Sample records for dna sequence upstream

  1. The nucleotide sequence of the putative transcription initiation site of a cloned ribosomal RNA gene of the mouse.

    PubMed Central

    Urano, Y; Kominami, R; Mishima, Y; Muramatsu, M

    1980-01-01

    Approximately one kilobase pairs surrounding and upstream the transcription initiation site of a cloned ribosomal DNA (rDNA) of the mouse were sequenced. The putative transcription initiation site was determined by two independent methods: one nuclease S1 protection and the other reverse transcriptase elongation mapping using isolated 45S ribosomal RNA precursor (45S RNA) and appropriate restriction fragments of rDNA. Both methods gave an identical result; 45S RNA had a structure starting from ACTCTTAG---. Characteristically, mouse rDNA had many T clusters (greater than or equal to 5) upstream the initiation site, the longest being 21 consecutive T's. A pentadecanucleotide, TGCCTCCCGAGTGCA, appeared twice within 260 nucleotides upstream the putative initiation site. No such characteristic sequences were found downstream this site. Little similarity was found in the upstream of the transcription initiation site between the mouse, Xenopus laevis and Saccharomyces cerevisiae rDNA. Images PMID:6162156

  2. Identification and positional distribution analysis of transcription factor binding sites for genes from the wheat fl-cDNA sequences.

    PubMed

    Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui

    2017-06-01

    The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.

  3. Simian virus 40 major late promoter: an upstream DNA sequence required for efficient in vitro transcription.

    PubMed Central

    Brady, J; Radonovich, M; Thoren, M; Das, G; Salzman, N P

    1984-01-01

    We have previously identified an 11-base DNA sequence, 5'-G-G-T-A-C-C-T-A-A-C-C-3' (simian virus 40 [SV40] map position 294 to 304), which is important in the control of SV40 late RNA expression in vitro and in vivo (Brady et al., Cell 31:625-633, 1982). We report here the identification of another domain of the SV40 late promoter. A series of mutants with deletions extending from SV40 map position 0 to 300 was prepared by nuclease BAL 31 treatment. The cloned templates were then analyzed for efficiency and accuracy of late SV40 RNA expression in the Manley in vitro transcription system. Our studies showed that, in addition to the promoter domain near map position 300, there are essential DNA sequences between nucleotide positions 74 and 95 that are required for efficient expression of late SV40 RNA. Included in this SV40 DNA sequence were two of the six GGGCGG SV40 repeat sequences and an 11-nucleotide segment which showed strong homology with the upstream sequences required for the efficient in vitro and in vivo expression of the histone H2A gene. This upstream promoter sequence supported transcription with the same efficiency even when it was moved 72 nucleotides closer to the major late cap site. In vitro promoter competition analysis demonstrated that the upstream promoter sequence, independent of the 294 to 304 promoter element, is capable of binding polymerase-transcription factors required for SV40 late gene transcription. Finally, we show that DNA sequences which control the specificity of RNA initiation at nucleotide 325 lie downstream of map position 294. Images PMID:6321950

  4. A Partial Least Squares Based Procedure for Upstream Sequence Classification in Prokaryotes.

    PubMed

    Mehmood, Tahir; Bohlin, Jon; Snipen, Lars

    2015-01-01

    The upstream region of coding genes is important for several reasons, for instance locating transcription factor, binding sites, and start site initiation in genomic DNA. Motivated by a recently conducted study, where multivariate approach was successfully applied to coding sequence modeling, we have introduced a partial least squares (PLS) based procedure for the classification of true upstream prokaryotic sequence from background upstream sequence. The upstream sequences of conserved coding genes over genomes were considered in analysis, where conserved coding genes were found by using pan-genomics concept for each considered prokaryotic species. PLS uses position specific scoring matrix (PSSM) to study the characteristics of upstream region. Results obtained by PLS based method were compared with Gini importance of random forest (RF) and support vector machine (SVM), which is much used method for sequence classification. The upstream sequence classification performance was evaluated by using cross validation, and suggested approach identifies prokaryotic upstream region significantly better to RF (p-value < 0.01) and SVM (p-value < 0.01). Further, the proposed method also produced results that concurred with known biological characteristics of the upstream region.

  5. Identification of a factor in HeLa cells specific for an upstream transcriptional control sequence of an EIA-inducible adenovirus promoter and its relative abundance in infected and uninfected cells.

    PubMed Central

    SivaRaman, L; Subramanian, S; Thimmappaya, B

    1986-01-01

    Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943

  6. Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

    PubMed Central

    Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

    1990-01-01

    The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

  7. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  8. Unexpected substrate specificity of T4 DNA ligase revealed by in vitro selection

    NASA Technical Reports Server (NTRS)

    Harada, Kazuo; Orgel, Leslie E.

    1993-01-01

    We have used in vitro selection techniques to characterize DNA sequences that are ligated efficiently by T4 DNA ligase. We find that the ensemble of selected sequences ligates about 50 times as efficiently as the random mixture of sequences used as the input for selection. Surprisingly many of the selected sequences failed to produce a match at or close to the ligation junction. None of the 20 selected oligomers that we sequenced produced a match two bases upstream from the ligation junction.

  9. The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

    PubMed Central

    Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

    1987-01-01

    Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

  10. The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase.

    PubMed Central

    Hitzeman, R A; Hagie, F E; Hayflick, J S; Chen, C Y; Seeburg, P H; Derynck, R

    1982-01-01

    The DNA sequence of the gene for the yeast glycolytic enzyme, 3-phosphoglycerate kinase (PGK), has been obtained by sequencing part of a 3.1 kbp HindIII fragment obtained from the yeast genome. The structural gene sequence corresponds to a reading frame of 1251 bp coding for 416 amino acids with no intervening DNA sequences. The amino acid sequence is approximately 65 percent homologous with human and horse PGK protein sequences and is in general agreement with the published protein sequence for yeast PGK. As for other highly expressed structural genes in yeast, the coding sequence is highly codon biased with 95 percent of the amino acids coded for by a select 25 codons (out of 61 possible). Besides structural DNA sequence, 291 bp of 5'-flanking sequence and 286 bp of 3'-flanking sequence were determined. Transcription starts 36 nucleotides upstream from the translational start and stops 86-93 nucleotides downstream from the translational stop. These results suggest a non-polyadenylated mRNA length of 1373 to 1380 nucleotides, which is consistent with the observed length of 1500 nucleotides for polyadenylated PGK mRNA. A sequence TATATATAAA is found at 145 nucleotides upstream from the translational start. This sequence resembles the TATAAA box that is possibly associated with RNA polymerase II binding. Images PMID:6296791

  11. A SHORT SEQUENCE IMMEDIATELY UPSTREAM OF THE INTERNAL REPEAT ELEMENTS IS CRITICAL FOR KSHV LANA MEDIATED DNA REPLICATION AND IMPACTS EPISOME PERSISTENCE

    PubMed Central

    León Vázquez, Erika De; Juillard, Franceline; Rosner, Bernard; Kaye, Kenneth M.

    2013-01-01

    Kaposi’s sarcoma-associated herpesvirus LANA (1162 residues) mediates episomal persistence of viral genomes during latency. LANA mediates viral DNA replication and segregates episomes to daughter nuclei. A 59 residue deletion immediately upstream of the internal repeat elements rendered LANA highly deficient for DNA replication and modestly deficient for the ability to segregate episomes, while smaller deletions did not. The 59 amino acid deletion reduced LANA episome persistence by ~14-fold, while sequentially smaller deletions resulted in ~3-fold, or no deficiency. Three distinct LANA regions reorganized heterochromatin, one of which contains the deleted sequence, but the deletion did not abolish LANA’s ability to alter chromatin. Therefore, this work identifies a short internal LANA sequence that is critical for DNA replication, has modest effects on episome segregation, and substantially impacts episome persistence; this region may exert its effects through an interacting host cell protein(s). PMID:24314665

  12. Sequence and transcriptional analysis of the barley ctDNA region upstream of psbD-psbC encoding trnK(UUU), rps16, trnQ(UUG), psbK, psbI, and trnS(GCU).

    PubMed

    Berends Sexton, T; Jones, J T; Mullet, J E

    1990-05-01

    A 6.25 kbp barley plastid DNA region located between psbA and psbD-psbC were sequenced and RNAs produced from this DNA were analyzed. TrnK(UUU), rps16 and trnQ(UUG) were located upstream of psbA. These genes were transcribed from the same DNA strand as psbA and multiple RNAs hybridized to them. TrnK and rsp16 contained introns; a 504 amino acid open reading frame (ORF504) was located within the trnK intron. Between trnQ and psbD-psbC was a 2.24 kbp region encoding psbK, psbI and trnS(GCU). PsbK and psbI are encoded on the same DNA strand as psbD-psbC whereas trnS(GCU) is transcribed from the opposite strand. Two large RNAs accumulate in barley etioplasts which contain psbK, psbI, anti-sense trnS(GCU) and psbD-psbC sequences. Other RNAs encode psbK and psbI only, or psbK only. The divergent trnS(GCU) located upstream of psbD-psbC and a second divergent trnS(UGA) located downstream of psbD-psbC were both expressed. Furthermore, RNA complementary to psbK and psbI mRNA was detected, suggesting that transcription from divergent overlapping transcription units may modulate expression from this DNA region.

  13. RNA from the 5' end of the R2 retrotransposon controls R2 protein binding to and cleavage of its DNA target site.

    PubMed

    Christensen, Shawn M; Ye, Junqiang; Eickbush, Thomas H

    2006-11-21

    Non-LTR retrotransposons insert into eukaryotic genomes by target-primed reverse transcription (TPRT), a process in which cleaved DNA targets are used to prime reverse transcription of the element's RNA transcript. Many of the steps in the integration pathway of these elements can be characterized in vitro for the R2 element because of the rigid sequence specificity of R2 for both its DNA target and its RNA template. R2 retrotransposition involves identical subunits of the R2 protein bound to different DNA sequences upstream and downstream of the insertion site. The key determinant regulating which DNA-binding conformation the protein adopts was found to be a 320-nt RNA sequence from near the 5' end of the R2 element. In the absence of this 5' RNA the R2 protein binds DNA sequences upstream of the insertion site, cleaves the first DNA strand, and conducts TPRT when RNA containing the 3' untranslated region of the R2 transcript is present. In the presence of the 320-nt 5' RNA, the R2 protein binds DNA sequences downstream of the insertion site. Cleavage of the second DNA strand by the downstream subunit does not appear to occur until after the 5' RNA is removed from this subunit. We postulate that the removal of the 5' RNA normally occurs during reverse transcription, and thus provides a critical temporal link to first- and second-strand DNA cleavage in the R2 retrotransposition reaction.

  14. LexA Binds to Transcription Regulatory Site of Cell Division Gene ftsZ in Toxic Cyanobacterium Microcystis aeruginosa.

    PubMed

    Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi

    2018-05-17

    Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.

  15. Characterization of a tandemly repeated DNA sequence family originally derived by retroposition of tRNA(Glu) in the newt.

    PubMed

    Nagahashi, S; Endoh, H; Suzuki, Y; Okada, N

    1991-11-20

    A previous report from this laboratory showed that in vitro transcription of total genomic DNA of the newt Cynopus pyrrhogaster resulted in a discrete sized 8 S RNA, which represented highly repetitive and transcribable sequences with a glutamic acid tRNA-like structure in the newt genome. We isolated four independent clones from a newt genomic library and determined the complete sequences of three 2000 to 2400 base-pair PstI fragments spanning the 8 S RNA gene. The glutamic acid tRNA-related segment in the 8 S RNA gene contains the CCA sequence expected as the 3' terminus of a tRNA molecule. Further, the 11 nucleotides located 13 nucleotides upstream from one of the two transcription initiation sites of the 8 S RNA were found to be repeated in the region upstream from the termination site, suggesting that the original unit, which is shorter than the 8 S RNA, was retrotransposed via cDNA intermediates from the PolIII transcript. In the upstream region of the 8 S RNA gene, a 360 nucleotide unit containing the glutamic acid tRNA-related segment was found to be duplicated (clones NE1 and NE10) or triplicated (clone NE3). Except for the difference in the number of the 360 nucleotide unit, the three sequences of the 2000 to 2400 base-pair PstI fragment were essentially the same with only a few mutations and minor deletions. Inverse polymerase chain reaction and sequence determination of the products, together with a Southern hybridization experiment, demonstrated that the family consists of a tandemly repeated unit of 3300, 3700 or 4100 base-pairs. Thus during evolution, this family in the newt was created by retroposition via cDNA intermediates, followed by duplication or triplication of the 360 nucleotide unit and multiplication of the 3300 to 4100 base-pair region at the DNA level.

  16. End Joining-Mediated Gene Expression in Mammalian Cells Using PCR-Amplified DNA Constructs that Contain Terminator in Front of Promoter.

    PubMed

    Nakamura, Mikiko; Suzuki, Ayako; Akada, Junko; Tomiyoshi, Keisuke; Hoshida, Hisashi; Akada, Rinji

    2015-12-01

    Mammalian gene expression constructs are generally prepared in a plasmid vector, in which a promoter and terminator are located upstream and downstream of a protein-coding sequence, respectively. In this study, we found that front terminator constructs-DNA constructs containing a terminator upstream of a promoter rather than downstream of a coding region-could sufficiently express proteins as a result of end joining of the introduced DNA fragment. By taking advantage of front terminator constructs, FLAG substitutions, and deletions were generated using mutagenesis primers to identify amino acids specifically recognized by commercial FLAG antibodies. A minimal epitope sequence for polyclonal FLAG antibody recognition was also identified. In addition, we analyzed the sequence of a C-terminal Ser-Lys-Leu peroxisome localization signal, and identified the key residues necessary for peroxisome targeting. Moreover, front terminator constructs of hepatitis B surface antigen were used for deletion analysis, leading to the identification of regions required for the particle formation. Collectively, these results indicate that front terminator constructs allow for easy manipulations of C-terminal protein-coding sequences, and suggest that direct gene expression with PCR-amplified DNA is useful for high-throughput protein analysis in mammalian cells.

  17. Building a dictionary for genomes: Identification of presumptive regulatory sites by statistical analysis

    PubMed Central

    Bussemaker, Harmen J.; Li, Hao; Siggia, Eric D.

    2000-01-01

    The availability of complete genome sequences and mRNA expression data for all genes creates new opportunities and challenges for identifying DNA sequence motifs that control gene expression. An algorithm, “MobyDick,” is presented that decomposes a set of DNA sequences into the most probable dictionary of motifs or words. This method is applicable to any set of DNA sequences: for example, all upstream regions in a genome or all genes expressed under certain conditions. Identification of words is based on a probabilistic segmentation model in which the significance of longer words is deduced from the frequency of shorter ones of various lengths, eliminating the need for a separate set of reference data to define probabilities. We have built a dictionary with 1,200 words for the 6,000 upstream regulatory regions in the yeast genome; the 500 most significant words (some with as few as 10 copies in all of the upstream regions) match 114 of 443 experimentally determined sites (a significance level of 18 standard deviations). When analyzing all of the genes up-regulated during sporulation as a group, we find many motifs in addition to the few previously identified by analyzing the subclusters individually to the expression subclusters. Applying MobyDick to the genes derepressed when the general repressor Tup1 is deleted, we find known as well as putative binding sites for its regulatory partners. PMID:10944202

  18. Structural and functional analysis of an enhancer GPEI having a phorbol 12-O-tetradecanoate 13-acetate responsive element-like sequence found in the rat glutathione transferase P gene.

    PubMed

    Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M

    1989-10-05

    We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.

  19. DNA sequence requirements for the accurate transcription of a protein-coding plastid gene in a plastid in vitro system from mustard (Sinapis alba L.)

    PubMed Central

    Link, Gerhard

    1984-01-01

    A nuclease-treated plastid extract from mustard (Sinapis alba L.) allows efficient transcription of cloned plastid DNA templates. In this in vitro system, the major runoff transcript of the truncated gene for the 32 000 mol. wt. photosystem II protein was accurately initiated from a site close to or identical with the in vivo start site. By using plasmids with deletions in the 5'-flanking region of this gene as templates, a DNA region required for efficient and selective initiation was detected ˜28-35 nucleotides upstream of the transcription start site. This region contains the sequence element TTGACA, which matches the consensus sequence for prokaryotic `−35' promoter elements. In the absence of this region, a region ˜13-27 nucleotides upstream of the start site still enables a basic level of specific transcription. This second region contains the sequence element TATATAA, which matches the consensus sequence for the `TATA' box of genes transcribed by RNA polymerase II (or B). The region between the `TATA'-like element and the transcription start site is not sufficient but may be required for specific transcription of the plastid gene. This latter region contains the sequence element TATACT, which resembles the prokaryotic `−10' (Pribnow) box. Based on the structural and transcriptional features of the 5' upstream region, a `promoter switch' mechanism is proposed, which may account for the developmentally regulated expression of this plastid gene. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Figure 5. PMID:16453540

  20. A 21.7 kb DNA segment on the left arm of yeast chromosome XIV carries WHI3, GCR2, SPX18, SPX19, an homologue to the heat shock gene SSB1 and 8 new open reading frames of unknown function.

    PubMed

    Jonniaux, J L; Coster, F; Purnelle, B; Goffeau, A

    1994-12-01

    We report the amino acid sequence of 13 open reading frames (ORF > 299 bp) located on a 21.7 kb DNA segment from the left arm of chromosome XIV of Saccharomyces cerevisiae. Five open reading frames had been entirely or partially sequenced previously: WHI3, GCR2, SPX19, SPX18 and a heat shock gene similar to SSB1. The products of 8 other ORFs are new putative proteins among which N1394 is probably a membrane protein. N1346 contains a leucine zipper pattern and the corresponding ORF presents an HAP (global regulator of respiratory genes) upstream activating sequence in the promoting region. N1386 shares homologies with the DNA structure-specific recognition protein family SSRPs and the corresponding ORF is preceded by an MCB (MluI cell cycle box) upstream activating factor.

  1. Reducing DNA context dependence in bacterial promoters

    PubMed Central

    Carr, Swati B.; Densmore, Douglas M.

    2017-01-01

    Variation in the DNA sequence upstream of bacterial promoters is known to affect the expression levels of the products they regulate, sometimes dramatically. While neutral synthetic insulator sequences have been found to buffer promoters from upstream DNA context, there are no established methods for designing effective insulator sequences with predictable effects on expression levels. We address this problem with Degenerate Insulation Screening (DIS), a novel method based on a randomized 36-nucleotide insulator library and a simple, high-throughput, flow-cytometry-based screen that randomly samples from a library of 436 potential insulated promoters. The results of this screen can then be compared against a reference uninsulated device to select a set of insulated promoters providing a precise level of expression. We verify this method by insulating the constitutive, inducible, and repressible promotors of a four transcriptional-unit inverter (NOT-gate) circuit, finding both that order dependence is largely eliminated by insulation and that circuit performance is also significantly improved, with a 5.8-fold mean improvement in on/off ratio. PMID:28422998

  2. Distinct patterns of alteration of myc genes associated with integration of human papillomavirus type 16 or type 45 DNA in two genital tumours.

    PubMed

    Sastre-Garau, X; Favre, M; Couturier, J; Orth, G

    2000-08-01

    We previously described two genital carcinomas (IC2, IC4) containing human papillomavirus type 16 (HPV-16)- or HPV-18-related sequences integrated in chromosomal bands containing the c-myc (8q24) or N-myc (2p24) gene, respectively. The c-myc gene was rearranged and amplified in IC2 cells without evidence of overexpression. The N-myc gene was amplified and highly transcribed in IC4 cells. Here, the sequence of an 8039 bp IC4 DNA fragment containing the integrated viral sequences and the cellular junctions is reported. A 3948 bp segment of the genome of HPV-45 encompassing the upstream regulatory region and the E6 and E7 ORFs was integrated into the untranslated part of N-myc exon 3, upstream of the N-myc polyadenylation signal. Both N-myc and HPV-45 sequences were amplified 10- to 20-fold. The 3' ends of the major N-myc transcript were mapped upstream of the 5' junction. A minor N-myc/HPV-45 fusion transcript was also identified, as well as two abundant transcripts from the HPV-45 E6-E7 region. Large amounts of N-myc protein were detected in IC4 cells. A major alteration of c-myc sequences in IC2 cells involved the insertion of a non-coding sequence into the second intron and their co-amplification with the third exon, without any evidence for the integration of HPV-16 sequences within or close to the gene. Different patterns of myc gene alterations may thus be associated with integration of HPV DNA in genital tumours, including the activation of the protooncogene via a mechanism of insertional mutagenesis and/or gene amplification.

  3. A high-throughput and quantitative method to assess the mutagenic potential of translesion DNA synthesis

    PubMed Central

    Taggart, David J.; Camerlengo, Terry L.; Harrison, Jason K.; Sherrer, Shanen M.; Kshetry, Ajay K.; Taylor, John-Stephen; Huang, Kun; Suo, Zucai

    2013-01-01

    Cellular genomes are constantly damaged by endogenous and exogenous agents that covalently and structurally modify DNA to produce DNA lesions. Although most lesions are mended by various DNA repair pathways in vivo, a significant number of damage sites persist during genomic replication. Our understanding of the mutagenic outcomes derived from these unrepaired DNA lesions has been hindered by the low throughput of existing sequencing methods. Therefore, we have developed a cost-effective high-throughput short oligonucleotide sequencing assay that uses next-generation DNA sequencing technology for the assessment of the mutagenic profiles of translesion DNA synthesis catalyzed by any error-prone DNA polymerase. The vast amount of sequencing data produced were aligned and quantified by using our novel software. As an example, the high-throughput short oligonucleotide sequencing assay was used to analyze the types and frequencies of mutations upstream, downstream and at a site-specifically placed cis–syn thymidine–thymidine dimer generated individually by three lesion-bypass human Y-family DNA polymerases. PMID:23470999

  4. DoOP: Databases of Orthologous Promoters, collections of clusters of orthologous upstream sequences from chordates and plants

    PubMed Central

    Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B.; Tóth, Gábor; Ortutay, Csaba P.; Patthy, László

    2005-01-01

    DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21 061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically. PMID:15608291

  5. DoOP: Databases of Orthologous Promoters, collections of clusters of orthologous upstream sequences from chordates and plants.

    PubMed

    Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B; Tóth, Gábor; Ortutay, Csaba P; Patthy, László

    2005-01-01

    DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21,061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically.

  6. Rapid amplification of 5' complementary DNA ends (5' RACE).

    PubMed

    2005-08-01

    This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.

  7. Cloning and sequencing of a laccase gene from the lignin-degrading basidiomycete Pleurotus ostreatus.

    PubMed Central

    Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G

    1995-01-01

    The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961

  8. Specific DNA binding of the two chicken Deformed family homeodomain proteins, Chox-1.4 and Chox-a.

    PubMed Central

    Sasaki, H; Yokoyama, E; Kuroiwa, A

    1990-01-01

    The cDNA clones encoding two chicken Deformed (Dfd) family homeobox containing genes Chox-1.4 and Chox-a were isolated. Comparison of their amino acid sequences with another chicken Dfd family homeodomain protein and with those of mouse homologues revealed that strong homologies are located in the amino terminal regions and around the homeodomains. Although homologies in other regions were relatively low, some short conserved sequences were also identified. E. coli-made full length proteins were purified and used for the production of specific antibodies and for DNA binding studies. The binding profiles of these proteins to the 5'-leader and 5'-upstream sequences of Chox-1.4 and Chox-a coding regions were analyzed by immunoprecipitation and DNase I footprint assays. These two Chox proteins bound to the same sites in the 5'-flanking sequences of their coding regions with various affinities and their binding affinities to each site were nearly the same. The consensus sequences of the high and low affinity binding sites were TAATGA(C/G) and CTAATTTT, respectively. A clustered binding site was identified in the 5'-upstream of the Chox-a gene, suggesting that this clustered binding site works as a cis-regulatory element for auto- and/or cross-regulation of Chox-a gene expression. Images PMID:1970866

  9. The yeast DNA ligase gene CDC9 is controlled by six orientation specific upstream activating sequences that respond to cellular proliferation but which alone cannot mediate cell cycle regulation.

    PubMed Central

    White, J H; Johnson, A L; Lowndes, N F; Johnston, L H

    1991-01-01

    By fusing the CDC9 structural gene to the PGK upstream sequences and the CDC9 upstream to lacZ, we showed that the cell cycle expression of CDC9 is largely due to transcriptional regulation. To investigate the role of six ATGATT upstream repeats in CDC9 regulation, synthetic copies of the sequence were attached to a heterologous gene. The repeats stimulated transcription strongly and additively, but, unlike conventional yeast UAS elements, only when present in one orientation. Transcription driven by the repeats declines in cells held at START of the cell cycle or in stationary phase, as occurs with CDC9. However, the repeats by themselves cannot impart cell cycle regulation to a heterologous gene. CDC9 may therefore be controlled by an activating system operating through the repeats that is sensitive to cellular proliferation and a separate mechanism that governs the periodic expression in the cell cycle. Images PMID:1901644

  10. Improved efficiency in amplification of Escherichia coli o-antigen gene clusters using genome-wide sequence comparison

    USDA-ARS?s Scientific Manuscript database

    Background: In many bacteria including E. coli, genes encoding O-antigens are clustered in the chromosome, with a 39-bp JUMPstart sequence and gnd gene located upstream and downstream of the cluster, respectively. For determining the DNA sequence of the E. coli O-antigen gene cluster, one set of P...

  11. Small gene family encoding an eggshell (chorion) protein of the human parasite Schistosoma mansoni

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bobek, L.A.; Rekosh, D.M.; Lo Verde, P.T.

    1988-08-01

    The authors isolated six independent genomic clones encoding schistosome chorion or eggshell proteins from a Schistosoma mansoni genomic library. A linkage map of five of the clones spanning 35 kilobase pairs (kbp) of the S. mansoni genome was constructed. The region contained two eggshell protein genes closely linked, separated by 7.5 kbp of intergenic DNA. The two genes of the cluster were arranged in the same orientation, that is, they were transcribed from the same strand. The sixth clone probably represents a third copy of the eggshell gene that is not contained within the 35-kbp region. The 5- end ofmore » the mRNA transcribed from these genes was defined by primer extension directly off the RNA. The ATCAT cap site sequence was homologous to a silkmoth chorion PuTCATT cap site sequence, where Pu indicates any purine. DNA sequence analysis showed that there were no introns in these genes. The DNA sequences of the three genes were very homologous to each other and to a cDNA clone, pSMf61-46, differing only in three or four nucleotices. A multiple TATA box was located at positions -23 to -31, and a CAAAT sequence was located at -52 upstream of the eggshell transcription unit. Comparison of sequences in regions further upstream with silkmoth and Drosophila sequences revealed very short elements that were shared. One such element, TCACGT, recently shown to be an essential cis-regulatory element for silkmoth chorion gene promoter function, was found at a similar position in all three organisms.« less

  12. DNA Recognition by a σ 54 Transcriptional Activator from Aquifex aeolicus

    DOE PAGES

    Vidangos, Natasha K.; Heideker, Johanna; Lyubimov, Artem; ...

    2014-08-23

    Transcription initiation by bacterial σ 54-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain. The structurally characterized DNA-binding domains from activators all belong to the Factor for Inversion Stimulation (Fis) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DNA-binding domain of NtrC4 (4DBD) from Aquifex aeolicus, a member of the NtrC family of σ 54 activators. Two NtrC4 binding sites were identified upstream (-145 and -85 base pairs) from the start of the lpxC gene, which is responsiblemore » for the first committed step in Lipid A biosynthesis. This is the first experimental evidence for σ 54 regulation in lpxC expression. 4DBD was crystallized both without DNA and in complex with the -145 binding site. The structures, together with biochemical data, indicate that NtrC4 binds to DNA in a manner that is similar to that of its close homologue, Fis. Ultimately, the greater sequence specificity for the binding of 4DBD relative to Fis seems to arise from a larger number of base specific contacts contributing to affinity than for Fis.« less

  13. Determination of the promoter region of mouse ribosomal RNA gene by an in vitro transcription system.

    PubMed Central

    Yamamoto, O; Takakusa, N; Mishima, Y; Kominami, R; Muramatsu, M

    1984-01-01

    Sequences required for a faithful and efficient transcription of a cloned mouse ribosomal RNA gene (rDNA) are determined by testing a series of deletion mutants in an in vitro transcription system utilizing two kinds of mouse cellular extract. Deletion of sequences upstream of -40 or downstream of +52 causes only slight reduction in promoter activity as compared with the "wild-type" template. For upstream deletion mutants, the removal of a sequence between -40 and -35 causes a significant decrease in the capacity to direct efficient initiation. This decrease becomes more pronounced when the deletion reaches -32 and the sequence A-T-C-T-T-T, conserved among mouse, rat, and human rDNAs, is lost. Residual template activity is further reduced as more upstream sequence is deleted and finally becomes undetectable when the deletion is extended from -22 down to -17, corresponding to the loss of the conserved sequence T-A-T-T-G. As for downstream deletion mutants, the removal of the sequence downstream of +23 causes some (and further deletions up to +11 cause a more) serious decrease in template activity in vitro. These deletions involve other conserved sequences downstream of the transcription start site. However, the removal of the original transcription start site does not abolish the transcription initiation completely, provided that the whole upstream sequence is intact. Images PMID:6320178

  14. The control of lambda DNA terminase synthesis.

    PubMed Central

    Murialdo, H; Davidson, A; Chow, S; Gold, M

    1987-01-01

    Nu1 and A, the genes coding for bacteriophage lambda DNA terminase, rank among the most poorly translated genes expressed in E. coli. To understand the reason for this low level of translation the genes were cloned into plasmids and their expression measured. In addition, the wild type DNA sequences immediately preceding the genes were reduced and modified. It was found that the elements that control translation are contained in the 100 base pairs upstream from the initiation codon. Interchanging these upstream sequences with those of an efficiently translated gene dramatically increased the translation of terminase subunits. It seems unlikely that the rare codons present in the genes, and any feature of their mRNA secondary structure play a role in the control of their translation. The elimination of cos from plasmids containing Nu1 and A also resulted in an increase in terminase production. This result suggests a role for cos in the control of late gene expression. The terminase subunit overproducer strains are potentially very useful for the design of improved DNA packaging and cosmid mapping techniques. Images PMID:3029667

  15. G-quadruplex and G-rich sequence stimulate Pif1p-catalyzed downstream duplex DNA unwinding through reducing waiting time at ss/dsDNA junction

    PubMed Central

    Zhang, Bo; Wu, Wen-Qiang; Liu, Na-Nv; Duan, Xiao-Lei; Li, Ming; Dou, Shuo-Xing; Hou, Xi-Miao; Xi, Xu-Guang

    2016-01-01

    Alternative DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by G-rich sequences that are widely distributed throughout the human genome. We have previously shown that Pif1p not only unfolds G4, but also unwinds the downstream duplex DNA in a G4-stimulated manner. In the present study, we further characterized the G4-stimulated duplex DNA unwinding phenomenon by means of single-molecule fluorescence resonance energy transfer. It was found that Pif1p did not unwind the partial duplex DNA immediately after unfolding the upstream G4 structure, but rather, it would dwell at the ss/dsDNA junction with a ‘waiting time’. Further studies revealed that the waiting time was in fact related to a protein dimerization process that was sensitive to ssDNA sequence and would become rapid if the sequence is G-rich. Furthermore, we identified that the G-rich sequence, as the G4 structure, equally stimulates duplex DNA unwinding. The present work sheds new light on the molecular mechanism by which G4-unwinding helicase Pif1p resolves physiological G4/duplex DNA structures in cells. PMID:27471032

  16. Overexpression of the Lactobacillus plantarum peptidoglycan biosynthesis murA2 gene increases the tolerance of Escherichia coli to alcohols and enhances ethanol production.

    PubMed

    Yuan, Yongbo; Bi, Changhao; Nicolaou, Sergios A; Zingaro, Kyle A; Ralston, Matthew; Papoutsakis, Eleftherios T

    2014-10-01

    A major challenge in producing chemicals and biofuels is to increase the tolerance of the host organism to toxic products or byproducts. An Escherichia coli strain with superior ethanol and more generally alcohol tolerance was identified by screening a library constructed by randomly integrating Lactobacillus plantarum genomic DNA fragments into the E. coli chromosome via Cre-lox recombination. Sequencing identified the inserted DNA fragment as the murA2 gene and its upstream intergenic 973-bp sequence, both coded on the negative genomic DNA strand. Overexpression of this murA2 gene and its upstream 973-bp sequence significantly enhanced ethanol tolerance in both E. coli EC100 and wild type E. coli MG1655 strains by 4.1-fold and 2.0-fold compared to control strains, respectively. Tolerance to n-butanol and i-butanol in E. coli MG1655 was increased by 1.85-fold and 1.91-fold, respectively. We show that the intergenic 973-bp sequence contains a native promoter for the murA2 gene along with a long 5' UTR (286 nt) on the negative strand, while a noncoding, small RNA, named MurA2S, is expressed off the positive strand. MurA2S is expressed in E. coli and may interact with murA2, but it does not affect murA2's ability to enhance alcohol tolerance in E. coli. Overexpression of murA2 with its upstream region in the ethanologenic E. coli KO11 strain significantly improved ethanol production in cultures that simulate the industrial Melle-Boinot fermentation process.

  17. Human ribosomal RNA gene: nucleotide sequence of the transcription initiation region and comparison of three mammalian genes.

    PubMed Central

    Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M

    1982-01-01

    The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460

  18. Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes.

    PubMed

    Majumder, P; Choudhury, A; Banerjee, M; Lahiri, A; Bhattacharyya, N P

    2007-08-01

    To investigate the mechanism of increased expression of caspase-1 caused by exogenous Hippi, observed earlier in HeLa and Neuro2A cells, in this work we identified a specific motif AAAGACATG (- 101 to - 93) at the caspase-1 gene upstream sequence where HIPPI could bind. Various mutations in this specific sequence compromised the interaction, showing the specificity of the interactions. In the luciferase reporter assay, when the reporter gene was driven by caspase-1 gene upstream sequences (- 151 to - 92) with the mutation G to T at position - 98, luciferase activity was decreased significantly in green fluorescent protein-Hippi-expressing HeLa cells in comparison to that obtained with the wild-type caspase-1 gene 60 bp upstream sequence, indicating the biological significance of such binding. It was observed that the C-terminal 'pseudo' death effector domain of HIPPI interacted with the 60 bp (- 151 to - 92) upstream sequence of the caspase-1 gene containing the motif. We further observed that expression of caspase-8 and caspase-10 was increased in green fluorescent protein-Hippi-expressing HeLa cells. In addition, HIPPI interacted in vitro with putative promoter sequences of these genes, containing a similar motif. In summary, we identified a novel function of HIPPI; it binds to specific upstream sequences of the caspase-1, caspase-8 and caspase-10 genes and alters the expression of the genes. This result showed the motif-specific interaction of HIPPI with DNA, and indicates that it could act as transcription regulator.

  19. Nucleotide sequence of the gene encoding the nitrogenase iron protein of Thiobacillus ferrooxidans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pretorius, I.M.; Rawlings, D.E.; O'Neill, E.G.

    1987-01-01

    The DNA sequence was determined for the cloned Thiobacillus ferrooxidans nifH and part of the nifD genes. The DNA chains were radiolabeled with (..cap alpha..-/sup 32/P)dCTP (3000 Ci/mmol) or (..cap alpha..-/sup 35/S)dCTP (400 Ci/mmol). A putative T. ferrooxidans nifH promoter was identified whose sequences showed perfect consensus with those of the Klebsiella pneumoniae nif promoter. Two putative consensus upstream activator sequences were also identified. The amino acid sequence was deduced from the DNA sequence. In a comparison of nifH DNA sequences from T. ferrooxidans and eight other nitrogen-fixing microbes, a Rhizobium sp. isolated from Parasponia andersonii showed the greatest homologymore » (74%) and Clostridium pasteurianum (nifH1) showed the least homology (54%). In the comparison of the amino acid sequences of the Fe proteins, the Rhizobium sp. and Rhizobium japonicum showed the greatest homology (both 86%) and C. pasteurianum (nifH1 gene product) demonstrated the least homology (56%) to the T. ferrooxidans Fe protein.« less

  20. Single-stranded DNA Binding by the Helix-Hairpin-Helix Domain of XPF Protein Contributes to the Substrate Specificity of the ERCC1-XPF Protein Complex*

    PubMed Central

    Das, Devashish; Faridounnia, Maryam; Kovacic, Lidija; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

    2017-01-01

    The nucleotide excision repair protein complex ERCC1-XPF is required for incision of DNA upstream of DNA damage. Functional studies have provided insights into the binding of ERCC1-XPF to various DNA substrates. However, because no structure for the ERCC1-XPF-DNA complex has been determined, the mechanism of substrate recognition remains elusive. Here we biochemically characterize the substrate preferences of the helix-hairpin-helix (HhH) domains of XPF and ERCC-XPF and show that the binding to single-stranded DNA (ssDNA)/dsDNA junctions is dependent on joint binding to the DNA binding domain of ERCC1 and XPF. We reveal that the homodimeric XPF is able to bind various ssDNA sequences but with a clear preference for guanine-containing substrates. NMR titration experiments and in vitro DNA binding assays also show that, within the heterodimeric ERCC1-XPF complex, XPF specifically recognizes ssDNA. On the other hand, the HhH domain of ERCC1 preferentially binds dsDNA through the hairpin region. The two separate non-overlapping DNA binding domains in the ERCC1-XPF heterodimer jointly bind to an ssDNA/dsDNA substrate and, thereby, at least partially dictate the incision position during damage removal. Based on structural models, NMR titrations, DNA-binding studies, site-directed mutagenesis, charge distribution, and sequence conservation, we propose that the HhH domain of ERCC1 binds to dsDNA upstream of the damage, and XPF binds to the non-damaged strand within a repair bubble. PMID:28028171

  1. Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharomyces cerevisiae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Buchman, A.R.; Kimmerly, W.J.; Rine, J.

