNA input at the single copy level (or ~10(-5) pg of plasmid HBV DNA) by using serially diluted plasmid HBV DNA samples. Compared with the conventional quantitative PCR assay in the detection of cccDNA, which required at least 50 ng of template DNA input, a parallel experiment applying a ddPCR system demonstrates that the lowest detection limit of cccDNA from HepG2.215 cellular DNA samples is around 1 ng, which is equivalent to 0.54 ± 0.94 copies of cccDNA. In addition, we demonstrated that the addition of cccDNA-safe exonuclease and utilization of cccDNA-specific primers in the ddPCR assay system significantly improved the detection accuracy of HBV cccDNA from HepG2.215 cellular DNA samples. The ddPCR-based cccDNA detection system is a sensitive and accurate assay for the quantification of cccDNA in HBV-transfected HepG2.215 cellular DNA samples and may represent an important method for future application in monitoring cccDNA fluctuation during antiviral therapy.

Didelphis marsupialis (common opossum): a potential reservoir host for zoonotic leishmaniasis in the metropolitan region of Belo Horizonte (Minas Gerais, Brazil).

PubMed

Schallig, Henk D F H; da Silva, Eduardo S; van der Meide, Wendy F; Schoone, Gerard J; Gontijo, Celia M F

2007-01-01

Identification of the zoonotic reservoir is important for leishmaniasis control program. A number of (wild) animal species may serve as reservoir hosts, including the opossum Didelphis marsupialis. A survey carried out in Didelphis specimens (n = 111) from the metropolitan region of Belo Horizonte, an important focus of human leishmaniasis in Brazil, is reported. All animals were serologically tested with indirect fluorescence antibody test (IFAT) and direct agglutination tests (DAT) based on L. (L.) donovani or L. (V.) braziliensis antigen. A sub-population (n = 20) was analyzed with polymerase chain reaction (PCR) for the presence of Leishmania-specific DNA. For species identification, PCR-positive samples were subjected to restriction enzyme fragment polymorphism (RFLP) analysis. Depending on the sero-diagnostic test employed, the sero-prevalence varied between 8.1% (9/111 animals positive with DAT test based on L. braziliensis antigen) and 21.6% (24/111 animals positive with IFAT). Five out of 20 samples analyzed with PCR tested positive for the presence of Leishmania-specific DNA. RFLP analysis revealed that two samples contained L. braziliensis complex DNA, one contained L. donovani complex DNA, and two samples could not be typed with the methodology used. These data suggest a potential role for the opossum as a reservoir host for zoonotic leishmaniasis in the region.

Establishing a novel automated magnetic bead-based method for the extraction of DNA from a variety of forensic samples.

PubMed

Witt, Sebastian; Neumann, Jan; Zierdt, Holger; Gébel, Gabriella; Röscheisen, Christiane

2012-09-01

Automated systems have been increasingly utilized for DNA extraction by many forensic laboratories to handle growing numbers of forensic casework samples while minimizing the risk of human errors and assuring high reproducibility. The step towards automation however is not easy: The automated extraction method has to be very versatile to reliably prepare high yields of pure genomic DNA from a broad variety of sample types on different carrier materials. To prevent possible cross-contamination of samples or the loss of DNA, the components of the kit have to be designed in a way that allows for the automated handling of the samples with no manual intervention necessary. DNA extraction using paramagnetic particles coated with a DNA-binding surface is predestined for an automated approach. For this study, we tested different DNA extraction kits using DNA-binding paramagnetic particles with regard to DNA yield and handling by a Freedom EVO(®)150 extraction robot (Tecan) equipped with a Te-MagS magnetic separator. Among others, the extraction kits tested were the ChargeSwitch(®)Forensic DNA Purification Kit (Invitrogen), the PrepFiler™Automated Forensic DNA Extraction Kit (Applied Biosystems) and NucleoMag™96 Trace (Macherey-Nagel). After an extensive test phase, we established a novel magnetic bead extraction method based upon the NucleoMag™ extraction kit (Macherey-Nagel). The new method is readily automatable and produces high yields of DNA from different sample types (blood, saliva, sperm, contact stains) on various substrates (filter paper, swabs, cigarette butts) with no evidence of a loss of magnetic beads or sample cross-contamination. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

The mitochondrial C16069T polymorphism, not mitochondrial D310 (D-loop) mononucleotide sequence variations, is associated with bladder cancer.

PubMed

Shakhssalim, Nasser; Houshmand, Massoud; Kamalidehghan, Behnam; Faraji, Abolfazl; Sarhangnejad, Reza; Dadgar, Sepideh; Mobaraki, Maryam; Rosli, Rozita; Sanati, Mohammad Hossein

2013-12-05

Bladder cancer is a relatively common and potentially life-threatening neoplasm that ranks ninth in terms of worldwide cancer incidence. The aim of this study was to determine deletions and sequence variations in the mitochondrial displacement loop (D-loop) region from the blood specimens and tumoral tissues of patients with bladder cancer, compared to adjacent non-tumoral tissues. The DNA from blood, tumoral tissues and adjacent non-tumoral tissues of twenty-six patients with bladder cancer and DNA from blood of 504 healthy controls from different ethnicities were investigated to determine sequence variation in the mitochondrial D-loop region using multiplex polymerase chain reaction (PCR), DNA sequencing and southern blotting analysis. From a total of 110 variations, 48 were reported as new mutations. No deletions were detected in tumoral tissues, adjacent non-tumoral tissues and blood samples from patients. Although the polymorphisms at loci 16189, 16261 and 16311 were not significantly correlated with bladder cancer, the C16069T variation was significantly present in patient samples compared to control samples (p < 0.05). Interestingly, there was no significant difference (p > 0.05) of C variations, including C7TC6, C8TC6, C9TC6 and C10TC6, in D310 mitochondrial DNA between patients and control samples. Our study suggests that 16069 mitochondrial DNA D-Loop mutations may play a significant role in the etiology of bladder cancer and facilitate the definition of carcinogenesis-related mutations in human cancer.

