Dielectrophoretic Isolation and Detection of cfc-DNA Nanoparticulate Biomarkers and Virus from Blood

PubMed Central

Sonnenberg, Avery; Marciniak, Jennifer Y.; McCanna, James; Krishnan, Rajaram; Rassenti, Laura; Kipps, Thomas J.; Heller, Michael J.

2015-01-01

Dielectrophoretic (DEP) microarray devices allow important cellular nanoparticulate biomarkers and virus to be rapidly isolated, concentrated and detected directly from clinical and biological samples. A variety of sub-micron nanoparticulate entities including cell free circulating (cfc) DNA, mitochondria and virus can be isolated into DEP high-field areas on microelectrodes, while blood cells and other micron-size entities become isolated into DEP low-field areas between the microelectrodes. The nanoparticulate entities are held in the DEP high-field areas while cells are washed away along with proteins and other small molecules which are not affected by the DEP electric fields. DEP carried out on 20 µL of whole blood obtained from Chronic Lymphocytic Leukemia (CLL) patients showed a considerable amount of SYBR Green stained DNA fluorescent material concentrated in the DEP high-field regions. Whole blood obtained from healthy individuals showed little or no fluorescent DNA materials in the DEP high-field regions. Fluorescent T7 bacteriophage virus could be isolated directly from blood samples, and fluorescently stained mitochondria could be isolated from biological buffer samples. Using newer DEP microarray devices, high molecular weight (hmw) DNA could be isolated from serum and detected at levels as low as 8–16 ng/mL. PMID:23436471

Novel Technology for Enrichment of Biomolecules from Cell-Free Body Fluids and Subsequent DNA Sizing.

PubMed

Patel, Vipulkumar; Celec, Peter; Grunt, Magdalena; Schwarzenbach, Heidi; Jenneckens, Ingo; Hillebrand, Timo

2016-01-01

Circulating cell-free DNA (ccfDNA) is a promising diagnostic tool and its size fractionation is of interest. However, kits for isolation of ccfDNA available on the market are designed for small volumes hence processing large sample volumes is laborious. We have tested a new method that enables enrichment of ccfDNA from large volumes of plasma and subsequently allows size-fractionation of isolated ccfDNA into two fractions with individually established cut-off levels of ccfDNA length. This method allows isolation of low-abundant DNA as well as separation of long and short DNA molecules. This procedure may be important e.g., in prenatal diagnostics and cancer research that have been already confirmed by our primary experiments. Here, we report the results of selective separation of 200- and 500-bp long synthetic DNA fragments spiked in plasma samples. Furthermore, we size-fractionated ccfDNA from the plasma of pregnant women and verified the prevalence of fetal ccfDNA in all fractions.

A simple non-enzymatic method for the preparation of white spot syndrome virus (WSSV) DNA from the haemolymph of Marsupenaeus japonicus using FTA matrix cards.

PubMed

Sudhakaran, R; Mekata, T; Kono, T; Supamattaya, K; Linh, N T H; Suzuki, Y; Sakai, M; Itami, T

2009-07-01

White spot syndrome virus (WSSV) is an important shrimp pathogen responsible for large economic losses for the shrimp culture industry worldwide. The nucleic acids of the virus must be adequately preserved and transported from the field to the laboratory before molecular diagnostic analysis is performed. Here, we developed a new method to isolate WSSV-DNA using Flinders Technology Associates filter paper (FTA matrix card; Whatman) without centrifugation or hazardous steps involved. FTA technology is a new method allowing the simple collection, shipment and archiving of nucleic acids from haemolymph samples providing DNA protection against nucleases, oxidation, UV damage, microbial and fungal attack. DNA samples prepared from 10-fold dilutions of moribund shrimp haemolymph using FTA matrix cards were analysed using semi-quantitative and quantitative polymerase chain reaction (PCR) and were compared with two commercially available DNA isolation methods, the blood GenomicPrep Mini Spin Kit (GE Healthcare) and the DNAzol (Invitrogen). Sequence analysis was performed for the DNA samples prepared using the various isolation procedures and no differences in the sequence among these methods were identified. Results based on the initial copy number of DNA prepared from the GenomicPrep Mini Spin Kit are a little more sensitive than the DNA prepared from FTA matrix cards, whereas the DNAzol method is not suitable for blood samples. Our data shows the efficiency of retention capacity of WSSV-DNA samples from impregnated FTA matrix cards. Matrix cards were easy to store and ship for long periods of time. They provide ease of handling and are a reliable alternative for sample collection and for molecular detection and characterization of WSSV isolates.

Genotyping of Single Nucleotide Polymorphisms in DNA Isolated from Serum Using Sequenom MassARRAY Technology.

PubMed

Clendenen, Tess V; Rendleman, Justin; Ge, Wenzhen; Koenig, Karen L; Wirgin, Isaac; Currie, Diane; Shore, Roy E; Kirchhoff, Tomas; Zeleniuch-Jacquotte, Anne

2015-01-01

Large epidemiologic studies have the potential to make valuable contributions to the assessment of gene-environment interactions because they prospectively collected detailed exposure data. Some of these studies, however, have only serum or plasma samples as a low quantity source of DNA. We examined whether DNA isolated from serum can be used to reliably and accurately genotype single nucleotide polymorphisms (SNPs) using Sequenom multiplex SNP genotyping technology. We genotyped 81 SNPs using samples from 158 participants in the NYU Women's Health Study. Each participant had DNA from serum and at least one paired DNA sample isolated from a high quality source of DNA, i.e. clots and/or cell precipitates, for comparison. We observed that 60 of the 81 SNPs (74%) had high call frequencies (≥95%) using DNA from serum, only slightly lower than the 85% of SNPs with high call frequencies in DNA from clots or cell precipitates. Of the 57 SNPs with high call frequencies for serum, clot, and cell precipitate DNA, 54 (95%) had highly concordant (>98%) genotype calls across all three sample types. High purity was not a critical factor to successful genotyping. Our results suggest that this multiplex SNP genotyping method can be used reliably on DNA from serum in large-scale epidemiologic studies.

TECHNICAL BRIEF: Isolation of total DNA from postmortem human eye tissues and quality comparison between iris and retina

PubMed Central

Wang, Jay Ching Chieh; Wang, Aikun; Gao, Jiangyuan; Cao, Sijia; Samad, Idris; Zhang, Dean; Ritland, Carol; Cui, Jing Z.

2012-01-01

Background Recent genomic technologies have propelled our understanding of the mechanisms underlying complex eye diseases such as age-related macular degeneration (AMD). Genotyping postmortem eye tissues for known single nucleotide polymorphisms (SNPs) associated with AMD may prove valuable, especially when combined with information obtained through other methods such as immunohistochemistry, western blot, enzyme-linked immunosorbent assay (ELISA), and proteomics. Initially intending to genotype postmortem eye tissues for AMD-related SNPs, our group became interested in isolating and comparing the quality of DNA from the iris and retina of postmortem donor eyes. Since there is no previously published protocol in the literature on this topic, we present a protocol suitable for isolating high-quality DNA from postmortem eye tissues for genomic studies. Methods DNA from 33 retinal samples and 35 iris samples was extracted using the phenol-chloroform-isoamyl method from postmortem donor eye tissues. The quantity of DNA was measured with a spectrophotometer while the quality was checked using gel electrophoresis. The DNA samples were then amplified with PCR for the complement factor H (CFH) gene. The purified amplified products were then genotyped for the SNPs in the CFH gene. Results Regarding concentration, the retina yielded 936 ng/μl of DNA, while the iris yielded 78 ng/μl of DNA. Retinal DNA was also purer than iris DNA (260/280=1.78 vs. 1.46, respectively), and produced superior PCR results. Retinal tissue yielded significantly more DNA than the iris tissue per mg of sample (21.7 ng/μl/mg vs. 7.42 ng/μl/mg). Retinal DNA can be readily amplified with PCR, while iris DNA can also be amplified by adding bovine serum albumin. Overall, retinal tissues yielded DNA of superior quality, quantity, and suitability for genotyping and genomic studies. Conclusions The protocol presented here provides a clear and reliable method for isolating total DNA from postmortem eye tissues. Retinal tissue provides DNA of excellent quantity and quality for genotyping and downstream genomic studies. However, DNA isolated from iris tissues, and treated with bovine serum albumin, may also be a valuable source of DNA for genotyping and genomic studies. PMID:23288996

Bacterial and fungal DNA extraction from blood samples: automated protocols.

PubMed

Lorenz, Michael G; Disqué, Claudia; Mühl, Helge

2015-01-01

Automation in DNA isolation is a necessity for routine practice employing molecular diagnosis of infectious agents. To this end, the development of automated systems for the molecular diagnosis of microorganisms directly in blood samples is at its beginning. Important characteristics of systems demanded for routine use include high recovery of microbial DNA, DNA-free containment for the reduction of DNA contamination from exogenous sources, DNA-free reagents and consumables, ideally a walkaway system, and economical pricing of the equipment and consumables. Such full automation of DNA extraction evaluated and in use for sepsis diagnostics is yet not available. Here, we present protocols for the semiautomated isolation of microbial DNA from blood culture and low- and high-volume blood samples. The protocols include a manual pretreatment step followed by automated extraction and purification of microbial DNA.

Evaluation of DNA extraction methods for PCR-based detection of Listeria monocytogenes from vegetables.

PubMed

Vojkovska, H; Kubikova, I; Kralik, P

2015-03-01

Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014 The Society for Applied Microbiology.

Fluorometric determination of the DNA concentration in municipal drinking water.

PubMed Central

McCoy, W F; Olson, B H

1985-01-01

DNA concentrations in municipal drinking water samples were measured by fluorometry, using Hoechst 33258 fluorochrome. The concentration, extraction, and detection methods used were adapted from existing techniques. The method is reproducible, fast, accurate, and simple. The amounts of DNA per cell for five different bacterial isolates obtained from drinking water samples were determined by measuring DNA concentration and total cell concentration (acridine orange epifluorescence direct cell counting) in stationary pure cultures. The relationship between DNA concentration and epifluorescence total direct cell concentration in 11 different drinking water samples was linear and positive; the amounts of DNA per cell in these samples did not differ significantly from the amounts in pure culture isolates. We found significant linear correlations between DNA concentration and colony-forming unit concentration, as well as between epifluorescence direct cell counts and colony-forming unit concentration. DNA concentration measurements of municipal drinking water samples appear to monitor changes in bacteriological quality at least as well as total heterotrophic plate counting and epifluorescence direct cell counting. PMID:3890737

Isolation of genomic DNA from defatted oil seed residue of rapeseed (Brassica napus).

PubMed

Sadia, M; Rabbani, M A; Hameed, S; Pearce, S R; Malik, S A

2011-02-08

A simple protocol for obtaining pure, restrictable and amplifiable megabase genomic DNA from oil-free seed residue of Brassica napus, an important oil seed plant, has been developed. Oil from the dry seeds was completely recovered in an organic solvent and quantified gravimetrically followed by processing of the residual biomass (defatted seed residue) for genomic DNA isolation. The isolated DNA can be cut by a range of restriction enzymes. The method enables simultaneous isolation and recovery of lipids and genomic DNA from the same test sample, thus allowing two independent analyses from a single sample. Multiple micro-scale oil extraction from the commercial seeds gave approximately 39% oil, which is close to the usual oil recovery from standard oil seed. Most of the amplified fragments were scored in the range of 2.5 to 0.5 kb, best suited for scoring as molecular diagnostics.

KRAS detection in colonic tumors by DNA extraction from FTA paper: the molecular touch-prep.

PubMed

Petras, Melissa L; Lefferts, Joel A; Ward, Brian P; Suriawinata, Arief A; Tsongalis, Gregory J

2011-12-01

DNA isolated from formalin-fixed paraffin-embedded (FFPE) tissue is usually more degraded and contains more polymerase chain reaction (PCR) inhibitors than DNA isolated from nonfixed tissue. In addition, the tumor size and cellular heterogeneity found in tissue sections can often impact testing for molecular biomarkers. As a potential remedy to this situation, we evaluated the use of Whatman FTA paper cards for collection of colorectal tumor samples before tissue fixation and for isolation of DNA for use in a real-time PCR-based KRAS mutation assay. Eleven colon tumor samples were collected by making a cut into the fresh tumor and applying the Whatman FTA paper to the cut surface. Matched FFPE tissue blocks from these tumors were also collected for comparison. KRAS mutation analysis was carried out using the Applied Biosystems 7500 Fast Real-time PCR System using 7 independent custom TaqMan PCR assays. Of the 11 colon tumors sampled, 6 were positive for KRAS mutations in both the Whatman FTA paper preparations and corresponding FFPE samples. Whatman FTA paper cards for collection of colorectal tumor samples before tissue fixation and for isolation of DNA have many advantages including ease of use, intrinsic antimicrobial properties, long storage potential (stability of DNA over time), and a faster turnaround time for results. Extracted DNA should be suitable for most molecular diagnostic assays that use PCR techniques. This novel means of DNA preservation from surgical specimens would benefit from additional study and validation as a dependable and practical technique to preserve specimens for molecular testing.

Evaluation of DNA extraction methods for Bacillus anthracis spores isolated from spiked food samples.

PubMed

Thomas, M C; Shields, M J; Hahn, K R; Janzen, T W; Goji, N; Amoako, K K

2013-07-01

Nine commercial DNA extraction kits were evaluated for the isolation of DNA from 10-fold serial dilutions of Bacillus anthracis spores using quantitative real-time PCR (qPCR). The three kits determined by qPCR to yield the most sensitive and consistent detection (Epicenter MasterPure Gram Positive; MoBio PowerFood; ABI PrepSeq) were subsequently tested for their ability to isolate DNA from trace amounts of B. anthracis spores (approx. 6·5 × 10(1) and 1·3 × 10(2)  CFU in 25 ml or 50 g of food sample) spiked into complex food samples including apple juice, ham, whole milk and bagged salad and recovered with immunomagnetic separation (IMS). The MasterPure kit effectively and consistently isolated DNA from low amounts of B. anthracis spores captured from food samples. Detection was achieved from apple juice, ham, whole milk and bagged salad from as few as 65 ± 14, 68 ± 8, 66 ± 4 and 52 ± 16 CFU, respectively, and IMS samples were demonstrated to be free of PCR inhibitors. Detection of B. anthracis spores isolated from food by IMS differs substantially between commercial DNA extraction kits; however, sensitive results can be obtained with the MasterPure Gram Positive kit. The extraction protocol identified herein combined with IMS is novel for B. anthracis and allows detection of low levels of B. anthracis spores from contaminated food samples. © Her Majesty the Queen in Right of Canada [2013]. Reproduced with the permission of the Canadian Food Inspection Agency.

Rapid and effective processing of blood specimens for diagnostic PCR using filter paper and Chelex-100.

PubMed Central

Polski, J M; Kimzey, S; Percival, R W; Grosso, L E

1998-01-01

AIM: To provide a more efficient method for isolating DNA from peripheral blood for use in diagnostic DNA mutation analysis. METHODS: The use of blood impregnated filter paper and Chelex-100 in DNA isolation was evaluated and compared with standard DNA isolation techniques. RESULTS: In polymerase chain reaction (PCR) based assays of five point mutations, identical results were obtained with DNA isolated routinely from peripheral blood and isolated using the filter paper and Chelex-100 method. CONCLUSION: In the clinical setting, this method provides a useful alternative to conventional DNA isolation. It is easily implemented and inexpensive, and provides sufficient, stable DNA for multiple assays. The potential for specimen contamination is reduced because most of the steps are performed in a single microcentrifuge tube. In addition, this method provides for easy storage and transport of samples from the point of acquisition. PMID:9893748

Rapid and effective processing of blood specimens for diagnostic PCR using filter paper and Chelex-100.

PubMed

Polski, J M; Kimzey, S; Percival, R W; Grosso, L E

1998-08-01

To provide a more efficient method for isolating DNA from peripheral blood for use in diagnostic DNA mutation analysis. The use of blood impregnated filter paper and Chelex-100 in DNA isolation was evaluated and compared with standard DNA isolation techniques. In polymerase chain reaction (PCR) based assays of five point mutations, identical results were obtained with DNA isolated routinely from peripheral blood and isolated using the filter paper and Chelex-100 method. In the clinical setting, this method provides a useful alternative to conventional DNA isolation. It is easily implemented and inexpensive, and provides sufficient, stable DNA for multiple assays. The potential for specimen contamination is reduced because most of the steps are performed in a single microcentrifuge tube. In addition, this method provides for easy storage and transport of samples from the point of acquisition.

Co-precipitation of protein and polyester as a method to isolate high molecular weight DNA.

PubMed

Dixson, Jamie D

2005-02-01

DNA isolation is often the limiting step in genetic analysis using PCR and automated fragment analysis due to low quality or purity of DNA, the need to determine and adjust DNA concentrations after isolation etc. Several protocols have been developed which are either safe and provide good quality DNA or hazardous and provide excellent quality DNA. In this brief communication I describe a new and rapid method of DNA isolation which employs the co-precipitation of protein and polyester, in the presence of acetone, to remove contaminating proteins from a lysed-tissue sample, thus leaving high quality pure DNA. The advantages of this method are increased safety over the phenol:chloroform and the chaotrophic salt methods and increased purity over the salting-out method. Since the concentrations of DNA isolated using this method are relatively consistent regardless of the amount of starting tissue (within limits), adjustments of the DNA concentrations before use as templates in PCR's are not necessary.

Enterohemorrhagic Escherichia coli O157 in milk and dairy products from Libya: Isolation and molecular identification by partial sequencing of 16S rDNA

PubMed Central

Garbaj, Aboubaker M.; Awad, Enas M.; Azwai, Salah M.; Abolghait, Said K.; Naas, Hesham T.; Moawad, Ashraf A.; Gammoudi, Fatim T.; Barbieri, Ilaria; Eldaghayes, Ibrahim M.

2016-01-01

Aim: The aim of this work was to isolate and molecularly identify enterohemorrhagic Escherichia coli (EHEC) O157 in milk and dairy products in Libya, in addition; to clear the accuracy of cultural and biochemical identification as compared with molecular identification by partial sequencing of 16S rDNA for the existing isolates. Materials and Methods: A total of 108 samples of raw milk (cow, she-camel, and goat) and locally made dairy products (fermented cow’s milk, Maasora, Ricotta and ice cream) were collected from some regions (Janzour, Tripoli, Kremiya, Tajoura and Tobruk) in Libya. Samples were subjected to microbiological analysis for isolation of E. coli that was detected by conventional cultural and molecular method using polymerase chain reaction and partial sequencing of 16S rDNA. Results: Out of 108 samples, only 27 isolates were found to be EHEC O157 based on their cultural characteristics (Tellurite-Cefixime-Sorbitol MacConkey) that include 3 isolates from cow’s milk (11%), 3 isolates from she-camel’s milk (11%), two isolates from goat’s milk (7.4%) and 7 isolates from fermented raw milk samples (26%), isolates from fresh locally made soft cheeses (Maasora and Ricotta) were 9 (33%) and 3 (11%), respectively, while none of the ice cream samples revealed any growth. However, out of these 27 isolates, only 11 were confirmed to be E. coli by partial sequencing of 16S rDNA and E. coli O157 Latex agglutination test. Phylogenetic analysis revealed that majority of local E. coli isolates were related to E. coli O157:H7 FRIK944 strain. Conclusion: These results can be used for further studies on EHEC O157 as an emerging foodborne pathogen and its role in human infection in Libya. PMID:27956766

Effect of DNA extraction and sample preservation method on rumen bacterial population.

PubMed

Fliegerova, Katerina; Tapio, Ilma; Bonin, Aurelie; Mrazek, Jakub; Callegari, Maria Luisa; Bani, Paolo; Bayat, Alireza; Vilkki, Johanna; Kopečný, Jan; Shingfield, Kevin J; Boyer, Frederic; Coissac, Eric; Taberlet, Pierre; Wallace, R John

2014-10-01

The comparison of the bacterial profile of intracellular (iDNA) and extracellular DNA (eDNA) isolated from cow rumen content stored under different conditions was conducted. The influence of rumen fluid treatment (cheesecloth squeezed, centrifuged, filtered), storage temperature (RT, -80 °C) and cryoprotectants (PBS-glycerol, ethanol) on quality and quantity parameters of extracted DNA was evaluated by bacterial DGGE analysis, real-time PCR quantification and metabarcoding approach using high-throughput sequencing. Samples clustered according to the type of extracted DNA due to considerable differences between iDNA and eDNA bacterial profiles, while storage temperature and cryoprotectants additives had little effect on sample clustering. The numbers of Firmicutes and Bacteroidetes were lower (P < 0.01) in eDNA samples. The qPCR indicated significantly higher amount of Firmicutes in iDNA sample frozen with glycerol (P < 0.01). Deep sequencing analysis of iDNA samples revealed the prevalence of Bacteroidetes and similarity of samples frozen with and without cryoprotectants, which differed from sample stored with ethanol at room temperature. Centrifugation and consequent filtration of rumen fluid subjected to the eDNA isolation procedure considerably changed the ratio of molecular operational taxonomic units (MOTUs) of Bacteroidetes and Firmicutes. Intracellular DNA extraction using bead-beating method from cheesecloth sieved rumen content mixed with PBS-glycerol and stored at -80 °C was found as the optimal method to study ruminal bacterial profile. Copyright © 2013 Elsevier Ltd. All rights reserved.

[On the use of FTA technology for collection, archieving, and molecular analysis of microsporidia dna from clinical stool samples].

PubMed

Sokolova, O I; Dem'ianov, A V; Bovers, L S; Did'e, E S; Sokolova, Iu Ia

2011-01-01

The FTA technology was applied for sampling, archiving, and molecular analysis of the DNA isolated from stool samples to diagnose and identify microsporidia, the intracellular opportunistic parasites which induce malabsortion syndrome in immunosuppressed humans, particularly in patients with AIDS. Microsporidia DNA was successfully amplified in 6 of 50 stool samples of HIV-positive patients of the S. P. Botkin Memorial Infectious Disease Hospital (St. Petersburg) applied to FTA cards (FTA-Cars, Whatman Inc. Florham Park, NJ, USA). Amplicons (the fragments of rDNA) were directly sequenced, and microsporidia species--Encephalitozoon intestinalis, E. cuniculi, E. hellem, and Enterocytozoon bieneusi--were identified in Genbank by NCBI BLAST program. The FTA method of DNA immobilization is especially promising for epidemiological and field population studies which involve genotyping of microsporidia species and isolates.

Detection of African swine fever virus DNA in blood samples stored on FTA cards from asymptomatic pigs in Mbeya region, Tanzania.

PubMed

Braae, U C; Johansen, M V; Ngowi, H A; Rasmussen, T B; Nielsen, J; Uttenthal, Å

2015-02-01

The aim of the study was to assess whether blood samples collected onto FTA(®) cards could be used in combination with real-time PCR for the detection of African swine fever virus (ASFV) DNA in samples from resource-poor settings under the assumption that asymptomatically (sub-clinically) infected pigs may be present. Blood samples were collected from clinically healthy pigs from Mbeya Region, Tanzania. The blood samples were stored on FTA(®) cards and analysed by real-time PCR assays in duplicate; three pigs had high levels of viral DNA (Ct values of 27-29), and three pigs had a low level of viral DNA (Ct 36-45). Four pigs were positive in one of the duplicate samples only, but clear products of the expected size were obtained when the reactions were analysed by gel electrophoresis. For comparison, blood samples from pigs experimentally infected with either a pathogenic (OURT T88/1) or a non-pathogenic (OURT T88/3) isolate of ASFV were collected, stored on FTA(®) cards and analysed in the same way. The blood from pigs infected with the OURT T88/1 isolate showed high levels of viral DNA (Ct 22-33), whereas infection with non-pathogenic OURT T88/3 isolate resulted in only low levels of viral DNA (Ct 39) in samples collected at 10-14 days after inoculation. © 2013 Blackwell Verlag GmbH.

Robust and effective methodologies for cryopreservation and DNA extraction from anaerobic gut fungi.

PubMed

Solomon, Kevin V; Henske, John K; Theodorou, Michael K; O'Malley, Michelle A

2016-04-01

Cell storage and DNA isolation are essential to developing an expanded suite of microorganisms for biotechnology. However, many features of non-model microbes, such as an anaerobic lifestyle and rigid cell wall, present formidable challenges to creating strain repositories and extracting high quality genomic DNA. Here, we establish accessible, high efficiency, and robust techniques to store lignocellulolytic anaerobic gut fungi long term without specialized equipment. Using glycerol as a cryoprotectant, gut fungal isolates were preserved for a minimum of 23 months at -80 °C. Unlike previously reported approaches, this improved protocol is non-toxic and rapid, with samples surviving twice as long with negligible growth impact. Genomic DNA extraction for these isolates was optimized to yield samples compatible with next generation sequencing platforms (e.g. Illumina, PacBio). Popular DNA isolation kits and precipitation protocols yielded preps that were unsuitable for sequencing due to carbohydrate contaminants from the chitin-rich cell wall and extensive energy reserves of gut fungi. To address this, we identified a proprietary method optimized for hardy plant samples that rapidly yielded DNA fragments in excess of 10 kb with minimal RNA, protein or carbohydrate contamination. Collectively, these techniques serve as fundamental tools to manipulate powerful biomass-degrading gut fungi and improve their accessibility among researchers. Copyright © 2015 Elsevier Ltd. All rights reserved.

Efficacy of the detection of Legionella in hot and cold water samples by culture and PCR. I. Standardization of methods.

PubMed

Wójcik-Fatla, Angelina; Stojek, Nimfa Maria; Dutkiewicz, Jacek

2012-01-01

The aim of the present study was: - to compare methods for concentration and isolation of Legionella DNA from water; - to examine the efficacy of various modifications of PCR test (PCR, semi-nested PCR, and real-time PCR) for the detection of known numbers of Legionella pneumophila in water samples artificially contaminated with the strain of this bacterium and in randomly selected samples of environmental water, in parallel with examination by culture. It was found that filtration is much more effective than centrifugation for the concentration of DNA in water samples, and that the Qiamp DNA Mini-Kit is the most efficient for isolation of Legionella DNA from water. The semi-nested PCR and real-time PCR proved to be the most sensitive methods for detection of Legionella DNA in water samples. Both PCR modifications showed a high correlation with recovery of Legionella by culture (p<0.01), while no correlation occurred between the results of one-stage PCR and culture (p>0.1).

Forensic genetic analysis of bone remain samples.

PubMed

Siriboonpiputtana, T; Rinthachai, T; Shotivaranon, J; Peonim, V; Rerkamnuaychoke, B

2018-03-01

DNA typing from degraded human remains is still challenging forensic DNA scientists not only in the prospective of DNA purification but also in the interpretation of established DNA profiles and data manipulation, especially in mass fatalities. In this report, we presented DNA typing protocol to investigate many skeletal remains in different degrees of decomposing. In addition, we established the grading system aiming for prior determination of the association between levels of decomposing and overall STR amplification efficacy. A total of 80 bone samples were subjected to DNA isolation using the modified DNA IQ™ System (Promega, USA) for bone extraction following with STR analysis using the AmpFLSTR Identifiler ® (Thermo Fisher Scientific, USA). In low destruction group, complete STR profiles were observed as 84.4% whereas partial profiles and non-amplified were found as 9.4% and 6.2%, respectively. Moreover, in medium destruction group, both complete and partial STR profiles were observed as 31.2% while 37.5% of this group was unable to amplify. Nevertheless, we could not purify DNA and were unable to generate STR profile in any sample from the high destroyed bone samples. Compact bones such as femur and humerus have high successful amplification rate superior than loose/spongy bones. Furthermore, costal cartilage could be a designate specimen for DNA isolation in a case of the body that was discovered approximately to 3 days after death which enabled to isolate high quality and quantity of DNA, reduce time and cost, and do not require special tools such as freezer mill. Copyright © 2018 Elsevier B.V. All rights reserved.

Comparison of hard tissues that are useful for DNA analysis in forensic autopsy.

PubMed

Kaneko, Yu; Ohira, Hiroshi; Tsuda, Yukio; Yamada, Yoshihiro

2015-11-01

Forensic analysis of DNA from hard tissues can be important when investigating a variety of cases resulting from mass disaster or criminal cases. This study was conducted to evaluate the most suitable tissues, method and sample size for processing of hard tissues prior to DNA isolation. We also evaluated the elapsed time after death in relation to the quantity of DNA extracted. Samples of hard tissues (37 teeth, 42 skull, 42 rib, and 39 nails) from 42 individuals aged between 50 and 83 years were used. The samples were taken from remains following forensic autopsy (from 2 days to 2 years after death). To evaluate the integrity of the nuclear DNA isolated, the percentage of allele calls for short tandem repeat profiles were compared between the hard tissues. DNA typing results indicated that until 1 month after death, any of the four hard tissue samples could be used as an alternative to teeth, allowing analysis of all of the loci. However, in terms of the sampling site, collection method and sample size adjustment, the rib appeared to be the best choice in view of the ease of specimen preparation. Our data suggest that the rib could be an alternative hard tissue sample for DNA analysis of human remains. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

The impact of lymphocyte isolation on induced DNA damage in human blood samples measured by the comet assay.

PubMed

Bausinger, Julia; Speit, Günter

2016-09-01

The comet assay is frequently used in human biomonitoring for the detection of exposure to genotoxic agents. Peripheral blood samples are most frequently used and tested either as whole blood or after isolation of lymphocytes (i.e. peripheral blood mononuclear cells, PBMC). To investigate a potential impact of lymphocyte isolation on induced DNA damage in human blood samples, we exposed blood ex vivo to mutagens with different modes of genotoxic action. The comet assay was performed either directly with whole blood at the end of the exposure period or with lymphocytes isolated directly after exposure. In addition to the recommended standard protocol for lymphocyte isolation, a shortened protocol was established to optimise the isolation procedure. The results indicate that the effects of induced DNA strand breaks and alkali-labile sites induced by ionising radiation and alkylants, respectively, are significantly reduced in isolated lymphocytes. In contrast, oxidative DNA base damage (induced by potassium bromate) and stable bulky adducts (induced by benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide; BPDE) seem to be less affected. Our findings suggest that in vivo-induced DNA damage might also be reduced in isolated lymphocytes in comparison with the whole blood depending of the types of DNA damage induced. Because only small genotoxic effects can generally be expected in human biomonitoring studies with the comet assay after occupational and environmental exposure to genotoxic agents, any loss might be relevant and should be avoided. The possibility of such effects and their potential impact on variability of comet assay results in human biomonitoring should be considered when performing or evaluating such kind of studies. © The Author 2016. Published by Oxford University Press on behalf of the UK Environmental Mutagen Society. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

DNA methylation profiling of genomic DNA isolated from urine in diabetic chronic kidney disease: A pilot study

PubMed Central

Sexton-Oates, Alexandra; Carmody, Jake; Ekinci, Elif I.; Dwyer, Karen M.; Saffery, Richard

2018-01-01

Aim To characterise the genomic DNA (gDNA) yield from urine and quality of derived methylation data generated from the widely used Illuminia Infinium MethylationEPIC (HM850K) platform and compare this with buffy coat samples. Background DNA methylation is the most widely studied epigenetic mark and variations in DNA methylation profile have been implicated in diabetes which affects approximately 415 million people worldwide. Methods QIAamp Viral RNA Mini Kit and QIAamp DNA micro kit were used to extract DNA from frozen and fresh urine samples as well as increasing volumes of fresh urine. Matched buffy coats to the frozen urine were also obtained and DNA was extracted from the buffy coats using the QIAamp DNA Mini Kit. Genomic DNA of greater concentration than 20μg/ml were used for methylation analysis using the HM850K array. Results Irrespective of extraction technique or the use of fresh versus frozen urine samples, limited genomic DNA was obtained using a starting sample volume of 5ml (0–0.86μg/mL). In order to optimize the yield, we increased starting volumes to 50ml fresh urine, which yielded only 0–9.66μg/mL A different kit, QIAamp DNA Micro Kit, was trialled in six fresh urine samples and ten frozen urine samples with inadequate DNA yields from 0–17.7μg/mL and 0–1.6μg/mL respectively. Sufficient genomic DNA was obtained from only 4 of the initial 41 frozen urine samples (10%) for DNA methylation profiling. In comparison, all four buffy coat samples (100%) provided sufficient genomic DNA. Conclusion High quality data can be obtained provided a sufficient yield of genomic DNA is isolated. Despite optimizing various extraction methodologies, the modest amount of genomic DNA derived from urine, may limit the generalisability of this approach for the identification of DNA methylation biomarkers of chronic diabetic kidney disease. PMID:29462136

DNA methylation profiling of genomic DNA isolated from urine in diabetic chronic kidney disease: A pilot study.

PubMed

Lecamwasam, Ashani; Sexton-Oates, Alexandra; Carmody, Jake; Ekinci, Elif I; Dwyer, Karen M; Saffery, Richard

2018-01-01

To characterise the genomic DNA (gDNA) yield from urine and quality of derived methylation data generated from the widely used Illuminia Infinium MethylationEPIC (HM850K) platform and compare this with buffy coat samples. DNA methylation is the most widely studied epigenetic mark and variations in DNA methylation profile have been implicated in diabetes which affects approximately 415 million people worldwide. QIAamp Viral RNA Mini Kit and QIAamp DNA micro kit were used to extract DNA from frozen and fresh urine samples as well as increasing volumes of fresh urine. Matched buffy coats to the frozen urine were also obtained and DNA was extracted from the buffy coats using the QIAamp DNA Mini Kit. Genomic DNA of greater concentration than 20μg/ml were used for methylation analysis using the HM850K array. Irrespective of extraction technique or the use of fresh versus frozen urine samples, limited genomic DNA was obtained using a starting sample volume of 5ml (0-0.86μg/mL). In order to optimize the yield, we increased starting volumes to 50ml fresh urine, which yielded only 0-9.66μg/mL A different kit, QIAamp DNA Micro Kit, was trialled in six fresh urine samples and ten frozen urine samples with inadequate DNA yields from 0-17.7μg/mL and 0-1.6μg/mL respectively. Sufficient genomic DNA was obtained from only 4 of the initial 41 frozen urine samples (10%) for DNA methylation profiling. In comparison, all four buffy coat samples (100%) provided sufficient genomic DNA. High quality data can be obtained provided a sufficient yield of genomic DNA is isolated. Despite optimizing various extraction methodologies, the modest amount of genomic DNA derived from urine, may limit the generalisability of this approach for the identification of DNA methylation biomarkers of chronic diabetic kidney disease.

[Validation of Differential Extraction Kit in forensic sexual assault cases].

PubMed

Wu, Dan; Cao, Yu; Xu, Yan; He, Bai-Fang; Bi, Gang; Zhou, Huai-Gu

2009-12-01

To evaluate the validity of Differential Extraction Kit in isolating spermatozoa and epithelial cell DNA from mixture samples. Selective lysis of spermatid and epithelial cells combined with paramagnetic particle method were applied to extract the DNA from the mock samples under controlled conditions and forensic case samples, and template DNA were analyzed by STR genotype method. This Differential Extraction Kit is efficient to obtain high quality spermatid and epithelial cell DNA from the mixture samples with different proportion of sperm to epithelial cell. The Differential Extraction Kit can be applied in DNA extraction for mixed stain from forensic sexual assault samples.

Isolation of a complete circular virus genome sequence from an Alaskan black-capped chickadee (Poecile atricapillus) gastrointestinal tract sample.

USGS Publications Warehouse

Hanna, Zachary R.; Runckel, Charles; Fuchs, Jerome; DeRisi, Joseph L.; Mindell, David P.; Van Hemert, Caroline R.; Handel, Colleen M.; Dumbacher, John P.

2015-01-01

We report here the genome sequence of a circular virus isolated from samples of an Alaskan black-capped chickadee (Poecile atricapillus) gastrointestinal tract. The genome is 2,152 bp in length and is most similar (30 to 44.5% amino acid identity) to the genome sequences of other single-stranded DNA (ssDNA) circular viruses belonging to the gemycircularvirus group.

Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods.

PubMed

Kaneko, Ikuko; Miyamoto, Kazuaki; Mimura, Kanako; Yumine, Natsuko; Utsunomiya, Hirotoshi; Akimoto, Shigeru; McClane, Bruce A

2011-11-01

To prevent food-borne bacterial diseases and to trace bacterial contamination events to foods, microbial source tracking (MST) methods provide important epidemiological information. To apply molecular methods to MST, it is necessary not only to amplify bacterial cells to detection limit levels but also to prepare DNA with reduced inhibitory compounds and contamination. Isolates carrying the Clostridium perfringens enterotoxin gene (cpe) on the chromosome or a plasmid rank among the most important food-borne pathogens. Previous surveys indicated that cpe-positive C. perfringens isolates are present in only ∼5% of nonoutbreak food samples and then only at low numbers, usually less than 3 cells/g. In this study, four molecular assays for the detection of cpe-positive C. perfringens isolates, i.e., ordinary PCR, nested PCR, real-time PCR, and loop-mediated isothermal amplification (LAMP), were developed and evaluated for their reliability using purified DNA. For use in the artificial contamination of meat samples, DNA templates were prepared by three different commercial DNA preparation kits. The four molecular assays always detected cpe when >10³ cells/g of cpe-positive C. perfringens were present, using any kit. Of three tested commercial DNA preparation kits, the InstaGene matrix kit appeared to be most suitable for the testing of a large number of samples. By using the InstaGene matrix kit, the four molecular assays efficiently detected cpe using DNA prepared from enrichment culture specimens of meat samples contaminated with low numbers of cpe-positive C. perfringens vegetative cells or spores. Overall, the current study developed molecular assay protocols for MST to detect the contamination of foods with low numbers of cells, and at a low frequency, of cpe-positive C. perfringens isolates.

Phylogenetic and physiological diversity of microorganisms isolated from a deep greenland glacier ice core

NASA Technical Reports Server (NTRS)

Miteva, V. I.; Sheridan, P. P.; Brenchley, J. E.

2004-01-01

We studied a sample from the GISP 2 (Greenland Ice Sheet Project) ice core to determine the diversity and survival of microorganisms trapped in the ice at least 120,000 years ago. Previously, we examined the phylogenetic relationships among 16S ribosomal DNA (rDNA) sequences in a clone library obtained by PCR amplification from genomic DNA extracted from anaerobic enrichments. Here we report the isolation of nearly 800 aerobic organisms that were grouped by morphology and amplified rDNA restriction analysis patterns to select isolates for further study. The phylogenetic analyses of 56 representative rDNA sequences showed that the isolates belonged to four major phylogenetic groups: the high-G+C gram-positives, low-G+C gram-positives, Proteobacteria, and the Cytophaga-Flavobacterium-Bacteroides group. The most abundant and diverse isolates were within the high-G+C gram-positive cluster that had not been represented in the clone library. The Jukes-Cantor evolutionary distance matrix results suggested that at least 7 isolates represent new species within characterized genera and that 49 are different strains of known species. The isolates were further categorized based on the isolation conditions, temperature range for growth, enzyme activity, antibiotic resistance, presence of plasmids, and strain-specific genomic variations. A significant observation with implications for the development of novel and more effective cultivation methods was that preliminary incubation in anaerobic and aerobic liquid prior to plating on agar media greatly increased the recovery of CFU from the ice core sample.

Modification of gDNA extraction from soil for PCR designed for the routine examination of soil samples contaminated with Toxocara spp. eggs.

PubMed

Borecka, A; Gawor, J

2008-06-01

A modification of gDNA extraction was developed for the polymerase chain reaction (PCR) technique, intended for the detection and differentiation of Toxocara spp. eggs in soil or sediments. Sand samples from sandpits confirmed as being contaminated with Toxocara spp. eggs by the flotation technique were analysed by PCR. The use of proteinase K made it possible to obtain genomic DNA from the sample without needing to isolate eggs using flotation or to inactivate PCR inhibitors present in the sand. Specific primers in the PCR reaction allowed discrimination between T. canis and T. cati eggs. The modification simplified the procedure, thanks to eliminating the step of gDNA isolation from eggs, which is both laborious and difficult.

Amoeba-Resisting Bacteria and Ventilator-Associated Pneumonia

PubMed Central

La Scola, Bernard; Boyadjiev, Ioanna; Greub, Gilbert; Khamis, Atieh; Martin, Claude

2003-01-01

To evaluate the role of amoeba-associated bacteria as agents of ventilator-associated pneumonia (VAP), we tested the water from an intensive care unit (ICU) every week for 6 months for such bacteria isolates; serum samples and bronchoalveolar lavage samples (BAL) were also obtained from 30 ICU patients. BAL samples were examined for amoeba-associated bacteria DNA by suicide-polymerase chain reaction, and serum samples were tested against ICU amoeba-associated bacteria. A total of 310 amoeba-associated bacteria from10 species were isolated. Twelve of 30 serum samples seroconverted to one amoeba-associated bacterium isolated in the ICU, mainly Legionella anisa and Bosea massiliensis, the most common isolates from water (p=0.021). Amoeba-associated bacteria DNA was detected in BAL samples from two patients whose samples later seroconverted. Seroconversion was significantly associated with VAP and systemic inflammatory response syndrome, especially in patients for whom no etiologic agent was found by usual microbiologic investigations. Amoeba-associated bacteria might be a cause of VAP in ICUs, especially when microbiologic investigations are negative. PMID:12890321

Successful isolation and PCR amplification of DNA from National Institute of Standards and Technology herbal dietary supplement standard reference material powders and extracts.

PubMed

Cimino, Matthew T

2010-03-01

Twenty-four herbal dietary supplement powder and extract reference standards provided by the National Institute of Standards and Technology (NIST) were investigated using three different commercially available DNA extraction kits to evaluate DNA availability for downstream nucleotide-based applications. The material included samples of Camellia, Citrus, Ephedra, Ginkgo, Hypericum, Serenoa, And Vaccinium. Protocols from Qiagen, MoBio, and Phytopure were used to isolate and purify DNA from the NIST standards. The resulting DNA concentration was quantified using SYBR Green fluorometry. Each of the 24 samples yielded DNA, though the concentration of DNA from each approach was notably different. The Phytopure method consistently yielded more DNA. The average yield ratio was 22 : 3 : 1 (ng/microL; Phytopure : Qiagen : MoBio). Amplification of the internal transcribed spacer II region using PCR was ultimately successful in 22 of the 24 samples. Direct sequencing chromatograms of the amplified material suggested that most of the samples were comprised of mixtures. However, the sequencing chromatograms of 12 of the 24 samples were sufficient to confirm the identity of the target material. The successful extraction, amplification, and sequencing of DNA from these herbal dietary supplement extracts and powders supports a continued effort to explore nucleotide sequence-based tools for the authentication and identification of plants in dietary supplements. (c) Georg Thieme Verlag KG Stuttgart . New York.

An efficient, reliable and inexpensive device for the rapid homogenization of multiple tissue samples by centrifugation.

PubMed

Ilyin, S E; Plata-Salamán, C R

2000-02-15

Homogenization of tissue samples is a common first step in the majority of current protocols for RNA, DNA, and protein isolation. This report describes a simple device for centrifugation-mediated homogenization of tissue samples. The method presented is applicable to RNA, DNA, and protein isolation, and we show examples where high quality total cell RNA, DNA, and protein were obtained from brain and other tissue samples. The advantages of the approach presented include: (1) a significant reduction in time investment relative to hand-driven or individual motorized-driven pestle homogenization; (2) easy construction of the device from inexpensive parts available in any laboratory; (3) high replicability in the processing; and (4) the capacity for the parallel processing of multiple tissue samples, thus allowing higher efficiency, reliability, and standardization.

Identification of multiple mRNA and DNA sequences from small tissue samples isolated by laser-assisted microdissection.

PubMed

Bernsen, M R; Dijkman, H B; de Vries, E; Figdor, C G; Ruiter, D J; Adema, G J; van Muijen, G N

1998-10-01

Molecular analysis of small tissue samples has become increasingly important in biomedical studies. Using a laser dissection microscope and modified nucleic acid isolation protocols, we demonstrate that multiple mRNA as well as DNA sequences can be identified from a single-cell sample. In addition, we show that the specificity of procurement of tissue samples is not compromised by smear contamination resulting from scraping of the microtome knife during sectioning of lesions. The procedures described herein thus allow for efficient RT-PCR or PCR analysis of multiple nucleic acid sequences from small tissue samples obtained by laser-assisted microdissection.

The effect of dilution and the use of a post-extraction nucleic acid purification column on the accuracy, precision, and inhibition of environmental DNA samples

USGS Publications Warehouse

Mckee, Anna M.; Spear, Stephen F.; Pierson, Todd W.

2015-01-01

Isolation of environmental DNA (eDNA) is an increasingly common method for detecting presence and assessing relative abundance of rare or elusive species in aquatic systems via the isolation of DNA from environmental samples and the amplification of species-specific sequences using quantitative PCR (qPCR). Co-extracted substances that inhibit qPCR can lead to inaccurate results and subsequent misinterpretation about a species’ status in the tested system. We tested three treatments (5-fold and 10-fold dilutions, and spin-column purification) for reducing qPCR inhibition from 21 partially and fully inhibited eDNA samples collected from coastal plain wetlands and mountain headwater streams in the southeastern USA. All treatments reduced the concentration of DNA in the samples. However, column purified samples retained the greatest sensitivity. For stream samples, all three treatments effectively reduced qPCR inhibition. However, for wetland samples, the 5-fold dilution was less effective than other treatments. Quantitative PCR results for column purified samples were more precise than the 5-fold and 10-fold dilutions by 2.2× and 3.7×, respectively. Column purified samples consistently underestimated qPCR-based DNA concentrations by approximately 25%, whereas the directional bias in qPCR-based DNA concentration estimates differed between stream and wetland samples for both dilution treatments. While the directional bias of qPCR-based DNA concentration estimates differed among treatments and locations, the magnitude of inaccuracy did not. Our results suggest that 10-fold dilution and column purification effectively reduce qPCR inhibition in mountain headwater stream and coastal plain wetland eDNA samples, and if applied to all samples in a study, column purification may provide the most accurate relative qPCR-based DNA concentrations estimates while retaining the greatest assay sensitivity.

Diagnosis of duck plague in waterfowl by polymerase chain reaction

USGS Publications Warehouse

Hansen, W.R.; Nashold, S.W.; Docherty, D.E.; Brown, S.E.; Knudson, D.L.

2000-01-01

A recently developed polymerase chain reaction (PCR) assay was used for diagnosis of duck plague in waterfowl tissues from past and current cases of waterfowl mortality and to identify duck plague virus in combined cloacal/oral-pharyngeal swab samples from healthy mallards (Anas platyrhynchos) after a disease outbreak. The PCR was able to detect viral DNA from all the individual or pooled tissues assayed from 10 waterfowl, including liver and spleen samples from three Muscovy ducks (Cairina moschata domesticus) that did not yield virus isolates. The strong staining intensity of the PCR products from the waterfowl tissues indicated that large amounts of virus were present, even when virus was not isolated. Duck plague DNA was also detected in a cloacal swab sample from a wood duck (Aix sponsa) carcass submitted for diagnosis. The PCR assay identified duck plague DNA in 13 swab samples that produced virus isolates from carrier mallards sampled in 1981 after a duck plague die-off. The duck plague PCR clearly demonstrated the ability to quickly diagnose duck plague in suspect mortality cases and to detect virus shed by carrier waterfowl.

Genomic fragmentation and extrachromosomal telomeric repeats impact assessment of telomere length in human spermatozoa: quantitative experiments and systematic review.

PubMed

Kurjanowicz, P; Moskovtsev, S; Librach, C

2017-11-01

Can differences in DNA isolation alter assessment of sperm telomere length (spTL) and do they account for conflicting results in the literature on spTL and male fertility? DNA isolation methods preferentially include or exclude short, extrachromosomal (EC) telomere-specific sequences that alter spTL measurements, and are responsible for a proportion of the disparity observed between investigations. The relationship between spTL and male fertility has become an active area of research. The results across investigations, however, have been discordant, generating a need to critically evaluate the existing body of knowledge to guide future investigations. Quantitative experiments determined the effect of DNA isolation on the integrity of sperm DNA and measures of spTL, while a systematic analysis of the current literature evaluated the effect of DNA isolation and study design on experimental outcomes. Two DNA isolation methods were compared: Genomic Tips which isolate 'High Molecular Weight' (HMW) DNA exclusively, and QIAamp® DNA Mini which isolates 'Total' genomic DNA irrespective of size. DNA quality was assessed via field inversion gel electrophoresis (FIGE) and spTL was measured via terminal restriction fragment analysis. In addition, major databases in medicine, health and the life sciences were subject to a targeted search, and results were independently screened according to defined exclusion/inclusion criterion. Findings from primary articles were analyzed for concordance and study designs were compared across six moderator variables (sample size, participant age, fertility status, semen fraction, telomere population and type of analysis). HMW DNA spTL was significantly longer than spTL measured from total DNA (P < 0.01), indicating that Total DNA contained short, EC telomeric repeats that shifted downstream assessment towards shorter spTL. HMW DNA spTL reflected the length of intact, chromosomal telomeres. Major findings on spTL showed the greatest concordance amongst studies that implemented HMW DNA isolation prior to spTL assessment. Studies that utilized Total DNA varied in concordance, but outcomes were similar if (i) a comparative analysis was applied or (ii) a sample size threshold of 81 was achieved for correlative analysis. Chromosomal and EC telomeric DNA were distinguished based on outcomes of HMW DNA isolation and size. Further experiments are required to determine the nature and function of these two types of telomeric sequences. This study reveals a dramatic impact of upstream DNA processing and study design on measurements of spTL, which accounts for conflicting results in the literature. Future assessments of spTL should incorporate independent detection of chromosomal and EC telomeric DNA and specific experimental planning. This study was funded by CReATe Fertility Centre, Toronto, Ontario, Canada. The authors have declared no conflict of interest. N/A. © The Author 2017. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Molecular Characterization of Watermelon Chlorotic Stunt Virus (WmCSV) from Palestine

PubMed Central

Ali-Shtayeh, Mohammed S.; Jamous, Rana M.; Mallah, Omar B.; Abu-Zeitoun, Salam Y.

2014-01-01

The incidence of watermelon chlorotic stunt disease and molecular characterization of the Palestinian isolate of Watermelon chlorotic stunt virus (WmCSV-[PAL]) are described in this study. Symptomatic leaf samples obtained from watermelon Citrullus lanatus (Thunb.), and cucumber (Cucumis sativus L.) plants were tested for WmCSV-[PAL] infection by polymerase chain reaction (PCR) and Rolling Circle Amplification (RCA). Disease incidence ranged between 25%–98% in watermelon fields in the studied area, 77% of leaf samples collected from Jenin were found to be mixed infected with WmCSV-[PAL] and SLCV. The full-length DNA-A and DNA-B genomes of WmCSV-[PAL] were amplified and sequenced, and the sequences were deposited in the GenBank. Sequence analysis of virus genomes showed that DNA-A and DNA-B had 97.6%–99.42% and 93.16%–98.26% nucleotide identity with other virus isolates in the region, respectively. Sequence analysis also revealed that the Palestinian isolate of WmCSV shared the highest nucleotide identity with an isolate from Israel suggesting that the virus was introduced to Palestine from Israel. PMID:24956181

DNA cards: determinants of DNA yield and quality in collecting genetic samples for pharmacogenetic studies.

PubMed

Mas, Sergi; Crescenti, Anna; Gassó, Patricia; Vidal-Taboada, Jose M; Lafuente, Amalia

2007-08-01

As pharmacogenetic studies frequently require establishment of DNA banks containing large cohorts with multi-centric designs, inexpensive methods for collecting and storing high-quality DNA are needed. The aims of this study were two-fold: to compare the amount and quality of DNA obtained from two different DNA cards (IsoCode Cards or FTA Classic Cards, Whatman plc, Brentford, Middlesex, UK); and to evaluate the effects of time and storage temperature, as well as the influence of anticoagulant ethylenediaminetetraacetic acid on the DNA elution procedure. The samples were genotyped by several methods typically used in pharmacogenetic studies: multiplex PCR, PCR-restriction fragment length polymorphism, single nucleotide primer extension, and allelic discrimination assay. In addition, they were amplified by whole genome amplification to increase genomic DNA mass. Time, storage temperature and ethylenediaminetetraacetic acid had no significant effects on either DNA card. This study reveals the importance of drying blood spots prior to isolation to avoid haemoglobin interference. Moreover, our results demonstrate that re-isolation protocols could be applied to increase the amount of DNA recovered. The samples analysed were accurately genotyped with all the methods examined herein. In conclusion, our study shows that both DNA cards, IsoCode Cards and FTA Classic Cards, facilitate genetic and pharmacogenetic testing for routine clinical practice.

Acidophiles of saline water at thermal vents of Vulcano, Italy.

PubMed

Simmons, Susan; Norris, R

2002-06-01

DNA was extracted from samples taken from close to acidic hydrothermal vents on shore of the Aeolian Island of Vulcano (Italy). RNA gene sequences were amplified by PCR, cloned, and sequenced. A sequence with an origin in samples at 35 degrees and 45 degrees C corresponded to that of a novel Acidithiobacillus species that was isolated from water close to the vents. Novel, iron-oxidizing mesophilic acidophiles were isolated through enrichment cultures with ferrous iron but were not represented in the clone banks of environmental rDNA. These acidophiles were related to Thiobacillus prosperus, which was isolated previously from Vulcano. The archaeal sequences that comprised a clone bank representing a high-temperature sample (75 degrees C) corresponded to those of Acidianus brierleyi and of thermophiles previously isolated from Vulcano, Thermoplasma volcanium and Acidianus infernus.

[Molecular typing of 12 Brucella strains isolated in Guizhou province in 2010-2013].

PubMed

Wang, Yue; Chen, Hong; Liu, Ying; Zhou, Jingzhu; Li, Shijun; Hang, Yan; Tang, Guangpeng; Wang, Dingming; Chen, Guichun

2015-09-01

To identify and characterize the Brucella strains from Guizhou province in 2010-2013. A total of 12 strains of Brucella suspicious bacteria were isolated in Guizhou province from 2010 to 2013. Four strains (GZLL3, GZLL4, GZLL11 and SH2) were isolated from goat blood samples and eight strains (SH4, GZZY, GZSQ, GZZA, BR13001, BR13004, BR13005 and BR13006) were isolated from blood samples of patient 12 Brucella suspicious strains were identified and characterized using conventional methods. Brucella genus specific gene BCSP31-based PCR (BCSP31-PCR) was used to identify the genus of Brucella and IS711 insert sequence-based PCR (AMOS-PCR) was applied to identify the species of Brucella strains. Goats and patients originated Brucella strains were comparatively analysed using Pulse-field Gel Electrophoresis (PFGE). Both of conventional methods and PCR identified the 12 Brucella suspicious strains as B. melitensis biotype 3. BCSP31-PCR identification results showed that a specific DNA bands (223 bp) were detected in all the 12 strains and positive control samples with no DNA band in negative samples. AMOS-PCR amplified a 731 bp-DNA bands in all the 12 strains, with 731 bp, 498 bp and 275 bp in M5, S2 and A19 strains, respectively, and no DNA band was detected in the negative control samples. PFGE analysis showed that 12 Brucella isolates from patients and goats showed consistent PFGE patterns with the digestion of restriction enzyme Xba I. The epidemic species/type of Brucella in both human and animal in Guizhou province was B. melitensis biotype 3 and goat was the main animal source of infection of brucellosis in Guizhou province.

Comparisons of molecular karyotype and RAPD patterns of anuran trypanosome isolates during long-term in vitro cultivation.

PubMed

Lun, Z R; Desser, S S

1996-01-01

The patterns of random amplified fragments and molecular karyotypes of 12 isolates of anuran trypanosomes continuously cultured in vitro were compared by random amplified polymorphic DNA (RAPD) analysis and pulsed field gradient gel electrophoresis (PFGE). The time interval between preparation of two series of samples was one year. Changes were not observed in the number and size of sharp, amplified fragments of DNA samples from both series examined with the ten primers used. Likewise, changes in the molecular karyotypes were not detected between the two samples of these isolates. These results suggest that the molecular karyotype and the RAPD patterns of the anuran trypanosomes remain stable after being cultured continuously in vitro for one year.

Isolating Viral and Host RNA Sequences from Archival Material and Production of cDNA Libraries for High-Throughput DNA Sequencing

PubMed Central

Xiao, Yongli; Sheng, Zong-Mei; Taubenberger, Jeffery K.

2015-01-01

The vast majority of surgical biopsy and post-mortem tissue samples are formalin-fixed and paraffin-embedded (FFPE), but this process leads to RNA degradation that limits gene expression analysis. As an example, the viral RNA genome of the 1918 pandemic influenza A virus was previously determined in a 9-year effort by overlapping RT-PCR from post-mortem samples. Using the protocols described here, the full genome of the 1918 virus at high coverage was determined in one high-throughput sequencing run of a cDNA library derived from total RNA of a 1918 FFPE sample after duplex-specific nuclease treatments. This basic methodological approach should assist in the analysis of FFPE tissue samples isolated over the past century from a variety of infectious diseases. PMID:26344216

Molecular characterization of Hepatozoon sp. in cats from São Luís Island, Maranhão, Northeastern Brazil.

PubMed

de Bortoli, Caroline P; André, Marcos R; Braga, Maria do Socorro C; Machado, Rosangela Zacarias

2011-10-01

Few molecular studies have been done concerning the molecular characterization of Hepatozoon species among domestic and wild felids. The present work aimed to characterize molecularly the presence of Hepatozoon sp. DNA in cat blood samples from São Luís Island, Maranhão state, Northeastern Brazil. EDTA-whole blood samples were collected from 200 domestic cats with outdoor and wood areas access from São Luís, Maranhão, Brazil. Each sample of extracted DNA was used as a template in PCR reactions aiming to amplify a partial sequence of 18S rRNA of Hepatozoon spp. We also performed sequence alignment to establish the identity of the parasite species infecting these animals using DNA sequences based on 18S rRNA. From 200 sampled cats, Hepatozoon DNA was only found in one animal (0.5%). The found Hepatozoon DNA showed 97% of identity with Hemobartonella felis isolates 1 and 2 from Spain. When analyzing the phylogenetic tree, the found Hepatozoon DNA was in the same clade than H. felis isolates. Our findings suggest that more than one species of Hepatozoon could infect felids in Brazil.

Identification of Bacterial Species in Kuwaiti Waters Through DNA Sequencing

NASA Astrophysics Data System (ADS)

Chen, K.

2017-01-01

With an objective of identifying the bacterial diversity associated with ecosystem of various Kuwaiti Seas, bacteria were cultured and isolated from 3 water samples. Due to the difficulties for cultured and isolated fecal coliforms on the selective agar plates, bacterial isolates from marine agar plates were selected for molecular identification. 16S rRNA genes were successfully amplified from the genome of the selected isolates using Universal Eubacterial 16S rRNA primers. The resulted amplification products were subjected to automated DNA sequencing. Partial 16S rDNA sequences obtained were compared directly with sequences in the NCBI database using BLAST as well as with the sequences available with Ribosomal Database Project (RDP).

Evaluation of a Multiplex PCR Assay for the Identification of Salmonella Serovars Enteritidis and Typhimurium Using Retail and Abattoir Samples.

PubMed

Ogunremi, Dele; Nadin-Davis, Susan; Dupras, Andrée Ann; Márquez, Imelda Gálvan; Omidi, Katayoun; Pope, Louise; Devenish, John; Burke, Teresa; Allain, Ray; Leclair, Daniel

2017-02-01

A multiplex PCR was developed to identify the two most common serovars of Salmonella causing foodborne illness in Canada, namely, serovars Enteritidis and Typhimurium. The PCR was designed to amplify DNA fragments from four Salmonella genes, namely, invA gene (211-bp fragment), iroB gene (309-bp fragment), Typhimurium STM 4497 (523-bp fragment), and Enteritidis SE147228 (612-bp fragment). In addition, a 1,026-bp ribosomal DNA (rDNA) fragment universally present in bacterial species was included in the assay as an internal control fragment. The detection rate of the PCR was 100% among Salmonella Enteritidis (n = 92) and Salmonella Typhimurium (n = 33) isolates. All tested Salmonella isolates (n = 194) were successfully identified based on the amplification of at least one Salmonella -specific DNA fragment. None of the four Salmonella DNA amplicons were detected in any of the non- Salmonella isolates (n = 126), indicating an exclusivity rate of 100%. When applied to crude extracts of 2,001 field isolates of Salmonella obtained during the course of a national microbiological baseline study in broiler chickens and chicken products sampled from abattoir and retail outlets, 163 isolates, or 8.1%, tested positive for Salmonella Enteritidis and another 80 isolates, or 4.0%, tested as Salmonella Typhimurium. All isolates identified by serological testing as Salmonella Enteritidis in the microbiological study were also identified by using the multiplex PCR. The new test can be used to identify or confirm pure isolates of the two serovars and is also amenable for integration into existing culture procedures for accurate detection of Salmonella colonies.

Polyethyleneimine-iron phosphate nanocomposite as a promising adsorbent for the isolation of DNA.

PubMed

Hu, Lin-Lin; Hu, Bo; Shen, Li-Ming; Zhang, Dan-Dan; Chen, Xu-Wei; Wang, Jian-Hua

2015-01-01

A polyethyleneimine (PEI)-iron phosphate (FePO4) nanocomposite is prepared by immobilization of PEI onto the surface of FePO4 nanoparticles via electrostatic interaction. The obtained PEI-FePO4 nanocomposites are spherical with a size centered in ca. 100 nm. They provide a novel adsorbent for the solid-phase extraction of DNA from complex sample matrices. At pH 4, 50 μg mL(-1) of DNA (salmon sperm DNA sodium salt) in 1.0 mL aqueous solution are quantitatively adsorbed (100%) by 2mg of the PEI-FePO4 nanocomposites, and meanwhile the coexisting albumin at a same concentration level is not retained, demonstrating the favorable selectivity of the nanocomposites to DNA against proteins. The adsorption behaviors of DNA onto the PEI-FePO4 nanocomposites fit Langmuir model, corresponding to an adsorption capacity of 61.88 mg g(-1). The adsorbed DNA could be readily recovered by using a 0.04 mol L(-1) Britton-Robinson (BR) buffer at pH 10, resulting in a recovery of 85%. The nanocomposites have been further used for the isolation of DNA from a series of real sample matrices, including synthetic λ-DNA sample, human whole blood and Escherichia coli cell lysate. The extraction efficiency and the purity of the recovered DNA are at least comparable to those achieved by using the reported sorbent materials or commercial kits. In addition, the DNAs isolated from human whole blood and E. coli cell lysate are of high quality, which have been further demonstrated by using them as templates for successful PCR amplifications. Copyright © 2014 Elsevier B.V. All rights reserved.

A simple method of DNA isolation from jute (Corchorus olitorius) seed suitable for PCR-based detection of the pathogen Macrophomina phaseolina (Tassi) Goid.

PubMed

Biswas, C; Dey, P; Satpathy, S; Sarkar, S K; Bera, A; Mahapatra, B S

2013-02-01

A simple method was developed for isolating DNA from jute seed, which contains high amounts of mucilage and secondary metabolites, and a PCR protocol was standardized for detecting the seedborne pathogen Macrophomina phaseolina. The cetyl trimethyl ammonium bromide method was modified with increased salt concentration and a simple sodium acetate treatment to extract genomic as well as fungal DNA directly from infected jute seed. The Miniprep was evaluated along with five other methods of DNA isolation in terms of yield and quality of DNA and number of PCR positive samples. The Miniprep consistently recovered high amounts of DNA with good spectral qualities at A260/A280. The DNA isolated from jute seed was found suitable for PCR amplification. Macrophomina phaseolina could be detected by PCR from artificially inoculated as well as naturally infected jute seeds. The limit of PCR-based detection of M. phaseolina in jute seed was determined to be 0·62 × 10(-7) CFU g(-1) seed. © 2012 The Society for Applied Microbiology.

Subclinical Reactivation and Shed of Infectious Varicella Zoster Virus in Saliva of Astronauts

NASA Technical Reports Server (NTRS)

Cohrs, Randall J.; Mehta, Satish K.; Schmid, D. Scott; Gilden, Donald H.; Pierson, Duane L.

2007-01-01

We have previously detected VZV in healthy astronauts both during spaceflight and shortly after landing. Herein, we show that VZV shed in seropositive astronauts is infectious. A total of 40 saliva samples were obtained from each of the 3 astronauts. From each astronaut, 14 samples were taken 109 to 133 days before liftoff, 1 sample was taken every day during 12 days in space, and one sample was taken for 14 consecutive days beginning the second day after landing. Quantitative PCR was used to detect VZV DNA in saliva. None of 42 preflight saliva samples contained VZV DNA. VZV DNA was detected in saliva from 2 of 3 astronauts. In 1 astronaut, 6 of 12 samples obtained during space flight contained 120 to 2,500 copies of VZV DNA per ml; after landing, 1250 copies of VZV DNA were present on day 2, 45 copies on day 3, and 110 copies on day 5. All samples taken 6 to 15 days after touchdown were negative for VZV DNA. In the second astronaut, 5 of 12 samples obtained during space flight contained 18 to 650 copies of VZV DNA per ml; after landing, 560 copies of VZV DNA were present in saliva on day 2, 340 copies on day 4, 45 copies on day 5, and 23 copes on day 6. All samples taken 7 to 15 days after touchdown were negative for VZV DNA. Saliva taken 2 to 6 days after landing from all 3 astronauts was cultured on human fetal lung cells. After one subcultivation, a cytopathic effect developed in cultures inoculated with saliva from the two astronauts whose saliva contained VZV DNA. Both PCR and immunostaining identified the isolates to be VZV and not HSV-1. Importantly, the astronaut in whom no VZV was detected had a history of zoster 9 years earlier. It is possible that a boost in cell-mediated immunity to VZV which is known to develop after zoster protected him from subclinical reactivation. The genotype of the two VZV isolates was determined by VZV ORF22-based PCR/sequencing along with FRET-based PCR assays that target specific nucleotide polymorphisms. Both VZV isolates were found to be the European genotype which also contained a rare MspI restriction enodnuclease site in VZV ORF62 at position 107,252. These findings extend our previous demonstration of VZV DNA in saliva of astronauts by showing that infectious VZV is also present. Thus, like HSV-1 and HSV-2, VZV can reactivate and shed infectious virus in the absence of clinical disease.

Comparison of DNA Microarray, Loop-Mediated Isothermal Amplification (LAMP) and Real-Time PCR with DNA Sequencing for Identification of Fusarium spp. Obtained from Patients with Hematologic Malignancies.

PubMed

de Souza, Marcela; Matsuzawa, Tetsuhiro; Sakai, Kanae; Muraosa, Yasunori; Lyra, Luzia; Busso-Lopes, Ariane Fidelis; Levin, Anna Sara Shafferman; Schreiber, Angélica Zaninelli; Mikami, Yuzuru; Gonoi, Tohoru; Kamei, Katsuhiko; Moretti, Maria Luiza; Trabasso, Plínio

2017-08-01

The performance of three molecular biology techniques, i.e., DNA microarray, loop-mediated isothermal amplification (LAMP), and real-time PCR were compared with DNA sequencing for properly identification of 20 isolates of Fusarium spp. obtained from blood stream as etiologic agent of invasive infections in patients with hematologic malignancies. DNA microarray, LAMP and real-time PCR identified 16 (80%) out of 20 samples as Fusarium solani species complex (FSSC) and four (20%) as Fusarium spp. The agreement among the techniques was 100%. LAMP exhibited 100% specificity, while DNA microarray, LAMP and real-time PCR showed 100% sensitivity. The three techniques had 100% agreement with DNA sequencing. Sixteen isolates were identified as FSSC by sequencing, being five Fusarium keratoplasticum, nine Fusarium petroliphilum and two Fusarium solani. On the other hand, sequencing identified four isolates as Fusarium non-solani species complex (FNSSC), being three isolates as Fusarium napiforme and one isolate as Fusarium oxysporum. Finally, LAMP proved to be faster and more accessible than DNA microarray and real-time PCR, since it does not require a thermocycler. Therefore, LAMP signalizes as emerging and promising methodology to be used in routine identification of Fusarium spp. among cases of invasive fungal infections.

A two-step electrodialysis method for DNA purification from polluted metallic environmental samples.

PubMed

Rodríguez-Mejía, José Luis; Martínez-Anaya, Claudia; Folch-Mallol, Jorge Luis; Dantán-González, Edgar

2008-08-01

Extracting DNA from samples of polluted environments using standard methods often results in low yields of poor-quality material unsuited to subsequent manipulation and analysis by molecular biological techniques. Here, we report a novel two-step electrodialysis-based method for the extraction of DNA from environmental samples. This technique permits the rapid and efficient isolation of high-quality DNA based on its acidic nature, and without the requirement for phenol-chloroform-isoamyl alcohol cleanup and ethanol precipitation steps. Subsequent PCR, endonuclease restriction, and cloning reactions were successfully performed utilizing DNA obtained by electrodialysis, whereas some or all of these techniques failed using DNA extracted with two alternative methods. We also show that his technique is applicable to purify DNA from a range of polluted and nonpolluted samples.

Isolation of Mitochondrial DNA from Single, Short Hairs without Roots Using Pressure Cycling Technology.

PubMed

Harper, Kathryn A; Meiklejohn, Kelly A; Merritt, Richard T; Walker, Jessica; Fisher, Constance L; Robertson, James M

2018-02-01

Hairs are commonly submitted as evidence to forensic laboratories, but standard nuclear DNA analysis is not always possible. Mitochondria (mt) provide another source of genetic material; however, manual isolation is laborious. In a proof-of-concept study, we assessed pressure cycling technology (PCT; an automated approach that subjects samples to varying cycles of high and low pressure) for extracting mtDNA from single, short hairs without roots. Using three microscopically similar donors, we determined the ideal PCT conditions and compared those yields to those obtained using the traditional manual micro-tissue grinder method. Higher yields were recovered from grinder extracts, but yields from PCT extracts exceeded the requirements for forensic analysis, with the DNA quality confirmed through sequencing. Automated extraction of mtDNA from hairs without roots using PCT could be useful for forensic laboratories processing numerous samples.

Rapid isolation of novel FK506 binding proteins from multiple organisms using gDNA and cDNA T7 phage display.

PubMed

Piggott, Andrew M; Kriegel, Alison M; Willows, Robert D; Karuso, Peter

2009-10-01

Reverse chemical proteomics using T7 phage display is a powerful technique for identifying cellular receptors of biologically active small molecules. However, to date this method has generally been limited to cDNA libraries constructed from mRNA isolated from eukaryotes. In this paper, we describe the construction of the first prokaryotic T7 phage display libraries from randomly digested Pseudomonas stutzeri and Vibrio fischeri gDNA, as well as a plant cDNA library from Arabidopsis thaliana. We also describe the use of T7 phage display to identify novel proteins from environmental DNA samples using biotinylated FK506 as a model affinity probe.

Two New Nuclear Isolation Buffers for Plant DNA Flow Cytometry: A Test with 37 Species

PubMed Central

Loureiro, João; Rodriguez, Eleazar; Doležel, Jaroslav; Santos, Conceição

2007-01-01

Background and Aims After the initial boom in the application of flow cytometry in plant sciences in the late 1980s and early 1990s, which was accompanied by development of many nuclear isolation buffers, only a few efforts were made to develop new buffer formulas. In this work, recent data on the performance of nuclear isolation buffers are utilized in order to develop new buffers, general purpose buffer (GPB) and woody plant buffer (WPB), for plant DNA flow cytometry. Methods GPB and WPB were used to prepare samples for flow cytometric analysis of nuclear DNA content in a set of 37 plant species that included herbaceous and woody taxa with leaf tissues differing in structure and chemical composition. The following parameters of isolated nuclei were assessed: forward and side light scatter, propidium iodide fluorescence, coefficient of variation of DNA peaks, quantity of debris background, and the number of particles released from sample tissue. The nuclear genome size of 30 selected species was also estimated using the buffer that performed better for a given species. Key Results In unproblematic species, the use of both buffers resulted in high quality samples. The analysis of samples obtained with GPB usually resulted in histograms of DNA content with higher or similar resolution than those prepared with the WPB. In more recalcitrant tissues, such as those from woody plants, WPB performed better and GPB failed to provide acceptable results in some cases. Improved resolution of DNA content histograms in comparison with previously published buffers was achieved in most of the species analysed. Conclusions WPB is a reliable buffer which is also suitable for the analysis of problematic tissues/species. Although GPB failed with some plant species, it provided high-quality DNA histograms in species from which nuclear suspensions are easy to prepare. The results indicate that even with a broad range of species, either GPB or WPB is suitable for preparation of high-quality suspensions of intact nuclei suitable for DNA flow cytometry. PMID:17684025

Isolation of PCR quality microbial community DNA from heavily contaminated environments.

PubMed

Gunawardana, Manjula; Chang, Simon; Jimenez, Abraham; Holland-Moritz, Daniel; Holland-Moritz, Hannah; La Val, Taylor P; Lund, Craig; Mullen, Madeline; Olsen, John; Sztain, Terra A; Yoo, Jennifer; Moss, John A; Baum, Marc M

2014-07-01

Asphalts, biochemically degraded oil, contain persistent, water-soluble compounds that pose a significant challenge to the isolation of PCR quality DNA. The adaptation of existing DNA purification protocols and commercial kits proved unsuccessful at overcoming this hurdle. Treatment of aqueous asphalt extracts with a polyamide resin afforded genomic microbial DNA templates that could readily be amplified by PCR. Physicochemically distinct asphalt samples from five natural oil seeps successfully generated the expected 291 bp amplicons targeting a region of the 16S rRNA gene, illustrating the robustness of the method. DNA recovery yields were in the 50-80% range depending on how the asphalt sample was seeded with exogenous DNA. The scope of the new method was expanded to include soil with high humic acid content. DNA from soil samples spiked with a range of humic acid concentrations was extracted with a commercial kit followed by treatment with the polyamide resin. The additional step significantly improved the purity of the DNA templates, especially at high humic acid concentrations, based on qPCR analysis of the bacterial 16S rRNA genes. The new method has the advantages of being inexpensive, simple, and rapid and should provide a valuable addition to protocols in the field of petroleum and soil microbiology. Copyright © 2014 Elsevier B.V. All rights reserved.

Cryopreservation of human blood for alkaline and Fpg-modified comet assay.

PubMed

Pu, Xinzhu; Wang, Zemin; Klaunig, James E

2016-01-01

The Comet assay is a reproducible and sensitive assay for the detection of DNA damage in eukaryotic cells and tissues. Incorporation of lesion specific, oxidative DNA damage repair enzymes (for example, Fpg, OGG1 and EndoIII) in the standard alkaline Comet assay procedure allows for the detection and measurement of oxidative DNA damage. The Comet assay using white blood cells (WBC) has proven useful in monitoring DNA damage from environmental agents in humans. However, it is often impractical to performance Comet assay immediately after blood sampling. Thus, storage of blood sample is required. In this study, we developed and tested a simple storage method for very small amount of whole blood for standard and Fpg-modified modified Comet assay. Whole blood was stored in RPMI 1640 media containing 10% FBS, 10% DMSO and 1 mM deferoxamine at a sample to media ratio of 1:50. Samples were stored at -20 °C and -80 °C for 1, 7, 14 and 28 days. Isolated lymphocytes from the same subjects were also stored under the same conditions for comparison. Direct DNA strand breakage and oxidative DNA damage in WBC and lymphocytes were analyzed using standard and Fpg-modified alkaline Comet assay and compared with freshly analyzed samples. No significant changes in either direct DNA strand breakage or oxidative DNA damage was seen in WBC and lymphocytes stored at -20 °C for 1 and 7 days compared to fresh samples. However, significant increases in both direct and oxidative DNA damage were seen in samples stored at -20 °C for 14 and 28 days. No changes in direct and oxidative DNA damage were observed in WBC and lymphocytes stored at -80 °C for up to 28 days. These results identified the proper storage conditions for storing whole blood or isolated lymphocytes to evaluate direct and oxidative DNA damage using standard and Fpg-modified alkaline Comet assay.

Methods for transforming and expression screening of filamentous fungal cells with a DNA library

DOEpatents

Teter, Sarah; Lamsa, Michael; Cherry, Joel; Ward, Connie

2015-06-02

The present invention relates to methods for expression screening of filamentous fungal transformants, comprising: (a) isolating single colony transformants of a DNA library introduced into E. coli; (b) preparing DNA from each of the single colony E. coli transformants; (c) introducing a sample of each of the DNA preparations of step (b) into separate suspensions of protoplasts of a filamentous fungus to obtain transformants thereof, wherein each transformant contains one or more copies of an individual polynucleotide from the DNA library; (d) growing the individual filamentous fungal transformants of step (c) on selective growth medium, thereby permitting growth of the filamentous fungal transformants, while suppressing growth of untransformed filamentous fungi; and (e) measuring activity or a property of each polypeptide encoded by the individual polynucleotides. The present invention also relates to isolated polynucleotides encoding polypeptides of interest obtained by such methods, to nucleic acid constructs, expression vectors, and recombinant host cells comprising the isolated polynucleotides, and to methods of producing the polypeptides encoded by the isolated polynucleotides.

Optimization of techniques for multiple platform testing in small, precious samples such as human chorionic villus sampling.

PubMed

Pisarska, Margareta D; Akhlaghpour, Marzieh; Lee, Bora; Barlow, Gillian M; Xu, Ning; Wang, Erica T; Mackey, Aaron J; Farber, Charles R; Rich, Stephen S; Rotter, Jerome I; Chen, Yii-der I; Goodarzi, Mark O; Guller, Seth; Williams, John

2016-11-01

Multiple testing to understand global changes in gene expression based on genetic and epigenetic modifications is evolving. Chorionic villi, obtained for prenatal testing, is limited, but can be used to understand ongoing human pregnancies. However, optimal storage, processing and utilization of CVS for multiple platform testing have not been established. Leftover CVS samples were flash-frozen or preserved in RNAlater. Modifications to standard isolation kits were performed to isolate quality DNA and RNA from samples as small as 2-5 mg. RNAlater samples had significantly higher RNA yields and quality and were successfully used in microarray and RNA-sequencing (RNA-seq). RNA-seq libraries generated using 200 versus 800-ng RNA showed similar biological coefficients of variation. RNAlater samples had lower DNA yields and quality, which improved by heating the elution buffer to 70 °C. Purification of DNA was not necessary for bisulfite-conversion and genome-wide methylation profiling. CVS cells were propagated and continue to express genes found in freshly isolated chorionic villi. CVS samples preserved in RNAlater are superior. Our optimized techniques provide specimens for genetic, epigenetic and gene expression studies from a single small sample which can be used to develop diagnostics and treatments using a systems biology approach in the prenatal period. © 2016 John Wiley & Sons, Ltd. © 2016 John Wiley & Sons, Ltd.

Impact of cultivation on characterisation of species composition of soil bacterial communities.

PubMed

McCaig, A E.; Grayston, S J.; Prosser, J I.; Glover, L A.

2001-03-01

The species composition of culturable bacteria in Scottish grassland soils was investigated using a combination of Biolog and 16S rDNA analysis for characterisation of isolates. The inclusion of a molecular approach allowed direct comparison of sequences from culturable bacteria with sequences obtained during analysis of DNA extracted directly from the same soil samples. Bacterial strains were isolated on Pseudomonas isolation agar (PIA), a selective medium, and on tryptone soya agar (TSA), a general laboratory medium. In total, 12 and 21 morphologically different bacterial cultures were isolated on PIA and TSA, respectively. Biolog and sequencing placed PIA isolates in the same taxonomic groups, the majority of cultures belonging to the Pseudomonas (sensu stricto) group. However, analysis of 16S rDNA sequences proved more efficient than Biolog for characterising TSA isolates due to limitations of the Microlog database for identifying environmental bacteria. In general, 16S rDNA sequences from TSA isolates showed high similarities to cultured species represented in sequence databases, although TSA-8 showed only 92.5% similarity to the nearest relative, Bacillus insolitus. In general, there was very little overlap between the culturable and uncultured bacterial communities, although two sequences, PIA-2 and TSA-13, showed >99% similarity to soil clones. A cloning step was included prior to sequence analysis of two isolates, TSA-5 and TSA-14, and analysis of several clones confirmed that these cultures comprised at least four and three sequence types, respectively. All isolate clones were most closely related to uncultured bacteria, with clone TSA-5.1 showing 99.8% similarity to a sequence amplified directly from the same soil sample. Interestingly, one clone, TSA-5.4, clustered within a novel group comprising only uncultured sequences. This group, which is associated with the novel, deep-branching Acidobacterium capsulatum lineage, also included clones isolated during direct analysis of the same soil and from a wide range of other sample types studied elsewhere. The study demonstrates the value of fine-scale molecular analysis for identification of laboratory isolates and indicates the culturability of approximately 1% of the total population but under a restricted range of media and cultivation conditions.

DNA and bone structure preservation in medieval human skeletons.

PubMed

Coulson-Thomas, Yvette M; Norton, Andrew L; Coulson-Thomas, Vivien J; Florencio-Silva, Rinaldo; Ali, Nadir; Elmrghni, Samir; Gil, Cristiane D; Sasso, Gisela R S; Dixon, Ronald A; Nader, Helena B

2015-06-01

Morphological and ultrastructural data from archaeological human bones are scarce, particularly data that have been correlated with information on the preservation of molecules such as DNA. Here we examine the bone structure of macroscopically well-preserved medieval human skeletons by transmission electron microscopy and immunohistochemistry, and the quantity and quality of DNA extracted from these skeletons. DNA technology has been increasingly used for analyzing physical evidence in archaeological forensics; however, the isolation of ancient DNA is difficult since it is highly degraded, extraction yields are low and the co-extraction of PCR inhibitors is a problem. We adapted and optimised a method that is frequently used for isolating DNA from modern samples, Chelex(®) 100 (Bio-Rad) extraction, for isolating DNA from archaeological human bones and teeth. The isolated DNA was analysed by real-time PCR using primers targeting the sex determining region on the Y chromosome (SRY) and STR typing using the AmpFlSTR(®) Identifiler PCR Amplification kit. Our results clearly show the preservation of bone matrix in medieval bones and the presence of intact osteocytes with well preserved encapsulated nuclei. In addition, we show how effective Chelex(®) 100 is for isolating ancient DNA from archaeological bones and teeth. This optimised method is suitable for STR typing using kits aimed specifically at degraded and difficult DNA templates since amplicons of up to 250bp were successfully amplified. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

[Study on the infection of taiga ticks with Borrelia in the territory of Novosibirsk Scientific Center SB PAS].

PubMed

Borgoiakov, V Iu; Fomenko, N V; Panov, V V; Chikova, E D

2010-01-01

In our study, Borrelia were revealed in the taiga ticks Ixodes persulcatus collected on vegetation by flagging, as well as in the ticks removed from the people who asked for help in the vaccination center located in the Novosibirsk Scientific Center of the Siberian Branch of Russian Academy of Science (NS SB RAS). By the isolation of Borrelia on BSK-H medum, the occurrence of B. garinii, B. afzelii, and B. miyamotoi was established in the territory of NSC. B. miyamotoi isolates were unstable and lost their ability to growth in later passages. DNA of the same three species of Borrelia was detected by PCR in the samples of ticks, both collected on vegetation by flagging and removed from humans. DNA of B. garinii was recorded most often; DNA of B. afzelii was less frequent; and the least number of positive samples was shown for B. miyamotoi. In the ticks collected on vegetation by flagging, DNA of B. garinii was found in 38.6%, B. afzelii in 9.9%, and B. miyamoboi in 3.9% of samples. In the ticks removed from people, number of positive samples was lesser; so, DNA of B. garinii was detected in 24.2%, B. afzelii in 6.9%, and B. miyamotoi in 5.6% of samples. Mixed infection with two Borrelia species was recorded, and DNA of B. mivamnotoi more often detected simultaneously with DNA of B. garinii.

Combined genetic transformation and nutritional assay for identification of Moraxella nonliquefaciens.

PubMed Central

Juni, E; Heym, G A; Maurer, M J; Miller, M L

1987-01-01

A combined genetic transformation and nutritional assay is described that permits definitive identification of clinically isolated strains of Moraxella nonliquefaciens. Crude DNA preparations of strains of various Moraxella species were used to transform nutritional mutants of a stably competent strain of M. nonliquefaciens for ability to grow on a defined medium (Mn-B). DNA samples from 24 independently isolated strains of M. nonliquefaciens all resulted in massive (4+) transformation of each of two mutant assay strains. DNA samples from strains of M. bovis and M. lacunata frequently gave weak (1+) transformation of one of the mutant assay strains (Mn64) but almost always failed to transform another assay strain (Mn136). DNA samples from eight other Moraxella species failed completely to transform either of the mutant assay strains. When streaked on the defined medium used for the transformation assay (Mn-B), 23 of the 24 strains of M. nonliquefaciens grew well, but all strains of M. bovis and M. lacunata failed to grow on this medium. Images PMID:3654942

A novel mechanism for direct real-time polymerase chain reaction that does not require DNA isolation from prokaryotic cells.

PubMed

Soejima, Takashi; Xiao, Jin-Zhong; Abe, Fumiaki

2016-06-23

Typically, polymerase chain reaction (PCR) is performed after DNA isolation. Real-time PCR (qPCR), also known as direct qPCR in mammalian cells with weak membranes, is a common technique using crude samples subjected to preliminary boiling to elute DNA. However, applying this methodology to prokaryotic cells, which have solid cell walls, in contrast to mammalian cells which immediately burst in water, can result in poor detection. We successfully achieved PCR elongation with the addition of 1.3 cfu of Cronobacter muytjensii to a newly developed direct qPCR master mix without performing any crude DNA extraction (detection limit of 1.6 × 10(0) cfu/ml for the test sample compared with a detection limit of 1.6 × 10(3) cfu/ml primarily for crude (boiling) or classical DNA isolation). We revealed that the chromosomal DNA retained in prokaryotic cells can function as a PCR template, similarly to the mechanism in in situ PCR. Elucidating this reaction mechanism may contribute to the development of an innovative master mix for direct qPCR to detect genes in a single bacterium with solid cell walls and might lead to numerous novel findings in prokaryotic genomics research.

Direct PCR Offers a Fast and Reliable Alternative to Conventional DNA Isolation Methods for Gut Microbiomes.

PubMed

Videvall, Elin; Strandh, Maria; Engelbrecht, Anel; Cloete, Schalk; Cornwallis, Charlie K

2017-01-01

The gut microbiome of animals is emerging as an important factor influencing ecological and evolutionary processes. A major bottleneck in obtaining microbiome data from large numbers of samples is the time-consuming laboratory procedures required, specifically the isolation of DNA and generation of amplicon libraries. Recently, direct PCR kits have been developed that circumvent conventional DNA extraction steps, thereby streamlining the laboratory process by reducing preparation time and costs. However, the reliability and efficacy of direct PCR for measuring host microbiomes have not yet been investigated other than in humans with 454 sequencing. Here, we conduct a comprehensive evaluation of the microbial communities obtained with direct PCR and the widely used Mo Bio PowerSoil DNA extraction kit in five distinct gut sample types (ileum, cecum, colon, feces, and cloaca) from 20 juvenile ostriches, using 16S rRNA Illumina MiSeq sequencing. We found that direct PCR was highly comparable over a range of measures to the DNA extraction method in cecal, colon, and fecal samples. However, the two methods significantly differed in samples with comparably low bacterial biomass: cloacal and especially ileal samples. We also sequenced 100 replicate sample pairs to evaluate repeatability during both extraction and PCR stages and found that both methods were highly consistent for cecal, colon, and fecal samples ( r s > 0.7) but had low repeatability for cloacal ( r s = 0.39) and ileal ( r s = -0.24) samples. This study indicates that direct PCR provides a fast, cheap, and reliable alternative to conventional DNA extraction methods for retrieving 16S rRNA data, which can aid future gut microbiome studies. IMPORTANCE The microbial communities of animals can have large impacts on their hosts, and the number of studies using high-throughput sequencing to measure gut microbiomes is rapidly increasing. However, the library preparation procedure in microbiome research is both costly and time-consuming, especially for large numbers of samples. We investigated a cheaper and faster direct PCR method designed to bypass the DNA isolation steps during 16S rRNA library preparation and compared it with a standard DNA extraction method. We used both techniques on five different gut sample types collected from 20 juvenile ostriches and sequenced samples with Illumina MiSeq. The methods were highly comparable and highly repeatable in three sample types with high microbial biomass (cecum, colon, and feces), but larger differences and low repeatability were found in the microbiomes obtained from the ileum and cloaca. These results will help microbiome researchers assess library preparation procedures and plan their studies accordingly.

