Scanning sequences after Gibbs sampling to find multiple occurrences of functional elements

PubMed Central

Tharakaraman, Kannan; Mariño-Ramírez, Leonardo; Sheetlin, Sergey L; Landsman, David; Spouge, John L

2006-01-01

Background Many DNA regulatory elements occur as multiple instances within a target promoter. Gibbs sampling programs for finding DNA regulatory elements de novo can be prohibitively slow in locating all instances of such an element in a sequence set. Results We describe an improvement to the A-GLAM computer program, which predicts regulatory elements within DNA sequences with Gibbs sampling. The improvement adds an optional "scanning step" after Gibbs sampling. Gibbs sampling produces a position specific scoring matrix (PSSM). The new scanning step resembles an iterative PSI-BLAST search based on the PSSM. First, it assigns an "individual score" to each subsequence of appropriate length within the input sequences using the initial PSSM. Second, it computes an E-value from each individual score, to assess the agreement between the corresponding subsequence and the PSSM. Third, it permits subsequences with E-values falling below a threshold to contribute to the underlying PSSM, which is then updated using the Bayesian calculus. A-GLAM iterates its scanning step to convergence, at which point no new subsequences contribute to the PSSM. After convergence, A-GLAM reports predicted regulatory elements within each sequence in order of increasing E-values, so users have a statistical evaluation of the predicted elements in a convenient presentation. Thus, although the Gibbs sampling step in A-GLAM finds at most one regulatory element per input sequence, the scanning step can now rapidly locate further instances of the element in each sequence. Conclusion Datasets from experiments determining the binding sites of transcription factors were used to evaluate the improvement to A-GLAM. Typically, the datasets included several sequences containing multiple instances of a regulatory motif. The improvements to A-GLAM permitted it to predict the multiple instances. PMID:16961919

[Genome-scale sequence data processing and epigenetic analysis of DNA methylation].

PubMed

Wang, Ting-Zhang; Shan, Gao; Xu, Jian-Hong; Xue, Qing-Zhong

2013-06-01

A new approach recently developed for detecting cytosine DNA methylation (mC) and analyzing the genome-scale DNA methylation profiling, is called BS-Seq which is based on bisulfite conversion of genomic DNA combined with next-generation sequencing. The method can not only provide an insight into the difference of genome-scale DNA methylation among different organisms, but also reveal the conservation of DNA methylation in all contexts and nucleotide preference for different genomic regions, including genes, exons, and repetitive DNA sequences. It will be helpful to under-stand the epigenetic impacts of cytosine DNA methylation on the regulation of gene expression and maintaining silence of repetitive sequences, such as transposable elements. In this paper, we introduce the preprocessing steps of DNA methylation data, by which cytosine (C) and guanine (G) in the reference sequence are transferred to thymine (T) and adenine (A), and cytosine in reads is transferred to thymine, respectively. We also comprehensively review the main content of the DNA methylation analysis on the genomic scale: (1) the cytosine methylation under the context of different sequences; (2) the distribution of genomic methylcytosine; (3) DNA methylation context and the preference for the nucleotides; (4) DNA- protein interaction sites of DNA methylation; (5) degree of methylation of cytosine in the different structural elements of genes. DNA methylation analysis technique provides a powerful tool for the epigenome study in human and other species, and genes and environment interaction, and founds the theoretical basis for further development of disease diagnostics and therapeutics in human.

Flow cytometry sorting of nuclei enables the first global characterization of Paramecium germline DNA and transposable elements.

PubMed

Guérin, Frédéric; Arnaiz, Olivier; Boggetto, Nicole; Denby Wilkes, Cyril; Meyer, Eric; Sperling, Linda; Duharcourt, Sandra

2017-04-26

DNA elimination is developmentally programmed in a wide variety of eukaryotes, including unicellular ciliates, and leads to the generation of distinct germline and somatic genomes. The ciliate Paramecium tetraurelia harbors two types of nuclei with different functions and genome structures. The transcriptionally inactive micronucleus contains the complete germline genome, while the somatic macronucleus contains a reduced genome streamlined for gene expression. During development of the somatic macronucleus, the germline genome undergoes massive and reproducible DNA elimination events. Availability of both the somatic and germline genomes is essential to examine the genome changes that occur during programmed DNA elimination and ultimately decipher the mechanisms underlying the specific removal of germline-limited sequences. We developed a novel experimental approach that uses flow cell imaging and flow cytometry to sort subpopulations of nuclei to high purity. We sorted vegetative micronuclei and macronuclei during development of P. tetraurelia. We validated the method by flow cell imaging and by high throughput DNA sequencing. Our work establishes the proof of principle that developing somatic macronuclei can be sorted from a complex biological sample to high purity based on their size, shape and DNA content. This method enabled us to sequence, for the first time, the germline DNA from pure micronuclei and to identify novel transposable elements. Sequencing the germline DNA confirms that the Pgm domesticated transposase is required for the excision of all ~45,000 Internal Eliminated Sequences. Comparison of the germline DNA and unrearranged DNA obtained from PGM-silenced cells reveals that the latter does not provide a faithful representation of the germline genome. We developed a flow cytometry-based method to purify P. tetraurelia nuclei to high purity and provided quality control with flow cell imaging and high throughput DNA sequencing. We identified 61 germline transposable elements including the first Paramecium retrotransposons. This approach paves the way to sequence the germline genomes of P. aurelia sibling species for future comparative genomic studies.

Modular structural elements in the replication origin region of Tetrahymena rDNA.

PubMed Central

Du, C; Sanzgiri, R P; Shaiu, W L; Choi, J K; Hou, Z; Benbow, R M; Dobbs, D L

1995-01-01

Computer analyses of the DNA replication origin region in the amplified rRNA genes of Tetrahymena thermophila identified a potential initiation zone in the 5'NTS [Dobbs, Shaiu and Benbow (1994), Nucleic Acids Res. 22, 2479-2489]. This region consists of a putative DNA unwinding element (DUE) aligned with predicted bent DNA segments, nuclear matrix or scaffold associated region (MAR/SAR) consensus sequences, and other common modular sequence elements previously shown to be clustered in eukaryotic chromosomal origin regions. In this study, two mung bean nuclease-hypersensitive sites in super-coiled plasmid DNA were localized within the major DUE-like element predicted by thermodynamic analyses. Three restriction fragments of the 5'NTS region predicted to contain bent DNA segments exhibited anomalous migration characteristic of bent DNA during electrophoresis on polyacrylamide gels. Restriction fragments containing the 5'NTS region bound Tetrahymena nuclear matrices in an in vitro binding assay, consistent with an association of the replication origin region with the nuclear matrix in vivo. The direct demonstration in a protozoan origin region of elements previously identified in Drosophila, chick and mammalian origin regions suggests that clusters of modular structural elements may be a conserved feature of eukaryotic chromosomal origins of replication. Images PMID:7784181

FARME DB: a functional antibiotic resistance element database

PubMed Central

Wallace, James C.; Port, Jesse A.; Smith, Marissa N.; Faustman, Elaine M.

2017-01-01

Antibiotic resistance (AR) is a major global public health threat but few resources exist that catalog AR genes outside of a clinical context. Current AR sequence databases are assembled almost exclusively from genomic sequences derived from clinical bacterial isolates and thus do not include many microbial sequences derived from environmental samples that confer resistance in functional metagenomic studies. These environmental metagenomic sequences often show little or no similarity to AR sequences from clinical isolates using standard classification criteria. In addition, existing AR databases provide no information about flanking sequences containing regulatory or mobile genetic elements. To help address this issue, we created an annotated database of DNA and protein sequences derived exclusively from environmental metagenomic sequences showing AR in laboratory experiments. Our Functional Antibiotic Resistant Metagenomic Element (FARME) database is a compilation of publically available DNA sequences and predicted protein sequences conferring AR as well as regulatory elements, mobile genetic elements and predicted proteins flanking antibiotic resistant genes. FARME is the first database to focus on functional metagenomic AR gene elements and provides a resource to better understand AR in the 99% of bacteria which cannot be cultured and the relationship between environmental AR sequences and antibiotic resistant genes derived from cultured isolates. Database URL: http://staff.washington.edu/jwallace/farme PMID:28077567

A novel species-specific tandem repeat DNA family from Sinapis arvensis: detection of telomere-like sequences.

PubMed

Kapila, R; Das, S; Srivastava, P S; Lakshmikumaran, M

1996-08-01

DNA sequences representing a tandemly repeated DNA family of the Sinapis arvensis genome were cloned and characterized. The 700-bp tandem repeat family is represented by two clones, pSA35 and pSA52, which are 697 and 709 bp in length, respectively. Dot matrix analysis of the sequences indicates the presence of repeated elements within each monomeric unit. Sequence analysis of the repetitive region of clones pSA35 and pSA52 shows that there are several copies of a 7-bp repeat element organized in tandem. The consensus sequence of this repeat element is 5'-TTTAGGG-3'. These elements are highly mutated and the difference in length between the two clones is due to different copy numbers of these elements. The repetitive region of clone pSA35 has 26 copies of the element TTTAGGG, whereas clone pSA52 has 28 copies. The repetitive region in both clones is flanked on either side by inverted repeats that may be footprints of a transposition event. Sequence comparison indicates that the element TTTAGGG is identical to telomeric repeats present in Arabidopsis, maize, tomato, and other plants. However, Bal31 digestion kinetics indicates non-telomeric localization of the 700-bp tandem repeats. The clones represent a novel repeat family as (i) they contain telomere-like motifs as subrepeats within each unit; and (ii) they do not hybridize to related crucifers and are species-specific in nature.

DEPPDB - DNA electrostatic potential properties database. Electrostatic properties of genome DNA elements.

PubMed

Osypov, Alexander A; Krutinin, Gleb G; Krutinina, Eugenia A; Kamzolova, Svetlana G

2012-04-01

Electrostatic properties of genome DNA are important to its interactions with different proteins, in particular, related to transcription. DEPPDB - DNA Electrostatic Potential (and other Physical) Properties Database - provides information on the electrostatic and other physical properties of genome DNA combined with its sequence and annotation of biological and structural properties of genomes and their elements. Genomes are organized on taxonomical basis, supporting comparative and evolutionary studies. Currently, DEPPDB contains all completely sequenced bacterial, viral, mitochondrial, and plastids genomes according to the NCBI RefSeq, and some model eukaryotic genomes. Data for promoters, regulation sites, binding proteins, etc., are incorporated from established DBs and literature. The database is complemented by analytical tools. User sequences calculations are available. Case studies discovered electrostatics complementing DNA bending in E.coli plasmid BNT2 promoter functioning, possibly affecting host-environment metabolic switch. Transcription factors binding sites gravitate to high potential regions, confirming the electrostatics universal importance in protein-DNA interactions beyond the classical promoter-RNA polymerase recognition and regulation. Other genome elements, such as terminators, also show electrostatic peculiarities. Most intriguing are gene starts, exhibiting taxonomic correlations. The necessity of the genome electrostatic properties studies is discussed.

Promoter selection in human mitochondria involves binding of a transcription factor to orientation-independent upstream regulatory elements.

PubMed

Fisher, R P; Topper, J N; Clayton, D A

1987-07-17

Selective transcription of human mitochondrial DNA requires a transcription factor (mtTF) in addition to an essentially nonselective RNA polymerase. Partially purified mtTF is able to sequester promoter-containing DNA in preinitiation complexes in the absence of mitochondrial RNA polymerase, suggesting a DNA-binding mechanism for factor activity. Functional domains, required for positive transcriptional regulation by mtTF, are identified within both major promoters of human mtDNA through transcription of mutant promoter templates in a reconstituted in vitro system. These domains are essentially coextensive with DNA sequences protected from nuclease digestion by mtTF-binding. Comparison of the sequences of the two mtTF-responsive elements reveals significant homology only when one sequence is inverted; the binding sites are in opposite orientations with respect to the predominant direction of transcription. Thus mtTF may function bidirectionally, requiring additional protein-DNA interactions to dictate transcriptional polarity. The mtTF-responsive elements are arrayed as direct repeats, separated by approximately 80 bp within the displacement-loop region of human mitochondrial DNA; this arrangement may reflect duplication of an ancestral bidirectional promoter, giving rise to separate, unidirectional promoters for each strand.

Deletion endpoint allele-specificity in the developmentally regulated elimination of an internal sequence (IES) in Paramecium.

PubMed Central

Dubrana, K; Le Mouël, A; Amar, L

1997-01-01

Ciliated protozoa undergo thousands of site-specific DNA deletion events during the programmed development of micronuclear genomes to macronuclear genomes. Two deletion elements, W1 and W2, were identified in the Paramecium primaurelia wild-type 156 strain. Here, we report the characterization of both elements in wild-type strain 168 and show that they display variant deletion patterns when compared with those of strain 156. The W1 ( 168 ) element is defective for deletion. The W2 ( 168 ) element is excised utilizing two alternative boundaries on one side, both are different from the boundary utilized to excise the W2156 element. By crossing the 156 and 168 strains, we demonstrate that the definition of all deletion endpoints are each controlled by cis -acting determinant(s) rather than by strain-specific trans-acting factor(s). Sequence comparison of all deleted DNA segments indicates that the 5'-TA-3'terminal sequence is strictly required at their ends. Furthermore the identity of the first eight base pairs of these ends to a previously established consensus sequence correlates with the frequency of the corresponding deletion events. Our data implies the existence of an adaptive convergent evolution of these Paramecium deleted DNA segment end sequences. PMID:9171098

The SIDER2 elements, interspersed repeated sequences that populate the Leishmania genomes, constitute subfamilies showing chromosomal proximity relationship.

PubMed

Requena, Jose M; Folgueira, Cristina; López, Manuel C; Thomas, M Carmen

2008-06-02

Protozoan parasites of the genus Leishmania are causative agents of a diverse spectrum of human diseases collectively known as leishmaniasis. These eukaryotic pathogens that diverged early from the main eukaryotic lineage possess a number of unusual genomic, molecular and biochemical features. The completion of the genome projects for three Leishmania species has generated invaluable information enabling a direct analysis of genome structure and organization. By using DNA macroarrays, made with Leishmania infantum genomic clones and hybridized with total DNA from the parasite, we identified a clone containing a repeated sequence. An analysis of the recently completed genome sequence of L. infantum, using this repeated sequence as bait, led to the identification of a new class of repeated elements that are interspersed along the different L. infantum chromosomes. These elements turned out to be homologues of SIDER2 sequences, which were recently identified in the Leishmania major genome; thus, we adopted this nomenclature for the Leishmania elements described herein. Since SIDER2 elements are very heterogeneous in sequence, their precise identification is rather laborious. We have characterized 54 LiSIDER2 elements in chromosome 32 and 27 ones in chromosome 20. The mean size for these elements is 550 bp and their sequence is G+C rich (mean value of 66.5%). On the basis of sequence similarity, these elements can be grouped in subfamilies that show a remarkable relationship of proximity, i.e. SIDER2s of a given subfamily locate close in a chromosomal region without intercalating elements. For comparative purposes, we have identified the SIDER2 elements existing in L. major and Leishmania braziliensis chromosomes 32. While SIDER2 elements are highly conserved both in number and location between L. infantum and L. major, no such conservation exists when comparing with SIDER2s in L. braziliensis chromosome 32. SIDER2 elements constitute a relevant piece in the Leishmania genome organization. Sequence characteristics, genomic distribution and evolutionarily conservation of SIDER2s are suggestive of relevant functions for these elements in Leishmania. Apart from a proved involvement in post-transcriptional mechanisms of gene regulation, SIDER2 elements could be involved in DNA amplification processes and, perhaps, in chromosome segregation as centromeric sequences.

Integrated in silico and biological validation of the blocking effect of Cot-1 DNA on Microarray-CGH.

PubMed

Kang, Seung-Hui; Park, Chan Hee; Jeung, Hei Cheul; Kim, Ki-Yeol; Rha, Sun Young; Chung, Hyun Cheol

2007-06-01

In array-CGH, various factors may act as variables influencing the result of experiments. Among them, Cot-1 DNA, which has been used as a repetitive sequence-blocking agent, may become an artifact-inducing factor in BAC array-CGH. To identify the effect of Cot-1 DNA on Microarray-CGH experiments, Cot-1 DNA was labeled directly and Microarray-CGH experiments were performed. The results confirmed that probes which hybridized more completely with Cot-1 DNA had a higher sequence similarity to the Alu element. Further, in the sex-mismatched Microarray-CGH experiments, the variation and intensity in the fluorescent signal were reduced in the high intensity probe group in which probes were better hybridized with Cot-1 DNA. Otherwise, those of the low intensity probe group showed no alterations regardless of Cot-1 DNA. These results confirmed by in silico methods that Cot-1 DNA could block repetitive sequences in gDNA and probes. In addition, it was confirmed biologically that the blocking effect of Cot-1 DNA could be presented via its repetitive sequences, especially Alu elements. Thus, in contrast to BAC-array CGH, the use of Cot-1 DNA is advantageous in controlling experimental variation in Microarray-CGH.

Long interspersed repeated DNA (LINE) causes polymorphism at the rat insulin 1 locus.

PubMed

Lakshmikumaran, M S; D'Ambrosio, E; Laimins, L A; Lin, D T; Furano, A V

1985-09-01

The insulin 1, but not the insulin 2, locus is polymorphic (i.e., exhibits allelic variation) in rats. Restriction enzyme analysis and hybridization studies showed that the polymorphic region is 2.2 kilobases upstream of the insulin 1 coding region and is due to the presence or absence of an approximately 2.7-kilobase repeated DNA element. DNA sequence determination showed that this DNA element is a member of a long interspersed repeated DNA family (LINE) that is highly repeated (greater than 50,000 copies) and highly transcribed in the rat. Although the presence or absence of LINE sequences at the insulin 1 locus occurs in both the homozygous and heterozygous states, LINE-containing insulin 1 alleles are more prevalent in the rat population than are alleles without LINEs. Restriction enzyme analysis of the LINE-containing alleles indicated that at least two versions of the LINE sequence may be present at the insulin 1 locus in different rats. Either repeated transposition of LINE sequences or gene conversion between the resident insulin 1 LINE and other sequences in the genome are possible explanations for this.

Regulation of the yeast RAD2 gene: DNA damage-dependent induction correlates with protein binding to regulatory sequences and their deletion influences survival.

PubMed

Siede, W; Friedberg, E C

1992-03-01

In the yeast Saccharomyces cerevisiae the RAD2 gene is absolutely required for damage-specific incision of DNA during nucleotide excision repair and is inducible by DNA-damaging agents. In the present study we correlated sensitivity to killing by DNA-damaging agents with the deletion of previously defined specific promoter elements. Deletion of the element DRE2 increased the UV sensitivity of cells in both the G1/early S and S/G2 phases of the cell cycle as well as in stationary phase. On the other hand, increased UV sensitivity associated with deletion of the sequence-related element DRE1 was restricted to cells irradiated in G1/S. Specific binding of protein(s) to the promoter elements DRE1 and DRE2 was observed under non-inducing conditions using gel retardation assays. Exposure of cells to DNA-damaging agents resulted in increased protein binding that was dependent on de novo protein synthesis.

Sequence variations in RepMP2/3 and RepMP4 elements reveal intragenomic homologous DNA recombination events in Mycoplasma pneumoniae.

PubMed

Spuesens, Emiel B M; Oduber, Minoushka; Hoogenboezem, Theo; Sluijter, Marcel; Hartwig, Nico G; van Rossum, Annemarie M C; Vink, Cornelis

2009-07-01

The gene encoding major adhesin protein P1 of Mycoplasma pneumoniae, MPN141, contains two DNA sequence stretches, designated RepMP2/3 and RepMP4, which display variation among strains. This variation allows strains to be differentiated into two major P1 genotypes (1 and 2) and several variants. Interestingly, multiple versions of the RepMP2/3 and RepMP4 elements exist at other sites within the bacterial genome. Because these versions are closely related in sequence, but not identical, it has been hypothesized that they have the capacity to recombine with their counterparts within MPN141, and thereby serve as a source of sequence variation of the P1 protein. In order to determine the variation within the RepMP2/3 and RepMP4 elements, both within the bacterial genome and among strains, we analysed the DNA sequences of all RepMP2/3 and RepMP4 elements within the genomes of 23 M. pneumoniae strains. Our data demonstrate that: (i) recombination is likely to have occurred between two RepMP2/3 elements in four of the strains, and (ii) all previously described P1 genotypes can be explained by inter-RepMP recombination events. Moreover, the difference between the two major P1 genotypes was reflected in all RepMP elements, such that subtype 1 and 2 strains can be differentiated on the basis of sequence variation in each RepMP element. This implies that subtype 1 and subtype 2 strains represent evolutionarily diverged strain lineages. Finally, a classification scheme is proposed in which the P1 genotype of M. pneumoniae isolates can be described in a sequence-based, universal fashion.

Nanopore sequencing technology: a new route for the fast detection of unauthorized GMO.

PubMed

Fraiture, Marie-Alice; Saltykova, Assia; Hoffman, Stefan; Winand, Raf; Deforce, Dieter; Vanneste, Kevin; De Keersmaecker, Sigrid C J; Roosens, Nancy H C

2018-05-21

In order to strengthen the current genetically modified organism (GMO) detection system for unauthorized GMO, we have recently developed a new workflow based on DNA walking to amplify unknown sequences surrounding a known DNA region. This DNA walking is performed on transgenic elements, commonly found in GMO, that were earlier detected by real-time PCR (qPCR) screening. Previously, we have demonstrated the ability of this approach to detect unauthorized GMO via the identification of unique transgene flanking regions and the unnatural associations of elements from the transgenic cassette. In the present study, we investigate the feasibility to integrate the described workflow with the MinION Next-Generation-Sequencing (NGS). The MinION sequencing platform can provide long read-lengths and deal with heterogenic DNA libraries, allowing for rapid and efficient delivery of sequences of interest. In addition, the ability of this NGS platform to characterize unauthorized and unknown GMO without any a priori knowledge has been assessed.

Sequence of retrovirus provirus resembles that of bacterial transposable elements

NASA Astrophysics Data System (ADS)

Shimotohno, Kunitada; Mizutani, Satoshi; Temin, Howard M.

1980-06-01

The nucleotide sequences of the terminal regions of an infectious integrated retrovirus cloned in the modified λ phage cloning vector Charon 4A have been elucidated. There is a 569-base pair direct repeat at both ends of the viral DNA. The cell-virus junctions at each end consist of a 5-base pair direct repeat of cell DNA next to a 3-base pair inverted repeat of viral DNA. This structure resembles that of a transposable element and is consistent with the protovirus hypothesis that retroviruses evolved from the cell genome.

Nanoparticle-labeled DNA capture elements for detection and identification of biological agents

NASA Astrophysics Data System (ADS)

Kiel, Johnathan L.; Holwitt, Eric A.; Parker, Jill E.; Vivekananda, Jeevalatha; Franz, Veronica

2004-12-01

Aptamers, synthetic DNA capture elements (DCEs), can be made chemically or in genetically engineered bacteria. DNA capture elements are artificial DNA sequences, from a random pool of sequences, selected for their specific binding to potential biological warfare or terrorism agents. These sequences were selected by an affinity method using filters to which the target agent was attached and the DNA isolated and amplified by polymerase chain reaction (PCR) in an iterative, increasingly stringent, process. The probes can then be conjugated to Quantum Dots and super paramagnetic nanoparticles. The former provide intense, bleach-resistant fluorescent detection of bioagent and the latter provide a means to collect the bioagents with a magnet. The fluorescence can be detected in a flow cytometer, in a fluorescence plate reader, or with a fluorescence microscope. To date, we have made DCEs to Bacillus anthracis spores, Shiga toxin, Venezuelan Equine Encephalitis (VEE) virus, and Francisella tularensis. DCEs can easily distinguish Bacillus anthracis from its nearest relatives, Bacillus cereus and Bacillus thuringiensis. Development of a high through-put process is currently being investigated.

Nucleosome core particles containing a poly(dA.dT) sequence element exhibit a locally distorted DNA structure.

PubMed

Bao, Yunhe; White, Cindy L; Luger, Karolin

2006-08-25

Poly(dA.dT) DNA sequence elements are thought to promote transcription by either excluding nucleosomes or by altering their structural or dynamic properties. Here, the stability and structure of a defined nucleosome core particle containing a 16 base-pair poly(dA.dT) element (A16 NCP) was investigated. The A16 NCP requires a significantly higher temperature for histone octamer sliding in vitro compared to comparable nucleosomes that do not contain a poly(dA.dT) element. Fluorescence resonance energy transfer showed that the interactions between the nucleosomal DNA ends and the histone octamer were destabilized in A16 NCP. The crystal structure of A16 NCP was determined to a resolution of 3.2 A. The overall structure was maintained except for local deviations in DNA conformation. These results are consistent with previous in vivo and in vitro observations that poly(dA.dT) elements cause only modest changes in DNA accessibility and modest increases in steady-state transcription levels.

Germ line insertion of mtDNA at the breakpoint junction of a reciprocal constitutional translocation.

PubMed

Willett-Brozick, J E; Savul, S A; Richey, L E; Baysal, B E

2001-08-01

Constitutional chromosomal translocations are relatively common causes of human morbidity, yet the DNA double-strand break (DSB) repair mechanisms that generate them are incompletely understood. We cloned, sequenced and analyzed the breakpoint junctions of a familial constitutional reciprocal translocation t(9;11)(p24;q23). Within the 10-kb region flanking the breakpoints, chromosome 11 had 25% repeat elements, whereas chromosome 9 had 98% repeats, 95% of which were L1-type LINE elements. The breakpoints occurred within an L1-type repeat element at 9p24 and at the 3'-end of an Alu sequence at 11q23. At the breakpoint junction of derivative chromosome 9, we discovered an unusually large 41-bp insertion, which showed 100% identity to 12S mitochondrial DNA (mtDNA) between nucleotides 896 and 936 of the mtDNA sequence. Analysis of the human genome failed to show the preexistence of the inserted sequence at normal chromosomes 9 and 11 breakpoint junctions or elsewhere in the genome, strongly suggesting that the insertion was derived from human mtDNA and captured into the junction during the DSB repair process. To our knowledge, these findings represent the first observation of spontaneous germ line insertion of modern human mtDNA sequences and suggest that DSB repair may play a role in inter-organellar gene transfer in vivo. Our findings also provide evidence for a previously unrecognized insertional mechanism in human, by which non-mobile extra-chromosomal fragments can be inserted into the genome at DSB repair junctions.

Surveying DNA Elements within Functional Genes of Heterocyst-Forming Cyanobacteria

PubMed Central

Hilton, Jason A.; Meeks, John C.; Zehr, Jonathan P.

2016-01-01

Some cyanobacteria are capable of differentiating a variety of cell types in response to environmental factors. For instance, in low nitrogen conditions, some cyanobacteria form heterocysts, which are specialized for N2 fixation. Many heterocyst-forming cyanobacteria have DNA elements interrupting key N2 fixation genes, elements that are excised during heterocyst differentiation. While the mechanism for the excision of the element has been well-studied, many questions remain regarding the introduction of the elements into the cyanobacterial lineage and whether they have been retained ever since or have been lost and reintroduced. To examine the evolutionary relationships and possible function of DNA sequences that interrupt genes of heterocyst-forming cyanobacteria, we identified and compared 101 interruption element sequences within genes from 38 heterocyst-forming cyanobacterial genomes. The interruption element lengths ranged from about 1 kb (the minimum able to encode the recombinase responsible for element excision), up to nearly 1 Mb. The recombinase gene sequences served as genetic markers that were common across the interruption elements and were used to track element evolution. Elements were found that interrupted 22 different orthologs, only five of which had been previously observed to be interrupted by an element. Most of the newly identified interrupted orthologs encode proteins that have been shown to have heterocyst-specific activity. However, the presence of interruption elements within genes with no known role in N2 fixation, as well as in three non-heterocyst-forming cyanobacteria, indicates that the processes that trigger the excision of elements may not be limited to heterocyst development or that the elements move randomly within genomes. This comprehensive analysis provides the framework to study the history and behavior of these unique sequences, and offers new insight regarding the frequency and persistence of interruption elements in heterocyst-forming cyanobacteria. PMID:27206019

Surveying DNA Elements within Functional Genes of Heterocyst-Forming Cyanobacteria.

PubMed

Hilton, Jason A; Meeks, John C; Zehr, Jonathan P

2016-01-01

Some cyanobacteria are capable of differentiating a variety of cell types in response to environmental factors. For instance, in low nitrogen conditions, some cyanobacteria form heterocysts, which are specialized for N2 fixation. Many heterocyst-forming cyanobacteria have DNA elements interrupting key N2 fixation genes, elements that are excised during heterocyst differentiation. While the mechanism for the excision of the element has been well-studied, many questions remain regarding the introduction of the elements into the cyanobacterial lineage and whether they have been retained ever since or have been lost and reintroduced. To examine the evolutionary relationships and possible function of DNA sequences that interrupt genes of heterocyst-forming cyanobacteria, we identified and compared 101 interruption element sequences within genes from 38 heterocyst-forming cyanobacterial genomes. The interruption element lengths ranged from about 1 kb (the minimum able to encode the recombinase responsible for element excision), up to nearly 1 Mb. The recombinase gene sequences served as genetic markers that were common across the interruption elements and were used to track element evolution. Elements were found that interrupted 22 different orthologs, only five of which had been previously observed to be interrupted by an element. Most of the newly identified interrupted orthologs encode proteins that have been shown to have heterocyst-specific activity. However, the presence of interruption elements within genes with no known role in N2 fixation, as well as in three non-heterocyst-forming cyanobacteria, indicates that the processes that trigger the excision of elements may not be limited to heterocyst development or that the elements move randomly within genomes. This comprehensive analysis provides the framework to study the history and behavior of these unique sequences, and offers new insight regarding the frequency and persistence of interruption elements in heterocyst-forming cyanobacteria.

Annotation, submission and screening of repetitive elements in Repbase: RepbaseSubmitter and Censor.

PubMed

Kohany, Oleksiy; Gentles, Andrew J; Hankus, Lukasz; Jurka, Jerzy

2006-10-25

Repbase is a reference database of eukaryotic repetitive DNA, which includes prototypic sequences of repeats and basic information described in annotations. Updating and maintenance of the database requires specialized tools, which we have created and made available for use with Repbase, and which may be useful as a template for other curated databases. We describe the software tools RepbaseSubmitter and Censor, which are designed to facilitate updating and screening the content of Repbase. RepbaseSubmitter is a java-based interface for formatting and annotating Repbase entries. It eliminates many common formatting errors, and automates actions such as calculation of sequence lengths and composition, thus facilitating curation of Repbase sequences. In addition, it has several features for predicting protein coding regions in sequences; searching and including Pubmed references in Repbase entries; and searching the NCBI taxonomy database for correct inclusion of species information and taxonomic position. Censor is a tool to rapidly identify repetitive elements by comparison to known repeats. It uses WU-BLAST for speed and sensitivity, and can conduct DNA-DNA, DNA-protein, or translated DNA-translated DNA searches of genomic sequence. Defragmented output includes a map of repeats present in the query sequence, with the options to report masked query sequence(s), repeat sequences found in the query, and alignments. Censor and RepbaseSubmitter are available as both web-based services and downloadable versions. They can be found at http://www.girinst.org/repbase/submission.html (RepbaseSubmitter) and http://www.girinst.org/censor/index.php (Censor).

Detecting authorized and unauthorized genetically modified organisms containing vip3A by real-time PCR and next-generation sequencing.

PubMed

Liang, Chanjuan; van Dijk, Jeroen P; Scholtens, Ingrid M J; Staats, Martijn; Prins, Theo W; Voorhuijzen, Marleen M; da Silva, Andrea M; Arisi, Ana Carolina Maisonnave; den Dunnen, Johan T; Kok, Esther J

2014-04-01

The growing number of biotech crops with novel genetic elements increasingly complicates the detection of genetically modified organisms (GMOs) in food and feed samples using conventional screening methods. Unauthorized GMOs (UGMOs) in food and feed are currently identified through combining GMO element screening with sequencing the DNA flanking these elements. In this study, a specific and sensitive qPCR assay was developed for vip3A element detection based on the vip3Aa20 coding sequences of the recently marketed MIR162 maize and COT102 cotton. Furthermore, SiteFinding-PCR in combination with Sanger, Illumina or Pacific BioSciences (PacBio) sequencing was performed targeting the flanking DNA of the vip3Aa20 element in MIR162. De novo assembly and Basic Local Alignment Search Tool searches were used to mimic UGMO identification. PacBio data resulted in relatively long contigs in the upstream (1,326 nucleotides (nt); 95 % identity) and downstream (1,135 nt; 92 % identity) regions, whereas Illumina data resulted in two smaller contigs of 858 and 1,038 nt with higher sequence identity (>99 % identity). Both approaches outperformed Sanger sequencing, underlining the potential for next-generation sequencing in UGMO identification.

Population genetics and molecular evolution of DNA sequences in transposable elements. I. A simulation framework.

PubMed

Kijima, T E; Innan, Hideki

2013-11-01

A population genetic simulation framework is developed to understand the behavior and molecular evolution of DNA sequences of transposable elements. Our model incorporates random transposition and excision of transposable element (TE) copies, two modes of selection against TEs, and degeneration of transpositional activity by point mutations. We first investigated the relationships between the behavior of the copy number of TEs and these parameters. Our results show that when selection is weak, the genome can maintain a relatively large number of TEs, but most of them are less active. In contrast, with strong selection, the genome can maintain only a limited number of TEs but the proportion of active copies is large. In such a case, there could be substantial fluctuations of the copy number over generations. We also explored how DNA sequences of TEs evolve through the simulations. In general, active copies form clusters around the original sequence, while less active copies have long branches specific to themselves, exhibiting a star-shaped phylogeny. It is demonstrated that the phylogeny of TE sequences could be informative to understand the dynamics of TE evolution.

DNA methylation dynamics during early plant life.

PubMed

Bouyer, Daniel; Kramdi, Amira; Kassam, Mohamed; Heese, Maren; Schnittger, Arp; Roudier, François; Colot, Vincent

2017-09-25

Cytosine methylation is crucial for gene regulation and silencing of transposable elements in mammals and plants. While this epigenetic mark is extensively reprogrammed in the germline and early embryos of mammals, the extent to which DNA methylation is reset between generations in plants remains largely unknown. Using Arabidopsis as a model, we uncovered distinct DNA methylation dynamics over transposable element sequences during the early stages of plant development. Specifically, transposable elements and their relics show invariably high methylation at CG sites but increasing methylation at CHG and CHH sites. This non-CG methylation culminates in mature embryos, where it reaches saturation for a large fraction of methylated CHH sites, compared to the typical 10-20% methylation level observed in seedlings or adult plants. Moreover, the increase in CHH methylation during embryogenesis matches the hypomethylated state in the early endosperm. Finally, we show that interfering with the embryo-to-seedling transition results in the persistence of high CHH methylation levels after germination, specifically over sequences that are targeted by the RNA-directed DNA methylation (RdDM) machinery. Our findings indicate the absence of extensive resetting of DNA methylation patterns during early plant life and point instead to an important role of RdDM in reinforcing DNA methylation of transposable element sequences in every cell of the mature embryo. Furthermore, we provide evidence that this elevated RdDM activity is a specific property of embryogenesis.

Evolutionary Dynamics of 5S rDNA and Recurrent Association of Transposable Elements in Electric Fish of the Family Gymnotidae (Gymnotiformes): The Case of Gymnotus mamiraua.

PubMed

da Silva, Maelin; Barbosa, Patricia; Artoni, Roberto F; Feldberg, Eliana

2016-01-01

Gymnotidae is a family of electric fish endemic to the Neotropics consisting of 2 genera: Electrophorus and Gymnotus. The genus Gymnotus is widely distributed and is found in all of the major Brazilian river systems. Physical and molecular mapping data for the ribosomal DNA (rDNA) in this genus are still scarce, with its chromosomal location known in only 11 species. As other species of Gymnotus with 2n = 54 chromosomes from the Paraná-Paraguay basin, G. mamiraua was found to have a large number of 5S rDNA sites. Isolation and cloning of the 5S rDNA sequences from G. mamiraua identified a fragment of a transposable element similar to the Tc1/mariner transposon associated with a non-transcribed spacer. Double fluorescence in situ hybridization analysis of this element and the 5S rDNA showed that they were colocalized on several chromosomes, in addition to acting as nonsyntenic markers on others. Our data show the association between these sequences and suggest that the Tc1 retrotransposon may be the agent that drives the spread of these 5S rDNA-like sequences in the G. mamiraua genome. © 2016 S. Karger AG, Basel.

Specificity determinants for the abscisic acid response element.

PubMed

Sarkar, Aditya Kumar; Lahiri, Ansuman

2013-01-01

Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interaction with ACGT core motif-containing ABRE sequences. We have also examined the variation in the stability of the protein-DNA complex upon mutating ABRE sequences using the protein design algorithm FoldX. The high throughput free energy calculations successfully predicted the ability of ABF1 to bind to alternative core motifs like GCGT or AAGT and also rationalized the role of the flanking sequences in determining the specificity of the protein-DNA interaction.

Uncoupling of sgRNAs from their associated barcodes during PCR amplification of combinatorial CRISPR screens

PubMed Central

2018-01-01

Many implementations of pooled screens in mammalian cells rely on linking an element of interest to a barcode, with the latter subsequently quantitated by next generation sequencing. However, substantial uncoupling between these paired elements during lentiviral production has been reported, especially as the distance between elements increases. We detail that PCR amplification is another major source of uncoupling, and becomes more pronounced with increased amounts of DNA template molecules and PCR cycles. To lessen uncoupling in systems that use paired elements for detection, we recommend minimizing the distance between elements, using low and equal template DNA inputs for plasmid and genomic DNA during PCR, and minimizing the number of PCR cycles. We also present a vector design for conducting combinatorial CRISPR screens that enables accurate barcode-based detection with a single short sequencing read and minimal uncoupling. PMID:29799876

SINE sequences detect DNA fingerprints in salmonid fishes.

PubMed

Spruell, P; Thorgaard, G H

1996-04-01

DNA probes homologous to two previously described salmonid short interspersed nuclear elements (SINEs) detected DNA fingerprint patterns in 14 species of salmonid fishes. The probes showed more homology to some species than to others and little homology to three nonsalmonid fishes. The DNA fingerprint patterns derived from the SINE probes are individual-specific and inherited in a Mendelian manner. Probes derived from different regions of the same SINE detect only partially overlapping banding patterns, reflecting a more complex SINE structure than has been previously reported. Like the human Alu sequence, the SINEs found in salmonids could provide useful genetic markers and primer sites for PCR-based techniques. These elements may be more desirable for some applications than traditional DNA fingerprinting probes that detect tandemly repeated arrays.

Translocation and gross deletion breakpoints in human inherited disease and cancer II: Potential involvement of repetitive sequence elements in secondary structure formation between DNA ends.

PubMed

Chuzhanova, Nadia; Abeysinghe, Shaun S; Krawczak, Michael; Cooper, David N

2003-09-01

Translocations and gross deletions are responsible for a significant proportion of both cancer and inherited disease. Although such gene rearrangements are nonuniformly distributed in the human genome, the underlying mutational mechanisms remain unclear. We have studied the potential involvement of various types of repetitive sequence elements in the formation of secondary structure intermediates between the single-stranded DNA ends that recombine during rearrangements. Complexity analysis was used to assess the potential of these ends to form secondary structures, the maximum decrease in complexity consequent to a gross rearrangement being used as an indicator of the type of repeat and the specific DNA ends involved. A total of 175 pairs of deletion/translocation breakpoint junction sequences available from the Gross Rearrangement Breakpoint Database [GRaBD; www.uwcm.ac.uk/uwcm/mg/grabd/grabd.html] were analyzed. Potential secondary structure was noted between the 5' flanking sequence of the first breakpoint and the 3' flanking sequence of the second breakpoint in 49% of rearrangements and between the 5' flanking sequence of the second breakpoint and the 3' flanking sequence of the first breakpoint in 36% of rearrangements. Inverted repeats, inversions of inverted repeats, and symmetric elements were found in association with gross rearrangements at approximately the same frequency. However, inverted repeats and inversions of inverted repeats accounted for the vast majority (83%) of deletions plus small insertions, symmetric elements for one-half of all antigen receptor-mediated translocations, while direct repeats appear only to be involved in mediating simple deletions. These findings extend our understanding of illegitimate recombination by highlighting the importance of secondary structure formation between single-stranded DNA ends at breakpoint junctions. Copyright 2003 Wiley-Liss, Inc.

Identification and chromosome mapping of repetitive elements in the Astyanax scabripinnis (Teleostei: Characidae) species complex.

PubMed

Barbosa, Patrícia; de Oliveira, Luiz Antonio; Pucci, Marcela Baer; Santos, Mateus Henrique; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo; Nogaroto, Viviane; de Almeida, Mara Cristina; Artoni, Roberto Ferreira

2015-02-01

Most part of the eukaryotic genome is composed of repeated sequences or multiple copies of DNA, which were considered as "junk DNA", and may be associated to the heterochromatin. In this study, three populations of Astyanax aff. scabripinnis from Brazilian rivers of Guaratinguetá and Pindamonhangaba (São Paulo) and a population from Maringá (Paraná) were analyzed concerning the localization of the nucleolar organizer regions (Ag-NORs), the As51 satellite DNA, the 18S ribosomal DNA (rDNA), and the 5S rDNA. Repeated sequences were also isolated and identified by the Cot - 1 method, which indicated similarity (90%) with the LINE UnaL2 retrotransposon. The fluorescence in situ hybridization (FISH) showed the retrotransposon dispersed and more concentrated markers in centromeric and telomeric chromosomal regions. These sequences were co-localized and interspaced with 18S and 5S rDNA and As51, confirmed by fiber-FISH essay. The B chromosome found in these populations pointed to a conspicuous hybridization with LINE probe, which is also co-located in As51 sequences. The NORs were active at unique sites of a homologous pair in the three populations. There were no evidences that transposable elements and repetitive DNA had influence in the transcriptional regulation of ribosomal genes in our analyses.

Long interspersed repeated DNA (LINE) causes polymorphism at the rat insulin 1 locus.

PubMed Central

Lakshmikumaran, M S; D'Ambrosio, E; Laimins, L A; Lin, D T; Furano, A V

1985-01-01

The insulin 1, but not the insulin 2, locus is polymorphic (i.e., exhibits allelic variation) in rats. Restriction enzyme analysis and hybridization studies showed that the polymorphic region is 2.2 kilobases upstream of the insulin 1 coding region and is due to the presence or absence of an approximately 2.7-kilobase repeated DNA element. DNA sequence determination showed that this DNA element is a member of a long interspersed repeated DNA family (LINE) that is highly repeated (greater than 50,000 copies) and highly transcribed in the rat. Although the presence or absence of LINE sequences at the insulin 1 locus occurs in both the homozygous and heterozygous states, LINE-containing insulin 1 alleles are more prevalent in the rat population than are alleles without LINEs. Restriction enzyme analysis of the LINE-containing alleles indicated that at least two versions of the LINE sequence may be present at the insulin 1 locus in different rats. Either repeated transposition of LINE sequences or gene conversion between the resident insulin 1 LINE and other sequences in the genome are possible explanations for this. Images PMID:3016521

Satellite DNA and Transposable Elements in Seabuckthorn (Hippophae rhamnoides), a Dioecious Plant with Small Y and Large X Chromosomes

PubMed Central

Puterova, Janka; Razumova, Olga; Martinek, Tomas; Alexandrov, Oleg; Divashuk, Mikhail; Kubat, Zdenek; Hobza, Roman; Karlov, Gennady

2017-01-01

Seabuckthorn (Hippophae rhamnoides) is a dioecious shrub commonly used in the pharmaceutical, cosmetic, and environmental industry as a source of oil, minerals and vitamins. In this study, we analyzed the transposable elements and satellites in its genome. We carried out Illumina DNA sequencing and reconstructed the main repetitive DNA sequences. For data analysis, we developed a new bioinformatics approach for advanced satellite DNA analysis and showed that about 25% of the genome consists of satellite DNA and about 24% is formed of transposable elements, dominated by Ty3/Gypsy and Ty1/Copia LTR retrotransposons. FISH mapping revealed X chromosome-accumulated, Y chromosome-specific or both sex chromosomes-accumulated satellites but most satellites were found on autosomes. Transposable elements were located mostly in the subtelomeres of all chromosomes. The 5S rDNA and 45S rDNA were localized on one autosomal locus each. Although we demonstrated the small size of the Y chromosome of the seabuckthorn and accumulated satellite DNA there, we were unable to estimate the age and extent of the Y chromosome degeneration. Analysis of dioecious relatives such as Shepherdia would shed more light on the evolution of these sex chromosomes. PMID:28057732

The genomes of many yam species contain transcriptionally active endogenous geminiviral sequences that may be functionally expressed

PubMed Central

Filloux, Denis; Murrell, Sasha; Koohapitagtam, Maneerat; Golden, Michael; Julian, Charlotte; Galzi, Serge; Uzest, Marilyne; Rodier-Goud, Marguerite; D’Hont, Angélique; Vernerey, Marie Stephanie; Wilkin, Paul; Peterschmitt, Michel; Winter, Stephan; Murrell, Ben; Martin, Darren P.; Roumagnac, Philippe

2015-01-01

Endogenous viral sequences are essentially ‘fossil records’ that can sometimes reveal the genomic features of long extinct virus species. Although numerous known instances exist of single-stranded DNA (ssDNA) genomes becoming stably integrated within the genomes of bacteria and animals, there remain very few examples of such integration events in plants. The best studied of these events are those which yielded the geminivirus-related DNA elements found within the nuclear genomes of various Nicotiana species. Although other ssDNA virus-like sequences are included within the draft genomes of various plant species, it is not entirely certain that these are not contaminants. The Nicotiana geminivirus-related DNA elements therefore remain the only definitively proven instances of endogenous plant ssDNA virus sequences. Here, we characterize two new classes of endogenous plant virus sequence that are also apparently derived from ancient geminiviruses in the genus Begomovirus. These two endogenous geminivirus-like elements (EGV1 and EGV2) are present in the Dioscorea spp. of the Enantiophyllum clade. We used fluorescence in situ hybridization to confirm that the EGV1 sequences are integrated in the D. alata genome and showed that one or two ancestral EGV sequences likely became integrated more than 1.4 million years ago during or before the diversification of the Asian and African Enantiophyllum Dioscorea spp. Unexpectedly, we found evidence of natural selection actively favouring the maintenance of EGV-expressed replication-associated protein (Rep) amino acid sequences, which clearly indicates that functional EGV Rep proteins were probably expressed for prolonged periods following endogenization. Further, the detection in D. alata of EGV gene transcripts, small 21–24 nt RNAs that are apparently derived from these transcripts, and expressed Rep proteins, provides evidence that some EGV genes are possibly still functionally expressed in at least some of the Enantiophyllum clade species. PMID:27774276

Bovine papilloma virus contains an activator of gene expression at the distal end of the early transcription unit.

PubMed Central

Lusky, M; Berg, L; Weiher, H; Botchan, M

1983-01-01

Bovine papilloma virus (BPV) contains a cis-acting DNA element which can enhance transcription of distal promoters. Utilizing both direct and indirect transient transfection assays, we showed that a 59-base-pair DNA sequence from the BPV genome could activate the simian virus 40 promoter from distances exceeding 2.5 kilobases and in an orientation-independent manner. In contrast to the promoter 5'-proximal localization of other known viral activators, this element was located immediately 3' to the early polyadenylation signal in the BPV genome. Deletion of these sequences from the BPV genome inactivated the transforming ability of BPV recombinant plasmids. Orientation-independent reinsertion of this 59-base-pair sequence, or alternatively of activator DNA sequences from simian virus 40 or polyoma virus, restored the transforming activity of the BPV recombinant plasmids. Furthermore, the stable transformation frequency of the herpes simplex virus type 1 thymidine kinase gene was enhanced when linked to restriction fragments of BPV DNA which included the defined activator element. This enhancement was orientation independent with respect to the thymidine kinase promoter. The enhancement also appeared to be unrelated to the establishment of the recombinant plasmids as episomes, since in transformed cells these sequences are found linked to high-molecular-weight DNA. We propose that the enhancement of stable transformation frequencies and the activation of transcription units are in this case alternate manifestations of the same biochemical events. Images PMID:6308425

Billions of basepairs of recently expanded, repetitive sequences are eliminated from the somatic genome during copepod development.

PubMed

Sun, Cheng; Wyngaard, Grace; Walton, D Brian; Wichman, Holly A; Mueller, Rachel Lockridge

2014-03-11

Chromatin diminution is the programmed deletion of DNA from presomatic cell or nuclear lineages during development, producing single organisms that contain two different nuclear genomes. Phylogenetically diverse taxa undergo chromatin diminution--some ciliates, nematodes, copepods, and vertebrates. In cyclopoid copepods, chromatin diminution occurs in taxa with massively expanded germline genomes; depending on species, germline genome sizes range from 15 - 75 Gb, 12-74 Gb of which are lost from pre-somatic cell lineages at germline--soma differentiation. This is more than an order of magnitude more sequence than is lost from other taxa. To date, the sequences excised from copepods have not been analyzed using large-scale genomic datasets, and the processes underlying germline genomic gigantism in this clade, as well as the functional significance of chromatin diminution, have remained unknown. Here, we used high-throughput genomic sequencing and qPCR to characterize the germline and somatic genomes of Mesocyclops edax, a freshwater cyclopoid copepod with a germline genome of ~15 Gb and a somatic genome of ~3 Gb. We show that most of the excised DNA consists of repetitive sequences that are either 1) verifiable transposable elements (TEs), or 2) non-simple repeats of likely TE origin. Repeat elements in both genomes are skewed towards younger (i.e. less divergent) elements. Excised DNA is a non-random sample of the germline repeat element landscape; younger elements, and high frequency DNA transposons and LINEs, are disproportionately eliminated from the somatic genome. Our results suggest that germline genome expansion in M. edax reflects explosive repeat element proliferation, and that billions of base pairs of such repeats are deleted from the somatic genome every generation. Thus, we hypothesize that chromatin diminution is a mechanism that controls repeat element load, and that this load can evolve to be divergent between tissue types within single organisms.

Billions of basepairs of recently expanded, repetitive sequences are eliminated from the somatic genome during copepod development

PubMed Central

2014-01-01

Background Chromatin diminution is the programmed deletion of DNA from presomatic cell or nuclear lineages during development, producing single organisms that contain two different nuclear genomes. Phylogenetically diverse taxa undergo chromatin diminution — some ciliates, nematodes, copepods, and vertebrates. In cyclopoid copepods, chromatin diminution occurs in taxa with massively expanded germline genomes; depending on species, germline genome sizes range from 15 – 75 Gb, 12–74 Gb of which are lost from pre-somatic cell lineages at germline – soma differentiation. This is more than an order of magnitude more sequence than is lost from other taxa. To date, the sequences excised from copepods have not been analyzed using large-scale genomic datasets, and the processes underlying germline genomic gigantism in this clade, as well as the functional significance of chromatin diminution, have remained unknown. Results Here, we used high-throughput genomic sequencing and qPCR to characterize the germline and somatic genomes of Mesocyclops edax, a freshwater cyclopoid copepod with a germline genome of ~15 Gb and a somatic genome of ~3 Gb. We show that most of the excised DNA consists of repetitive sequences that are either 1) verifiable transposable elements (TEs), or 2) non-simple repeats of likely TE origin. Repeat elements in both genomes are skewed towards younger (i.e. less divergent) elements. Excised DNA is a non-random sample of the germline repeat element landscape; younger elements, and high frequency DNA transposons and LINEs, are disproportionately eliminated from the somatic genome. Conclusions Our results suggest that germline genome expansion in M. edax reflects explosive repeat element proliferation, and that billions of base pairs of such repeats are deleted from the somatic genome every generation. Thus, we hypothesize that chromatin diminution is a mechanism that controls repeat element load, and that this load can evolve to be divergent between tissue types within single organisms. PMID:24618421

The site-specific ribosomal DNA insertion element R1Bm belongs to a class of non-long-terminal-repeat retrotransposons.

PubMed Central

Xiong, Y; Eickbush, T H

1988-01-01

Two types of insertion elements, R1 and R2 (previously called type I and type II), are known to interrupt the 28S ribosomal genes of several insect species. In the silkmoth, Bombyx mori, each element occupies approximately 10% of the estimated 240 ribosomal DNA units, while at most only a few copies are located outside the ribosomal DNA units. We present here the complete nucleotide sequence of an R1 insertion from B. mori (R1Bm). This 5.1-kilobase element contains two overlapping open reading frames (ORFs) which together occupy 88% of its length. ORF1 is 461 amino acids in length and exhibits characteristics of retroviral gag genes. ORF2 is 1,051 amino acids in length and contains homology to reverse transcriptase-like enzymes. The analysis of 3' and 5' ends of independent isolates from the ribosomal locus supports the suggestion that R1 is still functioning as a transposable element. The precise location of the element within the genome implies that its transposition must occur with remarkable insertion sequence specificity. Comparison of the deduced amino acid sequences from six retrotransposons, R1 and R2 of B. mori, I factor and F element of Drosophila melanogaster, L1 of Mus domesticus, and Ingi of Trypanosoma brucei, reveals a relatively high level of sequence homology in the reverse transcriptase region. Like R1, these elements lack long terminal repeats. We have therefore named this class of related elements the non-long-terminal-repeat (non-LTR) retrotransposons. Images PMID:2447482

copia-like retrotransposons are ubiquitous among plants.

PubMed Central

Voytas, D F; Cummings, M P; Koniczny, A; Ausubel, F M; Rodermel, S R

1992-01-01

Transposable genetic elements are assumed to be a feature of all eukaryotic genomes. Their identification, however, has largely been haphazard, limited principally to organisms subjected to molecular or genetic scrutiny. We assessed the phylogenetic distribution of copia-like retrotransposons, a class of transposable element that proliferates by reverse transcription, using a polymerase chain reaction assay designed to detect copia-like element reverse transcriptase sequences. copia-like retrotransposons were identified in 64 plant species as well as the photosynthetic protist Volvox carteri. The plant species included representatives from 9 of 10 plant divisions, including bryophytes, lycopods, ferns, gymnosperms, and angiosperms. DNA sequence analysis of 29 cloned PCR products and of a maize retrotransposon cDNA confirmed the identity of these sequences as copia-like reverse transcriptase sequences, thereby demonstrating that this class of retrotransposons is a ubiquitous component of plant genomes. Images PMID:1379734

In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax.

PubMed

Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z

1994-01-01

The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.

The DL1 repeats in the genome of Diphyllobothrium latum.

PubMed

Usmanova, Nadezhda M; Kazakov, Vasiliy I

2010-07-01

Diphyllobothrium latum is a widespread intestinal parasite, which has a great clinical relevance, but there are no sequences of its nuclear genome. In this paper, a repetitive element in the D. latum genome is firstly described. The adult D. latum was obtained in the result of expulsion from intestinum of a patient suffering from diphyllobothriasis. Genomic DNA was isolated from several proglottids of this individual. PstI restriction products of D. latum genomic DNA were sequenced. Polymerase chain reaction (PCR) amplification of these products using genomic DNA and selected primers was carried out. Thereby a cluster of a repetitive element, called DL1, was discovered. For precise identification of a beginning and an end of the repeat, a product of PCR amplification of D. latum genomic DNA with one specific primer was sequenced. In discussion, several evidences that DL1 repeat is a member of the SINE family of retroposons were adduced.

Repetitive sequence analysis and karyotyping reveals centromere-associated DNA sequences in radish (Raphanus sativus L.).

PubMed

He, Qunyan; Cai, Zexi; Hu, Tianhua; Liu, Huijun; Bao, Chonglai; Mao, Weihai; Jin, Weiwei

2015-04-18

Radish (Raphanus sativus L., 2n = 2x = 18) is a major root vegetable crop especially in eastern Asia. Radish root contains various nutritions which play an important role in strengthening immunity. Repetitive elements are primary components of the genomic sequence and the most important factors in genome size variations in higher eukaryotes. To date, studies about repetitive elements of radish are still limited. To better understand genome structure of radish, we undertook a study to evaluate the proportion of repetitive elements and their distribution in radish. We conducted genome-wide characterization of repetitive elements in radish with low coverage genome sequencing followed by similarity-based cluster analysis. Results showed that about 31% of the genome was composed of repetitive sequences. Satellite repeats were the most dominating elements of the genome. The distribution pattern of three satellite repeat sequences (CL1, CL25, and CL43) on radish chromosomes was characterized using fluorescence in situ hybridization (FISH). CL1 was predominantly located at the centromeric region of all chromosomes, CL25 located at the subtelomeric region, and CL43 was a telomeric satellite. FISH signals of two satellite repeats, CL1 and CL25, together with 5S rDNA and 45S rDNA, provide useful cytogenetic markers to identify each individual somatic metaphase chromosome. The centromere-specific histone H3 (CENH3) has been used as a marker to identify centromere DNA sequences. One putative CENH3 (RsCENH3) was characterized and cloned from radish. Its deduced amino acid sequence shares high similarities to those of the CENH3s in Brassica species. An antibody against B. rapa CENH3, specifically stained radish centromeres. Immunostaining and chromatin immunoprecipitation (ChIP) tests with anti-BrCENH3 antibody demonstrated that both the centromere-specific retrotransposon (CR-Radish) and satellite repeat (CL1) are directly associated with RsCENH3 in radish. Proportions of repetitive elements in radish were estimated and satellite repeats were the most dominating elements. Fine karyotyping analysis was established which allow us to easily identify each individual somatic metaphase chromosome. Immunofluorescence- and ChIP-based assays demonstrated the functional significance of satellite and centromere-specific retrotransposon at centromeres. Our study provides a valuable basis for future genomic studies in radish.

LINE-1 Elements in Structural Variation and Disease

PubMed Central

Beck, Christine R.; Garcia-Perez, José Luis; Badge, Richard M.; Moran, John V.

2014-01-01

The completion of the human genome reference sequence ushered in a new era for the study and discovery of human transposable elements. It now is undeniable that transposable elements, historically dismissed as junk DNA, have had an instrumental role in sculpting the structure and function of our genomes. In particular, long interspersed element-1 (LINE-1 or L1) and short interspersed elements (SINEs) continue to affect our genome, and their movement can lead to sporadic cases of disease. Here, we briefly review the types of transposable elements present in the human genome and their mechanisms of mobility. We next highlight how advances in DNA sequencing and genomic technologies have enabled the discovery of novel retrotransposons in individual genomes. Finally, we discuss how L1-mediated retrotransposition events impact human genomes. PMID:21801021

Complex structure of knob DNA on maize chromosome 9. Retrotransposon invasion into heterochromatin.

PubMed Central

Ananiev, E V; Phillips, R L; Rines, H W

1998-01-01

The recovery of maize (Zea mays L.) chromosome addition lines of oat (Avena sativa L.) from oat x maize crosses enables us to analyze the structure and composition of specific regions, such as knobs, of individual maize chromosomes. A DNA hybridization blot panel of eight individual maize chromosome addition lines revealed that 180-bp repeats found in knobs are present in each of these maize chromosomes, but the copy number varies from approximately 100 to 25, 000. Cosmid clones with knob DNA segments were isolated from a genomic library of an oat-maize chromosome 9 addition line with the help of the 180-bp knob-associated repeated DNA sequence used as a probe. Cloned knob DNA segments revealed a complex organization in which blocks of tandemly arranged 180-bp repeating units are interrupted by insertions of other repeated DNA sequences, mostly represented by individual full size copies of retrotransposable elements. There is an obvious preference for the integration of retrotransposable elements into certain sites (hot spots) of the 180-bp repeat. Sequence microheterogeneity including point mutations and duplications was found in copies of 180-bp repeats. The 180-bp repeats within an array all had the same polarity. Restriction maps constructed for 23 cloned knob DNA fragments revealed the positions of polymorphic sites and sites of integration of insertion elements. Discovery of the interspersion of retrotransposable elements among blocks of tandem repeats in maize and some other organisms suggests that this pattern may be basic to heterochromatin organization for eukaryotes. PMID:9691055

Evolutionary dynamics of selfish DNA explains the abundance distribution of genomic subsequences

PubMed Central

Sheinman, Michael; Ramisch, Anna; Massip, Florian; Arndt, Peter F.

2016-01-01

Since the sequencing of large genomes, many statistical features of their sequences have been found. One intriguing feature is that certain subsequences are much more abundant than others. In fact, abundances of subsequences of a given length are distributed with a scale-free power-law tail, resembling properties of human texts, such as Zipf’s law. Despite recent efforts, the understanding of this phenomenon is still lacking. Here we find that selfish DNA elements, such as those belonging to the Alu family of repeats, dominate the power-law tail. Interestingly, for the Alu elements the power-law exponent increases with the length of the considered subsequences. Motivated by these observations, we develop a model of selfish DNA expansion. The predictions of this model qualitatively and quantitatively agree with the empirical observations. This allows us to estimate parameters for the process of selfish DNA spreading in a genome during its evolution. The obtained results shed light on how evolution of selfish DNA elements shapes non-trivial statistical properties of genomes. PMID:27488939

A unique mitigator sequence determines the species specificity of the major late promoter in adenovirus type 12 DNA.

PubMed Central

Zock, C; Iselt, A; Doerfler, W

1993-01-01

Human adenovirus type 12 (Ad12) cannot replicate in hamster cells, whereas human cells are permissive for Ad12. Ad12 DNA replication and late-gene and virus-associated RNA expression are blocked in hamster cells. Early Ad12 genes are transcribed, and the viral DNA can be integrated into the host genome. Ad12 DNA replication and late-gene transcription can be complemented in hamster cells by E1 functions of Ad2 or Ad5, for which hamster cells are fully permissive (for a review, see W. Doerfler, Adv. Virus Res. 39:89-128, 1991). We have previously demonstrated that a 33-nucleotide mitigator sequence, which is located in the downstream region of the major late promoter (MLP) of Ad12 DNA, is responsible for the inactivity of the Ad12 MLP in hamster cells (C. Zock and W. Doerfler, EMBO J. 9:1615-1623, 1990). A similar negative regulator has not been found in the MLP of Ad2 DNA. We have now studied the mechanism of action of this mitigator element. The results of nuclear run-on experiments document the absence of MLP transcripts in the nuclei of Ad12-infected BHK21 hamster cells. Surprisingly, the mitigator element cannot elicit its function in in vitro transcription experiments with nuclear extracts from both hamster BHK21 and human HeLa cells. Intact nuclear topology and/or tightly bound nuclear elements that cannot be eluted in nuclear extracts are somehow required for recognition of the Ad12 mitigator. Electrophoretic mobility shift assays have not revealed significant differences in the binding of proteins from human HeLa or hamster BHK21 cells to the mitigator sequence in the MLP of Ad12 DNA or to the corresponding sequence in Ad2 DNA. We have converted the sequence of the mitigator in the MLP of Ad12 DNA to the equivalent sequence in the MLP of Ad2 DNA by site-directed mutagenesis. This construct was not active in hamster cells. When the Ad12 mitigator, on the other hand, was inserted into the Ad2 MLP, the latter's function in hamster cells was not compromised. Deletions in the 5' upstream region of the Ad12 MLP have provided evidence for the existence of additional sequences that codetermine the deficiency of the Ad12 MLP in hamster cells. The amphifunctional YY1 protein from HeLa cells can bind specifically to the mitigator and to upstream elements of the MLP of Ad12 DNA.(ABSTRACT TRUNCATED AT 400 WORDS) Images PMID:8419643

DNA sequence requirements for the accurate transcription of a protein-coding plastid gene in a plastid in vitro system from mustard (Sinapis alba L.)

PubMed Central

Link, Gerhard

1984-01-01

A nuclease-treated plastid extract from mustard (Sinapis alba L.) allows efficient transcription of cloned plastid DNA templates. In this in vitro system, the major runoff transcript of the truncated gene for the 32 000 mol. wt. photosystem II protein was accurately initiated from a site close to or identical with the in vivo start site. By using plasmids with deletions in the 5'-flanking region of this gene as templates, a DNA region required for efficient and selective initiation was detected ˜28-35 nucleotides upstream of the transcription start site. This region contains the sequence element TTGACA, which matches the consensus sequence for prokaryotic `−35' promoter elements. In the absence of this region, a region ˜13-27 nucleotides upstream of the start site still enables a basic level of specific transcription. This second region contains the sequence element TATATAA, which matches the consensus sequence for the `TATA' box of genes transcribed by RNA polymerase II (or B). The region between the `TATA'-like element and the transcription start site is not sufficient but may be required for specific transcription of the plastid gene. This latter region contains the sequence element TATACT, which resembles the prokaryotic `−10' (Pribnow) box. Based on the structural and transcriptional features of the 5' upstream region, a `promoter switch' mechanism is proposed, which may account for the developmentally regulated expression of this plastid gene. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Figure 5. PMID:16453540

Structural analysis of the rDNA intergenic spacer of Brassica nigra: evolutionary divergence of the spacers of the three diploid Brassica species.

PubMed

Bhatia, S; Singh Negi, M; Lakshmikumaran, M

1996-11-01

EcoRI restriction of the B. nigra rDNA recombinants, isolated from a lambda genomic library, showed that the 3.9-kb fragment corresponded to the Intergenic Spacer (IGS), which was sequenced and found to be 3,928 bp in size. Sequence and dot-matrix analyses showed that the organization of the B. nigra rDNA IGS was typical of most rDNA spacers, consisting of a central repetitive region and flanking unique sequences on either side. The repetitive region was composed of two repeat families-RF 'A' and RF 'B.' The B. nigra RF 'A' consisted of a tandem array of three full-length copies of a 106-bp sequence element. RF 'B' was composed of 66 tandemly repeated elements. Each 'B' element was only 21-bp in size and this is the smallest repeat unit identified in plant rDNA to date. The putative transcription initiation site (TIS) was identified as nucleotide position 3,110. Based on the sequence analysis it was suggested that the present organization of the repeat families was generated by successive cycles of deletions and amplifications and was being maintained by homogenization processes such as gene conversion and crossing-over.A detailed comparison of the rDNA IGS sequences of the three diploid Brassica species-namely, B. nigra, B. campestris, and B. oleracea-was carried out. First, comparisons revealed that B. campestris and B. oleracea were close to each other as the repeat families in both showed high sequence homology between each other. Second, the repeat elements in both the species were organized in an interspersed manner. Third, a 52-bp sequence, present just downstream of the repeats in B. campestris, was found to be identical to the B. oleracea repeats, thereby suggesting a common progenitor. On the other hand, in B. nigra no interspersion pattern of organization of repeats was observed. Further, the B. nigra RF 'A' was identified as distinct from the repeat families of B. campestris and B. oleracea. Based on this analysis, it was suggested that during speciation B. campestris and B. oleracea evolved in one lineage whereas B. nigra diverged into a separate lineage. The comparative analysis of the IGS helped in identifying not only conserved ancestral sequence motifs of possible functional significance such as promoters and enhancers, but also sequences which showed variation between the three diploid species and were therefore identified as species-specific sequences.

Elements in the transcriptional regulatory region flanking herpes simplex virus type 1 oriS stimulate origin function.

PubMed

Wong, S W; Schaffer, P A

1991-05-01

Like other DNA-containing viruses, the three origins of herpes simplex virus type 1 (HSV-1) DNA replication are flanked by sequences containing transcriptional regulatory elements. In a transient plasmid replication assay, deletion of sequences comprising the transcriptional regulatory elements of ICP4 and ICP22/47, which flank oriS, resulted in a greater than 80-fold decrease in origin function compared with a plasmid, pOS-822, which retains these sequences. In an effort to identify specific cis-acting elements responsible for this effect, we conducted systematic deletion analysis of the flanking region with plasmid pOS-822 and tested the resulting mutant plasmids for origin function. Stimulation by cis-acting elements was shown to be both distance and orientation dependent, as changes in either parameter resulted in a decrease in oriS function. Additional evidence for the stimulatory effect of flanking sequences on origin function was demonstrated by replacement of these sequences with the cytomegalovirus immediate-early promoter, resulting in nearly wild-type levels of oriS function. In competition experiments, cotransfection of cells with the test plasmid, pOS-822, and increasing molar concentrations of a competitor plasmid which contained the ICP4 and ICP22/47 transcriptional regulatory regions but lacked core origin sequences resulted in a significant reduction in the replication efficiency of pOS-822, demonstrating that factors which bind specifically to the oriS-flanking sequences are likely involved as auxiliary proteins in oriS function. Together, these studies demonstrate that trans-acting factors and the sites to which they bind play a critical role in the efficiency of HSV-1 DNA replication from oriS in transient-replication assays.

Tyrosine Recombinase Retrotransposons and Transposons.

PubMed

Poulter, Russell T M; Butler, Margi I

2015-04-01

Retrotransposons carrying tyrosine recombinases (YR) are widespread in eukaryotes. The first described tyrosine recombinase mobile element, DIRS1, is a retroelement from the slime mold Dictyostelium discoideum. The YR elements are bordered by terminal repeats related to their replication via free circular dsDNA intermediates. Site-specific recombination is believed to integrate the circle without creating duplications of the target sites. Recently a large number of YR retrotransposons have been described, including elements from fungi (mucorales and basidiomycetes), plants (green algae) and a wide range of animals including nematodes, insects, sea urchins, fish, amphibia and reptiles. YR retrotransposons can be divided into three major groups: the DIRS elements, PAT-like and the Ngaro elements. The three groups form distinct clades on phylogenetic trees based on alignments of reverse transcriptase/ribonuclease H (RT/RH) and YR sequences, and also having some structural distinctions. A group of eukaryote DNA transposons, cryptons, also carry tyrosine recombinases. These DNA transposons do not encode a reverse transcriptase. They have been detected in several pathogenic fungi and oomycetes. Sequence comparisons suggest that the crypton YRs are related to those of the YR retrotransposons. We suggest that the YR retrotransposons arose from the combination of a crypton-like YR DNA transposon and the RT/RH encoding sequence of a retrotransposon. This acquisition must have occurred at a very early point in the evolution of eukaryotes.

Palindromic repetitive DNA elements with coding potential in Methanocaldococcus jannaschii.

PubMed

Suyama, Mikita; Lathe, Warren C; Bork, Peer

2005-10-10

We have identified 141 novel palindromic repetitive elements in the genome of euryarchaeon Methanocaldococcus jannaschii. The total length of these elements is 14.3kb, which corresponds to 0.9% of the total genomic sequence and 6.3% of all extragenic regions. The elements can be divided into three groups (MJRE1-3) based on the sequence similarity. The low sequence identity within each of the groups suggests rather old origin of these elements in M. jannaschii. Three MJRE2 elements were located within the protein coding regions without disrupting the coding potential of the host genes, indicating that insertion of repeats might be a widespread mechanism to enhance sequence diversity in coding regions.

Applications of the rep-PCR DNA fingerprinting technique to study microbial diversity, ecology and evolution.

PubMed

Ishii, Satoshi; Sadowsky, Michael J

2009-04-01

A large number of repetitive DNA sequences are found in multiple sites in the genomes of numerous bacteria, archaea and eukarya. While the functions of many of these repetitive sequence elements are unknown, they have proven to be useful as the basis of several powerful tools for use in molecular diagnostics, medical microbiology, epidemiological analyses and environmental microbiology. The repetitive sequence-based PCR or rep-PCR DNA fingerprint technique uses primers targeting several of these repetitive elements and PCR to generate unique DNA profiles or 'fingerprints' of individual microbial strains. Although this technique has been extensively used to examine diversity among variety of prokaryotic microorganisms, rep-PCR DNA fingerprinting can also be applied to microbial ecology and microbial evolution studies since it has the power to distinguish microbes at the strain or isolate level. Recent advancement in rep-PCR methodology has resulted in increased accuracy, reproducibility and throughput. In this minireview, we summarize recent improvements in rep-PCR DNA fingerprinting methodology, and discuss its applications to address fundamentally important questions in microbial ecology and evolution.

Small gene family encoding an eggshell (chorion) protein of the human parasite Schistosoma mansoni

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bobek, L.A.; Rekosh, D.M.; Lo Verde, P.T.

1988-08-01

The authors isolated six independent genomic clones encoding schistosome chorion or eggshell proteins from a Schistosoma mansoni genomic library. A linkage map of five of the clones spanning 35 kilobase pairs (kbp) of the S. mansoni genome was constructed. The region contained two eggshell protein genes closely linked, separated by 7.5 kbp of intergenic DNA. The two genes of the cluster were arranged in the same orientation, that is, they were transcribed from the same strand. The sixth clone probably represents a third copy of the eggshell gene that is not contained within the 35-kbp region. The 5- end ofmore » the mRNA transcribed from these genes was defined by primer extension directly off the RNA. The ATCAT cap site sequence was homologous to a silkmoth chorion PuTCATT cap site sequence, where Pu indicates any purine. DNA sequence analysis showed that there were no introns in these genes. The DNA sequences of the three genes were very homologous to each other and to a cDNA clone, pSMf61-46, differing only in three or four nucleotices. A multiple TATA box was located at positions -23 to -31, and a CAAAT sequence was located at -52 upstream of the eggshell transcription unit. Comparison of sequences in regions further upstream with silkmoth and Drosophila sequences revealed very short elements that were shared. One such element, TCACGT, recently shown to be an essential cis-regulatory element for silkmoth chorion gene promoter function, was found at a similar position in all three organisms.« less

Analysis of Two Cosmid Clones from Chromosome 4 of Drosophila melanogaster Reveals Two New Genes Amid an Unusual Arrangement of Repeated Sequences

PubMed Central

Locke, John; Podemski, Lynn; Roy, Ken; Pilgrim, David; Hodgetts, Ross

1999-01-01

Chromosome 4 from Drosophila melanogaster has several unusual features that distinguish it from the other chromosomes. These include a diffuse appearance in salivary gland polytene chromosomes, an absence of recombination, and the variegated expression of P-element transgenes. As part of a larger project to understand these properties, we are assembling a physical map of this chromosome. Here we report the sequence of two cosmids representing ∼5% of the polytenized region. Both cosmid clones contain numerous repeated DNA sequences, as identified by cross hybridization with labeled genomic DNA, BLAST searches, and dot matrix analysis, which are positioned between and within the transcribed sequences. The repetitive sequences include three copies of the mobile element Hoppel, one copy of the mobile element HB, and 18 DINE repeats. DINE is a novel, short repeated sequence dispersed throughout both cosmid sequences. One cosmid includes the previously described cubitus interruptus (ci) gene and two new genes: that a gene with a predicted amino acid sequence similar to ribosomal protein S3a which is consistent with the Minute(4)101 locus thought to be in the region, and a novel member of the protein family that includes plexin and met–hepatocyte growth factor receptor. The other cosmid contains only the two short 5′-most exons from the zinc-finger-homolog-2 (zfh-2) gene. This is the first extensive sequence analysis of noncoding DNA from chromosome 4. The distribution of the various repeats suggests its organization is similar to the β-heterochromatic regions near the base of the major chromosome arms. Such a pattern may account for the diffuse banding of the polytene chromosome 4 and the variegation of many P-element transgenes on the chromosome. PMID:10022978

Colonization of heterochromatic genes by transposable elements in Drosophila.

PubMed

Dimitri, Patrizio; Junakovic, Nikolaj; Arcà, Bruno

2003-04-01

As a further step toward understanding transposable element-host genome interactions, we investigated the molecular anatomy of introns from five heterochromatic and 22 euchromatic protein-coding genes of Drosophila melanogaster. A total of 79 kb of intronic sequences from heterochromatic genes and 355 kb of intronic sequences from euchromatic genes have been used in Blast searches against Drosophila transposable elements (TEs). The results show that TE-homologous sequences belonging to 19 different families represent about 50% of intronic DNA from heterochromatic genes. In contrast, only 0.1% of the euchromatic intron DNA exhibits homology to known TEs. Intraspecific and interspecific size polymorphisms of introns were found, which are likely to be associated with changes in TE-related sequences. Together, the enrichment in TEs and the apparent dynamic state of heterochromatic introns suggest that TEs contribute significantly to the evolution of genes located in heterochromatin.

Satellite DNA and Transposable Elements in Seabuckthorn (Hippophae rhamnoides), a Dioecious Plant with Small Y and Large X Chromosomes.

PubMed

Puterova, Janka; Razumova, Olga; Martinek, Tomas; Alexandrov, Oleg; Divashuk, Mikhail; Kubat, Zdenek; Hobza, Roman; Karlov, Gennady; Kejnovsky, Eduard

2017-01-01

Seabuckthorn (Hippophae rhamnoides) is a dioecious shrub commonly used in the pharmaceutical, cosmetic, and environmental industry as a source of oil, minerals and vitamins. In this study, we analyzed the transposable elements and satellites in its genome. We carried out Illumina DNA sequencing and reconstructed the main repetitive DNA sequences. For data analysis, we developed a new bioinformatics approach for advanced satellite DNA analysis and showed that about 25% of the genome consists of satellite DNA and about 24% is formed of transposable elements, dominated by Ty3/Gypsy and Ty1/Copia LTR retrotransposons. FISH mapping revealed X chromosome-accumulated, Y chromosome-specific or both sex chromosomes-accumulated satellites but most satellites were found on autosomes. Transposable elements were located mostly in the subtelomeres of all chromosomes. The 5S rDNA and 45S rDNA were localized on one autosomal locus each. Although we demonstrated the small size of the Y chromosome of the seabuckthorn and accumulated satellite DNA there, we were unable to estimate the age and extent of the Y chromosome degeneration. Analysis of dioecious relatives such as Shepherdia would shed more light on the evolution of these sex chromosomes. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Sequence-Level Mechanisms of Human Epigenome Evolution

PubMed Central

Prendergast, James G.D.; Chambers, Emily V.; Semple, Colin A.M.

2014-01-01

DNA methylation and chromatin states play key roles in development and disease. However, the extent of recent evolutionary divergence in the human epigenome and the influential factors that have shaped it are poorly understood. To determine the links between genome sequence and human epigenome evolution, we examined the divergence of DNA methylation and chromatin states following segmental duplication events in the human lineage. Chromatin and DNA methylation states were found to have been generally well conserved following a duplication event, with the evolution of the epigenome largely uncoupled from the total number of genetic changes in the surrounding DNA sequence. However, the epigenome at tissue-specific, distal regulatory regions was observed to be unusually prone to diverge following duplication, with particular sequence differences, altering known sequence motifs, found to be associated with divergence in patterns of DNA methylation and chromatin. Alu elements were found to have played a particularly prominent role in shaping human epigenome evolution, and we show that human-specific AluY insertion events are strongly linked to the evolution of the DNA methylation landscape and gene expression levels, including at key neurological genes in the human brain. Studying paralogous regions within the same sample enables the study of the links between genome and epigenome evolution while controlling for biological and technical variation. We show DNA methylation and chromatin divergence between duplicated regions are linked to the divergence of particular genetic motifs, with Alu elements having played a disproportionate role in the evolution of the epigenome in the human lineage. PMID:24966180

Control of transcriptional pausing by biased thermal fluctuations on repetitive genomic sequences

PubMed Central

Imashimizu, Masahiko; Afek, Ariel; Takahashi, Hiroki; Lubkowska, Lucyna; Lukatsky, David B.