Development and application of non-invasive biomarkers for carcinogen-DNA adduct analysis in occupationally exposed populations.

PubMed

Talaska, G; Cudnik, J; Jaeger, M; Rothman, N; Hayes, R; Bhatnagar, V J; Kayshup, S J

1996-07-17

Biological monitoring of exposures to carcinogenic compounds in the workplace can be a valuable adjunct to environmental sampling and occupational medicine. Carcinogen-DNA adduct analysis has promise as a biomarker of effective dose if target organ samples can be obtained non-invasively. We have developed non-invasive techniques using exfoliated urothelial and bronchial cells collected in urine and sputum, respectively. First morning urine samples were collected from 33 workers exposed to benzidine or benzidine-based dyes and controls matched for age, education, and smoking status. Sufficient DNA for 32P-postlabelling analysis was obtained from every sample. Mean levels of a specific DNA adduct (which co-chromatographed with standard characterized by MS) were elevated significantly in the benzidine-exposed workers relative to controls. In addition, workers exposed to benzidine had higher adduct levels than those exposed to benzidine-based dyes. This study demonstrates the usefulness of these non-invasive techniques for exposure/effect assessment. To be useful in occupational studies, biomarkers must also be sensitive to exposure interventions. We have conducted topical application studies of used gasoline engine oils in mice and found that the levels of carcinogen-DNA adducts in skin and lung can be significantly lowered if skin cleaning is conducted in a timely manner. The combination of useful, non-invasive techniques to monitor exposure and effect and industrial hygiene interventions can be used to detect and prevent exposures to a wide range of carcinogens including those found in used gasoline engine oils and jet exhausts.

Pedigree and genotyping quality analyses of over 10,000 DNA samples from the Generation Scotland: Scottish Family Health Study.

PubMed

Kerr, Shona M; Campbell, Archie; Murphy, Lee; Hayward, Caroline; Jackson, Cathy; Wain, Louise V; Tobin, Martin D; Dominiczak, Anna; Morris, Andrew; Smith, Blair H; Porteous, David J

2013-03-22

Generation Scotland: Scottish Family Health Study (GS:SFHS) is a family-based biobank of 24,000 participants with rich phenotype and DNA available for genetic research. This paper describes the laboratory results from genotyping 32 single nucleotide polymorphisms (SNPs) on DNA from over 10,000 participants who attended GS:SFHS research clinics. The analysis described here was undertaken to test the quality of genetic information available to researchers. The success rate of each marker genotyped (call rate), minor allele frequency and adherence to Mendelian inheritance are presented. The few deviations in marker transmission in the 925 parent-child trios analysed were assessed as to whether they were likely to be miscalled genotypes, data or sample handling errors, or pedigree inaccuracies including non-paternity. The first 10,450 GS:SFHS clinic participants who had spirometry and smoking data available and DNA extracted were selected. 32 SNPs were assayed, chosen as part of a replication experiment from a Genome-Wide Association Study meta-analysis of lung function. In total 325,336 genotypes were returned. The overall project pass rate (32 SNPs on 10,450 samples) was 97.29%. A total of 925 parent-child trios were assessed for transmission of the SNP markers, with 16 trios indicating evidence of inconsistency in the recorded pedigrees. The Generation Scotland: Scottish Family Health Study used well-validated study methods and can produce good quality genetic data, with a low error rate. The GS:SFHS DNA samples are of high quality and the family groups were recorded and processed with accuracy during collection of the cohort.

Exploring the ancestry differentiation and inference capacity of the 28-plex AISNPs.

PubMed

Hao, Wei-Qi; Liu, Jing; Jiang, Li; Han, Jun-Ping; Wang, Ling; Li, Jiu-Ling; Ma, Quan; Liu, Chao; Wang, Hui-Jun; Li, Cai-Xia

2018-06-07

Inferring an unknown DNA's ancestry using a set of ancestry-informative single nucleotide polymorphisms (SNPs) in forensic science is useful to provide investigative leads. This is especially true when there is no DNA database match or specified suspect. Thus, a set of SNPs with highly robust and balanced differential power is strongly demanded in forensic science. In addition, it is also necessary to build a genotyping database for estimating the ancestry of an individual or an unknown DNA. For the differentiation of Africans, Europeans, East Asians, Native Americans, and Oceanians, the Global Nano set that includes just 31 SNPs was developed by de la Puente et al. Its ability for differentiation and balance was evaluated using the genotype data of the 1000 Genomes Phase III project and the Stanford University HGDP-CEPH. Just 402 samples were genotyped and analyzed as a reference set based on statistical methods. To validate the differentiating capacity using more samples, we developed a single-tube 28-plex SNP assay in which the SNPs were chosen from the 31 allelic loci of the Global AIMs Nano set. Three tri-allelic SNPs used to differentiate mixed-source DNA contribute little to population differentiation and were excluded here. Then, 998 individuals from 21 populations were typed, and these genotypes were combined with the genotype data obtained from 1000 Genomes Phase III and the Stanford University HGDP-CEPH (3090 total samples,43 populations) to estimate the power of this multiplex assay and build a database for the further inference of an individual or an unknown DNA sample in forensic practice.