Evaluation of milk sample fractions for characterization of milk microbiota from healthy and clinical mastitis cows

PubMed Central

Lima, Svetlana Ferreira; Bicalho, Marcela Lucas de Souza

2018-01-01

Amplicon sequencing technique has been increasingly applied to the clinical setting as a sensitive diagnostic tool. Therefore, it is of great importance to develop a DNA extraction method that accurate isolates DNA from complex host-associated microbiota. Given the multifactorial etiology of clinical mastitis and the diversified lifestyle of bacterial species harboring in milk, here four distinct milk sample fractions: raw whole milk, milk fat, casein-pellet, and casein-pellet + fat from healthy cows and cows with clinical mastitis, were subjected to bead-beating DNA extraction, followed by high-throughput sequencing. We aimed to identify the best approach for characterization of the milk microbiota and detection of mastitis pathogens (Klebsiella spp., Streptococcus spp. and Escherichia coli). DNA from each milk fraction tested was extracted by two commercial kits, which include physical, mechanical and chemical lysis; in total 280 DNA samples from 35 cows were analyzed. Milk-health-status were categorized into four groups (healthy group; E. coli-mastitis group; Klebsiella spp.-mastitis group; and Streptococcus spp.–mastitis group). Bacterial phyla and families were described for each milk-health-status group across milk sample fractions and DNA extraction kits. For the mastitis groups the relative abundance of f__Enterobacteriaceae and f__Streptococcaceae were compared to determine the efficacy of procedures in detecting the mastitis pathogens. The four milk fractions used allowed efficiently and uniformly detection of the causative agent of mastitis. Only 27% of the families detected in healthy milk were shared among the samples extracted from all fractions of milk samples; followed by 3, 4, and 12% for the samples from E. coli-mastitis, Klebsiella spp.-mastitis and Streptococcus spp-mastitis, respectively. However, the shared families comprised a mean relative abundance greater than 85%, regardless of milk-health-status, milk fraction and DNA isolation method. Taxonomic data at the family level showed that sequences from mastitis milk samples cultured positive for E. coli and Klebsiella spp. were predominantly affiliated with f__Enterobacteriaceae, while for Streptococcus spp. were dominated by f__Streptococcacea, followed by f__Pseudomonadaceae and f__Enterococcaceae. Microbial community analysis revealed that most of the microbial community composition corresponded to milk bacterial species irrespective of the DNA isolation method and milk fraction evaluated. PMID:29561873

Evaluation of DNA extraction methods for the analysis of microbial community in biological activated carbon.

PubMed

Zheng, Lu; Gao, Naiyun; Deng, Yang

2012-01-01

It is difficult to isolate DNA from biological activated carbon (BAC) samples used in water treatment plants, owing to the scarcity of microorganisms in BAC samples. The aim of this study was to identify DNA extraction methods suitable for a long-term, comprehensive ecological analysis of BAC microbial communities. To identify a procedure that can produce high molecular weight DNA, maximizes detectable diversity and is relatively free from contaminants, the microwave extraction method, the cetyltrimethylammonium bromide (CTAB) extraction method, a commercial DNA extraction kit, and the ultrasonic extraction method were used for the extraction of DNA from BAC samples. Spectrophotometry, agarose gel electrophoresis and polymerase chain reaction (PCR)-restriction fragment length polymorphisms (RFLP) analysis were conducted to compare the yield and quality of DNA obtained using these methods. The results showed that the CTAB method produce the highest yield and genetic diversity of DNA from BAC samples, but DNA purity was slightly less than that obtained with the DNA extraction-kit method. This study provides a theoretical basis for establishing and selecting DNA extraction methods for BAC samples.

Transmission of oral Prevotella melaninogenica between a mother and her young child.

PubMed

Könönen, E; Saarela, M; Karjalainen, J; Jousimies-Somer, H; Alaluusua, S; Asikainen, S

1994-10-01

Most likely, young children acquire their oral microflora by frequent transfer of bacteria between family members. The possible transmission of obligately anaerobic Prevotella melaninogenica recovered from 11 mother-child pairs was examined by ribotyping. One to 18 isolates (mean 13) per child from different oral sampling sites and 4 to 17 (mean 10) isolates per mother from stimulated salivary samples, collected on 2 occasions, were analyzed. On sampling, the mean ages of the children were 4 months and 32 months, respectively. Restriction endonucleases KpnI and ClaI were chosen for the digestion of chromosomal DNA. DNA fragments were electrophoretically separated, blotted onto a nylon membrane and hybridized with rRNA operon of Escherichia coli. DNA-DNA hybrids were detected immunologically. Extensive genetic heterogeneity, 101 distinct ribotypes, was observed among 248 P. melaninogenica isolates studied. Both mothers and children harbored several (up to 7) ribotypes which, apart from 3 ribotypes, were distinguishable in unrelated subjects. Several P. melaninogenica ribotypes were detected on both sampling occasions over 2 years apart. Identical ribotypes were found in 6 of the 11 mother-child pairs, 1 to 2 similar ribotypes per pair. This suggests the transmission of P. melaninogenica between the mother and her child, probably via maternal saliva. However, the unique ribotypes found in these children also indicate that other sources besides the mother influence the oral colonization of young children.

Air and surface contamination patterns of meticillin-resistant Staphylococcus aureus on eight acute hospital wards.

PubMed

Creamer, E; Shore, A C; Deasy, E C; Galvin, S; Dolan, A; Walley, N; McHugh, S; Fitzgerald-Hughes, D; Sullivan, D J; Cunney, R; Coleman, D C; Humphreys, H

2014-03-01

Meticillin-resistant Staphylococcus aureus (MRSA) can be recovered from hospital air and from environmental surfaces. This poses a potential risk of transmission to patients. To investigate associations between MRSA isolates recovered from air and environmental surfaces with those from patients when undertaking extensive patient and environmental sampling. This was a prospective observational study of patients and their environment in eight wards of a 700-bed tertiary care hospital during 2010 and 2011. Sampling of patients, air and surfaces was carried out on all ward bays, with more extended environmental sampling in ward high-dependency bays and at particular times of the day. The genetic relatedness of isolates was determined by DNA microarray profiling and spa typing. MRSA was recovered from 30/706 (4.3%) patients and from 19/132 (14.4%) air samples. On 9/132 (6.8%) occasions both patient and air samples yielded MRSA. In 32 high-dependency bays, MRSA was recovered from 12/161 (7.4%) patients, 8/32 (25%) air samples, and 21/644 (3.3%) environmental surface samples. On 10/132 (7.6%) occasions, MRSA was isolated from air in the absence of MRSA-positive patients. Patient demographic data combined with spa typing and DNA microarray profiling revealed four likely transmission clusters, where patient and environmental isolates were deemed to be very closely related. Air sampling yielded MRSA on frequent occasions, especially in high-dependency bays. Environmental and air sampling combined with patient demographic data, spa typing and DNA microarray profiling indicated the presence of clusters that were not otherwise apparent. Copyright © 2014 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

Incidence of human papilloma virus in esophageal squamous cell carcinoma in patients from the Lublin region.

PubMed

Dąbrowski, Andrzej; Kwaśniewski, Wojciech; Skoczylas, Tomasz; Bednarek, Wiesława; Kuźma, Dorota; Goździcka-Józefiak, Anna

2012-10-28

To assess the prevalence of human papilloma virus (HPV) in esophageal squamous cell carcinoma (ESCC) in the south-eastern region of Poland. The study population consisted of 56 ESCC patients and 35 controls. The controls were patients referred to our department due to other non-esophageal and non-oncological disorders with no gross or microscopic esophageal pathology as confirmed by endoscopy and histopathology. In the ESCC patients, samples were taken from normal mucosa (56 mucosa samples) and from the tumor (56 tumor samples). Tissue samples from the controls were taken from normal mucosa of the middle esophagus (35 control samples). Quantitative determination of DNA was carried out using a spectrophotometric method. Genomic DNA was isolated using the QIAamp DNA Midi Kit. HPV infection was identified following PCR amplification of the HPV gene sequence, using primers MY09 and MY11 complementary to the genome sequence of at least 33 types of HPV. The sequencing results were computationally analyzed using the basic local alignment search tool database. In tumor samples, HPV DNA was identified in 28 of 56 patients (50%). High risk HPV phenotypes (16 or/and 18) were found in 5 of 56 patients (8.9%), low risk in 19 of 56 patients (33.9%) and other types of HPV (37, 81, 97, CP6108) in 4 of 56 patients (7.1%). In mucosa samples, HPV DNA was isolated in 21 of 56 patients (37.5%). High risk HPV DNA was confirmed in 3 of 56 patients (5.3%), low risk HPV DNA in 12 of 56 patients (21.4%), and other types of HPV in 6 of 56 patients (10.7%). In control samples, HPV DNA was identified in 4 of 35 patients (11.4%) with no high risk HPV. The occurrence of HPV in ESCC patients was significantly higher than in the controls [28 of 56 (50%) vs 4 of 35 (11.4%), P < 0.001]. In esophageal cancer patients, both in tumor and mucosa samples, the predominant HPV phenotypes were low risk HPV, isolated 4 times more frequently than high risk phenotypes [19 of 56 (33.9%) vs 5 of 56 (8.9%), P < 0.001]. A higher prevalence of HPV was identified in female patients (71.4% vs 46.9%). Accordingly, the high risk phenotypes were isolated more frequently in female patients and this difference reached statistical significance [3 of 7 (42.9%) vs 2 of 49 (4.1%), P < 0.05]. Of the pathological characteristics, only an infiltrative pattern of macroscopic tumor type significantly correlated with the presence of HPV DNA in ESCC samples [20 of 27 (74.1%) vs 8 of 29 (27.6%) for ulcerative or protruding macroscopic type, P < 0.05]. The occurrence of total HPV DNA and both HPV high or low risk phenotypes did not significantly differ with regard to particular grades of cellular differentiation, phases in depth of tumor infiltration, grades of nodal involvement and stages of tumor progression. Low risk HPV phenotypes could be one of the co-activators or/and co-carcinogens in complex, progressive, multifactorial and multistep esophageal carcinogenesis.

Molecular characterization of Hepatozoon canis in dogs from Colombia.

PubMed

Vargas-Hernandez, Giovanni; André, Marcos R; Munhoz, Thiago D; Faria, Joice M L; Machado, Rosangela Z; Tinucci-Costa, Mirela

2012-01-01

Hepatozoonosis is a tick-borne disease whose transmission to dogs occurs by ingestion of oocysts infected ticks or feeding on preys infested by infected ticks. Until now, there is no previous report of molecular characterization of Hepatozoon sp. in dogs from Colombia. EDTA blood samples were collected from 91 dogs from central-western region of Colombia (Bogotá, Bucaramanga, and Villavicencio cities) and submitted to 18S rRNA Hepatozoon sp. PCR and blood smears confection. Phylogenetic analysis was used to access the identity of Hepatozoon species found in sampled dogs. From 91 sampled dogs, 29 (31.8%) were positive to Hepatozoon sp. (25 dogs were only positive in PCR, 1 was positive only in blood smears, and 3 were positive in both blood smears and PCR). After sequencing, the found Hepatozoon sp. DNA showed 100% of identity with Hepatozoon canis DNA isolates. The phylogenetic tree supported the identity of the found Hepatozoon sp. DNA, showing that the isolates from Colombia were placed in the same clade than other H. canis isolates from Venezuela, Spain, and Taiwan. This is the first molecular detection of H. canis in dogs from Colombia.

Prevalence, identification by a DNA microarray-based assay of human and food isolates Listeria spp. from Tunisia.

PubMed

Hmaïed, F; Helel, S; Le Berre, V; François, J-M; Leclercq, A; Lecuit, M; Smaoui, H; Kechrid, A; Boudabous, A; Barkallah, I

2014-02-01

We aimed at evaluating the prevalence of Listeria species isolated from food samples and characterizing food and human cases isolates. Between 2005 and 2007, one hundred food samples collected in the markets of Tunis were analysed in our study. Five strains of Listeria monocytogenes responsible for human listeriosis isolated in hospital of Tunis were included. Multiplex PCR serogrouping and pulsed field gel electrophoresis (PFGE) applying the enzyme AscI and ApaI were used for the characterization of isolates of L. monocytogenes. We have developed a rapid microarray-based assay to a reliable discrimination of species within the Listeria genus. The prevalence of Listeria spp. in food samples was estimated at 14% by using classical biochemical identification. Two samples were assigned to L. monocytogenes and 12 to L. innocua. DNA microarray allowed unambiguous identification of Listeria species. Our results obtained by microarray-based assay were in accordance with the biochemical identification. The two food L. monocytogenes isolates were assigned to the PCR serogroup IIa (serovar 1/2a). Whereas human L. monocytogenes isolates were of PCR serogroup IVb, (serovars 4b). These isolates present a high similarity in PFGE. Food L. monocytogenes isolates were classified into two different pulsotypes. These pulsotypes were different from that of the five strains responsible for the human cases. We confirmed the presence of Listeria spp. in variety of food samples in Tunis. Increased food and clinical surveillance must be taken into consideration in Tunisia to identify putative infections sources. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Circular replication-associated protein encoding DNA viruses identified in the faecal matter of various animals in New Zealand.

PubMed

Steel, Olivia; Kraberger, Simona; Sikorski, Alyssa; Young, Laura M; Catchpole, Ryan J; Stevens, Aaron J; Ladley, Jenny J; Coray, Dorien S; Stainton, Daisy; Dayaram, Anisha; Julian, Laurel; van Bysterveldt, Katherine; Varsani, Arvind

2016-09-01

In recent years, innovations in molecular techniques and sequencing technologies have resulted in a rapid expansion in the number of known viral sequences, in particular those with circular replication-associated protein (Rep)-encoding single-stranded (CRESS) DNA genomes. CRESS DNA viruses are present in the virome of many ecosystems and are known to infect a wide range of organisms. A large number of the recently identified CRESS DNA viruses cannot be classified into any known viral families, indicating that the current view of CRESS DNA viral sequence space is greatly underestimated. Animal faecal matter has proven to be a particularly useful source for sampling CRESS DNA viruses in an ecosystem, as it is cost-effective and non-invasive. In this study a viral metagenomic approach was used to explore the diversity of CRESS DNA viruses present in the faeces of domesticated and wild animals in New Zealand. Thirty-eight complete CRESS DNA viral genomes and two circular molecules (that may be defective molecules or single components of multicomponent genomes) were identified from forty-nine individual animal faecal samples. Based on shared genome organisations and sequence similarities, eighteen of the isolates were classified as gemycircularviruses and twelve isolates were classified as smacoviruses. The remaining eight isolates lack significant sequence similarity with any members of known CRESS DNA virus groups. This research adds significantly to our knowledge of CRESS DNA viral diversity in New Zealand, emphasising the prevalence of CRESS DNA viruses in nature, and reinforcing the suggestion that a large proportion of CRESS DNA viruses are yet to be identified. Copyright © 2016 Elsevier B.V. All rights reserved.

Direct detection of Mycobacterium tuberculosis rifampin resistance in bio-safe stained sputum smears.

PubMed

Lavania, Surabhi; Anthwal, Divya; Bhalla, Manpreet; Singh, Nagendra; Haldar, Sagarika; Tyagi, Jaya Sivaswami

2017-01-01

Direct smear microscopy of sputum forms the mainstay of TB diagnosis in resource-limited settings. Stained sputum smear slides can serve as a ready-made resource to transport sputum for molecular drug susceptibility testing. However, bio-safety is a major concern during transport of sputum/stained slides and for laboratory workers engaged in processing Mycobacterium tuberculosis infected sputum specimens. In this study, a bio-safe USP (Universal Sample Processing) concentration-based sputum processing method (Bio-safe method) was assessed on 87 M. tuberculosis culture positive sputum samples. Samples were processed for Ziehl-Neelsen (ZN) smear, liquid culture and DNA isolation. DNA isolated directly from sputum was subjected to an IS6110 PCR assay. Both sputum DNA and DNA extracted from bio-safe ZN concentrated smear slides were subjected to rpoB PCR and simultaneously assessed by DNA sequencing for determining rifampin (RIF) resistance. All sputum samples were rendered sterile by Bio-safe method. Bio-safe smears exhibited a 5% increment in positivity over direct smear with a 14% increment in smear grade status. All samples were positive for IS6110 and rpoB PCR. Thirty four percent samples were RIF resistant by rpoB PCR product sequencing. A 100% concordance (κ value = 1) was obtained between sequencing results derived from bio-safe smear slides and bio-safe sputum. This study demonstrates that Bio-safe method can address safety issues associated with sputum processing, provide an efficient alternative to sample transport in the form of bio-safe stained concentrated smear slides and can also provide information on drug (RIF) resistance by direct DNA sequencing.

Direct detection of Mycobacterium tuberculosis rifampin resistance in bio-safe stained sputum smears

PubMed Central

Lavania, Surabhi; Anthwal, Divya; Bhalla, Manpreet; Singh, Nagendra; Haldar, Sagarika; Tyagi, Jaya Sivaswami

2017-01-01

Direct smear microscopy of sputum forms the mainstay of TB diagnosis in resource-limited settings. Stained sputum smear slides can serve as a ready-made resource to transport sputum for molecular drug susceptibility testing. However, bio-safety is a major concern during transport of sputum/stained slides and for laboratory workers engaged in processing Mycobacterium tuberculosis infected sputum specimens. In this study, a bio-safe USP (Universal Sample Processing) concentration-based sputum processing method (Bio-safe method) was assessed on 87 M. tuberculosis culture positive sputum samples. Samples were processed for Ziehl-Neelsen (ZN) smear, liquid culture and DNA isolation. DNA isolated directly from sputum was subjected to an IS6110 PCR assay. Both sputum DNA and DNA extracted from bio-safe ZN concentrated smear slides were subjected to rpoB PCR and simultaneously assessed by DNA sequencing for determining rifampin (RIF) resistance. All sputum samples were rendered sterile by Bio-safe method. Bio-safe smears exhibited a 5% increment in positivity over direct smear with a 14% increment in smear grade status. All samples were positive for IS6110 and rpoB PCR. Thirty four percent samples were RIF resistant by rpoB PCR product sequencing. A 100% concordance (κ value = 1) was obtained between sequencing results derived from bio-safe smear slides and bio-safe sputum. This study demonstrates that Bio-safe method can address safety issues associated with sputum processing, provide an efficient alternative to sample transport in the form of bio-safe stained concentrated smear slides and can also provide information on drug (RIF) resistance by direct DNA sequencing. PMID:29216262

Isolation of entomopathogenic fungi from soils and Ixodes scapularis (Acari: Ixodidae) ticks: prevalence and methods.

PubMed

Tuininga, Amy R; Miller, Jessica L; Morath, Shannon U; Daniels, Thomas J; Falco, Richard C; Marchese, Michael; Sahabi, Sadia; Rosa, Dieshia; Stafford, Kirby C

2009-05-01

Entomopathogenic fungi are commonly found in forested soils that provide tick habitat, and many species are pathogenic to Ixodes scapularis Say, the blacklegged tick. As a first step to developing effective biocontrol strategies, the objective of this study was to determine the best methods to isolate entomopathogenic fungal species from field-collected samples of soils and ticks from an Eastern deciduous forest where I. scapularis is common. Several methods were assessed: (1) soils, leaf litter, and ticks were plated on two types of media; (2) soils were assayed for entomopathogenic fungi using the Galleria bait method; (3) DNA from internal transcribed spacer (ITS) regions of the nuclear ribosomal repeat was extracted from pure cultures obtained from soils, Galleria, and ticks and was amplified and sequenced; and (4) DNA was extracted directly from ticks, amplified, and sequenced. We conclude that (1) ticks encounter potentially entomopathogenic fungi more often in soil than in leaf litter, (2) many species of potentially entomopathogenic fungi found in the soil can readily be cultured, (3) the Galleria bait method is a sufficiently efficient method for isolation of these fungi from soils, and (4) although DNA extraction from ticks was not possible in this study because of small sample size, DNA extraction from fungi isolated from soils and from ticks was successful and provided clean sequences in 100 and 73% of samples, respectively. A combination of the above methods is clearly necessary for optimal characterization of entomopathogenic fungi associated with ticks in the environment.

Molecular application for identification of polycyclic aromatic hydrocarbons degrading bacteria (PAHD) species isolated from oil polluted soil in Dammam, Saud Arabia.

PubMed

Ibrahim, Mohamed M; Al-Turki, Ameena; Al-Sewedi, Dona; Arif, Ibrahim A; El-Gaaly, Gehan A

2015-09-01

Soil contamination with petroleum hydrocarbon products such as diesel and engine oil is becoming one of the major environmental problems. This study describes hydrocarbons degrading bacteria (PHAD) isolated from long-standing petrol polluted soil from the eastern region, Dammam, Saudi Arabia. The isolated strains were firstly categorized by accessible shape detection, physiological and biochemistry tests. Thereafter, a technique established on the sequence analysis of a 16S rDNA gene was used. Isolation of DNA from the bacterial strains was performed, on which the PCR reaction was carried out. Strains were identified based on 16S rDNA sequence analysis, As follows amplified samples were spontaneously sequenced automatically and the attained results were matched to open databases. Among the isolated bacterial strains, S1 was identified as Staphylococcus aureus and strain S1 as Corynebacterium amycolatum.

Characterization of DNA isolated from normal and cancerous ovarian tissues by ultraviolet resonance Raman spectroscopy

NASA Astrophysics Data System (ADS)

Zhao, Xiaojie; Vinson, Michael A.; Malins, Donald C.; Spiro, Thomas G.

2000-05-01

We report significant differences in UV resonance Raman (UVRR) spectra of DNA samples from normal and cancerous tissues. The four bases of DNA, adenosine, thymine, guanosine and cytidine, can be enhanced in UVRR spectra, and their intensities are very sensitive to base stacking and DNA H-bonding. 14 DNA samples from patients at different stages of ovarian cancer, 5 from normal, 2 from primary, 3 from metastasis primary and 4 from distant metastasis tumor tissues, were characterized by 257, 238, 229, 220 and 210 nm-excited UVRR spectra. Raman spectral difference between normal and tumor DNA could be readily detected.

Morphologic and genetic identification of Taenia tapeworms in Tanzania and DNA genotyping of Taenia solium.

PubMed

Eom, Keeseon S; Chai, Jong-Yil; Yong, Tai-Soon; Min, Duk-Young; Rim, Han-Jong; Kihamia, Charles; Jeon, Hyeong-Kyu

2011-12-01

Species identification of Taenia tapeworms was performed using morphologic observations and multiplex PCR and DNA sequencing of the mitochondrial cox1 gene. In 2008 and 2009, a total of 1,057 fecal samples were collected from residents of Kongwa district of Dodoma region, Tanzania, and examined microscopically for helminth eggs and proglottids. Of these, 4 Taenia egg positive cases were identified, and the eggs were subjected to DNA analysis. Several proglottids of Taenia solium were recovered from 1 of the 4 cases. This established that the species were T. solium (n = 1) and T. saginata (n = 3). One further T. solium specimen was found among 128 fecal samples collected from Mbulu district in Arusha, and this had an intact strobila with the scolex. Phylegenetic analysis of the mtDNA cox1 gene sequences of these 5 isolates showed that T. saginata was basal to the T. solium clade. The mitochondrial cox1 gene sequences of 3 of these Tanzanian isolates showed 99% similarity to T. saginata, and the other 2 isolates showed 100% similarity to T. solium. The present study has shown that Taenia tapeworms are endemic in Kongwa district of Tanzania, as well as in a previously identified Mbulu district. Both T. solium isolates were found to have an "African/Latin American" genotype (cox1).

Phylogenetic relationships in three species of canine Demodex mite based on partial sequences of mitochondrial 16S rDNA.

PubMed

Sastre, Natalia; Ravera, Ivan; Villanueva, Sergio; Altet, Laura; Bardagí, Mar; Sánchez, Armand; Francino, Olga; Ferrer, Lluís

2012-12-01

The historical classification of Demodex mites has been based on their hosts and morphological features. Genome sequencing has proved to be a very effective taxonomic tool in phylogenetic studies and has been applied in the classification of Demodex. Mitochondrial 16S rDNA has been demonstrated to be an especially useful marker to establish phylogenetic relationships. To amplify and sequence a segment of the mitochondrial 16S rDNA from Demodex canis and Demodex injai, as well as from the short-bodied mite called, unofficially, D. cornei and to determine their genetic proximity. Demodex mites were examined microscopically and classified as Demodex folliculorum (one sample), D. canis (four samples), D. injai (two samples) or the short-bodied species D. cornei (three samples). DNA was extracted, and a 338 bp fragment of the 16S rDNA was amplified and sequenced. The sequences of the four D. canis mites were identical and shared 99.6 and 97.3% identity with two D. canis sequences available at GenBank. The sequences of the D. cornei isolates were identical and showed 97.8, 98.2 and 99.6% identity with the D. canis isolates. The sequences of the two D. injai isolates were also identical and showed 76.6% identity with the D. canis sequence. Demodex canis and D. injai are two different species, with a genetic distance of 23.3%. It would seem that the short-bodied Demodex mite D. cornei is a morphological variant of D. canis. © 2012 The Authors. Veterinary Dermatology © 2012 ESVD and ACVD.

Influence of amino acids Shiff bases on irradiated DNA stability in vivo.

PubMed

Karapetyan, N H; Malakyan, M H; Bajinyan, S A; Torosyan, A L; Grigoryan, I E; Haroutiunian, S G

2013-01-01

To reveal protective role of the new Mn(II) complexes with Nicotinyl-L-Tyrosinate and Nicotinyl-L-Tryptophanate Schiff Bases against ionizing radiation. The DNA of the rats liver was isolated on 7, 14, and 30 days after X-ray irradiation. The differences between the DNA of irradiated rats and rats pre-treated with Mn(II) complexes were studied using the melting, microcalorimetry, and electrophoresis methods. The melting parameters and the melting enthalpy of rats livers DNA were changed after the X-ray irradiation: melting temperature and melting enthalpy were decreased and melting interval was increased. These results can be explained by destruction of DNA molecules. It was shown that pre-treatment of rats with Mn(II) complexes approximates the melting parameters to norm. Agarose gel electrophoresis data confirmed the results of melting studies. The separate DNA fragments were revealed in DNA samples isolated from irradiated animals. The DNA isolated from animals pre-treated with the Mn(II) chelates had better electrophoretic characteristics, which correspond to healthy DNA. Pre-treatment of the irradiated rats with Mn(II)(Nicotinil-L-Tyrosinate) and Mn(II)(Nicotinil-L-Tryptophanate)2 improves the DNA characteristics.

Novel and canine genotypes of Giardia duodenalis in harbor seals ( Phoca vitulina richardsi).

PubMed

Gaydos, J K; Miller, W A; Johnson, C; Zornetzer, H; Melli, A; Packham, A; Jeffries, S J; Lance, M M; Conrad, P A

2008-12-01

Feces of harbor seals (Phoca vitulina richardsi) and hybrid glaucous-winged/western gulls (Larus glaucescens / occidentalis) from Washington State's inland marine waters were examined for Giardia and Cryptosporidium spp. to determine if genotypes carried by these wildlife species were the same genotypes that commonly infect humans and domestic animals. Using immunomagnetic separation followed by direct fluorescent antibody detection, Giardia spp. cysts were detected in 42% of seal fecal samples (41/97). Giardia-positive samples came from 90% of the sites (9/10) and the prevalence of positive seal fecal samples differed significantly among study sites. Fecal samples collected from seal haulout sites with over 400 animals were 4.7 times more likely to have Giardia spp. cysts than samples collected at smaller haulout sites. In gulls, a single Giardia sp. cyst was detected in 4% of fecal samples (3/78). Cryptosporidium spp. oocysts were not detected in any of the seals or gulls tested. Sequence analysis of a 398 bp segment of G. duodenalis DNA at the glutamate dehydrogenase locus suggested that 11 isolates originating from seals throughout the region were a novel genotype and 3 isolates obtained from a single site in south Puget Sound were the G. duodenalis canine genotype D. Real-time TaqMan PCR amplification and subsequent sequencing of a 52 bp small subunit ribosomal DNA region from novel harbor seal genotype isolates showed sequence homology to canine genotypes C and D. Sequence analysis of the 52 bp small subunit ribosomal DNA products from the 3 canine genotype isolates from seals produced mixed sequences at could not be evaluated.

Molecular characterization of a new begomovirus associated with leaf yellow mosaic disease of Jatropha curcas in India.

PubMed

Srivastava, Ashish; Kumar, S; Jaidi, Meraj; Raj, S K

2015-05-01

During a survey in June 2011, severe leaf yellow mosaic disease was observed on about 45 % plants of Jatropha curcas growing in the Katerniaghat wildlife sanctuary in India. An association of a begomovirus with disease was detected in 15 out of 20 samples by PCR using begomovirus genus-specific primers and total DNA isolated from symptomatic leaf samples. For identification of the begomovirus, the complete genome was amplified using a Phi-29 DNA-polymerase-based rolling-circle amplification kit and total DNA from five representative samples and then digested with BamHI. The linearized RCA products were cloned and sequenced. Their GenBank accession numbers are JN698954 (SKRK1) and JN135236 (SKRK2). The sequences of the two begomovirus isolates were 97 % identical to each other and no more than 86 % to those of jatropha mosaic India virus (JMIV, HM230683) and other begomoviruses reported worldwide. In phylogenetic analysis, SKRK1 and SKRK2 clustered together and showed distant relationships to jatropha mosaic India virus, Jatropha curcas mosaic virus, Indian cassava mosaic virus, Sri Lankan cassava mosaic virus and other begomoviruses. Based on 86 % sequence identities and distant phylogenetic relationships to JMIV and other begomoviruses and the begomovirus species demarcation criteria of the ICTV (<89 % sequence identity of complete DNA-A genome), the begomovirus isolates associated with leaf yellow mosaic disease of J. curcas were identified as members of a new begomovirus species and provisionally designated as jatropha leaf yellow mosaic Katerniaghat virus (JLYMKV). Agroinfectious clones of the DNA molecule of the begomovirus isolate were also generated, and the fulfillment of Koch's postulates was demonstrated in J. curcas plants.

Profiling soil microbial communities with next-generation sequencing: the influence of DNA kit selection and technician technical expertise.

PubMed

Soliman, Taha; Yang, Sung-Yin; Yamazaki, Tomoko; Jenke-Kodama, Holger

2017-01-01

Structure and diversity of microbial communities are an important research topic in biology, since microbes play essential roles in the ecology of various environments. Different DNA isolation protocols can lead to data bias and can affect results of next-generation sequencing. To evaluate the impact of protocols for DNA isolation from soil samples and also the influence of individual handling of samples, we compared results obtained by two researchers (R and T) using two different DNA extraction kits: (1) MO BIO PowerSoil ® DNA Isolation kit (MO_R and MO_T) and (2) NucleoSpin ® Soil kit (MN_R and MN_T). Samples were collected from six different sites on Okinawa Island, Japan. For all sites, differences in the results of microbial composition analyses (bacteria, archaea, fungi, and other eukaryotes), obtained by the two researchers using the two kits, were analyzed. For both researchers, the MN kit gave significantly higher yields of genomic DNA at all sites compared to the MO kit (ANOVA; P  < 0.006). In addition, operational taxonomic units for some phyla and classes were missed in some cases: Micrarchaea were detected only in the MN_T and MO_R analyses; the bacterial phylum Armatimonadetes was detected only in MO_R and MO_T; and WIM5 of the phylum Amoebozoa of eukaryotes was found only in the MO_T analysis. Our results suggest the possibility of handling bias; therefore, it is crucial that replicated DNA extraction be performed by at least two technicians for thorough microbial analyses and to obtain accurate estimates of microbial diversity.

Real-time polymerase chain reaction detection of cauliflower mosaic virus to complement the 35S screening assay for genetically modified organisms.

PubMed

Cankar, Katarina; Ravnikar, Maja; Zel, Jana; Gruden, Kristina; Toplak, Natasa

2005-01-01

Labeling of genetically modified organisms (GMOs) is now in place in many countries, including the European Union, in order to guarantee the consumer's choice between GM and non-GM products. Screening of samples is performed by polymerase chain reaction (PCR) amplification of regulatory sequences frequently introduced into genetically modified plants. Primers for the 35S promoter from Cauliflower mosaic virus (CaMV) are those most frequently used. In virus-infected plants or in samples contaminated with plant material carrying the virus, false-positive results can consequently occur. A system for real-time PCR using a TaqMan minor groove binder probe was designed that allows recognition of virus coat protein in the sample, thus allowing differentiation between transgenic and virus-infected samples. We measured the efficiency of PCR amplification, limits of detection and quantification, range of linearity, and repeatability of the assay in order to assess the applicability of the assay for routine analysis. The specificity of the detection system was tested on various virus isolates and plant species. All 8 CaMV isolates were successfully amplified using the designed system. No cross-reactivity was detected with DNA from 3 isolates of the closely related Carnation etched ring virus. Primers do not amplify plant DNA from available genetically modified maize and soybean lines or from different species of Brassicaceae or Solanaceae that are natural hosts for CaMV. We evaluated the assay for different food matrixes by spiking CaMV DNA into DNA from food samples and have successfully amplified CaMV from all samples. The assay was tested on rapeseed samples from routine GMO testing that were positive in the 35S screening assay, and the presence of the virus was confirmed.

Comparison of Haemophilus parasuis reference strains and field isolates by using random amplified polymorphic DNA and protein profiles

PubMed Central

2012-01-01

Background Haemophilus parasuis is the causative agent of Glässer’s disease and is a pathogen of swine in high-health status herds. Reports on serotyping of field strains from outbreaks describe that approximately 30% of them are nontypeable and therefore cannot be traced. Molecular typing methods have been used as alternatives to serotyping. This study was done to compare random amplified polymorphic DNA (RAPD) profiles and whole cell protein (WCP) lysate profiles as methods for distinguishing H. parasuis reference strains and field isolates. Results The DNA and WCP lysate profiles of 15 reference strains and 31 field isolates of H. parasuis were analyzed using the Dice and neighbor joining algorithms. The results revealed unique and reproducible DNA and protein profiles among the reference strains and field isolates studied. Simpson’s index of diversity showed significant discrimination between isolates when three 10mer primers were combined for the RAPD method and also when both the RAPD and WCP lysate typing methods were combined. Conclusions The RAPD profiles seen among the reference strains and field isolates did not appear to change over time which may reflect a lack of DNA mutations in the genes of the samples. The recent field isolates had different WCP lysate profiles than the reference strains, possibly because the number of passages of the type strains may affect their protein expression. PMID:22703293

Assessment of environmental DNA for detecting presence of imperiled aquatic amphibian species in isolated wetlands

USGS Publications Warehouse

Mckee, Anna; Calhoun, Daniel L.; Barichivich, William J.; Spear, Stephen F.; Goldberg, Caren S.; Glenn, Travis C

2015-01-01

Environmental DNA (eDNA) is an emerging tool that allows low-impact sampling for aquatic species by isolating DNA from water samples and screening for DNA sequences specific to species of interest. However, researchers have not tested this method in naturally acidic wetlands that provide breeding habitat for a number of imperiled species, including the frosted salamander (Ambystoma cingulatum), reticulated flatwoods salamanders (Ambystoma bishopi), striped newt (Notophthalmus perstriatus), and gopher frog (Lithobates capito). Our objectives for this study were to develop and optimize eDNA survey protocols and assays to complement and enhance capture-based survey methods for these amphibian species. We collected three or more water samples, dipnetted or trapped larval and adult amphibians, and conducted visual encounter surveys for egg masses for target species at 40 sites on 12 different longleaf pine (Pinus palustris) tracts. We used quantitative PCRs to screen eDNA from each site for target species presence. We detected flatwoods salamanders at three sites with eDNA but did not detect them during physical surveys. Based on the sample location we assumed these eDNA detections to indicate the presence of frosted flatwoods salamanders. We did not detect reticulated flatwoods salamanders. We detected striped newts with physical and eDNA surveys at two wetlands. We detected gopher frogs at 12 sites total, three with eDNA alone, two with physical surveys alone, and seven with physical and eDNA surveys. We detected our target species with eDNA at 9 of 11 sites where they were present as indicated from traditional surveys and at six sites where they were not detected with traditional surveys. It was, however, critical to use at least three water samples per site for eDNA. Our results demonstrate eDNA surveys can be a useful complement to traditional survey methods for detecting imperiled pond-breeding amphibians. Environmental DNA may be particularly useful in situations where detection probability using traditional survey methods is low or access by trained personnel is limited.

Mitochondrial DNA structure of an isolated Tunisian Berber population and its relationship with Mediterranean populations.

PubMed

Ben Halim, Nizar; Hsouna, Sana; Lasram, Khaled; Chargui, Mariem; Khemira, Laaroussi; Saidane, Rachid; Abdelhak, Sonia; Kefi, Rym

2018-02-01

Douiret is an isolated Berber population from South-Eastern Tunisia. The strong geographic and cultural isolation characterising this population might have contributed to remarkable endogamy and consanguinity, which were practiced for several centuries. The objective of this study is to evaluate the mitochondrial DNA (mtDNA) genetic structure of Douiret and to compare it to other Mediterranean populations with a special focus on major haplogroup T. Genomic DNA was extracted from blood samples of 58 unrelated individuals collected from the different patrilineal lineages of the population. The hypervariable region 1 of the mtDNA was amplified and sequenced. For comparative analyses, additional HVS1 sequences (n = 4857) were compiled from previous studies. The maternal background of the studied sample from Douiret was mainly of Eurasian origin (74%) followed by Sub-Saharan (17%) and North African (3%) lineages. Douiret harbours the highest frequency of haplogroup T in the Mediterranean region, assigned to the unique subclade T1a (38%). Phylogenetic analysis showed an outlier position of Douiret at the Mediterranean level. The genetic structure of Douiret highlights the presence of founders, most likely of Near/Middle Eastern origin, who conquered this area during the Middle/Late Upper Palaeolithic and Neolithic dispersals.

Logistics and quality control for DNA sampling in large multicenter studies.

PubMed

Nederhand, R J; Droog, S; Kluft, C; Simoons, M L; de Maat, M P M

2003-05-01

To study associations between genetic variation and disease, large bio-banks need to be created in multicenter studies. Therefore, we studied the effects of storage time and temperature on DNA quality and quantity in a simulation experiment with storage up to 28 days frozen, at 4 degrees C and at room temperature. In the simulation experiment, the conditions did not influence the amount or quality of DNA to an unsatisfactory level. However, the amount of extracted DNA was decreased in frozen samples and in samples that were stored for > 7 days at room temperature. In a sample of patients from 24 countries of the EUROPA trial obtained by mail with transport times up to 1 month DNA yield and quality were adequate. From these results we conclude that transport of non-frozen blood by ordinary mail is usable and practical for DNA isolation for polymerase chain reaction in clinical and epidemiological studies.

Rapid Identification of a Cooling Tower-Associated Legionnaires' Disease Outbreak Supported by Polymerase Chain Reaction Testing of Environmental Samples, New York City, 2014-2015.

PubMed

Benowitz, Isaac; Fitzhenry, Robert; Boyd, Christopher; Dickinson, Michelle; Levy, Michael; Lin, Ying; Nazarian, Elizabeth; Ostrowsky, Belinda; Passaretti, Teresa; Rakeman, Jennifer; Saylors, Amy; Shamoonian, Elena; Smith, Terry-Ann; Balter, Sharon

2018-04-01

We investigated an outbreak of eight Legionnaires' disease cases among persons living in an urban residential community of 60,000 people. Possible environmental sources included two active cooling towers (air-conditioning units for large buildings) <1 km from patient residences, a market misting system, a community-wide water system used for heating and cooling, and potable water. To support a timely public health response, we used real-time polymerase chain reaction (PCR) to identify Legionella DNA in environmental samples within hours of specimen collection. We detected L. pneumophila serogroup 1 DNA only at a power plant cooling tower, supporting the decision to order remediation before culture results were available. An isolate from a power plant cooling tower sample was indistinguishable from a patient isolate by pulsed-field gel electrophoresis, suggesting the cooling tower was the outbreak source. PCR results were available <1 day after sample collection, and culture results were available as early as 5 days after plating. PCR is a valuable tool for identifying Legionella DNA in environmental samples in outbreak settings.

A new method for simultaneous detection and discrimination of Bovine herpesvirus types 1 (BoHV-1) and 5 (BoHV-5) using real time PCR with high resolution melting (HRM) analysis.

PubMed

Marin, M S; Quintana, S; Leunda, M R; Recavarren, M; Pagnuco, I; Späth, E; Pérez, S; Odeón, A

2016-01-01

Bovine herpesvirus types 1 (BoHV-1) and 5 (BoHV-5) are antigenically and genetically similar. The aim of this study was to develop a simple and reliable one-step real time PCR assay with high resolution melting (HRM) analysis for the simultaneous detection and differentiation of BoHV-1 and BoHV-5. Optimization of assay conditions was performed with DNA from reference strains. Then, DNA from field isolates, clinical samples and tissue samples of experimentally infected animals were studied by real time PCR-HRM. An efficient amplification of real time PCR products was obtained, and a clear melting curve and appropriate melting peaks for both viruses were achieved in the HRM curve analysis for BoHV type identification. BoHV was identified in all of the isolates and clinical samples, and BoHV types were properly differentiated. Furthermore, viral DNA was detected in 12/18 and 7/18 samples from BoHV-1- and BoHV-5-infected calves, respectively. Real time PCR-HRM achieved a higher sensitivity compared with virus isolation or conventional PCR. In this study, HRM was used as a novel procedure. This method provides rapid, sensitive, specific and simultaneous detection of bovine alpha-herpesviruses DNA. Thus, this technique is an excellent tool for diagnosis, research and epidemiological studies of these viruses in cattle. Copyright © 2015 Elsevier B.V. All rights reserved.

[Methanotrophs and methylobacteria are found in woody plant tissues within a winter period].

PubMed

Doronina, N V; Ivanova, E G; Suzina, N F; Trotsenko, Iu A

2004-01-01

Samples of tree seeds, buds, and needles collected within a winter period at ambient temperatures from -11 to -17 degrees C were analyzed for the presence of methylotrophic microflora. Thin sections of blue spruce needles were found to contain bacteria morphologically close to pink-pigmented methylobacteria. The methylobacteria that were isolated in pure cultures from samples of linden seeds and buds, pine and blue spruce needles, as well as of lilac, maple, and apple buds, were classified into the genera Methylobacterium and Paracoccus based on the data of morphological studies, enzyme assay, and DNA-DNA hybridization analysis. The methanotrophs that were isolated in pure cultures from samples of linden buds and blue spruce needles were identified into the genus Methylocystis based on the data of morphological studies, enzyme assay, DNA-DNA hybridization, and the phylogenetic analysis of the particulate methane monooxygenase gene pmoA sequences. The inference is made that aerobic methylotrophic bacteria are permanently associated with plants. At the beginning of the vegetative period in spring, the phyllosphere of coniferous and deciduous trees is colonized by the methylotrophic bacteria that have wintered inside plant tissues.

A novel method of genomic DNA extraction for Cactaceae1

PubMed Central

Fehlberg, Shannon D.; Allen, Jessica M.; Church, Kathleen

2013-01-01

• Premise of the study: Genetic studies of Cactaceae can at times be impeded by difficult sampling logistics and/or high mucilage content in tissues. Simplifying sampling and DNA isolation through the use of cactus spines has not previously been investigated. • Methods and Results: Several protocols for extracting DNA from spines were tested and modified to maximize yield, amplification, and sequencing. Sampling of and extraction from spines resulted in a simplified protocol overall and complete avoidance of mucilage as compared to typical tissue extractions. Sequences from one nuclear and three plastid regions were obtained across eight genera and 20 species of cacti using DNA extracted from spines. • Conclusions: Genomic DNA useful for amplification and sequencing can be obtained from cactus spines. The protocols described here are valuable for any cactus species, but are particularly useful for investigators interested in sampling living collections, extensive field sampling, and/or conservation genetic studies. PMID:25202521

High-throughput, automated extraction of DNA and RNA from clinical samples using TruTip technology on common liquid handling robots.

PubMed

Holmberg, Rebecca C; Gindlesperger, Alissa; Stokes, Tinsley; Brady, Dane; Thakore, Nitu; Belgrader, Philip; Cooney, Christopher G; Chandler, Darrell P

2013-06-11

TruTip is a simple nucleic acid extraction technology whereby a porous, monolithic binding matrix is inserted into a pipette tip. The geometry of the monolith can be adapted for specific pipette tips ranging in volume from 1.0 to 5.0 ml. The large porosity of the monolith enables viscous or complex samples to readily pass through it with minimal fluidic backpressure. Bi-directional flow maximizes residence time between the monolith and sample, and enables large sample volumes to be processed within a single TruTip. The fundamental steps, irrespective of sample volume or TruTip geometry, include cell lysis, nucleic acid binding to the inner pores of the TruTip monolith, washing away unbound sample components and lysis buffers, and eluting purified and concentrated nucleic acids into an appropriate buffer. The attributes and adaptability of TruTip are demonstrated in three automated clinical sample processing protocols using an Eppendorf epMotion 5070, Hamilton STAR and STARplus liquid handling robots, including RNA isolation from nasopharyngeal aspirate, genomic DNA isolation from whole blood, and fetal DNA extraction and enrichment from large volumes of maternal plasma (respectively).

Genetic homogeneity among Leishmania (Leishmania) infantum isolates from dog and human samples in Belo Horizonte Metropolitan Area (BHMA), Minas Gerais, Brazil.

PubMed

da Silva, Thais Almeida Marques; Gomes, Luciana Inácia; Oliveira, Edward; Coura-Vital, Wendel; Silva, Letícia de Azevedo; Pais, Fabiano Sviatopolk-Mirsky; Ker, Henrique Gama; Reis, Alexandre Barbosa; Rabello, Ana; Carneiro, Mariangela

2015-04-15

Certain municipalities in the Belo Horizonte Metropolitan Area (BHMA), Minas Gerais, Brazil, have the highest human visceral leishmaniasis (VL) mortality rates in the country and also demonstrate high canine seropositivity. In Brazil, the etiologic agent of VL is Leishmania (Leishmania) infantum. The aim of this study was to evaluate the intraspecific genetic variability of parasites from humans and from dogs with different clinical forms of VL in five municipalities of BHMA using PCR-RFLP and two target genes: kinetoplast DNA (kDNA) and gp63. In total, 45 samples of DNA extracted from clinical samples (n = 35) or L. infantum culture (n = 10) were evaluated. These samples originated from three groups: adults (with or without Leishmania/HIV co-infection; n = 14), children (n = 18) and dogs (n = 13). The samples were amplified for the kDNA target using the MC1 and MC2 primers (447 bp), while the Sg1 and Sg2 (1330 bp) primers were used for the gp63 glycoprotein target gene. The restriction enzyme patterns of all the samples tested were monomorphic. These findings reveal a high degree of genetic homogeneity for the evaluated gene targets among L. infantum samples isolated from different hosts and representing different clinical forms of VL in the municipalities of BHMA studied.

Optimization and validation of a fully automated silica-coated magnetic beads purification technology in forensics.

PubMed

Nagy, M; Otremba, P; Krüger, C; Bergner-Greiner, S; Anders, P; Henske, B; Prinz, M; Roewer, L

2005-08-11

Automated procedures for forensic DNA analyses are essential not only for large-throughput sample preparation, but are also needed to avoid errors during routine sample preparation. The most critical stage in PCR-based forensic analysis is DNA isolation, which should yield as much highly purified DNA as possible. The extraction method used consists of pre-treatment of stains and samples, cell lysis using chaotropic reagents, binding of the DNA to silica-coated magnetic particles, followed by elution of the DNA. Our work focuses mainly on sample preparation, obtaining the maximum possible amount of biological material from forensic samples, and the following cell lysis, to create a simple standardized lysis protocol suitable for nearly all forensic material. After optimization and validation, the M-48 BioRobot((R)) workstation has been used for more than 20,000 routine lab samples. There has been no evidence of cross contamination. Resulting DNA from as small as three nuclear cells yield reliable complete STR amplification profiles. The DNA remains stable after 2 years of storage.

Mosaic CREBBP mutation causes overlapping clinical features of Rubinstein-Taybi and Filippi syndromes.

PubMed

de Vries, Tamar I; Monroe, Glen R; van Belzen, Martine J; van der Lans, Christian A; Savelberg, Sanne Mc; Newman, William G; van Haaften, Gijs; Nievelstein, Rutger A; van Haelst, Mieke M

2016-08-01

Rubinstein-Taybi syndrome (RTS, OMIM 180849) and Filippi syndrome (FLPIS, OMIM 272440) are both rare syndromes, with multiple congenital anomalies and intellectual deficit (MCA/ID). We present a patient with intellectual deficit, short stature, bilateral syndactyly of hands and feet, broad thumbs, ocular abnormalities, and dysmorphic facial features. These clinical features suggest both RTS and FLPIS. Initial DNA analysis of DNA isolated from blood did not identify variants to confirm either of these syndrome diagnoses. Whole-exome sequencing identified a homozygous variant in C9orf173, which was novel at the time of analysis. Further Sanger sequencing analysis of FLPIS cases tested negative for CKAP2L variants did not, however, reveal any further variants. Subsequent analysis using DNA isolated from buccal mucosa revealed a mosaic variant in CREBBP. This report highlights the importance of excluding mosaic variants in patients with a strong but atypical clinical presentation of a MCA/ID syndrome if no disease-causing variants can be detected in DNA isolated from blood samples. As the striking syndactyly observed in the present case is typical for FLPIS, we suggest CREBBP analysis in saliva samples for FLPIS syndrome cases in which no causal CKAP2L variant is detected.

Sample size, library composition, and genotypic diversity among natural populations of Escherichia coli from different animals influence accuracy of determining sources of fecal pollution.

PubMed

Johnson, LeeAnn K; Brown, Mary B; Carruthers, Ethan A; Ferguson, John A; Dombek, Priscilla E; Sadowsky, Michael J

2004-08-01

A horizontal, fluorophore-enhanced, repetitive extragenic palindromic-PCR (rep-PCR) DNA fingerprinting technique (HFERP) was developed and evaluated as a means to differentiate human from animal sources of Escherichia coli. Box A1R primers and PCR were used to generate 2,466 rep-PCR and 1,531 HFERP DNA fingerprints from E. coli strains isolated from fecal material from known human and 12 animal sources: dogs, cats, horses, deer, geese, ducks, chickens, turkeys, cows, pigs, goats, and sheep. HFERP DNA fingerprinting reduced within-gel grouping of DNA fingerprints and improved alignment of DNA fingerprints between gels, relative to that achieved using rep-PCR DNA fingerprinting. Jackknife analysis of the complete rep-PCR DNA fingerprint library, done using Pearson's product-moment correlation coefficient, indicated that animal and human isolates were assigned to the correct source groups with an 82.2% average rate of correct classification. However, when only unique isolates were examined, isolates from a single animal having a unique DNA fingerprint, Jackknife analysis showed that isolates were assigned to the correct source groups with a 60.5% average rate of correct classification. The percentages of correctly classified isolates were about 15 and 17% greater for rep-PCR and HFERP, respectively, when analyses were done using the curve-based Pearson's product-moment correlation coefficient, rather than the band-based Jaccard algorithm. Rarefaction analysis indicated that, despite the relatively large size of the known-source database, genetic diversity in E. coli was very great and is most likely accounting for our inability to correctly classify many environmental E. coli isolates. Our data indicate that removal of duplicate genotypes within DNA fingerprint libraries, increased database size, proper methods of statistical analysis, and correct alignment of band data within and between gels improve the accuracy of microbial source tracking methods.

Identification of Stenotrophomonas maltophilia strains isolated from environmental and clinical samples: a rapid and efficient procedure.

PubMed

Pinot, C; Deredjian, A; Nazaret, S; Brothier, E; Cournoyer, B; Segonds, C; Favre-Bonté, S

2011-11-01

Aim of the study is to identify accurately Stenotrophomonas maltophilia isolates recovered from environmental and clinical samples. Recovery of Sten. maltophilia-like isolates from soil samples using the vancomycin, imipenem, amphotericin B (VIA) selective agar medium enabled distinction of various morphotype colonies. A set of soil and clinical isolates was tested for species identification using different methods. 16S rDNA analyses showed the dark green with a blue halo morphotype to be typical Sten. maltophilia strains. The API-20NE, Vitek-2 and Biolog phenotypic analyses typically used for the identification of clinical isolates did not perform well on these soil isolates. The species-specific PCR screening targeting Sten. maltophilia 23S rDNA and the multiplex smeD/ggpS PCR, differentiating Sten. maltophilia from Stenotrophomonas rhizophila, were tested for improvement of these identification schemes. The latter multiplex PCR identified all isolates tested in this study, whatever be their origin. Isolation on VIA medium and confirmation of Sten. maltophilia species membership by smeD PCR is proposed to identify environmental and clinical isolates of Sten. maltophilia. The proposed approach enables isolation and identification of Sten. maltophilia from different environments in an easy and rapid way. This approach will be useful to accurately manage studies on the abundance and distribution of Sten. maltophilia in hospital and nonhospital environments. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.

Isolation of Entomopathogenic Fungi From Soils and Ixodes scapularis (Acari: Ixodidae) Ticks: Prevalence and Methods

PubMed Central

Tuininga, Amy R.; Miller, Jessica L.; Morath, Shannon U.; Daniels, Thomas J.; Falco, Richard C.; Marchese, Michael; Sahabi, Sadia; Rosa, Dieshia; Stafford, Kirby C.

2009-01-01

Entomopathogenic fungi are commonly found in forested soils that provide tick habitat, and many species are pathogenic to Ixodes scapularis Say, the blacklegged tick. As a first step to developing effective biocontrol strategies, the objective of this study was to determine the best methods to isolate entomopathogenic fungal species from field-collected samples of soils and ticks from an Eastern deciduous forest where I. scapularis is common. Several methods were assessed: (1) soils, leaf litter, and ticks were plated on two types of media; (2) soils were assayed for entomopathogenic fungi using the Galleria bait method; (3) DNA from internal transcribed spacer (ITS) regions of the nuclear ribosomal repeat was extracted from pure cultures obtained from soils, Galleria, and ticks and was amplified and sequenced; and (4) DNA was extracted directly from ticks, amplified, and sequenced. We conclude that (1) ticks encounter potentially entomopathogenic fungi more often in soil than in leaf litter, (2) many species of potentially entomopathogenic fungi found in the soil can readily be cultured, (3) the Galleria bait method is a sufficiently efficient method for isolation of these fungi from soils, and (4) although DNA extraction from ticks was not possible in this study because of small sample size, DNA extraction from fungi isolated from soils and from ticks was successful and provided clean sequences in 100 and 73% of samples, respectively. A combination of the above methods is clearly necessary for optimal characterization of entomopathogenic fungi associated with ticks in the environment. PMID:19496427

Legionella species and serogroups in Malaysian water cooling towers: identification by latex agglutination and PCR-DNA sequencing of isolates.

PubMed

Yong, Stacey Foong Yee; Goh, Fen-Ning; Ngeow, Yun Fong

2010-03-01

In this study, we investigated the distribution of Legionella species in water cooling towers located in different parts of Malaysia to obtain information that may inform public health policies for the prevention of legionellosis. A total of 20 water samples were collected from 11 cooling towers located in three different states in east, west and south Malaysia. The samples were concentrated by filtration and treated with an acid buffer before plating on to BCYE agar. Legionella viable counts in these samples ranged from 100 to 2,000 CFU ml(-1); 28 isolates from the 24 samples were examined by latex agglutination as well as 16S rRNA and rpoB PCR-DNA sequencing. These isolates were identified as Legionella pneumophila serogroup 1 (35.7%), L. pneumophila serogroup 2-14 (39%), L. pneumophila non-groupable (10.7%), L. busanensis, L. gormanii, L. anisa and L. gresilensis. L. pneumophila was clearly the predominant species at all sampling sites. Repeat sampling from the same cooling tower and testing different colonies from the same water sample showed concurrent colonization by different serogroups and different species of Legionella in some of the cooling towers.

Characterization of viable bacteria from Siberian permafrost by 16S rDNA sequencing

NASA Technical Reports Server (NTRS)

Shi, T.; Reeves, R. H.; Gilichinsky, D. A.; Friedmann, E. I.

1997-01-01

Viable bacteria were found in permafrost core samples from the Kolyma-Indigirka lowland of northeast Siberia. The samples were obtained at different depths; the deepest was about 3 million years old. The average temperature of the permafrost is -10 degrees C. Twenty-nine bacterial isolates were characterized by 16S rDNA sequencing and phylogenetic analysis, cell morphology, Gram staining, endospore formation, and growth at 30 degrees C. The majority of the bacterial isolates were rod shaped and grew well at 30 degrees C; but two of them did not grow at or above 28 degrees C, and had optimum growth temperatures around 20 degrees C. Thirty percent of the isolates could form endospores. Phylogenetic analysis revealed that the isolates fell into four categories: high-GC Gram-positive bacteria, beta-proteobacteria, gamma-proteobacteria, and low-GC Gram-positive bacteria. Most high-GC Gram-positive bacteria and beta-proteobacteria, and all gamma-proteobacteria, came from samples with an estimated age of 1.8-3.0 million years (Olyor suite). Most low-GC Gram-positive bacteria came from samples with an estimated age of 5,000-8,000 years (Alas suite).

Genetic polymorphisms in prehistoric Pacific islanders determined by analysis of ancient bone DNA.

PubMed

Hagelberg, E; Clegg, J B

1993-05-22

A previously characterized Asian-specific mitochondrial DNA (mtDNA) length mutation has been detected in DNA isolated from prehistoric human bones from Polynesia, including Hawaii, Chatham Islands and Society Islands. In contrast, the Asian mutation was absent in skeletal samples from the Melanesian archipelagos of New Britain and Vanuatu and in the oldest samples from Fiji, Tonga and Samoa in the central Pacific (2700-1600 years BP) although it was present in a more recent prehistoric sample from Tonga. These results, augmented by informative DNA sequence data from the hypervariable region of mtDNA, fail to support current views that the central Pacific was settled directly by voyagers from island Southeast Asia, the putative ancestors of modern Polynesians. An earlier occupation by peoples from the neighbouring Melanesian archipelagos seems more likely.

Genetic variability in isolates of Chromobacterium violaceum from pulmonary secretion, water, and soil.

PubMed

Santini, A C; Magalhães, J T; Cascardo, J C M; Corrêa, R X

2016-04-28

Chromobacterium violaceum is a free-living Gram-negative bacillus usually found in the water and soil in tropical regions, which causes infections in humans. Chromobacteriosis is characterized by rapid dissemination and high mortality. The aim of this study was to detect the genetic variability among C. violaceum type strain ATCC 12472, and seven isolates from the environment and one from a pulmonary secretion from a chromobacteriosis patient from Ilhéus, Bahia. The molecular characterization of all samples was performed by polymerase chain reaction (PCR) sequencing and 16S rDNA analysis. Primers specific for two ATCC 12472 pathogenicity genes, hilA and yscD, as well as random amplified polymorphic DNA (RAPD), were used for PCR amplification and comparative sequencing of the products. For a more specific approach, the PCR products of 16S rDNA were digested with restriction enzymes. Seven of the samples, including type-strain ATCC 12472, were amplified by the hilA primers; these were subsequently sequenced. Gene yscD was amplified only in type-strain ATCC 12472. MspI and AluI digestion revealed 16S rDNA polymorphisms. This data allowed the generation of a dendogram for each analysis. The isolates of C. violaceum have variability in random genomic regions demonstrated by RAPD. Also, these isolates have variability in pathogenicity genes, as demonstrated by sequencing and restriction enzyme digestion.

Morphologic and Genetic Identification of Taenia Tapeworms in Tanzania and DNA Genotyping of Taenia solium

PubMed Central

Eom, Keeseon S.; Chai, Jong-Yil; Yong, Tai-Soon; Min, Duk-Young; Rim, Han-Jong; Kihamia, Charles

2011-01-01

Species identification of Taenia tapeworms was performed using morphologic observations and multiplex PCR and DNA sequencing of the mitochondrial cox1 gene. In 2008 and 2009, a total of 1,057 fecal samples were collected from residents of Kongwa district of Dodoma region, Tanzania, and examined microscopically for helminth eggs and proglottids. Of these, 4 Taenia egg positive cases were identified, and the eggs were subjected to DNA analysis. Several proglottids of Taenia solium were recovered from 1 of the 4 cases. This established that the species were T. solium (n=1) and T. saginata (n=3). One further T. solium specimen was found among 128 fecal samples collected from Mbulu district in Arusha, and this had an intact strobila with the scolex. Phylegenetic analysis of the mtDNA cox1 gene sequences of these 5 isolates showed that T. saginata was basal to the T. solium clade. The mitochondrial cox1 gene sequences of 3 of these Tanzanian isolates showed 99% similarity to T. saginata, and the other 2 isolates showed 100% similarity to T. solium. The present study has shown that Taenia tapeworms are endemic in Kongwa district of Tanzania, as well as in a previously identified Mbulu district. Both T. solium isolates were found to have an "African/Latin American" genotype (cox1). PMID:22355207

A rapid and efficient SDS-based RNA isolation protocol from different tissues of coffee.

PubMed

Huded, Arun Kumar C; Jingade, Pavankumar; Mishra, Manoj Kumar

2018-03-01

Isolation of high-quality RNA from coffee is challenging because of high level of polysaccharides, polyphenols and other secondary metabolites. In the present study, a rapid and efficient RNA extraction protocol from different tissues of coffee was optimized. Sufficiently high quality and quantity (225.6-454.8 µg/g) of RNA was obtained by using the optimized protocol. The presence of two distinct bands of 28S rRNA and 18S rRNA in agarose gel proved the intactness of the RNA samples. The average spectrophotometric values of the isolated RNA ranged from 1.96 to 2.02 ( A 260/280 ) and 1.95 to 2.14 ( A 260/230 ), indicating the high quality of RNA devoid of polyphenols, polysaccharides and protein contamination. In the optimized protocol, addition of PVPP to the extraction buffer and a brief incubation of samples at 65 °C and subsequent purification with potassium acetate resulted in good-quality RNA isolation. The suitability of RNA for downstream processing was confirmed by PCR amplification with cytochrome c oxidase gene-specific primers. The amplification of a single 392 bp fragment using cDNA and 1.5 kb fragment using genomic DNA samples confirmed the absence of DNA contamination. The present protocol is rapid and yielded good quality and quantity of RNA suitable for functional genomics studies.

Rapid Isolation and Detection for RNA Biomarkers for TBI Diagnostics

DTIC Science & Technology

2016-10-01

address the qualitative result of PCR by choosing the threshold crossover cycle (CT) as a surrogate measure of the RNA/DNA originally in the sample ...include developing DEP techniques for isolation of cell-free (cf) RNA from glioblastoma exosomes and TBI samples (IRB dependent); methods for on... Sample to Answer diagnostics. 15. SUBJECT TERMS 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF PAGES 19a. NAME OF

Mycobacterium smegmatis strain for detection of Mycobacterium tuberculosis by PCR used as internal control for inhibition of amplification and for quantification of bacteria.

PubMed Central

Kolk, A H; Noordhoek, G T; de Leeuw, O; Kuijper, S; van Embden, J D

1994-01-01

For the detection of Mycobacterium tuberculosis by PCR, the IS6110 sequence was used. A modified target was constructed by insertion of 56 nucleotides in the IS6110 insertion element of Mycobacterium bovis BCG. This modified insertion sequence was integrated into the genome of Mycobacterium smegmatis, a mycobacterium species which does not contain the IS6110 element. When DNA from the modified M. smegmatis 1008 strain was amplified with IS6110-specific primers INS1 and INS2, a band of 301 bp was seen on agarose gel, whereas the PCR product of M. tuberculosis complex DNA was a 245-bp fragment with these primers. The addition of a small number of M. smegmatis 1008 cells to clinical samples before DNA purification enables the detection of problems which may be due to the loss of DNA in the isolation procedure or to the presence of inhibitors. The presence of inhibitors of the amplification reaction can be confirmed by the addition of M. smegmatis 1008 DNA after the DNA isolation procedure. Furthermore, competition between the different target DNAs of M. smegmatis 1008 DNA and M. tuberculosis complex DNA enables the estimation of the number of IS6110 elements in the clinical sample. Images PMID:8051267

Phylogenetic analysis of bacterial isolates from man-made high-pH, high-salt environments and identification of gene-cassette-associated open reading frames.

PubMed

Ghauri, Muhammad A; Khalid, Ahmad M; Grant, Susan; Grant, William D; Heaphy, Shaun

2006-06-01

Environmental samples were collected from high-pH sites in Pakistan, including a uranium heap set up for carbonate leaching, the lime unit of a tannery, and the Khewra salt mine. Another sample was collected from a hot spring on the shore of the soda lake, Magadi, in Kenya. Microbial cultures were enriched from Pakistani samples. Phylogenetic analysis of isolates was carried out by sequencing 16S rRNA genes. Genomic DNA was amplified by polymerase chain reaction using integron gene-cassette-specific primers. Different gene-cassette-linked genes were recovered from the cultured strains related to Halomonas magadiensis, Virgibacillus halodenitrificans, and Yania flava and from the uncultured environmental DNA sample. The usefulness of this technique as a tool for gene mining is indicated.

Estimation of the Relative Abundance of Different Bacteroides and Prevotella Ribotypes in Gut Samples by Restriction Enzyme Profiling of PCR-Amplified 16S rRNA Gene Sequences

PubMed Central

Wood, Jacqueline; Scott, Karen P.; Avguštin, Gorazd; Newbold, C. James; Flint, Harry J.

1998-01-01

We describe an approach for determining the genetic composition of Bacteroides and Prevotella populations in gut contents based on selective amplification of 16S rRNA gene sequences (rDNA) followed by cleavage of the amplified material with restriction enzymes. The relative contributions of different ribotypes to total Bacteroides and Prevotella 16S rDNA are estimated after end labelling of one of the PCR primers, and the contribution of Bacteroides and Prevotella sequences to total eubacterial 16S rDNA is estimated by measuring the binding of oligonucleotide probes to amplified DNA. Bacteroides and Prevotella 16S rDNA accounted for between 12 and 62% of total eubacterial 16S rDNA in samples of ruminal contents from six sheep and a cow. Ribotypes 4, 5, 6, and 7, which include most cultivated rumen Prevotella strains, together accounted for between 20 and 86% of the total amplified Bacteroides and Prevotella rDNA in these samples. The most abundant Bacteroides or Prevotella ribotype in four animals, however, was ribotype 8, for which there is only one known cultured isolate, while ribotypes 1 and 2, which include many colonic Bacteroides spp., were the most abundant in two animals. This indicates that some abundant Bacteroides and Prevotella groups in the rumen are underrepresented among cultured rumen Prevotella isolates. The approach described here provides a rapid, convenient, and widely applicable method for comparing the genotypic composition of bacterial populations in gut samples. PMID:9758785

Real-Time PCR Assay To Detect Smallpox Virus

PubMed Central

Sofi Ibrahim, M.; Kulesh, David A.; Saleh, Sharron S.; Damon, Inger K.; Esposito, Joseph J.; Schmaljohn, Alan L.; Jahrling, Peter B.

2003-01-01

We developed a highly sensitive and specific assay for the rapid detection of smallpox virus DNA on both the Smart Cycler and LightCycler platforms. The assay is based on TaqMan chemistry with the orthopoxvirus hemagglutinin gene used as the target sequence. With genomic DNA purified from variola virus Bangladesh 1975, the limit of detection was estimated to be approximately 25 copies on both machines. The assay was evaluated in a blinded study with 322 coded samples that included genomic DNA from 48 different isolates of variola virus; 25 different strains and isolates of camelpox, cowpox, ectromelia, gerbilpox, herpes, monkeypox, myxoma, rabbitpox, raccoonpox, skunkpox, vaccinia, and varicella-zoster viruses; and two rickettsial species at concentrations mostly ranging from 100 fg/μl to 1 ng/μl. Contained within those 322 samples were variola virus DNA, obtained from purified viral preparations, at concentrations of 1 fg/μl to 1 ng/μl. On the Smart Cycler platform, 2 samples with false-positive results were detected among the 116 samples not containing variola virus tested; i.e., the overall specificity of the assay was 98.3%. On the LightCycler platform, five samples with false-positive results were detected (overall specificity, 95.7%). Of the 206 samples that contained variola virus DNA ranging in concentrations from 100 fg/μl to 1 ng/μl, 8 samples were considered negative on the Smart Cycler platform and 1 sample was considered negative on the LightCycler platform. Thus, the clinical sensitivities were 96.1% for the Smart Cycler instrument and 99.5% for the LightCycler instrument. The vast majority of these samples were derived from virus-infected cell cultures and variola virus-infected tissues; thus, the DNA material contained both viral DNA and cellular DNA. Of the 43 samples that contained purified variola virus DNA ranging in concentration from 1 fg/μl to 1 ng/μl, the assay correctly detected the virus in all 43 samples on both the Smart Cycler and the LightCycler platforms. The assay may be useful for the early detection of smallpox virus infections should such infections occur as a result of a deliberate or an accidental recurrence. PMID:12904397

An Efficient Method for Genomic DNA Extraction from Different Molluscs Species

PubMed Central

Pereira, Jorge C.; Chaves, Raquel; Bastos, Estela; Leitão, Alexandra; Guedes-Pinto, Henrique

2011-01-01

The selection of a DNA extraction method is a critical step when subsequent analysis depends on the DNA quality and quantity. Unlike mammals, for which several capable DNA extraction methods have been developed, for molluscs the availability of optimized genomic DNA extraction protocols is clearly insufficient. Several aspects such as animal physiology, the type (e.g., adductor muscle or gills) or quantity of tissue, can explain the lack of efficiency (quality and yield) in molluscs genomic DNA extraction procedure. In an attempt to overcome these aspects, this work describes an efficient method for molluscs genomic DNA extraction that was tested in several species from different orders: Veneridae, Ostreidae, Anomiidae, Cardiidae (Bivalvia) and Muricidae (Gastropoda), with different weight sample tissues. The isolated DNA was of high molecular weight with high yield and purity, even with reduced quantities of tissue. Moreover, the genomic DNA isolated, demonstrated to be suitable for several downstream molecular techniques, such as PCR sequencing among others. PMID:22174651

Antibiotic Resistance Genes in the Bacteriophage DNA Fraction of Environmental Samples

PubMed Central

Colomer-Lluch, Marta; Jofre, Juan; Muniesa, Maite

2011-01-01

Antibiotic resistance is an increasing global problem resulting from the pressure of antibiotic usage, greater mobility of the population, and industrialization. Many antibiotic resistance genes are believed to have originated in microorganisms in the environment, and to have been transferred to other bacteria through mobile genetic elements. Among others, β-lactam antibiotics show clinical efficacy and low toxicity, and they are thus widely used as antimicrobials. Resistance to β-lactam antibiotics is conferred by β-lactamase genes and penicillin-binding proteins, which are chromosomal- or plasmid-encoded, although there is little information available on the contribution of other mobile genetic elements, such as phages. This study is focused on three genes that confer resistance to β-lactam antibiotics, namely two β-lactamase genes (blaTEM and blaCTX-M9) and one encoding a penicillin-binding protein (mecA) in bacteriophage DNA isolated from environmental water samples. The three genes were quantified in the DNA isolated from bacteriophages collected from 30 urban sewage and river water samples, using quantitative PCR amplification. All three genes were detected in the DNA of phages from all the samples tested, in some cases reaching 104 gene copies (GC) of blaTEM or 102 GC of blaCTX-M and mecA. These values are consistent with the amount of fecal pollution in the sample, except for mecA, which showed a higher number of copies in river water samples than in urban sewage. The bla genes from phage DNA were transferred by electroporation to sensitive host bacteria, which became resistant to ampicillin. blaTEM and blaCTX were detected in the DNA of the resistant clones after transfection. This study indicates that phages are reservoirs of resistance genes in the environment. PMID:21390233

A method suitable for DNA extraction from humus-rich soil.

PubMed

Miao, Tianjin; Gao, Song; Jiang, Shengwei; Kan, Guoshi; Liu, Pengju; Wu, Xianming; An, Yingfeng; Yao, Shuo

2014-11-01

A rapid and convenient method for extracting DNA from soil is presented. Soil DNA is extracted by direct cell lysis in the presence of EDTA, SDS, phenol, chloroform and isoamyl alcohol (3-methyl-1-butanol) followed by precipitation with 2-propanol. The extracted DNA is purified by modified DNA purification kit and DNA gel extraction kit. With this method, DNA extracted from humus-rich dark brown forest soil was free from humic substances and, therefore, could be used for efficient PCR amplification and restriction digestion. In contrast, DNA sample extracted with the traditional CTAB-based method had lower yield and purity, and no DNA could be extracted from the same soil sample with a commonly-used commercial soil DNA isolation kit. In addition, this method is time-saving and convenient, providing an efficient choice especially for DNA extraction from humus-rich soils.

Molecular detection of Borrelia bissettii DNA in serum samples from patients in the Czech Republic with suspected borreliosis.

PubMed

Rudenko, Nataliia; Golovchenko, Maryna; Růzek, Daniel; Piskunova, Natalja; Mallátová, Nadja; Grubhoffer, Libor

2009-03-01

Until recently, three spirochete genospecies were considered to be the causative agents of Lyme borreliosis (LB) in Europe: Borrelia burgdorferi sensu stricto, Borrelia afzelii and Borrelia garinii. However, the DNA of Borrelia valaisiana, Borrelia lusitaniae, Borrelia spielmanii and Borrelia bissettii has already been detected in samples of human origin, or the spirochetes were isolated from the patients with symptoms of LB. Molecular analysis of 12 selected serum samples collected in the regional hospital confirmed the presence of B. bissettii DNA in cases of single and multiple infection in patients with symptomatic borreliosis or chronic borrelial infection. The presence of B. bissettii as a single strain in patients provides strong support of the fact that B. bissettii might be a causative agent of the disease. After the first isolation of B. bissettii from the samples of human origin in Slovenia, following the detection of this species in cardiac valve tissue of the patient with endocarditis and aortic valve stenosis in the Czech Republic, here we present additional molecular data supporting the involvement of B. bissettii in LB in Europe.

Research note: isolation of a herpesvirus from a bald eagle nestling

USGS Publications Warehouse

Docherty, D.E.; Romaine, R.I.; Knight, R.L.

1983-01-01

Cloacal swabs collected from wild bald eagle nestlings (Haliaeetus leucocephalus) were tested for viruses. A virus isolated from one of these samples had a lipid coat and contained DNA. Electron microscopy confirmed that it was a herpesvirus. This appears to be the first report of a herpesvirus isolation from a wild bald eagle.

Meticulous plasma isolation is essential to avoid false low-level viraemia in Roche Cobas HIV-1 viral load assays.

PubMed

Mortier, Virginie; Vancoillie, Leen; Dauwe, Kenny; Staelens, Delfien; Demecheleer, Els; Schauvliege, Marlies; Dinakis, Sylvie; Van Maerken, Tom; Dessilly, Géraldine; Ruelle, Jean; Verhofstede, Chris

2017-10-24

Pre-analytical sample processing is often overlooked as a potential cause of inaccurate assay results. Here we demonstrate how plasma, extracted from standard EDTA-containing blood collection tubes, may contain traces of blood cells consequently resulting in a false low-level HIV-1 viral load when using Roche Cobas HIV-1 assays. The presence of human DNA in Roche Cobas 4800 RNA extracts and in RNA extracts from the Abbott HIV-1 RealTime assay was assessed by quantifying the human albumin gene by means of quantitative PCR. RNA was extracted from plasma samples before and after an additional centrifugation and tested for viral load and DNA contamination. The relation between total DNA content and viral load was defined. Elevated concentrations of genomic DNA were detected in 28 out of 100 Cobas 4800 extracts and were significantly more frequent in samples processed outside of the AIDS Reference Laboratory. An association between genomic DNA presence and spurious low-level viraemia results was demonstrated. Supplementary centrifugation of plasma before RNA extraction eliminated the contamination and the false viraemia. Plasma isolated from standard EDTA-containing blood collection tubes may contain traces of HIV DNA leading to false viral load results above the clinical cutoff. Supplementary centrifugation of plasma before viral load analysis may eliminate the occurrence of this spurious low-level viraemia.

Nucleic Acid Extraction from Synthetic Mars Analog Soils for in situ Life Detection

NASA Astrophysics Data System (ADS)

Mojarro, Angel; Ruvkun, Gary; Zuber, Maria T.; Carr, Christopher E.

2017-08-01

Biological informational polymers such as nucleic acids have the potential to provide unambiguous evidence of life beyond Earth. To this end, we are developing an automated in situ life-detection instrument that integrates nucleic acid extraction and nanopore sequencing: the Search for Extra-Terrestrial Genomes (SETG) instrument. Our goal is to isolate and determine the sequence of nucleic acids from extant or preserved life on Mars, if, for example, there is common ancestry to life on Mars and Earth. As is true of metagenomic analysis of terrestrial environmental samples, the SETG instrument must isolate nucleic acids from crude samples and then determine the DNA sequence of the unknown nucleic acids. Our initial DNA extraction experiments resulted in low to undetectable amounts of DNA due to soil chemistry-dependent soil-DNA interactions, namely adsorption to mineral surfaces, binding to divalent/trivalent cations, destruction by iron redox cycling, and acidic conditions. Subsequently, we developed soil-specific extraction protocols that increase DNA yields through a combination of desalting, utilization of competitive binders, and promotion of anaerobic conditions. Our results suggest that a combination of desalting and utilizing competitive binders may establish a "universal" nucleic acid extraction protocol suitable for analyzing samples from diverse soils on Mars.

Nucleic Acid Extraction from Synthetic Mars Analog Soils for in situ Life Detection.

PubMed

Mojarro, Angel; Ruvkun, Gary; Zuber, Maria T; Carr, Christopher E

2017-08-01

Biological informational polymers such as nucleic acids have the potential to provide unambiguous evidence of life beyond Earth. To this end, we are developing an automated in situ life-detection instrument that integrates nucleic acid extraction and nanopore sequencing: the Search for Extra-Terrestrial Genomes (SETG) instrument. Our goal is to isolate and determine the sequence of nucleic acids from extant or preserved life on Mars, if, for example, there is common ancestry to life on Mars and Earth. As is true of metagenomic analysis of terrestrial environmental samples, the SETG instrument must isolate nucleic acids from crude samples and then determine the DNA sequence of the unknown nucleic acids. Our initial DNA extraction experiments resulted in low to undetectable amounts of DNA due to soil chemistry-dependent soil-DNA interactions, namely adsorption to mineral surfaces, binding to divalent/trivalent cations, destruction by iron redox cycling, and acidic conditions. Subsequently, we developed soil-specific extraction protocols that increase DNA yields through a combination of desalting, utilization of competitive binders, and promotion of anaerobic conditions. Our results suggest that a combination of desalting and utilizing competitive binders may establish a "universal" nucleic acid extraction protocol suitable for analyzing samples from diverse soils on Mars. Key Words: Life-detection instruments-Nucleic acids-Mars-Panspermia. Astrobiology 17, 747-760.

Properties of Thermus ruber Strains Isolated from Icelandic Hot Springs and DNA:DNA Homology of Thermus ruber and Thermus aquaticus

PubMed Central

Sharp, Richard J.; Williams, Ralph A. D.

1988-01-01

Seventeen pink-pigmented strains of the genus Thermus were isolated from samples collected from thermal areas of Iceland. The strains were examined by using phenotypic characterization and DNA:DNA homology and were compared with recognized strains. Visually, the strains could be divided into three groups based on their pigmentation; however, spectroscopic studies of the pigments indicated little difference among them. Most strains required a vitamin supplement for growth and used fructose, maltose, mannose, or sucrose as the sole carbon source. In the presence of nitrate, two strains were able to grow under anaerobic conditions. The optimum growth temperature was 60°C; growth did not occur at 30 or 70°C. PMID:16347714

An accurate bacterial DNA quantification assay for HTS library preparation of human biological samples.

PubMed

Seashols-Williams, Sarah; Green, Raquel; Wohlfahrt, Denise; Brand, Angela; Tan-Torres, Antonio Limjuco; Nogales, Francy; Brooks, J Paul; Singh, Baneshwar

2018-05-17

Sequencing and classification of microbial taxa within forensically relevant biological fluids has the potential for applications in the forensic science and biomedical fields. The quantity of bacterial DNA from human samples is currently estimated based on quantity of total DNA isolated. This method can miscalculate bacterial DNA quantity due to the mixed nature of the sample, and consequently library preparation is often unreliable. We developed an assay that can accurately and specifically quantify bacterial DNA within a mixed sample for reliable 16S ribosomal DNA (16S rDNA) library preparation and high throughput sequencing (HTS). A qPCR method was optimized using universal 16S rDNA primers, and a commercially available bacterial community DNA standard was used to develop a precise standard curve. Following qPCR optimization, 16S rDNA libraries from saliva, vaginal and menstrual secretions, urine, and fecal matter were amplified and evaluated at various DNA concentrations; successful HTS data were generated with as low as 20 pg of bacterial DNA. Changes in bacterial DNA quantity did not impact observed relative abundances of major bacterial taxa, but relative abundance changes of minor taxa were observed. Accurate quantification of microbial DNA resulted in consistent, successful library preparations for HTS analysis. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Isolation of thermotolerant Vermamoeba vermiformis strains from water sources in Lanzarote Island, Canary Islands, Spain.

PubMed

Reyes-Batlle, María; Wagner, Carolina; Zamora-Herrera, Jonadab; Vargas-Mesa, Alejandro; Sifaoui, Ines; González, Ana C; López-Arencibia, Atteneri; Valladares, Basilio; Martínez-Carretero, Enrique; Piñero, José E; Lorenzo-Morales, Jacob

2016-09-01

In this study, twenty water samples were collected in the island of Lanzarote, Canary Islands, Spain in order to check for the presence of V. vermiformis strains in these samples. Water samples were cultured on 2% Non-Nutrient Agar (NNA) plates covered with a thin layer of heat killed E. coli and checked daily for the presence of Vermamoeba. After a week, V. vermiformis amoebae were observed in 2 of the 20 processed samples (10%) incubated at room temperature and 37°C. Molecular characterization was carried out by amplifying the 18S rDNA gene and DNA sequencing in order to confirm the identity of the isolated amoebic strains. To the best of our knowledge, this is the first report on the presence of FLA in environmental sources in Lanzarote Island and the first report of Vermamoeba vermiformis in water sources in this island. Furthermore, the two strains isolated in this study were collected in recreational areas with close contact with humans and thus awareness should be raised.

Microbiological Impact on Carbon Capture and Sequestration: Biotic Processes in Natural CO2 Analogue

EPA Science Inventory

Multiple ground-water based microbial community analyses including membrane lipids assays for phospholipid fatty acid and DNA analysis were performed from hydraulically isolated zones. DGGE results from DNA extracts from vertical profiling of the entire depth of aquifer sampled a...

Separating endogenous ancient DNA from modern day contamination in a Siberian Neandertal

PubMed Central

Skoglund, Pontus; Northoff, Bernd H.; Shunkov, Michael V.; Derevianko, Anatoli P.; Pääbo, Svante; Krause, Johannes; Jakobsson, Mattias

2014-01-01

One of the main impediments for obtaining DNA sequences from ancient human skeletons is the presence of contaminating modern human DNA molecules in many fossil samples and laboratory reagents. However, DNA fragments isolated from ancient specimens show a characteristic DNA damage pattern caused by miscoding lesions that differs from present day DNA sequences. Here, we develop a framework for evaluating the likelihood of a sequence originating from a model with postmortem degradation—summarized in a postmortem degradation score—which allows the identification of DNA fragments that are unlikely to originate from present day sources. We apply this approach to a contaminated Neandertal specimen from Okladnikov Cave in Siberia to isolate its endogenous DNA from modern human contaminants and show that the reconstructed mitochondrial genome sequence is more closely related to the variation of Western Neandertals than what was discernible from previous analyses. Our method opens up the potential for genomic analysis of contaminated fossil material. PMID:24469802

A non-invasive technique for rapid extraction of DNA from fish scales.

PubMed

Kumar, Ravindra; Singh, Poonam Jayant; Nagpure, N S; Kushwaha, Basdeo; Srivastava, S K; Lakra, W S

2007-11-01

DNA markers are being increasingly used in studies related to population genetics and conservation biology of endangered species. DNA isolation for such studies requires a source of biological material that is easy to collect, non-bulky and reliable. Further, the sampling strategies based on non-invasive procedures are desirable, especially for the endangered fish species. In view of above, a rapid DNA extraction method from fish scales has been developed with the use of a modified lysis buffer that require about 2 hr duration. This methodology is non-invasive, less expensive and reproducible with high efficiency of DNA recovery. The DNA extracted by this technique, have been found suitable for performing restriction enzyme digestion and PCR amplification. Therefore, the present DNA extraction procedure can be used as an alternative technique in population genetic studies pertaining to endangered fish species. The technique was also found equally effective for DNA isolation from fresh, dried and ethanol preserved scales.

Specific primers design based on the superoxide dismutase b gene for Trypanosoma cruzi as a screening tool: Validation method using strains from Colombia classified according to their discrete typing unit.

PubMed

Olmo, Francisco; Escobedo-Orteg, Javier; Palma, Patricia; Sánchez-Moreno, Manuel; Mejía-Jaramillo, Ana; Triana, Omar; Marín, Clotilde

2014-11-01

To classify 21 new isolates of Trypanosoma cruzi (T. cruzi) according to the Discrete Typing Unit (DTU) which they belong to, as well as tune up a new pair of primers designed to detect the parasite in biological samples. Strains were isolated, DNA extracted, and classified by using three Polymerase Chain Reactions (PCR). Subsequently this DNA was used along with other isolates of various biological samples, for a new PCR using primers designed. Finally, the amplified fragments were sequenced. It was observed the predominance of DTU I in Colombia, as well as the specificity of our primers for detection of T. cruzi, while no band was obtained when other species were used. This work reveals the genetic variability of 21 new isolates of T. cruzi in Colombia.Our primers confirmed their specificity for detecting the presence of T. cruzi. Copyright © 2014 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

Molecular Epidemiological Study of Aspergillus fumigatus in a Bone Marrow Transplantation Unit by PCR Amplification of Ribosomal Intergenic Spacer Sequences

PubMed Central

Radford, Sarah A.; Johnson, Elizabeth M.; Leeming, John P.; Millar, Michael R.; Cornish, Jacqueline M.; Foot, Annabel B. M.; Warnock, David W.

1998-01-01

We have developed a PCR-based method for the subspecific discrimination of Aspergillus fumigatus types by using two primers designed to amplify the intergenic spacer regions between ribosomal DNA transcription units. The method permitted the reproducible discrimination of 11 distinct DNA types among a total of 119 isolates of A. fumigatus collected from patients and from the environment of a bone marrow transplantation (BMT) unit over a three-year period. Ten DNA types of A. fumigatus were isolated from patients in the BMT unit; eight of these types were also found in the hospital environment, and six of these were present in the unit itself. Thirteen BMT patients developed infection with one of three DNA types some months after these had first been found in the environment of the unit. In other instances, the same DNA types of A. fumigatus were isolated from BMT patients that were later recovered from the environment of the unit. Several DNA types of A. fumigatus were found in the hospital environment over an 18-month period. Molecular typing of multiple isolates of A. fumigatus, obtained from postmortem tissue samples, showed that one patient was infected with a single DNA type, but two others had up to three different DNA types. Our findings suggest that A. fumigatus infection in BMT recipients may be nosocomial in origin and underline the need for careful environmental monitoring of units in which high-risk patients are housed. PMID:9574694

Influence of heavy metal stress on antioxidant status and DNA damage in Urtica dioica.