2016-01-01

In the process of transcription elongation, RNA polymerase (RNAP) pauses at highly nonrandom positions across genomic DNA, broadly regulating transcription; however, molecular mechanisms responsible for the recognition of such pausing positions remain poorly understood. Here, using a combination of statistical mechanical modeling and high-throughput sequencing and biochemical data, we evaluate the effect of thermal fluctuations on the regulation of RNAP pausing. We demonstrate that diffusive backtracking of RNAP, which is biased by repetitive DNA sequence elements, causes transcriptional pausing. This effect stems from the increased microscopic heterogeneity of an elongation complex, and thus is entropy-dominated. This report shows a linkage between repetitive sequence elements encoded in the genome and regulation of RNAP pausing driven by thermal fluctuations. PMID:27830653

A family of long intergenic non-coding RNA genes in human chromosomal region 22q11.2 carry a DNA translocation breakpoint/AT-rich sequence

PubMed Central

2018-01-01

FAM230C, a long intergenic non-coding RNA (lincRNA) gene in human chromosome 13 (chr13) is a member of lincRNA genes termed family with sequence similarity 230. An analysis using bioinformatics search tools and alignment programs was undertaken to determine properties of FAM230C and its related genes. Results reveal that the DNA translocation element, the Translocation Breakpoint Type A (TBTA) sequence, which consists of satellite DNA, Alu elements, and AT-rich sequences is embedded in the FAM230C gene. Eight lincRNA genes related to FAM230C also carry the TBTA sequences. These genes were formed from a large segment of the 3’ half of the FAM230C sequence duplicated in chr22, and are specifically in regions of low copy repeats (LCR22)s, in or close to the 22q.11.2 region. 22q11.2 is a chromosomal segment that undergoes a high rate of DNA translocation and is prone to genetic deletions. FAM230C-related genes present in other chromosomes do not carry the TBTA motif and were formed from the 5’ half region of the FAM230C sequence. These findings identify a high specificity in lincRNA gene formation by gene sequence duplication in different chromosomes. PMID:29668722

Ribosomal RNA Genes Contribute to the Formation of Pseudogenes and Junk DNA in the Human Genome.

PubMed

Robicheau, Brent M; Susko, Edward; Harrigan, Amye M; Snyder, Marlene

2017-02-01

Approximately 35% of the human genome can be identified as sequence devoid of a selected-effect function, and not derived from transposable elements or repeated sequences. We provide evidence supporting a known origin for a fraction of this sequence. We show that: 1) highly degraded, but near full length, ribosomal DNA (rDNA) units, including both 45S and Intergenic Spacer (IGS), can be found at multiple sites in the human genome on chromosomes without rDNA arrays, 2) that these rDNA sequences have a propensity for being centromere proximal, and 3) that sequence at all human functional rDNA array ends is divergent from canonical rDNA to the point that it is pseudogenic. We also show that small sequence strings of rDNA (from 45S + IGS) can be found distributed throughout the genome and are identifiable as an "rDNA-like signal", representing 0.26% of the q-arm of HSA21 and ∼2% of the total sequence of other regions tested. The size of sequence strings found in the rDNA-like signal intergrade into the size of sequence strings that make up the full-length degrading rDNA units found scattered throughout the genome. We conclude that the displaced and degrading rDNA sequences are likely of a similar origin but represent different stages in their evolution towards random sequence. Collectively, our data suggests that over vast evolutionary time, rDNA arrays contribute to the production of junk DNA. The concept that the production of rDNA pseudogenes is a by-product of concerted evolution represents a previously under-appreciated process; we demonstrate here its importance. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Turnover of R1 (Type I) and R2 (Type Ii) Retrotransposable Elements in the Ribosomal DNA of Drosophila Melanogaster

PubMed Central

Jakubczak, J. L.; Zenni, M. K.; Woodruff, R. C.; Eickbush, T. H.

1992-01-01

R1 and R2 are distantly related non-long terminal repeat retrotransposable elements each of which inserts into a specific site in the 28S rRNA genes of most insects. We have analyzed aspects of R1 and R2 abundance and sequence variation in 27 geographical isolates of Drosophila melanogaster. The fraction of 28S rRNA genes containing these elements varied greatly between strains, 17-67% for R1 elements and 2-28% for R2 elements. The total percentage of the rDNA repeats inserted ranged from 32 to 77%. The fraction of the rDNA repeats that contained both of these elements suggested that R1 and R2 exhibit neither an inhibition of nor preference for insertion into a 28S gene already containing the other type of element. Based on the conservation of restriction sites in the elements of all strains, and sequence analysis of individual elements from three strains, nucleotide divergence is very low for R1 and R2 elements within or between strains (<0.6%). This sequence uniformity is the expected result of the forces of concerted evolution (unequal crossovers and gene conversion) which act on the rRNA genes themselves. Evidence for the role of retrotransposition in the turnover of R1 and R2 was obtained by using naturally occurring 5' length polymorphisms of the elements as markers for independent transposition events. The pattern of these different length 5' truncations of R1 and R2 was found to be diverse and unique to most strains analyzed. Because recombination can only, with time, amplify or eliminate those length variants already present, the diversity found in each strain suggests that retrotransposition has played a critical role in maintaining these elements in the rDNA repeats of D. melanogaster. PMID:1317313

Isolation of active regulatory elements from eukaryotic chromatin using FAIRE (Formaldehyde Assisted Isolation of Regulatory Elements)

PubMed Central

Giresi, Paul G.; Lieb, Jason D.

2009-01-01

The binding of sequence-specific regulatory factors and the recruitment of chromatin remodeling activities cause nucleosomes to be evicted from chromatin in eukaryotic cells. Traditionally, these active sites have been identified experimentally through their sensitivity to nucleases. Here we describe the details of a simple procedure for the genome-wide isolation of nucleosome-depleted DNA from human chromatin, termed FAIRE (Formaldehyde Assisted Isolation of Regulatory Elements). We also provide protocols for different methods of detecting FAIRE-enriched DNA, including use of PCR, DNA microarrays, and next-generation sequencing. FAIRE works on all eukaryotic chromatin tested to date. To perform FAIRE, chromatin is crosslinked with formaldehyde, sheared by sonication, and phenol-chloroform extracted. Most genomic DNA is crosslinked to nucleosomes and is sequestered to the interphase, whereas DNA recovered in the aqueous phase corresponds to nucleosome-depleted regions of the genome. The isolated regions are largely coincident with the location of DNaseI hypersensitive sites, transcriptional start sites, enhancers, insulators, and active promoters. Given its speed and simplicity, FAIRE has utility in establishing chromatin profiles of diverse cell types in health and disease, isolating DNA regulatory elements en masse for further characterization, and as a screening assay for the effects of small molecules on chromatin organization. PMID:19303047

DNA detection on ultrahigh-density optical fiber-based nanoarrays.

PubMed

Tam, Jenny M; Song, Linan; Walt, David R

2009-04-15

Nanoarrays for DNA detection were fabricated on etched nanofiber bundles based on recently developed techniques for microscale arrays. Two different-sized nanoarrays were created: one with 700 nm feature sizes and a 1 microm center-to-center pitch (approximately 1x10(6) array elements/mm(2)) and one with 300 nm feature sizes and a 500 nm center-to-center pitch (4.6x10(6) array elements/mm(2)). A random, multiplexed array composed of oligonucleotide-functionalized nanospheres was constructed and used for parallel detection and analysis of fluorescently labeled DNA targets. We have used these arrays to detect a variety of target sequences including Bacillus thuringiensis kurstaki and vaccina virus sequences, two potential biowarfare agents, as well as interleukin-2 sequences, an immune system modulator that has been used for the diagnosis of HIV.

Mitochondrial genome of the moon jelly Aurelia aurita (Cnidaria, Scyphozoa): A linear DNA molecule encoding a putative DNA-dependent DNA polymerase.

PubMed

Shao, Zhiyong; Graf, Shannon; Chaga, Oleg Y; Lavrov, Dennis V

2006-10-15

The 16,937-nuceotide sequence of the linear mitochondrial DNA (mt-DNA) molecule of the moon jelly Aurelia aurita (Cnidaria, Scyphozoa) - the first mtDNA sequence from the class Scypozoa and the first sequence of a linear mtDNA from Metazoa - has been determined. This sequence contains genes for 13 energy pathway proteins, small and large subunit rRNAs, and methionine and tryptophan tRNAs. In addition, two open reading frames of 324 and 969 base pairs in length have been found. The deduced amino-acid sequence of one of them, ORF969, displays extensive sequence similarity with the polymerase [but not the exonuclease] domain of family B DNA polymerases, and this ORF has been tentatively identified as dnab. This is the first report of dnab in animal mtDNA. The genes in A. aurita mtDNA are arranged in two clusters with opposite transcriptional polarities; transcription proceeding toward the ends of the molecule. The determined sequences at the ends of the molecule are nearly identical but inverted and lack any obvious potential secondary structures or telomere-like repeat elements. The acquisition of mitochondrial genomic data for the second class of Cnidaria allows us to reconstruct characteristic features of mitochondrial evolution in this animal phylum.

Extracting DNA words based on the sequence features: non-uniform distribution and integrity.

PubMed

Li, Zhi; Cao, Hongyan; Cui, Yuehua; Zhang, Yanbo

2016-01-25

DNA sequence can be viewed as an unknown language with words as its functional units. Given that most sequence alignment algorithms such as the motif discovery algorithms depend on the quality of background information about sequences, it is necessary to develop an ab initio algorithm for extracting the "words" based only on the DNA sequences. We considered that non-uniform distribution and integrity were two important features of a word, based on which we developed an ab initio algorithm to extract "DNA words" that have potential functional meaning. A Kolmogorov-Smirnov test was used for consistency test of uniform distribution of DNA sequences, and the integrity was judged by the sequence and position alignment. Two random base sequences were adopted as negative control, and an English book was used as positive control to verify our algorithm. We applied our algorithm to the genomes of Saccharomyces cerevisiae and 10 strains of Escherichia coli to show the utility of the methods. The results provide strong evidences that the algorithm is a promising tool for ab initio building a DNA dictionary. Our method provides a fast way for large scale screening of important DNA elements and offers potential insights into the understanding of a genome.

A SHORT SEQUENCE IMMEDIATELY UPSTREAM OF THE INTERNAL REPEAT ELEMENTS IS CRITICAL FOR KSHV LANA MEDIATED DNA REPLICATION AND IMPACTS EPISOME PERSISTENCE

PubMed Central

León Vázquez, Erika De; Juillard, Franceline; Rosner, Bernard; Kaye, Kenneth M.

2013-01-01

Kaposi’s sarcoma-associated herpesvirus LANA (1162 residues) mediates episomal persistence of viral genomes during latency. LANA mediates viral DNA replication and segregates episomes to daughter nuclei. A 59 residue deletion immediately upstream of the internal repeat elements rendered LANA highly deficient for DNA replication and modestly deficient for the ability to segregate episomes, while smaller deletions did not. The 59 amino acid deletion reduced LANA episome persistence by ~14-fold, while sequentially smaller deletions resulted in ~3-fold, or no deficiency. Three distinct LANA regions reorganized heterochromatin, one of which contains the deleted sequence, but the deletion did not abolish LANA’s ability to alter chromatin. Therefore, this work identifies a short internal LANA sequence that is critical for DNA replication, has modest effects on episome segregation, and substantially impacts episome persistence; this region may exert its effects through an interacting host cell protein(s). PMID:24314665

Robust k-mer frequency estimation using gapped k-mers

PubMed Central

Ghandi, Mahmoud; Mohammad-Noori, Morteza

2013-01-01

Oligomers of fixed length, k, commonly known as k-mers, are often used as fundamental elements in the description of DNA sequence features of diverse biological function, or as intermediate elements in the constuction of more complex descriptors of sequence features such as position weight matrices. k-mers are very useful as general sequence features because they constitute a complete and unbiased feature set, and do not require parameterization based on incomplete knowledge of biological mechanisms. However, a fundamental limitation in the use of k-mers as sequence features is that as k is increased, larger spatial correlations in DNA sequence elements can be described, but the frequency of observing any specific k-mer becomes very small, and rapidly approaches a sparse matrix of binary counts. Thus any statistical learning approach using k-mers will be susceptible to noisy estimation of k-mer frequencies once k becomes large. Because all molecular DNA interactions have limited spatial extent, gapped k-mers often carry the relevant biological signal. Here we use gapped k-mer counts to more robustly estimate the ungapped k-mer frequencies, by deriving an equation for the minimum norm estimate of k-mer frequencies given an observed set of gapped k-mer frequencies. We demonstrate that this approach provides a more accurate estimate of the k-mer frequencies in real biological sequences using a sample of CTCF binding sites in the human genome. PMID:23861010

Robust k-mer frequency estimation using gapped k-mers.

PubMed

Ghandi, Mahmoud; Mohammad-Noori, Morteza; Beer, Michael A

2014-08-01

Oligomers of fixed length, k, commonly known as k-mers, are often used as fundamental elements in the description of DNA sequence features of diverse biological function, or as intermediate elements in the constuction of more complex descriptors of sequence features such as position weight matrices. k-mers are very useful as general sequence features because they constitute a complete and unbiased feature set, and do not require parameterization based on incomplete knowledge of biological mechanisms. However, a fundamental limitation in the use of k-mers as sequence features is that as k is increased, larger spatial correlations in DNA sequence elements can be described, but the frequency of observing any specific k-mer becomes very small, and rapidly approaches a sparse matrix of binary counts. Thus any statistical learning approach using k-mers will be susceptible to noisy estimation of k-mer frequencies once k becomes large. Because all molecular DNA interactions have limited spatial extent, gapped k-mers often carry the relevant biological signal. Here we use gapped k-mer counts to more robustly estimate the ungapped k-mer frequencies, by deriving an equation for the minimum norm estimate of k-mer frequencies given an observed set of gapped k-mer frequencies. We demonstrate that this approach provides a more accurate estimate of the k-mer frequencies in real biological sequences using a sample of CTCF binding sites in the human genome.

A DNA sequence element that advances replication origin activation time in Saccharomyces cerevisiae.

PubMed

Pohl, Thomas J; Kolor, Katherine; Fangman, Walton L; Brewer, Bonita J; Raghuraman, M K

2013-11-06

Eukaryotic origins of DNA replication undergo activation at various times in S-phase, allowing the genome to be duplicated in a temporally staggered fashion. In the budding yeast Saccharomyces cerevisiae, the activation times of individual origins are not intrinsic to those origins but are instead governed by surrounding sequences. Currently, there are two examples of DNA sequences that are known to advance origin activation time, centromeres and forkhead transcription factor binding sites. By combining deletion and linker scanning mutational analysis with two-dimensional gel electrophoresis to measure fork direction in the context of a two-origin plasmid, we have identified and characterized a 19- to 23-bp and a larger 584-bp DNA sequence that are capable of advancing origin activation time.

Mycobacterium smegmatis strain for detection of Mycobacterium tuberculosis by PCR used as internal control for inhibition of amplification and for quantification of bacteria.

PubMed Central

Kolk, A H; Noordhoek, G T; de Leeuw, O; Kuijper, S; van Embden, J D

1994-01-01

For the detection of Mycobacterium tuberculosis by PCR, the IS6110 sequence was used. A modified target was constructed by insertion of 56 nucleotides in the IS6110 insertion element of Mycobacterium bovis BCG. This modified insertion sequence was integrated into the genome of Mycobacterium smegmatis, a mycobacterium species which does not contain the IS6110 element. When DNA from the modified M. smegmatis 1008 strain was amplified with IS6110-specific primers INS1 and INS2, a band of 301 bp was seen on agarose gel, whereas the PCR product of M. tuberculosis complex DNA was a 245-bp fragment with these primers. The addition of a small number of M. smegmatis 1008 cells to clinical samples before DNA purification enables the detection of problems which may be due to the loss of DNA in the isolation procedure or to the presence of inhibitors. The presence of inhibitors of the amplification reaction can be confirmed by the addition of M. smegmatis 1008 DNA after the DNA isolation procedure. Furthermore, competition between the different target DNAs of M. smegmatis 1008 DNA and M. tuberculosis complex DNA enables the estimation of the number of IS6110 elements in the clinical sample. Images PMID:8051267

New insights into replication origin characteristics in metazoans

PubMed Central

Puy, Aurore; Rialle, Stéphanie; Kaplan, Noam; Segal, Eran

2012-01-01

We recently reported the identification and characterization of DNA replication origins (Oris) in metazoan cell lines. Here, we describe additional bioinformatic analyses showing that the previously identified GC-rich sequence elements form origin G-rich repeated elements (OGREs) that are present in 67% to 90% of the DNA replication origins from Drosophila to human cells, respectively. Our analyses also show that initiation of DNA synthesis takes place precisely at 160 bp (Drosophila) and 280 bp (mouse) from the OGRE. We also found that in most CpG islands, an OGRE is positioned in opposite orientation on each of the two DNA strands and detected two sites of initiation of DNA synthesis upstream or downstream of each OGRE. Conversely, Oris not associated with CpG islands have a single initiation site. OGRE density along chromosomes correlated with previously published replication timing data. Ori sequences centered on the OGRE are also predicted to have high intrinsic nucleosome occupancy. Finally, OGREs predict G-quadruplex structures at Oris that might be structural elements controlling the choice or activation of replication origins. PMID:22373526

Evolution in the block: common elements of 5S rDNA organization and evolutionary patterns in distant fish genera.

PubMed

Campo, Daniel; García-Vázquez, Eva

2012-01-01

The 5S rDNA is organized in the genome as tandemly repeated copies of a structural unit composed of a coding sequence plus a nontranscribed spacer (NTS). The coding region is highly conserved in the evolution, whereas the NTS vary in both length and sequence. It has been proposed that 5S rRNA genes are members of a gene family that have arisen through concerted evolution. In this study, we describe the molecular organization and evolution of the 5S rDNA in the genera Lepidorhombus and Scophthalmus (Scophthalmidae) and compared it with already known 5S rDNA of the very different genera Merluccius (Merluccidae) and Salmo (Salmoninae), to identify common structural elements or patterns for understanding 5S rDNA evolution in fish. High intra- and interspecific diversity within the 5S rDNA family in all the genera can be explained by a combination of duplications, deletions, and transposition events. Sequence blocks with high similarity in all the 5S rDNA members across species were identified for the four studied genera, with evidences of intense gene conversion within noncoding regions. We propose a model to explain the evolution of the 5S rDNA, in which the evolutionary units are blocks of nucleotides rather than the entire sequences or single nucleotides. This model implies a "two-speed" evolution: slow within blocks (homogenized by recombination) and fast within the gene family (diversified by duplications and deletions).

Use of a Drosophila Genome-Wide Conserved Sequence Database to Identify Functionally Related cis-Regulatory Enhancers

PubMed Central

Brody, Thomas; Yavatkar, Amarendra S; Kuzin, Alexander; Kundu, Mukta; Tyson, Leonard J; Ross, Jermaine; Lin, Tzu-Yang; Lee, Chi-Hon; Awasaki, Takeshi; Lee, Tzumin; Odenwald, Ward F

2012-01-01

Background: Phylogenetic footprinting has revealed that cis-regulatory enhancers consist of conserved DNA sequence clusters (CSCs). Currently, there is no systematic approach for enhancer discovery and analysis that takes full-advantage of the sequence information within enhancer CSCs. Results: We have generated a Drosophila genome-wide database of conserved DNA consisting of >100,000 CSCs derived from EvoPrints spanning over 90% of the genome. cis-Decoder database search and alignment algorithms enable the discovery of functionally related enhancers. The program first identifies conserved repeat elements within an input enhancer and then searches the database for CSCs that score highly against the input CSC. Scoring is based on shared repeats as well as uniquely shared matches, and includes measures of the balance of shared elements, a diagnostic that has proven to be useful in predicting cis-regulatory function. To demonstrate the utility of these tools, a temporally-restricted CNS neuroblast enhancer was used to identify other functionally related enhancers and analyze their structural organization. Conclusions: cis-Decoder reveals that co-regulating enhancers consist of combinations of overlapping shared sequence elements, providing insights into the mode of integration of multiple regulating transcription factors. The database and accompanying algorithms should prove useful in the discovery and analysis of enhancers involved in any developmental process. Developmental Dynamics 241:169–189, 2012. © 2011 Wiley Periodicals, Inc. Key findings A genome-wide catalog of Drosophila conserved DNA sequence clusters. cis-Decoder discovers functionally related enhancers. Functionally related enhancers share balanced sequence element copy numbers. Many enhancers function during multiple phases of development. PMID:22174086

Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

DOE Office of Scientific and Technical Information (OSTI.GOV)

Santini, Simona; Boore, Jeffrey L.; Meyer, Axel

2003-12-31

Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involvedmore » in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.« less

Accurate Prediction of Inducible Transcription Factor Binding Intensities In Vivo

PubMed Central

Siepel, Adam; Lis, John T.

2012-01-01

DNA sequence and local chromatin landscape act jointly to determine transcription factor (TF) binding intensity profiles. To disentangle these influences, we developed an experimental approach, called protein/DNA binding followed by high-throughput sequencing (PB–seq), that allows the binding energy landscape to be characterized genome-wide in the absence of chromatin. We applied our methods to the Drosophila Heat Shock Factor (HSF), which inducibly binds a target DNA sequence element (HSE) following heat shock stress. PB–seq involves incubating sheared naked genomic DNA with recombinant HSF, partitioning the HSF–bound and HSF–free DNA, and then detecting HSF–bound DNA by high-throughput sequencing. We compared PB–seq binding profiles with ones observed in vivo by ChIP–seq and developed statistical models to predict the observed departures from idealized binding patterns based on covariates describing the local chromatin environment. We found that DNase I hypersensitivity and tetra-acetylation of H4 were the most influential covariates in predicting changes in HSF binding affinity. We also investigated the extent to which DNA accessibility, as measured by digital DNase I footprinting data, could be predicted from MNase–seq data and the ChIP–chip profiles for many histone modifications and TFs, and found GAGA element associated factor (GAF), tetra-acetylation of H4, and H4K16 acetylation to be the most predictive covariates. Lastly, we generated an unbiased model of HSF binding sequences, which revealed distinct biophysical properties of the HSF/HSE interaction and a previously unrecognized substructure within the HSE. These findings provide new insights into the interplay between the genomic sequence and the chromatin landscape in determining transcription factor binding intensity. PMID:22479205

[Structural organization of 5S ribosomal DNA of Rosa rugosa].

PubMed

Tynkevych, Iu O; Volkov, R A

2014-01-01

In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.

Organization and evolution of highly repeated satellite DNA sequences in plant chromosomes.

PubMed

Sharma, S; Raina, S N

2005-01-01

A major component of the plant nuclear genome is constituted by different classes of repetitive DNA sequences. The structural, functional and evolutionary aspects of the satellite repetitive DNA families, and their organization in the chromosomes is reviewed. The tandem satellite DNA sequences exhibit characteristic chromosomal locations, usually at subtelomeric and centromeric regions. The repetitive DNA family(ies) may be widely distributed in a taxonomic family or a genus, or may be specific for a species, genome or even a chromosome. They may acquire large-scale variations in their sequence and copy number over an evolutionary time-scale. These features have formed the basis of extensive utilization of repetitive sequences for taxonomic and phylogenetic studies. Hybrid polyploids have especially proven to be excellent models for studying the evolution of repetitive DNA sequences. Recent studies explicitly show that some repetitive DNA families localized at the telomeres and centromeres have acquired important structural and functional significance. The repetitive elements are under different evolutionary constraints as compared to the genes. Satellite DNA families are thought to arise de novo as a consequence of molecular mechanisms such as unequal crossing over, rolling circle amplification, replication slippage and mutation that constitute "molecular drive". Copyright 2005 S. Karger AG, Basel.

Noncoding sequence classification based on wavelet transform analysis: part I

NASA Astrophysics Data System (ADS)

Paredes, O.; Strojnik, M.; Romo-Vázquez, R.; Vélez Pérez, H.; Ranta, R.; Garcia-Torales, G.; Scholl, M. K.; Morales, J. A.

2017-09-01

DNA sequences in human genome can be divided into the coding and noncoding ones. Coding sequences are those that are read during the transcription. The identification of coding sequences has been widely reported in literature due to its much-studied periodicity. Noncoding sequences represent the majority of the human genome. They play an important role in gene regulation and differentiation among the cells. However, noncoding sequences do not exhibit periodicities that correlate to their functions. The ENCODE (Encyclopedia of DNA elements) and Epigenomic Roadmap Project projects have cataloged the human noncoding sequences into specific functions. We study characteristics of noncoding sequences with wavelet analysis of genomic signals.

Interaction of the alpha-subunit of Escherichia coli RNA polymerase with DNA: rigid body nature of the protein-DNA contact.

PubMed

Heyduk, E; Baichoo, N; Heyduk, T

2001-11-30

The alpha-subunit of Escherichia coli RNA polymerase plays an important role in the activity of many promoters by providing a direct protein-DNA contact with a specific sequence (UP element) located upstream of the core promoter sequence. To obtain insight into the nature of thermodynamic forces involved in the formation of this protein-DNA contact, the binding of the alpha-subunit of E. coli RNA polymerase to a fluorochrome-labeled DNA fragment containing the rrnB P1 promoter UP element sequence was quantitatively studied using fluorescence polarization. The alpha dimer and DNA formed a 1:1 complex in solution. Complex formation at 25 degrees C was enthalpy-driven, the binding was accompanied by a net release of 1-2 ions, and no significant specific ion effects were observed. The van't Hoff plot of temperature dependence of binding was linear suggesting that the heat capacity change (Deltac(p)) was close to zero. Protein footprinting with hydroxyradicals showed that the protein did not change its conformation upon protein-DNA contact formation. No conformational changes in the DNA molecule were detected by CD spectroscopy upon protein-DNA complex formation. The thermodynamic characteristics of the binding together with the lack of significant conformational changes in the protein and in the DNA suggested that the alpha-subunit formed a rigid body-like contact with the DNA in which a tight complementary recognition interface between alpha-subunit and DNA was not formed.

Concerted formation of macromolecular Suppressor–mutator transposition complexes

PubMed Central

Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina

1998-01-01

Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711

Transposable elements and G-quadruplexes.

PubMed

Kejnovsky, Eduard; Tokan, Viktor; Lexa, Matej

2015-09-01

A significant part of eukaryotic genomes is formed by transposable elements (TEs) containing not only genes but also regulatory sequences. Some of the regulatory sequences located within TEs can form secondary structures like hairpins or three-stranded (triplex DNA) and four-stranded (quadruplex DNA) conformations. This review focuses on recent evidence showing that G-quadruplex-forming sequences in particular are often present in specific parts of TEs in plants and humans. We discuss the potential role of these structures in the TE life cycle as well as the impact of G-quadruplexes on replication, transcription, translation, chromatin status, and recombination. The aim of this review is to emphasize that TEs may serve as vehicles for the genomic spread of G-quadruplexes. These non-canonical DNA structures and their conformational switches may constitute another regulatory system that, together with small and long non-coding RNA molecules and proteins, contribute to the complex cellular network resulting in the large diversity of eukaryotes.

Regulatory link between DNA methylation and active demethylation in Arabidopsis

PubMed Central

Lei, Mingguang; Zhang, Huiming; Julian, Russell; Tang, Kai; Xie, Shaojun; Zhu, Jian-Kang

2015-01-01

De novo DNA methylation through the RNA-directed DNA methylation (RdDM) pathway and active DNA demethylation play important roles in controlling genome-wide DNA methylation patterns in plants. Little is known about how cells manage the balance between DNA methylation and active demethylation activities. Here, we report the identification of a unique RdDM target sequence, where DNA methylation is required for maintaining proper active DNA demethylation of the Arabidopsis genome. In a genetic screen for cellular antisilencing factors, we isolated several REPRESSOR OF SILENCING 1 (ros1) mutant alleles, as well as many RdDM mutants, which showed drastically reduced ROS1 gene expression and, consequently, transcriptional silencing of two reporter genes. A helitron transposon element (TE) in the ROS1 gene promoter negatively controls ROS1 expression, whereas DNA methylation of an RdDM target sequence between ROS1 5′ UTR and the promoter TE region antagonizes this helitron TE in regulating ROS1 expression. This RdDM target sequence is also targeted by ROS1, and defective DNA demethylation in loss-of-function ros1 mutant alleles causes DNA hypermethylation of this sequence and concomitantly causes increased ROS1 expression. Our results suggest that this sequence in the ROS1 promoter region serves as a DNA methylation monitoring sequence (MEMS) that senses DNA methylation and active DNA demethylation activities. Therefore, the ROS1 promoter functions like a thermostat (i.e., methylstat) to sense DNA methylation levels and regulates DNA methylation by controlling ROS1 expression. PMID:25733903

Heterochromatin and molecular characterization of DsmarMITE transposable element in the beetle Dichotomius schiffleri (Coleoptera: Scarabaeidae).

PubMed

Xavier, Crislaine; Cabral-de-Mello, Diogo Cavalcanti; de Moura, Rita Cássia

2014-12-01

Cytogenetic studies of the Neotropical beetle genus Dichotomius (Scarabaeinae, Coleoptera) have shown dynamism for centromeric constitutive heterochromatin sequences. In the present work we studied the chromosomes and isolated repetitive sequences of Dichotomius schiffleri aiming to contribute to the understanding of coleopteran genome/chromosomal organization. Dichotomius schiffleri presented a conserved karyotype and heterochromatin distribution in comparison to other species of the genus with 2n = 18, biarmed chromosomes, and pericentromeric C-positive blocks. Similarly to heterochromatin distributional patterns, the highly and moderately repetitive DNA fraction (C 0 t-1 DNA) was detected in pericentromeric areas, contrasting with the euchromatic mapping of an isolated TE (named DsmarMITE). After structural analyses, the DsmarMITE was classified as a non-autonomous element of the type miniature inverted-repeat transposable element (MITE) with terminal inverted repeats similar to Mariner elements of insects from different orders. The euchromatic distribution for DsmarMITE indicates that it does not play a part in the dynamics of constitutive heterochromatin sequences.

Transposon facilitated DNA sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berg, D.E.; Berg, C.M.; Huang, H.V.

1990-01-01

The purpose of this research is to investigate and develop methods that exploit the power of bacterial transposable elements for large scale DNA sequencing: Our premise is that the use of transposons to put primer binding sites randomly in target DNAs should provide access to all portions of large DNA fragments, without the inefficiencies of methods involving random subcloning and attendant repetitive sequencing, or of sequential synthesis of many oligonucleotide primers that are used to match systematically along a DNA molecule. Two unrelated bacterial transposons, Tn5 and {gamma}{delta}, are being used because they have both proven useful for molecular analyses,more » and because they differ sufficiently in mechanism and specificity of transposition to merit parallel development.« less

An ancient trans-kingdom horizontal transfer of Penelope -like retroelements from arthropods to conifers

Treesearch

Xuan Lin; Nurul Faridi; Claudio Casola

2016-01-01

Comparative genomics analyses empowered by the wealth of sequenced genomes have revealed numerous instances of horizontal DNA transfers between distantly related species. In  eukaryotes, repetitive DNA sequences known as transposable elements (TEs) are especially prone to  move across species boundaries. Such horizontal transposon transfers, or HTTs, are relatively  ...

A DNA Sequence Element That Advances Replication Origin Activation Time in Saccharomyces cerevisiae

PubMed Central

Pohl, Thomas J.; Kolor, Katherine; Fangman, Walton L.; Brewer, Bonita J.; Raghuraman, M. K.

2013-01-01

Eukaryotic origins of DNA replication undergo activation at various times in S-phase, allowing the genome to be duplicated in a temporally staggered fashion. In the budding yeast Saccharomyces cerevisiae, the activation times of individual origins are not intrinsic to those origins but are instead governed by surrounding sequences. Currently, there are two examples of DNA sequences that are known to advance origin activation time, centromeres and forkhead transcription factor binding sites. By combining deletion and linker scanning mutational analysis with two-dimensional gel electrophoresis to measure fork direction in the context of a two-origin plasmid, we have identified and characterized a 19- to 23-bp and a larger 584-bp DNA sequence that are capable of advancing origin activation time. PMID:24022751

Evolutionary genomics of miniature inverted-repeat transposable elements (MITEs) in Brassica.

PubMed

Nouroz, Faisal; Noreen, Shumaila; Heslop-Harrison, J S

2015-12-01

Miniature inverted-repeat transposable elements (MITEs) are truncated derivatives of autonomous DNA transposons, and are dispersed abundantly in most eukaryotic genomes. We aimed to characterize various MITEs families in Brassica in terms of their presence, sequence characteristics and evolutionary activity. Dot plot analyses involving comparison of homoeologous bacterial artificial chromosome (BAC) sequences allowed identification of 15 novel families of mobile MITEs. Of which, 5 were Stowaway-like with TA Target Site Duplications (TSDs), 4 Tourist-like with TAA/TTA TSDs, 5 Mutator-like with 9-10 bp TSDs and 1 novel MITE (BoXMITE1) flanked by 3 bp TSDs. Our data suggested that there are about 30,000 MITE-related sequences in Brassica rapa and B. oleracea genomes. In situ hybridization showed one abundant family was dispersed in the A-genome, while another was located near 45S rDNA sites. PCR analysis using primers flanking sequences of MITE elements detected MITE insertion polymorphisms between and within the three Brassica (AA, BB, CC) genomes, with many insertions being specific to single genomes and others showing evidence of more recent evolutionary insertions. Our BAC sequence comparison strategy enables identification of evolutionarily active MITEs with no prior knowledge of MITE sequences. The details of MITE families reported in Brassica enable their identification, characterization and annotation. Insertion polymorphisms of MITEs and their transposition activity indicated important mechanism of genome evolution and diversification. MITE families derived from known Mariner, Harbinger and Mutator DNA transposons were discovered, as well as some novel structures. The identification of Brassica MITEs will have broad applications in Brassica genomics, breeding, hybridization and phylogeny through their use as DNA markers.

Amplification of a specific repetitive DNA sequence for Trypanosoma rangeli identification and its potential application in epidemiological investigations.

PubMed

Vargas, N; Souto, R P; Carranza, J C; Vallejo, G A; Zingales, B

2000-11-01

Trypanosoma rangeli can infect humans as well as the same domestic and wild animals and triatomine vectors infected by Trypanosoma cruzi in Central and South America. This overlapping distribution complicates the epidemiology of American trypanosomiasis due to the cross-reactivity between T. rangeli and T. cruzi antigens and the presence of conserved DNA sequences in these parasites. We have isolated a T. rangeli-specific DNA repetitive element which is represented in approximately 103 copies per parasite genome and is distributed in several chromosomal bands. The 542-bp nucleotide sequence of this element, named P542, was determined and a PCR assay was standardized for its amplification. The sensitivity of the assay is high, allowing the detection of one tenth of the DNA content of a single parasite. The presence of the P542 element was confirmed in 11 T. rangeli isolates from mammalian hosts and insect vectors originating from several countries in Latin America. Negative amplification was observed with different T. cruzi strains and other trypanosomatids. The potential field application of the P542 PCR assay was investigated in simulated samples containing T. rangeli and/or T. cruzi and intestinal tract and feces of Rhodnius prolixus. Epidemiological studies were conducted in DNA preparations obtained from the digestive tracts of 12 Rhodnius colombiensis insects collected in a sylvatic area in Colombia. Positive amplification of the P542 element was obtained in 9/12 insects. We have also compared in the same samples the diagnostic performance of two PCR assays for the amplification of the variable domain of minicircle kinetoplast DNA (kDNA) and of the large subunit (LSU) of the ribosomal RNA gene of T. cruzi and T. rangeli. Data indicate that the kDNA PCR assay does not allow diagnosis of mixed infections in most insects. On the other hand, the PCR assay of the LSU RNA gene showed lower sensitivity in the detection of T. rangeli than the PCR assay of the P542 element. It is predicted that the use of sensitive detection techniques will indicate that the actual distribution of T. rangeli in America is wider than presumed. Copyright 2000 Academic Press.

Chromosome ends: different sequences may provide conserved functions.

PubMed

Louis, Edward J; Vershinin, Alexander V

2005-07-01

The structures of specific chromosome regions, centromeres and telomeres, present a number of puzzles. As functions performed by these regions are ubiquitous and essential, their DNA, proteins and chromatin structure are expected to be conserved. Recent studies of centromeric DNA from human, Drosophila and plant species have demonstrated that a hidden universal centromere-specific sequence is highly unlikely. The DNA of telomeres is more conserved consisting of a tandemly repeated 6-8 bp Arabidopsis-like sequence in a majority of organisms as diverse as protozoan, fungi, mammals and plants. However, there are alternatives to short DNA repeats at the ends of chromosomes and for telomere elongation by telomerase. Here we focus on the similarities and diversity that exist among the structural elements, DNA sequences and proteins, that make up terminal domains (telomeres and subtelomeres), and how organisms use these in different ways to fulfil the functions of end-replication and end-protection. Copyright (c) 2005 Wiley Periodicals, Inc.

Identification of Genetic Elements Associated with EPSPS Gene Amplification

PubMed Central

Gaines, Todd A.; Wright, Alice A.; Molin, William T.; Lorentz, Lothar; Riggins, Chance W.; Tranel, Patrick J.; Beffa, Roland; Westra, Philip; Powles, Stephen B.

2013-01-01

Weed populations can have high genetic plasticity and rapid responses to environmental selection pressures. For example, 100-fold amplification of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene evolved in the weed species Amaranthus palmeri to confer resistance to glyphosate, the world’s most important herbicide. However, the gene amplification mechanism is unknown. We sequenced the EPSPS gene and genomic regions flanking EPSPS loci in A. palmeri, and searched for mobile genetic elements or repetitive sequences. The EPSPS gene was 10,229 bp, containing 8 exons and 7 introns. The gene amplification likely proceeded through a DNA-mediated mechanism, as introns exist in the amplified gene copies and the entire amplified sequence is at least 30 kb in length. Our data support the presence of two EPSPS loci in susceptible (S) A. palmeri, and that only one of these was amplified in glyphosate-resistant (R) A. palmeri. The EPSPS gene amplification event likely occurred recently, as no sequence polymorphisms were found within introns of amplified EPSPS copies from R individuals. Sequences with homology to miniature inverted-repeat transposable elements (MITEs) were identified next to EPSPS gene copies only in R individuals. Additionally, a putative Activator (Ac) transposase and a repetitive sequence region were associated with amplified EPSPS genes. The mechanism controlling this DNA-mediated amplification remains unknown. Further investigation is necessary to determine if the gene amplification may have proceeded via DNA transposon-mediated replication, and/or unequal recombination between different genomic regions resulting in replication of the EPSPS gene. PMID:23762434

Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharomyces cerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buchman, A.R.; Kimmerly, W.J.; Rine, J.

1988-01-01

Two DNA-binding factors from Saccharomyces cerevisiae have been characterized, GRFI (general regulatory factor I) and ABFI (ARS-binding factor I), that recognize specific sequences within diverse genetic elements. GRFI bound to sequences at the negative regulatory elements (silencers) of the silent mating type loci HML E and HMR E and to the upstream activating sequence (UAS) required for transcription of the MAT ..cap alpha.. genes. A putative conserved UAS located at genes involved in translation (RPG box) was also recognized by GRFI. In addition, GRFI bound with high affinity to sequences within the (C/sub 1-3/A)-repeat region at yeast telomeres. Binding sitesmore » for GRFI with the highest affinity appeared to be of the form 5'-(A/G)(A/C)ACCCAN NCA(T/C)(T/C)-3', where N is any nucleotide. ABFI-binding sites were located next to autonomously replicating sequences (ARSs) at controlling elements of the silent mating type loci HMR E, HMR I, and HML I and were associated with ARS1, ARS2, and the 2..mu..m plasmid ARS. Two tandem ABFI binding sites were found between the HIS3 and DED1 genes, several kilobase pairs from any ARS, indicating that ABFI-binding sites are not restricted to ARSs. The sequences recognized by AFBI showed partial dyad-symmetry and appeared to be variations of the consensus 5'-TATCATTNNNNACGA-3'. GRFI and ABFI were both abundant DNA-binding factors and did not appear to be encoded by the SIR genes, whose product are required for repression of the silent mating type loci. Together, these results indicate that both GRFI and ABFI play multiple roles within the cell.« less

qPMS9: An Efficient Algorithm for Quorum Planted Motif Search

NASA Astrophysics Data System (ADS)

Nicolae, Marius; Rajasekaran, Sanguthevar

2015-01-01

Discovering patterns in biological sequences is a crucial problem. For example, the identification of patterns in DNA sequences has resulted in the determination of open reading frames, identification of gene promoter elements, intron/exon splicing sites, and SH RNAs, location of RNA degradation signals, identification of alternative splicing sites, etc. In protein sequences, patterns have led to domain identification, location of protease cleavage sites, identification of signal peptides, protein interactions, determination of protein degradation elements, identification of protein trafficking elements, discovery of short functional motifs, etc. In this paper we focus on the identification of an important class of patterns, namely, motifs. We study the (l, d) motif search problem or Planted Motif Search (PMS). PMS receives as input n strings and two integers l and d. It returns all sequences M of length l that occur in each input string, where each occurrence differs from M in at most d positions. Another formulation is quorum PMS (qPMS), where the motif appears in at least q% of the strings. We introduce qPMS9, a parallel exact qPMS algorithm that offers significant runtime improvements on DNA and protein datasets. qPMS9 solves the challenging DNA (l, d)-instances (28, 12) and (30, 13). The source code is available at https://code.google.com/p/qpms9/.

Sequence variation between 462 human individuals fine-tunes functional sites of RNA processing

NASA Astrophysics Data System (ADS)

Ferreira, Pedro G.; Oti, Martin; Barann, Matthias; Wieland, Thomas; Ezquina, Suzana; Friedländer, Marc R.; Rivas, Manuel A.; Esteve-Codina, Anna; Estivill, Xavier; Guigó, Roderic; Dermitzakis, Emmanouil; Antonarakis, Stylianos; Meitinger, Thomas; Strom, Tim M.; Palotie, Aarno; François Deleuze, Jean; Sudbrak, Ralf; Lerach, Hans; Gut, Ivo; Syvänen, Ann-Christine; Gyllensten, Ulf; Schreiber, Stefan; Rosenstiel, Philip; Brunner, Han; Veltman, Joris; Hoen, Peter A. C. T.; Jan van Ommen, Gert; Carracedo, Angel; Brazma, Alvis; Flicek, Paul; Cambon-Thomsen, Anne; Mangion, Jonathan; Bentley, David; Hamosh, Ada; Rosenstiel, Philip; Strom, Tim M.; Lappalainen, Tuuli; Guigó, Roderic; Sammeth, Michael

2016-09-01

Recent advances in the cost-efficiency of sequencing technologies enabled the combined DNA- and RNA-sequencing of human individuals at the population-scale, making genome-wide investigations of the inter-individual genetic impact on gene expression viable. Employing mRNA-sequencing data from the Geuvadis Project and genome sequencing data from the 1000 Genomes Project we show that the computational analysis of DNA sequences around splice sites and poly-A signals is able to explain several observations in the phenotype data. In contrast to widespread assessments of statistically significant associations between DNA polymorphisms and quantitative traits, we developed a computational tool to pinpoint the molecular mechanisms by which genetic markers drive variation in RNA-processing, cataloguing and classifying alleles that change the affinity of core RNA elements to their recognizing factors. The in silico models we employ further suggest RNA editing can moonlight as a splicing-modulator, albeit less frequently than genomic sequence diversity. Beyond existing annotations, we demonstrate that the ultra-high resolution of RNA-Seq combined from 462 individuals also provides evidence for thousands of bona fide novel elements of RNA processing—alternative splice sites, introns, and cleavage sites—which are often rare and lowly expressed but in other characteristics similar to their annotated counterparts.

Transcription factor trapping by RNA in gene regulatory elements.

PubMed

Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A

2015-11-20

Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs. Copyright © 2015, American Association for the Advancement of Science.

Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using

DOEpatents

Weier, H.U.G.; Gray, J.W.

1995-06-27

A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers and probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity. 18 figs.

Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using

DOEpatents

Weier, Heinz-Ulrich G.; Gray, Joe W.

1995-01-01

A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers ard probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity.

Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements

PubMed Central

Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R

2006-01-01

As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome, we expect our report eventually to shed light on the evolution of the hymenopteran genome within higher insects, particularly regarding the relative maintenance of conserved rDNA genes, related variable spacer regions and retrotransposable elements. PMID:17069639

Genomic Heat Shock Element Sequences Drive Cooperative Human Heat Shock Factor 1 DNA Binding and Selectivity*

PubMed Central

Jaeger, Alex M.; Makley, Leah N.; Gestwicki, Jason E.; Thiele, Dennis J.

2014-01-01

The heat shock transcription factor 1 (HSF1) activates expression of a variety of genes involved in cell survival, including protein chaperones, the protein degradation machinery, anti-apoptotic proteins, and transcription factors. Although HSF1 activation has been linked to amelioration of neurodegenerative disease, cancer cells exhibit a dependence on HSF1 for survival. Indeed, HSF1 drives a program of gene expression in cancer cells that is distinct from that activated in response to proteotoxic stress, and HSF1 DNA binding activity is elevated in cycling cells as compared with arrested cells. Active HSF1 homotrimerizes and binds to a DNA sequence consisting of inverted repeats of the pentameric sequence nGAAn, known as heat shock elements (HSEs). Recent comprehensive ChIP-seq experiments demonstrated that the architecture of HSEs is very diverse in the human genome, with deviations from the consensus sequence in the spacing, orientation, and extent of HSE repeats that could influence HSF1 DNA binding efficacy and the kinetics and magnitude of target gene expression. To understand the mechanisms that dictate binding specificity, HSF1 was purified as either a monomer or trimer and used to evaluate DNA-binding site preferences in vitro using fluorescence polarization and thermal denaturation profiling. These results were compared with quantitative chromatin immunoprecipitation assays in vivo. We demonstrate a role for specific orientations of extended HSE sequences in driving preferential HSF1 DNA binding to target loci in vivo. These studies provide a biochemical basis for understanding differential HSF1 target gene recognition and transcription in neurodegenerative disease and in cancer. PMID:25204655

Sequence-dependent modelling of local DNA bending phenomena: curvature prediction and vibrational analysis.

PubMed

Vlahovicek, K; Munteanu, M G; Pongor, S

1999-01-01

Bending is a local conformational micropolymorphism of DNA in which the original B-DNA structure is only distorted but not extensively modified. Bending can be predicted by simple static geometry models as well as by a recently developed elastic model that incorporate sequence dependent anisotropic bendability (SDAB). The SDAB model qualitatively explains phenomena including affinity of protein binding, kinking, as well as sequence-dependent vibrational properties of DNA. The vibrational properties of DNA segments can be studied by finite element analysis of a model subjected to an initial bending moment. The frequency spectrum is obtained by applying Fourier analysis to the displacement values in the time domain. This analysis shows that the spectrum of the bending vibrations quite sensitively depends on the sequence, for example the spectrum of a curved sequence is characteristically different from the spectrum of straight sequence motifs of identical basepair composition. Curvature distributions are genome-specific, and pronounced differences are found between protein-coding and regulatory regions, respectively, that is, sites of extreme curvature and/or bendability are less frequent in protein-coding regions. A WWW server is set up for the prediction of curvature and generation of 3D models from DNA sequences (http:@www.icgeb.trieste.it/dna).

Location analysis for the estrogen receptor-α reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements

PubMed Central

Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.

2010-01-01

Location analysis for estrogen receptor-α (ERα)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERα-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10–20% nucleotide deviation from the canonical ERE sequence. We demonstrate that ∼50% of all ERα-bound loci do not have a discernable ERE and show that most ERα-bound EREs are not perfect consensus EREs. Approximately one-third of all ERα-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERα-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERα binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers. PMID:20047966

Location analysis for the estrogen receptor-alpha reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements.

PubMed

Mason, Christopher E; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M; Kallen, Roland G; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B

2010-04-01

Location analysis for estrogen receptor-alpha (ERalpha)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERalpha-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10-20% nucleotide deviation from the canonical ERE sequence. We demonstrate that approximately 50% of all ERalpha-bound loci do not have a discernable ERE and show that most ERalpha-bound EREs are not perfect consensus EREs. Approximately one-third of all ERalpha-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERalpha-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERalpha binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers.

Mechanisms of radiation-induced gene responses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Woloschak, G.E.; Paunesku, T.

1996-10-01

In the process of identifying genes differentially expressed in cells exposed ultraviolet radiation, we have identified a transcript having a 26-bp region that is highly conserved in a variety of species including Bacillus circulans, yeast, pumpkin, Drosophila, mouse, and man. When the 5` region (flanking region or UTR) of a gene, the sequence is predominantly in +/+ orientation with respect to the coding DNA strand; while in the coding region and the 3` region (UTR), the sequence is most frequently in the +/-orientation with respect to the coding DNA strand. In two genes, the element is split into two parts;more » however, in most cases, it is found only once but with a minimum of 11 consecutive nucleotides precisely depicting the original sequence. The element is found in a large number of different genes with diverse functions (from human ras p21 to B. circulans chitonase). Gel shift assays demonstrated the presence of a protein in HeLa cell extracts that binds to the sense and antisense single-stranded consensus oligomers, as well as to the double- stranded oligonucleotide. When double-stranded oligomer was used, the size shift demonstrated as additional protein-oligomer complex larger than the one bound to either sense or antisense single-stranded consensus oligomers alone. It is speculated either that this element binds to protein(s) important in maintaining DNA is a single-stranded orientation for transcription or, alternatively that this element is important in the transcription-coupled DNA repair process.« less

Dead Element Replicating: Degenerate R2 Element Replication and rDNA Genomic Turnover in the Bacillus rossius Stick Insect (Insecta: Phasmida)

PubMed Central

Martoni, Francesco; Eickbush, Danna G.; Scavariello, Claudia; Luchetti, Andrea; Mantovani, Barbara

2015-01-01

R2 is an extensively investigated non-LTR retrotransposon that specifically inserts into the 28S rRNA gene sequences of a wide range of metazoans, disrupting its functionality. During R2 integration, first strand synthesis can be incomplete so that 5’ end deleted copies are occasionally inserted. While active R2 copies repopulate the locus by retrotransposing, the non-functional truncated elements should frequently be eliminated by molecular drive processes leading to the concerted evolution of the rDNA array(s). Although, multiple R2 lineages have been discovered in the genome of many animals, the rDNA of the stick insect Bacillus rossius exhibits a peculiar situation: it harbors both a canonical, functional R2 element (R2Brfun) as well as a full-length but degenerate element (R2Brdeg). An intensive sequencing survey in the present study reveals that all truncated variants in stick insects are present in multiple copies suggesting they were duplicated by unequal recombination. Sequencing results also demonstrate that all R2Brdeg copies are full-length, i. e. they have no associated 5' end deletions, and functional assays indicate they have lost the active ribozyme necessary for R2 RNA maturation. Although it cannot be completely ruled out, it seems unlikely that the degenerate elements replicate via reverse transcription, exploiting the R2Brfun element enzymatic machinery, but rather via genomic amplification of inserted 28S by unequal recombination. That inactive copies (both R2Brdeg or 5'-truncated elements) are not eliminated in a short term in stick insects contrasts with findings for the Drosophila R2, suggesting a widely different management of rDNA loci and a lower efficiency of the molecular drive while achieving the concerted evolution. PMID:25799008

Transposable elements in fish chromosomes: a study in the marine cobia species.

PubMed

Costa, G W W F; Cioffi, M B; Bertollo, L A C; Molina, W F

2013-01-01

Rachycentron canadum, a unique representative of the Rachycentridae family, has been the subject of considerable biotechnological interest due to its potential use in marine fish farming. This species has undergone extensive research concerning the location of genes and multigene families on its chromosomes. Although most of the genome of some organisms is composed of repeated DNA sequences, aspects of the origin and dispersion of these elements are still largely unknown. The physical mapping of repetitive sequences on the chromosomes of R. canadum proved to be relevant for evolutionary and applied purposes. Therefore, here, we present the mapping by fluorescence in situ hybridization of the transposable element (TE) Tol2, the non-LTR retrotransposons Rex1 and Rex3, together with the 18S and 5S rRNA genes in the chromosome of this species. The Tol2 TE, belonging to the family of hAT transposons, is homogeneously distributed in the euchromatic regions of the chromosomes but with huge colocalization with the 18S rDNA sites. The hybridization signals for Rex1 and Rex3 revealed a semi-arbitrary distribution pattern, presenting differentiated dispersion in euchromatic and heterochromatic regions. Rex1 elements are associated preferentially in heterochromatic regions, while Rex3 shows a scarce distribution in the euchromatic regions of the chromosomes. The colocalization of TEs with 18S and 5S rDNA revealed complex chromosomal regions of repetitive sequences. In addition, the nonpreferential distribution of Rex1 and Rex3 in all heterochromatic regions, as well as the preferential distribution of the Tol2 transposon associated with 18S rDNA sequences, reveals a distinct pattern of organization of TEs in the genome of this species. A heterogeneous chromosomal colonization of TEs may confer different evolutionary rates to the heterochromatic regions of this species.

Repetitive sequences: the hidden diversity of heterochromatin in prochilodontid fish

PubMed Central

Terencio, Maria L.; Schneider, Carlos H.; Gross, Maria C.; do Carmo, Edson Junior; Nogaroto, Viviane; de Almeida, Mara Cristina; Artoni, Roberto Ferreira; Vicari, Marcelo R.; Feldberg, Eliana

2015-01-01

Abstract The structure and organization of repetitive elements in fish genomes are still relatively poorly understood, although most of these elements are believed to be located in heterochromatic regions. Repetitive elements are considered essential in evolutionary processes as hotspots for mutations and chromosomal rearrangements, among other functions – thus providing new genomic alternatives and regulatory sites for gene expression. The present study sought to characterize repetitive DNA sequences in the genomes of Semaprochilodus insignis (Jardine & Schomburgk, 1841) and Semaprochilodus taeniurus (Valenciennes, 1817) and identify regions of conserved syntenic blocks in this genome fraction of three species of Prochilodontidae (Semaprochilodus insignis, Semaprochilodus taeniurus, and Prochilodus lineatus (Valenciennes, 1836) by cross-FISH using Cot-1 DNA (renaturation kinetics) probes. We found that the repetitive fractions of the genomes of Semaprochilodus insignis and Semaprochilodus taeniurus have significant amounts of conserved syntenic blocks in hybridization sites, but with low degrees of similarity between them and the genome of Prochilodus lineatus, especially in relation to B chromosomes. The cloning and sequencing of the repetitive genomic elements of Semaprochilodus insignis and Semaprochilodus taeniurus using Cot-1 DNA identified 48 fragments that displayed high similarity with repetitive sequences deposited in public DNA databases and classified as microsatellites, transposons, and retrotransposons. The repetitive fractions of the Semaprochilodus insignis and Semaprochilodus taeniurus genomes exhibited high degrees of conserved syntenic blocks in terms of both the structures and locations of hybridization sites, but a low degree of similarity with the syntenic blocks of the Prochilodus lineatus genome. Future comparative analyses of other prochilodontidae species will be needed to advance our understanding of the organization and evolution of the genomes in this group of fish. PMID:26752156

Targeted gene insertion for molecular medicine.

PubMed

Voigt, Katrin; Izsvák, Zsuzsanna; Ivics, Zoltán

2008-11-01

Genomic insertion of a functional gene together with suitable transcriptional regulatory elements is often required for long-term therapeutical benefit in gene therapy for several genetic diseases. A variety of integrating vectors for gene delivery exist. Some of them exhibit random genomic integration, whereas others have integration preferences based on attributes of the targeted site, such as primary DNA sequence and physical structure of the DNA, or through tethering to certain DNA sequences by host-encoded cellular factors. Uncontrolled genomic insertion bears the risk of the transgene being silenced due to chromosomal position effects, and can lead to genotoxic effects due to mutagenesis of cellular genes. None of the vector systems currently used in either preclinical experiments or clinical trials displays sufficient preferences for target DNA sequences that would ensure appropriate and reliable expression of the transgene and simultaneously prevent hazardous side effects. We review in this paper the advantages and disadvantages of both viral and non-viral gene delivery technologies, discuss mechanisms of target site selection of integrating genetic elements (viruses and transposons), and suggest distinct molecular strategies for targeted gene delivery.

Primary analysis of repeat elements of the Asian seabass (Lates calcarifer) transcriptome and genome

PubMed Central

Kuznetsova, Inna S.; Thevasagayam, Natascha M.; Sridatta, Prakki S. R.; Komissarov, Aleksey S.; Saju, Jolly M.; Ngoh, Si Y.; Jiang, Junhui; Shen, Xueyan; Orbán, László

2014-01-01

As part of our Asian seabass genome project, we are generating an inventory of repeat elements in the genome and transcriptome. The karyotype showed a diploid number of 2n = 24 chromosomes with a variable number of B-chromosomes. The transcriptome and genome of Asian seabass were searched for repetitive elements with experimental and bioinformatics tools. Six different types of repeats constituting 8–14% of the genome were characterized. Repetitive elements were clustered in the pericentromeric heterochromatin of all chromosomes, but some of them were preferentially accumulated in pretelomeric and pericentromeric regions of several chromosomes pairs and have chromosomes specific arrangement. From the dispersed class of fish-specific non-LTR retrotransposon elements Rex1 and MAUI-like repeats were analyzed. They were wide-spread both in the genome and transcriptome, accumulated on the pericentromeric and peritelomeric areas of all chromosomes. Every analyzed repeat was represented in the Asian seabass transcriptome, some showed differential expression between the gonads. The other group of repeats analyzed belongs to the rRNA multigene family. FISH signal for 5S rDNA was located on a single pair of chromosomes, whereas that for 18S rDNA was found on two pairs. A BAC-derived contig containing rDNA was sequenced and assembled into a scaffold containing incomplete fragments of 18S rDNA. Their assembly and chromosomal position revealed that this part of Asian seabass genome is extremely rich in repeats containing evolutionarily conserved and novel sequences. In summary, transcriptome assemblies and cDNA data are suitable for the identification of repetitive DNA from unknown genomes and for comparative investigation of conserved elements between teleosts and other vertebrates. PMID:25120555

Rat L (long interspersed repeated DNA) elements contain guanine-rich homopurine sequences that induce unpairing of contiguous duplex DNA.

PubMed Central

Usdin, K; Furano, A V

1988-01-01

The L family (long interspersed repeated DNA) of mobile genetic elements is a persistent feature of the mammalian genome. In rats, this family contains approximately equal to 40,000 members and accounts for approximately equal to 10% of the haploid genome. We demonstrate here that the guanine-rich homopurine stretches located at the right end of L-DNA induce oligonucleotide uptake by contiguous duplex DNA. The uptake is dependent on negative supercoiling and the length of the homopurine stretch and occurs even when the L-DNA homopurine stretches are introduced into a different DNA environment. The bound oligomer primes DNA synthesis when DNA polymerase and deoxyribonucleoside triphosphates are added, resulting in a faithful copy of the template to which the oligonucleotide had bound. The implications of this property of the L-DNA guanine-rich homopurine stretches in the amplification, recombination, and dispersal of L elements is discussed. Images PMID:2837766

Current strategies for mobilome research.

PubMed

Jørgensen, Tue S; Kiil, Anne S; Hansen, Martin A; Sørensen, Søren J; Hansen, Lars H

2014-01-01

Mobile genetic elements (MGEs) are pivotal for bacterial evolution and adaptation, allowing shuffling of genes even between distantly related bacterial species. The study of these elements is biologically interesting as the mode of genetic propagation is kaleidoscopic and important, as MGEs are the main vehicles of the increasing bacterial antibiotic resistance that causes thousands of human deaths each year. The study of MGEs has previously focused on plasmids from individual isolates, but the revolution in sequencing technology has allowed the study of mobile genomic elements of entire communities using metagenomic approaches. The problem in using metagenomic sequencing for the study of MGEs is that plasmids and other mobile elements only comprise a small fraction of the total genetic content that are difficult to separate from chromosomal DNA based on sequence alone. The distinction between plasmid and chromosome is important as the mobility and regulation of genes largely depend on their genetic context. Several different approaches have been proposed that specifically enrich plasmid DNA from community samples. Here, we review recent approaches used to study entire plasmid pools from complex environments, and point out possible future developments for and pitfalls of these approaches. Further, we discuss the use of the PacBio long-read sequencing technology for MGE discovery.

DNA transposon activity is associated with increased mutation rates in genes of rice and other grasses

PubMed Central

Wicker, Thomas; Yu, Yeisoo; Haberer, Georg; Mayer, Klaus F. X.; Marri, Pradeep Reddy; Rounsley, Steve; Chen, Mingsheng; Zuccolo, Andrea; Panaud, Olivier; Wing, Rod A.; Roffler, Stefan

2016-01-01

DNA (class 2) transposons are mobile genetic elements which move within their ‘host' genome through excising and re-inserting elsewhere. Although the rice genome contains tens of thousands of such elements, their actual role in evolution is still unclear. Analysing over 650 transposon polymorphisms in the rice species Oryza sativa and Oryza glaberrima, we find that DNA repair following transposon excisions is associated with an increased number of mutations in the sequences neighbouring the transposon. Indeed, the 3,000 bp flanking the excised transposons can contain over 10 times more mutations than the genome-wide average. Since DNA transposons preferably insert near genes, this is correlated with increases in mutation rates in coding sequences and regulatory regions. Most importantly, we find this phenomenon also in maize, wheat and barley. Thus, these findings suggest that DNA transposon activity is a major evolutionary force in grasses which provide the basis of most food consumed by humankind. PMID:27599761

Active Site Sharing and Subterminal Hairpin Recognition in a New Class of DNA Transposases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ronning, Donald R.; Guynet, Catherine; Ton-Hoang, Bao

2010-07-20

Many bacteria harbor simple transposable elements termed insertion sequences (IS). In Helicobacter pylori, the chimeric IS605 family elements are particularly interesting due to their proximity to genes encoding gastric epithelial invasion factors. Protein sequences of IS605 transposases do not bear the hallmarks of other well-characterized transposases. We have solved the crystal structure of full-length transposase (TnpA) of a representative member, ISHp608. Structurally, TnpA does not resemble any characterized transposase; rather, it is related to rolling circle replication (RCR) proteins. Consistent with RCR, Mg{sup 2+} and a conserved tyrosine, Tyr127, are essential for DNA nicking and the formation of a covalentmore » intermediate between TnpA and DNA. TnpA is dimeric, contains two shared active sites, and binds two DNA stem loops representing the conserved inverted repeats near each end of ISHp608. The cocrystal structure with stem-loop DNA illustrates how this family of transposases specifically recognizes and pairs ends, necessary steps during transposition.« less

Lineage-specific genomics: Frequent birth and death in the human genome: The human genome contains many lineage-specific elements created by both sequence and functional turnover.

PubMed

Young, Robert S

2016-07-01

Frequent evolutionary birth and death events have created a large quantity of biologically important, lineage-specific DNA within mammalian genomes. The birth and death of DNA sequences is so frequent that the total number of these insertions and deletions in the human population remains unknown, although there are differences between these groups, e.g. transposable elements contribute predominantly to sequence insertion. Functional turnover - where the activity of a locus is specific to one lineage, but the underlying DNA remains conserved - can also drive birth and death. However, this does not appear to be a major driver of divergent transcriptional regulation. Both sequence and functional turnover have contributed to the birth and death of thousands of functional promoters in the human and mouse genomes. These findings reveal the pervasive nature of evolutionary birth and death and suggest that lineage-specific regions may play an important but previously underappreciated role in human biology and disease. © 2016 The Authors BioEssays Published by WILEY Periodicals, Inc.

Structures of Escherichia coli DNA adenine methyltransferase (Dam) in complex with a non-GATC sequence: Potential implications for methylation-independent transcriptional repression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Horton, John R.; Zhang, Xing; Blumenthal, Robert M.

DNA adenine methyltransferase (Dam) is widespread and conserved among the γ-proteobacteria. Methylation of the Ade in GATC sequences regulates diverse bacterial cell functions, including gene expression, mismatch repair and chromosome replication. Dam also controls virulence in many pathogenic Gram-negative bacteria. An unexplained and perplexing observation about Escherichia coli Dam (EcoDam) is that there is no obvious relationship between the genes that are transcriptionally responsive to Dam and the promoter-proximal presence of GATC sequences. Here, we demonstrate that EcoDam interacts with a 5-base pair non-cognate sequence distinct from GATC. The crystal structure of a non-cognate complex allowed us to identify amore » DNA binding element, GTYTA/TARAC (where Y = C/T and R = A/G). This element immediately flanks GATC sites in some Dam-regulated promoters, including the Pap operon which specifies pyelonephritis-associated pili. In addition, Dam interacts with near-cognate GATC sequences (i.e. 3/4-site ATC and GAT). All together, these results imply that Dam, in addition to being responsible for GATC methylation, could also function as a methylation-independent transcriptional repressor.« less

Structures of Escherichia coli DNA adenine methyltransferase (Dam) in complex with a non-GATC sequence: Potential implications for methylation-independent transcriptional repression

DOE PAGES

Horton, John R.; Zhang, Xing; Blumenthal, Robert M.; ...

2015-04-06

DNA adenine methyltransferase (Dam) is widespread and conserved among the γ-proteobacteria. Methylation of the Ade in GATC sequences regulates diverse bacterial cell functions, including gene expression, mismatch repair and chromosome replication. Dam also controls virulence in many pathogenic Gram-negative bacteria. An unexplained and perplexing observation about Escherichia coli Dam (EcoDam) is that there is no obvious relationship between the genes that are transcriptionally responsive to Dam and the promoter-proximal presence of GATC sequences. Here, we demonstrate that EcoDam interacts with a 5-base pair non-cognate sequence distinct from GATC. The crystal structure of a non-cognate complex allowed us to identify amore » DNA binding element, GTYTA/TARAC (where Y = C/T and R = A/G). This element immediately flanks GATC sites in some Dam-regulated promoters, including the Pap operon which specifies pyelonephritis-associated pili. In addition, Dam interacts with near-cognate GATC sequences (i.e. 3/4-site ATC and GAT). All together, these results imply that Dam, in addition to being responsible for GATC methylation, could also function as a methylation-independent transcriptional repressor.« less

Rapid Mitochondrial Genome Evolution through Invasion of Mobile Elements in Two Closely Related Species of Arbuscular Mycorrhizal Fungi

PubMed Central

Beaudet, Denis; Nadimi, Maryam; Iffis, Bachir; Hijri, Mohamed

2013-01-01

Arbuscular mycorrhizal fungi (AMF) are common and important plant symbionts. They have coenocytic hyphae and form multinucleated spores. The nuclear genome of AMF is polymorphic and its organization is not well understood, which makes the development of reliable molecular markers challenging. In stark contrast, their mitochondrial genome (mtDNA) is homogeneous. To assess the intra- and inter-specific mitochondrial variability in closely related Glomus species, we performed 454 sequencing on total genomic DNA of Glomus sp. isolate DAOM-229456 and we compared its mtDNA with two G. irregulare isolates. We found that the mtDNA of Glomus sp. is homogeneous, identical in gene order and, with respect to the sequences of coding regions, almost identical to G. irregulare. However, certain genomic regions vary substantially, due to insertions/deletions of elements such as introns, mitochondrial plasmid-like DNA polymerase genes and mobile open reading frames. We found no evidence of mitochondrial or cytoplasmic plasmids in Glomus species, and mobile ORFs in Glomus are responsible for the formation of four gene hybrids in atp6, atp9, cox2, and nad3, which are most probably the result of horizontal gene transfer and are expressed at the mRNA level. We found evidence for substantial sequence variation in defined regions of mtDNA, even among closely related isolates with otherwise identical coding gene sequences. This variation makes it possible to design reliable intra- and inter-specific markers. PMID:23637766

Rapid mitochondrial genome evolution through invasion of mobile elements in two closely related species of arbuscular mycorrhizal fungi.

PubMed

Beaudet, Denis; Nadimi, Maryam; Iffis, Bachir; Hijri, Mohamed

2013-01-01

Arbuscular mycorrhizal fungi (AMF) are common and important plant symbionts. They have coenocytic hyphae and form multinucleated spores. The nuclear genome of AMF is polymorphic and its organization is not well understood, which makes the development of reliable molecular markers challenging. In stark contrast, their mitochondrial genome (mtDNA) is homogeneous. To assess the intra- and inter-specific mitochondrial variability in closely related Glomus species, we performed 454 sequencing on total genomic DNA of Glomus sp. isolate DAOM-229456 and we compared its mtDNA with two G. irregulare isolates. We found that the mtDNA of Glomus sp. is homogeneous, identical in gene order and, with respect to the sequences of coding regions, almost identical to G. irregulare. However, certain genomic regions vary substantially, due to insertions/deletions of elements such as introns, mitochondrial plasmid-like DNA polymerase genes and mobile open reading frames. We found no evidence of mitochondrial or cytoplasmic plasmids in Glomus species, and mobile ORFs in Glomus are responsible for the formation of four gene hybrids in atp6, atp9, cox2, and nad3, which are most probably the result of horizontal gene transfer and are expressed at the mRNA level. We found evidence for substantial sequence variation in defined regions of mtDNA, even among closely related isolates with otherwise identical coding gene sequences. This variation makes it possible to design reliable intra- and inter-specific markers.

VEZF1 Elements Mediate Protection from DNA Methylation

PubMed Central

Strogantsev, Ruslan; Gaszner, Miklos; Hair, Alan; Felsenfeld, Gary; West, Adam G.

2010-01-01

There is growing consensus that genome organization and long-range gene regulation involves partitioning of the genome into domains of distinct epigenetic chromatin states. Chromatin insulator or barrier elements are key components of these processes as they can establish boundaries between chromatin states. The ability of elements such as the paradigm β-globin HS4 insulator to block the range of enhancers or the spread of repressive histone modifications is well established. Here we have addressed the hypothesis that a barrier element in vertebrates should be capable of defending a gene from silencing by DNA methylation. Using an established stable reporter gene system, we find that HS4 acts specifically to protect a gene promoter from de novo DNA methylation. Notably, protection from methylation can occur in the absence of histone acetylation or transcription. There is a division of labor at HS4; the sequences that mediate protection from methylation are separable from those that mediate CTCF-dependent enhancer blocking and USF-dependent histone modification recruitment. The zinc finger protein VEZF1 was purified as the factor that specifically interacts with the methylation protection elements. VEZF1 is a candidate CpG island protection factor as the G-rich sequences bound by VEZF1 are frequently found at CpG island promoters. Indeed, we show that VEZF1 elements are sufficient to mediate demethylation and protection of the APRT CpG island promoter from DNA methylation. We propose that many barrier elements in vertebrates will prevent DNA methylation in addition to blocking the propagation of repressive histone modifications, as either process is sufficient to direct the establishment of an epigenetically stable silent chromatin state. PMID:20062523

Inducible in vivo DNA footprints define sequences necessary for UV light activation of the parsley chalcone synthase gene.

PubMed Central

Schulze-Lefert, P; Dangl, J L; Becker-André, M; Hahlbrock, K; Schulz, W

1989-01-01

We began characterization of the protein--DNA interactions necessary for UV light induced transcriptional activation of the gene encoding chalcone synthase (CHS), a key plant defense enzyme. Three light dependent in vivo footprints appear on a 90 bp stretch of the CHS promoter with a time course correlated with the onset of CHS transcription. We define a minimal light responsive promoter by functional analysis of truncated CHS promoter fusions with a reporter gene in transient expression experiments in parsley protoplasts. Two of the three footprinted sequence 'boxes' reside within the minimal promoter. Replacement of 10 bp within either of these 'boxes' leads to complete loss of light responsiveness. We conclude that these sequences define the necessary cis elements of the minimal CHS promoter's light responsive element. One of the functionally defined 'boxes' is homologous to an element implicated in regulation of genes involved in photosynthesis. These data represent the first example in a plant defense gene of an induced change in protein--DNA contacts necessary for transcriptional activation. Also, our data argue strongly that divergent light induced biosynthetic pathways share common regulatory units. Images PMID:2566481

HMG-D is an architecture-specific protein that preferentially binds to DNA containing the dinucleotide TG.

PubMed Central

Churchill, M E; Jones, D N; Glaser, T; Hefner, H; Searles, M A; Travers, A A

1995-01-01

The high mobility group (HMG) protein HMG-D from Drosophila melanogaster is a highly abundant chromosomal protein that is closely related to the vertebrate HMG domain proteins HMG1 and HMG2. In general, chromosomal HMG domain proteins lack sequence specificity. However, using both NMR spectroscopy and standard biochemical techniques we show that binding of HMG-D to a single DNA site is sequence selective. The preferred duplex DNA binding site comprises at least 5 bp and contains the deformable dinucleotide TG embedded in A/T-rich sequences. The TG motif constitutes a common core element in the binding sites of the well-characterized sequence-specific HMG domain proteins. We show that a conserved aromatic residue in helix 1 of the HMG domain may be involved in recognition of this core sequence. In common with other HMG domain proteins HMG-D binds preferentially to DNA sites that are stably bent and underwound, therefore HMG-D can be considered an architecture-specific protein. Finally, we show that HMG-D bends DNA and may confer a superhelical DNA conformation at a natural DNA binding site in the Drosophila fushi tarazu scaffold-associated region. Images PMID:7720717

Characterization of the Fb-Nof Transposable Element of Drosophila Melanogaster

PubMed Central

Harden, N.; Ashburner, M.

1990-01-01

FB-NOF is a composite transposable element of Drosophila melanogaster. It is composed of foldback sequences, of variable length, which flank a 4-kb NOF sequence with 308-bp inverted repeat termini. The NOF sequence could potentially code for a 120-kD polypeptide. The FB-NOF element is responsible for unstable mutations of the white gene (w(c) and w(DZL)) and is associated with the large TEs of G. Ising. Although most strains of D. melanogaster have 20-30 sites of FB insertion, FB-NOF elements are usually rare, many strains lack this composite element or have only one copy of it. A few strains, including w(DZL) and Basc have many (8-21) copies of FB-NOF, and these show a tendency to insert at ``hot-spots.'' These strains also have an increased number of FB elements. The DNA sequence of the NOF region associated with TE146(Z) has been determined. PMID:2174013

Identification and nucleotide sequence analysis of the repetitive DNA element in the genome of fish lymphocystis disease virus.

PubMed

Schnitzler, P; Delius, H; Scholz, J; Touray, M; Orth, E; Darai, G

1987-12-01

The genome of the fish lymphocystis disease virus (FLDV) was screened for the existence of repetitive DNA sequences using a defined and complete gene library of the viral genome (98 kbp) by DNA-DNA hybridization, heteroduplex analysis, and restriction fine mapping. A repetitive DNA sequence was detected at the coordinates 0.034 to 0.057 and 0.718 to 0.736 map units (m.u.) of the FLDV genome. The first region (0.034 to 0.057 m.u.) corresponds to the 5' terminus of the EcoRI FLDV DNA fragment B (0.034 to 0.165 m.u.) and the second region (0.718 to 0.736 m.u.) is identical to the EcoRI DNA fragment M of the viral genome. The DNA nucleotide sequence of the EcoRI FLDV DNA fragment M was determined. This analysis revealed the presence of many short direct and inverted repetitions, e.g., a 18-mer direct repetition (TTTAAAATTTAATTAA) that started at nucleotide positions 812 and 942 and a 14-mer inverted repeat (TTAAATTTAAATTT) at nucleotide positions 820 and 959. Only short open reading frames were detected within this region. The DNA repetitions are discussed as sequences that play a possible regulatory role for virus replication. Furthermore, hybridization experiments revealed that the repetitive DNA sequences are conserved in the genome of different strains of fish lymphocystis disease virus isolated from two species of Pleuronectidae (flounder and dab).

Continuous in vitro evolution of bacteriophage RNA polymerase promoters

NASA Technical Reports Server (NTRS)

Breaker, R. R.; Banerji, A.; Joyce, G. F.

1994-01-01

Rapid in vitro evolution of bacteriophage T7, T3, and SP6 RNA polymerase promoters was achieved by a method that allows continuous enrichment of DNAs that contain functional promoter elements. This method exploits the ability of a special class of nucleic acid molecules to replicate continuously in the presence of both a reverse transcriptase and a DNA-dependent RNA polymerase. Replication involves the synthesis of both RNA and cDNA intermediates. The cDNA strand contains an embedded promoter sequence, which becomes converted to a functional double-stranded promoter element, leading to the production of RNA transcripts. Synthetic cDNAs, including those that contain randomized promoter sequences, can be used to initiate the amplification cycle. However, only those cDNAs that contain functional promoter sequences are able to produce RNA transcripts. Furthermore, each RNA transcript encodes the RNA polymerase promoter sequence that was responsible for initiation of its own transcription. Thus, the population of amplifying molecules quickly becomes enriched for those templates that encode functional promoters. Optimal promoter sequences for phage T7, T3, and SP6 RNA polymerase were identified after a 2-h amplification reaction, initiated in each case with a pool of synthetic cDNAs encoding greater than 10(10) promoter sequence variants.

Genome-wide evidence for local DNA methylation spreading from small RNA-targeted sequences in Arabidopsis.

PubMed

Ahmed, Ikhlak; Sarazin, Alexis; Bowler, Chris; Colot, Vincent; Quesneville, Hadi

2011-09-01

Transposable elements (TEs) and their relics play major roles in genome evolution. However, mobilization of TEs is usually deleterious and strongly repressed. In plants and mammals, this repression is typically associated with DNA methylation, but the relationship between this epigenetic mark and TE sequences has not been investigated systematically. Here, we present an improved annotation of TE sequences and use it to analyze genome-wide DNA methylation maps obtained at single-nucleotide resolution in Arabidopsis. We show that although the majority of TE sequences are methylated, ∼26% are not. Moreover, a significant fraction of TE sequences densely methylated at CG, CHG and CHH sites (where H = A, T or C) have no or few matching small interfering RNA (siRNAs) and are therefore unlikely to be targeted by the RNA-directed DNA methylation (RdDM) machinery. We provide evidence that these TE sequences acquire DNA methylation through spreading from adjacent siRNA-targeted regions. Further, we show that although both methylated and unmethylated TE sequences located in euchromatin tend to be more abundant closer to genes, this trend is least pronounced for methylated, siRNA-targeted TE sequences located 5' to genes. Based on these and other findings, we propose that spreading of DNA methylation through promoter regions explains at least in part the negative impact of siRNA-targeted TE sequences on neighboring gene expression.

Trichomonas vaginalis ribosomal RNA: identification and characterisation of the transcription promoter and terminator sequences.

PubMed

Franco, Bernardo; Hernández, Roberto; López-Villaseñor, Imelda

2012-09-01

Trichomonas vaginalis is a parasitic protozoan of both medical and biological relevance. Transcriptional studies in this organism have focused mainly on type II pol promoters, whereas the elements necessary for transcription by polI or polIII have not been investigated. Here, with the aid of a transient transcription system, we characterised the rDNA intergenic region, defining both the promoter and the terminator sequences required for transcription. We defined the promoter as a compact region of approximately 180 bp. We also identified a potential upstream control element (UCE) that was located 80 bp upstream of the transcription start point (TSP). A transcription termination element was identified within a 34 bp region that was located immediately downstream of the 28S coding sequence. The function of this element depends upon polarity and the presence of both a stretch of uridine residues (U's) and a hairpin structure in the transcript. Our observations provide a strong basis for the study of DNA recognition by the polI transcriptional machinery in this early divergent organism. Copyright © 2012 Elsevier B.V. All rights reserved.

Human T-cell leukemia virus type 1 Tax requires direct access to DNA for recruitment of CREB binding protein to the viral promoter.