[Application of multiple polymorphism genetic markers in determination of half sibling sharing a same mother].

PubMed

Que, Ting-zhi; Zhao, Shu-min; Li, Cheng-tao

2010-08-01

Determination strategies for half sibling sharing a same mother were investigated through the detection of autosomal and X-chromosomal STR (X-STR) loci and polymorphisms on hypervariable (HV) region of mitochondrial DNA (mtDNA). Genomic DNA were extracted from blood stain samples of the 3 full siblings and one dubious half sibling sharing the same mother with them. Fifteen autosomal STR loci were genotyped by Sinofiler kit, and 19 X-STR loci were genotyped by Mentype Argus X-8 kit and 16 plex in-house system. Polymorphisms of mtDNA HV-I and HV-II were also detected with sequencing technology. Full sibling relationship between the dubious half sibling and each of the 3 full siblings were excluded based on the results of autosomal STR genotyping and calculation of full sibling index (FSI) and half sibling index (HIS). Results of sequencing for mtDNA HV-I and HV-II showed that all of the 4 samples came from a same maternal line. X-STR genotyping results determined that the dubious half sibling shared a same mother with the 3 full siblings. It is reliable to combine three different genotyping technologies including autosomal STR, X-STR and sequencing of mtDNA HV-I and HV-II for determination of half sibling sharing a same mother.

Detection of a putative novel adenovirus by PCR amplification, sequencing and phylogenetic characterisation of two gene fragments from formalin-fixed paraffin-embedded tissues of a cat diagnosed with disseminated adenovirus disease.

PubMed

Lakatos, Béla; Hornyák, Ákos; Demeter, Zoltán; Forgách, Petra; Kennedy, Frances; Rusvai, Miklós

2017-12-01

Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in formalin-fixed paraffin-embedded tissue samples of a cat that had suffered from disseminated adenovirus infection. The identity of the amplified products from the hexon and DNA-dependent DNA polymerase genes was confirmed by DNA sequencing. The sequences were clearly distinguishable from corresponding hexon and polymerase sequences of other mastadenoviruses, including human adenoviruses. These results suggest the possible existence of a distinct feline adenovirus.

Smad4 loss promotes lung cancer formation but increases sensitivity to DNA topoisomerase inhibitors

PubMed Central

Kalra, Sean; Cleaver, Timothy G.; Merrick, Daniel; Wang, Xiao-Jing; Malkoski, Stephen P.

2015-01-01

Non-small cell lung cancer (NSCLC) is a common malignancy with a poor prognosis. Despite progress targeting oncogenic drivers, there are no therapies targeting tumor suppressor loss. Smad4 is an established tumor suppressor in pancreatic and colon cancer, however, the consequences of Smad4 loss in lung cancer are largely unknown. We evaluated Smad4 expression in human NSCLC samples and examined Smad4 alterations in large NSCLC datasets and found that reduced Smad4 expression is common in human NSCLC and occurs through a variety of mechanisms including mutation, homozygous deletion, and heterozygous loss. We modeled Smad4 loss in lung cancer by deleting Smad4 in airway epithelial cells and found that Smad4 deletion both initiates and promotes lung tumor development. Interestingly, both Smad4−/− mouse tumors and human NSCLC samples with reduced Smad4 expression demonstrated increased DNA damage while Smad4 knockdown in lung cancer cells reduced DNA repair and increased apoptosis after DNA damage. In addition, Smad4 deficient NSCLC cells demonstrated increased sensitivity to both chemotherapeutics that inhibit DNA topoisomerase and drugs that block double strand DNA break repair by non-homologous end joining. In sum, these studies establish Smad4 as a lung tumor suppressor and suggest that the defective DNA repair phenotype of Smad4 deficient tumors can be exploited by specific therapeutic strategies. PMID:25893305

Comparison of clinical application of the Abbott HBV PCR kit and the VERSANT HBV DNA 3.0 test to measure serum hepatitis B virus DNA in Taiwanese patients.

PubMed

Yang, Jeng-Fu; Lin, Ya-Yun; Huang, Jee-Fu; Liu, Shu-Fen; Chu, Pei-Yu; Hsieh, Ming-Yen; Lin, Zu-Yau; Chen, Shinn-Cherng; Wang, Liang-Yen; Dai, Chia-Yen; Chuang, Wan-Long; Yu, Ming-Lung