    1988-01-01

    Two DNA-binding factors from Saccharomyces cerevisiae have been characterized, GRFI (general regulatory factor I) and ABFI (ARS-binding factor I), that recognize specific sequences within diverse genetic elements. GRFI bound to sequences at the negative regulatory elements (silencers) of the silent mating type loci HML E and HMR E and to the upstream activating sequence (UAS) required for transcription of the MAT ..cap alpha.. genes. A putative conserved UAS located at genes involved in translation (RPG box) was also recognized by GRFI. In addition, GRFI bound with high affinity to sequences within the (C/sub 1-3/A)-repeat region at yeast telomeres. Binding sitesmore » for GRFI with the highest affinity appeared to be of the form 5'-(A/G)(A/C)ACCCAN NCA(T/C)(T/C)-3', where N is any nucleotide. ABFI-binding sites were located next to autonomously replicating sequences (ARSs) at controlling elements of the silent mating type loci HMR E, HMR I, and HML I and were associated with ARS1, ARS2, and the 2..mu..m plasmid ARS. Two tandem ABFI binding sites were found between the HIS3 and DED1 genes, several kilobase pairs from any ARS, indicating that ABFI-binding sites are not restricted to ARSs. The sequences recognized by AFBI showed partial dyad-symmetry and appeared to be variations of the consensus 5'-TATCATTNNNNACGA-3'. GRFI and ABFI were both abundant DNA-binding factors and did not appear to be encoded by the SIR genes, whose product are required for repression of the silent mating type loci. Together, these results indicate that both GRFI and ABFI play multiple roles within the cell.« less

  2. Construction of a self-cloning sake yeast that overexpresses alcohol acetyltransferase gene by a two-step gene replacement protocol.

    PubMed

    Hirosawa, I; Aritomi, K; Hoshida, H; Kashiwagi, S; Nishizawa, Y; Akada, R

    2004-07-01

    The commercial application of genetically modified industrial microorganisms has been problematic due to public concerns. We constructed a "self-cloning" sake yeast strain that overexpresses the ATF1 gene encoding alcohol acetyltransferase, to improve the flavor profile of Japanese sake. A constitutive yeast overexpression promoter, TDH3p, derived from the glyceraldehyde-3-phosphate dehydrogenase gene from sake yeast was fused to ATF1; and the 5' upstream non-coding sequence of ATF1 was further fused to TDH3p-ATF1. The fragment was placed on a binary vector, pGG119, containing a drug-resistance marker for transformation and a counter-selection marker for excision of unwanted DNA. The plasmid was integrated into the ATF1 locus of a sake yeast strain. This integration constructed tandem repeats of ATF1 and TDH3p-ATF1 sequences, between which the plasmid was inserted. Loss of the plasmid, which occurs through homologous recombination between either the TDH3p downstream ATF1 repeats or the TDH3p upstream repeat sequences, was selected by growing transformants on counter-selective medium. Recombination between the downstream repeats led to reversion to a wild type strain, but that between the upstream repeats resulted in a strain that possessed TDH3p-ATF1 without the extraneous DNA sequences. The self-cloning TDH3p-ATF1 yeast strain produced a higher amount of isoamyl acetate. This is the first expression-controlled self-cloning industrial yeast.

  3. DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio

    The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

  4. DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

    DOE PAGES

    Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio; ...

    2016-03-09

    The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

  5. Long interspersed repeated DNA (LINE) causes polymorphism at the rat insulin 1 locus.

    PubMed

    Lakshmikumaran, M S; D'Ambrosio, E; Laimins, L A; Lin, D T; Furano, A V

    1985-09-01

    The insulin 1, but not the insulin 2, locus is polymorphic (i.e., exhibits allelic variation) in rats. Restriction enzyme analysis and hybridization studies showed that the polymorphic region is 2.2 kilobases upstream of the insulin 1 coding region and is due to the presence or absence of an approximately 2.7-kilobase repeated DNA element. DNA sequence determination showed that this DNA element is a member of a long interspersed repeated DNA family (LINE) that is highly repeated (greater than 50,000 copies) and highly transcribed in the rat. Although the presence or absence of LINE sequences at the insulin 1 locus occurs in both the homozygous and heterozygous states, LINE-containing insulin 1 alleles are more prevalent in the rat population than are alleles without LINEs. Restriction enzyme analysis of the LINE-containing alleles indicated that at least two versions of the LINE sequence may be present at the insulin 1 locus in different rats. Either repeated transposition of LINE sequences or gene conversion between the resident insulin 1 LINE and other sequences in the genome are possible explanations for this.

  6. Identification, cloning, and sequencing of a fragment of Amsacta moorei entomopoxvirus DNA containing the spheroidin gene and three vaccinia virus-related open reading frames.

    PubMed Central

    Hall, R L; Moyer, R W

    1991-01-01

    Entomopoxvirus virions are frequently contained within crystalline occlusion bodies, which are composed of primarily a single protein, spheroidin, which is analogous to the polyhedrin protein of baculovirus. The spheroidin gene of Amsacta moorei entomopoxvirus was identified following the microsequencing of polypeptides generated from cyanogen bromide treatment of spheroidin and the subsequent synthesis of oligonucleotide hybridization probes. DNA sequencing of a 6.8-kb region of DNA containing the spheroidin gene showed that the spheroidin protein is derived from a 3.0-kb open reading frame potentially encoding a protein of 115 kDa. Three copies of the heptanucleotide, TTTTTNT, a sequence associated with early gene transcription in the vertebrate poxviruses, and four in-frame translational termination signals were found within 60 bp upstream of the putative spheroidin gene promoter (TAAATG). The spheroidin gene promoter region contains the sequence TAAATG, which is found in many late promoters of the vertebrate poxviruses and which serves as the site of transcriptional initiation, as shown by primer extension. Primer extension experiments also showed that spheroidin gene transcripts contain 5' poly(A) sequences typical of vertebrate poxvirus late transcripts. The 92 bases upstream of the initiating TAAATG are unusually A + T rich and contain only 7 G or C residues. An analysis of open reading frames around the spheroidin gene suggests that the colinear core of "essential genes" typical of the vertebrate poxviruses is absent in A. moorei entomopoxvirus. Images PMID:1942245

  7. Trichomonas vaginalis ribosomal RNA: identification and characterisation of the transcription promoter and terminator sequences.

    PubMed

    Franco, Bernardo; Hernández, Roberto; López-Villaseñor, Imelda

    2012-09-01

    Trichomonas vaginalis is a parasitic protozoan of both medical and biological relevance. Transcriptional studies in this organism have focused mainly on type II pol promoters, whereas the elements necessary for transcription by polI or polIII have not been investigated. Here, with the aid of a transient transcription system, we characterised the rDNA intergenic region, defining both the promoter and the terminator sequences required for transcription. We defined the promoter as a compact region of approximately 180 bp. We also identified a potential upstream control element (UCE) that was located 80 bp upstream of the transcription start point (TSP). A transcription termination element was identified within a 34 bp region that was located immediately downstream of the 28S coding sequence. The function of this element depends upon polarity and the presence of both a stretch of uridine residues (U's) and a hairpin structure in the transcript. Our observations provide a strong basis for the study of DNA recognition by the polI transcriptional machinery in this early divergent organism. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Myostatin-2 gene structure and polymorphism of the promoter and first intron in the marine fish Sparus aurata: evidence for DNA duplications and/or translocations.

    PubMed

    Nadjar-Boger, Elisabeth; Funkenstein, Bruria

    2011-02-01

    Myostatin (MSTN) is a member of the transforming growth factor-ß superfamily that functions as a negative regulator of skeletal muscle development and growth in mammals. Fish express at least two genes for MSTN: MSTN-1 and MSTN-2. To date, MSTN-2 promoters have been cloned only from salmonids and zebrafish. Here we described the cloning and sequence analysis of MSTN-2 gene and its 5' flanking region in the marine fish Sparus aurata (saMSTN-2). We demonstrate the existence of three alleles of the promoter and three alleles of the first intron. Sequence comparison of the promoter region in the three alleles revealed that although the sequences of the first 1050 bp upstream of the translation start site are almost identical in the three alleles, a substantial sequence divergence is seen further upstream. Careful sequence analysis of the region upstream of the first 1050 bp in the three alleles identified several elements that appear to be repeated in some or all sequences, at different positions. This suggests that the promoter region of saMSTN-2 has been subjected to various chromosomal rearrangements during the course of evolution, reflecting either insertion or deletion events. Screening of several genomic DNA collections indicated differences in allele frequency, with allele 'b' being the most abundant, followed by allele 'c', whereas allele 'a' is relatively rare. Sequence analysis of saMSTN-2 gene also revealed polymorphism in the first intron, identifying three alleles. The length difference in alleles '1R' and '2R' of the first intron is due to the presence of one or two copies of a repeated block of approximately 150 bp, located at the 5' end of the first intron. The third allele, '4R', has an additional insertion of 323 bp located 116 bp upstream of the 3' end of the first intron. Analysis of several DNA collections showed that the '2R' allele is the most common, followed by the '4R' allele, whereas the '1R' allele is relatively rare. Progeny analysis of a full-sib family showed a Mendelian mode of inheritance of the two genetic loci. No clear association was found between the two genetic markers and growth rate. These results show for the first time a substantial degree of polymorphism in both the promoter and first intron of MSTN-2 gene in a perciform fish species which points to chromosomal rearrangements that took place during evolution.

  9. Recognition of the Xenopus ribosomal core promoter by the transcription factor xUBF involves multiple HMG box domains and leads to an xUBF interdomain interaction.

    PubMed

    Leblanc, B; Read, C; Moss, T

    1993-02-01

    The interaction of the ribosomal transcription factor xUBF with the RNA polymerase I core promoter of Xenopus laevis has been studied both at the DNA and protein levels. It is shown that a single xUBF-DNA complex forms over the 40S initiation site (+1) and involves at least the DNA sequences between -20 and +60 bp. DNA sequences upstream of +10 and downstream of +18 are each sufficient to direct complex formation independently. HMG box 1 of xUBF independently recognizes the sequences -20 to -1 and +1 to +22 and the addition of the N-terminal dimerization domain to HMG box 1 stabilizes its interaction with these sequences approximately 10-fold. HMG boxes 2/3 interact with the DNA downstream of +22 and can independently position xUBF across the initiation site. The C-terminal segment of xUBF, HMG boxes 4, 5 or the acidic domain, directly or indirectly interact with HMG box 1, making the core promoter sequences between -11 and -15 hypersensitive to DNase. This interaction also requires the DNA sequences between +17 and +32, i.e. the HMG box 2/3 binding site. The data suggest extensive folding of the core promoter within the xUBF complex.

  10. Isolation and characterization of a water stress-specific genomic gene, pwsi 18, from rice.

    PubMed

    Joshee, N; Kisaka, H; Kitagawa, Y

    1998-01-01

    One of the water stress-specific cDNA clones of rice characterised previously, wsi18, was selected for further study. The wsi18 gene can be induced by water stress conditions such as mannitol, NaCl, and dryness, but not by ABA, cold, or heat. A genomic clone for wsi18, pwsi18, contained about 1.7 kbp of the 5' upstream sequence, two introns, and the full coding sequence. The 5'-upstream sequence of pwsi18 contained putative cis-acting elements, namely an ABA-responsive element (ABRE), three G-boxes, three E-boxes, a MEF-2 sequence, four direct and two inverted repeats, and four sequences similar to DRE, which is involved in the dehydration response of Arabidopsis genes. The gusA reporter gene under the control of the pwsi18 promoter showed transient expression in response to water stress. Deletion of the downstream DRE-like sequence between the distal G-boxes-2 and -3 resulted in rather low GUS expression.

  11. Human beta-globin gene polymorphisms characterized in DNA extracted from ancient bones 12,000 years old.

    PubMed

    Béraud-Colomb, E; Roubin, R; Martin, J; Maroc, N; Gardeisen, A; Trabuchet, G; Goosséns, M

    1995-12-01

    Analyzing the nuclear DNA from ancient human bones is an essential step to the understanding of genetic diversity in current populations, provided that such systematic studies are experimentally feasible. This article reports the successful extraction and amplification of nuclear DNA from the beta-globin region from 5 of 10 bone specimens up to 12,000 years old. These have been typed for beta-globin frameworks by sequencing through two variable positions and for a polymorphic (AT) chi (T) gamma microsatellite 500 bp upstream of the beta-globin gene. These specimens of human remains are somewhat older than those analyzed in previous nuclear gene sequencing reports and considerably older than those used to study high-copy-number human mtDNA. These results show that the systematic study of nuclear DNA polymorphisms of ancient populations is feasible.

  12. Identification and cloning of a gamma 3 subunit splice variant of the human GABA(A) receptor.

    PubMed

    Poulsen, C F; Christjansen, K N; Hastrup, S; Hartvig, L

    2000-05-31

    cDNA sequences encoding two forms of the GABA(A) gamma 3 receptor subunit were cloned from human hippocampus. The nucleotide sequences differ by the absence (gamma 3S) or presence (gamma 3L) of 18 bp located in the presumed intracellular loop between transmembrane region (TM) III and IV. The extra 18 bp in the gamma 3L subunit generates a consensus site for phosphorylation by protein kinase C (PKC). Analysis of human genomic DNA encoding the gamma 3 subunit reveals that the 18 bp insert is contiguous with the upstream proximal exon.

  13. Finding functional features in Saccharomyces genomes by phylogenetic footprinting.

    PubMed

    Cliften, Paul; Sudarsanam, Priya; Desikan, Ashwin; Fulton, Lucinda; Fulton, Bob; Majors, John; Waterston, Robert; Cohen, Barak A; Johnston, Mark

    2003-07-04

    The sifting and winnowing of DNA sequence that occur during evolution cause nonfunctional sequences to diverge, leaving phylogenetic footprints of functional sequence elements in comparisons of genome sequences. We searched for such footprints among the genome sequences of six Saccharomyces species and identified potentially functional sequences. Comparison of these sequences allowed us to revise the catalog of yeast genes and identify sequence motifs that may be targets of transcriptional regulatory proteins. Some of these conserved sequence motifs reside upstream of genes with similar functional annotations or similar expression patterns or those bound by the same transcription factor and are thus good candidates for functional regulatory sequences.

  14. The chloroplast tRNALys(UUU) gene from mustard (Sinapis alba) contains a class II intron potentially coding for a maturase-related polypeptide.

    PubMed

    Neuhaus, H; Link, G

    1987-01-01

    The trnK gene endocing the tRNALys(UUU) has been located on mustard (Sinapis alba) chloroplast DNA, 263 bp upstream of the psbA gene on the same strand. The nucleotide sequence of the trnK gene and its flanking regions as well as the putative transcription start and termination sites are shown. The 5' end of the transcript lies 121 bp upstream of the 5' tRNA coding region and is preceded by procaryotic-type "-10" and "-35" sequence elements, while the 3' end maps 2.77 kb downstream to a DNA region with possible stemloop secondary structure. The anticodon loop of the tRNALys is interrupted by a 2,574 bp intron containing a long open reading frame, which codes for 524 amino acids. Based on conserved stem and loop structures, this intron has characteristic features of a class II intron. A region near the carboxyl terminus of the derived polypeptide appears structurally related to maturases.

  15. Molecular cloning and analysis of Schizosaccharomyces pombe Reb1p: sequence-specific recognition of two sites in the far upstream rDNA intergenic spacer.

    PubMed Central

    Zhao, A; Guo, A; Liu, Z; Pape, L

    1997-01-01

    The coding sequences for a Schizosaccharomyces pombe sequence-specific DNA binding protein, Reb1p, have been cloned. The predicted S. pombe Reb1p is 24-29% identical to mouse TTF-1 (transcription termination factor-1) and Saccharomyces cerevisiae REB1 protein, both of which direct termination of RNA polymerase I catalyzed transcripts. The S.pombe Reb1 cDNA encodes a predicted polypeptide of 504 amino acids with a predicted molecular weight of 58.4 kDa. The S. pombe Reb1p is unusual in that the bipartite DNA binding motif identified originally in S.cerevisiae and Klyveromyces lactis REB1 proteins is uninterrupted and thus S.pombe Reb1p may contain the smallest natural REB1 homologous DNA binding domain. Its genomic coding sequences were shown to be interrupted by two introns. A recombinant histidine-tagged Reb1 protein bearing the rDNA binding domain has two homologous, sequence-specific binding sites in the S. pomber DNA intergenic spacer, located between 289 and 480 nt downstream of the end of the approximately 25S rRNA coding sequences. Each binding site is 13-14 bp downstream of two of the three proposed in vivo termination sites. The core of this 17 bp site, AGGTAAGGGTAATGCAC, is specifically protected by Reb1p in footprinting analysis. PMID:9016645

  16. Long interspersed repeated DNA (LINE) causes polymorphism at the rat insulin 1 locus.

    PubMed Central

    Lakshmikumaran, M S; D'Ambrosio, E; Laimins, L A; Lin, D T; Furano, A V

    1985-01-01

    The insulin 1, but not the insulin 2, locus is polymorphic (i.e., exhibits allelic variation) in rats. Restriction enzyme analysis and hybridization studies showed that the polymorphic region is 2.2 kilobases upstream of the insulin 1 coding region and is due to the presence or absence of an approximately 2.7-kilobase repeated DNA element. DNA sequence determination showed that this DNA element is a member of a long interspersed repeated DNA family (LINE) that is highly repeated (greater than 50,000 copies) and highly transcribed in the rat. Although the presence or absence of LINE sequences at the insulin 1 locus occurs in both the homozygous and heterozygous states, LINE-containing insulin 1 alleles are more prevalent in the rat population than are alleles without LINEs. Restriction enzyme analysis of the LINE-containing alleles indicated that at least two versions of the LINE sequence may be present at the insulin 1 locus in different rats. Either repeated transposition of LINE sequences or gene conversion between the resident insulin 1 LINE and other sequences in the genome are possible explanations for this. Images PMID:3016521

  17. A unique mitigator sequence determines the species specificity of the major late promoter in adenovirus type 12 DNA.

    PubMed Central

    Zock, C; Iselt, A; Doerfler, W

    1993-01-01

    Human adenovirus type 12 (Ad12) cannot replicate in hamster cells, whereas human cells are permissive for Ad12. Ad12 DNA replication and late-gene and virus-associated RNA expression are blocked in hamster cells. Early Ad12 genes are transcribed, and the viral DNA can be integrated into the host genome. Ad12 DNA replication and late-gene transcription can be complemented in hamster cells by E1 functions of Ad2 or Ad5, for which hamster cells are fully permissive (for a review, see W. Doerfler, Adv. Virus Res. 39:89-128, 1991). We have previously demonstrated that a 33-nucleotide mitigator sequence, which is located in the downstream region of the major late promoter (MLP) of Ad12 DNA, is responsible for the inactivity of the Ad12 MLP in hamster cells (C. Zock and W. Doerfler, EMBO J. 9:1615-1623, 1990). A similar negative regulator has not been found in the MLP of Ad2 DNA. We have now studied the mechanism of action of this mitigator element. The results of nuclear run-on experiments document the absence of MLP transcripts in the nuclei of Ad12-infected BHK21 hamster cells. Surprisingly, the mitigator element cannot elicit its function in in vitro transcription experiments with nuclear extracts from both hamster BHK21 and human HeLa cells. Intact nuclear topology and/or tightly bound nuclear elements that cannot be eluted in nuclear extracts are somehow required for recognition of the Ad12 mitigator. Electrophoretic mobility shift assays have not revealed significant differences in the binding of proteins from human HeLa or hamster BHK21 cells to the mitigator sequence in the MLP of Ad12 DNA or to the corresponding sequence in Ad2 DNA. We have converted the sequence of the mitigator in the MLP of Ad12 DNA to the equivalent sequence in the MLP of Ad2 DNA by site-directed mutagenesis. This construct was not active in hamster cells. When the Ad12 mitigator, on the other hand, was inserted into the Ad2 MLP, the latter's function in hamster cells was not compromised. Deletions in the 5' upstream region of the Ad12 MLP have provided evidence for the existence of additional sequences that codetermine the deficiency of the Ad12 MLP in hamster cells. The amphifunctional YY1 protein from HeLa cells can bind specifically to the mitigator and to upstream elements of the MLP of Ad12 DNA.(ABSTRACT TRUNCATED AT 400 WORDS) Images PMID:8419643

  18. Molecular cloning of actin genes in Trichomonas vaginalis and phylogeny inferred from actin sequences.

    PubMed

    Bricheux, G; Brugerolle, G

    1997-08-01

    The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.

  19. Characterization of an In Vivo Z-DNA Detection Probe Based on a Cell Nucleus Accumulating Intrabody.

    PubMed

    Gulis, Galina; Silva, Izabel Cristina Rodrigues; Sousa, Herdson Renney; Sousa, Isabel Garcia; Bezerra, Maryani Andressa Gomes; Quilici, Luana Salgado; Maranhao, Andrea Queiroz; Brigido, Marcelo Macedo

    2016-09-01

    Left-handed Z-DNA is a physiologically unstable DNA conformation, and its existence in vivo can be attributed to localized torsional distress. Despite evidence for the existence of Z-DNA in vivo, its precise role in the control of gene expression is not fully understood. Here, an in vivo probe based on an anti-Z-DNA intrabody is proposed for native Z-DNA detection. The probe was used for chromatin immunoprecipitation of potential Z-DNA-forming sequences in the human genome. One of the isolated putative Z-DNA-forming sequences was cloned upstream of a reporter gene expression cassette under control of the CMV promoter. The reporter gene encoded an antibody fragment fused to GFP. Transient co-transfection of this vector along with the Z-probe coding vector improved reporter gene expression. This improvement was demonstrated by measuring reporter gene mRNA and protein levels and the amount of fluorescence in co-transfected CHO-K1 cells. These results suggest that the presence of the anti-Z-DNA intrabody can interfere with a Z-DNA-containing reporter gene expression. Therefore, this in vivo probe for the detection of Z-DNA could be used for global correlation of Z-DNA-forming sequences and gene expression regulation.

  20. A novel class of plant-specific zinc-dependent DNA-binding protein that binds to A/T-rich DNA sequences

    PubMed Central

    Nagano, Yukio; Furuhashi, Hirofumi; Inaba, Takehito; Sasaki, Yukiko

    2001-01-01

    Complementary DNA encoding a DNA-binding protein, designated PLATZ1 (plant AT-rich sequence- and zinc-binding protein 1), was isolated from peas. The amino acid sequence of the protein is similar to those of other uncharacterized proteins predicted from the genome sequences of higher plants. However, no paralogous sequences have been found outside the plant kingdom. Multiple alignments among these paralogous proteins show that several cysteine and histidine residues are invariant, suggesting that these proteins are a novel class of zinc-dependent DNA-binding proteins with two distantly located regions, C-x2-H-x11-C-x2-C-x(4–5)-C-x2-C-x(3–7)-H-x2-H and C-x2-C-x(10–11)-C-x3-C. In an electrophoretic mobility shift assay, the zinc chelator 1,10-o-phenanthroline inhibited DNA binding, and two distant zinc-binding regions were required for DNA binding. A protein blot with 65ZnCl2 showed that both regions are required for zinc-binding activity. The PLATZ1 protein non-specifically binds to A/T-rich sequences, including the upstream region of the pea GTPase pra2 and plastocyanin petE genes. Expression of the PLATZ1 repressed those of the reporter constructs containing the coding sequence of luciferase gene driven by the cauliflower mosaic virus (CaMV) 35S90 promoter fused to the tandem repeat of the A/T-rich sequences. These results indicate that PLATZ1 is a novel class of plant-specific zinc-dependent DNA-binding protein responsible for A/T-rich sequence-mediated transcriptional repression. PMID:11600698

  1. Fragile sites, dysfunctional telomere and chromosome fusions: What is 5S rDNA role?

    PubMed

    Barros, Alain Victor; Wolski, Michele Andressa Vier; Nogaroto, Viviane; Almeida, Mara Cristina; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo

    2017-04-15

    Repetitive DNA regions are known as fragile chromosomal sites which present a high flexibility and low stability. Our focus was characterize fragile sites in 5S rDNA regions. The Ancistrus sp. species shows a diploid number of 50 and an indicative Robertsonian fusion at chromosomal pair 1. Two sequences of 5S rDNA were identified: 5S.1 rDNA and 5S.2 rDNA. The first sequence gathers the necessary structures to gene expression and shows a functional secondary structure prediction. Otherwise, the 5S.2 rDNA sequence does not contain the upstream sequences that are required to expression, furthermore its structure prediction reveals a nonfunctional ribosomal RNA. The chromosomal mapping revealed several 5S.1 and 5S.2 rDNA clusters. In addition, the 5S.2 rDNA clusters were found in acrocentric and metacentric chromosomes proximal regions. The pair 1 5S.2 rDNA cluster is co-located with interstitial telomeric sites (ITS). Our results indicate that its clusters are hotspots to chromosomal breaks. During the meiotic prophase bouquet arrangement, double strand breaks (DSBs) at proximal 5S.2 rDNA of acrocentric chromosomes could lead to homologous and non-homologous repair mechanisms as Robertsonian fusions. Still, ITS sites provides chromosomal instability, resulting in telomeric recombination via TRF2 shelterin protein and a series of breakage-fusion-bridge cycles. Our proposal is that 5S rDNA derived sequences, act as chromosomal fragile sites in association with some chromosomal rearrangements of Loricariidae. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Genome-wide analysis of salinity-stress induced DNA methylation alterations in cotton (Gossypium hirsutum L.) using the Me-DIP sequencing technology.

    PubMed

    Lu, X K; Shu, N; Wang, J J; Chen, X G; Wang, D L; Wang, S; Fan, W L; Guo, X N; Guo, L X; Ye, W W

    2017-06-29

    Cytosine DNA methylation is a significant form of DNA modification closely associated with gene expression in eukaryotes, fungi, animals, and plants. Although the reference genomes of cotton (Gossypium hirsutum L.) have been publically available, the salinity-stress-induced DNA methylome alterations in cotton are not well understood. Here, we constructed a map of genome-wide DNA methylation characteristics of cotton leaves under salt stress using the methylated DNA immunoprecipitation sequencing method. The results showed that the methylation reads on chromosome 9 were most comparable with those on the other chromosomes, but the greatest changes occurred on chromosome 8 under salt stress. The DNA methylation pattern analysis indicated that a relatively higher methylation density was found in the upstream2k and downstream2k elements of the CDS region and CG-islands. Almost 94% of the reads belonged to LTR-gspsy and LTR-copia, and the number of methylation reads in LTR-gypsy was four times greater than that in LTR-copia in both control and stressed samples. The analysis of differentially methylated regions (DMRs) showed that the gene elements upstream2k, intron, and downstream2k were hypomethylated, but the CDS regions were hypermethylated. The GO (Gene Ontology) analysis suggested that the methylated genes were most enriched in cellular processes, metabolic processes, cell parts and catalytic activities, which might be closely correlated with response to NaCl stress. In this study, we completed a genomic DNA methylation profile and conducted a DMR analysis under salt stress, which provided valuable information for the better understanding of epigenetics in response to salt stress in cotton.

  3. Promoter selection in human mitochondria involves binding of a transcription factor to orientation-independent upstream regulatory elements.

    PubMed

    Fisher, R P; Topper, J N; Clayton, D A

    1987-07-17

    Selective transcription of human mitochondrial DNA requires a transcription factor (mtTF) in addition to an essentially nonselective RNA polymerase. Partially purified mtTF is able to sequester promoter-containing DNA in preinitiation complexes in the absence of mitochondrial RNA polymerase, suggesting a DNA-binding mechanism for factor activity. Functional domains, required for positive transcriptional regulation by mtTF, are identified within both major promoters of human mtDNA through transcription of mutant promoter templates in a reconstituted in vitro system. These domains are essentially coextensive with DNA sequences protected from nuclease digestion by mtTF-binding. Comparison of the sequences of the two mtTF-responsive elements reveals significant homology only when one sequence is inverted; the binding sites are in opposite orientations with respect to the predominant direction of transcription. Thus mtTF may function bidirectionally, requiring additional protein-DNA interactions to dictate transcriptional polarity. The mtTF-responsive elements are arrayed as direct repeats, separated by approximately 80 bp within the displacement-loop region of human mitochondrial DNA; this arrangement may reflect duplication of an ancestral bidirectional promoter, giving rise to separate, unidirectional promoters for each strand.

  4. COUP-TF (chicken ovalbumin upstream promoter transcription factor)-interacting protein 1 (CTIP1) is a sequence-specific DNA binding protein.

    PubMed Central

    Avram, Dorina; Fields, Andrew; Senawong, Thanaset; Topark-Ngarm, Acharawan; Leid, Mark

    2002-01-01

    Chicken ovalbumin upstream promoter transcription factor (COUP-TF)-interacting proteins 1 and 2 [CTIP1/Evi9/B cell leukaemia (Bcl) l1a and CTIP2/Bcl11b respectively] are highly related C(2)H(2) zinc finger proteins that are abundantly expressed in brain and the immune system, and are associated with immune system malignancies. A selection procedure was employed to isolate high-affinity DNA binding sites for CTIP1. The core binding site on DNA identified in these studies, 5'-GGCCGG-3' (upper strand), is highly related to the canonical GC box and was bound by a CTIP1 oligomeric complex(es) in vitro. Furthermore, both CTIP1 and CTIP2 repressed transcription of a reporter gene harbouring a multimerized CTIP binding site, and this repression was neither reversed by trichostatin A (an inhibitor of known class I and II histone deacetylases) nor stimulated by co-transfection of a COUP-TF family member. These results demonstrate that CTIP1 is a sequence-specific DNA binding protein and a bona fide transcriptional repressor that is capable of functioning independently of COUP-TF family members. These findings may be relevant to the physiological and/or pathological action(s) of CTIPs in cells that do not express COUP-TF family members, such as cells of the haematopoietic and immune systems. PMID:12196208

  5. Genes encoding Xenopus laevis Ig L chains: Implications for the evolution of [kappa] and [lambda] chains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zezza, D.J.; Stewart, S.E.; Steiner, L.A.

    1992-12-15

    Xenopus laevis Ig contain two distinct types of L chains, designated [rho] or L1 and [sigma] or L2. The authors have analyzed Xenopus genomic DNA by Southern blotting with cDNA probes specific for L1 V and C regions. Many fragments hybridized to the V probe, but only one or two fragments hybridized to the C probe. Corresponding C, J, and V gene segments were identified on clones isolated from a genomic library prepared from the same DNA. One clone contains a C gene segment separated from a J gene segment by an intron of 3.4 kb. The J and Cmore » gene segments are nearly identical in sequence to cDNA clones analyzed previously. The C segment is somewhat more similar and the J segment considerably more similar in sequence to the corresponding segments of mammalian [kappa] chains than to those of mammalian [lambda] chains. Upstream of the J segment is a typical recombination signal sequence with a spacer of 23 bp, as in J[kappa]. A second clone from the library contains four V gene segments, separated by 2.1 to 3.6 kb. Two of these, V1 and V3, have the expected structural and regulatory features of V genes, and are very similar in sequence to each other and to mammalian V[kappa]. A third gene segment, V2, resembles V1 and V3 in its coding region and nearby 5[prime]-flanking region, but diverges in sequence 5[prime] to position [minus]95 with loss of the octamer promoter element. The fourth V-like segment is similar to the others at the 3[prime]-end, but upstream of codon 64 bears no resemblance in sequence to any Ig V region. All four V segments have typical recombination signal sequences with 12-bp spacers at their 3[prime]-ends, as in V[kappa]. Taken together, the data suggest that Xenopus L1 L chain genes are members of the [kappa] gene family. 80 refs., 9 figs.« less

  6. DNA Persistence in a Sink Drain Environment

    DOE PAGES

    Winder, Eric M.; Bonheyo, George T.

    2015-07-31

    Biofilms are organized structures composed mainly of cells and extracellular polymeric substances produced by the constituent microorganisms. Ubiquitous in nature, biofilms have an innate ability to capture and retain passing material and may therefore act as natural collectors of contaminants or signatures of upstream activities. To determine the persistence and detectability of DNA passing through a sink drain environment, Bacillus anthracis strain Ames35 was cultured (6.35 x 10 7 CFU/mL), sterilized, and disposed of by addition to a sink drain apparatus with an established biofilm. The sink drain apparatus was sampled before and for several days after the addition ofmore » the sterilized B. anthracis culture to detect the presence of B. anthracis DNA. Multiple PCR primer pairs were used to screen for chromosomal and plasmid DNA with primers targeting shorter sequences showing greater amplification efficiency and success. PCR amplification and detection of target sequences indicate persistence of chromosomal DNA and plasmid DNA in the biofilm for 5 or more and 14 or more days, respectively.« less

  7. DNA Persistence in a Sink Drain Environment

    PubMed Central

    Winder, Eric M.; Bonheyo, George T.

    2015-01-01

    Biofilms are organized structures composed mainly of cells and extracellular polymeric substances produced by the constituent microorganisms. Ubiquitous in nature, biofilms have an innate ability to capture and retain passing material and may therefore act as natural collectors of contaminants or signatures of upstream activities. To determine the persistence and detectability of DNA passing through a sink drain environment, Bacillus anthracis strain Ames35 was cultured (6.35 x 107 CFU/mL), sterilized, and disposed of by addition to a sink drain apparatus with an established biofilm. The sink drain apparatus was sampled before and for several days after the addition of the sterilized B. anthracis culture to detect the presence of B. anthracis DNA. Multiple PCR primer pairs were used to screen for chromosomal and plasmid DNA with primers targeting shorter sequences showing greater amplification efficiency and success. PCR amplification and detection of target sequences indicate persistence of chromosomal DNA and plasmid DNA in the biofilm for 5 or more and 14 or more days, respectively. PMID:26230525

  8. DNA Persistence in a Sink Drain Environment.

    PubMed

    Winder, Eric M; Bonheyo, George T

    2015-01-01

    Biofilms are organized structures composed mainly of cells and extracellular polymeric substances produced by the constituent microorganisms. Ubiquitous in nature, biofilms have an innate ability to capture and retain passing material and may therefore act as natural collectors of contaminants or signatures of upstream activities. To determine the persistence and detectability of DNA passing through a sink drain environment, Bacillus anthracis strain Ames35 was cultured (6.35 x 107 CFU/mL), sterilized, and disposed of by addition to a sink drain apparatus with an established biofilm. The sink drain apparatus was sampled before and for several days after the addition of the sterilized B. anthracis culture to detect the presence of B. anthracis DNA. Multiple PCR primer pairs were used to screen for chromosomal and plasmid DNA with primers targeting shorter sequences showing greater amplification efficiency and success. PCR amplification and detection of target sequences indicate persistence of chromosomal DNA and plasmid DNA in the biofilm for 5 or more and 14 or more days, respectively.

  9. Sense transcription through the S region is essential for immunoglobulin class switch recombination

    PubMed Central

    Haddad, Dania; Oruc, Zéliha; Puget, Nadine; Laviolette-Malirat, Nathalie; Philippe, Magali; Carrion, Claire; Le Bert, Marc; Khamlichi, Ahmed Amine

    2011-01-01

    Class switch recombination (CSR) occurs between highly repetitive sequences called switch (S) regions and is initiated by activation-induced cytidine deaminase (AID). CSR is preceded by a bidirectional transcription of S regions but the relative importance of sense and antisense transcription for CSR in vivo is unknown. We generated three mouse lines in which we attempted a premature termination of transcriptional elongation by inserting bidirectional transcription terminators upstream of Sμ, upstream of Sγ3 or downstream of Sγ3 sequences. The data show, at least for Sγ3, that sense transcriptional elongation across S region is absolutely required for CSR whereas its antisense counterpart is largely dispensable, strongly suggesting that sense transcription is sufficient for AID targeting to both DNA strands. PMID:21378751

  10. Integrating DNA strand displacement circuitry to the nonlinear hybridization chain reaction.

    PubMed

    Zhang, Zhuo; Fan, Tsz Wing; Hsing, I-Ming

    2017-02-23

    Programmable and modular attributes of DNA molecules allow one to develop versatile sensing platforms that can be operated isothermally and enzyme-free. In this work, we present an approach to integrate upstream DNA strand displacement circuits that can be turned on by a sequence-specific microRNA analyte with a downstream nonlinear hybridization chain reaction for a cascading hyperbranched nucleic acid assembly. This system provides a two-step amplification strategy for highly sensitive detection of the miRNA analyte, conducive for multiplexed detection. Multiple miRNA analytes were tested with our integrated circuitry using the same downstream signal amplification setting, showing the decoupling of nonlinear self-assembly with the analyte sequence. Compared with the reported methods, our signal amplification approach provides an additional control module for higher-order DNA self-assembly and could be developed into a promising platform for the detection of critical nucleic-acid based biomarkers.