PubMed

Gjorgieva, Darinka; Kadifkova Panovska, Tatjana; Ruskovska, Tatjana; Bačeva, Katerina; Stafilov, Trajče

2013-01-01

Heavy metals have the potential to interact and induce several stress responses in the plants; thus, effects of heavy metal stress on DNA damages and total antioxidants level in Urtica dioica leaves and stems were investigated. The samples are sampled from areas with different metal exposition. Metal content was analyzed by Inductively Coupled Plasma-Atomic Emission Spectrometer (ICP-AES), for total antioxidants level assessment the Ferric-Reducing Antioxidant Power (FRAP) assay was used, and genomic DNA isolation from frozen plant samples was performed to obtain DNA fingerprints of investigated plant. It was found that heavy metal contents in stems generally changed synchronously with those in leaves of the plant, and extraneous metals led to imbalance of mineral nutrient elements. DNA damages were investigated by Random Amplified Polymorphic DNA (RAPD) technique, and the results demonstrated that the samples exposed to metals yielded a large number of new fragments (total 12) in comparison with the control sample. This study showed that DNA stability is highly affected by metal pollution which was identified by RAPD markers. Results suggested that heavy metal stress influences antioxidant status and also induces DNA damages in U. dioica which may help to understand the mechanisms of metals genotoxicity.

Rapid Identification of a Cooling Tower-Associated Legionnaires’ Disease Outbreak Supported by Polymerase Chain Reaction Testing of Environmental Samples, New York City, 2014–2015

PubMed Central

Benowitz, Isaac; Fitzhenry, Robert; Boyd, Christopher; Dickinson, Michelle; Levy, Michael; Lin, Ying; Nazarian, Elizabeth; Ostrowsky, Belinda; Passaretti, Teresa; Rakeman, Jennifer; Saylors, Amy; Shamoonian, Elena; Smith, Terry-Ann; Balter, Sharon

2018-01-01

We investigated an outbreak of eight Legionnaires’ disease cases among persons living in an urban residential community of 60,000 people. Possible environmental sources included two active cooling towers (air-conditioning units for large buildings) <1 km from patient residences, a market misting system, a community-wide water system used for heating and cooling, and potable water. To support a timely public health response, we used real-time polymerase chain reaction (PCR) to identify Legionella DNA in environmental samples within hours of specimen collection. We detected L. pneumophila serogroup 1 DNA only at a power plant cooling tower, supporting the decision to order remediation before culture results were available. An isolate from a power plant cooling tower sample was indistinguishable from a patient isolate by pulsed-field gel electrophoresis, suggesting the cooling tower was the outbreak source. PCR results were available <1 day after sample collection, and culture results were available as early as 5 days after plating. PCR is a valuable tool for identifying Legionella DNA in environmental samples in outbreak settings. PMID:29780175

Fast and simple DNA extraction from saliva and sperm cells obtained from the skin or isolated from swabs.

PubMed

von Wurmb-Schwark, Nicole; Mályusz, Victoria; Fremdt, Heike; Koch, Christine; Simeoni, Eva; Schwark, Thorsten

2006-05-01

The forensic scientist often has to cope with problematic samples from the crime scene due to their minute size and thus the low amount of extractable DNA. The retrieval of DNA from swabs taken from the surface of the skin, for example, in cases of strangulation, can be especially difficult. We systematically investigated swabs taken from the skin (to obtain a genetic profile from the victim and also from a possible offender) and from sperm cell containing swabs using two extraction kits: the Invisorb forensic and the Invisorb spin swab kit (both Invitek, Germany). DNA quality and quantity were tested on ethidium bromide containing agarose gels and in a highly sensitive duplex-PCR, which amplifies fragments specific for mitochondrial and nuclear DNA. Absolute quantification was done using real time PCR. Samples, which were positive in the duplex-PCR, were also employed to genetic fingerprinting using the Powerplex ES and the AmpFlSTRIdentifiler(TM) kits. Our study shows that the easy-to-use Invisorb spin swab kit is very suitable for DNA isolation from swabs taken from the skin and also from sperm cells. Retrieval of cells from the skin with swabs moistened in extraction buffer, not in distilled water, led to a significant higher DNA yield.

Comparison of culture and biochemical tests with PCR for detection of Brachyspira hyodysenteriae and Brachyspira pilosicoli.

PubMed

Råsbäck, T; Fellström, C; Gunnarsson, A; Aspán, A

2006-08-01

Traditional culture and biochemical tests (CBT) were compared with PCR for sensitivity and detection of Brachyspira hyodysenteriae and Brachyspira pilosicoli in seeded faeces and clinical samples from diarrhoeic pigs. A duplex PCR system was developed based on primers detecting the tlyA-gene of B. hyodysenteriae and the 16S rRNA-gene of B. pilosicoli. Sensitivities for the PCR system were determined on seeded faeces, using DNA that had been recovered from primary cultures or extracted directly from faeces. Compared to CBT, PCR applied to DNA extracted directly from faeces lowered the sensitivity by a factor of 1000 to 10,000. B. hyodysenteriae and B. pilosicoli detection was compared for CBT and PCR using 200 clinical samples. CBT detected more B. hyodysenteriae isolates in the clinical samples than PCR, but fewer B. pilosicoli positive samples. An atypical strongly haemolytic isolate was detected only by CBT.

Mosaic CREBBP mutation causes overlapping clinical features of Rubinstein–Taybi and Filippi syndromes

PubMed Central

de Vries, Tamar I; R Monroe, Glen; van Belzen, Martine J; van der Lans, Christian A; Savelberg, Sanne MC; Newman, William G; van Haaften, Gijs; Nievelstein, Rutger A; van Haelst, Mieke M

2016-01-01

Rubinstein–Taybi syndrome (RTS, OMIM 180849) and Filippi syndrome (FLPIS, OMIM 272440) are both rare syndromes, with multiple congenital anomalies and intellectual deficit (MCA/ID). We present a patient with intellectual deficit, short stature, bilateral syndactyly of hands and feet, broad thumbs, ocular abnormalities, and dysmorphic facial features. These clinical features suggest both RTS and FLPIS. Initial DNA analysis of DNA isolated from blood did not identify variants to confirm either of these syndrome diagnoses. Whole-exome sequencing identified a homozygous variant in C9orf173, which was novel at the time of analysis. Further Sanger sequencing analysis of FLPIS cases tested negative for CKAP2L variants did not, however, reveal any further variants. Subsequent analysis using DNA isolated from buccal mucosa revealed a mosaic variant in CREBBP. This report highlights the importance of excluding mosaic variants in patients with a strong but atypical clinical presentation of a MCA/ID syndrome if no disease-causing variants can be detected in DNA isolated from blood samples. As the striking syndactyly observed in the present case is typical for FLPIS, we suggest CREBBP analysis in saliva samples for FLPIS syndrome cases in which no causal CKAP2L variant is detected. PMID:26956253

Characterization of Pasteurella multocida isolates from wetland ecosystems during 1996 to 1999

USGS Publications Warehouse

Samuel, M.D.; Shadduck, D.J.; Goldberg, Diana R.; Wilson, M.A.; Joly, D.O.; Lehr, M.A.

2003-01-01

We cultured 126 Pasteurella multocida isolates, 92 from water and 34 from sediment samples collected from wetlands in the Pacific and Central flyways of the United States between 1996 and 1999. Most (121) of the isolates were P. multocida serotype 1, but serotypes 3, 3/4, 10, and 11 were also found. Many (82) of the isolates were further characterized by DNA fingerprinting procedures and tested in Pekin ducks for virulence. Almost all the serotype 1 isolates we tested caused mortality in Pekin ducks. Serotype 1 isolates varied in virulence, but the most consistent pattern was higher mortality in male ducks than in females. We found no evidence that isolates found in sediment vs. water, between Pacific and Central flyways, or during El Nino years had consistently different virulence. We also found a number of non-serotype 1 isolates that were avirulent in Pekin ducks. Isolates had DNA fingerprint profiles similar to those found in birds that died during avian cholera outbreaks.

Microbial diversity in nonsulfur, sulfur and iron geothermal steam vents.

PubMed

Benson, Courtney A; Bizzoco, Richard W; Lipson, David A; Kelley, Scott T

2011-04-01

Fumaroles, commonly called steam vents, are ubiquitous features of geothermal habitats. Recent studies have discovered microorganisms in condensed fumarole steam, but fumarole deposits have proven refractory to DNA isolation. In this study, we report the development of novel DNA isolation approaches for fumarole deposit microbial community analysis. Deposit samples were collected from steam vents and caves in Hawaii Volcanoes National Park, Yellowstone National Park and Lassen Volcanic National Park. Samples were analyzed by X-ray microanalysis and classified as nonsulfur, sulfur or iron-dominated steam deposits. We experienced considerable difficulty in obtaining high-yield, high-quality DNA for cloning: only half of all the samples ultimately yielded sequences. Analysis of archaeal 16S rRNA gene sequences showed that sulfur steam deposits were dominated by Sulfolobus and Acidianus, while nonsulfur deposits contained mainly unknown Crenarchaeota. Several of these novel Crenarchaeota lineages were related to chemoautotrophic ammonia oxidizers, indicating that fumaroles represent a putative habitat for ammonia-oxidizing Archaea. We also generated archaeal and bacterial enrichment cultures from the majority of the deposits and isolated members of the Sulfolobales. Our results provide the first evidence of Archaea in geothermal steam deposits and show that fumaroles harbor diverse and novel microbial lineages. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Real-time polymerase chain reaction detection of parvovirus B19 DNA in blood donations using a commercial and an in-house assay.

PubMed

Koppelman, M H G M; van Swieten, P; Cuijpers, H T M

2011-06-01

European regulations require testing of manufacturing plasma for parvovirus B19 (B19) DNA to limit the load of this virus to a maximum acceptable level of 10 IU/µL. To meet this requirement, most manufacturers introduced a test algorithm to identify and eliminate high-load donations before making large manufacturing pools of plasma units. Sanquin screens all donations using a commercial assay from Roche and an in-house assay. Between 2006 and 2009, 6.2 million donations were screened using two different polymerase chain reaction (PCR) assays targeting B19 DNA. Donations with B19 DNA loads of greater than 1 × 10(6) IU/mL showing significant differences in viral load between the two assays were further analyzed by sequencing analysis. A total of 396 donations with B19 DNA loads of greater than 1 × 10(6) IU/mL were identified. Fifteen samples (3.8%) had discordant test results; 10 samples (2.5%) were underquantified by the Roche assay, two samples (0.5%) were underquantified by the in-house assay, and three samples (0.8%) were not detected by the Roche assay. Sequencing analysis revealed mismatches in primer and probe-binding regions. Phylogenetic analysis showed that 12 samples were B19 Genotype 1. The three samples not detected by the Roche assay were B19 Genotype 2. This study shows that 3.8% of the viremic B19 DNA-positive donations are not quantified correctly by the Roche or in-house B19 DNA assays. B19 Genotype 1 isolates showing incorrect test results are more common than B19 Genotype 2 or 3 isolates. Newly designed B19 PCR assays for blood screening should preferably have multiplexed formats targeting multiple regions of the B19 genome. © 2010 American Association of Blood Banks.

Serratia bozhouensis sp. nov., Isolated from Sewage Samples of a Dairy Farm.

PubMed

Shang, Fei; Xue, Ting; Wang, Man; Chen, Xiaolin; Yu, Li; Zhang, Ming

2017-07-01

A Gram-negative, rod-shaped, salt-tolerant, non-pigmented, and non-spore-forming bacterium, designated strain W1 T (type strain CICC 23797 = CGMCC1.14949), was isolated from sewage samples of a dairy farm in Bozhou, Anhui, China. Strain W1 was resistant to lincomycin, troleandomycin, rifamycin, and vancomycin. Sequence analysis of the 16S rDNA gene revealed that the strain showed sequence similarity of 98.2% with the closest related species Serratia quinivorans CP6a T . The genomic DNA G+C content of the isolate was 52.8 mol%. The biochemical characteristics of strain W1 T assessed by the API 20E and Biolog GEN III analysis were different from those of the members of the genus Serratia. On the basis of the phenotypic and genotypic differences, strain W1 was proposed to be a novel Serratia species, Serratia bozhouensis sp. nov W1 T .

Geographically diverse Australian isolates of Melissococcus pluton exhibit minimal genotypic diversity by restriction endonuclease analysis.

PubMed

Djordjevic, S P; Smith, L A; Forbes, W A; Hornitzky, M A

1999-04-15

Melissococcus pluton, the causative agent of European foulbrood is an economically significant disease of honey bees (Apis mellifera) across most regions of the world and is prevalent throughout most states of Australia. 49 Isolates of M. pluton recovered from diseased colonies or honey samples in New South Wales, Queensland, South Australia, Tasmania and Victoria were compared using SDS-PAGE, Western immunoblotting and restriction endonuclease analyses. DNA profiles of all 49 geographically diverse isolates showed remarkably similar AluI profiles although four isolates (one each from Queensland, South Australia, New South Wales and Victoria) displayed minor profile variations compared to AluI patterns of all other isolates. DNA from a subset of the 49 Australian and three isolates from the United Kingdom were digested separately with the restriction endonucleases CfoI, RsaI and DraI. Restriction endonuclease fragment patterns generated using these enzymes were also similar although minor variations were noted. SDS-PAGE of whole cell proteins from 13 of the 49 isolates from different states of Australia, including the four isolates which displayed minor profile variations (AluI) produced indistinguishable patterns. Major immunoreactive proteins of approximate molecular masses of 21, 24, 28, 30, 36, 40, 44, 56, 60, 71, 79 and 95 kDa were observed in immunoblots of whole cell lysates of 22 of the 49 isolates and reacted with rabbit hyperimmune antibodies raised against M. pluton whole cells. Neither SDS-PAGE or immunoblotting was capable of distinguishing differences between geographically diverse isolates of M. pluton. Collectively these data confirm that Australian isolates of M. pluton are genetically homogeneous and that this species may be clonal. Plasmid DNA was not detected in whole cell DNA profiles of any isolate resolved using agarose gel electrophoresis.

Taxonomic analysis of extremely halophilic archaea isolated from 56-years-old dead sea brine samples.

PubMed

Arahal, D R; Gutiérrez, M C; Volcani, B E; Ventosa, A

2000-10-01

A taxonomic study comprising both phenotypic and genotypic characterization, has been carried out on a total of 158 extremely halophilic aerobic archaeal strains. These strains were isolated from enrichments prepared from Dead Sea water samples dating from 1936 that were collected by B. E. Volcani for the demonstration of microbial life in the Dead Sea. The isolates were examined for 126 morphological, physiological, biochemical and nutritional tests. Numerical analysis of the data, by using the S(J) coefficient and UPGMA clustering method, showed that the isolates clustered into six phenons. Twenty-two out of the 158 strains used in this study were characterized previously (ARAHAL et al., 1996) and were placed into five phenotypic groups. The genotypic study included both the determination of the guanineplus-cytosine content of the DNA and DNA-DNA hybridization studies. For this purpose, representative strains from the six phenons were chosen. These groups were found to represent some members of three different genera - Haloarcula (phenons A, B, and C), Haloferax (phenons D and E) and Halobacterium (phenon F) - of the family Halobacteriaceae, some of them never reported to occur in the Dead Sea, such as Haloarcula hispanica, while Haloferax volcanii (phenons D and E) was described in the Dead Sea by studies carried out several decades later than Volcani's work.

Molecular analysis of the microbial diversity present in the colonic wall, colonic lumen, and cecal lumen of a pig.

PubMed

Pryde, S E; Richardson, A J; Stewart, C S; Flint, H J

1999-12-01

Random clones of 16S ribosomal DNA gene sequences were isolated after PCR amplification with eubacterial primers from total genomic DNA recovered from samples of the colonic lumen, colonic wall, and cecal lumen from a pig. Sequences were also obtained for cultures isolated anaerobically from the same colonic-wall sample. Phylogenetic analysis showed that many sequences were related to those of Lactobacillus or Streptococcus spp. or fell into clusters IX, XIVa, and XI of gram-positive bacteria. In addition, 59% of randomly cloned sequences showed less than 95% similarity to database entries or sequences from cultivated organisms. Cultivation bias is also suggested by the fact that the majority of isolates (54%) recovered from the colon wall by culturing were related to Lactobacillus and Streptococcus, whereas this group accounted for only one-third of the sequence variation for the same sample from random cloning. The remaining cultured isolates were mainly Selenomonas related. A higher proportion of Lactobacillus reuteri-related sequences than of Lactobacillus acidophilus- and Lactobacillus amylovorus-related sequences were present in the colonic-wall sample. Since the majority of bacterial ribosomal sequences recovered from the colon wall are less than 95% related to known organisms, the roles of many of the predominant wall-associated bacteria remain to be defined.

Molecular Analysis of the Microbial Diversity Present in the Colonic Wall, Colonic Lumen, and Cecal Lumen of a Pig

PubMed Central

Pryde, Susan E.; Richardson, Anthony J.; Stewart, Colin S.; Flint, Harry J.

1999-01-01

Random clones of 16S ribosomal DNA gene sequences were isolated after PCR amplification with eubacterial primers from total genomic DNA recovered from samples of the colonic lumen, colonic wall, and cecal lumen from a pig. Sequences were also obtained for cultures isolated anaerobically from the same colonic-wall sample. Phylogenetic analysis showed that many sequences were related to those of Lactobacillus or Streptococcus spp. or fell into clusters IX, XIVa, and XI of gram-positive bacteria. In addition, 59% of randomly cloned sequences showed less than 95% similarity to database entries or sequences from cultivated organisms. Cultivation bias is also suggested by the fact that the majority of isolates (54%) recovered from the colon wall by culturing were related to Lactobacillus and Streptococcus, whereas this group accounted for only one-third of the sequence variation for the same sample from random cloning. The remaining cultured isolates were mainly Selenomonas related. A higher proportion of Lactobacillus reuteri-related sequences than of Lactobacillus acidophilus- and Lactobacillus amylovorus-related sequences were present in the colonic-wall sample. Since the majority of bacterial ribosomal sequences recovered from the colon wall are less than 95% related to known organisms, the roles of many of the predominant wall-associated bacteria remain to be defined. PMID:10583991

Usefulness of molecular markers in the diagnosis of occupational and recreational histoplasmosis outbreaks.

PubMed

Frías-De-León, María Guadalupe; Ramírez-Bárcenas, José Antonio; Rodríguez-Arellanes, Gabriela; Velasco-Castrejón, Oscar; Taylor, Maria Lucia; Reyes-Montes, María Del Rocío

2017-03-01

Histoplasmosis is considered the most important systemic mycosis in Mexico, and its diagnosis requires fast and reliable methodologies. The present study evaluated the usefulness of PCR using Hcp100 and 1281-1283 (220) molecular markers in detecting Histoplasma capsulatum in occupational and recreational outbreaks. Seven clinical serum samples of infected individuals from three different histoplasmosis outbreaks were processed by enzyme-linked immunosorbent assay (ELISA) to titre anti-H. capsulatum antibodies and to extract DNA. Fourteen environmental samples were also processed for H. capsulatum isolation and DNA extraction. Both clinical and environmental DNA samples were analysed by PCR with Hcp100 and 1281-1283 (220) markers. Antibodies to H. capsulatum were detected by ELISA in all serum samples using specific antigens, and in six of these samples, the PCR products of both molecular markers were amplified. Four environmental samples amplified one of the two markers, but only one sample amplified both markers and an isolate of H. capsulatum was cultured from this sample. All PCR products were sequenced, and the sequences for each marker were analysed using the Basic Local Alignment Search Tool (BLASTn), which revealed 95-98 and 98-100 % similarities with the reference sequences deposited in the GenBank for Hcp100 and 1281-1283 (220) , respectively. Both molecular markers proved to be useful in studying histoplasmosis outbreaks because they are matched for pathogen detection in either clinical or environmental samples.

Analysis of 4-hydroxy-1-(-3-pyridyl)-1-butanone (HPB)-releasing DNA adducts in human exfoliated oral mucosa cells by liquid chromatography-electrospray ionization-tandem mass spectrometry

PubMed Central

Stepanov, Irina; Muzic, John; Le, Chap T.; Sebero, Erin; Villalta, Peter; Ma, Bin; Jensen, Joni; Hatsukami, Dorothy; Hecht, Stephen S.

2013-01-01

Quantitation of DNA adducts could provide critical information on the relationship between exposure to tobacco smoke and cancer risk in smokers. In this study, we developed a robust and sensitive liquid chromatography-tandem mass spectrometry method for the analysis of 4-hydroxy-1-(3-pyridyl)-1-butanone (HPB1)-releasing DNA adducts in human oral cells, a non-invasive source of DNA for biomarker studies. Isolated DNA undergoes acid hydrolysis, after which samples are purified by solid-phase extraction and analyzed by LC-ESI-MS/MS. The developed method was applied for analysis of samples obtained via collection with a commercial mouthwash from 30 smokers and 15 nonsmokers. In smokers, the levels of HPB-releasing DNA adducts averaged 12.0 pmol HPB/mg DNA (detected in 20 out of 28 samples with quantifiable DNA yield) and in nonsmokers, the levels of adducts averaged 0.23 pmol/mg DNA (detected in 3 out of 15 samples). For the 30 smoking subjects, matching buccal brushings were also analyzed and HPB-releasing DNA adducts were detected in 24 out of 27 samples with quantifiable DNA yield, averaging 44.7 pmol HPB/mg DNA. The levels of adducts in buccal brushings correlated with those in mouthwash samples of smokers (R = 0.73, p < 0.0001). Potentially the method can be applied in studies of individual susceptibility to tobacco-induced cancers in humans. PMID:23252610

First isolation and molecular characterization of Ehrlichia canis in Costa Rica, Central America.

PubMed

Romero, L E; Meneses, A I; Salazar, L; Jiménez, M; Romero, J J; Aguiar, D M; Labruna, M B; Dolz, G

2011-08-01

The present study investigated Ehrlichia species in blood samples from dogs suspected of clinical ehrlichiosis, using molecular and isolation techniques in cell culture. From a total of 310 canine blood samples analyzed by 16S rRNA nested PCR, 148 (47.7%) were positive for Ehrlichia canis. DNA from Ehrlichia chaffeensis or Ehrlichia ewingii was not detected in any sample using species-specific primers in separated reactions. Leukocytes from five PCR-positive dogs were inoculated into DH82 cells; successful isolation of E. canis was obtained in four samples. Partial sequence of the dsb gene of eight canine blood samples (including the five samples for in vitro isolation) was obtained by PCR and their analyses through BLAST showed 100% of identity with the corresponding sequence of E. canis in GenBank. This study represents the first molecular diagnosis, isolation, and molecular characterization of E. canis in dogs from Costa Rica. Copyright © 2010 Elsevier Ltd. All rights reserved.

Quantification of Parvovirus B19 DNA Using COBAS AmpliPrep Automated Sample Preparation and LightCycler Real-Time PCR

PubMed Central

Schorling, Stefan; Schalasta, Gunnar; Enders, Gisela; Zauke, Michael

2004-01-01

The COBAS AmpliPrep instrument (Roche Diagnostics GmbH, D-68305 Mannheim, Germany) automates the entire sample preparation process of nucleic acid isolation from serum or plasma for polymerase chain reaction analysis. We report the analytical performance of the LightCycler Parvovirus B19 Quantification Kit (Roche Diagnostics) using nucleic acids isolated with the COBAS AmpliPrep instrument. Nucleic acids were extracted using the Total Nucleic Acid Isolation Kit (Roche Diagnostics) and amplified with the LightCycler Parvovirus B19 Quantification Kit. The kit combination processes 72 samples per 8-hour shift. The lower detection limit is 234 IU/ml at a 95% hit-rate, linear range approximately 104-1010 IU/ml, and overall precision 16 to 40%. Relative sensitivity and specificity in routine samples from pregnant women are 100% and 93%, respectively. Identification of a persistent parvovirus B19-infected individual by the polymerase chain reaction among 51 anti-parvovirus B19 IgM-negative samples underlines the importance of additional nucleic acid testing in pregnancy and its superiority to serology in identifying the risk of parvovirus B19 transmission via blood or blood products. Combination of the Total Nucleic Acid Isolation Kit on the COBAS AmpliPrep instrument with the LightCycler Parvovirus B19 Quantification Kit provides a reliable and time-saving tool for sensitive and accurate detection of parvovirus B19 DNA. PMID:14736825

Collaborative environmental DNA sampling from petal surfaces of flowering cherry Cerasus × yedoensis 'Somei-yoshino' across the Japanese archipelago.

PubMed

Ohta, Tazro; Kawashima, Takeshi; Shinozaki, Natsuko O; Dobashi, Akito; Hiraoka, Satoshi; Hoshino, Tatsuhiko; Kanno, Keiichi; Kataoka, Takafumi; Kawashima, Shuichi; Matsui, Motomu; Nemoto, Wataru; Nishijima, Suguru; Suganuma, Natsuki; Suzuki, Haruo; Taguchi, Y-H; Takenaka, Yoichi; Tanigawa, Yosuke; Tsuneyoshi, Momoka; Yoshitake, Kazutoshi; Sato, Yukuto; Yamashita, Riu; Arakawa, Kazuharu; Iwasaki, Wataru

2018-02-19

Recent studies have shown that environmental DNA is found almost everywhere. Flower petal surfaces are an attractive tissue to use for investigation of the dispersal of environmental DNA in nature as they are isolated from the external environment until the bud opens and only then can the petal surface accumulate environmental DNA. Here, we performed a crowdsourced experiment, the "Ohanami Project", to obtain environmental DNA samples from petal surfaces of Cerasus × yedoensis 'Somei-yoshino' across the Japanese archipelago during spring 2015. C. × yedoensis is the most popular garden cherry species in Japan and clones of this cultivar bloom simultaneously every spring. Data collection spanned almost every prefecture and totaled 577 DNA samples from 149 collaborators. Preliminary amplicon-sequencing analysis showed the rapid attachment of environmental DNA onto the petal surfaces. Notably, we found DNA of other common plant species in samples obtained from a wide distribution; this DNA likely originated from the pollen of the Japanese cedar. Our analysis supports our belief that petal surfaces after blossoming are a promising target to reveal the dynamics of environmental DNA in nature. The success of our experiment also shows that crowdsourced environmental DNA analyses have considerable value in ecological studies.

A novel strategy for highly efficient isolation and analysis of circulating tumor-specific cell-free DNA from lung cancer patients using a reusable conducting polymer nanostructure.

PubMed

Lee, HyungJae; Jeon, SeungHyun; Seo, Jin-Suck; Goh, Sung-Ho; Han, Ji-Youn; Cho, Youngnam

2016-09-01

We have developed a reusable nanostructured polypyrrole nanochip and demonstrated its use in the electric field-mediated recovery of circulating cell-free DNA (cfDNA) from the plasma of lung cancer patients. Although cfDNA has been recognized and widely studied as a versatile and promising biomarker for the diagnosis and prognosis of cancers, the lack of efficient strategies to directly isolate cfDNA from the plasma has become a great hindrance to its potential clinical use. As a proof-of-concept study, we demonstrated a technique for the rapid and efficient isolation of cfDNA with high yield and purity. In particular, the synergistic effects of the electro-activity and the nanostructured features of the polypyrrole polymer enabled repeated retrieval of cfDNA using a single platform. Moreover, polypyrrole nanochip facilitated the amplification of tumor-specific DNA fragments from the plasma samples of patients with lung cancer characterized by mutations in exons 21 of the epidermal growth factor receptor gene (EGFR). Overall, the proposed polypyrrole nanochip has enormous potential for industrial and clinical applications with significantly enhanced efficiency in the recovery of tumor-associated circulating cfDNA. This may ultimately contribute to more robust and reliable evaluation of gene mutations in peripheral blood. Copyright © 2016 Elsevier Ltd. All rights reserved.

Sequencing of the large dsDNA genome of Oryctes rhinoceros nudivirus using multiple displacement amplification of nanogram amounts of virus DNA.

PubMed

Wang, Yongjie; Kleespies, Regina G; Ramle, Moslim B; Jehle, Johannes A

2008-09-01

The genomic sequence analysis of many large dsDNA viruses is hampered by the lack of enough sample materials. Here, we report a whole genome amplification of the Oryctes rhinoceros nudivirus (OrNV) isolate Ma07 starting from as few as about 10 ng of purified viral DNA by application of phi29 DNA polymerase- and exonuclease-resistant random hexamer-based multiple displacement amplification (MDA) method. About 60 microg of high molecular weight DNA with fragment sizes of up to 25 kbp was amplified. A genomic DNA clone library was generated using the product DNA. After 8-fold sequencing coverage, the 127,615 bp of OrNV whole genome was sequenced successfully. The results demonstrate that the MDA-based whole genome amplification enables rapid access to genomic information from exiguous virus samples.

A report on extensive lateral genetic reciprocation between arsenic resistant Bacillus subtilis and Bacillus pumilus strains analyzed using RAPD-PCR.

PubMed

Khowal, Sapna; Siddiqui, Md Zulquarnain; Ali, Shadab; Khan, Mohd Taha; Khan, Mather Ali; Naqvi, Samar Husain; Wajid, Saima

2017-02-01

The study involves isolation of arsenic resistant bacteria from soil samples. The characterization of bacteria isolates was based on 16S rRNA gene sequences. The phylogenetic consanguinity among isolates was studied employing rpoB and gltX gene sequence. RAPD-PCR technique was used to analyze genetic similarity between arsenic resistant isolates. In accordance with the results Bacillus subtilis and Bacillus pumilus strains may exhibit extensive horizontal gene transfer. Arsenic resistant potency in Bacillus sonorensis and high arsenite tolerance in Bacillus pumilus strains was identified. The RAPD-PCR primer OPO-02 amplified a 0.5kb DNA band specific to B. pumilus 3ZZZ strain and 0.75kb DNA band specific to B. subtilis 3PP. These unique DNA bands may have potential use as SCAR (Sequenced Characterized Amplified Region) molecular markers for identification of arsenic resistant B. pumilus and B. subtilis strains. Copyright © 2016 Elsevier Inc. All rights reserved.

Automated genomic DNA purification options in agricultural applications using MagneSil paramagnetic particles

NASA Astrophysics Data System (ADS)

Bitner, Rex M.; Koller, Susan C.

2002-06-01

The automated high throughput purification of genomic DNA form plant materials can be performed using MagneSil paramagnetic particles on the Beckman-Coulter FX, BioMek 2000, and the Tecan Genesis robot. Similar automated methods are available for DNA purifications from animal blood. These methods eliminate organic extractions, lengthy incubations and cumbersome filter plates. The DNA is suitable for applications such as PCR and RAPD analysis. Methods are described for processing traditionally difficult samples such as those containing large amounts of polyphenolics or oils, while still maintaining a high level of DNA purity. The robotic protocols have ben optimized for agricultural applications such as marker assisted breeding, seed-quality testing, and SNP discovery and scoring. In addition to high yield purification of DNA from plant samples or animal blood, the use of Promega's DNA-IQ purification system is also described. This method allows for the purification of a narrow range of DNA regardless of the amount of additional DNA that is present in the initial sample. This simultaneous Isolation and Quantification of DNA allows the DNA to be used directly in applications such as PCR, SNP analysis, and RAPD, without the need for separate quantitation of the DNA.

Investigation of interaction between magnetic silica particles and lambda phage DNA fragment.

PubMed

Smerkova, Kristyna; Dostalova, Simona; Vaculovicova, Marketa; Kynicky, Jindrich; Trnkova, Libuse; Kralik, Miroslav; Adam, Vojtech; Hubalek, Jaromir; Provaznik, Ivo; Kizek, Rene

2013-12-01

Nucleic acids belong to the most important molecules and therefore the understanding of their properties, function and behavior is crucial. Even though a range of analytical and biochemical methods have been developed for this purpose, one common step is essential for all of them - isolation of the nucleic acid from the from complex sample matrix. The use of magnetic particles for the separation of nucleic acids has many advantages over other isolation methods. In this study, an isolation procedure for extraction of DNA was optimized. Each step of the isolation process including washing, immobilization and elution was optimized and therefore the efficiency was increased from 1.7% to 28.7% and the total time was shortened from 75 to 30min comparing to the previously described method. Quantification of the particular parameter influence was performed by square-wave voltammetry using hanging drop mercury electrode. Further, we compared the optimized method with standard chloroform extraction and applied on isolation of DNA from Staphylococcus aureus and Escherichia coli. Copyright © 2013 Elsevier B.V. All rights reserved.

Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography.

PubMed

Hedayati Ch, Mojtaba; Amani, Jafar; Sedighian, Hamid; Amin, Mohsen; Salimian, Jafar; Halabian, Raheleh; Imani Fooladi, Abbas Ali

2016-09-01

Staphylococcus aureus are potent human pathogens possessing arsenal of virulence factors. Staphylococcal food poisoning (SFP) and respiratory infections mediated by staphylococcal enterotoxin B (SEB) are common clinical manifestations. Many diagnostic techniques are based on serological detection and quantification of SEB in different food and clinical samples. Aptamers are known as new therapeutic and detection tools which are available in different ssDNA, dsDNA and protein structures. In this study, we used a new set of ssDNA aptamers against SEB. The methods used included preparation of a dsDNA library using standard SEB protein as the target analyte, affinity chromatography matrix in microfuge tubes, SELEX procedures to isolate specific ssDNA-aptamer as an affinity ligand, aptamer purification using ethanol precipitation method, affinity binding assay using ELISA, aptamer cloning and specificity test. Among 12 readable sequences, three of them were selected as the most appropriate aptamer because of their affinity and specificity to SEB. This study presents a new set of ssDNA aptamer with favorable selectivity to SEB through 12 rounds of SELEX. Selected aptamers were used to detect SEB in infected serum samples. Results showed that SEB c1 aptamer (2 µg SEB/100 nM aptamer) had favorable specificity to SEB (kd  = 2.3 × 10(-11) ). In conclusion, aptamers can be considered as useful tools for detecting and evaluating SEB. The results showed that affinity chromatography was an affordable assay with acceptable accuracy to isolate sensitive and selective novel aptamers. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Isolation and identification of female DNA on postcoital penile swabs.

PubMed

Cina, S J; Collins, K A; Pettenati, M J; Fitts, M

2000-06-01

After sexual assault, cells originating from the assailant may be recovered from the victim. Through polymerase chain reaction (PCR)-based technology, positive scientific identification of the assailant may be made from these cells. Described is a prospective study describing a method for positively identifying cells from a female sex partner obtained from postcoital swabs of the penis of the male sex partner. Swabs were taken from the penis of a man at 1- to 24-hour intervals after coitus. DNA was isolated from each swab through standard organic extraction methods. The presence of female DNA was detected using the gender-specific amelogenin marker. Extracted DNA was amplified for eight different genetic loci using the Promega PowerPlex kit (Promega) and Amplitaq Gold (Perkin Elmer). Amplified samples were electrophoresed on precast sequencing gels (Hitachi) and were analyzed fluorescently using Hitachi's FMBIO 2 fluorescent scanner and software. Each sample obtained from a penile swab or condom was compared to male and female buccal controls. Female DNA was isolated from all postcoital penile swabs as determined by exclusive amplification of the X-chromosome specific 212 base pair amelogenin marker. In all cases, scientific identification of the female DNA from the swabs was determined by coamplification of eight STR loci (PowerPlex) and was compared to female and male control profiles. Cells shed from a female victim during sexual intercourse can be retrieved from the penis of a male offender after sexual intercourse during a 1- to 24-hour postcoital interval. DNA can be extracted from these cells and can be used to scientifically identify the female sexual participant through PCR-based technology. It is suggested that penile swabs be taken from alleged perpetrators of sexual assaults to associate them with a female victim.

Comparison of commercially-available preservatives for maintaining the integrity of bacterial DNA in human milk.

PubMed

Lackey, Kimberly A; Williams, Janet E; Price, William J; Carrothers, Janae M; Brooker, Sarah L; Shafii, Bahman; McGuire, Mark A; McGuire, Michelle K

2017-10-01

Inhibiting changes to bacteria in human milk between sample collection and analysis is necessary for unbiased characterization of the milk microbiome. Although cold storage is considered optimal, alternative preservation is sometimes necessary. The objective of this study was to compare the effectiveness of several commercially-available preservatives with regard to maintaining bacterial DNA in human milk for delayed microbiome analysis. Specifically, we compared Life Technologies' RNAlater® stabilization solution, Biomatrica's DNAgard® Saliva, Advanced Instruments' Broad Spectrum Microtabs II™, and Norgen Biotek Corporation's Milk DNA Preservation and Isolation Kit. Aliquots of 8 pools of human milk were treated with each preservative. DNA was extracted immediately and at 1, 2, 4, and 6wk, during which time milk was held at 37°C. The V1-V3 region of the bacterial 16S rRNA gene was amplified and sequenced. Changes in bacterial community structure and diversity over time were evaluated. Comparable to other studies, the most abundant genera were Streptococcus (33.3%), Staphylococcus (14.0%), Dyella (6.3%), Pseudomonas (3.0%), Veillonella (2.5%), Hafnia (2.0%), Prevotella (1.7%), Rhodococcus (1.6%), and Granulicatella (1.4%). Overall, use of Norgen's Milk DNA Preservation and Isolation Kit best maintained the consistency of the bacterial community structure. Total DNA, diversity, and evenness metrics were also highest in samples preserved with this method. When collecting human milk for bacterial community analysis in field conditions where cold storage is not available, our results suggest that Norgen's Milk DNA Preservation and Isolation Kit may be a useful method, at least for a period of 2weeks. Copyright © 2017 Elsevier B.V. All rights reserved.

Detection of restriction fragment length polymorphisms in clinical isolates and serially passaged Pseudomonas aeruginosa strains.

PubMed Central

Hjelm, L N; Branstrom, A A; Warren, R L

1990-01-01

An 800-base-pair HindIII-PstI fragment that flanks a hot spot for Tn7 insertion was isolated from the chromosome of Pseudomonas aeruginosa and cloned into pUC12. The fragment was used to probe XhoI digests of genomic DNA from 18 P. aeruginosa isolates collected from sputum samples of seven cystic fibrosis patients. Only two XhoI restriction fragment length polymorphisms (RFLPs), of 3.7 and 7.7 kilobases (kb), were detected. Isolate WSU3531-1 (3.7-kb XhoI fragment) and WSU3860 (7.7-kb XhoI fragment), while isolated from the same patient, showed different RFLPs. Serial passages of isolate WSU3531-1 demonstrated that this strain was phenotypically stable. In contrast, colony and pigment variants were readily isolated at a frequency of 1% from serial passages of isolate WSU3860. When XhoI-digested genomic DNA from phenotypic variants of serially passaged WSU3860 were probed with the 800-base-pair HindIII-PstI fragment, the probe hybridized to a 10.4-kb XhoI fragment from three isolates. Restriction analysis of the genomic DNA digested with a variety of restriction enzymes showed that a 2.7-kb insertion occurred in the same region for all three isolates. There appeared to be no correlation between changes in the RFLP and changes in colony morphology. Images PMID:1977762

Genetic diversity study of Chromobacterium violaceum isolated from Kolli Hills by amplified ribosomal DNA restriction analysis (ARDRA) and random amplified polymorphic DNA (RAPD).

PubMed

Ponnusamy, K; Jose, S; Savarimuthu, I; Michael, G P; Redenbach, M

2011-09-01

Chromobacterium are saprophytes that cause highly fatal opportunistic infections. Identification and strain differentiation were performed to identify the strain variability among the environmental samples. We have evaluated the suitability of individual and combined methods to detect the strain variations of the samples collected in different seasons. Amplified ribosomal DNA restriction analysis (ARDRA) and random amplified polymorphic DNA (RAPD) profiles were obtained using four different restriction enzyme digestions (AluI, HaeIII, MspI and RsaI) and five random primers. A matrix of dice similarity coefficients was calculated and used to compare these restriction patterns. ARDRA showed rapid differentiation of strains based on 16S rDNA, but the combined RAPD and ARDRA gave a more reliable differentiation than when either of them was analysed individually. A high level of genetic diversity was observed, which indicates that the Kolli Hills' C. violaceum isolates would fall into at least three new clusters. Results showed a noteworthy bacterial variation and genetic diversity of C. violaceum in the unexplored, virgin forest area. © 2011 The Authors. Letters in Applied Microbiology © 2011 The Society for Applied Microbiology.

Isolation of DNA from small amounts of elephant ivory: Sampling the cementum with total demineralization extraction.

PubMed

Winters, M; Torkelson, A; Booth, R; Mailand, C; Hoareau, Y; Tucker, S; Wasser, S K

2018-07-01

Genotyping ivory samples can determine the geographic origin of poached ivory as well as the legality of ivory being sold in ivory markets. We conducted a series of experiments to determine where the DNA is most concentrated in ivory samples and how best to increase DNA yield from groups of samples likely to vary in DNA concentration. We examined variation in DNA amplification success from: the layer(s) of the tusk (cementum and/or dentine) being extracted, demineralization temperature and time, and the concentration of eluates. Since demineralization of the pulverized sample produces a pellet and supernatant, we also assessed DNA amplification success from the pellet, the supernatant, their combination, as well as variation in the respective amounts used for extraction. Our results show that the outer cementum layer of the tusk contains the highest concentration of DNA and should be separated and used exclusively as the source material of ivory processed for extraction, when available. Utilizing the combined demineralized lysate improves extraction efficiency, as does increasing demineralization time to 3 or more days, conducted at 4°C. The most significant improvements occurred for low template DNA ivory samples followed by medium quality samples. Amplification success of high quality samples was not affected by these changes. Application of this optimized method to 3068 ivory samples resulted in 81.2% of samples being confirmed for both alleles at a minimum of 10 out of 16 microsatellite loci, which is our threshold for inclusion in DNA assignment analyses. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Specific detection of Neospora caninum oocysts in fecal samples from experimentally-infected dogs using the polymerase chain reaction.

PubMed

Hill, D E; Liddell, S; Jenkins, M C; Dubey, J P

2001-04-01

Neospora caninum oocysts, passed in the feces of a definitive host (dog), were isolated, and genomic DNA was extracted. A polymerase cahin reaction (PCR) targeting the N. caninum-specific Nc 5 genomic sequence was performed using the isolated DNA. A synthesized competitor molecule containing part of the Nc 5 sequence was included in the assay as a check against false-negative PCR results and to quantify N. caninum oocyst DNA in fecal samples. A standard curve of the ratio of fluorescence intensity of PCR-amplified competitor to that of oocyst DNA was constructed to compare oocyst equivalents from fecal samples containing unknown numbers of N. caninum oocysts and to assess the sensitivity of the assay. The specificity of the assay was determined using the Nc 5-specific primers in PCR assays against other parasites likely to be found in canine feces. Genomic DNA sequences from the canine coccidians Hammondia heydorni, Cryptosporidium parvum, Sarcocystis cruzi, S. tenella, and Isospora ohioensis and the canine helminth parasites Strongyloides stercoralis, Toxocara canis, Dipylidium caninum, and Ancylostoma caninum were not amplified. In addition, genomic DNA sequences from oocysts of coccidian parasites that might contaminate dog feces, such as Hammondia hammondi, Toxoplasma gondii, or Eimeria tenella, were not amplified in the PCR assay. The assay should be useful in epidemiological surveys of both domestic and wild canine hosts and in investigations of oocyst biology in experimental infections.

Strategy for Extracting DNA from Clay Soil and Detecting a Specific Target Sequence via Selective Enrichment and Real-Time (Quantitative) PCR Amplification ▿

PubMed Central

Yankson, Kweku K.; Steck, Todd R.

2009-01-01

We present a simple strategy for isolating and accurately enumerating target DNA from high-clay-content soils: desorption with buffers, an optional magnetic capture hybridization step, and quantitation via real-time PCR. With the developed technique, μg quantities of DNA were extracted from mg samples of pure kaolinite and a field clay soil. PMID:19633108

Lactobacillus crustorum sp. nov., isolated from two traditional Belgian wheat sourdoughs.

PubMed

Scheirlinck, Ilse; Van der Meulen, Roel; Van Schoor, Ann; Huys, Geert; Vandamme, Peter; De Vuyst, Luc; Vancanneyt, Marc

2007-07-01

A polyphasic taxonomic study of the lactic acid bacteria (LAB) population in three traditional Belgian sourdoughs, sampled between 2002 and 2004, revealed a group of isolates that could not be assigned to any recognized LAB species. Initially, sourdough isolates were screened by means of (GTG)(5)-PCR fingerprinting. Four isolates displaying unique (GTG)(5)-PCR patterns were further investigated by means of phenylalanyl-tRNA synthase (pheS) gene sequence analysis and represented a bifurcated branch that could not be allocated to any LAB species present in the in-house pheS database. Their phylogenetic affiliation was determined using 16S rRNA gene sequence analysis and showed that the four sourdough isolates belong to the Lactobacillus plantarum group with Lactobacillus mindensis, Lactobacillus farciminis and Lactobacillus nantensis as closest relatives. Further genotypic and phenotypic studies, including whole-cell protein analysis (SDS-PAGE), amplified fragment length polymorphism (AFLP) fingerprinting, DNA-DNA hybridization, DNA G+C content analysis, growth characteristics and biochemical features, demonstrated that the new sourdough isolates represent a novel Lactobacillus species for which the name Lactobacillus crustorum sp. nov. is proposed. The type strain of the new species is LMG 23699(T) (=CCUG 53174(T)).

Nucleic Acid Extraction from Synthetic Mars Analog Soils for in situ Life Detection

PubMed Central

Mojarro, Angel; Ruvkun, Gary; Zuber, Maria T.

2017-01-01

Abstract Biological informational polymers such as nucleic acids have the potential to provide unambiguous evidence of life beyond Earth. To this end, we are developing an automated in situ life-detection instrument that integrates nucleic acid extraction and nanopore sequencing: the Search for Extra-Terrestrial Genomes (SETG) instrument. Our goal is to isolate and determine the sequence of nucleic acids from extant or preserved life on Mars, if, for example, there is common ancestry to life on Mars and Earth. As is true of metagenomic analysis of terrestrial environmental samples, the SETG instrument must isolate nucleic acids from crude samples and then determine the DNA sequence of the unknown nucleic acids. Our initial DNA extraction experiments resulted in low to undetectable amounts of DNA due to soil chemistry–dependent soil-DNA interactions, namely adsorption to mineral surfaces, binding to divalent/trivalent cations, destruction by iron redox cycling, and acidic conditions. Subsequently, we developed soil-specific extraction protocols that increase DNA yields through a combination of desalting, utilization of competitive binders, and promotion of anaerobic conditions. Our results suggest that a combination of desalting and utilizing competitive binders may establish a “universal” nucleic acid extraction protocol suitable for analyzing samples from diverse soils on Mars. Key Words: Life-detection instruments—Nucleic acids—Mars—Panspermia. Astrobiology 17, 747–760. PMID:28704064

Extraction of Total DNA and RNA from Marine Filter Samples and Generation of a cDNA as Universal Template for Marker Gene Studies.

PubMed

Schneider, Dominik; Wemheuer, Franziska; Pfeiffer, Birgit; Wemheuer, Bernd

2017-01-01

Microbial communities play an important role in marine ecosystem processes. Although the number of studies targeting marker genes such as the 16S rRNA gene has been increased in the last few years, the vast majority of marine diversity is rather unexplored. Moreover, most studies focused on the entire bacterial community and thus disregarded active microbial community players. Here, we describe a detailed protocol for the simultaneous extraction of DNA and RNA from marine water samples and for the generation of cDNA from the isolated RNA which can be used as a universal template in various marker gene studies.

Influence of Heavy Metal Stress on Antioxidant Status and DNA Damage in Urtica dioica

PubMed Central

Kadifkova Panovska, Tatjana; Bačeva, Katerina; Stafilov, Trajče

2013-01-01

Heavy metals have the potential to interact and induce several stress responses in the plants; thus, effects of heavy metal stress on DNA damages and total antioxidants level in Urtica dioica leaves and stems were investigated. The samples are sampled from areas with different metal exposition. Metal content was analyzed by Inductively Coupled Plasma-Atomic Emission Spectrometer (ICP-AES), for total antioxidants level assessment the Ferric-Reducing Antioxidant Power (FRAP) assay was used, and genomic DNA isolation from frozen plant samples was performed to obtain DNA fingerprints of investigated plant. It was found that heavy metal contents in stems generally changed synchronously with those in leaves of the plant, and extraneous metals led to imbalance of mineral nutrient elements. DNA damages were investigated by Random Amplified Polymorphic DNA (RAPD) technique, and the results demonstrated that the samples exposed to metals yielded a large number of new fragments (total 12) in comparison with the control sample. This study showed that DNA stability is highly affected by metal pollution which was identified by RAPD markers. Results suggested that heavy metal stress influences antioxidant status and also induces DNA damages in U. dioica which may help to understand the mechanisms of metals genotoxicity. PMID:23862140

Successful application of FTA Classic Card technology and use of bacteriophage phi29 DNA polymerase for large-scale field sampling and cloning of complete maize streak virus genomes.

PubMed

Owor, Betty E; Shepherd, Dionne N; Taylor, Nigel J; Edema, Richard; Monjane, Adérito L; Thomson, Jennifer A; Martin, Darren P; Varsani, Arvind

2007-03-01

Leaf samples from 155 maize streak virus (MSV)-infected maize plants were collected from 155 farmers' fields in 23 districts in Uganda in May/June 2005 by leaf-pressing infected samples onto FTA Classic Cards. Viral DNA was successfully extracted from cards stored at room temperature for 9 months. The diversity of 127 MSV isolates was analysed by PCR-generated RFLPs. Six representative isolates having different RFLP patterns and causing either severe, moderate or mild disease symptoms, were chosen for amplification from FTA cards by bacteriophage phi29 DNA polymerase using the TempliPhi system. Full-length genomes were inserted into a cloning vector using a unique restriction enzyme site, and sequenced. The 1.3-kb PCR product amplified directly from FTA-eluted DNA and used for RFLP analysis was also cloned and sequenced. Comparison of cloned whole genome sequences with those of the original PCR products indicated that the correct virus genome had been cloned and that no errors were introduced by the phi29 polymerase. This is the first successful large-scale application of FTA card technology to the field, and illustrates the ease with which large numbers of infected samples can be collected and stored for downstream molecular applications such as diversity analysis and cloning of potentially new virus genomes.

Pseudomonas cichorii as the causal agent of midrib rot, an emerging disease of greenhouse-grown butterhead lettuce in Flanders.

PubMed

Cottyn, Bart; Heylen, Kim; Heyrman, Jeroen; Vanhouteghem, Katrien; Pauwelyn, Ellen; Bleyaert, Peter; Van Vaerenbergh, Johan; Höfte, Monica; De Vos, Paul; Maes, Martine

2009-05-01

Bacterial midrib rot of greenhouse-grown butterhead lettuce (Lactuca sativa L. var. capitata) is an emerging disease in Flanders (Belgium) and fluorescent pseudomonads are suspected to play an important role in the disease. Isolations from infected lettuces, collected from 14 commercial greenhouses in Flanders, yielded 149 isolates that were characterized polyphasically, which included morphological characteristics, pigmentation, pathogenicity tests by both injection and spraying of lettuce, LOPAT characteristics, FAME analysis, BOX-PCR fingerprinting, 16S rRNA and rpoB gene sequencing, as well as DNA-DNA hybridization. Ninety-eight isolates (66%) exhibited a fluorescent pigmentation and were associated with the genus Pseudomonas. Fifty-five of them induced an HR+ (hypersensitive reaction in tobacco leaves) response. The other 43 fluorescent isolates were most probably saprophytic bacteria and about half of them were able to cause rot on potato tuber slices. BOX-PCR genomic fingerprinting was used to assess the genetic diversity of the Pseudomonas midrib rot isolates. The delineated BOX-PCR patterns matched quite well with Pseudomonas morphotypes defined on the basis of colony appearance and variation in fluorescent pigmentation. 16S rRNA and rpoB gene sequence analyses allowed most of the fluorescent isolates to be allocated to Pseudomonas, and they belonged to either the Pseudomonas fluorescens group, Pseudomonas putida group, or the Pseudomonas cichorii/syringae group. In particular, the isolates allocated to this latter group constituted the vast majority of HR+ isolates and were identified as P. cichorii by DNA-DNA hybridization. They were demonstrated by spray-inoculation tests on greenhouse-grown lettuce to induce the midrib rot disease and could be re-isolated from lesions of inoculated plants. Four HR+ non-fluorescent isolates associated with one sample that showed an atypical midrib rot were identified as Dickeya sp.

Supercoiled plasmid DNA purification by integrating membrane technology with a monolithic chromatography.

PubMed

Nunes, Catherine; Sousa, Angela; Nunes, José C; Morão, António M; Sousa, Fani; Queiroz, João A

2014-06-01

The present study describes the integration of membrane technology with monolithic chromatography to obtain plasmid DNA with high quality. Isolation and clarification of plasmid DNA lysate were first conducted by a microfiltration step, by using a hydrophilic nylon microfiltration membrane, avoiding the need of centrifugation. For the total elimination of the remaining impurities, a suitable purification step is required. Monolithic stationary phases have been successfully applied as an alternative to conventional supports. Thus, the sample recovered from the membrane process was applied into a nongrafted CarbonylDiImidazole disk. Throughout the global procedure, a reduced level of impurities such as proteins and RNA was obtained, and no genomic DNA was detectable in the plasmid DNA sample. The chromatographic process demonstrated an efficient performance on supercoiled plasmid DNA purity and recovery (100 and 84.44%, respectively). Thereby, combining the membrane technology to eliminate some impurities from lysate sample with an efficient chromatographic strategy to purify the supercoiled plasmid DNA arises as a powerful approach for industrial-scale systems aiming at plasmid DNA purification. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Integrity of nuclear genomic deoxyribonucleic acid in cooked meat: Implications for food traceability.

PubMed

Aslan, O; Hamill, R M; Sweeney, T; Reardon, W; Mullen, A M

2009-01-01

It is essential to isolate high-quality DNA from muscle tissue for PCR-based applications in traceability of animal origin. We wished to examine the impact of cooking meat to a range of core temperatures on the quality and quantity of subsequently isolated genomic (specifically, nuclear) DNA. Triplicate steak samples were cooked in a water bath (100 degrees C) until their final internal temperature was 75, 80, 85, 90, 95, or 100 degrees C, and DNA was extracted. Deoxyribonucleic acid quantity was significantly reduced in cooked meat samples compared with raw (6.5 vs. 56.6 ng/microL; P < 0.001), but there was no relationship with cooking temperature. Quality (A(260)/A(280), i.e., absorbance at 260 and 280 nm) was also affected by cooking (P < 0.001). For all 3 genes, large PCR amplicons (product size >800 bp) were observed only when using DNA from raw meat and steak cooked to lower core temperatures. Small amplicons (<200 bp) were present for all core temperatures. Cooking meat to high temperatures thus resulted in a reduced overall yield and probable fragmentation of DNA to sizes less than 800 bp. Although nuclear DNA is preferable to mitochondrial DNA for food authentication, it is less abundant, and results suggest that analyses should be designed to use small amplicon sizes for meat cooked to high core temperatures.

Identification of a DNA restriction-modification system in Pectobacterium carotovorum strains isolated from Poland.

PubMed

Waleron, K; Waleron, M; Osipiuk, J; Podhajska, A J; Lojkowska, E

2006-02-01

Polish isolates of pectinolytic bacteria from the species Pectobacterium carotovorum were screened for the presence of a DNA restriction-modification (R-M) system. Eighty-nine strains of P. carotovorum were isolated from infected potato plants. Sixty-six strains belonged to P. carotovorum ssp. atrosepticum and 23 to P. carotovorum ssp. carotovorum. The presence of restriction enzyme Pca17AI, which is an isoschizomer of EcoRII endonuclease, was observed in all isolates of P. c. atrosepticum but not in P. c. carotovorum. The biochemical properties, PCR amplification, and sequences of the Pca17AI restriction endonuclease and methyltransferase genes were compared with the prototype EcoRII R-M system genes. Only when DNA isolated from cells of P. c. atrosepticum was used as a template, amplification of a 680 bp homologous to the gene coding EcoRII endonuclease. Endonuclease Pca17AI, having a relatively low temperature optimum, was identified. PCR amplification revealed that the nucleotide sequence of genes for EcoRII and Pca17AI R-M are different. Dcm methylation was observed in all strains of Pectobacterium and other Erwinia species tested. The sequence of a DNA fragment coding Dcm methylase in P. carotovorum was different from that of Escherichia coli. Pca17AI is the first psychrophilic isoschizomer of EcoRII endonuclease. The presence of specific Dcm methylation in chromosomal DNA isolated from P. carotovorum is described for the first time. A 680 bp PCR product, unique for P. c. atrosepticum strains, could serve as a molecular marker for detection of these bacteria in environmental samples.

DNA Identification of Skeletal Remains from World War II Mass Graves Uncovered in Slovenia

PubMed Central

Marjanović, Damir; Durmić-Pašić, Adaleta; Bakal, Narcisa; Haverić, Sanin; Kalamujić, Belma; Kovačević, Lejla; Ramić, Jasmin; Pojskić, Naris; Škaro, Vedrana; Projić, Petar; Bajrović, Kasim; Hadžiselimović, Rifat; Drobnič, Katja; Huffine, Ed; Davoren, Jon; Primorac, Dragan

2007-01-01

Aim To present the joint effort of three institutions in the identification of human remains from the World War II found in two mass graves in the area of Škofja Loka, Slovenia. Methods The remains of 27 individuals were found in two small and closely located mass graves. The DNA was isolated from bone and teeth samples using either standard phenol/chloroform alcohol extraction or optimized Qiagen DNA extraction procedure. Some recovered samples required the employment of additional DNA purification methods, such as N-buthanol treatment. QuantifilerTM Human DNA Quantification Kit was used for DNA quantification. PowerPlex 16 kit was used to simultaneously amplify 15 short tandem repeat (STR) loci. Matching probabilities were estimated using the DNA View program. Results Out of all processed samples, 15 remains were fully profiled at all 15 STR loci. The other 12 profiles were partial. The least successful profile included 13 loci. Also, 69 referent samples (buccal swabs) from potential living relatives were collected and profiled. Comparison of victims' profile against referent samples database resulted in 4 strong matches. In addition, 5 other profiles were matched to certain referent samples with lower probability. Conclusion Our results show that more than 6 decades after the end of the World War II, DNA analysis may significantly contribute to the identification of the remains from that period. Additional analysis of Y-STRs and mitochondrial DNA (mtDNA) markers will be performed in the second phase of the identification project. PMID:17696306

Identification and molecular characterization of a novel circular single-stranded DNA virus associated with yerba mate in Argentina.

PubMed

Bejerman, Nicolás; de Breuil, Soledad; Nome, Claudia

2018-06-06

A single-stranded DNA (ssDNA) virus was detected in Yerba mate samples showing chlorotic linear patterns, chlorotic rings and vein yellowing. The full-genome sequences of six different isolates of this ssDNA circular virus were obtained, which share > 99% sequence identity with each other. The newly identified virus has been tentatively named as yerba mate-associated circular DNA virus (YMaCV). The 2707 nt-long viral genome has two and three open reading frame on its complementary and virion-sense strands, respectively. The coat protein is more similar to that of mastreviruses (44% identity), whereas the replication-associated protein of YMaCV is more similar (49% identity) to that encoded by a recently described, unclassified ssDNA virus isolated on trees in Brazil. This is the first report of a circular DNA virus associated with yerba mate. Its unique genome organization and phylogenetic relationships indicates that YMaCV represents a distinct evolutionary lineage within the ssDNA viruses and therefore this virus should be classified as a member of a new species within an unassigned genus or family.

Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction.

PubMed

Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid

2017-01-01

Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA ® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. The CTAB method showed more positive results at 1:10-1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.

Lactobacilli and bifidobacteria in human breast milk: influence of antibiotherapy and other host and clinical factors.

PubMed

Soto, Ana; Martín, Virginia; Jiménez, Esther; Mader, Isabelle; Rodríguez, Juan M; Fernández, Leonides

2014-07-01

The objective of this work was to study the lactobacilli and bifidobacteria population in human milk of healthy women, and to investigate the influence that several factors (including antibioteraphy during pregnancy and lactation, country and date of birth, delivery mode, or infant age) may exert on such population. A total of 160 women living in Germany or Austria provided the breast milk samples. Initially, 66 samples were randomly selected and cultured on MRS-Cys agar plates. Then, the presence of DNA from the genera Lactobacillus and Bifidobacterium, and from most of the Lactobacillus and Bifidobacterium species that were isolated, was assessed by qualitative polymerase chain reaction (PCR) using genus- and species-specific primers. Lactobacilli and bifidobacteria could be isolated from the milk of 27 (40.91%) and 7 (10.61%), respectively, of the 66 cultured samples. On the contrary, Lactobacillus and Bifidobacterium sequences were detected by PCR in 108 (67.50%) and 41 (25.62%), respectively, of the 160 samples analyzed. The Lactobacillus species most frequently isolated and detected was L salivarius (35.00%), followed by L fermentum (25.00%) and L gasseri (21.88%), whereas B breve (13.75%) was the bifidobacterial species most commonly recovered and whose DNA was most regularly found. The number of lactobacilli- or bifidobacteria-positive samples was significantly lower in women who had received antibiotherapy during pregnancy or lactation. Our results suggest that either the presence of lactobacilli and/or bifidobacteria or their DNA may constitute good markers of a healthy human milk microbiota that has not been altered by the use of antibiotics.

Method for isolating chromosomal DNA in preparation for hybridization in suspension

DOEpatents

Lucas, Joe N.

2000-01-01

A method is provided for detecting nucleic acid sequence aberrations using two immobilization steps. According to the method, a nucleic acid sequence aberration is detected by detecting nucleic acid sequences having both a first nucleic acid sequence type (e.g., from a first chromosome) and a second nucleic acid sequence type (e.g., from a second chromosome), the presence of the first and the second nucleic acid sequence type on the same nucleic acid sequence indicating the presence of a nucleic acid sequence aberration. In the method, immobilization of a first hybridization probe is used to isolate a first set of nucleic acids in the sample which contain the first nucleic acid sequence type. Immobilization of a second hybridization probe is then used to isolate a second set of nucleic acids from within the first set of nucleic acids which contain the second nucleic acid sequence type. The second set of nucleic acids are then detected, their presence indicating the presence of a nucleic acid sequence aberration. Chromosomal DNA in a sample containing cell debris is prepared for hybridization in suspension by treating the mixture with RNase. The treated DNA can also be fixed prior to hybridization.

A DNA pooling based system to detect Escherichia coli virulence factors in fecal and wastewater samples

PubMed Central

Luz María Chacón, J; Lizeth Taylor, C; Carmen Valiente, A; Irene Alvarado, P; Ximena Cortés, B

2012-01-01

The availability of a useful tool for simple and timely detection of the most important virulent varieties of Escherichia coli is indispensable. To this end, bacterial DNA pools which had previously been categorized were obtained from isolated colonies as well as selected in terms of utilized phenotype; the pools were assessed by two PCR Multiplex for the detection of virulent E. coli eaeA, bfpA, stx1, stx2, ipaH, ST, LT, and aatA genes, with the 16S gene used as DNA control. The system was validated with 66 fecal samples and 44 wastewater samples. At least one positive isolate was detected by a virulent gene among the 20 that were screened. The analysis of fecal samples from children younger than 6 years of age detected frequencies of 25% LT positive strains, 8.3% eae, 8.3% bfpA, 16.7% ipaH, as well as 12.5 % aatA and ST. On the other hand, wastewater samples revealed frequencies of 25.7% eaeA positive, 30.3% stx1, 15.1% LT and 19.7% aatA. This study is an initial step toward carrying out epidemiological field research that will reveal the presence of these bacterial varieties. PMID:24031959

PCR-based study of conserved and variable DNA sequences of Tritrichomonas foetus isolates from Saskatchewan, Canada.

PubMed Central

Riley, D E; Wagner, B; Polley, L; Krieger, J N

1995-01-01

The protozoan parasite Tritrichomonas foetus causes infertility and spontaneous abortion in cattle. In Saskatchewan, Canada, the culture prevalence of trichomonads was 65 of 1,048 (6%) among 1,048 bulls tested within a 1-year period ending in April 1994. Saskatchewan was previously thought to be free of the parasite. To confirm the culture results, possible T. foetus DNA presence was determined by the PCR. All of the 16 culture-positive isolates tested were PCR positive by a single-band test, but one PCR product was weak. DNA fingerprinting by both T17 PCR and randomly amplified polymorphic DNA PCR revealed genetic variation or polymorphism among the T. foetus isolates. T17 PCR also revealed conserved loci that distinguished these T. foetus isolates from Trichomonas vaginalis, from a variety of other protozoa, and from prokaryotes. TCO-1 PCR, a PCR test designed to sample DNA sequence homologous to the 5' flank of a highly conserved cell division control gene, detected genetic polymorphism at low stringency and a conserved, single locus at higher stringency. These findings suggested that T. foetus isolates exhibit both conserved genetic loci and polymorphic loci detectable by independent PCR methods. Both conserved and polymorphic genetic loci may prove useful for improved clinical diagnosis of T. foetus. The polymorphic loci detected by PCR suggested either a long history of infection or multiple lines of T. foetus infection in Saskatchewan. Polymorphic loci detected by PCR may provide data for epidemiologic studies of T. foetus. PMID:7615746

[Development of a novel real-time PCR method for detection of HSV types 1 and 2 DNA using HybProbe chemistry].

PubMed

Chudzik, Emilia; Karabin, Karolina; Dzieciątkowski, Tomasz; Majewska, Anna; Przybylski, Maciej; Midak-Siewirska, Anna; Łuczak, Mirosław; Młynarczyk, Grazyna

2010-01-01

Herpes simplex viruses types 1 and 2 are members of the Alphaherpesviridae subfamily, as they can infect both skin and nerves and develop latent infection within the dorsal root and trigeminal ganglia. Infections with these viruses are common worldwide and cause wide range of clinical syndromes. Although HSV-1/2 infect healthy children and adults, disease is more severe and extensive in the immunocompromised individuals and/or during neuroinfections. The aim of the study was development of real-time PCR assay for detection and differentiation of herpes simplex viruses type 1 and 2. DNA in clinical samples, using specific dual-channel HybProbe chemistry. The nalytical sensitivity of assay was tested using serial dilutions of HSV-1 and HSV-2 DNA in range between 10 degrees and 10(-5). (4.35 x 10(5)-4.00 x 10(2) copies/ml and 4.18 x 10(5)-3.82 x 10(2) copies/ml, respectively). Thirty four cell line isolates and sixteen clinical samples taken from a group of adult patients with neurological signs were tested for the presence of HSV-1/2 DNA in the LightCycler instrument. Described in-house real-time PCR assay detected herpesviral DNA in all cell line isolates (31 of them were HSV-1 positive; 3 were HSV-2 positive) and in 10 clinical samples (positive only for HSV-1). The conclusion is that developed HybProbe-based real-time PCR test is very reliable and valuable tool for detection and differentiation of HSV-1/2 viremia in different kind of samples. The high level of sensitivity and accuracy provided by this assay is favorable for the quantification of herpes simplex virus 1 and 2 DNA in clinical specimens, especially during low-copy infections.

Establishment of an agamid cell line and isolation of adenoviruses from central bearded dragons (Pogona vitticeps).

PubMed

Ball, Inna; Hoferer, Marc; Marschang, Rachel E

2014-03-01

A cell line was established from whole 6-8-week-old central bearded dragon (Pogona vitticeps) embryos. Cells were mid-sized and showed an elongated and polymorphic form. The cell line grew in a monolayer and has been serially passaged for 17 passages at time of publication. This cell line has been used with samples from adenovirus polymerase chain reaction (PCR)-positive bearded dragons, and 2 virus isolates have been obtained so far. The isolates show a clear cytopathic effect in inoculated cells. Both virus isolates have been serially passaged on this cell line, and have been identified by PCR amplification and sequencing of a portion of the DNA-dependent DNA polymerase gene and show 100% nucleotide identity to the corresponding region of an agamid adenovirus. Electron microscopic examination of supernatant from infected cells demonstrated the presence of nonenveloped particles, with a diameter of approximately 80 nm in both virus isolates.

Detection of cholera (ctx) and zonula occludens (zot) toxin genes in Vibrio cholerae O1, O139 and non-O1 strains.

PubMed

Rivera, I G; Chowdhury, M A; Sanchez, P S; Sato, M I; Huq, A; Colwell, R R; Martins, M T

1995-09-01

Vibrio cholerae O1 and V. cholerae non-O1 strains isolated from environmental samples collected in São Paulo, Brazil, during cholera epidemics and pre-epidemic periods were examined for the presence of toxin genes. V. cholerae O1 strains isolated from clinical samples in Peru and Mexico, and V. cholerae O139 strains from India were also examined for the presence of ctx (cholera toxin gene) and zot (zonula occludens toxin gene) by polymerase chain reaction (PCR). A modified DNA-extraction method applied in this study yielded satisfactory recovery of genomic DNA from vibrios. Results showed that strains of V. cholerae O1 isolated during the preepidemic period were ctx (-)/zot (-) whereas strains isolated during the epidemic were ctx (+)/zot (+). All V. cholerae non-O1 strains tested in the study were ctx (-)/zot (-), whereas all V. cholerae O139 strains were ctx (+)/zot (+). Rapid detection of the virulence genes (ctx and zot) can be achieved by PCR and this can serve as an important tool in the epidemiology and surveillance of V. cholerae.

Identification of vaginal lactobacilli with potential probiotic properties isolated from women in North Lebanon.

PubMed

Al Kassaa, Imad; Hamze, Monzer; Hober, Didier; Chihib, Nour-Eddine; Drider, Djamel

2014-04-01

The aim of this work was to study the diversity of vaginal lactobacilli in Lebanese women and to evaluate the antagonism, hydrophobicity, and safety characteristics of these strains. This study was performed on samples from 135 women who visited a gynecology clinic in the north of Lebanon, between September 2012 and January 2013. From these samples, 53 different isolates of vaginal lactobacilli were collected from vaginal swabs and identified using biochemical and molecular methods. The use of genotypic Rep-PCR fingerprinting allowed for the organization of these isolates into 23 different groups. Seven of the isolated lactobacilli were antagonistic against the following vaginal pathogens: Gardnerella vaginalis CIP7074T, Staphylococcus aureus ATCC33862, Escherichia coli CIP103982, and Candida albicans ATCC10231. The antagonistic lactobacilli strains were then identified using 16S rDNA sequence. The data of this study show that the antagonistic lactobacilli were non-hemolytic, sensitive to most antibiotic tests, free of plasmid DNA, and exhibited interesting hydrophobicity and autoaggregation properties positioning them as potential candidates for probiotic design.

Molecular Typing of Treponema pallidum in the Czech Republic during 2011 to 2013: Increased Prevalence of Identified Genotypes and of Isolates with Macrolide Resistance

PubMed Central

Grillová, Linda; Pĕtrošová, Helena; Mikalová, Lenka; Strnadel, Radim; Dastychová, Eliška; Kuklová, Ivana; Kojanová, Martina; Kreidlová, Miluše; Vaňousová, Daniela; Hercogová, Jana; Procházka, Přemysl; Zákoucká, Hana; Krchňáková, Alena; Vašků, Vladimír

2014-01-01

From January 2011 to December 2013, a total of 262 samples, from 188 patients suspected of having syphilis were tested for the presence of treponemal DNA by PCR amplification of five chromosomal loci, including the polA (TP0105), tmpC (TP0319), TP0136, TP0548, and 23S rRNA genes. Altogether, 146 samples from 103 patients were PCR positive for treponemal DNA. A set of 81 samples from 62 PCR-positive patients were typeable, and among them, nine different genotypes were identified. Compared to a previous study in the Czech Republic during 2004 to 2010, the number of genotypes detected among syphilis patients in a particular year increased to six in both 2012 and 2013, although they were not the same six. The proportion of macrolide-resistant clinical isolates in this 3-year study was 66.7%. PMID:25100820

UV irradiation experiments under simulated martian surface conditions: Bio-effects on glycine, phage T7 and isolated T7 DNA

NASA Astrophysics Data System (ADS)

Bérces, Attila; ten Kate, I. L.; Fekete, A.; Hegedus, M.; Garry, J. R. C.; Lammer, Helmut; Ehrenfreund, Pascale; Peeters, Zan; Kovacs, G.; Ronto, G.

Mars is considered as a main target for astrobiologically relevant exploration programmes. In order to explain the non-detection of organic material to a detection level of several parts per billion (ppb) by the Viking landers, several hypotheses have been suggested, including degradation processes occurring on the martian surface and in the martian soil and subsurface. UV exposure experiments have been performed in which thin layers of glycine ( 300 nm), and aqueous suspensions of phage T7 and isolated T7 DNA were irradiated with a Deuterium lamp and for comparison with a Xenon arc lamp, modified to simulate the solar irradiation on the surface of Mars (MarsUV). The glycine sample was subjected to 24 hours of irradiation with MarsUV. The results of this glycine experiment show a destruction rate comparable to the results of previous experiments in which thin layers of glycine were irradiated with a deuterium lamp (ten Kate et al., 2005, 2006). After exposure of different doses of simulated Martian UV radiation a decrease of the biological activity of phages and characteristic changes in the UV absorption spectrum have been detected, indicating the UV damage of isolated and intraphage T7 DNA. The results of our experiments show that intraphage DNA is 4 times more sensitive to simulated martian UV and deuterium lamp radiation than isolated T7 DNA. This result indicates the significant role that phage proteins play in the UV damage. The effect of simulated martian radiation is smaller than the biological defects observed after the exposure with a deuterium lamp for both cases, in intraphage and isolated DNA, despite of the 100 times larger intensity of the MarsUV lamp. The detected spectral differences are about ten times smaller; the biological activity is about 3 - 4 times smaller, indicating that the shorter wavelength UV radiation from the deuterium lamp is more effective in inducing DNA damage, irrespective of being intraphage or isolated.

Molecular approaches to differentiate three species of Nematodirus in sheep and goats from China based on internal transcribed spacer rDNA sequences.

PubMed

Zhao, G H; Jia, Y Q; Bian, Q Q; Nisbet, A J; Cheng, W Y; Liu, Y; Fang, Y Q; Ma, X T; Yu, S K

2015-05-01

Internal transcribed spacer (ITS) rDNA sequences of three Nematodirus species from naturally infected goats or sheep in two endemic provinces of China were analysed to establish an effective molecular approach to differentiate Nematodirus species in small ruminants. The respective intra-specific genetic variations in ITS1 and ITS2 rDNA regions were 0.3-1.8% and 0-0.4% in N. spathiger, 0-6.5% and 0-5.4% in N. helvetianus, and 0-4.4% and 0-6.1% in N. oiratianus from China. The respective intra-specific variations of ITS1 and ITS2 were 1.8-4.4% and 1.6-6.1% between N. oiratianus isolates from China and Iran, 5.7-7.1% and 6.3-8.3% between N. helvetianus samples from China and America. For N. spathiger, compared with samples from China, sequence differences in ITS1 rDNA were 0.3-2.4% in isolates from America, 0.3-2.9% in New Zealand and 2.1-2.4% in Australia. Genetic variations in ITS2 rDNA of N. spathiger were 0-0.4% between samples from China and America, and 0-0.8% between samples from China and New Zealand. Using mutation sites, polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and specific PCR techniques were developed to differentiate these three Nematodirus species. The specific PCR assay allowed the accurate identification of N. oiratianus from other common nematodes with a sensitivity of 0.69 pg and further examination of Nematodirus samples demonstrated the reliability of these two molecular methods.

Comparison of nested PCR and qPCR for the detection and quantitation of BoHV6 DNA.

PubMed

Kubiś, Piotr; Materniak, Magdalena; Kuźmak, Jacek

2013-12-01

Nested PCR and qPCR (quantitative PCR) tests based on glycoprotein B (gB) gene were designed for detecting Bovine herpesvirus 6 (BoHV6) in bovine whole blood samples and wild ruminant blood clots (deer and roe-deer). This virus, commonly known as BLHV (bovine lymphotropic herpesvirus) belongs to the Herpesviridae family, subfamily Gammaherpesvirinae and Macavirus genus. DNA isolated from 92 dairy cow blood samples and 69 wild ruminant clots were examined for the presence of BoHV6 using nested PCR and qPCR tests. Viral DNA was detected by using nested PCR in 59 out of 92 bovine blood samples (64.1%), and by qPCR in 68 out of 92 bovine blood samples (73.9%), but none out of 69 DNA samples isolated from wild ruminant blood clots, was positive in both assays. The specificity of nested PCR and qPCR was confirmed by using BoHV1, BoHV4, BoHV6, BFV, BIV, and BLV DNA. The sensitivity of nested PCR and qPCR was determined using a serially 10-fold diluted vector pCR2.1HgB (2 × 10(0)-2 × 10(6)copies/reaction). In this testing, qPCR was more sensitive than the nested PCR, detecting two copies of BoHV6 whilst the limit of detection for nested PCR was 20 copies. In all qPCR assays, the coefficients of determination (R(2)) ranged between 0.990 and 0.999, and the calculated amplification efficiencies (Eff%) within the range of 89.7-106.9. The intra- and inter-assay CV (coefficient of variation) values did not exceed 4%. Copyright © 2013 Elsevier B.V. All rights reserved.

Evaluating the Impact of DNA Extraction Method on the Representation of Human Oral Bacterial and Fungal Communities

PubMed Central

Biswas, Kristi; Taylor, Michael W.; Gear, Kim

2017-01-01

The application of high-throughput, next-generation sequencing technologies has greatly improved our understanding of the human oral microbiome. While deciphering this diverse microbial community using such approaches is more accurate than traditional culture-based methods, experimental bias introduced during critical steps such as DNA extraction may compromise the results obtained. Here, we systematically evaluate four commonly used microbial DNA extraction methods (MoBio PowerSoil® DNA Isolation Kit, QIAamp® DNA Mini Kit, Zymo Bacterial/Fungal DNA Mini PrepTM, phenol:chloroform-based DNA isolation) based on the following criteria: DNA quality and yield, and microbial community structure based on Illumina amplicon sequencing of the V3–V4 region of the 16S rRNA gene of bacteria and the internal transcribed spacer (ITS) 1 region of fungi. Our results indicate that DNA quality and yield varied significantly with DNA extraction method. Representation of bacterial genera in plaque and saliva samples did not significantly differ across DNA extraction methods and DNA extraction method showed no effect on the recovery of fungal genera from plaque. By contrast, fungal diversity from saliva was affected by DNA extraction method, suggesting that not all protocols are suitable to study the salivary mycobiome. PMID:28099455

PCR-based Analysis of Microbial Communities in Extreme Environment: Results from EuroGeoMars MDRS campaign

NASA Astrophysics Data System (ADS)

Thiel, C.; Wills, D.; Foing, B.; Wadham, J.; Cullen, D.; van Sluis, C.

2009-04-01

Deoxyribonucleic acid (DNA) is found in almost all living organisms. The main function of DNA molecules is the long-term storage of genetic information.They are passed on from generation to generation as the hereditary material. This molecular structure is often compared to a genetic blueprint, a fingerprint, which is unique for each organism and can therefore be used as a mean of identification. In 1984 a revolutionary technique called polymerase chain reaction (PCR) was established, able to amplify a single or few copies of DNA molecules across several orders of magnitude, generating millions of copies of the original DNA fragment. PCR is nowadays a common technique used in medical and biological research laboratories for a large variety of applications like functional analysis of genes, DNA-based phylogeny, diagnosis of hereditary diseases, detection and diagnosis of infectious diseases, and identification of genetic fingerprints. This powerful tool gives us the opportunity to investigate, if there is or was life on Mars since DNA fragments are highly stable what allows not only amplification from living organisms but also from samples with an age of several thousand years. If we assume that micro-organisms were exchanged between Mars and Earth via meteorites, it is imaginable that Martian life might also be based on DNA as carrier of genetic information. Therefore our goal is to establish a routine for detection of DNA from micro-organisms based on the effective but also robust and simple PCR technique, demonstrated during the EuroGeoMars simulation campaign at Mars Desert Research Station (MDRS). We have already analysed some MDRS soil samples at ESTEC ExoGeoLab facility. During the MDRS simulation we will show that it is possible to establish a minimal molecular biology lab in the habitat for an immediate on site analysis by PCR after sample collection. Samples will be taken from different locations and soil depths. The sample analysis will start immediately after returning to the habitat and will be finished during the following days. DNA will be isolated from micro-organisms by Powersoil DNA isolation kit and serves as template for PCR using oligonucleotides specific for ribosomal DNA to identify representatives of the different groups of micro-organisms: archaea, bacteria and eukaryotes. PCR products will be analysed by agarose gel electrophoresis and documented via UV-trans-illuminator and digital camera.

Early Sex Identification in Date Palm by Male-Specific Sequence-Characterized Amplified Region (SCAR) Markers.

PubMed

Kharb, Pushpa; Mitra, Charu

2017-01-01

Date palm (Phoenix dactylifera L.) is a dioecious plant, and sex of the seedlings can be determined only at the time of first flowering which takes 4-5 years. Female date palm plants are of economic importance as they bear the fruit. Therefore, sex identification at an early stage is highly desirable. DNA-based markers are useful for early sex detection. In this chapter, we describe male-specific sequence-characterized amplified region (SCAR) markers to identify sex in date palm at the seedling stage. Genomic DNA is isolated separately from both male and female date palm genotypes. Amplification of this genomic DNA isolated from male and female plants using the SCAR primers results in an amplicon of 406 bp in both female and male samples and a unique amplicon of 354 bp only in male samples. Based on this amplification pattern, the sex of date palm seedlings can be predicted.

Kocuria polaris sp. nov., an orange-pigmented psychrophilic bacterium isolated from an Antarctic cyanobacterial mat sample.

PubMed

Reddy, Gundlapally S N; Prakash, Jogadhenu S S; Prabahar, Vadivel; Matsumoto, Genki I; Stackebrandt, Erko; Shivaji, Sisinthy

2003-01-01

Strain CMS 76orT, an orange-pigmented bacterium, was isolated from a cyanobacterial mat sample from a pond located in McMurdo Dry Valley, Antarctica. On the basis of chemotaxonomic and phylogenetic properties, strain CMS 76orT was identified as a member of the genus Kocuria. It exhibited a 16S rDNA similarity of 99.8% and DNA-DNA similarity of 71% with Kocuria rosea (ATCC 186T). Phenotypic traits confirmed that strain CMS 78orT and K. rosea were well differentiated. Furthermore, strain CMS 76orT could be differentiated from the other reported species of Kocuria, namely Kocuria kristinae (ATCC 27570T), Kocuria varians (ATCC 15306T), Kocuria rhizophila (DSM 11926T) and Kocuria palustris (DSM 11025T), on the basis of a number of phenotypic features. Therefore, it is proposed that strain CMS 76orT (= MTCC 3702T = DSM 14382T) be assigned to a novel species of the genus Kocuria, as Kocuria polaris.

Rapid DNA analysis for automated processing and interpretation of low DNA content samples.

PubMed

Turingan, Rosemary S; Vasantgadkar, Sameer; Palombo, Luke; Hogan, Catherine; Jiang, Hua; Tan, Eugene; Selden, Richard F

2016-01-01

Short tandem repeat (STR) analysis of casework samples with low DNA content include those resulting from the transfer of epithelial cells from the skin to an object (e.g., cells on a water bottle, or brim of a cap), blood spatter stains, and small bone and tissue fragments. Low DNA content (LDC) samples are important in a wide range of settings, including disaster response teams to assist in victim identification and family reunification, military operations to identify friend or foe, criminal forensics to identify suspects and exonerate the innocent, and medical examiner and coroner offices to identify missing persons. Processing LDC samples requires experienced laboratory personnel, isolated workstations, and sophisticated equipment, requires transport time, and involves complex procedures. We present a rapid DNA analysis system designed specifically to generate STR profiles from LDC samples in field-forward settings by non-technical operators. By performing STR in the field, close to the site of collection, rapid DNA analysis has the potential to increase throughput and to provide actionable information in real time. A Low DNA Content BioChipSet (LDC BCS) was developed and manufactured by injection molding. It was designed to function in the fully integrated Accelerated Nuclear DNA Equipment (ANDE) instrument previously designed for analysis of buccal swab and other high DNA content samples (Investigative Genet. 4(1):1-15, 2013). The LDC BCS performs efficient DNA purification followed by microfluidic ultrafiltration of the purified DNA, maximizing the quantity of DNA available for subsequent amplification and electrophoretic separation and detection of amplified fragments. The system demonstrates accuracy, precision, resolution, signal strength, and peak height ratios appropriate for casework analysis. The LDC rapid DNA analysis system is effective for the generation of STR profiles from a wide range of sample types. The technology broadens the range of sample types that can be processed and minimizes the time between sample collection, sample processing and analysis, and generation of actionable intelligence. The fully integrated Expert System is capable of interpreting a wide range or sample types and input DNA quantities, allowing samples to be processed and interpreted without a technical operator.

Screening, Isolation and Identification of Probiotic Producing Lactobacillus acidophilus Strains EMBS081 & EMBS082 by 16S rRNA Gene Sequencing.

PubMed

Chandok, Harshpreet; Shah, Pratik; Akare, Uday Raj; Hindala, Maliram; Bhadoriya, Sneha Singh; Ravi, G V; Sharma, Varsha; Bandaru, Srinivas; Rathore, Pragya; Nayarisseri, Anuraj

2015-09-01

16S rDNA sequencing which has gained wide popularity amongst microbiologists for the molecular characterization and identification of newly discovered isolates provides accurate identification of isolates down to the level of sub-species (strain). Its most important advantage over the traditional biochemical characterization methods is that it can provide an accurate identification of strains with atypical phenotypic characters as well. The following work is an application of 16S rRNA gene sequencing approach to identify a novel species of Probiotic Lactobacillus acidophilus. The sample was collected from pond water samples of rural and urban areas of Krishna district, Vijayawada, Andhra Pradesh, India. Subsequently, the sample was serially diluted and the aliquots were incubated for a suitable time period following which the suspected colony was subjected to 16S rDNA sequencing. The sequence aligned against other species was concluded to be a novel, Probiotic L. acidophilus bacteria, further which were named L. acidophilus strain EMBS081 & EMBS082. After the sequence characterization, the isolate was deposited in GenBank Database, maintained by the National Centre for Biotechnology Information NCBI. The sequence can also be retrieve from EMBL and DDBJ repositories with accession numbers JX255677 and KC150145.

The use of FTA cards for transport and detection of gyrA mutation of Campylobacter jejuni from poultry.

PubMed

Sierra-Arguello, Y M; Faulkner, O; Tellez, G; Hargis, B M; Pinheiro do Nascimento, V

2016-04-01

The purpose of the present study was to evaluate a technique involving the use of commercially available FTA classic card (Whatman) for transporting and detection of DNA to use in PCR analysis and genetic sequencing of Campylobacter jejuni of poultry origin. Fifty isolates of Campylobacter jejuni were obtained from broiler carcasses in Rio Grande do Sul, Brazil. Antimicrobial susceptibility testing to ciprofloxacin revealed that all 50 isolates were resistant to ciprofloxacin. Each isolate was transferred to Brucella broth tubes and incubated overnight at 41.5°C. Cell cultures were diluted to match a McFarland Turbidity Standard 0.5, and 110 μL of the cell suspension were applied to one circle on Whatman FTA classic cards. The samples were then covered and allowed to dry at room temperature. Cards were identified and stored at room temperature until further use (3 mo after collection). FTA cards were shipped for analysis to the Department of Poultry Science, University of Arkansas. Amplification of the Campylobacter gyrA gene was successful and demonstrated strong bands for a large amplicon for all 50 samples preserved on FTA cards. Mutations present in each gene were confirmed by DNA sequencing. Then, 7 samples were chosen for the sequencing. The detection of a mutation regarding ciprofloxacin-resistant isolates revealed that 7 samples had a mutation in the gyrA gene. In conclusion, the characteristics of the profiles suggest that the DNA has maintained its integrity after 3 mo of storage at room temperature and is a suitable template for PCR and sequencing from Campylobacter samples. The application of this technology has potential in numerous methodologies, especially when working in remote areas and in developing countries where access to laboratory facilities and equipment is limited. © 2016 Poultry Science Association Inc.