2009-08-01

With an estimated 350-400 million people worldwide chronically infected with hepatitis B virus (HBV), and the subsequent serious complications caused by liver damage including cirrhosis, liver failure, and hepatocellular carcinoma, HBV infection remains a global health issue, particularly in Taiwan, an HBV-hyperendemic area. Sensitive and accurate quantification of HBV DNA is necessary to monitor patients with chronic hepatitis B who are receiving antiviral therapy to determine treatment response and adapt therapy. We evaluated and compared the clinical performance of two HBV DNA assays based on different technologies: the RealArt HBV PCR Kit (Abbott HBV DNA PCR kit, real-time polymerase chain reaction assay, detection limit: 27 IU/mL) and the VERSANT bDNA 3.0 assay (Bayer, branched DNA signal amplification assay, detection limit: 357 IU/mL). Serum levels of HBV DNA in 173 chronic HBV carriers were determined using both the RealArt HBV PCR Kit and the VERSANT bDNA 3.0 test. Of the 173 samples analyzed for baseline viral load detection, HBV DNA was quantifiable in 147 patients (82.1%) by the RealArt HBV PCR Kit, which was significantly higher than the 92 (53.2%) samples quantified by the VERSANT bDNA 3.0 assay. A total of 86 (49.7%) samples were quantifiable by both assays, whereas 25 (14.5%) were below the detection limit of both assays. The HBV DNA quantification values measured by the RealArt HBV PCR Kit and the VERSANT bDNA 3.0 assay were positively correlated (Spearman's rank correlation coefficient r = 0.932, p < 0.001). On average, the results derived from the RealArt HBV PCR Kit were 0.67 log lower than those of the VERSANT bDNA 3.0 assay. HBV DNA concentrations were significantly higher in 63 HBV e antigen (HBeAg)-seropositive patients than in 110 HBeAg-seronegative patients (5.42 +/- 2.34 logs vs. 3.21 +/- 2.27 logs, p < 0.001). The RealArt HBV PCR Kit is more sensitive and has a wider dynamic range than the VERSANT bDNA 3.0 assay in the clinical setting of chronic hepatitis B patients. The sensitivity and wide dynamic range of the PCR assay allow optimal monitoring and timely adaptation of antiviral therapy. Nevertheless, the HBV DNA values measured by the RealArt HBV PCR Kit and the VERSANT bDNA 3.0 assay were significantly correlated.

A two-step electrodialysis method for DNA purification from polluted metallic environmental samples.

PubMed

Rodríguez-Mejía, José Luis; Martínez-Anaya, Claudia; Folch-Mallol, Jorge Luis; Dantán-González, Edgar

2008-08-01

Extracting DNA from samples of polluted environments using standard methods often results in low yields of poor-quality material unsuited to subsequent manipulation and analysis by molecular biological techniques. Here, we report a novel two-step electrodialysis-based method for the extraction of DNA from environmental samples. This technique permits the rapid and efficient isolation of high-quality DNA based on its acidic nature, and without the requirement for phenol-chloroform-isoamyl alcohol cleanup and ethanol precipitation steps. Subsequent PCR, endonuclease restriction, and cloning reactions were successfully performed utilizing DNA obtained by electrodialysis, whereas some or all of these techniques failed using DNA extracted with two alternative methods. We also show that his technique is applicable to purify DNA from a range of polluted and nonpolluted samples.

Implementation of Novel Design Features for qPCR-Based eDNA Assessment

PubMed Central

Veldhoen, Nik; Hobbs, Jared; Ikonomou, Georgios; Hii, Michael; Lesperance, Mary; Helbing, Caren C.

2016-01-01

Environmental stewardship requires timely, accurate information related to the status of a given ecosystem and the species that occupy it. Recent advances in the application of the highly sensitive real-time quantitative polymerase chain reaction (qPCR) towards identification of constituents within environmental DNA (eDNA) now allow targeted detection of the presence of species-specific biological material within a localized geographic region. However, as with all molecular techniques predicated on the specificity and sensitivity of the PCR assay, careful validation of each eDNA qPCR assay in development must be performed both under controlled laboratory conditions and when challenged with field-derived eDNA samples. Such a step-wise approach forms the basis for incorporation of innovative qPCR design features that strengthen the implementation and interpretation of the eDNA assay. This includes empirical determination that the qPCR assay is refractory to the presence of human DNA and the use of a tripartite assay approach comprised of 1) a primer set targeting plant chloroplast that evaluates the presence of amplifiable DNA from field samples to increase confidence in a negative result, 2) an animal group primer set to increase confidence in the assay result, and 3) a species-specific primer set to assess presence of DNA from the target species. To demonstrate this methodology, we generated eDNA assays specific for the North American bullfrog (Lithobates (Rana) catesbeiana) and the Rocky Mountain tailed frog (Ascaphus montanus) and characterized each with respect to detection sensitivity and specificity with demonstrated performance in a field survey scenario. The qPCR design features presented herein address specific challenges of eDNA assays thereby increasing their interpretative power. PMID:27802293

Comparison of the Gen-Probe Aptima HIV-1 and Abbott HIV-1 qualitative assays with the Roche Amplicor HIV-1 DNA assay for early infant diagnosis using dried blood spots.

PubMed

Nelson, Julie A E; Hawkins, J Tyler; Schanz, Maria; Mollan, Katie; Miller, Melissa B; Schmitz, John L; Fiscus, Susan A

2014-08-01

The current gold standard for infant diagnosis of HIV-1 is the Roche Amplicor Qualitative DNA assay, but it is being phased out. Compare the Abbott qualitative assay and the Gen-Probe Aptima assay to the gold standard Roche DNA assay using dried blood spots (DBS). The Gen-Probe Aptima and Abbott qualitative HIV-1 assays were compared to the Roche DNA assay for early infant diagnosis. Specificity and sensitivity were determined for the three assays using DBS from 50 HIV-exposed uninfected infants and 269 HIV-1 infected adults from North Carolina, respectively. All of the negative and 151 of the positive DBS had valid results on the 3 different assays, and an additional 118 positive DBS had valid results on the Roche DNA and Aptima assays. All three assays were very specific. The Roche DNA assay was the most sensitive (96.7%) over a wide range of HIV PVL, including samples with PVL<400 copies/ml. Restricted to samples with PVL>400 copies/ml, the Gen-Probe Aptima assay had sensitivity (96.5%) comparable to the Roche DNA assay (98.8%). The Abbott Qualitative assay was the least sensitive and only had sensitivity above 95% among samples with PVL over 1000 copies/ml. The Abbott HIV-1 Qualitative assay was not as sensitive as the comparator assays, so it would not be a useful replacement assay, especially for infants taking antiretroviral prophylaxis. The Gen-Probe Aptima assay is an adequate replacement option for infant diagnosis using DBS. Copyright © 2014 Elsevier B.V. All rights reserved.