PubMed

Lenzmeier, B A; Giebler, H A; Nyborg, J K

1998-02-01

Efficient human T-cell leukemia virus type 1 (HTLV-1) replication and viral gene expression are dependent upon the virally encoded oncoprotein Tax. To activate HTLV-1 transcription, Tax interacts with the cellular DNA binding protein cyclic AMP-responsive element binding protein (CREB) and recruits the coactivator CREB binding protein (CBP), forming a nucleoprotein complex on the three viral cyclic AMP-responsive elements (CREs) in the HTLV-1 promoter. Short stretches of dG-dC-rich (GC-rich) DNA, immediately flanking each of the viral CREs, are essential for Tax recruitment of CBP in vitro and Tax transactivation in vivo. Although the importance of the viral CRE-flanking sequences is well established, several studies have failed to identify an interaction between Tax and the DNA. The mechanistic role of the viral CRE-flanking sequences has therefore remained enigmatic. In this study, we used high resolution methidiumpropyl-EDTA iron(II) footprinting to show that Tax extended the CREB footprint into the GC-rich DNA flanking sequences of the viral CRE. The Tax-CREB footprint was enhanced but not extended by the KIX domain of CBP, suggesting that the coactivator increased the stability of the nucleoprotein complex. Conversely, the footprint pattern of CREB on a cellular CRE lacking GC-rich flanking sequences did not change in the presence of Tax or Tax plus KIX. The minor-groove DNA binding drug chromomycin A3 bound to the GC-rich flanking sequences and inhibited the association of Tax and the Tax-CBP complex without affecting CREB binding. Tax specifically cross-linked to the viral CRE in the 5'-flanking sequence, and this cross-link was blocked by chromomycin A3. Together, these data support a model where Tax interacts directly with both CREB and the minor-groove viral CRE-flanking sequences to form a high-affinity binding site for the recruitment of CBP to the HTLV-1 promoter.

Intercalation of XR5944 with the estrogen response element is modulated by the tri-nucleotide spacer sequence between half-sites

PubMed Central

Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou

2011-01-01

DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738

Mutations on the DNA Binding Surface of TBP Discriminate between Yeast TATA and TATA-Less Gene Transcription

PubMed Central

Kamenova, Ivanka; Warfield, Linda

2014-01-01

Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. PMID:24865972

Mutations on the DNA binding surface of TBP discriminate between yeast TATA and TATA-less gene transcription.

PubMed

Kamenova, Ivanka; Warfield, Linda; Hahn, Steven

2014-08-01

Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Zaba: a novel miniature transposable element present in genomes of legume plants.

PubMed

Macas, J; Neumann, P; Pozárková, D

2003-08-01

A novel family of miniature transposable elements, named Zaba, was identified in pea (Pisum sativum) and subsequently also in other legume species using computer analysis of their DNA sequences. Zaba elements are 141-190 bp long, generate 10-bp target site duplications, and their terminal inverted repeats make up most of the sequence. Zaba elements thus resemble class 3 foldback transposons. The elements are only moderately repetitive in pea (tens to hundreds copies per haploid genome), but they are present in up to thousands of copies in the genomes of several Medicago and Vicia species. More detailed analysis of the elements from pea, including isolation of new sequences from a genomic library, revealed that a fraction of these elements are truncated, and that their last transposition probably did not occur recently. A search for Zaba sequences in EST databases showed that at least some elements are transcribed, most probably due to their association with genic regions.

DNA is structured as a linear "jigsaw puzzle" in the genomes of Arabidopsis, rice, and budding yeast.

PubMed

Liu, Yun-Hua; Zhang, Meiping; Wu, Chengcang; Huang, James J; Zhang, Hong-Bin

2014-01-01

Knowledge of how a genome is structured and organized from its constituent elements is crucial to understanding its biology and evolution. Here, we report the genome structuring and organization pattern as revealed by systems analysis of the sequences of three model species, Arabidopsis, rice and yeast, at the whole-genome and chromosome levels. We found that all fundamental function elements (FFE) constituting the genomes, including genes (GEN), DNA transposable elements (DTE), retrotransposable elements (RTE), simple sequence repeats (SSR), and (or) low complexity repeats (LCR), are structured in a nonrandom and correlative manner, thus leading to a hypothesis that the DNA of the species is structured as a linear "jigsaw puzzle". Furthermore, we showed that different FFE differ in their importance in the formation and evolution of the DNA jigsaw puzzle structure between species. DTE and RTE play more important roles than GEN, LCR, and SSR in Arabidopsis, whereas GEN and RTE play more important roles than LCR, SSR, and DTE in rice. The genes having multiple recognized functions play more important roles than those having single functions. These results provide useful knowledge necessary for better understanding genome biology and evolution of the species and for effective molecular breeding of rice.

Sunflower centromeres consist of a centromere-specific LINE and a chromosome-specific tandem repeat.

PubMed

Nagaki, Kiyotaka; Tanaka, Keisuke; Yamaji, Naoki; Kobayashi, Hisato; Murata, Minoru

2015-01-01

The kinetochore is a protein complex including kinetochore-specific proteins that plays a role in chromatid segregation during mitosis and meiosis. The complex associates with centromeric DNA sequences that are usually species-specific. In plant species, tandem repeats including satellite DNA sequences and retrotransposons have been reported as centromeric DNA sequences. In this study on sunflowers, a cDNA-encoding centromere-specific histone H3 (CENH3) was isolated from a cDNA pool from a seedling, and an antibody was raised against a peptide synthesized from the deduced cDNA. The antibody specifically recognized the sunflower CENH3 (HaCENH3) and showed centromeric signals by immunostaining and immunohistochemical staining analysis. The antibody was also applied in chromatin immunoprecipitation (ChIP)-Seq to isolate centromeric DNA sequences and two different types of repetitive DNA sequences were identified. One was a long interspersed nuclear element (LINE)-like sequence, which showed centromere-specific signals on almost all chromosomes in sunflowers. This is the first report of a centromeric LINE sequence, suggesting possible centromere targeting ability. Another type of identified repetitive DNA was a tandem repeat sequence with a 187-bp unit that was found only on a pair of chromosomes. The HaCENH3 content of the tandem repeats was estimated to be much higher than that of the LINE, which implies centromere evolution from LINE-based centromeres to more stable tandem-repeat-based centromeres. In addition, the epigenetic status of the sunflower centromeres was investigated by immunohistochemical staining and ChIP, and it was found that centromeres were heterochromatic.

High-efficiency transformation of Pichia stipitis based on its URA3 gene and a homologous autonomous replication sequence, ARS2.

PubMed Central

Yang, V W; Marks, J A; Davis, B P; Jeffries, T W

1994-01-01

This paper describes the first high-efficiency transformation system for the xylose-fermenting yeast Pichia stipitis. The system includes integrating and autonomously replicating plasmids based on the gene for orotidine-5'-phosphate decarboxylase (URA3) and an autonomous replicating sequence (ARS) element (ARS2) isolated from P. stipitis CBS 6054. Ura- auxotrophs were obtained by selecting for resistance to 5-fluoroorotic acid and were identified as ura3 mutants by transformation with P. stipitis URA3. P. stipitis URA3 was cloned by its homology to Saccharomyces cerevisiae URA3, with which it is 69% identical in the coding region. P. stipitis ARS elements were cloned functionally through plasmid rescue. These sequences confer autonomous replication when cloned into vectors bearing the P. stipitis URA3 gene. P. stipitis ARS2 has features similar to those of the consensus ARS of S. cerevisiae and other ARS elements. Circular plasmids bearing the P. stipitis URA3 gene with various amounts of flanking sequences produced 600 to 8,600 Ura+ transformants per micrograms of DNA by electroporation. Most transformants obtained with circular vectors arose without integration of vector sequences. One vector yielded 5,200 to 12,500 Ura+ transformants per micrograms of DNA after it was linearized at various restriction enzyme sites within the P. stipitis URA3 insert. Transformants arising from linearized vectors produced stable integrants, and integration events were site specific for the genomic ura3 in 20% of the transformants examined. Plasmids bearing the P. stipitis URA3 gene and ARS2 element produced more than 30,000 transformants per micrograms of plasmid DNA. Autonomously replicating plasmids were stable for at least 50 generations in selection medium and were present at an average of 10 copies per nucleus. Images PMID:7811063

The mitochondrial genome of the gymnosperm Cycas taitungensis contains a novel family of short interspersed elements, Bpu sequences, and abundant RNA editing sites.

PubMed

Chaw, Shu-Miaw; Shih, Arthur Chun-Chieh; Wang, Daryi; Wu, Yu-Wei; Liu, Shu-Mei; Chou, The-Yuan

2008-03-01

The mtDNA of Cycas taitungensis is a circular molecule of 414,903 bp, making it 2- to 6-fold larger than the known mtDNAs of charophytes and bryophytes, but similar to the average of 7 elucidated angiosperm mtDNAs. It is characterized by abundant RNA editing sites (1,084), more than twice the number found in the angiosperm mtDNAs. The A + T content of Cycas mtDNA is 53.1%, the lowest among known land plants. About 5% of the Cycas mtDNA is composed of a novel family of mobile elements, which we designated as "Bpu sequences." They share a consensus sequence of 36 bp with 2 terminal direct repeats (AAGG) and a recognition site for the Bpu 10I restriction endonuclease (CCTGAAGC). Comparison of the Cycas mtDNA with other plant mtDNAs revealed many new insights into the biology and evolution of land plant mtDNAs. For example, the noncoding sequences in mtDNAs have drastically expanded as land plants have evolved, with abrupt increases appearing in the bryophytes, and then in the seed plants. As a result, the genomic organizations of seed plant mtDNAs are much less compact than in other plants. Also, the Cycas mtDNA appears to have been exempted from the frequent gene loss observed in angiosperm mtDNAs. Similar to the angiosperms, the 3 Cycas genes nad1, nad2, and nad5 are disrupted by 5 group II intron squences, which have brought the genes into trans-splicing arrangements. The evolutionary origin and invasion/duplication mechanism of the Bpu sequences in Cycas mtDNA are hypothesized and discussed.

Repetitive DNA in the pea (Pisum sativum L.) genome: comprehensive characterization using 454 sequencing and comparison to soybean and Medicago truncatula

PubMed Central

Macas, Jiří; Neumann, Pavel; Navrátilová, Alice

2007-01-01

Background Extraordinary size variation of higher plant nuclear genomes is in large part caused by differences in accumulation of repetitive DNA. This makes repetitive DNA of great interest for studying the molecular mechanisms shaping architecture and function of complex plant genomes. However, due to methodological constraints of conventional cloning and sequencing, a global description of repeat composition is available for only a very limited number of higher plants. In order to provide further data required for investigating evolutionary patterns of repeated DNA within and between species, we used a novel approach based on massive parallel sequencing which allowed a comprehensive repeat characterization in our model species, garden pea (Pisum sativum). Results Analysis of 33.3 Mb sequence data resulted in quantification and partial sequence reconstruction of major repeat families occurring in the pea genome with at least thousands of copies. Our results showed that the pea genome is dominated by LTR-retrotransposons, estimated at 140,000 copies/1C. Ty3/gypsy elements are less diverse and accumulated to higher copy numbers than Ty1/copia. This is in part due to a large population of Ogre-like retrotransposons which alone make up over 20% of the genome. In addition to numerous types of mobile elements, we have discovered a set of novel satellite repeats and two additional variants of telomeric sequences. Comparative genome analysis revealed that there are only a few repeat sequences conserved between pea and soybean genomes. On the other hand, all major families of pea mobile elements are well represented in M. truncatula. Conclusion We have demonstrated that even in a species with a relatively large genome like pea, where a single 454-sequencing run provided only 0.77% coverage, the generated sequences were sufficient to reconstruct and analyze major repeat families corresponding to a total of 35–48% of the genome. These data provide a starting point for further investigations of legume plant genomes based on their global comparative analysis and for the development of more sophisticated approaches for data mining. PMID:18031571

The 'dark matter' in the plant genomes: non-coding and unannotated DNA sequences associated with open chromatin.

PubMed

Jiang, Jiming

2015-04-01

Sequencing of complete plant genomes has become increasingly more routine since the advent of the next-generation sequencing technology. Identification and annotation of large amounts of noncoding but functional DNA sequences, including cis-regulatory DNA elements (CREs), have become a new frontier in plant genome research. Genomic regions containing active CREs bound to regulatory proteins are hypersensitive to DNase I digestion and are called DNase I hypersensitive sites (DHSs). Several recent DHS studies in plants illustrate that DHS datasets produced by DNase I digestion followed by next-generation sequencing (DNase-seq) are highly valuable for the identification and characterization of CREs associated with plant development and responses to environmental cues. DHS-based genomic profiling has opened a door to identify and annotate the 'dark matter' in sequenced plant genomes. Copyright © 2015 Elsevier Ltd. All rights reserved.

Characterisation of a DNA sequence element that directs Dictyostelium stalk cell-specific gene expression.

PubMed

Ceccarelli, A; Zhukovskaya, N; Kawata, T; Bozzaro, S; Williams, J

2000-12-01

The ecmB gene of Dictyostelium is expressed at culmination both in the prestalk cells that enter the stalk tube and in ancillary stalk cell structures such as the basal disc. Stalk tube-specific expression is regulated by sequence elements within the cap-site proximal part of the promoter, the stalk tube (ST) promoter region. Dd-STATa, a member of the STAT transcription factor family, binds to elements present in the ST promoter-region and represses transcription prior to entry into the stalk tube. We have characterised an activatory DNA sequence element, that lies distal to the repressor elements and that is both necessary and sufficient for expression within the stalk tube. We have mapped this activator to a 28 nucleotide region (the 28-mer) within which we have identified a GA-containing sequence element that is required for efficient gene transcription. The Dd-STATa protein binds to the 28-mer in an in vitro binding assay, and binding is dependent upon the GA-containing sequence. However, the ecmB gene is expressed in a Dd-STATa null mutant, therefore Dd-STATa cannot be responsible for activating the 28-mer in vivo. Instead, we identified a distinct 28-mer binding activity in nuclear extracts from the Dd-STATa null mutant, the activity of this GA binding activity being largely masked in wild type extracts by the high affinity binding of the Dd-STATa protein. We suggest, that in addition to the long range repression exerted by binding to the two known repressor sites, Dd-STATa inhibits transcription by direct competition with this putative activator for binding to the GA sequence.

FA-SAT Is an Old Satellite DNA Frozen in Several Bilateria Genomes

PubMed Central

Chaves, Raquel; Ferreira, Daniela; Mendes-da-Silva, Ana; Meles, Susana; Adega, Filomena

2017-01-01

Abstract In recent years, a growing body of evidence has recognized the tandem repeat sequences, and specifically satellite DNA, as a functional class of sequences in the genomic “dark matter.” Using an original, complementary, and thus an eclectic experimental design, we show that the cat archetypal satellite DNA sequence, FA-SAT, is “frozen” conservatively in several Bilateria genomes. We found different genomic FA-SAT architectures, and the interspersion pattern was conserved. In Carnivora genomes, the FA-SAT-related sequences are also amplified, with the predominance of a specific FA-SAT variant, at the heterochromatic regions. We inspected the cat genome project to locate FA-SAT array flanking regions and revealed an intensive intermingling with transposable elements. Our results also show that FA-SAT-related sequences are transcribed and that the most abundant FA-SAT variant is not always the most transcribed. We thus conclude that the DNA sequences of FA-SAT and their transcripts are “frozen” in these genomes. Future work is needed to disclose any putative function that these sequences may play in these genomes. PMID:29608678

Effects of a Transposable Element Insertion on Alcohol Dehydrogenase Expression in Drosophila Melanogaster

PubMed Central

Dunn, R. C.; Laurie, C. C.

1995-01-01

Variation in the DNA sequence and level of alcohol dehydrogenase (Adh) gene expression in Drosophila melanogaster have been studied to determine what types of DNA polymorphisms contribute to phenotypic variation in natural populations. The Adh gene, like many others, shows a high level of variability in both DNA sequence and quantitative level of expression. A number of transposable element insertions occur in the Adh region and one of these, a copia insertion in the 5' flanking region, is associated with unusually low Adh expression. To determine whether this insertion (called RI42) causes the low expression level, the insertion was excised from the cloned RI42 Adh gene and the effect was assessed by P-element transformation. Removal of this insertion causes a threefold increase in the level of ADH, clearly showing that it contributes to the naturally occurring variation in expression at this locus. Removal of all but one LTR also causes a threefold increase, indicating that the mechanism is not a simple sequence disruption. Furthermore, this copia insertion, which is located between the two Adh promoters and their upstream enhancer sequences, has differential effects on the levels of proximal and distal transcripts. Finally, a test for the possible modifying effects of two suppressor loci, su(w(a)) and su(f), on this insertional mutation was negative, in contrast to a previous report in the literature. PMID:7498745

Unit-length line-1 transcripts in human teratocarcinoma cells.

PubMed Central

Skowronski, J; Fanning, T G; Singer, M F

1988-01-01

We have characterized the approximately 6.5-kilobase cytoplasmic poly(A)+ Line-1 (L1) RNA present in a human teratocarcinoma cell line, NTera2D1, by primer extension and by analysis of cloned cDNAs. The bulk of the RNA begins (5' end) at the residue previously identified as the 5' terminus of the longest known primate genomic L1 elements, presumed to represent "unit" length. Several of the cDNA clones are close to 6 kilobase pairs, that is, close to full length. The partial sequences of 18 cDNA clones and full sequence of one (5,975 base pairs) indicate that many different genomic L1 elements contribute transcripts to the 6.5-kilobase cytoplasmic poly(A)+ RNA in NTera2D1 cells because no 2 of the 19 cDNAs analyzed had identical sequences. The transcribed elements appear to represent a subset of the total genomic L1s, a subset that has a characteristic consensus sequence in the 3' noncoding region and a high degree of sequence conservation throughout. Two open reading frames (ORFs) of 1,122 (ORF1) and 3,852 (ORF2) bases, flanked by about 800 and 200 bases of sequence at the 5' and 3' ends, respectively, can be identified in the cDNAs. Both ORFs are in the same frame, and they are separated by 33 bases bracketed by two conserved in-frame stop codons. ORF 2 is interrupted by at least one randomly positioned stop codon in the majority of the cDNAs. The data support proposals suggesting that the human L1 family includes one or more functional genes as well as an extraordinarily large number of pseudogenes whose ORFs are broken by stop codons. The cDNA structures suggest that both genes and pseudogenes are transcribed. At least one of the cDNAs (cD11), which was sequenced in its entirety, could, in principle, represent an mRNA for production of the ORF1 polypeptide. The similarity of mammalian L1s to several recently described invertebrate movable elements defines a new widely distributed class of elements which we term class II retrotransposons. Images PMID:2454389

High copy number of highly similar mariner-like transposons in planarian (Platyhelminthe): evidence for a trans-phyla horizontal transfer.

PubMed

Garcia-Fernàndez, J; Bayascas-Ramírez, J R; Marfany, G; Muñoz-Mármol, A M; Casali, A; Baguñà, J; Saló, E

1995-05-01

Several DNA sequences similar to the mariner element were isolated and characterized in the platyhelminthe Dugesia (Girardia) tigrina. They were 1,288 bp long, flanked by two 32 bp-inverted repeats, and contained a single 339 amino acid open-reading frame (ORF) encoding the transposase. The number of copies of this element is approximately 8,000 per haploid genome, constituting a member of the middle-repetitive DNA of Dugesia tigrina. Sequence analysis of several elements showed a high percentage of conservation between the different copies. Most of them presented an intact ORF and the standard signals of actively expressed genes, which suggests that some of them are or have recently been functional transposons. The high degree of similarity shared with other mariner elements from some arthropods, together with the fact that this element is undetectable in other planarian species, strongly suggests a case of horizontal transfer between these two distant phyla.

Identification of structural variation in mouse genomes.

PubMed

Keane, Thomas M; Wong, Kim; Adams, David J; Flint, Jonathan; Reymond, Alexandre; Yalcin, Binnaz

2014-01-01

Structural variation is variation in structure of DNA regions affecting DNA sequence length and/or orientation. It generally includes deletions, insertions, copy-number gains, inversions, and transposable elements. Traditionally, the identification of structural variation in genomes has been challenging. However, with the recent advances in high-throughput DNA sequencing and paired-end mapping (PEM) methods, the ability to identify structural variation and their respective association to human diseases has improved considerably. In this review, we describe our current knowledge of structural variation in the mouse, one of the prime model systems for studying human diseases and mammalian biology. We further present the evolutionary implications of structural variation on transposable elements. We conclude with future directions on the study of structural variation in mouse genomes that will increase our understanding of molecular architecture and functional consequences of structural variation.

Rational design of DNA sequences for nanotechnology, microarrays and molecular computers using Eulerian graphs.

PubMed

Pancoska, Petr; Moravek, Zdenek; Moll, Ute M

2004-01-01

Nucleic acids are molecules of choice for both established and emerging nanoscale technologies. These technologies benefit from large functional densities of 'DNA processing elements' that can be readily manufactured. To achieve the desired functionality, polynucleotide sequences are currently designed by a process that involves tedious and laborious filtering of potential candidates against a series of requirements and parameters. Here, we present a complete novel methodology for the rapid rational design of large sets of DNA sequences. This method allows for the direct implementation of very complex and detailed requirements for the generated sequences, thus avoiding 'brute force' filtering. At the same time, these sequences have narrow distributions of melting temperatures. The molecular part of the design process can be done without computer assistance, using an efficient 'human engineering' approach by drawing a single blueprint graph that represents all generated sequences. Moreover, the method eliminates the necessity for extensive thermodynamic calculations. Melting temperature can be calculated only once (or not at all). In addition, the isostability of the sequences is independent of the selection of a particular set of thermodynamic parameters. Applications are presented for DNA sequence designs for microarrays, universal microarray zip sequences and electron transfer experiments.

Alternative DNA structure formation in the mutagenic human c-MYC promoter

PubMed Central

del Mundo, Imee Marie A.; Zewail-Foote, Maha; Kerwin, Sean M.

2017-01-01

Abstract Mutation ‘hotspot’ regions in the genome are susceptible to genetic instability, implicating them in diseases. These hotspots are not random and often co-localize with DNA sequences potentially capable of adopting alternative DNA structures (non-B DNA, e.g. H-DNA and G4-DNA), which have been identified as endogenous sources of genomic instability. There are regions that contain overlapping sequences that may form more than one non-B DNA structure. The extent to which one structure impacts the formation/stability of another, within the sequence, is not fully understood. To address this issue, we investigated the folding preferences of oligonucleotides from a chromosomal breakpoint hotspot in the human c-MYC oncogene containing both potential G4-forming and H-DNA-forming elements. We characterized the structures formed in the presence of G4-DNA-stabilizing K+ ions or H-DNA-stabilizing Mg2+ ions using multiple techniques. We found that under conditions favorable for H-DNA formation, a stable intramolecular triplex DNA structure predominated; whereas, under K+-rich, G4-DNA-forming conditions, a plurality of unfolded and folded species were present. Thus, within a limited region containing sequences with the potential to adopt multiple structures, only one structure predominates under a given condition. The predominance of H-DNA implicates this structure in the instability associated with the human c-MYC oncogene. PMID:28334873

Variation in the genomic locations and sequence conservation of STAR elements among staphylococcal species provides insight into DNA repeat evolution

PubMed Central

2012-01-01

Background Staphylococcus aureus Repeat (STAR) elements are a type of interspersed intergenic direct repeat. In this study the conservation and variation in these elements was explored by bioinformatic analyses of published staphylococcal genome sequences and through sequencing of specific STAR element loci from a large set of S. aureus isolates. Results Using bioinformatic analyses, we found that the STAR elements were located in different genomic loci within each staphylococcal species. There was no correlation between the number of STAR elements in each genome and the evolutionary relatedness of staphylococcal species, however higher levels of repeats were observed in both S. aureus and S. lugdunensis compared to other staphylococcal species. Unexpectedly, sequencing of the internal spacer sequences of individual repeat elements from multiple isolates showed conservation at the sequence level within deep evolutionary lineages of S. aureus. Whilst individual STAR element loci were demonstrated to expand and contract, the sequences associated with each locus were stable and distinct from one another. Conclusions The high degree of lineage and locus-specific conservation of these intergenic repeat regions suggests that STAR elements are maintained due to selective or molecular forces with some of these elements having an important role in cell physiology. The high prevalence in two of the more virulent staphylococcal species is indicative of a potential role for STAR elements in pathogenesis. PMID:23020678

A model for genesis of transcription systems.

PubMed

Burton, Zachary F; Opron, Kristopher; Wei, Guowei; Geiger, James H

2016-01-01

Repeating sequences generated from RNA gene fusions/ligations dominate ancient life, indicating central importance of building structural complexity in evolving biological systems. A simple and coherent story of life on earth is told from tracking repeating motifs that generate α/β proteins, 2-double-Ψ-β-barrel (DPBB) type RNA polymerases (RNAPs), general transcription factors (GTFs), and promoters. A general rule that emerges is that biological complexity that arises through generation of repeats is often bounded by solubility and closure (i.e., to form a pseudo-dimer or a barrel). Because the first DNA genomes were replicated by DNA template-dependent RNA synthesis followed by RNA template-dependent DNA synthesis via reverse transcriptase, the first DNA replication origins were initially 2-DPBB type RNAP promoters. A simplifying model for evolution of promoters/replication origins via repetition of core promoter elements is proposed. The model can explain why Pribnow boxes in bacterial transcription (i.e., (-12)TATAATG(-6)) so closely resemble TATA boxes (i.e., (-31)TATAAAAG(-24)) in archaeal/eukaryotic transcription. The evolution of anchor DNA sequences in bacterial (i.e., (-35)TTGACA(-30)) and archaeal (BRE(up); BRE for TFB recognition element) promoters is potentially explained. The evolution of BRE(down) elements of archaeal promoters is potentially explained.

cDNA sequence and expression of a cold-responsive gene in Citrus unshiu.

PubMed

Hara, M; Wakasugi, Y; Ikoma, Y; Yano, M; Ogawa, K; Kuboi, T

1999-02-01

A cDNA clone encoding a protein (CuCOR19), the sequence of which is similar to Poncirus COR19, of the dehydrin family was isolated from the epicarp of Citrus unshiu. The molecular mass of the predicted protein was 18,980 daltons. CuCOR19 was highly hydrophilic and contained three repeating elements including Lys-rich motifs. The gene expression in leaves increased by cold stress.

Characterization of human glucocorticoid receptor complexes formed with DNA fragments containing or lacking glucocorticoid response elements

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tully, D.B.; Cidlowski, J.A.

1989-03-07

Sucrose density gradient shift assays were used to study the interactions of human glucocorticoid receptors (GR) with small DNA fragments either containing or lacking glucocorticoid response element (GRE) DNA consensus sequences. When crude cytoplasmic extracts containing ({sup 3}H)triamcinolone acetonide (({sup 3}H)TA) labeled GR were incubated with unlabeled DNA under conditions of DNA excess, a GRE-containing DNA fragment obtained from the 5' long terminal repeat of mouse mammary tumor virus (MMTV LTR) formed a stable 12-16S complex with activated, but not nonactivated, ({sup 3}H)TA receptor. By contrast, if the cytosols were treated with calf thymus DNA-cellulose to deplete non-GR-DNA-binding proteins priormore » to heat activation, a smaller 7-10S complex was formed with the MMTV LTR DNA fragment. Activated ({sup 3}H)TA receptor from DNA-cellulose pretreated cytosols also interacted with two similarly sized fragments from pBR322 DNA. Stability of the complexes formed between GR and these three DNA fragments was strongly affected by even moderate alterations in either the salt concentration or the pH of the gradient buffer. Under all conditions tested, the complex formed with the MMTV LTR DNA fragment was more stable than the complexes formed with either of the pBR322 DNA fragments. Together these observations indicate that the formation of stable complexes between activated GR and isolated DNA fragments requires the presence of GRE consensus sequences in the DNA.« less

Development and validation of an integrated DNA walking strategy to detect GMO expressing cry genes.

PubMed

Fraiture, Marie-Alice; Vandamme, Julie; Herman, Philippe; Roosens, Nancy H C

2018-06-27

Recently, an integrated DNA walking strategy has been proposed to prove the presence of GMO via the characterisation of sequences of interest, including their transgene flanking regions and the unnatural associations of elements in their transgenic cassettes. To this end, the p35S, tNOS and t35S pCAMBIA elements have been selected as key targets, allowing the coverage of most of GMO, EU authorized or not. In the present study, a bidirectional DNA walking method anchored on the CryAb/c genes is proposed with the aim to cover additional GMO and additional sequences of interest. The performance of the proposed bidirectional DNA walking method anchored on the CryAb/c genes has been evaluated in a first time for its feasibility using several GM events possessing these CryAb/c genes. Afterwards, its sensitivity has been investigated through low concentrations of targets (as low as 20 HGE). In addition, to illustrate its applicability, the entire workflow has been tested on a sample mimicking food/feed matrices analysed in GMO routine analysis. Given the successful assessment of its performance, the present bidirectional DNA walking method anchored on the CryAb/c genes can easily be implemented in GMO routine analysis by the enforcement laboratories and allows completing the entire DNA walking strategy in targeting an additional transgenic element frequently found in GMO.

Alteration of gene expression in human hepatocellular carcinoma with integrated hepatitis B virus DNA.

PubMed

Tamori, Akihiro; Yamanishi, Yoshihiro; Kawashima, Shuichi; Kanehisa, Minoru; Enomoto, Masaru; Tanaka, Hiromu; Kubo, Shoji; Shiomi, Susumu; Nishiguchi, Shuhei

2005-08-15

Integration of hepatitis B virus (HBV) DNA into the human genome is one of the most important steps in HBV-related carcinogenesis. This study attempted to find the link between HBV DNA, the adjoining cellular sequence, and altered gene expression in hepatocellular carcinoma (HCC) with integrated HBV DNA. We examined 15 cases of HCC infected with HBV by cassette ligation-mediated PCR. The human DNA adjacent to the integrated HBV DNA was sequenced. Protein coding sequences were searched for in the human sequence. In five cases with HBV DNA integration, from which good quality RNA was extracted, gene expression was examined by cDNA microarray analysis. The human DNA sequence successive to integrated HBV DNA was determined in the 15 HCCs. Eight protein-coding regions were involved: ras-responsive element binding protein 1, calmodulin 1, mixed lineage leukemia 2 (MLL2), FLJ333655, LOC220272, LOC255345, LOC220220, and LOC168991. The MLL2 gene was expressed in three cases with HBV DNA integrated into exon 3 of MLL2 and in one case with HBV DNA integrated into intron 3 of MLL2. Gene expression analysis suggested that two HCCs with HBV integrated into MLL2 had similar patterns of gene expression compared with three HCCs with HBV integrated into other loci of human chromosomes. HBV DNA was integrated at random sites of human DNA, and the MLL2 gene was one of the targets for integration. Our results suggest that HBV DNA might modulate human genes near integration sites, followed by integration site-specific expression of such genes during hepatocarcinogenesis.

In Vivo Control of CpG and Non-CpG DNA Methylation by DNA Methyltransferases

PubMed Central

Arand, Julia; Spieler, David; Karius, Tommy; Branco, Miguel R.; Meilinger, Daniela; Meissner, Alexander; Jenuwein, Thomas; Xu, Guoliang; Leonhardt, Heinrich; Wolf, Verena; Walter, Jörn

2012-01-01

The enzymatic control of the setting and maintenance of symmetric and non-symmetric DNA methylation patterns in a particular genome context is not well understood. Here, we describe a comprehensive analysis of DNA methylation patterns generated by high resolution sequencing of hairpin-bisulfite amplicons of selected single copy genes and repetitive elements (LINE1, B1, IAP-LTR-retrotransposons, and major satellites). The analysis unambiguously identifies a substantial amount of regional incomplete methylation maintenance, i.e. hemimethylated CpG positions, with variant degrees among cell types. Moreover, non-CpG cytosine methylation is confined to ESCs and exclusively catalysed by Dnmt3a and Dnmt3b. This sequence position–, cell type–, and region-dependent non-CpG methylation is strongly linked to neighboring CpG methylation and requires the presence of Dnmt3L. The generation of a comprehensive data set of 146,000 CpG dyads was used to apply and develop parameter estimated hidden Markov models (HMM) to calculate the relative contribution of DNA methyltransferases (Dnmts) for de novo and maintenance DNA methylation. The comparative modelling included wild-type ESCs and mutant ESCs deficient for Dnmt1, Dnmt3a, Dnmt3b, or Dnmt3a/3b, respectively. The HMM analysis identifies a considerable de novo methylation activity for Dnmt1 at certain repetitive elements and single copy sequences. Dnmt3a and Dnmt3b contribute de novo function. However, both enzymes are also essential to maintain symmetrical CpG methylation at distinct repetitive and single copy sequences in ESCs. PMID:22761581

On the roles of repetitive DNA elements in the context of a unified genomic-epigenetic system.

PubMed

von Sternberg, Richard

2002-12-01

Repetitive DNA sequences comprise a substantial portion of most eukaryotic and some prokaryotic chromosomes. Despite nearly forty years of research, the functions of various sequence families as a whole and their monomer units remain largely unknown. The inability to map specific functional roles onto many repetitive DNA elements (REs), coupled with the taxon-specificity of sequence families, have led many to speculate that these genomic components are "selfish" replicators generating genomic "junk." The purpose of this paper is to critically examine the selfishness, evolutionary effects, and functionality of REs. First, a brief overview of the range of ideas pertaining to RE function is presented. Second, the argument is presented that the selfish DNA "hypothesis" is actually a narrative scheme, that it serves to protect neo-Darwinian assumptions from criticism, and that this story is untestable and therefore not a hypothesis. Third, attempts to synthesize the selfish DNA concept with complex systems models of the genome and RE functionality are critiqued. Fourth, the supposed connection between RE-induced mutations and macroevolutionary events are stated to be at variance with empirical evidence and theoretical considerations. Hypotheses that base phylogenetic transitions in repetitive sequence changes thus remain speculative. Fifth and finally, the case is made for viewing REs as integrally functional components of chromosomes, genomes, and cells. It is argued throughout that a new conceptual framework is needed for understanding the roles of repetitive DNA in genomic/epigenetic systems, and that neo-Darwinian "narratives" have been the primary obstacle to elucidating the effects of these enigmatic components of chromosomes.

Structure and Genetic Content of the Megaplasmids of Neurotoxigenic Clostridium butyricum Type E Strains from Italy

PubMed Central

Iacobino, Angelo; Scalfaro, Concetta; Franciosa, Giovanna

2013-01-01

We determined the genetic maps of the megaplasmids of six neutoroxigenic Clostridium butyricum type E strains from Italy using molecular and bioinformatics techniques. The megaplasmids are circular, not linear as we had previously proposed. The differently-sized megaplasmids share a genetic region that includes structural, metabolic and regulatory genes. In addition, we found that a 168 kb genetic region is present only in the larger megaplasmids of two tested strains, whereas it is absent from the smaller megaplasmids of the four remaining strains. The genetic region unique to the larger megaplasmids contains, among other features, a locus for clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR associated (cas) genes, i.e. a bacterial adaptive immune system providing sequence-specific protection from invading genetic elements. Some CRISPR spacer sequences of the neurotoxigenic C. butyricum type E strains showed homology to prophage, phage and plasmid sequences from closely related clostridia species or from distant species, all sharing the intestinal habitat, suggesting that the CRISPR locus might be involved in the microorganism adaptation to the human or animal intestinal environment. Besides, we report here that each of four distinct CRISPR spacers partially matched DNA sequences of different prophages and phages, at identical nucleotide locations. This suggests that, at least in neurotoxigenic C. butyricum type E, the CRISPR locus is potentially able to recognize the same conserved DNA sequence of different invading genetic elements, besides targeting sequences unique to previously encountered invading DNA, as currently predicted for a CRISPR locus. Thus, the results of this study introduce the possibility that CRISPR loci can provide resistance to a wider range of invading DNA elements than previously appreciated. Whether it is more advantageous for the peculiar neurotoxigenic C. butyricum type E strains to maintain or to lose the CRISPR-cas system remains an open question. PMID:23967192

DNA–DNA kissing complexes as a new tool for the assembly of DNA nanostructures

PubMed Central

Barth, Anna; Kobbe, Daniela; Focke, Manfred

2016-01-01

Kissing-loop annealing of nucleic acids occurs in nature in several viruses and in prokaryotic replication, among other circumstances. Nucleobases of two nucleic acid strands (loops) interact with each other, although the two strands cannot wrap around each other completely because of the adjacent double-stranded regions (stems). In this study, we exploited DNA kissing-loop interaction for nanotechnological application. We functionalized the vertices of DNA tetrahedrons with DNA stem-loop sequences. The complementary loop sequence design allowed the hybridization of different tetrahedrons via kissing-loop interaction, which might be further exploited for nanotechnology applications like cargo transport and logical elements. Importantly, we were able to manipulate the stability of those kissing-loop complexes based on the choice and concentration of cations, the temperature and the number of complementary loops per tetrahedron either at the same or at different vertices. Moreover, variations in loop sequences allowed the characterization of necessary sequences within the loop as well as additional stability control of the kissing complexes. Therefore, the properties of the presented nanostructures make them an important tool for DNA nanotechnology. PMID:26773051

Recurrence time statistics: versatile tools for genomic DNA sequence analysis.

PubMed

Cao, Yinhe; Tung, Wen-Wen; Gao, J B

2004-01-01

With the completion of the human and a few model organisms' genomes, and the genomes of many other organisms waiting to be sequenced, it has become increasingly important to develop faster computational tools which are capable of easily identifying the structures and extracting features from DNA sequences. One of the more important structures in a DNA sequence is repeat-related. Often they have to be masked before protein coding regions along a DNA sequence are to be identified or redundant expressed sequence tags (ESTs) are to be sequenced. Here we report a novel recurrence time based method for sequence analysis. The method can conveniently study all kinds of periodicity and exhaustively find all repeat-related features from a genomic DNA sequence. An efficient codon index is also derived from the recurrence time statistics, which has the salient features of being largely species-independent and working well on very short sequences. Efficient codon indices are key elements of successful gene finding algorithms, and are particularly useful for determining whether a suspected EST belongs to a coding or non-coding region. We illustrate the power of the method by studying the genomes of E. coli, the yeast S. cervisivae, the nematode worm C. elegans, and the human, Homo sapiens. Computationally, our method is very efficient. It allows us to carry out analysis of genomes on the whole genomic scale by a PC.

Current strategies for mobilome research

PubMed Central

Jørgensen, Tue S.; Kiil, Anne S.; Hansen, Martin A.; Sørensen, Søren J.; Hansen, Lars H.

2015-01-01

Mobile genetic elements (MGEs) are pivotal for bacterial evolution and adaptation, allowing shuffling of genes even between distantly related bacterial species. The study of these elements is biologically interesting as the mode of genetic propagation is kaleidoscopic and important, as MGEs are the main vehicles of the increasing bacterial antibiotic resistance that causes thousands of human deaths each year. The study of MGEs has previously focused on plasmids from individual isolates, but the revolution in sequencing technology has allowed the study of mobile genomic elements of entire communities using metagenomic approaches. The problem in using metagenomic sequencing for the study of MGEs is that plasmids and other mobile elements only comprise a small fraction of the total genetic content that are difficult to separate from chromosomal DNA based on sequence alone. The distinction between plasmid and chromosome is important as the mobility and regulation of genes largely depend on their genetic context. Several different approaches have been proposed that specifically enrich plasmid DNA from community samples. Here, we review recent approaches used to study entire plasmid pools from complex environments, and point out possible future developments for and pitfalls of these approaches. Further, we discuss the use of the PacBio long-read sequencing technology for MGE discovery. PMID:25657641

Grasshopper, a long terminal repeat (LTR) retroelement in the phytopathogenic fungus Magnaporthe grisea.

PubMed

Dobinson, K F; Harris, R E; Hamer, J E

1993-01-01

The fungal phytopathogen Magnaporthe grisea parasitizes a wide variety of gramineous hosts. In the course of investigating the genetic relationship between pathogen genotype and host specificity we identified a retroelement that is present in some strains of M. grisea that infect finger millet and goosegrass (members of the plant genus Eleusine). The element, designated grasshopper (grh), is present in multiple copies and dispersed throughout the genome. DNA sequence analysis showed that grasshopper contains 198 base pair direct, long terminal repeats (LTRs) with features characteristic of retroviral and retrotransposon LTRs. Within the element we identified an open reading frame with sequences homologous to the reverse transcriptase, RNaseH, and integrase domains of retroelement pol genes. Comparison of the open reading frame with sequences from other retroelements showed that grh is related to the gypsy family of retrotransposons. Comparisons of the distribution of the grasshopper element with other dispersed repeated DNA sequences in M. grisea indicated that grasshopper was present in a broadly dispersed subgroup of Eleusine pathogens, suggesting that the element was acquired subsequent to the evolution of this host-specific form. We present arguments that the amplification of different retroelements within populations of M. grisea is a consequence of the clonal organization of the fungal populations.

In silico modeling of epigenetic-induced changes in photoreceptor cis-regulatory elements.

PubMed

Hossain, Reafa A; Dunham, Nicholas R; Enke, Raymond A; Berndsen, Christopher E

2018-01-01

DNA methylation is a well-characterized epigenetic repressor of mRNA transcription in many plant and vertebrate systems. However, the mechanism of this repression is not fully understood. The process of transcription is controlled by proteins that regulate recruitment and activity of RNA polymerase by binding to specific cis-regulatory sequences. Cone-rod homeobox (CRX) is a well-characterized mammalian transcription factor that controls photoreceptor cell-specific gene expression. Although much is known about the functions and DNA binding specificity of CRX, little is known about how DNA methylation modulates CRX binding affinity to genomic cis-regulatory elements. We used bisulfite pyrosequencing of human ocular tissues to measure DNA methylation levels of the regulatory regions of RHO , PDE6B, PAX6 , and LINE1 retrotransposon repeats. To describe the molecular mechanism of repression, we used molecular modeling to illustrate the effect of DNA methylation on human RHO regulatory sequences. In this study, we demonstrate an inverse correlation between DNA methylation in regulatory regions adjacent to the human RHO and PDE6B genes and their subsequent transcription in human ocular tissues. Docking of CRX to the DNA models shows that CRX interacts with the grooves of these sequences, suggesting changes in groove structure could regulate binding. Molecular dynamics simulations of the RHO promoter and enhancer regions show changes in the flexibility and groove width upon epigenetic modification. Models also demonstrate changes in the local dynamics of CRX binding sites within RHO regulatory sequences which may account for the repression of CRX-dependent transcription. Collectively, these data demonstrate epigenetic regulation of CRX binding sites in human retinal tissue and provide insight into the mechanism of this mode of epigenetic regulation to be tested in future experiments.

Inhibition of hepatitis B virus replication with linear DNA sequences expressing antiviral micro-RNA shuttles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chattopadhyay, Saket; Ely, Abdullah; Bloom, Kristie

2009-11-20

RNA interference (RNAi) may be harnessed to inhibit viral gene expression and this approach is being developed to counter chronic infection with hepatitis B virus (HBV). Compared to synthetic RNAi activators, DNA expression cassettes that generate silencing sequences have advantages of sustained efficacy and ease of propagation in plasmid DNA (pDNA). However, the large size of pDNAs and inclusion of sequences conferring antibiotic resistance and immunostimulation limit delivery efficiency and safety. To develop use of alternative DNA templates that may be applied for therapeutic gene silencing, we assessed the usefulness of PCR-generated linear expression cassettes that produce anti-HBV micro-RNA (miR)more » shuttles. We found that silencing of HBV markers of replication was efficient (>75%) in cell culture and in vivo. miR shuttles were processed to form anti-HBV guide strands and there was no evidence of induction of the interferon response. Modification of terminal sequences to include flanking human adenoviral type-5 inverted terminal repeats was easily achieved and did not compromise silencing efficacy. These linear DNA sequences should have utility in the development of gene silencing applications where modifications of terminal elements with elimination of potentially harmful and non-essential sequences are required.« less

High-resolution characterization of sequence signatures due to non-random cleavage of cell-free DNA.

PubMed

Chandrananda, Dineika; Thorne, Natalie P; Bahlo, Melanie

2015-06-17

High-throughput sequencing of cell-free DNA fragments found in human plasma has been used to non-invasively detect fetal aneuploidy, monitor organ transplants and investigate tumor DNA. However, many biological properties of this extracellular genetic material remain unknown. Research that further characterizes circulating DNA could substantially increase its diagnostic value by allowing the application of more sophisticated bioinformatics tools that lead to an improved signal to noise ratio in the sequencing data. In this study, we investigate various features of cell-free DNA in plasma using deep-sequencing data from two pregnant women (>70X, >50X) and compare them with matched cellular DNA. We utilize a descriptive approach to examine how the biological cleavage of cell-free DNA affects different sequence signatures such as fragment lengths, sequence motifs at fragment ends and the distribution of cleavage sites along the genome. We show that the size distributions of these cell-free DNA molecules are dependent on their autosomal and mitochondrial origin as well as the genomic location within chromosomes. DNA mapping to particular microsatellites and alpha repeat elements display unique size signatures. We show how cell-free fragments occur in clusters along the genome, localizing to nucleosomal arrays and are preferentially cleaved at linker regions by correlating the mapping locations of these fragments with ENCODE annotation of chromatin organization. Our work further demonstrates that cell-free autosomal DNA cleavage is sequence dependent. The region spanning up to 10 positions on either side of the DNA cleavage site show a consistent pattern of preference for specific nucleotides. This sequence motif is present in cleavage sites localized to nucleosomal cores and linker regions but is absent in nucleosome-free mitochondrial DNA. These background signals in cell-free DNA sequencing data stem from the non-random biological cleavage of these fragments. This sequence structure can be harnessed to improve bioinformatics algorithms, in particular for CNV and structural variant detection. Descriptive measures for cell-free DNA features developed here could also be used in biomarker analysis to monitor the changes that occur during different pathological conditions.

Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome

PubMed Central

2009-01-01

Background Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs) and full-length (FL)cDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. Results We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR) and a cytochrome P450 (CYP720B4) from a non-arrayed genomic BAC library of white spruce (Picea glauca). Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR) and 94 kbp (CYP720B4) long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs), high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. Conclusion We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene families can be isolated in a gene-specific fashion. The results of the present work provide important new information about the structure and content of conifer genomic DNA that will guide future efforts to sequence and assemble conifer genomes. PMID:19656416

Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome.

PubMed

Hamberger, Björn; Hall, Dawn; Yuen, Mack; Oddy, Claire; Hamberger, Britta; Keeling, Christopher I; Ritland, Carol; Ritland, Kermit; Bohlmann, Jörg

2009-08-06

Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs) and full-length (FL)cDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR) and a cytochrome P450 (CYP720B4) from a non-arrayed genomic BAC library of white spruce (Picea glauca). Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR) and 94 kbp (CYP720B4) long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs), high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene families can be isolated in a gene-specific fashion. The results of the present work provide important new information about the structure and content of conifer genomic DNA that will guide future efforts to sequence and assemble conifer genomes.

Developmental rearrangement of cyanobacterial nif genes: nucleotide sequence, open reading frames, and cytochrome P-450 homology of the Anabaena sp. strain PCC 7120 nifD element.

PubMed Central

Lammers, P J; McLaughlin, S; Papin, S; Trujillo-Provencio, C; Ryncarz, A J

1990-01-01

An 11-kbp DNA element of unknown function interrupts the nifD gene in vegetative cells of Anabaena sp. strain PCC 7120. In developing heterocysts the nifD element excises from the chromosome via site-specific recombination between short repeat sequences that flank the element. The nucleotide sequence of the nifH-proximal half of the element was determined to elucidate the genetic potential of the element. Four open reading frames with the same relative orientation as the nifD element-encoded xisA gene were identified in the sequenced region. Each of the open reading frames was preceded by a reasonable ribosome-binding site and had biased codon utilization preferences consistent with low levels of expression. Open reading frame 3 was highly homologous with three cytochrome P-450 omega-hydroxylase proteins and showed regional homology to functionally significant domains common to the cytochrome P-450 superfamily. The sequence encoding open reading frame 2 was the most highly conserved portion of the sequenced region based on heterologous hybridization experiments with three genera of heterocystous cyanobacteria. Images PMID:2123860

Visual ModuleOrganizer: a graphical interface for the detection and comparative analysis of repeat DNA modules

PubMed Central

2014-01-01

Background DNA repeats, such as transposable elements, minisatellites and palindromic sequences, are abundant in sequences and have been shown to have significant and functional roles in the evolution of the host genomes. In a previous study, we introduced the concept of a repeat DNA module, a flexible motif present in at least two occurences in the sequences. This concept was embedded into ModuleOrganizer, a tool allowing the detection of repeat modules in a set of sequences. However, its implementation remains difficult for larger sequences. Results Here we present Visual ModuleOrganizer, a Java graphical interface that enables a new and optimized version of the ModuleOrganizer tool. To implement this version, it was recoded in C++ with compressed suffix tree data structures. This leads to less memory usage (at least 120-fold decrease in average) and decreases by at least four the computation time during the module detection process in large sequences. Visual ModuleOrganizer interface allows users to easily choose ModuleOrganizer parameters and to graphically display the results. Moreover, Visual ModuleOrganizer dynamically handles graphical results through four main parameters: gene annotations, overlapping modules with known annotations, location of the module in a minimal number of sequences, and the minimal length of the modules. As a case study, the analysis of FoldBack4 sequences clearly demonstrated that our tools can be extended to comparative and evolutionary analyses of any repeat sequence elements in a set of genomic sequences. With the increasing number of sequences available in public databases, it is now possible to perform comparative analyses of repeated DNA modules in a graphic and friendly manner within a reasonable time period. Availability Visual ModuleOrganizer interface and the new version of the ModuleOrganizer tool are freely available at: http://lcb.cnrs-mrs.fr/spip.php?rubrique313. PMID:24678954

An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

PubMed

Itzhaki, H; Maxson, J M; Woodson, W R

1994-09-13

The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.

Genome-wide DNA methylation patterns in LSH mutant reveals de-repression of repeat elements and redundant epigenetic silencing pathways

PubMed Central

Yu, Weishi; McIntosh, Carl; Lister, Ryan; Zhu, Iris; Han, Yixing; Ren, Jianke; Landsman, David; Lee, Eunice; Briones, Victorino; Terashima, Minoru; Leighty, Robert; Ecker, Joseph R.

2014-01-01

Cytosine methylation is critical in mammalian development and plays a role in diverse biologic processes such as genomic imprinting, X chromosome inactivation, and silencing of repeat elements. Several factors regulate DNA methylation in early embryogenesis, but their precise role in the establishment of DNA methylation at a given site remains unclear. We have generated a comprehensive methylation map in fibroblasts derived from the murine DNA methylation mutant Hells−/− (helicase, lymphoid specific, also known as LSH). It has been previously shown that HELLS can influence de novo methylation of retroviral sequences and endogenous genes. Here, we describe that HELLS controls cytosine methylation in a nuclear compartment that is in part defined by lamin B1 attachment regions. Despite widespread loss of cytosine methylation at regulatory sequences, including promoter regions of protein-coding genes and noncoding RNA genes, overall relative transcript abundance levels in the absence of HELLS are similar to those in wild-type cells. A subset of promoter regions shows increases of the histone modification H3K27me3, suggesting redundancy of epigenetic silencing mechanisms. Furthermore, HELLS modulates CG methylation at all classes of repeat elements and is critical for repression of a subset of repeat elements. Overall, we provide a detailed analysis of gene expression changes in relation to DNA methylation alterations, which contributes to our understanding of the biological role of cytosine methylation. PMID:25170028

Mechanism of DNA-binding enhancement by the human T-cell leukaemia virus transactivator Tax.

PubMed

Baranger, A M; Palmer, C R; Hamm, M K; Giebler, H A; Brauweiler, A; Nyborg, J K; Schepartz, A

1995-08-17

Tax protein activates transcription of the human T-cell leukaemia virus type I (HTLV-I) genome through three imperfect cyclic AMP-responsive element (CRE) target sites located within the viral promoter. Previous work has shown that Tax interacts with the bZIP element of proteins that bind the CRE target site to promote peptide dimerization, suggesting an association between Tax and bZIP coiled coil. Here we show that the site of interaction with Tax is not the coiled coil, but the basic segment. This interaction increases the stability of the GCN4 bZIP dimer by 1.7 kcal mol-1 and the DNA affinity of the dimer by 1.9 kcal mol-1. The differential effect of Tax on several bZip-DNA complexes that differ in peptide sequence or DNA conformation suggests a model for Tax action based on stabilization of a distinct DNA-bound protein structure. This model may explain how Tax interacts with transcription factors of considerable sequence diversity to alter patterns of gene expression.

Continuous Influx of Genetic Material from Host to Virus Populations

PubMed Central

Gilbert, Clément; Peccoud, Jean; Chateigner, Aurélien; Moumen, Bouziane

2016-01-01

Many genes of large double-stranded DNA viruses have a cellular origin, suggesting that host-to-virus horizontal transfer (HT) of DNA is recurrent. Yet, the frequency of these transfers has never been assessed in viral populations. Here we used ultra-deep DNA sequencing of 21 baculovirus populations extracted from two moth species to show that a large diversity of moth DNA sequences (n = 86) can integrate into viral genomes during the course of a viral infection. The majority of the 86 different moth DNA sequences are transposable elements (TEs, n = 69) belonging to 10 superfamilies of DNA transposons and three superfamilies of retrotransposons. The remaining 17 sequences are moth sequences of unknown nature. In addition to bona fide DNA transposition, we uncover microhomology-mediated recombination as a mechanism explaining integration of moth sequences into viral genomes. Many sequences integrated multiple times at multiple positions along the viral genome. We detected a total of 27,504 insertions of moth sequences in the 21 viral populations and we calculate that on average, 4.8% of viruses harbor at least one moth sequence in these populations. Despite this substantial proportion, no insertion of moth DNA was maintained in any viral population after 10 successive infection cycles. Hence, there is a constant turnover of host DNA inserted into viral genomes each time the virus infects a moth. Finally, we found that at least 21 of the moth TEs integrated into viral genomes underwent repeated horizontal transfers between various insect species, including some lepidopterans susceptible to baculoviruses. Our results identify host DNA influx as a potent source of genetic diversity in viral populations. They also support a role for baculoviruses as vectors of DNA HT between insects, and call for an evaluation of possible gene or TE spread when using viruses as biopesticides or gene delivery vectors. PMID:26829124

Continuous Influx of Genetic Material from Host to Virus Populations.

PubMed

Gilbert, Clément; Peccoud, Jean; Chateigner, Aurélien; Moumen, Bouziane; Cordaux, Richard; Herniou, Elisabeth A

2016-02-01

Many genes of large double-stranded DNA viruses have a cellular origin, suggesting that host-to-virus horizontal transfer (HT) of DNA is recurrent. Yet, the frequency of these transfers has never been assessed in viral populations. Here we used ultra-deep DNA sequencing of 21 baculovirus populations extracted from two moth species to show that a large diversity of moth DNA sequences (n = 86) can integrate into viral genomes during the course of a viral infection. The majority of the 86 different moth DNA sequences are transposable elements (TEs, n = 69) belonging to 10 superfamilies of DNA transposons and three superfamilies of retrotransposons. The remaining 17 sequences are moth sequences of unknown nature. In addition to bona fide DNA transposition, we uncover microhomology-mediated recombination as a mechanism explaining integration of moth sequences into viral genomes. Many sequences integrated multiple times at multiple positions along the viral genome. We detected a total of 27,504 insertions of moth sequences in the 21 viral populations and we calculate that on average, 4.8% of viruses harbor at least one moth sequence in these populations. Despite this substantial proportion, no insertion of moth DNA was maintained in any viral population after 10 successive infection cycles. Hence, there is a constant turnover of host DNA inserted into viral genomes each time the virus infects a moth. Finally, we found that at least 21 of the moth TEs integrated into viral genomes underwent repeated horizontal transfers between various insect species, including some lepidopterans susceptible to baculoviruses. Our results identify host DNA influx as a potent source of genetic diversity in viral populations. They also support a role for baculoviruses as vectors of DNA HT between insects, and call for an evaluation of possible gene or TE spread when using viruses as biopesticides or gene delivery vectors.

Targeting of >1.5 Mb of Human DNA into the Mouse X Chromosome Reveals Presence of cis-Acting Regulators of Epigenetic Silencing

PubMed Central

Yang, Christine; McLeod, Andrea J.; Cotton, Allison M.; de Leeuw, Charles N.; Laprise, Stéphanie; Banks, Kathleen G.; Simpson, Elizabeth M.; Brown, Carolyn J.

2012-01-01

Regulatory sequences can influence the expression of flanking genes over long distances, and X chromosome inactivation is a classic example of cis-acting epigenetic gene regulation. Knock-ins directed to the Mus musculus Hprt locus offer a unique opportunity to analyze the spread of silencing into different human DNA sequences in the identical genomic environment. X chromosome inactivation of four knock-in constructs, including bacterial artificial chromosome (BAC) integrations of over 195 kb, was demonstrated by both the lack of expression from the inactive X chromosome in females with nonrandom X chromosome inactivation and promoter DNA methylation of the human transgene in females. We further utilized promoter DNA methylation to assess the inactivation status of 74 human reporter constructs comprising >1.5 Mb of DNA. Of the 47 genes examined, only the PHB gene showed female DNA hypomethylation approaching the level seen in males, and escape from X chromosome inactivation was verified by demonstration of expression from the inactive X chromosome. Integration of PHB resulted in lower DNA methylation of the flanking HPRT promoter in females, suggesting the action of a dominant cis-acting escape element. Female-specific DNA hypermethylation of CpG islands not associated with promoters implies a widespread imposition of DNA methylation during X chromosome inactivation; yet transgenes demonstrated differential capacities to accumulate DNA methylation when integrated into the identical location on the inactive X chromosome, suggesting additional cis-acting sequence effects. As only one of the human transgenes analyzed escaped X chromosome inactivation, we conclude that elements permitting ongoing expression from the inactive X are rare in the human genome. PMID:23023002

Ubiquitous and gene-specific regulatory 5' sequences in a sea urchin histone DNA clone coding for histone protein variants.

PubMed Central

Busslinger, M; Portmann, R; Irminger, J C; Birnstiel, M L

1980-01-01

The DNA sequences of the entire structural H4, H3, H2A and H2B genes and of their 5' flanking regions have been determined in the histone DNA clone h19 of the sea urchin Psammechinus miliaris. In clone h19 the polarity of transcription and the relative arrangement of the histone genes is identical to that in clone h22 of the same species. The histone proteins encoded by h19 DNA differ in their primary structure from those encoded by clone h22 and have been compared to histone protein sequences of other sea urchin species as well as other eukaryotes. A comparative analysis of the 5' flanking DNA sequences of the structural histone genes in both clones revealed four ubiquitous sequence motifs; a pentameric element GATCC, followed at short distance by the Hogness box GTATAAATAG, a conserved sequence PyCATTCPu, in or near which the 5' ends of the mRNAs map in h22 DNA and lastly a sequence A, containing the initiation codon. These sequences are also found, sometimes in modified version, in front of other eukaryotic genes transcribed by polymerase II. When prelude sequences of isocoding histone genes in clone h19 and h22 are compared areas of homology are seen to extend beyond the ubiquitous sequence motifs towards the divergent AT-rich spacer and terminate between approximately 140 and 240 nucleotides away from the structural gene. These prelude regions contain quite large conservative sequence blocks which are specific for each type of histone genes. Images PMID:7443547

An Evolutionary Classification of Genomic Function

PubMed Central

Graur, Dan; Zheng, Yichen; Azevedo, Ricardo B.R.

2015-01-01

The pronouncements of the ENCODE Project Consortium regarding “junk DNA” exposed the need for an evolutionary classification of genomic elements according to their selected-effect function. In the classification scheme presented here, we divide the genome into “functional DNA,” that is, DNA sequences that have a selected-effect function, and “rubbish DNA,” that is, sequences that do not. Functional DNA is further subdivided into “literal DNA” and “indifferent DNA.” In literal DNA, the order of nucleotides is under selection; in indifferent DNA, only the presence or absence of the sequence is under selection. Rubbish DNA is further subdivided into “junk DNA” and “garbage DNA.” Junk DNA neither contributes to nor detracts from the fitness of the organism and, hence, evolves under selective neutrality. Garbage DNA, on the other hand, decreases the fitness of its carriers. Garbage DNA exists in the genome only because natural selection is neither omnipotent nor instantaneous. Each of these four functional categories can be 1) transcribed and translated, 2) transcribed but not translated, or 3) not transcribed. The affiliation of a DNA segment to a particular functional category may change during evolution: Functional DNA may become junk DNA, junk DNA may become garbage DNA, rubbish DNA may become functional DNA, and so on; however, determining the functionality or nonfunctionality of a genomic sequence must be based on its present status rather than on its potential to change (or not to change) in the future. Changes in functional affiliation are divided into pseudogenes, Lazarus DNA, zombie DNA, and Jekyll-to-Hyde DNA. PMID:25635041

Retrotransposon insertion targeting: a mechanism for homogenization of centromere sequences on nonhomologous chromosomes.

PubMed

Birchler, James A; Presting, Gernot G

2012-04-01

The centromeres of most eukaryotic organisms consist of highly repetitive arrays that are similar across nonhomologous chromosomes. These sequences evolve rapidly, thus posing a mystery as to how such arrays can be homogenized. Recent work in species in which centromere-enriched retrotransposons occur indicates that these elements preferentially insert into the centromeric regions. In two different Arabidopsis species, a related element was recognized in which the specificity for such targeting was altered. These observations provide a partial explanation for how homogenization of centromere DNA sequences occurs.

Profiling DNA methylome landscapes of mammalian cells with single-cell reduced-representation bisulfite sequencing.

PubMed

Guo, Hongshan; Zhu, Ping; Guo, Fan; Li, Xianlong; Wu, Xinglong; Fan, Xiaoying; Wen, Lu; Tang, Fuchou

2015-05-01

The heterogeneity of DNA methylation within a population of cells necessitates DNA methylome profiling at single-cell resolution. Recently, we developed a single-cell reduced-representation bisulfite sequencing (scRRBS) technique in which we modified the original RRBS method by integrating all the experimental steps before PCR amplification into a single-tube reaction. These modifications enable scRRBS to provide digitized methylation information on ∼1 million CpG sites within an individual diploid mouse or human cell at single-base resolution. Compared with the single-cell bisulfite sequencing (scBS) technique, scRRBS covers fewer CpG sites, but it provides better coverage for CpG islands (CGIs), which are likely to be the most informative elements for DNA methylation. The entire procedure takes ∼3 weeks, and it requires strong molecular biology skills.

An Ancient Transkingdom Horizontal Transfer of Penelope-Like Retroelements from Arthropods to Conifers

PubMed Central

Lin, Xuan; Faridi, Nurul; Casola, Claudio

2016-01-01

Comparative genomics analyses empowered by the wealth of sequenced genomes have revealed numerous instances of horizontal DNA transfers between distantly related species. In eukaryotes, repetitive DNA sequences known as transposable elements (TEs) are especially prone to move across species boundaries. Such horizontal transposon transfers, or HTTs, are relatively common within major eukaryotic kingdoms, including animals, plants, and fungi, while rarely occurring across these kingdoms. Here, we describe the first case of HTT from animals to plants, involving TEs known as Penelope-like elements, or PLEs, a group of retrotransposons closely related to eukaryotic telomerases. Using a combination of in situ hybridization on chromosomes, polymerase chain reaction experiments, and computational analyses we show that the predominant PLE lineage, EN(+)PLEs, is highly diversified in loblolly pine and other conifers, but appears to be absent in other gymnosperms. Phylogenetic analyses of both protein and DNA sequences reveal that conifers EN(+)PLEs, or Dryads, form a monophyletic group clustering within a clade of primarily arthropod elements. Additionally, no EN(+)PLEs were detected in 1,928 genome assemblies from 1,029 nonmetazoan and nonconifer genomes from 14 major eukaryotic lineages. These findings indicate that Dryads emerged following an ancient horizontal transfer of EN(+)PLEs from arthropods to a common ancestor of conifers approximately 340 Ma. This represents one of the oldest known interspecific transmissions of TEs, and the most conspicuous case of DNA transfer between animals and plants. PMID:27190138

A proposal to rename the hyperthermophile Pyrococcus woesei as Pyrococcus furiosus subsp. woesei.

PubMed

Kanoksilapatham, Wirojne; González, Juan M; Maeder, Dennis L; DiRuggiero, Jocelyne; Robb, Frank T

2004-10-01

Pyrococcus species are hyperthermophilic members of the order Thermococcales, with optimal growth temperatures approaching 100 degrees C. All species grow heterotrophically and produce H2 or, in the presence of elemental sulfur (S(o)), H2S. Pyrococcus woesei and P. furiosus were isolated from marine sediments at the same Vulcano Island beach site and share many morphological and physiological characteristics. We report here that the rDNA operons of these strains have identical sequences, including their intergenic spacer regions and part of the 23S rRNA. Both species grow rapidly and produce H2 in the presence of 0.1% maltose and 10-100 microM sodium tungstate in S(o)-free medium. However, P. woesei shows more extensive autolysis than P. furiosus in the stationary phase. Pyrococcus furiosus and P. woesei share three closely related families of insertion sequences (ISs). A Southern blot performed with IS probes showed extensive colinearity between the genomes of P. woesei and P. furiosus. Cloning and sequencing of ISs that were in different contexts in P. woesei and P. furiosus revealed that the napA gene in P. woesei is disrupted by a type III IS element, whereas in P. furiosus, this gene is intact. A type I IS element, closely linked to the napA gene, was observed in the same context in both P. furiosus and P. woesei genomes. Our results suggest that the IS elements are implicated in genomic rearrangements and reshuffling in these closely related strains. We propose to rename P. woesei a subspecies of P. furiosus based on their identical rDNA operon sequences, many common IS elements that are shared genomic markers, and the observation that all P. woesei nucleotide sequences deposited in GenBank to date are > 99% identical to P. furiosus sequences.

Variation in a surface-exposed region of the Mycoplasma pneumoniae P40 protein as a consequence of homologous DNA recombination between RepMP5 elements.

PubMed

Spuesens, Emiel B M; van de Kreeke, Nick; Estevão, Silvia; Hoogenboezem, Theo; Sluijter, Marcel; Hartwig, Nico G; van Rossum, Annemarie M C; Vink, Cornelis

2011-02-01

Mycoplasma pneumoniae is a human pathogen that causes a range of respiratory tract infections. The first step in infection is adherence of the bacteria to the respiratory epithelium. This step is mediated by a specialized organelle, which contains several proteins (cytadhesins) that have an important function in adherence. Two of these cytadhesins, P40 and P90, represent the proteolytic products from a single 130 kDa protein precursor, which is encoded by the MPN142 gene. Interestingly, MPN142 contains a repetitive DNA element, termed RepMP5, of which homologues are found at seven other loci within the M. pneumoniae genome. It has been hypothesized that these RepMP5 elements, which are similar but not identical in sequence, recombine with their counterpart within MPN142 and thereby provide a source of sequence variation for this gene. As this variation may give rise to amino acid changes within P40 and P90, the recombination between RepMP5 elements may constitute the basis of antigenic variation and, possibly, immune evasion by M. pneumoniae. To investigate the sequence variation of MPN142 in relation to inter-RepMP5 recombination, we determined the sequences of all RepMP5 elements in a collection of 25 strains. The results indicate that: (i) inter-RepMP5 recombination events have occurred in seven of the strains, and (ii) putative RepMP5 recombination events involving MPN142 have induced amino acid changes in a surface-exposed part of the P40 protein in two of the strains. We conclude that recombination between RepMP5 elements is a common phenomenon that may lead to sequence variation of MPN142-encoded proteins.

A purified transcription factor (TIF-IB) binds to essential sequences of the mouse rDNA promoter.

PubMed Central

Clos, J; Buttgereit, D; Grummt, I

1986-01-01

A transcription factor that is specific for mouse rDNA has been partially purified from Ehrlich ascites cells. This factor [designated transcription initiation factor (TIF)-IB] is required for accurate in vitro synthesis of mouse rRNA in addition to RNA polymerase I and another regulatory factor, TIF-IA. TIF-IB activity is present in extracts both from growing and nongrowing cells in comparable amounts. Prebinding competition experiments with wild-type and mutant templates suggest that TIF-IB interacts with the core control element of the rDNA promoter, which is located immediately upstream of the initiation site. The specific binding of TIF-IB to the RNA polymerase I promoter is demonstrated by exonuclease III protection experiments. The 3' border of the sequences protected by TIF-IB is shown to be on the coding strand at position -21 and on the noncoding strand at position -7. The results suggest that direct binding of TIF-IB to sequences in the core promoter element is the mechanism by which this factor imparts promoter selectivity to RNA polymerase I. Images PMID:3456157

AP1 Keeps Chromatin Poised for Action | Center for Cancer Research

Cancer.gov

The human genome harbors gene-encoding DNA, the blueprint for building proteins that regulate cellular function. Embedded across the genome, in non-coding regions, are DNA elements to which regulatory factors bind. The interaction of regulatory factors with DNA at these sites modifies gene expression to modulate cell activity. In cells, DNA exists in a complex with proteins called chromatin that compacts the DNA in the nucleus, strongly restricting access to DNA sequences. As a result, regulatory factors only interact with a small subset of their potential binding elements in a given cell to regulate genes. How factors recognize and select sites in chromatin across the genome is not well understood -- but several discoveries in CCR’s Laboratory of Receptor Biology and Gene Expression (LRBGE) have shed light on the mechanisms that direct factors to DNA.

Localization of Action of the Is50-Encoded Transposase Protein

PubMed Central

Phadnis, Suhas H.; Sasakawa, Chihiro; Berg, Douglas E.

1986-01-01

The movement of the bacterial insertion sequence IS50 and of composite elements containing direct terminal repeats of IS50 involves the two ends of IS50, designated O (outside) and I (inside), which are weakly matched in DNA sequence, and an IS50 encoded protein, transposase, which recognizes the O and I ends and acts preferentially in cis. Previous data had suggested that, initially, transposase interacts preferentially with the O end sequence and then, in a second step, with either an O or an I end. To better understand the cis action of transposase and how IS50 ends are selected, we generated a series of composite transposons which contain direct repeats of IS50 elements. In each transposon, one IS50 element encoded transposase (tnp +), and the other contained a null (tnp-) allele. In each of the five sets of composite transposons studied, the transposon for which the tnp+ IS50 element contained its O end was more active than a complementary transposon for which the tnp - IS50 element contained its O end. This pattern of O end use suggests models in which the cis action of transposase and its choice of ends is determined by protein tracking along DNA molecules. PMID:3007274

Alternative DNA structure formation in the mutagenic human c-MYC promoter.

PubMed

Del Mundo, Imee Marie A; Zewail-Foote, Maha; Kerwin, Sean M; Vasquez, Karen M

2017-05-05

Mutation 'hotspot' regions in the genome are susceptible to genetic instability, implicating them in diseases. These hotspots are not random and often co-localize with DNA sequences potentially capable of adopting alternative DNA structures (non-B DNA, e.g. H-DNA and G4-DNA), which have been identified as endogenous sources of genomic instability. There are regions that contain overlapping sequences that may form more than one non-B DNA structure. The extent to which one structure impacts the formation/stability of another, within the sequence, is not fully understood. To address this issue, we investigated the folding preferences of oligonucleotides from a chromosomal breakpoint hotspot in the human c-MYC oncogene containing both potential G4-forming and H-DNA-forming elements. We characterized the structures formed in the presence of G4-DNA-stabilizing K+ ions or H-DNA-stabilizing Mg2+ ions using multiple techniques. We found that under conditions favorable for H-DNA formation, a stable intramolecular triplex DNA structure predominated; whereas, under K+-rich, G4-DNA-forming conditions, a plurality of unfolded and folded species were present. Thus, within a limited region containing sequences with the potential to adopt multiple structures, only one structure predominates under a given condition. The predominance of H-DNA implicates this structure in the instability associated with the human c-MYC oncogene. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Extended HSR/CARD domain mediates AIRE binding to DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maslovskaja, Julia, E-mail: julia.maslovskaja@ut.ee; Saare, Mario; Liiv, Ingrid

Autoimmune regulator (AIRE) activates the transcription of many genes in an unusual promiscuous and stochastic manner. The mechanism by which AIRE binds to the chromatin and DNA is not fully understood, and the regulatory elements that AIRE target genes possess are not delineated. In the current study, we demonstrate that AIRE activates the expression of transiently transfected luciferase reporters that lack defined promoter regions, as well as intron and poly(A) signal sequences. Our protein-DNA interaction experiments with mutated AIRE reveal that the intact homogeneously staining region/caspase recruitment domain (HSR/CARD) and amino acids R113 and K114 are key elements involved inmore » AIRE binding to DNA. - Highlights: • Promoter and mRNA processing elements are not important for AIRE to activate gene expression from reporter plasmids. • AIRE protein fragment aa 1–138 mediates direct binding to DNA. • Integrity of the HSR/CARD domain is needed for AIRE binding to DNA.« less

Interplay between DNA methylation, histone modification and chromatin remodeling in stem cells and during development.

PubMed

Ikegami, Kohta; Ohgane, Jun; Tanaka, Satoshi; Yagi, Shintaro; Shiota, Kunio

2009-01-01

Genes constitute only a small proportion of the mammalian genome, the majority of which is composed of non-genic repetitive elements including interspersed repeats and satellites. A unique feature of the mammalian genome is that there are numerous tissue-dependent, differentially methylated regions (T-DMRs) in the non-repetitive sequences, which include genes and their regulatory elements. The epigenetic status of T-DMRs varies from that of repetitive elements and constitutes the DNA methylation profile genome-wide. Since the DNA methylation profile is specific to each cell and tissue type, much like a fingerprint, it can be used as a means of identification. The formation of DNA methylation profiles is the basis for cell differentiation and development in mammals. The epigenetic status of each T-DMR is regulated by the interplay between DNA methyltransferases, histone modification enzymes, histone subtypes, non-histone nuclear proteins and non-coding RNAs. In this review, we will discuss how these epigenetic factors cooperate to establish cell- and tissue-specific DNA methylation profiles.

Identification and Characterization of Putative Integron-Like Elements of the Heavy-Metal-Hypertolerant Strains of Pseudomonas spp.

PubMed

Ciok, Anna; Adamczuk, Marcin; Bartosik, Dariusz; Dziewit, Lukasz

2016-11-28

Pseudomonas strains isolated from the heavily contaminated Lubin copper mine and Zelazny Most post-flotation waste reservoir in Poland were screened for the presence of integrons. This analysis revealed that two strains carried homologous DNA regions composed of a gene encoding a DNA_BRE_C domain-containing tyrosine recombinase (with no significant sequence similarity to other integrases of integrons) plus a three-component array of putative integron gene cassettes. The predicted gene cassettes encode three putative polypeptides with homology to (i) transmembrane proteins, (ii) GCN5 family acetyltransferases, and (iii) hypothetical proteins of unknown function (homologous proteins are encoded by the gene cassettes of several class 1 integrons). Comparative sequence analyses identified three structural variants of these novel integron-like elements within the sequenced bacterial genomes. Analysis of their distribution revealed that they are found exclusively in strains of the genus Pseudomonas .

Cis-acting elements in the promoter region of the human aldolase C gene.

PubMed

Buono, P; de Conciliis, L; Olivetta, E; Izzo, P; Salvatore, F

1993-08-16

We investigated the cis-acting sequences involved in the expression of the human aldolase C gene by transient transfections into human neuroblastoma cells (SKNBE). We demonstrate that 420 bp of the 5'-flanking DNA direct at high efficiency the transcription of the CAT reporter gene. A deletion between -420 bp and -164 bp causes a 60% decrease of CAT activity. Gel shift and DNase I footprinting analyses revealed four protected elements: A, B, C and D. Competition analyses indicate that Sp1 or factors sharing a similar sequence specificity bind to elements A and B, but not to elements C and D. Sequence analysis shows a half palindromic ERE motif (GGTCA), in elements B and D. Region D binds a transactivating factor which appears also essential to stabilize the initiation complex.

GATA: A graphic alignment tool for comparative sequenceanalysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nix, David A.; Eisen, Michael B.

2005-01-01

Several problems exist with current methods used to align DNA sequences for comparative sequence analysis. Most dynamic programming algorithms assume that conserved sequence elements are collinear. This assumption appears valid when comparing orthologous protein coding sequences. Functional constraints on proteins provide strong selective pressure against sequence inversions, and minimize sequence duplications and feature shuffling. For non-coding sequences this collinearity assumption is often invalid. For example, enhancers contain clusters of transcription factor binding sites that change in number, orientation, and spacing during evolution yet the enhancer retains its activity. Dotplot analysis is often used to estimate non-coding sequence relatedness. Yet dotmore » plots do not actually align sequences and thus cannot account well for base insertions or deletions. Moreover, they lack an adequate statistical framework for comparing sequence relatedness and are limited to pairwise comparisons. Lastly, dot plots and dynamic programming text outputs fail to provide an intuitive means for visualizing DNA alignments.« less

Instability of plasmid DNA sequences: macro and micro evolution of the antibiotic resistance plasmid R6-5.

PubMed

Timmis, K N; Cabello, F; Andrés, I; Nordheim, A; Burkhardt, H J; Cohen, S N

1978-11-16

Detailed examination of the structure of cloned DNA fragments of the R6-5 antibiotic resistance plasmid has revealed a substantial degree of polynucleotide sequence heterogeneity and indicates that sequence rearrangements in plasmids and possible other replicons occur more frequently than has hitherto been appreciated. The sequences changes in cloned R6-5 fragments were shown in some instances to have occurred prior to cloning, i.e. existing in the original population of R6-5 molecules that was obtained from a single bacterial clone and by several different criteria judged to be homogeneous, and in others to have occurred either during the cloning procedure or during subsequent propagation of hybrid molecules. The molecular changes that are described involved insertion/deletion of the previously characterized IS2 insertion element, formation of a new inverted repeat structure probably by duplication of a preexisting R6-5 DNA sequence, sequence inversion, and loss and gain of restriction endonuclease cleavage sites.

Ectopic recombination between Ty elements in Saccharomyces cerevisiae is not induced by DNA damage.

PubMed

Parket, A; Kupiec, M

1992-10-01

Mitotic recombination is increased when cells are treated with a variety of physical and chemical agents that cause damage to their DNA. We show here, using Saccharomyces cerevisiae strains that carry marked Ty elements, that recombination between members of this family of retrotransposons is not increased by UV irradiation or by treatment with the radiomimetic drug methyl methanesulfonate. Both ectopic recombination and mutation events were elevated by these agents for non-Ty sequences in the same strain. We discuss possible mechanisms that can prevent the induction of recombination between Ty elements.

Molecular coevolution of mammalian ribosomal gene terminator sequences and the transcription termination factor TTF-I.

PubMed Central

Evers, R; Grummt, I

1995-01-01

Both the DNA elements and the nuclear factors that direct termination of ribosomal gene transcription exhibit species-specific differences. Even between mammals--e.g., human and mouse--the termination signals are not identical and the respective transcription termination factors (TTFs) which bind to the terminator sequence are not fully interchangeable. To elucidate the molecular basis for this species-specificity, we have cloned TTF-I from human and mouse cells and compared their structural and functional properties. Recombinant TTF-I exhibits species-specific DNA binding and terminates transcription both in cell-free transcription assays and in transfection experiments. Chimeric constructs of mouse TTF-I and human TTF-I reveal that the major determinant for species-specific DNA binding resides within the C terminus of TTF-I. Replacing 31 C-terminal amino acids of mouse TTF-I with the homologous human sequences relaxes the DNA-binding specificity and, as a consequence, allows the chimeric factor to bind the human terminator sequence and to specifically stop rDNA transcription. Images Fig. 2 Fig. 3 Fig. 4 PMID:7597036

Nuclear Mitochondrial DNA Activates Replication in Saccharomyces cerevisiae

PubMed Central

Chatre, Laurent; Ricchetti, Miria

2011-01-01

The nuclear genome of eukaryotes is colonized by DNA fragments of mitochondrial origin, called NUMTs. These insertions have been associated with a variety of germ-line diseases in humans. The significance of this uptake of potentially dangerous sequences into the nuclear genome is unclear. Here we provide functional evidence that sequences of mitochondrial origin promote nuclear DNA replication in Saccharomyces cerevisiae. We show that NUMTs are rich in key autonomously replicating sequence (ARS) consensus motifs, whose mutation results in the reduction or loss of DNA replication activity. Furthermore, 2D-gel analysis of the mrc1 mutant exposed to hydroxyurea shows that several NUMTs function as late chromosomal origins. We also show that NUMTs located close to or within ARS provide key sequence elements for replication. Thus NUMTs can act as independent origins, when inserted in an appropriate genomic context or affect the efficiency of pre-existing origins. These findings show that migratory mitochondrial DNAs can impact on the replication of the nuclear region they are inserted in. PMID:21408151

Nuclear mitochondrial DNA activates replication in Saccharomyces cerevisiae.