Epidemiology of pertussis in Casablanca (Morocco): contribution of conventional and molecular diagnosis tools.

PubMed

Katfy, Khalid; Guiso, Nicole; Diawara, Idrissa; Zerouali, Khalid; Slaoui, Bouchra; Jouhadi, Zineb; Zineddine, Abdelhadi; Belabbes, Houria; Elmdaghri, Naima

2017-05-16

Pertussis, a vaccine preventable disease, is still responsible of significant morbidity and mortality around the world, mostly in newborns. The aim of the present study was (1) to introduce pertussis surveillance in the major pediatric hospital of Casablanca (2) to analyze the prevalence of pertussis among children under 14 years of age and their entourage in Casablanca, Morocco. This is a prospective and non-case controlled study, including children suspected of Pertussis admitted at the Abderrahim Harouchi Pediatric Hospital in Casablanca, from January 2013 to June 2015. Nasopharyngeal samples were obtained for Bordetella spp. culture and Real time PCR detection (RT-PCR) with specific primers of Bordetella spp., B. pertussis, B. parapertussis and B. holmesii. The detection of Bordetella spp. was also performed in some household contacts of the children suspected of pertussis. During the 2.5-years period, a total of 282 samples were collected from hospitalized children (156) and in some of their contacts (126). Among 156 samples from the children (from whom 57% were under 2 month of age), Bordetella DNA was detected in 61% (96/156) by RT-PCR. Among these positive samples, 91.7% (88/96) corresponded to B. pertussis DNA. Furthermore, in 39.5% (38/96) of the Bordetella positive samples, B. holmesii DNA was also detected. B. parapertussis DNA was detected in only one sample (1/156). Out of the 156 samples collected from the hospitalized children, only 48 were tested by culture, and 4 B. pertussis were isolated (8.3%). Among the 126 samples from the contacts of the children, mostly mothers (115 cases), Bordetella DNA was detected in 47% (59/126), 90% (53/59) being B. pertussis DNA. Moreover, B. holmesii DNA was also detected in 18.6% (11/59) of the Bordetella positive samples, and coexistence of B. pertussis and B. holmesii DNA in 36.5% (35/96). Two B. pertussis were isolated by culture performed on 43 samples of the contacts of the children (4.6%). This study highlights the circulation of B. pertussis but also of B. holmesii in Casablanca-Morocco with a high proportion of co-infections B. holmesii/B. pertussis in infants and their mothers, indicate that infection of non-vaccinated infants could be more associated with young parents. Moreover, the RT- PCR provides a sensitive and specific diagnosis of B. pertussis infections and distinguishes it from other Bordetella species, and is therefore suitable for implementation in the diagnostic laboratory.

Screening of eye-position related genes with DD-RT-PCR and RDA in the hybrids between Japanese flounder Paralichthys olivaceus and stone flounder Kareius bicoloratus

NASA Astrophysics Data System (ADS)

Chen, Yanjie; Zhang, Quanqi; Qi, Jie; Sun, Yeying; Zhong, Qiwang; Wang, Xubo; Wang, Zhigang; Li, Shuo; Li, Chunmei

2009-02-01

Flatfish or flounder moves one eye to change body proportion into vertebral asymmetry during metamorphosis, during which some become sinistral while others dextral. However, the mechanism behinds the eye-position has not been well understood. In this research, hybrids between Japanese flounder(♀) and stone flounder (♂) show mixed eye-location in both dextral type and sinistral type, and thus become good samples for studying the eye-migration. mRNAs from pro-metamorphosis sinistral and dextral hybrids larvae were screened with classical differential display RT-PCR (DD-RT-PCR) and representational difference analysis of cDNA (cDNA-RDA); 30 and 47 putative fragments were isolated, respectively. The cDNA fragments of creatine kinase and trypsinogen 2 precursor genes isolated by cDNA-RDA exhibited eye-position expression patterns during metamorphosis. However, none of the fragments was proved to be related to flatfishes’ eye-position specifically. Therefore, further studies and more sensitive gene isolated methods are needed to solve the problems.

Enterococcus caccae sp. nov., isolated from human stools.

PubMed

Carvalho, Maria da Glória S; Shewmaker, P Lynn; Steigerwalt, Arnold G; Morey, Roger E; Sampson, A J; Joyce, Kevin; Barrett, Timothy J; Teixeira, Lucia M; Facklam, Richard R

2006-07-01

The National Antimicrobial Resistance Monitoring System Laboratory at the Centers for Disease Control and Prevention (CDC) isolated two enterococcus-like strains that were referred to the CDC Streptococcus Laboratory for further identification. The isolates were recovered from human stool samples collected on different occasions from the same individual in Portland (OR, USA) in July 2000. Conventional physiological tests distinguished these strains from all known species of enterococci. Analyses of whole-cell-protein electrophoretic profiles showed the same unique profile for the two isolates, being most similar those of Enterococcus moraviensis and Enterococcus haemoperoxidus albeit not close enough to allow conclusive inclusion in any enterococcal species. Both isolates gave positive results in tests using the AccuProbe Enterococcus genetic probe, and Lancefield extracts reacted with CDC group D antiserum. Comparative 16S rRNA gene sequencing studies also revealed that these strains were closely related to the species E. moraviensis (99.6 % identity). The results of DNA-DNA relatedness experiments confirmed that these strains represented a single novel taxon. The highest level of DNA-DNA relatedness found between the novel taxon and any of the currently recognized species of Enterococcus was 32 %, for both E. moraviensis and E. haemoperoxidus. On the basis of this evidence, it is proposed that these stool isolates constitute a novel species, for which the name Enterococcus caccae sp. nov. is proposed. The type strain is 2215-02(T) (=SS-1777(T)=ATCC BAA-1240(T)=CCUG 51564(T)).

Comparative isolation and genetic diversity of Arcobacter sp. from fish and the coastal environment.

PubMed

Rathlavath, S; Kumar, S; Nayak, B B

2017-07-01

Arcobacter species are emerging food-borne and water-borne human pathogens associated mostly with food animals and their environment. The present study was aimed to isolate Arcobacter species from fish, shellfish and coastal water samples using two methods and to determine their genetic diversity. Of 201 samples of fish, shellfish and water samples analysed, 66 (32·8%) samples showed the presence of Arcobacter DNA from both Arcobacter enrichment broth and Bolton broth. Arcobacters were isolated from 58 (87·8%) and 38 (57·5%) of Arcobacter DNA-positive samples using Arcobacter blood agar and Preston blood agar, respectively. Arcobacter sp. identified by biochemical tests were further analysed by a genus-specific PCR, followed by a multiplex-PCR and 16S rRNA-RFLP. From both the methods, four different Arcobacter species namely Arcobacter butzleri, Arcobacter skirrowii, Arcobacter mytili and Arcobacter defluvii were isolated, of which A. butzleri was the predominant species. Enterobacterial repetitive intergenic consensus (ERIC)-PCR fingerprint analysis revealed that the arcobacters isolated in this study were genetically very diverse and no specific genotype was found associated with a specific source (seafood or water). Since pathogenic arcobacters are not known to be natural inhabitants of coastal marine environment, identifying the sources of contamination will be crucial for effective management of this problem. Arcobacter sp. are emerging food- and water-borne human pathogens. In this study, comparison of two selective media suggested Arcobacter blood agar to be more efficient in yielding Arcobacter sp. from seafood. Furthermore, the isolation of Arcobacter sp. such as Arcobacter butzleri, A. skirrowii, A. mytili and A. defluvii from seafood suggests diverse sources of contamination of seafood by Arcobacter sp. Analysis of enterobacterial repetitive intergenic consensus sequence-PCR patterns of A. butzleri showed high genetic diversity and lack of clonality among the isolates. Arcobacter contamination of seafood is an emerging issue both from seafood safety and seafood trade point of view. © 2017 The Society for Applied Microbiology.

Longitudinal monitoring of Listeria monocytogenes and Listeria phages in seafood processing environments in Thailand.

PubMed

Vongkamjan, Kitiya; Benjakul, Soottawat; Kim Vu, Hue Thi; Vuddhakul, Varaporn

2017-09-01

Listeria monocytogenes is a foodborne pathogen commonly found in environments of seafood processing, thus presenting a challenge for eradication from seafood processing facilities. Monitoring the prevalence and subtype diversity of L. monocytogenes together with phages that are specific to Listeria spp. ("Listeria phages") will provide knowledge on the bacteria-phage ecology in food processing plants. In this work, a total of 595 samples were collected from raw material, finished seafood products and environmental samples from different sites of a seafood processing plant during 17 sampling visits in 1.5 years of study. L. monocytogenes and Listeria spp. (non-monocytogenes) were found in 22 (3.7%) and 43 (7.2%) samples, respectively, whereas 29 Listeria phages were isolated from 9 (1.5%) phage-positive samples. DNA fingerprint analysis of L. monocytogenes isolates revealed 11 Random Amplified Polymorphic DNA (RAPD) profiles, with two subtypes were frequently observed over time. Our data reveal a presence of Listeria phages within the same seafood processing environments where a diverse set of L. monocytogenes subtypes was also found. Although serotype 4b was observed at lower frequency, data indicate that isolates from this seafood processing plant belonged to both epidemiologically important serotypes 1/2a and 4b, which may suggest a potential public health risk. Phages (all showed a unique genome size of 65 ± 2 kb) were classified into 9 host range groups, representing both broad- and narrow-host range. While most L. monocytogenes isolates from this facility were susceptible to phages, five isolates showed resistance to 12-20 phages. Variations in phage host range among Listeria phages isolated from food processing plant may affect a presence of a diverse set of L. monocytogenes isolates derived from the same processing environment in Thailand. Copyright © 2017 Elsevier Ltd. All rights reserved.

Hydrogenobacter subterraneus sp. nov., an extremely thermophilic, heterotrophic bacterium unable to grow on hydrogen gas, from deep subsurface geothermal water.

PubMed

Takai, K; Komatsu, T; Horikoshi, K

2001-07-01

A novel extreme thermophile was isolated from a water sample derived from a deep subsurface geothermal water pool at a depth of 1500 m in the Hacchoubaru geothermal plant in Oita Prefecture, Japan. The cells were found to be straight rods, each being motile by means of a polar flagellum. Growth was observed at temperatures between 60 and 85 degrees C (optimum 78 degrees C; 120 min doubling time) and between pH 5.5 and pH 9.0 (optimum 7.5). The isolate was a strictly aerobic heterotroph capable of utilizing a number of substrates such as yeast extract, peptone, tryptone, various carbohydrates, sugars, amino acids and organic acids. Elemental sulfur, thiosulfate, sulfide or cysteine-hydrochloride was required as an electron donor for growth. Hydrogen gas did not support growth. The G+C content of the genomic DNA was 44.7 mol%. Phylogenetic analysis based on 16S rDNA sequences and DNA-DNA hybridization analysis indicated that the isolate was closely related to members of the hydrogen-oxidizing, autotrophic and thermophilic genera Hydrogenobacter and Calderobacterium. However this isolate was differentiated from the previously described species of these genera on the basis of the physiological and molecular properties of the new isolate. The name Hydrogenobacter subterraneus sp. nov. is proposed; the type strain is HGP1T (= JCM 10560T = IFO 16485T).

Filter Paper-based Nucleic Acid Storage in High-throughput Solid Tumor Genotyping.

PubMed

Stachler, Matthew; Jia, Yonghui; Sharaf, Nematullah; Wade, Jacqueline; Longtine, Janina; Garcia, Elizabeth; Sholl, Lynette M

2015-01-01

Molecular testing of tumors from formalin-fixed paraffin-embedded (FFPE) tissue blocks is central to clinical practice; however, it requires histology support and increases test turnaround time. Prospective fresh frozen tissue collection requires special handling, additional storage space, and may not be feasible for small specimens. Filter paper-based collection of tumor DNA reduces the need for histology support, requires little storage space, and preserves high-quality nucleic acid. We investigated the performance of tumor smears on filter paper in solid tumor genotyping, as compared with paired FFPE samples. Whatman FTA Micro Card (FTA preps) smears were prepared from 21 fresh tumor samples. A corresponding cytology smear was used to assess tumor cellularity and necrosis. DNA was isolated from FTA preps and FFPE core samples using automated methods and quantified using SYBR green dsDNA detection. Samples were genotyped for 471 mutations on a mass spectrophotometry-based platform (Sequenom). DNA concentrations from FTA preps and FFPE correlated for untreated carcinomas but not for mesenchymal tumors (Spearman σ=0.39 and σ=-0.1, respectively). Average DNA concentrations were lower from FTA preps as compared with FFPE, but DNA quality was higher with less fragmentation. Seventy-six percent of FTA preps and 86% of FFPE samples generated adequate DNA for genotyping. FTA preps tended to perform poorly for collection of DNA from pretreated carcinomas and mesenchymal neoplasms. Of the 16 paired DNA samples that were genotyped, 15 (94%) gave entirely concordant results. Filter paper-based sample preservation is a feasible alternative to FFPE for use in automated, high-throughput genotyping of carcinomas.

Isolation and Characterization of Burkholderia rinojensis sp. nov., a Non-Burkholderia cepacia Complex Soil Bacterium with Insecticidal and Miticidal Activities

PubMed Central

Fernandez, Lorena E.; Koivunen, Marja; Yang, April; Flor-Weiler, Lina; Marrone, Pamela G.

2013-01-01

Isolate A396, a bacterium isolated from a Japanese soil sample demonstrated strong insecticidal and miticidal activities in laboratory bioassays. The isolate was characterized through biochemical methods, fatty acid methyl ester (FAME) analysis, sequencing of 16S rRNA, multilocus sequence typing and analysis, and DNA-DNA hybridization. FAME analysis matched A396 to Burkholderia cenocepacia, but this result was not confirmed by 16S rRNA or DNA-DNA hybridization. 16S rRNA sequencing indicated closest matches with B. glumae and B. plantarii. DNA-DNA hybridization experiments with B. plantarii, B. glumae, B. multivorans, and B. cenocepacia confirmed the low genetic similarity (11.5 to 37.4%) with known members of the genus. PCR-based screening showed that A396 lacks markers associated with members of the B. cepacia complex. Bioassay results indicated two mechanisms of action: through ingestion and contact. The isolate effectively controlled beet armyworms (Spodoptera exigua; BAW) and two-spotted spider mites (Tetranychus urticae; TSSM). In diet overlay bioassays with BAW, 1% to 4% (vol/vol) dilution of the whole-cell broth caused 97% to 100% mortality 4 days postexposure, and leaf disc treatment bioassays attained 75% ± 22% mortality 3 days postexposure. Contact bioassays led to 50% larval mortality, as well as discoloration, stunting, and failure to molt. TSSM mortality reached 93% in treated leaf discs. Activity was maintained in cell-free supernatants and after heat treatment (60°C for 2 h), indicating that a secondary metabolite or excreted thermostable enzyme might be responsible for the activity. Based on these results, we describe the novel species Burkholderia rinojensis, a good candidate for the development of a biocontrol product against insect and mite pests. PMID:24096416

Molecular Evidence for Occurrence of Tomato leaf curl New Delhi virus in Ash Gourd (Benincasa hispida) Germplasm Showing a Severe Yellow Stunt Disease in India.

PubMed

Roy, Anirban; Spoorthi, P; Panwar, G; Bag, Manas Kumar; Prasad, T V; Kumar, Gunjeet; Gangopadhyay, K K; Dutta, M

2013-06-01

An evaluation of 70 accessions of ash gourd germplasm grown at National Bureau of Plant Genetic Resources, New Delhi, India during Kharif season (2010) showed natural occurrence of a yellow stunt disease in three accessions (IC554690, IC036330 and Pusa Ujjwal). A set of begomovirus specific primers used in PCR gave expected amplicon from all the symptomatic plants; however no betasatellite was detected. Complete genome of the begomovirus (DNA-A and DNA-B), amplified through rolling circle amplification, was cloned and sequenced. The begomovirus under study shared high sequence identities to different isolates of Tomato leaf curl New Delhi virus (ToLCNDV) and clustered with them. Among those isolates, the DNA-A and DNA-B of the present begomovirus isolate showed highest 99.6 and 96.8 % sequence identities, respectively with an isolate reported on pumpkin from India (DNA-A: AM286433, DNA-B: AM286435). Based on the sequence analysis, the begomovirus obtained from ash gourd was considered as an isolate of ToLCNDV. Thus, the present findings constitute the first report of occurrence of a new yellow stunt disease in ash gourd from India and demonstrated the association of ToLCNDV with the symptomatic samples. Occurrence of ToLCNDV in ash gourd germplasm not only adds up a new cucurbitaceous host of this virus but also raises the concern about the perpetuation of this virus in absence of its main host tomato and thus has an epidemiological relevance for understanding the rapid spread of this virus in tomato and other hosts in Indian sub-continent.

Prevalence of Naegleria fowleri in Environmental Samples from Northern Part of India.

PubMed

Panda, Ashutosh; Khalil, Shehla; Mirdha, Bijay Ranjan; Singh, Yogita; Kaushik, Samander

2015-01-01

Naegleria fowleri the causative agent of Primary Amoebic Meningoencephalitis, is ubiquitously distributed worldwide in various warm aquatic environments and soil habitats. The present study reports on the presence of Naegleria spp. in various water bodies present in Rohtak and Jhajjar district, of state Haryana, India. A total of 107 water reservoirs were screened from summer till autumn (2012 and 2013). In order to isolate Naegleria spp. from the collected water samples, the water samples were filtered and the trapped debris after processing were transferred to non-nutrient agar plates already seeded with lawn culture of Escherichia coli. Out of total 107 water samples, 43 (40%) samples were positive by culture for free living amoeba after incubation for 14 days at 37°C. To identify the isolates, the ITS1, 5.8SrDNA and ITS2 regions were targeted for PCR assay. Out of total 43 positive samples, 37 isolates were positive for Naegleria spp. using genus specific primers and the most frequently isolated species was Naegleria australiensis. Out of 37 Naegleria spp. positive isolates, 1 isolate was positive for Naegleria fowleri. The sequence analysis revealed that the Naegleria fowleri strain belonged to Type 2.

Prevalence of Naegleria fowleri in Environmental Samples from Northern Part of India

PubMed Central

Panda, Ashutosh; Khalil, Shehla; Mirdha, Bijay Ranjan; Singh, Yogita; Kaushik, Samander

2015-01-01

Naegleria fowleri the causative agent of Primary Amoebic Meningoencephalitis, is ubiquitously distributed worldwide in various warm aquatic environments and soil habitats. The present study reports on the presence of Naegleria spp. in various water bodies present in Rohtak and Jhajjar district, of state Haryana, India. A total of 107 water reservoirs were screened from summer till autumn (2012 and 2013). In order to isolate Naegleria spp. from the collected water samples, the water samples were filtered and the trapped debris after processing were transferred to non-nutrient agar plates already seeded with lawn culture of Escherichia coli. Out of total 107 water samples, 43 (40%) samples were positive by culture for free living amoeba after incubation for 14 days at 37°C. To identify the isolates, the ITS1, 5.8SrDNA and ITS2 regions were targeted for PCR assay. Out of total 43 positive samples, 37 isolates were positive for Naegleria spp. using genus specific primers and the most frequently isolated species was Naegleria australiensis. Out of 37 Naegleria spp. positive isolates, 1 isolate was positive for Naegleria fowleri. The sequence analysis revealed that the Naegleria fowleri strain belonged to Type 2. PMID:26484533

A DNA fingerprinting procedure for ultra high-throughput genetic analysis of insects.

PubMed

Schlipalius, D I; Waldron, J; Carroll, B J; Collins, P J; Ebert, P R

2001-12-01

Existing procedures for the generation of polymorphic DNA markers are not optimal for insect studies in which the organisms are often tiny and background molecular information is often non-existent. We have used a new high throughput DNA marker generation protocol called randomly amplified DNA fingerprints (RAF) to analyse the genetic variability in three separate strains of the stored grain pest, Rhyzopertha dominica. This protocol is quick, robust and reliable even though it requires minimal sample preparation, minute amounts of DNA and no prior molecular analysis of the organism. Arbitrarily selected oligonucleotide primers routinely produced approximately 50 scoreable polymorphic DNA markers, between individuals of three independent field isolates of R. dominica. Multivariate cluster analysis using forty-nine arbitrarily selected polymorphisms generated from a single primer reliably separated individuals into three clades corresponding to their geographical origin. The resulting clades were quite distinct, with an average genetic difference of 37.5 +/- 6.0% between clades and of 21.0 +/- 7.1% between individuals within clades. As a prelude to future gene mapping efforts, we have also assessed the performance of RAF under conditions commonly used in gene mapping. In this analysis, fingerprints from pooled DNA samples accurately and reproducibly reflected RAF profiles obtained from individual DNA samples that had been combined to create the bulked samples.

Clinical significance of monitoring ESR1 mutations in circulating cell-free DNA in estrogen receptor positive breast cancer patients.

PubMed

Takeshita, Takashi; Yamamoto, Yutaka; Yamamoto-Ibusuki, Mutsuko; Inao, Toko; Sueta, Aiko; Fujiwara, Saori; Omoto, Yoko; Iwase, Hirotaka

2016-05-31

The measurement of circulating cell-free DNA (cfDNA) may transform the management of breast cancer patients. We aimed to investigate the clinical significance of sequential measurements of ESR1 mutations in primary breast cancer (PBC) and metastatic breast cancer (MBC) patients. ESR1 mutations ratio in the PBC groups was used as the minimum cutoff for determining increases in cfDNA ESR1 mutation ratio. An increase in cfDNA ESR1 mutations was found in 13 samples of cfDNA from 12 (28.6%) out of 42 MBC patients. A total of 10 (83.3%) out of 12 MBC patients with increase cfDNA ESR1 mutations showed a poor response to treatment. In survival analysis, increase cfDNA ESR1 mutations may predict a shorter duration of post-endocrine-therapy effectiveness (P = 0.0033). A total of 119 patients (253 plasma samples) with breast carcinoma were enrolled in this study. Cases were selected if archival plasma samples were available from PBC before and after treatment and from MBC gathered more than twice at the time of progression. cfDNA was isolated from the 77 PBC patients (154 plasma samples) and from the 42 MBC patients (99 plasma samples). To investigate any changes in each cfDNA ESR1 mutation before and after treatment, we analyzed the difference with cfDNA ESR1 mutations ratio in the first blood sample using droplet digital polymerase chain reaction (ddPCR). We demonstrate that ddPCR monitoring of the recurrent ESR1 mutation in cfDNA of MBC patients is a feasible and useful method of providing relevant predictive information.

Clinical significance of monitoring ESR1 mutations in circulating cell-free DNA in estrogen receptor positive breast cancer patients

PubMed Central

Takeshita, Takashi; Yamamoto, Yutaka; Yamamoto-Ibusuki, Mutsuko; Inao, Toko; Sueta, Aiko; Fujiwara, Saori; Omoto, Yoko; Iwase, Hirotaka

2016-01-01

Background The measurement of circulating cell-free DNA (cfDNA) may transform the management of breast cancer patients. We aimed to investigate the clinical significance of sequential measurements of ESR1 mutations in primary breast cancer (PBC) and metastatic breast cancer (MBC) patients. Results ESR1 mutations ratio in the PBC groups was used as the minimum cutoff for determining increases in cfDNA ESR1 mutation ratio. An increase in cfDNA ESR1 mutations was found in 13 samples of cfDNA from 12 (28.6%) out of 42 MBC patients. A total of 10 (83.3%) out of 12 MBC patients with increase cfDNA ESR1 mutations showed a poor response to treatment. In survival analysis, increase cfDNA ESR1 mutations may predict a shorter duration of post-endocrine-therapy effectiveness (P = 0.0033). Methods A total of 119 patients (253 plasma samples) with breast carcinoma were enrolled in this study. Cases were selected if archival plasma samples were available from PBC before and after treatment and from MBC gathered more than twice at the time of progression. cfDNA was isolated from the 77 PBC patients (154 plasma samples) and from the 42 MBC patients (99 plasma samples). To investigate any changes in each cfDNA ESR1 mutation before and after treatment, we analyzed the difference with cfDNA ESR1 mutations ratio in the first blood sample using droplet digital polymerase chain reaction (ddPCR). Conclusions We demonstrate that ddPCR monitoring of the recurrent ESR1 mutation in cfDNA of MBC patients is a feasible and useful method of providing relevant predictive information. PMID:27102299

Short communication: Identification of coagulase-negative staphylococcus species from goat milk with the API Staph identification test and with transfer RNA-intergenic spacer PCR combined with capillary electrophoresis.

PubMed

Koop, G; De Visscher, A; Collar, C A; Bacon, D A C; Maga, E A; Murray, J D; Supré, K; De Vliegher, S; Haesebrouck, F; Rowe, J D; Nielen, M; van Werven, T

2012-12-01

Coagulase-negative staphylococci (CNS) are the most commonly isolated bacteria from goat milk, but they have often been identified with phenotypic methods, which may have resulted in misclassification. The aims of this paper were to assess the amount of misclassification of a phenotypic test for identifying CNS species from goat milk compared with transfer RNA intergenic spacer PCR (tDNA-PCR) followed by capillary electrophoresis, and to apply the tDNA-PCR technique on different capillary electrophoresis equipment. Milk samples were collected from 416 does in 5 Californian dairy goat herds on 3 occasions during lactation. In total, 219 CNS isolates were identified at the species level with tDNA-PCR and subjected to the API 20 Staph identification test kit (API Staph; bioMérieux, Durham, NC). If the same species was isolated multiple times from the same udder gland, only the first isolate was used for further analyses, resulting in 115 unique CNS isolates. According to the tDNA-PCR test, the most prevalent CNS species were Staphylococcus epidermidis, Staphylococcus caprae, and Staphylococcus simulans. Typeability with API staph was low (72%). Although the API Staph test was capable of identifying the majority of Staph. epidermidis and Staph. caprae isolates, sensitivity for identification of Staph. simulans was low. The true positive fraction was high for the 3 most prevalent species. It was concluded that the overall performance of API Staph in differentiating CNS species from goat milk was moderate to low, mainly because of the low typeability, and that genotypic methods such as tDNA-PCR are preferred. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

The investigation of probiotic potential of lactic acid bacteria isolated from traditional Mongolian dairy products.

PubMed

Takeda, Shiro; Yamasaki, Keiko; Takeshita, Masahiko; Kikuchi, Yukiharu; Tsend-Ayush, Chuluunbat; Dashnyam, Bumbein; Ahhmed, Abdulatef M; Kawahara, Satoshi; Muguruma, Michio

2011-08-01

The aims of this study were to investigate the diversity of lactic acid bacteria (LAB) isolated from traditional Mongolian dairy products, and to estimate the probiotic potential of the isolated strains. We collected 66 samples of the traditional Mongolian dairy products tarag (n = 45), airag (n = 7), aaruul (n = 8), byasulag (n = 1) and eezgii (n = 5), from which 543 LAB strains were isolated and identified based on 16S ribosomal DNA sequence. The predominant species of those products were Lactobacillus (L.) delbrueckii ssp. bulgaricus, L. helveticus, L. fermentum, L. delbrueckii ssp. lactis and Lactococcus lactis ssp. lactis. However, we could not detect any LAB strains from eezgii. All LAB isolates were screened for tolerance to low pH and to bile acid, gas production from glucose, and adherence to Caco-2 cells. In vitro, we found 10 strains possess probiotic properties, and almost identified them as L. plantarum or L. paracasei subspecies, based on 16S ribosomal DNA and carbohydrate fermentation pattern. These strains were differentiated from each other individually by randomly amplified polymorphic DNA analysis. Additionally, it was notable that 6/10 strains were isolated from camel milk tarag from the Dornogovi province. 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.

Modified salting-out method: high-yield, high-quality genomic DNA extraction from whole blood using laundry detergent.

PubMed

Nasiri, H; Forouzandeh, M; Rasaee, M J; Rahbarizadeh, F

2005-01-01

Different approaches have been used to extract DNA from whole blood. In most of these methods enzymes (such as proteinase K and RNAse A) or toxic organic solvents (such as phenol or guanidine isothiocyanate) are used. Since these enzymes are expensive, and most of the materials that are used routinely are toxic, it is desirable to apply an efficient DNA extraction procedure that does not require the use of such materials. In this study, genomic DNA was extracted by the salting-out method, but instead of using an analytical-grade enzyme and chemical detergents, as normally used for DNA isolation, a common laundry powder was used. Different concentrations of the powder were tested, and proteins were precipitated by NaCl-saturated distilled water. Finally, DNA precipitation was performed with the use of 96% ethanol. From the results, we conclude that the optimum concentration of laundry powder for the highest yield and purity of isolated DNA is 30 mg/mL. The procedure was optimized, and a final protocol is suggested. Following the same protocol, DNA was extracted from 100 blood samples, and their amounts were found to be >50 microg/mL of whole blood. The integrity of the DNA fragments was confirmed by agarose gel electrophoresis. Furthermore, the extracted DNA was used as a template for PCR reaction. The results obtained from PCR showed that the final solutions of extracted DNA did not contain any inhibitory material for the enzyme used in the PCR reaction, and indicated that the isolated DNA was of good quality. These results show that this method is simple, fast, safe, and cost-effective, and can be used in medical laboratories and research centers. Copyright 2005 Wiley-Liss, Inc.

Comparison of DNA extraction methods for meat analysis.

PubMed

Yalçınkaya, Burhanettin; Yumbul, Eylem; Mozioğlu, Erkan; Akgoz, Muslum

2017-04-15

Preventing adulteration of meat and meat products with less desirable or objectionable meat species is important not only for economical, religious and health reasons, but also, it is important for fair trade practices, therefore, several methods for identification of meat and meat products have been developed. In the present study, ten different DNA extraction methods, including Tris-EDTA Method, a modified Cetyltrimethylammonium Bromide (CTAB) Method, Alkaline Method, Urea Method, Salt Method, Guanidinium Isothiocyanate (GuSCN) Method, Wizard Method, Qiagen Method, Zymogen Method and Genespin Method were examined to determine their relative effectiveness for extracting DNA from meat samples. The results show that the salt method is easy to perform, inexpensive and environmentally friendly. Additionally, it has the highest yield among all the isolation methods tested. We suggest this method as an alternative method for DNA isolation from meat and meat products. Copyright © 2016 Elsevier Ltd. All rights reserved.

Comparison of DNA extraction protocols for microbial communities from soil treated with biochar

PubMed Central

Leite, D.C.A.; Balieiro, F.C.; Pires, C.A.; Madari, B.E.; Rosado, A.S.; Coutinho, H.L.C.; Peixoto, R.S.

2014-01-01

Many studies have evaluated the effects of biochar application on soil structure and plant growth. However, there are very few studies describing the effect of biochar on native soil microbial communities. Microbial analysis of environmental samples requires accurate and reproducible methods for the extraction of DNA from samples. Because of the variety among microbial species and the strong adsorption of the phosphate backbone of the DNA molecule to biochar, extracting and purifying high quality microbial DNA from biochar-amended soil is not a trivial process and can be considerably more difficult than the extraction of DNA from other environmental samples. The aim of this study was to compare the relative efficacies of three commercial DNA extraction kits, the FastDNA® SPIN Kit for Soil (FD kit), the PowerSoil® DNA Isolation Kit (PS kit) and the ZR Soil Microbe DNA Kit Miniprep™ (ZR kit), for extracting microbial genomic DNA from sand treated with different types of biochar. The methods were evaluated by comparing the DNA yields and purity and by analysing the bacterial and fungal community profiles generated by PCR-DGGE. Our results showed that the PCR-DGGE profiles for bacterial and fungal communities were highly affected by the purity and yield of the different DNA extracts. Among the tested kits, the PS kit was the most efficient with respect to the amount and purity of recovered DNA and considering the complexity of the generated DGGE microbial fingerprint from the sand-biochar samples. PMID:24948928

Comparison of DNA extraction protocols for microbial communities from soil treated with biochar.

PubMed

Leite, D C A; Balieiro, F C; Pires, C A; Madari, B E; Rosado, A S; Coutinho, H L C; Peixoto, R S

2014-01-01

Many studies have evaluated the effects of biochar application on soil structure and plant growth. However, there are very few studies describing the effect of biochar on native soil microbial communities. Microbial analysis of environmental samples requires accurate and reproducible methods for the extraction of DNA from samples. Because of the variety among microbial species and the strong adsorption of the phosphate backbone of the DNA molecule to biochar, extracting and purifying high quality microbial DNA from biochar-amended soil is not a trivial process and can be considerably more difficult than the extraction of DNA from other environmental samples. The aim of this study was to compare the relative efficacies of three commercial DNA extraction kits, the FastDNA® SPIN Kit for Soil (FD kit), the PowerSoil® DNA Isolation Kit (PS kit) and the ZR Soil Microbe DNA Kit Miniprep™ (ZR kit), for extracting microbial genomic DNA from sand treated with different types of biochar. The methods were evaluated by comparing the DNA yields and purity and by analysing the bacterial and fungal community profiles generated by PCR-DGGE. Our results showed that the PCR-DGGE profiles for bacterial and fungal communities were highly affected by the purity and yield of the different DNA extracts. Among the tested kits, the PS kit was the most efficient with respect to the amount and purity of recovered DNA and considering the complexity of the generated DGGE microbial fingerprint from the sand-biochar samples.

Lactobacilli and Bifidobacteria in Human Breast Milk: Influence of Antibiotherapy and Other Host and Clinical Factors

PubMed Central

Soto, Ana; Martín, Virginia; Jiménez, Esther; Mader, Isabelle; Rodríguez, Juan M.; Fernández, Leonides

2014-01-01

ABSTRACT Objective: The objective of this work was to study the lactobacilli and bifidobacteria population in human milk of healthy women, and to investigate the influence that several factors (including antibioteraphy during pregnancy and lactation, country and date of birth, delivery mode, or infant age) may exert on such population. Methods: A total of 160 women living in Germany or Austria provided the breast milk samples. Initially, 66 samples were randomly selected and cultured on MRS-Cys agar plates. Then, the presence of DNA from the genera Lactobacillus and Bifidobacterium, and from most of the Lactobacillus and Bifidobacterium species that were isolated, was assessed by qualitative polymerase chain reaction (PCR) using genus- and species-specific primers. Results: Lactobacilli and bifidobacteria could be isolated from the milk of 27 (40.91%) and 7 (10.61%), respectively, of the 66 cultured samples. On the contrary, Lactobacillus and Bifidobacterium sequences were detected by PCR in 108 (67.50%) and 41 (25.62%), respectively, of the 160 samples analyzed. The Lactobacillus species most frequently isolated and detected was L salivarius (35.00%), followed by L fermentum (25.00%) and L gasseri (21.88%), whereas B breve (13.75%) was the bifidobacterial species most commonly recovered and whose DNA was most regularly found. The number of lactobacilli- or bifidobacteria-positive samples was significantly lower in women who had received antibiotherapy during pregnancy or lactation. Conclusions: Our results suggest that either the presence of lactobacilli and/or bifidobacteria or their DNA may constitute good markers of a healthy human milk microbiota that has not been altered by the use of antibiotics. PMID:24590211

Ecological survey of Saccharomyces cerevisiae strains from vineyards in the Vinho Verde Region of Portugal.

PubMed

Schuller, Dorit; Alves, Hugo; Dequin, Sylvie; Casal, Margarida

2005-01-01

One thousand six hundred and twenty yeast isolates were obtained from 54 spontaneous fermentations performed from grapes collected in 18 sampling sites of three vineyards (Vinho Verde Wine Region in northwest Portugal) during the 2001-2003 harvest seasons. All isolates were analyzed by mitochondrial DNA restriction fragment length polymorphism (mtDNA RFLP) and a pattern profile was verified for each isolate, resulting in a total of 297 different profiles, that all belonged to the species Saccharomyces cerevisiae. The strains corresponding to seventeen profiles showed a wider temporal and geographical distribution, being characterized by a generalized pattern of sporadic presence, absence and reappearance. One strain (ACP10) showed a more regional distribution with a perennial behavior. In different fermentations ACP10 was either dominant or not, showing that the final outcome of fermentation was dependent on the specific composition of the yeast community in the must. Few of the grape samples collected before harvest initiated a spontaneous fermentation, compared to the samples collected after harvest, in a time frame of about 2 weeks. The associated strains were also much more diversified: 267 patterns among 1260 isolates compared to 30 patterns among 360 isolates in the post- and pre-harvest samples, respectively. Fermenting yeast populations have never been characterized before in this region and the present work reports the presence of commercial yeast strains used by the wineries. The present study aims at the development of strategies for the preservation of biodiversity and genetic resources as a basis for further strain development.

DNA Identification of Commingled Human Remains from the Cemetery Relocated by Flooding in Central Bosnia and Herzegovina.

PubMed

Čakar, Jasmina; Pilav, Amela; Džehverović, Mirela; Ahatović, Anesa; Haverić, Sanin; Ramić, Jasmin; Marjanović, Damir

2018-01-01

The floods in Bosnia and Herzegovina in May 2014 caused landslides all over the country. In the small village of Šerići, near the town of Zenica, a landslide destroyed the local cemetery, relocated graves, and commingled skeletal remains. As the use of other physical methods of identification (facial recognition, fingerprint analysis, dental analysis, etc.) was not possible, DNA analysis was applied. DNA was isolated from 20 skeletal remains (bone and tooth samples) and six reference samples (blood from living relatives) and amplified using PowerPlex ® Fusion and PowerPlex ® Y23 kits. DNA profiles were generated for all reference samples and 17 skeletal remains. A statistical analysis (calculation of paternity, maternity, and sibling indexes and matching probabilities) resulted in 10 positive identifications. In this study, 5 individuals were identified based on one reference sample. This has once again demonstrated the significance of DNA analysis in resolving the most complicated cases, such as the identification of commingled human skeletal remains. © 2017 American Academy of Forensic Sciences.

Bat white-nose syndrome: a real-time TaqMan polymerase chain reaction test targeting the intergenic spacer region of Geomyces destructanstructans.

USGS Publications Warehouse

Muller, Laura K.; Lorch, Jeffrey M.; Lindner, Daniel L.; O'Connor, Michael; Gargas, Andrea; Blehert, David S.

2013-01-01

The fungus Geomyces destructans is the causative agent of white-nose syndrome (WNS), a disease that has killed millions of North American hibernating bats. We describe a real-time TaqMan PCR test that detects DNA from G. destructans by targeting a portion of the multicopy intergenic spacer region of the rRNA gene complex. The test is highly sensitive, consistently detecting as little as 3.3 fg of genomic DNA from G. destructans. The real-time PCR test specifically amplified genomic DNA from G. destructans but did not amplify target sequence from 54 closely related fungal isolates (including 43 Geomyces spp. isolates) associated with bats. The test was further qualified by analyzing DNA extracted from 91 bat wing skin samples, and PCR results matched histopathology findings. These data indicate the real-time TaqMan PCR method described herein is a sensitive, specific, and rapid test to detect DNA from G. destructans and provides a valuable tool for WNS diagnostics and research.

Design and Evaluation of PCR Primers for Analysis of Bacterial Populations in Wine by Denaturing Gradient Gel Electrophoresis

PubMed Central

Lopez, Isabel; Ruiz-Larrea, Fernanda; Cocolin, Luca; Orr, Erica; Phister, Trevor; Marshall, Megan; VanderGheynst, Jean; Mills, David A.

2003-01-01

Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified ribosomal DNA (rDNA) is routinely used to compare levels of diversity of microbial communities and to monitor population dynamics. While using PCR-DGGE to examine the bacteria in wine fermentations, we noted that several commonly used PCR primers for amplifying bacterial 16S rDNA also coamplified yeast, fungal, or plant DNA present in samples. Unfortunately, amplification of nonbacterial DNA can result in a masking of bacterial populations in DGGE profiles. To surmount this problem, we developed two new primer sets for specific amplification of bacterial 16S rDNA in wine fermentation samples without amplification of eukaryotic DNA. One primer set, termed WLAB1 and WLAB2, amplified lactic acid bacteria, while another, termed WBAC1 and WBAC2, amplified both lactic acid bacterial and acetic acid bacterial populations found in wine. Primer specificity and efficacy were examined with DNA isolated from numerous bacterial, yeast, and fungal species commonly found in wine and must samples. Importantly, both primer sets effectively distinguished bacterial species in wine containing mixtures of yeast and bacteria. PMID:14602643

Identification of the bacterial community of maple sap by using amplified ribosomal DNA (rDNA) restriction analysis and rDNA sequencing.

PubMed

Lagacé, L; Pitre, M; Jacques, M; Roy, D

2004-04-01

The bacterial community of maple sap was characterized by analysis of samples obtained at the taphole of maple trees for the 2001 and 2002 seasons. Among the 190 bacterial isolates, 32 groups were formed according to the similarity of the banding patterns obtained by amplified ribosomal DNA restriction analysis (ARDRA). A subset of representative isolates for each ARDRA group was identified by 16S rRNA gene fragment sequencing. Results showed a wide variety of organisms, with 22 different genera encountered. Pseudomonas and Ralstonia, of the gamma- and beta-Proteobacteria, respectively, were the most frequently encountered genera. Gram-positive bacteria were also observed, and Staphylococcus, Plantibacter, and Bacillus were the most highly represented genera. The sampling period corresponding to 50% of the cumulative sap flow percentage presented the greatest bacterial diversity according to its Shannon diversity index value (1.1). gamma-Proteobacteria were found to be dominant almost from the beginning of the season to the end. These results are providing interesting insights on maple sap microflora that will be useful for further investigation related to microbial contamination and quality of maple products and also for guiding new strategies on taphole contamination control.

Identification of human remains from the Second World War mass graves uncovered in Bosnia and Herzegovina

PubMed Central

Marjanović, Damir; Hadžić Metjahić, Negra; Čakar, Jasmina; Džehverović, Mirela; Dogan, Serkan; Ferić, Elma; Džijan, Snježana; Škaro, Vedrana; Projić, Petar; Madžar, Tomislav; Rod, Eduard; Primorac, Dragan

2015-01-01

Aim To present the results obtained in the identification of human remains from World War II found in two mass graves in Ljubuški, Bosnia and Herzegovina. Methods Samples from 10 skeletal remains were collected. Teeth and femoral fragments were collected from 9 skeletons and only a femoral fragment from 1 skeleton. DNA was isolated from bone and teeth samples using an optimized phenol/chloroform DNA extraction procedure. All samples required a pre-extraction decalcification with EDTA and additional post-extraction DNA purification using filter columns. Additionally, DNA from 12 reference samples (buccal swabs from potential living relatives) was extracted using the Qiagen DNA extraction method. QuantifilerTM Human DNA Quantification Kit was used for DNA quantification. PowerPlex ESI kit was used to simultaneously amplify 15 autosomal short tandem repeat (STR) loci, and PowerPlex Y23 was used to amplify 23 Y chromosomal STR loci. Matching probabilities were estimated using a standard statistical approach. Results A total of 10 samples were processed, 9 teeth and 1 femoral fragment. Nine of 10 samples were profiled using autosomal STR loci, which resulted in useful DNA profiles for 9 skeletal remains. A comparison of established victims' profiles against a reference sample database yielded 6 positive identifications. Conclusion DNA analysis may efficiently contribute to the identification of remains even seven decades after the end of the World War II. The significant percentage of positively identified remains (60%), even when the number of the examined possible living relatives was relatively small (only 12), proved the importance of cooperation with the members of the local community, who helped to identify the closest missing persons’ relatives and collect referent samples from them. PMID:26088850

Identification of human remains from the Second World War mass graves uncovered in Bosnia and Herzegovina.

PubMed

Marjanović, Damir; Hadžić Metjahić, Negra; Čakar, Jasmina; Džehverović, Mirela; Dogan, Serkan; Ferić, Elma; Džijan, Snježana; Škaro, Vedrana; Projić, Petar; Madžar, Tomislav; Rod, Eduard; Primorac, Dragan

2015-06-01

To present the results obtained in the identification of human remains from World War II found in two mass graves in Ljubuški, Bosnia and Herzegovina. Samples from 10 skeletal remains were collected. Teeth and femoral fragments were collected from 9 skeletons and only a femoral fragment from 1 skeleton. DNA was isolated from bone and teeth samples using an optimized phenol/chloroform DNA extraction procedure. All samples required a pre-extraction decalcification with EDTA and additional post-extraction DNA purification using filter columns. Additionally, DNA from 12 reference samples (buccal swabs from potential living relatives) was extracted using the Qiagen DNA extraction method. QuantifilerTM Human DNA Quantification Kit was used for DNA quantification. PowerPlex ESI kit was used to simultaneously amplify 15 autosomal short tandem repeat (STR) loci, and PowerPlex Y23 was used to amplify 23 Y chromosomal STR loci. Matching probabilities were estimated using a standard statistical approach. A total of 10 samples were processed, 9 teeth and 1 femoral fragment. Nine of 10 samples were profiled using autosomal STR loci, which resulted in useful DNA profiles for 9 skeletal remains. A comparison of established victims' profiles against a reference sample database yielded 6 positive identifications. DNA analysis may efficiently contribute to the identification of remains even seven decades after the end of the World War II. The significant percentage of positively identified remains (60%), even when the number of the examined possible living relatives was relatively small (only 12), proved the importance of cooperation with the members of the local community, who helped to identify the closest missing persons' relatives and collect referent samples from them.

Control of artefactual variation in reported inter-sample relatedness during clinical use of a Mycobacterium tuberculosis sequencing pipeline.

PubMed

Wyllie, David H; Sanderson, Nicholas; Myers, Richard; Peto, Tim; Robinson, Esther; Crook, Derrick W; Smith, E Grace; Walker, A Sarah

2018-06-06

Contact tracing requires reliable identification of closely related bacterial isolates. When we noticed the reporting of artefactual variation between M. tuberculosis isolates during routine next generation sequencing of Mycobacterium spp, we investigated its basis in 2,018 consecutive M. tuberculosis isolates. In the routine process used, clinical samples were decontaminated and inoculated into broth cultures; from positive broth cultures DNA was extracted, sequenced, reads mapped, and consensus sequences determined. We investigated the process of consensus sequence determination, which selects the most common nucleotide at each position. Having determined the high-quality read depth and depth of minor variants across 8,006 M. tuberculosis genomic regions, we quantified the relationship between the minor variant depth and the amount of non-Mycobacterial bacterial DNA, which originates from commensal microbes killed during sample decontamination. In the presence of non-Mycobacterial bacterial DNA, we found significant increases in minor variant frequencies of more than 1.5 fold in 242 regions covering 5.1% of the M. tuberculosis genome. Included within these were four high variation regions strongly influenced by the amount of non-Mycobacterial bacterial DNA. Excluding these four regions from pairwise distance comparisons reduced biologically implausible variation from 5.2% to 0% in an independent validation set derived from 226 individuals. Thus, we have demonstrated an approach identifying critical genomic regions contributing to clinically relevant artefactual variation in bacterial similarity searches. The approach described monitors the outputs of the complex multi-step laboratory and bioinformatics process, allows periodic process adjustments, and will have application to quality control of routine bacterial genomics. Copyright © 2018 Wyllie et al.

ESR1 Methylation: A Liquid Biopsy-Based Epigenetic Assay for the Follow-up of Patients with Metastatic Breast Cancer Receiving Endocrine Treatment.

PubMed

Mastoraki, Sophia; Strati, Areti; Tzanikou, Eleni; Chimonidou, Maria; Politaki, Eleni; Voutsina, Alexandra; Psyrri, Amanda; Georgoulias, Vassilis; Lianidou, Evi

2018-03-15

Purpose: Liquid biopsy provides real-time monitoring of tumor evolution and response to therapy through analysis of circulating tumor cells (CTCs) and plasma-circulating tumor DNA (ctDNA). ESR1 epigenetic silencing potentially affects response to endocrine treatment. We evaluated ESR1 methylation in CTCs and paired plasma ctDNA. We evaluated ESR1 methylation in CTCs and paired plasma ctDNA as a potential biomarker for response to everolimus/exemestane treatment. Experimental Design: A highly sensitive and specific real-time MSP assay for ESR1 methylation was developed and validated in (i) 65 primary breast tumors formalin-fixed paraffin-embedded (FFPE), (ii) EpCAM + CTC fractions (122 patients and 30 healthy donors; HD), (iii) plasma ctDNA (108 patients and 30HD), and (iv) in CTCs (CellSearch) and in paired plasma ctDNA for 58 patients with breast cancer. ESR1 methylation status was investigated in CTCs isolated from serial peripheral blood samples of 19 patients with ER + /HER2 - advanced breast cancer receiving everolimus/exemestane. Results: ESR1 methylation was detected in: (i) 25/65 (38.5%) FFPEs, (ii) EpCAM + CTC fractions : 26/112 (23.3%) patients and 1/30 (3.3%) HD, and (iii) plasma ctDNA: 8/108 (7.4%) patients and 1/30 (3.3%) HD. ESR1 methylation was highly concordant in 58 paired DNA samples, isolated from CTCs (CellSearch) and corresponding plasma. In serial peripheral blood samples of patients treated with everolimus/exemestane, ESR1 methylation was observed in 10/36 (27.8%) CTC-positive samples, and was associated with lack of response to treatment ( P = 0.023, Fisher exact test). Conclusions: We report for the first time the detection of ESR1 methylation in CTCs and a high concordance with paired plasma ctDNA. ESR1 methylation in CTCs was associated with lack of response to everolimus/exemestane regimen. ESR1 methylation should be further evaluated as a potential liquid biopsy-based biomarker. Clin Cancer Res; 24(6); 1500-10. ©2017 AACR . ©2017 American Association for Cancer Research.

Diversity of Streptomyces spp. in Eastern Himalayan region – computational RNomics approach to phylogeny

PubMed Central

Bhattacharjee, Kaushik; Banerjee, Subhro; Joshi, Santa Ram

2012-01-01

Isolation and characterization of actinomycetes from soil samples from altitudinal gradient of North-East India were investigated for computational RNomics based phylogeny. A total of 52 diverse isolates of Streptomyces from the soil samples were isolated on four different media and from these 6 isolates were selected on the basis of cultural characteristics, microscopic and biochemical studies. Sequencing of 16S rDNA of the selected isolates identified them to belong to six different species of Streptomyces. The molecular morphometric and physico-kinetic analysis of 16S rRNA sequences were performed to predict the diversity of the genus. The computational RNomics study revealed the significance of the structural RNA based phylogenetic analysis in a relatively diverse group of Streptomyces. PMID:22829729

Genetic Variability of Beauveria bassiana and a DNA Marker for Environmental Monitoring of a Highly Virulent Isolate Against Cosmopolites sordidus.

PubMed

Ferri, D V; Munhoz, C F; Neves, P M O; Ferracin, L M; Sartori, D; Vieira, M L C; Fungaro, M H P

2012-12-01

The banana weevil Cosmopolites sordidus (Germar) is one of a number of pests that attack banana crops. The use of the entomopathogenic fungus Beauveria bassiana as a biological control agent for this pest may contribute towards reducing the application of chemical insecticides on banana crops. In this study, the genetic variability of a collection of Brazilian isolates of B. bassiana was evaluated. Samples were obtained from various geographic regions of Brazil, and from different hosts of the Curculionidae family. Based on the DNA fingerprints generated by RAPD and AFLP, we found that 92 and 88 % of the loci were polymorphic, respectively. The B. bassiana isolates were attributed to two genotypic clusters based on the RAPD data, and to three genotypic clusters, when analyzed with AFLP. The nucleotide sequences of nuclear ribosomal DNA intergenic spacers confirmed that all isolates are in fact B. bassiana. Analysis of molecular variance showed that variability among the isolates was not correlated with geographic origin or hosts. A RAPD-specific marker for isolate CG 1024, which is highly virulent to C. sordidus, was cloned and sequenced. Based on the sequences obtained, specific PCR primers BbasCG1024F (5'-TGC GGC TGA GGA GGA CT-3') and BbasCG1024R (5'-TGC GGC TGA GTG TAG AAC-3') were designed for detecting and monitoring this isolate in the field.

Automation of DNA and miRNA co-extraction for miRNA-based identification of human body fluids and tissues.

PubMed

Kulstein, Galina; Marienfeld, Ralf; Miltner, Erich; Wiegand, Peter

2016-10-01

In the last years, microRNA (miRNA) analysis came into focus in the field of forensic genetics. Yet, no standardized and recommendable protocols for co-isolation of miRNA and DNA from forensic relevant samples have been developed so far. Hence, this study evaluated the performance of an automated Maxwell® 16 System-based strategy (Promega) for co-extraction of DNA and miRNA from forensically relevant (blood and saliva) samples compared to (semi-)manual extraction methods. Three procedures were compared on the basis of recovered quantity of DNA and miRNA (as determined by real-time PCR and Bioanalyzer), miRNA profiling (shown by Cq values and extraction efficiency), STR profiles, duration, contamination risk and handling. All in all, the results highlight that the automated co-extraction procedure yielded the highest miRNA and DNA amounts from saliva and blood samples compared to both (semi-)manual protocols. Also, for aged and genuine samples of forensically relevant traces the miRNA and DNA yields were sufficient for subsequent downstream analysis. Furthermore, the strategy allows miRNA extraction only in cases where it is relevant to obtain additional information about the sample type. Besides, this system enables flexible sample throughput and labor-saving sample processing with reduced risk of cross-contamination. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction

PubMed Central

Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid

2017-01-01

Background: Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. Materials and Methods: The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. Results: The CTAB method showed more positive results at 1:10–1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. Conclusions: According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor. PMID:29279831

Evaluating variation in human gut microbiota profiles due to DNA extraction method and inter-subject differences.

PubMed

Wagner Mackenzie, Brett; Waite, David W; Taylor, Michael W

2015-01-01

The human gut contains dense and diverse microbial communities which have profound influences on human health. Gaining meaningful insights into these communities requires provision of high quality microbial nucleic acids from human fecal samples, as well as an understanding of the sources of variation and their impacts on the experimental model. We present here a systematic analysis of commonly used microbial DNA extraction methods, and identify significant sources of variation. Five extraction methods (Human Microbiome Project protocol, MoBio PowerSoil DNA Isolation Kit, QIAamp DNA Stool Mini Kit, ZR Fecal DNA MiniPrep, phenol:chloroform-based DNA isolation) were evaluated based on the following criteria: DNA yield, quality and integrity, and microbial community structure based on Illumina amplicon sequencing of the V4 region of bacterial and archaeal 16S rRNA genes. Our results indicate that the largest portion of variation within the model was attributed to differences between subjects (biological variation), with a smaller proportion of variation associated with DNA extraction method (technical variation) and intra-subject variation. A comprehensive understanding of the potential impact of technical variation on the human gut microbiota will help limit preventable bias, enabling more accurate diversity estimates.

Development of a direct PCR assay to detect Taenia multiceps eggs isolated from dog feces.

PubMed

Wang, Ning; Wang, Yu; Ye, Qinghua; Yang, Yingdong; Wan, Jie; Guo, Cheng; Zhan, Jiafei; Gu, Xiaobin; Lai, Weimin; Xie, Yue; Peng, Xuerong; Yang, Guangyou

2018-02-15

Taenia multiceps is a tapeworm that leads to the death of livestock, resulting in major economic losses worldwide. The adult stage of this parasite invades the small intestine of dogs and other canids. In the present study, we developed a direct PCR assay to detect T. multiceps eggs isolated from dog feces to help curb further outbreaks. The genomic DNA was rapidly released using a lysis buffer and the PCR reaction was developed to amplify a 433-bp fragment of the T. multiceps mitochondrial gene encoding NADH dehydrogenase subunit 5 (nad5) from eggs isolated from dog feces. The procedure could be completed within 3 h, including flotation. The sensitivity of the assay was determined by detecting DNA from defined numbers of eggs, and the specificity was determined by detecting DNA from other intestinal tapeworm and roundworm species that commonly infect dogs. In addition, 14 taeniid-positive fecal samples determined by the flotation technique were collected and further evaluated by the regular PCR and our direct PCR. The results showed that the direct PCR developed herein was sensitive enough to detect the DNA from as few as 10 T. multiceps eggs and that no cross-reactions with other tapeworm and roundworm were observed, suggesting its high sensitivity and specificity for T. multiceps detection. Moreover, 14 taeniid-positive samples were screened by the regular PCR and direct PCR, with detection rates of 78.6% and 85.7%, respectively. In conclusion, the direct PCR assay developed in the present study has high sensitivity and specificity to identify T. multiceps eggs isolated from dog feces and therefore could represent an invaluable tool to identify T. multiceps outbreaks and would contribute to future clinical applications. Copyright © 2017 Elsevier B.V. All rights reserved.

Isolation and molecular identification of Vibrio spp. by sequencing of 16S rDNA from seafood, meat and meat products in Libya.

PubMed

Azwai, S M; Alfallani, E A; Abolghait, S K; Garbaj, A M; Naas, H T; Moawad, A A; Gammoudi, F T; Rayes, H M; Barbieri, I; Eldaghayes, I M

2016-01-01

The genus Vibrio includes several food-borne pathogens that cause a spectrum of clinical conditions including septicemia, cholera and milder forms of gastroenteritis. Several Vibrio spp. are commonly associated with food-borne transmission including Vibrio cholerae, Vibrio parahemolyticus, and Vibrio vulnificus. Microbiological analysis for enumeration and isolation of Vibrio spp. were carried out for a total of 93 samples of seafood, meat and meat products from different geographic localities in Libya (Tripoli, Regdalin, Janzour and Tobruk). Vibrio spp. were detected by conventional cultural and molecular method using PCR and sequencing of 16S rDNA. Out of the 93 cultured samples only 48 (51.6%) yielded colonies on Thiosulfate Citrate Bile Salt agar (TCBS) with culture characteristics of Vibrio spp. More than half (n=27) of processed seafood samples (n=46) yielded colonies on TCBS, while only 44.6 % of samples of meat and meat products showed colonies on TCBS. Among cultured seafood samples, the highest bacterial count was recorded in clam with a count of 3.8 ×10(4) CFU\\g. Chicken burger samples showed the highest bacterial count with 6.5 ×10(4) CFU\\g. Molecular analysis of the isolates obtained in this study, showed that 11 samples out of 48 (22.9%) were Vibrio spp. Vibrio parahemolyticus was isolated from camel meat for the first time. This study is an initial step to provide a baseline for future molecular research targeting Vibrio spp. foodborne illnesses. This data will be used to provide information on the magnitude of such pathogens in Libyan seafood, meat and meat products.

Isolation and molecular identification of Vibrio spp. by sequencing of 16S rDNA from seafood, meat and meat products in Libya

PubMed Central

Azwai, S.M.; Alfallani, E.A.; Abolghait, S.K.; Garbaj, A.M.; Naas, H.T.; Moawad, A.A.; Gammoudi, F.T.; Rayes, H.M.; Barbieri, I.; Eldaghayes, I.M.

2016-01-01

The genus Vibrio includes several food-borne pathogens that cause a spectrum of clinical conditions including septicemia, cholera and milder forms of gastroenteritis. Several Vibrio spp. are commonly associated with food-borne transmission including Vibrio cholerae, Vibrio parahemolyticus, and Vibrio vulnificus. Microbiological analysis for enumeration and isolation of Vibrio spp. were carried out for a total of 93 samples of seafood, meat and meat products from different geographic localities in Libya (Tripoli, Regdalin, Janzour and Tobruk). Vibrio spp. were detected by conventional cultural and molecular method using PCR and sequencing of 16S rDNA. Out of the 93 cultured samples only 48 (51.6%) yielded colonies on Thiosulfate Citrate Bile Salt agar (TCBS) with culture characteristics of Vibrio spp. More than half (n=27) of processed seafood samples (n=46) yielded colonies on TCBS, while only 44.6 % of samples of meat and meat products showed colonies on TCBS. Among cultured seafood samples, the highest bacterial count was recorded in clam with a count of 3.8 ×104 CFU\\g. Chicken burger samples showed the highest bacterial count with 6.5 ×104 CFU\\g. Molecular analysis of the isolates obtained in this study, showed that 11 samples out of 48 (22.9%) were Vibrio spp. Vibrio parahemolyticus was isolated from camel meat for the first time. This study is an initial step to provide a baseline for future molecular research targeting Vibrio spp. foodborne illnesses. This data will be used to provide information on the magnitude of such pathogens in Libyan seafood, meat and meat products. PMID:27004169

Modeling the Sensitivity of Field Surveys for Detection of Environmental DNA (eDNA)

PubMed Central

Schultz, Martin T.; Lance, Richard F.

2015-01-01

The environmental DNA (eDNA) method is the practice of collecting environmental samples and analyzing them for the presence of a genetic marker specific to a target species. Little is known about the sensitivity of the eDNA method. Sensitivity is the probability that the target marker will be detected if it is present in the water body. Methods and tools are needed to assess the sensitivity of sampling protocols, design eDNA surveys, and interpret survey results. In this study, the sensitivity of the eDNA method is modeled as a function of ambient target marker concentration. The model accounts for five steps of sample collection and analysis, including: 1) collection of a filtered water sample from the source; 2) extraction of DNA from the filter and isolation in a purified elution; 3) removal of aliquots from the elution for use in the polymerase chain reaction (PCR) assay; 4) PCR; and 5) genetic sequencing. The model is applicable to any target species. For demonstration purposes, the model is parameterized for bighead carp (Hypophthalmichthys nobilis) and silver carp (H. molitrix) assuming sampling protocols used in the Chicago Area Waterway System (CAWS). Simulation results show that eDNA surveys have a high false negative rate at low concentrations of the genetic marker. This is attributed to processing of water samples and division of the extraction elution in preparation for the PCR assay. Increases in field survey sensitivity can be achieved by increasing sample volume, sample number, and PCR replicates. Increasing sample volume yields the greatest increase in sensitivity. It is recommended that investigators estimate and communicate the sensitivity of eDNA surveys to help facilitate interpretation of eDNA survey results. In the absence of such information, it is difficult to evaluate the results of surveys in which no water samples test positive for the target marker. It is also recommended that invasive species managers articulate concentration-based sensitivity objectives for eDNA surveys. In the absence of such information, it is difficult to design appropriate sampling protocols. The model provides insights into how sampling protocols can be designed or modified to achieve these sensitivity objectives. PMID:26509674

Modeling the Sensitivity of Field Surveys for Detection of Environmental DNA (eDNA).

PubMed

Schultz, Martin T; Lance, Richard F

2015-01-01

The environmental DNA (eDNA) method is the practice of collecting environmental samples and analyzing them for the presence of a genetic marker specific to a target species. Little is known about the sensitivity of the eDNA method. Sensitivity is the probability that the target marker will be detected if it is present in the water body. Methods and tools are needed to assess the sensitivity of sampling protocols, design eDNA surveys, and interpret survey results. In this study, the sensitivity of the eDNA method is modeled as a function of ambient target marker concentration. The model accounts for five steps of sample collection and analysis, including: 1) collection of a filtered water sample from the source; 2) extraction of DNA from the filter and isolation in a purified elution; 3) removal of aliquots from the elution for use in the polymerase chain reaction (PCR) assay; 4) PCR; and 5) genetic sequencing. The model is applicable to any target species. For demonstration purposes, the model is parameterized for bighead carp (Hypophthalmichthys nobilis) and silver carp (H. molitrix) assuming sampling protocols used in the Chicago Area Waterway System (CAWS). Simulation results show that eDNA surveys have a high false negative rate at low concentrations of the genetic marker. This is attributed to processing of water samples and division of the extraction elution in preparation for the PCR assay. Increases in field survey sensitivity can be achieved by increasing sample volume, sample number, and PCR replicates. Increasing sample volume yields the greatest increase in sensitivity. It is recommended that investigators estimate and communicate the sensitivity of eDNA surveys to help facilitate interpretation of eDNA survey results. In the absence of such information, it is difficult to evaluate the results of surveys in which no water samples test positive for the target marker. It is also recommended that invasive species managers articulate concentration-based sensitivity objectives for eDNA surveys. In the absence of such information, it is difficult to design appropriate sampling protocols. The model provides insights into how sampling protocols can be designed or modified to achieve these sensitivity objectives.

Comparison of duplex PCR and phenotypic analysis in differentiating Candida dubliniensis from Candida albicans from oral samples.

PubMed

Sampath, Asanga; Weerasekera, Manjula; Dilhari, Ayomi; Gunasekara, Chinthika; Bulugahapitiya, Uditha; Fernando, Neluka; Samaranayake, Lakshman

2017-12-01

Candida dubliniensis shares a wide range of phenotypic characteristics with Candida albicans including a common trait called germ tube positivity. Hence, laboratory differentiation of these two species is cumbersome. Duplex PCR analyses for C. albicans and C. dubliniensis was performed directly on DNA extracted from a total of 122 germ tube positive isolates derived from 100 concentrated oral rinse samples from a random cohort of diabetics attending a clinic in Sri Lanka. These results were confirmed by DNA sequencing of internal transcribed spacer (ITS) region of rDNA of the yeasts. Performance efficacy of duplex PCR was then compared with phenotypic identification using a standard battery of phenotypic tests. Of the 122 germ tube positive isolates three were identified by duplex PCR as C. dubliniensis and the remainder as C. albicans. On the contrary, when the standard phenotypic tests, sugar assimilation and chlamydospore formation, were used to differentiate the two species 13 germ tube positive isolates were erroneously identified as C. dubliniensis. Duplex PCR was found to be rapid, sensitive and more specific than phenotypic identification methods in discriminating C. dubliniensis from C. albicans. This is also the first report on the oral carriage of C. dubliniensis in a Sri Lankan population.

Male-Specific Coliphages as Indicators of Thermal Inactivation of Pathogens in Biosolids

PubMed Central

Nappier, Sharon P.; Aitken, Michael D.; Sobsey, Mark D.

2006-01-01

Male-specific (F+) coliphages have been proposed as a candidate indicator of fecal contamination and of virus reduction in waste treatment. However, in this and earlier work with a laboratory thermophilic anaerobic digester, a heat-resistant fraction of F+ coliphage populations indigenous to municipal wastewater and sludge was evident. We therefore isolated coliphages from municipal wastewater sludge and from biosolid samples after thermophilic anaerobic digestion to evaluate the susceptibility of specific groups to thermal inactivation. Similar numbers of F+ DNA and F+ RNA coliphages were found in untreated sludge, but the majority of isolates in digested biosolids were group I F+ RNA phages. Separate experiments on individual isolates at 53°C confirmed the apparent heat resistance of group I F+ RNA coliphages as well as the susceptibility of group III F+ RNA coliphages. Although few F+ DNA coliphages were recovered from the treated biosolid samples, thermal inactivation experiments indicated heat resistance similar to that of group I F+ RNA phages. Hence, F+ DNA coliphage reductions during thermophilic anaerobic digestion are probably related to mechanisms other than thermal inactivation. Further studies should focus on the group III F+ RNA coliphages as potential indicators of reductions of heat-resistant pathogens in thermal processes for sludge treatment. PMID:16597945

Usefulness of detection of clarithromycin-resistant Helicobacter pylori from fecal specimens for young adults treated with eradication therapy.

PubMed

Osaki, Takako; Mabe, Katsuhiro; Zaman, Cynthia; Yonezawa, Hideo; Okuda, Masumi; Amagai, Kenji; Fujieda, Shinji; Goto, Mitsuhide; Shibata, Wataru; Kato, Mototsugu; Kamiya, Shigeru

2017-10-01

To prevent Helicobacter pylori infection in the younger generation, it is necessary to investigate the prevalence of antibiotic-resistant H. pylori. The aim of this study was to evaluate the method of PCR-based sequencing to detect clarithromycin (CAM) resistance-associated mutations using fecal samples as a noninvasive method. DNA extracted from fecal specimens and isolates from gastric biopsy specimens were collected from patients with H. pylori infection. Antibiotic resistance to CAM was analyzed by molecular and culture methods. The detection rates of CAM resistance-associated mutations (A2142C or A2143G) were compared before and after eradication therapy. With CAM resistance of H. pylori evaluated by antibiotic susceptibility test as a gold standard, the sensitivity and the specificity of gene mutation detection from fecal DNA were 80% and 84.8%, respectively. In contrast, using DNA of isolated strains, the sensitivity and the specificity were 80% and 100%. Of the seven cases in which eradication was unsuccessful by triple therapy including CAM, CAM-resistant H. pylori, and resistance-associated mutations were detected in three cases, CAM-resistant H. pylori without the mutation was detected in two patients, and resistance-associated mutation was only detected in one patient. PCR-based sequencing to detect CAM resistance-associated mutations using isolates or fecal samples was useful for finding antibiotic-resistant H. pylori infection. Although the specificity of the detection from fecal samples compared with antibiotic susceptibility testing was lower than that from isolates, this fecal detection method is suitable especially for asymptomatic subjects including children. Further improvement is needed before clinical application. © 2017 John Wiley & Sons Ltd.

DNA typing of ancient parasite eggs from environmental samples identifies human and animal worm infections in Viking-age settlement.

PubMed

Søe, Martin Jensen; Nejsum, Peter; Fredensborg, Brian Lund; Kapel, Christian Moliin Outzen

2015-02-01

Ancient parasite eggs were recovered from environmental samples collected at a Viking-age settlement in Viborg, Denmark, dated 1018-1030 A.D. Morphological examination identified Ascaris sp., Trichuris sp., and Fasciola sp. eggs, but size and shape did not allow species identification. By carefully selecting genetic markers, PCR amplification and sequencing of ancient DNA (aDNA) isolates resulted in identification of: the human whipworm, Trichuris trichiura , using SSUrRNA sequence homology; Ascaris sp. with 100% homology to cox1 haplotype 07; and Fasciola hepatica using ITS1 sequence homology. The identification of T. trichiura eggs indicates that human fecal material is present and, hence, that the Ascaris sp. haplotype 07 was most likely a human variant in Viking-age Denmark. The location of the F. hepatica finding suggests that sheep or cattle are the most likely hosts. Further, we sequenced the Ascaris sp. 18S rRNA gene in recent isolates from humans and pigs of global distribution and show that this is not a suited marker for species-specific identification. Finally, we discuss ancient parasitism in Denmark and the implementation of aDNA analysis methods in paleoparasitological studies. We argue that when employing species-specific identification, soil samples offer excellent opportunities for studies of human parasite infections and of human and animal interactions of the past.

Oligonucleotide Array for Identification and Detection of Pythium Species†

PubMed Central

Tambong, J. T.; de Cock, A. W. A. M.; Tinker, N. A.; Lévesque, C. A.

2006-01-01

A DNA array containing 172 oligonucleotides complementary to specific diagnostic regions of internal transcribed spacers (ITS) of more than 100 species was developed for identification and detection of Pythium species. All of the species studied, with the exception of Pythium ostracodes, exhibited a positive hybridization reaction with at least one corresponding species-specific oligonucleotide. Hybridization patterns were distinct for each species. The array hybridization patterns included cluster-specific oligonucleotides that facilitated the recognition of species, including new ones, belonging to groups such as those producing filamentous or globose sporangia. BLAST analyses against 500 publicly available Pythium sequences in GenBank confirmed that species-specific oligonucleotides were unique to all of the available strains of each species, of which there were numerous economically important ones. GenBank entries of newly described species that are not putative synonyms showed no homology to sequences of the spotted species-specific oligonucleotides, but most new species did match some of the cluster-specific oligonucleotides. Further verification of the specificity of the DNA array was done with 50 additional Pythium isolates obtained by soil dilution plating. The hybridization patterns obtained were consistent with the identification of these isolates based on morphology and ITS sequence analyses. In another blind test, total DNA of the same soil samples was amplified and hybridized on the array, and the results were compared to those of 130 Pythium isolates obtained by soil dilution plating and root baiting. The 13 species detected by the DNA array corresponded to the isolates obtained by a combination of soil dilution plating and baiting, except for one new species that was not represented on the array. We conclude that the reported DNA array is a reliable tool for identification and detection of the majority of Pythium species in environmental samples. Simultaneous detection and identification of multiple species of soilborne pathogens such as Pythium species could be a major step forward for epidemiological and ecological studies. PMID:16597974

Detection of Mycobacterium avium subsp. paratuberculosis in bovine manure using Whatman FTA card technology and Lightcycler real-time PCR.

PubMed

Jaravata, Carmela V; Smith, Wayne L; Rensen, Gabriel J; Ruzante, Juliana M; Cullor, James S

2006-01-01

A modified forensic DNA extraction and real-time fluorescent polymerase chain reaction assay has been evaluated for the detection of Mycobacterium avium subsp. paratuberculosis (MAP) in bovine fecal samples using primers and fluorescent resonance energy transfer (FRET) probes targeting the IS900 gene sequence of MAP. DNA was successfully extracted from manure samples by utilizing the Whatman FTA card technology, which allows for simple processing and storage of samples at room temperature. The FTA cards were washed and subjected to a Chelex-100 incubation to remove any remaining polymerase chain reaction (PCR) inhibitors and to elute the DNA from the FTA card. This isolated DNA was then subjected to direct real time fluorescent PCR analysis. Detection of MAP DNA from bovine fecal samples spiked with known concentrations of viable MAP cells was obtained. The detection limits of the assay was consistently found to be between 10(2) and 10(4) colony forming units [CFU]/g, with some samples containing as low as 10 CFU/g, yielding positive assay results. This cost-efficient assay allows reporting of results as early as 4 h after fecal collection, which can be particularly useful in highthroughput herd screening.

A DNA microarray-based assay to detect dual infection with two dengue virus serotypes.

PubMed

Díaz-Badillo, Alvaro; Muñoz, María de Lourdes; Perez-Ramirez, Gerardo; Altuzar, Victor; Burgueño, Juan; Mendoza-Alvarez, Julio G; Martínez-Muñoz, Jorge P; Cisneros, Alejandro; Navarrete-Espinosa, Joel; Sanchez-Sinencio, Feliciano

2014-04-25

Here; we have described and tested a microarray based-method for the screening of dengue virus (DENV) serotypes. This DNA microarray assay is specific and sensitive and can detect dual infections with two dengue virus serotypes and single-serotype infections. Other methodologies may underestimate samples containing more than one serotype. This technology can be used to discriminate between the four DENV serotypes. Single-stranded DNA targets were covalently attached to glass slides and hybridised with specific labelled probes. DENV isolates and dengue samples were used to evaluate microarray performance. Our results demonstrate that the probes hybridized specifically to DENV serotypes; with no detection of unspecific signals. This finding provides evidence that specific probes can effectively identify single and double infections in DENV samples.

A DNA Microarray-Based Assay to Detect Dual Infection with Two Dengue Virus Serotypes

PubMed Central

Díaz-Badillo, Alvaro; de Lourdes Muñoz, María; Perez-Ramirez, Gerardo; Altuzar, Victor; Burgueño, Juan; Mendoza-Alvarez, Julio G.; Martínez-Muñoz, Jorge P.; Cisneros, Alejandro; Navarrete-Espinosa, Joel; Sanchez-Sinencio, Feliciano

2014-01-01

Here; we have described and tested a microarray based-method for the screening of dengue virus (DENV) serotypes. This DNA microarray assay is specific and sensitive and can detect dual infections with two dengue virus serotypes and single-serotype infections. Other methodologies may underestimate samples containing more than one serotype. This technology can be used to discriminate between the four DENV serotypes. Single-stranded DNA targets were covalently attached to glass slides and hybridised with specific labelled probes. DENV isolates and dengue samples were used to evaluate microarray performance. Our results demonstrate that the probes hybridized specifically to DENV serotypes; with no detection of unspecific signals. This finding provides evidence that specific probes can effectively identify single and double infections in DENV samples. PMID:24776933

Detection of bacteraemias during non-surgicalroot canal treatment.

PubMed

Savarrio, L; Mackenzie, D; Riggio, M; Saunders, W P; Bagg, J

2005-04-01

Some dental procedures initiate a bacteraemia. In certain compromised patients, this bacteraemia may lead to distant site infections, most notably infective endocarditis. To investigate whether a detectable bacteraemia was produced during non-surgical root canal therapy. Thirty patients receiving non-surgical root canal therapy were studied. Three blood samples were taken per patient: pre-operatively, peri-operatively and post-operatively. In addition, a paper point sample was collected from the root canal. The blood samples were cultured by pour plate and blood bottle methods. The isolated organisms were identified by standard techniques. Blood samples were analysed for the presence of bacterial DNA by the polymerase chain reaction (PCR). In two cases where the same species of organism was identified in the root canal and the bloodstream, the isolates were typed by pulsed field gel electrophoresis (PFGE). By conventional culturing, a detectable bacteraemia was present in 9 (30%) of the 30 patients who had no positive pre-operative control blood sample. In 7 (23.3%) patients, the same species of organism was identified in both the bloodstream and in the paper point sample from the root canal system. Overall, PCR gave lower detection rates compared with conventional culture, with 10 of 90 (11%) of the blood samples displaying bacterial DNA. PFGE typing was undertaken for two pairs of culture isolates from blood and paper points; these were found to be genetically identical. Non-surgical root canal treatment may invoke a detectable bacteraemia.

Nanobacteria may be linked to calcification in placenta.

PubMed

Lu, He; Guo, Ya-nan; Liu, Sheng-nan; Zhang, De-chun

2012-05-01

Placental calcification is a common pathologic condition in obstetrics. To detect the bacteria infection mechanisms for calcification, an experiment was performed to isolate, culture, and identify the nanobacteria in placental calcification. Sixteen cases of placental calcification of pregnant women were collected for the purpose of the isolation of nanobacteria, cultivation, and identification of 16S rDNA sequence. Under transmission electron microscope, novel oval-shape nanobacteria-like particles (NLP) in extracellular matrix of calcified placenta tissues were found with 50-500 nm in diameter, and among hydroxyapatite crystals aggregation existed. After about 4 weeks of culturing and isolating NLP from these calcified tissues, all calcified placental tissue samples and one adjacent tissue of calcified placental tissue samples showed white granular depositions, which were firmly attached to the bottom of the culture tubes and visible to the naked eyes. In the control group they could not be seen. After PCR was amplified a 1407-bp fragment was obtained and submitted to GenBank after sequencing with accession number JN029830. The 16S rDNA sequence homology between the isolation strain and strain nanobacteria (X98418) was 92% in GenBank. For the first time isolated, cultured, and identified nanobacteria in placental calcification indicated that nanobacteria infection is related to placental calcification.

Genetic Characterization of Toxoplasma gondii Isolates from Pigs in Jilin Province, Northeastern China.

PubMed

Jiang, Hai-Hai; Wang, Shu-Chao; Huang, Si-Yang; Zhao, Lei; Wang, Ze-Dong; Zhu, Xing-Quan; Liu, Quan

2016-02-01

Toxoplasma gondii is prevalent in humans and animals worldwide. The present study aimed to determine the genetic diversity of T. gondii isolates from pigs in Jilin province, northeastern China. A total of 100 DNA samples were extracted from the hilar lymph nodes of slaughtered pigs, and 9 (9.0%, 95% confidence interval: 3.4-14.6%) were detected positive for T. gondii B1 gene by a nested polymerase chain reaction (PCR). The positive DNA samples were typed at 11 genetic markers, including 10 nuclear loci (SAG1, 5'-SAG2, and 3'-SAG2, alternative SAG2, SAG3, BTUB, GRA6, c22-8, c29-2, L358, and PK1) and an apicoplast locus (Apico) using the multilocus PCR-restriction fragment length polymorphism technology. Only three isolates were completely typed at all loci, showing that they all belonged to the clonal type I. One isolate was typed at five loci, including 5' +3'-SAG2, SAG2, SAG3, GRA6, and L358, revealing the possible clonal type I. This is the first report of the genetic characterization of T. gondii isolates in pigs in Jilin province, northeastern China, which has implications for better understanding the population structure of T. gondii infection in China.

Investigation of irradiated rats DNA in the presence of Cu(II) chelates of amino acids Schiff bases.

PubMed

Karapetyan, N H; Torosyan, A L; Malakyan, M; Bajinyan, S A; Haroutiunian, S G

2016-01-01

The new synthesized Cu(II) chelates of amino acids Schiff bases were studied as a potential radioprotectors. Male albino rats of Wistar strain were exposed to X-ray whole-body irradiation at 4.8 Gy. This dose caused 30% mortality of the animals (LD30). The survival of animals exposed to radiation after preliminary administration of 10 mg/kg Cu(II)(Nicotinyl-L-Tyrosinate)2 or Cu(II)(Nicotinyl-L-Tryptophanate)2 prior to irradiation was registered about 80 and 100% correspondingly. Using spectrophotometric melting and agarose gel electrophoresis methods, the differences between the DNA isolated from irradiated rats and rats pretreated with Cu(II) chelates were studied. The fragments of DNA with different breaks were revealed in DNA samples isolated from irradiated animals. While, the repair of the DNA structure was observed for animals pretreated with the Cu(II) chelates. The results suggested that pretreatment of the irradiated rats with Cu(II)(Nicotinyl-L-Tyrosinate)2 and Cu(II)(Nicotinyl-L-Tryptophanate)2 compounds improves the liver DNA characteristics.

Analysis of admixture and genetic structure of two Native American groups of Southern Argentinean Patagonia.

PubMed

Sala, Andrea; Corach, Daniel

2014-03-01

Argentinean Patagonia is inhabited by people that live principally in urban areas and by small isolated groups of individuals that belong to indigenous aboriginal groups; this territory exhibits the lowest population density of the country. Mapuche and Tehuelche (Mapudungun linguistic branch), are the only extant Native American groups that inhabit the Argentinean Patagonian provinces of Río Negro and Chubut. Fifteen autosomal STRs, 17 Y-STRs, mtDNA full length control region sequence and two sets of Y and mtDNA-coding region SNPs were analyzed in a set of 434 unrelated individuals. The sample set included two aboriginal groups, a group of individuals whose family name included Native American linguistic root and urban samples from Chubut, Río Negro and Buenos Aires provinces of Argentina. Specific Y Amerindian haplogroup Q1 was found in 87.5% in Mapuche and 58.82% in Tehuelche, while the Amerindian mtDNA haplogroups were present in all the aboriginal sample contributors investigated. Admixture analysis performed by means of autosomal and Y-STRs showed the highest degree of admixture in individuals carrying Mapuche surnames, followed by urban populations, and finally by isolated Native American populations as less degree of admixture. The study provided novel genetic information about the Mapuche and Tehuelche people and allowed us to establish a genetic correlation among individuals with Mapudungun surnames that demonstrates not only a linguistic but also a genetic relationship to the isolated aboriginal communities, representing a suitable proxy indicator for assessing genealogical background.

Diversity, molecular phylogeny and fingerprint profiles of airborne Aspergillus species using random amplified polymorphic DNA.

PubMed

Kermani, Firoozeh; Shams-Ghahfarokhi, Masoomeh; Gholami-Shabani, Mohammadhassan; Razzaghi-Abyaneh, Mehdi

2016-06-01

In the present study, diversity and phylogenetic relationship of Aspergillus species isolated from Tehran air was studied using random amplified polymorphic DNA (RAPD)-polymerase chain reaction (RAPD-PCR). Thirty-eight Aspergillus isolates belonging to 12 species i.e. A. niger (28.94 %, 11 isolates), A. flavus (18.42 %, 7 isolates), A. tubingensis (13.15 %, 5 isolates), A. japonicus (10.52 %, 4 isolates), A. ochraceus (10.52 %, 4 isolates), and 2.63 %, 1 isolate from each A. nidulans, A. amstelodami, A. oryzae, A. terreus, A. versicolor, A. flavipes and A. fumigatus were obtained by settle plate method which they were distributed in 18 out of 22 sampling sites examined. Fungal DNA was extracted from cultured mycelia of all Aspergillus isolates on Sabouraud Dextrose Agar and used for amplification of gene fragments in RAPD-PCR using 11 primers. RAPD-PCR data was analyzed using UPGMA software. Resulting dendrogram of combined selected primers including PM1, OPW-04, OPW-05, P160, P54, P10 and OPA14 indicated the distribution of 12 Aspergillus species in 8 major clusters. The similarity coefficient of all 38 Aspergillus isolates ranged from 0.02 to 0.40 indicating a wide degree of similarities and differences within and between species. Taken together, our results showed that various Aspergillus species including some important human pathogenic ones exist in the outdoor air of Tehran by different extents in distribution and diversity and suggested inter- and intra-species genetic diversity among Aspergillus species by RAPD-PCR as a rapid, sensitive and reproducible method.

Halopiger thermotolerans sp. nov., a thermo-tolerant haloarchaeon isolated from commercial salt.

PubMed

Minegishi, Hiroaki; Shimogaki, Ryuta; Enomoto, Shigeaki; Echigo, Akinobu; Kondo, Yusuke; Nagaoka, Shuhei; Shimane, Yasuhiro; Kamekura, Masahiro; Itoh, Takashi; Ohkuma, Moriya; Nunoura, Takuro; Takai, Ken; Usami, Ron

2016-12-01

Three thermo-tolerant halophilic archaeal strains, SR-441T, SR-412 and SR-188, were isolated from commercial salt samples. Cells were non-motile pleomorphic rod-shaped, and stained Gram-negative. Colonies were pink-pigmented. The three strains were able to grow with 1.7-4.6 M NaCl (optimum, 2.5 M), at pH 6.5-9.0 (optimum, pH 8.0) and at 35-60 °C (optimum, 45 °C). The orthologous 16S rRNA gene sequence similarities amongst the three strains were 98.8-99.3 %, and the level of DNA-DNA relatedness was 71-74 and 72-75 % (reciprocally). The closest relative was Halopiger aswanensis JCM 11628T with 98.6 %-99.1 % similarity in the orthologous 16S rRNA gene sequences, followed by two more Halopiger species, Halopiger xanaduensis JCM 14033T (98.5 %-99.1 %) and Halopiger salifodinae JCM 9578T (95.5 %-95.6 %). DNA-DNA relatednesses between the three strains and H. aswanensis JCM 11628T and H. xanaduensis JCM 14033T were 61 and 54 %, respectively. The polar lipids of the three novel strains were phosphatidylglycerol, phosphatidylglycerol phosphate methyl ester, and bis-sulfated diglycosyl archaeol-1. The most distinctive feature of the three strains was the ability to grow at 60 °C, while the maximum growth temperature of H. aswanensis is 55 °C. Based on phenotypic and phylogenetic analyses, the isolates are considered to represent a novel species of the genus Halopiger, for which the name Halopiger thermotolerans sp. nov. is proposed. The type strain is SR-441T (=JCM 19583T=KCTC 4248T) isolated from solar salt produced in Australia. SR-412 (=JCM 19582) and SR-188 (=JCM 19581) isolated from commercial salt samples are additional strains of the species.

Population structure of Cladophora-borne Escherichia coli in nearshore water of Lake Michigan.

PubMed

Byappanahalli, Muruleedhara N; Whitman, Richard L; Shively, Dawn A; Ferguson, John; Ishii, Satoshi; Sadowsky, Michael J

2007-08-01

We previously reported that the macrophytic green alga Cladophora harbors high densities (up to 10(6) colony-forming units/g dry weight) of the fecal indicator bacteria, Escherichia coli and enterococci, in shoreline waters of Lake Michigan. However, the population structure and genetic relatedness of Cladophora-borne indicator bacteria remain poorly understood. In this study, 835 E. coli isolates were collected from Cladophora tufts (mats) growing on rocks from a breakwater located within the Indiana Dunes National Lakeshore in northwest Indiana. The horizontal fluorophore enhanced rep-PCR (HFERP) DNA fingerprinting technique was used to determine the genetic relatedness of the isolates to each other and to those in a library of E. coli DNA fingerprints. While the E. coli isolates from Cladophora showed a high degree of genetic relatedness (92% similarity), in most cases, however, the isolates were genetically distinct. The Shannon diversity index for the population was very high (5.39). Both spatial and temporal influences contributed to the genetic diversity. There was a strong association of isolate genotypes by location (79% and 80% for lake- and ditch-side samplings, respectively), and isolates collected from 2002 were distinctly different from those obtained in 2003. Cladophora-borne E. coli isolates represented a unique group, which was distinct from other E. coli isolates in the DNA fingerprint library tested. Taken together, these results indicate that E. coli strains associated with Cladophora may be a recurring source of indicator bacteria to the nearshore beach.