The biobank of the Norwegian mother and child cohort Study: A resource for the next 100 years

PubMed Central

Rønningen, Kjersti S.; Paltiel, Liv; Meltzer, Helle M.; Nordhagen, Rannveig; Lie, Kari K.; Hovengen, Ragnhild; Haugen, Margaretha; Nystad, Wenche; Magnus, Per; Hoppin, Jane A.

2007-01-01

Introduction Long-term storage of biological materials is a critical component of any epidemiological study. In designing specimen repositories, efforts need to balance future needs for samples with logistical constraints necessary to process and store samples in a timely fashion. Objectives In the Norwegian Mother and Child Cohort Study (MoBa), the Biobank was charged with long-term storage of more than 380,000 biological samples from pregnant women, their partners and their children for up to 100 years. Methods Biological specimens include whole blood, plasma, DNA and urine; samples are collected at 50 hospitals in Norway. All samples are sent via ordinary mail to the Biobank in Oslo where the samples are registered, aliquoted and DNA extracted. DNA is stored at −20 °C while whole blood, urine and plasma are stored at − 80 °C. Results As of July 2006, over 227,000 sample sets have been collected, processed and stored at the Biobank. Currently 250–300 sets are received daily. An important part of the Biobank is the quality control program. Conclusion With the unique combination of biological specimens and questionnaire data, the MoBa Study will constitute a resource for many future investigations of the separate and combined effects of genetic, environmental factors on pregnancy outcome and on human morbidity, mortality and health in general. PMID:17031521

Universal multiplex PCR and CE for quantification of SMN1/SMN2 genes in spinal muscular atrophy.

PubMed

Wang, Chun-Chi; Chang, Jan-Gowth; Jong, Yuh-Jyh; Wu, Shou-Mei

2009-04-01

We established a universal multiplex PCR and CE to calculate the copy number of survival motor neuron (SMN1 and SMN2) genes for clinical screening of spinal muscular atrophy (SMA). In this study, one universal fluorescent primer was designed and applied for multiplex PCR of SMN1, SMN2 and two internal standards (CYBB and KRIT1). These amplicons were separated by conformation sensitive CE. Mixture of hydroxyethyl cellulose and hydroxypropyl cellulose were used in this CE system. Our method provided the potential to separate two 390-bp PCR products that differ in a single nucleotide. Differentiation and quantification of SMN1 and SMN2 are essential for clinical screening of SMA patients and carriers. The DNA samples included 22 SMA patients, 45 parents of SMA patients (obligatory carriers) and 217 controls. For evaluating accuracy, those 284 samples were blind-analyzed by this method and denaturing high pressure liquid chromatography (DHPLC). Eight of the total samples showed different results. Among them, two samples were diagnosed as having only SMN2 gene by DHPLC, however, they contained both SMN1 and SMN2 by our method. They were further confirmed by DNA sequencing. Our method showed good agreement with the DNA sequencing. The multiplex ligation-dependent probe amplification (MLPA) was used for confirming the other five samples, and showed the same results with our CE method. For only one sample, our CE showed different results with MLPA and DNA sequencing. One out of 284 samples (0.35%) belonged to mismatching. Our method provided a better accurate method and convenient method for clinical genotyping of SMA disease.

Development and evaluation of a real-time fluorescent polymerase chain reaction assay for the detection of bovine contaminates in cattle feed.

PubMed

Rensen, Gabriel; Smith, Wayne; Ruzante, Juliana; Sawyer, Mary; Osburn, Bennie; Cullor, James

2005-01-01

A real-time fluorescent polymerase chain reaction assay for detecting prohibited ruminant materials such as bovine meat and bone meal (BMBM) in cattle feed using primers and FRET probes targeting the ruminant specific mitochondrial cytochrome b gene was developed and evaluated on two different types of cattle feed. Common problems involved with PCR based testing of cattle feed include the presence of high levels of PCR inhibitors and the need for certain pre-sample processing techniques in order to perform DNA extractions. We have developed a pre-sample processing technique for extracting DNA from cattle feed which does not require the feed sample to be ground to a fine powder and utilizes materials that are disposed of between samples, thus, reducing the potential of cross contamination. The DNA extraction method utilizes Whatman FTA card technology, is adaptable to high sample throughput analysis and allows for room temperature storage with established archiving of samples of up to 14 years. The Whatman FTA cards are subsequently treated with RNAse and undergo a Chelex-100 extraction (BioRad, Hercules, CA), thus removing potential PCR inhibitors and eluting the DNA from the FTA card for downstream PCR analysis. The detection limit was evaluated over a period of 30 trials on calf starter mix and heifer starter ration feed samples spiked with known concentrations of BMBM. The PCR detection assay detected 0.05% wt/wt BMBM contamination with 100% sensitivity, 100% specificity, and 100% confidence. Concentrations of 0.005% and 0.001% wt/wt BMBM contamination were also detected in both feed types but with varying levels of confidence.