  11. Investigations of Escherichia coli promoter sequences with artificial neural networks: New signals discovered upstream of the transcriptional startpoint

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pedersen, A.G.; Engelbrecht, J.

    1995-12-31

    In this paper we present a novel method for using the learning ability of a neural network as a measure of information in local regions of input data. Using the method to analyze Escherichia coli promoters, we discover all previously described signals, and furthermore find new signals that are regularly spaced along the promoter region. The spacing of all signals correspond to the helical periodicity of DNA, meaning that the signals are all present on the same face of the DNA helix in the promoter region. This is consistent with a model where the RNA polymerase contacts the promoter onmore » one side of the DNA, and suggests that the regions important for promoter recognition may include more positions on the DNA than usually assumed. We furthermore analyze the E.coli promoters by calculating the Kullback Leibler distance, and by constructing sequence logos.« less

  12. Coliphage HK022 Nun protein inhibits RNA polymerase translocation

    PubMed Central

    Vitiello, Christal L.; Kireeva, Maria L.; Lubkowska, Lucyna; Kashlev, Mikhail; Gottesman, Max

    2014-01-01

    The Nun protein of coliphage HK022 arrests RNA polymerase (RNAP) in vivo and in vitro at pause sites distal to phage λ N-Utilization (nut) site RNA sequences. We tested the activity of Nun on ternary elongation complexes (TECs) assembled with templates lacking the λ nut sequence. We report that Nun stabilizes both translocation states of RNAP by restricting lateral movement of TEC along the DNA register. When Nun stabilized TEC in a pretranslocated register, immediately after NMP incorporation, it prevented binding of the next NTP and stimulated pyrophosphorolysis of the nascent transcript. In contrast, stabilization of TEC by Nun in a posttranslocated register allowed NTP binding and nucleotidyl transfer but inhibited pyrophosphorolysis and the next round of forward translocation. Nun binding to and action on the TEC requires a 9-bp RNA–DNA hybrid. We observed a Nun-dependent toe print upstream to the TEC. In addition, mutations in the RNAP β′ subunit near the upstream end of the transcription bubble suppress Nun binding and arrest. These results suggest that Nun interacts with RNAP near the 5′ edge of the RNA–DNA hybrid. By stabilizing translocation states through restriction of TEC lateral mobility, Nun represents a novel class of transcription arrest factors. PMID:24853501

  13. Expanded Genetic Codes in Next Generation Sequencing Enable Decontamination and Mitochondrial Enrichment

    PubMed Central

    McKernan, Kevin J.; Spangler, Jessica; Zhang, Lei; Tadigotla, Vasisht; McLaughlin, Stephen; Warner, Jason; Zare, Amir; Boles, Richard G.

    2014-01-01

    We have developed a PCR method, coined Déjà vu PCR, that utilizes six nucleotides in PCR with two methyl specific restriction enzymes that respectively digest these additional nucleotides. Use of this enzyme-and-nucleotide combination enables what we term a “DNA diode”, where DNA can advance in a laboratory in only one direction and cannot feedback into upstream assays. Here we describe aspects of this method that enable consecutive amplification with the introduction of a 5th and 6th base while simultaneously providing methylation dependent mitochondrial DNA enrichment. These additional nucleotides enable a novel DNA decontamination technique that generates ephemeral and easy to decontaminate DNA. PMID:24788618

  14. Evidence of birth-and-death evolution of 5S rRNA gene in Channa species (Teleostei, Perciformes).

    PubMed

    Barman, Anindya Sundar; Singh, Mamta; Singh, Rajeev Kumar; Lal, Kuldeep Kumar

    2016-12-01

    In higher eukaryotes, minor rDNA family codes for 5S rRNA that is arranged in tandem arrays and comprises of a highly conserved 120 bp long coding sequence with a variable non-transcribed spacer (NTS). Initially the 5S rDNA repeats are considered to be evolved by the process of concerted evolution. But some recent reports, including teleost fishes suggested that evolution of 5S rDNA repeat does not fit into the concerted evolution model and evolution of 5S rDNA family may be explained by a birth-and-death evolution model. In order to study the mode of evolution of 5S rDNA repeats in Perciformes fish species, nucleotide sequence and molecular organization of five species of genus Channa were analyzed in the present study. Molecular analyses revealed several variants of 5S rDNA repeats (four types of NTS) and networks created by a neighbor net algorithm for each type of sequences (I, II, III and IV) did not show a clear clustering in species specific manner. The stable secondary structure is predicted and upstream and downstream conserved regulatory elements were characterized. Sequence analyses also shown the presence of two putative pseudogenes in Channa marulius. Present study supported that 5S rDNA repeats in genus Channa were evolved under the process of birth-and-death.

  15. Isolation of a polyphenol oxidase (PPO) cDNA from artichoke and expression analysis in wounded artichoke heads.

    PubMed

    Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo

    2013-07-01

    The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  16. Phylogenetic relations of humans and African apes from DNA sequences in the Psi eta-globin region

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miyamoto, M.M.; Slightom, J.L.; Goodman, M.

    Sequences from the upstream and downstream flanking DNA regions of the Psi eta-globin locus in Pan troglodytes (common chimpanzee), Gorilla gorilla (gorilla), and Pongo pygmaeus (orangutan, the closest living relative to Homo, Pan, and Gorilla) provided further data for evaluating the phylogenetic relations of humans and African apes. These newly sequenced orthologs (an additional 4.9 kilobase pairs (kbp) for each species) were combined with published Psi eta-gene sequences and then compared to the same orthologous stretch (a continuous 7.1-kbp region) available for humans. Phylogenetic analysis of these nucleotide sequences by the parsimony method indicated (i) that human and chimpanzee aremore » more closely related to each other than either is to gorilla and (ii) that the slowdown in the rate of sequence evolution evident in higher primates is especially pronounced in humans. These results indicate that features unique to African apes (but not to humans) are primitive and that even local molecular clocks should be applied with caution.« less

  17. Characterization of the Campylobacter jejuni cryptic plasmid pTIW94 recovered from wild birds in the southeastern United States.

    PubMed

    Hiett, Kelli L; Rothrock, Michael J; Seal, Bruce S

    2013-09-01

    The complete nucleotide sequence was determined for a cryptic plasmid, pTIW94, recovered from several Campylobacter jejuni isolates from wild birds in the southeastern United States. pTIW94 is a circular molecule of 3860 nucleotides, with a G+C content (31.0%) similar to that of many Campylobacter spp. genomes. A typical origin of replication, with iteron sequences, was identified upstream of DNA sequences that demonstrated similarity to replication initiation proteins. A total of five open reading frames (ORFs) were identified; two of the five ORFs demonstrated significant similarity to plasmid pCC2228-2 found within Campylobacter coli. These two ORFs were similar to essential replication proteins RepA (100%; 26/26 aa identity) and RepB (95%; 327/346 aa identity). A third identified ORF demonstrated significant similarity (99%; 421/424 aa identity) to the MOB protein from C. coli 67-8, originally recovered from swine. The other two identified ORFs were either similar to hypothetical proteins from other Campylobacter spp., or exhibited no significant similarity to any DNA or protein sequence in the GenBank database. Promoter regions (-35 and -10 signal sites), ribosomal binding sites upstream of ORFs, and stem-loop structures were also identified within the plasmid. These results demonstrate that pTIW94 represents a previously un-reported small cryptic plasmid with unique sequences as well as highly similar sequences to other small plasmids found within Campylobacter spp., and that this cryptic plasmid is present among Campylobacter spp. recovered from different genera of wild birds. Copyright © 2013. Published by Elsevier Inc.

  18. DNA Sequence Variants in the Five Prime Untranslated Region of the Cyclooxygenase-2 Gene Are Commonly Found in Healthy Dogs and Gray Wolves.

    PubMed

    Safra, Noa; Hayward, Louisa J; Aguilar, Miriam; Sacks, Benjamin N; Westropp, Jodi L; Mohr, F Charles; Mellersh, Cathryn S; Bannasch, Danika L

    2015-01-01

    The aim of this study was to investigate the frequency of regional DNA variants upstream to the translation initiation site of the canine Cyclooxygenase-2 (Cox-2) gene in healthy dogs. Cox-2 plays a role in various disease conditions such as acute and chronic inflammation, osteoarthritis and malignancy. A role for Cox-2 DNA variants in genetic predisposition to canine renal dysplasia has been proposed and dog breeders have been encouraged to select against these DNA variants. We sequenced 272-422 bases in 152 dogs unaffected by renal dysplasia and found 19 different haplotypes including 11 genetic variants which had not been described previously. We genotyped 7 gray wolves to ascertain the wildtype variant and found that the wolves we analyzed had predominantly the second most common DNA variant found in dogs. Our results demonstrate an elevated level of regional polymorphism that appears to be a feature of healthy domesticated dogs.

  19. Familial 46,XY sex reversal without campomelic dysplasia caused by a deletion upstream of the SOX9 gene

    PubMed Central

    Layman, Lawrence C.; Ullmann, Reinhard; Shen, Yiping; Ha, Kyungsoo; Rehman, Khurram; Looney, Stephen; McDonough, Paul G.; Kim, Hyung-Goo; Carr, Bruce R.

    2014-01-01

    Background 46,XY sex reversal is a rare disorder and familial cases are even more rare. The purpose of the present study was to determine the molecular basis for a family with three affected siblings who had 46,XY sex reversal. Methods DNA was extracted from three females with 46,XY sex reversal, two normal sisters, and both unaffected parents. All protein coding exons of the SRY and NR5A1 genes were subjected to PCR-based DNA sequencing. In addition, array comparative genomic hybridization was performed on DNA from all seven family members. A deletion was confirmed using quantitative polymerase chain reaction. Expression of SOX9 gene was quantified using reverse transcriptase polymerase chain reaction. Results A 349kb heterozygous deletion located 353kb upstream of the SOX9 gene on the long arm of chromosome 17 was discovered in the father and three affected siblings, but not in the mother. The expression of SOX9 was significantly decreased in the affected siblings. Two of three affected sisters had gonadoblastomas. Conclusion This is the first report of 46,XY sex reversal in three siblings who have a paternally inherited deletion upstream of SOX9 associated with reduced SOX9 mRNA expression. PMID:24907458

  20. Dissecting transcription-coupled and global genomic repair in the chromatin of yeast GAL1-10 genes.

    PubMed

    Li, Shisheng; Smerdon, Michael J

    2004-04-02

    Transcription-coupled repair (TCR) and global genomic repair (GGR) of UV-induced cyclobutane pyrimidine dimers were investigated in the yeast GAL1-10 genes. Both Rpb9- and Rad26-mediated TCR are confined to the transcribed strands, initiating at upstream sites approximately 100 nucleotides from the upstream activating sequence shared by the two genes. However, TCR initiation sites do not correlate with either transcription start sites or TATA boxes. Rad16-mediated GGR tightly correlates with nucleosome positioning when the genes are repressed and are slow in the nucleosome core and fast in linker DNA. Induction of transcription enhanced GGR in nucleosome core DNA, especially in the nucleosomes around and upstream of the transcription start sites. Furthermore, when the genes were induced, GGR was slower in the transcribed regions than in the upstream regions. Finally, simultaneous deletion of RAD16, RAD26, and RPB9 resulted in no detectable repair in all sites along the region analyzed. Our results suggest that (a). TCR may be initiated by a transcription activator, presumably through the loading of RNA polymerase II, rather than by transcription initiation or elongation per se; (b). TCR and nucleosome disruption-enhanced GGR are the major causes of rapid repair in regions around and upstream of transcription start sites; (c). transcription machinery may hinder access of NER factors to a DNA lesion in the absence of a transcription-repair coupling factor; and (d). other than GGR mediated by Rad16 and TCR mediated by Rad26 and Rpb9, no other nucleotide excision repair pathway exists in these RNA polymerase II-transcribed genes.

  1. Role of UME6 in transcriptional regulation of a DNA repair gene in Saccharomyces cerevisiae.

    PubMed

    Sweet, D H; Jang, Y K; Sancar, G B

    1997-11-01

    In Saccharomyces cerevisiae UV radiation and a variety of chemical DNA-damaging agents induce the transcription of specific genes, including several involved in DNA repair. One of the best characterized of these genes is PHR1, which encodes the apoenzyme for DNA photolyase. Basal-level and damage-induced expression of PHR1 require an upstream activation sequence, UAS(PHR1), which has homology with DRC elements found upstream of at least 19 other DNA repair and DNA metabolism genes in yeast. Here we report the identification of the UME6 gene of S. cerevisiae as a regulator of UAS(PHR1) activity. Multiple copies of UME6 stimulate expression from UAS(PHR1) and the intact PHR1 gene. Surprisingly, the effect of deletion of UME6 is growth phase dependent. In wild-type cells PHR1 is induced in late exponential phase, concomitant with the initiation of glycogen accumulation that precedes the diauxic shift. Deletion of UME6 abolishes this induction, decreases the steady-state concentration of photolyase molecules and PHR1 mRNA, and increases the UV sensitivity of a rad2 mutant. Despite the fact that UAS(PHR1) does not contain the URS1 sequence, which has been previously implicated in UME6-mediated transcriptional regulation, we find that Ume6p binds to UAS(PHR1) with an affinity and a specificity similar to those seen for a URS1 site. Similar binding is also seen for DRC elements from RAD2, RAD7, and RAD53, suggesting that UME6 contributes to the regulated expression of a subset of damage-responsive genes in yeast.

  2. Preferential cleavage sites for Sau3A restriction endonuclease in human ribosomal DNA.

    PubMed

    Kupriyanova, N S; Kirilenko, P M; Netchvolodov, K K; Ryskov, A P

    2000-07-21

    Previous studies of cloned ribosomal DNA (rDNA) variants isolated from the cosmid library of human chromosome 13 have revealed some disproportion in representativity of different rDNA regions (N. S. Kupriyanova, K. K. Netchvolodov, P. M. Kirilenko, B. I. Kapanadze, N. K. Yankovsky, and A. P. Ryskov, Mol. Biol. 30, 51-60, 1996). Here we show nonrandom cleavage of human rDNA with Sau3A or its isoshizomer MboI under mild hydrolysis conditions. The hypersensitive cleavage sites were found to be located in the ribosomal intergenic spacer (rIGS), especially in the regions of about 5-5.5 and 11 kb upstream of the rRNA transcription start point. This finding is based on sequencing mapping of the rDNA insert ends in randomly selected cosmid clones of human chromosome 13 and on the data of digestion kinetics of cloned and noncloned human genomic rDNA with Sau3A and MboI. The results show that a methylation status and superhelicity state of the rIGS have no effect on cleavage site sensitivity. It is interesting that all primary cleavage sites are adjacent to or entering into Alu or Psi cdc 27 retroposons of the rIGS suggesting a possible role of neighboring sequences in nuclease accessibility. The results explain nonequal representation of rDNA sequences in the human genomic DNA library used for this study. Copyright 2000 Academic Press.

  3. Sequences in the intergenic spacer influence RNA Pol I transcription from the human rRNA promoter

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, W.M.; Sylvester, J.E.

    1994-09-01

    In most eucaryotic species, ribosomal genes are tandemly repeated about 100-5000 times per haploid genome. The 43 Kb human rDNA repeat consists of a 13 Kb coding region for the 18S, 5.8S, 28S ribosomal RNAs (rRNAs) and transcribed spacers separated by a 30 Kb intergenic spacer. For species such as frog, mouse and rat, sequences in the intergenic spacer other than the gene promoter have been shown to modulate transcription of the ribosomal gene. These sequences are spacer promoters, enhancers and the terminator for spacer transcription. We are addressing whether the human ribosomal gene promoter is similarly influenced. In-vitro transcriptionmore » run-off assays have revealed that the 4.5 kb region (CBE), directly upstream of the gene promoter, has cis-stimulation and trans-competition properties. This suggests that the CBE fragment contains an enhancer(s) for ribosomal gene transcription. Further experiments have shown that a fragment ({approximately}1.6 kb) within the CBE fragment also has trans-competition function. Deletion subclones of this region are being tested to delineate the exact sequences responsible for these modulating activities. Previous sequence analysis and functional studies have revealed that CBE contains regions of DNA capable of adopting alternative structures such as bent DNA, Z-DNA, and triple-stranded DNA. Whether these structures are required for modulating transcription remains to be determined as does the specific DNA-protein interaction involved.« less

  4. Analysis of the regulatory region of the protease III (ptr) gene of Escherichia coli K-12.

    PubMed

    Claverie-Martin, F; Diaz-Torres, M R; Kushner, S R

    1987-01-01

    The ptr gene of Escherichia coli encodes protease III (Mr 110,000) and a 50-kDa polypeptide, both of which are found in the periplasmic space. The gene is physically located between the recC and recB loci on the E. coli chromosome. The nucleotide sequence of a 1167-bp EcoRV-ClaI fragment of chromosomal DNA containing the promoter region and 885 bp of the ptr coding sequence has been determined. S1 nuclease mapping analysis showed that the major 5' end of the ptr mRNA was localized 127 bp upstream from the ATG start codon. The open reading frame (ORF), preceded by a Shine-Dalgarno sequence, extends to the end of the sequenced DNA. Downstream from the -35 and -10 regions is a sequence that strongly fits the consensus sequence of known nitrogen-regulated promoters. A signal peptide of 23 amino acids residues is present at the N terminus of the derived amino acid sequence. The cleavage site as well as the ORF were confirmed by sequencing the N terminus of mature protease III.

  5. Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection.

    PubMed

    Perina, Alejandra; Seoane, David; González-Tizón, Ana M; Rodríguez-Fariña, Fernanda; Martínez-Lage, Andrés

    2011-10-17

    The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection.

  6. Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection

    PubMed Central

    2011-01-01

    Background The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. Results The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. Conclusions These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection. PMID:22004418

  7. Interaction of the alpha-subunit of Escherichia coli RNA polymerase with DNA: rigid body nature of the protein-DNA contact.

    PubMed

    Heyduk, E; Baichoo, N; Heyduk, T

    2001-11-30

    The alpha-subunit of Escherichia coli RNA polymerase plays an important role in the activity of many promoters by providing a direct protein-DNA contact with a specific sequence (UP element) located upstream of the core promoter sequence. To obtain insight into the nature of thermodynamic forces involved in the formation of this protein-DNA contact, the binding of the alpha-subunit of E. coli RNA polymerase to a fluorochrome-labeled DNA fragment containing the rrnB P1 promoter UP element sequence was quantitatively studied using fluorescence polarization. The alpha dimer and DNA formed a 1:1 complex in solution. Complex formation at 25 degrees C was enthalpy-driven, the binding was accompanied by a net release of 1-2 ions, and no significant specific ion effects were observed. The van't Hoff plot of temperature dependence of binding was linear suggesting that the heat capacity change (Deltac(p)) was close to zero. Protein footprinting with hydroxyradicals showed that the protein did not change its conformation upon protein-DNA contact formation. No conformational changes in the DNA molecule were detected by CD spectroscopy upon protein-DNA complex formation. The thermodynamic characteristics of the binding together with the lack of significant conformational changes in the protein and in the DNA suggested that the alpha-subunit formed a rigid body-like contact with the DNA in which a tight complementary recognition interface between alpha-subunit and DNA was not formed.

  8. Spliced RNA of woodchuck hepatitis virus.

    PubMed

    Ogston, C W; Razman, D G

    1992-07-01

    Polymerase chain reaction was used to investigate RNA splicing in liver of woodchucks infected with woodchuck hepatitis virus (WHV). Two spliced species were detected, and the splice junctions were sequenced. The larger spliced RNA has an intron of 1300 nucleotides, and the smaller spliced sequence shows an additional downstream intron of 1104 nucleotides. We did not detect singly spliced sequences from which the smaller intron alone was removed. Control experiments showed that spliced sequences are present in both RNA and DNA in infected liver, showing that the viral reverse transcriptase can use spliced RNA as template. Spliced sequences were detected also in virion DNA prepared from serum. The upstream intron produces a reading frame that fuses the core to the polymerase polypeptide, while the downstream intron causes an inframe deletion in the polymerase open reading frame. Whereas the splicing patterns in WHV are superficially similar to those reported recently in hepatitis B virus, we detected no obvious homology in the coding capacity of spliced RNAs from these two viruses.

  9. Expression of the Pasteurella haemolytica leukotoxin is inhibited by a locus that encodes an ATP-binding cassette homolog.

    PubMed Central

    Highlander, S K; Wickersham, E A; Garza, O; Weinstock, G M

    1993-01-01

    Multicopy and single-copy chromosomal fusions between the Pasteurella haemolytica leukotoxin regulatory region and the Escherichia coli beta-galactosidase gene have been constructed. These fusions were used as reporters to identify and isolate regulators of leukotoxin expression from a P. haemolytica cosmid library. A cosmid clone, which inhibited leukotoxin expression from multicopy and single-copy protein fusions, was isolated and found to contain the complete leukotoxin gene cluster plus additional upstream sequences. The locus responsible for inhibition of expression from leukotoxin-beta-galactosidase fusions was mapped within these upstream sequences, by transposon mutagenesis with Tn5, and its DNA sequence was determined. The inhibitory activity was found to be associated with a predicted 440-amino-acid reading frame (lapA) that lies within a four-gene arginine transport locus. LapA is predicted to be the nucleotide-binding component of this transport system and shares homology with the Clp family of proteases. Images PMID:8359916

  10. LuFLA1PRO and LuBGAL1PRO promote gene expression in the phloem fibres of flax (Linum usitatissimum).

    PubMed

    Hobson, Neil; Deyholos, Michael K

    2013-04-01

    Cell type-specific promoters were identified that drive gene expression in an industrially important product. To identify flax (Linum usitatissimum) gene promoters, we analyzed the genomic regions upstream of a fasciclin-like arabinogalactan protein (LuFLA1) and a beta-galactosidase (LuBGAL1). Both of these genes encode transcripts that have been found to be highly enriched in tissues bearing phloem fibres. Using a beta-glucuronidase (GUS) reporter construct, we found that a 908-bp genomic sequence upstream of LuFLA1 (LuFLA1PRO) directed GUS expression with high specificity to phloem fibres undergoing secondary cell wall development. The DNA sequence upstream of LuBGAL1 (LuBGAL1PRO) likewise produced GUS staining in phloem fibres with developing secondary walls, as well as in tissues of developing flowers and seed bolls. These data provide further evidence of a specific role for LuFLA1 in phloem fibre development, and demonstrate the utility of LuFLA1PRO and LuBGAL1PRO as tools for biotechnology and further investigations of phloem fibre development.

  11. Avoidance of truncated proteins from unintended ribosome binding sites within heterologous protein coding sequences.

    PubMed

    Whitaker, Weston R; Lee, Hanson; Arkin, Adam P; Dueber, John E

    2015-03-20

    Genetic sequences ported into non-native hosts for synthetic biology applications can gain unexpected properties. In this study, we explored sequences functioning as ribosome binding sites (RBSs) within protein coding DNA sequences (CDSs) that cause internal translation, resulting in truncated proteins. Genome-wide prediction of bacterial RBSs, based on biophysical calculations employed by the RBS calculator, suggests a selection against internal RBSs within CDSs in Escherichia coli, but not those in Saccharomyces cerevisiae. Based on these calculations, silent mutations aimed at removing internal RBSs can effectively reduce truncation products from internal translation. However, a solution for complete elimination of internal translation initiation is not always feasible due to constraints of available coding sequences. Fluorescence assays and Western blot analysis showed that in genes with internal RBSs, increasing the strength of the intended upstream RBS had little influence on the internal translation strength. Another strategy to minimize truncated products from an internal RBS is to increase the relative strength of the upstream RBS with a concomitant reduction in promoter strength to achieve the same protein expression level. Unfortunately, lower transcription levels result in increased noise at the single cell level due to stochasticity in gene expression. At the low expression regimes desired for many synthetic biology applications, this problem becomes particularly pronounced. We found that balancing promoter strengths and upstream RBS strengths to intermediate levels can achieve the target protein concentration while avoiding both excessive noise and truncated protein.

  12. Brownian dynamics simulations of sequence-dependent duplex denaturation in dynamically superhelical DNA

    NASA Astrophysics Data System (ADS)

    Mielke, Steven P.; Grønbech-Jensen, Niels; Krishnan, V. V.; Fink, William H.; Benham, Craig J.

    2005-09-01

    The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.

  13. Brownian dynamics simulations of sequence-dependent duplex denaturation in dynamically superhelical DNA.

    PubMed

    Mielke, Steven P; Grønbech-Jensen, Niels; Krishnan, V V; Fink, William H; Benham, Craig J

    2005-09-22

    The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.

  14. Temporal and Spatial Expression of a Polygalacturonase during Leaf and Flower Abscission in Oilseed Rape and Arabidopsis1

    PubMed Central

    González-Carranza, Zinnia Haydé; Whitelaw, Catherine Ann; Swarup, Ranjan; Roberts, Jeremy Alan

    2002-01-01

    During leaf abscission in oilseed rape (Brassica napus), cell wall degradation is brought about by the action of several hydrolytic enzymes. One of these is thought to be polygalacturonase (PG). Degenerate primers were used to isolate a PG cDNA fragment by reverse transcriptase-polymerase chain reaction from RNA extracted from ethylene-promoted leaf abscission zones (AZs), and in turn a full-length clone (CAW471) from an oilseed rape AZ cDNA library. The highest homology of this cDNA (82%) was to an Arabidopsis sequence that was predicted to encode a PG protein. Analysis of expression revealed that CAW471 mRNA accumulated in the AZ of leaves and reached a peak 24 h after ethylene treatment. Ethylene-promoted leaf abscission in oilseed rape was not apparent until 42 h after exposure to the gas, reaching 50% at 48 h and 100% by 56 h. In floral organ abscission, expression of CAW471 correlated with cell separation. Genomic libraries from oilseed rape and Arabidopsis were screened with CAW471 and the respective genomic clones PGAZBRAN and PGAZAT isolated. Characterization of these PG genes revealed that they had substantial homology within both the coding regions and in the 5′-upstream sequences. Fusion of a 1,476-bp 5′-upstream sequence of PGAZAT to β-glucuronidase or green fluorescent protein and transformation of Arabidopsis revealed that this fragment was sufficient to drive expression of these reporter genes in the AZs at the base of the anther filaments, petals, and sepals. PMID:11842157

  15. DNA sequence analysis of the photosynthesis region of Rhodobacter sphaeroides 2.4.1.

    PubMed

    Choudhary, M; Kaplan, S

    2000-02-15

    This paper describes the DNA sequence of the photosynthesis region of Rhodobacter sphaeroides 2.4.1 (T). The photosynthesis gene cluster is located within a approximately 73 kb Ase I genomic DNA fragment containing the puf, puhA, cycA and puc operons. A total of 65 open reading frames (ORFs) have been identified, of which 61 showed significant similarity to genes/proteins of other organisms while only four did not reveal any significant sequence similarity to any gene/protein sequences in the database. The data were compared with the corresponding genes/ORFs from a different strain of R.sphaeroides and Rhodobacter capsulatus, a close relative of R. sphaeroides. A detailed analysis of the gene organization in the photosynthesis region revealed a similar gene order in both species with some notable differences located to the pucBAC = cycA region. In addition, photosynthesis gene regulatory protein (PpsR, FNR, IHF) binding motifs in upstream sequences of a number of photosynthesis genes have been identified and shown to differ between these two species. The difference in gene organization relative to pucBAC and cycA suggests that this region originated independently of the photosynthesis gene cluster of R.sphaeroides.

  16. Investigation of DNA sequence recognition by a streptomycete MarR family transcriptional regulator through surface plasmon resonance and X-ray crystallography

    PubMed Central

    Stevenson, Clare E. M.; Assaad, Aoun; Chandra, Govind; Le, Tung B. K.; Greive, Sandra J.; Bibb, Mervyn J.; Lawson, David M.

    2013-01-01

    Consistent with their complex lifestyles and rich secondary metabolite profiles, the genomes of streptomycetes encode a plethora of transcription factors, the vast majority of which are uncharacterized. Herein, we use Surface Plasmon Resonance (SPR) to identify and delineate putative operator sites for SCO3205, a MarR family transcriptional regulator from Streptomyces coelicolor that is well represented in sequenced actinomycete genomes. In particular, we use a novel SPR footprinting approach that exploits indirect ligand capture to vastly extend the lifetime of a standard streptavidin SPR chip. We define two operator sites upstream of sco3205 and a pseudopalindromic consensus sequence derived from these enables further potential operator sites to be identified in the S. coelicolor genome. We evaluate each of these through SPR and test the importance of the conserved bases within the consensus sequence. Informed by these results, we determine the crystal structure of a SCO3205-DNA complex at 2.8 Å resolution, enabling molecular level rationalization of the SPR data. Taken together, our observations support a DNA recognition mechanism involving both direct and indirect sequence readout. PMID:23748564

  17. Isolation of a gene (pbsC) required for siderophore biosynthesis in fluorescent Pseudomonas sp. strain M114.

    PubMed

    Adams, C; Dowling, D N; O'Sullivan, D J; O'Gara, F

    1994-06-03

    An iron-regulated gene, pbsC, required for siderophore production in fluorescent Pseudomonas sp. strain M114 has been identified. A kanamycin-resistance cassette was inserted at specific restriction sites within a 7 kb genomic fragment of M114 DNA and by marker exchange two siderophore-negative mutants, designated M1 and M2, were isolated. The nucleotide sequence of approximately 4 kb of the region flanking the insertion sites was determined and a large open reading frame (ORF) extending for 2409 bp was identified. This gene was designated pbsC (pseudobactin synthesis C) and its putative protein product termed PbsC. PbsC was found to be homologous to a family of enzymes involved in the biosynthesis of secondary metabolites, including EntF of Escherichia coli. These enzymes are believed to act via ATP-dependent binding of AMP to their substrate. Several areas of high sequence homology between these proteins and PbsC were observed, including a conserved AMP-binding domain. The expression of pbsC is iron-regulated as revealed when a DNA fragment containing the upstream region was cloned in a promoter probe vector and conjugated into the wild-type strain, M114. The nucleotide sequence upstream of the putative translational start site contains a region homologous to previously defined -16 to -25 sequences of iron-regulated genes but did not contain an iron-box consensus sequence. It was noted that inactivation of the pbsC gene also affected other iron-regulated phenotypes of Pseudomonas M114.

  18. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

    PubMed

    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

    2009-11-23

    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

  19. Target Site Recognition by a Diversity-Generating Retroelement

    PubMed Central

    Guo, Huatao; Tse, Longping V.; Nieh, Angela W.; Czornyj, Elizabeth; Williams, Steven; Oukil, Sabrina; Liu, Vincent B.; Miller, Jeff F.

    2011-01-01

    Diversity-generating retroelements (DGRs) are in vivo sequence diversification machines that are widely distributed in bacterial, phage, and plasmid genomes. They function to introduce vast amounts of targeted diversity into protein-encoding DNA sequences via mutagenic homing. Adenine residues are converted to random nucleotides in a retrotransposition process from a donor template repeat (TR) to a recipient variable repeat (VR). Using the Bordetella bacteriophage BPP-1 element as a prototype, we have characterized requirements for DGR target site function. Although sequences upstream of VR are dispensable, a 24 bp sequence immediately downstream of VR, which contains short inverted repeats, is required for efficient retrohoming. The inverted repeats form a hairpin or cruciform structure and mutational analysis demonstrated that, while the structure of the stem is important, its sequence can vary. In contrast, the loop has a sequence-dependent function. Structure-specific nuclease digestion confirmed the existence of a DNA hairpin/cruciform, and marker coconversion assays demonstrated that it influences the efficiency, but not the site of cDNA integration. Comparisons with other phage DGRs suggested that similar structures are a conserved feature of target sequences. Using a kanamycin resistance determinant as a reporter, we found that transplantation of the IMH and hairpin/cruciform-forming region was sufficient to target the DGR diversification machinery to a heterologous gene. In addition to furthering our understanding of DGR retrohoming, our results suggest that DGRs may provide unique tools for directed protein evolution via in vivo DNA diversification. PMID:22194701

  20. Modulation of tissue repair by regeneration enhancer elements.

    PubMed

    Kang, Junsu; Hu, Jianxin; Karra, Ravi; Dickson, Amy L; Tornini, Valerie A; Nachtrab, Gregory; Gemberling, Matthew; Goldman, Joseph A; Black, Brian L; Poss, Kenneth D

    2016-04-14

    How tissue regeneration programs are triggered by injury has received limited research attention. Here we investigate the existence of enhancer regulatory elements that are activated in regenerating tissue. Transcriptomic analyses reveal that leptin b (lepb) is highly induced in regenerating hearts and fins of zebrafish. Epigenetic profiling identified a short DNA sequence element upstream and distal to lepb that acquires open chromatin marks during regeneration and enables injury-dependent expression from minimal promoters. This element could activate expression in injured neonatal mouse tissues and was divisible into tissue-specific modules sufficient for expression in regenerating zebrafish fins or hearts. Simple enhancer-effector transgenes employing lepb-linked sequences upstream of pro- or anti-regenerative factors controlled the efficacy of regeneration in zebrafish. Our findings provide evidence for 'tissue regeneration enhancer elements' (TREEs) that trigger gene expression in injury sites and can be engineered to modulate the regenerative potential of vertebrate organs.

  1. Tobacco chloroplast tRNALys(UUU) gene contains a 2.5-kilobase-pair intron: An open reading frame and a conserved boundary sequence in the intron

    PubMed Central

    Sugita, Mamoru; Shinozaki, Kazuo; Sugiura, Masahiro

    1985-01-01

    The nucleotide sequence of a tRNALys(UUU) gene on tobacco (Nicotiana tabacum) chloroplast DNA has been determined. This gene is located 215 base pairs upstream from the gene for the 32,000-dalton thylakoid membrane protein on the same DNA strand and has a 2526-base-pair intron in the anticodon loop. The intron boundary sequence does not follow the G-U/A-G rule but is similar to those of tobacco chloroplast split genes for tRNAGly(UCC) and ribosomal proteins L2 and S12. The intron contains one major open reading frame of 509 codons. The codon usage in the open reading frame resembles those observed in the genes for tobacco chloroplast proteins so far analyzed. The primary transcript of this tRNA gene is 2.7 kilobases long. Images PMID:16593561

  2. Tobacco chloroplast tRNA(UUU) gene contains a 2.5-kilobase-pair intron: An open reading frame and a conserved boundary sequence in the intron.

    PubMed

    Sugita, M; Shinozaki, K; Sugiura, M

    1985-06-01

    The nucleotide sequence of a tRNA(Lys)(UUU) gene on tobacco (Nicotiana tabacum) chloroplast DNA has been determined. This gene is located 215 base pairs upstream from the gene for the 32,000-dalton thylakoid membrane protein on the same DNA strand and has a 2526-base-pair intron in the anticodon loop. The intron boundary sequence does not follow the G-U/A-G rule but is similar to those of tobacco chloroplast split genes for tRNA(Gly)(UCC) and ribosomal proteins L2 and S12. The intron contains one major open reading frame of 509 codons. The codon usage in the open reading frame resembles those observed in the genes for tobacco chloroplast proteins so far analyzed. The primary transcript of this tRNA gene is 2.7 kilobases long.

  3. DNA methylation inhibits expression and transposition of the Neurospora Tad retrotransposon.

    PubMed

    Zhou, Y; Cambareri, E B; Kinsey, J A

    2001-06-01

    Tad is a LINE-like retrotransposon of the filamentous fungus Neurospora crassa. We have analyzed both expression and transposition of this element using strains with a single copy of Tad located in the 5' noncoding sequences of the am (glutamate dehydrogenase) gene. Tad in this position has been shown to carry a de novo cytosine methylation signal which causes reversible methylation of both Tad and am upstream sequences. Here we find that methylation of the Tad sequences inhibits both Tad expression and transposition. This inhibition can be relieved by the use of 5-azacytidine, a drug which reduces cytosine methylation, or by placing the Tad/am sequences in a dim-2 genetic background.