First isolation and molecular characterization of Suid herpesvirus type 1 from a domestic dog in Argentina

PubMed Central

Serena, Maria Soledad; Metz, Germán Ernesto; Lozada, Maria Ines; Aspitia, Carolina Gabriela; Nicolino, Edgardo Héctor; Pidone, Claudio Luis; Fossaroli, Melisa; Balsalobre, Agustin; Quiroga, Maria Alejandra; Echeverria, Maria Gabriela

2018-01-01

Since Aujeszky`s disease (pseudorabies), which is caused by Suid herpesvirus type 1 (SuHV-1), was first notified in Argentina in 1978, many SuHV-1 strains have been isolated from swine. However, this disease can affect other vertebrates, such as dogs (secondary hosts), and lead to fatal neurological disease. The objective of the current work is to report the first isolation and molecular characterization of SuHV-1 from a dead domestic dog from Santa Fe Province (Argentina), which had had nervous signs compatible with pseudorabies. Samples of brain and trigeminal ganglia from this dog were obtained and fixed in formol for histopathology, and virology studies were conducted after cell disruption. Supernatants of both samples were inoculated onto RK13 cells and, after 72 h, DNA was extracted with phenol-chloroform. Purified DNA was cut with a restriction enzyme and subjected to agarose gel and an aliquot was used to amplify the gD and gC genes by PCR. The gC sequence was compared with other public sequences. The strain isolated from the dog was similar to other Argentinean swine strains. PMID:29721443

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

DNA fingerprinting and analysis of population structure in the chestnut blight fungus, Cryphonectria parasitica.

PubMed

Milgroom, M G; Lipari, S E; Powell, W A

1992-06-01

We analyzed DNA fingerprints in the chestnut blight fungus, Cryphonectria parasitica, for stability, inheritance, linkage and variability in a natural population. DNA fingerprints resulting from hybridization with a dispersed moderately repetitive DNA sequence of C. parasitica in plasmid pMS5.1 hybridized to 6-17 restriction fragments per individual isolate. In a laboratory cross and from progeny from a single perithecium collected from a field population, the presence/absence of 11 fragments in the laboratory cross and 12 fragments in the field progeny set segregated in 1:1 ratios. Two fragments in each progeny set cosegregated; no other linkage was detected among the segregating fragments. Mutations, identified by missing bands, were detected for only one fragment in which 4 of 43 progeny lacked a band present in both parents; no novel fragments were detected in any progeny. All other fragments appeared to be stably inherited. Hybridization patterns did not change during vegetative growth or sporulation. However, fingerprint patterns of single conidial isolates of strains EP155 and EP67 were found to be heterogenous due to mutations that occurred during culturing in the laboratory since these strains were first isolated in 1976-1977. In a population sample of 39 C. parasitica isolates, we found 33 different fingerprint patterns with pMS5.1. Most isolates differed from all other isolates by the presence or absence of several fragments. Six fingerprint patterns each occurred twice. Isolates with identical fingerprints occurred in cankers on the same chestnut stems three times; isolates within the other three pairs were isolated from cankers more than 5 m apart. The null hypothesis of random mating in this population could not be rejected if the six putative clones were removed from the analysis. Thus, a rough estimate of the clonal fraction of this population is 6 in 39 isolates (15.4%).

Absence of bacterial DNA in culture-negative urine from cats with and without lower urinary tract disease.

PubMed

Lund, Heidi Sjetne; Skogtun, Gaute; Sørum, Henning; Eggertsdóttir, Anna Vigdís

2015-10-01

A diagnosis of bacterial cystitis commonly relies on a positive microbiological culture demonstrating the presence of a significant number of colony-forming units/ml urine, as urine within the upper urinary tract, bladder and proximal urethra generally is considered sterile. Recent studies from human and veterinary medicine indicate the presence of non-culturable bacteria in culture-negative urine samples. The aim of the present study was to determine the occurrence of bacterial DNA in culture-negative urine samples from cats with signs of feline lower urinary tract disease (FLUTD) and healthy control cats by 16S ribosomal DNA PCR and subsequent sequencing. The study sample included 38 culture-negative urine samples from cats with FLUTD and 43 culture-negative samples from control cats. Eight culture-positive urine samples from cats with FLUTD were included as external positive controls in addition to negative reaction controls. Of possible methodological limitations, degradation of DNA due to storage, the use of non-sedimented urine for DNA isolation and lack of internal positive reaction controls should be mentioned. The positive controls were recognised, but occurrence of bacterial DNA in culture-negative urine from cats with or without signs of lower urinary tract disease was not demonstrated. However, considering the possible methodological limitations, the presence of bacterial DNA in the urine of culture-negative FLUTD cats cannot be excluded based on the present results alone. Therefore, a prospective study reducing the possibility of degradation of DNA due to storage, in combination with modifications enhancing the chance of detecting even lower levels of bacterial DNA in culture-negative samples, seems warranted. © ISFM and AAFP 2014.

Candida albicans and C. tropicalis Isolates from the Expired Breathes of Captive Dolphins and Their Environments in an Aquarium

PubMed Central

Takahashi, Hideo; Ueda, Keiichi; Itano, Eiko Nakagawa; Yanagisawa, Makio; Murata, Yoshiteru; Murata, Michiko; Yaguchi, Takashi; Murakami, Masaru; Kamei, Katsuhiko; Inomata, Tomo; Miyahara, Hirokazu; Sano, Ayako; Uchida, Senzo

2010-01-01

Genotypes of Candida spp. isolated from exhalation of 20 dolphins, 11 water samples from captive pools, and 24 oral cavities of staff members in an aquarium using a combination of multiple drug resistance 1 gene (MDR1) and the internal transcribed spacer (ITS) 1 5.8s-ITS 2 regions of ribosomal RNA gene (ITS rDNA) sequences were studied. The holding ratios of the dolphins, captive pools, and staff members were 70, 90, and 29%, respectively. Isolated pathogenic yeast species common to the dolphins and environments were Candida albicans and C. tropicalis. Identical genotypes in both Candida spp. based on the combination of MDR1 and ITSrDNA were found in some dolphins, between a dolphin and a staff, among dolphins and environments, and among environments. The results indicated the diffusion and exchange of pathogenic yeasts at the aquarium among dolphins and environments. The isolates at the aquarium showed higher rates of resistance to azole antifungals compared to reference isolates. PMID:21234394

Culture-dependent and culture-independent diversity of Actinobacteria associated with the marine sponge Hymeniacidon perleve from the South China Sea.

PubMed

Sun, Wei; Dai, Shikun; Jiang, Shumei; Wang, Guanghua; Liu, Guohui; Wu, Houbo; Li, Xiang

2010-06-01

In this report, the diversity of Actinobacteria associated with the marine sponge Hymeniacidon perleve collected from a remote island of the South China Sea was investigated employing classical cultivation and characterization, 16S rDNA library construction, 16S rDNA-restriction fragment length polymorphism (rDNA-RFLP) and phylogenetic analysis. A total of 184 strains were isolated using seven different media and 24 isolates were selected according to their morphological characteristics for phylogenetic analysis on the basis of their 16S rRNA gene sequences. Results showed that the 24 isolates were assigned to six genera including Salinispora, Gordonia, Mycobacterium, Nocardia, Rhodococcus and Streptomyces. This is the first report that Salinispora is present in a marine sponge from the South China Sea. Subsequently, 26 rDNA clones were selected from 191 clones in an Actinobacteria-specific 16S rDNA library of the H. perleve sample, using the RFLP technique for sequencing and phylogenetic analysis. In total, 26 phylotypes were clustered in eight known genera of Actinobacteria including Mycobacterium, Amycolatopsis, Arthrobacter, Brevibacterium, Microlunatus, Nocardioides, Pseudonocardia and Streptomyces. This study contributes to our understanding of actinobacterial diversity in the marine sponge H. perleve from the South China Sea.

Successful isolation of Leishmania infantum from Rhipicephalus sanguineus sensu lato (Acari: Ixodidae) collected from naturally infected dogs.

PubMed

Medeiros-Silva, Viviane; Gurgel-Gonçalves, Rodrigo; Nitz, Nadjar; Morales, Lucia Emilia D' Anduraim; Cruz, Laurício Monteiro; Sobral, Isabele Gonçalves; Boité, Mariana Côrtes; Ferreira, Gabriel Eduardo Melim; Cupolillo, Elisa; Romero, Gustavo Adolfo Sierra

2015-10-09

The main transmission route of Leishmania infantum is through the bites of sand flies. However, alternative mechanisms are being investigated, such as through the bites of ticks, which could have epidemiological relevance. The objective of this work was to verify the presence of Leishmania spp. in Rhipicephalus sanguineus sensu lato collected from naturally infected dogs in the Federal District of Brazil. Ticks were dissected to remove their intestines and salivary glands for DNA extraction and the subsequent amplification of the conserved region of 120 bp of kDNA and 234 bp of the hsp70 gene of Leishmania spp. The amplified kDNA products were digested with endonucleases HaeIII and BstUI and were submitted to DNA sequencing. Isolated Leishmania parasites from these ticks were analyzed by multilocus enzyme electrophoresis, and the DNA obtained from this culture was subjected to microsatellite analyses. Overall, 130 specimens of R. sanguineus were collected from 27 dogs. Leishmania spp. were successfully isolated in culture from five pools of salivary glands and the intestines of ticks collected from four dogs. The amplified kDNA products from the dog blood samples and from the tick cultures, when digested by HaeIII and BstUI, revealed the presence of L. braziliensis and L. infantum. One strain was cultivated and characterized as L. infantum by enzyme electrophoresis. The amplified kDNA products from the blood of one dog showed a sequence homology with L. braziliensis; however, the amplified kDNA from the ticks collected from this dog showed a sequence homology to L. infantum. The results confirm that the specimens of R. sanguineus that feed on dogs naturally infected by L. infantum contain the parasite DNA in their intestines and salivary glands, and viable L. infantum can be successfully isolated from these ectoparasites.

Characterization of free nitrogen fixing bacteria of the genus Azotobacter in organic vegetable-grown Colombian soils

PubMed Central

Jiménez, Diego Javier; Montaña, José Salvador; Martínez, María Mercedes

2011-01-01

With the purpose of isolating and characterizing free nitrogen fixing bacteria (FNFB) of the genus Azotobacter, soil samples were collected randomly from different vegetable organic cultures with neutral pH in different zones of Boyacá-Colombia. Isolations were done in selective free nitrogen Ashby-Sucrose agar obtaining a recovery of 40%. Twenty four isolates were evaluated for colony and cellular morphology, pigment production and metabolic activities. Molecular characterization was carried out using amplified ribosomal DNA restriction analysis (ARDRA). After digestion of 16S rDNA Y1-Y3 PCR products (1487pb) with AluI, HpaII and RsaI endonucleases, a polymorphism of 16% was obtained. Cluster analysis showed three main groups based on DNA fingerprints. Comparison between ribotypes generated by isolates and in silico restriction of 16S rDNA partial sequences with same restriction enzymes was done with Gen Workbench v.2.2.4 software. Nevertheless, Y1-Y2 PCR products were analysed using BLASTn. Isolate C5T from tomato (Lycopersicon esculentum) grown soils presented the same in silico restriction patterns with A. chroococcum (AY353708) and 99% of similarity with the same sequence. Isolate C5CO from cauliflower (Brassica oleracea var. botrytis) grown soils showed black pigmentation in Ashby-Benzoate agar and high similarity (91%) with A. nigricans (AB175651) sequence. In this work we demonstrated the utility of molecular techniques and bioinformatics tools as a support to conventional techniques in characterization of the genus Azotobacter from vegetable-grown soils. PMID:24031700

Cryptic Population Structuring and the Role of the Isthmus of Tehuantepec as a Gene Flow Barrier in the Critically Endangered Central American River Turtle

PubMed Central

González-Porter, Gracia P.; Maldonado, Jesús E.; Flores-Villela, Oscar; Vogt, Richard C.; Janke, Axel; Fleischer, Robert C.; Hailer, Frank

2013-01-01

The critically endangered Central American River Turtle (Dermatemys mawii) is the only remaining member of the Dermatemydidae family, yet little is known about its population structuring. In a previous study of mitochondrial (mt) DNA in the species, three main lineages were described. One lineage (Central) was dominant across most of the range, while two other lineages were restricted to Papaloapan (PAP; isolated by the Isthmus of Tehuantepec and the Sierra de Santa Marta) or the south-eastern part of the range (1D). Here we provide data from seven polymorphic microsatellite loci and the R35 intron to re-evaluate these findings using DNA from the nuclear genome. Based on a slightly expanded data set of a total of 253 samples from the same localities, we find that mtDNA and nuclear DNA markers yield a highly congruent picture of the evolutionary history and population structuring of D. mawii. While resolution provided by the R35 intron (sequenced for a subset of the samples) was very limited, the microsatellite data revealed pronounced population structuring. Within the Grijalva-Usumacinta drainage basin, however, many populations separated by more than 300 kilometers showed signals of high gene flow. Across the entire range, neither mitochondrial nor nuclear DNA show a significant isolation-by-distance pattern, but both genomes highlight that the D. mawii population in the Papaloapan basin is genetically distinctive. Further, both marker systems detect unique genomic signals in four individuals with mtDNA clade 1D sampled on the southeast edge of the Grijalva-Usumacinta basin. These individuals may represent a separate cryptic taxon that is likely impacted by recent admixture. PMID:24086253

Environmental DNA sequencing primers for eutardigrades and bdelloid rotifers

PubMed Central

2009-01-01

Background The time it takes to isolate individuals from environmental samples and then extract DNA from each individual is one of the problems with generating molecular data from meiofauna such as eutardigrades and bdelloid rotifers. The lack of consistent morphological information and the extreme abundance of these classes makes morphological identification of rare, or even common cryptic taxa a large and unwieldy task. This limits the ability to perform large-scale surveys of the diversity of these organisms. Here we demonstrate a culture-independent molecular survey approach that enables the generation of large amounts of eutardigrade and bdelloid rotifer sequence data directly from soil. Our PCR primers, specific to the 18s small-subunit rRNA gene, were developed for both eutardigrades and bdelloid rotifers. Results The developed primers successfully amplified DNA of their target organism from various soil DNA extracts. This was confirmed by both the BLAST similarity searches and phylogenetic analyses. Tardigrades showed much better phylogenetic resolution than bdelloids. Both groups of organisms exhibited varying levels of endemism. Conclusion The development of clade-specific primers for characterizing eutardigrades and bdelloid rotifers from environmental samples should greatly increase our ability to characterize the composition of these taxa in environmental samples. Environmental sequencing as shown here differs from other molecular survey methods in that there is no need to pre-isolate the organisms of interest from soil in order to amplify their DNA. The DNA sequences obtained from methods that do not require culturing can be identified post-hoc and placed phylogenetically as additional closely related sequences are obtained from morphologically identified conspecifics. Our non-cultured environmental sequence based approach will be able to provide a rapid and large-scale screening of the presence, absence and diversity of Bdelloidea and Eutardigrada in a variety of soils. PMID:20003362

Use of molecular markers to compare Fusarium verticillioides pathogenic strains isolated from plants and humans.

PubMed

Chang, S C; Macêdo, D P C; Souza-Motta, C M; Oliveira, N T

2013-08-12

Fusarium verticillioides is a pathogen of agriculturally important crops, especially maize. It is considered one of the most important pathogens responsible for fumonisin contamination of food products, which causes severe, chronic, and acute intoxication in humans and animals. Moreover, it is recognized as a cause of localized infections in immunocompetent patients and disseminated infections among severely immunosuppressed patients. Several molecular tools have been used to analyze the intraspecific variability of fungi. The objective of this study was to use molecular markers to compare pathogenic isolates of F. verticillioides and isolates of the same species obtained from clinical samples of patients with Fusarium mycoses. The molecular markers that we used were inter-simple sequence repeat markers (primers GTG5 and GACA4), intron splice site primer (primer EI1), random amplified polymorphic DNA marker (primer OPW-6), and restriction fragment length polymorphism-internal transcribed spacer (ITS) from rDNA. From the data obtained, clusters were generated based on the UPGMA clustering method. The amplification products obtained using primers ITS4 and ITS5 and loci ITS1-5.8-ITS2 of the rDNA yielded fragments of approximately 600 bp for all the isolates. Digestion of the ITS region fragment using restriction enzymes such as EcoRI, DraI, BshI, AluI, HaeIII, HinfI, MspI, and PstI did not permit differentiation among pathogenic and clinical isolates. The inter-simple sequence repeat, intron splice site primer, and random amplified polymorphic DNA markers presented high genetic homogeneity among clinical isolates in contrast to the high variability found among the phytopathogenic isolates of F. verticillioides.

Complete genome sequence of Pseudomonas antarctica PAMC 27494, a bacteriocin-producing psychrophile isolated from Antarctica.

PubMed

Lee, Jaejin; Cho, Yong-Joon; Yang, Jae Young; Jung, You-Jung; Hong, Soon Gyu; Kim, Ok-Sun

2017-10-10

Antimicrobial-producing, cold-adapted microorganisms have great potential for biotechnological applications in food, pharmaceutical, and cosmetic industries. Pseudomonas antarctica PAMC 27494, a psychrophile exhibiting antimicrobial activity, was isolated from an Antarctic freshwater sample. Here we report the complete genome of P. antarctica PAMC 27494. The strain contains a gene cluster encoding microcin B which inhibits DNA regulations by targeting the DNA gyrase. PAMC 27494 may produce R-type pyocins and also contains a complete set of proteins for the biosynthesis of adenosylcobalamin and possibly induces plant growth by supplying pyrroloquinoline quionone molecules. Copyright © 2017 Elsevier B.V. All rights reserved.

Apparent polyploidization after gamma irradiation: pitfalls in the use of quantitative polymerase chain reaction (qPCR) for the estimation of mitochondrial and nuclear DNA gene copy numbers.

PubMed

Kam, Winnie W Y; Lake, Vanessa; Banos, Connie; Davies, Justin; Banati, Richard

2013-05-30

Quantitative polymerase chain reaction (qPCR) has been widely used to quantify changes in gene copy numbers after radiation exposure. Here, we show that gamma irradiation ranging from 10 to 100 Gy of cells and cell-free DNA samples significantly affects the measured qPCR yield, due to radiation-induced fragmentation of the DNA template and, therefore, introduces errors into the estimation of gene copy numbers. The radiation-induced DNA fragmentation and, thus, measured qPCR yield varies with temperature not only in living cells, but also in isolated DNA irradiated under cell-free conditions. In summary, the variability in measured qPCR yield from irradiated samples introduces a significant error into the estimation of both mitochondrial and nuclear gene copy numbers and may give spurious evidence for polyploidization.

Enumeration and targeted analysis of KRAS, BRAF and PIK3CA mutations in CTCs captured by a label-free platform: Comparison to ctDNA and tissue in metastatic colorectal cancer.

PubMed

Kidess-Sigal, Evelyn; Liu, Haiyan E; Triboulet, Melanie M; Che, James; Ramani, Vishnu C; Visser, Brendan C; Poultsides, George A; Longacre, Teri A; Marziali, Andre; Vysotskaia, Valentina; Wiggin, Matthew; Heirich, Kyra; Hanft, Violet; Keilholz, Ulrich; Tinhofer, Ingeborg; Norton, Jeffrey A; Lee, Mark; Sollier-Christen, Elodie; Jeffrey, Stefanie S

2016-12-20

Treatment of advanced colorectal cancer (CRC) requires multimodal therapeutic approaches and need for monitoring tumor plasticity. Liquid biopsy biomarkers, including CTCs and ctDNA, hold promise for evaluating treatment response in real-time and guiding therapeutic modifications. From 15 patients with advanced CRC undergoing liver metastasectomy with curative intent, we collected 41 blood samples at different time points before and after surgery for CTC isolation and quantification using label-free Vortex technology. For mutational profiling, KRAS, BRAF, and PIK3CA hotspot mutations were analyzed in CTCs and ctDNA from 23 samples, nine matched liver metastases and three primary tumor samples. Mutational patterns were compared. 80% of patient blood samples were positive for CTCs, using a healthy baseline value as threshold (0.4 CTCs/mL), and 81.4% of captured cells were EpCAM+ CTCs. At least one mutation was detected in 78% of our blood samples. Among 23 matched CTC and ctDNA samples, we found a concordance of 78.2% for KRAS, 73.9% for BRAF and 91.3% for PIK3CA mutations. In several cases, CTCs exhibited a mutation that was not detected in ctDNA, and vice versa. Complementary assessment of both CTCs and ctDNA appears advantageous to assess dynamic tumor profiles.

Isolation of methanotrophic bacteria from a london landfill: a preliminary study using molecular and stable isotopic techniques.

NASA Astrophysics Data System (ADS)

Sriskantharajah, S.; Cutting, S.; Lowry, D.; Grassineau, N.; Nisbet, E.

2003-04-01

Methane emissions from landfills are an important source of European greenhouse emissions, and could be reduced by a biological management program that used methanotrophs in landfill cover soils. Topsoil samples taken from a London Landfill were incubated on Nitrate Mineral Salts medium in the presence of methane. The resulting colonies were probed for methanotrophic DNA using PCR amplification. DNA from methanotroph positive colonies was cloned and sequenced for identification. Isolates belonging to the genera Methylocaldum, Methylomonas and Methylosinus were detected. Phylogenetic analysis suggests the presence of possible new species. In addition dried samples of the isolates were analysed for their stable carbon isotope (δ 13C) composition. The results were δ 13C values of -27 per mil and -25 per mil for Methylomonas isolates, -35 per mil and -44 per mil for Methylosinus isolates, -58 per mil and -60 per mil for some of the Methylocaldum isolates and -35 per mil and -45 per mil for the others. This isotopic variation is reflected in a phylogenetic tree of the isolates. The differences shown in the δ 13C analysis could be due to differing biochemical properties, and if the technique is further developed, it may be used for rapid identification of bacteria useful in landfill management for reducing methane emissions. The results suggest that useful reductions in methane emissions could be achieved by a careful design of landfill cover to culture methanotrophs.

Genetic analysis of Fasciola isolates from cattle in Korea based on second internal transcribed spacer (ITS-2) sequence of nuclear ribosomal DNA.

PubMed

Choe, Se-Eun; Nguyen, Thuy Thi-Dieu; Kang, Tae-Gyu; Kweon, Chang-Hee; Kang, Seung-Won

2011-09-01

Nuclear ribosomal DNA sequence of the second internal transcribed spacer (ITS-2) has been used efficiently to identify the liver fluke species collected from different hosts and various geographic regions. ITS-2 sequences of 19 Fasciola samples collected from Korean native cattle were determined and compared. Sequence comparison including ITS-2 sequences of isolates from this study and reference sequences from Fasciola hepatica and Fasciola gigantica and intermediate Fasciola in Genbank revealed seven identical variable sites of investigated isolates. Among 19 samples, 12 individuals had ITS-2 sequences completely identical to that of pure F. hepatica, five possessed the sequences identical to F. gigantica type, whereas two shared the sequence of both F. hepatica and F. gigantica. No variations in length and nucleotide composition of ITS-2 sequence were observed within isolates that belonged to F. hepatica or F. gigantica. At the position of 218, five Fasciola containing a single-base substitution (C>T) formed a distinct branch inside the F. gigantica-type group which was similar to those of Asian-origin isolates. The phylogenetic tree of the Fasciola spp. based on complete ITS-2 sequences from this study and other representative isolates in different locations clearly showed that pure F. hepatica, F. gigantica type and intermediate Fasciola were observed. The result also provided additional genetic evidence for the existence of three forms of Fasciola isolated from native cattle in Korea by genetic approach using ITS-2 sequence.

Detection of genetically modified organisms in foods by DNA amplification techniques.

PubMed

García-Cañas, Virginia; Cifuentes, Alejandro; González, Ramón

2004-01-01

In this article, the different DNA amplification techniques that are being used for detecting genetically modified organisms (GMOs) in foods are examined. This study intends to provide an updated overview (including works published till June 2002) on the principal applications of such techniques together with their main advantages and drawbacks in GMO detection in foods. Some relevant facts on sampling, DNA isolation, and DNA amplification methods are discussed. Moreover; these analytical protocols are discuissed from a quantitative point of view, including the newest investigations on multiplex detection of GMOs in foods and validation of methods.

Tuberculosis patients co-infected with Mycobacterium bovis and Mycobacterium tuberculosis in an urban area of Brazil.

PubMed

Silva, Marcio Roberto; Rocha, Adalgiza da Silva; da Costa, Ronaldo Rodrigues; de Alencar, Andrea Padilha; de Oliveira, Vania Maria; Fonseca Júnior, Antônio Augusto; Sales, Mariana Lázaro; Issa, Marina de Azevedo; Filho, Paulo Martins Soares; Pereira, Omara Tereza Vianello; dos Santos, Eduardo Calazans; Mendes, Rejane Silva; Ferreira, Angela Maria de Jesus; Mota, Pedro Moacyr Pinto Coelho; Suffys, Philip Noel; Guimarães, Mark Drew Crosland

2013-05-01

In this cross-sectional study, mycobacteria specimens from 189 tuberculosis (TB) patients living in an urban area in Brazil were characterised from 2008-2010 using phenotypic and molecular speciation methods (pncA gene and oxyR pseudogene analysis). Of these samples, 174 isolates simultaneously grew on Löwenstein-Jensen (LJ) and Stonebrink (SB)-containing media and presented phenotypic and molecular profiles of Mycobacterium tuberculosis, whereas 12 had molecular profiles of M. tuberculosis based on the DNA analysis of formalin-fixed paraffin wax-embedded tissue samples (paraffin blocks). One patient produced two sputum isolates, the first of which simultaneously grew on LJ and SB media and presented phenotypic and molecular profiles of M. tuberculosis, and the second of which only grew on SB media and presented phenotypic profiles of Mycobacterium bovis. One patient provided a bronchial lavage isolate, which simultaneously grew on LJ and SB media and presented phenotypic and molecular profiles of M. tuberculosis, but had molecular profiles of M. bovis from paraffin block DNA analysis, and one sample had molecular profiles of M. tuberculosis and M. bovis identified from two distinct paraffin blocks. Moreover, we found a low prevalence (1.6%) of M. bovis among these isolates, which suggests that local health service procedures likely underestimate its real frequency and that it deserves more attention from public health officials.

Epidemiology of Staphylococcus aureus during space flight

NASA Technical Reports Server (NTRS)

Pierson, D. L.; Chidambaram, M.; Heath, J. D.; Mallary, L.; Mishra, S. K.; Sharma, B.; Weinstock, G. M.

1996-01-01

Staphylococcus aureus was isolated over 2 years from Space Shuttle mission crewmembers to determine dissemination and retention of bacteria. Samples before and after each mission were from nasal, throat, urine, and feces and from air and surface sampling of the Space Shuttle. DNA fingerprinting of samples by digestion of DNA with SmaI restriction endonuclease followed by pulsed-field gel electrophoresis showed S. aureus from each crewmember had a unique fingerprint and usually only one strain was carried by an individual. There was only one instance of transfer between crewmembers. Strains from interior surfaces after flight matched those of crewmembers, suggesting microbial fingerprinting may have forensic application.

In vivo conformation of mitochondrial DNA revealed by pulsed-field gel electrophoresis in the true slime mold, Physarum polycephalum.

PubMed

Sakurai, R; Sasaki, N; Takano, H; Abe, T; Kawano, S

2000-04-28

Pulsed-field gel electrophoresis (PFGE) was used to examine the in vivo and in vitro conformations of Physarum polycephalum mitochondrial DNA (mtDNA). We used plugs containing isolated mitochondria, isolated mitochondrial nucleoids (mt-nuclei), and isolated mtDNA, in addition to whole cells. The mtDNA contained in the myxamoebae, plasmodia, isolated mitochondria, and isolated mt-nuclei was circular, but most of the isolated mtDNA had been site-specifically fragmented and linearized during DNA preparation and storage under low ionic strength conditions. Restriction mapping of Physarum mtDNA by the direct digestion of the isolated mt-nuclei from two different strains, DP89 x AI16 and KM88 x AI16, resulted in the circular form. A linear mitochondrial plasmid, mF, is known to promote mitochondrial fusion and integration of itself into the mtDNA in Physarum. Linearization of mtDNA by the integration of the mF plasmid was demonstrated when we used PFGE to analyze isolated mitochondria from the plasmodial strain DP89 x NG7 carrying the mF plasmid (mF+). The PFGE system can be used not only to determine whether the form of mtDNA is linear or circular but also to analyze the dynamic conformational changes of mtDNA.

Identification of pork contamination in meatball using genetic marker mitochondrial DNA cytochrome b gene by duplex-PCR

NASA Astrophysics Data System (ADS)

Novianty, E.; Kartikasari, L. R.; Lee, J. H.; Cahyadi, M.

2017-04-01

Meat based food products have a big opportunity to mix and adulterated with other meats. Muslim communities are prohibited to consume pork-containing product or other pig derivatives in food. Therefore, the high sensitivity, fast, cheap and accurate approach is needed to detect pig contamination in raw meat and meat-processed product such as meatball. The aim of this study was to identify pork contamination in meatball using genetic marker of mitochondrial DNA cytochrome b gene by duplex-PCR. Samples were prepared and designed by following the proportions 0, 1, 5, 10, 25% of pork in meatballs, respectively. The DNA genome was extracted from meatballs and polymerase chain reaction (PCR) was performed using species specific primer to isolate mt-DNA cytochrome b gene. The results showed that the DNA genome was successfully isolated from pork, beef, and contaminated meatballs. Furthermore, 2% agarose gels was able to visualize of duplex-PCR to identify pork contamination in meatballs up to very small proportion (1%). It can be concluded that duplex-PCR of mt-DNA cytochrome b gene was very sensitive to identify pork contamination in meatball with the presence of specific 398 bp DNA band.

New evidence that a large proportion of human blood plasma cell-free DNA is localized in exosomes

PubMed Central

Jiang, Chao; Krzyzanowski, Gary D.; Ryan, Wayne L.

2017-01-01

Cell-free DNA (cfDNA) in blood is used as a source of genetic material for noninvasive prenatal and cancer diagnostic assays in clinical practice. Recently we have started a project for new biomarker discovery with a view to developing new noninvasive diagnostic assays. While reviewing literature, it was found that exosomes may be a rich source of biomarkers, because exosomes play an important role in human health and disease. While characterizing exosomes found in human blood plasma, we observed the presence of cfDNA in plasma exosomes. Plasma was obtained from blood drawn into K3EDTA tubes. Exosomes were isolated from cell-free plasma using a commercially available kit. Sizing and enumeration of exosomes were done using electron microscopy and NanoSight particle counter. NanoSight and confocal microscopy was used to demonstrate the association between dsDNA and exosomes. DNA extracted from plasma and exosomes was measured by a fluorometric method and a droplet digital PCR (ddPCR) method. Size of extracellular vesicles isolated from plasma was heterogeneous and showed a mean value of 92.6 nm and a mode 39.7 nm. A large proportion of extracellular vesicles isolated from plasma were identified as exosomes using a fluorescence probe specific for exosomes and three protein markers, Hsp70, CD9 and CD63, that are commonly used to identify exosome fraction. Fluorescence dye that stain dsDNA showed the association between exosomes and dsDNA. Plasma cfDNA concentration analysis showed more than 93% of amplifiable cfDNA in plasma is located in plasma exosomes. Storage of a blood sample showed significant increases in exosome count and exosome DNA concentration. This study provide evidence that a large proportion of plasma cfDNA is localized in exosomes. Exosome release from cells is a metabolic energy dependent process, thus suggesting active release of cfDNA from cells as a source of cfDNA in plasma. PMID:28850588

New evidence that a large proportion of human blood plasma cell-free DNA is localized in exosomes.

PubMed

Fernando, M Rohan; Jiang, Chao; Krzyzanowski, Gary D; Ryan, Wayne L

2017-01-01

Cell-free DNA (cfDNA) in blood is used as a source of genetic material for noninvasive prenatal and cancer diagnostic assays in clinical practice. Recently we have started a project for new biomarker discovery with a view to developing new noninvasive diagnostic assays. While reviewing literature, it was found that exosomes may be a rich source of biomarkers, because exosomes play an important role in human health and disease. While characterizing exosomes found in human blood plasma, we observed the presence of cfDNA in plasma exosomes. Plasma was obtained from blood drawn into K3EDTA tubes. Exosomes were isolated from cell-free plasma using a commercially available kit. Sizing and enumeration of exosomes were done using electron microscopy and NanoSight particle counter. NanoSight and confocal microscopy was used to demonstrate the association between dsDNA and exosomes. DNA extracted from plasma and exosomes was measured by a fluorometric method and a droplet digital PCR (ddPCR) method. Size of extracellular vesicles isolated from plasma was heterogeneous and showed a mean value of 92.6 nm and a mode 39.7 nm. A large proportion of extracellular vesicles isolated from plasma were identified as exosomes using a fluorescence probe specific for exosomes and three protein markers, Hsp70, CD9 and CD63, that are commonly used to identify exosome fraction. Fluorescence dye that stain dsDNA showed the association between exosomes and dsDNA. Plasma cfDNA concentration analysis showed more than 93% of amplifiable cfDNA in plasma is located in plasma exosomes. Storage of a blood sample showed significant increases in exosome count and exosome DNA concentration. This study provide evidence that a large proportion of plasma cfDNA is localized in exosomes. Exosome release from cells is a metabolic energy dependent process, thus suggesting active release of cfDNA from cells as a source of cfDNA in plasma.

DNA damage under simulated extraterrestrial conditions in bacteriophage T7

NASA Astrophysics Data System (ADS)

Fekete, A.; Módos, K.; Hegedüs, M.; Kovács, G.; Rontó, Gy.; Péter, Á.; Lammer, H.; Panitz, C.

The experiment "Phage and Uracil response" will be accommodated in the EXPOSE facility of the International Space Station. Its objective is to examine and quantify the effect of specific space conditions on nucleic acid models, especially on bacteriophage T7 and isolated T7 DNA thin films. In order to define the environmental and technical requirements of the EXPOSE, the samples were subjected to the experiment verification test (EVT). During EVT, the samples were exposed to vacuum (10 -4-10 -6 Pa) and polychromatic UV-radiation (200-400 nm) in air, in inert atmosphere, as well as in simulated space vacuum. The effect of extreme temperature in vacuum and the influence of temperature fluctuations around 0 °C were also studied. The total intraphage/isolated DNA damage was determined by quantitative PCR using 555 and 3826 bp fragments of T7 DNA. The type of the damage was resolved using a combination of enzymatic probes and neutral and alkaline agarose gel electrophoresis; the structural/chemical effects were analyzed by spectroscopic and microscopical methods. We obtained substantial evidence that DNA lesions accumulate throughout exposure, but the amount of damage depends on the thickness of the layers. According to our preliminary results, the damages by exposure to conditions of dehydration and UV-irradiation are larger than the sum of vacuum alone, or radiation alone case, suggesting a synergistic action of space vacuum and UV radiation with DNA being the critical target.

The environmental and intrinsic yeast diversity of Cuban cocoa bean heap fermentations.

PubMed

Fernández Maura, Yurelkys; Balzarini, Tom; Clapé Borges, Pablo; Evrard, Pierre; De Vuyst, Luc; Daniel, H-M

2016-09-16

The environmental yeast diversity of spontaneous cocoa bean fermentations in east Cuba was investigated. Seven fermentations, 25 equipment- and handling-related samples, and 115 environmental samples, such as flowers, leaf and cocoa pod surfaces, as well as drosophilid insects, were analysed. The basic fermentation parameters temperature and pH were recorded during five fermentations for at least six days. A total of 435 yeast isolates were identified by a combination of PCR-fingerprinting of genomic DNA with the M13 primer and sequence analysis of DNA from representative isolates, using the internal transcribed spacer region, the D1/D2 region of the large subunit rRNA gene, and an actin gene-encoding fragment, as required. Among 65 yeast species detected, Pichia manshurica and Hanseniaspora opuntiae were the most frequently isolated species, obtained from five and four fermentations, followed in frequency by Pichia kudriavzevii from two fermentations. Saccharomyces cerevisiae was isolated only occasionally. Cocoa fermentation yeast species were also present on processing equipment. The repeated isolation of a preliminarily as Yamadazyma sp. classified species, a group of strains similar to Saccharomycopsis crataegensis from fermentations and equipment, and the isolation of fifteen other potentially novel yeast species in low numbers provides material for further studies. Environmental samples showed higher yeast diversity compared to the fermentations, included the most frequent fermentation species, whereas the most frequently isolated environmental species were Candida carpophila, Candida conglobata, and Candida quercitrusa. Potential selective advantages of the most frequently isolated species were only partly explained by the physiological traits tested. For instance, tolerance to higher ethanol concentrations was more frequent in strains of Pichia spp. and S. cerevisiae compared to Hanseniaspora spp.; the ability to also assimilate ethanol might have conferred a selective advantage to Pichia spp. In contrast, high glucose tolerance was common among strains of Hanseniaspora spp., Torulaspora delbrueckii, and Candida tropicalis, among which only Hanseniaspora spp. were frequently isolated. Copyright © 2016 Elsevier B.V. All rights reserved.

DNA transfer-a never ending story. A study on scenarios involving a second person as carrier.

PubMed

Helmus, Janine; Bajanowski, Thomas; Poetsch, Micaela

2016-01-01

The transfer of DNA directly from one item to another has been shown in many studies with elaborate discussions on the nature of the DNA donor as well as material and surface of the items or surrounding features. Every DNA transfer scenario one can imagine seems to be possible. This evokes more and more intricate scenarios proposed by lawyers or attorneys searching for an explanation of the DNA of a certain person on a distinct item with impact on a crime. At court, the forensic genetic scientist has to comment on the probability of these scenarios thus calling for extensive studies on such settings. Here, the possibility of an involvement of a second person as a carrier of the donor's DNA in a variety of different scenarios including three pairs of people and two kinds of items (textiles and plastic bags) was investigated. All transfer settings were executed with and without gloves on the carrier's hands. DNA left on the items was isolated and analyzed using the Powerplex® ESX17 kit. In 21 out of 180 samples, all alleles of the donor DNA could be obtained on the second item (12%), on eight samples, the donor's DNA was dominant compared to all other alleles (38% of samples with complete donor profile). Additionally, 51 samples displayed at least more than half of the donor's alleles (28%). The complete DNA profile of the carrier was found in 47 out of 180 samples (42 partial profiles). In summary, it could be shown that a transfer of donor DNA from epithelial cells through a carrier to a second item is possible, even if the carrier does not wear gloves.

Acanthamoeba spp. in Contact Lenses from Healthy Individuals from Madrid, Spain.

PubMed

Gomes, Thiago Dos Santos; Magnet, Angela; Izquierdo, Fernando; Vaccaro, Lucianna; Redondo, Fernando; Bueno, Sara; Sánchez, Maria Luisa; Angulo, Santiago; Fenoy, Soledad; Hurtado, Carolina; Del Aguila, Carmen

2016-01-01

Acanthamoeba keratitis (AK) is a painful and potentially blinding corneal infection caused by Acanthamoeba spp. In Madrid, environmental studies have demonstrated a high presence of these free-living amoebae in tap water. Since most of AK cases occur in contact lenses (CL) wearers with inadequate hygiene habits, the presence of Acanthamoeba in discarded CL has been studied and compared with other common etiological agents of keratitis, such as Pseudomonas aeruginosa and Staphylococcus aureus. One hundred and seventy-seven healthy individuals from Madrid contributed their discarded CL and answered a questionnaire on hygiene habits. DNA was extracted from the CL solution and analyzed by real-time PCR for Acanthamoeba, Pseudomonas aeruginosa and Staphylococcus aureus. These CL and their solutions were also cultured on non-nutrient agar to isolate Acanthamoeba. Among the 177 samples, Acanthamoeba DNA was detected in 87 (49.2%), P. aeruginosa DNA in 14 (7.9%) and S. aureus DNA in 19 (10.7%). Cultivable amoebae, however, were observed in only one sample (0.6%). This isolate was genotyped as T4. The habits reported by this CL owner included some recognized risk factors for AK, but in this study only the practice of "not cleaning the CL case" presented some statistical significant association with Acanthamoeba DNA presence. Detection of the investigated bacterial DNA did not demonstrate statistical significant association with the studied practices, but the presence of P. aeruginosa revealed a possible inhibition of Acanthamoeba in these samples. The PCR results suggest a high presence of Acanthamoeba spp. in healthy CL wearers from Madrid, but we can assume that CL solutions are properly disinfecting the CL since only 1.1% of the positive PCR samples correspond to viable amoebae and, after four years, only one participant reported stronger ocular problems. Nevertheless, more studies are necessary to corroborate this hypothesis.

Acanthamoeba keratitis: the role of domestic tap water contamination in the United Kingdom.

PubMed

Kilvington, Simon; Gray, Trevor; Dart, John; Morlet, Nigel; Beeching, John R; Frazer, David G; Matheson, Melville

2004-01-01

The incidence of acanthamoeba keratitis (AK) in the UK is some 15 times that in the United States and seven times that in Holland. To investigate reasons for this higher frequency, a study of the role of domestic tap water as a potential source of AK was undertaken. Tap outlets from the homes of 27 patients with culture-proven AK were sampled and cultured for free-living amoebae (FLA). For all Acanthamoeba isolates, mitochondrial DNA (mtDNA) restriction fragment length polymorphisms (RFLPs) and cytochrome oxidase (cox 1/2) sequence typing was performed to determine the similarity between corneal and tap water isolates. FLA, including Acanthamoeba, were isolated from 24 (89%) of 27 homes, and the presence within the homes varied significantly with tap water temperature and location: 19 (76%) of 25 bathroom sink cold taps sampled compared with 6 (24%) of 25 hot and 9 (47%) of 19 kitchen cold taps compared with 3 (16%) of 19 of hot kitchen taps. Acanthamoeba were isolated from 8 (30%) of 27 homes (five bathroom sink cold taps, one cloakroom cold tap, one bath, and one bedroom sink mixer [hot/cold] taps). In six cases, identical Acanthamoeba mtDNA profiles were found for the clinical and home tap water isolates. In keeping with UK plumbing practice, 24 of 27 homes had internal roof water storage tanks to supply domestic taps, but the mains fed the kitchen cold tap. Water storage tanks promote colonization of domestic water with FLA, including Acanthamoeba, and hence increase the risk of AK. This accounts for the significantly greater incidence of AK in the UK and supports advice to avoid using tap water in contact lens care routines.

Culturable bacteria present in the fluid of the hooded-pitcher plant Sarracenia minor based on 16S rDNA gene sequence data.

PubMed

Siragusa, Alex J; Swenson, Janice E; Casamatta, Dale A

2007-08-01

The culturable microbial community within the pitcher fluid of 93 Sarracenia minor carnivorous plants was examined over a 2-year study. Many aspects of the plant/bacterial/insect interaction within the pitcher fluid are minimally understood because the bacterial taxa present in these pitchers have not been identified. Thirteen isolates were characterized by 16S rDNA sequencing and subsequent phylogenetic analysis. The Proteobacteria were the most abundant taxa and included representatives from Serratia, Achromobacter, and Pantoea. The Actinobacteria Micrococcus was also abundant while Bacillus, Lactococcus, Chryseobacterium, and Rhodococcus were infrequently encountered. Several isolates conformed to species identifiers (>98% rDNA gene sequence similarity) including Serratia marcescens (isolates found in 27.5% of pitchers), Achromobacter xylosoxidans (37.6%), Micrococcus luteus (40.9%), Bacillus cereus (isolates found in 10.2%), Bacillus thuringiensis (5.4%), Lactococcus lactis (17.2%), and Rhodococcus equi (2.2%). Species-area curves suggest that sampling efforts were sufficient to recover a representative culturable bacterial community. The bacteria present represent a diverse community probably as a result of introduction by insect vectors, but the ecological significance remains under explored.

Myceligenerans crystallogenes sp. nov., isolated from Roman catacombs.

PubMed

Groth, Ingrid; Schumann, Peter; Schütze, Barbara; Gonzalez, Juan M; Laiz, Leonila; Suihko, Maija-Liisa; Stackebrandt, Erko

2006-01-01

Three xylan-degrading actinobacterial strains were isolated from different sampling sites in the Roman catacombs of Domitilla and San Callisto. The organisms showed morphological and chemotaxonomic properties such as peptidoglycan type A4alpha, L-lys-L-thr-D-Glu; whole-cell sugars (glucose, mannose and galactose); octa-, hexa- and tetrahydrogenated menaquinones with nine isoprene units; phosphatidylglycerol and diphosphatidylglycerol as the major phospholipids; anteiso-C(15 : 0), iso-C(15 : 0) and iso-C(16 : 0) as the predominant fatty acids; and a DNA G+C content of 72 mol%. These features are consistent with affiliation of these isolates to the genus Myceligenerans. The three isolates shared a 16S rRNA gene similarity of 99.9 % and were most closely related to Myceligenerans xiligouense DSM 15700T (97.9 % sequence similarity). The low level of DNA-DNA relatedness (about 14 %) and the differences in phenotypic characteristics between the novel strains and M. xiligouense DSM 15700T justify the proposal of a novel species of the genus Myceligenerans, Myceligenerans crystallogenes sp. nov., with CD12E2-27T (= HKI 0369T = DSM 17134T = NCIMB 14061T = VTT E-032285T) as the type strain.

DNA adsorption onto glass surfaces

NASA Astrophysics Data System (ADS)

Carlson, Krista Lynn

Streaming potential measurements were performed on microspheres of silica, lime silicate (SLS) and calcium aluminate (CA) glasses containing silica and iron oxide (CASi and CAFe). The silicate based glasses exhibited acidic surfaces with isoelectric points (IEP) around a pH of 3 while the calcium aluminates displayed more basic surfaces with IEP ranging from 8--9.5. The surface of the calcium aluminate microspheres containing silica reacted with the background electrolyte, altering the measured zeta potential values and inhibiting electrolyte flow past the sample at ˜ pH 4 due to formation of a solid plug. DNA adsorption experiments were performed using the microspheres and a commercially available silicate based DNA isolation filter using a known quantity of DNA suspended in a chaotropic agent free 0.35 wt% Tris(hydroxymethyl)aminomethane (Tris) buffer solution. The microspheres and commercial filter were also used to isolate DNA from macrophage cells in the presence of chaotropic agents. UV absorbance at ˜260 nm and gel electrophoresis were used to quantify the amount and size of the DNA strands that adsorbed to the microsphere surfaces. In both experiments, the 43--106 microm CAFe microspheres adsorbed the largest quantity of DNA. However, the 43--106 microm SLS microspheres isolated more DNA from the cells than the <43 microm CAFe microspheres, indicating that microsphere size contributes to isolation ability. The UV absorbance of DNA at ˜260 nm was slightly altered due to the dissolution of the calcium aluminate glasses during the adsorption process. Inductively coupled plasma-optical emission spectroscopy (ICP-OES) determined that calcium and aluminum ions leached from the CA and CAFe microsphere surfaces during these experiments. Circular dichroism (CD) spectroscopy showed that the leached ions had no effect on the conformation of the DNA, and therefore would not be expected to interfere in downstream applications such as DNA replication. The 0.35 wt% Tris solution completely inhibited the formation of the hydrated crystalline layer that develops when the calcium aluminate glassess are incubated in deionized water. A Tris concentration of 0.24 wt% allowed for the formation of both hexagonal and cubic hydrates, however they were severely distorted and present in low amounts such that they were undectable by XRD.

Where is DNA preserved in soil organic matter?

NASA Astrophysics Data System (ADS)

Zaccone, Claudio; Beneduce, Luciano; Plaza, César

2015-04-01

Deoxyribonucleic acid (DNA) consists of long chains of alternating sugar and phosphate residues twisted in the form of a helix. Upon decomposition of plant and animal debris, this nucleic acid is released into the soil, where its fate is still not completely understood. In fact, although DNA is one of the organic compounds from living cells that is apparently broken down rapidly in soils, it is also potentially capable of being incorporated in (or interact with) the precursors of humic molecules. In order to track DNA occurrence in soil organic matter (SOM) fractions, an experiment was set up as a randomized complete block design with two factors, namely biochar addition and organic amendment. In particular, biochar (BC), applied at a rate of 20 t/ha, was combined with municipal solid waste compost (BC+MC) at a rate equivalent to 75 kg/ha of potentially available N, and with sewage sludge (BC+SS) at a rate equivalent to 75 kg/ha of potentially available N. Using a physical fractionation method, free SOM located between aggregates (unprotected C pool; FR), SOM occluded within macroaggregates (C pool weakly protected by physical mechanisms; MA), SOM occluded within microaggregates (C pool strongly protected by physical mechanisms; MI), and SOM associated with the mineral fractions (chemically-protected C pool; MIN) were separated from soil samples. DNA was then isolated from each fraction of the two series, as well as from the unamended soil (C) and from the bulk soils (WS), using Powersoil DNA isolation kit (MoBio, CA, USA) with a modified protocol. Data clearly show that the DNA survived the SOM fractionation, thus suggesting that physical fractionation methods create less artifacts compared to the chemical ones. Moreover, in both BC+MC and BC+SS series, most of the isolated DNA was present in the FR fraction, followed by the MA and the MI fractions. No DNA was recovered from the MIN fraction. This finding supports the idea that most of the DNA occurring in the SOM is unprotected or physically protected, with a short-to-medium mean residence time. Finally, the DNA isolated showed, in all cases, an acceptable level of degradation that makes it suitable for further analyses by PCR.

Draft Genome Sequence of Exiguobacterium sp. Strain BMC-KP, an Environmental Isolate from Bryn Mawr, Pennsylvania.

PubMed

Hyson, Peter; Shapiro, Joshua A; Wien, Michelle W

2015-10-08

Exiguobacterium sp. strain BMC-KP was isolated as part of a student environmental sampling project at Bryn Mawr College, PA. Sequencing of bacterial DNA assembled a 3.32-Mb draft genome. Analysis suggests the presence of genes for tolerance to cold and toxic metals, broad carbohydrate metabolism, and genes derived from phage. Copyright © 2015 Hyson et al.

Characterization of unusual bacteria isolated from respiratory secretions of cystic fibrosis patients and description of Inquilinus limosus gen. nov., sp. nov.

PubMed

Coenye, Tom; Goris, Johan; Spilker, Theodore; Vandamme, Peter; LiPuma, John J

2002-06-01

Using a polyphasic approach (including cellular protein and fatty acid analysis, biochemical characterization, 16S ribosomal DNA sequencing, and DNA-DNA hybridizations), we characterized 51 bacterial isolates recovered from respiratory secretions of cystic fibrosis (CF) patients. Our analyses showed that 24 isolates belong to taxa that have so far not (or only rarely) been reported from CF patients. These taxa include Acinetobacter sp., Bordetella hinzii, Burkholderia fungorum, Comamonas testosteroni, Chryseobacterium sp., Herbaspirillum sp., Moraxella osloensis, Pandoraea genomospecies 4, Ralstonia gilardii, Ralstonia mannitolilytica, Rhizobium radiobacter, and Xanthomonas sp. In addition, one isolate most likely represents a novel Ralstonia species, whereas nine isolates belong to novel taxa within the alpha-PROTEOBACTERIA: Eight of these latter isolates are classified into the novel genus Inquilinus gen. nov. as Inquilinus limosus gen. nov., sp. nov., or as Inquilinus sp. The remaining 17 isolates are characterized as members of the family ENTEROBACTERIACEAE: The recovery of these species suggests that the CF lung is an ecological niche capable of supporting the growth of a wide variety of bacteria rarely seen in clinical samples. Elucidation of the factors that account for the association between these unusual species and the respiratory tract of CF patients may provide important insights into the pathophysiology of CF infection. Because accurate identification of these organisms in the clinical microbiology laboratory may be problematic, the present study highlights the utility of reference laboratories capable of identifying unusual species recovered from CF sputum.

Evaluation of Digital PCR as a Technique for Monitoring Acute Rejection in Kidney Transplantation.

PubMed

Lee, Hyeseon; Park, Young-Mi; We, Yu-Mee; Han, Duck Jong; Seo, Jung-Woo; Moon, Haena; Lee, Yu-Ho; Kim, Yang-Gyun; Moon, Ju-Young; Lee, Sang-Ho; Lee, Jong-Keuk

2017-03-01

Early detection and proper management of kidney rejection are crucial for the long-term health of a transplant recipient. Recipients are normally monitored by serum creatinine measurement and sometimes with graft biopsies. Donor-derived cell-free deoxyribonucleic acid (cfDNA) in the recipient's plasma and/or urine may be a better indicator of acute rejection. We evaluated digital PCR (dPCR) as a system for monitoring graft status using single nucleotide polymorphism (SNP)-based detection of donor DNA in plasma or urine. We compared the detection abilities of the QX200, RainDrop, and QuantStudio 3D dPCR systems. The QX200 was the most accurate and sensitive. Plasma and/or urine samples were isolated from 34 kidney recipients at multiple time points after transplantation, and analyzed by dPCR using the QX200. We found that donor DNA was almost undetectable in plasma DNA samples, whereas a high percentage of donor DNA was measured in urine DNA samples, indicating that urine is a good source of cfDNA for patient monitoring. We found that at least 24% of the highly polymorphic SNPs used to identify individuals could also identify donor cfDNA in transplant patient samples. Our results further showed that autosomal, sex-specific, and mitochondrial SNPs were suitable markers for identifying donor cfDNA. Finally, we found that donor-derived cfDNA measurement by dPCR was not sufficient to predict a patient's clinical condition. Our results indicate that donor-derived cfDNA is not an accurate predictor of kidney status in kidney transplant patients.

Comparison of Four Nuclear Isolation Buffers for Plant DNA Flow Cytometry

PubMed Central

LOUREIRO, JOÃO; RODRIGUEZ, ELEAZAR; DOLEŽEL, JAROSLAV; SANTOS, CONCEIÇÃO

2006-01-01

• Background and Aims DNA flow cytometry requires preparation of suspensions of intact nuclei, which are stained using a DNA-specific fluorochrome prior to analysis. Various buffer formulas were developed to preserve nuclear integrity, protect DNA from degradation and facilitate its stoichiometric staining. Although nuclear isolation buffers differ considerably in chemical composition, no systematic comparison of their performance has been made until now. This knowledge is required to select the appropriate buffer for a given species and tissue. • Methods Four common lysis buffers (Galbraith's, LB01, Otto's and Tris.MgCl2) were used to prepare samples from leaf tissues of seven plant species (Sedum burrito, Oxalis pes-caprae, Lycopersicon esculentum, Celtis australis, Pisum sativum, Festuca rothmaleri and Vicia faba). The species were selected to cover a wide range of genome sizes (1·30–26·90 pg per 2C DNA) and a variety of leaf tissue types. The following parameters were assessed: forward (FS) and side (SS) light scatters, fluorescence of propidium iodide-stained nuclei, coefficient of variation of DNA peaks, presence of debris background and the number of nuclei released from sample tissue. The experiments were performed independently by two operators and repeated on three different days. • Key Results Clear differences among buffers were observed. With the exception of O. pes-caprae, any buffer provided acceptable results for all species. LB01 and Otto's were generally the best buffers, with Otto's buffer providing better results in species with low DNA content. Galbraith's buffer led to satisfactory results and Tris.MgCl2 was generally the worst, although it yielded the best histograms in C. australis. A combined analysis of FS and SS provided a ‘fingerprint’ for each buffer. The variation between days was more significant than the variation between operators. • Conclusions Each lysis buffer tested responded to a specific problem differently and none of the buffers worked best with all species. These results expand our knowledge on nuclear isolation buffers and will facilitate selection of the most appropriate buffer depending on species, tissue type and the presence of cytosolic compounds interfering with DNA staining. PMID:16820407

Development of a PCR assay to detect papillomavirus infection in the snow leopard.

PubMed

Mitsouras, Katherine; Faulhaber, Erica A; Hui, Gordon; Joslin, Janis O; Eng, Curtis; Barr, Margaret C; Irizarry, Kristopher Jl

2011-07-18

Papillomaviruses (PVs) are a group of small, non-encapsulated, species-specific DNA viruses that have been detected in a variety of mammalian and avian species including humans, canines and felines. PVs cause lesions in the skin and mucous membranes of the host and after persistent infection, a subset of PVs can cause tumors such as cervical malignancies and head and neck squamous cell carcinoma in humans. PVs from several species have been isolated and their genomes have been sequenced, thereby increasing our understanding of the mechanism of viral oncogenesis and allowing for the development of molecular assays for the detection of PV infection. In humans, molecular testing for PV DNA is used to identify patients with persistent infections at risk for developing cervical cancer. In felids, PVs have been isolated and sequenced from oral papillomatous lesions of several wild species including bobcats, Asian lions and snow leopards. Since a number of wild felids are endangered, PV associated disease is a concern and there is a need for molecular tools that can be used to further study papillomavirus in these species. We used the sequence of the snow leopard papillomavirus UuPV1 to develop a PCR strategy to amplify viral DNA from samples obtained from captive animals. We designed primer pairs that flank the E6 and E7 viral oncogenes and amplify two DNA fragments encompassing these genes. We detected viral DNA for E6 and E7 in genomic DNA isolated from saliva, but not in paired blood samples from snow leopards. We verified the identity of these PCR products by restriction digest and DNA sequencing. The sequences of the PCR products were 100% identical to the published UuPV1 genome sequence. We developed a PCR assay to detect papillomavirus in snow leopards and amplified viral DNA encompassing the E6 and E7 oncogenes specifically in the saliva of animals. This assay could be utilized for the molecular investigation of papillomavirus in snow leopards using saliva, thereby allowing the detection of the virus in the anatomical site where oral papillomatous lesions develop during later stages of infection and disease development.

Development of a PCR Assay to detect Papillomavirus Infection in the Snow Leopard

PubMed Central

2011-01-01

Background Papillomaviruses (PVs) are a group of small, non-encapsulated, species-specific DNA viruses that have been detected in a variety of mammalian and avian species including humans, canines and felines. PVs cause lesions in the skin and mucous membranes of the host and after persistent infection, a subset of PVs can cause tumors such as cervical malignancies and head and neck squamous cell carcinoma in humans. PVs from several species have been isolated and their genomes have been sequenced, thereby increasing our understanding of the mechanism of viral oncogenesis and allowing for the development of molecular assays for the detection of PV infection. In humans, molecular testing for PV DNA is used to identify patients with persistent infections at risk for developing cervical cancer. In felids, PVs have been isolated and sequenced from oral papillomatous lesions of several wild species including bobcats, Asian lions and snow leopards. Since a number of wild felids are endangered, PV associated disease is a concern and there is a need for molecular tools that can be used to further study papillomavirus in these species. Results We used the sequence of the snow leopard papillomavirus UuPV1 to develop a PCR strategy to amplify viral DNA from samples obtained from captive animals. We designed primer pairs that flank the E6 and E7 viral oncogenes and amplify two DNA fragments encompassing these genes. We detected viral DNA for E6 and E7 in genomic DNA isolated from saliva, but not in paired blood samples from snow leopards. We verified the identity of these PCR products by restriction digest and DNA sequencing. The sequences of the PCR products were 100% identical to the published UuPV1 genome sequence. Conclusions We developed a PCR assay to detect papillomavirus in snow leopards and amplified viral DNA encompassing the E6 and E7 oncogenes specifically in the saliva of animals. This assay could be utilized for the molecular investigation of papillomavirus in snow leopards using saliva, thereby allowing the detection of the virus in the anatomical site where oral papillomatous lesions develop during later stages of infection and disease development. PMID:21767399

Application of immobilized synthetic anti-lipopolysaccharide peptides for the isolation and detection of bacteria.

PubMed

Sandetskaya, N; Engelmann, B; Brandenburg, K; Kuhlmeier, D

2015-08-01

The molecular detection of microorganisms in liquid samples generally requires their enrichment or isolation. The aim of our study was to evaluate the capture and pre-concentration of bacteria by immobilized particular cationic antimicrobial peptides, called synthetic anti-lipopolysaccharide peptides (SALP). For the proof-of-concept and screening of different SALP, the peptides were covalently immobilized on glass slides, and the binding of bacteria was confirmed by microscopic examination of the slides or their scanning, in case of fluorescent bacterial cells. The most efficient SALP was further tethered to magnetic beads. SALP beads were used for the magnetic capture of Escherichia coli in liquid samples. The efficiency of this strategy was evaluated using polymerase chain reaction (PCR). Covalently immobilized SALP were capable of capturing bacteria in liquid samples. However, PCR was hampered by the unspecific binding of DNA to the positively charged peptide. We developed a method for DNA recovery by the enzymatic digestion of the peptide, which allowed for a successful PCR, though the method had its own adverse impact on the detection and, thus, did not allow for the reliable quantitative analysis of the pathogen enrichment. Immobilized SALP can be used as capture molecules for bacteria in liquid samples and can be recommended for the design of the assays or decontamination of the fluids. For the accurate subsequent detection of bacteria, DNA-independent methods should be used.

Maternal genetic heritage of Southeastern Europe reveals a new Croatian isolate and a novel, local sub-branching in the x2 haplogroup.

PubMed

Sarac, Jelena; Sarić, Tena; Auguštin, Dubravka Havaš; Jeran, Nina; Kovačević, Lejla; Cvjetan, Svjetlana; Lewis, Ana Perinić; Metspalu, Ene; Reidla, Maere; Novokmet, Natalija; Vidovič, Maruška; Nevajda, Branimir; Glasnović, Anton; Marjanović, Damir; Missoni, Saša; Villems, Richard; Rudan, Pavao

2014-05-01

High mtDNA variation in Southeastern Europe (SEE) is a reflection of the turbulent and complex demographic history of this area, influenced by gene flow from various parts of Eurasia and a long history of intermixing. Our results of 1035 samples (488 from Croatia, 239 from Bosnia and 130 from Herzegovina, reported earlier, and 97 Slovenians and 81 individuals from Žumberak, reported here for the first time) show that the SEE maternal genetic diversity fits within a broader European maternal genetic landscape. The study also shows that the population of Žumberak, located in the continental part of Croatia, developed some unique mtDNA haplotypes and elevated haplogroup frequencies due to distinctive demographic history and can be considered a moderate genetic isolate. We also report seven samples from the Bosnian population and one Herzegovinian sample designated as X2* individuals that could not be assigned to any of its sublineages (X2a'o) according to the existing X2 phylogeny. In an attempt to clarify the phylogeny of our X2 samples, their mitochondrial DNA has been completely sequenced. We suppose that these lineages are signs of local microdifferentiation processes that occurred in the recent demographic past in this area and could possibly be marked as SEE-specific X2 sublineages. © 2014 John Wiley & Sons Ltd/University College London.

Molecular identification of leishmania species using samples obtained from negative stained smears.

PubMed

Mohaghegh, Ma; Fata, A; Salehi, Gh; Berenji, F; Bazzaz, M Mousavi; Rafatpanah, H; Parian, M; Movahedi, A

2013-04-01

Cutaneous Leishmaniasis (CL) is a parasitic skin disease. Diagnosis primarily is based on clinical signs and microscopic observation of parasite on direct stained smears or tissue sections. Sensitivity of direct smear is not as high as molecular methods. The aim of this study was to identify and characterize Leishmania species among the negative direct smears obtained from skin ulcers suspected to CL by PCR method. Among 81 patients with suspicious skin lesions to CL referred to the Parasitology lab, negative Giemsa stained smears were collected. DNA extraction performed by scraping stained smears, then PCR was performed. Among the DNA extracted from smears, L. tropica was isolated from 9 (11.1%) of the smears and L.major was not isolated from any samples. Direct microscopy on stained smears for diagnosis of leishmaniasis is not enough accurate. PCR is recommended for clinically suspected lesions with negative result of direct smear.

Development of a LAMP assay for detection of Leishmania infantum infection in dogs using conjunctival swab samples.

PubMed

Gao, Chun-hua; Ding, Dan; Wang, Jun-yun; Steverding, Dietmar; Wang, Xia; Yang, Yue-tao; Shi, Feng

2015-07-15

Leishmania infantum infections in dogs play a crucial role in the transmission of pathogens causing visceral leishmaniasis to humans in the Gansu province, northwest China. To be able to control zoonotic transmission of the parasite to humans, a non-invasive loop-mediated isothermal amplification (LAMP) assay to specifically detect L. infantum infections in dogs was developed. The primers used in the LAMP assay were designed to target kinetoplast DNA minicircle sequences of the L. infantum isolate MCAN/CN/90/SC and tested using DNA isolated from promastigotes of different Leishmania species. The LAMP assay was evaluated with conjunctional swab samples obtained from 111 and 33 dogs living in an endemic and a non-endemic region of zoonotic visceral leishmaniasis in the Gansu province, respectively. The LAMP assay was also compared with conventional PCR, ELISA and microscopy using conjunctional swab, serum and bone marrow samples from the dogs, respectively. The LAMP assay detected 1 fg of L. infantum DNA purified from cultured promastigotes which was 10-fold more sensitive than a conventional PCR test using Leishmania genus-specific primers. No cross reaction was observed with DNA isolated from promastigotes of L. donovani, L. major, L. tropica, and L. braziliensis, and the L. infantum reference strain MHOM/TN/80/IPT1. The L. infantum-positive rates obtained for field-collected samples were 61.3%, 58.6%, 40.5% and 10.8% by LAMP, PCR, ELISA and microscopy, respectively. As only one out of the 33 samples from control dogs from the non-endemic region of zoonotic visceral leishmaniasis was positive by the LAMP assay and the PCR test, the observed true negative rate (specificity) was 97% for both methods. This study has shown that the non-invasive, conjunctional swab-based LAMP assay developed was more sensitive in the detection of leishmaniasis in dogs than PCR, ELISA and microscopy. The findings indicate that the LAMP assay is a sensitive and specific method for the field surveillance of domestic dogs, particularly of asymptomatic canines, in ZVL-endemic areas in western China.

Molecular characterization of banana bunchy top virus isolate from Sri Lanka and its genetic relationship with other isolates.

PubMed

Wickramaarachchi, W A R T; Shankarappa, K S; Rangaswamy, K T; Maruthi, M N; Rajapakse, R G A S; Ghosh, Saptarshi

2016-06-01

Bunchy top disease of banana caused by Banana bunchy top virus (BBTV, genus Babuvirus family Nanoviridae) is one of the most important constraints in production of banana in the different parts of the world. Six genomic DNA components of BBTV isolate from Kandy, Sri Lanka (BBTV-K) were amplified by polymerase chain reaction (PCR) with specific primers using total DNA extracted from banana tissues showing typical symptoms of bunchy top disease. The amplicons were of expected size of 1.0-1.1 kb, which were cloned and sequenced. Analysis of sequence data revealed the presence of six DNA components; DNA-R, DNA-U3, DNA-S, DNA-N, DNA-M and DNA-C for Sri Lanka isolate. Comparisons of sequence data of DNA components followed by the phylogenetic analysis, grouped Sri Lanka-(Kandy) isolate in the Pacific Indian Oceans (PIO) group. Sri Lanka-(Kandy) isolate of BBTV is classified a new member of PIO group based on analysis of six components of the virus.

Profiling Nematode Communities in Unmanaged Flowerbed and Agricultural Field Soils in Japan by DNA Barcode Sequencing

PubMed Central

Morise, Hisashi; Miyazaki, Erika; Yoshimitsu, Shoko; Eki, Toshihiko

2012-01-01

Soil nematodes play crucial roles in the soil food web and are a suitable indicator for assessing soil environments and ecosystems. Previous nematode community analyses based on nematode morphology classification have been shown to be useful for assessing various soil environments. Here we have conducted DNA barcode analysis for soil nematode community analyses in Japanese soils. We isolated nematodes from two different environmental soils of an unmanaged flowerbed and an agricultural field using the improved flotation-sieving method. Small subunit (SSU) rDNA fragments were directly amplified from each of 68 (flowerbed samples) and 48 (field samples) isolated nematodes to determine the nucleotide sequence. Sixteen and thirteen operational taxonomic units (OTUs) were obtained by multiple sequence alignment from the flowerbed and agricultural field nematodes, respectively. All 29 SSU rDNA-derived OTUs (rOTUs) were further mapped onto a phylogenetic tree with 107 known nematode species. Interestingly, the two nematode communities examined were clearly distinct from each other in terms of trophic groups: Animal predators and plant feeders were markedly abundant in the flowerbed soils, in contrast, bacterial feeders were dominantly observed in the agricultural field soils. The data from the flowerbed nematodes suggests a possible food web among two different trophic nematode groups and plants (weeds) in the closed soil environment. Finally, DNA sequences derived from the mitochondrial cytochrome oxidase c subunit 1 (COI) gene were determined as a DNA barcode from 43 agricultural field soil nematodes. These nematodes were assigned to 13 rDNA-derived OTUs, but in the COI gene analysis were assigned to 23 COI gene-derived OTUs (cOTUs), indicating that COI gene-based barcoding may provide higher taxonomic resolution than conventional SSU rDNA-barcoding in soil nematode community analysis. PMID:23284767

PCR detection of Burkholderia multivorans in water and soil samples.

PubMed

Peeters, Charlotte; Daenekindt, Stijn; Vandamme, Peter

2016-08-12

Although semi-selective growth media have been developed for the isolation of Burkholderia cepacia complex bacteria from the environment, thus far Burkholderia multivorans has rarely been isolated from such samples. Because environmental B. multivorans isolates mainly originate from water samples, we hypothesized that water rather than soil is its most likely environmental niche. The aim of the present study was to assess the occurrence of B. multivorans in water samples from Flanders (Belgium) using a fast, culture-independent PCR assay. A nested PCR approach was used to achieve high sensitivity, and specificity was confirmed by sequencing the resulting amplicons. B. multivorans was detected in 11 % of the water samples (n = 112) and 92 % of the soil samples (n = 25) tested. The percentage of false positives was higher for water samples compared to soil samples, showing that the presently available B. multivorans recA primers lack specificity when applied to the analysis of water samples. The results of the present study demonstrate that B. multivorans DNA is commonly present in soil samples and to a lesser extent in water samples in Flanders (Belgium).

Characterization of Two New Records of Zygomycete Species Belonging to Undiscovered Taxa in Korea.

PubMed

Nguyen, Thi Thuong Thuong; Lee, Seo Hee; Bae, Sarah; Jeon, Sun Jeong; Mun, Hye Yeon; Lee, Hyang Burm

2016-03-01

During a biodiversity survey of undiscovered taxa in Korea, two zygomycetous fungal strains were isolated. The first strain, EML-FSDY6-1 was isolated from a soil sample collected at Dokdo Island in the East Sea of Korea in 2013, and the second strain, EML-DG-NH3-1 was isolated from a rat dung sample collected at Chonnam National University garden, Gwangju, Korea in 2014. Based on the morphological characteristics and phylogenetic analysis of the internal transcribed spacer, 18S and 28S rDNA, actin and translation elongation factor-1α genes. EML-FSDY6-1 and EML-DG-NH3-1 isolates were confirmed as zygomycete species, Absidia pseudocylindrospora and Absidia glauca, respectively. Neither species has previously been described in Korea.

Characterization of Two New Records of Zygomycete Species Belonging to Undiscovered Taxa in Korea

PubMed Central

Nguyen, Thi Thuong Thuong; Lee, Seo Hee; Bae, Sarah; Jeon, Sun Jeong; Mun, Hye Yeon

2016-01-01

During a biodiversity survey of undiscovered taxa in Korea, two zygomycetous fungal strains were isolated. The first strain, EML-FSDY6-1 was isolated from a soil sample collected at Dokdo Island in the East Sea of Korea in 2013, and the second strain, EML-DG-NH3-1 was isolated from a rat dung sample collected at Chonnam National University garden, Gwangju, Korea in 2014. Based on the morphological characteristics and phylogenetic analysis of the internal transcribed spacer, 18S and 28S rDNA, actin and translation elongation factor-1α genes. EML-FSDY6-1 and EML-DG-NH3-1 isolates were confirmed as zygomycete species, Absidia pseudocylindrospora and Absidia glauca, respectively. Neither species has previously been described in Korea. PMID:27103852

Occurrence of Penicillium brocae and Penicillium citreonigrum, which Produce a Mutagenic Metabolite and a Mycotoxin Citreoviridin, Respectively, in Selected Commercially Available Rice Grains in Thailand.

PubMed

Shiratori, Nozomi; Kobayashi, Naoki; Tulayakul, Phitsanu; Sugiura, Yoshitsugu; Takino, Masahiko; Endo, Osamu; Sugita-Konishi, Yoshiko

2017-06-15

Commercially available rice grains in Thailand were examined to isolate the monoverticillate Penicillium species responsible for toxic yellowed rice. Penicillium species were obtained from seven out of 10 rice samples tested. Among them, one Penicillium citreonigrum isolate and six Penicillium brocae isolates were morphologically identified. The P. citreonigrum isolate produced the mycotoxin citreoviridin on a yeast extract sucrose broth medium. Mycotoxin surveys showed that citreoviridin was not detected in any samples, but one out of 10 rice samples tested was positive for aflatoxin B₁ at a level of 5.9 μg/kg. An Ames test revealed that methanol extracts from rice grains inoculated with selected P. brocae isolates were positive for strains TA100 and YG7108 of Salmonella typhimurium , suggesting the presence of base-pair substitution and DNA alkylation mutagens. Our data obtained here demonstrated that aflatoxin B₁ and toxic P. citreonigrum were present on domestic rice grains in Thailand, although limited samples were tested. Penicillium brocae , which may produce mutagenic metabolites, was isolated for the first time from the surface of Thai rice grains.

Occurrence of Penicillium brocae and Penicillium citreonigrum, which Produce a Mutagenic Metabolite and a Mycotoxin Citreoviridin, Respectively, in Selected Commercially Available Rice Grains in Thailand

PubMed Central

Shiratori, Nozomi; Kobayashi, Naoki; Tulayakul, Phitsanu; Sugiura, Yoshitsugu; Takino, Masahiko; Endo, Osamu; Sugita-Konishi, Yoshiko

2017-01-01

Commercially available rice grains in Thailand were examined to isolate the monoverticillate Penicillium species responsible for toxic yellowed rice. Penicillium species were obtained from seven out of 10 rice samples tested. Among them, one Penicillium citreonigrum isolate and six Penicillium brocae isolates were morphologically identified. The P. citreonigrum isolate produced the mycotoxin citreoviridin on a yeast extract sucrose broth medium. Mycotoxin surveys showed that citreoviridin was not detected in any samples, but one out of 10 rice samples tested was positive for aflatoxin B1 at a level of 5.9 μg/kg. An Ames test revealed that methanol extracts from rice grains inoculated with selected P. brocae isolates were positive for strains TA100 and YG7108 of Salmonella typhimurium, suggesting the presence of base-pair substitution and DNA alkylation mutagens. Our data obtained here demonstrated that aflatoxin B1 and toxic P. citreonigrum were present on domestic rice grains in Thailand, although limited samples were tested. Penicillium brocae, which may produce mutagenic metabolites, was isolated for the first time from the surface of Thai rice grains. PMID:28617318

Identification of the Bacterial Community of Maple Sap by Using Amplified Ribosomal DNA (rDNA) Restriction Analysis and rDNA Sequencing

PubMed Central

Lagacé, L.; Pitre, M.; Jacques, M.; Roy, D.

2004-01-01

The bacterial community of maple sap was characterized by analysis of samples obtained at the taphole of maple trees for the 2001 and 2002 seasons. Among the 190 bacterial isolates, 32 groups were formed according to the similarity of the banding patterns obtained by amplified ribosomal DNA restriction analysis (ARDRA). A subset of representative isolates for each ARDRA group was identified by 16S rRNA gene fragment sequencing. Results showed a wide variety of organisms, with 22 different genera encountered. Pseudomonas and Ralstonia, of the γ- and β-Proteobacteria, respectively, were the most frequently encountered genera. Gram-positive bacteria were also observed, and Staphylococcus, Plantibacter, and Bacillus were the most highly represented genera. The sampling period corresponding to 50% of the cumulative sap flow percentage presented the greatest bacterial diversity according to its Shannon diversity index value (1.1). γ-Proteobacteria were found to be dominant almost from the beginning of the season to the end. These results are providing interesting insights on maple sap microflora that will be useful for further investigation related to microbial contamination and quality of maple products and also for guiding new strategies on taphole contamination control. PMID:15066796

Development and evaluation of specific PCR primers targeting the ribosomal DNA-internal transcribed spacer (ITS) region of peritrich ciliates in environmental samples

NASA Astrophysics Data System (ADS)

Su, Lei; Zhang, Qianqian; Gong, Jun

2017-07-01

Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.

Museums and disease: using tissue archive and museum samples to study pathogens.

PubMed

Tsangaras, Kyriakos; Greenwood, Alex D

2012-01-20

Molecular studies of archival and fossil samples have traditionally focused on the nucleic acids derived from the host species. However, there has recently been an increase in ancient DNA research on the identification and characterization of infectious agents within the hosts. The study of pathogens from the past provides great opportunities for discovering the causes of historical infection events, characterizing host-microorganism co-evolution and directly investigating the evolution of specific pathogens. Several research teams have been able to isolate and characterize a variety of different bacterial, parasite and viral microorganisms. However, this emerging field is not without obstacles. The diagenetic processes that make ancient DNA research generally difficult are also impediments to ancient pathogen research and perhaps more so given that their DNA may represent an even rarer proportion of the remaining nucleic acids in a fossil sample than host DNA. However, studies performed under controlled conditions and following stringent ancient DNA protocols can and have yielded reliable and often surprising results. This article reviews the advantages, problems, and failures of ancient microbiological research. Copyright © 2011 Elsevier GmbH. All rights reserved.

Efficient isolation method for high-quality genomic DNA from cicada exuviae.

PubMed

Nguyen, Hoa Quynh; Kim, Ye Inn; Borzée, Amaël; Jang, Yikweon

2017-10-01

In recent years, animal ethics issues have led researchers to explore nondestructive methods to access materials for genetic studies. Cicada exuviae are among those materials because they are cast skins that individuals left after molt and are easily collected. In this study, we aim to identify the most efficient extraction method to obtain high quantity and quality of DNA from cicada exuviae. We compared relative DNA yield and purity of six extraction protocols, including both manual protocols and available commercial kits, extracting from four different exoskeleton parts. Furthermore, amplification and sequencing of genomic DNA were evaluated in terms of availability of sequencing sequence at the expected genomic size. Both the choice of protocol and exuvia part significantly affected DNA yield and purity. Only samples that were extracted using the PowerSoil DNA Isolation kit generated gel bands of expected size as well as successful sequencing results. The failed attempts to extract DNA using other protocols could be partially explained by a low DNA yield from cicada exuviae and partly by contamination with humic acids that exist in the soil where cicada nymphs reside before emergence, as shown by spectroscopic measurements. Genomic DNA extracted from cicada exuviae could provide valuable information for species identification, allowing the investigation of genetic diversity across consecutive broods, or spatiotemporal variation among various populations. Consequently, we hope to provide a simple method to acquire pure genomic DNA applicable for multiple research purposes.

Identification of the major yeasts isolated from high moisture corn and corn silages in the United States using genetic and biochemical methods.

PubMed

Santos, M C; Golt, C; Joerger, R D; Mechor, G D; Mourão, Gerson B; Kung, L

2017-02-01

The objective of this study was to identify species of yeasts in samples of high moisture corn (HMC) and corn silage (CS) collected from farms throughout the United States. Samples were plated and colonies were isolated for identification using DNA analysis. Randomly selected colonies were also identified by fatty acid methyl esters (FAME) and by physiological substrate profiling (ID 32C). For CS, Candida ethanolica, Saccharomyces bulderi, Pichia anomala, Kazachstania unispora, and Saccharomyces cerevisiae were the predominant yeasts. Pichia anomala, Issatchenkia orientalis, S. cerevisiae, and Pichia fermentans were the prevalent species in HMC. The 3 identification methods were in agreement at the species level for 16.6% of the isolates and showed no agreement for 25.7%. Agreement in species identification between ID 32C and DNA analysis, FAME and ID 32C, and FAME and DNA analysis was 41.1, 14.4, and 2.2%, respectively. Pichia anomala and I. orientalis were able to grow on lactic acid, whereas S. cerevisiae metabolized sugars (galactose, sucrose, and glucose) but failed to use lactic acid. The yeast diversity in CS and HMC varied due to type of feed and location. Differences in species assignments were seen among methods, but identification using substrate profiling generally corresponded with that based on DNA analysis. These findings provide information about the species that may be expected in silages, and this knowledge may lead to interventions that control unwanted yeasts. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Molecular characterization of the ribosomal DNA unit of Sarcocystis singaporensis, Sarcocystis zamani and Sarcocystis zuoi from rodents in Thailand

PubMed Central

WATTHANAKAIWAN, Vichan; SUKMAK, Manakorn; HAMARIT, Kriengsak; KAOLIM, Nongnid; WAJJWALKU, Worawidh; MUANGKRAM, Yuttamol

2017-01-01

Sarcocystis species are heteroxenous cyst-forming coccidian protozoan parasites with a wide host range, including rodents. In this study, Sarcocystis spp. samples were isolated from Bandicota indica, Rattus argentiventer, R. tiomanicus and R. norvegicus across five provinces of Thailand. Two major groups of Sarcocystis cysts were determined in this study: large and small cysts. By sequence comparisons and phylogenetic analyses based on the partial sequences of 28S ribosomal DNA, the large cysts showed the highest identity value (99%) with the S. zamani in GenBank database. While the small cysts could be divided into 2 groups of Sarcocystis: S. singaporensis and presupposed S. zuoi. The further analysis on 18S rDNA supported that the 2 isolates (S2 and B6 no.2) were as identified as S. singaporensis shared a high sequence identity with the S. singaporensis in GenBank database and the unidentified Sarcocystis (4 isolates, i.e., B6 no.10, B6 no.12, B10 no.4 and B10 no.7) showed 96.3–99.5% identity to S. zuoi as well as high distinct identity from others Sarcocystis spp. (≤93%). The result indicated that these four samples should be S. zuoi. In this study, we provided complete sequence of internal transcribed spacer 1 (ITS1), 5.8S rDNA and internal transcribed spacer 2 (ITS2) of these three Sarcocystis species and our new primer set could be useful to study the evolution of Sarcocystis. PMID:28701623

Molecular characterization of the ribosomal DNA unit of Sarcocystis singaporensis, Sarcocystis zamani and Sarcocystis zuoi from rodents in Thailand.

PubMed

Watthanakaiwan, Vichan; Sukmak, Manakorn; Hamarit, Kriengsak; Kaolim, Nongnid; Wajjwalku, Worawidh; Muangkram, Yuttamol

2017-08-18

Sarcocystis species are heteroxenous cyst-forming coccidian protozoan parasites with a wide host range, including rodents. In this study, Sarcocystis spp. samples were isolated from Bandicota indica, Rattus argentiventer, R. tiomanicus and R. norvegicus across five provinces of Thailand. Two major groups of Sarcocystis cysts were determined in this study: large and small cysts. By sequence comparisons and phylogenetic analyses based on the partial sequences of 28S ribosomal DNA, the large cysts showed the highest identity value (99%) with the S. zamani in GenBank database. While the small cysts could be divided into 2 groups of Sarcocystis: S. singaporensis and presupposed S. zuoi. The further analysis on 18S rDNA supported that the 2 isolates (S2 and B6 no.2) were as identified as S. singaporensis shared a high sequence identity with the S. singaporensis in GenBank database and the unidentified Sarcocystis (4 isolates, i.e., B6 no.10, B6 no.12, B10 no.4 and B10 no.7) showed 96.3-99.5% identity to S. zuoi as well as high distinct identity from others Sarcocystis spp. (≤93%). The result indicated that these four samples should be S. zuoi. In this study, we provided complete sequence of internal transcribed spacer 1 (ITS1), 5.8S rDNA and internal transcribed spacer 2 (ITS2) of these three Sarcocystis species and our new primer set could be useful to study the evolution of Sarcocystis.

An Optimized Centrifugal Method for Separation of Semen from Superabsorbent Polymers for Forensic Analysis.

PubMed

Camarena, Lucy R; Glasscock, Bailey K; Daniels, Demi; Ackley, Nicolle; Sciarretta, Marybeth; Seashols-Williams, Sarah J

2017-03-01

Connection of a perpetrator to a sexual assault is best performed through the confirmed presence of semen, thereby proving sexual contact. Evidentiary items can include sanitary napkins or diapers containing superabsorbent polymers (SAPs), complicating spermatozoa visualization and DNA analysis. In this report, we evaluated the impact of SAPS on the current forensic DNA workflow, developing an efficient centrifugal protocol for separating spermatozoa from SAP material. The optimized filtration method was compared to common practices of excising the top layer only, resulting in significantly higher sperm yields when a core sample of the substrate was taken. Direct isolation of the SAP-containing materials without filtering resulted in 20% sample failure; additionally, SAP material was observed in the final eluted DNA samples, causing physical interference. Thus, use of the described centrifugal-filtering method is a simple preliminary step that improves spermatozoa visualization and enables more consistent DNA yields, while also avoiding SAP interference. © 2016 American Academy of Forensic Sciences.

Evaluation of Two Matrices for Long-Term, Ambient Storage of Bacterial DNA.

PubMed

Miernyk, Karen M; DeByle, Carolynn K; Rudolph, Karen M

2017-12-01

Culture-independent molecular analyses allow researchers to identify diverse microorganisms. This approach requires microbiological DNA repositories. The standard for DNA storage is liquid nitrogen or ultralow freezers. These use large amounts of space, are costly to operate, and could fail. Room temperature DNA storage is a viable alternative. In this study, we investigated storage of bacterial DNA using two ambient storage matrices, Biomatrica DNAstable ® Plus and GenTegra ® DNA. We created crude and clean DNA extracts from five Streptococcus pneumoniae isolates. Extracts were stored at -30°C (our usual DNA storage temperature), 25°C (within the range of temperatures recommended for the products), and 50°C (to simulate longer storage time). Samples were stored at -30°C with no product and dried at 25°C and 50°C with no product, in Biomatrica DNAstable Plus or GenTegra DNA. We analyzed the samples after 0, 1, 2, 4, 8, 16, 32, and 64 weeks using the Nanodrop 1000 to determine the amount of DNA in each aliquot and by real-time PCR for the S. pneumoniae genes lytA and psaA. Using a 50°C storage temperature, we simulated 362 weeks of 25°C storage. The average amount of DNA in aliquots stored with a stabilizing matrix was 103%-116% of the original amount added to the tubes. This is similar to samples stored at -30°C (average 102%-121%). With one exception, samples stored with a stabilizing matrix had no change in lytA or psaA cycle threshold (Ct) value over time (Ct range ≤2.9), similar to samples stored at -30°C (Ct range ≤3.0). Samples stored at 25°C with no stabilizing matrix had Ct ranges of 2.2-5.1. DNAstable Plus and GenTegra DNA can protect dried bacterial DNA samples stored at room temperature with similar effectiveness as at -30°C. It is not effective to store bacterial DNA at room temperature without a stabilizing matrix.

Complete nucleotide sequences of okra isolates of Cotton leaf curl Gezira virus and their associated DNA-beta from Niger.

PubMed

Shih, S L; Kumar, S; Tsai, W S; Lee, L M; Green, S K

2009-01-01

Okra (Abelmoschus esculentus) is a major crop in Niger. In the fall of 2007, okra leaf curl disease was observed in Niger and the begomovirus and DNA-beta satellite were found associated with the disease. The complete nucleotide sequences of DNA-A (FJ469626 and FJ469627) and associated DNA-beta satellites (FJ469628 and FJ469629) were determined from two samples. This is the first report of molecular characterization of okra-infecting begomovirus and their associated DNA-beta from Niger. The begomovirus and DNA-beta have been identified as Cotton leaf curl Gezira virus and Cotton leaf curl Gezira betasatellite, respectively, which are reported to also infect okra in Egypt, Mali and Sudan.

Detection of trypanosomatid Phytomonas parasitic in plants by polymerase chain reaction amplification of small subunit ribosomal DNA.