Real-time polymerase chain reaction detection of cauliflower mosaic virus to complement the 35S screening assay for genetically modified organisms.

PubMed

Cankar, Katarina; Ravnikar, Maja; Zel, Jana; Gruden, Kristina; Toplak, Natasa

2005-01-01

Labeling of genetically modified organisms (GMOs) is now in place in many countries, including the European Union, in order to guarantee the consumer's choice between GM and non-GM products. Screening of samples is performed by polymerase chain reaction (PCR) amplification of regulatory sequences frequently introduced into genetically modified plants. Primers for the 35S promoter from Cauliflower mosaic virus (CaMV) are those most frequently used. In virus-infected plants or in samples contaminated with plant material carrying the virus, false-positive results can consequently occur. A system for real-time PCR using a TaqMan minor groove binder probe was designed that allows recognition of virus coat protein in the sample, thus allowing differentiation between transgenic and virus-infected samples. We measured the efficiency of PCR amplification, limits of detection and quantification, range of linearity, and repeatability of the assay in order to assess the applicability of the assay for routine analysis. The specificity of the detection system was tested on various virus isolates and plant species. All 8 CaMV isolates were successfully amplified using the designed system. No cross-reactivity was detected with DNA from 3 isolates of the closely related Carnation etched ring virus. Primers do not amplify plant DNA from available genetically modified maize and soybean lines or from different species of Brassicaceae or Solanaceae that are natural hosts for CaMV. We evaluated the assay for different food matrixes by spiking CaMV DNA into DNA from food samples and have successfully amplified CaMV from all samples. The assay was tested on rapeseed samples from routine GMO testing that were positive in the 35S screening assay, and the presence of the virus was confirmed.

Bona fide colour: DNA prediction of human eye and hair colour from ancient and contemporary skeletal remains

PubMed Central

2013-01-01

Background DNA analysis of ancient skeletal remains is invaluable in evolutionary biology for exploring the history of species, including humans. Contemporary human bones and teeth, however, are relevant in forensic DNA analyses that deal with the identification of perpetrators, missing persons, disaster victims or family relationships. They may also provide useful information towards unravelling controversies that surround famous historical individuals. Retrieving information about a deceased person’s externally visible characteristics can be informative in both types of DNA analyses. Recently, we demonstrated that human eye and hair colour can be reliably predicted from DNA using the HIrisPlex system. Here we test the feasibility of the novel HIrisPlex system at establishing eye and hair colour of deceased individuals from skeletal remains of various post-mortem time ranges and storage conditions. Methods Twenty-one teeth between 1 and approximately 800 years of age and 5 contemporary bones were subjected to DNA extraction using standard organic protocol followed by analysis using the HIrisPlex system. Results Twenty-three out of 26 bone DNA extracts yielded the full 24 SNP HIrisPlex profile, therefore successfully allowing model-based eye and hair colour prediction. HIrisPlex analysis of a tooth from the Polish general Władysław Sikorski (1881 to 1943) revealed blue eye colour and blond hair colour, which was positively verified from reliable documentation. The partial profiles collected in the remaining three cases (two contemporary samples and a 14th century sample) were sufficient for eye colour prediction. Conclusions Overall, we demonstrate that the HIrisPlex system is suitable, sufficiently sensitive and robust to successfully predict eye and hair colour from ancient and contemporary skeletal remains. Our findings, therefore, highlight the HIrisPlex system as a promising tool in future routine forensic casework involving skeletal remains, including ancient DNA studies, for the prediction of eye and hair colour of deceased individuals. PMID:23317428

Bona fide colour: DNA prediction of human eye and hair colour from ancient and contemporary skeletal remains.

PubMed

Draus-Barini, Jolanta; Walsh, Susan; Pośpiech, Ewelina; Kupiec, Tomasz; Głąb, Henryk; Branicki, Wojciech; Kayser, Manfred

2013-01-14

DNA analysis of ancient skeletal remains is invaluable in evolutionary biology for exploring the history of species, including humans. Contemporary human bones and teeth, however, are relevant in forensic DNA analyses that deal with the identification of perpetrators, missing persons, disaster victims or family relationships. They may also provide useful information towards unravelling controversies that surround famous historical individuals. Retrieving information about a deceased person's externally visible characteristics can be informative in both types of DNA analyses. Recently, we demonstrated that human eye and hair colour can be reliably predicted from DNA using the HIrisPlex system. Here we test the feasibility of the novel HIrisPlex system at establishing eye and hair colour of deceased individuals from skeletal remains of various post-mortem time ranges and storage conditions. Twenty-one teeth between 1 and approximately 800 years of age and 5 contemporary bones were subjected to DNA extraction using standard organic protocol followed by analysis using the HIrisPlex system. Twenty-three out of 26 bone DNA extracts yielded the full 24 SNP HIrisPlex profile, therefore successfully allowing model-based eye and hair colour prediction. HIrisPlex analysis of a tooth from the Polish general Władysław Sikorski (1881 to 1943) revealed blue eye colour and blond hair colour, which was positively verified from reliable documentation. The partial profiles collected in the remaining three cases (two contemporary samples and a 14th century sample) were sufficient for eye colour prediction. Overall, we demonstrate that the HIrisPlex system is suitable, sufficiently sensitive and robust to successfully predict eye and hair colour from ancient and contemporary skeletal remains. Our findings, therefore, highlight the HIrisPlex system as a promising tool in future routine forensic casework involving skeletal remains, including ancient DNA studies, for the prediction of eye and hair colour of deceased individuals.