  4. Association of Amine-Receptor DNA Sequence Variants with Associative Learning in the Honeybee.

    PubMed

    Lagisz, Malgorzata; Mercer, Alison R; de Mouzon, Charlotte; Santos, Luana L S; Nakagawa, Shinichi

    2016-03-01

    Octopamine- and dopamine-based neuromodulatory systems play a critical role in learning and learning-related behaviour in insects. To further our understanding of these systems and resulting phenotypes, we quantified DNA sequence variations at six loci coding octopamine-and dopamine-receptors and their association with aversive and appetitive learning traits in a population of honeybees. We identified 79 polymorphic sequence markers (mostly SNPs and a few insertions/deletions) located within or close to six candidate genes. Intriguingly, we found that levels of sequence variation in the protein-coding regions studied were low, indicating that sequence variation in the coding regions of receptor genes critical to learning and memory is strongly selected against. Non-coding and upstream regions of the same genes, however, were less conserved and sequence variations in these regions were weakly associated with between-individual differences in learning-related traits. While these associations do not directly imply a specific molecular mechanism, they suggest that the cross-talk between dopamine and octopamine signalling pathways may influence olfactory learning and memory in the honeybee.

  5. Genetic characterization of the UCS and Kex1 loci of Pneumocystis jirovecii.

    PubMed

    Esteves, F; Tavares, A; Costa, M C; Gaspar, J; Antunes, F; Matos, O

    2009-02-01

    Nucleotide variation in the Pneumocystis jirovecii upstream conserved sequence (UCS) and kexin-like serine protease (Kex1) loci was studied in pulmonary specimens from Portuguese HIV-positive patients. DNA was extracted and used for specific molecular sequence analysis. The number of UCS tandem repeats detected in 13 successfully sequenced isolates ranged from three (9 isolates, 69%) to four (4 isolates, 31%). A novel tandem repeat pattern and two novel polymorphisms were detected in the UCS region. For the Kex1 gene, the wild-type (24 isolates, 86%) was the most frequent sequence detected among the 28 sequenced isolates. Nevertheless, a nonsynonymous (1 isolate, 3%) and three synonymous (3 isolates, 11%) polymorphisms were detected and are described here for the first time.

  6. New insights into replication origin characteristics in metazoans

    PubMed Central

    Puy, Aurore; Rialle, Stéphanie; Kaplan, Noam; Segal, Eran

    2012-01-01

    We recently reported the identification and characterization of DNA replication origins (Oris) in metazoan cell lines. Here, we describe additional bioinformatic analyses showing that the previously identified GC-rich sequence elements form origin G-rich repeated elements (OGREs) that are present in 67% to 90% of the DNA replication origins from Drosophila to human cells, respectively. Our analyses also show that initiation of DNA synthesis takes place precisely at 160 bp (Drosophila) and 280 bp (mouse) from the OGRE. We also found that in most CpG islands, an OGRE is positioned in opposite orientation on each of the two DNA strands and detected two sites of initiation of DNA synthesis upstream or downstream of each OGRE. Conversely, Oris not associated with CpG islands have a single initiation site. OGRE density along chromosomes correlated with previously published replication timing data. Ori sequences centered on the OGRE are also predicted to have high intrinsic nucleosome occupancy. Finally, OGREs predict G-quadruplex structures at Oris that might be structural elements controlling the choice or activation of replication origins. PMID:22373526

  7. DNA sequences of three beta-1,4-endoglucanase genes from Thermomonospora fusca.

    PubMed Central

    Lao, G; Ghangas, G S; Jung, E D; Wilson, D B

    1991-01-01

    The DNA sequences of the Thermomonospora fusca genes encoding cellulases E2 and E5 and the N-terminal end of E4 were determined. Each sequence contains an identical 14-bp inverted repeat upstream of the initiation codon. There were no significant homologies between the coding regions of the three genes. The E2 gene is 73% identical to the celA gene from Microbispora bispora, but this was the only homology found with other cellulase genes. E2 belongs to a family of cellulases that includes celA from M. bispora, cenA from Cellulomonas fimi, casA from an alkalophilic Streptomyces strain, and cellobiohydrolase II from Trichoderma reesei. E4 shows 44% identity to an avocado cellulase, while E5 belongs to the Bacillus cellulase family. There were strong similarities between the amino acid sequences of the E2 and E5 cellulose binding domains, and these regions also showed homology with C. fimi and Pseudomonas fluorescens cellulose binding domains. PMID:1904434

  8. Proliferating cell nuclear antigen (Pcna) as a direct downstream target gene of Hoxc8

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Min, Hyehyun; Lee, Ji-Yeon; Bok, Jinwoong

    2010-02-19

    Hoxc8 is a member of Hox family transcription factors that play crucial roles in spatiotemporal body patterning during embryogenesis. Hox proteins contain a conserved 61 amino acid homeodomain, which is responsible for recognition and binding of the proteins onto Hox-specific DNA binding motifs and regulates expression of their target genes. Previously, using proteome analysis, we identified Proliferating cell nuclear antigen (Pcna) as one of the putative target genes of Hoxc8. Here, we asked whether Hoxc8 regulates Pcna expression by directly binding to the regulatory sequence of Pcna. In mouse embryos at embryonic day 11.5, the expression pattern of Pcna wasmore » similar to that of Hoxc8 along the anteroposterior body axis. Moreover, Pcna transcript levels as well as cell proliferation rate were increased by overexpression of Hoxc8 in C3H10T1/2 mouse embryonic fibroblast cells. Characterization of 2.3 kb genomic sequence upstream of Pcna coding region revealed that the upstream sequence contains several Hox core binding sequences and one Hox-Pbx binding sequence. Direct binding of Hoxc8 proteins to the Pcna regulatory sequence was verified by chromatin immunoprecipitation assay. Taken together, our data suggest that Pcna is a direct downstream target of Hoxc8.« less

  9. Sequence-length variation of mtDNA HVS-I C-stretch in Chinese ethnic groups.

    PubMed

    Chen, Feng; Dang, Yong-hui; Yan, Chun-xia; Liu, Yan-ling; Deng, Ya-jun; Fulton, David J R; Chen, Teng

    2009-10-01

    The purpose of this study was to investigate mitochondrial DNA (mtDNA) hypervariable segment-I (HVS-I) C-stretch variations and explore the significance of these variations in forensic and population genetics studies. The C-stretch sequence variation was studied in 919 unrelated individuals from 8 Chinese ethnic groups using both direct and clone sequencing approaches. Thirty eight C-stretch haplotypes were identified, and some novel and population specific haplotypes were also detected. The C-stretch genetic diversity (GD) values were relatively high, and probability (P) values were low. Additionally, C-stretch length heteroplasmy was observed in approximately 9% of individuals studied. There was a significant correlation (r=-0.961, P<0.01) between the expansion of the cytosine sequence length in the C-stretch of HVS-I and a reduction in the number of upstream adenines. These results indicate that the C-stretch could be a useful genetic maker in forensic identification of Chinese populations. The results from the Fst and dA genetic distance matrix, neighbor-joining tree, and principal component map also suggest that C-stretch could be used as a reliable genetic marker in population genetics.

  10. A purified transcription factor (TIF-IB) binds to essential sequences of the mouse rDNA promoter.

    PubMed Central

    Clos, J; Buttgereit, D; Grummt, I

    1986-01-01

    A transcription factor that is specific for mouse rDNA has been partially purified from Ehrlich ascites cells. This factor [designated transcription initiation factor (TIF)-IB] is required for accurate in vitro synthesis of mouse rRNA in addition to RNA polymerase I and another regulatory factor, TIF-IA. TIF-IB activity is present in extracts both from growing and nongrowing cells in comparable amounts. Prebinding competition experiments with wild-type and mutant templates suggest that TIF-IB interacts with the core control element of the rDNA promoter, which is located immediately upstream of the initiation site. The specific binding of TIF-IB to the RNA polymerase I promoter is demonstrated by exonuclease III protection experiments. The 3' border of the sequences protected by TIF-IB is shown to be on the coding strand at position -21 and on the noncoding strand at position -7. The results suggest that direct binding of TIF-IB to sequences in the core promoter element is the mechanism by which this factor imparts promoter selectivity to RNA polymerase I. Images PMID:3456157

  11. In and out of the rRNA genes: characterization of Pokey elements in the sequenced Daphnia genome

    PubMed Central

    2013-01-01

    Background Only a few transposable elements are known to exhibit site-specific insertion patterns, including the well-studied R-element retrotransposons that insert into specific sites within the multigene rDNA. The only known rDNA-specific DNA transposon, Pokey (superfamily: piggyBac) is found in the freshwater microcrustacean, Daphnia pulex. Here, we present a genome-wide analysis of Pokey based on the recently completed whole genome sequencing project for D. pulex. Results Phylogenetic analysis of Pokey elements recovered from the genome sequence revealed the presence of four lineages corresponding to two divergent autonomous families and two related lineages of non-autonomous miniature inverted repeat transposable elements (MITEs). The MITEs are also found at the same 28S rRNA gene insertion site as the Pokey elements, and appear to have arisen as deletion derivatives of autonomous elements. Several copies of the full-length Pokey elements may be capable of producing an active transposase. Surprisingly, both families of Pokey possess a series of 200 bp repeats upstream of the transposase that is derived from the rDNA intergenic spacer (IGS). The IGS sequences within the Pokey elements appear to be evolving in concert with the rDNA units. Finally, analysis of the insertion sites of Pokey elements outside of rDNA showed a target preference for sites similar to the specific sequence that is targeted within rDNA. Conclusions Based on the target site preference of Pokey elements and the concerted evolution of a segment of the element with the rDNA unit, we propose an evolutionary path by which the ancestors of Pokey elements have invaded the rDNA niche. We discuss how specificity for the rDNA unit may have evolved and how this specificity has played a role in the long-term survival of these elements in the subgenus Daphnia. PMID:24059783

  12. Regulation of expression of the ada gene controlling the adaptive response. Interactions with the ada promoter of the Ada protein and RNA polymerase.

    PubMed

    Sakumi, K; Sekiguchi, M

    1989-01-20

    The Ada protein of Escherichia coli catalyzes transfer of methyl groups from methylated DNA to its own molecule, and the methylated form of Ada protein promotes transcription of its own gene, ada. Using an in vitro reconstituted system, we found that both the sigma factor and the methylated Ada protein are required for transcription of the ada gene. To elucidate molecular mechanisms involved in the regulation of the ada transcription, we investigated interactions of the non-methylated and methylated forms of Ada protein and the RNA polymerase holo enzyme (the core enzyme and sigma factor) with a DNA fragment carrying the ada promoter region. Footprinting analyses revealed that the methylated Ada protein binds to a region from positions -63 to -31, which includes the ada regulatory sequence AAAGCGCA. No firm binding was observed with the non-methylated Ada protein, although some DNase I-hypersensitive sites were produced in the promoter by both types of Ada protein. RNA polymerase did bind to the promoter once the methylated Ada protein had bound to the upstream sequence. To correlate these phenomena with the process in vivo, we used the DNAs derived from promoter-defective mutants. No binding of Ada protein nor of RNA polymerase occurred with a mutant DNA having a C to G substitution at position -47 within the ada regulatory sequence. In the case of a -35 box mutant with a T to A change at position -34, the methylated Ada protein did bind to the ada regulatory sequence, yet there was no RNA polymerase binding. Thus, the binding of the methylated Ada protein to the upstream region apparently facilitates binding of the RNA polymerase to the proper region of the promoter. The Ada protein possesses two known methyl acceptor sites, Cys69 and Cys321. The role of methylation of each cysteine residue was investigated using mutant forms of the Ada protein. The Ada protein with the cysteine residue at position 69 replaced by alanine was incapable of binding to the ada promoter even when the cysteine residue at position 321 of the protein was methylated. When the Ada protein with alanine at position 321 was methylated, it acquired the potential to bind to the ada promoter. These results are compatible with the notion that methylation of the cysteine residue at position 69 causes a conformational change of the Ada protein, thereby facilitating binding of the protein to the upstream regulatory sequence.

  13. A variable DNA recognition site organization establishes the LiaR-mediated cell envelope stress response of enterococci to daptomycin

    DOE PAGES

    Davlieva, Milya; Shi, Yiwen; Leonard, Paul G.; ...

    2015-04-19

    LiaR is a ‘master regulator’ of the cell envelope stress response in enterococci and many other Gram-positive organisms. Mutations to liaR can lead to antibiotic resistance to a variety of antibiotics including the cyclic lipopeptide daptomycin. LiaR is phosphorylated in response to membrane stress to regulate downstream target operons. Using DNA footprinting of the regions upstream of the liaXYZ and liaFSR operons we show that LiaR binds an extended stretch of DNA that extends beyond the proposed canonical consensus sequence suggesting a more complex level of regulatory control of target operons. We go on to determine the biochemical and structuralmore » basis for increased resistance to daptomycin by the adaptive mutation to LiaR (D191N) first identified from the pathogen Enterococcus faecalis S613. LiaR D191N increases oligomerization of LiaR to form a constitutively activated tetramer that has high affinity for DNA even in the absence of phosphorylation leading to increased resistance. The crystal structures of the LiaR DNA binding domain complexed to the putative consensus sequence as well as an adjoining secondary sequence show that upon binding, LiaR induces DNA bending that is consistent with increased recruitment of RNA polymerase to the transcription start site and upregulation of target operons.« less

  14. Identification of a second flagellin gene and functional characterization of a sigma70-like promoter upstream of a Leptospira borgpetersenii flaB gene.

    PubMed

    Lin, Min; Dan, Hanhong; Li, Yijing

    2004-02-01

    Leptospira borgpetersenii, one of the causative agents of leptospirosis in both animals and humans, is a bacterial pathogen with characteristic motility that is mediated by the rotation of two periplasmic flagella (PF). The flaB gene coding for a core polypeptide subunit of PF was previously characterized by sequence analysis of its open reading frame (ORF) (M. Lin, J Biochem Mol Biol Biophys 2:181-187, 1999). The present study was undertaken to isolate and clone the uncharacterized sequence upstream of the flaB gene by using a PCR-based genome walking procedure. This has resulted in a 1470-bp genomic DNA sequence in which an 846-bp ORF coding for a 281-amino acid polypeptide (31.3 kDa) is identified 455 bp upstream from the flaB start codon. The encoded protein exhibits 72% amino acid identity to the deduced FlaB protein sequence of L. borgpetersenii and a high degree of sequence homology to the FlaB proteins of other spirochaetes. This has demonstrated for the first time that a second flaB gene homolog is present in a Leptospira species. The newly identified gene is designated flaB1, and the previously cloned flaB renamed flaB2. Within the intergenic sequence between flaB1 and flaB2, a potential stem-loop structure (12-bp inverted repeats) was identified 25 bp downstream of the flaB1 stop codon; this could serve as a transcription terminator for the flaB1 mRNA. Three E. coli-like promoter regions (I, II, and III) for binding Esigma(70), a regulatory sequence uncommonly found in flagellar genes, were predicted upstream of the flaB2 ORF. Only promoter region II contains a promoter that is functional in E. coli, as revealed at phenotypic and transcriptional levels by its capability of directing the expression of the chloramphenicol acetyltransferase (CAT) gene in the promoter probe vector pKK232-8. These observations may suggest that flaB1 and flaB2 are transcribed separately and do not form a transcriptional operon controlled by a single promoter.

  15. Robust Translation of the Nucleoid Protein Fis Requires a Remote Upstream AU Element and Is Enhanced by RNA Secondary Structure

    PubMed Central

    Nafissi, Maryam; Chau, Jeannette; Xu, Jimin

    2012-01-01

    Synthesis of the Fis nucleoid protein rapidly increases in response to nutrient upshifts, and Fis is one of the most abundant DNA binding proteins in Escherichia coli under nutrient-rich growth conditions. Previous work has shown that control of Fis synthesis occurs at transcription initiation of the dusB-fis operon. We show here that while translation of the dihydrouridine synthase gene dusB is low, unusual mechanisms operate to enable robust translation of fis. At least two RNA sequence elements located within the dusB coding region are responsible for high fis translation. The most important is an AU element centered 35 nucleotides (nt) upstream of the fis AUG, which may function as a binding site for ribosomal protein S1. In addition, a 44-nt segment located upstream of the AU element and predicted to form a stem-loop secondary structure plays a prominent role in enhancing fis translation. On the other hand, mutations close to the AUG, including over a potential Shine-Dalgarno sequence, have little effect on Fis protein levels. The AU element and stem-loop regions are phylogenetically conserved within dusB-fis operons of representative enteric bacteria. PMID:22389479

  16. Core histone genes of Giardia intestinalis: genomic organization, promoter structure, and expression

    PubMed Central

    Yee, Janet; Tang, Anita; Lau, Wei-Ling; Ritter, Heather; Delport, Dewald; Page, Melissa; Adam, Rodney D; Müller, Miklós; Wu, Gang

    2007-01-01

    Background Giardia intestinalis is a protist found in freshwaters worldwide, and is the most common cause of parasitic diarrhea in humans. The phylogenetic position of this parasite is still much debated. Histones are small, highly conserved proteins that associate tightly with DNA to form chromatin within the nucleus. There are two classes of core histone genes in higher eukaryotes: DNA replication-independent histones and DNA replication-dependent ones. Results We identified two copies each of the core histone H2a, H2b and H3 genes, and three copies of the H4 gene, at separate locations on chromosomes 3, 4 and 5 within the genome of Giardia intestinalis, but no gene encoding a H1 linker histone could be recognized. The copies of each gene share extensive DNA sequence identities throughout their coding and 5' noncoding regions, which suggests these copies have arisen from relatively recent gene duplications or gene conversions. The transcription start sites are at triplet A sequences 1–27 nucleotides upstream of the translation start codon for each gene. We determined that a 50 bp region upstream from the start of the histone H4 coding region is the minimal promoter, and a highly conserved 15 bp sequence called the histone motif (him) is essential for its activity. The Giardia core histone genes are constitutively expressed at approximately equivalent levels and their mRNAs are polyadenylated. Competition gel-shift experiments suggest that a factor within the protein complex that binds him may also be a part of the protein complexes that bind other promoter elements described previously in Giardia. Conclusion In contrast to other eukaryotes, the Giardia genome has only a single class of core histone genes that encode replication-independent histones. Our inability to locate a gene encoding the linker histone H1 leads us to speculate that the H1 protein may not be required for the compaction of Giardia's small and gene-rich genome. PMID:17425802

  17. Genomic Structure of the Luciferase Gene from the Bioluminescent Beetle, Nyctophila cf. Caucasica

    PubMed Central

    Day, John C.; Chaichi, Mohammad J.; Najafil, Iraj; Whiteley, Andrew S.

    2006-01-01

    The gene coding for beetle luciferase, the enzyme responsible for bioluminescence in over two thousand coleopteran species has, to date, only been characterized from one Palearctic species of Lampyridae. Here we report the characterization of the luciferase gene from a female beetle of an Iranian lampyrid species, Nyctophila cf. caucasica (Coleoptera:Lampyridae). The luciferase gene was composed of seven exons, coding for 547 amino acids, separated by six introns spanning 1976 bp of genomic DNA. The deduced amino acid sequences of the luciferase gene of N. caucasica showed 98.9% homology to that of the Palearctic species Lampyris noctiluca. Analysis of the 810 bp upstream region of the luciferase gene revealed three TATA boxes and several other consensus transcriptional factor recognition sequences presenting evidence for a putative core promoter region conserved in Lampyrinae from -190 through to -155 upstream of the luciferase start codon. Along with the core promoter region the luciferase gene was compared with orthologous sequences from other lampyrid species and found to have greatest identity to Lampyris turkistanicus and Lampyris noctiluca. The significant sequence identity to the former is discussed in relation to taxonomic issues of Iranian lampyrids. PMID:20298115

  18. Mutations that alter a conserved element upstream of the potato virus X triple block and coat protein genes affect subgenomic RNA accumulation.

    PubMed

    Kim, K H; Hemenway, C

    1997-05-26

    The putative subgenomic RNA (sgRNA) promoter regions upstream of the potato virus X (PVX) triple block and coat protein (CP) genes contain sequences common to other potexviruses. The importance of these sequences to PVX sgRNA accumulation was determined by inoculation of Nicotiana tabacum NT1 cell suspension protoplasts with transcripts derived from wild-type and modified PVX cDNA clones. Analyses of RNA accumulation by S1 nuclease digestion and primer extension indicated that a conserved octanucleotide sequence element and the spacing between this element and the start-site for sgRNA synthesis are critical for accumulation of the two major sgRNA species. The impact of mutations on CP sgRNA levels was also reflected in the accumulation of CP. In contrast, genomic minus- and plus-strand RNA accumulation were not significantly affected by mutations in these regions. Studies involving inoculation of tobacco plants with the modified transcripts suggested that the conserved octanucleotide element functions in sgRNA accumulation and some other aspect of the infection process.

  19. Detecting authorized and unauthorized genetically modified organisms containing vip3A by real-time PCR and next-generation sequencing.

    PubMed

    Liang, Chanjuan; van Dijk, Jeroen P; Scholtens, Ingrid M J; Staats, Martijn; Prins, Theo W; Voorhuijzen, Marleen M; da Silva, Andrea M; Arisi, Ana Carolina Maisonnave; den Dunnen, Johan T; Kok, Esther J

    2014-04-01

    The growing number of biotech crops with novel genetic elements increasingly complicates the detection of genetically modified organisms (GMOs) in food and feed samples using conventional screening methods. Unauthorized GMOs (UGMOs) in food and feed are currently identified through combining GMO element screening with sequencing the DNA flanking these elements. In this study, a specific and sensitive qPCR assay was developed for vip3A element detection based on the vip3Aa20 coding sequences of the recently marketed MIR162 maize and COT102 cotton. Furthermore, SiteFinding-PCR in combination with Sanger, Illumina or Pacific BioSciences (PacBio) sequencing was performed targeting the flanking DNA of the vip3Aa20 element in MIR162. De novo assembly and Basic Local Alignment Search Tool searches were used to mimic UGMO identification. PacBio data resulted in relatively long contigs in the upstream (1,326 nucleotides (nt); 95 % identity) and downstream (1,135 nt; 92 % identity) regions, whereas Illumina data resulted in two smaller contigs of 858 and 1,038 nt with higher sequence identity (>99 % identity). Both approaches outperformed Sanger sequencing, underlining the potential for next-generation sequencing in UGMO identification.

  20. Genomic sequences of murine gamma B- and gamma C-crystallin-encoding genes: promoter analysis and complete evolutionary pattern of mouse, rat and human gamma-crystallins.

    PubMed

    Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T

    1993-12-22

    The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.

  1. Coupled transcription and processing of mouse ribosomal RNA in a cell-free system.

    PubMed Central

    Mishima, Y; Mitsuma, T; Ogata, K

    1985-01-01

    An in vitro processing system of mouse rRNA was achieved using an RNA polymerase I-specific transcription system, (S100) and recombinant plasmids consisting of mouse rRNA gene (rDNA) segments containing the transcription initiation and 5'-terminal region of 18S (or 41S) rRNA. Pulse-chase experiments showed that a specific processing occurred with transcripts of the plasmid DNAs when the direction of transcription was the correct orientation relative to the 18S rRNA coding sequence, but not with transcripts of the DNA templates in which this coding sequence was in the opposite orientation. From the S1 nuclease protection analyses, we concluded that there are several steps of endonucleolytic cleavage including one 105 nucleotides upstream from the 5' end of 18S rRNA. Intermediates cleaved at this site were identified in in vivo processing of rRNA. This result indicates that endonucleolytic cleavage takes place 105 nucleotides upstream from the 5' terminus of 18S rRNA prior to the formation of mature 18S rRNA. Trimming or cleavage of the 105 nucleotides may be involved in the formation of the 5' terminus of mature 18S rRNA. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:3004977

  2. Structure of the human gene encoding the protein repair L-isoaspartyl (D-aspartyl) O-methyltransferase.

    PubMed

    DeVry, C G; Tsai, W; Clarke, S

    1996-11-15

    The protein L-isoaspartyl/D-aspartyl O-methyltransferase (EC 2.1.1.77) catalyzes the first step in the repair of proteins damaged in the aging process by isomerization or racemization reactions at aspartyl and asparaginyl residues. A single gene has been localized to human chromosome 6 and multiple transcripts arising through alternative splicing have been identified. Restriction enzyme mapping, subcloning, and DNA sequence analysis of three overlapping clones from a human genomic library in bacteriophage P1 indicate that the gene spans approximately 60 kb and is composed of 8 exons interrupted by 7 introns. Analysis of intron/exon splice junctions reveals that all of the donor and acceptor splice sites are in agreement with the mammalian consensus splicing sequence. Determination of transcription initiation sites by primer extension analysis of poly(A)+ mRNA from human brain identifies multiple start sites, with a major site 159 nucleotides upstream from the ATG start codon. Sequence analysis of the 5'-untranslated region demonstrates several potential cis-acting DNA elements including SP1, ETF, AP1, AP2, ARE, XRE, CREB, MED-1, and half-palindromic ERE motifs. The promoter of this methyltransferase gene lacks an identifiable TATA box but is characterized by a CpG island which begins approximately 723 nucleotides upstream of the major transcriptional start site and extends through exon 1 and into the first intron. These features are characteristic of housekeeping genes and are consistent with the wide tissue distribution observed for this methyltransferase activity.

  3. Organizational differences between cytoplasmic male sterile and male fertile Brassica mitochondrial genomes are confined to a single transposed locus.

    PubMed Central

    L'Homme, Y; Brown, G G

    1993-01-01

    Comparison of the physical maps of male fertile (cam) and male sterile (pol) mitochondrial genomes of Brassica napus indicates that structural differences between the two mtDNAs are confined to a region immediately upstream of the atp6 gene. Relative to cam mtDNA, pol mtDNA possesses a 4.5 kb segment at this locus that includes a chimeric gene that is cotranscribed with atp6 and lacks an approximately 1kb region located upstream of the cam atp6 gene. The 4.5 kb pol segment is present and similarly organized in the mitochondrial genome of the common nap B.napus cytoplasm; however, the nap and pol DNA regions flanking this segment are different and the nap sequences are not expressed. The 4.5 kb CMS-associated pol segment has thus apparently undergone transposition during the evolution of the nap and pol cytoplasms and has been lost in the cam genome subsequent to the pol-cam divergence. This 4.5 kb segment comprises the single DNA region that is expressed differently in fertile, pol CMS and fertility restored pol cytoplasm plants. The finding that this locus is part of the single mtDNA region organized differently in the fertile and male sterile mitochondrial genomes provides strong support for the view that it specifies the pol CMS trait. Images PMID:8388101

  4. Identification of upstream and intragenic regulatory elements that confer cell-type-restricted and differentiation-specific expression on the muscle creatine kinase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sternberg, E.A.; Spizz, G.; Perry, W.M.

    1988-07-01

    Terminal differentiation of skeletal myobalsts is accompanied by induction of a series of tissue-specific gene products, which includes the muscle isoenzymte of creatine kinase (MCK). To begin to define the sequences and signals involved in MCK regulation in developing muscle cells, the mouse MCK gene has been isolated. Sequence analysis of 4,147 bases of DNA surrounding the transcription initiation site revealed several interesting structural features, some of which are common to other muscle-specific genes and to cellular and viral enhancers.

  5. The genetic basis of adaptive pigmentation variation in Drosophila melanogaster.

    PubMed

    Pool, John E; Aquadro, Charles F

    2007-07-01

    In a broad survey of Drosophila melanogaster population samples, levels of abdominal pigmentation were found to be highly variable and geographically differentiated. A strong positive correlation was found between dark pigmentation and high altitude, suggesting adaptation to specific environments. DNA sequence polymorphism at the candidate gene ebony revealed a clear association with the pigmentation of homozygous third chromosome lines. The darkest lines sequenced had nearly identical haplotypes spanning 14.5 kb upstream of the protein-coding exons of ebony. Thus, natural selection may have elevated the frequency of an allele that confers dark abdominal pigmentation by influencing the regulation of ebony.

  6. BplI, a new BcgI-like restriction endonuclease, which recognizes a symmetric sequence.

    PubMed Central

    Vitkute, J; Maneliene, Z; Petrusyte, M; Janulaitis, A

    1997-01-01

    Bcg I and Bcg I-like restriction endonucleases cleave double stranded DNA specifically on both sides of their asymmetric recognition sequences which are interrupted by several ambiguous base pairs. Their heterosubunit structure, bifunctionality and stimulation by AdoMet make them different from other classified restriction enzymes. Here we report on a new Bcg I-like restriction endonuclease, Bpl I from Bacillus pumilus , which in contrast to all other Bcg I-like enzymes, recognizes a symmetric interrupted sequence, and which, like Bcg I, cleaves double stranded DNA upstream and downstream of its recognition sequence (8/13)GAGN5CTC(13/8). Like Bcg I, Bpl I is a bifunctional enzyme revealing both DNA cleavage and methyltransferase activities. There are two polypeptides in the homogeneous preparation of Bpl I with molecular masses of approximately 74 and 37 kDa. The sizes of the Bpl I subunits are close to those of Bcg I, but the proportion 1:1 in the final preparation is different from that of 2:1 in Bcg I. Low activity observed with Mg2+increases >100-fold in the presence of AdoMet. Even with AdoMet though, specific cleavage is incomplete. S -adenosylhomocysteine (AdoHcy) or sinefungin can replace AdoMet in the cleavage reaction. AdoHcy activated Bpl I yields complete cleavage of DNA. PMID:9358150

  7. Analysis of LexA binding sites and transcriptomics in response to genotoxic stress in Leptospira interrogans.

    PubMed

    Schons-Fonseca, Luciane; da Silva, Josefa B; Milanez, Juliana S; Domingos, Renan H; Smith, Janet L; Nakaya, Helder I; Grossman, Alan D; Ho, Paulo L; da Costa, Renata M A

    2016-02-18

    We determined the effects of DNA damage caused by ultraviolet radiation on gene expression in Leptospira interrogans using DNA microarrays. These data were integrated with DNA binding in vivo of LexA1, a regulator of the DNA damage response, assessed by chromatin immunoprecipitation and massively parallel DNA sequencing (ChIP-seq). In response to DNA damage, Leptospira induced expression of genes involved in DNA metabolism, in mobile genetic elements and defective prophages. The DNA repair genes involved in removal of photo-damage (e.g. nucleotide excision repair uvrABC, recombinases recBCD and resolvases ruvABC) were not induced. Genes involved in various metabolic pathways were down regulated, including genes involved in cell growth, RNA metabolism and the tricarboxylic acid cycle. From ChIP-seq data, we observed 24 LexA1 binding sites located throughout chromosome 1 and one binding site in chromosome 2. Expression of many, but not all, genes near those sites was increased following DNA damage. Binding sites were found as far as 550 bp upstream from the start codon, or 1 kb into the coding sequence. Our findings indicate that there is a shift in gene expression following DNA damage that represses genes involved in cell growth and virulence, and induces genes involved in mutagenesis and recombination. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Yeast one-hybrid system used to identify the binding proteins for rat glutathione S-transferase P enhancer I.

    PubMed

    Liao, Ming-Xiang; Liu, Dong-Yuan; Zuo, Jin; Fang, Fu-De

    2002-03-01

    To detect the trans-factors specifically binding to the strong enhancer element (GPEI) in the upstream of rat glutathione S-transferase P (GST-P) gene. Yeast one-hybrid system was used to screen rat lung MATCHMAKER cDNA library to identify potential trans-factors that can interact with core sequence of GPEI(cGPEI). Electrophoresis mobility shift assay (EMSA) was used to analyze the binding of transfactors to cGPEI. cDNA fragments coding for the C-terminal part of the transcription factor c-Jun and rat adenine nucleotide translocator (ANT) were isolated. The binding of c-Jun and ANT to GPEI core sequence were confirmed. Rat c-jun transcriptional factor and ANT may interact with cGPEI. They could play an important role in the induced expression of GST-P gene.

  9. Overcoming a nucleosomal barrier to replication

    PubMed Central

    Chang, Han-Wen; Pandey, Manjula; Kulaeva, Olga I.; Patel, Smita S.; Studitsky, Vasily M.

    2016-01-01

    Efficient overcoming and accurate maintenance of chromatin structure and associated histone marks during DNA replication are essential for normal functioning of the daughter cells. However, the molecular mechanisms of replication through chromatin are unknown. We have studied traversal of uniquely positioned mononucleosomes by T7 replisome in vitro. Nucleosomes present a strong, sequence-dependent barrier for replication, with particularly strong pausing of DNA polymerase at the +(31–40) and +(41–65) regions of the nucleosomal DNA. The exonuclease activity of T7 DNA polymerase increases the overall rate of progression of the replisome through a nucleosome, likely by resolving nonproductive complexes. The presence of nucleosome-free DNA upstream of the replication fork facilitates the progression of DNA polymerase through the nucleosome. After replication, at least 50% of the nucleosomes assume an alternative conformation, maintaining their original positions on the DNA. Our data suggest a previously unpublished mechanism for nucleosome maintenance during replication, likely involving transient formation of an intranucleosomal DNA loop. PMID:27847876

  10. A phylogenetic study of Laeliinae (Orchidaceae) based on combined nuclear and plastid DNA sequences

    PubMed Central

    van den Berg, Cássio; Higgins, Wesley E.; Dressler, Robert L.; Whitten, W. Mark; Soto-Arenas, Miguel A.; Chase, Mark W.

    2009-01-01

    Background and Aims Laeliinae are a neotropical orchid subtribe with approx. 1500 species in 50 genera. In this study, an attempt is made to assess generic alliances based on molecular phylogenetic analysis of DNA sequence data. Methods Six DNA datasets were gathered: plastid trnL intron, trnL-F spacer, matK gene and trnK introns upstream and dowstream from matK and nuclear ITS rDNA. Data were analysed with maximum parsimony (MP) and Bayesian analysis with mixed models (BA). Key Results Although relationships between Laeliinae and outgroups are well supported, within the subtribe sequence variation is low considering the broad taxonomic range covered. Localized incongruence between the ITS and plastid trees was found. A combined tree followed the ITS trees more closely, but the levels of support obtained with MP were low. The Bayesian analysis recovered more well-supported nodes. The trees from combined MP and BA allowed eight generic alliances to be recognized within Laeliinae, all of which show trends in morphological characters but lack unambiguous synapomorphies. Conclusions By using combined plastid and nuclear DNA data in conjunction with mixed-models Bayesian inference, it is possible to delimit smaller groups within Laeliinae and discuss general patterns of pollination and hybridization compatibility. Furthermore, these small groups can now be used for further detailed studies to explain morphological evolution and diversification patterns within the subtribe. PMID:19423551

  11. Direct Spectroscopic Study of Reconstituted Transcription Complexes Reveals That Intrinsic Termination Is Driven Primarily by Thermodynamic Destabilization of the Nucleic Acid Framework*S

    PubMed Central

    Datta, Kausiki; von Hippel, Peter H.

    2008-01-01

    Changes in near UV circular dichroism (CD) and fluorescence spectra of site-specifically placed pairs of 2-aminopurine residues have been used to probe the roles of the RNA hairpin and the RNA-DNA hybrid in controlling intrinsic termination of transcription. Functional transcription complexes were assembled directly by mixing preformed nucleic acid scaffolds of defined sequence with T7 RNA polymerase (RNAP). Scaffolds containing RNA hairpins immediately upstream of a GC-rich hybrid formed complexes of reduced stability, whereas the same hairpins adjacent to a hybrid of rU-dA base pairs triggered complex dissociation and transcript release. 2-Aminopurine probes at the upstream ends of the hairpin stems show that the hairpins open on RNAP binding and that stem re-formation begins after one or two RNA bases on the downstream side of the stem have emerged from the RNAP exit tunnel. Hairpins directly adjacent to the RNA-DNA hybrid weaken RNAP binding, decrease elongation efficiency, and disrupt the upstream end of the hybrid as well as interfere with the movement of the template base at the RNAP active site. Probing the edges of the DNA transcription bubble demonstrates that termination hairpins prevent translocation of the RNAP, suggesting that they transiently “lock” the polymerase to the nucleic acid scaffold and, thus, hold the RNA-DNA hybrid “in frame.” At intrinsic terminators the weak rU-dA hybrid and the adjacent termination hairpin combine to destabilize the elongation complex sufficiently to permit significant transcript release, whereas hairpin-dependent pausing provides time for the process to go to completion. PMID:18070878

  12. EXONSAMPLER: a computer program for genome-wide and candidate gene exon sampling for targeted next-generation sequencing.

    PubMed

    Cosart, Ted; Beja-Pereira, Albano; Luikart, Gordon

    2014-11-01

    The computer program EXONSAMPLER automates the sampling of thousands of exon sequences from publicly available reference genome sequences and gene annotation databases. It was designed to provide exon sequences for the efficient, next-generation gene sequencing method called exon capture. The exon sequences can be sampled by a list of gene name abbreviations (e.g. IFNG, TLR1), or by sampling exons from genes spaced evenly across chromosomes. It provides a list of genomic coordinates (a bed file), as well as a set of sequences in fasta format. User-adjustable parameters for collecting exon sequences include a minimum and maximum acceptable exon length, maximum number of exonic base pairs (bp) to sample per gene, and maximum total bp for the entire collection. It allows for partial sampling of very large exons. It can preferentially sample upstream (5 prime) exons, downstream (3 prime) exons, both external exons, or all internal exons. It is written in the Python programming language using its free libraries. We describe the use of EXONSAMPLER to collect exon sequences from the domestic cow (Bos taurus) genome for the design of an exon-capture microarray to sequence exons from related species, including the zebu cow and wild bison. We collected ~10% of the exome (~3 million bp), including 155 candidate genes, and ~16,000 exons evenly spaced genomewide. We prioritized the collection of 5 prime exons to facilitate discovery and genotyping of SNPs near upstream gene regulatory DNA sequences, which control gene expression and are often under natural selection. © 2014 John Wiley & Sons Ltd.