PubMed

Chatre, Laurent; Ricchetti, Miria

2011-03-08

The nuclear genome of eukaryotes is colonized by DNA fragments of mitochondrial origin, called NUMTs. These insertions have been associated with a variety of germ-line diseases in humans. The significance of this uptake of potentially dangerous sequences into the nuclear genome is unclear. Here we provide functional evidence that sequences of mitochondrial origin promote nuclear DNA replication in Saccharomyces cerevisiae. We show that NUMTs are rich in key autonomously replicating sequence (ARS) consensus motifs, whose mutation results in the reduction or loss of DNA replication activity. Furthermore, 2D-gel analysis of the mrc1 mutant exposed to hydroxyurea shows that several NUMTs function as late chromosomal origins. We also show that NUMTs located close to or within ARS provide key sequence elements for replication. Thus NUMTs can act as independent origins, when inserted in an appropriate genomic context or affect the efficiency of pre-existing origins. These findings show that migratory mitochondrial DNAs can impact on the replication of the nuclear region they are inserted in.

Repetitive DNA loci and their modulation by the non-canonical nucleic acid structures R-loops and G-quadruplexes

PubMed Central

Hall, Amanda C.; Ostrowski, Lauren A.; Mekhail, Karim

2017-01-01

ABSTRACT Cells have evolved intricate mechanisms to maintain genome stability despite allowing mutational changes to drive evolutionary adaptation. Repetitive DNA sequences, which represent the bulk of most genomes, are a major threat to genome stability often driving chromosome rearrangements and disease. The major source of repetitive DNA sequences and thus the most vulnerable constituents of the genome are the rDNA (rDNA) repeats, telomeres, and transposable elements. Maintaining the stability of these loci is critical to overall cellular fitness and lifespan. Therefore, cells have evolved mechanisms to regulate rDNA copy number, telomere length and transposon activity, as well as DNA repair at these loci. In addition, non-canonical structure-forming DNA motifs can also modulate the function of these repetitive DNA loci by impacting their transcription, replication, and stability. Here, we discuss key mechanisms that maintain rDNA repeats, telomeres, and transposons in yeast and human before highlighting emerging roles for non-canonical DNA structures at these repetitive loci. PMID:28406751

Ribosomal DNA Organization Before and After Magnification in Drosophila melanogaster

PubMed Central

Bianciardi, Alessio; Boschi, Manuela; Swanson, Ellen E.; Belloni, Massimo; Robbins, Leonard G.

2012-01-01

In all eukaryotes, the ribosomal RNA genes are stably inherited redundant elements. In Drosophila melanogaster, the presence of a Ybb− chromosome in males, or the maternal presence of the Ribosomal exchange (Rex) element, induces magnification: a heritable increase of rDNA copy number. To date, several alternative classes of mechanisms have been proposed for magnification: in situ replication or extra-chromosomal replication, either of which might act on short or extended strings of rDNA units, or unequal sister chromatid exchange. To eliminate some of these hypotheses, none of which has been clearly proven, we examined molecular-variant composition and compared genetic maps of the rDNA in the bb2 mutant and in some magnified bb+ alleles. The genetic markers used are molecular-length variants of IGS sequences and of R1 and R2 mobile elements present in many 28S sequences. Direct comparison of PCR products does not reveal any particularly intensified electrophoretic bands in magnified alleles compared to the nonmagnified bb2 allele. Hence, the increase of rDNA copy number is diluted among multiple variants. We can therefore reject mechanisms of magnification based on multiple rounds of replication of short strings. Moreover, we find no changes of marker order when pre- and postmagnification maps are compared. Thus, we can further restrict the possible mechanisms to two: replication in situ of an extended string of rDNA units or unequal exchange between sister chromatids. PMID:22505623

The CGTCA sequence motif is essential for biological activity of the vasoactive intestinal peptide gene cAMP-regulated enhancer.

PubMed Central

Fink, J S; Verhave, M; Kasper, S; Tsukada, T; Mandel, G; Goodman, R H

1988-01-01

cAMP-regulated transcription of the human vasoactive intestinal peptide gene is dependent upon a 17-base-pair DNA element located 70 base pairs upstream from the transcriptional initiation site. This element is similar to sequences in other genes known to be regulated by cAMP and to sequences in several viral enhancers. We have demonstrated that the vasoactive intestinal peptide regulatory element is an enhancer that depends upon the integrity of two CGTCA sequence motifs for biological activity. Mutations in either of the CGTCA motifs diminish the ability of the element to respond to cAMP. Enhancers containing the CGTCA motif from the somatostatin and adenovirus genes compete for binding of nuclear proteins from C6 glioma and PC12 cells to the vasoactive intestinal peptide enhancer, suggesting that CGTCA-containing enhancers interact with similar transacting factors. Images PMID:2842787

ngs.plot: Quick mining and visualization of next-generation sequencing data by integrating genomic databases.

PubMed

Shen, Li; Shao, Ningyi; Liu, Xiaochuan; Nestler, Eric

2014-04-15

Understanding the relationship between the millions of functional DNA elements and their protein regulators, and how they work in conjunction to manifest diverse phenotypes, is key to advancing our understanding of the mammalian genome. Next-generation sequencing technology is now used widely to probe these protein-DNA interactions and to profile gene expression at a genome-wide scale. As the cost of DNA sequencing continues to fall, the interpretation of the ever increasing amount of data generated represents a considerable challenge. We have developed ngs.plot - a standalone program to visualize enrichment patterns of DNA-interacting proteins at functionally important regions based on next-generation sequencing data. We demonstrate that ngs.plot is not only efficient but also scalable. We use a few examples to demonstrate that ngs.plot is easy to use and yet very powerful to generate figures that are publication ready. We conclude that ngs.plot is a useful tool to help fill the gap between massive datasets and genomic information in this era of big sequencing data.

ngs.plot: Quick mining and visualization of next-generation sequencing data by integrating genomic databases

PubMed Central

2014-01-01

Background Understanding the relationship between the millions of functional DNA elements and their protein regulators, and how they work in conjunction to manifest diverse phenotypes, is key to advancing our understanding of the mammalian genome. Next-generation sequencing technology is now used widely to probe these protein-DNA interactions and to profile gene expression at a genome-wide scale. As the cost of DNA sequencing continues to fall, the interpretation of the ever increasing amount of data generated represents a considerable challenge. Results We have developed ngs.plot – a standalone program to visualize enrichment patterns of DNA-interacting proteins at functionally important regions based on next-generation sequencing data. We demonstrate that ngs.plot is not only efficient but also scalable. We use a few examples to demonstrate that ngs.plot is easy to use and yet very powerful to generate figures that are publication ready. Conclusions We conclude that ngs.plot is a useful tool to help fill the gap between massive datasets and genomic information in this era of big sequencing data. PMID:24735413

Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing

PubMed Central

Eastman, Alexander W.; Yuan, Ze-Chun

2015-01-01

Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing projects. PMID:25653642

Transcription of highly repetitive tandemly organized DNA in amphibians and birds: A historical overview and modern concepts.

PubMed

Trofimova, Irina; Krasikova, Alla

2016-12-01

Tandemly organized highly repetitive DNA sequences are crucial structural and functional elements of eukaryotic genomes. Despite extensive evidence, satellite DNA remains an enigmatic part of the eukaryotic genome, with biological role and significance of tandem repeat transcripts remaining rather obscure. Data on tandem repeats transcription in amphibian and avian model organisms is fragmentary despite their genomes being thoroughly characterized. Review systematically covers historical and modern data on transcription of amphibian and avian satellite DNA in somatic cells and during meiosis when chromosomes acquire special lampbrush form. We highlight how transcription of tandemly repetitive DNA sequences is organized in interphase nucleus and on lampbrush chromosomes. We offer LTR-activation hypotheses of widespread satellite DNA transcription initiation during oogenesis. Recent explanations are provided for the significance of high-yield production of non-coding RNA derived from tandemly organized highly repetitive DNA. In many cases the data on the transcription of satellite DNA can be extrapolated from lampbrush chromosomes to interphase chromosomes. Lampbrush chromosomes with applied novel technical approaches such as superresolution imaging, chromosome microdissection followed by high-throughput sequencing, dynamic observation in life-like conditions provide amazing opportunities for investigation mechanisms of the satellite DNA transcription.

Transcription of highly repetitive tandemly organized DNA in amphibians and birds: A historical overview and modern concepts

PubMed Central

Krasikova, Alla

2016-01-01

ABSTRACT Tandemly organized highly repetitive DNA sequences are crucial structural and functional elements of eukaryotic genomes. Despite extensive evidence, satellite DNA remains an enigmatic part of the eukaryotic genome, with biological role and significance of tandem repeat transcripts remaining rather obscure. Data on tandem repeats transcription in amphibian and avian model organisms is fragmentary despite their genomes being thoroughly characterized. Review systematically covers historical and modern data on transcription of amphibian and avian satellite DNA in somatic cells and during meiosis when chromosomes acquire special lampbrush form. We highlight how transcription of tandemly repetitive DNA sequences is organized in interphase nucleus and on lampbrush chromosomes. We offer LTR-activation hypotheses of widespread satellite DNA transcription initiation during oogenesis. Recent explanations are provided for the significance of high-yield production of non-coding RNA derived from tandemly organized highly repetitive DNA. In many cases the data on the transcription of satellite DNA can be extrapolated from lampbrush chromosomes to interphase chromosomes. Lampbrush chromosomes with applied novel technical approaches such as superresolution imaging, chromosome microdissection followed by high-throughput sequencing, dynamic observation in life-like conditions provide amazing opportunities for investigation mechanisms of the satellite DNA transcription. PMID:27763817

The identification of cis-regulatory elements: A review from a machine learning perspective.

PubMed

Li, Yifeng; Chen, Chih-Yu; Kaye, Alice M; Wasserman, Wyeth W

2015-12-01

The majority of the human genome consists of non-coding regions that have been called junk DNA. However, recent studies have unveiled that these regions contain cis-regulatory elements, such as promoters, enhancers, silencers, insulators, etc. These regulatory elements can play crucial roles in controlling gene expressions in specific cell types, conditions, and developmental stages. Disruption to these regions could contribute to phenotype changes. Precisely identifying regulatory elements is key to deciphering the mechanisms underlying transcriptional regulation. Cis-regulatory events are complex processes that involve chromatin accessibility, transcription factor binding, DNA methylation, histone modifications, and the interactions between them. The development of next-generation sequencing techniques has allowed us to capture these genomic features in depth. Applied analysis of genome sequences for clinical genetics has increased the urgency for detecting these regions. However, the complexity of cis-regulatory events and the deluge of sequencing data require accurate and efficient computational approaches, in particular, machine learning techniques. In this review, we describe machine learning approaches for predicting transcription factor binding sites, enhancers, and promoters, primarily driven by next-generation sequencing data. Data sources are provided in order to facilitate testing of novel methods. The purpose of this review is to attract computational experts and data scientists to advance this field. Crown Copyright © 2015. Published by Elsevier Ireland Ltd. All rights reserved.

The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

PubMed

Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

2016-08-01

The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.

Single-Stranded DNA Aptamers against Pathogens and Toxins: Identification and Biosensing Applications

PubMed Central

Hong, Ka Lok

2015-01-01

Molecular recognition elements (MREs) can be short sequences of single-stranded DNA, RNA, small peptides, or antibody fragments. They can bind to user-defined targets with high affinity and specificity. There has been an increasing interest in the identification and application of nucleic acid molecular recognition elements, commonly known as aptamers, since they were first described in 1990 by the Gold and Szostak laboratories. A large number of target specific nucleic acids MREs and their applications are currently in the literature. This review first describes the general methodologies used in identifying single-stranded DNA (ssDNA) aptamers. It then summarizes advancements in the identification and biosensing application of ssDNA aptamers specific for bacteria, viruses, their associated molecules, and selected chemical toxins. Lastly, an overview of the basic principles of ssDNA aptamer-based biosensors is discussed. PMID:26199940

Genome-wide mapping of DNase I hypersensitive sites in rare cell populations using single-cell DNase sequencing.

PubMed

Cooper, James; Ding, Yi; Song, Jiuzhou; Zhao, Keji

2017-11-01

Increased chromatin accessibility is a feature of cell-type-specific cis-regulatory elements; therefore, mapping of DNase I hypersensitive sites (DHSs) enables the detection of active regulatory elements of transcription, including promoters, enhancers, insulators and locus-control regions. Single-cell DNase sequencing (scDNase-seq) is a method of detecting genome-wide DHSs when starting with either single cells or <1,000 cells from primary cell sources. This technique enables genome-wide mapping of hypersensitive sites in a wide range of cell populations that cannot be analyzed using conventional DNase I sequencing because of the requirement for millions of starting cells. Fresh cells, formaldehyde-cross-linked cells or cells recovered from formalin-fixed paraffin-embedded (FFPE) tissue slides are suitable for scDNase-seq assays. To generate scDNase-seq libraries, cells are lysed and then digested with DNase I. Circular carrier plasmid DNA is included during subsequent DNA purification and library preparation steps to prevent loss of the small quantity of DHS DNA. Libraries are generated for high-throughput sequencing on the Illumina platform using standard methods. Preparation of scDNase-seq libraries requires only 2 d. The materials and molecular biology techniques described in this protocol should be accessible to any general molecular biology laboratory. Processing of high-throughput sequencing data requires basic bioinformatics skills and uses publicly available bioinformatics software.

A new family of polymerases related to superfamily A DNA polymerases and T7-like DNA-dependent RNA polymerases.

PubMed

Iyer, Lakshminarayan M; Abhiman, Saraswathi; Aravind, L

2008-10-04

Using sequence profile methods and structural comparisons we characterize a previously unknown family of nucleic acid polymerases in a group of mobile elements from genomes of diverse bacteria, an algal plastid and certain DNA viruses, including the recently reported Sputnik virus. Using contextual information from domain architectures and gene-neighborhoods we present evidence that they are likely to possess both primase and DNA polymerase activity, comparable to the previously reported prim-pol proteins. These newly identified polymerases help in defining the minimal functional core of superfamily A DNA polymerases and related RNA polymerases. Thus, they provide a framework to understand the emergence of both DNA and RNA polymerization activity in this class of enzymes. They also provide evidence that enigmatic DNA viruses, such as Sputnik, might have emerged from mobile elements coding these polymerases.

A new family of polymerases related to superfamily A DNA polymerases and T7-like DNA-dependent RNA polymerases

PubMed Central

Iyer, Lakshminarayan M; Abhiman, Saraswathi; Aravind, L

2008-01-01

Using sequence profile methods and structural comparisons we characterize a previously unknown family of nucleic acid polymerases in a group of mobile elements from genomes of diverse bacteria, an algal plastid and certain DNA viruses, including the recently reported Sputnik virus. Using contextual information from domain architectures and gene-neighborhoods we present evidence that they are likely to possess both primase and DNA polymerase activity, comparable to the previously reported prim-pol proteins. These newly identified polymerases help in defining the minimal functional core of superfamily A DNA polymerases and related RNA polymerases. Thus, they provide a framework to understand the emergence of both DNA and RNA polymerization activity in this class of enzymes. They also provide evidence that enigmatic DNA viruses, such as Sputnik, might have emerged from mobile elements coding these polymerases. This article was reviewed by Eugene Koonin and Mark Ragan. PMID:18834537

Structural basis of DNA target recognition by the B3 domain of Arabidopsis epigenome reader VAL1

PubMed Central

Sasnauskas, Giedrius; Kauneckaitė, Kotryna; Siksnys, Virginijus

2018-01-01

Abstract Arabidopsis thaliana requires a prolonged period of cold exposure during winter to initiate flowering in a process termed vernalization. Exposure to cold induces epigenetic silencing of the FLOWERING LOCUS C (FLC) gene by Polycomb group (PcG) proteins. A key role in this epigenetic switch is played by transcriptional repressors VAL1 and VAL2, which specifically recognize Sph/RY DNA sequences within FLC via B3 DNA binding domains, and mediate recruitment of PcG silencing machinery. To understand the structural mechanism of site-specific DNA recognition by VAL1, we have solved the crystal structure of VAL1 B3 domain (VAL1-B3) bound to a 12 bp oligoduplex containing the canonical Sph/RY DNA sequence 5′-CATGCA-3′/5′-TGCATG-3′. We find that VAL1-B3 makes H-bonds and van der Waals contacts to DNA bases of all six positions of the canonical Sph/RY element. In agreement with the structure, in vitro DNA binding studies show that VAL1-B3 does not tolerate substitutions at any position of the 5′-TGCATG-3′ sequence. The VAL1-B3–DNA structure presented here provides a structural model for understanding the specificity of plant B3 domains interacting with the Sph/RY and other DNA sequences. PMID:29660015

The Organization of Repetitive DNA in the Genomes of Amazonian Lizard Species in the Family Teiidae.

PubMed

Carvalho, Natalia D M; Pinheiro, Vanessa S S; Carmo, Edson J; Goll, Leonardo G; Schneider, Carlos H; Gross, Maria C

2015-01-01

Repetitive DNA is the largest fraction of the eukaryote genome and comprises tandem and dispersed sequences. It presents variations in relation to its composition, number of copies, distribution, dynamics, and genome organization, and participates in the evolutionary diversification of different vertebrate species. Repetitive sequences are usually located in the heterochromatin of centromeric and telomeric regions of chromosomes, contributing to chromosomal structures. Therefore, the aim of this study was to physically map repetitive DNA sequences (5S rDNA, telomeric sequences, tropomyosin gene 1, and retroelements Rex1 and SINE) of mitotic chromosomes of Amazonian species of teiids (Ameiva ameiva, Cnemidophorus sp. 1, Kentropyx calcarata, Kentropyx pelviceps, and Tupinambis teguixin) to understand their genome organization and karyotype evolution. The mapping of repetitive sequences revealed a distinct pattern in Cnemidophorus sp. 1, whereas the other species showed all sequences interspersed in the heterochromatic region. Physical mapping of the tropomyosin 1 gene was performed for the first time in lizards and showed that in addition to being functional, this gene has a structural function similar to the mapped repetitive elements as it is located preferentially in centromeric regions and termini of chromosomes. © 2016 S. Karger AG, Basel.

An Efficient Method for Electroporation of Small Interfering RNAs into ENCODE Project Tier 1 GM12878 and K562 Cell Lines.

PubMed

Muller, Ryan Y; Hammond, Ming C; Rio, Donald C; Lee, Yeon J

2015-12-01

The Encyclopedia of DNA Elements (ENCODE) Project aims to identify all functional sequence elements in the human genome sequence by use of high-throughput DNA/cDNA sequencing approaches. To aid the standardization, comparison, and integration of data sets produced from different technologies and platforms, the ENCODE Consortium selected several standard human cell lines to be used by the ENCODE Projects. The Tier 1 ENCODE cell lines include GM12878, K562, and H1 human embryonic stem cell lines. GM12878 is a lymphoblastoid cell line, transformed with the Epstein-Barr virus, that was selected by the International HapMap Project for whole genome and transcriptome sequencing by use of the Illumina platform. K562 is an immortalized myelogenous leukemia cell line. The GM12878 cell line is attractive for the ENCODE Projects, as it offers potential synergy with the International HapMap Project. Despite the vast amount of sequencing data available on the GM12878 cell line through the ENCODE Project, including transcriptome, chromatin immunoprecipitation-sequencing for histone marks, and transcription factors, no small interfering siRNA-mediated knockdown studies have been performed in the GM12878 cell line, as cationic lipid-mediated transfection methods are inefficient for lymphoid cell lines. Here, we present an efficient and reproducible method for transfection of a variety of siRNAs into the GM12878 and K562 cell lines, which subsequently results in targeted protein depletion.

Is a Genome a Codeword of an Error-Correcting Code?

PubMed Central

Kleinschmidt, João H.; Silva-Filho, Márcio C.; Bim, Edson; Herai, Roberto H.; Yamagishi, Michel E. B.; Palazzo, Reginaldo

2012-01-01

Since a genome is a discrete sequence, the elements of which belong to a set of four letters, the question as to whether or not there is an error-correcting code underlying DNA sequences is unavoidable. The most common approach to answering this question is to propose a methodology to verify the existence of such a code. However, none of the methodologies proposed so far, although quite clever, has achieved that goal. In a recent work, we showed that DNA sequences can be identified as codewords in a class of cyclic error-correcting codes known as Hamming codes. In this paper, we show that a complete intron-exon gene, and even a plasmid genome, can be identified as a Hamming code codeword as well. Although this does not constitute a definitive proof that there is an error-correcting code underlying DNA sequences, it is the first evidence in this direction. PMID:22649495

Neurotoxic Doses of Chronic Methamphetamine Trigger Retrotransposition of the Identifier Element in Rat Dorsal Dentate Gyrus

PubMed Central

Moszczynska, Anna; Burghardt, Kyle J.; Yu, Dongyue

2017-01-01

Short interspersed elements (SINEs) are typically silenced by DNA hypermethylation in somatic cells, but can retrotranspose in proliferating cells during adult neurogenesis. Hypomethylation caused by disease pathology or genotoxic stress leads to genomic instability of SINEs. The goal of the present investigation was to determine whether neurotoxic doses of binge or chronic methamphetamine (METH) trigger retrotransposition of the identifier (ID) element, a member of the rat SINE family, in the dentate gyrus genomic DNA. Adult male Sprague-Dawley rats were treated with saline or high doses of binge or chronic METH and sacrificed at three different time points thereafter. DNA methylation analysis, immunohistochemistry and next-generation sequencing (NGS) were performed on the dorsal dentate gyrus samples. Binge METH triggered hypomethylation, while chronic METH triggered hypermethylation of the CpG-2 site. Both METH regimens were associated with increased intensities in poly(A)-binding protein 1 (PABP1, a SINE regulatory protein)-like immunohistochemical staining in the dentate gyrus. The amplification of several ID element sequences was significantly higher in the chronic METH group than in the control group a week after METH, and they mapped to genes coding for proteins regulating cell growth and proliferation, transcription, protein function as well as for a variety of transporters. The results suggest that chronic METH induces ID element retrotransposition in the dorsal dentate gyrus and may affect hippocampal neurogenesis. PMID:28272323

The application of the high throughput sequencing technology in the transposable elements.

PubMed

Liu, Zhen; Xu, Jian-hong

2015-09-01

High throughput sequencing technology has dramatically improved the efficiency of DNA sequencing, and decreased the costs to a great extent. Meanwhile, this technology usually has advantages of better specificity, higher sensitivity and accuracy. Therefore, it has been applied to the research on genetic variations, transcriptomics and epigenomics. Recently, this technology has been widely employed in the studies of transposable elements and has achieved fruitful results. In this review, we summarize the application of high throughput sequencing technology in the fields of transposable elements, including the estimation of transposon content, preference of target sites and distribution, insertion polymorphism and population frequency, identification of rare copies, transposon horizontal transfers as well as transposon tagging. We also briefly introduce the major common sequencing strategies and algorithms, their advantages and disadvantages, and the corresponding solutions. Finally, we envision the developing trends of high throughput sequencing technology, especially the third generation sequencing technology, and its application in transposon studies in the future, hopefully providing a comprehensive understanding and reference for related scientific researchers.

Mavericks, a novel class of giant transposable elements widespread in eukaryotes and related to DNA viruses.

PubMed

Pritham, Ellen J; Putliwala, Tasneem; Feschotte, Cédric

2007-04-01

We previously identified a group of atypical mobile elements designated Mavericks from the nematodes Caenorhabditis elegans and C. briggsae and the zebrafish Danio rerio. Here we present the results of comprehensive database searches of the genome sequences available, which reveal that Mavericks are widespread in invertebrates and non-mammalian vertebrates but show a patchy distribution in non-animal species, being present in the fungi Glomus intraradices and Phakopsora pachyrhizi and in several single-celled eukaryotes such as the ciliate Tetrahymena thermophila, the stramenopile Phytophthora infestans and the trichomonad Trichomonas vaginalis, but not detectable in plants. This distribution, together with comparative and phylogenetic analyses of Maverick-encoded proteins, is suggestive of an ancient origin of these elements in eukaryotes followed by lineage-specific losses and/or recurrent episodes of horizontal transmission. In addition, we report that Maverick elements have amplified recently to high copy numbers in T. vaginalis where they now occupy as much as 30% of the genome. Sequence analysis confirms that most Mavericks encode a retroviral-like integrase, but lack other open reading frames typically found in retroelements. Nevertheless, the length and conservation of the target site duplication created upon Maverick insertion (5- or 6-bp) is consistent with a role of the integrase-like protein in the integration of a double-stranded DNA transposition intermediate. Mavericks also display long terminal-inverted repeats but do not contain ORFs similar to proteins encoded by DNA transposons. Instead, Mavericks encode a conserved set of 5 to 9 genes (in addition to the integrase) that are predicted to encode proteins with homology to replication and packaging proteins of some bacteriophages and diverse eukaryotic double-stranded DNA viruses, including a DNA polymerase B homolog and putative capsid proteins. Based on these and other structural similarities, we speculate that Mavericks represent an evolutionary missing link between seemingly disparate invasive DNA elements that include bacteriophages, adenoviruses and eukaryotic linear plasmids.

Repeated extragenic sequences in prokaryotic genomes: a proposal for the origin and dynamics of the RUP element in Streptococcus pneumoniae.

PubMed

Oggioni, M R; Claverys, J P

1999-10-01

A survey of all Streptococcus pneumoniae GenBank/EMBL DNA sequence entries and of the public domain sequence (representing more than 90% of the genome) of an S. pneumoniae type 4 strain allowed identification of 108 copies of a 107-bp-long highly repeated intergenic element called RUP (for repeat unit of pneumococcus). Several features of the element, revealed in this study, led to the proposal that RUP is an insertion sequence (IS)-derivative that could still be mobile. Among these features are: (1) a highly significant homology between the terminal inverted repeats (IRs) of RUPs and of IS630-Spn1, a new putative IS of S. pneumoniae; and (2) insertion at a TA dinucleotide, a characteristic target of several members of the IS630 family. Trans-mobilization of RUP is therefore proposed to be mediated by the transposase of IS630-Spn1. To account for the observation that RUPs are distributed among four subtypes which exhibit different degrees of sequence homogeneity, a scenario is invoked based on successive stages of RUP mobility and non-mobility, depending on whether an active transposase is present or absent. In the latter situation, an active transposase could be reintroduced into the species through natural transformation. Examination of sequences flanking RUP revealed a preferential association with ISs. It also provided evidence that RUPs promote sequence rearrangements, thereby contributing to genome flexibility. The possibility that RUP preferentially targets transforming DNA of foreign origin and subsequently favours disruption/rearrangement of exogenous sequences is discussed.

Molecular Cloning and Analysis of a DNA Repetitive Element from the Mouse Genome

ERIC Educational Resources Information Center

Geisinger, Adriana; Cossio, Gabriela; Wettstein, Rodolfo

2006-01-01

We report the development of a 3-week laboratory activity for an undergraduate molecular biology course. This activity introduces students to the practice of basic molecular techniques such as restriction enzyme digestion, agarose gel electrophoresis, cloning, plasmid DNA purification, Southern blotting, and sequencing. Students learn how to carry…

Cyclosporin A and FK-506 both affect DNA binding of regulatory nuclear proteins to the human interleukin-2 promoter.

PubMed

Baumann, G; Geisse, S; Sullivan, M

1991-03-01

The structurally unrelated immunosuppressive drugs cyclosporin A (Sandimmun) and FK-506 both interfere with the process of T-cell proliferation by blocking the transcription of the T-cell growth factor interleukin-2 (IL-2). Here we demonstrate that the transcriptional activation of this gene requires the binding of regulatory nuclear proteins to a promoter element with sequence similarity to the consensus binding site for NF-kappa B-related transcription factors. We present evidence that the binding by regulatory nuclear proteins to the kappa B element of the IL-2 promoter is affected negatively by cyclosporin A and FK-506 at concentrations paralleling their immunosuppressive activity in vivo. The decrease in DNA-protein complex formation induced by the immunosuppressive drugs correlates with a decrease in IL-2 production. FK-506 is 10 to 100 times more potent than cyclosporin A in its ability to inhibit sequence-specific DNA binding and IL-2 production. Our findings suggest that the actions of both drugs converge at the level of DNA-protein interaction.

Molecular structure and chromosome distribution of three repetitive DNA families in Anemone hortensis L. (Ranunculaceae).

PubMed

Mlinarec, Jelena; Chester, Mike; Siljak-Yakovlev, Sonja; Papes, Drazena; Leitch, Andrew R; Besendorfer, Visnja

2009-01-01

The structure, abundance and location of repetitive DNA sequences on chromosomes can characterize the nature of higher plant genomes. Here we report on three new repeat DNA families isolated from Anemone hortensis L.; (i) AhTR1, a family of satellite DNA (stDNA) composed of a 554-561 bp long EcoRV monomer; (ii) AhTR2, a stDNA family composed of a 743 bp long HindIII monomer and; (iii) AhDR, a repeat family composed of a 945 bp long HindIII fragment that exhibits some sequence similarity to Ty3/gypsy-like retroelements. Fluorescence in-situ hybridization (FISH) to metaphase chromosomes of A. hortensis (2n = 16) revealed that both AhTR1 and AhTR2 sequences co-localized with DAPI-positive AT-rich heterochromatic regions. AhTR1 sequences occur at intercalary DAPI bands while AhTR2 sequences occur at 8-10 terminally located heterochromatic blocks. In contrast AhDR sequences are dispersed over all chromosomes as expected of a Ty3/gypsy-like element. AhTR2 and AhTR1 repeat families include polyA- and polyT-tracks, AT/TA-motifs and a pentanucleotide sequence (CAAAA) that may have consequences for chromatin packing and sequence homogeneity. AhTR2 repeats also contain TTTAGGG motifs and degenerate variants. We suggest that they arose by interspersion of telomeric repeats with subtelomeric repeats, before hybrid unit(s) amplified through the heterochromatic domain. The three repetitive DNA families together occupy approximately 10% of the A. hortensis genome. Comparative analyses of eight Anemone species revealed that the divergence of the A. hortensis genome was accompanied by considerable modification and/or amplification of repeats.

Novel green tissue-specific synthetic promoters and cis-regulatory elements in rice.

PubMed

Wang, Rui; Zhu, Menglin; Ye, Rongjian; Liu, Zuoxiong; Zhou, Fei; Chen, Hao; Lin, Yongjun

2015-12-11

As an important part of synthetic biology, synthetic promoter has gradually become a hotspot in current biology. The purposes of the present study were to synthesize green tissue-specific promoters and to discover green tissue-specific cis-elements. We first assembled several regulatory sequences related to tissue-specific expression in different combinations, aiming to obtain novel green tissue-specific synthetic promoters. GUS assays of the transgenic plants indicated 5 synthetic promoters showed green tissue-specific expression patterns and different expression efficiencies in various tissues. Subsequently, we scanned and counted the cis-elements in different tissue-specific promoters based on the plant cis-elements database PLACE and the rice cDNA microarray database CREP for green tissue-specific cis-element discovery, resulting in 10 potential cis-elements. The flanking sequence of one potential core element (GEAT) was predicted by bioinformatics. Then, the combination of GEAT and its flanking sequence was functionally identified with synthetic promoter. GUS assays of the transgenic plants proved its green tissue-specificity. Furthermore, the function of GEAT flanking sequence was analyzed in detail with site-directed mutagenesis. Our study provides an example for the synthesis of rice tissue-specific promoters and develops a feasible method for screening and functional identification of tissue-specific cis-elements with their flanking sequences at the genome-wide level in rice.

Two new miniature inverted-repeat transposable elements in the genome of the clam Donax trunculus.

PubMed

Šatović, Eva; Plohl, Miroslav

2017-10-01

Repetitive sequences are important components of eukaryotic genomes that drive their evolution. Among them are different types of mobile elements that share the ability to spread throughout the genome and form interspersed repeats. To broaden the generally scarce knowledge on bivalves at the genome level, in the clam Donax trunculus we described two new non-autonomous DNA transposons, miniature inverted-repeat transposable elements (MITEs), named DTC M1 and DTC M2. Like other MITEs, they are characterized by their small size, their A + T richness, and the presence of terminal inverted repeats (TIRs). DTC M1 and DTC M2 are 261 and 286 bp long, respectively, and in addition to TIRs, both of them contain a long imperfect palindrome sequence in their central parts. These elements are present in complete and truncated versions within the genome of the clam D. trunculus. The two new MITEs share only structural similarity, but lack any nucleotide sequence similarity to each other. In a search for related elements in databases, blast search revealed within the Crassostrea gigas genome a larger element sharing sequence similarity only to DTC M1 in its TIR sequences. The lack of sequence similarity with any previously published mobile elements indicates that DTC M1 and DTC M2 elements may be unique to D. trunculus.

Analysis of Duck Hepatitis B Virus Reverse Transcription Indicates a Common Mechanism for the Two Template Switches during Plus-Strand DNA Synthesis

PubMed Central

Havert, Michael B.; Ji, Lin; Loeb, Daniel D.

2002-01-01

The synthesis of the hepadnavirus relaxed circular DNA genome requires two template switches, primer translocation and circularization, during plus-strand DNA synthesis. Repeated sequences serve as donor and acceptor templates for these template switches, with direct repeat 1 (DR1) and DR2 for primer translocation and 5′r and 3′r for circularization. These donor and acceptor sequences are at, or near, the ends of the minus-strand DNA. Analysis of plus-strand DNA synthesis of duck hepatitis B virus (DHBV) has indicated that there are at least three other cis-acting sequences that make contributions during the synthesis of relaxed circular DNA. These sequences, 5E, M, and 3E, are located near the 5′ end, the middle, and the 3′ end of minus-strand DNA, respectively. The mechanism by which these sequences contribute to the synthesis of plus-strand DNA was unclear. Our aim was to better understand the mechanism by which 5E and M act. We localized the DHBV 5E element to a short sequence of approximately 30 nucleotides that is 100 nucleotides 3′ of DR2 on minus-strand DNA. We found that the new 5E mutants were partially defective for primer translocation/utilization at DR2. They were also invariably defective for circularization. In addition, examination of several new DHBV M variants indicated that they too were defective for primer translocation/utilization and circularization. Thus, this analysis indicated that 5E and M play roles in both primer translocation/utilization and circularization. In conjunction with earlier findings that 3E functions in both template switches, our findings indicate that the processes of primer translocation and circularization share a common underlying mechanism. PMID:11861843

BIPAD: A web server for modeling bipartite sequence elements

PubMed Central

Bi, Chengpeng; Rogan, Peter K

2006-01-01

Background Many dimeric protein complexes bind cooperatively to families of bipartite nucleic acid sequence elements, which consist of pairs of conserved half-site sequences separated by intervening distances that vary among individual sites. Results We introduce the Bipad Server [1], a web interface to predict sequence elements embedded within unaligned sequences. Either a bipartite model, consisting of a pair of one-block position weight matrices (PWM's) with a gap distribution, or a single PWM matrix for contiguous single block motifs may be produced. The Bipad program performs multiple local alignment by entropy minimization and cyclic refinement using a stochastic greedy search strategy. The best models are refined by maximizing incremental information contents among a set of potential models with varying half site and gap lengths. Conclusion The web service generates information positional weight matrices, identifies binding site motifs, graphically represents the set of discovered elements as a sequence logo, and depicts the gap distribution as a histogram. Server performance was evaluated by generating a collection of bipartite models for distinct DNA binding proteins. PMID:16503993

Optimal Ancient DNA Yields from the Inner Ear Part of the Human Petrous Bone.

PubMed

Pinhasi, Ron; Fernandes, Daniel; Sirak, Kendra; Novak, Mario; Connell, Sarah; Alpaslan-Roodenberg, Songül; Gerritsen, Fokke; Moiseyev, Vyacheslav; Gromov, Andrey; Raczky, Pál; Anders, Alexandra; Pietrusewsky, Michael; Rollefson, Gary; Jovanovic, Marija; Trinhhoang, Hiep; Bar-Oz, Guy; Oxenham, Marc; Matsumura, Hirofumi; Hofreiter, Michael

2015-01-01

The invention and development of next or second generation sequencing methods has resulted in a dramatic transformation of ancient DNA research and allowed shotgun sequencing of entire genomes from fossil specimens. However, although there are exceptions, most fossil specimens contain only low (~ 1% or less) percentages of endogenous DNA. The only skeletal element for which a systematically higher endogenous DNA content compared to other skeletal elements has been shown is the petrous part of the temporal bone. In this study we investigate whether (a) different parts of the petrous bone of archaeological human specimens give different percentages of endogenous DNA yields, (b) there are significant differences in average DNA read lengths, damage patterns and total DNA concentration, and (c) it is possible to obtain endogenous ancient DNA from petrous bones from hot environments. We carried out intra-petrous comparisons for ten petrous bones from specimens from Holocene archaeological contexts across Eurasia dated between 10,000-1,800 calibrated years before present (cal. BP). We obtained shotgun DNA sequences from three distinct areas within the petrous: a spongy part of trabecular bone (part A), the dense part of cortical bone encircling the osseous inner ear, or otic capsule (part B), and the dense part within the otic capsule (part C). Our results confirm that dense bone parts of the petrous bone can provide high endogenous aDNA yields and indicate that endogenous DNA fractions for part C can exceed those obtained for part B by up to 65-fold and those from part A by up to 177-fold, while total endogenous DNA concentrations are up to 126-fold and 109-fold higher for these comparisons. Our results also show that while endogenous yields from part C were lower than 1% for samples from hot (both arid and humid) parts, the DNA damage patterns indicate that at least some of the reads originate from ancient DNA molecules, potentially enabling ancient DNA analyses of samples from hot regions that are otherwise not amenable to ancient DNA analyses.

BiRen: predicting enhancers with a deep-learning-based model using the DNA sequence alone.

PubMed

Yang, Bite; Liu, Feng; Ren, Chao; Ouyang, Zhangyi; Xie, Ziwei; Bo, Xiaochen; Shu, Wenjie

2017-07-01

Enhancer elements are noncoding stretches of DNA that play key roles in controlling gene expression programmes. Despite major efforts to develop accurate enhancer prediction methods, identifying enhancer sequences continues to be a challenge in the annotation of mammalian genomes. One of the major issues is the lack of large, sufficiently comprehensive and experimentally validated enhancers for humans or other species. Thus, the development of computational methods based on limited experimentally validated enhancers and deciphering the transcriptional regulatory code encoded in the enhancer sequences is urgent. We present a deep-learning-based hybrid architecture, BiRen, which predicts enhancers using the DNA sequence alone. Our results demonstrate that BiRen can learn common enhancer patterns directly from the DNA sequence and exhibits superior accuracy, robustness and generalizability in enhancer prediction relative to other state-of-the-art enhancer predictors based on sequence characteristics. Our BiRen will enable researchers to acquire a deeper understanding of the regulatory code of enhancer sequences. Our BiRen method can be freely accessed at https://github.com/wenjiegroup/BiRen . shuwj@bmi.ac.cn or boxc@bmi.ac.cn. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Two-Way Gold Nanoparticle Label-Free Sensing of Specific Sequence and Small Molecule Targets Using Switchable Concatemers.

PubMed

Zhu, Longjiao; Shao, Xiangli; Luo, Yunbo; Huang, Kunlung; Xu, Wentao

2017-05-19

A two-way colorimetric biosensor based on unmodified gold nanoparticles (GNPs) and a switchable double-stranded DNA (dsDNA) concatemer have been demonstrated. Two hairpin probes (H1 and H2) were first designed that provided the fuels to assemble the dsDNA concatemers via hybridization chain reaction (HCR). A functional hairpin (FH) was rationally designed to recognize the target sequences. All the hairpins contained a single-stranded DNA (ssDNA) loop and sticky end to prevent GNPs from salt-induced aggregation. In the presence of target sequence, the capture probe blocked in the FH recognizes the target to form a duplex DNA, which causes the release of the initiator probe by FH conformational change. This process then starts the alternate-opening of H1 and H2 through HCR, and dsDNA concatemers grow from the target sequence. As a result, unmodified GNPs undergo salt-induced aggregation because the formed dsDNA concatemers are stiffer and provide less stabilization. A light purple-to-blue color variation was observed in the bulk solution, termed the light-off sensing way. Furthermore, H1 ingeniously inserted an aptamer sequence to generate dsDNA concatemers with multiple small molecule binding sites. In the presence of small molecule targets, concatemers can be disassembled into mixtures with ssDNA sticky ends. A blue-to-purple reverse color variation was observed due to the regeneration of the ssDNA, termed the light-on way. The two-way biosensor can detect both nucleic acids and small molecule targets with one sensing device. This switchable sensing element is label-free, enzyme-free, and sophisticated-instrumentation-free. The detection limits of both targets were below nanomolar.

Genetic exchange between endogenous and exogenous LINE-1 repetitive elements in mouse cells.

PubMed Central

Belmaaza, A; Wallenburg, J C; Brouillette, S; Gusew, N; Chartrand, P

1990-01-01

The repetitive LINE (L1) elements of the mouse, which are present at about 10(5) copies per genome and share over 80% of sequence homology, were examined for their ability to undergo genetic exchange with exogenous L1 sequences. The exogenous L1 sequences, carried by a shuttle vector, consisted of an internal fragment from L1Md-A2, a previously described member of the L1 family of the mouse. Using an assay that does not require the reconstitution of a selectable marker we found that this vector, in either circular or linear form, acquired DNA sequences from endogenous L1 elements at a frequency of 10(-3) to 10(-4) per rescued vector. Physical analysis of the acquired L1 sequences revealed that distinct endogenous L1 elements acted as donors and that different subfamilies participated. These results demonstrate that L1 elements are readily capable of genetic exchange. Apart from gene conversion events, the acquisition of L1 sequences outside the region of homology suggested that a second mechanism was also involved in the genetic exchange. A model which accounts for this mechanism is presented and its potential implication on the rearrangement of L1 elements is discussed. Images PMID:1978749

LINE-1 retrotransposons: from 'parasite' sequences to functional elements.

PubMed

Paço, Ana; Adega, Filomena; Chaves, Raquel

2015-02-01

Long interspersed nuclear elements-1 (LINE-1) are the most abundant and active retrotransposons in the mammalian genomes. Traditionally, the occurrence of LINE-1 sequences in the genome of mammals has been explained by the selfish DNA hypothesis. Nevertheless, recently, it has also been argued that these sequences could play important roles in these genomes, as in the regulation of gene expression, genome modelling and X-chromosome inactivation. The non-random chromosomal distribution is a striking feature of these retroelements that somehow reflects its functionality. In the present study, we have isolated and analysed a fraction of the open reading frame 2 (ORF2) LINE-1 sequence from three rodent species, Cricetus cricetus, Peromyscus eremicus and Praomys tullbergi. Physical mapping of the isolated sequences revealed an interspersed longitudinal AT pattern of distribution along all the chromosomes of the complement in the three genomes. A detailed analysis shows that these sequences are preferentially located in the euchromatic regions, although some signals could be detected in the heterochromatin. In addition, a coincidence between the location of imprinted gene regions (as Xist and Tsix gene regions) and the LINE-1 retroelements was also observed. According to these results, we propose an involvement of LINE-1 sequences in different genomic events as gene imprinting, X-chromosome inactivation and evolution of repetitive sequences located at the heterochromatic regions (e.g. satellite DNA sequences) of the rodents' genomes analysed.

A label-free DNA hairpin biosensor for colorimetric detection of target with suitable functional DNA partners.

PubMed

Nie, Ji; Zhang, De-Wen; Tie, Cai; Zhou, Ying-Lin; Zhang, Xin-Xiang

2013-11-15

The combination of aptamer and peroxidase-mimicking DNAzyme within a hairpin structure can form a functional DNA probe. The activities of both aptamer (as biorecognition element) and DNAzyme (as signal amplification element) are blocked via base pairing in the hairpin structure. The presence of target triggers the opening of the hairpin to form target/aptamer complex and releases G-quadruplex sequence which can generate amplified colorimetric signals. In this work, we elaborated a universal and simple procedure to design an efficient and sensitive hairpin probe with suitable functional DNA partners. A fill-in-the-blank process was developed for sequence design, and two key points including the pretreatment of the hairpin probe and the selection of suitable signal transducer sequence were proved to enhance the detection sensitivity. Cocaine was chosen as a model target for a proof of concept. A series of hairpins with different numbers of base pairs in the stem region were prepared. Hairpin-C10 with ten base pairs was screened out and a lowest detectable cocaine concentration of 5 μM by colorimetry was obtained. The proposed functional DNA hairpin showed good selectivity and satisfactory analysis in spiked biologic fluid. The whole "mix-and-measure" detection based on DNA hairpin without the need of immobilization and labeling was indicated to be time and labor saving. The strategy has potential to be transplanted into more smart hairpins toward other targets for general application in bioanalytical chemistry. Copyright © 2013 Elsevier B.V. All rights reserved.

Molecular Population Genetics of the Alcohol Dehydrogenase Gene Region of DROSOPHILA MELANOGASTER

PubMed Central

Aquadro, Charles F.; Desse, Susan F.; Bland, Molly M.; Langley, Charles H.; Laurie-Ahlberg, Cathy C.

1986-01-01

Variation in the DNA restriction map of a 13-kb region of chromosome II including the alcohol dehydrogenase structural gene (Adh) was examined in Drosophila melanogaster from natural populations. Detailed analysis of 48 D. melanogaster lines representing four eastern United States populations revealed extensive DNA sequence variation due to base substitutions, insertions and deletions. Cloning of this region from several lines allowed characterization of length variation as due to unique sequence insertions or deletions [nine sizes; 21–200 base pairs (bp)] or transposable element insertions (several sizes, 340 bp to 10.2 kb, representing four different elements). Despite this extensive variation in sequences flanking the Adh gene, only one length polymorphism is clearly associated with altered Adh expression (a copia element approximately 250 bp 5' to the distal transcript start site). Nonetheless, the frequency spectra of transposable elements within and between Drosophila species suggests they are slightly deleterious. Strong nonrandom associations are observed among Adh region sequence variants, ADH allozyme (Fast vs. Slow), ADH enzyme activity and the chromosome inversion ln(2L) t. Phylogenetic analysis of restriction map haplotypes suggest that the major twofold component of ADH activity variation (high vs. low, typical of Fast and Slow allozymes, respectively) is due to sequence variation tightly linked to and possibly distinct from that underlying the allozyme difference. The patterns of nucleotide and haplotype variation for Fast and Slow allozyme lines are consistent with the recent increase in frequency and spread of the Fast haplotype associated with high ADH activity. These data emphasize the important role of evolutionary history and strong nonrandom associations among tightly linked sequence variation as determinants of the patterns of variation observed in natural populations. PMID:3026893

Recognition of the CDEI motif GTCACATG by mouse nuclear proteins and interference with the early development of the mouse embryo.

PubMed Central

Blangy, A; Léopold, P; Vidal, F; Rassoulzadegan, M; Cuzin, F

1991-01-01

We have reported previously (1) two unexpected consequences of the microinjection into fertilized mouse eggs of a recombinant plasmid designated p12B1, carrying a 343 bp insert of non-repetitive mouse DNA. Injected at very low concentrations, this plasmid could be established as an extrachromosomal genetic element. When injected in greater concentration, an early arrest of embryonic development resulted. In the present work, we have studied this toxic effect in more detail by microinjecting short synthetic oligonucleotides with sequences from the mouse insert. Lethality was associated with the nucleotide sequence GTCACATG, identical with the CDEl element of yeast centromeres. Development of injected embryos was arrested between the one-cell and the early morula stages, with abnormal structures and DNA contents. Electrophoretic mobility shift and DNAse foot-printing assays demonstrated the binding of mouse nuclear protein(s) to the CDEl-like box. Base changes within the CDEl sequence prevented both the toxic effects in embryos and the formation of protein complex in vitro, suggesting that protein binding at such sites in chromosomal DNA plays an important role in early development. Images PMID:1766880

The DNA of ciliated protozoa.

PubMed Central

Prescott, D M

1994-01-01

Ciliates contain two types of nuclei: a micronucleus and a macronucleus. The micronucleus serves as the germ line nucleus but does not express its genes. The macronucleus provides the nuclear RNA for vegetative growth. Mating cells exchange haploid micronuclei, and a new macronucleus develops from a new diploid micronucleus. The old macronucleus is destroyed. This conversion consists of amplification, elimination, fragmentation, and splicing of DNA sequences on a massive scale. Fragmentation produces subchromosomal molecules in Tetrahymena and Paramecium cells and much smaller, gene-sized molecules in hypotrichous ciliates to which telomere sequences are added. These molecules are then amplified, some to higher copy numbers than others. rDNA is differentially amplified to thousands of copies per macronucleus. Eliminated sequences include transposonlike elements and sequences called internal eliminated sequences that interrupt gene coding regions in the micronuclear genome. Some, perhaps all, of these are excised as circular molecules and destroyed. In at least some hypotrichs, segments of some micronuclear genes are scrambled in a nonfunctional order and are recorded during macronuclear development. Vegetatively growing ciliates appear to possess a mechanism for adjusting copy numbers of individual genes, which corrects gene imbalances resulting from random distribution of DNA molecules during amitosis of the macronucleus. Other distinctive features of ciliate DNA include an altered use of the conventional stop codons. Images PMID:8078435

[Construction of a general AAV vector regulated by minimal and artificial hypoxic-responsive element].

PubMed

Nie, Xiao-wei; Sun, Li-jun; Hao, Yue-wen; Yang, Guang-xiao; Wang, Quan-ying

2011-03-01

To synthesize the minimal and artificial HRE, and to insert it into the anterior extremity of CMV promoter of a AAV plasmid, and then to construct the AAV regulated by hypoxic-responsive element which was introduced into 293 cell by method of Ca3(PO4)2 using three plasmids. Thus obtaining the adenoassociated virus vector regulated by hypoxic-responsive element was possibly used for gene therapy in ischemia angiocardiopathy and cerebrovascular disease. Artificially synthesize the 36 bp nucleotide sequences of four connection in series HIF-binding sites A/GCGTG(4×HBS)and a 35 bp nucleotide sequences spacing inserted into anterior extremity of CMV promoter TATA Box, then amplified by PCR. The cDNA fragment was confirmed to be right by DNA sequencing. Molecular biology routine method was used to construct a AAV vector regulated by minimal hypoxic-responsive element after the normal CMV promoter in AAV vector was replaced by the CMV promoter included minimal hypoxic-responsive element. Then, NT4-6His-PR39 fusogenic peptide was inserted into MCS of the plasmid, the recombinant AAV vector was obtained by three plasmid co-transfection in 293 cells, in which we can also investigate the expression of 6×His using immunochemistry in hypoxia environment. Artificial HRE was inserted into anterior extremity of CMV promoter and there was a correct spacing between the HRE and the TATA-box. The DNA sequencing and restriction enzyme digestion results indicated that the AAV regulated by hypoxic-responsive element was successfully constructed. Compared to the control group, the expressions of 6×His was significantly increased in the experimental groups in hypoxia environment, which confirmed that the AAV effectually regulated by the minimal HRE was inserted into anterior extremity of CMV promoter. The HRE is inserted into anterior extremity of CMV promoter to lack incision enzyme recognition site by PCR. And eukaryotic expression vector regulated by hypoxic-responsive is constructed. The AAV effectually regulated by the minimal HRE inserted into anterior extremity of CMV promoter. The vector is successfully constructed and it has important theoretical and practical value in the synteresis and therapy of ischemia angiocardiopathy and cerebrovascular disease.

Massive Collection of Full-Length Complementary DNA Clones and Microarray Analyses:. Keys to Rice Transcriptome Analysis

NASA Astrophysics Data System (ADS)

Kikuchi, Shoshi

2009-02-01

Completion of the high-precision genome sequence analysis of rice led to the collection of about 35,000 full-length cDNA clones and the determination of their complete sequences. Mapping of these full-length cDNA sequences has given us information on (1) the number of genes expressed in the rice genome; (2) the start and end positions and exon-intron structures of rice genes; (3) alternative transcripts; (4) possible encoded proteins; (5) non-protein-coding (np) RNAs; (6) the density of gene localization on the chromosome; (7) setting the parameters of gene prediction programs; and (8) the construction of a microarray system that monitors global gene expression. Manual curation for rice gene annotation by using mapping information on full-length cDNA and EST assemblies has revealed about 32,000 expressed genes in the rice genome. Analysis of major gene families, such as those encoding membrane transport proteins (pumps, ion channels, and secondary transporters), along with the evolution from bacteria to higher animals and plants, reveals how gene numbers have increased through adaptation to circumstances. Family-based gene annotation also gives us a new way of comparing organisms. Massive amounts of data on gene expression under many kinds of physiological conditions are being accumulated in rice oligoarrays (22K and 44K) based on full-length cDNA sequences. Cluster analyses of genes that have the same promoter cis-elements, that have similar expression profiles, or that encode enzymes in the same metabolic pathways or signal transduction cascades give us clues to understanding the networks of gene expression in rice. As a tool for that purpose, we recently developed "RiCES", a tool for searching for cis-elements in the promoter regions of clustered genes.

Single-molecule DNA unzipping reveals asymmetric modulation of a transcription factor by its binding site sequence and context

PubMed Central

Rudnizky, Sergei; Khamis, Hadeel; Malik, Omri; Squires, Allison H; Meller, Amit; Melamed, Philippa

2018-01-01

Abstract Most functional transcription factor (TF) binding sites deviate from their ‘consensus’ recognition motif, although their sites and flanking sequences are often conserved across species. Here, we used single-molecule DNA unzipping with optical tweezers to study how Egr-1, a TF harboring three zinc fingers (ZF1, ZF2 and ZF3), is modulated by the sequence and context of its functional sites in the Lhb gene promoter. We find that both the core 9 bp bound to Egr-1 in each of the sites, and the base pairs flanking them, modulate the affinity and structure of the protein–DNA complex. The effect of the flanking sequences is asymmetric, with a stronger effect for the sequence flanking ZF3. Characterization of the dissociation time of Egr-1 revealed that a local, mechanical perturbation of the interactions of ZF3 destabilizes the complex more effectively than a perturbation of the ZF1 interactions. Our results reveal a novel role for ZF3 in the interaction of Egr-1 with other proteins and the DNA, providing insight on the regulation of Lhb and other genes by Egr-1. Moreover, our findings reveal the potential of small changes in DNA sequence to alter transcriptional regulation, and may shed light on the organization of regulatory elements at promoters. PMID:29253225

Evolutional dynamics of 45S and 5S ribosomal DNA in ancient allohexaploid Atropa belladonna.

PubMed

Volkov, Roman A; Panchuk, Irina I; Borisjuk, Nikolai V; Hosiawa-Baranska, Marta; Maluszynska, Jolanta; Hemleben, Vera

2017-01-23

Polyploid hybrids represent a rich natural resource to study molecular evolution of plant genes and genomes. Here, we applied a combination of karyological and molecular methods to investigate chromosomal structure, molecular organization and evolution of ribosomal DNA (rDNA) in nightshade, Atropa belladonna (fam. Solanaceae), one of the oldest known allohexaploids among flowering plants. Because of their abundance and specific molecular organization (evolutionarily conserved coding regions linked to variable intergenic spacers, IGS), 45S and 5S rDNA are widely used in plant taxonomic and evolutionary studies. Molecular cloning and nucleotide sequencing of A. belladonna 45S rDNA repeats revealed a general structure characteristic of other Solanaceae species, and a very high sequence similarity of two length variants, with the only difference in number of short IGS subrepeats. These results combined with the detection of three pairs of 45S rDNA loci on separate chromosomes, presumably inherited from both tetraploid and diploid ancestor species, example intensive sequence homogenization that led to substitution/elimination of rDNA repeats of one parent. Chromosome silver-staining revealed that only four out of six 45S rDNA sites are frequently transcriptionally active, demonstrating nucleolar dominance. For 5S rDNA, three size variants of repeats were detected, with the major class represented by repeats containing all functional IGS elements required for transcription, the intermediate size repeats containing partially deleted IGS sequences, and the short 5S repeats containing severe defects both in the IGS and coding sequences. While shorter variants demonstrate increased rate of based substitution, probably in their transition into pseudogenes, the functional 5S rDNA variants are nearly identical at the sequence level, pointing to their origin from a single parental species. Localization of the 5S rDNA genes on two chromosome pairs further supports uniparental inheritance from the tetraploid progenitor. The obtained molecular, cytogenetic and phylogenetic data demonstrate complex evolutionary dynamics of rDNA loci in allohexaploid species of Atropa belladonna. The high level of sequence unification revealed in 45S and 5S rDNA loci of this ancient hybrid species have been seemingly achieved by different molecular mechanisms.

Identification and positional distribution analysis of transcription factor binding sites for genes from the wheat fl-cDNA sequences.

PubMed

Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui

2017-06-01

The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.

Global Analysis of Transcription Factor-Binding Sites in Yeast Using ChIP-Seq

PubMed Central

Lefrançois, Philippe; Gallagher, Jennifer E. G.; Snyder, Michael

2016-01-01

Transcription factors influence gene expression through their ability to bind DNA at specific regulatory elements. Specific DNA-protein interactions can be isolated through the chromatin immunoprecipitation (ChIP) procedure, in which DNA fragments bound by the protein of interest are recovered. ChIP is followed by high-throughput DNA sequencing (Seq) to determine the genomic provenance of ChIP DNA fragments and their relative abundance in the sample. This chapter describes a ChIP-Seq strategy adapted for budding yeast to enable the genome-wide characterization of binding sites of transcription factors (TFs) and other DNA-binding proteins in an efficient and cost-effective way. Yeast strains with epitope-tagged TFs are most commonly used for ChIP-Seq, along with their matching untagged control strains. The initial step of ChIP involves the cross-linking of DNA and proteins. Next, yeast cells are lysed and sonicated to shear chromatin into smaller fragments. An antibody against an epitope-tagged TF is used to pull down chromatin complexes containing DNA and the TF of interest. DNA is then purified and proteins degraded. Specific barcoded adapters for multiplex DNA sequencing are ligated to ChIP DNA. Short DNA sequence reads (28–36 base pairs) are parsed according to the barcode and aligned against the yeast reference genome, thus generating a nucleotide-resolution map of transcription factor-binding sites and their occupancy. PMID:25213249

Novel Structure of Ty3 Reverse Transcriptase | Center for Cancer Research

Cancer.gov

Retrotransposons are mobile genetic elements that self amplify via a single-stranded RNA intermediate, which is converted to double-stranded DNA by an encoded reverse transcriptase (RT) with both DNA polymerase (pol) and ribonuclease H (RNase) activities. Categorized by whether they contain flanking long terminal repeat (LTR) sequences, retrotransposons play a critical role in

Deppdb--DNA electrostatic potential properties database: electrostatic properties of genome DNA.

PubMed

Osypov, Alexander A; Krutinin, Gleb G; Kamzolova, Svetlana G

2010-06-01

The electrostatic properties of genome DNA influence its interactions with different proteins, in particular, the regulation of transcription by RNA-polymerases. DEPPDB--DNA Electrostatic Potential Properties Database--was developed to hold and provide all available information on the electrostatic properties of genome DNA combined with its sequence and annotation of biological and structural properties of genome elements and whole genomes. Genomes in DEPPDB are organized on a taxonomical basis. Currently, the database contains all the completely sequenced bacterial and viral genomes according to NCBI RefSeq. General properties of the genome DNA electrostatic potential profile and principles of its formation are revealed. This potential correlates with the GC content but does not correspond to it exactly and strongly depends on both the sequence arrangement and its context (flanking regions). Analysis of the promoter regions for bacterial and viral RNA polymerases revealed a correspondence between the scale of these proteins' physical properties and electrostatic profile patterns. We also discovered a direct correlation between the potential value and the binding frequency of RNA polymerase to DNA, supporting the idea of the role of electrostatics in these interactions. This matches a pronounced tendency of the promoter regions to possess higher values of the electrostatic potential.

Pstl repeat: a family of short interspersed nucleotide element (SINE)-like sequences in the genomes of cattle, goat, and buffalo.

PubMed

Sheikh, Faruk G; Mukhopadhyay, Sudit S; Gupta, Prabhakar

2002-02-01

The PstI family of elements are short, highly repetitive DNA sequences interspersed throughout the genome of the Bovidae. We have cloned and sequenced some members of the PstI family from cattle, goat, and buffalo. These elements are approximately 500 bp, have a copy number of 2 x 10(5) - 4 x 10(5), and comprise about 4% of the haploid genome. Studies of nucleotide sequence homology indicate that the buffalo and goat PstI repeats (type II) are similar types of short interspersed nucleotide element (SINE) sequences, but the cattle PstI repeat (type I) is considerably more divergent. Additionally, the goat PstI sequence showed significant sequence homology with bovine serine tRNA, and is therefore likely derived from serine tRNA. Interestingly, Southern hybridization suggests that both types of SINEs (I and II) are present in all the species of Bovidae. Dendrogram analysis indicates that cattle PstI SINE is similar to bovine Alu-like SINEs. Goat and buffalo SINEs formed a separate cluster, suggesting that these two types of SINEs evolved separately in the genome of the Bovidae.

Fine organization of genomic regions tagged to the 5S rDNA locus of the bread wheat 5B chromosome.

PubMed

Sergeeva, Ekaterina M; Shcherban, Andrey B; Adonina, Irina G; Nesterov, Michail A; Beletsky, Alexey V; Rakitin, Andrey L; Mardanov, Andrey V; Ravin, Nikolai V; Salina, Elena A

2017-11-14

The multigene family encoding the 5S rRNA, one of the most important structurally-functional part of the large ribosomal subunit, is an obligate component of all eukaryotic genomes. 5S rDNA has long been a favored target for cytological and phylogenetic studies due to the inherent peculiarities of its structural organization, such as the tandem arrays of repetitive units and their high interspecific divergence. The complex polyploid nature of the genome of bread wheat, Triticum aestivum, and the technically difficult task of sequencing clusters of tandem repeats mean that the detailed organization of extended genomic regions containing 5S rRNA genes remains unclear. This is despite the recent progress made in wheat genomic sequencing. Using pyrosequencing of BAC clones, in this work we studied the organization of two distinct 5S rDNA-tagged regions of the 5BS chromosome of bread wheat. Three BAC-clones containing 5S rDNA were identified in the 5BS chromosome-specific BAC-library of Triticum aestivum. Using the results of pyrosequencing and assembling, we obtained six 5S rDNA- containing contigs with a total length of 140,417 bp, and two sets (pools) of individual 5S rDNA sequences belonging to separate, but closely located genomic regions on the 5BS chromosome. Both regions are characterized by the presence of approximately 70-80 copies of 5S rDNA, however, they are completely different in their structural organization. The first region contained highly diverged short-type 5S rDNA units that were disrupted by multiple insertions of transposable elements. The second region contained the more conserved long-type 5S rDNA, organized as a single tandem array. FISH using probes specific to both 5S rDNA unit types showed differences in the distribution and intensity of signals on the chromosomes of polyploid wheat species and their diploid progenitors. A detailed structural organization of two closely located 5S rDNA-tagged genomic regions on the 5BS chromosome of bread wheat has been established. These two regions differ in the organization of both 5S rDNA and the neighboring sequences comprised of transposable elements, implying different modes of evolution for these regions.

Genomic sequences of murine gamma B- and gamma C-crystallin-encoding genes: promoter analysis and complete evolutionary pattern of mouse, rat and human gamma-crystallins.

PubMed

Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T

1993-12-22

The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.

Variation in the number of nucleoli and incomplete homogenization of 18S ribosomal DNA sequences in leaf cells of the cultivated Oriental ginseng (Panax ginseng Meyer).

PubMed

Chelomina, Galina N; Rozhkovan, Konstantin V; Voronova, Anastasia N; Burundukova, Olga L; Muzarok, Tamara I; Zhuravlev, Yuri N

2016-04-01

Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440-640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine.

Variation in the number of nucleoli and incomplete homogenization of 18S ribosomal DNA sequences in leaf cells of the cultivated Oriental ginseng (Panax ginseng Meyer)

PubMed Central

Chelomina, Galina N.; Rozhkovan, Konstantin V.; Voronova, Anastasia N.; Burundukova, Olga L.; Muzarok, Tamara I.; Zhuravlev, Yuri N.

2015-01-01

Background Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. Methods The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. Results In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440–640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. Conclusion This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine. PMID:27158239

Preservation and Significance of Extracellular DNA in Ferruginous Sediments from Lake Towuti, Indonesia

PubMed Central

Vuillemin, Aurèle; Horn, Fabian; Alawi, Mashal; Henny, Cynthia; Wagner, Dirk; Crowe, Sean A.; Kallmeyer, Jens

2017-01-01

Extracellular DNA is ubiquitous in soil and sediment and constitutes a dominant fraction of environmental DNA in aquatic systems. In theory, extracellular DNA is composed of genomic elements persisting at different degrees of preservation produced by processes occurring on land, in the water column and sediment. Extracellular DNA can be taken up as a nutrient source, excreted or degraded by microorganisms, or adsorbed onto mineral matrices, thus potentially preserving information from past environments. To test whether extracellular DNA records lacustrine conditions, we sequentially extracted extracellular and intracellular DNA from anoxic sediments of ferruginous Lake Towuti, Indonesia. We applied 16S rRNA gene Illumina sequencing on both fractions to discriminate exogenous from endogenous sources of extracellular DNA in the sediment. Environmental sequences exclusively found as extracellular DNA in the sediment originated from multiple sources. For instance, Actinobacteria, Verrucomicrobia, and Acidobacteria derived from soils in the catchment. Limited primary productivity in the water column resulted in few sequences of Cyanobacteria in the oxic photic zone, whereas stratification of the water body mainly led to secondary production by aerobic and anaerobic heterotrophs. Chloroflexi and Planctomycetes, the main degraders of sinking organic matter and planktonic sequences at the water-sediment interface, were preferentially preserved during the initial phase of burial. To trace endogenous sources of extracellular DNA, we used relative abundances of taxa in the intracellular DNA to define which microbial populations grow, decline or persist at low density with sediment depth. Cell lysis became an important additional source of extracellular DNA, gradually covering previous genetic assemblages as other microbial genera became more abundant with depth. The use of extracellular DNA as nutrient by active microorganisms led to selective removal of sequences with lowest GC contents. We conclude that extracellular DNA preserved in shallow lacustrine sediments reflects the initial environmental context, but is gradually modified and thereby shifts from its stratigraphic context. Discrimination of exogenous and endogenous sources of extracellular DNA allows simultaneously addressing in-lake and post-depositional processes. In deeper sediments, the accumulation of resting stages and sequences from cell lysis would require stringent extraction and specific primers if ancient DNA is targeted. PMID:28798742

Caught in the act: the lifetime of synaptic intermediates during the search for homology on DNA

PubMed Central

Mani, Adam; Braslavsky, Ido; Arbel-Goren, Rinat; Stavans, Joel

2010-01-01

Homologous recombination plays pivotal roles in DNA repair and in the generation of genetic diversity. To locate homologous target sequences at which strand exchange can occur within a timescale that a cell’s biology demands, a single-stranded DNA-recombinase complex must search among a large number of sequences on a genome by forming synapses with chromosomal segments of DNA. A key element in the search is the time it takes for the two sequences of DNA to be compared, i.e. the synapse lifetime. Here, we visualize for the first time fluorescently tagged individual synapses formed by RecA, a prokaryotic recombinase, and measure their lifetime as a function of synapse length and differences in sequence between the participating DNAs. Surprisingly, lifetimes can be ∼10 s long when the DNAs are fully heterologous, and much longer for partial homology, consistently with ensemble FRET measurements. Synapse lifetime increases rapidly as the length of a region of full homology at either the 3′- or 5′-ends of the invading single-stranded DNA increases above 30 bases. A few mismatches can reduce dramatically the lifetime of synapses formed with nearly homologous DNAs. These results suggest the need for facilitated homology search mechanisms to locate homology successfully within the timescales observed in vivo. PMID:20044347

A novel self-powered and sensitive label-free DNA biosensor in microbial fuel cell.

PubMed

Asghary, Maryam; Raoof, Jahan Bakhsh; Rahimnejad, Mostafa; Ojani, Reza

2016-08-15

In this work, a novel self-powered, sensitive, low-cost, and label-free DNA biosensor is reported by applying a two-chambered microbial fuel cell (MFC) as a power supply. A graphite electrode and an Au nanoparticles modified graphite electrode (AuNP/graphite electrode) were used as anode and cathode in the MFC system, respectively. The active biocatalyst in the anodic chamber was a mixed culture of microorganisms. The sensing element of the biosensor was fabricated by the well-known Au-thiol binding the ssDNA probe on the surface of an AuNP/graphite cathode. Electrons produced by microorganisms were transported from the anode to the cathode through an external circuit, which could be detected by the terminal multi-meter detector. The difference between power densities of the ssDNA probe modified cathode in the absence and presence of complementary sequence served as the detection signal of the DNA hybridization with detection limit of 3.1nM. Thereafter, this biosensor was employed for diagnosis and determination of complementary sequence in a human serum sample. The hybridization specificity studies further revealed that the developed DNA biosensor could distinguish fully complementary sequences from one-base mismatched and non-complementary sequences. Copyright © 2016 Elsevier B.V. All rights reserved.

cDNA cloning, genomic organization and expression analysis during somatic embryogenesis of the translationally controlled tumor protein (TCTP) gene from Japanese larch (Larix leptolepis).

PubMed

Zhang, Li-Feng; Li, Wan-Feng; Han, Su-Ying; Yang, Wen-Hua; Qi, Li-Wang

2013-10-15

A full-length cDNA and genomic sequences of a translationally controlled tumor protein (TCTP) gene were isolated from Japanese larch (Larix leptolepis) and designated LaTCTP. The length of the cDNA was 1, 043 bp and contained a 504 bp open reading frame that encodes a predicted protein of 167 amino acids, characterized by two signature sequences of the TCTP protein family. Analysis of the LaTCTP gene structure indicated four introns and five exons, and it is the largest of all currently known TCTP genes in plants. The 5'-flanking promoter region of LaTCTP was cloned using an improved TAIL-PCR technique. In this region we identified many important potential cis-acting elements, such as a Box-W1 (fungal elicitor responsive element), a CAT-box (cis-acting regulatory element related to meristem expression), a CGTCA-motif (cis-acting regulatory element involved in MeJA-responsiveness), a GT1-motif (light responsive element), a Skn-1-motif (cis-acting regulatory element required for endosperm expression) and a TGA-element (auxin-responsive element), suggesting that expression of LaTCTP is highly regulated. Expression analysis demonstrated ubiquitous localization of LaTCTP mRNA in the roots, stems and needles, high mRNA levels in the embryonal-suspensor mass (ESM), browning embryogenic cultures and mature somatic embryos, and low levels of mRNA at day five during somatic embryogenesis. We suggest that LaTCTP might participate in the regulation of somatic embryo development. These results provide a theoretical basis for understanding the molecular regulatory mechanism of LaTCTP and lay the foundation for artificial regulation of somatic embryogenesis. © 2013.

An exploration of the sequence of a 2.9-Mb region of the genome of Drosophila melanogaster: the Adh region.

PubMed Central

Ashburner, M; Misra, S; Roote, J; Lewis, S E; Blazej, R; Davis, T; Doyle, C; Galle, R; George, R; Harris, N; Hartzell, G; Harvey, D; Hong, L; Houston, K; Hoskins, R; Johnson, G; Martin, C; Moshrefi, A; Palazzolo, M; Reese, M G; Spradling, A; Tsang, G; Wan, K; Whitelaw, K; Celniker, S

1999-01-01

A contiguous sequence of nearly 3 Mb from the genome of Drosophila melanogaster has been sequenced from a series of overlapping P1 and BAC clones. This region covers 69 chromosome polytene bands on chromosome arm 2L, including the genetically well-characterized "Adh region." A computational analysis of the sequence predicts 218 protein-coding genes, 11 tRNAs, and 17 transposable element sequences. At least 38 of the protein-coding genes are arranged in clusters of from 2 to 6 closely related genes, suggesting extensive tandem duplication. The gene density is one protein-coding gene every 13 kb; the transposable element density is one element every 171 kb. Of 73 genes in this region identified by genetic analysis, 49 have been located on the sequence; P-element insertions have been mapped to 43 genes. Ninety-five (44%) of the known and predicted genes match a Drosophila EST, and 144 (66%) have clear similarities to proteins in other organisms. Genes known to have mutant phenotypes are more likely to be represented in cDNA libraries, and far more likely to have products similar to proteins of other organisms, than are genes with no known mutant phenotype. Over 650 chromosome aberration breakpoints map to this chromosome region, and their nonrandom distribution on the genetic map reflects variation in gene spacing on the DNA. This is the first large-scale analysis of the genome of D. melanogaster at the sequence level. In addition to the direct results obtained, this analysis has allowed us to develop and test methods that will be needed to interpret the complete sequence of the genome of this species.Before beginning a Hunt, it is wise to ask someone what you are looking for before you begin looking for it. Milne 1926 PMID:10471707

Functional and mechanistic diversity of distal transcription enhancers

PubMed Central

Bulger, Michael; Groudine, Mark

2013-01-01

Biological differences among metazoans, and between cell types in a given organism, arise in large part due to differences in gene expression patterns. The sequencing of multiple metazoan genomes, coupled with recent advances in genome-wide analysis of histone modifications and transcription factor binding, has revealed that among regulatory DNA sequences, gene-distal enhancers appear to exhibit the greatest diversity and cell-type specificity. Moreover, such elements are emerging as important targets for mutations that can give rise to disease and to genetic variability that underlies evolutionary change. Studies of long-range interactions between distal genomic sequences in the nucleus indicate that enhancers are often important determinants of nuclear organization, contributing to a general model for enhancer function that involves direct enhancer-promoter contact. In a number of systems, however, mechanisms for enhancer function are emerging that do not fit solely within such a model, suggesting that enhancers as a class of DNA regulatory element may be functionally and mechanistically diverse. PMID:21295696

Complete genome sequences and comparative genome analysis of Lactobacillus plantarum strain 5-2 isolated from fermented soybean.

PubMed

Liu, Chen-Jian; Wang, Rui; Gong, Fu-Ming; Liu, Xiao-Feng; Zheng, Hua-Jun; Luo, Yi-Yong; Li, Xiao-Ran

2015-12-01

Lactobacillus plantarum is an important probiotic and is mostly isolated from fermented foods. We sequenced the genome of L. plantarum strain 5-2, which was derived from fermented soybean isolated from Yunnan province, China. The strain was determined to contain 3114 genes. Fourteen complete insertion sequence (IS) elements were found in 5-2 chromosome. There were 24 DNA replication proteins and 76 DNA repair proteins in the 5-2 genome. Consistent with the classification of L. plantarum as a facultative heterofermentative lactobacillus, the 5-2 genome encodes key enzymes required for the EMP (Embden-Meyerhof-Parnas) and phosphoketolase (PK) pathways. Several components of the secretion machinery are found in the 5-2 genome, which was compared with L. plantarum ST-III, JDM1 and WCFS1. Most of the specific proteins in the four genomes appeared to be related to their prophage elements. Copyright © 2015 Elsevier Inc. All rights reserved.

Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia.

PubMed

Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W

2010-08-01

The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

An optimized and low-cost FPGA-based DNA sequence alignment--a step towards personal genomics.

PubMed

Shah, Hurmat Ali; Hasan, Laiq; Ahmad, Nasir

2013-01-01

DNA sequence alignment is a cardinal process in computational biology but also is much expensive computationally when performing through traditional computational platforms like CPU. Of many off the shelf platforms explored for speeding up the computation process, FPGA stands as the best candidate due to its performance per dollar spent and performance per watt. These two advantages make FPGA as the most appropriate choice for realizing the aim of personal genomics. The previous implementation of DNA sequence alignment did not take into consideration the price of the device on which optimization was performed. This paper presents optimization over previous FPGA implementation that increases the overall speed-up achieved as well as the price incurred by the platform that was optimized. The optimizations are (1) The array of processing elements is made to run on change in input value and not on clock, so eliminating the need for tight clock synchronization, (2) the implementation is unrestrained by the size of the sequences to be aligned, (3) the waiting time required for the sequences to load to FPGA is reduced to the minimum possible and (4) an efficient method is devised to store the output matrix that make possible to save the diagonal elements to be used in next pass, in parallel with the computation of output matrix. Implemented on Spartan3 FPGA, this implementation achieved 20 times performance improvement in terms of CUPS over GPP implementation.

The repetitive landscape of the chicken genome.

PubMed

Wicker, Thomas; Robertson, Jon S; Schulze, Stefan R; Feltus, F Alex; Magrini, Vincent; Morrison, Jason A; Mardis, Elaine R; Wilson, Richard K; Peterson, Daniel G; Paterson, Andrew H; Ivarie, Robert

2005-01-01

Cot-based cloning and sequencing (CBCS) is a powerful tool for isolating and characterizing the various repetitive components of any genome, combining the established principles of DNA reassociation kinetics with high-throughput sequencing. CBCS was used to generate sequence libraries representing the high, middle, and low-copy fractions of the chicken genome. Sequencing high-copy DNA of chicken to about 2.7 x coverage of its estimated sequence complexity led to the initial identification of several new repeat families, which were then used for a survey of the newly released first draft of the complete chicken genome. The analysis provided insight into the diversity and biology of known repeat structures such as CR1 and CNM, for which only limited sequence data had previously been available. Cot sequence data also resulted in the identification of four novel repeats (Birddawg, Hitchcock, Kronos, and Soprano), two new subfamilies of CR1 repeats, and many elements absent from the chicken genome assembly. Multiple autonomous elements were found for a novel Mariner-like transposon, Galluhop, in addition to nonautonomous deletion derivatives. Phylogenetic analysis of the high-copy repeats CR1, Galluhop, and Birddawg provided insight into two distinct genome dispersion strategies. This study also exemplifies the power of the CBCS method to create representative databases for the repetitive fractions of genomes for which only limited sequence data is available.

The repetitive landscape of the chicken genome

PubMed Central

Wicker, Thomas; Robertson, Jon S.; Schulze, Stefan R.; Feltus, F. Alex; Magrini, Vincent; Morrison, Jason A.; Mardis, Elaine R.; Wilson, Richard K.; Peterson, Daniel G.; Paterson, Andrew H.; Ivarie, Robert

2005-01-01

Cot-based cloning and sequencing (CBCS) is a powerful tool for isolating and characterizing the various repetitive components of any genome, combining the established principles of DNA reassociation kinetics with high-throughput sequencing. CBCS was used to generate sequence libraries representing the high, middle, and low-copy fractions of the chicken genome. Sequencing high-copy DNA of chicken to about 2.7× coverage of its estimated sequence complexity led to the initial identification of several new repeat families, which were then used for a survey of the newly released first draft of the complete chicken genome. The analysis provided insight into the diversity and biology of known repeat structures such as CR1 and CNM, for which only limited sequence data had previously been available. Cot sequence data also resulted in the identification of four novel repeats (Birddawg, Hitchcock, Kronos, and Soprano), two new subfamilies of CR1 repeats, and many elements absent from the chicken genome assembly. Multiple autonomous elements were found for a novel Mariner-like transposon, Galluhop, in addition to nonautonomous deletion derivatives. Phylogenetic analysis of the high-copy repeats CR1, Galluhop, and Birddawg provided insight into two distinct genome dispersion strategies. This study also exemplifies the power of the CBCS method to create representative databases for the repetitive fractions of genomes for which only limited sequence data is available. PMID:15256510

The octamer-binding proteins form multi-protein--DNA complexes with the HSV alpha TIF regulatory protein.