DNA Damage among Wood Workers Assessed with the Comet Assay

PubMed Central

Bruschweiler, Evin Danisman; Wild, Pascal; Huynh, Cong Khanh; Savova-Bianchi, Dessislava; Danuser, Brigitta; Hopf, Nancy B.

2016-01-01

Exposure to wood dust, a human carcinogen, is common in wood-related industries, and millions of workers are occupationally exposed to wood dust worldwide. The comet assay is a rapid, simple, and sensitive method for determining DNA damage. The objective of this study was to investigate the DNA damage associated with occupational exposure to wood dust using the comet assay (peripheral blood samples) among nonsmoking wood workers (n = 31, furniture and construction workers) and controls (n = 19). DNA damage was greater in the group exposed to composite wood products compared to the group exposed to natural woods and controls (P < 0.001). No difference in DNA damage was observed between workers exposed to natural woods and controls (P = 0.13). Duration of exposure and current dust concentrations had no effect on DNA damage. In future studies, workers’ exposures should include cumulative dust concentrations and exposures originating from the binders used in composite wood products. PMID:27398027

Diverse circovirus-like genome architectures revealed by environmental metagenomics.

PubMed

Rosario, Karyna; Duffy, Siobain; Breitbart, Mya

2009-10-01

Single-stranded DNA (ssDNA) viruses with circular genomes are the smallest viruses known to infect eukaryotes. The present study identified 10 novel genomes similar to ssDNA circoviruses through data-mining of public viral metagenomes. The metagenomic libraries included samples from reclaimed water and three different marine environments (Chesapeake Bay, British Columbia coastal waters and Sargasso Sea). All the genomes have similarities to the replication (Rep) protein of circoviruses; however, only half have genomic features consistent with known circoviruses. Some of the genomes exhibit a mixture of genomic features associated with different families of ssDNA viruses (i.e. circoviruses, geminiviruses and parvoviruses). Unique genome architectures and phylogenetic analysis of the Rep protein suggest that these viruses belong to novel genera and/or families. Investigating the complex community of ssDNA viruses in the environment can lead to the discovery of divergent species and help elucidate evolutionary links between ssDNA viruses.

Detection of human papillomavirus DNA in urine. A review of the literature.

PubMed

Vorsters, A; Micalessi, I; Bilcke, J; Ieven, M; Bogers, J; Van Damme, P

2012-05-01

The detection of human papillomavirus (HPV) DNA in urine, a specimen easily obtained by a non-invasive self-sampling method, has been the subject of a considerable number of studies. This review provides an overview of 41 published studies; assesses how different methods and settings may contribute to the sometimes contradictory outcomes; and discusses the potential relevance of using urine samples in vaccine trials, disease surveillance, epidemiological studies, and specific settings of cervical cancer screening. Urine sampling, storage conditions, sample preparation, DNA extraction, and DNA amplification may all have an important impact on HPV DNA detection and the form of viral DNA that is detected. Possible trends in HPV DNA prevalence in urine could be inferred from the presence of risk factors or the diagnosis of cervical lesions. HPV DNA detection in urine is feasible and may become a useful tool but necessitates further improvement and standardization.

A Hybrid DNA Extraction Method for the Qualitative and Quantitative Assessment of Bacterial Communities from Poultry Production Samples

PubMed Central

Rothrock, Michael J.; Hiett, Kelli L.; Gamble, John; Caudill, Andrew C.; Cicconi-Hogan, Kellie M.; Caporaso, J. Gregory

2014-01-01

The efficacy of DNA extraction protocols can be highly dependent upon both the type of sample being investigated and the types of downstream analyses performed. Considering that the use of new bacterial community analysis techniques (e.g., microbiomics, metagenomics) is becoming more prevalent in the agricultural and environmental sciences and many environmental samples within these disciplines can be physiochemically and microbiologically unique (e.g., fecal and litter/bedding samples from the poultry production spectrum), appropriate and effective DNA extraction methods need to be carefully chosen. Therefore, a novel semi-automated hybrid DNA extraction method was developed specifically for use with environmental poultry production samples. This method is a combination of the two major types of DNA extraction: mechanical and enzymatic. A two-step intense mechanical homogenization step (using bead-beating specifically formulated for environmental samples) was added to the beginning of the “gold standard” enzymatic DNA extraction method for fecal samples to enhance the removal of bacteria and DNA from the sample matrix and improve the recovery of Gram-positive bacterial community members. Once the enzymatic extraction portion of the hybrid method was initiated, the remaining purification process was automated using a robotic workstation to increase sample throughput and decrease sample processing error. In comparison to the strict mechanical and enzymatic DNA extraction methods, this novel hybrid method provided the best overall combined performance when considering quantitative (using 16S rRNA qPCR) and qualitative (using microbiomics) estimates of the total bacterial communities when processing poultry feces and litter samples. PMID:25548939

Impact of Heterogeneity and Lattice Bond Strength on DNA Triangle Crystal Growth.