PubMed

Teixeira, M M; Campaner, M; Camargo, E P

1994-01-01

To improve the diagnosis of Phytomonas infections in plants, we developed a polymerase chain reaction (PCR) assay using synthetic oligonucleotides complementary to conserved sequences of the 18S small subunit ribosomal (SSU) gene. From 10 ng upward of DNA of cultures of Phytomonas isolated from plants, fruits, and insects, PCR amplified an 800-bp DNA band that, after restriction analysis and probe hybridization, proved to be of 18S rDNA Phytomonas origin. PCR was also done with sap samples of tomatoes experimentally infected with Phytomonas, yielding amplified 800-bp ribosomal DNA bands before any flagellate could be detected by microscopic examination of the fruit sap.

Genetic structure in contemporary south Tyrolean isolated populations revealed by analysis of Y-chromosome, mtDNA, and Alu polymorphisms.

PubMed

Pichler, Irene; Mueller, Jakob C; Stefanov, Stefan A; De Grandi, Alessandro; Volpato, Claudia Beu; Pinggera, Gerd K; Mayr, Agnes; Ogriseg, Martin; Ploner, Franz; Meitinger, Thomas; Pramstaller, Peter P

2006-08-01

Most of the inhabitants of South Tyrol in the eastern Italian Alps can be considered isolated populations because of their physical separation by mountain barriers and their sociocultural heritage. We analyzed the genetic structure of South Tyrolean populations using three types of genetic markers: Y-chromosome, mitochondrial DNA (mtDNA), and autosomal Alu markers. Using random samples taken from the populations of Val Venosta, Val Pusteria, Val Isarco, Val Badia, and Val Gardena, we calculated genetic diversity within and among the populations. Microsatellite diversity and unique event polymorphism diversity (on the Y chromosome) were substantially lower in the Ladin-speaking population of Val Badia compared to the neighboring German-speaking populations. In contrast, the genetic diversity of mtDNA haplotypes was lowest for the upper Val Venosta and Val Pusteria. These data suggest a low effective population size, or little admixture, for the gene pool of the Ladin-speaking population from Val Badia. Interestingly, this is more pronounced for Ladin males than for Ladin females. For the pattern of genetic Alu variation, both Ladin samples (Val Gardena and Val Badia) are among the samples with the lowest diversity. An admixture analysis of one German-speaking valley (Val Venosta) indicates a relatively high genetic contribution of Ladin origin. The reduced genetic diversity and a high genetic differentiation in the Rhaetoroman- and German-speaking South Tyrolean populations may constitute an important basis for future medical genetic research and gene mapping studies in South Tyrol.

Population structure of Cladophora-borne Escherichia coli in nearshore water of Lake Michigan

USGS Publications Warehouse

Byappanahalli, M.N.; Whitman, R.L.; Shively, D.A.; Ferguson, J.; Ishii, S.; Sadowsky, M.J.

2007-01-01

We previously reported that the macrophytic green alga Cladophora harbors high densities (up to 106 colony-forming units/g dry weight) of the fecal indicator bacteria,Escherichia coli and enterococci, in shoreline waters of Lake Michigan. However, the population structure and genetic relatedness of Cladophora-borne indicator bacteria remain poorly understood. In this study, 835 E. coli isolates were collected fromCladophora tufts (mats) growing on rocks from a breakwater located within the Indiana Dunes National Lakeshore in northwest Indiana. The horizontal fluorophore enhanced rep-PCR (HFERP) DNA fingerprinting technique was used to determine the genetic relatedness of the isolates to each other and to those in a library of E. coli DNA fingerprints. While the E. coli isolates from Cladophora showed a high degree of genetic relatedness (⩾92% similarity), in most cases, however, the isolates were genetically distinct. The Shannon diversity index for the population was very high (5.39). Both spatial and temporal influences contributed to the genetic diversity. There was a strong association of isolate genotypes by location (79% and 80% for lake- and ditch-side samplings, respectively), and isolates collected from 2002 were distinctly different from those obtained in 2003. Cladophora-borne E. coli isolates represented a unique group, which was distinct from other E. coli isolates in the DNA fingerprint library tested. Taken together, these results indicate that E. coli strains associated with Cladophora may be a recurring source of indicator bacteria to the nearshore beach.

Use of molecular techniques to evaluate the survival of a microorganism injected into an aquifer

USGS Publications Warehouse

Thiem, S.M.; Krumme, M.L.; Smith, R.L.; Tiedje, J.M.

1994-01-01

A PCR primer set and an internal probe that are specific for Pseudomonas sp. strain B13, a 3-chlorobenzoate-metabolizing strain, were developed. Using this primer set and probe, we were able to detect Pseudomonas sp. strain B13 DNA sequences in DNA extracted from aquifer samples 14.5 months after Pseudomonas sp. strain B13 had been injected into a sand and gravel aquifer. This primer set and probe were also used to analyze isolates from 3-chlorobenzoate enrichments of the aquifer samples by Southern blot analysis. Hybridization of Southern blots with the Pseudomonas sp. strain B13-specific probe and a catabolic probe in conjunction with restriction fragment length polymorphism (RFLP) analysis of ribosome genes was used to determine that viable Pseudomonas sp. strain B13 persisted in this environment. We isolated a new 3-chlorobenzoate-degrading strain from one of these enrichment cultures. The B13-specific probe does not hybridize to DNA from this isolate. The new strain could be the result of gene exchange between Pseudomonas sp. strain B13 and an indigenous bacterium. This speculation is based on an RFLP pattern of ribosome genes that differs from that of Pseudomonas sp. strain B13, the fact that identically sized restriction fragments hybridized to the catabolic gene probe, and the absence of any enrichable 3-chlorobenzoate-degrading strains in the aquifer prior to inoculation.

Evaluation and comparison of FTA card and CTAB DNA extraction methods for non-agricultural taxa.

PubMed

Siegel, Chloe S; Stevenson, Florence O; Zimmer, Elizabeth A

2017-02-01

An efficient, effective DNA extraction method is necessary for comprehensive analysis of plant genomes. This study analyzed the quality of DNA obtained using paper FTA cards prepared directly in the field when compared to the more traditional cetyltrimethylammonium bromide (CTAB)-based extraction methods from silica-dried samples. DNA was extracted using FTA cards according to the manufacturer's protocol. In parallel, CTAB-based extractions were done using the automated AutoGen DNA isolation system. DNA quality for both methods was determined for 15 non-agricultural species collected in situ, by gel separation, spectrophotometry, fluorometry, and successful amplification and sequencing of nuclear and chloroplast gene markers. The FTA card extraction method yielded less concentrated, but also less fragmented samples than the CTAB-based technique. The card-extracted samples provided DNA that could be successfully amplified and sequenced. The FTA cards are also useful because the collected samples do not require refrigeration, extensive laboratory expertise, or as many hazardous chemicals as extractions using the CTAB-based technique. The relative success of the FTA card method in our study suggested that this method could be a valuable tool for studies in plant population genetics and conservation biology that may involve screening of hundreds of individual plants. The FTA cards, like the silica gel samples, do not contain plant material capable of propagation, and therefore do not require permits from the U.S. Department of Agriculture (USDA) Animal and Plant Health Inspection Service (APHIS) for transportation.

Rapid and Specific Detection of Salmonella spp. in Animal Feed Samples by PCR after Culture Enrichment

PubMed Central

Löfström, Charlotta; Knutsson, Rickard; Axelsson, Charlotta Engdahl; Rådström, Peter

2004-01-01

A PCR procedure has been developed for routine analysis of viable Salmonella spp. in feed samples. The objective was to develop a simple PCR-compatible enrichment procedure to enable DNA amplification without any sample pretreatment such as DNA extraction or cell lysis. PCR inhibition by 14 different feed samples and natural background flora was circumvented by the use of the DNA polymerase Tth. This DNA polymerase was found to exhibit a high level of resistance to PCR inhibitors present in these feed samples compared to DyNAzyme II, FastStart Taq, Platinum Taq, Pwo, rTth, Taq, and Tfl. The specificity of the Tth assay was confirmed by testing 101 Salmonella and 43 non-Salmonella strains isolated from feed and food samples. A sample preparation method based on culture enrichment in buffered peptone water and DNA amplification with Tth DNA polymerase was developed. The probability of detecting small numbers of salmonellae in feed, in the presence of natural background flora, was accurately determined and found to follow a logistic regression model. From this model, the probability of detecting 1 CFU per 25 g of feed in artificially contaminated soy samples was calculated and found to be 0.81. The PCR protocol was evaluated on 155 naturally contaminated feed samples and compared to an established culture-based method, NMKL-71. Eight percent of the samples were positive by PCR, compared with 3% with the conventional method. The reasons for the differences in sensitivity are discussed. Use of this method in the routine analysis of animal feed samples would improve safety in the food chain. PMID:14711627

Complete sequence analysis of 18S rDNA based on genomic DNA extraction from individual Demodex mites (Acari: Demodicidae).

PubMed

Zhao, Ya-E; Xu, Ji-Ru; Hu, Li; Wu, Li-Ping; Wang, Zheng-Hang

2012-05-01

The study for the first time attempted to accomplish 18S ribosomal DNA (rDNA) complete sequence amplification and analysis for three Demodex species (Demodex folliculorum, Demodex brevis and Demodex canis) based on gDNA extraction from individual mites. The mites were treated by DNA Release Additive and Hot Start II DNA Polymerase so as to promote mite disruption and increase PCR specificity. Determination of D. folliculorum gDNA showed that the gDNA yield reached the highest at 1 mite, tending to descend with the increase of mite number. The individual mite gDNA was successfully used for 18S rDNA fragment (about 900 bp) amplification examination. The alignments of 18S rDNA complete sequences of individual mite samples and those of pooled mite samples ( ≥ 1000mites/sample) showed over 97% identities for each species, indicating that the gDNA extracted from a single individual mite was as satisfactory as that from pooled mites for PCR amplification. Further pairwise sequence analyses showed that average divergence, genetic distance, transition/transversion or phylogenetic tree could not effectively identify the three Demodex species, largely due to the differentiation in the D. canis isolates. It can be concluded that the individual Demodex mite gDNA can satisfy the molecular study of Demodex. 18S rDNA complete sequence is suitable for interfamily identification in Cheyletoidea, but whether it is suitable for intrafamily identification cannot be confirmed until the ascertainment of the types of Demodex mites parasitizing in dogs. Copyright © 2012 Elsevier Inc. All rights reserved.

RNA interference inhibits herpes simplex virus type 1 isolated from saliva samples and mucocutaneous lesions.

PubMed

Silva, Amanda Perse da; Lopes, Juliana Freitas; Paula, Vanessa Salete de

2014-01-01

The aim of this study was to evaluate the use of RNA interference to inhibit herpes simplex virus type-1 replication in vitro. For herpes simplex virus type-1 gene silencing, three different small interfering RNAs (siRNAs) targeting the herpes simplex virus type-1 UL39 gene (sequence si-UL 39-1, si-UL 39-2, and si-UL 39-3) were used, which encode the large subunit of ribonucleotide reductase, an essential enzyme for DNA synthesis. Herpes simplex virus type-1 was isolated from saliva samples and mucocutaneous lesions from infected patients. All mucocutaneous lesions' samples were positive for herpes simplex virus type-1 by real-time PCR and by virus isolation; all herpes simplex virus type-1 from saliva samples were positive by real-time PCR and 50% were positive by virus isolation. The levels of herpes simplex virus type-1 DNA remaining after siRNA treatment were assessed by real-time PCR, whose results demonstrated that the effect of siRNAs on gene expression depends on siRNA concentration. The three siRNA sequences used were able to inhibit viral replication, assessed by real-time PCR and plaque assays and among them, the sequence si-UL 39-1 was the most effective. This sequence inhibited 99% of herpes simplex virus type-1 replication. The results demonstrate that silencing herpes simplex virus type-1 UL39 expression by siRNAs effectively inhibits herpes simplex virus type-1 replication, suggesting that siRNA based antiviral strategy may be a potential therapeutic alternative. Copyright © 2014. Published by Elsevier Editora Ltda.

An improved protocol for DNA extraction from alkaline soil and sediment samples for constructing metagenomic libraries.

PubMed

Verma, Digvijay; Satyanarayana, T

2011-09-01

An improved single-step protocol has been developed for extracting pure community humic substance-free DNA from alkaline soils and sediments. The method is based on direct cell lysis in the presence of powdered activated charcoal and polyvinylpolypyrrolidone followed by precipitation with polyethyleneglycol and isopropanol. The strategy allows simultaneous isolation and purification of DNA while minimizing the loss of DNA with respect to other available protocols for metagenomic DNA extraction. Moreover, the purity levels are significant, which are difficult to attain with any of the methods reported in the literature for DNA extraction from soils. The DNA thus extracted was free from humic substances and, therefore, could be processed for restriction digestion, PCR amplification as well as for the construction of metagenomic libraries.

Associative diazotrophic bacteria in grass roots and soils from heavy metal contaminated sites.

PubMed

Moreira, Fátima M S; Lange, Anderson; Klauberg-Filho, Osmar; Siqueira, José O; Nóbrega, Rafaela S A; Lima, Adriana S

2008-12-01

This work aimed to evaluate density of associative diazotrophic bacteria populations in soil and grass root samples from heavy metal contaminated sites, and to characterize isolates from these populations, both, phenotypically (Zinc, Cadmium and NaCl tolerance in vitro, and protein profiles) and genotypically (16S rDNA sequencing), as compared to type strains of known diazotrophic species. Densities were evaluated by using NFb, Fam and JNFb media, commonly used for enrichment cultures of diazotrophic bacteria. Bacterial densities found in soil and grass root samples from contaminated sites were similar to those reported for agricultural soils. Azospirillum spp. isolates from contaminated sites and type strains from non-contaminated sites varied substantially in their in vitro tolerance to Zn+2 and Cd+2, being Cd+2 more toxic than Zn+2. Among the most tolerant isolates (UFLA 1S, 1R, S181, S34 and S22), some (1R, S34 and S22) were more tolerant to heavy metals than rhizobia from tropical and temperate soils. The majority of the isolates tolerant to heavy metals were also tolerant to salt stress as indicated by their ability to grow in solid medium supplemented with 30 g L(-1) NaCl. Five isolates exhibited high dissimilarity in protein profiles, and the 16S rDNA sequence analysis of two of them revealed new sequences for Azospirillum.

Detection of processed genetically modified food using CIM monolithic columns for DNA isolation.

PubMed

Jerman, Sergej; Podgornik, Ales; Cankar, Katarina; Cadet, Neza; Skrt, Mihaela; Zel, Jana; Raspor, Peter

2005-02-11

The availability of sufficient quantities of DNA of adequate quality is crucial in polymerase chain reaction (PCR)-based methods for genetically modified food detection. In this work, the suitability of anion-exchange CIM (Convective Interaction Media; BIA Separations, Ljubljana, Slovenia) monolithic columns for isolation of DNA from food was studied. Maize and its derivates corn meal and thermally pretreated corn meal were chosen as model food. Two commercially available CIM disk columns were tested: DEAE (diethylaminoethyl) and QA (quaternary amine). Preliminary separations were performed with standard solution of salmon DNA at different pH values and different NaCl concentrations in mobile phase. DEAE groups and pH 8 were chosen for further isolations of DNA from a complex matrix-food extract. The quality and quantity of isolated DNA were tested on agarose gel electrophoresis, with UV-scanning spectrophotometry, and by amplification with real-time PCR. DNA isolated in this way was of suitable quality for further PCR analyses. The described method is also applicable for DNA isolation from processed foods with decreased DNA content. Furthermore, it is more effective and less time-consuming in comparison with the existing proposed methods for isolation of DNA from plant-derived foods.

Molecular characterization of eimeria species naturally infecting egyptian baldi chickens.

PubMed

Gadelhaq, Sahar M; Arafa, Waleed M; Aboelhadid, Shawky M

2015-01-01

Coccidiosis is a serious protozoal disease of poultry. The identification of Eimeria species has important implications for diagnosis and control as well as for epidemiology. The molecular characterization of Eimeria species infecting Egyptian baladi chickens was investigated. Eimeria species oocysts were harvested from intestines of naturally infected Egyptian baldi chickens. The morphometry characterization of oocysts along with COCCIMORPH software was done. The DNA was extracted initially by freezing and thawing then the prepared samples was subjected to commercial DNA kits. The DNA products were analyzed through conventional polymerase chain reaction by using amplified region (SCAR) marker. The PCR results confirmed the presence of 7 Eimeria species in the examined fecal samples of Egyptian baldi breed with their specific ampilicon sizes being E. acervulina (811bp), E. brunette (626bp), E. tenella (539bp), E. maxima (272bp), E. necatrix (200bp), E. mitis (327bp) and E. praecopx (354bp). A sequencing of the two most predominant species of Eimeria was done, on E. tenella and E. máxima. Analysis of the obtained sequences revealed high identities 99% between Egyptian isolates and the reference one. Similarly, E. maxima isolated from Egyptian baldi chickens showed 98% nucleotide identities with the reference strain. Only single nucleotide substitution was observed among the Egyptian E. tenella isolates (A181G) when compared to the reference one. The Egyptian isolates acquired 4 unique mutations (A68T, C164T, G190A and C227G) in compared with the reference sequence. This is the first time to identify the 7 species of Eimeria from Egyptian baladi chickens.

Archetypal analysis of diverse Pseudomonas aeruginosa transcriptomes reveals adaptation in cystic fibrosis airways

PubMed Central

2013-01-01

Background Analysis of global gene expression by DNA microarrays is widely used in experimental molecular biology. However, the complexity of such high-dimensional data sets makes it difficult to fully understand the underlying biological features present in the data. The aim of this study is to introduce a method for DNA microarray analysis that provides an intuitive interpretation of data through dimension reduction and pattern recognition. We present the first “Archetypal Analysis” of global gene expression. The analysis is based on microarray data from five integrated studies of Pseudomonas aeruginosa isolated from the airways of cystic fibrosis patients. Results Our analysis clustered samples into distinct groups with comprehensible characteristics since the archetypes representing the individual groups are closely related to samples present in the data set. Significant changes in gene expression between different groups identified adaptive changes of the bacteria residing in the cystic fibrosis lung. The analysis suggests a similar gene expression pattern between isolates with a high mutation rate (hypermutators) despite accumulation of different mutations for these isolates. This suggests positive selection in the cystic fibrosis lung environment, and changes in gene expression for these isolates are therefore most likely related to adaptation of the bacteria. Conclusions Archetypal analysis succeeded in identifying adaptive changes of P. aeruginosa. The combination of clustering and matrix factorization made it possible to reveal minor similarities among different groups of data, which other analytical methods failed to identify. We suggest that this analysis could be used to supplement current methods used to analyze DNA microarray data. PMID:24059747

Lentibacillus amyloliquefaciens sp. nov., a halophilic bacterium isolated from saline sediment sample.

PubMed

Wang, Jing-Li; Ma, Ke-Dong; Wang, Yan-Wei; Wang, Hui-Min; Li, Yan-Bin; Zhou, Shan; Chen, Xiao-Rong; Kong, De-Long; Guo, Xiang; He, Ming-Xiong; Ruan, Zhi-Yong

2016-02-01

A Gram-stain positive, non-motile, non-sporogenous, aerobic, rod-shaped and halophilic bacterium, designated LAM0015(T), was isolated from a saline sediment sample collected from Yantai City in China. The isolate was found to be able to grow at NaCl concentrations of 5-25 % (w/v) (optimum: 7-12 %), 15-45 °C (optimum: 35 °C) and pH 5.0-9.0 (optimum: 7.0). The major fatty acids were determined to be anteiso-C15:0 and anteiso-C17:0. The predominant respiratory quinone was identified as MK-7. The cell wall peptidoglycan was determined to contain meso-diaminopimelic acid. The polar lipids were found to be diphosphatidyglycerol, phosphatidylglycerol, five phospholipids and one glycolipid. The DNA G+C content was 43.1 mol% as determined by the T m method. Analysis of the 16S rRNA gene sequence indicated that the isolate belongs within the genus Lentibacillus and is closely related to Lentibacillus persicus DSM 22530(T), Lentibacillus salicampi JCM 11462(T) and Lentibacillus jeotgali JCM 15795(T) with 97.3, 96.7 and 96.4 % sequence similarity, respectively. The DNA-DNA hybridization value between LAM0015(T) and L. persicus DSM 22530(T) was 51.2 ± 1.4 %. Based on its phenotypic, phylogenetic and chemotaxonomic characteristics, strain LAM0015(T) is concluded to represent a novel species of the genus Lentibacillus, for which the name Lentibacillus amyloliquefaciens sp. nov. is proposed. The type strain is LAM0015(T) (=ACCC 06401(T) = JCM 19838(T)).

Application of rapid onsite PCR (TaqMan) for Phytophthora ramorum under U.S. conditions

Treesearch

Kelvin Hughes; Jenny Tomlinson; Neil Boonham; Kelly Ivors; Matteo Garbelotto; Ian Barker

2006-01-01

Currently, diagnosis of Phytophthora ramorum involves sending samples to a laboratory for traditional isolation and morphological characterisation, and/or PCR analysis. This can take as long as 2 weeks from sampling to final diagnosis. However, the Plant Health Group, Central Science Laboratory, has produced on-site DNA extraction and real-time PCR (...

DNA methylation abnormalities in congenital heart disease.

PubMed

Serra-Juhé, Clara; Cuscó, Ivon; Homs, Aïda; Flores, Raquel; Torán, Núria; Pérez-Jurado, Luis A

2015-01-01

Congenital heart defects represent the most common malformation at birth, occurring also in ∼50% of individuals with Down syndrome. Congenital heart defects are thought to have multifactorial etiology, but the main causes are largely unknown. We have explored the global methylation profile of fetal heart DNA in comparison to blood DNA from control subjects: an absolute correlation with the type of tissue was detected. Pathway analysis revealed a significant enrichment of differential methylation at genes related to muscle contraction and cardiomyopathies in the developing heart DNA. We have also searched for abnormal methylation profiles on developing heart-tissue DNA of syndromic and non-syndromic congenital heart defects. On average, 3 regions with aberrant methylation were detected per sample and 18 regions were found differentially methylated between groups. Several epimutations were detected in candidate genes involved in growth regulation, apoptosis and folate pathway. A likely pathogenic hypermethylation of several intragenic sites at the MSX1 gene, involved in outflow tract morphogenesis, was found in a fetus with isolated heart malformation. In addition, hypermethylation of the GATA4 gene was present in fetuses with Down syndrome with or without congenital heart defects, as well as in fetuses with isolated heart malformations. Expression deregulation of the abnormally methylated genes was detected. Our data indicate that epigenetic alterations of relevant genes are present in developing heart DNA in fetuses with both isolated and syndromic heart malformations. These epimutations likely contribute to the pathogenesis of the malformation by cis-acting effects on gene expression.

Genetic diversity of Burkholderia (Proteobacteria) species from the Caatinga and Atlantic rainforest biomes in Bahia, Brazil.

PubMed

Santini, A C; Santos, H R M; Gross, E; Corrêa, R X

2013-03-11

The genus Burkholderia (β-Proteobacteria) currently comprises more than 60 species, including parasites, symbionts and free-living organisms. Several new species of Burkholderia have recently been described showing a great diversity of phenotypes. We examined the diversity of Burkholderia spp in environmental samples collected from Caatinga and Atlantic rainforest biomes of Bahia, Brazil. Legume nodules were collected from five locations, and 16S rDNA and recA genes of the isolated microorganisms were analyzed. Thirty-three contigs of 16S rRNA genes and four contigs of the recA gene related to the genus Burkholderia were obtained. The genetic dissimilarity of the strains ranged from 0 to 2.5% based on 16S rDNA analysis, indicating two main branches: one distinct branch of the dendrogram for the B. cepacia complex and another branch that rendered three major groups, partially reflecting host plants and locations. A dendrogram designed with sequences of this research and those designed with sequences of Burkholderia-type strains and the first hit BLAST had similar topologies. A dendrogram similar to that constructed by analysis of 16S rDNA was obtained using sequences of the fragment of the recA gene. The 16S rDNA sequences enabled sufficient identification of relevant similarities and groupings amongst isolates and the sequences that we obtained. Only 6 of the 33 isolates analyzed via 16S rDNA sequencing showed high similarity with the B. cepacia complex. Thus, over 3/4 of the isolates have potential for biotechnological applications.

Clinical validation of an ultra high-throughput spiral microfluidics for the detection and enrichment of viable circulating tumor cells.

PubMed

Khoo, Bee Luan; Warkiani, Majid Ebrahimi; Tan, Daniel Shao-Weng; Bhagat, Ali Asgar S; Irwin, Darryl; Lau, Dawn Pingxi; Lim, Alvin S T; Lim, Kiat Hon; Krisna, Sai Sakktee; Lim, Wan-Teck; Yap, Yoon Sim; Lee, Soo Chin; Soo, Ross A; Han, Jongyoon; Lim, Chwee Teck

2014-01-01

Circulating tumor cells (CTCs) are cancer cells that can be isolated via liquid biopsy from blood and can be phenotypically and genetically characterized to provide critical information for guiding cancer treatment. Current analysis of CTCs is hindered by the throughput, selectivity and specificity of devices or assays used in CTC detection and isolation. Here, we enriched and characterized putative CTCs from blood samples of patients with both advanced stage metastatic breast and lung cancers using a novel multiplexed spiral microfluidic chip. This system detected putative CTCs under high sensitivity (100%, n = 56) (Breast cancer samples: 12-1275 CTCs/ml; Lung cancer samples: 10-1535 CTCs/ml) rapidly from clinically relevant blood volumes (7.5 ml under 5 min). Blood samples were completely separated into plasma, CTCs and PBMCs components and each fraction were characterized with immunophenotyping (Pan-cytokeratin/CD45, CD44/CD24, EpCAM), fluorescence in-situ hybridization (FISH) (EML4-ALK) or targeted somatic mutation analysis. We used an ultra-sensitive mass spectrometry based system to highlight the presence of an EGFR-activating mutation in both isolated CTCs and plasma cell-free DNA (cf-DNA), and demonstrate concordance with the original tumor-biopsy samples. We have clinically validated our multiplexed microfluidic chip for the ultra high-throughput, low-cost and label-free enrichment of CTCs. Retrieved cells were unlabeled and viable, enabling potential propagation and real-time downstream analysis using next generation sequencing (NGS) or proteomic analysis.

Enhanced genetic analysis of single human bioparticles recovered by simplified micromanipulation from forensic 'touch DNA' evidence.

PubMed

Farash, Katherine; Hanson, Erin K; Ballantyne, Jack

2015-03-09

DNA profiles can be obtained from 'touch DNA' evidence, which comprises microscopic traces of human biological material. Current methods for the recovery of trace DNA employ cotton swabs or adhesive tape to sample an area of interest. However, such a 'blind-swabbing' approach will co-sample cellular material from the different individuals, even if the individuals' cells are located in geographically distinct locations on the item. Thus, some of the DNA mixtures encountered in touch DNA samples are artificially created by the swabbing itself. In some instances, a victim's DNA may be found in significant excess thus masking any potential perpetrator's DNA. In order to circumvent the challenges with standard recovery and analysis methods, we have developed a lower cost, 'smart analysis' method that results in enhanced genetic analysis of touch DNA evidence. We describe an optimized and efficient micromanipulation recovery strategy for the collection of bio-particles present in touch DNA samples, as well as an enhanced amplification strategy involving a one-step 5 µl microvolume lysis/STR amplification to permit the recovery of STR profiles from the bio-particle donor(s). The use of individual or few (i.e., "clumps") bioparticles results in the ability to obtain single source profiles. These procedures represent alternative enhanced techniques for the isolation and analysis of single bioparticles from forensic touch DNA evidence. While not necessary in every forensic investigation, the method could be highly beneficial for the recovery of a single source perpetrator DNA profile in cases involving physical assault (e.g., strangulation) that may not be possible using standard analysis techniques. Additionally, the strategies developed here offer an opportunity to obtain genetic information at the single cell level from a variety of other non-forensic trace biological material.

Nucleic acid isolation

DOEpatents

Longmire, J.L.; Lewis, A.K.; Hildebrand, C.E.

1988-01-21

A method is provided for isolating DNA from eukaryotic cell and flow sorted chromosomes. When DNA is removed from chromosome and cell structure, detergent and proteolytic digestion products remain with the DNA. These products can be removed with organic extraction, but the process steps associated with organic extraction reduces the size of DNA fragments available for experimental use. The present process removes the waste products by dialyzing a solution containing the DNA against a solution containing polyethylene glycol (PEG). The waste products dialyze into the PEG leaving isolated DNA. The remaining DNA has been prepared with fragments containing more than 160 kb. The isolated DNA has been used in conventional protocols without effect on the protocol.

Isolation of human genomic DNA for genetic analysis from premature neonates: a comparison between newborn dried blood spots, whole blood and umbilical cord tissue

PubMed Central

2013-01-01

Background Genotyping requires biological sample collection that must be reliable, convenient and acceptable for patients and clinicians. Finding the most optimal procedure of sample collection for premature neonates who have a very limited blood volume is a particular challenge. The aim of the current study was to evaluate the use of umbilical cord (UC) tissue and newborn dried blood spot (DBS)-extracted genomic DNA (gDNA) as an alternative to venous blood-derived gDNA from premature neonates for molecular genetic analysis. All samples were obtained from premature newborn infants between 24-32 weeks of gestation. Paired blood and UC samples were collected from 31 study participants. gDNA was extracted from ethylenediaminetetraacetic acid (EDTA) anticoagulant-treated blood samples (~500 μl) and newborn DBSs (n = 723) using QIAamp DNA Micro kit (Qiagen Ltd., Crawley, UK); and from UC using Qiagen DNAeasy Blood and Tissue kit (Qiagen Ltd., Crawley, UK). gDNA was quantified and purity confirmed by measuring the A260:A280 ratio. PCR amplification and pyrosequencing was carried out to determine suitability of the gDNA for molecular genetic analysis. Minor allele frequency of two unrelated single nucleotide polymorphisms (SNPs) was calculated using the entire cohort. Results Both whole blood samples and UC tissue provided good quality and yield of gDNA, which was considerably less from newborn DBS. The gDNA purity was also reduced after 3 years of storage of the newborn DBS. PCR amplification of three unrelated genes resulted in clear products in all whole blood and UC samples and 86%-100% of newborn DBS. Genotyping using pyrosequencing showed 100% concordance in the paired UC and whole blood samples. Minor allele frequencies of the two SNPs indicated that no maternal gDNA contamination occurred in the genotyping of the UC samples. Conclusions gDNAs from all three sources are suitable for standard PCR and pyrosequencing assays. Given that UC provide good quality and quantity gDNA with 100% concordance in the genetic analysis with whole blood, it can replace blood sampling from premature infants. This is likely to reduce the stress and potential side effects associated with invasive sample collection and thus, greatly facilitate participant recruitment for genetic studies. PMID:24168095

Rapid Electrokinetic Isolation of Cancer-Related Circulating Cell-Free DNA Directly from Blood

PubMed Central

Sonnenberg, Avery; Marciniak, Jennifer Y.; Rassenti, Laura; Ghia, Emanuela M.; Skowronski, Elaine A.; Manouchehri, Sareh; McCanna, James; Widhopf, George F.; Kipps, Thomas J.; Heller, Michael J.

2014-01-01

BACKGROUND Circulating cell-free DNA (ccf-DNA) is becoming an important biomarker for cancer diagnostics and therapy monitoring. The isolation of ccf-DNA from plasma as a “liquid biopsy” may begin to replace more invasive tissue biopsies for the detection and analysis of cancer-related mutations. Conventional methods for the isolation of ccf-DNA from plasma are costly, time-consuming, and complex, preventing the use of ccf-DNA biomarkers for point-of-care diagnostics and limiting other biomedical research applications. METHODS We used an AC electrokinetic device to rapidly isolate ccf-DNA from 25 μL unprocessed blood. ccf-DNA from 15 chronic lymphocytic leukemia (CLL) patients and 3 healthy individuals was separated into dielectrophoretic (DEP) high-field regions, after which other blood components were removed by a fluidic wash. Concentrated ccf-DNA was detected by fluorescence and eluted for quantification,PCR,and DNA sequencing. The complete process, blood to PCR, required <10 min. ccf-DNA was amplified by PCR with immunoglobulin heavy chain variable region (IGHV)-specific primers to identify the unique IGHV gene expressed by the leukemic B-cell clone, and then sequenced. RESULTS PCR and DNA sequencing results obtained by DEP from 25 μL CLL blood matched results obtained by use of conventional methods for ccf-DNA isolation from 1 mL plasma and for genomic DNA isolation from CLL patient leukemic B cells isolated from 15–20 mL blood. CONCLUSIONS Rapid isolation of ccf-DNA directly from a drop of blood will advance disease-related biomarker research, accelerate the transition from tissue to liquid biopsies, and enable point-of-care diagnostic systems for patient monitoring. PMID:24270796

Rapid electrokinetic isolation of cancer-related circulating cell-free DNA directly from blood.

PubMed

Sonnenberg, Avery; Marciniak, Jennifer Y; Rassenti, Laura; Ghia, Emanuela M; Skowronski, Elaine A; Manouchehri, Sareh; McCanna, James; Widhopf, George F; Kipps, Thomas J; Heller, Michael J

2014-03-01

Circulating cell-free DNA (ccf-DNA) is becoming an important biomarker for cancer diagnostics and therapy monitoring. The isolation of ccf-DNA from plasma as a "liquid biopsy" may begin to replace more invasive tissue biopsies for the detection and analysis of cancer-related mutations. Conventional methods for the isolation of ccf-DNA from plasma are costly, time-consuming, and complex, preventing the use of ccf-DNA biomarkers for point-of-care diagnostics and limiting other biomedical research applications. We used an AC electrokinetic device to rapidly isolate ccf-DNA from 25 μL unprocessed blood. ccf-DNA from 15 chronic lymphocytic leukemia (CLL) patients and 3 healthy individuals was separated into dielectrophoretic (DEP) high-field regions, after which other blood components were removed by a fluidic wash. Concentrated ccf-DNA was detected by fluorescence and eluted for quantification, PCR, and DNA sequencing. The complete process, blood to PCR, required <10 min. ccf-DNA was amplified by PCR with immunoglobulin heavy chain variable region (IGHV)-specific primers to identify the unique IGHV gene expressed by the leukemic B-cell clone, and then sequenced. PCR and DNA sequencing results obtained by DEP from 25 μL CLL blood matched results obtained by use of conventional methods for ccf-DNA isolation from 1 mL plasma and for genomic DNA isolation from CLL patient leukemic B cells isolated from 15-20 mL blood. Rapid isolation of ccf-DNA directly from a drop of blood will advance disease-related biomarker research, accelerate the transition from tissue to liquid biopsies, and enable point-of-care diagnostic systems for patient monitoring.

Genetic characterization of Toxoplasma gondii from pigs from different localities in China by PCR-RFLP.

PubMed

Jiang, Hai-Hai; Huang, Si-Yang; Zhou, Dong-Hui; Zhang, Xiao-Xuan; Su, Chunlei; Deng, Shun-Zhou; Zhu, Xing-Quan

2013-08-07

Toxoplasma gondii is a widely prevalent protozoan parasite that causes serious toxoplasmosis in humans and animals. The present study aimed to determine the genetic diversity of T. gondii isolates from pigs in Jiangxi, Sichuan, Guangdong Provinces and Chongqing Municipality in China using multilocous polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technology. A total of 38 DNA samples were extracted from hilar lymph nodes of pigs with suspected toxoplasmosis, and were detected for the presence of T. gondii by semi-nested PCR of B1 gene. The positive DNA samples were typed at 11 genetic markers, including 10 nuclear loci, namely, SAG1, 5'-SAG2 and 3'-SAG2, alternative SAG2, SAG3, BTUB, GRA6, c22-8, c29-2, L358, PK1, and an apicoplast locus Apico. Twenty-five of the 38 DNA samples were T. gondii B1 gene positive. Complete genotyping data for all loci could be obtained for 17 of the 25 samples. Two genotypes were revealed (ToxoDB PCR-RFLP genotypes #9 and #3). Sixteen samples belong to genotype #9 which is the major lineage in mainland China and one sample belongs to genotype #3 which is Type II variant. To our knowledge, this is the first report of genetic typing of T. gondii isolates from pigs in Jiangxi, Sichuan Province and Chongqing Municipality, and the first report of ToxoDB #3 T. gondii from pigs in China. These results have implications for the prevention and control of foodborne toxoplasmosis in humans.

[Individual identification of cadaver parts after a bomb explosion using oligonucleotide fingerprinting by (GTG)5].

PubMed

Kondo, T; Ohshima, T

1998-01-01

A blind shell suddenly and unexpectedly exploded, and 20 dismembered human remains were discovered. DNA fingerprint was performed to determine whether the 20 human remains were derived from one person or not. DNA was isolated from each of the remains and digested by the restriction enzyme Hinf I and Hae III and hybridized with the oligonucleotide probe (GTG)5. DNA fingerprint using Hinf I demonstrated the same band pattern in 17 out of the 20 remains. However, in the remaining 3 samples, two novel strange bands were observed. DNA fingerprint using Hae III showed completely identical pattern in all of the remains.

DNA isolation protocol effects on nuclear DNA analysis by microarrays, droplet digital PCR, and whole genome sequencing, and on mitochondrial DNA copy number estimation.

PubMed

Nacheva, Elizabeth; Mokretar, Katya; Soenmez, Aynur; Pittman, Alan M; Grace, Colin; Valli, Roberto; Ejaz, Ayesha; Vattathil, Selina; Maserati, Emanuela; Houlden, Henry; Taanman, Jan-Willem; Schapira, Anthony H; Proukakis, Christos

2017-01-01

Potential bias introduced during DNA isolation is inadequately explored, although it could have significant impact on downstream analysis. To investigate this in human brain, we isolated DNA from cerebellum and frontal cortex using spin columns under different conditions, and salting-out. We first analysed DNA using array CGH, which revealed a striking wave pattern suggesting primarily GC-rich cerebellar losses, even against matched frontal cortex DNA, with a similar pattern on a SNP array. The aCGH changes varied with the isolation protocol. Droplet digital PCR of two genes also showed protocol-dependent losses. Whole genome sequencing showed GC-dependent variation in coverage with spin column isolation from cerebellum. We also extracted and sequenced DNA from substantia nigra using salting-out and phenol / chloroform. The mtDNA copy number, assessed by reads mapping to the mitochondrial genome, was higher in substantia nigra when using phenol / chloroform. We thus provide evidence for significant method-dependent bias in DNA isolation from human brain, as reported in rat tissues. This may contribute to array "waves", and could affect copy number determination, particularly if mosaicism is being sought, and sequencing coverage. Variations in isolation protocol may also affect apparent mtDNA abundance.

DNA isolation protocol effects on nuclear DNA analysis by microarrays, droplet digital PCR, and whole genome sequencing, and on mitochondrial DNA copy number estimation

PubMed Central

Nacheva, Elizabeth; Mokretar, Katya; Soenmez, Aynur; Pittman, Alan M.; Grace, Colin; Valli, Roberto; Ejaz, Ayesha; Vattathil, Selina; Maserati, Emanuela; Houlden, Henry; Taanman, Jan-Willem; Schapira, Anthony H.

2017-01-01

Potential bias introduced during DNA isolation is inadequately explored, although it could have significant impact on downstream analysis. To investigate this in human brain, we isolated DNA from cerebellum and frontal cortex using spin columns under different conditions, and salting-out. We first analysed DNA using array CGH, which revealed a striking wave pattern suggesting primarily GC-rich cerebellar losses, even against matched frontal cortex DNA, with a similar pattern on a SNP array. The aCGH changes varied with the isolation protocol. Droplet digital PCR of two genes also showed protocol-dependent losses. Whole genome sequencing showed GC-dependent variation in coverage with spin column isolation from cerebellum. We also extracted and sequenced DNA from substantia nigra using salting-out and phenol / chloroform. The mtDNA copy number, assessed by reads mapping to the mitochondrial genome, was higher in substantia nigra when using phenol / chloroform. We thus provide evidence for significant method-dependent bias in DNA isolation from human brain, as reported in rat tissues. This may contribute to array “waves”, and could affect copy number determination, particularly if mosaicism is being sought, and sequencing coverage. Variations in isolation protocol may also affect apparent mtDNA abundance. PMID:28683077

Morphological and molecular identification of filamentous Aspergillus flavus and Aspergillus parasiticus isolated from compound feeds in South Africa.

PubMed

Iheanacho, Henry E; Njobeh, Patrick B; Dutton, Francis M; Steenkamp, Paul A; Steenkamp, Lucia; Mthombeni, Julian Q; Daru, Barnabas H; Makun, Anthony H

2014-12-01

Isolation of filamentous species of two Aspergillum genera from compound feeds produced in South Africa, and subsequent extraction of their individual DNA in this study, presents a simple but rapid molecular procedure for high through-put analysis of the individual morphological forms. DNA was successfully isolated from the Aspergillus spp. from agar cultures by use of a commercial kit. Agarose gel electrophoresis fractionation of the fungi DNA, showed distinct bands. The DNA extracted by this procedure appears to be relatively pure with a ratio absorbance at 260 and 280 nm. However, the overall morphological and molecular data indicated that 67.5 and 51.1% of feed samples were found to be contaminated with Aspergillus flavus and Aspergillus parasiticus, respectively, with poultry feed having the highest contamination mean level of 5.7 × 105 CFU/g when compared to cattle (mean: 4.0 × 106 CFU/g), pig (mean: 2.7 × 104 CFU/g) and horse (1.0 × 102 CFU) feed. This technique presents a readily achievable, easy to use method in the extraction of filamentous fungal DNA and it's identification. Hence serves as an important tool towards molecular study of these organisms for routine analysis check in monitoring and improving compound feed quality against fungal contamination. Copyright © 2014 Elsevier Ltd. All rights reserved.

Isolation and characterization of a novel violacein-like pigment producing psychrotrophic bacterial species Janthinobacterium svalbardensis sp. nov.

PubMed

Ambrožič Avguštin, Jerneja; Žgur Bertok, Darja; Kostanjšek, Rok; Avguštin, Gorazd

2013-04-01

A bacterial strain designated JA-1, related to Janthinobacterium lividum, was isolated from glacier ice samples from the island Spitsbergen in the Arctic. The strain was tested for phenotypic traits and the most prominent appeared to be the dark red brown to black pigmentation different from the violet pigment of Janthinobacterium, Chromobacterium and Iodobacter. Phylogenetic analysis based on 16S rRNA gene sequences and DNA-DNA hybridization tests showed that strain JA-1 belongs to the genus Janthinobacterium but represents a novel lineage distinct from the two known species of this genus, J. lividum and Janthinobacterium agaricidamnosum. The DNA G + C content of strain JA-1 was determined to be 62.3 mol %. The isolate is a psychrotrophic Gram negative bacterium, rod-shaped with rounded ends, containing intracellular inclusions and one polar flagellum. On the basis of the presented results strain JA-1 is proposed as the type strain of a novel species of the genus Janthinobacterium, for which the name Janthinobacterium svalbardensis sp. nov. is proposed (JA-1(T) = DSM 25734, ZIM B637).

Identification of Lactobacillus plantarum, Lactobacillus pentosus and Lactobacillus fermentum from honey stomach of honeybee

PubMed Central

Tajabadi, Naser; Mardan, Makhdzir; Saari, Nazamid; Mustafa, Shuhaimi; Bahreini, Rasoul; Manap, Mohd Yazid Abdul

2013-01-01

This study aimed to isolate and identify Lactobacillus in the honey stomach of honeybee Apis dorsata. Samples of honeybee were collected from A. dorsata colonies in different bee trees and Lactobacillus bacteria isolated from honey stomachs. Ninety two isolates were Gram-stained and tested for catalase reaction. By using bacterial universal primers, the 16S rDNA gene from DNA of bacterial colonies amplified with polymerase chain reaction (PCR). Forty-nine bacterial 16S rDNA gene were sequenced and entrusted in GenBank. Phylogenetic analysis showed they were different phylotypes of Lactobacillus. Two of them were most closely relevant to the previously described species Lactobacillus plantarum. Other two phylotypes were identified to be closely related to Lactobacillus pentosus. However, only one phylotype was found to be distantly linked to the Lactobacillus fermentum. The outcomes of the present study indicated that L. plantarum, L. pentosus, and L. fermentum were the dominant lactobacilli in the honey stomach of honeybee A. dorsata collected during the dry season from Malaysia forest area - specifically “Melaleuca in Terengganu”. PMID:24516438

Identification of Lactobacillus plantarum, Lactobacillus pentosus and Lactobacillus fermentum from honey stomach of honeybee.

PubMed

Tajabadi, Naser; Mardan, Makhdzir; Saari, Nazamid; Mustafa, Shuhaimi; Bahreini, Rasoul; Manap, Mohd Yazid Abdul

2013-01-01

This study aimed to isolate and identify Lactobacillus in the honey stomach of honeybee Apis dorsata. Samples of honeybee were collected from A. dorsata colonies in different bee trees and Lactobacillus bacteria isolated from honey stomachs. Ninety two isolates were Gram-stained and tested for catalase reaction. By using bacterial universal primers, the 16S rDNA gene from DNA of bacterial colonies amplified with polymerase chain reaction (PCR). Forty-nine bacterial 16S rDNA gene were sequenced and entrusted in GenBank. Phylogenetic analysis showed they were different phylotypes of Lactobacillus. Two of them were most closely relevant to the previously described species Lactobacillus plantarum. Other two phylotypes were identified to be closely related to Lactobacillus pentosus. However, only one phylotype was found to be distantly linked to the Lactobacillus fermentum. The outcomes of the present study indicated that L. plantarum, L. pentosus, and L. fermentum were the dominant lactobacilli in the honey stomach of honeybee A. dorsata collected during the dry season from Malaysia forest area - specifically "Melaleuca in Terengganu".

Environmental Screening for the Scedosporium apiospermum Species Complex in Public Parks in Bangkok, Thailand.

PubMed

Luplertlop, Natthanej; Pumeesat, Potjaman; Muangkaew, Watcharamat; Wongsuk, Thanwa; Alastruey-Izquierdo, Ana

2016-01-01

The Scedosporium apiospermum species complex, comprising filamentous fungal species S. apiospermum sensu stricto, S. boydii, S. aurantiacum, S. dehoogii and S. minutispora, are important pathogens that cause a wide variety of infections. Although some species (S. boydii and S. apiospermum) have been isolated from patients in Thailand, no environmental surveys of these fungi have been performed in Thailand or surrounding countries. In this study, we isolated and identified species of these fungi from 68 soil and 16 water samples randomly collected from 10 parks in Bangkok. After filtration and subsequent inoculation of samples on Scedo-Select III medium, colony morphological examinations and microscopic observations were performed. Scedosporium species were isolated from soil in 8 of the 10 parks, but were only detected in one water sample. Colony morphologies of isolates from 41 of 68 soil samples (60.29%) and 1 of 15 water samples (6.67%) were consistent with that of the S. apiospermum species complex. Each morphological type was selected for species identification based on DNA sequencing and phylogenetic analysis of the β-tubulin gene. Three species of the S. apiospermum species complex were identified: S. apiospermum (71 isolates), S. aurantiacum (6 isolates) and S. dehoogii (5 isolates). In addition, 16 sequences could not be assigned to an exact Scedosporium species. According to our environmental survey, the S. apiospermum species complex is widespread in soil in Bangkok, Thailand.

Environmental Screening for the Scedosporium apiospermum Species Complex in Public Parks in Bangkok, Thailand

PubMed Central

Pumeesat, Potjaman; Muangkaew, Watcharamat; Wongsuk, Thanwa; Alastruey-Izquierdo, Ana

2016-01-01

The Scedosporium apiospermum species complex, comprising filamentous fungal species S. apiospermum sensu stricto, S. boydii, S. aurantiacum, S. dehoogii and S. minutispora, are important pathogens that cause a wide variety of infections. Although some species (S. boydii and S. apiospermum) have been isolated from patients in Thailand, no environmental surveys of these fungi have been performed in Thailand or surrounding countries. In this study, we isolated and identified species of these fungi from 68 soil and 16 water samples randomly collected from 10 parks in Bangkok. After filtration and subsequent inoculation of samples on Scedo-Select III medium, colony morphological examinations and microscopic observations were performed. Scedosporium species were isolated from soil in 8 of the 10 parks, but were only detected in one water sample. Colony morphologies of isolates from 41 of 68 soil samples (60.29%) and 1 of 15 water samples (6.67%) were consistent with that of the S. apiospermum species complex. Each morphological type was selected for species identification based on DNA sequencing and phylogenetic analysis of the β-tubulin gene. Three species of the S. apiospermum species complex were identified: S. apiospermum (71 isolates), S. aurantiacum (6 isolates) and S. dehoogii (5 isolates). In addition, 16 sequences could not be assigned to an exact Scedosporium species. According to our environmental survey, the S. apiospermum species complex is widespread in soil in Bangkok, Thailand. PMID:27467209

Methanogenic archaea isolated from Taiwan's Chelungpu fault.

PubMed

Wu, Sue-Yao; Lai, Mei-Chin

2011-02-01

Terrestrial rocks, petroleum reservoirs, faults, coal seams, and subseafloor gas hydrates contain an abundance of diverse methanoarchaea. However, reports on the isolation, purification, and characterization of methanoarchaea in the subsurface environment are rare. Currently, no studies investigating methanoarchaea within fault environments exist. In this report, we succeeded in obtaining two new methanogen isolates, St545Mb(T) of newly proposed species Methanolobus chelungpuianus and Methanobacterium palustre FG694aF, from the Chelungpu fault, which is the fault that caused a devastating earthquake in central Taiwan in 1999. Strain FG694aF was isolated from a fault gouge sample obtained at 694 m below land surface (mbls) and is an autotrophic, mesophilic, nonmotile, thin, filamentous-rod-shaped organism capable of using H(2)-CO(2) and formate as substrates for methanogenesis. The morphological, biochemical, and physiological characteristics and 16S rRNA gene sequence analysis revealed that this isolate belongs to Methanobacterium palustre. The mesophilic strain St545Mb(T), isolated from a sandstone sample at 545 mbls, is a nonmotile, irregular, coccoid organism that uses methanol and trimethylamine as substrates for methanogenesis. The 16S rRNA gene sequence of strain St545Mb(T) was 99.0% similar to that of Methanolobus psychrophilus strain R15 and was 96 to 97.5% similar to the those of other Methanolobus species. However, the optimal growth temperature and total cell protein profile of strain St545Mb(T) were different from those of M. psychrophilus strain R15, and whole-genome DNA-DNA hybridization revealed less than 20% relatedness between these two strains. On the basis of these observations, we propose that strain St545Mb(T) (DSM 19953(T); BCRC AR10030; JCM 15159) be named Methanolobus chelungpuianus sp. nov. Moreover, the environmental DNA database survey indicates that both Methanolobus chelungpuianus and Methanobacterium palustre are widespread in the subsurface environment.

Massilia sp. BS-1, a novel violacein-producing bacterium isolated from soil.

PubMed

Agematu, Hitosi; Suzuki, Kazuya; Tsuya, Hiroaki

2011-01-01

A novel bacterium, Massilia sp. BS-1, producing violacein and deoxyviolacein was isolated from a soil sample collected from Akita Prefecture, Japan. The 16S ribosomal DNA of strain BS-1 displayed 93% homology with its nearest violacein-producing neighbor, Janthinobacterium lividum. Strain BS-1 grew well in a synthetic medium, but required both L-tryptophan and a small amount of L-histidine to produce violacein.

Efficient recovery of proteins from multiple source samples after TRIzol(®) or TRIzol(®)LS RNA extraction and long-term storage.

PubMed

Simões, André E S; Pereira, Diane M; Amaral, Joana D; Nunes, Ana F; Gomes, Sofia E; Rodrigues, Pedro M; Lo, Adrian C; D'Hooge, Rudi; Steer, Clifford J; Thibodeau, Stephen N; Borralho, Pedro M; Rodrigues, Cecília M P

2013-03-15

Simultaneous isolation of nucleic acids and proteins from a single biological sample facilitates meaningful data interpretation and reduces time, cost and sampling errors. This is particularly relevant for rare human and animal specimens, often scarce, and/or irreplaceable. TRIzol(®) and TRIzol(®)LS are suitable for simultaneous isolation of RNA, DNA and proteins from the same biological sample. These reagents are widely used for RNA and/or DNA isolation, while reports on their use for protein extraction are limited, attributable to technical difficulties in protein solubilisation. TRIzol(®)LS was used for RNA isolation from 284 human colon cancer samples, including normal colon mucosa, tubulovillous adenomas, and colon carcinomas with proficient and deficient mismatch repair system. TRIzol(®) was used for RNA isolation from human colon cancer cells, from brains of transgenic Alzheimer's disease mice model, and from cultured mouse cortical neurons. Following RNA extraction, the TRIzol(®)-chloroform fractions from human colon cancer samples and from mouse hippocampus and frontal cortex were stored for 2 years and 3 months, respectively, at -80°C until used for protein isolation.Simple modifications to the TRIzol(®) manufacturer's protocol, including Urea:SDS solubilization and sonication, allowed improved protein recovery yield compared to the TRIzol(®) manufacturer's protocol. Following SDS-PAGE and Ponceau and Coomassie staining, recovered proteins displayed wide molecular weight range and staining pattern comparable to those obtainable with commonly used protein extraction protocols. We also show that nuclear and cytosolic proteins can be easily extracted and detected by immunoblotting, and that posttranslational modifications, such as protein phosphorylation, are detectable in proteins recovered from TRIzol(®)-chloroform fractions stored for up to 2 years at -80°C. We provide a novel approach to improve protein recovery from samples processed for nucleic acid extraction with TRIzol(®) and TRIzol(®)LS compared to the manufacturer`s protocol, allowing downstream immunoblotting and evaluation of steady-state relative protein expression levels. The method was validated in large sets of samples from multiple sources, including human colon cancer and brains of transgenic Alzheimer's disease mice model, stored in TRIzol(®)-chloroform for up to two years. Collectively, we provide a faster and cheaper alternative to the TRIzol(®) manufacturer`s protein extraction protocol, illustrating the high relevance, and wide applicability, of the present protein isolation method for the immunoblot evaluation of steady-state relative protein expression levels in samples from multiple sources, and following prolonged storage.

Thermal ecology of Naegleria fowleri from a power plant cooling reservoir

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huizinga, H.W.; McLaughlin, G.L.

1990-07-01

The pathogenic, free-living amoeba Naegleria fowleri is the causative agent of human primary amebic meningoencephalitis. N. fowleri has been isolated from thermally elevated aquatic environments worldwide, but temperature factors associated with occurrence of the amoeba remain undefined. In this study, a newly created cooling reservoir (Clinton Lake, Illinois) was surveyed for Naegleria spp. before and after thermal additions from a nuclear power plant. Water and sediment samples were collected from heated and unheated arms of the reservoir and analyzed for the presence of thermophilic Naegleria spp. and pathogenic N. fowleri. Amoebae were identified by morphology, in vitro cultivation, temperature tolerance,more » mouse pathogenicity assay, and DNA restriction fragment length analysis. N. fowleri was isolated from the thermally elevated arm but not from the ambient-temperature arm of the reservoir. The probability of isolating thermophilic Naegleria and pathogenic N. fowleri increased significantly with temperature. Repetitive DNA restriction fragment profiles of the N. fowleri Clinton Lake isolates and a known N. fowleri strain of human origin were homogeneous.« less

Streptomyces gamaensis sp. nov., a novel actinomycete with antifungal activity isolated from soil in Gama, Chad.

PubMed

Zhao, Shanshan; Ye, Lan; Liu, Chongxi; Abagana, Adam Yacoub; Zheng, Weiwei; Sun, Pengyu; Li, Jiansong; Xiang, Wensheng; Wang, Xiangjing

2017-04-01

During an investigation exploring potential sources of novel species and natural products, a novel actinomycete with antifungal activity, designated strain NEAU-Gz11 T , was isolated from a soil sample, which was collected from Gama, Chad. The isolate was found to have morphological and chemotaxonomic characteristics typical of members of the genus Streptomyces. 16S rRNA gene sequence similarity studies showed that strain NEAU-Gz11 T belongs to the genus Streptomyces with high sequence similarity to Streptomyces hiroshimensis JCM 4098 T (98.0 %). Similarities to other type strains of the genus Streptomyces were lower than 98.0 %. However, the physiological and biochemical characteristics and low levels of DNA-DNA relatedness could differentiate the isolate genotypically and phenotypically from S. hiroshimensis JCM 4098 T . Therefore, the strain is concluded to represent a novel species of the genus Streptomyces, for which the name Streptomyces gamaensis sp. nov. is proposed. The type strain is NEAU-Gz11 T (=CGMCC 4.7304 T =DSM 101531 T ).

Does Extracellular DNA Production Vary in Staphylococcal Biofilms Isolated From Infected Implants versus Controls?

PubMed

Zatorska, Beata; Groger, Marion; Moser, Doris; Diab-Elschahawi, Magda; Lusignani, Luigi Segagni; Presterl, Elisabeth

2017-08-01

Prosthetic implant infections caused by Staphylococcus aureus and epidermidis are major challenges for early diagnosis and treatment owing to biofilm formation on the implant surface. Extracellular DNA (eDNA) is actively excreted from bacterial cells in biofilms, contributing to biofilm stability, and may offer promise in the detection or treatment of such infections. (1) Does DNA structure change during biofilm formation? (2) Are there time-dependent differences in eDNA production during biofilm formation? (3) Is there differential eDNA production between clinical and control Staphylococcal isolates? (4) Is eDNA production correlated to biofilm thickness? We investigated eDNA presence during biofilm formation in 60 clinical and 30 control isolates of S aureus and S epidermidis. The clinical isolates were isolated from patients with infections of orthopaedic prostheses and implants: 30 from infected hip prostheses and 30 from infected knee prostheses. The control isolates were taken from healthy volunteers who had not been exposed to antibiotics and a hospital environment during the previous 3 and 12 months, respectively. Control S epidermidis was isolated from the skin of the antecubital fossa, and control S aureus was isolated from the nares. For the biofilm experiments the following methods were used to detect eDNA: (1) fluorescent staining with 4',6-diamidino-2-phenylindole (DAPI), (2) eDNA extraction using a commercial kit, and (3) confocal laser scanning microscopy for 24-hour biofilm observation using propidium iodide and concanavalin-A staining; TOTO ® -1 and SYTO ® 60 staining were used for observation and quantification of eDNA after 6 and 24 hours of biofilm formation. Additionally antibiotic resistance was described. eDNA production as observed by confocal laser scanning microscopy was greater in clinical isolates than controls (clinical isolates mean ± SD: 1.84% ± 1.31%; control mean ± SD: 1.17% ± 1.37%; p < 0.005) after 6 hours of biofilm formation. After 24 hours, the amount of eDNA was greater in biofilms of S epidermidis than in biofilms of S aureus (S aureus mean ± SD: 1.35% ± 2.0%; S epidermidis mean ± SD: 6.42% ± 10.6%; p < 0.05). Clinical isolates of S aureus and S epidermidis produced more eDNA than control isolates at 6 hours of biofilm formation. The extraction method also showed that clinical isolates produced substantially greater amounts of eDNA than controls. S aureus and S epidermidis exhibit a differential production of DNA with time. Clinical isolates associated with implant infections produce greater amounts of eDNA than controls. Future research might focus on the diagnostic value of eDNA as a surrogate laboratory marker for biofilm formation in implant infections. eDNA should be considered as a potential future diagnostic tool or even a possible target to modify biofilms for successful treatment of biofilm-associated infections.

Lab on a chip genotyping for Brucella spp. based on 15-loci multi locus VNTR analysis.

PubMed

De Santis, Riccardo; Ciammaruconi, Andrea; Faggioni, Giovanni; D'Amelio, Raffaele; Marianelli, Cinzia; Lista, Florigio

2009-04-07

Brucellosis is an important zoonosis caused by the genus Brucella. In addition Brucella represents potential biological warfare agents due to the high contagious rates for humans and animals. Therefore, the strain typing epidemiological tool may be crucial for tracing back source of infection in outbreaks and discriminating naturally occurring outbreaks versus bioterroristic event. A Multiple Locus Variable-number tandem repeats (VNTR) Analysis (MLVA) assay based on 15 polymorphic markers was previously described. The obtained MLVA band profiles may be resolved by techniques ranging from low cost manual agarose gels to the more expensive capillary electrophoresis sequencing. In this paper a rapid, accurate and reproducible system, based on the Lab on a chip technology was set up for Brucella spp. genotyping. Seventeen DNA samples of Brucella strains isolated in Sicily, previously genotyped, and twelve DNA samples, provided by MLVA Brucella VNTR ring trial, were analyzed by MLVA-15 on Agilent 2100. The DNA fragment sizes produced by Agilent, compared with those expected, showed discrepancies; therefore, in order to assign the correct alleles to the Agilent DNA fragment sizes, a conversion table was produced. In order to validate the system twelve unknown DNA samples were analyzed by this method obtaining a full concordance with the VNTR ring trial results. In this paper we described a rapid and specific detection method for the characterization of Brucella isolates. The comparison of the MLVA typing data produced by Agilent system with the data obtained by standard sequencing or ethidium bromide slab gel electrophoresis showed a general concordance of the results. Therefore this platform represents a fair compromise among costs, speed and specificity compared to any conventional molecular typing technique.

Use of DNA from human stools to detect aberrant CpG island methylation of genes implicated in colorectal cancer.

PubMed

Belshaw, Nigel J; Elliott, Giles O; Williams, Elizabeth A; Bradburn, David M; Mills, Sarah J; Mathers, John C; Johnson, Ian T

2004-09-01

Hypermethylation of cytosine residues in the CpG islands of tumor suppressor genes is a key mechanism of colorectal carcinogenesis. Detection and quantification of CpG island methylation in human DNA isolated from stools might provide a novel strategy for the detection and investigation of colorectal neoplasia. To explore the feasibility of this approach, colorectal biopsies and fecal samples were obtained from 32 patients attending for colonoscopy or surgery, who were found to have adenomatous polyps, colorectal cancer, or no evidence of neoplasia. A further 18 fecal samples were obtained from healthy volunteers, with no bowel symptoms. Isolated DNA was modified with sodium bisulfite and analyzed by methylation-specific PCR and combined bisulfite restriction analysis for CpG island methylation of ESR1, MGMT, HPP1, p16(INK4a), APC, and MLH1. CpG island methylation was readily detectable in both mucosal and fecal DNA with methylation-specific PCR. Using combined bisulfite restriction analysis, it was established that, in volunteers from whom biopsies were available, the levels of methylation at two CpG sites within ESR1 assayed using fecal DNA were significantly correlated with methylation in DNA from colorectal mucosa. Thus, noninvasive techniques can be used to obtain quantitative information about the level of CpG island methylation in human colorectal mucosa. The methods described here could be applied to a much expanded range of genes and may be valuable both for screening purposes and to provide greater insight into the functional consequences of epigenetic changes in the colorectal mucosa of free-living individuals.

Autoantibodies associated with RNA are more enriched than anti-dsDNA antibodies in circulating immune complexes in SLE.

PubMed

Ahlin, E; Mathsson, L; Eloranta, M-L; Jonsdottir, T; Gunnarsson, I; Rönnblom, L; Rönnelid, J

2012-05-01

To what extent different autoantibodies accumulate in systemic lupus erythematosus (SLE) immune complexes (ICs), and whether such accumulation is associated with disease activity has been investigated. ICs were isolated from SLE sera by both polyethylene glycol (PEG) precipitation and C1q-binding. Autoantibody specificities were determined using a lineblot assay quantified by densitometry. To compare the relative levels of autoantibodies, levels were normalized to the total levels of IgG measured by ELISA in sera and parallel ICs. Samples were investigated both in a cross-sectional design as well as in a paired design with samples obtained during both active and inactive SLE. All investigated autoantibody specificities except anti-dsDNA were enriched in circulating ICs as compared with parallel sera. The group of antibodies against RNA-associated antigens (anti-RNP/Sm, anti-Sm, anti-SSA/Ro60, anti-SSA/Ro52, anti-SSB/La) all exhibited higher median enrichment than the DNA-associated (anti-dsDNA, anti-histones, anti-nucleosomes) or cytoplasmic (anti-ribosomal P) antigens. In particular autoantibodies against RNP/Sm and SSA/Ro52 had the highest degree of enrichment in SLE PEG precipitates. These findings were corroborated by analysis of autoantibody content in C1q-bound ICs. There was no difference in degree of IC accumulation of the investigated autoantibodies during active and inactive SLE. Our findings demonstrate a difference in enrichment between autoantibodies against RNA- and DNA-associated autoantigens in isolated SLE IC, suggesting that the RNA-associated autoantibodies are more prone to form circulating ICs in SLE, in contrast to antibodies against DNA-associated autoantigens such as dsDNA. These finding have implications in understanding mechanisms of differential autoantibody accumulation in target organs in SLE.

[Variation of mini- and microsatellite DNA markers in populations of parthenogenetic rock lizard Darevskia rostombekovi].

PubMed

Martirosian, I A; Ryskov, A P; Petrosian, V G; Arakelian, M S; Aslanian, A V; Danielian, F D; Darevskiĭ, I S; Tokarskaia, O N

2002-06-01

Variation and clonal diversity in populations of the parthenogenetic rock lizard Darevskia rostombekovi was examined by means of multilocus DNA fingerprinting using mini- and microsatellite DNA markers M13, (GATA)4, and (TCC)50). The animals examined were shown to exhibit a clonally inherited, species-specific pattern of DNA markers (fingerprint profile) that is different from the species-specific patterns of parthenogenetic species D. dahli, D. armeniaca, and D. unisexualis. The mean intraspecific similarity index S was 0.950 (0.003) for a sample of 19 animals from three isolated populations of North Armenia. This significantly differed from the estimate of this parameter for a sample of 21 animals including two individuals from mountainous, relict population from the vicinity of the Sevan Lake, which was equal to 0.875 (0.001). A comparison of DNA fingerprints showed differences between 21 individuals attaining 79 DNA fragments of 1801 mini- and microsatellite markers included in the analysis. The results obtained show that intraspecific variation in D. rostombekovi is higher than that in the previously studied parthenogenetic species D. dahli (S = 0.962) and D. unisexualis (S = 0.950) (P < 0.001). Taking into account that D. rostombekovi is considered monoclonal on the basis of allozyme data, the problem of clonal variability is discussed with regard to the evidence on nuclear DNA markers. It is suggested that the hybrid karyotype of D. rostombekovi, which is more unstable than that of D. dahli and D. unisexualis, generates a series of chromosomal rearrangements (mutations). This may lead to the appearance of a geographically isolated chromosomal race (clone) in the population inhabiting the southeastern coast of the Sevan Lake.

Nucleic acid isolation process

DOEpatents

Longmire, Jonathan L.; Lewis, Annette K.; Hildebrand, Carl E.

1990-01-01

A method is provided for isolating DNA from eukaryotic cell and flow sorted chromosomes. When DNA is removed from chromosome and cell structure, detergent and proteolytic digestion products remain with the DNA. These products can be removed with organic extraction, but the process steps associated with organic extraction reduce the size of DNA fragments available for experimental use. The present process removes the waste products by dialyzing a solution containing the DNA against a solution containing polyethylene glycol (PEG). The waste products dialyze into the PEG leaving isolated DNA. The remaining DNA has been prepared with fragments containing more than 160 kb. The isolated DNA has been used in conventional protocols without affect on the protocol.

Isolation and molecular identification of keratinophilic fungi from public parks soil in Shiraz, Iran.

PubMed

Pakshir, Keyvan; Ghiasi, Moosa Rahimi; Zomorodian, Kamiar; Gharavi, Ali Reza

2013-01-01

Keratinophilic fungi are an important group of fungi that live in soil. The aim of this study was to isolate and identify keratinophilic fungi from the soil of different parks in Shiraz. A total of 196 soil samples from 43 parks were collected. Isolation of the fungi was performed by hair bait technique. The isolated colonies were identified by morphologic feature of macro- and microconidia and molecular method, using DNA sequence analysis. ITS region of ribosomal DNA was amplified and the PCR products were sequenced. Results. 411 isolates from 22 genera were identified. Fusarium (23.8%), Chrysosporium (13.13%), Acremonium (12.65%), Penicillium (12.39%), Microsporum gypseum (1.94%), Bionectria ochroleuca (1.21%), Bipolaris spicifera (1.21%), Scedosporium apiospermum (0.82%), Phialophora reptans (0.82%), Cephalosporium curtipes (0.49%), Scedosporium dehoogii (0.24%), Ochroconis constricta (0.24%), Nectria mauritiicola (0.49%), Chaetomium (0.49%), Scopulariopsis (0.24%), Malbranchea (0.24%), and Tritirachium (0.24%) were the most important isolates. Most of the fungi were isolated from the soils with the PH range of 7 to 8. Our study results showed that many keratinophilic fungi isolated from the parks soil are important for public health and children are an important group at a high risk of being exposed to these fungi.

Characterization of Vibrio parahaemolyticus causing acute hepatopancreatic necrosis disease in southern Thailand.

PubMed

Kongrueng, J; Yingkajorn, M; Bunpa, S; Sermwittayawong, N; Singkhamanan, K; Vuddhakul, V

2015-11-01

Vibrio parahaemolyticus was isolated from shrimp of five farms located in the Pattani and Songkhla provinces of southern Thailand. Using a PCR method targeted to the unique DNA sequences derived from the plasmid (AP2 primers) and the toxin gene (AP3 primers) of V. parahaemolyticus that caused acute hepatopancreatic necrosis disease (AHPND), a total of 33 of 108 isolates were positive. In contrast, all 63 and 66 isolates of clinical and environmental V. parahaemolyticus, respectively, obtained previously from 2008 to 2014 from the same area were negative. This implied that these strains were likely to be the cause of the outbreak of AHPND in this area. Intestinal samples proved to be a better source for the isolation of V. parahaemolyticus AHPND than the hepatopancreas. All isolates were investigated for haemolytic activity, virulence genes, serotypes, genotypes and antibiotic susceptibility. All the AHPND isolates had a unique O antigen, but small variations of the K antigens were detected from different farms. In addition, the DNA profiles of V. parahaemolyticus AHPND isolates were similar, but distinct from those clinical and environmental isolates. It is postulated that the causative agent of AHPND might have originated from one clone and then slightly different serotypes subsequently developed. © 2014 John Wiley & Sons Ltd.

Genetic variability among Schistosoma japonicum isolates from the Philippines, Japan and China revealed by sequence analysis of three mitochondrial genes.

PubMed

Chen, Fen; Li, Juan; Sugiyama, Hiromu; Zhou, Dong-Hui; Song, Hui-Qun; Zhao, Guang-Hui; Zhu, Xing-Quan

2015-02-01

The present study examined sequence variability in the mitochondrial (mt) protein-coding genes cytochrome b (cytb), NADH dehydrogenase subunits 2 and 6 (nad2 and nad6) among 24 isolates of Schistosoma japonicum from different endemic regions in the Philippines, Japan and China. The complete cytb, nad2 and nad6 genes were amplified and sequenced separately from individual schistosome. Sequence variations for isolates from the Philippines were 0-0.5% for cytb, 0-0.6% for nad2, and 0-0.9% for nad6. Variation was 0-0.5%, 0.1-0.8%, 0-0.7% for corresponding genes for schistosome samples from mainland China. For worms in Japan, genetic variations were 0-0.2%, 0.1-0.2% and 0 for the three genes, respectively. Sequence variations were 0-1.0%, 0-1.8% and 0-1.1% for cytb, nad2 and nad6, respectively, among schistosome isolates from different geographical strains in the Philippines, Japan and China. Of the three countries, lowest sequence variations were found between isolates from mainland China and the Philippines and highest were detected between Japan and the Philippines in three mtDNA genes. Phylogenetic analyses based on the combined sequences of cytb, nad2 and nad6 revealed that all isolates in the Philippines clustered together sistered to samples from Yunnan and Zhejiang provinces in China, while isolates from Yamanashi in Japan were in a solitary clade. These results demonstrated the usefulness of the combined three mtDNA sequences for studying genetic diversity and population structure among S. japonicum isolates from the Philippines, China and Japan.

Measurement of indicator genes using global complementary DNA (cDNA) amplification, by polyadenylic acid reverse transcriptase polymerase chain reaction (poly A RT-PCR): A feasibility study using paired samples from tissue and ductal juice in patients undergoing pancreatoduodenectomy.

PubMed

Sanyal, Sudip; Siriwardena, Ajith K; Byers, Richard

2018-06-01

The aim of this study is to compare gene expression profiles in RNA isolated from pancreatic ductal juice with the RNA expression profiles of the same genes from matched intra-operative tissue samples from pancreatic tumours. Intra-operative sampling of pancreatic juice and collection of matched tissue samples was undertaken in patients undergoing pancreatoduodenectomy for clinically suspected pancreatic cancer and a precursor lesion, main-duct intraductal papillary mucinous neoplasm. RNA was isolated and Poly A PCR was used to globally amplify the RNA. Real-time polymerase chain reaction (RT-PCR) was used to measure expression levels of 17 genes selected from microarray studies. Spearman's rank correlation test was used to examine the relationship of gene expression between pancreatic juice and tissue. The study was approved by Regional Ethics Committee. Mesothelin (MSLN) showed significant correlation (p < 0.008) in expression levels between paired pancreatic juice and tissue samples in pancreas cancer. In intraductal papillary mucinous neoplasms (IPMN), Matrix Metalloproteinase 7 (MMP7), showed significant correlation (p < 0.01) in the expression levels between paired pancreatic juice and tissue samples. This study confirms that RNA analysis of paired pancreatic juice and tissue samples and establishment of cDNA using poly A PCR is technically feasible. Application of the technique to non-invasively obtained pancreatic juice during endoscopic assessment of tumours and the use of gene arrays of cancer indicator genes are the next steps in development of this technique. Copyright © 2018 IAP and EPC. Published by Elsevier B.V. All rights reserved.

Molecular Diagnosis of Invasive Aspergillosis and Detection of Azole Resistance by a Newly Commercialized PCR Kit

PubMed Central

Gabriel, Frédéric; Gaboyard, Manuel; Lagardere, Gaëlle; Audebert, Lucile; Quesne, Gilles; Godichaud, Sandrine; Verweij, Paul E.; Accoceberry, Isabelle

2017-01-01

ABSTRACT Aspergillus fumigatus is the main species responsible for aspergillosis in humans. The diagnosis of aspergillosis remains difficult, and the rapid emergence of azole resistance in A. fumigatus is worrisome. The aim of this study was to validate the new MycoGENIE A. fumigatus real-time PCR kit and to evaluate its performance on clinical samples for the detection of A. fumigatus and its azole resistance. This multiplex assay detects DNA from the A. fumigatus species complex by targeting the multicopy 28S rRNA gene and specific TR34 and L98H mutations in the single-copy-number cyp51A gene of A. fumigatus. The specificity of cyp51A mutation detection was assessed by testing DNA samples from 25 wild-type or mutated clinical A. fumigatus isolates. Clinical validation was performed on 88 respiratory samples obtained from 62 patients and on 69 serum samples obtained from 16 patients with proven or probable aspergillosis and 13 patients without aspergillosis. The limit of detection was <1 copy for the Aspergillus 28S rRNA gene and 6 copies for the cyp51A gene harboring the TR34 and L98H alterations. No cross-reactivity was detected with various fungi and bacteria. All isolates harboring the TR34 and L98H mutations were accurately detected by quantitative PCR (qPCR) analysis. With respiratory samples, qPCR results showed a sensitivity and specificity of 92.9% and 90.1%, respectively, while with serum samples, the sensitivity and specificity were 100% and 84.6%, respectively. Our study demonstrated that this new real-time PCR kit enables sensitive and rapid detection of A. fumigatus DNA and azole resistance due to TR34 and L98H mutations in clinical samples. PMID:28814586

Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-Rich DNA, and nuclear DNA analyses

USGS Publications Warehouse

Freeman, S.; Pham, M.; Rodriguez, R.J.

1993-01-01

Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-rich DNA, and nuclear DNA analyses. Experimental Mycology 17, 309-322. Isolates of Colletotrichum were grouped into 10 separate species based on arbitrarily primed PCR (ap-PCR), A + T-rich DNA (AT-DNA) and nuclear DNA banding patterns. In general, the grouping of Colletotrichum isolates by these molecular approaches corresponded to that done by classical taxonomic identification, however, some exceptions were observed. PCR amplification of genomic DNA using four different primers allowed for reliable differentiation between isolates of the 10 species. HaeIII digestion patterns of AT-DNA also distinguished between species of Colletotrichum by generating species-specific band patterns. In addition, hybridization of the repetitive DNA element (GcpR1) to genomic DNA identified a unique set of Pst 1-digested nuclear DNA fragments in each of the 10 species of Colletotrichum tested. Multiple isolates of C. acutatum, C. coccodes, C. fragariae, C. lindemuthianum, C. magna, C. orbiculare, C. graminicola from maize, and C. graminicola from sorghum showed 86-100% intraspecies similarity based on ap-PCR and AT-DNA analyses. Interspecies similarity determined by ap-PCR and AT-DNA analyses varied between 0 and 33%. Three distinct banding patterns were detected in isolates of C. gloeosporioides from strawberry. Similarly, three different banding patterns were observed among isolates of C. musae from diseased banana.

Genotype identification of human cystic echinococcosis in Isfahan, central Iran.

PubMed

Kia, Eshrat Bigom; Rahimi, Hamidreza; Sharbatkhori, Mitra; Talebi, Ardeshir; Fasihi Harandi, Majid; Mirhendi, Hossein

2010-08-01

Echinococcosis/hydatidosis is one of the most important zoonotic diseases commonly found in different regions of Iran with a major economic and public health importance. In the current study, Echinococcus granulosus isolates were collected from hospitalized patients in Isfahan, central Iran. The genotypes of 30 samples were determined by polymerase chain reaction amplification of internal transcribed spacer-1 region of ribosomal DNA, followed by restriction fragment length polymorphism (RFLP) with two restriction enzymes namely AluI and MspI. As expected, each isolate yielded an approximately 1-kbp DNA fragment on the electrophoresis gel. According to RFLP results for both enzymes, all isolates had an equal pattern indicating the G1 genotype. Our findings confirmed that G1 is the dominant genotype of cystic echinococcosis in human in central Iran, with predilection to different organs including liver, lung, and brain, and warrants the importance of sheep dog cycle in public health.

First Isolates of Leptospira spp., from Rodents Captured in Angola

PubMed Central

Fortes-Gabriel, Elsa; Carreira, Teresa; Vieira, Maria Luísa

2016-01-01

Rodents play an important role in the transmission of pathogenic Leptospira spp. However, in Angola, neither the natural reservoirs of these spirochetes nor leptospirosis diagnosis has been considered. Regarding this gap, we captured rodents in Luanda and Huambo provinces to identify circulating Leptospira spp. Rodent kidney tissue was cultured and DNA amplified and sequenced. Culture isolates were evaluated for pathogenic status and typing with rabbit antisera; polymerase chain reaction (PCR) and sequencing were also performed. A total of 37 rodents were captured: Rattus rattus (15, 40.5%), Rattus norvegicus (9, 24.3%), and Mus musculus (13, 35.2%). Leptospiral DNA was amplified in eight (21.6%) kidney samples. From the cultures, we obtained four (10.8%) Leptospira isolates belonging to the Icterohaemorrhagiae and Ballum serogroups of Leptospira interrogans and Leptospira borgpetersenii genospecies, respectively. This study provides information about circulating leptospires spread by rats and mice in Angola. PMID:26928840

Sensitive life detection strategies for low-biomass environments: optimizing extraction of nucleic acids adsorbing to terrestrial and Mars analogue minerals.

PubMed

Direito, Susana O L; Marees, Andries; Röling, Wilfred F M

2012-07-01

The adsorption of nucleic acids to mineral matrixes can result in low extraction yields and negatively influences molecular microbial ecology studies, in particular for low-biomass environments on Earth and Mars. We determined the recovery of nucleic acids from a range of minerals relevant to Earth and Mars. Clay minerals, but also other silicates and nonsilicates, showed very low recovery (< 1%). Consequently, optimization of DNA extraction was directed towards clays. The high temperatures and acidic conditions used in some methods to dissolve mineral matrices proved to destruct DNA. The most efficient method comprised a high phosphate solution (P/EtOH; 1 M phosphate, 15% ethanol buffer at pH 8) introduced at the cell-lysing step in DNA extraction, to promote chemical competition with DNA for adsorption sites. This solution increased DNA yield from clay samples spiked with known quantities of cells up to nearly 100-fold. DNA recovery was also enhanced from several mineral samples retrieved from an aquifer, while maintaining reproducible DGGE profiles. DGGE profiles were obtained for a clay sample for which no profile could be generated with the standard DNA isolation protocol. Mineralogy influenced microbial community composition. The method also proved suitable for the recovery of low molecular weight DNA (< 1.5 kb). © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Portability of tag SNPs across isolated population groups: an example from India.

PubMed

Sarkar Roy, N; Farheen, S; Roy, N; Sengupta, S; Majumder, P P

2008-01-01

Isolated population groups are useful in conducting association studies of complex diseases to avoid various pitfalls, including those arising from population stratification. Since DNA resequencing is expensive, it is recommended that genotyping be carried out at tagSNP (tSNP) loci. For this, tSNPs identified in one isolated population need to be used in another. Unless tSNPs are highly portable across populations this strategy may result in loss of information in association studies. We examined the issue of tSNP portability by sampling individuals from 10 isolated ethnic groups from India. We generated DNA resequencing data pertaining to 3 genomic regions and identified tSNPs in each population. We defined an index of tSNP portability and showed that portability is low across isolated Indian ethnic groups. The extent of portability did not significantly correlate with genetic similarity among the populations studied here. We also analyzed our data with sequence data from individuals of African and European descent. Our results indicated that it may be necessary to carry out resequencing in a small number of individuals to discover SNPs and identify tSNPs in the specific isolated population in which a disease association study is to be conducted.

Identification and susceptibility of clinical isolates of Candida spp. to killer toxins.

PubMed

Robledo-Leal, E; Rivera-Morales, L G; Sangorrín, M P; González, G M; Ramos-Alfano, G; Adame-Rodriguez, J M; Alcocer-Gonzalez, J M; Arechiga-Carvajal, E T; Rodriguez-Padilla, C

2018-02-01

Although invasive infections and mortality caused by Candida species are increasing among compromised patients, resistance to common antifungal agents is also an increasing problem. We analyzed 60 yeasts isolated from patients with invasive candidiasis using a PCR/RFLP strategy based on the internal transcribed spacer (ITS2) region to identify different Candida pathogenic species. PCR analysis was performed from genomic DNA with a primer pair of the ITS2-5.8S rDNA region. PCR-positive samples were characterized by RFLP. Restriction resulted in 23 isolates identified as C. albicans using AlwI, 24 isolates as C. parapsilosis using RsaI, and 13 as C. tropicalis using XmaI. Then, a group of all isolates were evaluated for their susceptibility to a panel of previously described killer yeasts, resulting in 75% being susceptible to at least one killer yeast while the remaining were not inhibited by any strain. C. albicans was the most susceptible group while C. tropicalis had the fewest inhibitions. No species-specific pattern of inhibition was obtained with this panel of killer yeasts. Metschnikowia pulcherrima, Pichia kluyveri and Wickerhamomyces anomalus were the strains that inhibited the most isolates of Candida spp.

Streptococcus oriloxodontae sp. nov., isolated from the oral cavities of elephants.

PubMed

Shinozaki-Kuwahara, Noriko; Saito, Masanori; Hirasawa, Masatomo; Takada, Kazuko

2014-11-01

Two strains were isolated from oral cavity samples of healthy elephants. The isolates were Gram-positive, catalase-negative, coccus-shaped organisms that were tentatively identified as a streptococcal species based on the results of biochemical tests. Comparative 16S rRNA gene sequence analysis suggested classification of these organisms in the genus Streptococcus with Streptococcus criceti ATCC 19642(T) and Streptococcus orisuis NUM 1001(T) as their closest phylogenetic neighbours with 98.2 and 96.9% gene sequence similarity, respectively. When multi-locus sequence analysis using four housekeeping genes, groEL, rpoB, gyrB and sodA, was carried out, similarity of concatenated sequences of the four housekeeping genes from the new isolates and Streptococcus mutans was 89.7%. DNA-DNA hybridization experiments suggested that the new isolates were distinct from S. criceti and other species of the genus Streptococcus. On the basis of genotypic and phenotypic differences, it is proposed that the novel isolates are classified in the genus Streptococcus as representatives of Streptococcus oriloxodontae sp. nov. The type strain of S. oriloxodontae is NUM 2101(T) ( =JCM 19285(T) =DSM 27377(T)). © 2014 IUMS.

Population Structure and Phylogeography in Nassau Grouper (Epinephelus striatus), a Mass-Aggregating Marine Fish

PubMed Central

Jackson, Alexis M.; Semmens, Brice X.; Sadovy de Mitcheson, Yvonne; Nemeth, Richard S.; Heppell, Scott A.; Bush, Phillippe G.; Aguilar-Perera, Alfonso; Claydon, John A. B.; Calosso, Marta C.; Sealey, Kathleen S.; Schärer, Michelle T.; Bernardi, Giacomo

2014-01-01

To address patterns of genetic connectivity in a mass-aggregating marine fish, we analyzed genetic variation in mitochondrial DNA (mtDNA), microsatellites, and single nucleotide polymorphisms (SNPs) for Nassau grouper (Epinephelus striatus). We expected Nassau grouper to exhibit genetic differentiation among its subpopulations due to its reproductive behavior and retentive oceanographic conditions experienced across the Caribbean basin. All samples were genotyped for two mitochondrial markers and 9 microsatellite loci, and a subset of samples were genotyped for 4,234 SNPs. We found evidence of genetic differentiation in a Caribbean-wide study of this mass-aggregating marine fish using mtDNA (FST = 0.206, p<0.001), microsatellites (FST = 0.002, p = 0.004) and SNPs (FST = 0.002, p = 0.014), and identified three potential barriers to larval dispersal. Genetically isolated regions identified in our work mirror those seen for other invertebrate and fish species in the Caribbean basin. Oceanographic regimes in the Caribbean may largely explain patterns of genetic differentiation among Nassau grouper subpopulations. Regional patterns observed warrant standardization of fisheries management and conservation initiatives among countries within genetically isolated regions. PMID:24830641

A Blood-based Test for the Detection of ROS1 and RET Fusion Transcripts from Circulating Ribonucleic Acid Using Digital Polymerase Chain Reaction

PubMed Central

Mellert, Hestia S.; Alexander, Kristin E.; Jackson, Leisa P.; Pestano, Gary A.

2018-01-01

We have developed novel methods for the isolation and characterization of tumor-derived circulating ribonucleic acid (cRNA) for blood-based liquid biopsy. Robust detection of cRNA recovered from blood represents a solution to a critical unmet need in clinical diagnostics. The test begins with the collection of whole blood into blood collection tubes containing preservatives that stabilize cRNA. Cell-free, exosomal, and platelet-associated RNA is isolated from plasma in this test system. The cRNA is reverse transcribed to complementary DNA (cDNA) and amplified using digital polymerase chain reaction (dPCR). Samples are evaluated for both the target biomarker as well as a control gene. Test validation included limit of detection, accuracy, and robustness studies with analytic samples. The method developed as a result of these studies reproducibly detect multiple fusion variants for ROS1 (C-Ros proto-oncogene 1; 8 variants) and RET (rearranged during transfection proto-oncogene; 8 variants). The sample processing workflow has been optimized so that test results can consistently be generated within 72 hours of sample receipt. PMID:29683453

Molecular characterization and pathogenicity of a carrot (Daucus carota) infecting begomovirus and associated betasatellite from India.