PubMed Central

Kristie, T M; LeBowitz, J H; Sharp, P A

1989-01-01

The herpes simplex virus transactivator, alpha TIF, stimulates transcription of the alpha/immediate early genes via a cis-acting site containing an octamer element and a conserved flanking sequence. The alpha TIF protein, produced in a baculovirus expression system, nucleates the formation of at least two DNA--protein complexes on this regulatory element. Both of these complexes contain the ubiquitous Oct-1 protein, whose POU domain alone is sufficient to allow assembly of the alpha TIF-dependent complexes. A second member of the POU domain family, the lymphoid specific Oct-2 protein, can also be assembled into similar complexes at high concentrations of alpha TIF protein. These complexes contain at least two cellular proteins in addition to Oct-1. One of these proteins is present in both insect and HeLa cells and probably recognizes sequences in the cis element. The second cellular protein, only present in HeLa cells, probably binds by protein-protein interactions. Images PMID:2556266

The octamer-binding proteins form multi-protein--DNA complexes with the HSV alpha TIF regulatory protein.

PubMed

Kristie, T M; LeBowitz, J H; Sharp, P A

1989-12-20

The herpes simplex virus transactivator, alpha TIF, stimulates transcription of the alpha/immediate early genes via a cis-acting site containing an octamer element and a conserved flanking sequence. The alpha TIF protein, produced in a baculovirus expression system, nucleates the formation of at least two DNA--protein complexes on this regulatory element. Both of these complexes contain the ubiquitous Oct-1 protein, whose POU domain alone is sufficient to allow assembly of the alpha TIF-dependent complexes. A second member of the POU domain family, the lymphoid specific Oct-2 protein, can also be assembled into similar complexes at high concentrations of alpha TIF protein. These complexes contain at least two cellular proteins in addition to Oct-1. One of these proteins is present in both insect and HeLa cells and probably recognizes sequences in the cis element. The second cellular protein, only present in HeLa cells, probably binds by protein-protein interactions.

DNA Fingerprinting of Lactobacillus crispatus Strain CTV-05 by Repetitive Element Sequence-Based PCR Analysis in a Pilot Study of Vaginal Colonization

PubMed Central

Antonio, May A. D.; Hillier, Sharon L.

2003-01-01

Lactobacillus crispatus is one of the predominant hydrogen peroxide (H2O2)-producing species found in the vagina and is under development as a probiotic for the treatment of bacterial vaginosis. In this study, we assessed whether DNA fingerprinting by repetitive element sequence-based PCR (rep-PCR) can be used to distinguish the capsule strain of L. crispatus (CTV-05) from other endogenous strains as well as other species of vaginal lactobacilli. Vaginal and rectal lactobacilli were identified to the species level by using whole-chromosome probe DNA hybridization. The DNAs from L. crispatus, L. jensenii, L. gasseri, and an as-yet-unnamed H2O2-negative Lactobacillus species designated 1086V were subjected to rep-PCR. The results of gel electrophoresis and ethidium bromide staining of the DNA fingerprints obtained were compared. L. crispatus CTV-05 had a unique DNA fingerprint compared to all other lactobacilli. DNA fingerprints for 27 production lots of L. crispatus sampled from 1994 through 2001 were identical to that of the original strain isolated in 1993, suggesting strain stability. In a pilot study of nine women, this DNA fingerprinting method distinguished CTV-05 from other endogenous vaginal lactobacilli prior to and after vaginal capsule use. rep-PCR DNA fingerprinting is useful for strain typing and for evaluating longitudinal loss or acquisition of vaginal lactobacilli used as probiotics. PMID:12734221

A User's Guide to the Encyclopedia of DNA Elements (ENCODE)

PubMed Central

2011-01-01

The mission of the Encyclopedia of DNA Elements (ENCODE) Project is to enable the scientific and medical communities to interpret the human genome sequence and apply it to understand human biology and improve health. The ENCODE Consortium is integrating multiple technologies and approaches in a collective effort to discover and define the functional elements encoded in the human genome, including genes, transcripts, and transcriptional regulatory regions, together with their attendant chromatin states and DNA methylation patterns. In the process, standards to ensure high-quality data have been implemented, and novel algorithms have been developed to facilitate analysis. Data and derived results are made available through a freely accessible database. Here we provide an overview of the project and the resources it is generating and illustrate the application of ENCODE data to interpret the human genome. PMID:21526222

Complete Genome Sequence of Sporisorium scitamineum and Biotrophic Interaction Transcriptome with Sugarcane

PubMed Central

Benevenuto, Juliana; Peters, Leila P.; Carvalho, Giselle; Palhares, Alessandra; Quecine, Maria C.; Nunes, Filipe R. S.; Kmit, Maria C. P.; Wai, Alvan; Hausner, Georg; Aitken, Karen S.; Berkman, Paul J.; Fraser, James A.; Moolhuijzen, Paula M.; Coutinho, Luiz L.; Creste, Silvana; Vieira, Maria L. C.; Kitajima, João P.; Monteiro-Vitorello, Claudia B.

2015-01-01

Sporisorium scitamineum is a biotrophic fungus responsible for the sugarcane smut, a worldwide spread disease. This study provides the complete sequence of individual chromosomes of S. scitamineum from telomere to telomere achieved by a combination of PacBio long reads and Illumina short reads sequence data, as well as a draft sequence of a second fungal strain. Comparative analysis to previous available sequences of another strain detected few polymorphisms among the three genomes. The novel complete sequence described herein allowed us to identify and annotate extended subtelomeric regions, repetitive elements and the mitochondrial DNA sequence. The genome comprises 19,979,571 bases, 6,677 genes encoding proteins, 111 tRNAs and 3 assembled copies of rDNA, out of our estimated number of copies as 130. Chromosomal reorganizations were detected when comparing to sequences of S. reilianum, the closest smut relative, potentially influenced by repeats of transposable elements. Repetitive elements may have also directed the linkage of the two mating-type loci. The fungal transcriptome profiling from in vitro and from interaction with sugarcane at two time points (early infection and whip emergence) revealed that 13.5% of the genes were differentially expressed in planta and particular to each developmental stage. Among them are plant cell wall degrading enzymes, proteases, lipases, chitin modification and lignin degradation enzymes, sugar transporters and transcriptional factors. The fungus also modulates transcription of genes related to surviving against reactive oxygen species and other toxic metabolites produced by the plant. Previously described effectors in smut/plant interactions were detected but some new candidates are proposed. Ten genomic islands harboring some of the candidate genes unique to S. scitamineum were expressed only in planta. RNAseq data was also used to reassure gene predictions. PMID:26065709

DNA transposons have colonized the genome of the giant virus Pandoravirus salinus.

PubMed

Sun, Cheng; Feschotte, Cédric; Wu, Zhiqiang; Mueller, Rachel Lockridge

2015-06-12

Transposable elements are mobile DNA sequences that are widely distributed in prokaryotic and eukaryotic genomes, where they represent a major force in genome evolution. However, transposable elements have rarely been documented in viruses, and their contribution to viral genome evolution remains largely unexplored. Pandoraviruses are recently described DNA viruses with genome sizes that exceed those of some prokaryotes, rivaling parasitic eukaryotes. These large genomes appear to include substantial noncoding intergenic spaces, which provide potential locations for transposable element insertions. However, no mobile genetic elements have yet been reported in pandoravirus genomes. Here, we report a family of miniature inverted-repeat transposable elements (MITEs) in the Pandoravirus salinus genome, representing the first description of a virus populated with a canonical transposable element family that proliferated by transposition within the viral genome. The MITE family, which we name Submariner, includes 30 copies with all the hallmarks of MITEs: short length, terminal inverted repeats, TA target site duplication, and no coding capacity. Submariner elements show signs of transposition and are undetectable in the genome of Pandoravirus dulcis, the closest known relative Pandoravirus salinus. We identified a DNA transposon related to Submariner in the genome of Acanthamoeba castellanii, a species thought to host pandoraviruses, which contains remnants of coding sequence for a Tc1/mariner transposase. These observations suggest that the Submariner MITEs of P. salinus belong to the widespread Tc1/mariner superfamily and may have been mobilized by an amoebozoan host. Ten of the 30 MITEs in the P. salinus genome are located within coding regions of predicted genes, while others are close to genes, suggesting that these transposons may have contributed to viral genetic novelty. Our discovery highlights the remarkable ability of DNA transposons to colonize and shape genomes from all domains of life, as well as giant viruses. Our findings continue to blur the division between viral and cellular genomes, adhering to the emerging view that the content, dynamics, and evolution of the genomes of giant viruses do not substantially differ from those of cellular organisms.

High-Resolution Whole-Genome Sequencing Reveals That Specific Chromatin Domains from Most Human Chromosomes Associate with Nucleoli

PubMed Central

van Koningsbruggen, Silvana; Gierliński, Marek; Schofield, Pietá; Martin, David; Barton, Geoffey J.; Ariyurek, Yavuz; den Dunnen, Johan T.

2010-01-01

The nuclear space is mostly occupied by chromosome territories and nuclear bodies. Although this organization of chromosomes affects gene function, relatively little is known about the role of nuclear bodies in the organization of chromosomal regions. The nucleolus is the best-studied subnuclear structure and forms around the rRNA repeat gene clusters on the acrocentric chromosomes. In addition to rDNA, other chromatin sequences also surround the nucleolar surface and may even loop into the nucleolus. These additional nucleolar-associated domains (NADs) have not been well characterized. We present here a whole-genome, high-resolution analysis of chromatin endogenously associated with nucleoli. We have used a combination of three complementary approaches, namely fluorescence comparative genome hybridization, high-throughput deep DNA sequencing and photoactivation combined with time-lapse fluorescence microscopy. The data show that specific sequences from most human chromosomes, in addition to the rDNA repeat units, associate with nucleoli in a reproducible and heritable manner. NADs have in common a high density of AT-rich sequence elements, low gene density and a statistically significant enrichment in transcriptionally repressed genes. Unexpectedly, both the direct DNA sequencing and fluorescence photoactivation data show that certain chromatin loci can specifically associate with either the nucleolus, or the nuclear envelope. PMID:20826608

High-resolution whole-genome sequencing reveals that specific chromatin domains from most human chromosomes associate with nucleoli.

PubMed

van Koningsbruggen, Silvana; Gierlinski, Marek; Schofield, Pietá; Martin, David; Barton, Geoffey J; Ariyurek, Yavuz; den Dunnen, Johan T; Lamond, Angus I

2010-11-01

The nuclear space is mostly occupied by chromosome territories and nuclear bodies. Although this organization of chromosomes affects gene function, relatively little is known about the role of nuclear bodies in the organization of chromosomal regions. The nucleolus is the best-studied subnuclear structure and forms around the rRNA repeat gene clusters on the acrocentric chromosomes. In addition to rDNA, other chromatin sequences also surround the nucleolar surface and may even loop into the nucleolus. These additional nucleolar-associated domains (NADs) have not been well characterized. We present here a whole-genome, high-resolution analysis of chromatin endogenously associated with nucleoli. We have used a combination of three complementary approaches, namely fluorescence comparative genome hybridization, high-throughput deep DNA sequencing and photoactivation combined with time-lapse fluorescence microscopy. The data show that specific sequences from most human chromosomes, in addition to the rDNA repeat units, associate with nucleoli in a reproducible and heritable manner. NADs have in common a high density of AT-rich sequence elements, low gene density and a statistically significant enrichment in transcriptionally repressed genes. Unexpectedly, both the direct DNA sequencing and fluorescence photoactivation data show that certain chromatin loci can specifically associate with either the nucleolus, or the nuclear envelope.

Mutations Affecting Expression of the rosy Locus in Drosophila melanogaster

PubMed Central

Lee, Chong Sung; Curtis, Daniel; McCarron, Margaret; Love, Carol; Gray, Mark; Bender, Welcome; Chovnick, Arthur

1987-01-01

The rosy locus in Drosophila melanogaster codes for the enzyme xanthine dehydrogenase (XDH). Previous studies defined a "control element" near the 5' end of the gene, where variant sites affected the amount of rosy mRNA and protein produced. We have determined the DNA sequence of this region from both genomic and cDNA clones, and from the ry+10 underproducer strain. This variant strain had many sequence differences, so that the site of the regulatory change could not be fixed. A mutagenesis was also undertaken to isolate new regulatory mutations. We induced 376 new mutations with 1-ethyl-1-nitrosourea (ENU) and screened them to isolate those that reduced the amount of XDH protein produced, but did not change the properties of the enzyme. Genetic mapping was used to find mutations located near the 5' end of the gene. DNA from each of seven mutants was cloned and sequenced through the 5' region. Mutant base changes were identified in all seven; they appear to affect splicing and translation of the rosy mRNA. In a related study (T. P. Keith et al. 1987), the genomic and cDNA sequences are extended through the 3' end of the gene; the combined sequences define the processing pattern of the rosy transcript and predict the amino acid sequence of XDH. PMID:3036645

Conformation of Tax-response elements in the human T-cell leukemia virus type I promoter.

PubMed

Cox, J M; Sloan, L S; Schepartz, A

1995-12-01

HTLV-I Tax is believed to activate viral gene expression by binding bZIP proteins (such as CREB) and increasing their affinities for proviral TRE target sites. Each 21 bp TRE target site contains an imperfect copy of the intrinsically bent CRE target site (the TRE core) surrounded by highly conserved flanking sequences. These flanking sequences are essential for maximal increases in DNA affinity and transactivation, but they are not, apparently, contacted by protein. Here we employ non-denaturing gel electrophoresis to evaluate TRE conformation in the presence and absence of bZIP proteins, and to explore the role of DNA conformation in viral transactivation. Our results show that the TRE-1 flanking sequences modulate the structure and modestly increase the affinity of a CREB bZIP peptide for the TRE-1 core recognition sequence. These flanking sequences are also essential for a maximal increase in stability of the CREB-DNA complex in the presence of Tax. The CRE-like TRE core and the TRE flanking sequences are both essential for formation of stable CREB-TRE-1 and Tax-CREB-TRE-1 complexes. These two DNA segments may have co-evolved into a unique structure capable of recognizing Tax and a bZIP protein.

Evidence of birth-and-death evolution of 5S rRNA gene in Channa species (Teleostei, Perciformes).

PubMed

Barman, Anindya Sundar; Singh, Mamta; Singh, Rajeev Kumar; Lal, Kuldeep Kumar

2016-12-01

In higher eukaryotes, minor rDNA family codes for 5S rRNA that is arranged in tandem arrays and comprises of a highly conserved 120 bp long coding sequence with a variable non-transcribed spacer (NTS). Initially the 5S rDNA repeats are considered to be evolved by the process of concerted evolution. But some recent reports, including teleost fishes suggested that evolution of 5S rDNA repeat does not fit into the concerted evolution model and evolution of 5S rDNA family may be explained by a birth-and-death evolution model. In order to study the mode of evolution of 5S rDNA repeats in Perciformes fish species, nucleotide sequence and molecular organization of five species of genus Channa were analyzed in the present study. Molecular analyses revealed several variants of 5S rDNA repeats (four types of NTS) and networks created by a neighbor net algorithm for each type of sequences (I, II, III and IV) did not show a clear clustering in species specific manner. The stable secondary structure is predicted and upstream and downstream conserved regulatory elements were characterized. Sequence analyses also shown the presence of two putative pseudogenes in Channa marulius. Present study supported that 5S rDNA repeats in genus Channa were evolved under the process of birth-and-death.

Transcriptional activation of short interspersed elements by DNA-damaging agents.

PubMed

Rudin, C M; Thompson, C B

2001-01-01

Short interspersed elements (SINEs), typified by the human Alu repeat, are RNA polymerase III (pol III)-transcribed sequences that replicate within the genome through an RNA intermediate. Replication of SINEs has been extensive in mammalian evolution: an estimated 5% of the human genome consists of Alu repeats. The mechanisms regulating transcription, reverse transcription, and reinsertion of SINE elements in genomic DNA are poorly understood. Here we report that expression of murine SINE transcripts of both the B1 and B2 classes is strongly upregulated after prolonged exposure to cisplatin, etoposide, or gamma radiation. A similar induction of Alu transcripts in human cells occurs under these conditions. This induction is not due to a general upregulation of pol III activity in either species. Genotoxic treatment of murine cells containing an exogenous human Alu element induced Alu transcription. Concomitant with the increased expression of SINEs, an increase in cellular reverse transcriptase was observed after exposure to these same DNA-damaging agents. These findings suggest that genomic damage may be an important activator of SINEs, and that SINE mobility may contribute to secondary malignancy after exposure to DNA-damaging chemotherapy.

Dfam: a database of repetitive DNA based on profile hidden Markov models.

PubMed

Wheeler, Travis J; Clements, Jody; Eddy, Sean R; Hubley, Robert; Jones, Thomas A; Jurka, Jerzy; Smit, Arian F A; Finn, Robert D

2013-01-01

We present a database of repetitive DNA elements, called Dfam (http://dfam.janelia.org). Many genomes contain a large fraction of repetitive DNA, much of which is made up of remnants of transposable elements (TEs). Accurate annotation of TEs enables research into their biology and can shed light on the evolutionary processes that shape genomes. Identification and masking of TEs can also greatly simplify many downstream genome annotation and sequence analysis tasks. The commonly used TE annotation tools RepeatMasker and Censor depend on sequence homology search tools such as cross_match and BLAST variants, as well as Repbase, a collection of known TE families each represented by a single consensus sequence. Dfam contains entries corresponding to all Repbase TE entries for which instances have been found in the human genome. Each Dfam entry is represented by a profile hidden Markov model, built from alignments generated using RepeatMasker and Repbase. When used in conjunction with the hidden Markov model search tool nhmmer, Dfam produces a 2.9% increase in coverage over consensus sequence search methods on a large human benchmark, while maintaining low false discovery rates, and coverage of the full human genome is 54.5%. The website provides a collection of tools and data views to support improved TE curation and annotation efforts. Dfam is also available for download in flat file format or in the form of MySQL table dumps.

Adjacent DNA sequences modulate Sox9 transcriptional activation at paired Sox sites in three chondrocyte-specific enhancer elements

PubMed Central

Bridgewater, Laura C.; Walker, Marlan D.; Miller, Gwen C.; Ellison, Trevor A.; Holsinger, L. Daniel; Potter, Jennifer L.; Jackson, Todd L.; Chen, Reuben K.; Winkel, Vicki L.; Zhang, Zhaoping; McKinney, Sandra; de Crombrugghe, Benoit

2003-01-01

Expression of the type XI collagen gene Col11a2 is directed to cartilage by at least three chondrocyte-specific enhancer elements, two in the 5′ region and one in the first intron of the gene. The three enhancers each contain two heptameric sites with homology to the Sox protein-binding consensus sequence. The two sites are separated by 3 or 4 bp and arranged in opposite orientation to each other. Targeted mutational analyses of these three enhancers showed that in the intronic enhancer, as in the other two enhancers, both Sox sites in a pair are essential for enhancer activity. The transcription factor Sox9 binds as a dimer at the paired sites, and the introduction of insertion mutations between the sites demonstrated that physical interactions between the adjacently bound proteins are essential for enhancer activity. Additional mutational analyses demonstrated that although Sox9 binding at the paired Sox sites is necessary for enhancer activity, it alone is not sufficient. Adjacent DNA sequences in each enhancer are also required, and mutation of those sequences can eliminate enhancer activity without preventing Sox9 binding. The data suggest a new model in which adjacently bound proteins affect the DNA bend angle produced by Sox9, which in turn determines whether an active transcriptional enhancer complex is assembled. PMID:12595563

Structure and regulation of an archaebacterial promoter: An in vivo study. Progress report, August 1, 1991--March 31, 1993

DOE Office of Scientific and Technical Information (OSTI.GOV)

Daniels, C.J.

1993-06-01

We have established that a 100 bp DNA fragment from the Haloferax volcanii tRNALys gene directs transcription in vivo. This element served as the starting point for a detailed analysis of the requirements for in vivo transcription. Among several gene tentatively identified as reporter elements, we selected a eukaryotic intron-containing tRNAPro gene for when it is driven by the H. volcanii tRNALys promoter fragment, produces a single small transcript. Transcript analysis, by Sl mapping and primer extension, showed that this RNA initiated at the expected tRNALys BoxB sequence and terminated in the tRNAPro RNA Pol III termination element present onmore » the DNA fragment. In initial studies we determined that the 3 inches proximal region of this tRNALys promoter element was sufficient for transcription initiation in vivo. This 40 bp region contains only the BoxA and BoxB regions and short purine rich regions 5 inches to the BoxA and BoxB sequence. Using the tRNAPro gene as the reporter and this minimal promoter, we performed a comprehensive analysis of the BoxA region. Each position of the BoxA region was converted to an four possible nucleotides and the transcription of 36 mutants was quantitated. Among the sites analyzed, only five of the positions showed high levels of discrimination; the preferred BoxA element was 5 inches-TT({sub T}/A)({sup A}/T) ANNNN-3 inches. Mutational analysis demonstrated that a transition from T-rich to A-rich sequences in the BoxA element is essential and that there is some flexibility in the location of the ``TA`` sequence. Additionally the TA sequence appears to determine the location of the transcription start site. The BoxA element defined in this study is similar to those observed for Sulfolobus and the methanogen promoters, and supports the hypothesis that a similar core promoter element is used by all archaeal RNA polymerases.« less

An Ancient Transkingdom Horizontal Transfer of Penelope-Like Retroelements from Arthropods to Conifers.

PubMed

Lin, Xuan; Faridi, Nurul; Casola, Claudio

2016-05-02

Comparative genomics analyses empowered by the wealth of sequenced genomes have revealed numerous instances of horizontal DNA transfers between distantly related species. In eukaryotes, repetitive DNA sequences known as transposable elements (TEs) are especially prone to move across species boundaries. Such horizontal transposon transfers, or HTTs, are relatively common within major eukaryotic kingdoms, including animals, plants, and fungi, while rarely occurring across these kingdoms. Here, we describe the first case of HTT from animals to plants, involving TEs known as Penelope-like elements, or PLEs, a group of retrotransposons closely related to eukaryotic telomerases. Using a combination of in situ hybridization on chromosomes, polymerase chain reaction experiments, and computational analyses we show that the predominant PLE lineage, EN(+)PLEs, is highly diversified in loblolly pine and other conifers, but appears to be absent in other gymnosperms. Phylogenetic analyses of both protein and DNA sequences reveal that conifers EN(+)PLEs, or Dryads, form a monophyletic group clustering within a clade of primarily arthropod elements. Additionally, no EN(+)PLEs were detected in 1,928 genome assemblies from 1,029 nonmetazoan and nonconifer genomes from 14 major eukaryotic lineages. These findings indicate that Dryads emerged following an ancient horizontal transfer of EN(+)PLEs from arthropods to a common ancestor of conifers approximately 340 Ma. This represents one of the oldest known interspecific transmissions of TEs, and the most conspicuous case of DNA transfer between animals and plants. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution 2016. This work is written by US Government employees and is in the public domain in the US.

Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection.

PubMed

Perina, Alejandra; Seoane, David; González-Tizón, Ana M; Rodríguez-Fariña, Fernanda; Martínez-Lage, Andrés

2011-10-17

The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection.

Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection

PubMed Central

2011-01-01

Background The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. Results The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. Conclusions These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection. PMID:22004418

Incidence of genome structure, DNA asymmetry, and cell physiology on T-DNA integration in chromosomes of the phytopathogenic fungus Leptosphaeria maculans.

PubMed

Bourras, Salim; Meyer, Michel; Grandaubert, Jonathan; Lapalu, Nicolas; Fudal, Isabelle; Linglin, Juliette; Ollivier, Benedicte; Blaise, Françoise; Balesdent, Marie-Hélène; Rouxel, Thierry

2012-08-01

The ever-increasing generation of sequence data is accompanied by unsatisfactory functional annotation, and complex genomes, such as those of plants and filamentous fungi, show a large number of genes with no predicted or known function. For functional annotation of unknown or hypothetical genes, the production of collections of mutants using Agrobacterium tumefaciens-mediated transformation (ATMT) associated with genotyping and phenotyping has gained wide acceptance. ATMT is also widely used to identify pathogenicity determinants in pathogenic fungi. A systematic analysis of T-DNA borders was performed in an ATMT-mutagenized collection of the phytopathogenic fungus Leptosphaeria maculans to evaluate the features of T-DNA integration in its particular transposable element-rich compartmentalized genome. A total of 318 T-DNA tags were recovered and analyzed for biases in chromosome and genic compartments, existence of CG/AT skews at the insertion site, and occurrence of microhomologies between the T-DNA left border (LB) and the target sequence. Functional annotation of targeted genes was done using the Gene Ontology annotation. The T-DNA integration mainly targeted gene-rich, transcriptionally active regions, and it favored biological processes consistent with the physiological status of a germinating spore. T-DNA integration was strongly biased toward regulatory regions, and mainly promoters. Consistent with the T-DNA intranuclear-targeting model, the density of T-DNA insertion correlated with CG skew near the transcription initiation site. The existence of microhomologies between promoter sequences and the T-DNA LB flanking sequence was also consistent with T-DNA integration to host DNA mediated by homologous recombination based on the microhomology-mediated end-joining pathway.

Whats, hows and whys of programmed DNA elimination in Tetrahymena

PubMed Central

Noto, Tomoko

2017-01-01

Programmed genome rearrangements in ciliates provide fascinating examples of flexible epigenetic genome regulations and important insights into the interaction between transposable elements (TEs) and host genomes. DNA elimination in Tetrahymena thermophila removes approximately 12 000 internal eliminated sequences (IESs), which correspond to one-third of the genome, when the somatic macronucleus (MAC) differentiates from the germline micronucleus (MIC). More than half of the IESs, many of which show high similarity to TEs, are targeted for elimination in cis by the small RNA-mediated genome comparison of the MIC to the MAC. Other IESs are targeted for elimination in trans by the same small RNAs through repetitive sequences. Furthermore, the small RNA–heterochromatin feedback loop ensures robust DNA elimination. Here, we review an updated picture of the DNA elimination mechanism, discuss the physiological and evolutionary roles of DNA elimination, and outline the key questions that remain unanswered. PMID:29021213

Hsmar1 Transposition Is Sensitive to the Topology of the Transposon Donor and the Target

PubMed Central

Claeys Bouuaert, Corentin; Chalmers, Ronald

2013-01-01

Hsmar1 is a member of the Tc1-mariner superfamily of DNA transposons. These elements mobilize within the genome of their host by a cut-and-paste mechanism. We have exploited the in vitro reaction provided by Hsmar1 to investigate the effect of DNA supercoiling on transposon integration. We found that the topology of both the transposon and the target affect integration. Relaxed transposons have an integration defect that can be partially restored in the presence of elevated levels of negatively supercoiled target DNA. Negatively supercoiled DNA is a better target than nicked or positively supercoiled DNA, suggesting that underwinding of the DNA helix promotes target interactions. Like other Tc1-mariner elements, Hsmar1 integrates into 5′-TA dinucleotides. The direct vicinity of the target TA provides little sequence specificity for target interactions. However, transposition within a plasmid substrate was not random and some TA dinucleotides were targeted preferentially. The distribution of intramolecular target sites was not affected by DNA topology. PMID:23341977

Alpha3, a transposable element that promotes host sexual reproduction.

PubMed

Barsoum, Emad; Martinez, Paula; Aström, Stefan U

2010-01-01

Theoretical models predict that selfish DNA elements require host sex to persist in a population. Therefore, a transposon that induces sex would strongly favor its own spread. We demonstrate that a protein homologous to transposases, called alpha3, was essential for mating type switch in Kluyveromyces lactis. Mutational analysis showed that amino acids conserved among transposases were essential for its function. During switching, sequences in the 5' and 3' flanking regions of the alpha3 gene were joined, forming a DNA circle, showing that alpha3 mobilized from the genome. The sequences encompassing the alpha3 gene circle junctions in the mating type alpha (MATalpha) locus were essential for switching from MATalpha to MATa, suggesting that alpha3 mobilization was a coupled event. Switching also required a DNA-binding protein, Mating type switch 1 (Mts1), whose binding sites in MATalpha were important. Expression of Mts1 was repressed in MATa/MATalpha diploids and by nutrients, limiting switching to haploids in low-nutrient conditions. A hairpin-capped DNA double-strand break (DSB) was observed in the MATa locus in mre11 mutant strains, indicating that mating type switch was induced by MAT-specific DSBs. This study provides empirical evidence for selfish DNA promoting host sexual reproduction by mediating mating type switch.

Cell Type-Specific Chromatin Signatures Underline Regulatory DNA Elements in Human Induced Pluripotent Stem Cells and Somatic Cells.

PubMed

Zhao, Ming-Tao; Shao, Ning-Yi; Hu, Shijun; Ma, Ning; Srinivasan, Rajini; Jahanbani, Fereshteh; Lee, Jaecheol; Zhang, Sophia L; Snyder, Michael P; Wu, Joseph C

2017-11-10

Regulatory DNA elements in the human genome play important roles in determining the transcriptional abundance and spatiotemporal gene expression during embryonic heart development and somatic cell reprogramming. It is not well known how chromatin marks in regulatory DNA elements are modulated to establish cell type-specific gene expression in the human heart. We aimed to decipher the cell type-specific epigenetic signatures in regulatory DNA elements and how they modulate heart-specific gene expression. We profiled genome-wide transcriptional activity and a variety of epigenetic marks in the regulatory DNA elements using massive RNA-seq (n=12) and ChIP-seq (chromatin immunoprecipitation combined with high-throughput sequencing; n=84) in human endothelial cells (CD31 + CD144 + ), cardiac progenitor cells (Sca-1 + ), fibroblasts (DDR2 + ), and their respective induced pluripotent stem cells. We uncovered 2 classes of regulatory DNA elements: class I was identified with ubiquitous enhancer (H3K4me1) and promoter (H3K4me3) marks in all cell types, whereas class II was enriched with H3K4me1 and H3K4me3 in a cell type-specific manner. Both class I and class II regulatory elements exhibited stimulatory roles in nearby gene expression in a given cell type. However, class I promoters displayed more dominant regulatory effects on transcriptional abundance regardless of distal enhancers. Transcription factor network analysis indicated that human induced pluripotent stem cells and somatic cells from the heart selected their preferential regulatory elements to maintain cell type-specific gene expression. In addition, we validated the function of these enhancer elements in transgenic mouse embryos and human cells and identified a few enhancers that could possibly regulate the cardiac-specific gene expression. Given that a large number of genetic variants associated with human diseases are located in regulatory DNA elements, our study provides valuable resources for deciphering the epigenetic modulation of regulatory DNA elements that fine-tune spatiotemporal gene expression in human cardiac development and diseases. © 2017 American Heart Association, Inc.

[The ENCODE project and functional genomics studies].

PubMed

Ding, Nan; Qu, Hongzhu; Fang, Xiangdong

2014-03-01

Upon the completion of the Human Genome Project, scientists have been trying to interpret the underlying genomic code for human biology. Since 2003, National Human Genome Research Institute (NHGRI) has invested nearly $0.3 billion and gathered over 440 scientists from more than 32 institutions in the United States, China, United Kingdom, Japan, Spain and Singapore to initiate the Encyclopedia of DNA Elements (ENCODE) project, aiming to identify and analyze all regulatory elements in the human genome. Taking advantage of the development of next-generation sequencing technologies and continuous improvement of experimental methods, ENCODE had made remarkable achievements: identified methylation and histone modification of DNA sequences and their regulatory effects on gene expression through altering chromatin structures, categorized binding sites of various transcription factors and constructed their regulatory networks, further revised and updated database for pseudogenes and non-coding RNA, and identified SNPs in regulatory sequences associated with diseases. These findings help to comprehensively understand information embedded in gene and genome sequences, the function of regulatory elements as well as the molecular mechanism underlying the transcriptional regulation by noncoding regions, and provide extensive data resource for life sciences, particularly for translational medicine. We re-viewed the contributions of high-throughput sequencing platform development and bioinformatical technology improve-ment to the ENCODE project, the association between epigenetics studies and the ENCODE project, and the major achievement of the ENCODE project. We also provided our prospective on the role of the ENCODE project in promoting the development of basic and clinical medicine.

Electrophoretic mobility shift scanning using an automated infrared DNA sequencer.

PubMed

Sano, M; Ohyama, A; Takase, K; Yamamoto, M; Machida, M

2001-11-01

Electrophoretic mobility shift assay (EMSA) is widely used in the study of sequence-specific DNA-binding proteins, including transcription factors and mismatch binding proteins. We have established a non-radioisotope-based protocol for EMSA that features an automated DNA sequencer with an infrared fluorescent dye (IRDye) detection unit. Our modification of the elec- trophoresis unit, which includes cooling the gel plates with a reduced well-to-read length, has made it possible to detect shifted bands within 1 h. Further, we have developed a rapid ligation-based method for generating IRDye-labeled probes with an approximately 60% cost reduction. This method has the advantages of real-time scanning, stability of labeled probes, and better safety associated with nonradioactive methods of detection. Analysis of a promoter from an industrially important filamentous fungus, Aspergillus oryzae, in a prototype experiment revealed that the method we describe has potential for use in systematic scanning and identification of the functionally important elements to which cellular factors bind in a sequence-specific manner.

Deep Investigation of Arabidopsis thaliana Junk DNA Reveals a Continuum between Repetitive Elements and Genomic Dark Matter

PubMed Central

Maumus, Florian; Quesneville, Hadi

2014-01-01

Eukaryotic genomes contain highly variable amounts of DNA with no apparent function. This so-called junk DNA is composed of two components: repeated and repeat-derived sequences (together referred to as the repeatome), and non-annotated sequences also known as genomic dark matter. Because of their high duplication rates as compared to other genomic features, transposable elements are predominant contributors to the repeatome and the products of their decay is thought to be a major source of genomic dark matter. Determining the origin and composition of junk DNA is thus important to help understanding genome evolution as well as host biology. In this study, we have used a combination of tools enabling to show that the repeatome from the small and reducing A. thaliana genome is significantly larger than previously thought. Furthermore, we present the concepts and results from a series of innovative approaches suggesting that a significant amount of the A. thaliana dark matter is of repetitive origin. As a tentative standard for the community, we propose a deep compendium annotation of the A. thaliana repeatome that may help addressing farther genome evolution as well as transcriptional and epigenetic regulation in this model plant. PMID:24709859

Protection of CpG islands from DNA methylation is DNA-encoded and evolutionarily conserved

PubMed Central

Long, Hannah K.; King, Hamish W.; Patient, Roger K.; Odom, Duncan T.; Klose, Robert J.

2016-01-01

DNA methylation is a repressive epigenetic modification that covers vertebrate genomes. Regions known as CpG islands (CGIs), which are refractory to DNA methylation, are often associated with gene promoters and play central roles in gene regulation. Yet how CGIs in their normal genomic context evade the DNA methylation machinery and whether these mechanisms are evolutionarily conserved remains enigmatic. To address these fundamental questions we exploited a transchromosomic animal model and genomic approaches to understand how the hypomethylated state is formed in vivo and to discover whether mechanisms governing CGI formation are evolutionarily conserved. Strikingly, insertion of a human chromosome into mouse revealed that promoter-associated CGIs are refractory to DNA methylation regardless of host species, demonstrating that DNA sequence plays a central role in specifying the hypomethylated state through evolutionarily conserved mechanisms. In contrast, elements distal to gene promoters exhibited more variable methylation between host species, uncovering a widespread dependence on nucleotide frequency and occupancy of DNA-binding transcription factors in shaping the DNA methylation landscape away from gene promoters. This was exemplified by young CpG rich lineage-restricted repeat sequences that evaded DNA methylation in the absence of co-evolved mechanisms targeting methylation to these sequences, and species specific DNA binding events that protected against DNA methylation in CpG poor regions. Finally, transplantation of mouse chromosomal fragments into the evolutionarily distant zebrafish uncovered the existence of a mechanistically conserved and DNA-encoded logic which shapes CGI formation across vertebrate species. PMID:27084945

Ubiquiter circovirus sequences raise challenges in laboratory diagnosis: the case of honey bee and bee mite, reptiles, and free living amoebae.

PubMed

Marton, Szilvia; Ihász, Katalin; Lengyel, György; Farkas, Szilvia L; Dán, Ádám; Paulus, Petra; Bányai, Krisztián; Fehér, Enikő

2015-03-01

Circoviruses of pigs and birds are established pathogens, however, the exact role of other, recently described circoviruses and circovirus-like viruses remains to be elucidated. The aim of this study was the detection of circoviruses in neglected host species, including honey bees, exotic reptiles and free-living amoebae by widely used broad-spectrum polymerase chain reaction (PCR) assays specific for the replication initiation protein coding gene of these viruses. The majority of sequences obtained from honey bees were highly similar to canine and porcine circoviruses, or, were distantly related to dragonfly cycloviruses. Other rep sequences detected in some honey bees, reptiles and amoebae showed similarities to various rep sequences deposited in the GenBank. Back-to-back PCR primers designed for the amplification of whole viral genomes failed to work that suggested the existence of integrated rep-like elements in many samples. Rolling circle amplification and exonuclease treatment confirmed the absence of small circular DNA genomes in the specimens analysed. In case of honey bees Varroa mite DNA contamination might be a source of the identified endogenous rep-like elements. The reptile and amoebae rep-like sequences were nearly identical with each other and with sequences detected in chimpanzee feces raising the possibility that detection of novel or unusual rep-like elements in some host species might originate from the microbial community of the host. Our results indicate that attention is needed when broad-spectrum rep gene specific polymerase chain reaction is chosen for laboratory diagnosis of circovirus infections.

Finding functional features in Saccharomyces genomes by phylogenetic footprinting.

PubMed

Cliften, Paul; Sudarsanam, Priya; Desikan, Ashwin; Fulton, Lucinda; Fulton, Bob; Majors, John; Waterston, Robert; Cohen, Barak A; Johnston, Mark

2003-07-04

The sifting and winnowing of DNA sequence that occur during evolution cause nonfunctional sequences to diverge, leaving phylogenetic footprints of functional sequence elements in comparisons of genome sequences. We searched for such footprints among the genome sequences of six Saccharomyces species and identified potentially functional sequences. Comparison of these sequences allowed us to revise the catalog of yeast genes and identify sequence motifs that may be targets of transcriptional regulatory proteins. Some of these conserved sequence motifs reside upstream of genes with similar functional annotations or similar expression patterns or those bound by the same transcription factor and are thus good candidates for functional regulatory sequences.

Structure of genes and an insertion element in the methane producing archaebacterium Methanobrevibacter smithii.

PubMed

Hamilton, P T; Reeve, J N

1985-01-01

DNA fragments cloned from the methanogenic archaebacterium Methanobrevibacter smithii which complement mutations in the purE and proC genes of E. coli have been sequenced. Sequence analyses, transposon mutagenesis and expression in E. coli minicells indicate that purE and proC complementations result from the synthesis of M. smithii polypeptides with molecular weights of 36,697 and 27,836 respectively. The encoding genes appear to be located in operons. The M. smithii genome contains 69% A/T basepairs (bp) which is reflected in unusual codon usages and intergenic regions containing approximately 85% A/T bp. An insertion element, designated ISM1, was found within the cloned M. smithii DNA located adjacent to the proC complementing region. ISM1 is 1381 bp in length, has 29 bp terminal inverted repeat sequences and contains one major ORF encoded in 87% of the ISM1 sequence. ISM1 is mobile, present in approximately 10 copies per genome and integration duplicates 8 bp at the site of insertion. The duplicated sequences show homology with sequences within the 29 bp terminal repeat sequence of ISM1. Comparison of our data with sequences from halophilic archaebacteria suggests that 5'GAANTTTCA and 5'TTTTAATATAAA may be consensus promoter sequences for archaebacteria. These sequences closely resemble the consensus sequences which precede Drosophila heat-shock genes (Pelham 1982; Davidson et al. 1983). Methanogens appear to employ the eubacterial system of mRNA: 16SrRNA hybridization to ensure initiation of translation; the consensus ribosome binding sequence is 5'AGGTGA.

H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element.

PubMed

Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K

1989-11-01

Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, but not to other MHC cis-acting sequences or to mutant region II sequences, similar to the naturally occurring region II factor in mouse cells. The deduced amino acid sequence of H-2RIIBP revealed two putative zinc fingers homologous to the DNA-binding domain of steroid/thyroid hormone receptors. Although sequence similarity in other regions was minimal, H-2RIIBP has apparent modular domains characteristic of the nuclear hormone receptors. Further analyses showed that both H-2RIIBP and the natural region II factor bind to the estrogen response element (ERE) of the vitellogenin A2 gene. The ERE is composed of a palindrome, and half of this palindrome resembles the region II binding site of the MHC CRE. These results indicate that H-2RIIBP (i) is a member of the superfamily of nuclear hormone receptors and (ii) may regulate not only MHC class I genes but also genes containing the ERE and related sequences. Sequences homologous to the H-2RIIBP gene are widely conserved in the animal kingdom. H-2RIIBP mRNA is expressed in many mouse tissues, in agreement with the distribution of the natural region II factor.

DDM1 represses noncoding RNA expression and RNA-directed DNA methylation in heterochromatin.

PubMed

Tan, Feng; Lu, Yue; Jiang, Wei; Zhao, Yu; Wu, Tian; Zhang, Ruoyu; Zhou, Dao-Xiu

2018-05-24

Cytosine methylation of DNA, which occurs at CG, CHG, and CHH (H=A, C, or T) sequences in plants, is a hallmark for epigenetic repression of repetitive sequences. The chromatin remodeling factor DECREASE IN DNA METHYLATION1 (DDM1) is essential for DNA methylation, especially at CG and CHG sequences. However, its potential role in RNA-directed DNA methylation (RdDM) and in chromatin function is not completely understood in rice (Oryza sativa). In this work, we used high-throughput approaches to study the function of rice DDM1 (OsDDM1) in RdDM and the expression of non-coding RNA (ncRNA). We show that loss of function of OsDDM1 results in ectopic CHH methylation of transposable elements and repeats. The ectopic CHH methylation was dependent on rice DOMAINS REARRANGED METHYLTRANSFERASE2 (OsDRM2), a DNA methyltransferase involved in RdDM. Mutations in OsDDM1 lead to decreases of histone H3K9me2 and increases in the levels of heterochromatic small RNA (sRNA) and long noncoding RNA (lncRNA). In particular, OsDDM1 was found to be essential to repress transcription of the two repetitive sequences, Centromeric Retrotransposons of Rice1 (CRR1) and the dominant centromeric CentO repeats. These results suggest that OsDDM1 antagonizes RdDM at heterochromatin and represses tissue-specific expression of ncRNA from repetitive sequences in the rice genome. {copyright, serif} 2018 American Society of Plant Biologists. All rights reserved.

Complete genome sequence of a novel extrachromosomal virus-like element identified in planarian Girardia tigrina

PubMed Central

Rebrikov, Denis V; Bulina, Maria E; Bogdanova, Ekaterina A; Vagner, Loura L; Lukyanov, Sergey A

2002-01-01

Background Freshwater planarians are widely used as models for investigation of pattern formation and studies on genetic variation in populations. Despite extensive information on the biology and genetics of planaria, the occurrence and distribution of viruses in these animals remains an unexplored area of research. Results Using a combination of Suppression Subtractive Hybridization (SSH) and Mirror Orientation Selection (MOS), we compared the genomes of two strains of freshwater planarian, Girardia tigrina. The novel extrachromosomal DNA-containing virus-like element denoted PEVE (Planarian Extrachromosomal Virus-like Element) was identified in one planarian strain. The PEVE genome (about 7.5 kb) consists of two unique regions (Ul and Us) flanked by inverted repeats. Sequence analyses reveal that PEVE comprises two helicase-like sequences in the genome, of which the first is a homolog of a circoviral replication initiator protein (Rep), and the second is similar to the papillomavirus E1 helicase domain. PEVE genome exists in at least two variant forms with different arrangements of single-stranded and double-stranded DNA stretches that correspond to the Us and Ul regions. Using PCR analysis and whole-mount in situ hybridization, we characterized PEVE distribution and expression in the planarian body. Conclusions PEVE is the first viral element identified in free-living flatworms. This element differs from all known viruses and viral elements, and comprises two potential helicases that are homologous to proteins from distant viral phyla. PEVE is unevenly distributed in the worm body, and is detected in specific parenchyma cells. PMID:12065025

Improved PCR-Based Detection of Soil Transmitted Helminth Infections Using a Next-Generation Sequencing Approach to Assay Design.

PubMed

Pilotte, Nils; Papaiakovou, Marina; Grant, Jessica R; Bierwert, Lou Ann; Llewellyn, Stacey; McCarthy, James S; Williams, Steven A

2016-03-01

The soil transmitted helminths are a group of parasitic worms responsible for extensive morbidity in many of the world's most economically depressed locations. With growing emphasis on disease mapping and eradication, the availability of accurate and cost-effective diagnostic measures is of paramount importance to global control and elimination efforts. While real-time PCR-based molecular detection assays have shown great promise, to date, these assays have utilized sub-optimal targets. By performing next-generation sequencing-based repeat analyses, we have identified high copy-number, non-coding DNA sequences from a series of soil transmitted pathogens. We have used these repetitive DNA elements as targets in the development of novel, multi-parallel, PCR-based diagnostic assays. Utilizing next-generation sequencing and the Galaxy-based RepeatExplorer web server, we performed repeat DNA analysis on five species of soil transmitted helminths (Necator americanus, Ancylostoma duodenale, Trichuris trichiura, Ascaris lumbricoides, and Strongyloides stercoralis). Employing high copy-number, non-coding repeat DNA sequences as targets, novel real-time PCR assays were designed, and assays were tested against established molecular detection methods. Each assay provided consistent detection of genomic DNA at quantities of 2 fg or less, demonstrated species-specificity, and showed an improved limit of detection over the existing, proven PCR-based assay. The utilization of next-generation sequencing-based repeat DNA analysis methodologies for the identification of molecular diagnostic targets has the ability to improve assay species-specificity and limits of detection. By exploiting such high copy-number repeat sequences, the assays described here will facilitate soil transmitted helminth diagnostic efforts. We recommend similar analyses when designing PCR-based diagnostic tests for the detection of other eukaryotic pathogens.

oriTfinder: a web-based tool for the identification of origin of transfers in DNA sequences of bacterial mobile genetic elements.

PubMed

Li, Xiaobin; Xie, Yingzhou; Liu, Meng; Tai, Cui; Sun, Jingyong; Deng, Zixin; Ou, Hong-Yu

2018-05-04

oriTfinder is a web server that facilitates the rapid identification of the origin of transfer site (oriT) of a conjugative plasmid or chromosome-borne integrative and conjugative element. The utilized back-end database oriTDB was built upon more than one thousand known oriT regions of bacterial mobile genetic elements (MGEs) as well as the known MGE-encoding relaxases and type IV coupling proteins (T4CP). With a combination of similarity searches for the oriTDB-archived oriT nucleotide sequences and the co-localization of the flanking relaxase homologous genes, the oriTfinder can predict the oriT region with high accuracy in the DNA sequence of a bacterial plasmid or chromosome in minutes. The server also detects the other transfer-related modules, including the potential relaxase gene, T4CP gene and the type IV secretion system gene cluster, and the putative genes coding for virulence factors and acquired antibiotic resistance determinants. oriTfinder may contribute to meeting the increasing demands of re-annotations for bacterial conjugative, mobilizable or non-transferable elements and aid in the rapid risk accession of disease-relevant trait dissemination in pathogenic bacteria of interest. oriTfinder is freely available to all users without any login requirement at http://bioinfo-mml.sjtu.edu.cn/oriTfinder.

A novel image encryption algorithm based on the chaotic system and DNA computing

NASA Astrophysics Data System (ADS)

Chai, Xiuli; Gan, Zhihua; Lu, Yang; Chen, Yiran; Han, Daojun

A novel image encryption algorithm using the chaotic system and deoxyribonucleic acid (DNA) computing is presented. Different from the traditional encryption methods, the permutation and diffusion of our method are manipulated on the 3D DNA matrix. Firstly, a 3D DNA matrix is obtained through bit plane splitting, bit plane recombination, DNA encoding of the plain image. Secondly, 3D DNA level permutation based on position sequence group (3DDNALPBPSG) is introduced, and chaotic sequences generated from the chaotic system are employed to permutate the positions of the elements of the 3D DNA matrix. Thirdly, 3D DNA level diffusion (3DDNALD) is given, the confused 3D DNA matrix is split into sub-blocks, and XOR operation by block is manipulated to the sub-DNA matrix and the key DNA matrix from the chaotic system. At last, by decoding the diffused DNA matrix, we get the cipher image. SHA 256 hash of the plain image is employed to calculate the initial values of the chaotic system to avoid chosen plaintext attack. Experimental results and security analyses show that our scheme is secure against several known attacks, and it can effectively protect the security of the images.

Simian virus 40 major late promoter: an upstream DNA sequence required for efficient in vitro transcription.

PubMed Central

Brady, J; Radonovich, M; Thoren, M; Das, G; Salzman, N P

1984-01-01

We have previously identified an 11-base DNA sequence, 5'-G-G-T-A-C-C-T-A-A-C-C-3' (simian virus 40 [SV40] map position 294 to 304), which is important in the control of SV40 late RNA expression in vitro and in vivo (Brady et al., Cell 31:625-633, 1982). We report here the identification of another domain of the SV40 late promoter. A series of mutants with deletions extending from SV40 map position 0 to 300 was prepared by nuclease BAL 31 treatment. The cloned templates were then analyzed for efficiency and accuracy of late SV40 RNA expression in the Manley in vitro transcription system. Our studies showed that, in addition to the promoter domain near map position 300, there are essential DNA sequences between nucleotide positions 74 and 95 that are required for efficient expression of late SV40 RNA. Included in this SV40 DNA sequence were two of the six GGGCGG SV40 repeat sequences and an 11-nucleotide segment which showed strong homology with the upstream sequences required for the efficient in vitro and in vivo expression of the histone H2A gene. This upstream promoter sequence supported transcription with the same efficiency even when it was moved 72 nucleotides closer to the major late cap site. In vitro promoter competition analysis demonstrated that the upstream promoter sequence, independent of the 294 to 304 promoter element, is capable of binding polymerase-transcription factors required for SV40 late gene transcription. Finally, we show that DNA sequences which control the specificity of RNA initiation at nucleotide 325 lie downstream of map position 294. Images PMID:6321950

Selfish DNA in protein-coding genes of Rickettsia.

PubMed

Ogata, H; Audic, S; Barbe, V; Artiguenave, F; Fournier, P E; Raoult, D; Claverie, J M

2000-10-13

Rickettsia conorii, the aetiological agent of Mediterranean spotted fever, is an intracellular bacterium transmitted by ticks. Preliminary analyses of the nearly complete genome sequence of R. conorii have revealed 44 occurrences of a previously undescribed palindromic repeat (150 base pairs long) throughout the genome. Unexpectedly, this repeat was found inserted in-frame within 19 different R. conorii open reading frames likely to encode functional proteins. We found the same repeat in proteins of other Rickettsia species. The finding of a mobile element inserted in many unrelated genes suggests the potential role of selfish DNA in the creation of new protein sequences.

Spread of X-chromosome inactivation into autosomal sequences: role for DNA elements, chromatin features and chromosomal domains

PubMed Central

Cotton, Allison M.; Chen, Chih-Yu; Lam, Lucia L.; Wasserman, Wyeth W.; Kobor, Michael S.; Brown, Carolyn J.

2014-01-01

X-chromosome inactivation results in dosage equivalence between the X chromosome in males and females; however, over 15% of human X-linked genes escape silencing and these genes are enriched on the evolutionarily younger short arm of the X chromosome. The spread of inactivation onto translocated autosomal material allows the study of inactivation without the confounding evolutionary history of the X chromosome. The heterogeneity and reduced extent of silencing on autosomes are evidence for the importance of DNA elements underlying the spread of silencing. We have assessed DNA methylation in six unbalanced X-autosome translocations using the Illumina Infinium HumanMethylation450 array. Two to 42% of translocated autosomal genes showed this mark of silencing, with the highest degree of inactivation observed for trisomic autosomal regions. Generally, the extent of silencing was greatest close to the translocation breakpoint; however, silencing was detected well over 100 kb into the autosomal DNA. Alu elements were found to be enriched at autosomal genes that escaped from inactivation while L1s were enriched at subject genes. In cells without the translocation, there was enrichment of heterochromatic features such as EZH2 and H3K27me3 for those genes that become silenced when translocated, suggesting that underlying chromatin structure predisposes genes towards silencing. Additionally, the analysis of topological domains indicated physical clustering of autosomal genes of common inactivation status. Overall, our analysis indicated a complex interaction between DNA sequence, chromatin features and the three-dimensional structure of the chromosome. PMID:24158853

Co-located hAT transposable element and 5S rDNA in an interstitial telomeric sequence suggest the formation of Robertsonian fusion in armored catfish.

PubMed

Glugoski, Larissa; Giuliano-Caetano, Lucia; Moreira-Filho, Orlando; Vicari, Marcelo R; Nogaroto, Viviane

2018-04-15

Co-located 5S rDNA genes and interstitial telomeric sites (ITS) revealed the involvement of multiple 5S rDNA clusters in chromosome rearrangements of Loricariidae. Interstitial (TTAGGG)n vestiges, in addition to telomeric sites, can coincide with locations of chromosomal rearrangements, and they are considered to be hotspots for chromosome breaks. This study aimed the molecular characterization of 5S rDNA in two Rineloricaria latirostris populations and examination of roles of 5S rDNA in breakpoint sites and its in situ localization. Rineloricaria latirostris from Brazil's Das Pedras river (2n = 46 chromosomes) presented five pairs identified using a 5S rDNA probe, in addition to a pair bearing a co-located ITS/5S rDNA. Rineloricaria latirostris from the Piumhi river (2n = 48 chromosomes) revealed two pairs containing 5S rDNA, without ITS. A 702-bp amplified sequence, using 5S rDNA primers, revealed an insertion of the hAT transposable element (TE), referred to as a degenerate 5S rDNA. Double-FISH (fluorescence in situ hybridization) demonstrated co-localization of 5S rDNA/degenerate 5S rDNA, 5S rDNA/hAT and ITS/5S rDNA from the Das Pedras river population. Piumhi river isolates possessed only 5S rDNA sites. We suggest that the degenerate 5S rDNA was generated by unequal crossing over, which was driven by invasion of hAT, establishing a breakpoint region susceptible to chromosome breakage, non-homologous recombination and Robertsonian (Rb) fusion. Furthermore, the presence of clusters of 5S rDNA at fusion points in other armored catfish species suggests its re-use and that these regions represent hotspots for evolutionary rearrangements within Loricariidae genomes. Copyright © 2018 Elsevier B.V. All rights reserved.

Isolation of a promoter region in mouse cytochrome P450 3A (Cyp3A16) gene and its transcriptional control.

PubMed

Itoh, S; Abe, Y; Kubo, A; Okuda, M; Shimoji, M; Nakayama, K; Kamataki, T

1997-02-07

An 11.5 kb fragment of the mouse Cyp3a16 gene containing the 5' flanking region was isolated from the lambda DASHII mouse genomic library. A part of the 5' flanking region and the first exon of Cyp3a16 gene were sequenced. S1 mapping analysis showed the presence of two transcriptional initiation sites. The first exon was completely identical to Cyp3a16 cDNA. The identity of 5' flanking sequences between Cyp3a16 and Cyp3a11 genes was about 69%. A typical TATA box and a basic transcription element (BTE) were found as seen with other CYP3A genes from various animal species Moreover, some putative transcriptional regulatory elements were also found in addition to the sequence motif seen for the formation of Z-type DNA. To examine the transcriptional activity of Cyp3a11 gene, DNA fragments in the 5'-flanking region of the gene were inserted front of the luciferase structural gene, and the constructs were transfected in primary hepatocytes. The analysis of the luciferase activity indicated that the region between -146 and -56 was necessary for the transcription of CYP3a16 gene.

Influence of quasi-specific sites on kinetics of target DNA search by a sequence-specific DNA-binding protein.

PubMed

Kemme, Catherine A; Esadze, Alexandre; Iwahara, Junji

2015-11-10

Functions of transcription factors require formation of specific complexes at particular sites in cis-regulatory elements of genes. However, chromosomal DNA contains numerous sites that are similar to the target sequences recognized by transcription factors. The influence of such "quasi-specific" sites on functions of the transcription factors is not well understood at present by experimental means. In this work, using fluorescence methods, we have investigated the influence of quasi-specific DNA sites on the efficiency of target location by the zinc finger DNA-binding domain of the inducible transcription factor Egr-1, which recognizes a 9 bp sequence. By stopped-flow assays, we measured the kinetics of Egr-1's association with a target site on 143 bp DNA in the presence of various competitor DNAs, including nonspecific and quasi-specific sites. The presence of quasi-specific sites on competitor DNA significantly decelerated the target association by the Egr-1 protein. The impact of the quasi-specific sites depended strongly on their affinity, their concentration, and the degree of their binding to the protein. To quantitatively describe the kinetic impact of the quasi-specific sites, we derived an analytical form of the apparent kinetic rate constant for the target association and used it for fitting to the experimental data. Our kinetic data with calf thymus DNA as a competitor suggested that there are millions of high-affinity quasi-specific sites for Egr-1 among the 3 billion bp of genomic DNA. This study quantitatively demonstrates that naturally abundant quasi-specific sites on DNA can considerably impede the target search processes of sequence-specific DNA-binding proteins.

Influence of Quasi-Specific Sites on Kinetics of Target DNA Search by a Sequence-Specific DNA-Binding Protein

PubMed Central

2015-01-01

Functions of transcription factors require formation of specific complexes at particular sites in cis-regulatory elements of genes. However, chromosomal DNA contains numerous sites that are similar to the target sequences recognized by transcription factors. The influence of such “quasi-specific” sites on functions of the transcription factors is not well understood at present by experimental means. In this work, using fluorescence methods, we have investigated the influence of quasi-specific DNA sites on the efficiency of target location by the zinc finger DNA-binding domain of the inducible transcription factor Egr-1, which recognizes a 9 bp sequence. By stopped-flow assays, we measured the kinetics of Egr-1’s association with a target site on 143 bp DNA in the presence of various competitor DNAs, including nonspecific and quasi-specific sites. The presence of quasi-specific sites on competitor DNA significantly decelerated the target association by the Egr-1 protein. The impact of the quasi-specific sites depended strongly on their affinity, their concentration, and the degree of their binding to the protein. To quantitatively describe the kinetic impact of the quasi-specific sites, we derived an analytical form of the apparent kinetic rate constant for the target association and used it for fitting to the experimental data. Our kinetic data with calf thymus DNA as a competitor suggested that there are millions of high-affinity quasi-specific sites for Egr-1 among the 3 billion bp of genomic DNA. This study quantitatively demonstrates that naturally abundant quasi-specific sites on DNA can considerably impede the target search processes of sequence-specific DNA-binding proteins. PMID:26502071

The mitochondrial genome of Malus domestica and the import-driven hypothesis of mitochondrial genome expansion in seed plants.

PubMed

Goremykin, Vadim V; Lockhart, Peter J; Viola, Roberto; Velasco, Riccardo

2012-08-01

Mitochondrial genomes of spermatophytes are the largest of all organellar genomes. Their large size has been attributed to various factors; however, the relative contribution of these factors to mitochondrial DNA (mtDNA) expansion remains undetermined. We estimated their relative contribution in Malus domestica (apple). The mitochondrial genome of apple has a size of 396 947 bp and a one to nine ratio of coding to non-coding DNA, close to the corresponding average values for angiosperms. We determined that 71.5% of the apple mtDNA sequence was highly similar to sequences of its nuclear DNA. Using nuclear gene exons, nuclear transposable elements and chloroplast DNA as markers of promiscuous DNA content in mtDNA, we estimated that approximately 20% of the apple mtDNA consisted of DNA sequences imported from other cell compartments, mostly from the nucleus. Similar marker-based estimates of promiscuous DNA content in the mitochondrial genomes of other species ranged between 21.2 and 25.3% of the total mtDNA length for grape, between 23.1 and 38.6% for rice, and between 47.1 and 78.4% for maize. All these estimates are conservative, because they underestimate the import of non-functional DNA. We propose that the import of promiscuous DNA is a core mechanism for mtDNA size expansion in seed plants. In apple, maize and grape this mechanism contributed far more to genome expansion than did homologous recombination. In rice the estimated contribution of both mechanisms was found to be similar. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

Molecular determinants of origin discrimination by Orc1 initiators in archaea.

PubMed

Dueber, Erin C; Costa, Alessandro; Corn, Jacob E; Bell, Stephen D; Berger, James M

2011-05-01

Unlike bacteria, many eukaryotes initiate DNA replication from genomic sites that lack apparent sequence conservation. These loci are identified and bound by the origin recognition complex (ORC), and subsequently activated by a cascade of events that includes recruitment of an additional factor, Cdc6. Archaeal organisms generally possess one or more Orc1/Cdc6 homologs, belonging to the Initiator clade of ATPases associated with various cellular activities (AAA(+)) superfamily; however, these proteins recognize specific sequences within replication origins. Atomic resolution studies have shown that archaeal Orc1 proteins contact double-stranded DNA through an N-terminal AAA(+) domain and a C-terminal winged-helix domain (WHD), but use remarkably few base-specific contacts. To investigate the biochemical effects of these associations, we mutated the DNA-interacting elements of the Orc1-1 and Orc1-3 paralogs from the archaeon Sulfolobus solfataricus, and tested their effect on origin binding and deformation. We find that the AAA(+) domain has an unpredicted role in controlling the sequence selectivity of DNA binding, despite an absence of base-specific contacts to this region. Our results show that both the WHD and ATPase region influence origin recognition by Orc1/Cdc6, and suggest that not only DNA sequence, but also local DNA structure help define archaeal initiator binding sites. © The Author(s) 2011. Published by Oxford University Press.

Multiple horizontal transfers of nuclear ribosomal genes between phylogenetically distinct grass lineages.

PubMed

Mahelka, Václav; Krak, Karol; Kopecký, David; Fehrer, Judith; Šafář, Jan; Bartoš, Jan; Hobza, Roman; Blavet, Nicolas; Blattner, Frank R

2017-02-14

The movement of nuclear DNA from one vascular plant species to another in the absence of fertilization is thought to be rare. Here, nonnative rRNA gene [ribosomal DNA (rDNA)] copies were identified in a set of 16 diploid barley ( Hordeum ) species; their origin was traceable via their internal transcribed spacer (ITS) sequence to five distinct Panicoideae genera, a lineage that split from the Pooideae about 60 Mya. Phylogenetic, cytogenetic, and genomic analyses implied that the nonnative sequences were acquired between 1 and 5 Mya after a series of multiple events, with the result that some current Hordeum sp. individuals harbor up to five different panicoid rDNA units in addition to the native Hordeum rDNA copies. There was no evidence that any of the nonnative rDNA units were transcribed; some showed indications of having been silenced via pseudogenization. A single copy of a Panicum sp. rDNA unit present in H. bogdanii had been interrupted by a native transposable element and was surrounded by about 70 kbp of mostly noncoding sequence of panicoid origin. The data suggest that horizontal gene transfer between vascular plants is not a rare event, that it is not necessarily restricted to one or a few genes only, and that it can be selectively neutral.

eShadow: A tool for comparing closely related sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ovcharenko, Ivan; Boffelli, Dario; Loots, Gabriela G.

2004-01-15

Primate sequence comparisons are difficult to interpret due to the high degree of sequence similarity shared between such closely related species. Recently, a novel method, phylogenetic shadowing, has been pioneered for predicting functional elements in the human genome through the analysis of multiple primate sequence alignments. We have expanded this theoretical approach to create a computational tool, eShadow, for the identification of elements under selective pressure in multiple sequence alignments of closely related genomes, such as in comparisons of human to primate or mouse to rat DNA. This tool integrates two different statistical methods and allows for the dynamic visualizationmore » of the resulting conservation profile. eShadow also includes a versatile optimization module capable of training the underlying Hidden Markov Model to differentially predict functional sequences. This module grants the tool high flexibility in the analysis of multiple sequence alignments and in comparing sequences with different divergence rates. Here, we describe the eShadow comparative tool and its potential uses for analyzing both multiple nucleotide and protein alignments to predict putative functional elements. The eShadow tool is publicly available at http://eshadow.dcode.org/« less

Birth and death of genes linked to chromosomal inversion

PubMed Central

Furuta, Yoshikazu; Kawai, Mikihiko; Yahara, Koji; Takahashi, Noriko; Handa, Naofumi; Tsuru, Takeshi; Oshima, Kenshiro; Yoshida, Masaru; Azuma, Takeshi; Hattori, Masahira; Uchiyama, Ikuo; Kobayashi, Ichizo

2011-01-01

The birth and death of genes is central to adaptive evolution, yet the underlying genome dynamics remain elusive. The availability of closely related complete genome sequences helps to follow changes in gene contents and clarify their relationship to overall genome organization. Helicobacter pylori, bacteria in our stomach, are known for their extreme genome plasticity through mutation and recombination and will make a good target for such an analysis. In comparing their complete genome sequences, we found that gain and loss of genes (loci) for outer membrane proteins, which mediate host interaction, occurred at breakpoints of chromosomal inversions. Sequence comparison there revealed a unique mechanism of DNA duplication: DNA duplication associated with inversion. In this process, a DNA segment at one chromosomal locus is copied and inserted, in an inverted orientation, into a distant locus on the same chromosome, while the entire region between these two loci is also inverted. Recognition of this and three more inversion modes, which occur through reciprocal recombination between long or short sequence similarity or adjacent to a mobile element, allowed reconstruction of synteny evolution through inversion events in this species. These results will guide the interpretation of extensive DNA sequencing results for understanding long- and short-term genome evolution in various organisms and in cancer cells. PMID:21212362

A fitness cost associated with the antibiotic resistance enzyme SME-1 beta-lactamase.

PubMed

Marciano, David C; Karkouti, Omid Y; Palzkill, Timothy

2007-08-01

The bla(TEM-1) beta-lactamase gene has become widespread due to the selective pressure of beta-lactam use and its stable maintenance on transferable DNA elements. In contrast, bla(SME-1) is rarely isolated and is confined to the chromosome of carbapenem-resistant Serratia marcescens strains. Dissemination of bla(SME-1) via transfer to a mobile DNA element could hinder the use of carbapenems. In this study, bla(SME-1) was determined to impart a fitness cost upon Escherichia coli in multiple genetic contexts and assays. Genetic screens and designed SME-1 mutants were utilized to identify the source of this fitness cost. These experiments established that the SME-1 protein was required for the fitness cost but also that the enzyme activity of SME-1 was not associated with the fitness cost. The genetic screens suggested that the SME-1 signal sequence was involved in the fitness cost. Consistent with these findings, exchange of the SME-1 signal sequence for the TEM-1 signal sequence alleviated the fitness cost while replacing the TEM-1 signal sequence with the SME-1 signal sequence imparted a fitness cost to TEM-1 beta-lactamase. Taken together, these results suggest that fitness costs associated with some beta-lactamases may limit their dissemination.

A Fitness Cost Associated With the Antibiotic Resistance Enzyme SME-1 β-Lactamase

PubMed Central

Marciano, David C.; Karkouti, Omid Y.; Palzkill, Timothy

2007-01-01

The blaTEM-1 β-lactamase gene has become widespread due to the selective pressure of β-lactam use and its stable maintenance on transferable DNA elements. In contrast, blaSME-1 is rarely isolated and is confined to the chromosome of carbapenem-resistant Serratia marcescens strains. Dissemination of blaSME-1 via transfer to a mobile DNA element could hinder the use of carbapenems. In this study, blaSME-1 was determined to impart a fitness cost upon Escherichia coli in multiple genetic contexts and assays. Genetic screens and designed SME-1 mutants were utilized to identify the source of this fitness cost. These experiments established that the SME-1 protein was required for the fitness cost but also that the enzyme activity of SME-1 was not associated with the fitness cost. The genetic screens suggested that the SME-1 signal sequence was involved in the fitness cost. Consistent with these findings, exchange of the SME-1 signal sequence for the TEM-1 signal sequence alleviated the fitness cost while replacing the TEM-1 signal sequence with the SME-1 signal sequence imparted a fitness cost to TEM-1 β-lactamase. Taken together, these results suggest that fitness costs associated with some β-lactamases may limit their dissemination. PMID:17565956

Specific interaction of mutant p53 with regions of matrix attachment region DNA elements (MARs) with a high potential for base-unpairing

PubMed Central

Will, Katrin; Warnecke, Gabriele; Wiesmüller, Lisa; Deppert, Wolfgang

1998-01-01

Mutant, but not wild-type p53 binds with high affinity to a variety of MAR-DNA elements (MARs), suggesting that MAR-binding of mutant p53 relates to the dominant-oncogenic activities proposed for mutant p53. MARs recognized by mutant p53 share AT richness and contain variations of an AATATATTT “DNA-unwinding motif,” which enhances the structural dynamics of chromatin and promotes regional DNA base-unpairing. Mutant p53 specifically interacted with MAR-derived oligonucleotides carrying such unwinding motifs, catalyzing DNA strand separation when this motif was located within a structurally labile sequence environment. Addition of GC-clamps to the respective MAR-oligonucleotides or introducing mutations into the unwinding motif strongly reduced DNA strand separation, but supported the formation of tight complexes between mutant p53 and such oligonucleotides. We conclude that the specific interaction of mutant p53 with regions of MAR-DNA with a high potential for base-unpairing provides the basis for the high-affinity binding of mutant p53 to MAR-DNA. PMID:9811860

The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure.

PubMed

Valle-García, David; Griffiths, Lyra M; Dyer, Michael A; Bernstein, Emily; Recillas-Targa, Félix

2014-01-01

The SWI/SNF-like chromatin-remodeling protein ATRX has emerged as a key factor in the regulation of α-globin gene expression, incorporation of histone variants into the chromatin template and, more recently, as a frequently mutated gene across a wide spectrum of cancers. Therefore, the availability of a functional ATRX cDNA for expression studies is a valuable tool for the scientific community. We have identified two independent transposon insertions of a bacterial IS10 element into exon 8 of ATRX isoform 2 coding sequence in two different plasmids derived from a single source. We demonstrate that these insertion events are common and there is an insertion hotspot within the ATRX cDNA. Such IS10 insertions produce a truncated form of ATRX, which significantly compromises its nuclear localization. In turn, we describe ways to prevent IS10 insertion during propagation and cloning of ATRX-containing vectors, including optimal growth conditions, bacterial strains, and suggested sequencing strategies. Finally, we have generated an insertion-free plasmid that is available to the community for expression studies of ATRX.

Behavior of restriction–modification systems as selfish mobile elements and their impact on genome evolution

PubMed Central

Kobayashi, Ichizo

2001-01-01

Restriction–modification (RM) systems are composed of genes that encode a restriction enzyme and a modification methylase. RM systems sometimes behave as discrete units of life, like viruses and transposons. RM complexes attack invading DNA that has not been properly modified and thus may serve as a tool of defense for bacterial cells. However, any threat to their maintenance, such as a challenge by a competing genetic element (an incompatible plasmid or an allelic homologous stretch of DNA, for example) can lead to cell death through restriction breakage in the genome. This post-segregational or post-disturbance cell killing may provide the RM complexes (and any DNA linked with them) with a competitive advantage. There is evidence that they have undergone extensive horizontal transfer between genomes, as inferred from their sequence homology, codon usage bias and GC content difference. They are often linked with mobile genetic elements such as plasmids, viruses, transposons and integrons. The comparison of closely related bacterial genomes also suggests that, at times, RM genes themselves behave as mobile elements and cause genome rearrangements. Indeed some bacterial genomes that survived post-disturbance attack by an RM gene complex in the laboratory have experienced genome rearrangements. The avoidance of some restriction sites by bacterial genomes may result from selection by past restriction attacks. Both bacteriophages and bacteria also appear to use homologous recombination to cope with the selfish behavior of RM systems. RM systems compete with each other in several ways. One is competition for recognition sequences in post-segregational killing. Another is super-infection exclusion, that is, the killing of the cell carrying an RM system when it is infected with another RM system of the same regulatory specificity but of a different sequence specificity. The capacity of RM systems to act as selfish, mobile genetic elements may underlie the structure and function of RM enzymes. PMID:11557807

Behavior of restriction-modification systems as selfish mobile elements and their impact on genome evolution.

PubMed

Kobayashi, I

2001-09-15

Restriction-modification (RM) systems are composed of genes that encode a restriction enzyme and a modification methylase. RM systems sometimes behave as discrete units of life, like viruses and transposons. RM complexes attack invading DNA that has not been properly modified and thus may serve as a tool of defense for bacterial cells. However, any threat to their maintenance, such as a challenge by a competing genetic element (an incompatible plasmid or an allelic homologous stretch of DNA, for example) can lead to cell death through restriction breakage in the genome. This post-segregational or post-disturbance cell killing may provide the RM complexes (and any DNA linked with them) with a competitive advantage. There is evidence that they have undergone extensive horizontal transfer between genomes, as inferred from their sequence homology, codon usage bias and GC content difference. They are often linked with mobile genetic elements such as plasmids, viruses, transposons and integrons. The comparison of closely related bacterial genomes also suggests that, at times, RM genes themselves behave as mobile elements and cause genome rearrangements. Indeed some bacterial genomes that survived post-disturbance attack by an RM gene complex in the laboratory have experienced genome rearrangements. The avoidance of some restriction sites by bacterial genomes may result from selection by past restriction attacks. Both bacteriophages and bacteria also appear to use homologous recombination to cope with the selfish behavior of RM systems. RM systems compete with each other in several ways. One is competition for recognition sequences in post-segregational killing. Another is super-infection exclusion, that is, the killing of the cell carrying an RM system when it is infected with another RM system of the same regulatory specificity but of a different sequence specificity. The capacity of RM systems to act as selfish, mobile genetic elements may underlie the structure and function of RM enzymes.

Organisation of the plant genome in chromosomes.

PubMed

Heslop-Harrison, J S Pat; Schwarzacher, Trude

2011-04-01

The plant genome is organized into chromosomes that provide the structure for the genetic linkage groups and allow faithful replication, transcription and transmission of the hereditary information. Genome sizes in plants are remarkably diverse, with a 2350-fold range from 63 to 149,000 Mb, divided into n=2 to n= approximately 600 chromosomes. Despite this huge range, structural features of chromosomes like centromeres, telomeres and chromatin packaging are well-conserved. The smallest genomes consist of mostly coding and regulatory DNA sequences present in low copy, along with highly repeated rDNA (rRNA genes and intergenic spacers), centromeric and telomeric repetitive DNA and some transposable elements. The larger genomes have similar numbers of genes, with abundant tandemly repeated sequence motifs, and transposable elements alone represent more than half the DNA present. Chromosomes evolve by fission, fusion, duplication and insertion events, allowing evolution of chromosome size and chromosome number. A combination of sequence analysis, genetic mapping and molecular cytogenetic methods with comparative analysis, all only becoming widely available in the 21st century, is elucidating the exact nature of the chromosome evolution events at all timescales, from the base of the plant kingdom, to intraspecific or hybridization events associated with recent plant breeding. As well as being of fundamental interest, understanding and exploiting evolutionary mechanisms in plant genomes is likely to be a key to crop development for food production. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

GC-Rich DNA Elements Enable Replication Origin Activity in the Methylotrophic Yeast Pichia pastoris

PubMed Central

Liachko, Ivan; Youngblood, Rachel A.; Tsui, Kyle; Bubb, Kerry L.; Queitsch, Christine; Raghuraman, M. K.; Nislow, Corey; Brewer, Bonita J.; Dunham, Maitreya J.

2014-01-01

The well-studied DNA replication origins of the model budding and fission yeasts are A/T-rich elements. However, unlike their yeast counterparts, both plant and metazoan origins are G/C-rich and are associated with transcription start sites. Here we show that an industrially important methylotrophic budding yeast, Pichia pastoris, simultaneously employs at least two types of replication origins—a G/C-rich type associated with transcription start sites and an A/T-rich type more reminiscent of typical budding and fission yeast origins. We used a suite of massively parallel sequencing tools to map and dissect P. pastoris origins comprehensively, to measure their replication dynamics, and to assay the global positioning of nucleosomes across the genome. Our results suggest that some functional overlap exists between promoter sequences and G/C-rich replication origins in P. pastoris and imply an evolutionary bifurcation of the modes of replication initiation. PMID:24603708

ATAC-see reveals the accessible genome by transposase-mediated imaging and sequencing.

PubMed

Chen, Xingqi; Shen, Ying; Draper, Will; Buenrostro, Jason D; Litzenburger, Ulrike; Cho, Seung Woo; Satpathy, Ansuman T; Carter, Ava C; Ghosh, Rajarshi P; East-Seletsky, Alexandra; Doudna, Jennifer A; Greenleaf, William J; Liphardt, Jan T; Chang, Howard Y

2016-12-01

Spatial organization of the genome plays a central role in gene expression, DNA replication, and repair. But current epigenomic approaches largely map DNA regulatory elements outside of the native context of the nucleus. Here we report assay of transposase-accessible chromatin with visualization (ATAC-see), a transposase-mediated imaging technology that employs direct imaging of the accessible genome in situ, cell sorting, and deep sequencing to reveal the identity of the imaged elements. ATAC-see revealed the cell-type-specific spatial organization of the accessible genome and the coordinated process of neutrophil chromatin extrusion, termed NETosis. Integration of ATAC-see with flow cytometry enables automated quantitation and prospective cell isolation as a function of chromatin accessibility, and it reveals a cell-cycle dependence of chromatin accessibility that is especially dynamic in G1 phase. The integration of imaging and epigenomics provides a general and scalable approach for deciphering the spatiotemporal architecture of gene control.

GC-rich DNA elements enable replication origin activity in the methylotrophic yeast Pichia pastoris.

PubMed

Liachko, Ivan; Youngblood, Rachel A; Tsui, Kyle; Bubb, Kerry L; Queitsch, Christine; Raghuraman, M K; Nislow, Corey; Brewer, Bonita J; Dunham, Maitreya J

2014-03-01

The well-studied DNA replication origins of the model budding and fission yeasts are A/T-rich elements. However, unlike their yeast counterparts, both plant and metazoan origins are G/C-rich and are associated with transcription start sites. Here we show that an industrially important methylotrophic budding yeast, Pichia pastoris, simultaneously employs at least two types of replication origins--a G/C-rich type associated with transcription start sites and an A/T-rich type more reminiscent of typical budding and fission yeast origins. We used a suite of massively parallel sequencing tools to map and dissect P. pastoris origins comprehensively, to measure their replication dynamics, and to assay the global positioning of nucleosomes across the genome. Our results suggest that some functional overlap exists between promoter sequences and G/C-rich replication origins in P. pastoris and imply an evolutionary bifurcation of the modes of replication initiation.