  13. Replicative Intermediates of Human Papillomavirus Type 11 in Laryngeal Papillomas: Site of Replication Initiation and Direction of Replication

    NASA Astrophysics Data System (ADS)

    Auborn, K. J.; Little, R. D.; Platt, T. H. K.; Vaccariello, M. A.; Schildkraut, C. L.

    1994-07-01

    We have examined the structures of replication intermediates from the human papillomavirus type 11 genome in DNA extracted from papilloma lesions (laryngeal papillomas). The sites of replication initiation and termination utilized in vivo were mapped by using neutral/neutral and neutral/alkaline two-dimensional agarose gel electrophoresis methods. Initiation of replication was detected in or very close to the upstream regulatory region (URR; the noncoding, regulatory sequences upstream of the open reading frames in the papillomavirus genome). We also show that replication forks proceed bidirectionally from the origin and converge 180circ opposite the URR. These results demonstrate the feasibility of analysis of replication of viral genomes directly from infected tissue.

  14. Rat prostatic steroid binding protein: DNA sequence and transcript maps of the two C3 genes.

    PubMed Central

    Hurst, H C; Parker, M G

    1983-01-01

    In the rat there are two non-allelic genes C3(1) and C3(2) for the C3 polypeptide of prostatic steroid binding protein. We have cloned and sequenced both genes and show that only C3(1) is responsible for the production of authentic C3. Although there is a marked difference in their transcriptional activity, the two genes share extensive DNA sequence homology there being only one base difference from nucleotide - 235 to within the first intron. Transcript mapping has shown that there are two distinct C3 transcripts which share a unique 3' terminus but have 5' termini 38 bases apart each preceded by a 'TATA' box homology. Interestingly, an identical repetitive element is present just upstream of both genes. Both families of transcripts, which are produced in a ratio of 18:1, are coordinately regulated by testosterone. Images Fig. 3. Fig. 4. Fig. 5. PMID:6685625

  15. (S)-3-hydroxy-3-methylglutaryl coenzyme A reductase, a product of the mva operon of Pseudomonas mevalonii, is regulated at the transcriptional level.

    PubMed Central

    Wang, Y L; Beach, M J; Rodwell, V W

    1989-01-01

    We have cloned and sequenced a 505-base-pair (bp) segment of DNA situated upstream of mvaA, the structural gene for (S)-3-hydroxy-3-methylglutaryl coenzyme A reductase (EC 1.1.1.88) of Pseudomonas mevalonii. The DNA segment that we characterized includes the promoter region for the mva operon. Nuclease S1 mapping and primer extension analysis showed that mvaA is the promoter-proximal gene of the mva operon. Transcription initiates at -56 bp relative to the first A (+1) of the translation start site. Transcription in vivo was induced by mevalonate. Structural features of the mva promoter region include an 80-bp A + T-rich region, and -12, -24 consensus sequences that resemble sequences of sigma 54 promoters in enteric organisms. The relative amplitudes of catalytic activity, enzyme protein, and mvaA mRNA are consistent with a model of regulation of this operon at the transcriptional level. Images PMID:2477360

  16. The Role of eIF4E Activity in Breast Cancer

    DTIC Science & Technology

    2010-08-01

    ORF, open reading frame; qPCR, quantitative PCR; RACE, rapid amplification of cDNA ends; RT, reverse transcriptase ; uORF, upstream ORF; UTR...were also performed using template lacking RT ( reverse transcriptase ): products were either undetectable or greatly reduced (>30000-fold less product...have previously shown that a 5’UTR expressed from the human AXIN2 gene contains a sixty nucleotide sequence that is predicted to form a stable stem

  17. Systematic analysis and evolution of 5S ribosomal DNA in metazoans.

    PubMed

    Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

    2013-11-01

    Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.

  18. Systematic analysis and evolution of 5S ribosomal DNA in metazoans

    PubMed Central

    Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

    2013-01-01

    Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12 766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades. PMID:23838690

  19. Regulatory interactions between the human HOXB1, HOXB2, and HOXB3 proteins and the upstream sequence of the Otx2 gene in embryonal carcinoma cells.

    PubMed

    Guazzi, S; Pintonello, M L; Viganò, A; Boncinelli, E

    1998-05-01

    Vertebrate Hox and Otx genes encode homeodomain-containing transcription factors thought to transduce positional information along the body axis in the segmental portion of the trunk and in the rostral brain, respectively. Moreover, Hox and Otx2 genes show a complementary spatial regulation during embryogenesis. In this report, we show that a 1821-base pair (bp) upstream DNA fragment of the Otx2 gene is positively regulated by co-transfection with expression vectors for the human HOXB1, HOXB2, and HOXB3 proteins in an embryonal carcinoma cell line (NT2/D1) and that a shorter fragment of only 534 bp is able to drive this regulation. We also identified the HOXB1, HOXB2, and HOXB3 DNA-binding region on the 534-bp Otx2 genomic fragment using nuclear extracts from Hox-transfected COS cells and 12.5 days postcoitum mouse embryos or HOXB3 homeodomain-containing bacterial extracts. HOXB1, HOXB3, and nuclear extracts from 12.5 days postcoitum mouse embryos bind to a sequence containing two palindromic TAATTA sites, which bear four copies of the ATTA core sequence, a common feature of most HOM-C/HOX binding sites. HOXB2 protected an adjacent site containing a direct repeat of an ACTT sequence, quite divergent from the ATTA consensus. The region bound by the three homeoproteins is strikingly conserved through evolution and necessary (at least for HOXB1 and HOXB3) to mediate the up-regulation of the Otx2 transcription. Taken together, our data support the hypothesis that anteriorly expressed Hox genes might play a role in the refinement of the Otx2 early expression boundaries in vivo.

  20. Translocation-coupled DNA cleavage by the Type ISP restriction-modification enzymes

    PubMed Central

    Chand, Mahesh Kumar; Nirwan, Neha; Diffin, Fiona M.; van Aelst, Kara; Kulkarni, Manasi; Pernstich, Christian; Szczelkun, Mark D.; Saikrishnan, Kayarat

    2015-01-01

    Endonucleolytic double-strand DNA break production requires separate strand cleavage events. Although catalytic mechanisms for simple dimeric endonucleases are available, there are many complex nuclease machines which are poorly understood in comparison. Here we studied the single polypeptide Type ISP restriction-modification (RM) enzymes, which cleave random DNA between distant target sites when two enzymes collide following convergent ATP-driven translocation. We report the 2.7 Angstroms resolution X-ray crystal structure of a Type ISP enzyme-DNA complex, revealing that both the helicase-like ATPase and nuclease are unexpectedly located upstream of the direction of translocation, inconsistent with simple nuclease domain-dimerization. Using single-molecule and biochemical techniques, we demonstrate that each ATPase remodels its DNA-protein complex and translocates along DNA without looping it, leading to a collision complex where the nuclease domains are distal. Sequencing of single cleavage events suggests a previously undescribed endonuclease model, where multiple, stochastic strand nicking events combine to produce DNA scission. PMID:26389736

  1. DNA barcoding and evaluation of genetic diversity in Cyprinidae fish in the midstream of the Yangtze River.

    PubMed

    Shen, Yanjun; Guan, Lihong; Wang, Dengqiang; Gan, Xiaoni

    2016-05-01

    The Yangtze River is the longest river in China and is divided into upstream and mid-downstream regions by the Three Gorges (the natural barriers of the Yangtze River), resulting in a complex distribution of fish. Dramatic changes to habitat environments may ultimately threaten fish survival; thus, it is necessary to evaluate the genetic diversity and propose protective measures. Species identification is the most significant task in many fields of biological research and in conservation efforts. DNA barcoding, which constitutes the analysis of a short fragment of the mitochondrial cytochrome c oxidase subunit I (COI) sequence, has been widely used for species identification. In this study, we collected 561 COI barcode sequences from 35 fish from the midstream of the Yangtze River. The intraspecific distances of all species were below 2% (with the exception of Acheilognathus macropterus and Hemibarbus maculatus). Nevertheless, all species could be unambiguously identified from the trees, barcoding gaps and taxonomic resolution ratio values. Furthermore, the COI barcode diversity was found to be low (≤0.5%), with the exception of H. maculatus (0.87%), A. macropterus (2.02%) and Saurogobio dabryi (0.82%). No or few shared haplotypes were detected between the upstream and downstream populations for ten species with overall nucleotide diversities greater than 0.00%, which indicated the likelihood of significant population genetic structuring. Our analyses indicated that DNA barcoding is an effective tool for the identification of cyprinidae fish in the midstream of the Yangtze River. It is vital that some protective measures be taken immediately because of the low COI barcode diversity.

  2. RNA-DNA and DNA-DNA base-pairing at the upstream edge of the transcription bubble regulate translocation of RNA polymerase and transcription rate.

    PubMed

    KIreeva, Maria; Trang, Cyndi; Matevosyan, Gayane; Turek-Herman, Joshua; Chasov, Vitaly; Lubkowska, Lucyna; Kashlev, Mikhail

    2018-06-20

    Translocation of RNA polymerase (RNAP) along DNA may be rate-limiting for transcription elongation. The Brownian ratchet model posits that RNAP rapidly translocates back and forth until the post-translocated state is stabilized by NTP binding. An alternative model suggests that RNAP translocation is slow and poorly reversible. To distinguish between these two models, we take advantage of an observation that pyrophosphorolysis rates directly correlate with the abundance of the pre-translocated fraction. Pyrophosphorolysis by RNAP stabilized in the pre-translocated state by bacteriophage HK022 protein Nun was used as a reference point to determine the pre-translocated fraction in the absence of Nun. The stalled RNAP preferentially occupies the post-translocated state. The forward translocation rate depends, among other factors, on melting of the RNA-DNA base pair at the upstream edge of the transcription bubble. DNA-DNA base pairing immediately upstream from the RNA-DNA hybrid stabilizes the post-translocated state. This mechanism is conserved between E. coli RNAP and S. cerevisiae RNA polymerase II and is partially dependent on the lid domain of the catalytic subunit. Thus, the RNA-DNA hybrid and DNA reannealing at the upstream edge of the transcription bubble emerge as targets for regulation of the transcription elongation rate.

  3. Fungal Genes in Context: Genome Architecture Reflects Regulatory Complexity and Function

    PubMed Central

    Noble, Luke M.; Andrianopoulos, Alex

    2013-01-01

    Gene context determines gene expression, with local chromosomal environment most influential. Comparative genomic analysis is often limited in scope to conserved or divergent gene and protein families, and fungi are well suited to this approach with low functional redundancy and relatively streamlined genomes. We show here that one aspect of gene context, the amount of potential upstream regulatory sequence maintained through evolution, is highly predictive of both molecular function and biological process in diverse fungi. Orthologs with large upstream intergenic regions (UIRs) are strongly enriched in information processing functions, such as signal transduction and sequence-specific DNA binding, and, in the genus Aspergillus, include the majority of experimentally studied, high-level developmental and metabolic transcriptional regulators. Many uncharacterized genes are also present in this class and, by implication, may be of similar importance. Large intergenic regions also share two novel sequence characteristics, currently of unknown significance: they are enriched for plus-strand polypyrimidine tracts and an information-rich, putative regulatory motif that was present in the last common ancestor of the Pezizomycotina. Systematic consideration of gene UIR in comparative genomics, particularly for poorly characterized species, could help reveal organisms’ regulatory priorities. PMID:23699226

  4. Structural analysis of two length variants of the rDNA intergenic spacer from Eruca sativa.

    PubMed

    Lakshmikumaran, M; Negi, M S

    1994-03-01

    Restriction enzyme analysis of the rRNA genes of Eruca sativa indicated the presence of many length variants within a single plant and also between different cultivars which is unusual for most crucifers studied so far. Two length variants of the rDNA intergenic spacer (IGS) from a single individual E. sativa (cv. Itsa) plant were cloned and characterized. The complete nucleotide sequences of both the variants (3 kb and 4 kb) were determined. The intergenic spacer contains three families of tandemly repeated DNA sequences denoted as A, B and C. However, the long (4 kb) variant shows the presence of an additional repeat, denoted as D, which is a duplication of a 224 bp sequence just upstream of the putative transcription initiation site. Repeat units belonging to the three different families (A, B and C) were in the size range of 22 to 30 bp. Such short repeat elements are present in the IGS of most of the crucifers analysed so far. Sequence analysis of the variants (3 kb and 4 kb) revealed that the length heterogeneity of the spacer is located at three different regions and is due to the varying copy numbers of repeat units belonging to families A and B. Length variation of the spacer is also due to the presence of a large duplication (D repeats) in the 4 kb variant which is absent in the 3 kb variant. The putative transcription initiation site was identified by comparisons with the rDNA sequences from other plant species.

  5. The genetic basis of adaptive pigmentation variation in Drosophila melanogaster

    PubMed Central

    Pool, John E.; Aquadro, Charles F.

    2009-01-01

    In a broad survey of Drosophila melanogaster population samples, levels of abdominal pigmentation were found to be highly variable and geographically differentiated. A strong positive correlation was found between dark pigmentation and high altitude, suggesting adaptation to specific environments. DNA sequence polymorphism at the candidate gene ebony revealed a clear association with the pigmentation of homozygous third chromosome lines. The darkest lines sequenced had nearly identical haplotypes spanning 14.5 kilobases upstream of the protein-coding exons of ebony. Thus, natural selection may have elevated the frequency of an allele that confers dark abdominal pigmentation by influencing the regulation of ebony. PMID:17614900

  6. Inter-individual and intragenomic variations in the ITS region of Clonorchis sinensis (Trematoda: Opisthorchiidae) from Russia and Vietnam.

    PubMed

    Tatonova, Yulia V; Chelomina, Galina N; Nguyen, Hung Manh

    2017-11-01

    Here we examined the intraspecific genetic variability of Clonorchis sinensis from Russia and Vietnam using nuclear DNA sequences (the 5.8S gene and two internal transcribed spacers of the ribosomal cluster). Despite the low level of variability in the ITS1 region, this marker has revealed some features of C. sinensis across multiple geographic regions. The genetic diversity levels for the Russian and Vietnamese populations were similar (0.1 and 0.09%, respectively) but were significantly lower than the C. sinensis from China (0.31%). About half of the sequences of the Chinese (53%) and Korean (47%) populations and about a tenth of the Vietnamese (12%) and Russian (8%) sequences included a 5bp insertion. No sequences with nucleotide substitutions both upstream and downstream of the 5bp insertion were found within the whole data set. The population of northern China had both sequence variants (with substitutions either upstream or downstream of the insertion), while only one of these variants was presented at the other localities. The Vietnamese population had a higher frequency of intragenomic polymorphism than the Russian population (69% vs. 46% and 23% vs. 3% at the 114bp and 339bp positions, respectively). These data are discussed in connection with parasite origin and adaptation, and also its invasive capacity and drug-resistance. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. The Role of elF4E Activity in Breast Cancer

    DTIC Science & Technology

    2011-08-01

    protein; ORF, open reading frame; qPCR, quantitative PCR; RACE, rapid amplification of cDNA ends; RT, reverse transcriptase ; uORF, upstream ORF; UTR...Reactions were also performed using template lacking RT ( reverse transcriptase ): products were either undetectable or greatly reduced (>30000-fold less...that a 5’UTR expressed from the human AXIN2 gene contains a sixty nucleotide sequence that is predicted to form a stable stem-loop structure6. This

  8. Structure of the horseradish peroxidase isozyme C genes.

    PubMed

    Fujiyama, K; Takemura, H; Shibayama, S; Kobayashi, K; Choi, J K; Shinmyo, A; Takano, M; Yamada, Y; Okada, H

    1988-05-02

    We have isolated, cloned and characterized three cDNAs and two genomic DNAs corresponding to the mRNAs and genes for the horseradish (Armoracia rusticana) peroxidase isoenzyme C (HPR C). The amino acid sequence of HRP C1, deduced from the nucleotide sequence of one of the cDNA clone, pSK1, contained the same primary sequence as that of the purified enzyme established by Welinder [FEBS Lett. 72, 19-23 (1976)] with additional sequences at the N and C terminal. All three inserts in the cDNA clones, pSK1, pSK2 and pSK3, coded the same size of peptide (308 amino acid residues) if these are processed in the same way, and the amino acid sequence were homologous to each other by 91-94%. Functional amino acids, including His40, His170, Tyr185 and Arg183 and S-S-bond-forming Cys, were conserved in the three isozymes, but a few N-glycosylation sites were not the same. Two HRP C isoenzyme genomic genes, prxC1 and prxC2, were tandem on the chromosomal DNA and each gene consisted of four exons and three introns. The positions in the exons interrupted by introns were the same in two genes. We observed a putative promoter sequence 5' upstream and a poly(A) signal 3' downstream in both genes. The gene product of prxC1 might be processed with a signal sequence of 30 amino acid residues at the N terminus and a peptide consisting of 15 amino acid residues at the C terminus.

  9. Distribution of CpG Motifs in Upstream Gene Domains in a Reef Coral and Sea Anemone: Implications for Epigenetics in Cnidarians.

    PubMed

    Marsh, Adam G; Hoadley, Kenneth D; Warner, Mark E

    2016-01-01

    Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG) motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera) and an anemone (Nematostella vectensis). Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS) are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to environmental stress in reef corals and potential roles of epigenetics on survival and fitness in the face of global climate change.

  10. Nucleotide sequences of bovine alpha S1- and kappa-casein cDNAs.

    PubMed Central

    Stewart, A F; Willis, I M; Mackinlay, A G

    1984-01-01

    The nucleotide sequences corresponding to bovine alpha S1- and kappa-casein mRNAs are presented. An unusual alpha S1-casein cDNA has been characterised whose 5' end commences upstream from its putative TATA box. The alpha S1-casein mRNA is compared to rat alpha-casein mRNA and two components of divergence are identified. Firstly, the two sequences have diverged at a high point mutation rate and the rate of amino acid replacement by this mechanism is at least as great as the rate of divergence of any other part of the mRNAs. Secondly, the protein coding sequence has been subjected to several insertion/deletion events, one of which may be an example of exon shuffling . The kappa-casein mRNA sequence verifies the proposition that it has arisen from a different ancestral gene to the other caseins. Images PMID:6328443

  11. Internal Associations of the Acidic Region of Upstream Binding Factor Control Its Nucleolar Localization.

    PubMed

    Ueshima, Shuhei; Nagata, Kyosuke; Okuwaki, Mitsuru

    2017-11-15

    Upstream binding factor (UBF) is a member of the high-mobility group (HMG) box protein family, characterized by multiple HMG boxes and a C-terminal acidic region (AR). UBF is an essential transcription factor for rRNA genes and mediates the formation of transcriptionally active chromatin in the nucleolus. However, it remains unknown how UBF is specifically localized to the nucleolus. Here, we examined the molecular mechanisms that localize UBF to the nucleolus. We found that the first HMG box (HMG box 1), the linker region (LR), and the AR cooperatively regulate the nucleolar localization of UBF1. We demonstrated that the AR intramolecularly associates with and attenuates the DNA binding activity of HMG boxes and confers the structured DNA preference to HMG box 1. In contrast, the LR was found to serve as a nuclear localization signal and compete with HMG boxes to bind the AR, permitting nucleolar localization of UBF1. The LR sequence binds DNA and assists the stable chromatin binding of UBF. We also showed that the phosphorylation status of the AR does not clearly affect the localization of UBF1. Our results strongly suggest that associations of the AR with HMG boxes and the LR regulate UBF nucleolar localization. Copyright © 2017 American Society for Microbiology.

  12. POZ domain transcription factor, FBI-1, represses transcription of ADH5/FDH by interacting with the zinc finger and interfering with DNA binding activity of Sp1.

    PubMed

    Lee, Dong-Kee; Suh, Dongchul; Edenberg, Howard J; Hur, Man-Wook

    2002-07-26

    The POZ domain is a protein-protein interaction motif that is found in many transcription factors, which are important for development, oncogenesis, apoptosis, and transcription repression. We cloned the POZ domain transcription factor, FBI-1, that recognizes the cis-element (bp -38 to -22) located just upstream of the core Sp1 binding sites (bp -22 to +22) of the ADH5/FDH minimal promoter (bp -38 to +61) in vitro and in vivo, as revealed by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. The ADH5/FDH minimal promoter is potently repressed by the FBI-1. Glutathione S-transferase fusion protein pull-down showed that the POZ domains of FBI-1, Plzf, and Bcl-6 directly interact with the zinc finger DNA binding domain of Sp1. DNase I footprinting assays showed that the interaction prevents binding of Sp1 to the GC boxes of the ADH5/FDH promoter. Gal4-POZ domain fusions targeted proximal to the GC boxes repress transcription of the Gal4 upstream activator sequence-Sp1-adenovirus major late promoter. Our data suggest that POZ domain represses transcription by interacting with Sp1 zinc fingers and by interfering with the DNA binding activity of Sp1.

  13. Spacing requirements for interactions between the C-terminal domain of the alpha subunit of Escherichia coli RNA polymerase and the cAMP receptor protein.

    PubMed Central

    Lloyd, G S; Busby, S J; Savery, N J

    1998-01-01

    During transcription initiation at bacterial promoters, the C-terminal domain of the RNA polymerase alpha subunit (alphaCTD) can interact with DNA-sequence elements (known as UP elements) and with activator proteins. We have constructed a series of semi-synthetic promoters carrying both an UP element and a consensus DNA-binding site for the Escherichia coli cAMP receptor protein (CRP; a factor that activates transcription by making direct contacts with alphaCTD). At these promoters, the UP element was located at a variety of distances upstream of the CRP-binding site, which was fixed at position -41.5 bp upstream of the transcript start. At some positions, the UP element caused enhanced promoter activity whereas, at other positions, it had very little effect. In no case was the CRP-dependence of the promoter relieved. DNase I and hydroxyl-radical footprinting were used to study ternary RNA polymerase-CRP-promoter complexes formed at two of the most active of these promoters, and co-operativity between the binding of CRP and purified alpha subunits was studied. The footprints show that alphaCTD binds to the UP element as it is displaced upstream but that this displacement does not prevent alphaCTD from being contacted by CRP. Models to account for this are discussed. PMID:9461538

  14. Cloning Should Be Simple: Escherichia coli DH5α-Mediated Assembly of Multiple DNA Fragments with Short End Homologies

    PubMed Central

    Richardson, Ruth E.; Suzuki, Yo

    2015-01-01

    Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six double-stranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processes associated with most common applications of DNA assembly. We demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work. PMID:26348330

  15. The construction of recombinant industrial yeasts free of bacterial sequences by directed gene replacement into a nonessential region of the genome.

    PubMed

    Xiao, W; Rank, G H

    1989-03-15

    The yeast SMR1 gene was used as a dominant resistance-selectable marker for industrial yeast transformation and for targeting integration of an economically important gene at the homologous ILV2 locus. A MEL1 gene, which codes for alpha-galactosidase, was inserted into a dispensable upstream region of SMR1 in vitro; different treatments of the plasmid (pWX813) prior to transformation resulted in 3' end, 5' end and replacement integrations that exhibited distinct integrant structures. One-step replacement within a nonessential region of the host genome generated a stable integration of MEL1 devoid of bacterial plasmid DNA. Using this method, we have constructed several alpha-galactosidase positive industrial Saccharomyces strains. Our study provides a general method for stable gene transfer in most industrial Saccharomyces yeasts, including those used in the baking, brewing (ale and lager), distilling, wine and sake industries, with solely nucleotide sequences of interest. The absence of bacterial DNA in the integrant structure facilitates the commercial application of recombinant DNA technology in the food and beverage industry.

  16. Selection of differently temporally regulated African swine fever virus promoters with variable expression activities and their application for transient and recombinant virus mediated gene expression.

    PubMed

    Portugal, Raquel S; Bauer, Anja; Keil, Guenther M

    2017-08-01

    African swine fever virus threatens pig production worldwide due to the lack of vaccines, for which generation of both deletion and insertion mutants is considered. For development of the latter, operational ASFV promoters of different temporal regulation and strengths are desirable. We therefore compared the capacities of putative promoter sequences from p72, CD2v, p30, viral DNA polymerase and U104L genes to mediate expression of luciferase from transfected plasmids after activation in trans, or p30-, DNA polymerase- and U104L promoters in cis, using respective ASFV recombinants. We identified sequences with promoter activities upstream the viral ORFs, and showed that they differ in both their expression intensity regulating properties and in their temporal regulation. In summary, p30 and DNA polymerase promoters are recommended for high level early regulated transgene expression. For late expression, the p72, CD2v and U104L promoter are suitable. The latter however, only if low level transgene expression is aimed. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Effects of a Transposable Element Insertion on Alcohol Dehydrogenase Expression in Drosophila Melanogaster

    PubMed Central

    Dunn, R. C.; Laurie, C. C.

    1995-01-01

    Variation in the DNA sequence and level of alcohol dehydrogenase (Adh) gene expression in Drosophila melanogaster have been studied to determine what types of DNA polymorphisms contribute to phenotypic variation in natural populations. The Adh gene, like many others, shows a high level of variability in both DNA sequence and quantitative level of expression. A number of transposable element insertions occur in the Adh region and one of these, a copia insertion in the 5' flanking region, is associated with unusually low Adh expression. To determine whether this insertion (called RI42) causes the low expression level, the insertion was excised from the cloned RI42 Adh gene and the effect was assessed by P-element transformation. Removal of this insertion causes a threefold increase in the level of ADH, clearly showing that it contributes to the naturally occurring variation in expression at this locus. Removal of all but one LTR also causes a threefold increase, indicating that the mechanism is not a simple sequence disruption. Furthermore, this copia insertion, which is located between the two Adh promoters and their upstream enhancer sequences, has differential effects on the levels of proximal and distal transcripts. Finally, a test for the possible modifying effects of two suppressor loci, su(w(a)) and su(f), on this insertional mutation was negative, in contrast to a previous report in the literature. PMID:7498745

  18. Molecular cloning and identification of the transcriptional regulatory domain of the goat neurokinin B gene TAC3.

    PubMed

    Suetomi, Yuta; Matsuda, Fuko; Uenoyama, Yoshihisa; Maeda, Kei-ichiro; Tsukamura, Hiroko; Ohkura, Satoshi

    2013-10-01

    Neurokinin B (NKB), encoded by TAC3, is thought to be an important accelerator of pulsatile gonadotropin-releasing hormone release. This study aimed to clarify the transcriptional regulatory mechanism of goat TAC3. First, we determined the full-length mRNA sequence of goat TAC3 from the hypothalamus to be 820 b, including a 381 b coding region, with the putative transcription start site located 143-b upstream of the start codon. The deduced amino acid sequence of NKB, which is produced from preproNKB, was completely conserved among goat, cattle, and human. Next, we cloned 5'-upstream region of goat TAC3 up to 3400 b from the translation initiation site, and this region was highly homologous with cattle TAC3 (89%). We used this goat TAC3 5'-upstream region to perform luciferase assays. We created a luciferase reporter vector containing DNA constructs from -2706, -1837, -834, -335, or -197 to +166 bp (the putative transcription start site was designated as +1) of goat TAC3 and these were transiently transfected into mouse hypothalamus-derived N7 cells and human neuroblastoma-derived SK-N-AS cells. The luciferase activity gradually increased with the deletion of the 5'-upstream region, suggesting that the transcriptional suppressive region is located between -2706 and -336 bp and that the core promoter exists downstream of -197 bp. Estradiol treatment did not lead to significant suppression of luciferase activity of any constructs, suggesting the existence of other factor(s) that regulate goat TAC3 transcription.

  19. The Pea light-independent photomorphogenesis1 Mutant Results from Partial Duplication of COP1 Generating an Internal Promoter and Producing Two Distinct Transcripts

    PubMed Central

    Sullivan, James A.; Gray, John C.

    2000-01-01

    The pea lip1 (light-independent photomorphogenesis1) mutant shows many of the characteristics of light-grown development when grown in continuous darkness. To investigate the identity of LIP1, cDNAs encoding the pea homolog of COP1, a repressor of photomorphogenesis identified in Arabidopsis, were isolated from wild-type and lip1 pea seedlings. lip1 seedlings contained a wild-type COP1 transcript as well as a larger COP1′ transcript that contained an internal in-frame duplication of 894 bp. The COP1′ transcript segregated with the lip1 phenotype in F2 seedlings and could be translated in vitro to produce a protein of ∼100 kD. The COP1 gene in lip1 peas contained a 7.5-kb duplication, consisting of exons 1 to 7 of the wild-type sequence, located 2.5 kb upstream of a region of genomic DNA identical to the wild-type COP1 DNA sequence. Transcription and splicing of the mutant COP1 gene was predicted to produce the COP1′ transcript, whereas transcription from an internal promoter in the 2.5-kb region of DNA located between the duplicated regions of COP1 would produce the wild-type COP1 transcript. The presence of small quantities of wild-type COP1 transcripts may reduce the severity of the phenotype produced by the mutated COP1′ protein. The genomic DNA sequences of the COP1 gene from wild-type and lip1 peas and the cDNA sequences of COP1 and COP1′ transcripts have been submitted to the EMBL database under the EMBL accession numbers AJ276591, AJ276592, AJ289773, and AJ289774, respectively. PMID:11041887

  20. DNA pooling: a comprehensive, multi-stage association analysis of ACSL6 and SIRT5 polymorphisms in schizophrenia.

    PubMed

    Chowdari, K V; Northup, A; Pless, L; Wood, J; Joo, Y H; Mirnics, K; Lewis, D A; Levitt, P R; Bacanu, S-A; Nimgaonkar, V L

    2007-04-01

    Many candidate gene association studies have evaluated incomplete, unrepresentative sets of single nucleotide polymorphisms (SNPs), producing non-significant results that are difficult to interpret. Using a rapid, efficient strategy designed to investigate all common SNPs, we tested associations between schizophrenia and two positional candidate genes: ACSL6 (Acyl-Coenzyme A synthetase long-chain family member 6) and SIRT5 (silent mating type information regulation 2 homologue 5). We initially evaluated the utility of DNA sequencing traces to estimate SNP allele frequencies in pooled DNA samples. The mean variances for the DNA sequencing estimates were acceptable and were comparable to other published methods (mean variance: 0.0008, range 0-0.0119). Using pooled DNA samples from cases with schizophrenia/schizoaffective disorder (Diagnostic and Statistical Manual of Mental Disorders edition IV criteria) and controls (n=200, each group), we next sequenced all exons, introns and flanking upstream/downstream sequences for ACSL6 and SIRT5. Among 69 identified SNPs, case-control allele frequency comparisons revealed nine suggestive associations (P<0.2). Each of these SNPs was next genotyped in the individual samples composing the pools. A suggestive association with rs 11743803 at ACSL6 remained (allele-wise P=0.02), with diminished evidence in an extended sample (448 cases, 554 controls, P=0.062). In conclusion, we propose a multi-stage method for comprehensive, rapid, efficient and economical genetic association analysis that enables simultaneous SNP detection and allele frequency estimation in large samples. This strategy may be particularly useful for research groups lacking access to high throughput genotyping facilities. Our analyses did not yield convincing evidence for associations of schizophrenia with ACSL6 or SIRT5.

  1. Pea chloroplast tRNA(Lys) (UUU) gene: transcription and analysis of an intron-containing gene.

    PubMed

    Boyer, S K; Mullet, J E

    1988-07-01

    The pea chloroplast trnK gene which encodes tRNA(Lys) (UUU) was sequenced. TrnK is located 210 bp upstream from the promoter of psbA and immediately downstream from the 3'-end of rbcL. The gene is transcribed from the same DNA strand as psbA and rbcL. A 2447 bp intron with class II features is located in the trnK anticodon loop. The intron contains a 506 amino acid open reading frame which could encode an RNA maturase. The primary transcript of trnK is 2.9 kb long; its 5'-end was identified as a site of transcription initiation by in vitro transcription experiments. The 5'-terminus is adjacent to DNA sequences previously identified as transcription promoter elements. The most abundant trnK transcript is 2.5 kb long with termini corresponding to the 5' and 3' ends of the trnK exons. Intron specific RNAs were not detected. This suggests that RNA processing which produces tRNA(Lys) leads to rapid degradation of intron sequences.

  2. Conserved features of eukaryotic hsp70 genes revealed by comparison with the nucleotide sequence of human hsp70.

    PubMed Central

    Hunt, C; Morimoto, R I

    1985-01-01

    We have determined the nucleotide sequence of the human hsp70 gene and 5' flanking region. The hsp70 gene is transcribed as an uninterrupted primary transcript of 2440 nucleotides composed of a 5' noncoding leader sequence of 212 nucleotides, a 3' noncoding region of 242 nucleotides, and a continuous open reading frame of 1986 nucleotides that encodes a protein with predicted molecular mass of 69,800 daltons. Upstream of the 5' terminus are the canonical TATAAA box, the sequence ATTGG that corresponds in the inverted orientation to the CCAAT motif, and the dyad sequence CTGGAAT/ATTCCCG that shares homology in 12 of 14 positions with the consensus transcription regulatory sequence common to Drosophila heat shock genes. Comparison of the predicted amino acid sequences of human hsp70 with the published sequences of Drosophila hsp70 and Escherichia coli dnaK reveals that human hsp70 is 73% identical to Drosophila hsp70 and 47% identical to E. coli dnaK. Surprisingly, the nucleotide sequences of the human and Drosophila genes are 72% identical and human and E. coli genes are 50% identical, which is more highly conserved than necessary given the degeneracy of the genetic code. The lack of accumulated silent nucleotide substitutions leads us to propose that there may be additional information in the nucleotide sequence of the hsp70 gene or the corresponding mRNA that precludes the maximum divergence allowed in the silent codon positions. PMID:3931075

  3. Splicing stimulates siRNA formation at Drosophila DNA double-strand breaks

    PubMed Central

    Merk, Karin; Breinig, Marco; Böttcher, Romy; Krebs, Stefan; Blum, Helmut; Boutros, Michael

    2017-01-01

    DNA double-strand breaks trigger the production of locus-derived siRNAs in fruit flies, human cells and plants. At least in flies, their biogenesis depends on active transcription running towards the break. Since siRNAs derive from a double-stranded RNA precursor, a major question is how broken DNA ends can generate matching sense and antisense transcripts. We performed a genome-wide RNAi-screen in cultured Drosophila cells, which revealed that in addition to DNA repair factors, many spliceosome components are required for efficient siRNA generation. We validated this observation through site-specific DNA cleavage with CRISPR-cas9 followed by deep sequencing of small RNAs. DNA breaks in intron-less genes or upstream of a gene’s first intron did not efficiently trigger siRNA production. When DNA double-strand breaks were induced downstream of an intron, however, this led to robust siRNA generation. Furthermore, a downstream break slowed down splicing of the upstream intron and a detailed analysis of siRNA coverage at the targeted locus revealed that unspliced pre-mRNA contributes the sense strand to the siRNA precursor. Since splicing factors are stimulating the response but unspliced transcripts are entering the siRNA biogenesis, the spliceosome is apparently stalled in a pre-catalytic state and serves as a signaling hub. We conclude that convergent transcription at DNA breaks is stimulated by a splicing dependent control process. The resulting double-stranded RNA is converted into siRNAs that instruct the degradation of cognate mRNAs. In addition to a potential role in DNA repair, the break-induced transcription may thus be a means to cull improper RNAs from the transcriptome of Drosophila melanogaster. Since the splicing factors identified in our screen also stimulated siRNA production from high copy transgenes, it is possible that this surveillance mechanism serves in genome defense beyond DNA double-strand breaks. PMID:28628606

  4. A Rapid Method for Engineering Recombinant Polioviruses or Other Enteroviruses.

    PubMed

    Bessaud, Maël; Pelletier, Isabelle; Blondel, Bruno; Delpeyroux, Francis

    2016-01-01

    The cloning of large enterovirus RNA sequences is labor-intensive because of the frequent instability in bacteria of plasmidic vectors containing the corresponding cDNAs. In order to circumvent this issue we have developed a PCR-based method that allows the generation of highly modified or chimeric full-length enterovirus genomes. This method relies on fusion PCR which enables the concatenation of several overlapping cDNA amplicons produced separately. A T7 promoter sequence added upstream the fusion PCR products allows its transcription into infectious genomic RNAs directly in transfected cells constitutively expressing the phage T7 RNA polymerase. This method permits the rapid recovery of modified viruses that can be subsequently amplified on adequate cell-lines.

  5. The location of a disease-associated polymorphism and genomic structure of the human 52-kDa Ro/SSA locus (SSA1)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tsugu, H.; Horowitz, R.; Gibson, N.