PubMed

Stahl, Evi; Praetorius, Florian; de Oliveira Mann, Carina C; Hopfner, Karl-Peter; Dietz, Hendrik

2016-09-07

One key goal of DNA nanotechnology is the bottom-up construction of macroscopic crystalline materials. Beyond applications in fields such as photonics or plasmonics, DNA-based crystal matrices could possibly facilitate the diffraction-based structural analysis of guest molecules. Seeman and co-workers reported in 2009 the first designed crystal matrices based on a 38 kDa DNA triangle that was composed of seven chains. The crystal lattice was stabilized, unprecedentedly, by Watson-Crick base pairing. However, 3D crystallization of larger designed DNA objects that include more chains such as DNA origami remains an unsolved problem. Larger objects would offer more degrees of freedom and design options with respect to tailoring lattice geometry and for positioning other objects within a crystal lattice. The greater rigidity of multilayer DNA origami could also positively influence the diffractive properties of crystals composed of such particles. Here, we rationally explore the role of heterogeneity and Watson-Crick interaction strengths in crystal growth using 40 variants of the original DNA triangle as model multichain objects. Crystal growth of the triangle was remarkably robust despite massive chemical, geometrical, and thermodynamical sample heterogeneity that we introduced, but the crystal growth sensitively depended on the sequences of base pairs next to the Watson-Crick sticky ends of the triangle. Our results point to weak lattice interactions and high concentrations as decisive factors for achieving productive crystallization, while sample heterogeneity and impurities played a minor role.

Successful collection of stool samples for microbiome analyses from a large community-based population of elderly men.

PubMed

Abrahamson, Melanie; Hooker, Elizabeth; Ajami, Nadim J; Petrosino, Joseph F; Orwoll, Eric S

2017-09-01

The relationship of the gastrointestinal microbiome to health and disease is of major research interest, including the effects of the gut microbiota on age related conditions. Here we report on the outcome of a project to collect stool samples on a large number of community dwelling elderly men using the OMNIgene-GUT stool/feces collection kit (OMR-200, DNA Genotek, Ottawa, Canada). Among 1,328 men who were eligible for stool collection, 982 (74%) agreed to participate and 951 submitted samples. The collection process was reported to be acceptable, almost all samples obtained were adequate, the process of sample handling by mail was uniformly successful. The DNA obtained provided excellent results in microbiome analyses, yielding an abundance of species and a diversity of taxa as would be predicted. Our results suggest that population studies of older participants involving remote stool sample collection are feasible. These approaches would allow large scale research projects of the association of the gut microbiota with important clinical outcomes.

An accurate bacterial DNA quantification assay for HTS library preparation of human biological samples.

PubMed

Seashols-Williams, Sarah; Green, Raquel; Wohlfahrt, Denise; Brand, Angela; Tan-Torres, Antonio Limjuco; Nogales, Francy; Brooks, J Paul; Singh, Baneshwar

2018-05-17

Sequencing and classification of microbial taxa within forensically relevant biological fluids has the potential for applications in the forensic science and biomedical fields. The quantity of bacterial DNA from human samples is currently estimated based on quantity of total DNA isolated. This method can miscalculate bacterial DNA quantity due to the mixed nature of the sample, and consequently library preparation is often unreliable. We developed an assay that can accurately and specifically quantify bacterial DNA within a mixed sample for reliable 16S ribosomal DNA (16S rDNA) library preparation and high throughput sequencing (HTS). A qPCR method was optimized using universal 16S rDNA primers, and a commercially available bacterial community DNA standard was used to develop a precise standard curve. Following qPCR optimization, 16S rDNA libraries from saliva, vaginal and menstrual secretions, urine, and fecal matter were amplified and evaluated at various DNA concentrations; successful HTS data were generated with as low as 20 pg of bacterial DNA. Changes in bacterial DNA quantity did not impact observed relative abundances of major bacterial taxa, but relative abundance changes of minor taxa were observed. Accurate quantification of microbial DNA resulted in consistent, successful library preparations for HTS analysis. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Understanding environmental DNA detection probabilities: A case study using a stream-dwelling char Salvelinus fontinalis

USGS Publications Warehouse

Wilcox, Taylor M; Mckelvey, Kevin S.; Young, Michael K.; Sepulveda, Adam; Shepard, Bradley B.; Jane, Stephen F; Whiteley, Andrew R.; Lowe, Winsor H.; Schwartz, Michael K.

2016-01-01

Environmental DNA sampling (eDNA) has emerged as a powerful tool for detecting aquatic animals. Previous research suggests that eDNA methods are substantially more sensitive than traditional sampling. However, the factors influencing eDNA detection and the resulting sampling costs are still not well understood. Here we use multiple experiments to derive independent estimates of eDNA production rates and downstream persistence from brook trout (Salvelinus fontinalis) in streams. We use these estimates to parameterize models comparing the false negative detection rates of eDNA sampling and traditional backpack electrofishing. We find that using the protocols in this study eDNA had reasonable detection probabilities at extremely low animal densities (e.g., probability of detection 0.18 at densities of one fish per stream kilometer) and very high detection probabilities at population-level densities (e.g., probability of detection > 0.99 at densities of ≥ 3 fish per 100 m). This is substantially more sensitive than traditional electrofishing for determining the presence of brook trout and may translate into important cost savings when animals are rare. Our findings are consistent with a growing body of literature showing that eDNA sampling is a powerful tool for the detection of aquatic species, particularly those that are rare and difficult to sample using traditional methods.