A Helitron-like Transposon Superfamily from Lepidoptera Disrupts (GAAA)n Microsatellites and is Responsible for Flanking Sequence Similarity within a Microsatellite Family

USDA-ARS?s Scientific Manuscript database

Transposable elements (TEs) are mobile DNA regions that alter host genome structure and gene expression. A novel 588 bp non-autonomous high copy number TE in the Ostrinia nubilalis genome has features in common with miniature inverted-repeat transposable elements (MITEs): high A+T content (62.3%),...

MOCCS: Clarifying DNA-binding motif ambiguity using ChIP-Seq data.

PubMed

Ozaki, Haruka; Iwasaki, Wataru

2016-08-01

As a key mechanism of gene regulation, transcription factors (TFs) bind to DNA by recognizing specific short sequence patterns that are called DNA-binding motifs. A single TF can accept ambiguity within its DNA-binding motifs, which comprise both canonical (typical) and non-canonical motifs. Clarification of such DNA-binding motif ambiguity is crucial for revealing gene regulatory networks and evaluating mutations in cis-regulatory elements. Although chromatin immunoprecipitation sequencing (ChIP-seq) now provides abundant data on the genomic sequences to which a given TF binds, existing motif discovery methods are unable to directly answer whether a given TF can bind to a specific DNA-binding motif. Here, we report a method for clarifying the DNA-binding motif ambiguity, MOCCS. Given ChIP-Seq data of any TF, MOCCS comprehensively analyzes and describes every k-mer to which that TF binds. Analysis of simulated datasets revealed that MOCCS is applicable to various ChIP-Seq datasets, requiring only a few minutes per dataset. Application to the ENCODE ChIP-Seq datasets proved that MOCCS directly evaluates whether a given TF binds to each DNA-binding motif, even if known position weight matrix models do not provide sufficient information on DNA-binding motif ambiguity. Furthermore, users are not required to provide numerous parameters or background genomic sequence models that are typically unavailable. MOCCS is implemented in Perl and R and is freely available via https://github.com/yuifu/moccs. By complementing existing motif-discovery software, MOCCS will contribute to the basic understanding of how the genome controls diverse cellular processes via DNA-protein interactions. Copyright © 2016 Elsevier Ltd. All rights reserved.

Evolution of Sphingomonad Gene Clusters Related to Pesticide Catabolism Revealed by Genome Sequence and Mobilomics of Sphingobium herbicidovorans MH

PubMed Central

Nielsen, Tue Kjærgaard; Rasmussen, Morten; Demanèche, Sandrine; Cecillon, Sébastien; Vogel, Timothy M.

2017-01-01

Abstract Bacterial degraders of chlorophenoxy herbicides have been isolated from various ecosystems, including pristine environments. Among these degraders, the sphingomonads constitute a prominent group that displays versatile xenobiotic-degradation capabilities. Four separate sequencing strategies were required to provide the complete sequence of the complex and plastic genome of the canonical chlorophenoxy herbicide-degrading Sphingobium herbicidovorans MH. The genome has an intricate organization of the chlorophenoxy-herbicide catabolic genes sdpA, rdpA, and cadABCD that encode the (R)- and (S)-enantiomer-specific 2,4-dichlorophenoxypropionate dioxygenases and four subunits of a Rieske non-heme iron oxygenase involved in 2-methyl-chlorophenoxyacetic acid degradation, respectively. Several major genomic rearrangements are proposed to help understand the evolution and mobility of these important genes and their genetic context. Single-strain mobilomic sequence analysis uncovered plasmids and insertion sequence-associated circular intermediates in this environmentally important bacterium and enabled the description of evolutionary models for pesticide degradation in strain MH and related organisms. The mobilome presented a complex mosaic of mobile genetic elements including four plasmids and several circular intermediate DNA molecules of insertion-sequence elements and transposons that are central to the evolution of xenobiotics degradation. Furthermore, two individual chromosomally integrated prophages were shown to excise and form free circular DNA molecules. This approach holds great potential for improving the understanding of genome plasticity, evolution, and microbial ecology. PMID:28961970

Structural and functional analysis of an enhancer GPEI having a phorbol 12-O-tetradecanoate 13-acetate responsive element-like sequence found in the rat glutathione transferase P gene.

PubMed

Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M

1989-10-05

We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.

Burkholderia pseudomallei sequencing identifies genomic clades with distinct recombination, accessory, and epigenetic profiles

PubMed Central

Nandi, Tannistha; Holden, Matthew T.G.; Didelot, Xavier; Mehershahi, Kurosh; Boddey, Justin A.; Beacham, Ifor; Peak, Ian; Harting, John; Baybayan, Primo; Guo, Yan; Wang, Susana; How, Lee Chee; Sim, Bernice; Essex-Lopresti, Angela; Sarkar-Tyson, Mitali; Nelson, Michelle; Smither, Sophie; Ong, Catherine; Aw, Lay Tin; Hoon, Chua Hui; Michell, Stephen; Studholme, David J.; Titball, Richard; Chen, Swaine L.; Parkhill, Julian

2015-01-01

Burkholderia pseudomallei (Bp) is the causative agent of the infectious disease melioidosis. To investigate population diversity, recombination, and horizontal gene transfer in closely related Bp isolates, we performed whole-genome sequencing (WGS) on 106 clinical, animal, and environmental strains from a restricted Asian locale. Whole-genome phylogenies resolved multiple genomic clades of Bp, largely congruent with multilocus sequence typing (MLST). We discovered widespread recombination in the Bp core genome, involving hundreds of regions associated with multiple haplotypes. Highly recombinant regions exhibited functional enrichments that may contribute to virulence. We observed clade-specific patterns of recombination and accessory gene exchange, and provide evidence that this is likely due to ongoing recombination between clade members. Reciprocally, interclade exchanges were rarely observed, suggesting mechanisms restricting gene flow between clades. Interrogation of accessory elements revealed that each clade harbored a distinct complement of restriction-modification (RM) systems, predicted to cause clade-specific patterns of DNA methylation. Using methylome sequencing, we confirmed that representative strains from separate clades indeed exhibit distinct methylation profiles. Finally, using an E. coli system, we demonstrate that Bp RM systems can inhibit uptake of non-self DNA. Our data suggest that RM systems borne on mobile elements, besides preventing foreign DNA invasion, may also contribute to limiting exchanges of genetic material between individuals of the same species. Genomic clades may thus represent functional units of genetic isolation in Bp, modulating intraspecies genetic diversity. PMID:25236617

Protection of CpG islands from DNA methylation is DNA-encoded and evolutionarily conserved.

PubMed

Long, Hannah K; King, Hamish W; Patient, Roger K; Odom, Duncan T; Klose, Robert J

2016-08-19

DNA methylation is a repressive epigenetic modification that covers vertebrate genomes. Regions known as CpG islands (CGIs), which are refractory to DNA methylation, are often associated with gene promoters and play central roles in gene regulation. Yet how CGIs in their normal genomic context evade the DNA methylation machinery and whether these mechanisms are evolutionarily conserved remains enigmatic. To address these fundamental questions we exploited a transchromosomic animal model and genomic approaches to understand how the hypomethylated state is formed in vivo and to discover whether mechanisms governing CGI formation are evolutionarily conserved. Strikingly, insertion of a human chromosome into mouse revealed that promoter-associated CGIs are refractory to DNA methylation regardless of host species, demonstrating that DNA sequence plays a central role in specifying the hypomethylated state through evolutionarily conserved mechanisms. In contrast, elements distal to gene promoters exhibited more variable methylation between host species, uncovering a widespread dependence on nucleotide frequency and occupancy of DNA-binding transcription factors in shaping the DNA methylation landscape away from gene promoters. This was exemplified by young CpG rich lineage-restricted repeat sequences that evaded DNA methylation in the absence of co-evolved mechanisms targeting methylation to these sequences, and species specific DNA binding events that protected against DNA methylation in CpG poor regions. Finally, transplantation of mouse chromosomal fragments into the evolutionarily distant zebrafish uncovered the existence of a mechanistically conserved and DNA-encoded logic which shapes CGI formation across vertebrate species. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

[Study of alpha-satellite DNA in cosmid libraries, specific for chromosomes 13, 21, and 22, using fluorescence in situ hybridization].

PubMed

Solov'ev, I V; Iurov, Iu B; Vorsanova, S G; Marcais, B; Rogaev, E I; Kapanadze, B I; Brodianskiĭ, V M; Iankovskiĭ, N K; Roizes, G

1998-11-01

Fluorescent in situ hybridization (FISH) was employed in mapping the alpha-satellite DNA that was revealed in the cosmid libraries specific for human chromosomes 13, 21, and 22. In total, 131 clones were revealed. They contained various elements of centromeric alphoid DNA sequences of acrocentric chromosomes, including those located close to SINEs, LINEs, and classical satellite sequences. The heterochromatin of acrocentric chromosomes was shown to contain two different groups of alphoid sequences: (1) those immediately adjacent to the centromeric regions (alpha 13-1, alpha 21-1, and alpha 22-1 loci) and (2) those located in the short arm of acrocentric chromosomes (alpha 13-2, alpha 21-2, and alpha 22-2 loci). Alphoid DNA sequences from the alpha 13-2, alpha 21-2, and alpha 22-2 loci are apparently not involved in the formation of centromeres and are absent from mitotically stable marker chromosomes with a deleted short arm. Robertsonian translocations t(13q; 21q) and t(14q; 22q), and chromosome 21p-. The heterochromatic regions of chromosomes 13, 21, and 22 were also shown to contain relatively chromosome-specific repetitive sequences of various alphoid DNA families, whose numerous copies occur in other chromosomes. Pools of centromeric alphoid cosmids can be of use in further studies of the structural and functional properties of heterochromatic DNA and the identification of centromeric sequences. Moreover, these clones can be employed in high-resolution mapping and in sequencing the heterochromatic regions of the human genome. The detailed FISH analysis of numerous alphoid cosmid clones allowed the identification of several new, highly specific DNA probes of molecular cytogenetic studies--in particular, the interphase and metaphase analyses of chromosomes 2, 9, 11, 14, 15, 16, 18, 20, 21-13, 22-14, and X.

Studies of Xenopus laevis mitochondrial DNA: D-loop mapping and characterization of DNA-binding proteins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cairns, S.S.

1987-01-01

In X. laevis oocytes, mitochondrial DNA accumulates to 10/sup 5/ times the somatic cell complement, and is characterized by a high frequency of a triple-stranded displacement hoop structure at the origin of replication. To map the termini of the single strands, it was necessary to correct the nucleotide sequence of the D-loop region. The revised sequence of 2458 nucleotides contains 54 discrepancies in comparison to a previously published sequence. Radiolabeling of the nascent strands of the D-loop structure either at the 5' end or at the 3' end identifies a major species with a length of 1670 nucleotides. Cleavage ofmore » the 5' labeled strands reveals two families of ends located near several matches to an element, designated CSB-1, that is conserved in this location in several vertebrate genomes. Cleavage of 3' labeled strands produced one fragment. The unique 3' end maps to about 15 nucleotides preceding the tRNA/sup Pro/ gene. A search for proteins which may bind to mtDNA in this region to regulate nucleic acid synthesis has identified three activities in lysates of X. laevis mitochondria. The DNA-binding proteins were assayed by monitoring their ability to retard the migration of labeled double- or single-stranded DNA fragments in polyacrylamide gels. The DNA binding preference was determined by competition with an excess of either ds- or ssDNA.« less

Cut-and-Paste Transposons in Fungi with Diverse Lifestyles

PubMed Central

Steczkiewicz, Kamil; Ginalski, Krzysztof

2017-01-01

Abstract Transposable elements (TEs) shape genomes via recombination and transposition, lead to chromosomal rearrangements, create new gene neighborhoods, and alter gene expression. They play key roles in adaptation either to symbiosis in Amanita genus or to pathogenicity in Pyrenophora tritici-repentis. Despite growing evidence of their importance, the abundance and distribution of mobile elements replicating in a “cut-and-paste” fashion is barely described so far. In order to improve our knowledge on this old and ubiquitous class of transposable elements, 1,730 fungal genomes were scanned using both de novo and homology-based approaches. DNA TEs have been identified across the whole data set and display uneven distribution from both DNA TE classification and fungal taxonomy perspectives. DNA TE content correlates with genome size, which confirms that many transposon families proliferate simultaneously. In contrast, it is independent from intron density, average gene distance and GC content. TE count is associated with species’ lifestyle and tends to be elevated in plant symbionts and decreased in animal parasites. Lastly, we found that fungi with both RIP and RNAi systems have more total DNA TE sequences but less elements retaining a functional transposase, what reflects stringent control over transposition. PMID:29228286

Lesion bypass activity of DNA polymerase θ (POLQ) is an intrinsic property of the pol domain and depends on unique sequence inserts.

PubMed

Hogg, Matthew; Seki, Mineaki; Wood, Richard D; Doublié, Sylvie; Wallace, Susan S

2011-01-21

DNA polymerase θ (POLQ, polθ) is a large, multidomain DNA polymerase encoded in higher eukaryotic genomes. It is important for maintaining genetic stability in cells and helping protect cells from DNA damage caused by ionizing radiation. POLQ contains an N-terminal helicase-like domain, a large central domain of indeterminate function, and a C-terminal polymerase domain with sequence similarity to the A-family of DNA polymerases. The enzyme has several unique properties, including low fidelity and the ability to insert and extend past abasic sites and thymine glycol lesions. It is not known whether the abasic site bypass activity is an intrinsic property of the polymerase domain or whether helicase activity is also required. Three "insertion" sequence elements present in POLQ are not found in any other A-family DNA polymerase, and it has been proposed that they may lend some unique properties to POLQ. Here, we analyzed the activity of the DNA polymerase in the absence of each sequence insertion. We found that the pol domain is capable of highly efficient bypass of abasic sites in the absence of the helicase-like or central domains. Insertion 1 increases the processivity of the polymerase but has little, if any, bearing on the translesion synthesis properties of the enzyme. However, removal of insertions 2 and 3 reduces activity on undamaged DNA and completely abrogates the ability of the enzyme to bypass abasic sites or thymine glycol lesions. Copyright © 2010 Elsevier Ltd. All rights reserved.

Origin of B chromosomes in Characidium alipioi (Characiformes, Crenuchidae) and its relationship with supernumerary chromosomes in other Characidium species.

PubMed

Serrano, Érica Alves; Utsunomia, Ricardo; Scudeller, Patrícia Sobrinho; Oliveira, Claudio; Foresti, Fausto

2017-01-01

B chromosomes are apparently dispensable components found in the genomes of many species that are mainly composed of repetitive DNA sequences. Among the numerous questions concerning B chromosomes, the origin of these elements has been widely studied. To date, supernumerary chromosomes have been identified in approximately 60 species of fish, including species of the genus Characidium Reinhardt, 1867 in which these elements appear to have independently originated. In this study, we used molecular cytogenetic techniques to investigate the origin of B chromosomes in a population of Characidium alipioi Travassos, 1955 and determine their relationship with the extra chromosomes of other species of the genus. The results showed that the B chromosomes of Characidium alipioi had an intraspecific origin, apparently originated independently in relation to the B chromosomes of Characidium gomesi Travassos, 1956 Characidium pterostictum Gomes, 1947 and Characidium oiticicai Travassos, 1967, since they do not share specific DNA sequences, as well as their possible ancestral chromosomes and belong to different phylogenetic clades. The shared sequences between the supernumerary chromosomes and the autosommal sm pair indicate the origin of these chromosomes.

Target Site Recognition by a Diversity-Generating Retroelement

PubMed Central

Guo, Huatao; Tse, Longping V.; Nieh, Angela W.; Czornyj, Elizabeth; Williams, Steven; Oukil, Sabrina; Liu, Vincent B.; Miller, Jeff F.

2011-01-01

Diversity-generating retroelements (DGRs) are in vivo sequence diversification machines that are widely distributed in bacterial, phage, and plasmid genomes. They function to introduce vast amounts of targeted diversity into protein-encoding DNA sequences via mutagenic homing. Adenine residues are converted to random nucleotides in a retrotransposition process from a donor template repeat (TR) to a recipient variable repeat (VR). Using the Bordetella bacteriophage BPP-1 element as a prototype, we have characterized requirements for DGR target site function. Although sequences upstream of VR are dispensable, a 24 bp sequence immediately downstream of VR, which contains short inverted repeats, is required for efficient retrohoming. The inverted repeats form a hairpin or cruciform structure and mutational analysis demonstrated that, while the structure of the stem is important, its sequence can vary. In contrast, the loop has a sequence-dependent function. Structure-specific nuclease digestion confirmed the existence of a DNA hairpin/cruciform, and marker coconversion assays demonstrated that it influences the efficiency, but not the site of cDNA integration. Comparisons with other phage DGRs suggested that similar structures are a conserved feature of target sequences. Using a kanamycin resistance determinant as a reporter, we found that transplantation of the IMH and hairpin/cruciform-forming region was sufficient to target the DGR diversification machinery to a heterologous gene. In addition to furthering our understanding of DGR retrohoming, our results suggest that DGRs may provide unique tools for directed protein evolution via in vivo DNA diversification. PMID:22194701

A programming language for composable DNA circuits

PubMed Central

Phillips, Andrew; Cardelli, Luca

2009-01-01

Recently, a range of information-processing circuits have been implemented in DNA by using strand displacement as their main computational mechanism. Examples include digital logic circuits and catalytic signal amplification circuits that function as efficient molecular detectors. As new paradigms for DNA computation emerge, the development of corresponding languages and tools for these paradigms will help to facilitate the design of DNA circuits and their automatic compilation to nucleotide sequences. We present a programming language for designing and simulating DNA circuits in which strand displacement is the main computational mechanism. The language includes basic elements of sequence domains, toeholds and branch migration, and assumes that strands do not possess any secondary structure. The language is used to model and simulate a variety of circuits, including an entropy-driven catalytic gate, a simple gate motif for synthesizing large-scale circuits and a scheme for implementing an arbitrary system of chemical reactions. The language is a first step towards the design of modelling and simulation tools for DNA strand displacement, which complements the emergence of novel implementation strategies for DNA computing. PMID:19535415

A programming language for composable DNA circuits.

PubMed

Phillips, Andrew; Cardelli, Luca

2009-08-06

Recently, a range of information-processing circuits have been implemented in DNA by using strand displacement as their main computational mechanism. Examples include digital logic circuits and catalytic signal amplification circuits that function as efficient molecular detectors. As new paradigms for DNA computation emerge, the development of corresponding languages and tools for these paradigms will help to facilitate the design of DNA circuits and their automatic compilation to nucleotide sequences. We present a programming language for designing and simulating DNA circuits in which strand displacement is the main computational mechanism. The language includes basic elements of sequence domains, toeholds and branch migration, and assumes that strands do not possess any secondary structure. The language is used to model and simulate a variety of circuits, including an entropy-driven catalytic gate, a simple gate motif for synthesizing large-scale circuits and a scheme for implementing an arbitrary system of chemical reactions. The language is a first step towards the design of modelling and simulation tools for DNA strand displacement, which complements the emergence of novel implementation strategies for DNA computing.

Demonstration of retrotransposition of the Tf1 element in fission yeast.

PubMed

Levin, H L; Boeke, J D

1992-03-01

Tf1, a retrotransposon from fission yeast, has LTRs and coding sequences resembling the protease, reverse transcriptase and integrase domains of retroviral pol genes. A unique aspect of Tf1 is that it contains a single open reading frame whereas other retroviruses and retrotransposons usually possess two or more open reading frames. To determine whether Tf1 can transpose, we overproduced Tf1 transcripts encoded by a plasmid copy of the element marked with a neo gene. Approximately 0.1-4.0% of the cell population acquired chromosomally inherited resistance to G418. DNA blot analysis demonstrated that such strains had acquired both Tf1 and neo specific sequences within a restriction fragment of the same size; the size of this restriction fragment varied between different isolates. Structural analysis of the cloned DNA flanking the Tf1-neo element of two transposition candidates with the same regions in the parent strain showed that the ability to grow on G418 was due to transposition of Tf1-neo and not other types of recombination events.

The Foldback-like element Galileo belongs to the P superfamily of DNA transposons and is widespread within the Drosophila genus.

PubMed

Marzo, Mar; Puig, Marta; Ruiz, Alfredo

2008-02-26

Galileo is the only transposable element (TE) known to have generated natural chromosomal inversions in the genus Drosophila. It was discovered in Drosophila buzzatii and classified as a Foldback-like element because of its long, internally repetitive, terminal inverted repeats (TIRs) and lack of coding capacity. Here, we characterized a seemingly complete copy of Galileo from the D. buzzatii genome. It is 5,406 bp long, possesses 1,229-bp TIRs, and encodes a 912-aa transposase similar to those of the Drosophila melanogaster 1360 (Hoppel) and P elements. We also searched the recently available genome sequences of 12 Drosophila species for elements similar to Dbuz\\Galileo by using bioinformatic tools. Galileo was found in six species (ananassae, willistoni, peudoobscura, persimilis, virilis, and mojavensis) from the two main lineages within the Drosophila genus. Our observations place Galileo within the P superfamily of cut-and-paste transposons and extend considerably its phylogenetic distribution. The interspecific distribution of Galileo indicates an ancient presence in the genus, but the phylogenetic tree built with the transposase amino acid sequences contrasts significantly with that of the species, indicating lineage sorting and/or horizontal transfer events. Our results also suggest that Foldback-like elements such as Galileo may evolve from DNA-based transposon ancestors by loss of the transposase gene and disproportionate elongation of TIRs.

The Foldback-like element Galileo belongs to the P superfamily of DNA transposons and is widespread within the Drosophila genus

PubMed Central

Marzo, Mar; Puig, Marta; Ruiz, Alfredo

2008-01-01

Galileo is the only transposable element (TE) known to have generated natural chromosomal inversions in the genus Drosophila. It was discovered in Drosophila buzzatii and classified as a Foldback-like element because of its long, internally repetitive, terminal inverted repeats (TIRs) and lack of coding capacity. Here, we characterized a seemingly complete copy of Galileo from the D. buzzatii genome. It is 5,406 bp long, possesses 1,229-bp TIRs, and encodes a 912-aa transposase similar to those of the Drosophila melanogaster 1360 (Hoppel) and P elements. We also searched the recently available genome sequences of 12 Drosophila species for elements similar to Dbuz\\Galileo by using bioinformatic tools. Galileo was found in six species (ananassae, willistoni, peudoobscura, persimilis, virilis, and mojavensis) from the two main lineages within the Drosophila genus. Our observations place Galileo within the P superfamily of cut-and-paste transposons and extend considerably its phylogenetic distribution. The interspecific distribution of Galileo indicates an ancient presence in the genus, but the phylogenetic tree built with the transposase amino acid sequences contrasts significantly with that of the species, indicating lineage sorting and/or horizontal transfer events. Our results also suggest that Foldback-like elements such as Galileo may evolve from DNA-based transposon ancestors by loss of the transposase gene and disproportionate elongation of TIRs. PMID:18287066

Gene conversion as a secondary mechanism of short interspersed element (SINE) evolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kass, D.H.; Batzer, M.A.; Deininger, P.L.

The Alu repetitive family of short interspersed elements (SINEs) in primates can be subdivided into distinct subfamilies by specific diagnostic nucleotide changes. The older subfamilies are generally very abundant, while the younger subfamilies have fewer copies. Some of the youngest Alu elements are absent in the orthologous loci of nonhuman primates, indicative of recent retroposition events, the primary mode of SINE evolutions. PCR analysis of one young Alu subfamily (Sb2) member found in the low-density lipoprotein receptor gene apparently revealed the presence of this element in the green monkey, orangutan, gorilla, and chimpanzee genomes, as well as the human genome.more » However, sequence analysis of these genomes revealed a highly mutated, older, primate-specific Alu element was present at this position in the nonhuman primates. Comparison of the flanking DNA sequences upstream of this Alu insertion corresponded to evolution expected for standard primate phylogeny, but comparison of the Alu repeat sequences revealed that the human element departed from this phylogeny. The change in the human sequence apparently occurred by a gene conversion event only within the Alu element itself, converting it from one of the oldest to one of the youngest Alu subfamilies. Although gene conversions of Alu elements are clearly very rare, this finding shows that such events can occur and contribute to specific cases of SINE subfamily evolution.« less

Analysis of plastid and mitochondrial DNA insertions in the nucleus (NUPTs and NUMTs) of six plant species: size, relative age and chromosomal localization.

PubMed

Michalovova, M; Vyskot, B; Kejnovsky, E

2013-10-01

We analysed the size, relative age and chromosomal localization of nuclear sequences of plastid and mitochondrial origin (NUPTs-nuclear plastid DNA and NUMTs-nuclear mitochondrial DNA) in six completely sequenced plant species. We found that the largest insertions showed lower divergence from organelle DNA than shorter insertions in all species, indicating their recent origin. The largest NUPT and NUMT insertions were localized in the vicinity of the centromeres in the small genomes of Arabidopsis and rice. They were also present in other chromosomal regions in the large genomes of soybean and maize. Localization of NUPTs and NUMTs correlated positively with distribution of transposable elements (TEs) in Arabidopsis and sorghum, negatively in grapevine and soybean, and did not correlate in rice or maize. We propose a model where new plastid and mitochondrial DNA sequences are inserted close to centromeres and are later fragmented by TE insertions and reshuffled away from the centromere or removed by ectopic recombination. The mode and tempo of TE dynamism determines the turnover of NUPTs and NUMTs resulting in their species-specific chromosomal distributions.

Plasmodium falciparum Nucleosomes Exhibit Reduced Stability and Lost Sequence Dependent Nucleosome Positioning

PubMed Central

Silberhorn, Elisabeth; Schwartz, Uwe; Symelka, Anne; de Koning-Ward, Tania; Längst, Gernot

2016-01-01

The packaging and organization of genomic DNA into chromatin represents an additional regulatory layer of gene expression, with specific nucleosome positions that restrict the accessibility of regulatory DNA elements. The mechanisms that position nucleosomes in vivo are thought to depend on the biophysical properties of the histones, sequence patterns, like phased di-nucleotide repeats and the architecture of the histone octamer that folds DNA in 1.65 tight turns. Comparative studies of human and P. falciparum histones reveal that the latter have a strongly reduced ability to recognize internal sequence dependent nucleosome positioning signals. In contrast, the nucleosomes are positioned by AT-repeat sequences flanking nucleosomes in vivo and in vitro. Further, the strong sequence variations in the plasmodium histones, compared to other mammalian histones, do not present adaptations to its AT-rich genome. Human and parasite histones bind with higher affinity to GC-rich DNA and with lower affinity to AT-rich DNA. However, the plasmodium nucleosomes are overall less stable, with increased temperature induced mobility, decreased salt stability of the histones H2A and H2B and considerable reduced binding affinity to GC-rich DNA, as compared with the human nucleosomes. In addition, we show that plasmodium histone octamers form the shortest known nucleosome repeat length (155bp) in vitro and in vivo. Our data suggest that the biochemical properties of the parasite histones are distinct from the typical characteristics of other eukaryotic histones and these properties reflect the increased accessibility of the P. falciparum genome. PMID:28033404

Comparative genomics and repetitive sequence divergence in the species of diploid Nicotiana section Alatae.

PubMed

Lim, K Yoong; Kovarik, Ales; Matyasek, Roman; Chase, Mark W; Knapp, Sandra; McCarthy, Elizabeth; Clarkson, James J; Leitch, Andrew R

2006-12-01

Combining phylogenetic reconstructions of species relationships with comparative genomic approaches is a powerful way to decipher evolutionary events associated with genome divergence. Here, we reconstruct the history of karyotype and tandem repeat evolution in species of diploid Nicotiana section Alatae. By analysis of plastid DNA, we resolved two clades with high bootstrap support, one containing N. alata, N. langsdorffii, N. forgetiana and N. bonariensis (called the n = 9 group) and another containing N. plumbaginifolia and N. longiflora (called the n = 10 group). Despite little plastid DNA sequence divergence, we observed, via fluorescent in situ hybridization, substantial chromosomal repatterning, including altered chromosome numbers, structure and distribution of repeats. Effort was focussed on 35S and 5S nuclear ribosomal DNA (rDNA) and the HRS60 satellite family of tandem repeats comprising the elements HRS60, NP3R and NP4R. We compared divergence of these repeats in diploids and polyploids of Nicotiana. There are dramatic shifts in the distribution of the satellite repeats and complete replacement of intergenic spacers (IGSs) of 35S rDNA associated with divergence of the species in section Alatae. We suggest that sequence homogenization has replaced HRS60 family repeats at sub-telomeric regions, but that this process may not occur, or occurs more slowly, when the repeats are found at intercalary locations. Sequence homogenization acts more rapidly (at least two orders of magnitude) on 35S rDNA than 5S rDNA and sub-telomeric satellite sequences. This rapid rate of divergence is analogous to that found in polyploid species, and is therefore, in plants, not only associated with polyploidy.

Chromosome Evolution in Connection with Repetitive Sequences and Epigenetics in Plants.

PubMed

Li, Shu-Fen; Su, Ting; Cheng, Guang-Qian; Wang, Bing-Xiao; Li, Xu; Deng, Chuan-Liang; Gao, Wu-Jun

2017-10-24

Chromosome evolution is a fundamental aspect of evolutionary biology. The evolution of chromosome size, structure and shape, number, and the change in DNA composition suggest the high plasticity of nuclear genomes at the chromosomal level. Repetitive DNA sequences, which represent a conspicuous fraction of every eukaryotic genome, particularly in plants, are found to be tightly linked with plant chromosome evolution. Different classes of repetitive sequences have distinct distribution patterns on the chromosomes. Mounting evidence shows that repetitive sequences may play multiple generative roles in shaping the chromosome karyotypes in plants. Furthermore, recent development in our understanding of the repetitive sequences and plant chromosome evolution has elucidated the involvement of a spectrum of epigenetic modification. In this review, we focused on the recent evidence relating to the distribution pattern of repetitive sequences in plant chromosomes and highlighted their potential relevance to chromosome evolution in plants. We also discussed the possible connections between evolution and epigenetic alterations in chromosome structure and repatterning, such as heterochromatin formation, centromere function, and epigenetic-associated transposable element inactivation.

An Evolutionary/Biochemical Connection Between Promoter- and Primer-Dependent Polymerases Revealed by Selective Evolution of Ligands by Exponential Enrichment (SELEX).

PubMed

Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J

2018-01-16

DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of ancestral DNA polymerases to develop their promotors. Conversely, DNA polymerases could have evolved from related RNA polymerases and retained the intrinsic binding preference despite there being no clear function for such a preference in DNA biology. Copyright © 2018 American Society for Microbiology.

Adenovirus EIIA early promoter: transcriptional control elements and induction by the viral pre-early EIA gene, which appears to be sequence independent.

PubMed Central

Murthy, S C; Bhat, G P; Thimmappaya, B

1985-01-01

A molecular dissection of the adenovirus EIIA early (E) promoter was undertaken to study the sequence elements required for transcription and to examine the nucleotide sequences, if any, specific for its trans-activation by the viral pre-early EIA gene product. A chimeric gene in which the EIIA-E promoter region fused to the coding sequences of the bacterial chloramphenicol acetyltransferase (CAT) gene was used in transient assays to identify the transcriptional control regions. Deletion mapping studies revealed that the upstream DNA sequences up to -86 were sufficient for the optimal basal level transcription in HeLa cells and also for the EIA-induced transcription. A series of linker-scanning (LS) mutants were constructed to precisely identify the nucleotide sequences that control transcription. Analysis of these LS mutants allowed us to identify two regions of the promoter that are critical for the EIIA-E transcription. These regions are located between -29 and -21 (region I) and between -82 and -66 (region II). Mutations in region I affected initiation and appeared functionally similar to the "TATA" sequence of the commonly studied promoters. To examine whether or not the EIIA-E promoter contained DNA sequences specific for the trans-activation by the EIA, the LS mutants were analyzed in a cotransfection assay containing a plasmid carrying the EIA gene. CAT activity of all of the LS mutants was induced by the EIA gene in this assay, suggesting that the induction of transcription of the EIIA-E promoter by the EIA gene is not sequence-specific. Images PMID:3857577

Cryo-EM Structures Reveal Mechanism and Inhibition of DNA Targeting by a CRISPR-Cas Surveillance Complex.

PubMed

Guo, Tai Wei; Bartesaghi, Alberto; Yang, Hui; Falconieri, Veronica; Rao, Prashant; Merk, Alan; Eng, Edward T; Raczkowski, Ashleigh M; Fox, Tara; Earl, Lesley A; Patel, Dinshaw J; Subramaniam, Sriram

2017-10-05

Prokaryotic cells possess CRISPR-mediated adaptive immune systems that protect them from foreign genetic elements, such as invading viruses. A central element of this immune system is an RNA-guided surveillance complex capable of targeting non-self DNA or RNA for degradation in a sequence- and site-specific manner analogous to RNA interference. Although the complexes display considerable diversity in their composition and architecture, many basic mechanisms underlying target recognition and cleavage are highly conserved. Using cryoelectron microscopy (cryo-EM), we show that the binding of target double-stranded DNA (dsDNA) to a type I-F CRISPR system yersinia (Csy) surveillance complex leads to large quaternary and tertiary structural changes in the complex that are likely necessary in the pathway leading to target dsDNA degradation by a trans-acting helicase-nuclease. Comparison of the structure of the surveillance complex before and after dsDNA binding, or in complex with three virally encoded anti-CRISPR suppressors that inhibit dsDNA binding, reveals mechanistic details underlying target recognition and inhibition. Published by Elsevier Inc.

Unrelated sequences at the 5' end of mouse LINE-1 repeated elements define two distinct subfamilies.

PubMed Central

Wincker, P; Jubier-Maurin, V; Roizès, G

1987-01-01

Some full length members of the mouse long interspersed repeated DNA family L1Md have been shown to be associated at their 5' end with a variable number of tandem repetitions, the A repeats, that have been suggested to be transcription controlling elements. We report that the other type of repeat, named F, found at the 5' end of a few L1 elements is also an integral part of full length L1 copies. Sequencing shows that the F repeats are GC rich, and organized in tandem. The L1 copies associated with either A or F repeats can be correlated with two different subsets of L1 sequences distinguished by a series of variant nucleotides specific to each and by unassociated but frequent restriction sites. These findings suggest that sequence replacement has occurred at least once in 5' of L1Md, and is related to the generation of specific subfamilies. Images PMID:3684566

Identification of a Recently Active Mammalian SINE Derived from Ribosomal RNA

PubMed Central

Longo, Mark S.; Brown, Judy D.; Zhang, Chu; O’Neill, Michael J.; O’Neill, Rachel J.

2015-01-01

Complex eukaryotic genomes are riddled with repeated sequences whose derivation does not coincide with phylogenetic history and thus is often unknown. Among such sequences, the capacity for transcriptional activity coupled with the adaptive use of reverse transcription can lead to a diverse group of genomic elements across taxa, otherwise known as selfish elements or mobile elements. Short interspersed nuclear elements (SINEs) are nonautonomous mobile elements found in eukaryotic genomes, typically derived from cellular RNAs such as tRNAs, 7SL or 5S rRNA. Here, we identify and characterize a previously unknown SINE derived from the 3′-end of the large ribosomal subunit (LSU or 28S rDNA) and transcribed via RNA polymerase III. This new element, SINE28, is represented in low-copy numbers in the human reference genome assembly, wherein we have identified 27 discrete loci. Phylogenetic analysis indicates these elements have been transpositionally active within primate lineages as recently as 6 MYA while modern humans still carry transcriptionally active copies. Moreover, we have identified SINE28s in all currently available assembled mammalian genome sequences. Phylogenetic comparisons indicate that these elements are frequently rederived from the highly conserved LSU rRNA sequences in a lineage-specific manner. We propose that this element has not been previously recognized as a SINE given its high identity to the canonical LSU, and that SINE28 likely represents one of possibly many unidentified, active transposable elements within mammalian genomes. PMID:25637222

Transcription initiation from the dihydrofolate reductase promoter is positioned by HIP1 binding at the initiation site.

PubMed

Means, A L; Farnham, P J

1990-02-01

We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).

Studying long 16S rDNA sequences with ultrafast-metagenomic sequence classification using exact alignments (Kraken).

PubMed

Valenzuela-González, Fabiola; Martínez-Porchas, Marcel; Villalpando-Canchola, Enrique; Vargas-Albores, Francisco

2016-03-01

Ultrafast-metagenomic sequence classification using exact alignments (Kraken) is a novel approach to classify 16S rDNA sequences. The classifier is based on mapping short sequences to the lowest ancestor and performing alignments to form subtrees with specific weights in each taxon node. This study aimed to evaluate the classification performance of Kraken with long 16S rDNA random environmental sequences produced by cloning and then Sanger sequenced. A total of 480 clones were isolated and expanded, and 264 of these clones formed contigs (1352 ± 153 bp). The same sequences were analyzed using the Ribosomal Database Project (RDP) classifier. Deeper classification performance was achieved by Kraken than by the RDP: 73% of the contigs were classified up to the species or variety levels, whereas 67% of these contigs were classified no further than the genus level by the RDP. The results also demonstrated that unassembled sequences analyzed by Kraken provide similar or inclusively deeper information. Moreover, sequences that did not form contigs, which are usually discarded by other programs, provided meaningful information when analyzed by Kraken. Finally, it appears that the assembly step for Sanger sequences can be eliminated when using Kraken. Kraken cumulates the information of both sequence senses, providing additional elements for the classification. In conclusion, the results demonstrate that Kraken is an excellent choice for use in the taxonomic assignment of sequences obtained by Sanger sequencing or based on third generation sequencing, of which the main goal is to generate larger sequences. Copyright © 2016 Elsevier B.V. All rights reserved.

Intramolecular transposition by a synthetic IS50 (Tn5) derivative

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tomcsanyi, T.; Phadnis, S.H.; Berg, D.E.

1990-11-01

We report the formation of deletions and inversions by intramolecular transposition of Tn5-derived mobile elements. The synthetic transposons used contained the IS50 O and I end segments and the transposase gene, a contraselectable gene encoding sucrose sensitivity (sacB), antibiotic resistance genes, and a plasmid replication origin. Both deletions and inversions were associated with loss of a 300-bp segment that is designated the vector because it is outside of the transposon. Deletions were severalfold more frequent than inversions, perhaps reflecting constraints on DNA twisting or abortive transposition. Restriction and DNA sequence analyses showed that both types of rearrangements extended from onemore » transposon end to many different sites in target DNA. In the case of inversions, transposition generated 9-bp direct repeats of target sequences.« less

Global mapping of DNA conformational flexibility on Saccharomyces cerevisiae.

PubMed

Menconi, Giulia; Bedini, Andrea; Barale, Roberto; Sbrana, Isabella

2015-04-01

In this study we provide the first comprehensive map of DNA conformational flexibility in Saccharomyces cerevisiae complete genome. Flexibility plays a key role in DNA supercoiling and DNA/protein binding, regulating DNA transcription, replication or repair. Specific interest in flexibility analysis concerns its relationship with human genome instability. Enrichment in flexible sequences has been detected in unstable regions of human genome defined fragile sites, where genes map and carry frequent deletions and rearrangements in cancer. Flexible sequences have been suggested to be the determinants of fragile gene proneness to breakage; however, their actual role and properties remain elusive. Our in silico analysis carried out genome-wide via the StabFlex algorithm, shows the conserved presence of highly flexible regions in budding yeast genome as well as in genomes of other Saccharomyces sensu stricto species. Flexibile peaks in S. cerevisiae identify 175 ORFs mapping on their 3'UTR, a region affecting mRNA translation, localization and stability. (TA)n repeats of different extension shape the central structure of peaks and co-localize with polyadenylation efficiency element (EE) signals. ORFs with flexible peaks share common features. Transcripts are characterized by decreased half-life: this is considered peculiar of genes involved in regulatory systems with high turnover; consistently, their function affects biological processes such as cell cycle regulation or stress response. Our findings support the functional importance of flexibility peaks, suggesting that the flexible sequence may be derived by an expansion of canonical TAYRTA polyadenylation efficiency element. The flexible (TA)n repeat amplification could be the outcome of an evolutionary neofunctionalization leading to a differential 3'-end processing and expression regulation in genes with peculiar function. Our study provides a new support to the functional role of flexibility in genomes and a strategy for its characterization inside human fragile sites.

Global Mapping of DNA Conformational Flexibility on Saccharomyces cerevisiae

PubMed Central

Menconi, Giulia; Bedini, Andrea; Barale, Roberto; Sbrana, Isabella

2015-01-01

In this study we provide the first comprehensive map of DNA conformational flexibility in Saccharomyces cerevisiae complete genome. Flexibility plays a key role in DNA supercoiling and DNA/protein binding, regulating DNA transcription, replication or repair. Specific interest in flexibility analysis concerns its relationship with human genome instability. Enrichment in flexible sequences has been detected in unstable regions of human genome defined fragile sites, where genes map and carry frequent deletions and rearrangements in cancer. Flexible sequences have been suggested to be the determinants of fragile gene proneness to breakage; however, their actual role and properties remain elusive. Our in silico analysis carried out genome-wide via the StabFlex algorithm, shows the conserved presence of highly flexible regions in budding yeast genome as well as in genomes of other Saccharomyces sensu stricto species. Flexibile peaks in S. cerevisiae identify 175 ORFs mapping on their 3’UTR, a region affecting mRNA translation, localization and stability. (TA)n repeats of different extension shape the central structure of peaks and co-localize with polyadenylation efficiency element (EE) signals. ORFs with flexible peaks share common features. Transcripts are characterized by decreased half-life: this is considered peculiar of genes involved in regulatory systems with high turnover; consistently, their function affects biological processes such as cell cycle regulation or stress response. Our findings support the functional importance of flexibility peaks, suggesting that the flexible sequence may be derived by an expansion of canonical TAYRTA polyadenylation efficiency element. The flexible (TA)n repeat amplification could be the outcome of an evolutionary neofunctionalization leading to a differential 3’-end processing and expression regulation in genes with peculiar function. Our study provides a new support to the functional role of flexibility in genomes and a strategy for its characterization inside human fragile sites. PMID:25860149

DNA Data Visualization (DDV): Software for Generating Web-Based Interfaces Supporting Navigation and Analysis of DNA Sequence Data of Entire Genomes.

PubMed

Neugebauer, Tomasz; Bordeleau, Eric; Burrus, Vincent; Brzezinski, Ryszard

2015-01-01

Data visualization methods are necessary during the exploration and analysis activities of an increasingly data-intensive scientific process. There are few existing visualization methods for raw nucleotide sequences of a whole genome or chromosome. Software for data visualization should allow the researchers to create accessible data visualization interfaces that can be exported and shared with others on the web. Herein, novel software developed for generating DNA data visualization interfaces is described. The software converts DNA data sets into images that are further processed as multi-scale images to be accessed through a web-based interface that supports zooming, panning and sequence fragment selection. Nucleotide composition frequencies and GC skew of a selected sequence segment can be obtained through the interface. The software was used to generate DNA data visualization of human and bacterial chromosomes. Examples of visually detectable features such as short and long direct repeats, long terminal repeats, mobile genetic elements, heterochromatic segments in microbial and human chromosomes, are presented. The software and its source code are available for download and further development. The visualization interfaces generated with the software allow for the immediate identification and observation of several types of sequence patterns in genomes of various sizes and origins. The visualization interfaces generated with the software are readily accessible through a web browser. This software is a useful research and teaching tool for genetics and structural genomics.

DNA Microarray Profiling of a Diverse Collection of Nosocomial Methicillin-Resistant Staphylococcus aureus Isolates Assigns the Majority to the Correct Sequence Type and Staphylococcal Cassette Chromosome mec (SCCmec) Type and Results in the Subsequent Identification and Characterization of Novel SCCmec-SCCM1 Composite Islands

PubMed Central

Brennan, Orla M.; Deasy, Emily C.; Rossney, Angela S.; Kinnevey, Peter M.; Ehricht, Ralf; Monecke, Stefan; Coleman, David C.

2012-01-01

One hundred seventy-five isolates representative of methicillin-resistant Staphylococcus aureus (MRSA) clones that predominated in Irish hospitals between 1971 and 2004 and that previously underwent multilocus sequence typing (MLST) and staphylococcal cassette chromosome mec (SCCmec) typing were characterized by spa typing (175 isolates) and DNA microarray profiling (107 isolates). The isolates belonged to 26 sequence type (ST)-SCCmec types and subtypes and 35 spa types. The array assigned all isolates to the correct MLST clonal complex (CC), and 94% (100/107) were assigned an ST, with 98% (98/100) correlating with MLST. The array assigned all isolates to the correct SCCmec type, but subtyping of only some SCCmec elements was possible. Additional SCCmec/SCC genes or DNA sequence variation not detected by SCCmec typing was detected by array profiling, including the SCC-fusidic acid resistance determinant Q6GD50/fusC. Novel SCCmec/SCC composite islands (CIs) were detected among CC8 isolates and comprised SCCmec IIA-IIE, IVE, IVF, or IVg and a ccrAB4-SCC element with 99% DNA sequence identity to SCCM1 from ST8/t024-MRSA, SCCmec VIII, and SCC-CI in Staphylococcus epidermidis. The array showed that the majority of isolates harbored one or more superantigen (94%; 100/107) and immune evasion cluster (91%; 97/107) genes. Apart from fusidic acid and trimethoprim resistance, the correlation between isolate antimicrobial resistance phenotype and the presence of specific resistance genes was ≥97%. Array profiling allowed high-throughput, accurate assignment of MRSA to CCs/STs and SCCmec types and provided further evidence of the diversity of SCCmec/SCC. In most cases, array profiling can accurately predict the resistance phenotype of an isolate. PMID:22869569

Identification of multiple binding sites for the THAP domain of the Galileo transposase in the long terminal inverted-repeats☆

PubMed Central

Marzo, Mar; Liu, Danxu; Ruiz, Alfredo; Chalmers, Ronald

2013-01-01

Galileo is a DNA transposon responsible for the generation of several chromosomal inversions in Drosophila. In contrast to other members of the P-element superfamily, it has unusually long terminal inverted-repeats (TIRs) that resemble those of Foldback elements. To investigate the function of the long TIRs we derived consensus and ancestral sequences for the Galileo transposase in three species of Drosophilids. Following gene synthesis, we expressed and purified their constituent THAP domains and tested their binding activity towards the respective Galileo TIRs. DNase I footprinting located the most proximal DNA binding site about 70 bp from the transposon end. Using this sequence we identified further binding sites in the tandem repeats that are found within the long TIRs. This suggests that the synaptic complex between Galileo ends may be a complicated structure containing higher-order multimers of the transposase. We also attempted to reconstitute Galileo transposition in Drosophila embryos but no events were detected. Thus, although the limited numbers of Galileo copies in each genome were sufficient to provide functional consensus sequences for the THAP domains, they do not specify a fully active transposase. Since the THAP recognition sequence is short, and will occur many times in a large genome, it seems likely that the multiple binding sites within the long, internally repetitive, TIRs of Galileo and other Foldback-like elements may provide the transposase with its binding specificity. PMID:23648487

Identification of multiple binding sites for the THAP domain of the Galileo transposase in the long terminal inverted-repeats.

PubMed

Marzo, Mar; Liu, Danxu; Ruiz, Alfredo; Chalmers, Ronald

2013-08-01

Galileo is a DNA transposon responsible for the generation of several chromosomal inversions in Drosophila. In contrast to other members of the P-element superfamily, it has unusually long terminal inverted-repeats (TIRs) that resemble those of Foldback elements. To investigate the function of the long TIRs we derived consensus and ancestral sequences for the Galileo transposase in three species of Drosophilids. Following gene synthesis, we expressed and purified their constituent THAP domains and tested their binding activity towards the respective Galileo TIRs. DNase I footprinting located the most proximal DNA binding site about 70 bp from the transposon end. Using this sequence we identified further binding sites in the tandem repeats that are found within the long TIRs. This suggests that the synaptic complex between Galileo ends may be a complicated structure containing higher-order multimers of the transposase. We also attempted to reconstitute Galileo transposition in Drosophila embryos but no events were detected. Thus, although the limited numbers of Galileo copies in each genome were sufficient to provide functional consensus sequences for the THAP domains, they do not specify a fully active transposase. Since the THAP recognition sequence is short, and will occur many times in a large genome, it seems likely that the multiple binding sites within the long, internally repetitive, TIRs of Galileo and other Foldback-like elements may provide the transposase with its binding specificity. Copyright © 2013 The Authors. Published by Elsevier B.V. All rights reserved.

Human genome project: revolutionizing biology through leveraging technology

NASA Astrophysics Data System (ADS)

Dahl, Carol A.; Strausberg, Robert L.

1996-04-01

The Human Genome Project (HGP) is an international project to develop genetic, physical, and sequence-based maps of the human genome. Since the inception of the HGP it has been clear that substantially improved technology would be required to meet the scientific goals, particularly in order to acquire the complete sequence of the human genome, and that these technologies coupled with the information forthcoming from the project would have a dramatic effect on the way biomedical research is performed in the future. In this paper, we discuss the state-of-the-art for genomic DNA sequencing, technological challenges that remain, and the potential technological paths that could yield substantially improved genomic sequencing technology. The impact of the technology developed from the HGP is broad-reaching and a discussion of other research and medical applications that are leveraging HGP-derived DNA analysis technologies is included. The multidisciplinary approach to the development of new technologies that has been successful for the HGP provides a paradigm for facilitating new genomic approaches toward understanding the biological role of functional elements and systems within the cell, including those encoded within genomic DNA and their molecular products.

Comparison of Methods of Detection of Exceptional Sequences in Prokaryotic Genomes.

PubMed

Rusinov, I S; Ershova, A S; Karyagina, A S; Spirin, S A; Alexeevski, A V

2018-02-01

Many proteins need recognition of specific DNA sequences for functioning. The number of recognition sites and their distribution along the DNA might be of biological importance. For example, the number of restriction sites is often reduced in prokaryotic and phage genomes to decrease the probability of DNA cleavage by restriction endonucleases. We call a sequence an exceptional one if its frequency in a genome significantly differs from one predicted by some mathematical model. An exceptional sequence could be either under- or over-represented, depending on its frequency in comparison with the predicted one. Exceptional sequences could be considered biologically meaningful, for example, as targets of DNA-binding proteins or as parts of abundant repetitive elements. Several methods to predict frequency of a short sequence in a genome, based on actual frequencies of certain its subsequences, are used. The most popular are methods based on Markov chain models. But any rigorous comparison of the methods has not previously been performed. We compared three methods for the prediction of short sequence frequencies: the maximum-order Markov chain model-based method, the method that uses geometric mean of extended Markovian estimates, and the method that utilizes frequencies of all subsequences including discontiguous ones. We applied them to restriction sites in complete genomes of 2500 prokaryotic species and demonstrated that the results depend greatly on the method used: lists of 5% of the most under-represented sites differed by up to 50%. The method designed by Burge and coauthors in 1992, which utilizes all subsequences of the sequence, showed a higher precision than the other two methods both on prokaryotic genomes and randomly generated sequences after computational imitation of selective pressure. We propose this method as the first choice for detection of exceptional sequences in prokaryotic genomes.

RAD tag sequencing as a source of SNP markers in Cynara cardunculus L

PubMed Central

2012-01-01

Background The globe artichoke (Cynara cardunculus L. var. scolymus) genome is relatively poorly explored, especially compared to those of the other major Asteraceae crops sunflower and lettuce. No SNP markers are in the public domain. We have combined the recently developed restriction-site associated DNA (RAD) approach with the Illumina DNA sequencing platform to effect the rapid and mass discovery of SNP markers for C. cardunculus. Results RAD tags were sequenced from the genomic DNA of three C. cardunculus mapping population parents, generating 9.7 million reads, corresponding to ~1 Gbp of sequence. An assembly based on paired ends produced ~6.0 Mbp of genomic sequence, separated into ~19,000 contigs (mean length 312 bp), of which ~21% were fragments of putative coding sequence. The shared sequences allowed for the discovery of ~34,000 SNPs and nearly 800 indels, equivalent to a SNP frequency of 5.6 per 1,000 nt, and an indel frequency of 0.2 per 1,000 nt. A sample of heterozygous SNP loci was mapped by CAPS assays and this exercise provided validation of our mining criteria. The repetitive fraction of the genome had a high representation of retrotransposon sequence, followed by simple repeats, AT-low complexity regions and mobile DNA elements. The genomic k-mers distribution and CpG rate of C. cardunculus, compared with data derived from three whole genome-sequenced dicots species, provided a further evidence of the random representation of the C. cardunculus genome generated by RAD sampling. Conclusion The RAD tag sequencing approach is a cost-effective and rapid method to develop SNP markers in a highly heterozygous species. Our approach permitted to generate a large and robust SNP datasets by the adoption of optimized filtering criteria. PMID:22214349

Automated design of genomic Southern blot probes

PubMed Central

2010-01-01

Background Sothern blotting is a DNA analysis technique that has found widespread application in molecular biology. It has been used for gene discovery and mapping and has diagnostic and forensic applications, including mutation detection in patient samples and DNA fingerprinting in criminal investigations. Southern blotting has been employed as the definitive method for detecting transgene integration, and successful homologous recombination in gene targeting experiments. The technique employs a labeled DNA probe to detect a specific DNA sequence in a complex DNA sample that has been separated by restriction-digest and gel electrophoresis. Critically for the technique to succeed the probe must be unique to the target locus so as not to cross-hybridize to other endogenous DNA within the sample. Investigators routinely employ a manual approach to probe design. A genome browser is used to extract DNA sequence from the locus of interest, which is searched against the target genome using a BLAST-like tool. Ideally a single perfect match is obtained to the target, with little cross-reactivity caused by homologous DNA sequence present in the genome and/or repetitive and low-complexity elements in the candidate probe. This is a labor intensive process often requiring several attempts to find a suitable probe for laboratory testing. Results We have written an informatic pipeline to automatically design genomic Sothern blot probes that specifically attempts to optimize the resultant probe, employing a brute-force strategy of generating many candidate probes of acceptable length in the user-specified design window, searching all against the target genome, then scoring and ranking the candidates by uniqueness and repetitive DNA element content. Using these in silico measures we can automatically design probes that we predict to perform as well, or better, than our previous manual designs, while considerably reducing design time. We went on to experimentally validate a number of these automated designs by Southern blotting. The majority of probes we tested performed well confirming our in silico prediction methodology and the general usefulness of the software for automated genomic Southern probe design. Conclusions Software and supplementary information are freely available at: http://www.genes2cognition.org/software/southern_blot PMID:20113467

Definition of RNA Polymerase II CoTC Terminator Elements in the Human Genome

PubMed Central

Nojima, Takayuki; Dienstbier, Martin; Murphy, Shona; Proudfoot, Nicholas J.; Dye, Michael J.

2013-01-01

Summary Mammalian RNA polymerase II (Pol II) transcription termination is an essential step in protein-coding gene expression that is mediated by pre-mRNA processing activities and DNA-encoded terminator elements. Although much is known about the role of pre-mRNA processing in termination, our understanding of the characteristics and generality of terminator elements is limited. Whereas promoter databases list up to 40,000 known and potential Pol II promoter sequences, fewer than ten Pol II terminator sequences have been described. Using our knowledge of the human β-globin terminator mechanism, we have developed a selection strategy for mapping mammalian Pol II terminator elements. We report the identification of 78 cotranscriptional cleavage (CoTC)-type terminator elements at endogenous gene loci. The results of this analysis pave the way for the full understanding of Pol II termination pathways and their roles in gene expression. PMID:23562152

Modulation of tissue repair by regeneration enhancer elements.

PubMed

Kang, Junsu; Hu, Jianxin; Karra, Ravi; Dickson, Amy L; Tornini, Valerie A; Nachtrab, Gregory; Gemberling, Matthew; Goldman, Joseph A; Black, Brian L; Poss, Kenneth D

2016-04-14

How tissue regeneration programs are triggered by injury has received limited research attention. Here we investigate the existence of enhancer regulatory elements that are activated in regenerating tissue. Transcriptomic analyses reveal that leptin b (lepb) is highly induced in regenerating hearts and fins of zebrafish. Epigenetic profiling identified a short DNA sequence element upstream and distal to lepb that acquires open chromatin marks during regeneration and enables injury-dependent expression from minimal promoters. This element could activate expression in injured neonatal mouse tissues and was divisible into tissue-specific modules sufficient for expression in regenerating zebrafish fins or hearts. Simple enhancer-effector transgenes employing lepb-linked sequences upstream of pro- or anti-regenerative factors controlled the efficacy of regeneration in zebrafish. Our findings provide evidence for 'tissue regeneration enhancer elements' (TREEs) that trigger gene expression in injury sites and can be engineered to modulate the regenerative potential of vertebrate organs.

A Short Interspersed Nuclear Element (SINE)-Based Real-Time PCR Approach to Detect and Quantify Porcine Component in Meat Products.

PubMed

Zhang, Chi; Fang, Xin; Qiu, Haopu; Li, Ning

2015-01-01

Real-time PCR amplification of mitochondria gene could not be used for DNA quantification, and that of single copy DNA did not allow an ideal sensitivity. Moreover, cross-reactions among similar species were commonly observed in the published methods amplifying repetitive sequence, which hindered their further application. The purpose of this study was to establish a short interspersed nuclear element (SINE)-based real-time PCR approach having high specificity for species detection that could be used in DNA quantification. After massive screening of candidate Sus scrofa SINEs, one optimal combination of primers and probe was selected, which had no cross-reaction with other common meat species. LOD of the method was 44 fg DNA/reaction. Further, quantification tests showed this approach was practical in DNA estimation without tissue variance. Thus, this study provided a new tool for qualitative detection of porcine component, which could be promising in the QC of meat products.

Identification of Bari Transposons in 23 Sequenced Drosophila Genomes Reveals Novel Structural Variants, MITEs and Horizontal Transfer.

PubMed

Palazzo, Antonio; Lovero, Domenica; D'Addabbo, Pietro; Caizzi, Ruggiero; Marsano, René Massimiliano

2016-01-01

Bari elements are members of the Tc1-mariner superfamily of DNA transposons, originally discovered in Drosophila melanogaster, and subsequently identified in silico in 11 sequenced Drosophila genomes and as experimentally isolated in four non-sequenced Drosophila species. Bari-like elements have been also studied for their mobility both in vivo and in vitro. We analyzed 23 Drosophila genomes and carried out a detailed characterization of the Bari elements identified, including those from the heterochromatic Bari1 cluster in D. melanogaster. We have annotated 401 copies of Bari elements classified either as putatively autonomous or inactive according to the structure of the terminal sequences and the presence of a complete transposase-coding region. Analyses of the integration sites revealed that Bari transposase prefers AT-rich sequences in which the TA target is cleaved and duplicated. Furthermore evaluation of transposon's co-occurrence near the integration sites of Bari elements showed a non-random distribution of other transposable elements. We also unveil the existence of a putatively autonomous Bari1 variant characterized by two identical long Terminal Inverted Repeats, in D. rhopaloa. In addition, we detected MITEs related to Bari transposons in 9 species. Phylogenetic analyses based on transposase gene and the terminal sequences confirmed that Bari-like elements are distributed into three subfamilies. A few inconsistencies in Bari phylogenetic tree with respect to the Drosophila species tree could be explained by the occurrence of horizontal transfer events as also suggested by the results of dS analyses. This study further clarifies the Bari transposon's evolutionary dynamics and increases our understanding on the Tc1-mariner elements' biology.

Signatures of DNA Methylation across Insects Suggest Reduced DNA Methylation Levels in Holometabola

PubMed Central

Provataris, Panagiotis; Meusemann, Karen; Niehuis, Oliver; Grath, Sonja; Misof, Bernhard

2018-01-01

Abstract It has been experimentally shown that DNA methylation is involved in the regulation of gene expression and the silencing of transposable element activity in eukaryotes. The variable levels of DNA methylation among different insect species indicate an evolutionarily flexible role of DNA methylation in insects, which due to a lack of comparative data is not yet well-substantiated. Here, we use computational methods to trace signatures of DNA methylation across insects by analyzing transcriptomic and genomic sequence data from all currently recognized insect orders. We conclude that: 1) a functional methylation system relying exclusively on DNA methyltransferase 1 is widespread across insects. 2) DNA methylation has potentially been lost or extremely reduced in species belonging to springtails (Collembola), flies and relatives (Diptera), and twisted-winged parasites (Strepsiptera). 3) Holometabolous insects display signs of reduced DNA methylation levels in protein-coding sequences compared with hemimetabolous insects. 4) Evolutionarily conserved insect genes associated with housekeeping functions tend to display signs of heavier DNA methylation in comparison to the genomic/transcriptomic background. With this comparative study, we provide the much needed basis for experimental and detailed comparative analyses required to gain a deeper understanding on the evolution and function of DNA methylation in insects. PMID:29697817

Experimental mapping of DNA duplex shape enabled by global lineshape analyses of a nucleotide-independent nitroxide probe

PubMed Central

Ding, Yuan; Zhang, Xiaojun; Tham, Kenneth W.; Qin, Peter Z.

2014-01-01

Sequence-dependent variation in structure and dynamics of a DNA duplex, collectively referred to as ‘DNA shape’, critically impacts interactions between DNA and proteins. Here, a method based on the technique of site-directed spin labeling was developed to experimentally map shapes of two DNA duplexes that contain response elements of the p53 tumor suppressor. An R5a nitroxide spin label, which was covalently attached at a specific phosphate group, was scanned consecutively through the DNA duplex. X-band continuous-wave electron paramagnetic resonance spectroscopy was used to monitor rotational motions of R5a, which report on DNA structure and dynamics at the labeling site. An approach based on Pearson's coefficient analysis was developed to collectively examine the degree of similarity among the ensemble of R5a spectra. The resulting Pearson's coefficients were used to generate maps representing variation of R5a mobility along the DNA duplex. The R5a mobility maps were found to correlate with maps of certain DNA helical parameters, and were capable of revealing similarity and deviation in the shape of the two closely related DNA duplexes. Collectively, the R5a probe and the Pearson's coefficient-based lineshape analysis scheme yielded a generalizable method for examining sequence-dependent DNA shapes. PMID:25092920

Tardigrade workbench: comparing stress-related proteins, sequence-similar and functional protein clusters as well as RNA elements in tardigrades

PubMed Central

2009-01-01

Background Tardigrades represent an animal phylum with extraordinary resistance to environmental stress. Results To gain insights into their stress-specific adaptation potential, major clusters of related and similar proteins are identified, as well as specific functional clusters delineated comparing all tardigrades and individual species (Milnesium tardigradum, Hypsibius dujardini, Echiniscus testudo, Tulinus stephaniae, Richtersius coronifer) and functional elements in tardigrade mRNAs are analysed. We find that 39.3% of the total sequences clustered in 58 clusters of more than 20 proteins. Among these are ten tardigrade specific as well as a number of stress-specific protein clusters. Tardigrade-specific functional adaptations include strong protein, DNA- and redox protection, maintenance and protein recycling. Specific regulatory elements regulate tardigrade mRNA stability such as lox P DICE elements whereas 14 other RNA elements of higher eukaryotes are not found. Further features of tardigrade specific adaption are rapidly identified by sequence and/or pattern search on the web-tool tardigrade analyzer http://waterbear.bioapps.biozentrum.uni-wuerzburg.de. The work-bench offers nucleotide pattern analysis for promotor and regulatory element detection (tardigrade specific; nrdb) as well as rapid COG search for function assignments including species-specific repositories of all analysed data. Conclusion Different protein clusters and regulatory elements implicated in tardigrade stress adaptations are analysed including unpublished tardigrade sequences. PMID:19821996

Tardigrade workbench: comparing stress-related proteins, sequence-similar and functional protein clusters as well as RNA elements in tardigrades.

PubMed

Förster, Frank; Liang, Chunguang; Shkumatov, Alexander; Beisser, Daniela; Engelmann, Julia C; Schnölzer, Martina; Frohme, Marcus; Müller, Tobias; Schill, Ralph O; Dandekar, Thomas

2009-10-12

Tardigrades represent an animal phylum with extraordinary resistance to environmental stress. To gain insights into their stress-specific adaptation potential, major clusters of related and similar proteins are identified, as well as specific functional clusters delineated comparing all tardigrades and individual species (Milnesium tardigradum, Hypsibius dujardini, Echiniscus testudo, Tulinus stephaniae, Richtersius coronifer) and functional elements in tardigrade mRNAs are analysed. We find that 39.3% of the total sequences clustered in 58 clusters of more than 20 proteins. Among these are ten tardigrade specific as well as a number of stress-specific protein clusters. Tardigrade-specific functional adaptations include strong protein, DNA- and redox protection, maintenance and protein recycling. Specific regulatory elements regulate tardigrade mRNA stability such as lox P DICE elements whereas 14 other RNA elements of higher eukaryotes are not found. Further features of tardigrade specific adaption are rapidly identified by sequence and/or pattern search on the web-tool tardigrade analyzer http://waterbear.bioapps.biozentrum.uni-wuerzburg.de. The work-bench offers nucleotide pattern analysis for promotor and regulatory element detection (tardigrade specific; nrdb) as well as rapid COG search for function assignments including species-specific repositories of all analysed data. Different protein clusters and regulatory elements implicated in tardigrade stress adaptations are analysed including unpublished tardigrade sequences.

Genome-wide analysis of salinity-stress induced DNA methylation alterations in cotton (Gossypium hirsutum L.) using the Me-DIP sequencing technology.

PubMed

Lu, X K; Shu, N; Wang, J J; Chen, X G; Wang, D L; Wang, S; Fan, W L; Guo, X N; Guo, L X; Ye, W W

2017-06-29

Cytosine DNA methylation is a significant form of DNA modification closely associated with gene expression in eukaryotes, fungi, animals, and plants. Although the reference genomes of cotton (Gossypium hirsutum L.) have been publically available, the salinity-stress-induced DNA methylome alterations in cotton are not well understood. Here, we constructed a map of genome-wide DNA methylation characteristics of cotton leaves under salt stress using the methylated DNA immunoprecipitation sequencing method. The results showed that the methylation reads on chromosome 9 were most comparable with those on the other chromosomes, but the greatest changes occurred on chromosome 8 under salt stress. The DNA methylation pattern analysis indicated that a relatively higher methylation density was found in the upstream2k and downstream2k elements of the CDS region and CG-islands. Almost 94% of the reads belonged to LTR-gspsy and LTR-copia, and the number of methylation reads in LTR-gypsy was four times greater than that in LTR-copia in both control and stressed samples. The analysis of differentially methylated regions (DMRs) showed that the gene elements upstream2k, intron, and downstream2k were hypomethylated, but the CDS regions were hypermethylated. The GO (Gene Ontology) analysis suggested that the methylated genes were most enriched in cellular processes, metabolic processes, cell parts and catalytic activities, which might be closely correlated with response to NaCl stress. In this study, we completed a genomic DNA methylation profile and conducted a DMR analysis under salt stress, which provided valuable information for the better understanding of epigenetics in response to salt stress in cotton.

A comprehensive resource of genomic, epigenomic and transcriptomic sequencing data for the black truffle Tuber melanosporum

PubMed Central

2014-01-01

Background Tuber melanosporum, also known in the gastronomic community as “truffle”, features one of the largest fungal genomes (125 Mb) with an exceptionally high transposable element (TE) and repetitive DNA content (>58%). The main purpose of DNA methylation in fungi is TE silencing. As obligate outcrossing organisms, truffles are bound to a sexual mode of propagation, which together with TEs is thought to represent a major force driving the evolution of DNA methylation. Thus, it was of interest to examine if and how T. melanosporum exploits DNA methylation to maintain genome integrity. Findings We performed whole-genome DNA bisulfite sequencing and mRNA sequencing on different developmental stages of T. melanosporum; namely, fruitbody (“truffle”), free-living mycelium and ectomycorrhiza. The data revealed a high rate of cytosine methylation (>44%), selectively targeting TEs rather than genes with a strong preference for CpG sites. Whole genome DNA sequencing uncovered multiple TE-enriched, copy number variant regions bearing a significant fraction of hypomethylated and expressed TEs, almost exclusively in free-living mycelium propagated in vitro. Treatment of mycelia with 5-azacytidine partially reduced DNA methylation and increased TE transcription. Our transcriptome assembly also resulted in the identification of a set of novel transcripts from 614 genes. Conclusions The datasets presented here provide valuable and comprehensive (epi)genomic information that can be of interest for evolutionary genomics studies of multicellular (filamentous) fungi, in particular Ascomycetes belonging to the subphylum, Pezizomycotina. Evidence derived from comparative methylome and transcriptome analyses indicates that a non-exhaustive and partly reversible methylation process operates in truffles. PMID:25392735

A comprehensive resource of genomic, epigenomic and transcriptomic sequencing data for the black truffle Tuber melanosporum.

PubMed

Chen, Pao-Yang; Montanini, Barbara; Liao, Wen-Wei; Morselli, Marco; Jaroszewicz, Artur; Lopez, David; Ottonello, Simone; Pellegrini, Matteo

2014-01-01

Tuber melanosporum, also known in the gastronomic community as "truffle", features one of the largest fungal genomes (125 Mb) with an exceptionally high transposable element (TE) and repetitive DNA content (>58%). The main purpose of DNA methylation in fungi is TE silencing. As obligate outcrossing organisms, truffles are bound to a sexual mode of propagation, which together with TEs is thought to represent a major force driving the evolution of DNA methylation. Thus, it was of interest to examine if and how T. melanosporum exploits DNA methylation to maintain genome integrity. We performed whole-genome DNA bisulfite sequencing and mRNA sequencing on different developmental stages of T. melanosporum; namely, fruitbody ("truffle"), free-living mycelium and ectomycorrhiza. The data revealed a high rate of cytosine methylation (>44%), selectively targeting TEs rather than genes with a strong preference for CpG sites. Whole genome DNA sequencing uncovered multiple TE-enriched, copy number variant regions bearing a significant fraction of hypomethylated and expressed TEs, almost exclusively in free-living mycelium propagated in vitro. Treatment of mycelia with 5-azacytidine partially reduced DNA methylation and increased TE transcription. Our transcriptome assembly also resulted in the identification of a set of novel transcripts from 614 genes. The datasets presented here provide valuable and comprehensive (epi)genomic information that can be of interest for evolutionary genomics studies of multicellular (filamentous) fungi, in particular Ascomycetes belonging to the subphylum, Pezizomycotina. Evidence derived from comparative methylome and transcriptome analyses indicates that a non-exhaustive and partly reversible methylation process operates in truffles.

Genome-wide identification of conserved intronic non-coding sequences using a Bayesian segmentation approach.

PubMed

Algama, Manjula; Tasker, Edward; Williams, Caitlin; Parslow, Adam C; Bryson-Richardson, Robert J; Keith, Jonathan M

2017-03-27

Computational identification of non-coding RNAs (ncRNAs) is a challenging problem. We describe a genome-wide analysis using Bayesian segmentation to identify intronic elements highly conserved between three evolutionarily distant vertebrate species: human, mouse and zebrafish. We investigate the extent to which these elements include ncRNAs (or conserved domains of ncRNAs) and regulatory sequences. We identified 655 deeply conserved intronic sequences in a genome-wide analysis. We also performed a pathway-focussed analysis on genes involved in muscle development, detecting 27 intronic elements, of which 22 were not detected in the genome-wide analysis. At least 87% of the genome-wide and 70% of the pathway-focussed elements have existing annotations indicative of conserved RNA secondary structure. The expression of 26 of the pathway-focused elements was examined using RT-PCR, providing confirmation that they include expressed ncRNAs. Consistent with previous studies, these elements are significantly over-represented in the introns of transcription factors. This study demonstrates a novel, highly effective, Bayesian approach to identifying conserved non-coding sequences. Our results complement previous findings that these sequences are enriched in transcription factors. However, in contrast to previous studies which suggest the majority of conserved sequences are regulatory factor binding sites, the majority of conserved sequences identified using our approach contain evidence of conserved RNA secondary structures, and our laboratory results suggest most are expressed. Functional roles at DNA and RNA levels are not mutually exclusive, and many of our elements possess evidence of both. Moreover, ncRNAs play roles in transcriptional and post-transcriptional regulation, and this may contribute to the over-representation of these elements in introns of transcription factors. We attribute the higher sensitivity of the pathway-focussed analysis compared to the genome-wide analysis to improved alignment quality, suggesting that enhanced genomic alignments may reveal many more conserved intronic sequences.

CRISPR/Cas9 for genome editing: progress, implications and challenges.

PubMed

Zhang, Feng; Wen, Yan; Guo, Xiong

2014-09-15

Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) protein 9 system provides a robust and multiplexable genome editing tool, enabling researchers to precisely manipulate specific genomic elements, and facilitating the elucidation of target gene function in biology and diseases. CRISPR/Cas9 comprises of a nonspecific Cas9 nuclease and a set of programmable sequence-specific CRISPR RNA (crRNA), which can guide Cas9 to cleave DNA and generate double-strand breaks at target sites. Subsequent cellular DNA repair process leads to desired insertions, deletions or substitutions at target sites. The specificity of CRISPR/Cas9-mediated DNA cleavage requires target sequences matching crRNA and a protospacer adjacent motif locating at downstream of target sequences. Here, we review the molecular mechanism, applications and challenges of CRISPR/Cas9-mediated genome editing and clinical therapeutic potential of CRISPR/Cas9 in future. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

G-Anchor: a novel approach for whole-genome comparative mapping utilizing evolutionary conserved DNA sequences.

PubMed

Lenis, Vasileios Panagiotis E; Swain, Martin; Larkin, Denis M

2018-05-01

Cross-species whole-genome sequence alignment is a critical first step for genome comparative analyses, ranging from the detection of sequence variants to studies of chromosome evolution. Animal genomes are large and complex, and whole-genome alignment is a computationally intense process, requiring expensive high-performance computing systems due to the need to explore extensive local alignments. With hundreds of sequenced animal genomes available from multiple projects, there is an increasing demand for genome comparative analyses. Here, we introduce G-Anchor, a new, fast, and efficient pipeline that uses a strictly limited but highly effective set of local sequence alignments to anchor (or map) an animal genome to another species' reference genome. G-Anchor makes novel use of a databank of highly conserved DNA sequence elements. We demonstrate how these elements may be aligned to a pair of genomes, creating anchors. These anchors enable the rapid mapping of scaffolds from a de novo assembled genome to chromosome assemblies of a reference species. Our results demonstrate that G-Anchor can successfully anchor a vertebrate genome onto a phylogenetically related reference species genome using a desktop or laptop computer within a few hours and with comparable accuracy to that achieved by a highly accurate whole-genome alignment tool such as LASTZ. G-Anchor thus makes whole-genome comparisons accessible to researchers with limited computational resources. G-Anchor is a ready-to-use tool for anchoring a pair of vertebrate genomes. It may be used with large genomes that contain a significant fraction of evolutionally conserved DNA sequences and that are not highly repetitive, polypoid, or excessively fragmented. G-Anchor is not a substitute for whole-genome aligning software but can be used for fast and accurate initial genome comparisons. G-Anchor is freely available and a ready-to-use tool for the pairwise comparison of two genomes.

The Paramecium germline genome provides a niche for intragenic parasitic DNA: evolutionary dynamics of internal eliminated sequences.

PubMed

Arnaiz, Olivier; Mathy, Nathalie; Baudry, Céline; Malinsky, Sophie; Aury, Jean-Marc; Denby Wilkes, Cyril; Garnier, Olivier; Labadie, Karine; Lauderdale, Benjamin E; Le Mouël, Anne; Marmignon, Antoine; Nowacki, Mariusz; Poulain, Julie; Prajer, Malgorzata; Wincker, Patrick; Meyer, Eric; Duharcourt, Sandra; Duret, Laurent; Bétermier, Mireille; Sperling, Linda

2012-01-01

Insertions of parasitic DNA within coding sequences are usually deleterious and are generally counter-selected during evolution. Thanks to nuclear dimorphism, ciliates provide unique models to study the fate of such insertions. Their germline genome undergoes extensive rearrangements during development of a new somatic macronucleus from the germline micronucleus following sexual events. In Paramecium, these rearrangements include precise excision of unique-copy Internal Eliminated Sequences (IES) from the somatic DNA, requiring the activity of a domesticated piggyBac transposase, PiggyMac. We have sequenced Paramecium tetraurelia germline DNA, establishing a genome-wide catalogue of -45,000 IESs, in order to gain insight into their evolutionary origin and excision mechanism. We obtained direct evidence that PiggyMac is required for excision of all IESs. Homology with known P. tetraurelia Tc1/mariner transposons, described here, indicates that at least a fraction of IESs derive from these elements. Most IES insertions occurred before a recent whole-genome duplication that preceded diversification of the P. aurelia species complex, but IES invasion of the Paramecium genome appears to be an ongoing process. Once inserted, IESs decay rapidly by accumulation of deletions and point substitutions. Over 90% of the IESs are shorter than 150 bp and present a remarkable size distribution with a -10 bp periodicity, corresponding to the helical repeat of double-stranded DNA and suggesting DNA loop formation during assembly of a transpososome-like excision complex. IESs are equally frequent within and between coding sequences; however, excision is not 100% efficient and there is selective pressure against IES insertions, in particular within highly expressed genes. We discuss the possibility that ancient domestication of a piggyBac transposase favored subsequent propagation of transposons throughout the germline by allowing insertions in coding sequences, a fraction of the genome in which parasitic DNA is not usually tolerated.

The Paramecium Germline Genome Provides a Niche for Intragenic Parasitic DNA: Evolutionary Dynamics of Internal Eliminated Sequences

PubMed Central

Arnaiz, Olivier; Mathy, Nathalie; Baudry, Céline; Malinsky, Sophie; Aury, Jean-Marc; Denby Wilkes, Cyril; Garnier, Olivier; Labadie, Karine; Lauderdale, Benjamin E.; Le Mouël, Anne; Marmignon, Antoine; Nowacki, Mariusz; Poulain, Julie; Prajer, Malgorzata; Wincker, Patrick; Meyer, Eric; Duharcourt, Sandra; Duret, Laurent; Bétermier, Mireille; Sperling, Linda

2012-01-01

Insertions of parasitic DNA within coding sequences are usually deleterious and are generally counter-selected during evolution. Thanks to nuclear dimorphism, ciliates provide unique models to study the fate of such insertions. Their germline genome undergoes extensive rearrangements during development of a new somatic macronucleus from the germline micronucleus following sexual events. In Paramecium, these rearrangements include precise excision of unique-copy Internal Eliminated Sequences (IES) from the somatic DNA, requiring the activity of a domesticated piggyBac transposase, PiggyMac. We have sequenced Paramecium tetraurelia germline DNA, establishing a genome-wide catalogue of ∼45,000 IESs, in order to gain insight into their evolutionary origin and excision mechanism. We obtained direct evidence that PiggyMac is required for excision of all IESs. Homology with known P. tetraurelia Tc1/mariner transposons, described here, indicates that at least a fraction of IESs derive from these elements. Most IES insertions occurred before a recent whole-genome duplication that preceded diversification of the P. aurelia species complex, but IES invasion of the Paramecium genome appears to be an ongoing process. Once inserted, IESs decay rapidly by accumulation of deletions and point substitutions. Over 90% of the IESs are shorter than 150 bp and present a remarkable size distribution with a ∼10 bp periodicity, corresponding to the helical repeat of double-stranded DNA and suggesting DNA loop formation during assembly of a transpososome-like excision complex. IESs are equally frequent within and between coding sequences; however, excision is not 100% efficient and there is selective pressure against IES insertions, in particular within highly expressed genes. We discuss the possibility that ancient domestication of a piggyBac transposase favored subsequent propagation of transposons throughout the germline by allowing insertions in coding sequences, a fraction of the genome in which parasitic DNA is not usually tolerated. PMID:23071448

The Autographa californica Multiple Nucleopolyhedrovirus ac83 Gene Contains a cis-Acting Element That Is Essential for Nucleocapsid Assembly.