PubMed

Kumar, Jitendra; Gunapati, Samatha; Singh, Sudhir P; Gadre, Rekha; Sharma, Naresh C; Tuli, Rakesh

2013-10-24

The yellow mosaic pattern and shortening of leaf petiole are common disease symptoms associated with begomovirus infection in carrot. DNA from field infected carrot leaves was analyzed by rolling circle amplification and sequencing. The results established the presence of ageratum enation virus (AEV), which is referred to here as ageratum enation virus-carrot (AEV-Car). Symptomatic ageratum (Ageratum conyzoides) plants, growing adjacent to the carrot fields, also showed the presence of AEV (AEV-Age). Ageratum yellow leaf curl betasatellite (AYLCB) was also detected in the AEV infected carrot and ageratum samples. AEV-Car and AEV-Age are 95-97% identical in their DNA sequences, represents groups of isolates from the respective plant hosts (carrot and ageratum). Agroinoculation using infectious clones of AEV-Car plus AYLCB or AEV-Age plus AYLCB in carrot, ageratum, tobacco (Nicotiana tabacum) and tomato (Solanum lycopersicum) produced yellow mosaic and curling symptoms in leaves of inoculated plants. Agroinoculation of the two isolates together, along with the betasatellite (AEV-Car plus AEV-Age plus AYLCB) resulted in the enhancement of symptoms in comparison to the plants inoculated with single isolate. Plants with more severe symptoms showed a higher level of viral DNA accumulation, suggesting synergistic interactions between the two isolates of AEV. Copyright © 2013. Published by Elsevier B.V.

Isolation and molecular characterization of Vibrio parahaemolyticus from fresh, low-temperature preserved, dried, and salted seafood products in two coastal areas of eastern China.

PubMed

Yang, Zhen-Quan; Jiao, Xin-An; Zhou, Xiao-Hui; Cao, Guo-Xiang; Fang, Wei-Ming; Gu, Rui-Xia

2008-07-31

A total of 1293 seafood samples from fishing farm, retail markets, restaurants and cooking rooms of hotels in Jiangsu province and Shanghai city of China were collected and analyzed for the prevalence of Vibrio parahaemolyticus during July to October in 2007. Two hundred and fifty one isolates of V. parahaemolyticus were identified, of which 8 isolates were positive for tdh and 2 were positive for trh gene. Three tdh positive isolates were identified from low-temperature preserved seafood samples and 5 isolates from fresh seafood samples, of these tdh positive isolates, 3 were positive in ORF8-PCR test. The genetic diversity among V. parahaemolyticus isolates was assessed using random amplified polymorphic DNA (RAPD)-PCR and the results showed that there were 33 different genetic patterns that were clustered into nine groups (groups A to I) at 82% similarity level. About 31.9% of the isolates belong to type III9d that were widely distributed in fresh, iced, frozen, dried and salted seafood samples. Seven tdh positive isolates belonged to group A and one belonged to group C, 2 trh positive isolates were type I10d belonging to group F, which was identical to that of reference strains isolated from patients. This study demonstrated genetic variability within V. parahaemolyticus isolates from seafood in Chinese markets and confirmed the presence of toxigenic V. parahaemolyticus not only in fresh but also in iced and frozen seafood products indicating that low-temperature preserved seafood might be also a vehicle for transmitting pathogenic V. parahaemolyticus.

Molecular typing of Treponema pallidum isolates from Buenos Aires, Argentina: Frequent Nichols-like isolates and low levels of macrolide resistance

PubMed Central

Gallo Vaulet, Lucía; Grillová, Linda; Mikalová, Lenka; Casco, Ricardo; Rodríguez Fermepin, Marcelo; Pando, María A.; Šmajs, David

2017-01-01

A total of 54 clinical samples, including genital lesion swabs, whole blood and cerebrospinal fluid from patients diagnosed with syphilis were collected in 2006 and in 2013 in Buenos Aires, Argentina. Treponemal DNA was detected in 43 of the analyzed samples (79.6%) and further analyzed using Sequencing-based molecular typing (SBMT) and Enhanced CDC-typing (ECDCT). By SBMT, 10 different Treponema pallidum subsp. pallidum (TPA) genotypes were found, of which six were related to the TPA SS14 strain, and four to the TPA Nichols strain. The 23S rRNA gene was amplified in samples isolated from 42 patients, and in six of them (14.3%), either the A2058G (four patients, 9.5%) or the A2059G (two patients, 4.8%) mutations were found. In addition to Taiwan, Madagascar and Peru, Argentina is another country where the prevalence of Nichols-like isolates (26.8%) is greater than 10%. PMID:28235102

Molecular typing of Treponema pallidum isolates from Buenos Aires, Argentina: Frequent Nichols-like isolates and low levels of macrolide resistance.

PubMed

Gallo Vaulet, Lucía; Grillová, Linda; Mikalová, Lenka; Casco, Ricardo; Rodríguez Fermepin, Marcelo; Pando, María A; Šmajs, David

2017-01-01

A total of 54 clinical samples, including genital lesion swabs, whole blood and cerebrospinal fluid from patients diagnosed with syphilis were collected in 2006 and in 2013 in Buenos Aires, Argentina. Treponemal DNA was detected in 43 of the analyzed samples (79.6%) and further analyzed using Sequencing-based molecular typing (SBMT) and Enhanced CDC-typing (ECDCT). By SBMT, 10 different Treponema pallidum subsp. pallidum (TPA) genotypes were found, of which six were related to the TPA SS14 strain, and four to the TPA Nichols strain. The 23S rRNA gene was amplified in samples isolated from 42 patients, and in six of them (14.3%), either the A2058G (four patients, 9.5%) or the A2059G (two patients, 4.8%) mutations were found. In addition to Taiwan, Madagascar and Peru, Argentina is another country where the prevalence of Nichols-like isolates (26.8%) is greater than 10%.

Detection of a Diverse Marine Fish Fauna Using Environmental DNA from Seawater Samples

PubMed Central

Iversen, Lars Lønsmann; Møller, Peter Rask; Rasmussen, Morten; Willerslev, Eske

2012-01-01

Marine ecosystems worldwide are under threat with many fish species and populations suffering from human over-exploitation. This is greatly impacting global biodiversity, economy and human health. Intriguingly, marine fish are largely surveyed using selective and invasive methods, which are mostly limited to commercial species, and restricted to particular areas with favourable conditions. Furthermore, misidentification of species represents a major problem. Here, we investigate the potential of using metabarcoding of environmental DNA (eDNA) obtained directly from seawater samples to account for marine fish biodiversity. This eDNA approach has recently been used successfully in freshwater environments, but never in marine settings. We isolate eDNA from ½-litre seawater samples collected in a temperate marine ecosystem in Denmark. Using next-generation DNA sequencing of PCR amplicons, we obtain eDNA from 15 different fish species, including both important consumption species, as well as species rarely or never recorded by conventional monitoring. We also detect eDNA from a rare vagrant species in the area; European pilchard (Sardina pilchardus). Additionally, we detect four bird species. Records in national databases confirmed the occurrence of all detected species. To investigate the efficiency of the eDNA approach, we compared its performance with 9 methods conventionally used in marine fish surveys. Promisingly, eDNA covered the fish diversity better than or equal to any of the applied conventional methods. Our study demonstrates that even small samples of seawater contain eDNA from a wide range of local fish species. Finally, in order to examine the potential dispersal of eDNA in oceans, we performed an experiment addressing eDNA degradation in seawater, which shows that even small (100-bp) eDNA fragments degrades beyond detectability within days. Although further studies are needed to validate the eDNA approach in varying environmental conditions, our findings provide a strong proof-of-concept with great perspectives for future monitoring of marine biodiversity and resources. PMID:22952584

Detection of a diverse marine fish fauna using environmental DNA from seawater samples.

PubMed

Thomsen, Philip Francis; Kielgast, Jos; Iversen, Lars Lønsmann; Møller, Peter Rask; Rasmussen, Morten; Willerslev, Eske

2012-01-01

Marine ecosystems worldwide are under threat with many fish species and populations suffering from human over-exploitation. This is greatly impacting global biodiversity, economy and human health. Intriguingly, marine fish are largely surveyed using selective and invasive methods, which are mostly limited to commercial species, and restricted to particular areas with favourable conditions. Furthermore, misidentification of species represents a major problem. Here, we investigate the potential of using metabarcoding of environmental DNA (eDNA) obtained directly from seawater samples to account for marine fish biodiversity. This eDNA approach has recently been used successfully in freshwater environments, but never in marine settings. We isolate eDNA from ½-litre seawater samples collected in a temperate marine ecosystem in Denmark. Using next-generation DNA sequencing of PCR amplicons, we obtain eDNA from 15 different fish species, including both important consumption species, as well as species rarely or never recorded by conventional monitoring. We also detect eDNA from a rare vagrant species in the area; European pilchard (Sardina pilchardus). Additionally, we detect four bird species. Records in national databases confirmed the occurrence of all detected species. To investigate the efficiency of the eDNA approach, we compared its performance with 9 methods conventionally used in marine fish surveys. Promisingly, eDNA covered the fish diversity better than or equal to any of the applied conventional methods. Our study demonstrates that even small samples of seawater contain eDNA from a wide range of local fish species. Finally, in order to examine the potential dispersal of eDNA in oceans, we performed an experiment addressing eDNA degradation in seawater, which shows that even small (100-bp) eDNA fragments degrades beyond detectability within days. Although further studies are needed to validate the eDNA approach in varying environmental conditions, our findings provide a strong proof-of-concept with great perspectives for future monitoring of marine biodiversity and resources.

Utility of 16S rDNA Sequencing for Identification of Rare Pathogenic Bacteria.

PubMed

Loong, Shih Keng; Khor, Chee Sieng; Jafar, Faizatul Lela; AbuBakar, Sazaly

2016-11-01

Phenotypic identification systems are established methods for laboratory identification of bacteria causing human infections. Here, the utility of phenotypic identification systems was compared against 16S rDNA identification method on clinical isolates obtained during a 5-year study period, with special emphasis on isolates that gave unsatisfactory identification. One hundred and eighty-seven clinical bacteria isolates were tested with commercial phenotypic identification systems and 16S rDNA sequencing. Isolate identities determined using phenotypic identification systems and 16S rDNA sequencing were compared for similarity at genus and species level, with 16S rDNA sequencing as the reference method. Phenotypic identification systems identified ~46% (86/187) of the isolates with identity similar to that identified using 16S rDNA sequencing. Approximately 39% (73/187) and ~15% (28/187) of the isolates showed different genus identity and could not be identified using the phenotypic identification systems, respectively. Both methods succeeded in determining the species identities of 55 isolates; however, only ~69% (38/55) of the isolates matched at species level. 16S rDNA sequencing could not determine the species of ~20% (37/187) of the isolates. The 16S rDNA sequencing is a useful method over the phenotypic identification systems for the identification of rare and difficult to identify bacteria species. The 16S rDNA sequencing method, however, does have limitation for species-level identification of some bacteria highlighting the need for better bacterial pathogen identification tools. © 2016 Wiley Periodicals, Inc.

Prevalence and persistence of male DNA identified in mixed saliva samples after intense kissing.

PubMed

Kamodyová, Natália; Durdiaková, Jaroslava; Celec, Peter; Sedláčková, Tatiana; Repiská, Gabriela; Sviežená, Barbara; Minárik, Gabriel

2013-01-01

Identification of foreign biological material by genetic profiling is widely used in forensic DNA testing in different cases of sexual violence, sexual abuse or sexual harassment. In all these kinds of sexual assaults, the perpetrator could constrain the victim to kissing. The value of the victim's saliva taken after such an assault has not been investigated in the past with currently widely used molecular methods of extremely high sensitivity (e.g. qPCR) and specificity (e.g. multiplex Y-STR PCR). In our study, 12 voluntary pairs were tested at various intervals after intense kissing and saliva samples were taken from the women to assess the presence of male DNA. Sensitivity-focused assays based on the SRY (single-copy gene) and DYS (multi-copy gene) sequence motifs confirmed the presence of male DNA in female saliva after 10 and even 60min after kissing, respectively. For specificity, standard multiplex Y-STR PCR profiling was performed and male DNA was found in female saliva samples, as the entire Y-STR profile, even after 30min in one sample. Our study confirms that foreign DNA tends to persist for a restricted period of time in the victim's mouth, can be isolated from saliva after prompt collection and can be used as a valuable source of evidence. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Molecular variability among isolates of Fusarium oxysporum associated with root rot disease of Agave tequilana.

PubMed

Vega-Ramos, Karla L; Uvalle-Bueno, J Xavier; Gómez-Leyva, Juan F

2013-04-01

In this study, 115 isolates of Fusarium oxysporum from roots of Agave tequilana Weber cv azul plants and soil in commercial plantations in western Mexico were characterized using morphological and molecular methods. Genetic analyses of monosporic isolates included restriction enzyme analysis of rDNA (ARDRA) using HaeIII and HinfI, and genetic diversity was determined using Box-PCR molecular markers. Box-PCR analysis generated 14 groups. The groups correlated highly with the geographic location of the isolate and sample type. These results demonstrate the usefulness of ARDRA and Box-PCR techniques in the molecular characterization of the Fusarium genus for the discrimination of pathogenic isolates.

Cropping Systems and Cultural Practices Determine the Rhizoctonia Anastomosis Groups Associated with Brassica spp. in Vietnam

PubMed Central

Soltaninejad, Saman; Höfte, Monica

2014-01-01

Ninety seven Rhizoctonia isolates were collected from different Brassica species with typical Rhizoctonia symptoms in different provinces of Vietnam. The isolates were identified using staining of nuclei and sequencing of the rDNA-ITS barcoding gene. The majority of the isolates were multinucleate R. solani and four isolates were binucleate Rhizoctonia belonging to anastomosis groups (AGs) AG-A and a new subgroup of A-F that we introduce here as AG-Fc on the basis of differences in rDNA-ITS sequence. The most prevalent multinucleate AG was AG 1-IA (45.4% of isolates), followed by AG 1-ID (17.5%), AG 1-IB (13.4%), AG 4-HGI (12.4%), AG 2-2 (5.2%), AG 7 (1.0%) and an unknown AG related to AG 1-IA and AG 1-IE that we introduce here as AG 1-IG (1.0%) on the basis of differences in rDNA-ITS sequence. AG 1-IA and AG 1-ID have not been reported before on Brassica spp. Pathogenicity tests revealed that isolates from all AGs, except AG-A, induced symptoms on detached leaves of several cabbage species. In in vitro tests on white cabbage and Chinese cabbage, both hosts were severely infected by AG 1-IB, AG 2-2, AG 4-HGI, AG 1-IG and AG-Fc isolates, while under greenhouse conditions, only AG 4-HGI, AG 2-2 and AG-Fc isolates could cause severe disease symptoms. The occurrence of the different AGs seems to be correlated with the cropping systems and cultural practices in different sampling areas suggesting that agricultural practices determine the AGs associated with Brassica plants in Vietnam. PMID:25372406

Evaluation and comparison of FTA card and CTAB DNA extraction methods for non-agricultural taxa1

PubMed Central

Siegel, Chloe S.; Stevenson, Florence O.; Zimmer, Elizabeth A.

2017-01-01

Premise of the study: An efficient, effective DNA extraction method is necessary for comprehensive analysis of plant genomes. This study analyzed the quality of DNA obtained using paper FTA cards prepared directly in the field when compared to the more traditional cetyltrimethylammonium bromide (CTAB)–based extraction methods from silica-dried samples. Methods: DNA was extracted using FTA cards according to the manufacturer’s protocol. In parallel, CTAB-based extractions were done using the automated AutoGen DNA isolation system. DNA quality for both methods was determined for 15 non-agricultural species collected in situ, by gel separation, spectrophotometry, fluorometry, and successful amplification and sequencing of nuclear and chloroplast gene markers. Results: The FTA card extraction method yielded less concentrated, but also less fragmented samples than the CTAB-based technique. The card-extracted samples provided DNA that could be successfully amplified and sequenced. The FTA cards are also useful because the collected samples do not require refrigeration, extensive laboratory expertise, or as many hazardous chemicals as extractions using the CTAB-based technique. Discussion: The relative success of the FTA card method in our study suggested that this method could be a valuable tool for studies in plant population genetics and conservation biology that may involve screening of hundreds of individual plants. The FTA cards, like the silica gel samples, do not contain plant material capable of propagation, and therefore do not require permits from the U.S. Department of Agriculture (USDA) Animal and Plant Health Inspection Service (APHIS) for transportation. PMID:28224056

The Extraction and Recovery Efficiency of Pure DNA for Different Types of Swabs.

PubMed

Bruijns, Brigitte B; Tiggelaar, Roald M; Gardeniers, Han

2018-06-11

The extraction and recovery efficiency of swabs used to collect evidence at crime scenes is relatively low (typically <50%) for bacterial spores and body fluids. Cell-free deoxyribonucleic acid (DNA) is an interesting alternative compared to whole cells as a source for forensic analysis, but extraction and recovery from swabs has not been tested before using pure DNA. In this study cotton, foam, nylon flocked, polyester and rayon swabs are investigated in order to collect pure DNA isolated from saliva samples. The morphology and absorption capacity of swabs is studied. Extraction and recovery efficiencies are determined and compared to the maximum theoretical efficiency. The results indicate that a substantial part of DNA is not extracted from the swab and some types of swab seem to bind effectively with DNA. The efficiency of the different types of swab never exceeds 50%. The nylon flocked 4N6FLOQSwab used for buccal sampling performs the best. © 2018 The Authors. Journal of Forensic Sciences published by Wiley Periodicals, Inc. on behalf of American Academy of Forensic Sciences.

Early detection of marine invasive species, Bugula neritina (Bryozoa: Cheilostomatida), using species-specific primers and environmental DNA analysis in Korea.

PubMed

Kim, Philjae; Kim, Donghwan; Yoon, Tae Joong; Shin, Sook

2018-08-01

The bryozoan, Bugula neritina, is one of the most widespread sessile marine invasive species. Since its first discovery in Korea in 1978, the gradual increase in the distribution and abundance of this species resulted in a significant damage to growth of aquaculture. Environmental DNA (eDNA) is a potentially useful tool for species detection including rare, invasive and threatened native species. In this study, species-specific primers and probe were designed to amplify a 185-bp region based on mitochondrial COI of B. neritina for monitoring, and tested on environmental samples from 35 harbors of Korea in 2017. Among 35 sites monitored, B. neritina colonies were detected in 27 sites during field survey. However, B. neritina DNA was detected in all examined eDNA isolated from seawater. These results suggested that eDNA-based methods coupled with simple seawater sampling could be suitable for determining the distribution and abundance of B. neritina as complementary traditional monitoring. Copyright © 2018 Elsevier Ltd. All rights reserved.

Genetic testing and counseling of a recipient after bone marrow transplant from a sibling harboring a germline BRCA1 pathogenic mutation.

PubMed

Škerl, Petra; Krajc, Mateja; Blatnik, Ana; Novaković, Srdjan

2017-07-01

Allogenic bone marrow transplant recipients represent a unique challenge, when they are referred for genetic testing and counseling. When performing genetic testing, it is extremely important to ensure that the detected DNA mutations originate from the patients own DNA, and therefore the most appropriate and reliable biological sample for DNA isolation must be obtained. The aim of the present study was to present the germline testing and counseling approach utilized in a rare case of a chimeric woman who received an allogenic bone marrow transplant from a sibling with a germline BRCA1 pathogenic mutation. According to our results, hairs with follicles are a reliable and ready source of DNA in a patient whose blood is of allogenic bone marrow transplant donor origin. Compared with a fibroblast culture, which is more difficult to obtain, the hair follicles are much more accessible and hair sampling is less invasive for the patient. Genetic testing based on the other sources of DNA, such as buccal swabs, is questionable due to the known risk of donor DNA contamination.

Prevalence of Toxoplasma gondii infection in HIV-infected patients and food animals and direct genotyping of T. gondii isolates, Southern Ghana.

PubMed

Pappoe, Faustina; Cheng, Weisheng; Wang, Lin; Li, Yuanling; Obiri-Yeboah, Dorcas; Nuvor, Samuel Victor; Ambachew, Henock; Hu, Xiaodong; Luo, Qingli; Chu, Deyong; Xu, Yuanhong; Shen, Jilong

2017-06-01

Toxoplasma gondii is of public health and veterinary importance causing severe diseases in immunocompromised individuals including HIV/AIDS patients and in congenital cases and animals. There is limited information on the epidemiology of T. gondii infection in humans, particularly HIV patients and food animals and the parasite genotypes in Ghana. A total of 394 HIV-infected patients from three hospitals were screened for T. gondii anti-IgG and IgM using ELISA. DNAs from blood samples of seropositve participants and 95 brain tissues of food animals were PCR assayed to detect Toxoplasma gra6. DNA positive samples were genotyped using multilocus nested polymerase chain reaction restriction fragment length polymorphism at 10 loci: sag1, alt.sag2, sag3, btub, gra6, l358, c22-8, c29-2, pk1, and apico. The overall seroprevalence was 74.37% (293/394). Toxoplasma DNAs were detected in 3.07% of the seropositive participants and 9.47% of the animals. Six of the human DNA positive samples were partly typed at sag3: 33.33, 50, and 16.67% isolates had type I, II, and III alleles, respectively. All nine isolates from food animals typed at nine loci except apico were atypical: six isolates were identical to ToxoDB #41 and #145, and one was identical to TgCkBrRj2 all identified in Brazil. The genotype of two isolates has not been reported previously and was named as TgCtGh1. T. gondii seroprevalence is high among the HIV-infected individuals with T. gondii circulating in Ghana being genetically diverse.

Evaluation of Stachybotrys chartarum in the house of an infant with pulmonary hemorrhage: quantitative assessment before, during, and after remediation.

PubMed

Vesper, S; Dearborn, D G; Yike, I; Allan, T; Sobolewski, J; Hinkley, S F; Jarvis, B B; Haugland, R A

2000-03-01

Stachybotrys chartarum is an indoor mold that has been associated with pulmonary hemorrhage cases in the Cleveland, Ohio, area. This study applied two new quantitative measurements to air samples from a home in which an infant developed PH. Quantitative polymerase chain reaction and a protein synthesis inhibition assay were used to determine the level of S. chartarum spores and their toxicity in air samples taken before, during, and after a remediation program was implemented to remove the fungus. Initial spore concentrations were between 0.1 and 9.3 spores/m3 of air, and the toxicity of air particulates was correspondingly low. However, the dust in the house contained between 0.4 and 2.1 x 10(3) spores/mg (as determined by hemocytometer counts). The remediation program removed all contaminated wallboard, paneling, and carpeting in the water-damaged areas of the home. In addition, a sodium hypochlorite solution was used to spray all surfaces during remediation. Although spore counts and toxicity were high during remediation, air samples taken postremediation showed no detectable levels of S. chartarum or related toxicity. Nine isolates of S. chartarum obtained from the home were analyzed for spore toxicity, hemolytic activity, and random amplified polymorphic DNA banding patterns. None of the isolates produced highly toxic spores (>90 microg T2 toxin equivalents per gram wet weight spores) after growth for 10 and 30 days on wet wallboard, but three isolates were hemolytic consistently. DNA banding patterns suggested that at least one of these isolates was related to isolates from homes of infants with previously investigated cases.

Multilocus sequence analysis of Giardia spp. isolated from patients with diarrhea in Austria.

PubMed

Lee, Mellesia F; Auer, Herbert; Lindo, John F; Walochnik, Julia

2017-02-01

Giardia duodenalis is a protozoan parasite causing intestinal infections in a wide range of mammals. Two distinct assemblages, A and B, infect humans predominantly; however, both are believed to be generally zoonotic. Giardia strains associated with infections in Austria have not been investigated at the molecular level. In this study, 65 human stool samples microscopically positive for Giardia spp. were subjected to DNA isolation and nested PCR targeting fragments of the glutamate dehydrogenase (gdh), triose phosphate isomerase (tpi), and beta-gardin (bg) genes. A total of 52 samples were successfully analyzed using PCR and DNA sequencing. Assemblage B was detected most frequently and accounted for 65.4% (34/52) of infections, while Assemblage A accounted for 34.6% (18/52). There was a high level of genetic diversity among the isolates with 46.2% designated as sub-assemblage BIV (24/52), 25% sub-assemblage AII (13/52), 19.2% sub-assemblage BIII (10/52), and 9.6% sub-assemblage AI (5/52). No mixed infections were detected. The results suggest that the majority of infections were imported and that endemic anthroponotic transmission plays a minor role in Austria.

DNA damage under simulated extraterrestrial conditions in bacteriophage T7

NASA Astrophysics Data System (ADS)

Fekete, A.; Kovács, G.; Hegedüs, M.; Módos, K.; Rontó, Gy.; Lammer, H.; Panitz, C.

The experiment ``Phage and uracil response'' (PUR) will be accommodated in the EXPOSE facility of the ISS aiming to examine and quantify the effect of specific space conditions on bacteriophage T7 and isolated T7 DNA thin films. To achieve this new method was elaborated for the preparation of DNA and nucleoprotein thin films (1). During the EXPOSE Experiment Verification Tests (EVT) the samples were exposed to vacuum (10 -6 Pa), to monochromatic (254 nm) and polychromatic (200-400 nm) UV radiation in air as well in simulated space vacuum. Using neutral density (ND) filters dose-effect curves were performed in order to define the maximum doses tolerated, and we also studied the effect of temperature in vacuum as well as the influence of temperature fluctuations. We obtained substantial evidence that DNA lesions (e.g. strand breaks, DNA-protein cross-links, DNA-DNA cross-links) accumulate throughout exposure. DNA damage was determined by quantitative PCR using 555 bp and 3826 bp fragments of T7 DNA (2) and by neutral and alkaline agarose gel electrophoresis; the structural/chemical effects were analyzed by spectroscopic and microscopical methods. Characteristic changes in the absorption spectrum, in the electrophoretic pattern of DNA and the decrease of the amount of the PCR products have been detected indicating the damage of isolated and intraphage DNA. Preliminary results suggest a synergistic action of space vacuum and UV radiation with DNA being the critical target. Fekete et al. J. Luminescence 102-103, 469-475, 2003 Hegedüs et al. Photochem. Photobiol. 78, 213-219, 2003

PCR Assays for Identification of Coccidioides posadasii Based on the Nucleotide Sequence of the Antigen 2/Proline-Rich Antigen

PubMed Central

Bialek, Ralf; Kern, Jan; Herrmann, Tanja; Tijerina, Rolando; Ceceñas, Luis; Reischl, Udo; González, Gloria M.

2004-01-01

A conventional nested PCR and a real-time LightCycler PCR assay for detection of Coccidioides posadasii DNA were designed and tested in 120 clinical strains. These had been isolated from 114 patients within 10 years in Monterrey, Nuevo Leon, Mexico, known to be endemic for coccidioidomycosis. The gene encoding the specific antigen 2/proline-rich antigen (Ag2/PRA) was used as a target. All strains were correctly identified, whereas DNA from related members of the family Onygenaceae remained negative. Melting curve analysis by LightCycler and sequencing of the 526-bp product of the first PCR demonstrated either 100% identity to the GenBank sequence of the Silveira strain, now known to be C. posadasii (accession number AF013256), or a single silent mutation at position 1228. Length determination of two microsatellite-containing loci (GAC and 621) identified all 120 isolates as C. posadasii. Specific DNA was amplified by conventional nested PCR from three microscopically spherule-positive paraffin-embedded tissue samples, whereas 20 human tissue samples positive for other dimorphic fungi remained negative. Additionally, the safety of each step of a modified commercially available DNA extraction procedure was evaluated by using 10 strains. At least three steps of the protocol were demonstrated to sufficiently kill arthroconidia. This safe procedure is applicable to cultures and to clinical specimens. PMID:14766853

Isolation and characterization of lactic acid bacteria from pobuzihi (fermented cummingcordia), a traditional fermented food in Taiwan.

PubMed

Chen, Yi-Sheng; Wu, Hui-Chung; Wang, Chiung-Mei; Lin, Chia-Chun; Chen, Yi-Ting; Jhong, Yu-Jyun; Yanagida, Fujitoshi

2013-03-01

Lactobacillus pobuzihii is a novel species which has been previously found in pobuzihi (fermented cummingcordia), a traditional fermented food in Taiwan. However, the lactic acid bacteria (LAB) microflora in pobuzihi has not been studied in detail. In this study, LAB from pobuzihi were isolated, identified, and characterized. A total of 196 LAB were isolated; 79 cultures were isolated from the sample collected from a manufacturing factory, 38 from pobuzihi samples collected from 4 different markets, and 79 from 2 fresh cummingcordia samples. These isolates were characterized phenotypically and then divided into eight groups (A to H) by restriction fragment length polymorphism analysis and sequencing of 16S ribosomal DNA. Lactobacillus plantarum was the most abundant LAB found in most samples during the fermentation of pobuzihi. On the other hand, Enterococcus casseliflavus and Weissella cibaria were, respectively, the major species found in the two fresh cummingcordia samples. A potential novel species or subspecies of lactococcal strain was found. In addition, seven L. plantarum and five W. cibaria strains showed inhibitory activity against the indicator strain Lactobacillus sakei JCM 1157(T). This is the first report describing the distribution and varieties of LAB existing in the pobuzihi during its fermentation process and the final product on the market.

Molecular ecology of Listeria spp., Salmonella, Escherichia coli O157:H7 and non-O157 Shiga toxin-producing E. coli in pristine natural environments in Northern Colorado.

PubMed

Ahlstrom, C A; Manuel, C S; Den Bakker, H C; Wiedmann, M; Nightingale, K K

2018-02-01

Molecular subtyping is commonly used in foodborne disease surveillance and microbial source tracking. There is a knowledge gap regarding the molecular ecology of foodborne pathogens in non-food-associated environments. The objective of this study was to isolate and subtype foodborne pathogens from pristine natural environments with minimal anthropogenic inputs. Five locations (wilderness areas) in Northern Colorado were sampled during the spring, summer and fall over a 2-year period. Soil, water, sediment, surface soil and wildlife faecal samples were microbiologically analysed to detect Listeria, Salmonella and Shiga toxin-producing Escherichia coli (STEC), and resultant isolates were subtyped. Three samples tested positive for Listeria monocytogenes and 19 samples contained other Listeria spp. Salmonella was isolated from two samples, five samples contained non-O157 STEC, and E. coli O157:H7 was not detected. Two L. monocytogenes isolates from faecal samples collected from the same wilderness area over a year apart shared the same PFGE pattern, while all other isolates had a unique type. Our data indicate that (i) there was a rare presence of human foodborne pathogens in pristine natural environments in Northern Colorado, (ii) there was genetic diversity between organisms isolated within a given wilderness area, and (iii) the Northern Colorado climate and topography may contribute to the low occurrence of these organisms. Relatively little is known about the molecular ecology of foodborne pathogens in pristine natural environments. While foodborne pathogens were rarely detected in wildlife faecal and environmental samples from the wilderness areas in this study, some isolates shared DNA fingerprint types with human clinical isolates from same region during the same time frame, highlighting the need for environmental isolate subtype data. The availability of molecular subtyping data for non-food-associated foodborne pathogen isolates can facilitate epidemiological and microbial source tracking investigations. © 2017 The Society for Applied Microbiology.

Genotoxic effect of N-hydroxy-4-acetylaminobiphenyl on human DNA: implications in bladder cancer.

PubMed

Shahab, Uzma; Moinuddin; Ahmad, Saheem; Dixit, Kiran; Habib, Safia; Alam, Khursheed; Ali, Asif

2013-01-01

The interaction of environmental chemicals and their metabolites with biological macromolecules can result in cytotoxic and genotoxic effects. 4-Aminobiphenyl (4-ABP) and several other related arylamines have been shown to be causally involved in the induction of human urinary bladder cancers. The genotoxic and the carcinogenic effects of 4-ABP are exhibited only when it is metabolically converted to a reactive electrophile, the aryl nitrenium ions, which subsequently binds to DNA and induce lesions. Although several studies have reported the formation of 4-ABP-DNA adducts, no extensive work has been done to investigate the immunogenicity of 4-ABP-modified DNA and its possible involvement in the generation of antibodies in bladder cancer patients. Human DNA was modified by N-hydroxy-4-acetylaminobiphenyl (N-OH-AABP), a reactive metabolite of 4-ABP. Structural perturbations in the N-OH-AABP modified DNA were assessed by ultraviolet, fluorescence, and circular dichroic spectroscopy as well as by agarose gel electrophoresis. Genotoxicity of N-OH-AABP modified DNA was ascertained by comet assay. High performance liquid chromatography (HPLC) analysis of native and modified DNA samples confirmed the formation of N-(deoxyguanosine-8-yl)-4-aminobiphenyl (dG-C8-4ABP) in the N-OH-AABP damaged DNA. The experimentally induced antibodies against N-OH-AABP-modified DNA exhibited much better recognition of the DNA isolated from bladder cancer patients as compared to the DNA obtained from healthy individuals in competitive binding ELISA. This work shows epitope sharing between the DNA isolated from bladder cancer patients and the N-OH-AABP-modified DNA implicating the role of 4-ABP metabolites in the DNA damage and neo-antigenic epitope generation that could lead to the induction of antibodies in bladder cancer patients.

Extrachromosomal DNA length and antibiograms of Staphylococcus aureus and Pseudomonas aeruginosa isolated from tears of HIV/AIDS patients after curing with sodium dodecyl sulphate.

PubMed

Ajayi, B O; Otajevwo, F D

2012-01-01

Staphylococcus aureus and Pseudomonas aeruginosa strains were isolated from eye swab samples randomly obtained from 100 seropositive HIV/AIDS patients who reported to various anti-retroviral treatment clinics at the University of Benin Teaching Hospital and Central Hospital both based in Benin City, Nigeria. Invitro antibiotic sensitivity patterns of strains before curing were determined by the Kirby-Bauer disc diffusion technique. Resistance plasmid DNA of multidrug resistant strains was cured with 0.1% sodium dodecyl sulphate and cured strains were again subjected to in vitro antibiotic sensitivity testing. EcoRI and Hind III restriction endonuclease enzymes were used to make cuts on extracted plasmid DNA whose length sizes were then determined. A total of 36 (36.0%) strains made up of 27 (75.0%) Staphylococcus. aureus and 9 (25.0%) Pseudomonas aeruginosa were isolated of which 7 (19.4%) strains showed multidrug resistance to ciprofloxacin, pefloxacin, ofloxacine, gentamycin, tetracycline, ampicillin, chloramphenicol, nitrofurantoin and erythromycin. All seven multidrug resistant strains before curing, recorded 85.7%, 42.9%, 14.3% and 14.3% sensitivity in that decreasing order to ciprofloxacin, pefloxacin, ofloxacin and gentamycin respectively. There was 0.0% sensitivity each to tetracycline and ampicillin. After curing, there was enhanced sensitivity of 100.0%, 85.7%, 28.6% and 71.4% respectively. There was also 28.6% and 57.1% improved sensitivity to tetracycline and ampicillin after curing. Before curing, there was 76.2% average resistance to all used antibiotics and this reduced to 47.6% after curing Staph. aureus plasmid DNA. In the case of Pseudomonas aeruginosa, there was an average resistance of 76.3% before curing which fell to 42.5% after curing. EcoRI restriction enzyme gave the plasmid DNA length of Staphylococcus aureus strain 04 as 4.0Kb and this size depended upon the distance between recognition sites. Isolation of 36 (36.0%) strains of both isolates from 100 eye swabs shows the danger these organisms portend to all categories of opticians. The cheapness and high sensitivity of gentamycin justifies its use as eye drops for treatment of some eye infections. Curing of plasmid DNA is an indication that if SDS is administered to the organisms in sublethal doses, it can lead to the elimination of plasmid DNA without adverse effect on the genomic DNA of the bacterial strains.

Extrachromosomal DNA Length and Antibiograms of Staphylococcus aureus and Pseudomonas aeruginosa Isolated from Tears of HIV/AIDS Patients after Curing with Sodium Dodecyl Sulphate

PubMed Central

B. O., Ajayi; F. D., Otajevwo

2012-01-01

Staphylococcus aureus and Pseudomonas aeruginosa strains were isolated from eye swab samples randomly obtained from 100 seropositive HIV/AIDS patients who reported to various anti-retroviral treatment clinics at the University of Benin Teaching Hospital and Central Hospital both based in Benin City, Nigeria. Invitro antibiotic sensitivity patterns of strains before curing were determined by the Kirby-Bauer disc diffusion technique. Resistance plasmid DNA of multidrug resistant strains was cured with 0.1% sodium dodecyl sulphate and cured strains were again subjected to invitro antibiotic sensitivity testing. EcoRI and Hind III restriction endonuclease enzymes were used to make cuts on extracted plasmid DNA whose length sizes were then determined. A total of 36 (36.0%) strains made up of 27 (75.0%) Staphylococcus. aureus and 9 (25.0%) Pseudomonas aeruginosa were isolated of which 7 (19.4%) strains showed multidrug resistance to ciprofloxacin, pefloxacin, ofloxacine, gentamycin, tetracycline, ampicillin, chloramphenicol, nitrofurantoin and erythromycin. All seven multidrug resistant strains before curing, recorded 85.7%, 42.9%, 14.3% and 14.3% sensitivity in that decreasing order to ciprofloxacin, pefloxacin, ofloxacin and gentamycin respectively. There was 0.0% sensitivity each to tetracycline and ampicillin. After curing, there was enhanced sensitivity of 100.0%, 85.7%, 28.6% and 71.4% respectively. There was also 28.6% and 57.1% improved sensitivity to tetracycline and ampicillin after curing. Before curing, there was 76.2% average resistance to all used antibiotics and this reduced to 47.6% after curing Staph. aureus plasmid DNA. In the case of Pseudomonas aeruginosa, there was an average resistance of 76.3% before curing which fell to 42.5% after curing. EcoRI restriction enzyme gave the plasmid DNA length of Staphylococcus aureus strain 04 as 4.0Kb and this size depended upon the distance between recognition sites. Isolation of 36 (36.0%) strains of both isolates from 100 eye swabs shows the danger these organisms portend to all categories of opticians. The cheapness and high sensitivity of gentamycin justifies its use as eye drops for treatment of some eye infections. Curing of plasmid DNA is an indication that if SDS is administered to the organisms in sublethal doses, it can lead to the elimination of plasmid DNA without adverse effect on the genomic DNA of the bacterial strains. PMID:22980121

Real-time PCR to quantify composition of arbuscular mycorrhizal fungal communities--marker design, verification, calibration and field validation.

PubMed

Thonar, C; Erb, A; Jansa, J

2012-03-01

Quantitative real-time PCR (qPCR) is slowly becoming established as a tool to quantify abundance of different arbuscular mycorrhizal fungal (AMF) taxa in roots and in soil. Here, we describe the development and field validation of qPCR markers (i.e. primers with associated hydrolysis probes), targeting taxon-specific motifs in the nuclear large ribosomal subunit RNA genes. Design of such markers is complicated by the multinuclear and multigenomic cellular organization of these fungi and the high DNA sequence diversity within the smallest biologically relevant units (i.e. single-spore isolates). These limitations are further compounded by inefficient biomass production of these fungi, resulting in limited availability of pure genomic DNA (gDNA) of well-defined isolates for cross-specificity testing of the markers. Here we demonstrate, using a number of AMF isolates, the possibility to establish stringent qPCR running conditions allowing quantification of phylogenetically disjunctive AMF taxa. Further, we show that these markers can more generally be used to quantify abundance (i.e. number of target gene copies or amount of gDNA) of what is usually considered the level of AMF species, regardless of the isolate identities. We also illustrate the range of variation within qPCR signal strength across different AMF taxa with respect to the detected number of gene copies per unit amount of gDNA. This information is paramount for interpretation of the qPCR analyses of field samples. Finally, the field validation of these markers confirmed their potential to assess composition of field AMF communities and monitor the changes owing to agricultural practices such as soil tillage. © 2011 Blackwell Publishing Ltd.

Rapid DNA extraction from dried blood spots on filter paper: potential applications in biobanking.

PubMed

Choi, Eun-Hye; Lee, Sang Kwang; Ihm, Chunhwa; Sohn, Young-Hak

2014-12-01

Dried blood spot (DBS) technology is a microsampling alternative to traditional plasma or serum sampling for pharmaco- or toxicokinetic evaluation. DBS technology has been applied to diagnostic screening in drug discovery, nonclinical, and clinical settings. We have developed an improved elution protocol involving boiling of blood spots dried on Whatman filter paper. The purpose of this study was to compare the quality, purity, and quantity of DNA isolated from frozen blood samples and DBSs. We optimized a method for extraction and estimation of DNA from blood spots dried on filter paper (3-mm FTA card). A single DBS containing 40 μL blood was used. DNA was efficiently extracted in phosphate-buffered saline (PBS) or Tris-EDTA (TE) buffer by incubation at 37°C overnight. DNA was stable in DBSs that were stored at room temperature or frozen. The housekeeping genes GAPDH and beta-actin were used as positive standards for polymerase chain reaction (PCR) validation of general diagnostic screening. Our simple and convenient DBS storage and extraction methods are suitable for diagnostic screening by using very small volumes of blood collected on filter paper, and can be used in biobanks for blood sample storage.

Modification of CMV DNA detection from dried blood spots for diagnosing congenital CMV infection.

PubMed

Binda, Sandro; Caroppo, Simona; Didò, Patrizia; Primache, Valeria; Veronesi, Licia; Calvario, Agata; Piana, Andrea; Barbi, Maria

2004-07-01

Detection of viral DNA in dried blood spots using the Guthrie card (DBS test) is a reliable and practical method of diagnosing congenital cytomegalovirus (CMV) infection. The test lends itself to epidemiological studies to establish the prevalence of the infection, but also to neonatal screening for secondary prevention of sequelae. These applications would be facilitated if it were possible to use smaller samples and do the test on pools of individual cases. To ascertain whether doing the test on smaller, pooled samples still accurately identifies neonates with congenital CMV infection. We tested DBS from: (A) 39 laboratory reference cases; (B) 156 neonates suspected of having congenital CMV infection; (C) 119 children examined for the retrospective diagnosis of congenital CMV; (D) mock specimens prepared with known amounts of viral DNA. The test using only one third of the usual amount of dried blood was 100% sensitive and specific compared to the standard DBS test (A) and to viral isolation (A and B). Pools of three single cases gave the same results as viral isolation (B) and the small-sample test (B and C). All the versions of the test gave a detection limit of 400 copies/ml. The modified procedure can accurately diagnose congenital CMV infection. It achieves savings in both the patient material and the costs of testing.

A Versatile Nanowire Platform for Highly Efficient Isolation and Direct PCR-free Colorimetric Detection of Human Papillomavirus DNA from Unprocessed Urine

PubMed Central

Lee, HyungJae; Choi, Mihye; Hwang, Sang-Hyun; Cho, Youngnam

2018-01-01

Purpose: As human papillomavirus (HPV) is primarily responsible for the development of cervical cancer, significant efforts have been devoted to develop novel strategies for detecting and identifying HPV DNA in urine. The analysis of target DNA sequences in urine offers a potential alternative to conventional methods as a non-invasive clinical screening and diagnostic assessment tool for the detection of HPV. However, the lack of efficient approaches to isolate and directly detect HPV DNA in urine has restricted its potential clinical use. In this study, we demonstrated a novel approach of using polyethylenimine-conjugated magnetic polypyrrole nanowires (PEI-mPpy NWs) for the extraction, identification, and PCR-free colorimetric detection of high-risk strains of HPV DNA sequences, particularly HPV-16 and HPV-18, in urine specimens of cervical cancer patients. Materials and Methods: We fabricated and characterized polyethylenimine-conjugated magnetic nanowires (PEI/mPpy NWs). PEI/mPpy NWs-based HPV DNA isolation and detection strategy appears to be a cost-effective and practical technology with greater sensitivity and accuracy than other urine-based methods. Results: The analytical and clinical performance of PEI-mPpy NWs was evaluated and compared with those of cervical swabs, demonstrating a superior type-specific concordance rate of 100% between urine and cervical swabs, even when using a small volume of urine (300 µL). Conclusion: We envision that PEI-mPpy NWs provide substantive evidence for clinical diagnosis and management of HPV-associated disease with their excellent performance in the recovery and detection of HPV DNA from minimal amounts of urine samples. PMID:29290816

Molecular Characterization of Eimeria Species Naturally Infecting Egyptian Baldi Chickens

PubMed Central

GADELHAQ, Sahar M; ARAFA, Waleed M; ABOELHADID, Shawky M

2015-01-01

Background: Coccidiosis is a serious protozoal disease of poultry. The identification of Eimeria species has important implications for diagnosis and control as well as for epidemiology. The molecular characterization of Eimeria species infecting Egyptian baladi chickens was investigated. Methods: Eimeria species oocysts were harvested from intestines of naturally infected Egyptian baldi chickens. The morphometry characterization of oocysts along with COCCIMORPH software was done. The DNA was extracted initially by freezing and thawing then the prepared samples was subjected to commercial DNA kits. The DNA products were analyzed through conventional polymerase chain reaction by using amplified region (SCAR) marker. Results: The PCR results confirmed the presence of 7 Eimeria species in the examined fecal samples of Egyptian baldi breed with their specific ampilicon sizes being E. acervulina (811bp), E. brunette (626bp), E. tenella (539bp), E. maxima (272bp), E. necatrix (200bp), E. mitis (327bp) and E. praecopx (354bp). A sequencing of the two most predominant species of Eimeria was done, on E. tenella and E. máxima. Analysis of the obtained sequences revealed high identities 99% between Egyptian isolates and the reference one. Similarly, E. maxima isolated from Egyptian baldi chickens showed 98% nucleotide identities with the reference strain. Only single nucleotide substitution was observed among the Egyptian E. tenella isolates (A181G) when compared to the reference one. The Egyptian isolates acquired 4 unique mutations (A68T, C164T, G190A and C227G) in compared with the reference sequence. Conclusion: This is the first time to identify the 7 species of Eimeria from Egyptian baladi chickens. PMID:25904950

Paraburkholderia caffeinitolerans sp. nov., a caffeine degrading species isolated from a tea plantation soil sample.

PubMed

Gao, Zi-Qing; Zhao, Dong-Ying; Xu, Lei; Zhao, Rui-Ting; Chen, Ming; Zhang, Chun-Zhi

2016-11-01

A Gram-stain negative, facultatively anaerobic, non-sporulating, non-motile and rod-shaped bacterium, designated CF3 T , was isolated from a tea plantation soil sample and its taxonomic position was determined using polyphasic taxonomy. Strain CF3 T displayed optimum growth at 25 °C, pH 5.0 and in the presence of 0-1 % NaCl. Comparative phylogenetic analysis of the 16S rRNA, recA and gyrB gene sequences showed that the isolate belongs to the genus Paraburkholderia, showing high levels of similarity with respect to Paraburkholderia oxyphila OX-01 T (98.3, 95 and 93 %, respectively) and Paraburkholderia sacchari IPT101 T (98.2, 95 and 95 %, respectively). The predominant ubiquinone was determined to be Q-8, and the polar lipids are phosphatidylethanolamine, phosphatidylglycerol, diphosphatidylglycerol, one unidentified amino-phospholipid, three unidentified amino-lipids and three unidentified polar lipids. The major fatty acids were found to be C16:0, C17:0 cyclo, summed feature 8 (C18:1 ω7c and/or C18:1 ω6c) and summed feature 3 (C16:1 ω7c and/or C16:1 ω6c). The DNA G+C content was found to be 63.8 mol% and the DNA-DNA relatedness values between strain CF3 T and its two close relatives P. oxyphila OX-01 T and P. sacchari IPT101 T was 41 and 40 %, respectively. Based on phylogenetic analysis, phenotypic and genotypic data, it is concluded that the isolate represents a novel species of the genus Paraburkholderia, for which the name Paraburkholderia caffeinitolerans sp. nov. is proposed. The type strain is CF3 T (= LMG 28688 T  = CGMCC 1.15105 T ).

Highly Effective DNA Extraction Method for Nuclear Short Tandem Repeat Testing of Skeletal Remains from Mass Graves

PubMed Central

Davoren, Jon; Vanek, Daniel; Konjhodzić, Rijad; Crews, John; Huffine, Edwin; Parsons, Thomas J.

2007-01-01

Aim To quantitatively compare a silica extraction method with a commonly used phenol/chloroform extraction method for DNA analysis of specimens exhumed from mass graves. Methods DNA was extracted from twenty randomly chosen femur samples, using the International Commission on Missing Persons (ICMP) silica method, based on Qiagen Blood Maxi Kit, and compared with the DNA extracted by the standard phenol/chloroform-based method. The efficacy of extraction methods was compared by real time polymerase chain reaction (PCR) to measure DNA quantity and the presence of inhibitors and by amplification with the PowerPlex 16 (PP16) multiplex nuclear short tandem repeat (STR) kit. Results DNA quantification results showed that the silica-based method extracted on average 1.94 ng of DNA per gram of bone (range 0.25-9.58 ng/g), compared with only 0.68 ng/g by the organic method extracted (range 0.0016-4.4880 ng/g). Inhibition tests showed that there were on average significantly lower levels of PCR inhibitors in DNA isolated by the organic method. When amplified with PP16, all samples extracted by silica-based method produced 16 full loci profiles, while only 75% of the DNA extracts obtained by organic technique amplified 16 loci profiles. Conclusions The silica-based extraction method showed better results in nuclear STR typing from degraded bone samples than a commonly used phenol/chloroform method. PMID:17696302

Traditional goat husbandry may substantially contribute to human toxoplasmosis exposure.

PubMed

Paştiu, Anamaria I; Ajzenberg, Daniel; Györke, Adriana; Şuteu, Ovidiu; Balea, Anamaria; Rosenthal, Benjamin M; Kalmár, Zsuzsa; Domşa, Cristian; Cozma, Vasile

2015-02-01

Raising goats in settings that are highly contaminated with oocysts of Toxoplasma gondii may contribute significantly to human exposure to this zoonotic parasite. Increasing consumption of young goats in countries where goats are frequently reared in backyards that are also homes to cats (the definitive host of this parasite) elevates such concern. To date, there has been little attention to either the prevalence or genotypic characteristics of T. gondii isolates in young ruminant food animals in Europe. Here, we estimated the prevalence of T. gondii goat-kids raised in backyards and slaughtered for human consumption during Easter. We collected 181 paired samples of serum and diaphragm. Serum samples were analyzed by enzyme-linked immunosorbent assay for antibodies against T. gondii , and muscle tissues were analyzed by polymerase chain reaction to detect T. gondii DNA. Thirty-two diaphragm samples were also bioassayed in mice, and the isolates were genotyped using microsatellite markers. The overall seroprevalence of T. gondii infection in goat-kids was 33.1% (60/181; 95% confidence interval [CI] 26.3-40.5%), and T. gondii DNA was found in 6.1% (11/181; 95% CI 3.1-10.6) of the diaphragm samples. We isolated the parasite from 2 of 32 goat-kids, and the T. gondii strains belonged to genotype II. The results showed that 1/3 of 3-mo-old goats may be infected with T. gondii, and their consumption during Easter (as barbecue) may seriously compromise food safety as a result.

Genotyping of Plant and Animal Samples without Prior DNA Purification

PubMed Central

Chum, Pak Y.; Haimes, Josh D.; André, Chas P.; Kuusisto, Pia K.; Kelley, Melissa L.

2012-01-01

The Direct PCR approach facilitates PCR amplification directly from small amounts of unpurified samples, and is demonstrated here for several plant and animal tissues (Figure 1). Direct PCR is based on specially engineered Thermo Scientific Phusion and Phire DNA Polymerases, which include a double-stranded DNA binding domain that gives them unique properties such as high tolerance of inhibitors. PCR-based target DNA detection has numerous applications in plant research, including plant genotype analysis and verification of transgenes. PCR from plant tissues traditionally involves an initial DNA isolation step, which may require expensive or toxic reagents. The process is time consuming and increases the risk of cross contamination1, 2. Conversely, by using Thermo Scientific Phire Plant Direct PCR Kit the target DNA can be easily detected, without prior DNA extraction. In the model demonstrated here, an example of derived cleaved amplified polymorphic sequence analysis (dCAPS)3,4 is performed directly from Arabidopsis plant leaves. dCAPS genotyping assays can be used to identify single nucleotide polymorphisms (SNPs) by SNP allele-specific restriction endonuclease digestion3. Some plant samples tend to be more challenging when using Direct PCR methods as they contain components that interfere with PCR, such as phenolic compounds. In these cases, an additional step to remove the compounds is traditionally required2,5. Here, this problem is overcome by using a quick and easy dilution protocol followed by Direct PCR amplification (Figure 1). Fifteen year-old oak leaves are used as a model for challenging plants as the specimen contains high amounts of phenolic compounds including tannins. Gene transfer into mice is broadly used to study the roles of genes in development, physiology and human disease. The use of these animals requires screening for the presence of the transgene, usually with PCR. Traditionally, this involves a time consuming DNA isolation step, during which DNA for PCR analysis is purified from ear, tail or toe tissues6,7. However, with the Thermo Scientific Phire Animal Tissue Direct PCR Kit transgenic mice can be genotyped without prior DNA purification. In this protocol transgenic mouse genotyping is achieved directly from mouse ear tissues, as demonstrated here for a challenging example where only one primer set is used for amplification of two fragments differing greatly in size. PMID:23051689

Assessment of in vitro oxalate degradation by Lactobacillus species cultured from veterinary probiotics.

PubMed

Cho, Jenny G; Gebhart, Connie J; Furrow, Eva; Lulich, Jody P

2015-09-01

To culture Lactobacillus spp from veterinary probiotics and measure their in vitro oxalate-degrading capacity. 2 commercial veterinary probiotics containing Lactobacillus spp. Lactobacillus spp were cultured anaerobically on selective deMan, Rogosa, Sharpe agar medium and subcultured for speciation by 16S rDNA gene sequencing. Isolates were inoculated into broth containing sodium oxalate (5 mg/L) and incubated anaerobically for 72 hours. An oxalate-degrading isolate of Lactobacillus acidophilus (American Type Culture Collection [ATCC] 53544) was the positive control sample; sterile broth containing a known quantity of sodium oxalate was the negative control sample. Oxalate concentrations were detected with ion chromatography. Oxalate degradation was assessed with Dunnett tests to detect differences in mean oxalate concentration for each isolate, compared with results for the negative control. Lactobacillus acidophilus, Lactobacillus plantarum, and Lactobacillus casei or Lactobacillus zeae (too closely related to differentiate) were isolated from probiotic 1, and L plantarum was isolated from probiotic 2. Sequencing of the 16S rDNA gene confirmed 100% homology to type species. Lactobacillus acidophilus (ATCC 53544) and L acidophilus from probiotic 1 significantly decreased oxalate concentrations by 85.3 and 161.9 mg/L, respectively. Lactobacillus plantarum from probiotics 1 and 2 significantly increased oxalate concentrations by 56.1 and 36.1 mg/L, respectively. Lactobacillus casei did not alter oxalate concentrations. Lactobacillus acidophilus isolates significantly reduced oxalate concentrations. In vivo studies are needed to determine whether probiotics containing L acidophilus decrease urine oxalate concentrations and reduce risk of urolith recurrence in dogs with a history of calcium oxalate urolithiasis.

Molecular Phylogenetics of Trichostrongylus Species (Nematoda: Trichostrongylidae) from Humans of Mazandaran Province, Iran.

PubMed

Sharifdini, Meysam; Heidari, Zahra; Hesari, Zahra; Vatandoost, Sajad; Kia, Eshrat Beigom

2017-06-01

The present study was performed to analyze molecularly the phylogenetic positions of human-infecting Trichostrongylus species in Mazandaran Province, Iran, which is an endemic area for trichostrongyliasis. DNA from 7 Trichostrongylus infected stool samples were extracted by using in-house (IH) method. PCR amplification of ITS2-rDNA region was performed, and products were sequenced. Phylogenetic analysis of the nucleotide sequence data was performed using MEGA 5.0 software. Six out of 7 isolates had high similarity with Trichostrongylus colubriformis , while the other one showed high homology with Trichostrongylus axei registered in GenBank reference sequences. Intra-specific variations within isolates of T. colubriformis and T. axei amounted to 0-1.8% and 0-0.6%, respectively. Trichostrongylus species obtained in the present study were in a cluster with the relevant reference sequences from previous studies. BLAST analysis indicated that there was 100% homology among all 6 ITS2 sequences of T. colubriformis in the present study and most previously registered sequences of T. colubriformis from human, sheep, and goat isolates from Iran and also human isolates from Laos, Thailand, and France. The ITS2 sequence of T. axei exhibited 99.4% homology with the human isolate of T. axei from Thailand, sheep isolates from New Zealand and Iran, and cattle isolate from USA.

Isolation and characterization of new facultative alkaliphilic Bacillus flexus strains from maize processing waste water (nejayote).

PubMed

Sanchez-Gonzalez, M; Blanco-Gamez, A; Escalante, A; Valladares, A G; Olvera, C; Parra, R

2011-04-01

This work describes the isolation and characterization of two new alkaliphilic micro-organisms present in nejayote. Samples of fresh industrial nejayote were plated on nejayote medium and incubated for 4 days at 37 °C. Isolates were identified based on morphological and physiological characteristics, as well as 16S rDNA sequence analysis. Two gram-positive strains, NJY2 and NJY4, able to hydrolyse starch, xylan, and gelatin were isolated from nejayote. Comparative sequence analysis of 16S rDNA and phylogenetic studies indicate that the micro-organisms studied were closely related to members of the Bacillus flexus species. The strains were identified as facultative alkaliphilic salt tolerant bacteria. Isolate NJY2 produced cell associated phenolic acid esterases, able to release ferulic acid from nixtamalised corn bran and ethyl and methyl esters. The isolated strains of B. flexus NJY2 and NJY4 showed important physiological properties to produce high-value molecules from agroindustrial by-products. This is the first report about the isolation of alkaliphilic micro-organisms from nejayote and the first report of phenolic acid esterases synthesised by alkaliphiles. The new alkaliphilic micro-organisms have potential application in the treatment and transformation of tortilla industry residues. © 2011 The Authors. Letters in Applied Microbiology © 2011 The Society for Applied Microbiology.

First report of Tasmanian sheep strain (G2) genotype isolated from Iranian goat using the high resolution melting (HRM) analysis.

PubMed

Hosseini-Safa, Ahmad; Mohag Hegh, Mohammad Ali; Pestechian, Nader; Ganji, Maryam; Mohammadi, Rasoul; Mahmoudi Lamouki, Reza; Rostami-Nejad, Mohammad

2016-12-01

The present study was aimed to evaluate E. granulosus genotypes isolated from goats using HRM analysis in Isfahan province. Cystic echincoccosis, so-called hydatidosis, is widespread infection caused by the larval stage of Echinococcus granulosus . This is an important zoonotic disease worldwide, especially in the developing countries such as Iran. To date, molecular studies mainly based on the mitochondrial DNA sequences have identified distinct genotypes termed G1-G10 which can differ in some characteristics such as the growth and infectivity to different intermediate hosts or the survival rate in the definitive hosts that are important for the development of control strategies. From August to December 2014, 1341 goats were investigated and hydatid cysts were collected from the liver and lungs of 43 infected goats in Isfahan province abattoirs, Isfahan, Iran. Total genomic DNA was extracted from each sample, amplified for the presence of polymorphism of mitochondrial gene coding for cytochrome c oxidase subunit 1 (CO1), using high resolution melting curve (HRM) method. the results of HRM analysis using the sequence of CO1 gene for 43 Echinococcus granulosus isolates from goats showed 31, 2 and 10 isolates were identified as G1, G2, and G3 genotypes, respectively. G1 is the predominant genotype in the isolated goat samples in Isfahan province, and the presence of G2 strain was reported for the first time in goat in Iran.

Genome-Wide Cell Type-Specific Mapping of In Vivo Chromatin Protein Binding Using an FLP-Inducible DamID System in Drosophila.

PubMed

Pindyurin, Alexey V

2017-01-01

A thorough study of the genome-wide binding patterns of chromatin proteins is essential for understanding the regulatory mechanisms of genomic processes in eukaryotic nuclei, including DNA replication, transcription, and repair. The DNA adenine methyltransferase identification (DamID) method is a powerful tool to identify genomic binding sites of chromatin proteins. This method does not require fixation of cells and the use of specific antibodies, and has been used to generate genome-wide binding maps of more than a hundred different proteins in Drosophila tissue culture cells. Recent versions of inducible DamID allow performing cell type-specific profiling of chromatin proteins even in small samples of Drosophila tissues that contain heterogeneous cell types. Importantly, with these methods sorting of cells of interest or their nuclei is not necessary as genomic DNA isolated from the whole tissue can be used as an input. Here, I describe in detail an FLP-inducible DamID method, namely generation of suitable transgenic flies, activation of the Dam transgenes by the FLP recombinase, isolation of DNA from small amounts of dissected tissues, and subsequent identification of the DNA binding sites of the chromatin proteins.

Detection of a transient mitochondrial DNA heteroplasmy in the progeny of crossed genetically divergent isolates of arbuscular mycorrhizal fungi.

PubMed

de la Providencia, Ivan Enrique; Nadimi, Maryam; Beaudet, Denis; Morales, Gabriela Rodriguez; Hijri, Mohamed

2013-10-01

Nonself fusion and nuclear genetic exchange have been documented in arbuscular mycorrhizal fungi (AMF), particularly in Rhizophagus irregularis. However, mitochondrial transmission accompanying nonself fusion of genetically divergent isolates remains unknown. Here, we tested the hypothesis that mitochondrial DNA (mtDNA) heteroplasmy occurs in the progeny of spores, obtained by crossing genetically divergent mtDNAs in R. irregularis isolates. Three isolates of geographically distant locations were used to investigate nonself fusions and mtDNA transmission to the progeny. We sequenced two additional mtDNAs of two R. irregularis isolates and developed isolate-specific size-variable markers in intergenic regions of these isolates and those of DAOM-197198. We achieved three crossing combinations in pre-symbiotic and symbiotic phases. Progeny spores per crossing combination were genotyped using isolate-specific markers. We found evidence that nonself recognition occurs between isolates originating from different continents both in pre-symbiotic and symbiotic phases. Genotyping patterns of individual spores from the progeny clearly showed the presence of markers of the two parental mtDNA haplotypes. Our results demonstrate that mtDNA heteroplasmy occurs in the progeny of the crossed isolates. However, this heteroplasmy appears to be a transient stage because all the live progeny spores that were able to germinate showed only one mtDNA haplotype. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

Monitoring of resistance genes in Listeria monocytogenes isolates and their presence in the extracellular DNA of biofilms: a case study from the Czech Republic.

PubMed

Boháčová, Martina; Zdeňková, Kamila; Tomáštíková, Zuzana; Fuchsová, Viviana; Demnerová, Kateřina; Karpíšková, Renáta; Pazlarová, Jarmila

2018-04-21

The alarming occurrence of antibiotic resistance genes in food production demands continuous monitoring worldwide. One reservoir of resistance genes is thought to be eDNA. There is currently little available information in Europe about either the extracellular DNA distribution of the bacterium or the spread of resistance genes in L. monocytogenes. Therefore, our aims were to give insight into the Listeria monocytogenes resistance situation in the Czech Republic and assess the presence of resistance genes in their extracellular DNA (eDNA). First, susceptibility tests were performed on 49 isolates of L. monocytogenes with selected antibiotics. Next, we tested DNA of suspected isolates for the presence of resistance genes in both planktonic cells and the eDNA of biofilms. Finally, fluorescent confocal microscopy was used to observe the eDNA pattern of selected isolates under conditions that mimicked the food processing environment and the human body. Susceptibility tests found isolates intermediate resistant to chloramphenicol, tetracycline, and ciprofloxacin as well as isolates resistant to ciprofloxacin. For all suspected isolates, PCR confirmed the presence of the gene lde encoding efflux pump in both types of DNA. When the biofilm was observed using confocal laser scanning microscope, the eDNA distribution patterns varied considerably according to the culture conditions. Furthermore, the food and clinical isolates varied in terms of the amount of eDNA detected. The presence of an efflux pump in both types of DNA suggests that the eDNA might serve as a reservoir of resistance genes. Surprising differences were observed in the eDNA pattern. Our results suggest that the current risk of the spread of L. monocytogenes resistance genes is low in the Czech Republic, but they also indicate the need for continuous long-term monitoring of the situation.

Clinical evaluation of a novel microfluidic device for epitope-independent enrichment of circulating tumour cells in patients with small cell lung cancer.

PubMed

Chudziak, Jakub; Burt, Deborah J; Mohan, Sumitra; Rothwell, Dominic G; Mesquita, Bárbara; Antonello, Jenny; Dalby, Suzanne; Ayub, Mahmood; Priest, Lynsey; Carter, Louise; Krebs, Matthew G; Blackhall, Fiona; Dive, Caroline; Brady, Ged

2016-01-21

Circulating tumour cells (CTCs) have potential utility as minimally-invasive biomarkers to aid cancer treatment decision making. However, many current CTC technologies enrich CTCs using specific surface epitopes that do not necessarily reflect CTC heterogeneity. Here we evaluated the epitope-independent Parsortix system which enriches CTCs based on size and rigidity using both healthy normal volunteer blood samples spiked with tumour cells and blood samples from patients with small cell lung cancer (SCLC). Blood samples were maintained unfractionated at room temperature for up to 4 days followed by plasma removal for circulating free DNA (cfDNA) isolation and direct application of the remaining cell component to the Parsortix system. For tumour cells expressing the EpCAM cell surface marker the numbers of spiked cells retained using the Parsortix system and by EpCAM-positive selection using CellSearch® were not significantly different, whereas only the Parsortix system showed strong enrichment of cells with undetectable EpCAM expression. In a pilot clinical study we banked both enriched CTCs as well as plasma from SCLC patient blood samples. Upon retrieval of the banked Parsortix cellular samples we could detect cytokeratin positive CTCs in all 12 SCLC patients tested. Interestingly, processing parallel samples from the same patients by EpCAM enrichment using CellSearch® revealed only 83% (10/12) with cytokeratin positive CTCs indicating the Parsortix system is enriching for EpCAM negative SCLC CTCs. Our combined results indicate the Parsortix system is a valuable tool for combined cfDNA isolation and CTC enrichment that enables CTC analysis to be extended beyond dependence on surface epitopes.

Identification of eukaryotic open reading frames in metagenomic cDNA libraries made from environmental samples.

PubMed

Grant, Susan; Grant, William D; Cowan, Don A; Jones, Brian E; Ma, Yanhe; Ventosa, Antonio; Heaphy, Shaun

2006-01-01

Here we describe the application of metagenomic technologies to construct cDNA libraries from RNA isolated from environmental samples. RNAlater (Ambion) was shown to stabilize RNA in environmental samples for periods of at least 3 months at -20 degrees C. Protocols for library construction were established on total RNA extracted from Acanthamoeba polyphaga trophozoites. The methodology was then used on algal mats from geothermal hot springs in Tengchong county, Yunnan Province, People's Republic of China, and activated sludge from a sewage treatment plant in Leicestershire, United Kingdom. The Tenchong libraries were dominated by RNA from prokaryotes, reflecting the mainly prokaryote microbial composition. The majority of these clones resulted from rRNA; only a few appeared to be derived from mRNA. In contrast, many clones from the activated sludge library had significant similarity to eukaryote mRNA-encoded protein sequences. A library was also made using polyadenylated RNA isolated from total RNA from activated sludge; many more clones in this library were related to eukaryotic mRNA sequences and proteins. Open reading frames (ORFs) up to 378 amino acids in size could be identified. Some resembled known proteins over their full length, e.g., 36% match to cystatin, 49% match to ribosomal protein L32, 63% match to ribosomal protein S16, 70% to CPC2 protein. The methodology described here permits the polyadenylated transcriptome to be isolated from environmental samples with no knowledge of the identity of the microorganisms in the sample or the necessity to culture them. It has many uses, including the identification of novel eukaryotic ORFs encoding proteins and enzymes.

Introducing automation to the molecular diagnosis of Trypanosoma cruzi infection: A comparative study of sample treatments, DNA extraction methods and real-time PCR assays.

PubMed

Abras, Alba; Ballart, Cristina; Llovet, Teresa; Roig, Carme; Gutiérrez, Cristina; Tebar, Silvia; Berenguer, Pere; Pinazo, María-Jesús; Posada, Elizabeth; Gascón, Joaquim; Schijman, Alejandro G; Gállego, Montserrat; Muñoz, Carmen

2018-01-01

Polymerase chain reaction (PCR) has become a useful tool for the diagnosis of Trypanosoma cruzi infection. The development of automated DNA extraction methodologies and PCR systems is an important step toward the standardization of protocols in routine diagnosis. To date, there are only two commercially available Real-Time PCR assays for the routine laboratory detection of T. cruzi DNA in clinical samples: TCRUZIDNA.CE (Diagnostic Bioprobes Srl) and RealCycler CHAG (Progenie Molecular). Our aim was to evaluate the RealCycler CHAG assay taking into account the whole process. We assessed the usefulness of an automated DNA extraction system based on magnetic particles (EZ1 Virus Mini Kit v2.0, Qiagen) combined with a commercially available Real-Time PCR assay targeting satellite DNA (SatDNA) of T. cruzi (RealCycler CHAG), a methodology used for routine diagnosis in our hospital. It was compared with a well-known strategy combining a commercial DNA isolation kit based on silica columns (High Pure PCR Template Preparation Kit, Roche Diagnostics) with an in-house Real-Time PCR targeting SatDNA. The results of the two methodologies were in almost perfect agreement, indicating they can be used interchangeably. However, when variations in protocol factors were applied (sample treatment, extraction method and Real-Time PCR), the results were less convincing. A comprehensive fine-tuning of the whole procedure is the key to successful results. Guanidine EDTA-blood (GEB) samples are not suitable for DNA extraction based on magnetic particles due to inhibition, at least when samples are not processed immediately. This is the first study to evaluate the RealCycler CHAG assay taking into account the overall process, including three variables (sample treatment, extraction method and Real-Time PCR). Our findings may contribute to the harmonization of protocols between laboratories and to a wider application of Real-Time PCR in molecular diagnostic laboratories associated with health centers.

Quartz crystal microbalance (QCM) affinity biosensor for genetically modified organisms (GMOs) detection.

PubMed

Mannelli, Ilaria; Minunni, Maria; Tombelli, Sara; Mascini, Marco

2003-03-01

A DNA piezoelectric sensor has been developed for the detection of genetically modified organisms (GMOs). Single stranded DNA (ssDNA) probes were immobilised on the sensor surface of a quartz crystal microbalance (QCM) device and the hybridisation between the immobilised probe and the target complementary sequence in solution was monitored. The probe sequences were internal to the sequence of the 35S promoter (P) and Nos terminator (T), which are inserted sequences in the genome of GMOs regulating the transgene expression. Two different probe immobilisation procedures were applied: (a) a thiol-dextran procedure and (b) a thiol-derivatised probe and blocking thiol procedure. The system has been optimised using synthetic oligonucleotides, which were then applied to samples of plasmidic and genomic DNA isolated from the pBI121 plasmid, certified reference materials (CRM), and real samples amplified by the polymerase chain reaction (PCR). The analytical parameters of the sensor have been investigated (sensitivity, reproducibility, lifetime etc.). The results obtained showed that both immobilisation procedures enabled sensitive and specific detection of GMOs, providing a useful tool for screening analysis in food samples.

Sphingomonas alaskensis Strain AFO1, an Abundant Oligotrophic Ultramicrobacterium from the North Pacific

PubMed Central

Eguchi, Mitsuru; Ostrowski, Martin; Fegatella, Fitri; Bowman, John; Nichols, David; Nishino, Tomohiko; Cavicchioli, Ricardo

2001-01-01

Numerous studies have established the importance of picoplankton (microorganisms of ≤2 μm in length) in energy flow and nutrient cycling in marine oligotrophic environments, and significant effort has been directed at identifying and isolating heterotrophic picoplankton from the world's oceans. Using a method of diluting natural seawater to extinction followed by monthly subculturing for 12 months, a bacterium was isolated that was able to form colonies on solid medium. The strain was isolated from a 105 dilution of seawater where the standing bacterial count was 3.1 × 105 cells ml−1. This indicated that the isolate was representative of the most abundant bacteria at the sampling site, 1.5 km from Cape Muroto, Japan. The bacterium was characterized and found to be ultramicrosized (less than 0.1 μm3), and the size varied to only a small degree when the cells were starved or grown in rich media. A detailed molecular (16S rRNA sequence, DNA-DNA hybridization, G+C mol%, genome size), chemotaxonomic (lipid analysis, morphology), and physiological (resistance to hydrogen peroxide, heat, and ethanol) characterization of the bacterium revealed that it was a strain of Sphingomonas alaskensis. The type strain, RB2256, was previously isolated from Resurrection Bay, Alaska, and similar isolates have been obtained from the North Sea. The isolation of this species over an extended period, its high abundance at the time of sampling, and its geographical distribution indicate that it has the capacity to proliferate in ocean waters and is therefore likely to be an important contributor in terms of biomass and nutrient cycling in marine environments. PMID:11679312

Molecular detection of field isolates of Turkey Eimeria by polymerase chain reaction amplification of the cytochrome c oxidase I gene.

PubMed

Rathinam, T; Gadde, U; Chapman, H D

2015-07-01

Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70 %) of the farms while 9 (30 %) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7 %) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods.

Entomopathogenic nematodes in agricultural areas in Brazil.

PubMed

de Brida, Andressa Lima; Rosa, Juliana Magrinelli Osório; Oliveira, Cláudio Marcelo Gonçalves de; Castro, Bárbara Monteiro de Castro E; Serrão, José Eduardo; Zanuncio, José Cola; Leite, Luis Garrigós; Wilcken, Silvia Renata Siciliano

2017-04-06

Entomopathogenic nematodes (EPNs) (Steinernematidae and Heterorhabditidae) can control pests due to the mutualistic association with bacteria that kill the host by septicemia and make the environment favorable for EPNs development and reproduction. The diversity of EPNs in Brazilian soils requires further study. The identification of EPNs, adapted to environmental and climatic conditions of cultivated areas is important for sustainable pest suppression in integrated management programs in agricultural areas of Brazil. The objective was to identify EPNs isolated from agricultural soils with annual, fruit and forest crops in Brazil. Soil samples were collected and stored in 250 ml glass vials. The nematodes were isolated from these samples with live bait traps ([Galleria mellonella L. (Lepidoptera: Pyralidae) larvae]. Infective juveniles were collected with White traps and identified by DNA barcoding procedures by sequencing the D2/D3 expansion of the 28S rDNA region by PCR. EPNs identified in agricultural areas in Brazil were Heterorhabditis amazonensis, Metarhabditis rainai, Oscheios tipulae and Steinernema rarum. These species should be considered pest biocontrol agents in Brazilian agricultural areas.

Comparison of commercial DNA extraction kits for isolation and purification of bacterial and eukaryotic DNA from PAH-contaminated soils.

PubMed

Mahmoudi, Nagissa; Slater, Greg F; Fulthorpe, Roberta R

2011-08-01

Molecular characterization of the microbial populations of soils and sediments contaminated with polycyclic aromatic hydrocarbons (PAHs) is often a first step in assessing intrinsic biodegradation potential. However, soils are problematic for molecular analysis owing to the presence of organic matter, such as humic acids. Furthermore, the presence of contaminants, such as PAHs, can cause further challenges to DNA extraction, quantification, and amplification. The goal of our study was to compare the effectiveness of four commercial soil DNA extraction kits (UltraClean Soil DNA Isolation kit, PowerSoil DNA Isolation kit, PowerMax Soil DNA Isolation kit, and FastDNA SPIN kit) to extract pure, high-quality bacterial and eukaryotic DNA from PAH-contaminated soils. Six different contaminated soils were used to determine if there were any biases among the kits due to soil properties or level of contamination. Extracted DNA was used as a template for bacterial 16S rDNA and eukaryotic 18S rDNA amplifications, and PCR products were subsequently analyzed using denaturing gel gradient electrophoresis (DGGE). We found that the FastDNA SPIN kit provided significantly higher DNA yields for all soils; however, it also resulted in the highest levels of humic acid contamination. Soil texture and organic carbon content of the soil did not affect the DNA yield of any kit. Moreover, a liquid-liquid extraction of the DNA extracts found no residual PAHs, indicating that all kits were effective at removing contaminants in the extraction process. Although the PowerSoil DNA Isolation kit gave relatively low DNA yields, it provided the highest quality DNA based on successful amplification of both bacterial and eukaryotic DNA for all six soils. DGGE fingerprints among the kits were dramatically different for both bacterial and eukaryotic DNA. The PowerSoil DNA Isolation kit revealed multiple bands for each soil and provided the most consistent DGGE profiles among replicates for both bacterial and eukaryotic DNA.

Description of Kribbella italica sp. nov., isolated from a Roman catacomb.

PubMed

Everest, Gareth J; Curtis, Sarah M; De Leo, Filomena; Urzì, Clara; Meyers, Paul R

2015-02-01

A novel actinobacterium, strain BC637(T), was isolated from a biodeteriogenic biofilm sample collected in 2009 in the Saint Callixstus Roman catacomb. The strain was found to belong to the genus Kribbella by analysis of the 16S rRNA gene. Phylogenetic analysis using the 16S rRNA gene and the gyrB, rpoB, relA, recA and atpD concatenated gene sequences showed that strain BC637(T) was most closely related to the type strains of Kribbella lupini and Kribbella endophytica. DNA-DNA hybridization experiments confirmed that strain BC637(T) is a genomic species that is distinct from its closest phylogenetic relatives, K. endophytica DSM 23718(T) (63 % DNA relatedness) and K. lupini LU14(T) (63 % DNA relatedness). Physiological comparisons showed that strain BC637(T) is phenotypically distinct from the type strains of K. endophytica and K. lupini. Thus, strain BC637(T) represents the type strain of a novel species, for which the name Kribella italica sp. nov. is proposed ( = DSM 28967(T) = NRRL B-59155(T)). © 2015 IUMS.

Unusual Aspergillus species in patients with cystic fibrosis.

PubMed

Symoens, Françoise; Haase, Gerhard; Pihet, Marc; Carrere, Jacqueline; Beguin, Hugues; Degand, Nicolas; Mely, Laurent; Bouchara, Jean-Philippe

2010-11-01

Poorly sporulating Aspergillus isolates from patients with cystic fibrosis (CF) are generally identified in routine procedures as Aspergillus spp. In this study, we identified and characterized 11 isolates belonging to two unusual Aspergillus species of the section Fumigati (A. lentulus and Neosartorya pseudofischeri) recovered from four different patients. Aspergillus lentulus was found occasionally during a 10-year follow-up study of one CF patient colonized by A. fumigatus. Neosartorya pseudofischeri was isolated from three patients followed in different European hospitals. This species was recovered from two sputum samples of one patient, and from four successive samples of the two other patients, suggesting that it may be responsible for chronic colonization. Both species were isolated together with A. fumigatus. Isolates from both species did not grow at 50°C, and DNA sequence analysis, together with further morphological observations permitted identification at the species level. Growth at different temperatures and antifungal susceptibility were also investigated. All the isolates of N. pseudofischeri exhibited a very low susceptibility to voriconazole (VRZ) whereas a very low susceptibility to VRZ and amphotericin B was seen with the A. lentulus isolates.

A Comprehensive Characterization of Microorganisms and Allergens in Spacecraft Environment

NASA Technical Reports Server (NTRS)

Castro, V.A.; Ott, C.M.; Garcia, V.M.; John, J.; Buttner, M.P.; Cruz, P.; Pierson, D.L.

2009-01-01

The determination of risk from infectious disease during long-duration missions is composed of several factors including the concentration and the characteristics of the infectious agent. Thus, a thorough knowledge of the microorganisms aboard spacecraft is essential in mitigating infectious disease risk to the crew. While stringent steps are taken to minimize the transfer of potential pathogens to spacecraft, several medically significant organisms have been isolated from both the Mir and International Space Station (ISS). Historically, the method for isolation and identification of microorganisms from spacecraft environmental samples depended upon their growth on culture media. Unfortunately, only a fraction of the organisms may grow on a culture medium, potentially omitting those microorganisms whose nutritional and physical requirements for growth are not met. Thus, several pathogens may not have been detected, such as Legionella pneumophila, the etiological agent of Legionnaire s disease. We hypothesize that environmental analysis using non-culture-based technologies will reveal microorganisms, allergens, and microbial toxins not previously reported in spacecraft, allowing for a more complete health assessment. The development of techniques for this flight experiment, operationally named SWAB, has already provided advances in NASA laboratory processes and beneficial information toward human health risk assessment. The translation of 16S ribosomal DNA sequencing for the identification of bacteria from the SWAB experiment to nominal operations has increased bacterial speciation of environmental isolates from previous flights three fold compared to previous conventional methodology. The incorporation of molecular-based DNA fingerprinting using repetitive sequence-based polymerase chain reaction (rep-PCR) into the capabilities of the laboratory has provided a methodology to track microorganisms between crewmembers and their environment. Both 16S ribosomal DNA identification and bacterial fingerprinting have improved NASA s capability to better understand spacecraft environments and determine the source of contamination events. Preflight sampling has been completed for air, surface, and water samples. In-flight sample collection has been completed for a total of 8 air and surface sample collection sessions. In-flight hardware has performed well and the surface sampling device received positive feedback from the crew for its ease of use. While processing and analysis continue for these samples, early results have begun to provide information on the spacecraft environment. Using a method called Denaturing Gradient Gel Electrophoresis (DGGE), several air and samples were evaluated to determine the types of organisms that were present. Using only molecular techniques, DGGE does not depend on any microbial growth on culture media, allowing a more comprehensive assessment of the spacecraft interior. Preliminary results have identified several microorganisms that would not have been isolated using current technology, though none of these organisms would be considered medically significant. Interestingly, the isolation of Gram negative organisms is greater using DGGE than conventional media based isolation. The cause of this finding is unclear, though it may be the result of the technique s ability to isolate both viable and non-viable bacteria. The next phase of the SWAB sample analysis is the use of quantitative polymerase chain reaction (QPCR) to look for specific medically significant organisms. While not as broad as DGGE, QPCR is much more sensitive and may reveal findings that were not seen during the initial evaluation. Together, this information will lead toward an accurate microbial risk assessment to help set flight requirements to protect the safety, health, and performance of the crew.

Biodiversity of Clostridium botulinum Type E Associated with a Large Outbreak of Botulism in Wildlife from Lake Erie and Lake Ontario ▿

PubMed Central

Hannett, George E.; Stone, Ward B.; Davis, Stephen W.; Wroblewski, Danielle

2011-01-01

The genetic relatedness of Clostridium botulinum type E isolates associated with an outbreak of wildlife botulism was studied using random amplification of polymorphic DNA (RAPD). Specimens were collected from November 2000 to December 2008 during a large outbreak of botulism affecting birds and fish living in and around Lake Erie and Lake Ontario. In our present study, a total of 355 wildlife samples were tested for the presence of botulinum toxin and/or organisms. Type E botulinum toxin was detected in 110 samples from birds, 12 samples from fish, and 2 samples from mammals. Sediment samples from Lake Erie were also examined for the presence of C. botulinum. Fifteen of 17 sediment samples were positive for the presence of C. botulinum type E. Eighty-one C. botulinum isolates were obtained from plants, animals, and sediments; of these isolates, 44 C. botulinum isolates produced type E toxin, as determined by mouse bioassay, while the remaining 37 isolates were not toxic for mice. All toxin-producing isolates were typed by RAPD; that analysis showed 12 different RAPD types and multiple subtypes. Our study thus demonstrates that multiple genetically distinct strains of C. botulinum were involved in the present outbreak of wildlife botulism. We found that C. botulinum type E is present in the sediments of Lake Erie and that a large range of bird and fish species is affected. PMID:21115703

Polymerase Chain Reaction Detection of Leishmania kDNA from the Urine of Peruvian Patients with Cutaneous and Mucocutaneous Leishmaniasis

PubMed Central

Veland, Nicolas; Espinosa, Diego; Valencia, Braulio Mark; Ramos, Ana Pilar; Calderon, Flor; Arevalo, Jorge; Low, Donald E.; Llanos-Cuentas, Alejandro; Boggild, Andrea K.

2011-01-01

We hypothesized that Leishmania kDNA may be present in urine of patients with cutaneous leishmaniasis (CL). Urine samples and standard diagnostic specimens were collected from patients with skin lesions. kDNA polymerase chain reaction (PCR) was performed on samples from patients and 10 healthy volunteers from non-endemic areas. Eighty-six of 108 patients were diagnosed with CL and 18 (21%) had detectable Leishmania Viannia kDNA in the urine. Sensitivity and specificity were 20.9% (95% confidence interval [CI] 12.3–29.5%) and 100%. Six of 8 patients with mucocutaneous involvement had detectable kDNA in urine versus 12 of 78 patients with isolated cutaneous disease (P < 0.001). L. (V.) braziliensis (N = 3), L. (V.) guyanensis (N = 6), and L. (V.) peruviana (N = 3) were identified from urine. No healthy volunteer or patient with an alternate diagnosis had detectable kDNA in urine. Sensitivity of urine PCR is sub-optimal for diagnosis. On the basis of these preliminary data in a small number of patients, detectable kDNA in urine may identify less localized forms of infection and inform treatment decisions. PMID:21460009

Direct Detection and Genotyping of Klebsiella pneumoniae Carbapenemases from Urine by Use of a New DNA Microarray Test

PubMed Central

Peter, Harald; Berggrav, Kathrine; Thomas, Peter; Pfeifer, Yvonne; Witte, Wolfgang; Templeton, Kate

2012-01-01

Klebsiella pneumoniae carbapenemases (KPCs) are considered a serious threat to antibiotic therapy, as they confer resistance to carbapenems, which are used to treat extended-spectrum beta-lactamase (ESBL)-producing bacteria. Here, we describe the development and evaluation of a DNA microarray for the detection and genotyping of KPC genes (blaKPC) within a 5-h period. To test the whole assay procedure (DNA extraction plus a DNA microarray assay) directly from clinical specimens, we compared two commercial DNA extraction kits (the QIAprep Spin miniprep kit [Qiagen] and the urine bacterial DNA isolation kit [Norgen]) for the direct DNA extraction from urine samples (dilution series spiked in human urine). Reliable single nucleotide polymorphism (SNP) typing was demonstrated using 1 × 105 CFU/ml urine for Escherichia coli (Qiagen and Norgen) and 80 CFU/ml urine, on average, for K. pneumoniae (Norgen). This study presents, for the first time, the combination of a new KPC microarray with commercial sample preparation for detecting and genotyping microbial pathogens directly from clinical specimens; this paves the way toward tests providing epidemiological and diagnostic data, enabling better antimicrobial stewardship. PMID:23035190

Isolation and characterization of ethanol tolerant yeast strains

PubMed Central

Tikka, Chiranjeevi; Osuru, Hari Prasad; Atluri, Navya; Raghavulu, Praveen Chakravarthi Veera; yellapu, Nanda Kumar; Mannur, Ismail Shaik; Prasad, Uppu Venkateswara; Aluru, Sudheer; K, Narasimha Varma; Bhaskar, Matcha

2013-01-01

Yeast strains are commonly associated with sugar rich environments. Various fruit samples were selected as source for isolating yeast cells. The isolated cultures were identified at Genus level by colony morphology, biochemical characteristics and cell morphological characters. An attempt has been made to check the viability of yeast cells under different concentrations of ethanol. Ethanol tolerance of each strain was studied by allowing the yeast to grow in liquid YEPD (Yeast Extract Peptone Dextrose) medium having different concentrations of ethanol. A total of fifteen yeast strains isolated from different samples were used for the study. Seven strains of Saccharomyces cerevisiae obtained from different fruit sources were screened for ethanol tolerance. The results obtained in this study show a range of tolerance levels between 7%-12% in all the stains. Further, the cluster analysis based on 22 RAPD (Random Amplified polymorphic DNA) bands revealed polymorphisms in these seven Saccharomyces strains. PMID:23750092

Molecular identification of Aspergillus and Eurotium species isolated from rice and their toxin-producing ability.

PubMed

Yazdani, D; Zainal Abidin, M A; Tan, Y H; Kamaruzaman, S

2011-01-01

Thirty milled rice samples were collected from retailers in 4 provinces of Malaysia. These samples were evaluated for Aspergillus spp. infection by direct plating on malt extract salt agar (MESA). All Aspergillus holomorphs were isolated and identified using nucleotide sequences of ITS 1 and ITS 2 of rDNA. Five anamorphs (Aspergillus flavus, A. oryzae, A. tamarii, A. fumigatus and A. niger) and 5 teleomorphs (Eurotium rubrum, E. amstelodami, E. chevalieri, E. cristatum and E. tonophilum) were identified. The PCR-sequencing based technique for sequences of ITS 1 and ITS 2 is a fast technique for identification of Aspergillus and Eurotium species, although it doesn't work flawlessly for differentiation of Eurotium species. All Aspergillus and Eurotium isolates were screened for their ability to produce aflatoxin and ochratoxin A (OTA) by HPLC and TLC techniques. Only A. flavus isolate UPM 89 was able to produce aflatoxins B1 and B2.