    1994-12-01

    Sera from approximately 30% of patients with systemic lupus erythematosus (SLE) contain high titers of autoantibodies that bind to the 52-kDa Ro/SSA protein. We previously detected polymorphisms in the 52-kDa Ro/SSA gene (SSA1) with restriction enzymes, one of which is strongly associated with the presence of SLE (P < 0.0005) in African Americans. A higher disease frequency and more severe forms of the disease are commonly noted among these female patients. To determine the location and nature of this polymorphism, we obtained two clones that span 8.5 kb of the 52-kDa Ro/SSA locus including its upstream regulatory region. Six exonsmore » were identified, and their nucleotide sequences plus adjacent noncoding regions were determined. No differences were found between these exons and the coding region of one of the reported cDNAs. The disease-associated polymorphic site suggested by a restriction enzyme map and confirmed by DNA amplification and nucleotide sequencing was present upstream of exon 1. This polymorphism may be a genetic marker for a disease-related variation in the coding region for the protein or in the upstream regulatory region of this gene. Although this RFLP is present in Japanese, it is not associated with lupus in this race. 41 refs., 4 figs., 2 tabs.« less

  6. Molecular characterization of a 40 kDa OmpC-like porin from Serratia marcescens.

    PubMed

    Hutsul, J A; Worobec, E

    1994-02-01

    An oligonucleotide that encodes the N-terminal portion of a 41 kDa porin of Serratia marcescens was used to probe S. marcescens UOC-51 genomic DNA. An 11 kb EcoRI fragment which hybridized with the oligonucleotide was subcloned into Escherichia coli, examined for expression, and sequenced. The product expressed by the cloned gene was 40 kDa. The nucleotide sequence has an ORF of 1.13 kb. When the deduced amino acid sequence was aligned and compared to other enterobacterial porins the cloned S. marcescens porin most closely resembled E. coli OmpC. Although we did not detect osmoregulation or thermoregulation of any porins in S. marcescens UOC-51, sequences analogous to the E. coli osmoregulator OmpR-binding regions are seen upstream to the cloned gene. We examined the regulation of the S. marcescens porin in E. coli and found that its expression increased in a high salt environment. A micF gene, whose transcriptional product functions to inhibit synthesis of OmpF by hybridizing with the ompF transcript, was also seen upstream of the S. marcescens ompC. An alignment with the E. coli micF gene revealed that the functional region of the S. marcescens micF gene is conserved. Based on the results obtained we have determined that S. marcescens UOC-51 produces a 40 kDa porin similar to the E. coli OmpC porin.

  7. A novel pathogenic variant in an Iranian Ataxia telangiectasia family revealed by next-generation sequencing followed by in silico analysis.

    PubMed

    Tabatabaiefar, Mohammad Amin; Alipour, Paria; Pourahmadiyan, Azam; Fattahi, Najmeh; Shariati, Laleh; Golchin, Neda; Mohammadi-Asl, Javad

    2017-08-15

    Ataxia telangiectasia (A-T) is a neurodegenerative autosomal recessive disorder with the main characteristics of progressive cerebellar degeneration, sensitivity to ionizing radiation, immunodeficiency, telangiectasia, premature aging, recurrent sinopulmonary infections, and increased risk of malignancy, especially of lymphoid origin. Ataxia Telangiectasia Mutated gene, ATM, as a causative gene for the A-T disorder, encodes the ATM protein, which plays an important role in the activation of cell-cycle checkpoints and initiation of DNA repair in response to DNA damage. Targeted next-generation sequencing (NGS) was performed on an Iranian 5-year-old boy presented with truncal and limb ataxia, telangiectasia of the eye, Hodgkin lymphoma, hyper pigmentation, total alopecia, hepatomegaly, and dysarthria. Sanger sequencing was used to confirm the candidate pathogenic variants. Computational docking was done using the HEX software to examine how this change affects the interactions of ATM with the upstream and downstream proteins. Three different variants were identified comprising two homozygous SNPs and one novel homozygous frameshift variant (c.80468047delTA, p.Thr2682ThrfsX5), which creates a stop codon in exon 57 leaving the protein truncated at its C-terminal portion. Therefore, the activation and phosphorylation of target proteins are lost. Moreover, the HEX software confirmed that the mutated protein lost its interaction with upstream and downstream proteins. The variant was classified as pathogenic based on the American College of Medical Genetics and Genomics guideline. This study expands the spectrum of ATM pathogenic variants in Iran and demonstrates the utility of targeted NGS in genetic diagnostics. Copyright © 2017. Published by Elsevier B.V.

  8. Identification and expression analysis of cDNA encoding insulin-like growth factor 2 in horses

    PubMed Central

    KIKUCHI, Kohta; SASAKI, Keisuke; AKIZAWA, Hiroki; TSUKAHARA, Hayato; BAI, Hanako; TAKAHASHI, Masashi; NAMBO, Yasuo; HATA, Hiroshi; KAWAHARA, Manabu

    2017-01-01

    Insulin-like growth factor 2 (IGF2) is responsible for a broad range of physiological processes during fetal development and adulthood, but genomic analyses of IGF2 containing the 5ʹ- and 3ʹ-untranslated regions (UTRs) in equines have been limited. In this study, we characterized the IGF2 mRNA containing the UTRs, and determined its expression pattern in the fetal tissues of horses. The complete equine IGF2 mRNA sequence harboring another exon approximately 2.8 kb upstream from the canonical transcription start site was identified as a new transcript variant. As this upstream exon did not contain the start codon, the amino acid sequence was identical to the canonical variant. Analysis of the deduced amino acid sequence revealed that the protein possessed two major domains, IlGF and IGF2_C, and analysis of IGF2 sequence polymorphism in fetal tissues of Hokkaido native horse and Thoroughbreds revealed a single nucleotide polymorphism (T to C transition) at position 398 in Thoroughbreds, which caused an amino acid substitution at position 133 in the IGF2 sequence. Furthermore, the expression pattern of the IGF2 mRNA in the fetal tissues of horses was determined for the first time, and was found to be consistent with those of other species. Taken together, these results suggested that the transcriptional and translational products of the IGF2 gene have conserved functions in the fetal development of mammals, including horses. PMID:29151450

  9. Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

    PubMed

    Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

    2011-09-01

    Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

  10. Transcription of two adjacent carbohydrate utilization gene clusters in Bifidobacterium breve UCC2003 is controlled by LacI- and repressor open reading frame kinase (ROK)-type regulators.

    PubMed

    O'Connell, Kerry Joan; Motherway, Mary O'Connell; Liedtke, Andrea; Fitzgerald, Gerald F; Paul Ross, R; Stanton, Catherine; Zomer, Aldert; van Sinderen, Douwe

    2014-06-01

    Members of the genus Bifidobacterium are commonly found in the gastrointestinal tracts of mammals, including humans, where their growth is presumed to be dependent on various diet- and/or host-derived carbohydrates. To understand transcriptional control of bifidobacterial carbohydrate metabolism, we investigated two genetic carbohydrate utilization clusters dedicated to the metabolism of raffinose-type sugars and melezitose. Transcriptomic and gene inactivation approaches revealed that the raffinose utilization system is positively regulated by an activator protein, designated RafR. The gene cluster associated with melezitose metabolism was shown to be subject to direct negative control by a LacI-type transcriptional regulator, designated MelR1, in addition to apparent indirect negative control by means of a second LacI-type regulator, MelR2. In silico analysis, DNA-protein interaction, and primer extension studies revealed the MelR1 and MelR2 operator sequences, each of which is positioned just upstream of or overlapping the correspondingly regulated promoter sequences. Similar analyses identified the RafR binding operator sequence located upstream of the rafB promoter. This study indicates that transcriptional control of gene clusters involved in carbohydrate metabolism in bifidobacteria is subject to conserved regulatory systems, representing either positive or negative control.

  11. The CGTCA sequence motif is essential for biological activity of the vasoactive intestinal peptide gene cAMP-regulated enhancer.

    PubMed Central

    Fink, J S; Verhave, M; Kasper, S; Tsukada, T; Mandel, G; Goodman, R H

    1988-01-01

    cAMP-regulated transcription of the human vasoactive intestinal peptide gene is dependent upon a 17-base-pair DNA element located 70 base pairs upstream from the transcriptional initiation site. This element is similar to sequences in other genes known to be regulated by cAMP and to sequences in several viral enhancers. We have demonstrated that the vasoactive intestinal peptide regulatory element is an enhancer that depends upon the integrity of two CGTCA sequence motifs for biological activity. Mutations in either of the CGTCA motifs diminish the ability of the element to respond to cAMP. Enhancers containing the CGTCA motif from the somatostatin and adenovirus genes compete for binding of nuclear proteins from C6 glioma and PC12 cells to the vasoactive intestinal peptide enhancer, suggesting that CGTCA-containing enhancers interact with similar transacting factors. Images PMID:2842787

  12. Fission yeast retrotransposon Tf1 integration is targeted to 5' ends of open reading frames.

    PubMed

    Behrens, R; Hayles, J; Nurse, P

    2000-12-01

    Target site selection of transposable elements is usually not random but involves some specificity for a DNA sequence or a DNA binding host factor. We have investigated the target site selection of the long terminal repeat-containing retrotransposon Tf1 from the fission yeast Schizosaccharomyces pombe. By monitoring induced transposition events we found that Tf1 integration sites were distributed throughout the genome. Mapping these insertions revealed that Tf1 did not integrate into open reading frames, but occurred preferentially in longer intergenic regions with integration biased towards a region 100-420 bp upstream of the translation start site. Northern blot analysis showed that transcription of genes adjacent to Tf1 insertions was not significantly changed.

  13. Fission yeast retrotransposon Tf1 integration is targeted to 5′ ends of open reading frames

    PubMed Central

    Behrens, Ralf; Hayles, Jacky; Nurse, Paul

    2000-01-01

    Target site selection of transposable elements is usually not random but involves some specificity for a DNA sequence or a DNA binding host factor. We have investigated the target site selection of the long terminal repeat-containing retrotransposon Tf1 from the fission yeast Schizosaccharomyces pombe. By monitoring induced transposition events we found that Tf1 integration sites were distributed throughout the genome. Mapping these insertions revealed that Tf1 did not integrate into open reading frames, but occurred preferentially in longer intergenic regions with integration biased towards a region 100–420 bp upstream of the translation start site. Northern blot analysis showed that transcription of genes adjacent to Tf1 insertions was not significantly changed. PMID:11095681

  14. Binding sites for abundant nuclear factors modulate RNA polymerase I-dependent enhancer function in Saccharomyces cerevisiae.

    PubMed

    Kang, J J; Yokoi, T J; Holland, M J

    1995-12-01

    The 190-base pair (bp) rDNA enhancer within the intergenic spacer sequences of Saccharomyces cerevisiae rRNA cistrons activates synthesis of the 35S-rRNA precursor about 20-fold in vivo (Mestel,, R., Yip, M., Holland, J. P., Wang, E., Kang, J., and Holland, M. J. (1989) Mol. Cell. Biol. 9, 1243-1254). We now report identification and analysis of transcriptional activities mediated by three cis-acting sites within a 90-bp portion of the rDNA enhancer designated the modulator region. In vivo, these sequences mediated termination of transcription by RNA polymerase I and potentiated the activity of the rDNA enhancer element. Two trans-acting factors, REB1 and REB2, bind independently to sites within the modulator region (Morrow, B. E., Johnson, S. P., and Warner, J. R. (1989) J. Biol. Chem. 264, 9061-9068). We show that REB2 is identical to the ABF1 protien. Site-directed mutagenesis of REB1 and ABF1 binding sites demonstrated uncoupling of RNA polymerase I-dependent termination from transcriptional activation in vivo. We conclude that REB1 and ABF1 are required for RNA polymerase I-dependent termination and enhancer function, respectively, Since REB1 and ABF1 proteins also regulate expression of class II genes and other nuclear functions, our results suggest further similarities between RNA polymerase I and II regulatory mechanisms. Two rDNA enhancers flanking a rDNA minigene stimulated RNA polymerase I transcription in a "multiplicative" fashion. Deletion mapping analysis showed that similar cis-acting sequences were required for enhancer function when positioned upstream or downstream from a rDNA minigene.

  15. Probing the Potential Role of Non-B DNA Structures at Yeast Meiosis-Specific DNA Double-Strand Breaks.

    PubMed

    Kshirsagar, Rucha; Khan, Krishnendu; Joshi, Mamata V; Hosur, Ramakrishna V; Muniyappa, K

    2017-05-23

    A plethora of evidence suggests that different types of DNA quadruplexes are widely present in the genome of all organisms. The existence of a growing number of proteins that selectively bind and/or process these structures underscores their biological relevance. Moreover, G-quadruplex DNA has been implicated in the alignment of four sister chromatids by forming parallel guanine quadruplexes during meiosis; however, the underlying mechanism is not well defined. Here we show that a G/C-rich motif associated with a meiosis-specific DNA double-strand break (DSB) in Saccharomyces cerevisiae folds into G-quadruplex, and the C-rich sequence complementary to the G-rich sequence forms an i-motif. The presence of G-quadruplex or i-motif structures upstream of the green fluorescent protein-coding sequence markedly reduces the levels of gfp mRNA expression in S. cerevisiae cells, with a concomitant decrease in green fluorescent protein abundance, and blocks primer extension by DNA polymerase, thereby demonstrating the functional significance of these structures. Surprisingly, although S. cerevisiae Hop1, a component of synaptonemal complex axial/lateral elements, exhibits strong affinity to G-quadruplex DNA, it displays a much weaker affinity for the i-motif structure. However, the Hop1 C-terminal but not the N-terminal domain possesses strong i-motif binding activity, implying that the C-terminal domain has a distinct substrate specificity. Additionally, we found that Hop1 promotes intermolecular pairing between G/C-rich DNA segments associated with a meiosis-specific DSB site. Our results support the idea that the G/C-rich motifs associated with meiosis-specific DSBs fold into intramolecular G-quadruplex and i-motif structures, both in vitro and in vivo, thus revealing an important link between non-B form DNA structures and Hop1 in meiotic chromosome synapsis and recombination. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  16. [A study of PDE6B gene mutation and phenotype in Chinese cases with retinitis pigmentosa].

    PubMed

    Cui, Yun; Zhao, Kan-xing; Wang, Li; Wang, Qing; Zhang, Wei; Chen, Wei-ying; Wang, Li-ming

    2003-01-01

    To identify the mutation spectrum of phosphodiesterase beta subunit (PDE6B) gene, the incidence in Chinese patients with retinitis pigmentosa (RP) and their clinical phenotypic characteristics. Screening of mutations within PDE6B gene was performed using polymerase chain reaction-heteroduplex-single strand conformation polymorphism (PCR-SSCP) and DNA sequence in 35 autosomal recessive (AR) RP and 55 sporadic RP cases. The phenotypes of the patients with the gene mutation were examined and analyzed. Novel complex heterozygous variants of PDE6B gene in a sporadic case, a T to C transversion in codon 323 resulting in the substitution of Gly by Ser and 2 base pairs (bp: G and T) insert between the 27th-28th bp upstream of the 5'-end of exon 10 were both present in a same isolate RP. But they are not found in 100 unrelated healthy individuals. Ocular findings showed diffuse pigmentary retinal degeneration in the midperipheral and peripheral fundi, optic atrophy and vessel attenuation. Multi-focal ERG indicated that the rod function was more severely deteriorated. A mutation was found in a case with RP in a ARRP family, a G to A transversion at 19th base upstream 5'-end of exon 11 (within intron 10) of PDE6B gene. A sporadic RP carried a sequence variant of PDE6B gene, a G to C transition, at the 15th base adjacent to the 3'-end of exon l8. In another isolate case with RP was found 2 bp (GT) insert between 31st and 32nd base upstream 5'-end of exon 4 (in intron 3) of PDE6B gene. There are novel complex heterozygous mutations of PDE6B gene responsible for a sporadic RP patient in China. This gene mutation associated with rod deterioration and RP. Several DNA variants were found in introns of PDE6B gene in national population.

  17. Motif finding in DNA sequences based on skipping nonconserved positions in background Markov chains.

    PubMed

    Zhao, Xiaoyan; Sze, Sing-Hoi

    2011-05-01

    One strategy to identify transcription factor binding sites is through motif finding in upstream DNA sequences of potentially co-regulated genes. Despite extensive efforts, none of the existing algorithms perform very well. We consider a string representation that allows arbitrary ignored positions within the nonconserved portion of single motifs, and use O(2(l)) Markov chains to model the background distributions of motifs of length l while skipping these positions within each Markov chain. By focusing initially on positions that have fixed nucleotides to define core occurrences, we develop an algorithm to identify motifs of moderate lengths. We compare the performance of our algorithm to other motif finding algorithms on a few benchmark data sets, and show that significant improvement in accuracy can be obtained when the sites are sufficiently conserved within a given sample, while comparable performance is obtained when the site conservation rate is low. A software program (PosMotif ) and detailed results are available online at http://faculty.cse.tamu.edu/shsze/posmotif.

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cheng, J.; Liu, C.; Koopman, W.J.

    Ligation of the Fas cell-surface molecule induces apoptosis. Defective Fas-mediated apoptosis has been associated with spontaneous autoimmunity in mice. Using human Fas/Apo-1 cDNA as a probe, the authors have molecularly cloned and characterized the human Fas chromosomal gene. The gene consists of nine exons and spans more than 26 kilobases of DNA. The lengths of introns vary from > 14 kilobases at the 5` end of the gene to 152 base pairs upstream of the exon encoding the transmembrane domain. The domain structure of the human Fas is encoded by an exon or a set of exons. Primer extension analysismore » revealed three major transcription initiation sites. The promoter region lacked canonical {open_quotes}TATA{close_quotes} and {open_quotes}CAAT{close_quotes} boxes but was a {open_quotes}GC-rich{close_quotes} sequence, and contained consensus sequences for AP-1, GF-1, NY-Y, CP-2, EBP20, and c-myb. These data provide the first characterization of the human Fas gene and insight into its regulatory region. 54 refs., 3 figs., 1 tab.« less

  19. Universal strategies for the DNA-encoding of libraries of small molecules using the chemical ligation of oligonucleotide tags

    PubMed Central

    Litovchick, Alexander; Clark, Matthew A; Keefe, Anthony D

    2014-01-01

    The affinity-mediated selection of large libraries of DNA-encoded small molecules is increasingly being used to initiate drug discovery programs. We present universal methods for the encoding of such libraries using the chemical ligation of oligonucleotides. These methods may be used to record the chemical history of individual library members during combinatorial synthesis processes. We demonstrate three different chemical ligation methods as examples of information recording processes (writing) for such libraries and two different cDNA-generation methods as examples of information retrieval processes (reading) from such libraries. The example writing methods include uncatalyzed and Cu(I)-catalyzed alkyne-azide cycloadditions and a novel photochemical thymidine-psoralen cycloaddition. The first reading method “relay primer-dependent bypass” utilizes a relay primer that hybridizes across a chemical ligation junction embedded in a fixed-sequence and is extended at its 3′-terminus prior to ligation to adjacent oligonucleotides. The second reading method “repeat-dependent bypass” utilizes chemical ligation junctions that are flanked by repeated sequences. The upstream repeat is copied prior to a rearrangement event during which the 3′-terminus of the cDNA hybridizes to the downstream repeat and polymerization continues. In principle these reading methods may be used with any ligation chemistry and offer universal strategies for the encoding (writing) and interpretation (reading) of DNA-encoded chemical libraries. PMID:25483841

  20. What Information is Stored in DNA: Does it Contain Digital Error Correcting Codes?

    NASA Astrophysics Data System (ADS)

    Liebovitch, Larry

    1998-03-01

    The longest term correlations in living systems are the information stored in DNA which reflects the evolutionary history of an organism. The 4 bases (A,T,G,C) encode sequences of amino acids as well as locations of binding sites for proteins that regulate DNA. The fidelity of this important information is maintained by ANALOG error check mechanisms. When a single strand of DNA is replicated the complementary base is inserted in the new strand. Sometimes the wrong base is inserted that sticks out disrupting the phosphate backbone. The new base is not yet methylated, so repair enzymes, that slide along the DNA, can tear out the wrong base and replace it with the right one. The bases in DNA form a sequence of 4 different symbols and so the information is encoded in a DIGITAL form. All the digital codes in our society (ISBN book numbers, UPC product codes, bank account numbers, airline ticket numbers) use error checking code, where some digits are functions of other digits to maintain the fidelity of transmitted informaiton. Does DNA also utitlize a DIGITAL error chekcing code to maintain the fidelity of its information and increase the accuracy of replication? That is, are some bases in DNA functions of other bases upstream or downstream? This raises the interesting mathematical problem: How does one determine whether some symbols in a sequence of symbols are a function of other symbols. It also bears on the issue of determining algorithmic complexity: What is the function that generates the shortest algorithm for reproducing the symbol sequence. The error checking codes most used in our technology are linear block codes. We developed an efficient method to test for the presence of such codes in DNA. We coded the 4 bases as (0,1,2,3) and used Gaussian elimination, modified for modulus 4, to test if some bases are linear combinations of other bases. We used this method to analyze the base sequence in the genes from the lac operon and cytochrome C. We did not find evidence for such error correcting codes in these genes. However, we analyzed only a small amount of DNA and if digitial error correcting schemes are present in DNA, they may be more subtle than such simple linear block codes. The basic issue we raise here, is how information is stored in DNA and an appreciation that digital symbol sequences, such as DNA, admit of interesting schemes to store and protect the fidelity of their information content. Liebovitch, Tao, Todorov, Levine. 1996. Biophys. J. 71:1539-1544. Supported by NIH grant EY6234.

  1. Factors affecting expression of the recF gene of Escherichia coli K-12.

    PubMed

    Sandler, S J; Clark, A J

    1990-01-31

    This report describes four factors which affect expression of the recF gene from strong upstream lambda promoters under temperature-sensitive cIAt2-encoded repressor control. The first factor was the long mRNA leader sequence consisting of the Escherichia coli dnaN gene and 95% of the dnaA gene and lambda bet, N (double amber) and 40% of the exo gene. When most of this DNA was deleted, RecF became detectable in maxicells. The second factor was the vector, pBEU28, a runaway replication plasmid. When we substituted pUC118 for pBEU28, RecF became detectable in whole cells by the Coomassie blue staining technique. The third factor was the efficiency of initiation of translation. We used site-directed mutagenesis to change the mRNA leader, ribosome-binding site and the 3 bp before and after the translational start codon. Monitoring the effect of these mutational changes by translational fusion to lacZ, we discovered that the efficiency of initiation of translation was increased 30-fold. Only an estimated two- or threefold increase in accumulated levels of RecF occurred, however. This led us to discover the fourth factor, namely sequences in the recF gene itself. These sequences reduce expression of the recF-lacZ fusion genes 100-fold. The sequences responsible for this decrease in expression occur in four regions in the N-terminal half of recF. Expression is reduced by some sequences at the transcriptional level and by others at the translational level.

  2. Molecular characterization of the Serratia marcescens OmpF porin, and analysis of S. marcescens OmpF and OmpC osmoregulation.

    PubMed

    Hutsul, J A; Worobec, E

    1997-08-01

    Serratia marcescens is a nosocomial pathogen with a high incidence of beta-lactam resistance. Reduced amounts of outer-membrane porins have been correlated with increased resistance to beta-lactams but only one porin, OmpC, has been characterized at the molecular level. In this study we present the molecular characterization of a second porin, OmpF, and an analysis of the expression of S. marcescens porins in response to various environmental changes. Two porins were isolated from the outer membrane using urea-SDS-PAGE and the relative amounts were shown to be influenced by the osmolarity of the medium and the presence of salicylate. From a S. marcescens genomic DNA library an 8 kb EcoRI fragment was isolated that hybridized with an oligonucleotide encoding the published N-terminal amino acid sequence of the S. marcescens 41 kDa porin. A 41 kDa protein was detected in the outer membrane of Escherichia coli NM522 carrying the cloned S. marcescens DNA. The cloned gene was sequenced and shown to code for a protein that shared 60-70% identity with other known OmpF and OmpC sequences. The upstream DNA sequence of the S. marcescens gene was similar to the corresponding E. coli ompF sequence; however, a regulatory element important in repression of E. coli ompF at high osmolarity was absent. The cloned S. marcescens OmpF in E. coli increased in expression in conditions of high osmolarity. The potential involvement of micF in the observed osmoregulation of S. marcescens porins is discussed.

  3. Epigenetic Control of Gonadal Aromatase (cyp19a1) in Temperature-Dependent Sex Determination of Red-Eared Slider Turtles

    PubMed Central

    Matsumoto, Yuiko; Buemio, Alvin; Chu, Randy; Vafaee, Mozhgon; Crews, David

    2013-01-01

    In the red-eared slider turtle (Trachemys scripta), a species with temperature-dependent sex determination (TSD), the expression of the aromatase gene during gonad development is strictly limited to the female-producing temperature. The underlying mechanism remains unknown. In this study, we identified the upstream 5′-flanking region of the aromatase gene, gonad-specific promoter, and the temperature-dependent DNA methylation signatures during gonad development in the red-eared slider turtle. The 5′-flanking region of the slider aromatase exhibited sequence similarities to the aromatase genes of the American alligator, chicken, quail, and zebra finch. A putative TATA box was located 31 bp upstream of the gonad-specific transcription start site. DNA methylation at the CpG sites between the putative binding sites of the fork head domain factor (FOX) and vertebrate steroidogenic factor 1 (SF1) and adjacent TATA box in the promoter region were significantly lower in embryonic gonads at the female-producing temperature compared the male-producing temperature. A shift from male- to female-, but not from female- to male-, producing temperature changed the level of DNA methylation in gonads. Taken together these results indicate that the temperature, particularly female-producing temperature, allows demethylation at the specific CpG sites of the promoter region which leads the temperature-specific expression of aromatase during gonad development. PMID:23762231

  4. Properties of an intergenic terminator and start site switch that regulate IMD2 transcription in yeast.

    PubMed

    Jenks, M Harley; O'Rourke, Thomas W; Reines, Daniel

    2008-06-01

    The IMD2 gene in Saccharomyces cerevisiae is regulated by intracellular guanine nucleotides. Regulation is exerted through the choice of alternative transcription start sites that results in synthesis of either an unstable short transcript terminating upstream of the start codon or a full-length productive IMD2 mRNA. Start site selection is dictated by the intracellular guanine nucleotide levels. Here we have mapped the polyadenylation sites of the upstream, unstable short transcripts that form a heterogeneous family of RNAs of approximately 200 nucleotides. The switch from the upstream to downstream start sites required the Rpb9 subunit of RNA polymerase II. The enzyme's ability to locate the downstream initiation site decreased exponentially as the start was moved downstream from the TATA box. This suggests that RNA polymerase II's pincer grip is important as it slides on DNA in search of a start site. Exosome degradation of the upstream transcripts was highly dependent upon the distance between the terminator and promoter. Similarly, termination was dependent upon the Sen1 helicase when close to the promoter. These findings extend the emerging concept that distinct modes of termination by RNA polymerase II exist and that the distance of the terminator from the promoter, as well as its sequence, is important for the pathway chosen.

  5. Cloning should be simple: Escherichia coli DH5α-mediated assembly of multiple DNA fragments with short end homologies

    DOE PAGES

    Kostylev, Maxim; Otwell, Anne E.; Richardson, Ruth E.; ...

    2015-09-08

    Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six doublestranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processesmore » associated with most common applications of DNA assembly. In addition, we demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work.« less

  6. Cloning should be simple: Escherichia coli DH5α-mediated assembly of multiple DNA fragments with short end homologies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kostylev, Maxim; Otwell, Anne E.; Richardson, Ruth E.

    Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six doublestranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processesmore » associated with most common applications of DNA assembly. In addition, we demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work.« less

  7. Evolutionary differences in chromosomal locations of four early genes of the tryptophan pathway in fluorescent pseudomonads: DNA sequences and characterization of Pseudomonas putida trpE and trpGDC.

    PubMed

    Essar, D W; Eberly, L; Crawford, I P

    1990-02-01

    Pseudomonas putida possesses seven structural genes for enzymes of the tryptophan pathway. All but one, trpG, which encodes the small (beta) subunit of anthranilate synthase, have been mapped on the circular chromosome. This report describes the cloning and sequencing of P. putida trpE, trpG, trpD, and trpC. In P. putida and Pseudomonas aeruginosa, DNA sequence analysis as well as growth and enzyme assays of insertionally inactivated strains indicated that trpG is the first gene in a three-gene operon that also contains trpD and trpC. In P. putida, trpE is 2.2 kilobases upstream from the trpGDC cluster, whereas in P. aeruginosa, they are separated by at least 25 kilobases (T. Shinomiya, S. Shiga, and M. Kageyama, Mol. Gen. Genet., 189:382-389, 1983). The DNA sequence in P. putida shows an open reading frame on the opposite strand between trpE and trpGDC; this putative gene was not characterized. Evidence is also presented for sequence similarities in the 5' untranslated regions of trpE and trpGDC in both pseudomonads; the function of these regions is unknown, but it is possible that they play some role in regulation of these genes, since all the genes respond to repression by tryptophan. The sequences of the anthranilate synthase genes in the fluorescent pseudomonads resemble those of p-aminobenzoate synthase genes of the enteric bacteria more closely than the anthranilate synthase genes of those organisms; however, no requirement for p-aminobenzoate was found in the Pseudomonas mutants created in this study.

  8. In vitro transcription of a cloned mouse ribosomal RNA gene.

    PubMed Central

    Mishima, Y; Yamamoto, O; Kominami, R; Muramatsu, M

    1981-01-01

    An in vitro transcription system which utilizes cloned mouse ribosomal RNA gene (rDNA) fragments and a mouse cell extract has been developed. RNA polymerases I is apparently responsible for this transcription as evidenced by the complete resistance to a high concentration (200 micrograms/ml) of alpha-amanitin. Run-off products obtained with three different truncated rDNA fragments indicated that RNA was transcribed from a unique site of rDNA. The S1 nuclease protection mapping of the in vitro product and of in vivo 45S RNA confirmed this site, indicating that, in this in vitro system, transcription of rDNA started from the same site as in vivo. This site is located at several hundred nucleotides upstream from the putative initiation site reported by us (1) and by others (2). Some sequence homology surrounding this region was noted among mouse, Xenopus laevis and Drosophila melanogaster. The data also suggest that some processing of the primary transcript occurs in this in vitro system. Images PMID:6278446

  9. Regulation of SNM1, an inducible Saccharomyces cerevisiae gene required for repair of DNA cross-links.

    PubMed

    Wolter, R; Siede, W; Brendel, M

    1996-02-05

    The interstrand cross-link repair gene SNM1 of Saccharomyces cerevisiae was examined for regulation in response to DNA-damaging agents. Induction of SNM1-lacZ fusions was detected in response to nitrogen mustard, cis-platinum (II) diamine dichloride, UV light, and 8-methoxypsoralen + UVA, but not after heat-shock treatment or incubation with 2-dimethylaminoethylchloride, methylmethane sulfonate or 4-nitroquinoline-N-oxide. The promoter of SNM1 contains a 15 bp motif, which shows homology to the DRE2 box of the RAD2 promoter. Similar motifs have been found in promoter regions of other damage-inducible DNA repair genes. Deletion of this motif results in loss of inducibility of SNM1. Also, a putative negative upstream regulation sequence was found to be responsible for repression of constitutive transcription of SNM1. Surprisingly, no inducibility of SNM1 was found after treatment with DNA-damaging agents in strains without an intact DUN1 gene, while regulation seems unchanged in sad1 mutants.

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kennedy, M.A.; Morris, C.M.; Fitzgerald, P.H.

    The human kappa deleting element (Kde) mediates loss of CK and JK genes in B cells. A probe for Kde detects two genomic sequences on Southern blots. The Kde is located 24kb 3{prime} to CK, but the position of the homologous sequence is unknown. The authors in situ hybridized m141-2 to metaphase cells of JC11, a B-cell line bearing a t(2;14)(p11;q32) in which the chromosome 2 breakpoint is within JK or the VK-JK intron. Three peaks of labelled sites were obtained. Southern analysis of BamH1 digested DNA showed that Kde (14kb) and the homologous sequence (3kb) were both intact. Kdemore » accounts for hybridization to 14q+ and the 2p- signal presumably derives from the related sequence. This locates the sequence homologous to Kde upstream from JK, possibly within the VK cluster, and may reflect transposition or some other duplicative event as proposed for the evolution of other regions of the kappa locus.« less

  11. Recombined sequences between the non-coding control regions of JC and BK viruses found in the urine of a renal transplantation patient.

    PubMed

    Liaw, Yu-Ching; Chen, Cheng-Hsu; Shu, Kuo-Hsiung; Fang, Chiung-Yao; Ou, Wei-Chih; Chen, Pei-Lain; Shen, Cheng-Huang; Lin, Mien-Chun; Chang, Deching; Wang, Meilin

    2012-12-01

    Kidney cells are the common host for JC virus (JCV) and BK virus (BKV). Reactivation of JCV and/or BKV in patients after organ transplantation, such as renal transplantation, may cause hemorrhagic cystitis and polyomavirus-associated nephropathy. Furthermore, JCV and BKV may be shed in the urine after reactivation in the kidney. Rearranged as well as archetypal non-coding control regions (NCCRs) of JCV and BKV have been frequently identified in human samples. In this study, three JC/BK recombined NCCR sequences were identified in the urine of a patient who had undergone renal transplantation. They were designated as JC-BK hybrids 1, 2, and 3. The three JC/BK recombinant NCCRs contain up-stream JCV as well as down-stream BKV sequences. Deletions of both JCV and BKV sequences were found in these recombined NCCRs. Recombination of DNA sequences between JCV and BKV may occur during co-infection due to the relatively high homology of the two viral genomes.

  12. Genome-wide mapping of autonomous promoter activity in human cells

    PubMed Central

    van Arensbergen, Joris; FitzPatrick, Vincent D.; de Haas, Marcel; Pagie, Ludo; Sluimer, Jasper; Bussemaker, Harmen J.; van Steensel, Bas

    2017-01-01

    Previous methods to systematically characterize sequence-intrinsic activity of promoters have been limited by relatively low throughput and the length of sequences that could be tested. Here we present Survey of Regulatory Elements (SuRE), a method to assay more than 108 DNA fragments, each 0.2–2kb in size, for their ability to drive transcription autonomously. In SuRE, a plasmid library is constructed of random genomic fragments upstream of a 20bp barcode and decoded by paired-end sequencing. This library is then transfected into cells and transcribed barcodes are quantified in the RNA by high throughput sequencing. When applied to the human genome, we achieved a 55-fold genome coverage, allowing us to map autonomous promoter activity genome-wide. By computational modeling we delineated subregions within promoters that are relevant for their activity. For instance, we show that antisense promoter transcription is generally dependent on the sense core promoter sequences, and that most enhancers and several families of repetitive elements act as autonomous transcription initiation sites. PMID:28024146

  13. Genomewide analysis indicates that queen larvae have lower methylation levels in the honey bee ( Apis mellifera)

    NASA Astrophysics Data System (ADS)

    Shi, Yuan Yuan; Yan, Wei Yu; Huang, Zachary Y.; Wang, Zi Long; Wu, Xiao Bo; Zeng, Zhi Jiang

    2013-02-01

    The honey bee is a social insect characterized by caste differentiation, by which a young larva can develop into either a queen or a worker. Despite possessing the same genome, queen and workers display marked differences in reproductive capacity, physiology, and behavior. Recent studies have shown that DNA methylation plays important roles in caste differentiation. To further explore the roles of DNA methylation in this process, we analyzed DNA methylome profiles of both queen larvae (QL) and worker larvae (WL) of different ages (2, 4, and 6 day old), by using methylated DNA immunoprecipitation-sequencing (meDIP-seq) technique. The global DNA methylation levels varied between the larvae of two castes. DNA methylation increased from 2-day- to 4-day-old QL and then decreased in 6-day-old larvae. In WL, methylation levels increased with age. The methylcytosines in both larvae were enriched in introns, followed by coding sequence (CDS) regions, CpG islands, 2 kbp downstream and upstream of genes, and 5' and 3' untranslated regions (UTRs). The number of differentially methylated genes (DMGs) in 2-, 4-, and 6-day-old QL and WL was 725, 3,013, and 5,049, respectively. Compared to 4- and 6-day-old WL, a large number of genes in QL were downmethylated, which were involved in many processes including development, reproduction, and metabolic regulation. In addition, some DMGs were concerned with caste differentiation.

  14. Increased expression of Aspergillus parasiticus aflR, encoding a sequence-specific DNA-binding protein, relieves nitrate inhibition of aflatoxin biosynthesis.