PubMed

Huang, Zhihong; Pan, Mengjia; Zhu, Silei; Zhang, Hao; Wu, Wenbi; Yuan, Meijin; Yang, Kai

2017-03-01

Baculoviridae is a family of insect-specific viruses that have a circular double-stranded DNA genome packaged within a rod-shaped capsid. The mechanism of baculovirus nucleocapsid assembly remains unclear. Previous studies have shown that deletion of the ac83 gene of Autographa californica multiple nucleopolyhedrovirus (AcMNPV) blocks viral nucleocapsid assembly. Interestingly, the ac83 -encoded protein Ac83 is not a component of the nucleocapsid, implying a particular role for ac83 in nucleocapsid assembly that may be independent of its protein product. To examine this possibility, Ac83 synthesis was disrupted by insertion of a chloramphenicol resistance gene into its coding sequence or by deleting its promoter and translation start codon. Both mutants produced progeny viruses normally, indicating that the Ac83 protein is not required for nucleocapsid assembly. Subsequently, complementation assays showed that the production of progeny viruses required the presence of ac83 in the AcMNPV genome instead of its presence in trans Therefore, we reasoned that ac83 is involved in nucleocapsid assembly via an internal cis -acting element, which we named the nucleocapsid assembly-essential element (NAE). The NAE was identified to lie within nucleotides 1651 to 1850 of ac83 and had 8 conserved A/T-rich regions. Sequences homologous to the NAE were found only in alphabaculoviruses and have a conserved positional relationship with another essential cis -acting element that was recently identified. The identification of the NAE may help to connect the data of viral cis -acting elements and related proteins in the baculovirus nucleocapsid assembly, which is important for elucidating DNA-protein interaction events during this process. IMPORTANCE Virus nucleocapsid assembly usually requires specific cis -acting elements in the viral genome for various processes, such as the selection of the viral genome from the cellular nucleic acids, the cleavage of concatemeric viral genome replication intermediates, and the encapsidation of the viral genome into procapsids. In linear DNA viruses, such elements generally locate at the ends of the viral genome; however, most of these elements remain unidentified in circular DNA viruses (including baculovirus) due to their circular genomic conformation. Here, we identified a nucleocapsid assembly-essential element in the AcMNPV (the archetype of baculovirus) genome. This finding provides an important reference for studies of nucleocapsid assembly-related elements in baculoviruses and other circular DNA viruses. Moreover, as most of the previous studies of baculovirus nucleocapsid assembly have been focused on viral proteins, our study provides a novel entry point to investigate this mechanism via cis -acting elements in the viral genome. Copyright © 2017 American Society for Microbiology.

Mitochondrial genome rearrangements in glomus species triggered by homologous recombination between distinct mtDNA haplotypes.

PubMed

Beaudet, Denis; Terrat, Yves; Halary, Sébastien; de la Providencia, Ivan Enrique; Hijri, Mohamed

2013-01-01

Comparative mitochondrial genomics of arbuscular mycorrhizal fungi (AMF) provide new avenues to overcome long-lasting obstacles that have hampered studies aimed at understanding the community structure, diversity, and evolution of these multinucleated and genetically polymorphic organisms.AMF mitochondrial (mt) genomes are homogeneous within isolates, and their intergenic regions harbor numerous mobile elements that have rapidly diverged, including homing endonuclease genes, small inverted repeats, and plasmid-related DNA polymerase genes (dpo), making them suitable targets for the development of reliable strain-specific markers. However, these elements may also lead to genome rearrangements through homologous recombination, although this has never previously been reported in this group of obligate symbiotic fungi. To investigate whether such rearrangements are present and caused by mobile elements in AMF, the mitochondrial genomes from two Glomeraceae members (i.e., Glomus cerebriforme and Glomus sp.) with substantial mtDNA synteny divergence,were sequenced and compared with available glomeromycotan mitochondrial genomes. We used an extensive nucleotide/protein similarity network-based approach to investigated podiversity in AMF as well as in other organisms for which sequences are publicly available. We provide strong evidence of dpo-induced inter-haplotype recombination, leading to a reshuffled mitochondrial genome in Glomus sp. These findings raise questions as to whether AMF single spore cultivations artificially underestimate mtDNA genetic diversity.We assessed potential dpo dispersal mechanisms in AMF and inferred a robust phylogenetic relationship with plant mitochondrial plasmids. Along with other indirect evidence, our analyses indicate that members of the Glomeromycota phylum are potential donors of mitochondrial plasmids to plants.

Mitochondrial Genome Rearrangements in Glomus Species Triggered by Homologous Recombination between Distinct mtDNA Haplotypes

PubMed Central

Beaudet, Denis; Terrat, Yves; Halary, Sébastien; de la Providencia, Ivan Enrique; Hijri, Mohamed

2013-01-01

Comparative mitochondrial genomics of arbuscular mycorrhizal fungi (AMF) provide new avenues to overcome long-lasting obstacles that have hampered studies aimed at understanding the community structure, diversity, and evolution of these multinucleated and genetically polymorphic organisms. AMF mitochondrial (mt) genomes are homogeneous within isolates, and their intergenic regions harbor numerous mobile elements that have rapidly diverged, including homing endonuclease genes, small inverted repeats, and plasmid-related DNA polymerase genes (dpo), making them suitable targets for the development of reliable strain-specific markers. However, these elements may also lead to genome rearrangements through homologous recombination, although this has never previously been reported in this group of obligate symbiotic fungi. To investigate whether such rearrangements are present and caused by mobile elements in AMF, the mitochondrial genomes from two Glomeraceae members (i.e., Glomus cerebriforme and Glomus sp.) with substantial mtDNA synteny divergence, were sequenced and compared with available glomeromycotan mitochondrial genomes. We used an extensive nucleotide/protein similarity network-based approach to investigate dpo diversity in AMF as well as in other organisms for which sequences are publicly available. We provide strong evidence of dpo-induced inter-haplotype recombination, leading to a reshuffled mitochondrial genome in Glomus sp. These findings raise questions as to whether AMF single spore cultivations artificially underestimate mtDNA genetic diversity. We assessed potential dpo dispersal mechanisms in AMF and inferred a robust phylogenetic relationship with plant mitochondrial plasmids. Along with other indirect evidence, our analyses indicate that members of the Glomeromycota phylum are potential donors of mitochondrial plasmids to plants. PMID:23925788

The human haptoglobin gene promoter: interleukin-6-responsive elements interact with a DNA-binding protein induced by interleukin-6.

PubMed Central

Oliviero, S; Cortese, R

1989-01-01

Transcription of the human haptoglobin (Hp) gene is induced by interleukin-6 (IL-6) in the human hepatoma cell line Hep3B. Cis-acting elements responsible for this response are localized within the first 186 bp of the 5'-flanking region. Site-specific mutants of the Hp promoter fused to the chloramphenicol acetyl transferase (CAT) gene were analysed by transient transfection into uninduced and IL-6-treated Hep3B cells. We identified three regions, A, B and C, defined by mutation, which are important for the IL-6 response. Band shift experiments using nuclear extracts from untreated or IL-6-treated cells revealed the presence of IL-6-inducible DNA binding activities when DNA fragments containing the A or the C sequences were used. Competition experiments showed that both sequences bind to the same nuclear factors. Polymers of oligonucleotides containing either the A or the C regions confer IL-6 responsiveness to a truncated SV40 promoter. The B region forms several complexes with specific DNA-binding proteins different from those which bind to the A and C region. The B region complexes are identical in nuclear extracts from IL-6-treated and untreated cells. While important for IL-6 induction in the context of the haptoglobin promoter, the B site does not confer IL-6 inducibility to the SV40 promoter. Our results indicate that the IL-6 response of the haptoglobin promoter is dependent on the presence of multiple, partly redundant, cis-acting elements. Images PMID:2787245

Oncogenic LINE-1 Retroelements Sustain Prostate Tumor Cells and Promote Metastatic Progression

DTIC Science & Technology

2015-10-01

elements in prostate cancer contribute to its progression by activating oncogenic DNA sequences, or silencing tumor suppressor like sequences. We have...prostate cancer cells. Experiments are ongoing to determine if PIWIL-1 expression in prostate cancer cells will reduce their growth, thereby providing...proof of principle for future gene-based therapeutics for this cancer . 15. SUBJECT TERMS Prostate cancer , LINE-1, PIWIL-1, retrotransposons 16

CHARACTERIZATION AND NUCLEOTIDE SEQUENCE DETERMINATION OF A REPEAT ELEMENT ISOLATED FROM A 2,4,5,-T DEGRADING STRAIN OF PSEUDOMONAS CEPACIA

EPA Science Inventory

Pseudomonas cepacia strain AC1100, capable of growth on 2,4,5-trichlorophenoxyacetic acid (2,4,5-T), was mutated to the 2,4,5-T− strain PT88 by a ColE1 :: Tn5 chromosomal insertion. Using cloned DNA from the region flanking the insertion, a 1477-bp sequence (designated RS1100) wa...

An Integrated Encyclopedia of DNA Elements in the Human Genome

PubMed Central

2012-01-01

Summary The human genome encodes the blueprint of life, but the function of the vast majority of its nearly three billion bases is unknown. The Encyclopedia of DNA Elements (ENCODE) project has systematically mapped regions of transcription, transcription factor association, chromatin structure, and histone modification. These data enabled us to assign biochemical functions for 80% of the genome, in particular outside of the well-studied protein-coding regions. Many discovered candidate regulatory elements are physically associated with one another and with expressed genes, providing new insights into the mechanisms of gene regulation. The newly identified elements also show a statistical correspondence to sequence variants linked to human disease, and can thereby guide interpretation of this variation. Overall the project provides new insights into the organization and regulation of our genes and genome, and an expansive resource of functional annotations for biomedical research. PMID:22955616

Repetitive part of the banana (Musa acuminata) genome investigated by low-depth 454 sequencing.

PubMed

Hribová, Eva; Neumann, Pavel; Matsumoto, Takashi; Roux, Nicolas; Macas, Jirí; Dolezel, Jaroslav

2010-09-16

Bananas and plantains (Musa spp.) are grown in more than a hundred tropical and subtropical countries and provide staple food for hundreds of millions of people. They are seed-sterile crops propagated clonally and this makes them vulnerable to a rapid spread of devastating diseases and at the same time hampers breeding improved cultivars. Although the socio-economic importance of bananas and plantains cannot be overestimated, they remain outside the focus of major research programs. This slows down the study of nuclear genome and the development of molecular tools to facilitate banana improvement. In this work, we report on the first thorough characterization of the repeat component of the banana (M. acuminata cv. 'Calcutta 4') genome. Analysis of almost 100 Mb of sequence data (0.15× genome coverage) permitted partial sequence reconstruction and characterization of repetitive DNA, making up about 30% of the genome. The results showed that the banana repeats are predominantly made of various types of Ty1/copia and Ty3/gypsy retroelements representing 16 and 7% of the genome respectively. On the other hand, DNA transposons were found to be rare. In addition to new families of transposable elements, two new satellite repeats were discovered and found useful as cytogenetic markers. To help in banana sequence annotation, a specific Musa repeat database was created, and its utility was demonstrated by analyzing the repeat composition of 62 genomic BAC clones. A low-depth 454 sequencing of banana nuclear genome provided the largest amount of DNA sequence data available until now for Musa and permitted reconstruction of most of the major types of DNA repeats. The information obtained in this study improves the knowledge of the long-range organization of banana chromosomes, and provides sequence resources needed for repeat masking and annotation during the Musa genome sequencing project. It also provides sequence data for isolation of DNA markers to be used in genetic diversity studies and in marker-assisted selection.

Repetitive part of the banana (Musa acuminata) genome investigated by low-depth 454 sequencing

PubMed Central

2010-01-01

Background Bananas and plantains (Musa spp.) are grown in more than a hundred tropical and subtropical countries and provide staple food for hundreds of millions of people. They are seed-sterile crops propagated clonally and this makes them vulnerable to a rapid spread of devastating diseases and at the same time hampers breeding improved cultivars. Although the socio-economic importance of bananas and plantains cannot be overestimated, they remain outside the focus of major research programs. This slows down the study of nuclear genome and the development of molecular tools to facilitate banana improvement. Results In this work, we report on the first thorough characterization of the repeat component of the banana (M. acuminata cv. 'Calcutta 4') genome. Analysis of almost 100 Mb of sequence data (0.15× genome coverage) permitted partial sequence reconstruction and characterization of repetitive DNA, making up about 30% of the genome. The results showed that the banana repeats are predominantly made of various types of Ty1/copia and Ty3/gypsy retroelements representing 16 and 7% of the genome respectively. On the other hand, DNA transposons were found to be rare. In addition to new families of transposable elements, two new satellite repeats were discovered and found useful as cytogenetic markers. To help in banana sequence annotation, a specific Musa repeat database was created, and its utility was demonstrated by analyzing the repeat composition of 62 genomic BAC clones. Conclusion A low-depth 454 sequencing of banana nuclear genome provided the largest amount of DNA sequence data available until now for Musa and permitted reconstruction of most of the major types of DNA repeats. The information obtained in this study improves the knowledge of the long-range organization of banana chromosomes, and provides sequence resources needed for repeat masking and annotation during the Musa genome sequencing project. It also provides sequence data for isolation of DNA markers to be used in genetic diversity studies and in marker-assisted selection. PMID:20846365

Novel Structure of Ty3 Reverse Transcriptase | Center for Cancer Research

Cancer.gov

Retrotransposons are mobile genetic elements that self amplify via a single-stranded RNA intermediate, which is converted to double-stranded DNA by an encoded reverse transcriptase (RT) with both DNA polymerase (pol) and ribonuclease H (RNase) activities. Categorized by whether they contain flanking long terminal repeat (LTR) sequences, retrotransposons play a critical role in the architecture of eukaryotic genomes and are the evolutionary origin of retroviruses, including human immunodeficiency virus (HIV).

Lactase non-persistence is directed by DNA variation-dependent epigenetic aging

PubMed Central

Labrie, Viviane; Buske, Orion J; Oh, Edward; Jeremian, Richie; Ptak, Carolyn; Gasiūnas, Giedrius; Maleckas, Almantas; Petereit, Rūta; Žvirbliene, Aida; Adamonis, Kęstutis; Kriukienė, Edita; Koncevičius, Karolis; Gordevičius, Juozas; Nair, Akhil; Zhang, Aiping; Ebrahimi, Sasha; Oh, Gabriel; Šikšnys, Virginijus; Kupčinskas, Limas; Brudno, Michael; Petronis, Arturas

2016-01-01

Inability to digest lactose due to lactase non-persistence is a common trait in adult mammals, with the exception of certain human populations that exhibit lactase persistence. It is not clear how the lactase gene can be dramatically downregulated with age in most individuals, but remains active in some. We performed a comprehensive epigenetic study of the human and mouse intestine using chromosome-wide DNA modification profiling and targeted bisulfite sequencing. Epigenetically-controlled regulatory elements were found to account for the differences in lactase mRNA levels between individuals, intestinal cell types and species. The importance of these regulatory elements in modulating lactase mRNA levels was confirmed by CRISPR-Cas9-induced deletions. Genetic factors contribute to epigenetic changes occurring with age at the regulatory elements, as lactase persistence- and non-persistence-DNA haplotypes demonstrated markedly different epigenetic aging. Thus, genetic factors facilitate a gradual accumulation of epigenetic changes with age to affect phenotypic outcome. PMID:27159559

Isolation and characterization of a water stress-specific genomic gene, pwsi 18, from rice.

PubMed

Joshee, N; Kisaka, H; Kitagawa, Y

1998-01-01

One of the water stress-specific cDNA clones of rice characterised previously, wsi18, was selected for further study. The wsi18 gene can be induced by water stress conditions such as mannitol, NaCl, and dryness, but not by ABA, cold, or heat. A genomic clone for wsi18, pwsi18, contained about 1.7 kbp of the 5' upstream sequence, two introns, and the full coding sequence. The 5'-upstream sequence of pwsi18 contained putative cis-acting elements, namely an ABA-responsive element (ABRE), three G-boxes, three E-boxes, a MEF-2 sequence, four direct and two inverted repeats, and four sequences similar to DRE, which is involved in the dehydration response of Arabidopsis genes. The gusA reporter gene under the control of the pwsi18 promoter showed transient expression in response to water stress. Deletion of the downstream DRE-like sequence between the distal G-boxes-2 and -3 resulted in rather low GUS expression.

Evolution of Sphingomonad Gene Clusters Related to Pesticide Catabolism Revealed by Genome Sequence and Mobilomics of Sphingobium herbicidovorans MH.

PubMed

Nielsen, Tue Kjærgaard; Rasmussen, Morten; Demanèche, Sandrine; Cecillon, Sébastien; Vogel, Timothy M; Hansen, Lars Hestbjerg

2017-09-01

Bacterial degraders of chlorophenoxy herbicides have been isolated from various ecosystems, including pristine environments. Among these degraders, the sphingomonads constitute a prominent group that displays versatile xenobiotic-degradation capabilities. Four separate sequencing strategies were required to provide the complete sequence of the complex and plastic genome of the canonical chlorophenoxy herbicide-degrading Sphingobium herbicidovorans MH. The genome has an intricate organization of the chlorophenoxy-herbicide catabolic genes sdpA, rdpA, and cadABCD that encode the (R)- and (S)-enantiomer-specific 2,4-dichlorophenoxypropionate dioxygenases and four subunits of a Rieske non-heme iron oxygenase involved in 2-methyl-chlorophenoxyacetic acid degradation, respectively. Several major genomic rearrangements are proposed to help understand the evolution and mobility of these important genes and their genetic context. Single-strain mobilomic sequence analysis uncovered plasmids and insertion sequence-associated circular intermediates in this environmentally important bacterium and enabled the description of evolutionary models for pesticide degradation in strain MH and related organisms. The mobilome presented a complex mosaic of mobile genetic elements including four plasmids and several circular intermediate DNA molecules of insertion-sequence elements and transposons that are central to the evolution of xenobiotics degradation. Furthermore, two individual chromosomally integrated prophages were shown to excise and form free circular DNA molecules. This approach holds great potential for improving the understanding of genome plasticity, evolution, and microbial ecology. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Transposable element evolution in Heliconius suggests genome diversity within Lepidoptera

PubMed Central

2013-01-01

Background Transposable elements (TEs) have the potential to impact genome structure, function and evolution in profound ways. In order to understand the contribution of transposable elements (TEs) to Heliconius melpomene, we queried the H. melpomene draft sequence to identify repetitive sequences. Results We determined that TEs comprise ~25% of the genome. The predominant class of TEs (~12% of the genome) was the non-long terminal repeat (non-LTR) retrotransposons, including a novel SINE family. However, this was only slightly higher than content derived from DNA transposons, which are diverse, with several families having mobilized in the recent past. Compared to the only other well-studied lepidopteran genome, Bombyx mori, H. melpomene exhibits a higher DNA transposon content and a distinct repertoire of retrotransposons. We also found that H. melpomene exhibits a high rate of TE turnover with few older elements accumulating in the genome. Conclusions Our analysis represents the first complete, de novo characterization of TE content in a butterfly genome and suggests that, while TEs are able to invade and multiply, TEs have an overall deleterious effect and/or that maintaining a small genome is advantageous. Our results also hint that analysis of additional lepidopteran genomes will reveal substantial TE diversity within the group. PMID:24088337

Tomato ASR1 abrogates the response to abscisic acid and glucose in Arabidopsis by competing with ABI4 for DNA binding.

PubMed

Shkolnik, Doron; Bar-Zvi, Dudy

2008-05-01

The manipulation of transacting factors is commonly used to achieve a wide change in the expression of a large number of genes in transgenic plants as a result of a change in the expression of a single gene product. This is mostly achieved by the overexpression of transactivator or repressor proteins. In this study, it is demonstrated that the overexpression of an exogenous DNA-binding protein can be used to compete with the expression of an endogenous transcription factor sharing the same DNA-binding sequence. Arabidopsis was transformed with cDNA encoding tomato abscisic acid stress ripening 1 (ASR1), a sequence-specific DNA protein that has no orthologues in the Arabidopsis genome. ASR1-overexpressing (ASR1-OE) plants display an abscisic acid-insensitive 4 (abi4) phenotype: seed germination is not sensitive to inhibition by abscisic acid (ABA), glucose, NaCl and paclobutrazol. ASR1 binds coupling element 1 (CE1), a cis-acting element bound by the ABI4 transcription factor, located in the ABI4-regulated promoters, including that of the ABI4 gene. Chromatin immunoprecipitation demonstrates that ASR1 is bound in vivo to the promoter of the ABI4 gene in ASR1-OE plants, but not to promoters of genes known to be regulated by the transcription factors ABI3 or ABI5. Real-time polymerase chain reaction (PCR) analysis confirmed that the expression of ABI4 and ABI4-regulated genes is markedly reduced in ASR1-OE plants. Therefore, it is concluded that the abi4 phenotype of ASR1-OE plants is the result of competition between the foreign ASR1 and the endogenous ABI4 on specific promoter DNA sequences. The biotechnological advantage of using this approach in crop plants from the Brassicaceae family to reduce the transactivation activity of ABI4 is discussed.

Recombination, rearrangement, reshuffling, and divergence in a centromeric region of rice.

PubMed

Ma, Jianxin; Bennetzen, Jeffrey L

2006-01-10

Centromeres have many unusual biological properties, including kinetochore attachment and severe repression of local meiotic recombination. These properties are partly an outcome, partly a cause, of unusual DNA structure in the centromeric region. Although several plant and animal genomes have been sequenced, most centromere sequences have not been completed or analyzed in depth. To shed light on the unique organization, variability, and evolution of centromeric DNA, detailed analysis of a 1.97-Mb sequence that includes centromere 8 (CEN8) of japonica rice was undertaken. Thirty-three long-terminal repeat (LTR)-retrotransposon families (including 11 previously unknown) were identified in the CEN8 region, totaling 245 elements and fragments that account for 67% of the region. The ratio of solo LTRs to intact elements in the CEN8 region is approximately 0.9:1, compared with approximately 2.2:1 in noncentromeric regions of rice. However, the ratio of solo LTRs to intact elements in the core of the CEN8 region ( approximately 2.5:1) is higher than in any other region investigated in rice, suggesting a hotspot for unequal recombination. Comparison of the CEN8 region of japonica and its orthologous segments from indica rice indicated that approximately 15% of the intact retrotransposons and solo LTRs were inserted into CEN8 after the divergence of japonica and indica from a common ancestor, compared with approximately 50% for previously studied euchromatic regions. Frequent DNA rearrangements were observed in the CEN8 region, including a 212-kb subregion that was found to be composed of three rearranged tandem repeats. Phylogenetic analysis also revealed recent segmental duplication and extensive rearrangement and reshuffling of the CentO satellite repeats.

Transcription of Gypsy Elements in a Y-Chromosome Male Fertility Gene of Drosophila Hydei

PubMed Central

Hochstenbach, R.; Harhangi, H.; Schouren, K.; Bindels, P.; Suijkerbuijk, R.; Hennig, W.

1996-01-01

We have found that defective gypsy retrotransposons are a major constituent of the lampbrush loop pair Nooses in the short arm of the Y chromosome of Drosophila hydei. The loop pair is formed by male fertility gene Q during the primary spermatocyte stage of spermatogenesis, each loop being a single transcription unit with an estimated length of 260 kb. Using fluorescent in situ hybridization, we show that throughout the loop transcripts gypsy elements are interspersed with blocks of a tandemly repetitive Y-specific DNA sequence, ay1. Nooses transcripts containing both sequence types show a wide size range on Northern blots, do not migrate to the cytoplasm, and are degraded just before the first meiotic division. Only one strand of ay1 and only the coding strand of gypsy can be detected in the loop transcripts. However, as cloned genomic DNA fragments also display opposite orientations of ay1 and gypsy, such DNA sections cannot be part of the Nooses. Hence, they are most likely derived from the flanking heterochromatin. The direction of transcription of ay1 and gypsy thus appears to be of a functional significance. PMID:8852843

Cooperative heteroassembly of the adenoviral L4-22K and IVa2 proteins onto the viral packaging sequence DNA.

PubMed

Yang, Teng-Chieh; Maluf, Nasib Karl

2012-02-21

Human adenovirus (Ad) is an icosahedral, double-stranded DNA virus. Viral DNA packaging refers to the process whereby the viral genome becomes encapsulated by the viral particle. In Ad, activation of the DNA packaging reaction requires at least three viral components: the IVa2 and L4-22K proteins and a section of DNA within the viral genome, called the packaging sequence. Previous studies have shown that the IVa2 and L4-22K proteins specifically bind to conserved elements within the packaging sequence and that these interactions are absolutely required for the observation of DNA packaging. However, the equilibrium mechanism for assembly of IVa2 and L4-22K onto the packaging sequence has not been determined. Here we characterize the assembly of the IVa2 and L4-22K proteins onto truncated packaging sequence DNA by analytical sedimentation velocity and equilibrium methods. At limiting concentrations of L4-22K, we observe a species with two IVa2 monomers and one L4-22K monomer bound to the DNA. In this species, the L4-22K monomer is promoting positive cooperative interactions between the two bound IVa2 monomers. As L4-22K levels are increased, we observe a species with one IVa2 monomer and three L4-22K monomers bound to the DNA. To explain this result, we propose a model in which L4-22K self-assembly on the DNA competes with IVa2 for positive heterocooperative interactions, destabilizing binding of the second IVa2 monomer. Thus, we propose that L4-22K levels control the extent of cooperativity observed between adjacently bound IVa2 monomers. We have also determined the hydrodynamic properties of all observed stoichiometric species; we observe that species with three L4-22K monomers bound have more extended conformations than species with a single L4-22K bound. We suggest this might reflect a molecular switch that controls insertion of the viral DNA into the capsid.

Evolutionary diversity and potential recombinogenic role of integration targets of non-LTR retrotransposons

PubMed Central

Gentles, Andrew J.; Kohany, Oleksiy; Jurka, Jerzy

2005-01-01

Short interspersed elements (SINEs) make up a significant fraction of total DNA in mammalian genomes, providing a rich substrate for chromosomal rearrangements by SINE-SINE recombinations. Proliferation of mammalian SINEs is mediated primarily by LINE1 (L1) non-LTR retrotransposons that preferentially integrate at DNA sequence targets with average length ~15 bp and containing conserved endonucleolytic nicking signals at both ends. We report that sequence variations in the first of the two nicking signals, represented by a 5′TT-AAAA consensus sequence, affect the position of the second signal thus leading to target site duplications (TSDs) of different lengths. The length distribution of TSDs appears to be affected also by L1-encoded enzyme variants, since targets with the same 5′ nicking site can be of different average length in different mammalian species. Taking this into account, we re-analyzed the second nicking site and found that it is larger and includes more conserved sites than previously appreciated, with a consensus of 5′ANTNTN-AA. We also studied potential involvement of the nicking sites in stimulating recombinations between SINE elements. We determined that SINE elements retaining TSDs with perfect 5′TT-AAAA nicking sites appear to be lost relatively rapidly from the human and rat genomes, and less rapidly from dog. We speculate that the introduction of single-strand DNA breaks induced by recurring endonucleolytic attacks at these sites, combined with the ubiquitousness of SINEs, may significantly promote recombination between repetitive elements, leading to the observed losses. At the same time new L1 subfamilies may be selected for “incompatibility” with pre-existing targets. This provides a possible driving force for the continual emergence of new L1 subfamilies which, in turn, may affect selection of L1-dependent SINE subfamilies. PMID:15944437

Comparative Genomics in Drosophila.

PubMed

Oti, Martin; Pane, Attilio; Sammeth, Michael

2018-01-01

Since the pioneering studies of Thomas Hunt Morgan and coworkers at the dawn of the twentieth century, Drosophila melanogaster and its sister species have tremendously contributed to unveil the rules underlying animal genetics, development, behavior, evolution, and human disease. Recent advances in DNA sequencing technologies launched Drosophila into the post-genomic era and paved the way for unprecedented comparative genomics investigations. The complete sequencing and systematic comparison of the genomes from 12 Drosophila species represents a milestone achievement in modern biology, which allowed a plethora of different studies ranging from the annotation of known and novel genomic features to the evolution of chromosomes and, ultimately, of entire genomes. Despite the efforts of countless laboratories worldwide, the vast amount of data that were produced over the past 15 years is far from being fully explored.In this chapter, we will review some of the bioinformatic approaches that were developed to interrogate the genomes of the 12 Drosophila species. Setting off from alignments of the entire genomic sequences, the degree of conservation can be separately evaluated for every region of the genome, providing already first hints about elements that are under purifying selection and therefore likely functional. Furthermore, the careful analysis of repeated sequences sheds light on the evolutionary dynamics of transposons, an enigmatic and fascinating class of mobile elements housed in the genomes of animals and plants. Comparative genomics also aids in the computational identification of the transcriptionally active part of the genome, first and foremost of protein-coding loci, but also of transcribed nevertheless apparently noncoding regions, which were once considered "junk" DNA. Eventually, the synergy between functional and comparative genomics also facilitates in silico and in vivo studies on cis-acting regulatory elements, like transcription factor binding sites, that due to the high degree of sequence variability usually impose increased challenges for bioinformatics approaches.

Identification of Bari Transposons in 23 Sequenced Drosophila Genomes Reveals Novel Structural Variants, MITEs and Horizontal Transfer

PubMed Central

D’Addabbo, Pietro; Caizzi, Ruggiero

2016-01-01

Bari elements are members of the Tc1-mariner superfamily of DNA transposons, originally discovered in Drosophila melanogaster, and subsequently identified in silico in 11 sequenced Drosophila genomes and as experimentally isolated in four non-sequenced Drosophila species. Bari-like elements have been also studied for their mobility both in vivo and in vitro. We analyzed 23 Drosophila genomes and carried out a detailed characterization of the Bari elements identified, including those from the heterochromatic Bari1 cluster in D. melanogaster. We have annotated 401 copies of Bari elements classified either as putatively autonomous or inactive according to the structure of the terminal sequences and the presence of a complete transposase-coding region. Analyses of the integration sites revealed that Bari transposase prefers AT-rich sequences in which the TA target is cleaved and duplicated. Furthermore evaluation of transposon’s co-occurrence near the integration sites of Bari elements showed a non-random distribution of other transposable elements. We also unveil the existence of a putatively autonomous Bari1 variant characterized by two identical long Terminal Inverted Repeats, in D. rhopaloa. In addition, we detected MITEs related to Bari transposons in 9 species. Phylogenetic analyses based on transposase gene and the terminal sequences confirmed that Bari-like elements are distributed into three subfamilies. A few inconsistencies in Bari phylogenetic tree with respect to the Drosophila species tree could be explained by the occurrence of horizontal transfer events as also suggested by the results of dS analyses. This study further clarifies the Bari transposon’s evolutionary dynamics and increases our understanding on the Tc1-mariner elements’ biology. PMID:27213270

Optical mapping reveals a large genetic inversion between two methicillin-resistant Staphylococcus aureus strains.

PubMed

Shukla, Sanjay K; Kislow, Jennifer; Briska, Adam; Henkhaus, John; Dykes, Colin

2009-09-01

Staphylococcus aureus is a highly versatile and evolving bacterium of great clinical importance. S. aureus can evolve by acquiring single nucleotide polymorphisms and mobile genetic elements and by recombination events. Identification and location of novel genomic elements in a bacterial genome are not straightforward, unless the whole genome is sequenced. Optical mapping is a new tool that creates a high-resolution, in situ ordered restriction map of a bacterial genome. These maps can be used to determine genomic organization and perform comparative genomics to identify genomic rearrangements, such as insertions, deletions, duplications, and inversions, compared to an in silico (virtual) restriction map of a known genome sequence. Using this technology, we report here the identification, approximate location, and characterization of a genetic inversion of approximately 500 kb of a DNA element between the NRS387 (USA800) and FPR3757 (USA300) strains. The presence of the inversion and location of its junction sites were confirmed by site-specific PCR and sequencing. At both the left and right junction sites in NRS387, an IS1181 element and a 73-bp sequence were identified as inverted repeats, which could explain the possible mechanism of the inversion event.

Control of DEMETER DNA demethylase gene transcription in male and female gamete companion cells in Arabidopsis thaliana.

PubMed

Park, Jin-Sup; Frost, Jennifer M; Park, Kyunghyuk; Ohr, Hyonhwa; Park, Guen Tae; Kim, Seohyun; Eom, Hyunjoo; Lee, Ilha; Brooks, Janie S; Fischer, Robert L; Choi, Yeonhee

2017-02-21

The DEMETER (DME) DNA glycosylase initiates active DNA demethylation via the base-excision repair pathway and is vital for reproduction in Arabidopsis thaliana DME-mediated DNA demethylation is preferentially targeted to small, AT-rich, and nucleosome-depleted euchromatic transposable elements, influencing expression of adjacent genes and leading to imprinting in the endosperm. In the female gametophyte, DME expression and subsequent genome-wide DNA demethylation are confined to the companion cell of the egg, the central cell. Here, we show that, in the male gametophyte, DME expression is limited to the companion cell of sperm, the vegetative cell, and to a narrow window of time: immediately after separation of the companion cell lineage from the germline. We define transcriptional regulatory elements of DME using reporter genes, showing that a small region, which surprisingly lies within the DME gene, controls its expression in male and female companion cells. DME expression from this minimal promoter is sufficient to rescue seed abortion and the aberrant DNA methylome associated with the null dme-2 mutation. Within this minimal promoter, we found short, conserved enhancer sequences necessary for the transcriptional activities of DME and combined predicted binding motifs with published transcription factor binding coordinates to produce a list of candidate upstream pathway members in the genetic circuitry controlling DNA demethylation in gamete companion cells. These data show how DNA demethylation is regulated to facilitate endosperm gene imprinting and potential transgenerational epigenetic regulation, without subjecting the germline to potentially deleterious transposable element demethylation.

A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

PubMed Central

Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C

1992-01-01

Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867

New insights into Acinetobacter baumannii pathogenesis revealed by high-density pyrosequencing and transposon mutagenesis.

PubMed

Smith, Michael G; Gianoulis, Tara A; Pukatzki, Stefan; Mekalanos, John J; Ornston, L Nicholas; Gerstein, Mark; Snyder, Michael

2007-03-01

Acinetobacter baumannii has emerged as an important and problematic human pathogen as it is the causative agent of several types of infections including pneumonia, meningitis, septicemia, and urinary tract infections. We explored the pathogenic content of this harmful pathogen using a combination of DNA sequencing and insertional mutagenesis. The genome of this organism was sequenced using a strategy involving high-density pyrosequencing, a novel, rapid method of high-throughput sequencing. Excluding the rDNA repeats, the assembled genome is 3,976,746 base pairs (bp) and has 3830 ORFs. A significant fraction of ORFs (17.2%) are located in 28 putative alien islands, indicating that the genome has acquired a large amount of foreign DNA. Consistent with its role in pathogenesis, a remarkable number of the islands (16) contain genes implicated in virulence, indicating the organism devotes a considerable portion of its genes to pathogenesis. The largest island contains elements homologous to the Legionella/Coxiella Type IV secretion apparatus. Type IV secretion systems have been demonstrated to be important for virulence in other organisms and thus are likely to help mediate pathogenesis of A. baumannii. Insertional mutagenesis generated avirulent isolates of A. baumannii and verified that six of the islands contain virulence genes, including two novel islands containing genes that lacked homology with others in the databases. The DNA sequencing approach described in this study allows the rapid elucidation of the DNA sequence of any microbe and, when combined with genetic screens, can identify many novel genes important for microbial pathogenesis.

The Targeted Sequencing of Alpha Satellite DNA in Cercopithecus pogonias Provides New Insight into the Diversity and Dynamics of Centromeric Repeats in Old World monkeys.

PubMed

Cacheux, Lauriane; Ponger, Loïc; Gerbault-Seureau, Michèle; Loll, François; Gey, Delphine; Richard, Florence Anne; Escudé, Christophe

2018-06-01

Alpha satellite is the major repeated DNA element of primate centromeres. Specific evolutionary mechanisms have led to a great diversity of sequence families with peculiar genomic organization and distribution, which have till now been studied mostly in great apes. Using high throughput sequencing of alpha satellite monomers obtained by enzymatic digestion followed by computational and cytogenetic analysis, we compare here the diversity and genomic distribution of alpha satellite DNA in two related Old World monkey species, Cercopithecus pogonias and Cercopithecus solatus, which are known to have diverged about seven million years ago. Two main families of monomers, called C1 and C2, are found in both species. A detailed analysis of our datasets revealed the existence of numerous subfamilies within the centromeric C1 family. Although the most abundant subfamily is conserved between both species, our FISH experiments clearly show that some subfamilies are specific for each species and that their distribution is restricted to a subset of chromosomes, thereby pointing to the existence of recurrent amplification/homogenization events. The pericentromeric C2 family is very abundant on the short arm of all acrocentric chromosomes in both species, pointing to specific mechanisms that lead to this distribution. Results obtained using two different restriction enzymes are fully consistent with a predominant monomeric organization of alpha satellite DNA which coexists with higher order organization patterns in the Cercopithecus pogonias genome. Our study suggests a high dynamics of alpha satellite DNA in Cercopithecini, with recurrent apparition of new sequence variants and interchromosomal sequence transfer.

Families of short interspersed elements in the genome of the oomycete plant pathogen, Phytophthora infestans.

PubMed

Whisson, Stephen C; Avrova, Anna O; Lavrova, Olga; Pritchard, Leighton

2005-04-01

The first known families of tRNA-related short interspersed elements (SINEs) in the oomycetes were identified by exploiting the genomic DNA sequence resources for the potato late blight pathogen, Phytophthora infestans. Fifteen families of tRNA-related SINEs, as well as predicted tRNAs, and other possible RNA polymerase III-transcribed sequences were identified. The size of individual elements ranges from 101 to 392 bp, representing sequences present from low (1) to highly abundant (over 2000) copy number in the P. infestans genome, based on quantitative PCR analysis. Putative short direct repeat sequences (6-14 bp) flanking the elements were also identified for eight of the SINEs. Predicted SINEs were named in a series prefixed infSINE (for infestans-SINE). Two SINEs were apparently present as multimers of tRNA-related units; four copies of a related unit for infSINEr, and two unrelated units for infSINEz. Two SINEs, infSINEh and infSINEi, were typically located within 400 bp of each other. These were also the only two elements identified as being actively transcribed in the mycelial stage of P. infestans by RT-PCR. It is possible that infSINEh and infSINEi represent active retrotransposons in P. infestans. Based on the quantitative PCR estimates of copy number for all of the elements identified, tRNA-related SINEs were estimated to comprise 0.3% of the 250 Mb P. infestans genome. InfSINE-related sequences were found to occur in species throughout the genus Phytophthora. However, seven elements were shown to be exclusive to P. infestans.

A variant Tc4 transposable element in the nematode C. elegans could encode a novel protein.

PubMed Central

Li, W; Shaw, J E

1993-01-01

A variant C. elegans Tc4 transposable element, Tc4-rh1030, has been sequenced and is 3483 bp long. The Tc4 element that had been analyzed previously is 1605 bp long, consists of two 774-bp nearly perfect inverted terminal repeats connected by a 57-bp loop, and lacks significant open reading frames. In Tc4-rh1030, by comparison, a 2343-bp novel sequence is present in place of a 477-bp segment in one of the inverted repeats. The novel sequence of Tc4-rh1030 is present about five times per haploid genome and is invariably associated with Tc4 elements; we have used the designation Tc4v to denote this variant subfamily of Tc4 elements. Sequence analysis of three cDNA clones suggests that a Tc4v element contains at least five exons that could encode a novel basic protein of 537 amino acid residues. On northern blots, a 1.6-kb Tc4v-specific transcript was detected in the mutator strain TR679 but not in the wild-type strain N2; Tc4 elements are known to transpose in TR679 but appear to be quiescent in N2. We have analyzed transcripts produced by an unc-33 gene that has the Tc4-rh1030 insertional mutation in its transcribed region; all or almost all of the Tc4v sequence is frequently spliced out of the mutant unc-33 transcripts, sometimes by means of non-consensus splice acceptor sites. Images PMID:8382791

Optimized smith waterman processor design for breast cancer early diagnosis

NASA Astrophysics Data System (ADS)

Nurdin, D. S.; Isa, M. N.; Ismail, R. C.; Ahmad, M. I.

2017-09-01

This paper presents an optimized design of Processing Element (PE) of Systolic Array (SA) which implements affine gap penalty Smith Waterman (SW) algorithm on the Xilinx Virtex-6 XC6VLX75T Field Programmable Gate Array (FPGA) for Deoxyribonucleic Acid (DNA) sequence alignment. The PE optimization aims to reduce PE logic resources to increase number of PEs in FPGA for higher degree of parallelism during alignment matrix computations. This is useful for aligning long DNA-based disease sequence such as Breast Cancer (BC) for early diagnosis. The optimized PE architecture has the smallest PE area with 15 slices in a PE and 776 PEs implemented in the Virtex - 6 FPGA.

Using FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements) to isolate active regulatory DNA

PubMed Central

Simon, Jeremy M.; Giresi, Paul G.; Davis, Ian J.; Lieb, Jason D.

2013-01-01

Eviction or destabilization of nucleosomes from chromatin is a hallmark of functional regulatory elements of the eukaryotic genome. Historically identified by nuclease hypersensitivity, these regulatory elements are typically bound by transcription factors or other regulatory proteins. FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements) is an alternative approach to identify these genomic regions and has proven successful in a multitude of eukaryotic cell and tissue types. Cells or dissociated tissues are crosslinked briefly with formaldehyde, lysed, and sonicated. Sheared chromatin is subjected to phenol-chloroform extraction and the isolated DNA, typically encompassing 1–3% of the human genome, is purified. We provide guidelines for quantitative analysis by PCR, microarrays, or next-generation sequencing. Regulatory elements enriched by FAIRE display high concordance with those identified by nuclease hypersensitivity or ChIP, and the entire procedure can be completed in three days. FAIRE exhibits low technical variability, which allows its use in large-scale studies of chromatin from normal or diseased tissues. PMID:22262007

Genetic Perturbation of the Maize Methylome[W

PubMed Central

Li, Qing; Hermanson, Peter J.; Zaunbrecher, Virginia M.; Song, Jawon; Wendt, Jennifer; Rosenbaum, Heidi; Madzima, Thelma F.; Sloan, Amy E.; Huang, Ji; Burgess, Daniel L.; Richmond, Todd A.; McGinnis, Karen M.; Meeley, Robert B.; Danilevskaya, Olga N.; Vaughn, Matthew W.; Kaeppler, Shawn M.; Jeddeloh, Jeffrey A.

2014-01-01

DNA methylation can play important roles in the regulation of transposable elements and genes. A collection of mutant alleles for 11 maize (Zea mays) genes predicted to play roles in controlling DNA methylation were isolated through forward- or reverse-genetic approaches. Low-coverage whole-genome bisulfite sequencing and high-coverage sequence-capture bisulfite sequencing were applied to mutant lines to determine context- and locus-specific effects of these mutations on DNA methylation profiles. Plants containing mutant alleles for components of the RNA-directed DNA methylation pathway exhibit loss of CHH methylation at many loci as well as CG and CHG methylation at a small number of loci. Plants containing loss-of-function alleles for chromomethylase (CMT) genes exhibit strong genome-wide reductions in CHG methylation and some locus-specific loss of CHH methylation. In an attempt to identify stocks with stronger reductions in DNA methylation levels than provided by single gene mutations, we performed crosses to create double mutants for the maize CMT3 orthologs, Zmet2 and Zmet5, and for the maize DDM1 orthologs, Chr101 and Chr106. While loss-of-function alleles are viable as single gene mutants, the double mutants were not recovered, suggesting that severe perturbations of the maize methylome may have stronger deleterious phenotypic effects than in Arabidopsis thaliana. PMID:25527708

Plasmids encoding PKI(1-31), a specific inhibitor of cAMP-stimulated gene expression, inhibit the basal transcriptional activity of some but not all cAMP-regulated DNA response elements in JEG-3 cells.

PubMed

Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J

1989-11-25

Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids encoding PKI(1-31) inhibit the expression that is stimulated by the addition of cAMP analogs in both cell lines; basal expression, however, is inhibited by PKI(1-31) only in the JEG-3 cell line and not in the CV-1 cells. These observations indicate that, in JEG-3 cells, PKI(1-31) is a specific inhibitor of kinase A-mediated gene transcription, but it does not modify kinase C-directed transcription.(ABSTRACT TRUNCATED AT 400 WORDS)

Detection of DNA polymerase λ activity during seed germination and enhancement after salinity stress and dehydration in the plumules of indica rice (Oryza sativa L.

PubMed

Sihi, Sayantani; Bakshi, Sankar; Sengupta, Dibyendu Narayan

2015-02-01

DNA polymerase λ (DNA pol λ) is the only reported X-family DNA polymerases in plants and has been shown to play a significant role in dry quiescent seeds, growth, development and nuclear DNA repair. cDNA for DNA pol λ has been reported in Arabidopsis and japonica rice cultivar and has been characterized from E. coli expressed protein, but very little is known about its activity at protein level in plants. The enzymatic activity of DNA pol λ was studied in dry, imbibed and during different germination stages of indica rice IR-8 (salt sensitive) by in-gel activity assay to determine its physiological role in important stages of growth and development. The upstream sequence was also analyzed using plantCARE database and was found to contain several cis-acting elements, including light responsive elements, dehydration responsive elements, Myb binding sites, etc. Hence, 4-day-old germinating seedlings of IR29, a salt-sensitive, but high yielding indica rice cultivar and Nonabokra, a salt-tolerant, but low yielding cultivar were treated with water (control) or 250 mM NaCl or 20% polyethyleneglycol-6000 for 4 and 8 h. The protein was analyzed by in vitro DNA pol λ activity assay, in-gel activity assay and Western blot analysis. DNA pol λ was not detected in dry seeds, but enhanced after imbibition and detectable from low level to high level during subsequent germination steps. Both salinity and dehydration stress led to the enhancement of the activity and protein level of DNA pol λ, as compared to control tissues. This is the first evidence of the salinity or dehydration stress induced enhancement of DNA pol λ activity in the plumules of rice (Oryza sativa L.) cultivars.

Stretching and Controlled Motion of Single-Stranded DNA in Locally-Heated Solid-State Nanopores

PubMed Central

Belkin, Maxim; Maffeo, Christopher; Wells, David B.

2013-01-01

Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4–8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA. PMID:23876013

Entropy and long-range memory in random symbolic additive Markov chains

NASA Astrophysics Data System (ADS)

Melnik, S. S.; Usatenko, O. V.

2016-06-01

The goal of this paper is to develop an estimate for the entropy of random symbolic sequences with elements belonging to a finite alphabet. As a plausible model, we use the high-order additive stationary ergodic Markov chain with long-range memory. Supposing that the correlations between random elements of the chain are weak, we express the conditional entropy of the sequence by means of the symbolic pair correlation function. We also examine an algorithm for estimating the conditional entropy of finite symbolic sequences. We show that the entropy contains two contributions, i.e., the correlation and the fluctuation. The obtained analytical results are used for numerical evaluation of the entropy of written English texts and DNA nucleotide sequences. The developed theory opens the way for constructing a more consistent and sophisticated approach to describe the systems with strong short-range and weak long-range memory.

Entropy and long-range memory in random symbolic additive Markov chains.

PubMed

Melnik, S S; Usatenko, O V

2016-06-01

The goal of this paper is to develop an estimate for the entropy of random symbolic sequences with elements belonging to a finite alphabet. As a plausible model, we use the high-order additive stationary ergodic Markov chain with long-range memory. Supposing that the correlations between random elements of the chain are weak, we express the conditional entropy of the sequence by means of the symbolic pair correlation function. We also examine an algorithm for estimating the conditional entropy of finite symbolic sequences. We show that the entropy contains two contributions, i.e., the correlation and the fluctuation. The obtained analytical results are used for numerical evaluation of the entropy of written English texts and DNA nucleotide sequences. The developed theory opens the way for constructing a more consistent and sophisticated approach to describe the systems with strong short-range and weak long-range memory.

Mobility and generation of mosaic non-autonomous transposons by Tn3-derived inverted-repeat miniature elements (TIMEs).

PubMed

Szuplewska, Magdalena; Ludwiczak, Marta; Lyzwa, Katarzyna; Czarnecki, Jakub; Bartosik, Dariusz

2014-01-01

Functional transposable elements (TEs) of several Pseudomonas spp. strains isolated from black shale ore of Lubin mine and from post-flotation tailings of Zelazny Most in Poland, were identified using a positive selection trap plasmid strategy. This approach led to the capture and characterization of (i) 13 insertion sequences from 5 IS families (IS3, IS5, ISL3, IS30 and IS1380), (ii) isoforms of two Tn3-family transposons--Tn5563a and Tn4662a (the latter contains a toxin-antitoxin system), as well as (iii) non-autonomous TEs of diverse structure, ranging in size from 262 to 3892 bp. The non-autonomous elements transposed into AT-rich DNA regions and generated 5- or 6-bp sequence duplications at the target site of transposition. Although these TEs lack a transposase gene, they contain homologous 38-bp-long terminal inverted repeat sequences (IRs), highly conserved in Tn5563a and many other Tn3-family transposons. The simplest elements of this type, designated TIMEs (Tn3 family-derived Inverted-repeat Miniature Elements) (262 bp), were identified within two natural plasmids (pZM1P1 and pLM8P2) of Pseudomonas spp. It was demonstrated that TIMEs are able to mobilize segments of plasmid DNA for transposition, which results in the generation of more complex non-autonomous elements, resembling IS-driven composite transposons in structure. Such transposon-like elements may contain different functional genetic modules in their core regions, including plasmid replication systems. Another non-autonomous element "captured" with a trap plasmid was a TIME derivative containing a predicted resolvase gene and a res site typical for many Tn3-family transposons. The identification of a portable site-specific recombination system is another intriguing example confirming the important role of non-autonomous TEs of the TIME family in shuffling genetic information in bacterial genomes. Transposition of such mosaic elements may have a significant impact on diversity and evolution, not only of transposons and plasmids, but also of other types of mobile genetic elements.

Identification of viral and non-viral reverse transcribing elements in pineapple (Ananas comosus), including members of two new badnavirus species.

PubMed

Gambley, C F; Geering, A D W; Steele, V; Thomas, J E

2008-01-01

A previously published partial sequence of pineapple bacilliform virus was shown to be from a retrotransposon (family Metaviridae) and not from a badnavirus as previously thought. Two newly discovered sequence groups isolated from pineapple were associated with bacilliform virions and were transmitted by mealybugs. Phylogenetic analyses indicated that they were members of new badnavirus species. A third caulimovirid sequence was also amplified from pineapple, but available evidence suggests that this DNA is not encapsidated, but more likely derived from an endogenous virus.

Chromosome Evolution in Connection with Repetitive Sequences and Epigenetics in Plants

PubMed Central

Li, Shu-Fen; Su, Ting; Cheng, Guang-Qian; Wang, Bing-Xiao; Li, Xu; Deng, Chuan-Liang; Gao, Wu-Jun

2017-01-01

Chromosome evolution is a fundamental aspect of evolutionary biology. The evolution of chromosome size, structure and shape, number, and the change in DNA composition suggest the high plasticity of nuclear genomes at the chromosomal level. Repetitive DNA sequences, which represent a conspicuous fraction of every eukaryotic genome, particularly in plants, are found to be tightly linked with plant chromosome evolution. Different classes of repetitive sequences have distinct distribution patterns on the chromosomes. Mounting evidence shows that repetitive sequences may play multiple generative roles in shaping the chromosome karyotypes in plants. Furthermore, recent development in our understanding of the repetitive sequences and plant chromosome evolution has elucidated the involvement of a spectrum of epigenetic modification. In this review, we focused on the recent evidence relating to the distribution pattern of repetitive sequences in plant chromosomes and highlighted their potential relevance to chromosome evolution in plants. We also discussed the possible connections between evolution and epigenetic alterations in chromosome structure and repatterning, such as heterochromatin formation, centromere function, and epigenetic-associated transposable element inactivation. PMID:29064432

The Evolution of Mobile DNAs: When Will Transposons Create Phylogenies That Look As If There Is a Master Gene?

PubMed Central

Brookfield, John F. Y.; Johnson, Louise J.

2006-01-01

Some families of mammalian interspersed repetitive DNA, such as the Alu SINE sequence, appear to have evolved by the serial replacement of one active sequence with another, consistent with there being a single source of transposition: the “master gene.” Alternative models, in which multiple source sequences are simultaneously active, have been called “transposon models.” Transposon models differ in the proportion of elements that are active and in whether inactivation occurs at the moment of transposition or later. Here we examine the predictions of various types of transposon model regarding the patterns of sequence variation expected at an equilibrium between transposition, inactivation, and deletion. Under the master gene model, all bifurcations in the true tree of elements occur in a single lineage. We show that this property will also hold approximately for transposon models in which most elements are inactive and where at least some of the inactivation events occur after transposition. Such tree shapes are therefore not conclusive evidence for a single source of transposition. PMID:16790583

ProGeRF: Proteome and Genome Repeat Finder Utilizing a Fast Parallel Hash Function

PubMed Central

Moraes, Walas Jhony Lopes; Rodrigues, Thiago de Souza; Bartholomeu, Daniella Castanheira

2015-01-01

Repetitive element sequences are adjacent, repeating patterns, also called motifs, and can be of different lengths; repetitions can involve their exact or approximate copies. They have been widely used as molecular markers in population biology. Given the sizes of sequenced genomes, various bioinformatics tools have been developed for the extraction of repetitive elements from DNA sequences. However, currently available tools do not provide options for identifying repetitive elements in the genome or proteome, displaying a user-friendly web interface, and performing-exhaustive searches. ProGeRF is a web site for extracting repetitive regions from genome and proteome sequences. It was designed to be efficient, fast, and accurate and primarily user-friendly web tool allowing many ways to view and analyse the results. ProGeRF (Proteome and Genome Repeat Finder) is freely available as a stand-alone program, from which the users can download the source code, and as a web tool. It was developed using the hash table approach to extract perfect and imperfect repetitive regions in a (multi)FASTA file, while allowing a linear time complexity. PMID:25811026

Quantifying the Number of Independent Organelle DNA Insertions in Genome Evolution and Human Health

PubMed Central

Martin, William F.

2017-01-01

Fragments of organelle genomes are often found as insertions in nuclear DNA. These fragments of mitochondrial DNA (numts) and plastid DNA (nupts) are ubiquitous components of eukaryotic genomes. They are, however, often edited out during the genome assembly process, leading to systematic underestimation of their frequency. Numts and nupts, once inserted, can become further fragmented through subsequent insertion of mobile elements or other recombinational events that disrupt the continuity of the inserted sequence relative to the genuine organelle DNA copy. Because numts and nupts are typically identified through sequence comparison tools such as BLAST, disruption of insertions into smaller fragments can lead to systematic overestimation of numt and nupt frequencies. Accurate identification of numts and nupts is important, however, both for better understanding of their role during evolution, and for monitoring their increasingly evident role in human disease. Human populations are polymorphic for 141 numt loci, five numts are causal to genetic disease, and cancer genomic studies are revealing an abundance of numts associated with tumor progression. Here, we report investigation of salient parameters involved in obtaining accurate estimates of numt and nupt numbers in genome sequence data. Numts and nupts from 44 sequenced eukaryotic genomes reveal lineage-specific differences in the number, relative age and frequency of insertional events as well as lineage-specific dynamics of their postinsertional fragmentation. Our findings outline the main technical parameters influencing accurate identification and frequency estimation of numts in genomic studies pertinent to both evolution and human health. PMID:28444372

Sequence Composition and Gene Content of the Short Arm of Rye (Secale cereale) Chromosome 1

PubMed Central

Fluch, Silvia; Kopecky, Dieter; Burg, Kornel; Šimková, Hana; Taudien, Stefan; Petzold, Andreas; Kubaláková, Marie; Platzer, Matthias; Berenyi, Maria; Krainer, Siegfried; Doležel, Jaroslav; Lelley, Tamas

2012-01-01

Background The purpose of the study is to elucidate the sequence composition of the short arm of rye chromosome 1 (Secale cereale) with special focus on its gene content, because this portion of the rye genome is an integrated part of several hundreds of bread wheat varieties worldwide. Methodology/Principal Findings Multiple Displacement Amplification of 1RS DNA, obtained from flow sorted 1RS chromosomes, using 1RS ditelosomic wheat-rye addition line, and subsequent Roche 454FLX sequencing of this DNA yielded 195,313,589 bp sequence information. This quantity of sequence information resulted in 0.43× sequence coverage of the 1RS chromosome arm, permitting the identification of genes with estimated probability of 95%. A detailed analysis revealed that more than 5% of the 1RS sequence consisted of gene space, identifying at least 3,121 gene loci representing 1,882 different gene functions. Repetitive elements comprised about 72% of the 1RS sequence, Gypsy/Sabrina (13.3%) being the most abundant. More than four thousand simple sequence repeat (SSR) sites mostly located in gene related sequence reads were identified for possible marker development. The existence of chloroplast insertions in 1RS has been verified by identifying chimeric chloroplast-genomic sequence reads. Synteny analysis of 1RS to the full genomes of Oryza sativa and Brachypodium distachyon revealed that about half of the genes of 1RS correspond to the distal end of the short arm of rice chromosome 5 and the proximal region of the long arm of Brachypodium distachyon chromosome 2. Comparison of the gene content of 1RS to 1HS barley chromosome arm revealed high conservation of genes related to chromosome 5 of rice. Conclusions The present study revealed the gene content and potential gene functions on this chromosome arm and demonstrated numerous sequence elements like SSRs and gene-related sequences, which can be utilised for future research as well as in breeding of wheat and rye. PMID:22328922

Mutations that alter a conserved element upstream of the potato virus X triple block and coat protein genes affect subgenomic RNA accumulation.

PubMed

Kim, K H; Hemenway, C

1997-05-26

The putative subgenomic RNA (sgRNA) promoter regions upstream of the potato virus X (PVX) triple block and coat protein (CP) genes contain sequences common to other potexviruses. The importance of these sequences to PVX sgRNA accumulation was determined by inoculation of Nicotiana tabacum NT1 cell suspension protoplasts with transcripts derived from wild-type and modified PVX cDNA clones. Analyses of RNA accumulation by S1 nuclease digestion and primer extension indicated that a conserved octanucleotide sequence element and the spacing between this element and the start-site for sgRNA synthesis are critical for accumulation of the two major sgRNA species. The impact of mutations on CP sgRNA levels was also reflected in the accumulation of CP. In contrast, genomic minus- and plus-strand RNA accumulation were not significantly affected by mutations in these regions. Studies involving inoculation of tobacco plants with the modified transcripts suggested that the conserved octanucleotide element functions in sgRNA accumulation and some other aspect of the infection process.

Mutation in a primate-conserved retrotransposon reveals a noncoding RNA as a mediator of infantile encephalopathy

PubMed Central

Cartault, François; Munier, Patrick; Benko, Edgar; Desguerre, Isabelle; Hanein, Sylvain; Boddaert, Nathalie; Bandiera, Simonetta; Vellayoudom, Jeanine; Krejbich-Trotot, Pascale; Bintner, Marc; Hoarau, Jean-Jacques; Girard, Muriel; Génin, Emmanuelle; de Lonlay, Pascale; Fourmaintraux, Alain; Naville, Magali; Rodriguez, Diana; Feingold, Josué; Renouil, Michel; Munnich, Arnold; Westhof, Eric; Fähling, Michael; Lyonnet, Stanislas; Henrion-Caude, Alexandra

2012-01-01

The human genome is densely populated with transposons and transposon-like repetitive elements. Although the impact of these transposons and elements on human genome evolution is recognized, the significance of subtle variations in their sequence remains mostly unexplored. Here we report homozygosity mapping of an infantile neurodegenerative disease locus in a genetic isolate. Complete DNA sequencing of the 400-kb linkage locus revealed a point mutation in a primate-specific retrotransposon that was transcribed as part of a unique noncoding RNA, which was expressed in the brain. In vitro knockdown of this RNA increased neuronal apoptosis, consistent with the inappropriate dosage of this RNA in vivo and with the phenotype. Moreover, structural analysis of the sequence revealed a small RNA-like hairpin that was consistent with the putative gain of a functional site when mutated. We show here that a mutation in a unique transposable element-containing RNA is associated with lethal encephalopathy, and we suggest that RNAs that harbor evolutionarily recent repetitive elements may play important roles in human brain development. PMID:22411793

Specific DNA binding of the two chicken Deformed family homeodomain proteins, Chox-1.4 and Chox-a.

PubMed Central

Sasaki, H; Yokoyama, E; Kuroiwa, A

1990-01-01

The cDNA clones encoding two chicken Deformed (Dfd) family homeobox containing genes Chox-1.4 and Chox-a were isolated. Comparison of their amino acid sequences with another chicken Dfd family homeodomain protein and with those of mouse homologues revealed that strong homologies are located in the amino terminal regions and around the homeodomains. Although homologies in other regions were relatively low, some short conserved sequences were also identified. E. coli-made full length proteins were purified and used for the production of specific antibodies and for DNA binding studies. The binding profiles of these proteins to the 5'-leader and 5'-upstream sequences of Chox-1.4 and Chox-a coding regions were analyzed by immunoprecipitation and DNase I footprint assays. These two Chox proteins bound to the same sites in the 5'-flanking sequences of their coding regions with various affinities and their binding affinities to each site were nearly the same. The consensus sequences of the high and low affinity binding sites were TAATGA(C/G) and CTAATTTT, respectively. A clustered binding site was identified in the 5'-upstream of the Chox-a gene, suggesting that this clustered binding site works as a cis-regulatory element for auto- and/or cross-regulation of Chox-a gene expression. Images PMID:1970866

Problem-Solving Test: Conditional Gene Targeting Using the Cre/loxP Recombination System

ERIC Educational Resources Information Center

Szeberényi, József

2013-01-01

Terms to be familiar with before you start to solve the test: gene targeting, knock-out mutation, bacteriophage, complementary base-pairing, homologous recombination, deletion, transgenic organisms, promoter, polyadenylation element, transgene, DNA replication, RNA polymerase, Shine-Dalgarno sequence, restriction endonuclease, polymerase chain…

Defining functional DNA elements in the human genome

PubMed Central

Kellis, Manolis; Wold, Barbara; Snyder, Michael P.; Bernstein, Bradley E.; Kundaje, Anshul; Marinov, Georgi K.; Ward, Lucas D.; Birney, Ewan; Crawford, Gregory E.; Dekker, Job; Dunham, Ian; Elnitski, Laura L.; Farnham, Peggy J.; Feingold, Elise A.; Gerstein, Mark; Giddings, Morgan C.; Gilbert, David M.; Gingeras, Thomas R.; Green, Eric D.; Guigo, Roderic; Hubbard, Tim; Kent, Jim; Lieb, Jason D.; Myers, Richard M.; Pazin, Michael J.; Ren, Bing; Stamatoyannopoulos, John A.; Weng, Zhiping; White, Kevin P.; Hardison, Ross C.

2014-01-01

With the completion of the human genome sequence, attention turned to identifying and annotating its functional DNA elements. As a complement to genetic and comparative genomics approaches, the Encyclopedia of DNA Elements Project was launched to contribute maps of RNA transcripts, transcriptional regulator binding sites, and chromatin states in many cell types. The resulting genome-wide data reveal sites of biochemical activity with high positional resolution and cell type specificity that facilitate studies of gene regulation and interpretation of noncoding variants associated with human disease. However, the biochemically active regions cover a much larger fraction of the genome than do evolutionarily conserved regions, raising the question of whether nonconserved but biochemically active regions are truly functional. Here, we review the strengths and limitations of biochemical, evolutionary, and genetic approaches for defining functional DNA segments, potential sources for the observed differences in estimated genomic coverage, and the biological implications of these discrepancies. We also analyze the relationship between signal intensity, genomic coverage, and evolutionary conservation. Our results reinforce the principle that each approach provides complementary information and that we need to use combinations of all three to elucidate genome function in human biology and disease. PMID:24753594

AzaHx, a novel fluorescent, DNA minor groove and G·C recognition element: Synthesis and DNA binding properties of a p-anisyl-4-aza-benzimidazole-pyrrole-imidazole (azaHx-PI) polyamide.

PubMed

Satam, Vijay; Babu, Balaji; Patil, Pravin; Brien, Kimberly A; Olson, Kevin; Savagian, Mia; Lee, Megan; Mepham, Andrew; Jobe, Laura Beth; Bingham, John P; Pett, Luke; Wang, Shuo; Ferrara, Maddi; Bruce, Chrystal D; Wilson, W David; Lee, Moses; Hartley, John A; Kiakos, Konstantinos

2015-09-01

The design, synthesis, and DNA binding properties of azaHx-PI or p-anisyl-4-aza-benzimidazole-pyrrole-imidazole (5) are described. AzaHx, 2-(p-anisyl)-4-aza-benzimidazole-5-carboxamide, is a novel, fluorescent DNA recognition element, derived from Hoechst 33258 to recognize G·C base pairs. Supported by theoretical data, the results from DNase I footprinting, CD, ΔT(M), and SPR studies provided evidence that an azaHx/IP pairing, formed from antiparallel stacking of two azaHx-PI molecules in a side-by-side manner in the minor groove, selectively recognized a C-G doublet. AzaHx-PI was found to target 5'-ACGCGT-3', the Mlu1 Cell Cycle Box (MCB) promoter sequence with specificity and significant affinity (K(eq) 4.0±0.2×10(7) M(-1)). Copyright © 2015 Elsevier Ltd. All rights reserved.

Characterization of an estrogen-responsive element implicated in regulation of the rainbow trout estrogen receptor gene.

PubMed

Le Dréan, Y; Lazennec, G; Kern, L; Saligaut, D; Pakdel, F; Valotaire, Y

1995-08-01

We previously reported that the expression of the rainbow trout estrogen receptor (rtER) gene is markedly increased by estradiol (E2). In this paper, we have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyl transferase (CAT), linked to 5' flanking regions of the rtER gene promoter, to identify cis-elements responsible for E2 inducibility. Deletion analysis localized an estrogen-responsive element (ERE), at position +242, with one mutation on the first base compared with the consensus sequence. This element confers estrogen responsiveness to CAT reporter linked to both the herpes simplex virus thymidine kinase promoter and the homologous rtER promoter. Moreover, using a 0.2 kb fragment of the rtER promoter encompassing the ERE and the rtER DNA binding domain obtained from a bacterial expression system, DNase I footprinting experiments demonstrated a specific protection covering 20 bp (+240/+260) containing the ERE sequence. Based on these studies, we believe that this ERE sequence, identified in the rtER gene promoter, may be a major cis-acting element involved in the regulation of the gene by estrogen.

Stereochemical analysis of the functional significance of the conserved inverted CCAAT and TATA elements in the rat bone sialoprotein gene promoter.

PubMed

Su, Ming; Lee, Daniel; Ganss, Bernhard; Sodek, Jaro

2006-04-14

Basal transcription of the bone sialoprotein gene is mediated by highly conserved inverted CCAAT (ICE; ATTGG) and TATA elements (TTTATA) separated by precisely 21 nucleotides. Here we studied the importance of the relative position and orientation of the CCAAT and TATA elements in the proximal promoter by measuring the transcriptional activity of a series of mutated reporter constructs in transient transfection assays. Whereas inverting the TTTATA (wild type) to a TATAAA (consensus TATA) sequence increased transcription slightly, transcription was reduced when the flanking dinucleotides were also inverted. In contrast, reversing the ATTGG (wild type; ICE) to a CCAAT (RICE) sequence caused a marked reduction in transcription, whereas both transcription and NF-Y binding were progressively increased with the simultaneous inversion of flanking nucleotides (f-RICE-f). Reducing the distance between the ICE and TATA elements produced cyclical changes in transcriptional activity that correlated with progressive alterations in the relative positions of the CCAAT and TATA elements on the face of the DNA helix. Minimal transcription was observed after 5 nucleotides were deleted (equivalent to approximately one half turn of the helix), whereas transcription was fully restored after deleting 10 nucleotides (approximately one full turn of the DNA helix), transcriptional activity being progressively lost with deletions beyond 10 nucleotides. In comparison, when deletions were made with the ICE in the reversed (f-RICE-f) orientation transcriptional activity was progressively lost with no recovery. These results show that, although transcription can still occur when the CCAAT box is reversed and/or displaced relative to the TATA box, the activity is dependent upon the flexibility of the intervening DNA helix needed to align the NF-Y complex on the CCAAT box with preinitiation complex proteins that bind to the TATA box. Thus, the precise location and orientation of the CCAAT element is necessary for optimizing basal transcription of the bone sialoprotein gene.

Genome-wide mapping of autonomous promoter activity in human cells

PubMed Central

van Arensbergen, Joris; FitzPatrick, Vincent D.; de Haas, Marcel; Pagie, Ludo; Sluimer, Jasper; Bussemaker, Harmen J.; van Steensel, Bas

2017-01-01

Previous methods to systematically characterize sequence-intrinsic activity of promoters have been limited by relatively low throughput and the length of sequences that could be tested. Here we present Survey of Regulatory Elements (SuRE), a method to assay more than 108 DNA fragments, each 0.2–2kb in size, for their ability to drive transcription autonomously. In SuRE, a plasmid library is constructed of random genomic fragments upstream of a 20bp barcode and decoded by paired-end sequencing. This library is then transfected into cells and transcribed barcodes are quantified in the RNA by high throughput sequencing. When applied to the human genome, we achieved a 55-fold genome coverage, allowing us to map autonomous promoter activity genome-wide. By computational modeling we delineated subregions within promoters that are relevant for their activity. For instance, we show that antisense promoter transcription is generally dependent on the sense core promoter sequences, and that most enhancers and several families of repetitive elements act as autonomous transcription initiation sites. PMID:28024146

Sequence information signal processor for local and global string comparisons

DOEpatents

Peterson, John C.; Chow, Edward T.; Waterman, Michael S.; Hunkapillar, Timothy J.

1997-01-01

A sequence information signal processing integrated circuit chip designed to perform high speed calculation of a dynamic programming algorithm based upon the algorithm defined by Waterman and Smith. The signal processing chip of the present invention is designed to be a building block of a linear systolic array, the performance of which can be increased by connecting additional sequence information signal processing chips to the array. The chip provides a high speed, low cost linear array processor that can locate highly similar global sequences or segments thereof such as contiguous subsequences from two different DNA or protein sequences. The chip is implemented in a preferred embodiment using CMOS VLSI technology to provide the equivalent of about 400,000 transistors or 100,000 gates. Each chip provides 16 processing elements, and is designed to provide 16 bit, two's compliment operation for maximum score precision of between -32,768 and +32,767. It is designed to provide a comparison between sequences as long as 4,194,304 elements without external software and between sequences of unlimited numbers of elements with the aid of external software. Each sequence can be assigned different deletion and insertion weight functions. Each processor is provided with a similarity measure device which is independently variable. Thus, each processor can contribute to maximum value score calculation using a different similarity measure.

DNA-Demethylase Regulated Genes Show Methylation-Independent Spatiotemporal Expression Patterns

PubMed Central

Schumann, Ulrike; Lee, Joanne; Kazan, Kemal; Ayliffe, Michael; Wang, Ming-Bo

2017-01-01

Recent research has indicated that a subset of defense-related genes is downregulated in the Arabidopsis DNA demethylase triple mutant rdd (ros1 dml2 dml3) resulting in increased susceptibility to the fungal pathogen Fusarium oxysporum. In rdd plants these downregulated genes contain hypermethylated transposable element sequences (TE) in their promoters, suggesting that this methylation represses gene expression in the mutant and that these sequences are actively demethylated in wild-type plants to maintain gene expression. In this study, the tissue-specific and pathogen-inducible expression patterns of rdd-downregulated genes were investigated and the individual role of ROS1, DML2, and DML3 demethylases in these spatiotemporal regulation patterns was determined. Large differences in defense gene expression were observed between pathogen-infected and uninfected tissues and between root and shoot tissues in both WT and rdd plants, however, only subtle changes in promoter TE methylation patterns occurred. Therefore, while TE hypermethylation caused decreased gene expression in rdd plants it did not dramatically effect spatiotemporal gene regulation, suggesting that this latter regulation is largely methylation independent. Analysis of ros1-3, dml2-1, and dml3-1 single gene mutant lines showed that promoter TE hypermethylation and defense-related gene repression was predominantly, but not exclusively, due to loss of ROS1 activity. These data demonstrate that DNA demethylation of TE sequences, largely by ROS1, promotes defense-related gene expression but does not control spatiotemporal expression in Arabidopsis. Summary: Ros1-mediated DNA demethylation of promoter transposable elements is essential for activation of defense-related gene expression in response to fungal infection in Arabidopsis thaliana. PMID:28894455

Cryptic MCAT enhancer regulation in fibroblasts and smooth muscle cells. Suppression of TEF-1 mediated activation by the single-stranded DNA-binding proteins, Pur alpha, Pur beta, and MSY1.

PubMed

Carlini, Leslie E; Getz, Michael J; Strauch, Arthur R; Kelm, Robert J

2002-03-08

An asymmetric polypurine-polypyrimidine cis-element located in the 5' region of the mouse vascular smooth muscle alpha-actin gene serves as a binding site for multiple proteins with specific affinity for either single- or double-stranded DNA. Here, we test the hypothesis that single-stranded DNA-binding proteins are responsible for preventing a cryptic MCAT enhancer centered within this element from cooperating with a nearby serum response factor-interacting CArG motif to trans-activate the minimal promoter in fibroblasts and smooth muscle cells. DNA binding studies revealed that the core MCAT sequence mediates binding of transcription enhancer factor-1 to the double-stranded polypurine-polypyrimidine element while flanking nucleotides account for interaction of Pur alpha and Pur beta with the purine-rich strand and MSY1 with the complementary pyrimidine-rich strand. Mutations that selectively impaired high affinity single-stranded DNA binding by fibroblast or smooth muscle cell-derived Pur alpha, Pur beta, and MSY1 in vitro, released the cryptic MCAT enhancer from repression in transfected cells. Additional experiments indicated that Pur alpha, Pur beta, and MSY1 also interact specifically, albeit weakly, with double-stranded DNA and with transcription enhancer factor-1. These results are consistent with two plausible models of cryptic MCAT enhancer regulation by Pur alpha, Pur beta, and MSY1 involving either competitive single-stranded DNA binding or masking of MCAT-bound transcription enhancer factor-1.

Mobile DNA in cancer. Extensive transduction of nonrepetitive DNA mediated by L1 retrotransposition in cancer genomes.

PubMed

Tubio, Jose M C; Li, Yilong; Ju, Young Seok; Martincorena, Inigo; Cooke, Susanna L; Tojo, Marta; Gundem, Gunes; Pipinikas, Christodoulos P; Zamora, Jorge; Raine, Keiran; Menzies, Andrew; Roman-Garcia, Pablo; Fullam, Anthony; Gerstung, Moritz; Shlien, Adam; Tarpey, Patrick S; Papaemmanuil, Elli; Knappskog, Stian; Van Loo, Peter; Ramakrishna, Manasa; Davies, Helen R; Marshall, John; Wedge, David C; Teague, Jon W; Butler, Adam P; Nik-Zainal, Serena; Alexandrov, Ludmil; Behjati, Sam; Yates, Lucy R; Bolli, Niccolo; Mudie, Laura; Hardy, Claire; Martin, Sancha; McLaren, Stuart; O'Meara, Sarah; Anderson, Elizabeth; Maddison, Mark; Gamble, Stephen; Foster, Christopher; Warren, Anne Y; Whitaker, Hayley; Brewer, Daniel; Eeles, Rosalind; Cooper, Colin; Neal, David; Lynch, Andy G; Visakorpi, Tapio; Isaacs, William B; Veer, Laura Van't; Caldas, Carlos; Desmedt, Christine; Sotiriou, Christos; Aparicio, Sam; Foekens, John A; Eyfjörd, Jórunn Erla; Lakhani, Sunil R; Thomas, Gilles; Myklebost, Ola; Span, Paul N; Børresen-Dale, Anne-Lise; Richardson, Andrea L; Van de Vijver, Marc; Vincent-Salomon, Anne; Van den Eynden, Gert G; Flanagan, Adrienne M; Futreal, P Andrew; Janes, Sam M; Bova, G Steven; Stratton, Michael R; McDermott, Ultan; Campbell, Peter J

2014-08-01

Long interspersed nuclear element-1 (L1) retrotransposons are mobile repetitive elements that are abundant in the human genome. L1 elements propagate through RNA intermediates. In the germ line, neighboring, nonrepetitive sequences are occasionally mobilized by the L1 machinery, a process called 3' transduction. Because 3' transductions are potentially mutagenic, we explored the extent to which they occur somatically during tumorigenesis. Studying cancer genomes from 244 patients, we found that tumors from 53% of the patients had somatic retrotranspositions, of which 24% were 3' transductions. Fingerprinting of donor L1s revealed that a handful of source L1 elements in a tumor can spawn from tens to hundreds of 3' transductions, which can themselves seed further retrotranspositions. The activity of individual L1 elements fluctuated during tumor evolution and correlated with L1 promoter hypomethylation. The 3' transductions disseminated genes, exons, and regulatory elements to new locations, most often to heterochromatic regions of the genome. Copyright © 2014, American Association for the Advancement of Science.

Sequencing the extrachromosomal circular mobilome reveals retrotransposon activity in plants

PubMed Central

Llauro, Christel; Jobet, Edouard; Robakowska-Hyzorek, Dagmara; Lasserre, Eric; Ghesquière, Alain; Panaud, Olivier

2017-01-01

Retrotransposons are mobile genetic elements abundant in plant and animal genomes. While efficiently silenced by the epigenetic machinery, they can be reactivated upon stress or during development. Their level of transcription not reflecting their transposition ability, it is thus difficult to evaluate their contribution to the active mobilome. Here we applied a simple methodology based on the high throughput sequencing of extrachromosomal circular DNA (eccDNA) forms of active retrotransposons to characterize the repertoire of mobile retrotransposons in plants. This method successfully identified known active retrotransposons in both Arabidopsis and rice material where the epigenome is destabilized. When applying mobilome-seq to developmental stages in wild type rice, we identified PopRice as a highly active retrotransposon producing eccDNA forms in the wild type endosperm. The mobilome-seq strategy opens new routes for the characterization of a yet unexplored fraction of plant genomes. PMID:28212378

Sequencing the extrachromosomal circular mobilome reveals retrotransposon activity in plants.

PubMed

Lanciano, Sophie; Carpentier, Marie-Christine; Llauro, Christel; Jobet, Edouard; Robakowska-Hyzorek, Dagmara; Lasserre, Eric; Ghesquière, Alain; Panaud, Olivier; Mirouze, Marie

2017-02-01

Retrotransposons are mobile genetic elements abundant in plant and animal genomes. While efficiently silenced by the epigenetic machinery, they can be reactivated upon stress or during development. Their level of transcription not reflecting their transposition ability, it is thus difficult to evaluate their contribution to the active mobilome. Here we applied a simple methodology based on the high throughput sequencing of extrachromosomal circular DNA (eccDNA) forms of active retrotransposons to characterize the repertoire of mobile retrotransposons in plants. This method successfully identified known active retrotransposons in both Arabidopsis and rice material where the epigenome is destabilized. When applying mobilome-seq to developmental stages in wild type rice, we identified PopRice as a highly active retrotransposon producing eccDNA forms in the wild type endosperm. The mobilome-seq strategy opens new routes for the characterization of a yet unexplored fraction of plant genomes.

Transcriptional activation of transforming growth factor alpha by estradiol: requirement for both a GC-rich site and an estrogen response element half-site.