Mitochondrial DNA diversity of present-day Aboriginal Australians and implications for human evolution in Oceania.

PubMed

Nagle, Nano; Ballantyne, Kaye N; van Oven, Mannis; Tyler-Smith, Chris; Xue, Yali; Wilcox, Stephen; Wilcox, Leah; Turkalov, Rust; van Oorschot, Roland A H; van Holst Pellekaan, Sheila; Schurr, Theodore G; McAllister, Peter; Williams, Lesley; Kayser, Manfred; Mitchell, R John

2017-03-01

Aboriginal Australians are one of the more poorly studied populations from the standpoint of human evolution and genetic diversity. Thus, to investigate their genetic diversity, the possible date of their ancestors' arrival and their relationships with neighboring populations, we analyzed mitochondrial DNA (mtDNA) diversity in a large sample of Aboriginal Australians. Selected mtDNA single-nucleotide polymorphisms and the hypervariable segment haplotypes were analyzed in 594 Aboriginal Australians drawn from locations across the continent, chiefly from regions not previously sampled. Most (~78%) samples could be assigned to mtDNA haplogroups indigenous to Australia. The indigenous haplogroups were all ancient (with estimated ages >40 000 years) and geographically widespread across the continent. The most common haplogroup was P (44%) followed by S (23%) and M42a (9%). There was some geographic structure at the haplotype level. The estimated ages of the indigenous haplogroups range from 39 000 to 55 000 years, dates that fit well with the estimated date of colonization of Australia based on archeological evidence (~47 000 years ago). The distribution of mtDNA haplogroups in Australia and New Guinea supports the hypothesis that the ancestors of Aboriginal Australians entered Sahul through at least two entry points. The mtDNA data give no support to the hypothesis of secondary gene flow into Australia during the Holocene, but instead suggest long-term isolation of the continent.

Isolation from genomic DNA of sequences binding specific regulatory proteins by the acceleration of protein electrophoretic mobility upon DNA binding.

PubMed

Subrahmanyam, S; Cronan, J E

1999-01-21

We report an efficient and flexible in vitro method for the isolation of genomic DNA sequences that are the binding targets of a given DNA binding protein. This method takes advantage of the fact that binding of a protein to a DNA molecule generally increases the rate of migration of the protein in nondenaturing gel electrophoresis. By the use of a radioactively labeled DNA-binding protein and nonradioactive DNA coupled with PCR amplification from gel slices, we show that specific binding sites can be isolated from Escherichia coli genomic DNA. We have applied this method to isolate a binding site for FadR, a global regulator of fatty acid metabolism in E. coli. We have also isolated a second binding site for BirA, the biotin operon repressor/biotin ligase, from the E. coli genome that has a very low binding efficiency compared with the bio operator region.

Absolute quantification of olive oil DNA by droplet digital-PCR (ddPCR): Comparison of isolation and amplification methodologies.

PubMed

Scollo, Francesco; Egea, Leticia A; Gentile, Alessandra; La Malfa, Stefano; Dorado, Gabriel; Hernandez, Pilar

2016-12-15

Olive oil is considered a premium product for its nutritional value and health benefits, and the ability to define its origin and varietal composition is a key step towards ensuring the traceability of the product. However, isolating the DNA from such a matrix is a difficult task. In this study, the quality and quantity of olive oil DNA, isolated using four different DNA isolation protocols, was evaluated using the qRT-PCR and ddPCR techniques. The results indicate that CTAB-based extraction methods were the best for unfiltered oil, while Nucleo Spin-based extraction protocols showed greater overall reproducibility. The use of both qRT-PCR and ddPCR led to the absolute quantification of the DNA copy number. The results clearly demonstrate the importance of the choice of DNA-isolation protocol, which should take into consideration the qualitative aspects of DNA and the evaluation of the amplified DNA copy number. Copyright © 2016 Elsevier Ltd. All rights reserved.

Fluorescence resonance energy transfer-based real-time polymerase chain reaction method without DNA extraction for the genotyping of F5, F2, F12, MTHFR, and HFE.

PubMed

Martinez-Serra, Jordi; Robles, Juan; Nicolàs, Antoni; Gutierrez, Antonio; Ros, Teresa; Amat, Juan Carlos; Alemany, Regina; Vögler, Oliver; Abelló, Aina; Noguera, Aina; Besalduch, Joan

2014-01-01

Blood samples are extensively used for the molecular diagnosis of many hematological diseases. The daily practice in a clinical laboratory of molecular diagnosis in hematology involves using a variety of techniques, based on the amplification of nucleic acids. Current methods for polymerase chain reaction (PCR) use purified genomic DNA, mostly isolated from total peripheral blood cells or white blood cells (WBC). In this paper we describe a real-time fluorescence resonance energy transfer-based method for genotyping directly from blood cells. Our strategy is based on an initial isolation of the WBCs, allowing the removal of PCR inhibitors, such as the heme group, present in the erythrocytes. Once the erythrocytes have been lysed, in the LightCycler(®) 2.0 Instrument, we perform a real-time PCR followed by a melting curve analysis for different genes (Factors 2, 5, 12, MTHFR, and HFE). After testing 34 samples comparing the real-time crossing point (CP) values between WBC (5×10(6) WBC/mL) and purified DNA (20 ng/μL), the results for F5 Leiden were as follows: CP mean value for WBC was 29.26±0.566 versus purified DNA 24.79±0.56. Thus, when PCR was performed from WBC (5×10(6) WBC/mL) instead of DNA (20 ng/μL), we observed a delay of about 4 cycles. These small differences in CP values were similar for all genes tested and did not significantly affect the subsequent analysis by melting curves. In both cases the fluorescence values were high enough, allowing a robust genotyping of all these genes without a previous DNA purification/extraction.

Multicenter Comparative Evaluation of Five Commercial Methods for Toxoplasma DNA Extraction from Amniotic Fluid▿

PubMed Central

Yera, H.; Filisetti, D.; Bastien, P.; Ancelle, T.; Thulliez, P.; Delhaes, L.

2009-01-01

Over the past few years, a number of new nucleic acid extraction methods and extraction platforms using chemistry combined with magnetic or silica particles have been developed, in combination with instruments to facilitate the extraction procedure. The objective of the present study was to investigate the suitability of these automated methods for the isolation of Toxoplasma gondii DNA from amniotic fluid (AF). Therefore, three automated procedures were compared to two commercialized manual extraction methods. The MagNA Pure Compact (Roche), BioRobot EZ1 (Qiagen), and easyMAG (bioMérieux) automated procedures were compared to two manual DNA extraction kits, the QIAamp DNA minikit (Qiagen) and the High Pure PCR template preparation kit (Roche). Evaluation was carried out with two specific Toxoplasma PCRs (targeting the 529-bp repeat element), inhibitor search PCRs, and human beta-globin PCRs. The samples each consisted of 4 ml of AF with or without a calibrated Toxoplasma gondii RH strain suspension (0, 1, 2.5, 5, and 25 tachyzoites/ml). All PCR assays were laboratory-developed real-time PCR assays, using either TaqMan or fluorescent resonance energy transfer probes. A total of 1,178 PCRs were performed, including 978 Toxoplasma PCRs. The automated and manual methods were similar in sensitivity for DNA extraction from T. gondii at the highest concentration (25 Toxoplasma gondii cells/ml). However, our results showed that the DNA extraction procedures led to variable efficacy in isolating low concentrations of tachyzoites in AF samples (<5 Toxoplasma gondii cells/ml), a difference that might have repercussions since low parasite concentrations in AF exist and can lead to congenital toxoplasmosis. PMID:19846633

PCR Inhibition of a Quantitative PCR for Detection of Mycobacterium avium Subspecies Paratuberculosis DNA in Feces: Diagnostic Implications and Potential Solutions

PubMed Central

Acharya, Kamal R.; Dhand, Navneet K.; Whittington, Richard J.; Plain, Karren M.

2017-01-01

Molecular tests such as polymerase chain reaction (PCR) are increasingly being applied for the diagnosis of Johne’s disease, a chronic intestinal infection of ruminants caused by Mycobacterium avium subspecies paratuberculosis (MAP). Feces, as the primary test sample, presents challenges in terms of effective DNA isolation, with potential for PCR inhibition and ultimately for reduced analytical and diagnostic sensitivity. However, limited evidence is available regarding the magnitude and diagnostic implications of PCR inhibition for the detection of MAP in feces. This study aimed to investigate the presence and diagnostic implications of PCR inhibition in a quantitative PCR assay for MAP (High-throughput Johne’s test) to investigate the characteristics of samples prone to inhibition and to identify measures that can be taken to overcome this. In a study of fecal samples derived from a high prevalence, endemically infected cattle herd, 19.94% of fecal DNA extracts showed some evidence of inhibition. Relief of inhibition by a five-fold dilution of the DNA extract led to an average increase in quantification of DNA by 3.3-fold that consequently increased test sensitivity of the qPCR from 55 to 80% compared to fecal culture. DNA extracts with higher DNA and protein content had 19.33 and 10.94 times higher odds of showing inhibition, respectively. The results suggest that the current test protocol is sensitive for herd level diagnosis of Johne’s disease but that test sensitivity and individual level diagnosis could be enhanced by relief of PCR inhibition, achieved by five-fold dilution of the DNA extract. Furthermore, qualitative and quantitative parameters derived from absorbance measures of DNA extracts could be useful for prediction of inhibitory fecal samples. PMID:28210245

Intratumoral heterogeneity in breast carcinoma revealed by laser-microdissection and comparative genomic hybridization.

PubMed

Aubele, M; Mattis, A; Zitzelsberger, H; Walch, A; Kremer, M; Hutzler, P; Höfler, H; Werner, M

1999-04-15

To evaluate the potential cytogenetic heterogeneity in breast carcinoma, several small cell groups (each consisting of 20 to 50 cells) were investigated within paraffin sections. By laser-microdissection, three to seven cell groups were taken per case. The DNA was amplified by degenerate oligonucleotide primed PCR (DOP-PCR), and the samples were analyzed by CGH for chromosomal gains and losses. Two ductal invasive breast carcinomas, one of them with two lymphnode metastases, were investigated. To compare the results from the small samples, CGH was also performed on DNA isolated from the tumorous regions of three to five serial sections (10(7) to 10(6) cells). The aberrations observed in the microdissected tumor samples were multiple and involved up to 14 different chromosomal or subchromosomal regions. The most frequent changes were gains on chromosomes 12q (14/20) and 20q (16/20), and loss on 13q (12/20). Some aberrations have rarely been detected (e.g., loss on 2p, gain on 8q). Comparing chromosomal imbalances in primary tumors and lymph node metastases, more consistent changes were found between the primary tumor and its corresponding metastases than between both primary tumors. The laser-microdissected samples in general showed more chromosomal aberrations than DNA isolated from several tumor sections. Our CGH results were confirmed by fluorescence in situ hybridization (FISH) for the chromosomal regions of centromere 1 and 20, and 20q13. In addition, microsatellite analyses on 31 samples confirmed our CGH findings for selected chromosome regions 2p and 11q. It can be concluded that there is a distinct intratumoral heterogeneity in primary breast tumors as well as in the corresponding lymph node metastases. The combination of microdissection and CGH enabled us to detect cytogenetic aberrations from important clones which are missed when analyzing DNA extracted from large cell numbers.

A Prospective Evaluation of Circulating Tumor Cells and Cell-Free DNA in EGFR-Mutant Non-Small Cell Lung Cancer Patients Treated with Erlotinib on a Phase II Trial.

PubMed

Yanagita, Masahiko; Redig, Amanda J; Paweletz, Cloud P; Dahlberg, Suzanne E; O'Connell, Allison; Feeney, Nora; Taibi, Myriam; Boucher, David; Oxnard, Geoffrey R; Johnson, Bruce E; Costa, Daniel B; Jackman, David M; Jänne, Pasi A

2016-12-15

Genotype-directed therapy is the standard of care for advanced non-small cell lung cancer (NSCLC), but obtaining tumor tissue for genotyping remains a challenge. Circulating tumor cell (CTC) or cell-free DNA (cfDNA) analysis may allow for noninvasive evaluation. This prospective trial evaluated CTCs and cfDNA in EGFR-mutant NSCLC patients treated with erlotinib until progression. EGFR-mutant NSCLC patients were enrolled in a phase II trial of erlotinib. Blood was collected at baseline, every 2 months on study, and at disease progression. Plasma genotyping was performed by droplet digital PCR for EGFR19del, L858R, and T790M. CTCs were isolated by CellSave, enumerated, and analyzed by immunofluorescence for CD45 and pan-cytokeratin and EGFR and MET FISH were also performed. Rebiopsy was performed at disease progression. Sixty patients were enrolled; 44 patients discontinued therapy for disease progression. Rebiopsy occurred in 35 of 44 patients (80%), with paired CTC/cfDNA analysis in 41 of 44 samples at baseline and 36 of 44 samples at progression. T790M was identified in 23 of 35 (66%) tissue biopsies and 9 of 39 (23%) cfDNA samples. CTC analysis at progression identified MET amplification in 3 samples in which tissue analysis could not be performed. cfDNA analysis identified T790M in 2 samples in which rebiopsy was not possible. At diagnosis, high levels of cfDNA but not high levels of CTCs correlated with progression-free survival. cfDNA and CTCs are complementary, noninvasive assays for evaluation of acquired resistance to first-line EGFR TKIs and may expand the number of patients in whom actionable genetic information can be obtained at acquired resistance. Serial cfDNA monitoring may offer greater clinical utility than serial monitoring of CTCs. Clin Cancer Res; 22(24); 6010-20. ©2016 AACR. ©2016 American Association for Cancer Research.

Deinococcus frigens sp. nov., Deinococcus saxicola sp. nov., and Deinococcus marmoris sp. nov., low temperature and draught-tolerating, UV-resistant bacteria from continental Antarctica.

PubMed

Hirsch, Peter; Gallikowski, Claudia A; Siebert, Jörg; Peissl, Klaus; Kroppenstedt, Reiner; Schumann, Peter; Stackebrandt, Erko; Anderson, Robert

2004-11-01

Six Gram-positive, non-motile, UV- and draught-tolerant bacteria were isolated from antarctic soil and rock samples. The pink to orange cocci grew well on oligotrophic medium PYGV (pH 7.5) at 9-18 degrees C. They tolerated 0-10% NaCl, were aerobic to facultatively anaerobic and contained ornithine in their cell wall (type A3beta, Orn-Gly2). The lipid profiles of four strains were found to be typical for those of D. radiodurans. Major fatty acids were 16:1cis9, 15:1cis9, 17:1cis9 and i17:1cis9, the respiratory quinone of three strains was MK-8. Comparative 16S rDNA gene sequencing revealed phylogenetic relationships to the Deinococcus clade, especially to D. radiopugnans. The levels of 16S rRNA gene sequence similarity and DNA-DNA hybridisation data showed the six isolates represented new taxa. Phenotypic properties supported the description of three new species which were different from the eight known Deinococcus species and particularly from D. radiopugnans. Soil isolate AA-692T (DSM 12807T) is the type strain of Deinococcus frigens sp. nov., with AA-752 (DSM 15993) and AA-829 (DSM 15994) as additional strains from soil. The endolithic isolate AA-1444T, Deinococcus saxicola sp. nov., (DSM 15974T) came from antarctic sandstone, and Deinococcus marmoris sp. nov. (isolate AA-63T [DSM 12784T]) as well as AA-69 (DSM 15951) were isolated from antarctic marble.

Urinary cell-free DNA is a versatile analyte for monitoring infections of the urinary tract.

PubMed

Burnham, Philip; Dadhania, Darshana; Heyang, Michael; Chen, Fanny; Westblade, Lars F; Suthanthiran, Manikkam; Lee, John Richard; De Vlaminck, Iwijn

2018-06-20

Urinary tract infections are one of the most common infections in humans. Here we tested the utility of urinary cell-free DNA (cfDNA) to comprehensively monitor host and pathogen dynamics in bacterial and viral urinary tract infections. We isolated cfDNA from 141 urine samples from a cohort of 82 kidney transplant recipients and performed next-generation sequencing. We found that urinary cfDNA is highly informative about bacterial and viral composition of the microbiome, antimicrobial susceptibility, bacterial growth dynamics, kidney allograft injury, and host response to infection. These different layers of information are accessible from a single assay and individually agree with corresponding clinical tests based on quantitative PCR, conventional bacterial culture, and urinalysis. In addition, cfDNA reveals the frequent occurrence of pathologies that remain undiagnosed with conventional diagnostic protocols. Our work identifies urinary cfDNA as a highly versatile analyte to monitor infections of the urinary tract.

Development of a Multilocus Sequence Typing (MLST) scheme for Treponema pallidum subsp. pertenue: Application to yaws in Lihir Island, Papua New Guinea

PubMed Central

Godornes, Charmie; Giacani, Lorenzo; Barry, Alyssa E.; Mitja, Oriol

2017-01-01

Background Yaws is a neglected tropical disease, caused by Treponema pallidum subsp. pertenue. The disease causes chronic lesions, primarily in young children living in remote villages in tropical climates. As part of a global yaws eradication campaign initiated by the World Health Organization, we sought to develop and evaluate a molecular typing method to distinguish different strains of T. pallidum subsp. pertenue for disease control and epidemiological purposes. Methods and principal findings Published genome sequences of strains of T. pallidum subsp. pertenue and pallidum were compared to identify polymorphic genetic loci among the strains. DNA from a number of existing historical Treponema isolates, as well as a subset of samples from yaws patients collected in Lihir Island, Papua New Guinea, were analyzed using these targets. From these data, three genes (tp0548, tp0136 and tp0326) were ultimately selected to give a high discriminating capability among the T. pallidum subsp. pertenue samples tested. Intragenic regions of these three target genes were then selected to enhance the discriminating capability of the typing scheme using short readily amplifiable loci. This 3-gene multilocus sequence typing (MLST) method was applied to existing historical human yaws strains, the Fribourg-Blanc simian isolate, and DNA from 194 lesion swabs from yaws patients on Lihir Island, Papua New Guinea. Among all samples tested, fourteen molecular types were identified, seven of which were found in patient samples and seven among historical isolates or DNA. Three types (JG8, TD6, and SE7) were predominant on Lihir Island. Conclusions This MLST approach allows molecular typing and differentiation of yaws strains. This method could be a useful tool to complement epidemiological studies in regions where T. pallidum subsp. pertenue is prevalent with the overall goals of improving our understanding of yaws transmission dynamics and helping the yaws eradication campaign to succeed. PMID:29281641

Modified Primers for the Identification of Nonpathogenic Fusarium oxysporum Isolates That Have Biological Control Potential against Fusarium Wilt of Cucumber in Taiwan

PubMed Central

Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin

2013-01-01

Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289

Construction and characterization of a full-length infectious cDNA clone of foot-and-mouth disease virus strain O/JPN/2010 isolated in Japan in 2010.

PubMed

Nishi, Tatsuya; Onozato, Hiroyuki; Ohashi, Seiichi; Fukai, Katsuhiko; Yamada, Manabu; Morioka, Kazuki; Kanno, Toru

2016-06-01

A full-length infectious cDNA clone of the genome of a foot-and-mouth disease virus isolated from the 2010 epidemic in Japan was constructed and designated pSVL-f02. Transfection of Cos-7 or IBRS-2 cells with this clone allowed the recovery of infectious virus. The recovered virus had the same in vitro characterization as the parental virus with regard to antigenicity in neutralization and indirect immunofluorescence tests, plaque size and one-step growth. Pigs were experimentally infected with the parental virus or the recombinant virus recovered from pSVL-f02 transfected cells. There were no significant differences in clinical signs or antibody responses between the two groups, and virus isolation and viral RNA detection from clinical samples were similar. Virus recovered from transfected cells therefore retained the in vitro characteristics and the in vivo pathogenicity of their parental strain. This cDNA clone should be a valuable tool to analyze determinants of pathogenicity and mechanisms of virus replication, and to develop genetically engineered vaccines against foot-and-mouth disease virus. Copyright © 2016 Elsevier Ltd. All rights reserved.

Protocol: a rapid and economical procedure for purification of plasmid or plant DNA with diverse applications in plant biology

PubMed Central

2010-01-01

Research in plant molecular biology involves DNA purification on a daily basis. Although different commercial kits enable convenient extraction of high-quality DNA from E. coli cells, PCR and agarose gel samples as well as plant tissues, each kit is designed for a particular type of DNA extraction work, and the cost of purchasing these kits over a long run can be considerable. Furthermore, a simple method for the isolation of binary plasmid from Agrobacterium tumefaciens cells with satisfactory yield is lacking. Here we describe an easy protocol using homemade silicon dioxide matrix and seven simple solutions for DNA extraction from E. coli and A. tumefaciens cells, PCR and restriction digests, agarose gel slices, and plant tissues. Compared with the commercial kits, this protocol allows rapid DNA purification from diverse sources with comparable yield and purity at negligible cost. Following this protocol, we have demonstrated: (1) DNA fragments as small as a MYC-epitope tag coding sequence can be successfully recovered from an agarose gel slice; (2) Miniprep DNA from E. coli can be eluted with as little as 5 μl water, leading to high DNA concentrations (>1 μg/μl) for efficient biolistic bombardment of Arabidopsis seedlings, polyethylene glycol (PEG)-mediated Arabidopsis protoplast transfection and maize protoplast electroporation; (3) Binary plasmid DNA prepared from A. tumefaciens is suitable for verification by restriction analysis without the need for large scale propagation; (4) High-quality genomic DNA is readily isolated from several plant species including Arabidopsis, tobacco and maize. Thus, the silicon dioxide matrix-based DNA purification protocol offers an easy, efficient and economical way to extract DNA for various purposes in plant research. PMID:20180960

Molecular characterization of chikungunya virus from Andhra Pradesh, India & phylogenetic relationship with Central African isolates.

PubMed

M Naresh Kumar, C V; Anthony Johnson, A M; R Sai Gopal, D V

2007-12-01

Chikungunya virus has caused numerous large outbreaks in India. Suspected blood samples from the epidemic were collected and characterized for the identification of the responsible causative from Rayalaseema region of Andhra Pradesh. RT-PCR was used for screening of suspected blood samples. Primers were designed to amplify partial E1 gene and the amplified fragment was cloned and sequenced. The sequence was analyzed and compared with other geographical isolates to find the phylogenetic relationship. The sequence was submitted to the Gen bank DNA database (accession DQ888620). Comparative nucleotide homology analysis of the AP Ra-CTR isolate with the other isolates revealed 94.7+/-3.6 per cent of homology of CHIKAPRa-CTR with other isolates of Chikungunya virus at nucleotide level and 96.8+/-3.2 per cent of homology at amino acid level. The current epidemic was caused by the Central African genotype of CHIKV, grouped in Central Africa cluster in phylogenetic trees generated based on nucleotide and amino acid sequences.

Identification of novel Theileria genotypes from Grant's gazelle

PubMed Central

Hooge, Janis; Howe, Laryssa; Ezenwa, Vanessa O.

2015-01-01

Blood samples collected from Grant's gazelles (Nanger granti) in Kenya were screened for hemoparasites using a combination of microscopic and molecular techniques. All 69 blood smears examined by microscopy were positive for hemoparasites. In addition, Theileria/Babesia DNA was detected in all 65 samples screened by PCR for a ~450-base pair fragment of the V4 hypervariable region of the 18S rRNA gene. Sequencing and BLAST analysis of a subset of PCR amplicons revealed widespread co-infection (25/39) and the existence of two distinct Grant's gazelle Theileria subgroups. One group of 11 isolates clustered as a subgroup with previously identified Theileria ovis isolates from small ruminants from Europe, Asia and Africa; another group of 3 isolates clustered with previously identified Theileria spp. isolates from other African antelope. Based on extensive levels of sequence divergence (1.2–2%) from previously reported Theileria species within Kenya and worldwide, the Theileria isolates detected in Grant's gazelles appear to represent at least two novel Theileria genotypes. PMID:25973394

Identification of novel Theileria genotypes from Grant's gazelle.

PubMed

Hooge, Janis; Howe, Laryssa; Ezenwa, Vanessa O

2015-08-01

Blood samples collected from Grant's gazelles (Nanger granti) in Kenya were screened for hemoparasites using a combination of microscopic and molecular techniques. All 69 blood smears examined by microscopy were positive for hemoparasites. In addition, Theileria/Babesia DNA was detected in all 65 samples screened by PCR for a ~450-base pair fragment of the V4 hypervariable region of the 18S rRNA gene. Sequencing and BLAST analysis of a subset of PCR amplicons revealed widespread co-infection (25/39) and the existence of two distinct Grant's gazelle Theileria subgroups. One group of 11 isolates clustered as a subgroup with previously identified Theileria ovis isolates from small ruminants from Europe, Asia and Africa; another group of 3 isolates clustered with previously identified Theileria spp. isolates from other African antelope. Based on extensive levels of sequence divergence (1.2-2%) from previously reported Theileria species within Kenya and worldwide, the Theileria isolates detected in Grant's gazelles appear to represent at least two novel Theileria genotypes.

Isolation and Characterization of Three Unrecorded Zygomycete Fungi in Korea: Cunninghamella bertholletiae, Cunninghamella echinulata, and Cunninghamella elegans.

PubMed

Nguyen, Thuong T T; Choi, Young-Joon; Lee, Hyang Burm

2017-12-01

In a survey of undiscovered taxa in Korea, three zygomycete fungal strains-EML-W31, EML-HGD1-1, and EML-RUS1-1-were isolated from freshwater, grasshopper fecal, and soil samples in Korea. On the basis of the morphological characteristics and phylogenetic analysis of internal transcribed spacer and 28S rDNA, the isolates of EML-W31, EML-HGD1-1, and EML-RUS1-1 were confirmed to be Cunninghamella bertholletiae , Cunninghamella echinulata , and Cunninghamella elegans , respectively. These species have not been previously described in Korea.

Isolation and Characterization of Three Unrecorded Zygomycete Fungi in Korea: Cunninghamella bertholletiae, Cunninghamella echinulata, and Cunninghamella elegans

PubMed Central

Nguyen, Thuong T. T.; Choi, Young-Joon

2017-01-01

In a survey of undiscovered taxa in Korea, three zygomycete fungal strains–EML-W31, EML-HGD1-1, and EML-RUS1-1–were isolated from freshwater, grasshopper fecal, and soil samples in Korea. On the basis of the morphological characteristics and phylogenetic analysis of internal transcribed spacer and 28S rDNA, the isolates of EML-W31, EML-HGD1-1, and EML-RUS1-1 were confirmed to be Cunninghamella bertholletiae, Cunninghamella echinulata, and Cunninghamella elegans, respectively. These species have not been previously described in Korea. PMID:29371799

Isolation of bacterial extrachromosomal DNA from human dental plaque associated with periodontal disease, using transposon-aided capture (TRACA).

PubMed

Warburton, Philip J; Allan, Elaine; Hunter, Stephanie; Ward, John; Booth, Veronica; Wade, William G; Mullany, Peter

2011-11-01

The human oral cavity is host to a complex microbial community estimated to comprise >700 bacterial species, of which at least half are thought to be not yet cultivable in vitro. To investigate the plasmids present in this community, we used a transposon-aided capture system, which allowed the isolation of plasmids from human oral supra- and subgingival plaque samples. Thirty-two novel plasmids and a circular molecule that could be an integrase-generated circular intermediate were isolated. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Searching for Helicobacter pylori and Chlamydia pneumoniae in primary endodontic infections.

PubMed

Rôças, Isabela N; Siqueira, José F

2012-04-01

The purpose of this study was to search samples from primary endodontic infections for the presence of two common human bacterial pathogens - Helicobacter pylori and Chlamydia pneumoniae. Genomic DNA isolated from samples taken from 25 root canals of teeth with asymptomatic (chronic) apical periodontitis and 25 aspirates from acute apical abscess was initially amplified by the multiple displacement amplification approach and then used as template in species-specific polymerase chain reaction (PCR) for detection of H. pylori and C. pneumoniae. All clinical samples were positive for the presence of bacterial DNA. However, no clinical sample was positive for either H. pylori or C. pneumoniae. Neither H. pylori nor C. pneumoniae were found in samples from primary endodontic infections. These findings suggest that these species are not candidate endodontic pathogens and that the necrotic root canal does not serve as a reservoir for these human pathogens in healthy patients.

Bacillus pumilus SAFR-032 isolate

NASA Technical Reports Server (NTRS)

Venkateswaran, Kasthuri J. (Inventor)

2007-01-01

The present invention relates to discovery and isolation of a biologically pure culture of a Bacillus pumilus SAFR-032 isolate with UV sterilization resistant properties. This novel strain has been characterized on the basis of phenotypic traits, 16S rDNA sequence analysis and DNA-DNA hybridization. According to the results of these analyses, this strain belongs to the genus Bacillus. The GenBank accession number for the 16S rDNA sequence of the Bacillus pumilus SAFR-032 isolate is AY167879.

DNA encoding a DNA repair protein

DOEpatents

Petrini, John H.; Morgan, William Francis; Maser, Richard Scott; Carney, James Patrick

2006-08-15

An isolated and purified DNA molecule encoding a DNA repair protein, p95, is provided, as is isolated and purified p95. Also provided are methods of detecting p95 and DNA encoding p95. The invention further provides p95 knock-out mice.

DNA Probes Show Genetic Variation in Cyanobacterial Symbionts of the Azolla Fern and a Closer Relationship to Free-Living Nostoc Strains than to Free-Living Anabaena Strains

PubMed Central

Plazinski, Jacek; Zheng, Qi; Taylor, Rona; Croft, Lynn; Rolfe, Barry G.; Gunning, Brian E. S.

1990-01-01

Twenty-two isolates of Anabaena azollae derived from seven Azolla species from various geographic and ecological sources were characterized by DNA-DNA hybridization. Cloned DNA fragments derived from the genomic sequences of three different A. azollae isolates were used to detect restriction fragment length polymorphism among all symbiotic anabaenas. DNA clones were radiolabeled and hybridized against southern blot transfers of genomic DNAs of different isolates of A. azollae digested with restriction endonucleases. Eight DNA probes were selected to identify the Anabaena strains tested. Two were strain specific and hybridized only to A. azollae strains isolated from Azolla microphylla or Azolla caroliniana. One DNA probe was section specific (hybridized only to anabaenas isolated from Azolla ferns representing the section Euazolla), and five other probes gave finer discrimination among anabaenas representing various ecotypes of Azolla species. These cloned genomic DNA probes identified 11 different genotypes of A. azollae isolates. These included three endosymbiotic genotypes within Azolla filiculoides species and two genotypes within both A. caroliniana and Azolla pinnata endosymbionts. Although we were not able to discriminate among anabaenas extracted from different ecotypes of Azolla nilotica, Azolla mexicina, Azolla rubra and Azolla microphylla species, each of the endosymbionts was easily identified as a unique genotype. When total DNA isolated from free-living Anabaena sp. strain PCC7120 was screened, none of the genomic DNA probes gave detectable positive hybridization. Total DNA of Nostoc cycas PCC7422 hybridized with six of eight genomic DNA fragments. These data imply that the dominant symbiotic organism in association with Azolla spp. is more closely related to Nostoc spp. than to free-living Anabaena spp. Images PMID:16348182

Genetic analysis among environmental strains of Balamuthia mandrillaris recovered from an artificial lagoon and from soil in Sonora, Mexico.

PubMed

Lares-Jiménez, Luis Fernando; Booton, Gregory C; Lares-Villa, Fernando; Velázquez-Contreras, Carlos Arturo; Fuerst, Paul A

2014-11-01

Since the first report of Balamuthia mandrillaris as a causative agent of granulomatous amoebic encephalitis in humans, the environmental niche of this amoeba was assumed to be restricted to soil and dust. A single isolation from water was recently made independently by us from Northern Mexico. Now we report the isolation of 8 new strains of B. mandrillaris from Mexico. This continues the pattern of an excess of isolates from North America, compared to other parts of the world. All of the new isolates are environmental isolates, 7 from water samples and one from soil. The identity of each isolate was confirmed by PCR and by examining the sequences of the mitochondrial 16S-like rRNA gene. Success in amplification was determined using comparisons of amplifications of DNA from the strain CDC: V039 and the water strain (ITSON-BM1) as positive controls. The DNA sequences of the new isolates were compared to older strains from clinical cases using phylogenetic analysis, showing very high sequence similarity. The similarity among the new isolates and with previous clinical and environmental isolates of B. mandrillaris was also examined using biochemical and immunological studies. High homogeneity of total protein products, and similarity in antigenic moiety among the eight new isolates and two controls was found. Taken together, the molecular and biochemical studies indicate very low levels of genetic variation within B. mandrillaris. Copyright © 2014 Elsevier Inc. All rights reserved.

An improved method for the isolation of rat alveolar type II lung cells: Use in the Comet assay to determine DNA damage induced by cigarette smoke.

PubMed

Dalrymple, Annette; Ordoñez, Patricia; Thorne, David; Dillon, Debbie; Meredith, Clive

2015-06-01

Smoking is a cause of serious diseases, including lung cancer, emphysema, chronic bronchitis and heart disease. DNA damage is thought to be one of the mechanisms by which cigarette smoke (CS) initiates disease in the lung. Indeed, CS induced DNA damage can be measured in vitro and in vivo. The potential of the Comet assay to measure DNA damage in isolated rat lung alveolar type II epithelial cells (AEC II) was explored as a means to include a genotoxicity end-point in rodent sub-chronic inhalation studies. In this study, published AEC II isolation methods were improved to yield viable cells suitable for use in the Comet assay. The improved method reduced the level of basal DNA damage and DNA repair in isolated AEC II. CS induced DNA damage could also be quantified in isolated cells following a single or 5 days CS exposure. In conclusion, the Comet assay has the potential to determine CS or other aerosol induced DNA damage in AEC II isolated from rodents used in sub-chronic inhalation studies. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Variation in Ribosomal DNA among Isolates of the Mycorrhizal Fungus Cenococcum Geophilum FR.

NASA Astrophysics Data System (ADS)

Lobuglio, Katherine Frances

1990-01-01

Cenococcum geophilum Fr., a cosmopolitan mycorrhizal fungus, is well-known for its extremely wide host and habitat range. The ecological diversity of C. geophilum sharply contrasts its present taxonomic status as a monotypic form -genus. Restriction fragment length polymorphisms (RFLPs) in nuclear ribosomal DNA (rDNA) was used to assess the degree of genetic variation among 72 isolates of C. geophilum. The probe used in this study was the rDNA repeat cloned from C. geophilum isolate A145 (pCG15). Length of the rDNA repeat was approximately 9 kb. The rDNA clone was mapped for 5 restriction endonucleases. Hybridization with cloned Saccharomyces cerevisiae rDNA (pSR118, and pSR125 containing the 18S, and 5.8-25S rRNA genes respectively), and alignment of restriction endonuclease sites conserved in the rDNA genes of other fungi, were used to position the corresponding rDNAs of C. geophilum. Southern hybridizations with EcoRI, HindIII, XhoI, and PstI digested DNAs indicated extensive variation among the C. geophilum isolates, greater than has been previously reported to occur within a fungal species. Most of the rDNA polymorphisms occurred in the IGS region. Restriction endonuclease site and length polymorphisms were also observed in the 5.8S-26S genic regions. Sixteen size categories of length mutations, 6 restriction endonuclease site additions, and 4 restriction endonuclease site deletions were determined using isolate A145 as a reference. The rDNA repeat length among the isolates varied from approximately 8.5 to 10.2 kb. RFLPs were also observed in the mitochondrial (mt) 24S rRNA gene and flanking regions of HindIII digested DNAs of C. geophilum isolates representing both geographically distinct and similar origins. Among the C. geophilum isolates analyzed there were fewer RFLPs in mt-DNA than in nuclear rDNA. EcoRI rDNA phenotypes between C. geophilum and Elaphomyces anthracinus, its proposed teleomorph or sexual state, did not correspond. In addition, the four Elaphomyces species examined had smaller rDNA repeat sizes (approximately 7.3 to 8.0 kb) than that observed among C. geophilum isolates. UPGMA cluster analysis grouped C. geophilum isolates, on the basis of shared nuclear rDNA phenotypes, into a broad range of clusters ranging from 100% to 44% similarity. Limited correlation was observed among nuclear rDNA phenotypes and culture morphology, mycorrhizal characteristics, or geographic origins of the isolates. The amount of genetic variation demonstrated in this study indicates that C. geophilum is either an extremely heterogenous species or it represents more than one species and possibly more than one genus.

Characterization of isolates of meloidogyne from rice-wheat production fields in Nepal.

PubMed

Pokharel, Ramesh R; Abawi, George S; Zhang, Ning; Duxbury, John M; Smart, Christine D

2007-09-01

Thirty-three isolates of root-knot nematode were recovered from soil samples from rice-wheat fields in Nepal and maintained on rice cv. BR 11. The isolates were characterized using morphology, host range and DNA sequence analyses in order to ascertain their identity. Results indicated phenotypic similarity (juvenile measurements, perennial pattern, host range and gall shape) of the Nepalese isolates with Meloidogyne graminicola, with minor variations. The rice varieties LA 110 and Labelle were susceptible to all of the Nepalese isolates, but differences in the aggressiveness of the isolates were observed. Phylogenetic analyses based on the sequences of partial internal transcribed spacer (ITS) of the rRNA genes indicated that all Nepalese isolates formed a distinct clade with known isolates of M. graminicola with high bootstrap support. Furthermore, two groups were identified within the M. graminicola clade. No correlation between ITS haplotype and aggressiveness or host range was found among the tested isolates.

Detection of Bordetella avium by TaqMan real-time PCR in tracheal swabs from wildlife birds.

PubMed

Stenzel, T; Pestka, D; Tykałowski, B; Śmiałek, M; Koncicki, A; Bancerz-Kisiel, A

2017-03-28

Bordetella avium, the causing agent of bordetellosis, a highly contagious infection of the respiratory tract in young poultry, causes significant losses in poultry farming throughout the world. Wildlife birds can be a reservoir of various pathogens that infect farm animals. For this reason the studies were conducted to estimate the prevalence of Bordetella avium in wildlife birds in Poland. Tracheal swab samples were collected from 650 birds representing 27 species. The bacterial DNA was isolated directly from the swabs and screened for Bordetella avium by TaqMan real-time PCR. The assay specificity was evaluated by testing DNA isolated from 8 other bacteria that can be present in avian respiratory tract, and there was no amplification from non-Bordetella avium agents. Test sensitivity was determined by preparing standard tenfold serial dilutions of DNA isolated from positive control. The assay revealed to be sensitive, with detection limit of approximately 4.07x10^2 copies of Bordetella avium DNA. The genetic material of Bordetella avium was found in 54.54% of common pheasants, in 9.09% of Eurasian coots, in 3.22% of black-headed gulls and in 2.77% of mallard ducks. The results of this study point to low prevalence of Bordetella avium infections in wildlife birds. The results also show that described molecular assay proved to be suitable for the rapid diagnosis of bordetellosis in the routine diagnostic laboratory.

Prevalence of Parvovirus B19 and Parvovirus V9 DNA and Antibodies in Paired Bone Marrow and Serum Samples from Healthy Individuals

PubMed Central

Heegaard, Erik D.; Petersen, Bodil Laub; Heilmann, Carsten J.; Hornsleth, Allan

2002-01-01

Parvovirus B19 (hereafter referred to as B19) exhibits a marked tropism to human bone marrow (BM), and infection may lead to erythema infectiosum, arthropathy, hydrops fetalis, and various hematologic disorders. Recently, a distinct parvovirus isolate termed V9 with an unknown clinical spectrum was discovered. In contrast to the many studies of B19 serology and viremia, valid information on the frequency of B19 or V9 DNA in the BM of healthy individuals is limited. To develop a reference value, paired BM and serum samples from healthy subjects were tested for the presence of B19 and V9 DNA and specific antibodies. Immunoglobulin M (IgM) was not found in any of the serum samples. The prevalence of IgG showed a gradual and steady increase from 37% in children aged 1 to 5 years to 87% in people aged >50 years. When 190 well-characterized subjects were examined, B19 DNA was detected in the BM of 4 individuals (2.1%; 95% confidence interval, 0.58 to 5.3%) while none of the paired serum samples showed evidence of circulating viral DNA. V9 DNA was not found in any of the BM or serum samples. The finding of B19 DNA probably indicated a primary infection in one 7-year-old individual and reinfection or reactivation of persistent infection in the remaining three persons, aged 47 to 58 years. Serving as a benchmark for future studies, these findings are useful when interpreting epidemiologic data, performing BM transplantation, or considering clinical implications of parvovirus infection. PMID:11880419

Prevalence of parvovirus B19 and parvovirus V9 DNA and antibodies in paired bone marrow and serum samples from healthy individuals.

PubMed

Heegaard, Erik D; Petersen, Bodil Laub; Heilmann, Carsten J; Hornsleth, Allan

2002-03-01

Parvovirus B19 (hereafter referred to as B19) exhibits a marked tropism to human bone marrow (BM), and infection may lead to erythema infectiosum, arthropathy, hydrops fetalis, and various hematologic disorders. Recently, a distinct parvovirus isolate termed V9 with an unknown clinical spectrum was discovered. In contrast to the many studies of B19 serology and viremia, valid information on the frequency of B19 or V9 DNA in the BM of healthy individuals is limited. To develop a reference value, paired BM and serum samples from healthy subjects were tested for the presence of B19 and V9 DNA and specific antibodies. Immunoglobulin M (IgM) was not found in any of the serum samples. The prevalence of IgG showed a gradual and steady increase from 37% in children aged 1 to 5 years to 87% in people aged >50 years. When 190 well-characterized subjects were examined, B19 DNA was detected in the BM of 4 individuals (2.1%; 95% confidence interval, 0.58 to 5.3%) while none of the paired serum samples showed evidence of circulating viral DNA. V9 DNA was not found in any of the BM or serum samples. The finding of B19 DNA probably indicated a primary infection in one 7-year-old individual and reinfection or reactivation of persistent infection in the remaining three persons, aged 47 to 58 years. Serving as a benchmark for future studies, these findings are useful when interpreting epidemiologic data, performing BM transplantation, or considering clinical implications of parvovirus infection.

Optimization of whole-transcriptome amplification from low cell density deep-sea microbial samples for metatranscriptomic analysis.

PubMed

Wu, Jieying; Gao, Weimin; Zhang, Weiwen; Meldrum, Deirdre R

2011-01-01

Limitation in sample quality and quantity is one of the big obstacles for applying metatranscriptomic technologies to explore gene expression and functionality of microbial communities in natural environments. In this study, several amplification methods were evaluated for whole-transcriptome amplification of deep-sea microbial samples, which are of low cell density and high impurity. The best amplification method was identified and incorporated into a complete protocol to isolate and amplify deep-sea microbial samples. In the protocol, total RNA was first isolated by a modified method combining Trizol (Invitrogen, CA) and RNeasy (QIAGEN, CA) method, amplified with a WT-Ovation™ Pico RNA Amplification System (NuGEN, CA), and then converted to double-strand DNA from single-strand cDNA with a WT-Ovation™ Exon Module (NuGEN, CA). The products from the whole-transcriptome amplification of deep-sea microbial samples were assessed first through random clone library sequencing. The BLAST search results showed that marine-based sequences are dominant in the libraries, consistent with the ecological source of the samples. The products were then used for next-generation Roche GS FLX Titanium sequencing to obtain metatranscriptome data. Preliminary analysis of the metatranscriptomic data showed good sequencing quality. Although the protocol was designed and demonstrated to be effective for deep-sea microbial samples, it should be applicable to similar samples from other extreme environments in exploring community structure and functionality of microbial communities. Copyright © 2010 Elsevier B.V. All rights reserved.

[Variation of mini- and microsatellite DNA repeats in parthenogenetic lizard Darevskia armeniaca as revealed by DNA fingerprinting analysis].

PubMed

Martirosian, I A; Kan, N G; Petrosian, V G; Malysheva, D N; Trofimova, A A; Danielian, F D; Darevskiĭ, I S; Korochkin, L I; Ryskov, A P; Tokarskaia, O N

2003-02-01

Population and family samples of two morphological forms (mutant and normal with respect to dorsal color) of pathogenetic lizard Darevskia armeniaca were examined by means of DNA fingerprinting using M13 mini- and (GATA)n and (TCC)n microsatellite DNA markers. The morphological forms examined were characterized by clonally inherited, species-specific patterns of the DNA markers, which were different from the species-specific DNA fingerprints of the other parthenogenetic species of the genus Darevskia (D. dahli. D. unisexualis, and D. rostombekovi). The mean index of similarity (S) obtained for a sample of 36 individuals from three isolated populations using three types of DNA markers was 0.966. This was similar to the variability level observed in D. dahli (0.962) (P > 0.05), but higher than that in D. unisexualis (0.950) (P < 0.05) and D. rostombekovi (0.875) (P < 0.01). Inheritance of M13 minisatellite and (TCC)n microsatellite DNA markers in the F1 offspring of parthenogenetic lizards was examined. It was shown that variability and clonal diversity of the fingerprint phenotypes observed in the populations and families of D. armeniaca could be at least partly explained by RFLP mutations in microsatellite repeats.

Isolation of high quality and polysaccharide-free DNA from leaves of Dimorphandra mollis (Leguminosae), a tree from the Brazilian Cerrado.

PubMed

Souza, H A V; Muller, L A C; Brandão, R L; Lovato, M B

2012-03-22

Dimorphandra mollis (Leguminosae), known as faveiro and fava d'anta, is a tree that is widely distributed throughout the Brazilian Cerrado (a savanna-like biome). This species is economically valuable and has been extensively exploited because its fruits contain the flavonoid rutin, which is used to produce medications for human circulatory diseases. Knowledge about its genetic diversity is needed to guide decisions about the conservation and rational use of this species in order to maintain its diversity. DNA extraction is an essential step for obtaining good results in a molecular analysis. However, DNA isolation from plants is usually compromised by excessive contamination by secondary metabolites. DNA extraction of D. mollis, mainly from mature leaves, results in a highly viscous mass that is difficult to handle and use in techniques that require pure DNA. We tested four protocols for plant DNA extraction that can be used to minimize problems such as contamination by polysaccharides, which is more pronounced in material from mature leaves. The protocol that produced the best DNA quality initially utilizes a sorbitol buffer to remove mucilaginous polysaccharides. The macerated leaf material is washed with this buffer until there is no visible mucilage in the sample. This protocol is adequate for DNA extraction both from young and mature leaves, and could be useful not only for D. mollis but also for other species that have high levels of polysaccharide contamination during the extraction process.

Evaluation of commercial DNA and RNA extraction methods for high-throughput sequencing of FFPE samples.

PubMed

Kresse, Stine H; Namløs, Heidi M; Lorenz, Susanne; Berner, Jeanne-Marie; Myklebost, Ola; Bjerkehagen, Bodil; Meza-Zepeda, Leonardo A

2018-01-01

Nucleic acid material of adequate quality is crucial for successful high-throughput sequencing (HTS) analysis. DNA and RNA isolated from archival FFPE material are frequently degraded and not readily amplifiable due to chemical damage introduced during fixation. To identify optimal nucleic acid extraction kits, DNA and RNA quantity, quality and performance in HTS applications were evaluated. DNA and RNA were isolated from five sarcoma archival FFPE blocks, using eight extraction protocols from seven kits from three different commercial vendors. For DNA extraction, the truXTRAC FFPE DNA kit from Covaris gave higher yields and better amplifiable DNA, but all protocols gave comparable HTS library yields using Agilent SureSelect XT and performed well in downstream variant calling. For RNA extraction, all protocols gave comparable yields and amplifiable RNA. However, for fusion gene detection using the Archer FusionPlex Sarcoma Assay, the truXTRAC FFPE RNA kit from Covaris and Agencourt FormaPure kit from Beckman Coulter showed the highest percentage of unique read-pairs, providing higher complexity of HTS data and more frequent detection of recurrent fusion genes. truXTRAC simultaneous DNA and RNA extraction gave similar outputs as individual protocols. These findings show that although successful HTS libraries could be generated in most cases, the different protocols gave variable quantity and quality for FFPE nucleic acid extraction. Selecting the optimal procedure is highly valuable and may generate results in borderline quality specimens.

DNA Extraction by Isotachophoresis in a Microfluidic Channel

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stephenson, S J

Biological assays have many applications. For example, forensics personnel and medical professionals use these tests to diagnose diseases and track their progression or identify pathogens and the host response to them. One limitation of these tests, however, is that most of them target only one piece of the sample - such as bacterial DNA - and other components (e.g. host genomic DNA) get in the way, even though they may be useful for different tests. To address this problem, it would be useful to extract several different substances from a complex biological sample - such as blood - in anmore » inexpensive and efficient manner. This summer, I worked with Maxim Shusteff at Lawrence Livermore National Lab on the Rapid Automated Sample Prep project. The goal of the project is to solve the aforementioned problem by creating a system that uses a series of different extraction methods to extract cells, bacteria, and DNA from a complex biological sample. Biological assays can then be run on purified output samples. In this device, an operator could input a complex sample such as blood or saliva, and would receive separate outputs of cells, bacteria, viruses, and DNA. I had the opportunity to work this summer with isotachophoresis (ITP), a technique that can be used to extract nucleic acids from a sample. This technique is intended to be the last stage of the purification device. Isotachophoresis separates particles based on different electrophoretic mobilities. This technique is convenient for out application because free solution DNA mobility is approximately equal for DNA longer than 300 base pairs in length. The sample of interest - in our case DNA - is fed into the chip with streams of leading electrolyte (LE) and trailing electrolyte (TE). When an electric field is applied, the species migrate based on their electrophoretic mobilities. Because the ions in the leading electrolyte have a high electrophoretic mobility, they race ahead of the slower sample and trailing electrolyte ions. Conversely, the trailing electrolyte ions have a slow electrophoretic mobility, so they lag behind the sample, thus trapping the species of interest between the LE and TE streams. In a typical isotachophoresis configuration, the electric field is applied in a direction parallel to the direction of flow. The species then form bands that stretch across the width of the channel. A major limitation of that approach is that only a finite amount of sample can be processed at once, and the sample must be processed in batches. For our purposes, a form of free-flow isotachophoresis is more convenient, where the DNA forms a band parallel to the edges of the channel. To achieve this, in our chip, the electric field is applied transversely. This creates a force perpendicular to the direction of flow, which causes the different ions to migrate across the flow direction. Because the mobility of the DNA is between the mobility of the leading and the trailing electrolyte, the DNA is focused in a tight band near the center of the channel. The stream of DNA can then be directed to a different output to produce a highly concentrated outlet stream without batch processing. One hurdle that must be overcome for successful ITP is isolating the electrochemical reactions that result from the application of high voltage for the actual process of isotachophoresis. The electrochemical reactions that occur around metal electrodes produce bubbles and pH changes that are detrimental to successful ITP. The design of the chips we use incorporates polyacrylamide gels to serve as electrodes along the central channel. For our design, the metal electrodes are located away from the chip, and high conductivity buffer streams carry the potential to the chip, functioning as a 'liquid electrode.' The stream then runs alongside a gel barrier. The gel electrode permits ion transfer while simultaneously isolating the separation chamber from any contaminants in the outer, 'liquid electrode' streams. The difference in potential from one side of the chip to the other creates an electric field. This field traverses the inner, separation channel, containing the leading electrolyte, the trailing electrolyte, and the sample of interest (DNA). To increase the ease of use of the chips, a newer chip design has been fabricated. This design has wire electrodes integrated on the chip, rather than elsewhere. To keep the pH changes and bubbling isolated from the separation channel, the chip contains deeper wells near the electrodes so that the flowing buffer can wash away any gases that form around the electrode. This design is significantly more compact because it eliminates the cumbersome electrode boxes. Eliminating the electrode boxes also decreases the required voltage, making the experiments safer. This happens because when the 'liquid electrode' streams travel through small diameter tubing, they lose much of their voltage due to the electrical resistance of the fluid in the tubing.« less

Improved EGFR mutation detection using combined exosomal RNA and circulating tumor DNA in NSCLC patient plasma

PubMed Central

Krug, A K; Enderle, D; Karlovich, C; Priewasser, T; Bentink, S; Spiel, A; Brinkmann, K; Emenegger, J; Grimm, D G; Castellanos-Rizaldos, E; Goldman, J W; Sequist, L V; Soria, J -C; Camidge, D R; Gadgeel, S M; Wakelee, H A; Raponi, M; Noerholm, M; Skog, J

2018-01-01

Abstract Background A major limitation of circulating tumor DNA (ctDNA) for somatic mutation detection has been the low level of ctDNA found in a subset of cancer patients. We investigated whether using a combined isolation of exosomal RNA (exoRNA) and cell-free DNA (cfDNA) could improve blood-based liquid biopsy for EGFR mutation detection in non-small-cell lung cancer (NSCLC) patients. Patients and methods Matched pretreatment tumor and plasma were collected from 84 patients enrolled in TIGER-X (NCT01526928), a phase 1/2 study of rociletinib in mutant EGFR NSCLC patients. The combined isolated exoRNA and cfDNA (exoNA) was analyzed blinded for mutations using a targeted next-generation sequencing panel (EXO1000) and compared with existing data from the same samples using analysis of ctDNA by BEAMing. Results For exoNA, the sensitivity was 98% for detection of activating EGFR mutations and 90% for EGFR T790M. The corresponding sensitivities for ctDNA by BEAMing were 82% for activating mutations and 84% for T790M. In a subgroup of patients with intrathoracic metastatic disease (M0/M1a; n = 21), the sensitivity increased from 26% to 74% for activating mutations (P = 0.003) and from 19% to 31% for T790M (P = 0.5) when using exoNA for detection. Conclusions Combining exoRNA and ctDNA increased the sensitivity for EGFR mutation detection in plasma, with the largest improvement seen in the subgroup of M0/M1a disease patients known to have low levels of ctDNA and poses challenges for mutation detection on ctDNA alone. Clinical Trials NCT01526928 PMID:29216356

Three distinct pneumotypes characterize the microbiome of the lung in BALB/cJ mice.

PubMed

Scheiermann, Julia; Klinman, Dennis M

2017-01-01

Bacteria can rarely be isolated from normal healthy lungs using conventional culture techniques, supporting the traditional belief that the lungs are sterile. Yet recent studies using next generation sequencing report that bacterial DNA commonly found in the upper respiratory tract (URT) is present at lower levels in the lungs. Interpretation of that finding is complicated by the technical limitations and potential for contamination introduced when dealing with low biomass samples. The current work sought to overcome those limitations to clarify the number, type and source of bacteria present in the lungs of normal mice. Results showed that the oral microbiome is diverse and highly conserved whereas murine lung samples fall into three distinct patterns. 33% of the samples were sterile, as they lacked culturable bacteria and their bacterial DNA content did not differ from background. 9% of samples contained comparatively higher amounts of bacterial DNA whose composition mimicked that detected in the URT. A final group (58%) contained smaller amounts of microbial DNA whose composition was correlating to that of rodent chow and cage bedding, likely acquired by inspiration of food and bedding fragments. By analyzing each sample independently rather than working with group averages, this work eliminated the bias introduced by aspiration-contaminated samples to establish that three distinct microbiome pneumotypes are present in normal murine lungs.

Blood-Based Analyses of Cancer: Circulating Tumor Cells and Circulating Tumor DNA

PubMed Central

Haber, Daniel A.; Velculescu, Victor E.

2015-01-01

The ability to study nonhematologic cancers through noninvasive sampling of blood is one of the most exciting and rapidly advancing fields in cancer diagnostics. This has been driven both by major technologic advances, including the isolation of intact cancer cells and the analysis of cancer cell–derived DNA from blood samples, and by the increasing application of molecularly driven therapeutics, which rely on such accurate and timely measurements of critical biomarkers. Moreover, the dramatic efficacy of these potent cancer therapies drives the selection for additional genetic changes as tumors acquire drug resistance, necessitating repeated sampling of cancer cells to adjust therapy in response to tumor evolution. Together, these advanced noninvasive diagnostic capabilities and their applications in guiding precision cancer therapies are poised to change the ways in which we select and monitor cancer treatments. Significance Recent advances in technologies to analyze circulating tumor cells and circulating tumor DNA are setting the stage for real-time, noninvasive monitoring of cancer and providing novel insights into cancer evolution, invasion, and metastasis. PMID:24801577

[Real-time PCR in rapid diagnosis of Aeromonas hydrophila necrotizing soft tissue infections].

PubMed

Kohayagawa, Yoshitaka; Izumi, Yoko; Ushita, Misuzu; Niinou, Norio; Koshizaki, Masayuki; Yamamori, Yuji; Kaneko, Sakae; Fukushima, Hiroshi

2009-11-01

We report a case of rapidly progressive necrotizing soft tissue infection and sepsis followed by a patient's death. We suspected Vibrio vulnificus infection because the patient's underlying disease was cirrhosis and the course extremely rapid. No microbe had been detected at death. We extracted DNA from a blood culture bottle. SYBR green I real-time PCR was conducted but could not detect V. vulnificus vvh in the DNA sample. Aeromonas hydrophila was cultured and identified in blood and necrotized tissue samples. Real-time PCR was conducted to detect A. hydrophila ahh1, AHCYTOEN and aerA in the DNA sample extracted from the blood culture bottle and an isolated necrotized tissue strain, but only ahh1 was positive. High-mortality in necrotizing soft tissue infections makes it is crucial to quickly detect V. vulnificus and A. hydrophila. We found real-time PCR for vvh, ahh1, AHCYTOEN, and aerA useful in detecting V. vulnificus and A. hydrophila in necrotizing soft tissue infections.

No evidence of Bartonella quintana but detection of Acinetobacter baumannii in head lice from elementary schoolchildren in Paris.

PubMed

Bouvresse, Sophie; Socolovshi, Cristina; Berdjane, Zohra; Durand, Rémy; Izri, Arezki; Raoult, Didier; Chosidow, Olivier; Brouqui, Philippe

2011-12-01

The human body louse is the only known vector of Bartonella quintana. However, the presence of this bacterium has recently been detected in the head lice of homeless individuals and Nepalese slum children. Previous studies have reported the isolation of Acinetobacter baumannii from the body lice of homeless individuals. An epidemiological survey including 74 schools was conducted between 2008 and 2009 in Paris. After a first visual examination, the hair of children with suspected pediculosis was combed with a fine-tooth comb to collect live adult head lice. Molecular studies were performed on randomly selected DNA samples to detect B. quintana and A. baumannii by specific quantitative real-time PCR. Among a collection of 288 DNA samples, B. quintana was not detected, but A. baumannii was detected in 95 DNA samples (33%). Further study is needed to determine the significance of the finding of A. baumannii in head lice. 2011. Published by Elsevier Ltd. All rights reserved.

Specific Identification and Targeted Characterization of Bifidobacterium lactis from Different Environmental Isolates by a Combined Multiplex-PCR Approach

PubMed Central

Ventura, Marco; Reniero, Roberto; Zink, Ralf

2001-01-01

The species Bifidobacterium lactis, with its main representative strain Bb12 (DSM 10140), is a yoghurt isolate used as a probiotic strain and is commercially applied in different types of yoghurts and infant formulas. In order to ensure the genetic identity and safety of this bacterial isolate, species- and strain-specific molecular tools for genetic fingerprinting must be available to identify isolated bifidobacteria or lactic acid bacteria from, e.g., various clinical environments of relevance in medical microbiology. Two opposing rRNA gene-targeted primers have been developed for specific detection of this microorganism by PCR. The specificity of this approach was evaluated and verified with DNA samples isolated from single and mixed cultures of bifidobacteria and lactobacilli (48 isolates, including the type strains of 29 Bifidobacterium and 9 Lactobacillus species). Furthermore, we performed a Multiplex-PCR using oligonucleotide primers targeting a specific region of the 16S rRNA gene for the genus Bifidobacterium and a conserved eubacterial 16S rDNA sequence. The specificity and sensitivity of this detection with a pure culture of B. lactis were, respectively, 100 bacteria/ml after 25 cycles of PCR and 1 to 10 bacteria/ml after a 50-cycle nested-PCR approach. PMID:11375192

Experimental Review of DNA-Based Methods for Wine Traceability and Development of a Single-Nucleotide Polymorphism (SNP) Genotyping Assay for Quantitative Varietal Authentication.

PubMed

Catalano, Valentina; Moreno-Sanz, Paula; Lorenzi, Silvia; Grando, Maria Stella

2016-09-21

The genetic varietal authentication of wine was investigated according to DNA isolation procedures reported for enological matrices and also by testing 11 commercial extraction kits and various protocol modifications. Samples were collected at different stages of the winemaking process of renowned Italian wines Brunello di Montalcino, Lambruschi Modenesi, and Trento DOC. Results demonstrated not only that grape DNA loss is produced by the fermentation process but also that clarification and stabilization operations contribute to the reduction of double-stranded DNA content on wine. Despite the presence of inhibitors, downstream PCR genotyping yielded reliable nuclear and chloroplast SSR markers for must samples, whereas no amplification or inconsistent results were obtained at later stages of the vinification. In addition, a TaqMan genotyping assay based on cultivar-specific single-nucleotide polymorphisms (SNPs) was designed, which allowed assessment of grapevine DNA mixtures. Once the wine matrix limitations are overcome, this sensitive tool may be implemented for the relative quantification of cultivars used for blend wines or frauds.

Isolation of a 250 million-year-old halotolerant bacterium from a primary salt crystal

NASA Astrophysics Data System (ADS)

Vreeland, Russell H.; Rosenzweig, William D.; Powers, Dennis W.

2000-10-01

Bacteria have been found associated with a variety of ancient samples, however few studies are generally accepted due to questions about sample quality and contamination. When Cano and Borucki isolated a strain of Bacillus sphaericus from an extinct bee trapped in 25-30 million-year-old amber, careful sample selection and stringent sterilization techniques were the keys to acceptance. Here we report the isolation and growth of a previously unrecognized spore-forming bacterium (Bacillus species, designated 2-9-3) from a brine inclusion within a 250million-year-old salt crystal from the Permian Salado Formation. Complete gene sequences of the 16S ribosomal DNA show that the organism is part of the lineage of Bacillus marismortui and Virgibacillus pantothenticus. Delicate crystal structures and sedimentary features indicate the salt has not recrystallized since formation. Samples were rejected if brine inclusions showed physical signs of possible contamination. Surfaces of salt crystal samples were sterilized with strong alkali and acid before extracting brines from inclusions. Sterilization procedures reduce the probability of contamination to less than 1 in 10 9.

Isolation of a 250 million-year-old halotolerant bacterium from a primary salt crystal.

PubMed

Vreeland, R H; Rosenzweig, W D; Powers, D W

2000-10-19

Bacteria have been found associated with a variety of ancient samples, however few studies are generally accepted due to questions about sample quality and contamination. When Cano and Borucki isolated a strain of Bacillus sphaericus from an extinct bee trapped in 25-30 million-year-old amber, careful sample selection and stringent sterilization techniques were the keys to acceptance. Here we report the isolation and growth of a previously unrecognized spore-forming bacterium (Bacillus species, designated 2-9-3) from a brine inclusion within a 250 million-year-old salt crystal from the Permian Salado Formation. Complete gene sequences of the 16S ribosomal DNA show that the organism is part of the lineage of Bacillus marismortui and Virgibacillus pantothenticus. Delicate crystal structures and sedimentary features indicate the salt has not recrystallized since formation. Samples were rejected if brine inclusions showed physical signs of possible contamination. Surfaces of salt crystal samples were sterilized with strong alkali and acid before extracting brines from inclusions. Sterilization procedures reduce the probability of contamination to less than 1 in 10(9).

MULTILOCUS SEQUENCE TYPING OF BRUCELLA ISOLATES FROM THAILAND.

PubMed

Chawjiraphan, Wireeya; Sonthayanon, Piengchan; Chanket, Phanita; Benjathummarak, Surachet; Kerdsin, Anusak; Kalambhaheti, Thareerat

2016-11-01

Although brucellosis outbreaks in Thailand are rare, they cause abortions and infertility in animals, resulting in significant economic loss. Because Brucella spp display > 90% DNA homology, multilocus sequence typing (MLST) was employed to categorize local Brucella isolates into sequence types (STs) and to determine their genetic relatedness. Brucella samples were isolated from vaginal secretion of cows and goats, and from blood cultures of infected individuals. Brucella species were determined by multiplex PCR of eight loci, in addition to MLST based on partial DNA sequences of nine house-keeping genes. MLST analysis of 36 isolates revealed 78 distinct novel allele types and 34 novel STs, while two isolates possessed the known ST8. Sequence alignments identified polymorphic sites in each allele, ranging from 2-6%, while overall genetic diversity was 3.6%. MLST analysis of the 36 Brucella isolates classified them into three species, namely, B. melitensis, B. abortus and B. suis, in agreement with multiplex PCR results. Genetic relatedness among ST members of B. melitensis and B. abortus determined by eBURST program revealed ST2 as founder of B. abortus isolates and ST8 the founder of B. melitensis isolates. ST 36, 41 and 50 of Thai Brucella isolates were identified as single locus variants of clonal cluster (CC) 8, while the majority of STs were diverse. The genetic diversity and relatedness identified using MLST revealed hitherto unexpected diversity among Thai Brucella isolates. Genetic classification of isolates could reveal the route of brucellosis transmission among humans and farm animals and also reveal their relationship with other isolates in the region and other parts of the world.

The identity of Penicillium sp. 1, a major contaminant of the stone chambers in the Takamatsuzuka and Kitora Tumuli in Japan, is Penicillium paneum.

PubMed

An, Kwang-Deuk; Kiyuna, Tomohiko; Kigawa, Rika; Sano, Chie; Miura, Sadatoshi; Sugiyama, Junta

2009-11-01

Penicillium appeared as the major dweller in the Takamatsuzuka Tumulus (TT) and Kitora Tumulus (KT) stone chambers, both located in the village of Asuka, Nara Prefecture, in relation to the biodeterioration of the 1,300-year-old mural paintings, plaster walls and ceilings. Of 662 Penicillium isolates from 373 samples of the TT (sampling period, May 2004-2007) and the KT (sampling period, June 2004-Sep 2007), 181 were phenotypically assigned as Penicillium sp. 1 which shared similar phenotypic characteristics of sect. Roqueforti in Penicillium subg. Penicillium. Fifteen representative isolates of Penicillium sp. 1, 13 from TT and 2 from KT, were selected for molecular phylogenetic analysis. The 28S rDNA D1/D2, ITS, beta-tubulin, and lys2 gene sequence-based phylogenies clearly demonstrated that the three known species P. roqueforti, P. carneum and P. paneum in sect. Roqueforti, and all TT and KT isolates grouped together. In addition to this, TT and KT isolates formed a monophyletic group with the ex-holotype strain CBS 101032 of P. paneum Frisvad with very strong bootstrap supports. So far, P. paneum has been isolated only from mouldy rye breads, other foods, and baled grass silage. Therefore, this is the first report of P. paneum isolation from samples relating to the biodeteriorated cultural properties such as mural paintings on plaster walls.

Microarray Genomic Systems Development

DTIC Science & Technology

2008-06-01

11 species), Escherichia coli TOP10 (7 strains), and Geobacillus stearothermophilus . Using standard molecular biology methods, we isolated genomic...comparisons. Results: Different species of bacteria, including Escherichia coli, Bacillus bacteria, and Geobacillus stearothermophilus produce qualitatively...oligonucleotides to labelled genomic DNA from a set of test samples, including eleven Bacillus species, Geobacillus stearothermophilus , and seven Escherichia

Investigating population continuity with ancient DNA under a spatially explicit simulation framework.

PubMed

Silva, Nuno Miguel; Rio, Jeremy; Currat, Mathias

2017-12-15

Recent advances in sequencing technologies have allowed for the retrieval of ancient DNA data (aDNA) from skeletal remains, providing direct genetic snapshots from diverse periods of human prehistory. Comparing samples taken in the same region but at different times, hereafter called "serial samples", may indicate whether there is continuity in the peopling history of that area or whether an immigration of a genetically different population has occurred between the two sampling times. However, the exploration of genetic relationships between serial samples generally ignores their geographical locations and the spatiotemporal dynamics of populations. Here, we present a new coalescent-based, spatially explicit modelling approach to investigate population continuity using aDNA, which includes two fundamental elements neglected in previous methods: population structure and migration. The approach also considers the extensive temporal and geographical variance that is commonly found in aDNA population samples. We first showed that our spatially explicit approach is more conservative than the previous (panmictic) approach and should be preferred to test for population continuity, especially when small and isolated populations are considered. We then applied our method to two mitochondrial datasets from Germany and France, both including modern and ancient lineages dating from the early Neolithic. The results clearly reject population continuity for the maternal line over the last 7500 years for the German dataset but not for the French dataset, suggesting regional heterogeneity in post-Neolithic migratory processes. Here, we demonstrate the benefits of using a spatially explicit method when investigating population continuity with aDNA. It constitutes an improvement over panmictic methods by considering the spatiotemporal dynamics of genetic lineages and the precise location of ancient samples. The method can be used to investigate population continuity between any pair of serial samples (ancient-ancient or ancient-modern) and to investigate more complex evolutionary scenarios. Although we based our study on mitochondrial DNA sequences, diploid molecular markers of different types (DNA, SNP, STR) can also be simulated with our approach. It thus constitutes a promising tool for the analysis of the numerous aDNA datasets being produced, including genome wide data, in humans but also in many other species.

Direct identification of antibiotic resistance genes on single plasmid molecules using CRISPR/Cas9 in combination with optical DNA mapping

NASA Astrophysics Data System (ADS)

Müller, Vilhelm; Rajer, Fredrika; Frykholm, Karolin; Nyberg, Lena K.; Quaderi, Saair; Fritzsche, Joachim; Kristiansson, Erik; Ambjörnsson, Tobias; Sandegren, Linus; Westerlund, Fredrik

2016-12-01

Bacterial plasmids are extensively involved in the rapid global spread of antibiotic resistance. We here present an assay, based on optical DNA mapping of single plasmids in nanofluidic channels, which provides detailed information about the plasmids present in a bacterial isolate. In a single experiment, we obtain the number of different plasmids in the sample, the size of each plasmid, an optical barcode that can be used to identify and trace the plasmid of interest and information about which plasmid that carries a specific resistance gene. Gene identification is done using CRISPR/Cas9 loaded with a guide-RNA (gRNA) complementary to the gene of interest that linearizes the circular plasmids at a specific location that is identified using the optical DNA maps. We demonstrate the principle on clinically relevant extended spectrum beta-lactamase (ESBL) producing isolates. We discuss how the gRNA sequence can be varied to obtain the desired information. The gRNA can either be very specific to identify a homogeneous group of genes or general to detect several groups of genes at the same time. Finally, we demonstrate an example where we use a combination of two gRNA sequences to identify carbapenemase-encoding genes in two previously not characterized clinical bacterial samples.

Novel gastric helicobacters and oral campylobacters are present in captive and wild cetaceans

PubMed Central

Goldman, Cinthia G.; Matteo, Mario J.; Loureiro, Julio D.; Almuzara, Marisa; Barberis, Claudia; Vay, Carlos; Catalano, Mariana; Heredia, Sergio Rodríguez; Mantero, Paula; Boccio, Jose R.; Zubillaga, Marcela B.; Cremaschi, Graciela A.; Solnick, Jay V.; Perez-Perez, Guillermo I.; Blaser, Martin J.

2011-01-01

The mammalian gastric and oral mucosa may be colonized by mixed Helicobacter and Campylobacter species, respectively, in individual animals. To better characterize the presence and distribution of Helicobacter and Campylobacter among marine mammals, we used PCR and 16S rDNA sequence analysis to examine gastric and oral samples from ten dolphins (Tursiops gephyreus), one killer whale (Orcinus orca), one false killer whale (Pseudorca crassidens), and three wild La Plata river dolphins (Pontoporia blainvillei). Helicobacter spp. DNA was widely distributed in gastric and oral samples from both captive and wild cetaceans. Phylogenetic analysis demonstrated two Helicobacter sequence clusters, one closely related to H. cetorum, a species isolated from dolphins and whales in North America. The second related cluster was to sequences obtained from dolphins in Australia and to gastric non-Helicobacter pylori helicobacters, and may represent a novel taxonomic group. Dental plaque sequences from four dolphins formed a third cluster within the Campylobacter genus that likely represents a novel species isolated from marine mammals. Identification of identical Helicobacter spp. DNA sequences from dental plaque, saliva and gastric fluids from the same hosts, suggests that the oral cavity may be involved in transmission. These results demonstrate that Helicobacter and Campylobacter species are commonly distributed in marine mammals, and identify taxonomic clusters that may represent novel species. PMID:21592686

Improved diagnosis of Trichuris trichiura by using a bead-beating procedure on ethanol preserved stool samples prior to DNA isolation and the performance of multiplex real-time PCR for intestinal parasites.

PubMed

Kaisar, Maria M M; Brienen, Eric A T; Djuardi, Yenny; Sartono, Erliyani; Yazdanbakhsh, Maria; Verweij, Jaco J; Supali, Taniawati; VAN Lieshout, Lisette

2017-06-01

For the majority of intestinal parasites, real-time PCR-based diagnosis outperforms microscopy. However, the data for Trichuris trichiura have been less convincing and most comparative studies have been performed in populations with low prevalence. This study aims to improve detection of T. trichuria DNA in human stool by evaluating four sample preparation methods. Faecal samples (n = 60) were collected at Flores island, Indonesia and examined by microscopy. Aliquots were taken and a bead-beating procedure was used both on directly frozen stool and on material preserved with 96% ethanol. PCR on frozen samples showed 40% to be positive for T. trichiura, compared with 45% positive by microscopy. The percentage positive increased when using ethanol preservation (45·0%), bead-beating (51·7%) and a combination (55·0%) and all three methods showed significantly higher DNA loads. The various procedures had a less pronounced effect on the PCR results of nine other parasite targets tested. Most prevalent were Ascaris lumbricoides (≈60%), Necator americanus (≈60%), Dientamoeba fragilis (≈50%) and Giardia lamblia (≈12%). To validate the practicality of the procedure, bead-beating was applied in a population-based survey testing 910 stool samples. Findings confirmed bead-beating before DNA extraction to be a highly efficient procedure for the detection of T. trichiura DNA in stool.

Discovery of Sclerotinia sclerotiorum Hypovirulence-Associated Virus-1 in Urban River Sediments of Heathcote and Styx Rivers in Christchurch City, New Zealand.

PubMed

Kraberger, Simona; Stainton, Daisy; Dayaram, Anisha; Zawar-Reza, Peyman; Gomez, Christopher; Harding, Jon S; Varsani, Arvind

2013-08-08

In samples of benthic and bank river sediments of two urban rivers in Christchurch city (New Zealand), we identified and recovered isolates of Sclerotinia sclerotiorum hypovirulence-associated virus-1 (SsHADV-1), a fungus-infecting circular single-stranded DNA virus. This is the first report of SsHADV-1 outside of China and in environmental samples.

Drug resistance patterns in Mycobacterium leprae isolates from relapsed leprosy patients attending The Leprosy Mission (TLM) Hospitals in India.

PubMed

Lavania, Mallika; Jadhav, Rupendra S; Chaitanya, Vedithi Sundeep; Turankar, Ravindra; Selvasekhar, Abraham; Das, Loretta; Darlong, Famkima; Hambroom, Ujjwal K; Kumar, Sandip; Sengupta, Utpal

2014-09-01

Implementation of multidrug therapy (MDT) in leprosy control programmes has significantly reduced the global prevalence of the disease in the last two decades. After many years of use of MDT, it is expected that drug resistance in Mycobacterium leprae may emerge. This is a major concern, especially during the stage of elimination. In the present study, slit-skin smears were collected from 140 leprosy relapse cases from different Leprosy Mission hospitals across India. DNA extracted from 111 (79%) of these samples was analysed for the genes associated with drug resistance in M. leprae. More than 90% of the patients relapsed as multibacillary (MB) cases. In our study, four (3.6%) of the DNA samples analysed showed mutations associated with rifampicin resistance. We also observed that mutations associated with resistance to dapsone and ofloxacin were observed in 9 (8.1%) of the DNA samples each; two samples had both dapsone and ofloxacin resistance. Further surveillance and appropriate interventions are needed to ensure the continued success of chemotherapy for leprosy.

Use of 16S rRNA Sequencing for Identification of Actinobacillus ureae Isolated from a Cerebrospinal Fluid Sample

PubMed Central

Whitelaw, A. C.; Shankland, I. M.; Elisha, B. G.

2002-01-01

Actinobacillus ureae, previously Pasteurella ureae, has on rare occasions been described as a cause of human infection. Owing to its rarity, it may not be easily identified in clinical microbiology laboratories by standard tests. This report describes a patient with acute bacterial meningitis due to A. ureae. The identity of the isolate was determined by means of DNA sequence analysis of a portion of the 16S rRNA gene. PMID:11825992

Prevalence of selected zoonotic and vector-borne agents in dogs and cats in Costa Rica.

PubMed

Scorza, Andrea V; Duncan, Colleen; Miles, Laura; Lappin, Michael R

2011-12-29

To estimate the prevalence of enteric parasites and selected vector-borne agents of dogs and cats in San Isidro de El General, Costa Rica, fecal and serum samples were collected from animals voluntarily undergoing sterilization. Each fecal sample was examined for parasites by microscopic examination after fecal flotation and for Giardia and Cryptosporidium using an immunofluorescence assay (IFA). Giardia and Cryptosporidium IFA positive samples were genotyped after PCR amplification of specific DNA if possible. The seroprevalence rates for the vector-borne agents (Dirofilaria immitis, Borrelia burgdorferi, Ehrlichia canis, and Anaplasma phagocytophilum) were estimated based on results from a commercially available ELISA. Enteric parasites were detected in samples from 75% of the dogs; Ancylostoma caninum, Trichuris vulpis, Giardia, and Toxocara canis were detected. Of the cats, 67.5% harbored Giardia spp., Cryptosporidium spp., Ancylostoma tubaeforme, or Toxocara cati. Both Cryptosporidium spp. isolates that could be sequenced were Cryptosporidium parvum (one dog isolate and one cat isolate). Of the Giardia spp. isolates that were successfully sequenced, the 2 cat isolates were assemblage A and the 2 dog isolates were assemblage D. D. immitis antigen and E. canis antibodies were identified in 2.3% and 3.5% of the serum samples, respectively. The prevalence of enteric zoonotic parasites in San Isidro de El General in Costa Rica is high in companion animals and this information should be used to mitigate public health risks. Copyright © 2011. Published by Elsevier B.V.

Multiple correspondence analysis and random amplified polymorphic DNA molecular typing to assess the sources of Staphylococcus aureus contamination in alheira production lines.

PubMed

Esteves, A; Patarata, L; Aymerich, T; Garriga, M; Martins, C

2007-03-01

Sources and tracing of Staphylococcus aureus in alheira (garlic sausage) production were evaluated by multifactorial correspondence analysis (MCA) of occurrence data and a random amplified polymorphic DNA (RAPD) on S. aureus isolates. Samples from four production lines, four different production batches, and 14 different sampling sites (including raw material, different contact surfaces, and several stages of alheira manufacturing) were analyzed at four sampling times. From the 896 microbial analyses completed, a collection of 170 S. aureus isolates was obtained. Although analysis of the occurrence data alone was not elucidative enough, MCA and RAPD-PCR were able to assess the sources of contamination and to trace the spread of this microorganism along the production lines. MCA results indicated that the presence of S. aureus in alheira was related to its presence in the intermediate manufacturing stages after heat treatment but before stuffing in the casings. It was also possible to associate a cross-contamination path related to handler procedures. RAPD-PCR typing in accordance to MCA results confirmed the cross-contamination path between the raw material and casings and the role of handlers as an important cross-contamination vehicle.

Isolation of a DNA Probe for Lactobacillus curvatus

PubMed Central

Petrick, Hendrik A. R.; Ambrosio, Riccardo E.; Holzapfel, Wilhelm H.

1988-01-01

A genomic library of Lactobacillus curvatus DSM 20019 was constructed in bacteriophage λ gt11. A 1.2-kilobase DNA probe specific for L. curvatus was isolated from this library. When this probe was hybridized to DNA from Lactobacillus isolates from different sources classified by conventional techniques, differing degrees of hybridization were obtained. This could imply that these isolates may have been incorrectly classified. Images PMID:16347554

Isolation and molecular identification of free-living amoebae of the genus Naegleria from Arctic and sub-Antarctic regions.

PubMed

De Jonckheere, Johan F

2006-07-01

Twenty-three freshwater samples with sediment taken from two regions in the Arctic, Spitzbergen and Greenland, and one region in sub-Antarctica, Ile de la Possession, were cultured for amoebae at 37 degrees C and room temperature (RT). Only two samples yielded amoebae at 37 degrees C and the two isolates were identified from their morphological features to belong to the genus Acanthamoeba. Vahlkampfiid amoebae were isolated from 11 samples at RT. Morphological analysis of the cysts identified all 11 isolates as belonging to the genus Naegleria, although only about half of them (45%) transformed into flagellates. Ribosomal DNA sequence analysis demonstrated that these isolates represent novel species and that N. antarctica, N. dobsoni and N. chilensis are their closest relatives. Not surprisingly, these three species also grow at lower temperatures (<37 degrees C) than the majority of described Naegleria spp. Two of the eight new species were found in both Arctic and sub-Antarctic regions, and other new species from the Arctic are closely related to new species from the sub-Antarctic. Therefore, it seems the Naegleria gene pool present in the polar regions is different from that found in temperate and tropical regions.

Identification and Genotyping of Mycobacterium tuberculosis Isolated From Water and Soil Samples of a Metropolitan City

PubMed Central

Velayati, Ali Akbar; Farnia, Parissa; Mozafari, Mohadese; Malekshahian, Donya; Farahbod, Amir Masoud; Seif, Shima; Rahideh, Snaz

2015-01-01

BACKGROUND: The potential role of environmental Mycobacterium tuberculosis in the epidemiology of TB remains unknown. We investigated the transmission of M tuberculosis from humans to the environment and the possible transmission of M tuberculosis from the environment to humans. METHODS: A total of 1,500 samples were collected from three counties of the Tehran, Iran metropolitan area from February 2012 to January 2014. A total of 700 water samples (47%) and 800 soil samples (53%) were collected. Spoligotyping and the mycobacterial interspersed repetitive units-variable number of tandem repeats typing method were performed on DNA extracted from single colonies. Genotypes of M tuberculosis strains isolated from the environment were compared with the genotypes obtained from 55 patients with confirmed pulmonary TB diagnosed during the study period in the same three counties. RESULTS: M tuberculosis was isolated from 11 of 800 soil samples (1%) and 71 of 700 water samples (10%). T family (56 of 82, 68%) followed by Delhi/CAS (11 of 82, 13.4%) were the most frequent M tuberculosis superfamilies in both water and soil samples. Overall, 27.7% of isolates in clusters were related. No related typing patterns were detected between soil, water, and clinical isolates. The most frequent superfamily of M tuberculosis in clinical isolates was Delhi/CAS (142, 30.3%) followed by NEW-1 (127, 27%). The bacilli in contaminated soil (36%) and damp water (8.4%) remained reculturable in some samples up to 9 months. CONCLUSIONS: Although the dominant M tuberculosis superfamilies in soil and water did not correspond to the dominant M tuberculosis family in patients, the presence of circulating genotypes of M tuberculosis in soil and water highlight the risk of transmission. PMID:25340935

Characterization of arsenic resistant and arsenopyrite oxidizing Acidithiobacillus ferrooxidans from Hutti gold leachate and effluents.

PubMed

Dave, Shailesh R; Gupta, Kajal H; Tipre, Devayani R

2008-11-01

Four arsenic resistant ferrous oxidizers were isolated from Hutti Gold Mine Ltd. (HGML) samples. Characterization of these isolates was done using conventional microbiological, biochemical and molecular methods. The ferrous oxidation rates with these isolates were 16, 48, 34 and 34 mg L(-1)h(-1) and 15, 47, 34 and 32 mg L(-1)h(-1) in absence and presence of 20 mM of arsenite (As3+) respectively. Except isolate HGM 8, other three isolates showed 2.9-6.3% inhibition due to the presence of 20 mM arsenite. Isolate HGM 8 was able to grow in presence of 14.7 g L(-1) of arsenite, with 25.77 mg L(-1)h(-1) ferrous oxidation rate. All the four isolates were able to oxidize iron and arsenopyrite from 20 g L(-1) and 40 g L(-1) refractory gold ore and 20 g L(-1) refractory gold concentrate. Once the growth was established pH adjustment was not needed inspite of ferrous oxidation, which could be due to concurrent oxidation of pyrite. Isolate HGM 8 showed the final cell count of as high as 1.12 x 10(8) cells mL(-1) in 40 g L(-1) refractory gold ore. The isolates were grouped into one haplotypes by amplified ribosomal DNA restriction analysis (ARDRA). The phylogenetic position of HGM 8 was determined by 16S rDNA sequencing. It was identified as Acidithiobacillus ferrooxidans and strain name was given as SRHGM 1.

Rapid non-enzymatic extraction method for isolating PCR-quality camelpox virus DNA from skin.

PubMed

Yousif, A Ausama; Al-Naeem, A Abdelmohsen; Al-Ali, M Ahmad

2010-10-01

Molecular diagnostic investigations of orthopoxvirus (OPV) infections are performed using a variety of clinical samples including skin lesions, tissues from internal organs, blood and secretions. Skin samples are particularly convenient for rapid diagnosis and molecular epidemiological investigations of camelpox virus (CMLV). Classical extraction procedures and commercial spin-column-based kits are time consuming, relatively expensive, and require multiple extraction and purification steps in addition to proteinase K digestion. A rapid non-enzymatic procedure for extracting CMLV DNA from dried scabs or pox lesions was developed to overcome some of the limitations of the available DNA extraction techniques. The procedure requires as little as 10mg of tissue and produces highly purified DNA [OD(260)/OD(280) ratios between 1.47 and 1.79] with concentrations ranging from 6.5 to 16 microg/ml. The extracted CMLV DNA was proven suitable for virus-specific qualitative and, semi-quantitative PCR applications. Compared to spin-column and conventional viral DNA extraction techniques, the two-step extraction procedure saves money and time, and retains the potential for automation without compromising CMLV PCR sensitivity. Copyright (c) 2010 Elsevier B.V. All rights reserved.

Microfluidic cartridges for DNA purification and genotyping processed in standard laboratory instruments

NASA Astrophysics Data System (ADS)

Focke, Maximilian; Mark, Daniel; Stumpf, Fabian; Müller, Martina; Roth, Günter; Zengerle, Roland; von Stetten, Felix

2011-06-01

Two microfluidic cartridges intended for upgrading standard laboratory instruments with automated liquid handling capability by use of centrifugal forces are presented. The first microfluidic cartridge enables purification of DNA from human whole blood and is operated in a standard laboratory centrifuge. The second microfluidic catridge enables genotyping of pathogens by geometrically multiplexed real-time PCR. It is operated in a slightly modified off-the-shelf thermal cycler. Both solutions aim at smart and cost-efficient ways to automate work flows in laboratories. The DNA purification cartridge automates all liquid handling steps starting from a lysed blood sample to PCR ready DNA. The cartridge contains two manually crushable glass ampoules with liquid reagents. The DNA yield extracted from a 32 μl blood sample is 192 +/- 30 ng which corresponds to 53 +/- 8% of a reference extraction. The genotyping cartridge is applied to analyse isolates of the multi-resistant Staphyloccus aureus (MRSA) by real-time PCR. The wells contain pre-stored dry reagents such as primers and probes. Evaluation of the system with 44 genotyping assays showed a 100% specificity and agreement with the reference assays in standard tubes. The lower limit of detection was well below 10 copies of DNA per reaction.