    PubMed Central

    Chang, P K; Ehrlich, K C; Yu, J; Bhatnagar, D; Cleveland, T E

    1995-01-01

    The aflR gene from Aspergillus parasiticus and Aspergillus flavus may be involved in the regulation of aflatoxin biosynthesis. The aflR gene product, AFLR, possesses a GAL4-type binuclear zinc finger DNA-binding domain. A transformant, SU1-N3 (pHSP), containing an additional copy of aflR, showed increased transcription of aflR and the aflatoxin pathway structural genes, nor-1, ver-1, and omt-1, when cells were grown in nitrate medium, which normally suppresses aflatoxin production. Electrophoretic mobility shift assays showed that the recombinant protein containing the DNA-binding domain, AFLR1, bound specifically to the palindromic sequence, TTAGGCCTAA, 120 bp upstream of the AFLR translation start site. Expression of aflR thus appears to be autoregulated. Increased expression of aflatoxin biosynthetic genes in the transformant might result from an elevated basal level of AFLR, allowing it to overcome nitrate inhibition and to bind to the aflR promotor region, thereby initiating aflatoxin biosynthesis. Results further suggest that aflR is involved in the regulation of multiple parts of the aflatoxin biosynthetic pathway. PMID:7793958

  15. Chromosome-encoded narrow-spectrum Ambler class A beta-lactamase GIL-1 from Citrobacter gillenii.

    PubMed

    Naas, Thierry; Aubert, Daniel; Ozcan, Ayla; Nordmann, Patrice

    2007-04-01

    A novel beta-lactamase gene was cloned from the whole-cell DNA of an enterobacterial Citrobacter gillenii reference strain that displayed a weak narrow-spectrum beta-lactam-resistant phenotype and was expressed in Escherichia coli. It encoded a clavulanic acid-inhibited Ambler class A beta-lactamase, GIL-1, with a pI value of 7.5 and a molecular mass of ca. 29 kDa. GIL-1 had the highest percent amino acid sequence identity with TEM-1 and SHV-1, 77%, and 67%, respectively, and only 46%, 31%, and 32% amino acid sequence identity with CKO-1 (C. koseri), CdiA1 (C. diversus), and SED-1 (C. sedlaki), respectively. The substrate profile of the purified GIL-1 was similar to that of beta-lactamases TEM-1 and SHV-1. The blaGIL-1 gene was chromosomally located, as revealed by I-CeuI experiments, and was constitutively expressed at a low level in C. gillenii. No gene homologous to the regulatory ampR genes of chromosomal class C beta-lactamases was found upstream of the blaGIL-1 gene, which fits the noninducibility of beta-lactamase expression in C. gillenii. Rapid amplification of DNA 5' ends analysis of the promoter region revealed putative promoter sequences that diverge from what has been identified as the consensus sequence in E. coli. The blaGIL-1 gene was part of a 5.5-kb DNA fragment bracketed by a 9-bp duplication and inserted between the d-lactate dehydrogenase gene and the ydbH genes; this DNA fragment was absent in other Citrobacter species. This work further illustrates the heterogeneity of beta-lactamases in Citrobacter spp., which may indicate that the variability of Citrobacter species is greater than expected.

  16. An Archaeal Immune System Can Detect Multiple Protospacer Adjacent Motifs (PAMs) to Target Invader DNA*

    PubMed Central

    Fischer, Susan; Maier, Lisa-Katharina; Stoll, Britta; Brendel, Jutta; Fischer, Eike; Pfeiffer, Friedhelm; Dyall-Smith, Mike; Marchfelder, Anita

    2012-01-01

    The clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated (Cas) system provides adaptive and heritable immunity against foreign genetic elements in most archaea and many bacteria. Although this system is widespread and diverse with many subtypes, only a few species have been investigated to elucidate the precise mechanisms for the defense of viruses or plasmids. Approximately 90% of all sequenced archaea encode CRISPR/Cas systems, but their molecular details have so far only been examined in three archaeal species: Sulfolobus solfataricus, Sulfolobus islandicus, and Pyrococcus furiosus. Here, we analyzed the CRISPR/Cas system of Haloferax volcanii using a plasmid-based invader assay. Haloferax encodes a type I-B CRISPR/Cas system with eight Cas proteins and three CRISPR loci for which the identity of protospacer adjacent motifs (PAMs) was unknown until now. We identified six different PAM sequences that are required upstream of the protospacer to permit target DNA recognition. This is only the second archaeon for which PAM sequences have been determined, and the first CRISPR group with such a high number of PAM sequences. Cells could survive the plasmid challenge if their CRISPR/Cas system was altered or defective, e.g. by deletion of the cas gene cassette. Experimental PAM data were supplemented with bioinformatics data on Haloferax and Haloquadratum. PMID:22767603

  17. Characterization of 5' end of human thromboxane receptor gene. Organizational analysis and mapping of protein kinase C--responsive elements regulating expression in platelets.

    PubMed

    D'Angelo, D D; Davis, M G; Houser, W A; Eubank, J J; Ritchie, M E; Dorn, G W

    1995-09-01

    Platelet thromboxane receptors are acutely and reversibly upregulated after acute myocardial infarction. To determine if platelet thromboxane receptors are under transcriptional control, we isolated and characterized human genomic DNA clones containing the 5' flanking region of the thromboxane receptor gene. The exon-intron structure of the 5' portion of the thromboxane receptor gene was determined initially by comparing the nucleotide sequence of the 5' flanking genomic clone with that of a novel human uterine thromboxane receptor cDNA that extended the mRNA 141 bp further upstream than the previously identified human placental cDNA. A major transcription initiation site was located in three human tissues approximately 560 bp upstream from the translation initiation codon and 380 bp upstream from any previously identified transcription initiation site. The thromboxane receptor gene has neither a TATA nor a CAAT consensus site. Promoter function of the 5' flanking region of the thromboxane receptor gene was evaluated by transfection of thromboxane receptor gene promoter/chloramphenicol acetyltransferase (CAT) chimera plasmids into platelet-like K562 cells. Thromboxane receptor promoter activity, as assessed by CAT expression, was relatively weak but was significantly enhanced by phorbol ester treatment. Functional analysis of 5' deletion constructs in transfected K562 cells and gel mobility shift localized the major phorbol ester-responsive motifs in the thromboxane receptor gene promoter to a cluster of activator protein-2 (AP-2) binding consensus sites located approximately 1.8 kb 5' from the transcription initiation site. These studies are the first to determine the structure and organization of the 5' end of the thromboxane receptor gene and demonstrate that thromboxane receptor gene expression can be regulated by activation of protein kinase C via induction of an AP-2-like nuclear factor binding to upstream promoter elements. These findings strongly suggest that the mechanism for previously described upregulation of platelet thromboxane receptors after acute myocardial infarction is increased thromboxane receptor gene transcription in platelet-progenitor cells.

  18. Molecular Characterization of Lactobacillus plantarum DMDL 9010, a Strain with Efficient Nitrite Degradation Capacity

    PubMed Central

    Fei, Yong-tao; Liu, Dong-mei; Luo, Tong-hui; Chen, Gu; Wu, Hui; Li, Li; Yu, Yi-gang

    2014-01-01

    Nitrites commonly found in food, especially in fermented vegetables, are potential carcinogens. Therefore, limiting nitrites in food is critically important for food safety. A Lactobacillus strain (Lactobacillus sp. DMDL 9010) was previously isolated from fermented vegetables by our group, and is not yet fully characterized. A number of phenotypical and genotypical approaches were employed to characterize Lactobacillus sp. DMDL 9010. Its nitrite degradation capacity was compared with four other Lactobacillus strains, including Lactobacillus casei subsp. rhamnosus 719, Lactobacillus delbrueckii subsp. bulgaricu 1.83, Streptococcus thermophilus 1.204, and lactobacillus plantarum 8140, on MRS medium. Compared to these four Lactobacillus strains, Lactobacillus sp. DMDL 9010 had a significantly higher nitrite degradation capacity (P<0.001). Based on 16S rDNA sequencing and sequence comparison, Lactobacillus sp. DMDL 9010 was identified as either Lactobacillus plantarum or Lactobacillus pentosus. To further identify this strain, the flanking regions (922 bp and 806 bp upstream and downstream, respectively) of the L-lactate dehydrogenase 1 (L-ldh1) gene were amplified and sequenced. Lactobacillus sp. DMDL 9010 had 98.92 and 76.98% sequence identity in the upstream region with L. plantarum WCFS1 and L. pentosus IG1, respectively, suggesting that Lactobacillu sp. DMDL 9010 is an L. plantarum strain. It was therefore named L. plantarum DMDL 9010. Our study provides a platform for genetic engineering of L. plantarum DMDL 9010, in order to further improve its nitrite degradation capacity. PMID:25423449

  19. Molecular characterization of Lactobacillus plantarum DMDL 9010, a strain with efficient nitrite degradation capacity.

    PubMed

    Fei, Yong-tao; Liu, Dong-mei; Luo, Tong-hui; Chen, Gu; Wu, Hui; Li, Li; Yu, Yi-gang

    2014-01-01

    Nitrites commonly found in food, especially in fermented vegetables, are potential carcinogens. Therefore, limiting nitrites in food is critically important for food safety. A Lactobacillus strain (Lactobacillus sp. DMDL 9010) was previously isolated from fermented vegetables by our group, and is not yet fully characterized. A number of phenotypical and genotypical approaches were employed to characterize Lactobacillus sp. DMDL 9010. Its nitrite degradation capacity was compared with four other Lactobacillus strains, including Lactobacillus casei subsp. rhamnosus 719, Lactobacillus delbrueckii subsp. bulgaricu 1.83, Streptococcus thermophilus 1.204, and lactobacillus plantarum 8140, on MRS medium. Compared to these four Lactobacillus strains, Lactobacillus sp. DMDL 9010 had a significantly higher nitrite degradation capacity (P<0.001). Based on 16S rDNA sequencing and sequence comparison, Lactobacillus sp. DMDL 9010 was identified as either Lactobacillus plantarum or Lactobacillus pentosus. To further identify this strain, the flanking regions (922 bp and 806 bp upstream and downstream, respectively) of the L-lactate dehydrogenase 1 (L-ldh1) gene were amplified and sequenced. Lactobacillus sp. DMDL 9010 had 98.92 and 76.98% sequence identity in the upstream region with L. plantarum WCFS1 and L. pentosus IG1, respectively, suggesting that Lactobacillu sp. DMDL 9010 is an L. plantarum strain. It was therefore named L. plantarum DMDL 9010. Our study provides a platform for genetic engineering of L. plantarum DMDL 9010, in order to further improve its nitrite degradation capacity.

  20. Transcription initiation from the dihydrofolate reductase promoter is positioned by HIP1 binding at the initiation site.

    PubMed

    Means, A L; Farnham, P J

    1990-02-01

    We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).

  1. Adenovirus EIIA early promoter: transcriptional control elements and induction by the viral pre-early EIA gene, which appears to be sequence independent.

    PubMed Central

    Murthy, S C; Bhat, G P; Thimmappaya, B

    1985-01-01

    A molecular dissection of the adenovirus EIIA early (E) promoter was undertaken to study the sequence elements required for transcription and to examine the nucleotide sequences, if any, specific for its trans-activation by the viral pre-early EIA gene product. A chimeric gene in which the EIIA-E promoter region fused to the coding sequences of the bacterial chloramphenicol acetyltransferase (CAT) gene was used in transient assays to identify the transcriptional control regions. Deletion mapping studies revealed that the upstream DNA sequences up to -86 were sufficient for the optimal basal level transcription in HeLa cells and also for the EIA-induced transcription. A series of linker-scanning (LS) mutants were constructed to precisely identify the nucleotide sequences that control transcription. Analysis of these LS mutants allowed us to identify two regions of the promoter that are critical for the EIIA-E transcription. These regions are located between -29 and -21 (region I) and between -82 and -66 (region II). Mutations in region I affected initiation and appeared functionally similar to the "TATA" sequence of the commonly studied promoters. To examine whether or not the EIIA-E promoter contained DNA sequences specific for the trans-activation by the EIA, the LS mutants were analyzed in a cotransfection assay containing a plasmid carrying the EIA gene. CAT activity of all of the LS mutants was induced by the EIA gene in this assay, suggesting that the induction of transcription of the EIIA-E promoter by the EIA gene is not sequence-specific. Images PMID:3857577

  2. Phyloscan: locating transcription-regulating binding sites in mixed aligned and unaligned sequence data.

    PubMed

    Palumbo, Michael J; Newberg, Lee A

    2010-07-01

    The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).

  3. Cloning, sequencing, and expression of the Zymomonas mobilis phosphoglycerate mutase gene (pgm) in Escherichia coli.

    PubMed Central

    Yomano, L P; Scopes, R K; Ingram, L O

    1993-01-01

    Phosphoglycerate mutase is an essential glycolytic enzyme for Zymomonas mobilis, catalyzing the reversible interconversion of 3-phosphoglycerate and 2-phosphoglycerate. The pgm gene encoding this enzyme was cloned on a 5.2-kbp DNA fragment and expressed in Escherichia coli. Recombinants were identified by using antibodies directed against purified Z. mobilis phosphoglycerate mutase. The pgm gene contains a canonical ribosome-binding site, a biased pattern of codon usage, a long upstream untranslated region, and four promoters which share sequence homology. Interestingly, adhA and a D-specific 2-hydroxyacid dehydrogenase were found on the same DNA fragment and appear to form a cluster of genes which function in central metabolism. The translated sequence for Z. mobilis pgm was in full agreement with the 40 N-terminal amino acid residues determined by protein sequencing. The primary structure of the translated sequence is highly conserved (52 to 60% identity with other phosphoglycerate mutases) and also shares extensive homology with bisphosphoglycerate mutases (51 to 59% identity). Since Southern blots indicated the presence of only a single copy of pgm in the Z. mobilis chromosome, it is likely that the cloned pgm gene functions to provide both activities. Z. mobilis phosphoglycerate mutase is unusual in that it lacks the flexible tail and lysines at the carboxy terminus which are present in the enzyme isolated from all other organisms examined. Images PMID:8320209

  4. Engineering an efficient and tight D-amino acid-inducible gene expression system in Rhodosporidium/Rhodotorula species.

    PubMed

    Liu, Yanbin; Koh, Chong Mei John; Ngoh, Si Te; Ji, Lianghui

    2015-10-26

    Rhodosporidium and Rhodotorula are two genera of oleaginous red yeast with great potential for industrial biotechnology. To date, there is no effective method for inducible expression of proteins and RNAs in these hosts. We have developed a luciferase gene reporter assay based on a new codon-optimized LUC2 reporter gene (RtLUC2), which is flanked with CAR2 homology arms and can be integrated into the CAR2 locus in the nuclear genome at >90 % efficiency. We characterized the upstream DNA sequence of a D-amino acid oxidase gene (DAO1) from R. toruloides ATCC 10657 by nested deletions. By comparing the upstream DNA sequences of several putative DAO1 homologs of Basidiomycetous fungi, we identified a conserved DNA motif with a consensus sequence of AGGXXGXAGX11GAXGAXGG within a 0.2 kb region from the mRNA translation initiation site. Deletion of this motif led to strong mRNA transcription under non-inducing conditions. Interestingly, DAO1 promoter activity was enhanced about fivefold when the 108 bp intron 1 was included in the reporter construct. We identified a conserved CT-rich motif in the intron with a consensus sequence of TYTCCCYCTCCYCCCCACWYCCGA, deletion or point mutations of which drastically reduced promoter strength under both inducing and non-inducing conditions. Additionally, we created a selection marker-free DAO1-null mutant (∆dao1e) which displayed greatly improved inducible gene expression, particularly when both glucose and nitrogen were present in high levels. To avoid adding unwanted peptide to proteins to be expressed, we converted the original translation initiation codon to ATC and re-created a translation initiation codon at the start of exon 2. This promoter, named P DAO1-in1m1 , showed very similar luciferase activity to the wild-type promoter upon induction with D-alanine. The inducible system was tunable by adjusting the levels of inducers, carbon source and nitrogen source. The intron 1-containing DAO1 promoters coupled with a DAO1 null mutant makes an efficient and tight D-amino acid-inducible gene expression system in Rhodosporidium and Rhodotorula genera. The system will be a valuable tool for metabolic engineering and enzyme expression in these yeast hosts.

  5. Identification of the target DNA sequence and characterization of DNA binding features of HlyU, and suggestion of a redox switch for hlyA expression in the human pathogen Vibrio cholerae from in silico studies.

    PubMed

    Mukherjee, Debadrita; Pal, Aritrika; Chakravarty, Devlina; Chakrabarti, Pinak

    2015-02-18

    HlyU, a transcriptional regulator common in many Vibrio species, activates the hemolysin gene hlyA in Vibrio cholerae, the rtxA1 operon in Vibrio vulnificus and the genes of plp-vah1 and rtxACHBDE gene clusters in Vibrio anguillarum. The protein is also proposed to be a potential global virulence regulator for V. cholerae and V. vulnificus. Mechanisms of gene control by HlyU in V. vulnificus and V. anguillarum are reported. However, detailed elucidation of the interaction of HlyU in V. cholerae with its target DNA at the molecular level is not available. Here we report a 17-bp imperfect palindrome sequence, 5'-TAATTCAGACTAAATTA-3', 173 bp upstream of hlyA promoter, as the binding site of HlyU. This winged helix-turn-helix protein binds necessarily as a dimer with the recognition helices contacting the major grooves and the β-sheet wings, the minor grooves. Such interactions enhance hlyA promoter activity in vivo. Mutations affecting dimerization as well as those in the DNA-protein interface hamper DNA binding and transcription regulation. Molecular dynamic simulations show hydrogen bonding patterns involving residues at the mutation sites and confirmed their importance in DNA binding. On binding to HlyU, DNA deviates by ∼68º from linearity. Dynamics also suggest a possible redox control in HlyU. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Identification and characterization of novel and potent transcription promoters of Francisella tularensis.

    PubMed

    Zaide, Galia; Grosfeld, Haim; Ehrlich, Sharon; Zvi, Anat; Cohen, Ofer; Shafferman, Avigdor

    2011-03-01

    Two alternative promoter trap libraries, based on the green fluorescence protein (gfp) reporter and on the chloramphenicol acetyltransferase (cat) cassette, were constructed for isolation of potent Francisella tularensis promoters. Of the 26,000 F. tularensis strain LVS gfp library clones, only 3 exhibited visible fluorescence following UV illumination and all appeared to carry the bacterioferritin promoter (Pbfr). Out of a total of 2,000 chloramphenicol-resistant LVS clones isolated from the cat promoter library, we arbitrarily selected 40 for further analysis. Over 80% of these clones carry unique F. tularensis DNA sequences which appear to drive a wide range of protein expression, as determined by specific chloramphenicol acetyltransferase (CAT) Western dot blot and enzymatic assays. The DNA sequence information for the 33 unique and novel F. tularensis promoters reported here, along with the results of in silico and primer extension analyses, suggest that F. tularensis possesses classical Escherichia coli σ(70)-related promoter motifs. These motifs include the -10 (TATAAT) and -35 [TTGA(C/T)A] domains and an AT-rich region upstream from -35, reminiscent of but distinct from the E. coli upstream region that is termed the UP element. The most efficient promoter identified (Pbfr) appears to be about 10 times more potent than the F. tularensis groEL promoter and is probably among the strongest promoters in F. tularensis. The battery of promoters identified in this work will be useful, among other things, for genetic manipulation in the background of F. tularensis intended to gain better understanding of the mechanisms involved in pathogenesis and virulence, as well as for vaccine development studies.

  7. Isolation and functional characterization of TIF-IB, a factor that confers promoter specificity to mouse RNA polymerase I.

    PubMed

    Schnapp, A; Clos, J; Hädelt, W; Schreck, R; Cvekl, A; Grummt, I

    1990-03-25

    The murine ribosomal gene promoter contains two cis-acting control elements which operate in concert to promote efficient and accurate transcription initiation by RNA polymerase I. The start site proximal core element which is indispensable for promoter recognition by RNA polymerase I (pol I) encompasses sequences from position -39 to -1. An upstream control element (UCE) which is located between nucleotides -142 and -112 stimulates the efficiency of transcription initiation both in vivo and in vitro. Here we report the isolation and functional characterization of a specific rDNA binding protein, the transcription initiation factor TIF-IB, which specifically interacts with the core region of the mouse ribosomal RNA gene promoter. Highly purified TIF-IB complements transcriptional activity in the presence of two other essential initiation factors TIF-IA and TIF-IC. We demonstrate that the binding efficiency of purified TIF-IB to the core promoter is strongly enhanced by the presence in cis of the UCE. This positive effect of upstream sequences on TIF-IB binding is observed throughout the purification procedure suggesting that the synergistic action of the two distant promoter elements is not mediated by a protein different from TIF-IB. Increasing the distance between both control elements still facilitates stable factor binding but eliminates transcriptional activation. The results demonstrate that TIF-IB binding to the rDNA promoter is an essential early step in the assembly of a functional transcription initiation complex. The subsequent interaction of TIF-IB with other auxiliary transcription initiation factors, however, requires the correct spacing between the UCE and the core promoter element.

  8. Transcription of Two Adjacent Carbohydrate Utilization Gene Clusters in Bifidobacterium breve UCC2003 Is Controlled by LacI- and Repressor Open Reading Frame Kinase (ROK)-Type Regulators

    PubMed Central

    O'Connell, Kerry Joan; O'Connell Motherway, Mary; Liedtke, Andrea; Fitzgerald, Gerald F.; Ross, R. Paul; Stanton, Catherine; Zomer, Aldert

    2014-01-01

    Members of the genus Bifidobacterium are commonly found in the gastrointestinal tracts of mammals, including humans, where their growth is presumed to be dependent on various diet- and/or host-derived carbohydrates. To understand transcriptional control of bifidobacterial carbohydrate metabolism, we investigated two genetic carbohydrate utilization clusters dedicated to the metabolism of raffinose-type sugars and melezitose. Transcriptomic and gene inactivation approaches revealed that the raffinose utilization system is positively regulated by an activator protein, designated RafR. The gene cluster associated with melezitose metabolism was shown to be subject to direct negative control by a LacI-type transcriptional regulator, designated MelR1, in addition to apparent indirect negative control by means of a second LacI-type regulator, MelR2. In silico analysis, DNA-protein interaction, and primer extension studies revealed the MelR1 and MelR2 operator sequences, each of which is positioned just upstream of or overlapping the correspondingly regulated promoter sequences. Similar analyses identified the RafR binding operator sequence located upstream of the rafB promoter. This study indicates that transcriptional control of gene clusters involved in carbohydrate metabolism in bifidobacteria is subject to conserved regulatory systems, representing either positive or negative control. PMID:24705323

  9. Sequences required for transcription termination at the intrinsic lambdatI terminator.

    PubMed

    Martínez-Trujillo, Miguel; Sánchez-Trujillo, Alejandra; Ceja, Víctor; Avila-Moreno, Federico; Bermúdez-Cruz, Rosa María; Court, Donald; Montañez, Cecilia

    2010-02-01

    The lambdatI terminator is located approximately 280 bp beyond the lambdaint gene, and it has a typical structure of an intrinsic terminator. To identify sequences required for lambdatI transcription termination a set of deletion mutants were generated, either from the 5' or the 3' end onto the lambdatI region. The termination efficiency was determined by measuring galactokinase (galK) levels by Northern blot assays and by in vitro transcription termination. The importance of the uridines and the stability of the stem structure in the termination were demonstrated. The nontranscribed DNA beyond the 3' end also affects termination. Additionally, sequences upstream have a small effect on transcription termination. The in vivo RNA termination sites at lambdatI were determined by S1 mapping and were located at 8 different positions. Processing of transcripts from the 3' end confirmed the importance of the hairpin stem in protection against exonuclease.

  10. A Gibbs sampler for motif detection in phylogenetically close sequences

    NASA Astrophysics Data System (ADS)

    Siddharthan, Rahul; van Nimwegen, Erik; Siggia, Eric

    2004-03-01

    Genes are regulated by transcription factors that bind to DNA upstream of genes and recognize short conserved ``motifs'' in a random intergenic ``background''. Motif-finders such as the Gibbs sampler compare the probability of these short sequences being represented by ``weight matrices'' to the probability of their arising from the background ``null model'', and explore this space (analogous to a free-energy landscape). But closely related species may show conservation not because of functional sites but simply because they have not had sufficient time to diverge, so conventional methods will fail. We introduce a new Gibbs sampler algorithm that accounts for common ancestry when searching for motifs, while requiring minimal ``prior'' assumptions on the number and types of motifs, assessing the significance of detected motifs by ``tracking'' clusters that stay together. We apply this scheme to motif detection in sporulation-cycle genes in the yeast S. cerevisiae, using recent sequences of other closely-related Saccharomyces species.

  11. Changes in the DNA methylation profile of the rat H19 gene upstream region during development and transgenic hepatocarcinogenesis and its role in the imprinted transcriptional regulation of the H19 gene.

    PubMed

    Manoharan, Herbert; Babcock, Karlee; Pitot, Henry C

    2004-09-01

    Monoallelic expression of the imprinted H19 and insulin-like growth factor-2 (Igf2) genes depends on the hypomethylation of the maternal allele and hypermethylation of the paternal allele of the H19 upstream region. Previous studies from our laboratory on liver carcinogenesis in the F1 hybrid of Fischer 344 (F344) and Sprague-Dawley Alb SV40 T Ag transgenic rat (SD) strains revealed the biallelic expression of H19 in hepatomas. We undertook a comparative study of the DNA methylation status of the upstream region of H19 in fetal, adult, and neoplastic liver. Bisulfite DNA sequencing analysis of a 3.745-kb DNA segment extending from 2950 to 6695 bp of the H19 upstream region revealed marked variations in the methylation patterns in fetal, adult, and neoplastic liver. In the fetal liver, equal proportions of hyper- and hypomethylated strands revealed the differentially methylated status of the parental alleles, but in neoplastic liver a pronounced change in the pattern of methylation was observed with a distinct change to hypomethylation in the short segments between 2984 and 3301 bp, 6033-6123 bp, and 6518-6548 bp. These results indicated that methylation of all cytosines in this region may contribute to the imprinting status of the rat H19 gene. This phenomenon of differential methylation-related epigenetic alteration in the key cis-regulatory domains of the H19 promoter influences switching to biallelic expression in hepatocellular carcinogenesis. Similar to mouse and human, we showed that the zinc-finger CCTCC binding factor (CTCF) binds to the unmethylated CTCF binding site in the upstream region to influence monoallelic imprinted expression in fetal liver. CTCF does not appear to be rate limiting in fetal, normal, and neoplastic liver. 3' to the CTCF binding sites, another DNA region exhibits methylation of CpG's in both DNA strands in adult liver, retention of the imprint in fetal liver, and complete demethylation in neoplastic liver. In this region is also a putative binding site for a basic helix-loop-helix leucine-zipper transcription factor, TFEB. The differential CpG methylation seen in the adult that involves the TFEB binding site may explain the lack of expression of the H19 gene in adult normal liver. Furthermore, these findings demonstrate that the loss of imprinting of the H19 gene in hepatic neoplasms of the SD Alb SV40 T Ag transgenic rat is directly correlated with and probably the result of differential methylation of CpG dinucleotides in two distinct regions of the gene that are within 4 kb 5' of the transcription start site. Cytogenetic analysis of hepatocytes in the transgenic animal prior to the appearance of nodules or neoplasms indicates a role of such loss of imprinting in the very early period of neoplastic development, possibly the transition from the stage of promotion to that of progression. Copyright 2004 Wiley-Liss, Inc.

  12. Characterization and expression analysis of Toll-like receptor 3 cDNA from Atlantic salmon (Salmo salar).

    PubMed

    Vidal, R; González, R; Gil, F

    2015-06-10

    Innate pathway activation is fundamental for early anti-viral defense in fish, but currently there is insufficient understanding of how salmonid fish identify viral molecules and activate these pathways. The Toll-like receptor (TLR) is believed to play a crucial role in host defense of pathogenic microbes in the innate immune system. In the present study, the full-length cDNA of Salmo salar TLR3 (ssTLR3) was cloned. The ssTLR3 cDNA sequence was 6071 bp long, containing an open reading frame of 2754 bp and encoding 971 amino acids. The TLR group motifs, such as leucine-rich repeat (LRR) domains and Toll-interleukin-1 receptor (TIR) domains, were maintained in ssTLR3, with sixteen LRR domains and one TIR domain. In contrast to descriptions of the TLR3 in rainbow trout and the murine (TATA-less), we found a putative TATA box in the proximal promoter region 29 bp upstream of the transcription start point of ssTLR3. Multiple-sequence alignment analysis of the ssTLR3 protein-coding sequence with other known TLR3 sequences showed the sequence to be conserved among all species analyzed, implying that the function of the TLR3 had been sustained throughout evolution. The ssTLR3 mRNA expression patterns were measured using real-time PCR. The results revealed that TLR3 is widely expressed in various healthy tissues. Individuals challenged with infectious pancreatic necrosis virus and immunostimulated with polyinosinic:polycytidylic acid exhibited increased expression of TLR3 at the mRNA level, indicating that ssTLR3 may be involved in pathogen recognition in the early innate immune system.

  13. Lactate Utilization Is Regulated by the FadR-Type Regulator LldR in Pseudomonas aeruginosa

    PubMed Central

    Gao, Chao; Hu, Chunhui; Zheng, Zhaojuan; Jiang, Tianyi; Dou, Peipei; Zhang, Wen; Che, Bin; Wang, Yujiao; Lv, Min

    2012-01-01

    NAD-independent l-lactate dehydrogenase (l-iLDH) and NAD-independent d-lactate dehydrogenase (d-iLDH) activities are induced coordinately by either enantiomer of lactate in Pseudomonas strains. Inspection of the genomic sequences of different Pseudomonas strains revealed that the lldPDE operon comprises 3 genes, lldP (encoding a lactate permease), lldD (encoding an l-iLDH), and lldE (encoding a d-iLDH). Cotranscription of lldP, lldD, and lldE in Pseudomonas aeruginosa strain XMG starts with the base, C, that is located 138 bp upstream of the lldP ATG start codon. The lldPDE operon is located adjacent to lldR (encoding an FadR-type regulator, LldR). The gel mobility shift assays revealed that the purified His-tagged LldR binds to the upstream region of lldP. An XMG mutant strain that constitutively expresses d-iLDH and l-iLDH was found to contain a mutation in lldR that leads to an Ile23-to-serine substitution in the LldR protein. The mutated protein, LldRM, lost its DNA-binding activity. A motif with a hyphenated dyad symmetry (TGGTCTTACCA) was identified as essential for the binding of LldR to the upstream region of lldP by using site-directed mutagenesis. l-Lactate and d-lactate interfered with the DNA-binding activity of LldR. Thus, l-iLDH and d-iLDH were expressed when the operon was induced in the presence of l-lactate or d-lactate. PMID:22408166

  14. Sequence analysis of dolphin ferritin H and L subunits and possible iron-dependent translational control of dolphin ferritin gene

    PubMed Central

    Takaesu, Azusa; Watanabe, Kiyotaka; Takai, Shinji; Sasaki, Yukako; Orino, Koichi

    2008-01-01

    Background Iron-storage protein, ferritin plays a central role in iron metabolism. Ferritin has dual function to store iron and segregate iron for protection of iron-catalyzed reactive oxygen species. Tissue ferritin is composed of two kinds of subunits (H: heavy chain or heart-type subunit; L: light chain or liver-type subunit). Ferritin gene expression is controlled at translational level in iron-dependent manner or at transcriptional level in iron-independent manner. However, sequencing analysis of marine mammalian ferritin subunits has not yet been performed fully. The purpose of this study is to reveal cDNA-derived amino acid sequences of cetacean ferritin H and L subunits, and demonstrate the possibility of expression of these subunits, especially H subunit, by iron. Methods Sequence analyses of cetacean ferritin H and L subunits were performed by direct sequencing of polymerase chain reaction (PCR) fragments from cDNAs generated via reverse transcription-PCR of leukocyte total RNA prepared from blood samples of six different dolphin species (Pseudorca crassidens, Lagenorhynchus obliquidens, Grampus griseus, Globicephala macrorhynchus, Tursiops truncatus, and Delphinapterus leucas). The putative iron-responsive element sequence in the 5'-untranslated region of the six different dolphin species was revealed by direct sequencing of PCR fragments obtained using leukocyte genomic DNA. Results Dolphin H and L subunits consist of 182 and 174 amino acids, respectively, and amino acid sequence identities of ferritin subunits among these dolphins are highly conserved (H: 99–100%, (99→98) ; L: 98–100%). The conserved 28 bp IRE sequence was located -144 bp upstream from the initiation codon in the six different dolphin species. Conclusion These results indicate that six different dolphin species have conserved ferritin sequences, and suggest that these genes are iron-dependently expressed. PMID:18954429

  15. Development of a bioassay to screen for chemicals mimicking the anti-aging effects of calorie restriction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chiba, Takuya, E-mail: takuya@nagasaki-u.ac.jp; Tsuchiya, Tomoshi; Komatsu, Toshimitsu

    2010-10-15

    Research highlights: {yields} We identified four sequence motifs lying upstream of putative pro-longevity genes. {yields} One of these motifs binds to HNF-4{alpha}. {yields} HNF-4{alpha}/PGC-1{alpha} could up-regulate the transcription of a reporter gene linked to this motif. {yields} The reporter system described here could be used to screen candidate anti-aging molecules. -- Abstract: Suppression of the growth hormone/insulin-like growth factor-I pathway in Ames dwarf (DF) mice, and caloric restriction (CR) in normal mice extends lifespan and delays the onset of age-related disorders. In combination, these interventions have an additive effect on lifespan in Ames DF mice. Therefore, common signaling pathways regulatedmore » by DF and CR could have additive effects on longevity. In this study, we tried to identity the signaling mechanism and develop a system to assess pro-longevity status in cells and mice. We previously identified genes up-regulated in the liver of DF and CR mice by DNA microarray analysis. Motif analysis of the upstream sequences of those genes revealed four major consensus sequence motifs, which have been named dwarfism and calorie restriction-responsive elements (DFCR-REs). One of the synthesized sequences bound to hepatocyte nuclear factor-4{alpha} (HNF-4{alpha}), an important transcription factor involved in liver metabolism. Furthermore, using this sequence information, we developed a highly sensitive bioassay to identify chemicals mimicking the anti-aging effects of CR. When the reporter construct, containing an element upstream of a secreted alkaline phosphatase (SEAP) gene, was co-transfected with HNF-4{alpha} and its regulator peroxisome proliferator-activated receptor (PPAR) {gamma} coactivator-1{alpha} (PGC-1{alpha}), SEAP activity was increased compared with untransfected controls. Moreover, transient transgenic mice established using this construct showed increased SEAP activity in CR mice compared with ad libitum-fed mice. These data suggest that because of its rapidity, ease of use, and specificity, our bioassay will be more useful than the systems currently employed to screen for CR mimetics, which mimic the beneficial effects of CR. Our system will be particularly useful for high-throughput screening of natural and synthetic candidate molecules.« less

  16. Engineering Promoter Architecture in Oleaginous Yeast Yarrowia lipolytica.

    PubMed

    Shabbir Hussain, Murtaza; Gambill, Lauren; Smith, Spencer; Blenner, Mark A

    2016-03-18

    Eukaryotic promoters have a complex architecture to control both the strength and timing of gene transcription spanning up to thousands of bases from the initiation site. This complexity makes rational fine-tuning of promoters in fungi difficult to predict; however, this very same complexity enables multiple possible strategies for engineering promoter strength. Here, we studied promoter architecture in the oleaginous yeast, Yarrowia lipolytica. While recent studies have focused on upstream activating sequences, we systematically examined various components common in fungal promoters. Here, we examine several promoter components including upstream activating sequences, proximal promoter sequences, core promoters, and the TATA box in autonomously replicating expression plasmids and integrated into the genome. Our findings show that promoter strength can be fine-tuned through the engineering of the TATA box sequence, core promoter, and upstream activating sequences. Additionally, we identified a previously unreported oleic acid responsive transcription enhancement in the XPR2 upstream activating sequences, which illustrates the complexity of fungal promoters. The promoters engineered here provide new genetic tools for metabolic engineering in Y. lipolytica and provide promoter engineering strategies that may be useful in engineering other non-model fungal systems.

  17. Cloning and characterization of the mouse XPAC gene.

    PubMed Central

    van Oostrom, C T; de Vries, A; Verbeek, S J; van Kreijl, C F; van Steeg, H

    1994-01-01

    Xeroderma Pigmentosum is a human disease, which is, among others, characterized by a high incidence of (sunlight induced) skin cancer, due to a defect in nucleotide excision repair (NER). The human DNA repair gene XPAC corrects this defect in cells isolated from Xeroderma Pigmentosum complementation group A (XP-A) patients. To enable the development of a transgenic mouse model for XP-A by gene targeting in embryonic stem cells, we cloned and characterized the mouse homologue of the XPAC gene. The mouse XPAC gene was found to consist of 6 exons, spanning approximately 21 kb. The nucleotide sequence of the exons is identical to that of the also cloned the mouse XPAC cDNA. Furthermore, the deduced amino acid sequence of the XPAC protein is the same as the one published previously by Tanaka et al. From CAT assay analysis, the promoter of the XPAC gene appeared to be located within 313 bp upstream of the assumed transcriptional start site. Like the promoters of other eukaryotic DNA repair genes (i.e. ERCC-1 and XPBC/ERCC-3), the mouse XPAC promoter region lacks classical promoter elements like TATA-, GC- and CAAT boxes. However, it contains an unique polypyrimidine-rich box, which is so far only found in genes encoding DNA repair enzymes. The function of this box in the regulation of transcription is still unclear. PMID:8127648

  18. Sequence-specific sepsis-related DNA capture and fluorescent labeling in monoliths prepared by single-step photopolymerization in microfluidic devices.