PubMed

Vyhlidal, C; Samudio, I; Kladde, M P; Safe, S

2000-06-01

17beta-Estradiol (E2) induces transforming growth factor alpha (TGFalpha) gene expression in MCF-7 cells and previous studies have identified a 53 bp (-252 to -200) sequence containing two imperfect estrogen responsive elements (EREs) that contribute to E2 responsiveness. Deletion analysis of the TGFalpha gene promoter in this study identified a second upstream region of the promoter (-623 to -549) that is also E2 responsive. This sequence contains three GC-rich sites and an imperfect ERE half-site, and the specific cis-elements and trans-acting factors were determined by promoter analysis in transient transfection experiments, gel mobility shift assays and in vitro DNA footprinting. The results are consistent with an estrogen receptor alpha (ERalpha)/Sp1 complex interacting with an Sp1(N)(30) ERE half-site ((1/2)) motif in which both ERalpha and Sp1 bind promoter DNA. The ER/Sp1-DNA complex is formed using nuclear extracts from MCF-7 cells but not with recombinant human ERalpha or Sp1 proteins, suggesting that other nuclear factor(s) are required for complex stabilization. The E2-responsive Sp1(N)(x)ERE(1/2) motif identified in the TGFalpha gene promoter has also been characterized in the cathepsin D and heat shock protein 27 gene promoters; however, in the latter two promoters the numbers of intervening nucleotides are 23 and 10 respectively.

Vertical Transmission of the Retrotransposable Elements R1 and R2 during the Evolution of the Drosophila Melanogaster Species Subgroup

PubMed Central

Eickbush, D. G.; Eickbush, T. H.

1995-01-01

R1 and R2 are non-long-terminal repeat retrotransposable elements that insert into specific sequences of insect 28S ribosomal RNA genes. These elements have been extensively described in Drosophila melanogaster. To determine whether these elements have been horizontally or vertically transmitted, we characterized R1 and R2 elements from the seven other members of the melanogaster species subgroup by genomic blotting and nucleotide sequencing. Each species was found to have homogeneous families of R1 and R2 elements with the exception of erecta and orena, which have no R2 elements. The DNA sequences of multiple R1 and R2 copies from each species indicated nucleotide divergence within each species averaged only 0.48% for R1 and 0.35% for R2, well below the level of divergence among the species. Most copies of R1 and R2 (40 of 47) sequenced from the seven species were potentially functional, as indicated by the absence of premature termination codons or translational frameshifts that would destroy the open reading frame of the element. The sequence relationships of both the R1 and R2 elements from the various members of the melanogaster subgroup closely followed that of the species phylogeny, suggesting that R1 and R2 have been stably maintained by vertical transmission since the origin of this species subgroup 17-20 million years ago. The remarkable stability of R1 and R2, compared to what has been suggested for transposable elements that insert at multiple locations in these same species, may be due to their unique specificity for sites in the rRNA gene locus. Under low copy number conditions, when it is essential for any mobile element to transpose, the insertion specificities of R1 and R2 ensure uniform developmentally regulated target sites that can be occupied with little or no detrimental effect on the host. PMID:7713424

Definition of RNA polymerase II CoTC terminator elements in the human genome.

PubMed

Nojima, Takayuki; Dienstbier, Martin; Murphy, Shona; Proudfoot, Nicholas J; Dye, Michael J

2013-04-25

Mammalian RNA polymerase II (Pol II) transcription termination is an essential step in protein-coding gene expression that is mediated by pre-mRNA processing activities and DNA-encoded terminator elements. Although much is known about the role of pre-mRNA processing in termination, our understanding of the characteristics and generality of terminator elements is limited. Whereas promoter databases list up to 40,000 known and potential Pol II promoter sequences, fewer than ten Pol II terminator sequences have been described. Using our knowledge of the human β-globin terminator mechanism, we have developed a selection strategy for mapping mammalian Pol II terminator elements. We report the identification of 78 cotranscriptional cleavage (CoTC)-type terminator elements at endogenous gene loci. The results of this analysis pave the way for the full understanding of Pol II termination pathways and their roles in gene expression. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

Epigenetically-inherited centromere and neocentromere DNA replicates earliest in S-phase.

PubMed

Koren, Amnon; Tsai, Hung-Ji; Tirosh, Itay; Burrack, Laura S; Barkai, Naama; Berman, Judith

2010-08-19

Eukaryotic centromeres are maintained at specific chromosomal sites over many generations. In the budding yeast Saccharomyces cerevisiae, centromeres are genetic elements defined by a DNA sequence that is both necessary and sufficient for function; whereas, in most other eukaryotes, centromeres are maintained by poorly characterized epigenetic mechanisms in which DNA has a less definitive role. Here we use the pathogenic yeast Candida albicans as a model organism to study the DNA replication properties of centromeric DNA. By determining the genome-wide replication timing program of the C. albicans genome, we discovered that each centromere is associated with a replication origin that is the first to fire on its respective chromosome. Importantly, epigenetic formation of new ectopic centromeres (neocentromeres) was accompanied by shifts in replication timing, such that a neocentromere became the first to replicate and became associated with origin recognition complex (ORC) components. Furthermore, changing the level of the centromere-specific histone H3 isoform led to a concomitant change in levels of ORC association with centromere regions, further supporting the idea that centromere proteins determine origin activity. Finally, analysis of centromere-associated DNA revealed a replication-dependent sequence pattern characteristic of constitutively active replication origins. This strand-biased pattern is conserved, together with centromere position, among related strains and species, in a manner independent of primary DNA sequence. Thus, inheritance of centromere position is correlated with a constitutively active origin of replication that fires at a distinct early time. We suggest a model in which the distinct timing of DNA replication serves as an epigenetic mechanism for the inheritance of centromere position.

The hormone response element mimic sequence of GAS5 lncRNA is sufficient to induce apoptosis in breast cancer cells

PubMed Central

Pickard, Mark R.; Williams, Gwyn T.

2016-01-01

Growth arrest-specific 5 (GAS5) lncRNA promotes apoptosis, and its expression is down-regulated in breast cancer. GAS5 lncRNA is a decoy of glucocorticoid/related receptors; a stem-loop sequence constitutes the GAS5 hormone response element mimic (HREM), which is essential for the regulation of breast cancer cell apoptosis. This preclinical study aimed to determine if the GAS5 HREM sequence alone promotes the apoptosis of breast cancer cells. Nucleofection of hormone-sensitive and –insensitive breast cancer cell lines with a GAS5 HREM DNA oligonucleotide increased both basal and ultraviolet-C-induced apoptosis, and decreased culture viability and clonogenic growth, similar to GAS5 lncRNA. The HREM oligonucleotide demonstrated similar sequence specificity to the native HREM for its functional activity and had no effect on endogenous GAS5 lncRNA levels. Certain chemically modified HREM oligonucleotides, notably DNA and RNA phosphorothioates, retained pro-apoptotic. activity. Crucially the HREM oligonucleotide could overcome apoptosis resistance secondary to deficient endogenous GAS5 lncRNA levels. Thus, the GAS5 lncRNA HREM sequence alone is sufficient to induce apoptosis in breast cancer cells, including triple-negative breast cancer cells. These findings further suggest that emerging knowledge of structure/function relationships in the field of lncRNA biology can be exploited for the development of entirely novel, oligonucleotide mimic-based, cancer therapies. PMID:26862727

Development of synthetic selfish elements based on modular nucleases in Drosophila melanogaster

PubMed Central

Simoni, Alekos; Siniscalchi, Carla; Chan, Yuk-Sang; Huen, David S.; Russell, Steven; Windbichler, Nikolai; Crisanti, Andrea

2014-01-01

Selfish genes are DNA elements that increase their rate of genetic transmission at the expense of other genes in the genome and can therefore quickly spread within a population. It has been suggested that selfish elements could be exploited to modify the genome of entire populations for medical and ecological applications. Here we report that transcription activator-like effector nuclease (TALEN) and zinc finger nuclease (ZFN) can be engineered into site-specific synthetic selfish elements (SSEs) and demonstrate their transmission of up to 70% in the Drosophila germline. We show here that SSEs can spread via DNA break-induced homologous recombination, a process known as ‘homing’ similar to that observed for homing endonuclease genes (HEGs), despite their fundamentally different modes of DNA binding and cleavage. We observed that TALEN and ZFN have a reduced capability of secondary homing compared to HEG as their repetitive structure had a negative effect on their genetic stability. The modular architecture of ZFNs and TALENs allows for the rapid design of novel SSEs against specific genomic sequences making them potentially suitable for the genetic engineering of wild-type populations of animals and plants, in applications such as gene replacement or population suppression of pest species. PMID:24803674

Organization and transient expression of the gene for human U11 snRNA

PubMed Central

Clemens, Suter-Crazzolara; Walter, Keller

1991-01-01

The nucleotide sequence of U11 small nuclear RNA, a minor U RNA from HeLa cells, was determined. Computer analysis of the sequence (135 residues) predicts two strong hairpin loops which are separated by seventeen nucleotides containing an Sm binding site (AAUUUUUUGG). A synthetic gene was constructed in which the coding region of U11 RNA is under the control of a T7 promoter. This vector can be used to produce U11 RNA in vitro. Southern hybridization and PCR analysis of HeLa genomic DNA suggest that U11 RNA is encoded by a single copy gene, and that at least three genomic regions could be U11 RNA pseudogenes. A HeLa genomic copy of a U11 gene was isolated by inverted PCR. This gene contains the U11 RNA coding sequence and several sequence elements unique for the U RNA genes. These include a Distal Sequence Element (DSE, ATTTGCATA) present between positions −215 and −223 relative to the start of transcription; a Proximal Sequence Element (PSE, TTCACCTTTACCAAAAATG) located between positions −43 and −63 ; and a 3′box (GTTAGGCGAAATATTA) between positions +150 and +166. Transfection of HeLa cells with this gene revealed that it is functioning in vivo and can produce U11 RNA. PMID:1820214

A novel non prophage(-like) gene-intervening element within gerE that is reconstituted during sporulation in Bacillus cereus ATCC10987.

PubMed

Abe, Kimihiro; Shimizu, Shin-Ya; Tsuda, Shuhei; Sato, Tsutomu

2017-09-12

Gene rearrangement is a widely-shared phenomenon in spore forming bacteria, in which prophage(-like) elements interrupting sporulation-specific genes are excised from the host genome to reconstitute the intact gene. Here, we report a novel class of gene-intervening elements, named gin, inserted in the 225 bp gerE-coding region of the B. cereus ATCC10987 genome, which generates a sporulation-specific rearrangement. gin has no phage-related genes and possesses three site-specific recombinase genes; girA, girB, and girC. We demonstrated that the gerE rearrangement occurs at the middle stage of sporulation, in which site-specific DNA recombination took place within the 9 bp consensus sequence flanking the disrupted gerE segments. Deletion analysis of gin uncovered that GirC and an additional factor, GirX, are responsible for gerE reconstitution. Involvement of GirC and GirX in DNA recombination was confirmed by an in vitro recombination assay. These results broaden the definition of the sporulation-specific gene rearrangement phenomenon: gene-intervening elements are not limited to phage DNA but may include non-viral genetic elements that carry a developmentally-regulated site-specific recombination system.

Development and validation of real-time PCR screening methods for detection of cry1A.105 and cry2Ab2 genes in genetically modified organisms.

PubMed

Dinon, Andréia Z; Prins, Theo W; van Dijk, Jeroen P; Arisi, Ana Carolina M; Scholtens, Ingrid M J; Kok, Esther J

2011-05-01

Primers and probes were developed for the element-specific detection of cry1A.105 and cry2Ab2 genes, based on their DNA sequence as present in GM maize MON89034. Cry genes are present in many genetically modified (GM) plants and they are important targets for developing GMO element-specific detection methods. Element-specific methods can be of use to screen for the presence of GMOs in food and feed supply chains. Moreover, a combination of GMO elements may indicate the potential presence of unapproved GMOs (UGMs). Primer-probe combinations were evaluated in terms of specificity, efficiency and limit of detection. Except for specificity, the complete experiment was performed in 9 PCR runs, on 9 different days and by testing 8 DNA concentrations. The results showed a high specificity and efficiency for cry1A.105 and cry2Ab2 detection. The limit of detection was between 0.05 and 0.01 ng DNA per PCR reaction for both assays. These data confirm the applicability of these new primer-probe combinations for element detection that can contribute to the screening for GM and UGM crops in food and feed samples.

Structural Basis for Sequence-specific DNA Recognition by an Arabidopsis WRKY Transcription Factor*

PubMed Central

Yamasaki, Kazuhiko; Kigawa, Takanori; Watanabe, Satoru; Inoue, Makoto; Yamasaki, Tomoko; Seki, Motoaki; Shinozaki, Kazuo; Yokoyama, Shigeyuki

2012-01-01

The WRKY family transcription factors regulate plant-specific reactions that are mostly related to biotic and abiotic stresses. They share the WRKY domain, which recognizes a DNA element (TTGAC(C/T)) termed the W-box, in target genes. Here, we determined the solution structure of the C-terminal WRKY domain of Arabidopsis WRKY4 in complex with the W-box DNA by NMR. A four-stranded β-sheet enters the major groove of DNA in an atypical mode termed the β-wedge, where the sheet is nearly perpendicular to the DNA helical axis. Residues in the conserved WRKYGQK motif contact DNA bases mainly through extensive apolar contacts with thymine methyl groups. The importance of these contacts was verified by substituting the relevant T bases with U and by surface plasmon resonance analyses of DNA binding. PMID:22219184

footprintDB: a database of transcription factors with annotated cis elements and binding interfaces.

PubMed

Sebastian, Alvaro; Contreras-Moreira, Bruno

2014-01-15

Traditional and high-throughput techniques for determining transcription factor (TF) binding specificities are generating large volumes of data of uneven quality, which are scattered across individual databases. FootprintDB integrates some of the most comprehensive freely available libraries of curated DNA binding sites and systematically annotates the binding interfaces of the corresponding TFs. The first release contains 2422 unique TF sequences, 10 112 DNA binding sites and 3662 DNA motifs. A survey of the included data sources, organisms and TF families was performed together with proprietary database TRANSFAC, finding that footprintDB has a similar coverage of multicellular organisms, while also containing bacterial regulatory data. A search engine has been designed that drives the prediction of DNA motifs for input TFs, or conversely of TF sequences that might recognize input regulatory sequences, by comparison with database entries. Such predictions can also be extended to a single proteome chosen by the user, and results are ranked in terms of interface similarity. Benchmark experiments with bacterial, plant and human data were performed to measure the predictive power of footprintDB searches, which were able to correctly recover 10, 55 and 90% of the tested sequences, respectively. Correctly predicted TFs had a higher interface similarity than the average, confirming its diagnostic value. Web site implemented in PHP,Perl, MySQL and Apache. Freely available from http://floresta.eead.csic.es/footprintdb.

Analysis of LexA binding sites and transcriptomics in response to genotoxic stress in Leptospira interrogans.

PubMed

Schons-Fonseca, Luciane; da Silva, Josefa B; Milanez, Juliana S; Domingos, Renan H; Smith, Janet L; Nakaya, Helder I; Grossman, Alan D; Ho, Paulo L; da Costa, Renata M A

2016-02-18

We determined the effects of DNA damage caused by ultraviolet radiation on gene expression in Leptospira interrogans using DNA microarrays. These data were integrated with DNA binding in vivo of LexA1, a regulator of the DNA damage response, assessed by chromatin immunoprecipitation and massively parallel DNA sequencing (ChIP-seq). In response to DNA damage, Leptospira induced expression of genes involved in DNA metabolism, in mobile genetic elements and defective prophages. The DNA repair genes involved in removal of photo-damage (e.g. nucleotide excision repair uvrABC, recombinases recBCD and resolvases ruvABC) were not induced. Genes involved in various metabolic pathways were down regulated, including genes involved in cell growth, RNA metabolism and the tricarboxylic acid cycle. From ChIP-seq data, we observed 24 LexA1 binding sites located throughout chromosome 1 and one binding site in chromosome 2. Expression of many, but not all, genes near those sites was increased following DNA damage. Binding sites were found as far as 550 bp upstream from the start codon, or 1 kb into the coding sequence. Our findings indicate that there is a shift in gene expression following DNA damage that represses genes involved in cell growth and virulence, and induces genes involved in mutagenesis and recombination. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Studies on DNA-binding selectivity of WRKY transcription factors lend structural clues into WRKY-domain function.

PubMed

Ciolkowski, Ingo; Wanke, Dierk; Birkenbihl, Rainer P; Somssich, Imre E

2008-09-01

WRKY transcription factors have been shown to play a major role in regulating, both positively and negatively, the plant defense transcriptome. Nearly all studied WRKY factors appear to have a stereotypic binding preference to one DNA element termed the W-box. How specificity for certain promoters is accomplished therefore remains completely unknown. In this study, we tested five distinct Arabidopsis WRKY transcription factor subfamily members for their DNA binding selectivity towards variants of the W-box embedded in neighboring DNA sequences. These studies revealed for the first time differences in their binding site preferences, which are partly dependent on additional adjacent DNA sequences outside of the TTGACY-core motif. A consensus WRKY binding site derived from these studies was used for in silico analysis to identify potential target genes within the Arabidopsis genome. Furthermore, we show that even subtle amino acid substitutions within the DNA binding region of AtWRKY11 strongly impinge on its binding activity. Additionally, all five factors were found localized exclusively to the plant cell nucleus and to be capable of trans-activating expression of a reporter gene construct in vivo.

A Mobile Element in mutS Drives Hypermutation in a Marine Vibrio

PubMed Central

Chu, Nathaniel D.; Clarke, Sean A.; Timberlake, Sonia; Polz, Martin F.; Grossman, Alan D.

2017-01-01

ABSTRACT Bacteria face a trade-off between genetic fidelity, which reduces deleterious mistakes in the genome, and genetic innovation, which allows organisms to adapt. Evidence suggests that many bacteria balance this trade-off by modulating their mutation rates, but few mechanisms have been described for such modulation. Following experimental evolution and whole-genome resequencing of the marine bacterium Vibrio splendidus 12B01, we discovered one such mechanism, which allows this bacterium to switch to an elevated mutation rate. This switch is driven by the excision of a mobile element residing in mutS, which encodes a DNA mismatch repair protein. When integrated within the bacterial genome, the mobile element provides independent promoter and translation start sequences for mutS—different from the bacterium’s original mutS promoter region—which allow the bacterium to make a functional mutS gene product. Excision of this mobile element rejoins the mutS gene with host promoter and translation start sequences but leaves a 2-bp deletion in the mutS sequence, resulting in a frameshift and a hypermutator phenotype. We further identified hundreds of clinical and environmental bacteria across Betaproteobacteria and Gammaproteobacteria that possess putative mobile elements within the same amino acid motif in mutS. In a subset of these bacteria, we detected excision of the element but not a frameshift mutation; the mobile elements leave an intact mutS coding sequence after excision. Our findings reveal a novel mechanism by which one bacterium alters its mutation rate and hint at a possible evolutionary role for mobile elements within mutS in other bacteria. PMID:28174306

Comparative analysis of the complete sequence of the plastid genome of Parthenium argentatum and identification of DNA barcodes to differentiate Parthenium species and lines

PubMed Central

2009-01-01

Background Parthenium argentatum (guayule) is an industrial crop that produces latex, which was recently commercialized as a source of latex rubber safe for people with Type I latex allergy. The complete plastid genome of P. argentatum was sequenced. The sequence provides important information useful for genetic engineering strategies. Comparison to the sequences of plastid genomes from three other members of the Asteraceae, Lactuca sativa, Guitozia abyssinica and Helianthus annuus revealed details of the evolution of the four genomes. Chloroplast-specific DNA barcodes were developed for identification of Parthenium species and lines. Results The complete plastid genome of P. argentatum is 152,803 bp. Based on the overall comparison of individual protein coding genes with those in L. sativa, G. abyssinica and H. annuus, we demonstrate that the P. argentatum chloroplast genome sequence is most closely related to that of H. annuus. Similar to chloroplast genomes in G. abyssinica, L. sativa and H. annuus, the plastid genome of P. argentatum has a large 23 kb inversion with a smaller 3.4 kb inversion, within the large inversion. Using the matK and psbA-trnH spacer chloroplast DNA barcodes, three of the four Parthenium species tested, P. tomentosum, P. hysterophorus and P. schottii, can be differentiated from P. argentatum. In addition, we identified lines within P. argentatum. Conclusion The genome sequence of the P. argentatum chloroplast will enrich the sequence resources of plastid genomes in commercial crops. The availability of the complete plastid genome sequence may facilitate transformation efficiency by using the precise sequence of endogenous flanking sequences and regulatory elements in chloroplast transformation vectors. The DNA barcoding study forms the foundation for genetic identification of commercially significant lines of P. argentatum that are important for producing latex. PMID:19917140

The DNA sequence of the human X chromosome

PubMed Central

Ross, Mark T.; Grafham, Darren V.; Coffey, Alison J.; Scherer, Steven; McLay, Kirsten; Muzny, Donna; Platzer, Matthias; Howell, Gareth R.; Burrows, Christine; Bird, Christine P.; Frankish, Adam; Lovell, Frances L.; Howe, Kevin L.; Ashurst, Jennifer L.; Fulton, Robert S.; Sudbrak, Ralf; Wen, Gaiping; Jones, Matthew C.; Hurles, Matthew E.; Andrews, T. Daniel; Scott, Carol E.; Searle, Stephen; Ramser, Juliane; Whittaker, Adam; Deadman, Rebecca; Carter, Nigel P.; Hunt, Sarah E.; Chen, Rui; Cree, Andrew; Gunaratne, Preethi; Havlak, Paul; Hodgson, Anne; Metzker, Michael L.; Richards, Stephen; Scott, Graham; Steffen, David; Sodergren, Erica; Wheeler, David A.; Worley, Kim C.; Ainscough, Rachael; Ambrose, Kerrie D.; Ansari-Lari, M. Ali; Aradhya, Swaroop; Ashwell, Robert I. S.; Babbage, Anne K.; Bagguley, Claire L.; Ballabio, Andrea; Banerjee, Ruby; Barker, Gary E.; Barlow, Karen F.; Barrett, Ian P.; Bates, Karen N.; Beare, David M.; Beasley, Helen; Beasley, Oliver; Beck, Alfred; Bethel, Graeme; Blechschmidt, Karin; Brady, Nicola; Bray-Allen, Sarah; Bridgeman, Anne M.; Brown, Andrew J.; Brown, Mary J.; Bonnin, David; Bruford, Elspeth A.; Buhay, Christian; Burch, Paula; Burford, Deborah; Burgess, Joanne; Burrill, Wayne; Burton, John; Bye, Jackie M.; Carder, Carol; Carrel, Laura; Chako, Joseph; Chapman, Joanne C.; Chavez, Dean; Chen, Ellson; Chen, Guan; Chen, Yuan; Chen, Zhijian; Chinault, Craig; Ciccodicola, Alfredo; Clark, Sue Y.; Clarke, Graham; Clee, Chris M.; Clegg, Sheila; Clerc-Blankenburg, Kerstin; Clifford, Karen; Cobley, Vicky; Cole, Charlotte G.; Conquer, Jen S.; Corby, Nicole; Connor, Richard E.; David, Robert; Davies, Joy; Davis, Clay; Davis, John; Delgado, Oliver; DeShazo, Denise; Dhami, Pawandeep; Ding, Yan; Dinh, Huyen; Dodsworth, Steve; Draper, Heather; Dugan-Rocha, Shannon; Dunham, Andrew; Dunn, Matthew; Durbin, K. James; Dutta, Ireena; Eades, Tamsin; Ellwood, Matthew; Emery-Cohen, Alexandra; Errington, Helen; Evans, Kathryn L.; Faulkner, Louisa; Francis, Fiona; Frankland, John; Fraser, Audrey E.; Galgoczy, Petra; Gilbert, James; Gill, Rachel; Glöckner, Gernot; Gregory, Simon G.; Gribble, Susan; Griffiths, Coline; Grocock, Russell; Gu, Yanghong; Gwilliam, Rhian; Hamilton, Cerissa; Hart, Elizabeth A.; Hawes, Alicia; Heath, Paul D.; Heitmann, Katja; Hennig, Steffen; Hernandez, Judith; Hinzmann, Bernd; Ho, Sarah; Hoffs, Michael; Howden, Phillip J.; Huckle, Elizabeth J.; Hume, Jennifer; Hunt, Paul J.; Hunt, Adrienne R.; Isherwood, Judith; Jacob, Leni; Johnson, David; Jones, Sally; de Jong, Pieter J.; Joseph, Shirin S.; Keenan, Stephen; Kelly, Susan; Kershaw, Joanne K.; Khan, Ziad; Kioschis, Petra; Klages, Sven; Knights, Andrew J.; Kosiura, Anna; Kovar-Smith, Christie; Laird, Gavin K.; Langford, Cordelia; Lawlor, Stephanie; Leversha, Margaret; Lewis, Lora; Liu, Wen; Lloyd, Christine; Lloyd, David M.; Loulseged, Hermela; Loveland, Jane E.; Lovell, Jamieson D.; Lozado, Ryan; Lu, Jing; Lyne, Rachael; Ma, Jie; Maheshwari, Manjula; Matthews, Lucy H.; McDowall, Jennifer; McLaren, Stuart; McMurray, Amanda; Meidl, Patrick; Meitinger, Thomas; Milne, Sarah; Miner, George; Mistry, Shailesh L.; Morgan, Margaret; Morris, Sidney; Müller, Ines; Mullikin, James C.; Nguyen, Ngoc; Nordsiek, Gabriele; Nyakatura, Gerald; O’Dell, Christopher N.; Okwuonu, Geoffery; Palmer, Sophie; Pandian, Richard; Parker, David; Parrish, Julia; Pasternak, Shiran; Patel, Dina; Pearce, Alex V.; Pearson, Danita M.; Pelan, Sarah E.; Perez, Lesette; Porter, Keith M.; Ramsey, Yvonne; Reichwald, Kathrin; Rhodes, Susan; Ridler, Kerry A.; Schlessinger, David; Schueler, Mary G.; Sehra, Harminder K.; Shaw-Smith, Charles; Shen, Hua; Sheridan, Elizabeth M.; Shownkeen, Ratna; Skuce, Carl D.; Smith, Michelle L.; Sotheran, Elizabeth C.; Steingruber, Helen E.; Steward, Charles A.; Storey, Roy; Swann, R. Mark; Swarbreck, David; Tabor, Paul E.; Taudien, Stefan; Taylor, Tineace; Teague, Brian; Thomas, Karen; Thorpe, Andrea; Timms, Kirsten; Tracey, Alan; Trevanion, Steve; Tromans, Anthony C.; d’Urso, Michele; Verduzco, Daniel; Villasana, Donna; Waldron, Lenee; Wall, Melanie; Wang, Qiaoyan; Warren, James; Warry, Georgina L.; Wei, Xuehong; West, Anthony; Whitehead, Siobhan L.; Whiteley, Mathew N.; Wilkinson, Jane E.; Willey, David L.; Williams, Gabrielle; Williams, Leanne; Williamson, Angela; Williamson, Helen; Wilming, Laurens; Woodmansey, Rebecca L.; Wray, Paul W.; Yen, Jennifer; Zhang, Jingkun; Zhou, Jianling; Zoghbi, Huda; Zorilla, Sara; Buck, David; Reinhardt, Richard; Poustka, Annemarie; Rosenthal, André; Lehrach, Hans; Meindl, Alfons; Minx, Patrick J.; Hillier, LaDeana W.; Willard, Huntington F.; Wilson, Richard K.; Waterston, Robert H.; Rice, Catherine M.; Vaudin, Mark; Coulson, Alan; Nelson, David L.; Weinstock, George; Sulston, John E.; Durbin, Richard; Hubbard, Tim; Gibbs, Richard A.; Beck, Stephan; Rogers, Jane; Bentley, David R.

2009-01-01

The human X chromosome has a unique biology that was shaped by its evolution as the sex chromosome shared by males and females. We have determined 99.3% of the euchromatic sequence of the X chromosome. Our analysis illustrates the autosomal origin of the mammalian sex chromosomes, the stepwise process that led to the progressive loss of recombination between X and Y, and the extent of subsequent degradation of the Y chromosome. LINE1 repeat elements cover one-third of the X chromosome, with a distribution that is consistent with their proposed role as way stations in the process of X-chromosome inactivation. We found 1,098 genes in the sequence, of which 99 encode proteins expressed in testis and in various tumour types. A disproportionately high number of mendelian diseases are documented for the X chromosome. Of this number, 168 have been explained by mutations in 113 X-linked genes, which in many cases were characterized with the aid of the DNA sequence. PMID:15772651

What tangled web: barriers to rampant horizontal gene transfer.

PubMed

Kurland, Charles G

2005-07-01

Dawkins in his The Selfish Gene(1) quite aptly applies the term "selfish" to parasitic repetitive DNA sequences endemic to eukaryotic genomes, especially vertebrates. Doolittle and Sapienza(2) as well as Orgel and Crick(3) enlivened this notion of selfish DNA with the identification of such repetitive sequences as remnants of mobile elements such as transposons. In addition, Orgel and Crick(3) associated parasitic DNA with a potential to outgrow their host genomes by propagating both vertically via conventional genome replication as well as infectiously by horizontal gene transfer (HGT) to other genomes. Still later, Doolittle(4) speculated that unchecked HGT between unrelated genomes so complicates phylogeny that the conventional representation of a tree of life would have to be replaced by a thicket or a web of life.(4) In contrast, considerable data now show that reconstructions based on whole genome sequences are consistent with the conventional "tree of life".(5-10) Here, we identify natural barriers that protect modern genome populations from the inroads of rampant HGT. Copyright (c) 2005 Wiley Periodicals, Inc.

A Predictive Approach to Network Reverse-Engineering

NASA Astrophysics Data System (ADS)

Wiggins, Chris

2005-03-01

A central challenge of systems biology is the ``reverse engineering" of transcriptional networks: inferring which genes exert regulatory control over which other genes. Attempting such inference at the genomic scale has only recently become feasible, via data-intensive biological innovations such as DNA microrrays (``DNA chips") and the sequencing of whole genomes. In this talk we present a predictive approach to network reverse-engineering, in which we integrate DNA chip data and sequence data to build a model of the transcriptional network of the yeast S. cerevisiae capable of predicting the response of genes in unseen experiments. The technique can also be used to extract ``motifs,'' sequence elements which act as binding sites for regulatory proteins. We validate by a number of approaches and present comparison of theoretical prediction vs. experimental data, along with biological interpretations of the resulting model. En route, we will illustrate some basic notions in statistical learning theory (fitting vs. over-fitting; cross- validation; assessing statistical significance), highlighting ways in which physicists can make a unique contribution in data- driven approaches to reverse engineering.

B chromosome dynamics in Prochilodus costatus (Teleostei, Characiformes) and comparisons with supernumerary chromosome system in other Prochilodus species

PubMed Central

Melo, Silvana; Utsunomia, Ricardo; Penitente, Manolo; Sobrinho-Scudeler, Patrícia Elda; Porto-Foresti, Fábio; Oliveira, Claudio; Foresti, Fausto; Dergam, Jorge Abdala

2017-01-01

Abstract Within the genus Prochilodus Agassiz, 1829, five species are known to carry B chromosomes, i.e. chromosomes beyond the usual diploid number that have been traditionally considered as accessory for the genome. Chromosome microdissection and mapping of repetitive DNA sequences are effective tools to assess the DNA content and allow a better understanding about the origin and composition of these elements in an array of species. In this study, a novel characterization of B chromosomes in Prochilodus costatus Valenciennes, 1850 (2n=54) was reported for the first time and their sequence complementarity with the supernumerary chromosomes observed in Prochilodus lineatus (Valenciennes, 1836) and Prochilodus argenteus Agassiz, 1829 was investigated. The hybridization patterns obtained with chromosome painting using the micro B probe of P. costatus and the satDNA SATH1 mapping made it possible to assume homology of sequences between the B chromosomes of these congeneric species. Our results suggest that the origin of B chromosomes in the genus Prochilodus is a phylogenetically old event. PMID:28919971

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Properties of a U1 RNA enhancer-like sequence.

PubMed Central

Ciliberto, G; Palla, F; Tebb, G; Mattaj, I W; Philipson, L

1987-01-01

The properties of a X.laevis U1B snRNA gene enhancer have been studied by microinjection in Xenopus oocytes. The enhancer-like sequence, defined as a short DNA stretch that is able to activate transcription in an orientation independent manner, is interchangeable between different U snRNA genes. The enhancer sequence alone does not, however, efficiently activate transcription from an SV40 pol II promoter but regains its activity when combined with the U-gene specific proximal sequence element. DNase I protection experiments show that the X.laevis U1B enhancer can interact specifically with a nuclear factor present in mammalian cells. Images PMID:3031597

Combinatorial events of insertion sequences and ICE in Gram-negative bacteria.

PubMed

Toleman, Mark A; Walsh, Timothy R

2011-09-01

The emergence of antibiotic and antimicrobial resistance in Gram-negative bacteria is incremental and linked to genetic elements that function in a so-called 'one-ended transposition' manner, including ISEcp1, ISCR elements and Tn3-like transposons. The power of these elements lies in their inability to consistently recognize one of their own terminal sequences, while recognizing more genetically distant surrogate sequences. This has the effect of mobilizing the DNA sequence found adjacent to their initial location. In general, resistance in Gram-negatives is closely linked to a few one-off events. These include the capture of the class 1 integron by a Tn5090-like transposon; the formation of the 3' conserved segment (3'-CS); and the fusion of the ISCR1 element to the 3'-CS. The structures formed by these rare events have been massively amplified and disseminated in Gram-negative bacteria, but hitherto, are rarely found in Gram-positives. Such events dominate current resistance gene acquisition and are instrumental in the construction of large resistance gene islands on chromosomes and plasmids. Similar combinatorial events appear to have occurred between conjugative plasmids and phages constructing hybrid elements called integrative and conjugative elements or conjugative transposons. These elements are beginning to be closely linked to some of the more powerful resistance mechanisms such as the extended spectrum β-lactamases, metallo- and AmpC type β-lactamases. Antibiotic resistance in Gram-negative bacteria is dominated by unusual combinatorial mistakes of Insertion sequences and gene fusions which have been selected and amplified by antibiotic pressure enabling the formation of extended resistance islands. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Emergence of Sequence Type 779 Methicillin-Resistant Staphylococcus aureus Harboring a Novel Pseudo Staphylococcal Cassette Chromosome mec (SCCmec)-SCC-SCCCRISPR Composite Element in Irish Hospitals

PubMed Central

Kinnevey, Peter M.; Shore, Anna C.; Brennan, Grainne I.; Sullivan, Derek J.; Ehricht, Ralf; Monecke, Stefan; Slickers, Peter

2013-01-01

Methicillin-resistant Staphylococcus aureus (MRSA) has been a major cause of nosocomial infection in Irish hospitals for 4 decades, and replacement of predominant MRSA clones has occurred several times. An MRSA isolate recovered in 2006 as part of a larger study of sporadic MRSA exhibited a rare spa (t878) and multilocus sequence (ST779) type and was nontypeable by PCR- and DNA microarray-based staphylococcal cassette chromosome mec (SCCmec) element typing. Whole-genome sequencing revealed the presence of a novel 51-kb composite island (CI) element with three distinct domains, each flanked by direct repeat and inverted repeat sequences, including (i) a pseudo SCCmec element (16.3 kb) carrying mecA with a novel mec class region, a fusidic acid resistance gene (fusC), and two copper resistance genes (copB and copC) but lacking ccr genes; (ii) an SCC element (17.5 kb) carrying a novel ccrAB4 allele; and (iii) an SCC element (17.4 kb) carrying a novel ccrC allele and a clustered regularly interspaced short palindromic repeat (CRISPR) region. The novel CI was subsequently identified by PCR in an additional 13 t878/ST779 MRSA isolates, six from bloodstream infections, recovered between 2006 and 2011 in 11 hospitals. Analysis of open reading frames (ORFs) carried by the CI showed amino acid sequence similarity of 44 to 100% to ORFs from S. aureus and coagulase-negative staphylococci (CoNS). These findings provide further evidence of genetic transfer between S. aureus and CoNS and show how this contributes to the emergence of novel SCCmec elements and MRSA strains. Ongoing surveillance of this MRSA strain is warranted and will require updating of currently used SCCmec typing methods. PMID:23147725

Control of DEMETER DNA demethylase gene transcription in male and female gamete companion cells in Arabidopsis thaliana

PubMed Central

Park, Jin-Sup; Frost, Jennifer M.; Park, Kyunghyuk; Ohr, Hyonhwa; Park, Guen Tae; Kim, Seohyun; Eom, Hyunjoo; Lee, Ilha; Brooks, Janie S.; Fischer, Robert L.; Choi, Yeonhee

2017-01-01

The DEMETER (DME) DNA glycosylase initiates active DNA demethylation via the base-excision repair pathway and is vital for reproduction in Arabidopsis thaliana. DME-mediated DNA demethylation is preferentially targeted to small, AT-rich, and nucleosome-depleted euchromatic transposable elements, influencing expression of adjacent genes and leading to imprinting in the endosperm. In the female gametophyte, DME expression and subsequent genome-wide DNA demethylation are confined to the companion cell of the egg, the central cell. Here, we show that, in the male gametophyte, DME expression is limited to the companion cell of sperm, the vegetative cell, and to a narrow window of time: immediately after separation of the companion cell lineage from the germline. We define transcriptional regulatory elements of DME using reporter genes, showing that a small region, which surprisingly lies within the DME gene, controls its expression in male and female companion cells. DME expression from this minimal promoter is sufficient to rescue seed abortion and the aberrant DNA methylome associated with the null dme-2 mutation. Within this minimal promoter, we found short, conserved enhancer sequences necessary for the transcriptional activities of DME and combined predicted binding motifs with published transcription factor binding coordinates to produce a list of candidate upstream pathway members in the genetic circuitry controlling DNA demethylation in gamete companion cells. These data show how DNA demethylation is regulated to facilitate endosperm gene imprinting and potential transgenerational epigenetic regulation, without subjecting the germline to potentially deleterious transposable element demethylation. PMID:28130550

Different domains of the murine RNA polymerase I-specific termination factor mTTF-I serve distinct functions in transcription termination.

PubMed

Evers, R; Smid, A; Rudloff, U; Lottspeich, F; Grummt, I

1995-03-15

Termination of mouse ribosomal gene transcription by RNA polymerase I (Pol I) requires the specific interaction of a DNA binding protein, mTTF-I, with an 18 bp sequence element located downstream of the rRNA coding region. Here we describe the molecular cloning and functional characterization of the cDNA encoding this transcription termination factor. Recombinant mTTF-I binds specifically to the murine terminator elements and terminates Pol I transcription in a reconstituted in vitro system. Deletion analysis has defined a modular structure of mTTF-I comprising a dispensable N-terminal half, a large C-terminal DNA binding region and an internal domain which is required for transcription termination. Significantly, the C-terminal region of mTTF-I reveals striking homology to the DNA binding domains of the proto-oncogene c-Myb and the yeast transcription factor Reb1p. Site-directed mutagenesis of one of the tryptophan residues that is conserved in the homology region of c-Myb, Reb1p and mTTF-I abolishes specific DNA binding, a finding which underscores the functional relevance of these residues in DNA-protein interactions.

Different domains of the murine RNA polymerase I-specific termination factor mTTF-I serve distinct functions in transcription termination.

PubMed Central

Evers, R; Smid, A; Rudloff, U; Lottspeich, F; Grummt, I

1995-01-01

Termination of mouse ribosomal gene transcription by RNA polymerase I (Pol I) requires the specific interaction of a DNA binding protein, mTTF-I, with an 18 bp sequence element located downstream of the rRNA coding region. Here we describe the molecular cloning and functional characterization of the cDNA encoding this transcription termination factor. Recombinant mTTF-I binds specifically to the murine terminator elements and terminates Pol I transcription in a reconstituted in vitro system. Deletion analysis has defined a modular structure of mTTF-I comprising a dispensable N-terminal half, a large C-terminal DNA binding region and an internal domain which is required for transcription termination. Significantly, the C-terminal region of mTTF-I reveals striking homology to the DNA binding domains of the proto-oncogene c-Myb and the yeast transcription factor Reb1p. Site-directed mutagenesis of one of the tryptophan residues that is conserved in the homology region of c-Myb, Reb1p and mTTF-I abolishes specific DNA binding, a finding which underscores the functional relevance of these residues in DNA-protein interactions. Images PMID:7720715

DNA sequence selectivity of hairpin polyamide turn units

PubMed Central

Farkas, Michelle E.; Li, Benjamin C.; Dose, Christian; Dervan, Peter B.

2011-01-01

A class of hairpin polyamides linked by 3,4-diaminobutyric acid, resulting in a β-amine residue at the turn unit, showed improved binding affinities relative to their α-amino-γ-turn analogs for particular sequences. We incorporated β-amino-γ-turns in six-ring polyamides and determined whether there are any sequence preferences under the turn unit by quantitative footprinting titrations. Although there was an energetic penalty for G·C and C·G base pairs, we found little preference for T·A over A·T at the β-amino-γ-turn position. Fluorine and hydroxyl substituted α-amino-γ-turns were synthesized for comparison. Their binding affinities and specificities in the context of six-ring polyamides demonstrated overall diminished affinity and no additional specificity at the turn position. We anticipate that this study will be a baseline for further investigation of the turn subunit as a recognition element for the DNA minor groove. PMID:19349175

Dynamic epigenetic states of maize centromeres

PubMed Central

Liu, Yalin; Su, Handong; Zhang, Jing; Liu, Yang; Han, Fangpu; Birchler, James A.

2015-01-01

The centromere is a specialized chromosomal region identified as the major constriction, upon which the kinetochore complex is formed, ensuring accurate chromosome orientation and segregation during cell division. The rapid evolution of centromere DNA sequence and the conserved centromere function are two contradictory aspects of centromere biology. Indeed, the sole presence of genetic sequence is not sufficient for centromere formation. Various dicentric chromosomes with one inactive centromere have been recognized. It has also been found that de novo centromere formation is common on fragments in which centromeric DNA sequences are lost. Epigenetic factors play important roles in centromeric chromatin assembly and maintenance. Non-disjunction of the supernumerary B chromosome centromere is independent of centromere function, but centromere pairing during early prophase of meiosis I requires an active centromere. This review discusses recent studies in maize about genetic and epigenetic elements regulating formation and maintenance of centromere chromatin, as well as centromere behavior in meiosis. PMID:26579154

Principles of regulatory information conservation between mouse and human.

PubMed

Cheng, Yong; Ma, Zhihai; Kim, Bong-Hyun; Wu, Weisheng; Cayting, Philip; Boyle, Alan P; Sundaram, Vasavi; Xing, Xiaoyun; Dogan, Nergiz; Li, Jingjing; Euskirchen, Ghia; Lin, Shin; Lin, Yiing; Visel, Axel; Kawli, Trupti; Yang, Xinqiong; Patacsil, Dorrelyn; Keller, Cheryl A; Giardine, Belinda; Kundaje, Anshul; Wang, Ting; Pennacchio, Len A; Weng, Zhiping; Hardison, Ross C; Snyder, Michael P

2014-11-20

To broaden our understanding of the evolution of gene regulation mechanisms, we generated occupancy profiles for 34 orthologous transcription factors (TFs) in human-mouse erythroid progenitor, lymphoblast and embryonic stem-cell lines. By combining the genome-wide transcription factor occupancy repertoires, associated epigenetic signals, and co-association patterns, here we deduce several evolutionary principles of gene regulatory features operating since the mouse and human lineages diverged. The genomic distribution profiles, primary binding motifs, chromatin states, and DNA methylation preferences are well conserved for TF-occupied sequences. However, the extent to which orthologous DNA segments are bound by orthologous TFs varies both among TFs and with genomic location: binding at promoters is more highly conserved than binding at distal elements. Notably, occupancy-conserved TF-occupied sequences tend to be pleiotropic; they function in several tissues and also co-associate with many TFs. Single nucleotide variants at sites with potential regulatory functions are enriched in occupancy-conserved TF-occupied sequences.

Dynamic epigenetic states of maize centromeres.

PubMed

Liu, Yalin; Su, Handong; Zhang, Jing; Liu, Yang; Han, Fangpu; Birchler, James A

2015-01-01

The centromere is a specialized chromosomal region identified as the major constriction, upon which the kinetochore complex is formed, ensuring accurate chromosome orientation and segregation during cell division. The rapid evolution of centromere DNA sequence and the conserved centromere function are two contradictory aspects of centromere biology. Indeed, the sole presence of genetic sequence is not sufficient for centromere formation. Various dicentric chromosomes with one inactive centromere have been recognized. It has also been found that de novo centromere formation is common on fragments in which centromeric DNA sequences are lost. Epigenetic factors play important roles in centromeric chromatin assembly and maintenance. Non-disjunction of the supernumerary B chromosome centromere is independent of centromere function, but centromere pairing during early prophase of meiosis I requires an active centromere. This review discusses recent studies in maize about genetic and epigenetic elements regulating formation and maintenance of centromere chromatin, as well as centromere behavior in meiosis.

DNA enrichment approaches to identify unauthorized genetically modified organisms (GMOs).

PubMed

Arulandhu, Alfred J; van Dijk, Jeroen P; Dobnik, David; Holst-Jensen, Arne; Shi, Jianxin; Zel, Jana; Kok, Esther J

2016-07-01

With the increased global production of different genetically modified (GM) plant varieties, chances increase that unauthorized GM organisms (UGMOs) may enter the food chain. At the same time, the detection of UGMOs is a challenging task because of the limited sequence information that will generally be available. PCR-based methods are available to detect and quantify known UGMOs in specific cases. If this approach is not feasible, DNA enrichment of the unknown adjacent sequences of known GMO elements is one way to detect the presence of UGMOs in a food or feed product. These enrichment approaches are also known as chromosome walking or gene walking (GW). In recent years, enrichment approaches have been coupled with next generation sequencing (NGS) analysis and implemented in, amongst others, the medical and microbiological fields. The present review will provide an overview of these approaches and an evaluation of their applicability in the identification of UGMOs in complex food or feed samples.

Role of UME6 in transcriptional regulation of a DNA repair gene in Saccharomyces cerevisiae.

PubMed

Sweet, D H; Jang, Y K; Sancar, G B

1997-11-01

In Saccharomyces cerevisiae UV radiation and a variety of chemical DNA-damaging agents induce the transcription of specific genes, including several involved in DNA repair. One of the best characterized of these genes is PHR1, which encodes the apoenzyme for DNA photolyase. Basal-level and damage-induced expression of PHR1 require an upstream activation sequence, UAS(PHR1), which has homology with DRC elements found upstream of at least 19 other DNA repair and DNA metabolism genes in yeast. Here we report the identification of the UME6 gene of S. cerevisiae as a regulator of UAS(PHR1) activity. Multiple copies of UME6 stimulate expression from UAS(PHR1) and the intact PHR1 gene. Surprisingly, the effect of deletion of UME6 is growth phase dependent. In wild-type cells PHR1 is induced in late exponential phase, concomitant with the initiation of glycogen accumulation that precedes the diauxic shift. Deletion of UME6 abolishes this induction, decreases the steady-state concentration of photolyase molecules and PHR1 mRNA, and increases the UV sensitivity of a rad2 mutant. Despite the fact that UAS(PHR1) does not contain the URS1 sequence, which has been previously implicated in UME6-mediated transcriptional regulation, we find that Ume6p binds to UAS(PHR1) with an affinity and a specificity similar to those seen for a URS1 site. Similar binding is also seen for DRC elements from RAD2, RAD7, and RAD53, suggesting that UME6 contributes to the regulated expression of a subset of damage-responsive genes in yeast.

Selfish DNA: homing endonucleases find a home.

PubMed

Edgell, David R

2009-02-10

Self-splicing group I introns come in two flavours - those with a homing endonuclease to promote mobility of the intron, and those without an endonuclease. How homing endonucleases and self-splicing introns associate to form a composite selfish genetic element is a question of long-standing interest. Recent work has revealed that a shared characteristic of both introns and endonucleases, the targeting of conserved sequences, may provide the impetus for the evolution of composite mobile genetic elements.

Characterization of full-length sequenced cDNA inserts (FLIcs) from Atlantic salmon (Salmo salar)

PubMed Central

Andreassen, Rune; Lunner, Sigbjørn; Høyheim, Bjørn

2009-01-01

Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs) are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP), the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91%) of the transcripts were annotated using Gene Ontology (GO) terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS). The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS). This suggests that the remaining cDNA libraries generated by SGP represent a valuable cCDS FLIc source. The conservation of 7-mers in 3'UTRs indicates that these motifs are functionally important. Identity between some of these 7-mers and miRNA target sequences suggests that they are miRNA targets in Salmo salar transcripts as well. PMID:19878547

Developing expressed sequence tag libraries and the discovery of simple sequence repeat markers for two species of raspberry (Rubus L.).

PubMed

Bushakra, Jill M; Lewers, Kim S; Staton, Margaret E; Zhebentyayeva, Tetyana; Saski, Christopher A

2015-10-26

Due to a relatively high level of codominant inheritance and transferability within and among taxonomic groups, simple sequence repeat (SSR) markers are important elements in comparative mapping and delineation of genomic regions associated with traits of economic importance. Expressed sequence tags (ESTs) are a source of SSRs that can be used to develop markers to facilitate plant breeding and for more basic research across genera and higher plant orders. Leaf and meristem tissue from 'Heritage' red raspberry (Rubus idaeus) and 'Bristol' black raspberry (R. occidentalis) were utilized for RNA extraction. After conversion to cDNA and library construction, ESTs were sequenced, quality verified, assembled and scanned for SSRs.  Primers flanking the SSRs were designed and a subset tested for amplification, polymorphism and transferability across species. ESTs containing SSRs were functionally annotated using the GenBank non-redundant (nr) database and further classified using the gene ontology database. To accelerate development of EST-SSRs in the genus Rubus (Rosaceae), 1149 and 2358 cDNA sequences were generated from red raspberry and black raspberry, respectively. The cDNA sequences were screened using rigorous filtering criteria which resulted in the identification of 121 and 257 SSR loci for red and black raspberry, respectively. Primers were designed from the surrounding sequences resulting in 131 and 288 primer pairs, respectively, as some sequences contained more than one SSR locus. Sequence analysis revealed that the SSR-containing genes span a diversity of functions and share more sequence identity with strawberry genes than with other Rosaceous species. This resource of Rubus-specific, gene-derived markers will facilitate the construction of linkage maps composed of transferable markers for studying and manipulating important traits in this economically important genus.

Isolation and functional characterization of TIF-IB, a factor that confers promoter specificity to mouse RNA polymerase I.

PubMed

Schnapp, A; Clos, J; Hädelt, W; Schreck, R; Cvekl, A; Grummt, I

1990-03-25

The murine ribosomal gene promoter contains two cis-acting control elements which operate in concert to promote efficient and accurate transcription initiation by RNA polymerase I. The start site proximal core element which is indispensable for promoter recognition by RNA polymerase I (pol I) encompasses sequences from position -39 to -1. An upstream control element (UCE) which is located between nucleotides -142 and -112 stimulates the efficiency of transcription initiation both in vivo and in vitro. Here we report the isolation and functional characterization of a specific rDNA binding protein, the transcription initiation factor TIF-IB, which specifically interacts with the core region of the mouse ribosomal RNA gene promoter. Highly purified TIF-IB complements transcriptional activity in the presence of two other essential initiation factors TIF-IA and TIF-IC. We demonstrate that the binding efficiency of purified TIF-IB to the core promoter is strongly enhanced by the presence in cis of the UCE. This positive effect of upstream sequences on TIF-IB binding is observed throughout the purification procedure suggesting that the synergistic action of the two distant promoter elements is not mediated by a protein different from TIF-IB. Increasing the distance between both control elements still facilitates stable factor binding but eliminates transcriptional activation. The results demonstrate that TIF-IB binding to the rDNA promoter is an essential early step in the assembly of a functional transcription initiation complex. The subsequent interaction of TIF-IB with other auxiliary transcription initiation factors, however, requires the correct spacing between the UCE and the core promoter element.

Role of transposon-derived small RNAs in the interplay between genomes and parasitic DNA in rice.

PubMed

Nosaka, Misuzu; Itoh, Jun-Ichi; Nagato, Yasuo; Ono, Akemi; Ishiwata, Aiko; Sato, Yutaka

2012-09-01

RNA silencing is a defense system against "genomic parasites" such as transposable elements (TE), which are potentially harmful to host genomes. In plants, transcripts from TEs induce production of double-stranded RNAs (dsRNAs) and are processed into small RNAs (small interfering RNAs, siRNAs) that suppress TEs by RNA-directed DNA methylation. Thus, the majority of TEs are epigenetically silenced. On the other hand, most of the eukaryotic genome is composed of TEs and their remnants, suggesting that TEs have evolved countermeasures against host-mediated silencing. Under some circumstances, TEs can become active and increase in copy number. Knowledge is accumulating on the mechanisms of TE silencing by the host; however, the mechanisms by which TEs counteract silencing are poorly understood. Here, we show that a class of TEs in rice produces a microRNA (miRNA) to suppress host silencing. Members of the microRNA820 (miR820) gene family are located within CACTA DNA transposons in rice and target a de novo DNA methyltransferase gene, OsDRM2, one of the components of epigenetic silencing. We confirmed that miR820 negatively regulates the expression of OsDRM2. In addition, we found that expression levels of various TEs are increased quite sensitively in response to decreased OsDRM2 expression and DNA methylation at TE loci. Furthermore, we found that the nucleotide sequence of miR820 and its recognition site within the target gene in some Oryza species have co-evolved to maintain their base-pairing ability. The co-evolution of these sequences provides evidence for the functionality of this regulation. Our results demonstrate how parasitic elements in the genome escape the host's defense machinery. Furthermore, our analysis of the regulation of OsDRM2 by miR820 sheds light on the action of transposon-derived small RNAs, not only as a defense mechanism for host genomes but also as a regulator of interactions between hosts and their parasitic elements.

Characterisation of IS153, an IS3-family insertion sequence isolated from Lactobacillus sanfranciscensis and its use for strain differentiation.

PubMed

Ehrmann, M A; Vogel, R E

2001-11-01

An insertion sequence has been identified in the genome of Lactobacillus sanfranciscensis DSM 20451T as segment of 1351 nucleotides containing 37-bp imperfect terminal inverted repeats. The sequence of this element encodes two out of phase, overlapping open reading frames, orfA and orfB, from which three putative proteins are produced. OrfAB is a transframe protein produced by -1 translational frame shifting between orf A and orf B that is presumed to be the transposase. The large orfAB of this element encodes a 342 amino acid protein that displays similarities with transposases encoded by bacterial insertion sequences belonging to the IS3 family. In L. sanfranciscensis type strain DSM 20451T multiple truncated IS elements were identified. Inverse PCR was used to analyze target sites of four of these elements, but except of their highly AT rich character not any sequence specificity was identified so far. Moreover, no flanking direct repeats were identified. Multiple copies of IS153 were detected by hybridization in other strains of L. sanfranciscensis. Resulting hybridization patterns were shown to differentiate between organisms at strain level rather than a probe targeted against the 16S rDNA. With a PCR based approach IS153 or highly similar sequences were detected in L. acidophilus, L. casei, L. malefermentans, L. plantarum, L. hilgardii, L. collinoides L. farciminis L. sakei and L. salivarius, L. reuteri as well as in Enterococcus faecium, Pediococcus acidilactici and P. pentosaceus.

Sequence capture of ultraconserved elements from bird museum specimens.

PubMed

McCormack, John E; Tsai, Whitney L E; Faircloth, Brant C

2016-09-01

New DNA sequencing technologies are allowing researchers to explore the genomes of the millions of natural history specimens collected prior to the molecular era. Yet, we know little about how well specific next-generation sequencing (NGS) techniques work with the degraded DNA typically extracted from museum specimens. Here, we use one type of NGS approach, sequence capture of ultraconserved elements (UCEs), to collect data from bird museum specimens as old as 120 years. We targeted 5060 UCE loci in 27 western scrub-jays (Aphelocoma californica) representing three evolutionary lineages that could be species, and we collected an average of 3749 UCE loci containing 4460 single nucleotide polymorphisms (SNPs). Despite older specimens producing fewer and shorter loci in general, we collected thousands of markers from even the oldest specimens. More sequencing reads per individual helped to boost the number of UCE loci we recovered from older specimens, but more sequencing was not as successful at increasing the length of loci. We detected contamination in some samples and determined that contamination was more prevalent in older samples that were subject to less sequencing. For the phylogeny generated from concatenated UCE loci, contamination led to incorrect placement of some individuals. In contrast, a species tree constructed from SNPs called within UCE loci correctly placed individuals into three monophyletic groups, perhaps because of the stricter analytical procedures used for SNP calling. This study and other recent studies on the genomics of museum specimens have profound implications for natural history collections, where millions of older specimens should now be considered genomic resources. © 2015 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.

Single molecule real-time (SMRT) sequencing comes of age: applications and utilities for medical diagnostics

PubMed Central

Ardui, Simon; Ameur, Adam; Vermeesch, Joris R; Hestand, Matthew S

2018-01-01

Abstract Short read massive parallel sequencing has emerged as a standard diagnostic tool in the medical setting. However, short read technologies have inherent limitations such as GC bias, difficulties mapping to repetitive elements, trouble discriminating paralogous sequences, and difficulties in phasing alleles. Long read single molecule sequencers resolve these obstacles. Moreover, they offer higher consensus accuracies and can detect epigenetic modifications from native DNA. The first commercially available long read single molecule platform was the RS system based on PacBio's single molecule real-time (SMRT) sequencing technology, which has since evolved into their RSII and Sequel systems. Here we capsulize how SMRT sequencing is revolutionizing constitutional, reproductive, cancer, microbial and viral genetic testing. PMID:29401301

The Dfam database of repetitive DNA families.

PubMed

Hubley, Robert; Finn, Robert D; Clements, Jody; Eddy, Sean R; Jones, Thomas A; Bao, Weidong; Smit, Arian F A; Wheeler, Travis J

2016-01-04

Repetitive DNA, especially that due to transposable elements (TEs), makes up a large fraction of many genomes. Dfam is an open access database of families of repetitive DNA elements, in which each family is represented by a multiple sequence alignment and a profile hidden Markov model (HMM). The initial release of Dfam, featured in the 2013 NAR Database Issue, contained 1143 families of repetitive elements found in humans, and was used to produce more than 100 Mb of additional annotation of TE-derived regions in the human genome, with improved speed. Here, we describe recent advances, most notably expansion to 4150 total families including a comprehensive set of known repeat families from four new organisms (mouse, zebrafish, fly and nematode). We describe improvements to coverage, and to our methods for identifying and reducing false annotation. We also describe updates to the website interface. The Dfam website has moved to http://dfam.org. Seed alignments, profile HMMs, hit lists and other underlying data are available for download. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Homing endonucleases from mobile group I introns: discovery to genome engineering

PubMed Central

2014-01-01

Homing endonucleases are highly specific DNA cleaving enzymes that are encoded within genomes of all forms of microbial life including phage and eukaryotic organelles. These proteins drive the mobility and persistence of their own reading frames. The genes that encode homing endonucleases are often embedded within self-splicing elements such as group I introns, group II introns and inteins. This combination of molecular functions is mutually advantageous: the endonuclease activity allows surrounding introns and inteins to act as invasive DNA elements, while the splicing activity allows the endonuclease gene to invade a coding sequence without disrupting its product. Crystallographic analyses of representatives from all known homing endonuclease families have illustrated both their mechanisms of action and their evolutionary relationships to a wide range of host proteins. Several homing endonucleases have been completely redesigned and used for a variety of genome engineering applications. Recent efforts to augment homing endonucleases with auxiliary DNA recognition elements and/or nucleic acid processing factors has further accelerated their use for applications that demand exceptionally high specificity and activity. PMID:24589358

Seedling lethality in Nicotiana plumbaginifolia conferred by Ds transposable element insertion into a plant-specific gene.

PubMed

Majira, Amel; Domin, Monique; Grandjean, Olivier; Gofron, Krystyna; Houba-Hérin, Nicole

2002-10-01

A seedling lethal mutant of Nicotiana plumbaginifolia (sdl-1) was isolated by transposon tagging using a maize Dissociation (Ds) element. The insertion mutation was produced by direct co-transformation of protoplasts with two plasmids: one containing Ds and a second with an Ac transposase gene. sdl-1 seedlings exhibit several phenotypes: swollen organs, short hypocotyls in light and dark conditions, and enlarged and multinucleated cells, that altogether suggest cell growth defects. Mutant cells are able to proliferate under in vitro culture conditions. Genomic DNA sequences bordering the transposon were used to recover cDNA from the normal allele. Complementation of the mutant phenotype with the cDNA confirmed that the transposon had caused the mutation. The Ds element was inserted into the first exon of the open reading frame and the homozygous mutant lacked detectable transcript. Phenocopies of the mutant were obtained by an antisense approach. SDL-1 encodes a novel protein found in several plant genomes but apparently missingfrom animal and fungal genomes; the protein is highly conserved and has a potential plastid targeting motif.

The legumin gene family: structure of a B type gene of Vicia faba and a possible legumin gene specific regulatory element.

PubMed Central

Bäumlein, H; Wobus, U; Pustell, J; Kafatos, F C

1986-01-01

The field bean, Vicia faba L. var. minor, possesses two sub-families of 11 S legumin genes named A and B. We isolated from a genomic library a B-type gene (LeB4) and determined its primary DNA sequence. Gene LeB4 codes for a 484 amino acid residue prepropolypeptide, encompassing a signal peptide of 22 amino acid residues, an acidic, very hydrophilic alpha-chain of 281 residues and a basic, somewhat hydrophobic beta-chain of 181 residues. The latter two coding regions are immediately contiguous, but each is interrupted by a short intron. Type A legumin genes from soybean and pea are known to have introns in the same two positions, in addition to an extra intron (within the alpha-coding sequence). Sequence comparisons of legumin genes from these three plants revealed a highly conserved sequence element of at least 28 bp, centered at approximately 100 bp upstream of each cap site. The element is absent from the equivalent position of all non-legumin and other plant and fungal genes examined. We tentatively name this element "legumin box" and suggest that it may have a function in the regulation of legumin gene expression. PMID:3960730

Genome-wide characterization of centromeric satellites from multiple mammalian genomes.

PubMed

Alkan, Can; Cardone, Maria Francesca; Catacchio, Claudia Rita; Antonacci, Francesca; O'Brien, Stephen J; Ryder, Oliver A; Purgato, Stefania; Zoli, Monica; Della Valle, Giuliano; Eichler, Evan E; Ventura, Mario

2011-01-01

Despite its importance in cell biology and evolution, the centromere has remained the final frontier in genome assembly and annotation due to its complex repeat structure. However, isolation and characterization of the centromeric repeats from newly sequenced species are necessary for a complete understanding of genome evolution and function. In recent years, various genomes have been sequenced, but the characterization of the corresponding centromeric DNA has lagged behind. Here, we present a computational method (RepeatNet) to systematically identify higher-order repeat structures from unassembled whole-genome shotgun sequence and test whether these sequence elements correspond to functional centromeric sequences. We analyzed genome datasets from six species of mammals representing the diversity of the mammalian lineage, namely, horse, dog, elephant, armadillo, opossum, and platypus. We define candidate monomer satellite repeats and demonstrate centromeric localization for five of the six genomes. Our analysis revealed the greatest diversity of centromeric sequences in horse and dog in contrast to elephant and armadillo, which showed high-centromeric sequence homogeneity. We could not isolate centromeric sequences within the platypus genome, suggesting that centromeres in platypus are not enriched in satellite DNA. Our method can be applied to the characterization of thousands of other vertebrate genomes anticipated for sequencing in the near future, providing an important tool for annotation of centromeres.

Searching for nuclear export elements in hepatitis D virus RNA.

PubMed

Freitas, Natália; Cunha, Celso

2013-08-12

To search for the presence of cis elements in hepatitis D virus (HDV) genomic and antigenomic RNA capable of promoting nuclear export. We made use of a well characterized chloramphenicol acetyl-transferase reporter system based on plasmid pDM138. Twenty cDNA fragments corresponding to different HDV genomic and antigenomic RNA sequences were inserted in plasmid pDM138, and used in transfection experiments in Huh7 cells. The relative amounts of HDV RNA in nuclear and cytoplasmic fractions were then determined by real-time polymerase chain reaction and Northern blotting. The secondary structure of the RNA sequences that displayed nuclear export ability was further predicted using a web interface. Finally, the sensitivity to leptomycin B was assessed in order to investigate possible cellular pathways involved in HDV RNA nuclear export. Analysis of genomic RNA sequences did not allow identifying an unequivocal nuclear export element. However, two regions were found to promote the export of reporter mRNAs with efficiency higher than the negative controls albeit lower than the positive control. These regions correspond to nucleotides 266-489 and 584-920, respectively. In addition, when analyzing antigenomic RNA sequences a nuclear export element was found in positions 214-417. Export mediated by the nuclear export element of HDV antigenomic RNA is sensitive to leptomycin B suggesting a possible role of CRM1 in this transport pathway. A cis-acting nuclear export element is present in nucleotides 214-417 of HDV antigenomic RNA.

Facile Recovery of Individual High-Molecular-Weight, Low-Copy-Number Natural Plasmids for Genomic Sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Williams, L.E.; Detter, C,; Barrie, K.

2006-06-01

Sequencing of the large (>50 kb), low-copy-number (<5 per cell) plasmids that mediate horizontal gene transfer has been hindered by the difficulty and expense of isolating DNA from individual plasmids of this class. We report here that a kit method previously devised for purification of bacterial artificial chromosomes (BACs) can be adapted for effective preparation of individual plasmids up to 220 kb from wild gram-negative and gram-positive bacteria. Individual plasmid DNA recovered from less than 10 ml of Escherichia coli, Staphylococcus, and Corynebacterium cultures was of sufficient quantity and quality for construction of highcoverage libraries, as shown by sequencing fivemore » native plasmids ranging in size from 30 kb to 94 kb. We also report recommendations for vector screening to optimize plasmid sequence assembly, preliminary annotation of novel plasmid genomes, and insights on mobile genetic element biology derived from these sequences. Adaptation of this BAC method for large plasmid isolation removes one major technical hurdle to expanding our knowledge of the natural plasmid gene pool.« less

Stress-induced rearrangement of Fusarium retrotransposon sequences.

PubMed

Anaya, N; Roncero, M I

1996-11-27

Rearrangement of fusarium oxysporum retrotransposon skippy was induced by growth in the presence of potassium chlorate. Three fungal strains, one sensitive to chlorate (Co60) and two resistant to chlorate and deficient for nitrate reductase (Co65 and Co94), were studied by Southern analysis of their genomic DNA. Polymorphism was detected in their hybridization banding pattern, relative to the wild type grown in the absence of chlorate, using various enzymes with or without restriction sites within the retrotransposon. Results were consistent with the assumption that three different events had occurred in strain Co60: genomic amplification of skippy yielding tandem arrays of the element, generation of new skippy sequences, and deletion of skippy sequences. Amplification of Co60 genomic DNA using the polymerase chain reaction and divergent primers derived from the retrotransposon generated a new band, corresponding to one long terminal repeat plus flanking sequences, that was not present in the wild-type strain. Molecular analysis of nitrate reductase-deficient mutants showed that generation and deletion of skippy sequences, but not genomic amplification in tandem repeats, had occurred in their genomes.

Rotifer rDNA-specific R9 retrotransposable elements generate an exceptionally long target site duplication upon insertion.

PubMed

Gladyshev, Eugene A; Arkhipova, Irina R

2009-12-15

Ribosomal DNA genes in many eukaryotes contain insertions of non-LTR retrotransposable elements belonging to the R2 clade. These elements persist in the host genomes by inserting site-specifically into multicopy target sites, thereby avoiding random disruption of single-copy host genes. Here we describe R9 retrotransposons from the R2 clade in the 28S RNA genes of bdelloid rotifers, small freshwater invertebrate animals best known for their long-term asexuality and for their ability to survive repeated cycles of desiccation and rehydration. While the structural organization of R9 elements is highly similar to that of other members of the R2 clade, they are characterized by two distinct features: site-specific insertion into a previously unreported target sequence within the 28S gene, and an unusually long target site duplication of 126 bp. We discuss the implications of these findings in the context of bdelloid genome organization and the mechanisms of target-primed reverse transcription.

Analytical applications of aptamers

NASA Astrophysics Data System (ADS)

Tombelli, S.; Minunni, M.; Mascini, M.

2007-05-01

Aptamers are single stranded DNA or RNA ligands which can be selected for different targets starting from a library of molecules containing randomly created sequences. Aptamers have been selected to bind very different targets, from proteins to small organic dyes. Aptamers are proposed as alternatives to antibodies as biorecognition elements in analytical devices with ever increasing frequency. This in order to satisfy the demand for quick, cheap, simple and highly reproducible analytical devices, especially for protein detection in the medical field or for the detection of smaller molecules in environmental and food analysis. In our recent experience, DNA and RNA aptamers, specific for three different proteins (Tat, IgE and thrombin), have been exploited as bio-recognition elements to develop specific biosensors (aptasensors). These recognition elements have been coupled to piezoelectric quartz crystals and surface plasmon resonance (SPR) devices as transducers where the aptamers have been immobilized on the gold surface of the crystals electrodes or on SPR chips, respectively.

Prediction of TF target sites based on atomistic models of protein-DNA complexes

PubMed Central

Angarica, Vladimir Espinosa; Pérez, Abel González; Vasconcelos, Ana T; Collado-Vides, Julio; Contreras-Moreira, Bruno

2008-01-01

Background The specific recognition of genomic cis-regulatory elements by transcription factors (TFs) plays an essential role in the regulation of coordinated gene expression. Studying the mechanisms determining binding specificity in protein-DNA interactions is thus an important goal. Most current approaches for modeling TF specific recognition rely on the knowledge of large sets of cognate target sites and consider only the information contained in their primary sequence. Results Here we describe a structure-based methodology for predicting sequence motifs starting from the coordinates of a TF-DNA complex. Our algorithm combines information regarding the direct and indirect readout of DNA into an atomistic statistical model, which is used to estimate the interaction potential. We first measure the ability of our method to correctly estimate the binding specificities of eight prokaryotic and eukaryotic TFs that belong to different structural superfamilies. Secondly, the method is applied to two homology models, finding that sampling of interface side-chain rotamers remarkably improves the results. Thirdly, the algorithm is compared with a reference structural method based on contact counts, obtaining comparable predictions for the experimental complexes and more accurate sequence motifs for the homology models. Conclusion Our results demonstrate that atomic-detail structural information can be feasibly used to predict TF binding sites. The computational method presented here is universal and might be applied to other systems involving protein-DNA recognition. PMID:18922190

G-quadruplex-interacting compounds alter latent DNA replication and episomal persistence of KSHV

PubMed Central

Madireddy, Advaitha; Purushothaman, Pravinkumar; Loosbroock, Christopher P.; Robertson, Erle S.; Schildkraut, Carl L.; Verma, Subhash C.

2016-01-01

Kaposi's sarcoma associated herpesvirus (KSHV) establishes life-long latent infection by persisting as an extra-chromosomal episome in the infected cells and by maintaining its genome in dividing cells. KSHV achieves this by tethering its epigenome to the host chromosome by latency associated nuclear antigen (LANA), which binds in the terminal repeat (TR) region of the viral genome. Sequence analysis of the TR, a GC-rich DNA element, identified several potential Quadruplex G-Rich Sequences (QGRS). Since quadruplexes have the tendency to obstruct DNA replication, we used G-quadruplex stabilizing compounds to examine their effect on latent DNA replication and the persistence of viral episomes. Our results showed that these G-quadruplex stabilizing compounds led to the activation of dormant origins of DNA replication, with preferential bi-directional pausing of replications forks moving out of the TR region, implicating the role of the G-rich TR in the perturbation of episomal DNA replication. Over time, treatment with PhenDC3 showed a loss of viral episomes in the infected cells. Overall, these data show that G-quadruplex stabilizing compounds retard the progression of replication forks leading to a reduction in DNA replication and episomal maintenance. These results suggest a potential role for G-quadruplex stabilizers in the treatment of KSHV-associated diseases. PMID:26837574

Development and Application of a Salmonid EST Database and cDNA Microarray: Data Mining and Interspecific Hybridization Characteristics

PubMed Central

Rise, Matthew L.; von Schalburg, Kristian R.; Brown, Gordon D.; Mawer, Melanie A.; Devlin, Robert H.; Kuipers, Nathanael; Busby, Maura; Beetz-Sargent, Marianne; Alberto, Roberto; Gibbs, A. Ross; Hunt, Peter; Shukin, Robert; Zeznik, Jeffrey A.; Nelson, Colleen; Jones, Simon R.M.; Smailus, Duane E.; Jones, Steven J.M.; Schein, Jacqueline E.; Marra, Marco A.; Butterfield, Yaron S.N.; Stott, Jeff M.; Ng, Siemon H.S.; Davidson, William S.; Koop, Ben F.

2004-01-01

We report 80,388 ESTs from 23 Atlantic salmon (Salmo salar) cDNA libraries (61,819 ESTs), 6 rainbow trout (Oncorhynchus mykiss) cDNA libraries (14,544 ESTs), 2 chinook salmon (Oncorhynchus tshawytscha) cDNA libraries (1317 ESTs), 2 sockeye salmon (Oncorhynchus nerka) cDNA libraries (1243 ESTs), and 2 lake whitefish (Coregonus clupeaformis) cDNA libraries (1465 ESTs). The majority of these are 3′ sequences, allowing discrimination between paralogs arising from a recent genome duplication in the salmonid lineage. Sequence assembly reveals 28,710 different S. salar, 8981 O. mykiss, 1085 O. tshawytscha, 520 O. nerka, and 1176 C. clupeaformis putative transcripts. We annotate the submitted portion of our EST database by molecular function. Higher- and lower-molecular-weight fractions of libraries are shown to contain distinct gene sets, and higher rates of gene discovery are associated with higher-molecular weight libraries. Pyloric caecum library group annotations indicate this organ may function in redox control and as a barrier against systemic uptake of xenobiotics. A microarray is described, containing 7356 salmonid elements representing 3557 different cDNAs. Analyses of cross-species hybridizations to this cDNA microarray indicate that this resource may be used for studies involving all salmonids. PMID:14962987

The evolutionary history of Saccharomyces species inferred from completed mitochondrial genomes and revision in the ‘yeast mitochondrial genetic code’

PubMed Central

Szabóová, Dana; Bielik, Peter; Poláková, Silvia; Šoltys, Katarína; Jatzová, Katarína; Szemes, Tomáš

2017-01-01

Abstract The yeast Saccharomyces are widely used to test ecological and evolutionary hypotheses. A large number of nuclear genomic DNA sequences are available, but mitochondrial genomic data are insufficient. We completed mitochondrial DNA (mtDNA) sequencing from Illumina MiSeq reads for all Saccharomyces species. All are circularly mapped molecules decreasing in size with phylogenetic distance from Saccharomyces cerevisiae but with similar gene content including regulatory and selfish elements like origins of replication, introns, free-standing open reading frames or GC clusters. Their most profound feature is species-specific alteration in gene order. The genetic code slightly differs from well-established yeast mitochondrial code as GUG is used rarely as the translation start and CGA and CGC code for arginine. The multilocus phylogeny, inferred from mtDNA, does not correlate with the trees derived from nuclear genes. mtDNA data demonstrate that Saccharomyces cariocanus should be assigned as a separate species and Saccharomyces bayanus CBS 380T should not be considered as a distinct species due to mtDNA nearly identical to Saccharomyces uvarum mtDNA. Apparently, comparison of mtDNAs should not be neglected in genomic studies as it is an important tool to understand the origin and evolutionary history of some yeast species. PMID:28992063

Traffic at the tmRNA Gene

PubMed Central

Williams, Kelly P.

2003-01-01

A partial screen for genetic elements integrated into completely sequenced bacterial genomes shows more significant bias in specificity for the tmRNA gene (ssrA) than for any type of tRNA gene. Horizontal gene transfer, a major avenue of bacterial evolution, was assessed by focusing on elements using this single attachment locus. Diverse elements use ssrA; among enterobacteria alone, at least four different integrase subfamilies have independently evolved specificity for ssrA, and almost every strain analyzed presents a unique set of integrated elements. Even elements using essentially the same integrase can be very diverse, as is a group with an ssrA-specific integrase of the P4 subfamily. This same integrase appears to promote damage routinely at attachment sites, which may be adaptive. Elements in arrays can recombine; one such event mediated by invertible DNA segments within neighboring elements likely explains the monophasic nature of Salmonella enterica serovar Typhi. One of a limited set of conserved sequences occurs at the attachment site of each enterobacterial element, apparently serving as a transcriptional terminator for ssrA. Elements were usually found integrated into tRNA-like sequence at the 3′ end of ssrA, at subsites corresponding to those used in tRNA genes; an exception was found at the non-tRNA-like 3′ end produced by ssrA gene permutation in cyanobacteria, suggesting that, during the evolution of new site specificity by integrases, tropism toward a conserved 3′ end of an RNA gene may be as strong as toward a tRNA-like sequence. The proximity of ssrA and smpB, which act in concert, was also surveyed. PMID:12533482

Comparative analysis of complete orthologous centromeres from two subspecies of rice reveals rapid variation of centromere organization and structure.

PubMed

Wu, Jianzhong; Fujisawa, Masaki; Tian, Zhixi; Yamagata, Harumi; Kamiya, Kozue; Shibata, Michie; Hosokawa, Satomi; Ito, Yukiyo; Hamada, Masao; Katagiri, Satoshi; Kurita, Kanako; Yamamoto, Mayu; Kikuta, Ari; Machita, Kayo; Karasawa, Wataru; Kanamori, Hiroyuki; Namiki, Nobukazu; Mizuno, Hiroshi; Ma, Jianxin; Sasaki, Takuji; Matsumoto, Takashi

2009-12-01

Centromeres are sites for assembly of the chromosomal structures that mediate faithful segregation at mitosis and meiosis. This function is conserved across species, but the DNA components that are involved in kinetochore formation differ greatly, even between closely related species. To shed light on the nature, evolutionary timing and evolutionary dynamics of rice centromeres, we decoded a 2.25-Mb DNA sequence covering the centromeric region of chromosome 8 of an indica rice variety, 'Kasalath' (Kas-Cen8). Analysis of repetitive sequences in Kas-Cen8 led to the identification of 222 long terminal repeat (LTR)-retrotransposon elements and 584 CentO satellite monomers, which account for 59.2% of the region. A comparison of the Kas-Cen8 sequence with that of japonica rice 'Nipponbare' (Nip-Cen8) revealed that about 66.8% of the Kas-Cen8 sequence was collinear with that of Nip-Cen8. Although the 27 putative genes are conserved between the two subspecies, only 55.4% of the total LTR-retrotransposon elements in 'Kasalath' had orthologs in 'Nipponbare', thus reflecting recent proliferation of a considerable number of LTR-retrotransposons since the divergence of two rice subspecies of indica and japonica within Oryza sativa. Comparative analysis of the subfamilies, time of insertion, and organization patterns of inserted LTR-retrotransposons between the two Cen8 regions revealed variations between 'Kasalath' and 'Nipponbare' in the preferential accumulation of CRR elements, and the expansion of CentO satellite repeats within the core domain of Cen8. Together, the results provide insights into the recent proliferation of LTR-retrotransposons, and the rapid expansion of CentO satellite repeats, underlying the dynamic variation and plasticity of plant centromeres.