    PubMed

    Knob, Radim; Hanson, Robert L; Tateoka, Olivia B; Wood, Ryan L; Guerrero-Arguero, Israel; Robison, Richard A; Pitt, William G; Woolley, Adam T

    2018-05-21

    Fast determination of antibiotic resistance is crucial in selecting appropriate treatment for sepsis patients, but current methods based on culture are time consuming. We are developing a microfluidic platform with a monolithic column modified with oligonucleotides designed for sequence-specific capture of target DNA related to the Klebsiella pneumoniae carbapenemase (KPC) gene. We developed a novel single-step monolith fabrication method with an acrydite-modified capture oligonucleotide in the polymerization mixture, enabling fast monolith preparation in a microfluidic channel using UV photopolymerization. These prepared columns had a threefold higher capacity compared to monoliths prepared in a multistep process involving Schiff-base DNA attachment. Conditions for denaturing, capture and fluorescence labeling using hybridization probes were optimized with synthetic 90-mer oligonucleotides. These procedures were applied for extraction of a PCR amplicon from the KPC antibiotic resistance gene in bacterial lysate obtained from a blood sample spiked with E. coli. The results showed similar eluted peak areas for KPC amplicon extracted from either hybridization buffer or bacterial lysate. Selective extraction of the KPC DNA was verified by real time PCR on eluted fractions. These results show great promise for application in an integrated microfluidic diagnostic system that combines upstream blood sample preparation and downstream single-molecule counting detection. Copyright © 2018 Elsevier B.V. All rights reserved.

  19. Characterization of a highly polymorphic region 5′ to JH in the human immunoglobulin heavy chain

    PubMed Central

    Silva, Alcino J.; Johnson, John P.; White, Raymond L.

    1987-01-01

    A cloned DNA segment 1.25 kilobases (kb) upstream from the joining segments of the human heavy chain immunoglobulin gene revealed extensive polymorphic variation at this locus, and the polymorphic pattern was stably transmitted to the next generation. Genomic restriction analysis showed that the polymorphism was caused by insertions/deletions within an MspI/BamHI fragment. Sequencing of one allele, 848 base pairs (bp) long, revealed eleven 50-base-pair tandem repeats. A second allele, 648 bp long, was cloned from a human genomic cosmid library, sequenced, and found to contain four fewer repeats than the first allele. A survey of 186 chromosomes from unrelated individuals of primarily northern European descent revealed at least six alleles. Images PMID:2884636

  20. Cis-regulation of the amphioxus engrailed gene: insights into evolution of a muscle-specific enhancer.

    PubMed

    Beaster-Jones, Laura; Schubert, Michael; Holland, Linda Z

    2007-08-01

    To gain insights into the relation between evolution of cis-regulatory DNA and evolution of gene function, we identified tissue-specific enhancers of the engrailed gene of the basal chordate amphioxus (Branchiostoma floridae) and compared their ability to direct expression in both amphioxus and its nearest chordate relative, the tunicate Ciona intestinalis. In amphioxus embryos, the native engrailed gene is expressed in three domains - the eight most anterior somites, a few cells in the central nervous system (CNS) and a few ectodermal cells. In contrast, in C. intestinalis, in which muscle development is highly divergent, engrailed expression is limited to the CNS. To characterize the tissue-specific enhancers of amphioxus engrailed, we first showed that 7.8kb of upstream DNA of amphioxus engrailed directs expression to all three domains in amphioxus that express the native gene. We then identified the amphioxus engrailed muscle-specific enhancer as the 1.2kb region of upstream DNA with the highest sequence identity to the mouse en-2 jaw muscle enhancer. This amphioxus enhancer directed expression to both the somites in amphioxus and to the larval muscles in C. intestinalis. These results show that even though expression of the native engrailed has apparently been lost in developing C. intestinalis muscles, they express the transcription factors necessary to activate transcription from the amphioxus engrailed enhancer, suggesting that gene networks may not be completely disrupted if an individual component is lost.

  1. The genomic structure of the human UFO receptor.

    PubMed

    Schulz, A S; Schleithoff, L; Faust, M; Bartram, C R; Janssen, J W

    1993-02-01

    Using a DNA transfection-tumorigenicity assay we have recently identified the UFO oncogene. It encodes a tyrosine kinase receptor characterized by the juxtaposition of two immunoglobulin-like and two fibronectin type III repeats in its extracellular domain. Here we describe the genomic organization of the human UFO locus. The UFO receptor is encoded by 20 exons that are distributed over a region of 44 kb. Different isoforms of UFO mRNA are generated by alternative splicing of exon 10 and differential usage of two imperfect polyadenylation sites resulting in the presence or absence of 1.5-kb 3' untranslated sequences. Primer extension and S1 nuclease analyses revealed multiple transcriptional initiation sites including a major site 169 bp upstream of the translation start site. The promoter region is GC rich, lacks TATA and CAAT boxes, but contains potential recognition sites for a variety of trans-acting factors, including Sp1, AP-2 and the cyclic AMP response element-binding protein. Proto-UFO and its oncogenic counterpart exhibit identical cDNA and promoter regions sequences. Possible modes of UFO activation are discussed.

  2. Unexpected sequences and structures of mtDNA required for efficient transcription from the first heavy-strand promoter

    PubMed Central

    Uchida, Akira; Murugesapillai, Divakaran; Kastner, Markus; Wang, Yao; Lodeiro, Maria F; Prabhakar, Shaan; Oliver, Guinevere V; Arnold, Jamie J; Maher, L James; Williams, Mark C; Cameron, Craig E

    2017-01-01

    Human mtDNA contains three promoters, suggesting a need for differential expression of the mitochondrial genome. Studies of mitochondrial transcription have used a reductionist approach, perhaps masking differential regulation. Here we evaluate transcription from light-strand (LSP) and heavy-strand (HSP1) promoters using templates that mimic their natural context. These studies reveal sequences upstream, hypervariable in the human population (HVR3), and downstream of the HSP1 transcription start site required for maximal yield. The carboxy-terminal tail of TFAM is essential for activation of HSP1 but not LSP. Images of the template obtained by atomic force microscopy show that TFAM creates loops in a discrete region, the formation of which correlates with activation of HSP1; looping is lost in tail-deleted TFAM. Identification of HVR3 as a transcriptional regulatory element may contribute to between-individual variability in mitochondrial gene expression. The unique requirement of HSP1 for the TFAM tail may enable its regulation by post-translational modifications. DOI: http://dx.doi.org/10.7554/eLife.27283.001 PMID:28745586

  3. Association of Tissue-Specific DNA Methylation Alterations with α-Thalassemia Southeast Asian Deletion

    PubMed Central

    Pangeson, Tanapat; Sanguansermsri, Phanchana; Sanguansermsri, Torpong; Seeratanachot, Teerapat; Suwanakhon, Narutchala; Srikummool, Metawee; Kaewkong, Worasak; Mahingsa, Khwanruedee

    2017-01-01

    In the wild-type allele, DNA methylation levels of 10 consecutive CpG sites adjacent to the upstream 5′-breakpoint of α-thalassemia Southeast Asian (SEA) deletion are not different between placenta and leukocytes. However, no previous study has reported the map of DNA methylation in the SEA allele. This report aims to show that the SEA mutation is associated with DNA methylation changes, resulting in differential methylation between placenta and leukocytes. Methylation-sensitive high-resolution analysis was used to compare DNA methylation among placenta, leukocytes, and unmethylated control DNA. The result indicates that the DNA methylation between placenta and leukocyte DNA is different and shows that the CpG status of both is not fully unmethylated. Mapping of individual CpG sites was performed by targeted bisulfite sequencing. The DNA methylation level of the 10 consecutive CpG sites was different between placenta and leukocyte DNA. When the 10th CpG of the mutation allele was considered as a hallmark for comparing DNA methylation level, it was totally different from the unmethylated 10th CpG of the wild-type allele. Finally, the distinct DNA methylation patterns between both DNA were extracted. In total, 24 patterns were found in leukocyte samples and 9 patterns were found in placenta samples. This report shows that the large deletion is associated with DNA methylation change. In further studies for clinical application, the distinct DNA methylation pattern might be a potential marker for detecting cell-free fetal DNA. PMID:29162979

  4. Nucleotide sequence of the gene for the Mr 32,000 thylakoid membrane protein from Spinacia oleracea and Nicotiana debneyi predicts a totally conserved primary translation product of Mr 38,950

    PubMed Central

    Zurawski, Gerard; Bohnert, Hans J.; Whitfeld, Paul R.; Bottomley, Warwick

    1982-01-01

    The gene for the so-called Mr 32,000 rapidly labeled photosystem II thylakoid membrane protein (here designated psbA) of spinach (Spinacia oleracea) chloroplasts is located on the chloroplast DNA in the large single-copy region immediately adjacent to one of the inverted repeat sequences. In this paper we show that the size of the mRNA for this protein is ≈ 1.25 kilobases and that the direction of transcription is towards the inverted repeat unit. The nucleotide sequence of the gene and its flanking regions is presented. The only large open reading frame in the sequence codes for a protein of Mr 38,950. The nucleotide sequence of psbA from Nicotiana debneyi also has been determined, and comparison of the sequences from the two species shows them to be highly conserved (>95% homology) throughout the entire reading frame. Conservation of the amino acid sequence is absolute, there being no changes in a total of 353 residues. This leads us to conclude that the primary translation product of psbA must be a protein of Mr 38,950. The protein is characterized by the complete absence of lysine residues and is relatively rich in hydrophobic amino acids, which tend to be clustered. Transcription of spinach psbA starts about 86 base pairs before the first ATG codon. Immediately upstream from this point there is a sequence typical of that found in E. coli promoters. An almost identical sequence occurs in the equivalent region of N. debneyi DNA. Images PMID:16593262

  5. Functional Architecture of T7 RNA Polymerase Transcription Complexes

    PubMed Central

    Nayak, Dhananjaya; Guo, Qing; Sousa, Rui

    2007-01-01

    Summary T7 RNA polymerase is the best-characterized member of a widespread family of single-subunit RNA polymerases. Crystal structures of T7 RNA polymerase initiation and elongation complexes have provided a wealth of detailed information on RNA polymerase interactions with the promoter and transcription bubble, but the absence of DNA downstream of the melted region of the template in the initiation complex structure, and the absence of DNA upstream of the transcription bubble in the elongation complex structure means that our picture of the functional architecture of T7 RNA polymerase transcription complexes remains incomplete. Here we use the site-specifically tethered chemical nucleases and functional characterization of directed T7 RNAP mutants to both reveal the architecture of the duplex DNA that flanks the transcription bubble in the T7 RNAP initiation and elongation complexes, and to define the function of the interactions made by these duplex elements. We find that downstream duplex interactions made with a cluster of lysines (K711/K713/K714) are present during both elongation and initiation where they contribute to stabilizing a bend in the downstream DNA that is important for promoter opening. The upstream DNA in the elongation complex is also found to be sharply bent at the upstream edge of the transcription bubble, thereby allowing formation of upstream duplex:polymerase interactions that contribute to elongation complex stability. PMID:17580086

  6. Degenerative minimalism in the genome of a psyllid endosymbiont.

    PubMed

    Clark, M A; Baumann, L; Thao, M L; Moran, N A; Baumann, P

    2001-03-01

    Psyllids, like aphids, feed on plant phloem sap and are obligately associated with prokaryotic endosymbionts acquired through vertical transmission from an ancestral infection. We have sequenced 37 kb of DNA of the genome of Carsonella ruddii, the endosymbiont of psyllids, and found that it has a number of unusual properties revealing a more extreme case of degeneration than was previously reported from studies of eubacterial genomes, including that of the aphid endosymbiont Buchnera aphidicola. Among the unusual properties are an exceptionally low guanine-plus-cytosine content (19.9%), almost complete absence of intergenic spaces, operon fusion, and lack of the usual promoter sequences upstream of 16S rDNA. These features suggest the synthesis of long mRNAs and translational coupling. The most extreme instances of base compositional bias occur in the genes encoding proteins that have less highly conserved amino acid sequences; the guanine-plus-cytosine content of some protein-coding sequences is as low as 10%. The shift in base composition has a large effect on proteins: in polypeptides of C. ruddii, half of the residues consist of five amino acids with codons low in guanine plus cytosine. Furthermore, the proteins of C. ruddii are reduced in size, with an average of about 9% fewer amino acids than in homologous proteins of related bacteria. These observations suggest that the C. ruddii genome is not subject to constraints that limit the evolution of other known eubacteria.

  7. Sequence and Genetic Characterization of etrA, an fnr Analog that Regulates Anaerobic Respiration in Shewanella putrefaciens MR-1

    NASA Technical Reports Server (NTRS)

    Saffarini, Daad A.; Nelson, Kenneth H.

    1993-01-01

    An electron transport regulatory gene, etrA, has been isolated and characterized from the obligate respiratory bacterium Shewanella putrefaciens MR-l. The deduced amino acid sequence of etrA (EtrA) shows a high degree of identity to both the Fnr of Escherichia coli (73.6%) and the analogous protein (ANR) of Pseudomonas aeruginosa (50.8%). The four active cysteine residues of Fnr are conserved in EtrA, and the amino acid sequence of the DNA-binding domains of the two proteins are identical. Further, S.putrefaciens etrA is able to complement an fnr mutant of E.coli. In contrast to fnr, there is no recognizable Fnr box upstream of the etrA sequence. Gene replacement etr.A mutants of MR-1 were deficient in growth on nitrite, thiosulfate, sulfite, trimethylamine-N-oxide, dimethyl sulfoxide, Fe(III), and fumarate, suggesting that EtrA is involved in the regulation of the corresponding reductase genes. However, the mutants were all positive for reduction of and growth on nitrate and Mn(IV), indicating that EtrA is not involved in the regulation of these two systems. Southern blots of S.putrefaciens DNA with use of etrA as a probe revealed the expected etrA bands and a second set of hybridization signals whose genetic and functional properties remain to be determined.

  8. Cloning and sequence analysis of the Antheraea pernyi nucleopolyhedrovirus gp64 gene.

    PubMed

    Wang, Wenbing; Zhu, Shanying; Wang, Liqun; Yu, Feng; Shen, Weide

    2005-12-01

    Frequent outbreaks of the purulence disease of Chinese oak silkworm are reported in Middle and Northeast China. The disease is produced by the pathogen Antheraea pernyi nucleopolyhedrovirus (AnpeNPV). To obtain molecular information of the virus, the polyhedra of AnpeNPV were purified and characterized. The genomic DNA of AnpeNPV was extracted and digested with HindIII. The genome size of AnpeNPV is estimated at 128 kb. Based on the analysis of DNA fragments digested with HindIII, 23 fragments were bigger than 564 bp. A genomic library was generated using HindIII and the positive clones were sequenced and analysed. The gp64 gene, encoding the baculovirus envelope protein GP64, was found in an insert. The nucleotide sequence analysis indicated that the AnpeNPV gp64 gene consists of a 1,530 nucleotide open reading frame (ORF), encoding a protein of 509 amino acids. Of the eight gp64 homologues, the AnpeNPV gp64 ORF shared the most sequence similarity with the gp64 gene of Anticarsia gemmatalis NPV, but not Bombyx mori NPV. The upstream region of the AnpeNPV gp64 ORF encoded the conserved transcriptional elements for early and late stage of the viral infection cycle. These results indicated that AnpeNPV belongs to group I NPV and was far removed in molecular phylogeny from the BmNPV.

  9. Control of asgE Expression during Growth and Development of Myxococcus xanthus

    PubMed Central

    Garza, Anthony G.; Harris, Baruch Z.; Greenberg, Brandon M.; Singer, Mitchell

    2000-01-01

    One of the earliest events in the Myxococcus xanthus developmental cycle is production of an extracellular cell density signal called A-signal (or A-factor). Previously, we showed that cells carrying an insertion in the asgE gene fail to produce normal levels of this cell-cell signal. In this study we found that expression of asgE is growth phase regulated and developmentally regulated. Several lines of evidence indicate that asgE is cotranscribed with an upstream gene during development. Using primer extension analyses, we identified two 5′ ends for this developmental transcript. The DNA sequence upstream of one 5′ end has similarity to the promoter regions of several genes that are A-signal dependent, whereas sequences located upstream of the second 5′ end show similarity to promoter elements identified for genes that are C-signal dependent. Consistent with this result is our finding that mutants failing to produce A-signal or C-signal are defective for developmental expression of asgE. In contrast to developing cells, the large majority of the asgE transcript found in vegetative cells appears to be monocistronic. This finding suggests that asgE uses different promoters for expression during vegetative growth and development. Growth phase regulation of asgE is abolished in a relA mutant, indicating that this vegetative promoter is induced by starvation. The data presented here, in combination with our previous results, indicate that the level of AsgE in vegetative cells is sufficient for this protein to carry out its function during development. PMID:11073904

  10. Long-range transcriptional control of an operon necessary for virulence-critical ESX-1 secretion in Mycobacterium tuberculosis.

    PubMed

    Hunt, Debbie M; Sweeney, Nathan P; Mori, Luisa; Whalan, Rachael H; Comas, Iñaki; Norman, Laura; Cortes, Teresa; Arnvig, Kristine B; Davis, Elaine O; Stapleton, Melanie R; Green, Jeffrey; Buxton, Roger S

    2012-05-01

    The ESX-1 secretion system of Mycobacterium tuberculosis has to be precisely regulated since the secreted proteins, although required for a successful virulent infection, are highly antigenic and their continued secretion would alert the immune system to the infection. The transcription of a five-gene operon containing espACD-Rv3613c-Rv3612c, which is required for ESX-1 secretion and is essential for virulence, was shown to be positively regulated by the EspR transcription factor. Thus, transcription from the start site, found to be located 67 bp upstream of espA, was dependent upon EspR enhancer-like sequences far upstream (between 884 and 1,004 bp), which we term the espA activating region (EAR). The EAR contains one of the known binding sites for EspR, providing the first in vivo evidence that transcriptional activation at the espA promoter occurs by EspR binding to the EAR and looping out DNA between this site and the promoter. Regulation of transcription of this operon thus takes place over long regions of the chromosome. This regulation may differ in some members of the M. tuberculosis complex, including Mycobacterium bovis, since deletions of the intergenic region have removed the upstream sequence containing the EAR, resulting in lowered espA expression. Consequent differences in expression of ESX-1 in these bacteria may contribute to their various pathologies and host ranges. The virulence-critical nature of this operon means that transcription factors controlling its expression are possible drug targets.

  11. Use of signal sequences as an in situ removable sequence element to stimulate protein synthesis in cell-free extracts

    PubMed Central

    Ahn, Jin-Ho; Hwang, Mi-Yeon; Lee, Kyung-Ho; Choi, Cha-Yong; Kim, Dong-Myung

    2007-01-01

    This study developed a method to boost the expression of recombinant proteins in a cell-free protein synthesis system without leaving additional amino acid residues. It was found that the nucleotide sequences of the signal peptides serve as an efficient downstream box to stimulate protein synthesis when they were fused upstream of the target genes. The extent of stimulation was critically affected by the identity of the second codons of the signal sequences. Moreover, the yield of the synthesized protein was enhanced by as much as 10 times in the presence of an optimal second codon. The signal peptides were in situ cleaved and the target proteins were produced in their native sizes by carrying out the cell-free synthesis reactions in the presence of Triton X-100, most likely through the activation of signal peptidase in the S30 extract. The amplification of the template DNA and the addition of the signal sequences were accomplished by PCR. Hence, elevated levels of recombinant proteins were generated within several hours. PMID:17185295

  12. Recovery of infectious type Asia1 foot-and-mouth disease virus from suckling mice directly inoculated with an RNA polymerase I/II-driven unidirectional transcription plasmid.

    PubMed

    Lian, Kaiqi; Yang, Fan; Zhu, Zixiang; Cao, Weijun; Jin, Ye; Li, Dan; Zhang, Keshan; Guo, Jianhong; Zheng, Haixue; Liu, Xiangtao

    2015-10-02

    We developed an RNA polymerase (pol) I- and II-driven plasmid-based reverse genetics system to rescue infectious foot-and-mouth disease virus (FMDV) from cloned cDNA. In this plasmid-based transfection, the full-length viral cDNA was flanked by hammerhead ribozyme (HamRz) and hepatitis delta ribozyme (HdvRz) sequences, which were arranged downstream of the two promoters (cytomegalovirus (CMV) and pol I promoter) and upstream of the terminators and polyadenylation signal, respectively. The utility of this method was demonstrated by the recovery of FMDV Asia1 HN/CHA/06 in BHK-21 cells transfected with cDNA plasmids. Furthermore, infectious FMDV Asia1 HN/CHA/06 could be rescued from suckling mice directly inoculated with cDNA plasmids. Thus, this reverse genetics system can be applied to fundamental research and vaccine studies, most notably to rescue those viruses for which there is currently an absence of a suitable cell culture system. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Libraries of Synthetic TALE-Activated Promoters: Methods and Applications.

    PubMed

    Schreiber, T; Tissier, A

    2016-01-01

    The discovery of proteins with programmable DNA-binding specificities triggered a whole array of applications in synthetic biology, including genome editing, regulation of transcription, and epigenetic modifications. Among those, transcription activator-like effectors (TALEs) due to their natural function as transcription regulators, are especially well-suited for the development of orthogonal systems for the control of gene expression. We describe here the construction and testing of libraries of synthetic TALE-activated promoters which are under the control of a single TALE with a given DNA-binding specificity. These libraries consist of a fixed DNA-binding element for the TALE, a TATA box, and variable sequences of 19 bases upstream and 43 bases downstream of the DNA-binding element. These libraries were cloned using a Golden Gate cloning strategy making them usable as standard parts in a modular cloning system. The broad range of promoter activities detected and the versatility of these promoter libraries make them valuable tools for applications in the fine-tuning of expression in metabolic engineering projects or in the design and implementation of regulatory circuits. © 2016 Elsevier Inc. All rights reserved.

  14. Conserved regulatory elements of the promoter sequence of the gene rpoH of enteric bacteria

    PubMed Central

    Ramírez-Santos, Jesús; Collado-Vides, Julio; García-Varela, Martin; Gómez-Eichelmann, M. Carmen

    2001-01-01

    The rpoH regulatory region of different members of the enteric bacteria family was sequenced or downloaded from GenBank and compared. In addition, the transcriptional start sites of rpoH of Yersinia frederiksenii and Proteus mirabilis, two distant members of this family, were determined. Sequences similar to the σ70 promoters P1, P4 and P5, to the σE promoter P3 and to boxes DnaA1, DnaA2, cAMP receptor protein (CRP) boxes CRP1, CRP2 and box CytR present in Escherichia coli K12, were identified in sequences of closely related bacteria such as: E.coli, Shigella flexneri, Salmonella enterica serovar Typhimurium, Citrobacter freundii, Enterobacter cloacae and Klebsiella pneumoniae. In more distant bacteria, Y.frederiksenii and P.mirabilis, the rpoH regulatory region has a distal P1-like σ70 promoter and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. Sequences similar to the regulatory boxes were not identified in these bacteria. This study suggests that the general pattern of transcription of the rpoH gene in enteric bacteria includes a distal σ70 promoter, >200 nt upstream of the initiation codon, and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. A second proximal σ70 promoter under catabolite-regulation is probably present only in bacteria closely related to E.coli. PMID:11139607

  15. Cloning and functional characterization of the Xenopus orthologue of the Treacher Collins syndrome (TCOF1) gene product.

    PubMed

    Gonzales, Bianca; Yang, Hushan; Henning, Dale; Valdez, Benigno C

    2005-10-10

    Treacher Collins syndrome (TCS) is an autosomal dominant disorder of craniofacial development caused by mutations in the TCOF1 gene, which encodes the nucleolar phosphoprotein treacle. We previously reported a function for mammalian treacle in ribosomal DNA gene transcription by its interaction with upstream binding factor. As an initial step in the development of a TCS model for frog the cDNA that encodes the Xenopus laevis treacle was cloned. Although the derived amino acid sequence shows a poor homology with its mammalian orthologues, Xenopus treacle has 11 highly homologous direct repeats near the center of the protein molecule similar to those present in its human, dog and mouse orthologues. Comparison of their amino acid compositions indicates conservation of predominant specific amino acid residues. Antisense-mediated down-regulation of treacle expression in X. laevis oocytes resulted in inhibition of rDNA gene transcription. The results suggest evolutionary conservation of the function of treacle in ribosomal RNA biogenesis in higher eukaryotes.

  16. The silent mutation MLH1 c.543C>T resulting in aberrant splicing can cause Lynch syndrome: a case report.

    PubMed

    Yamaguchi, Tatsuro; Wakatsuki, Tomokazu; Kikuchi, Mari; Horiguchi, Shin-Ichiro; Akagi, Kiwamu

    2017-06-01

    The proband was a 67-year-old man with transverse and sigmoid colon cancer. Microsatellite instability analysis revealed a high frequency of microsatellite instability, and immunohistochemical staining showed the absence of both MLH1 and PMS2 proteins in the sigmoid colon cancer tissue specimens from the patient. DNA sequencing revealed a nucleotide substitution c.543C>T in MLH1, but this variant did not substitute an amino acid. The MLH1 c.543C>T variant was located 3 bases upstream from the end of exon 6 and created a new splice donor site 4 bases upstream from the end of exon 6. Consequently, the last 4 bases of exon 6 were deleted and frameshift occurred. Thus, the MLH1 c.543C>T silent mutation is considered 'pathogenic'. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  17. A murC gene from coryneform bacteria.

    PubMed

    Wachi, M; Wijayarathna, C D; Teraoka, H; Nagai, K

    1999-02-01

    The upstream flanking region of the ftsQ and ftsZ genes of Brevibacterium flavum MJ233, which belongs to the coryneform bacteria, was amplified by the inverse polymerase chain reaction method and cloned in Escherichia coli. Complementation analysis of E. coli mutant with a defective cell-wall synthesis mechanism with the cloned fragment and its DNA sequencing indicated the presence of the murC gene, encoding UDP-N-acetylmuramate:L-alanine ligase involved in peptidoglycan synthesis, just upstream from the ftsQ gene. The B. flavum murC gene could encode a protein of 486 amino acid residues with a calculated molecular mass of 51 198 Da. A 50-kDa protein was synthesized by the B. flavum murC gene in an in vitro transcription/translation system using E. coli S30 lysate. These results indicate that the genes responsible for cell-wall synthesis and cell division are located as a cluster in B. flavum similar to the E. coli mra region.

  18. Methylation-dependent DNA discrimination in natural transformation of Campylobacter jejuni

    PubMed Central

    Leveque, Rhiannon M.; Dawid, Suzanne; DiRita, Victor J.

    2017-01-01

    Campylobacter jejuni, a leading cause of bacterial gastroenteritis, is naturally competent. Like many competent organisms, C. jejuni restricts the DNA that can be used for transformation to minimize undesirable changes in the chromosome. Although C. jejuni can be transformed by C. jejuni-derived DNA, it is poorly transformed by the same DNA propagated in Escherichia coli or produced with PCR. Our work indicates that methylation plays an important role in marking DNA for transformation. We have identified a highly conserved DNA methyltransferase, which we term Campylobacter transformation system methyltransferase (ctsM), which methylates an overrepresented 6-bp sequence in the chromosome. DNA derived from a ctsM mutant transforms C. jejuni significantly less well than DNA derived from ctsM+ (parental) cells. The ctsM mutation itself does not affect transformation efficiency when parental DNA is used, suggesting that CtsM is important for marking transforming DNA, but not for transformation itself. The mutant has no growth defect, arguing against ongoing restriction of its own DNA. We further show that E. coli plasmid and PCR-derived DNA can efficiently transform C. jejuni when only a subset of the CtsM sites are methylated in vitro. A single methylation event 1 kb upstream of the DNA involved in homologous recombination is sufficient to transform C. jejuni, whereas otherwise identical unmethylated DNA is not. Methylation influences DNA uptake, with a slight effect also seen on DNA binding. This mechanism of DNA discrimination in C. jejuni is distinct from the DNA discrimination described in other competent bacteria. PMID:28855338

  19. Appearance of the pituitary factor Pit-1 increases chromatin remodeling at hypersensitive site III in the human GH locus.

    PubMed

    Yang, Xiaoyang; Jin, Yan; Cattini, Peter A

    2010-07-01

    Expression of pituitary and placental members of the human GH and chorionic somatomammotropin (CS) gene family is directed by an upstream remote locus control region (LCR). Pituitary-specific expression of GH requires direct binding of Pit-1 (listed as POU1F1 in the HUGO database) to sequences marked by a hypersensitive site (HS) region (HS I/II) 14.6 kb upstream of the GH-N gene (listed as GH1 in the HUGO database). We used human embryonic kidney 293 (HEK293) cells overexpressing wild-type and mutant Pit-1 proteins as a model system to gain insight into the mechanism by which Pit-1 gains access to the GH LCR. Addition of Pit-1 to these cells increased DNA accessibility at HS III, located 28 kb upstream of the human GH-N gene, in a POU homeodomain-dependent manner, as reflected by effects on histone hyperacetylation and RNA polymerase II activity. Direct binding of Pit-1 to HS III sequences is not supported. However, the potential for binding of ETS family members to this region has been demonstrated, and Pit-1 association with this ETS element in HS III sequences requires the POU homeodomain. Also, both ETS1 and ELK1 co-precipitate from human pituitary extracts using two independent sources of Pit-1 antibodies. Finally, overexpression of ELK1 or Pit-1 expression in HEK293 cells increased GH-N RNA levels. However, while ELK1 overexpression also stimulated placental CS RNA levels, the effect of Pit-1 appeared to correlate with ETS factor levels and target GH-N preferentially. These data are consistent with recruitment and an early role for Pit-1 in remodeling of the GH LCR at the constitutively open HS III through protein-protein interaction.

  20. Inhibition of recombinase polymerase amplification by background DNA: a lateral flow-based method for enriching target DNA.

    PubMed

    Rohrman, Brittany; Richards-Kortum, Rebecca

    2015-02-03

    Recombinase polymerase amplification (RPA) may be used to detect a variety of pathogens, often after minimal sample preparation. However, previous work has shown that whole blood inhibits RPA. In this paper, we show that the concentrations of background DNA found in whole blood prevent the amplification of target DNA by RPA. First, using an HIV-1 RPA assay with known concentrations of nonspecific background DNA, we show that RPA tolerates more background DNA when higher HIV-1 target concentrations are present. Then, using three additional assays, we demonstrate that the maximum amount of background DNA that may be tolerated in RPA reactions depends on the DNA sequences used in the assay. We also show that changing the RPA reaction conditions, such as incubation time and primer concentration, has little effect on the ability of RPA to function when high concentrations of background DNA are present. Finally, we develop and characterize a lateral flow-based method for enriching the target DNA concentration relative to the background DNA concentration. This sample processing method enables RPA of 10(4) copies of HIV-1 DNA in a background of 0-14 μg of background DNA. Without lateral flow sample enrichment, the maximum amount of background DNA tolerated is 2 μg when 10(6) copies of HIV-1 DNA are present. This method requires no heating or other external equipment, may be integrated with upstream DNA extraction and purification processes, is compatible with the components of lysed blood, and has the potential to detect HIV-1 DNA in infant whole blood with high proviral loads.

  1. Cell-penetrating DNA-binding protein as a safe and efficient naked DNA delivery carrier in vitro and in vivo

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Eun-Sung; Yang, Seung-Woo; Hong, Dong-Ki

    Non-viral gene delivery is a safe and suitable alternative to viral vector-mediated delivery to overcome the immunogenicity and tumorigenesis associated with viral vectors. Using the novel, human-origin Hph-1 protein transduction domain that can facilitate the transduction of protein into cells, we developed a new strategy to deliver naked DNA in vitro and in vivo. The new DNA delivery system contains Hph-1-GAL4 DNA-binding domain (DBD) fusion protein and enhanced green fluorescent protein (EGFP) reporter plasmid that includes the five repeats of GAL4 upstream activating sequence (UAS). Hph-1-GAL4-DBD protein formed complex with plasmid DNA through the specific interaction between GAL4-DBD and UAS,more » and delivered into the cells via the Hph-1-PTD. The pEGFP DNA was successfully delivered by the Hph-1-GAL4 system, and the EGFP was effectively expressed in mammalian cells such as HeLa and Jurkat, as well as in Bright Yellow-2 (BY-2) plant cells. When 10 {mu}g of pEGFP DNA was intranasally administered to mice using Hph-1-GAL4 protein, a high level of EGFP expression was detected throughout the lung tissue for 7 days. These results suggest that an Hph-1-PTD-mediated DNA delivery strategy may be an useful non-viral DNA delivery system for gene therapy and DNA vaccines.« less

  2. Genome-Wide Negative Feedback Drives Transgenerational DNA Methylation Dynamics in Arabidopsis

    PubMed Central

    Kassam, Mohamed; Duvernois-Berthet, Evelyne; Cortijo, Sandra; Takashima, Kazuya; Saze, Hidetoshi; Toyoda, Atsushi; Fujiyama, Asao; Colot, Vincent; Kakutani, Tetsuji

    2015-01-01

    Epigenetic variations of phenotypes, especially those associated with DNA methylation, are often inherited over multiple generations in plants. The active and inactive chromatin states are heritable and can be maintained or even be amplified by positive feedback in a transgenerational manner. However, mechanisms controlling the transgenerational DNA methylation dynamics are largely unknown. As an approach to understand the transgenerational dynamics, we examined long-term effect of impaired DNA methylation in Arabidopsis mutants of the chromatin remodeler gene DDM1 (Decrease in DNA Methylation 1) through whole genome DNA methylation sequencing. The ddm1 mutation induces a drastic decrease in DNA methylation of transposable elements (TEs) and repeats in the initial generation, while also inducing ectopic DNA methylation at hundreds of loci. Unexpectedly, this ectopic methylation can only be seen after repeated self-pollination. The ectopic cytosine methylation is found primarily in the non-CG context and starts from 3’ regions within transcription units and spreads upstream. Remarkably, when chromosomes with reduced DNA methylation were introduced from a ddm1 mutant into a DDM1 wild-type background, the ddm1-derived chromosomes also induced analogous de novo accumulation of DNA methylation in trans. These results lead us to propose a model to explain the transgenerational DNA methylation redistribution by genome-wide negative feedback. The global negative feedback, together with local positive feedback, would ensure robust and balanced differentiation of chromatin states within the genome. PMID:25902052

  3. A 5′ Noncoding Exon Containing Engineered Intron Enhances Transgene Expression from Recombinant AAV Vectors in vivo

    PubMed Central

    Lu, Jiamiao; Williams, James A.; Luke, Jeremy; Zhang, Feijie; Chu, Kirk; Kay, Mark A.

    2017-01-01

    We previously developed a mini-intronic plasmid (MIP) expression system in which the essential bacterial elements for plasmid replication and selection are placed within an engineered intron contained within a universal 5′ UTR noncoding exon. Like minicircle DNA plasmids (devoid of bacterial backbone sequences), MIP plasmids overcome transcriptional silencing of the transgene. However, in addition MIP plasmids increase transgene expression by 2 and often >10 times higher than minicircle vectors in vivo and in vitro. Based on these findings, we examined the effects of the MIP intronic sequences in a recombinant adeno-associated virus (AAV) vector system. Recombinant AAV vectors containing an intron with a bacterial replication origin and bacterial selectable marker increased transgene expression by 40 to 100 times in vivo when compared with conventional AAV vectors. Therefore, inclusion of this noncoding exon/intron sequence upstream of the coding region can substantially enhance AAV-mediated gene expression in vivo. PMID:27903072

  4. Systematic screening for mutations in the human serotonin 1F receptor gene in patients with bipolar affective disorder and schizophrenia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shimron-Abarbanell, D.; Harms, H.; Erdmann, J.

    1996-04-09

    Using single strand conformational analysis we screened the complete coding sequence of the serotonin 1F (5-HT{sub 1F}) receptor gene for the presence of DNA sequence variation in a sample of 137 unrelated individuals including 45 schizophrenic patients, 46 bipolar patients, as well as 46 healthy controls. We detected only three rare sequence variants which are characterized by single base pair substitutions, namely a silent T{r_arrow}A transversion in the third position of codon 261 (encoding isoleucine), a silent C{r_arrow}T transition in the third position of codon 176 (encoding histidine), and a C{r_arrow}T transition in position -78 upstream from the start codon.more » The lack of significant mutations in patients suffering from schizophrenia and bipolar affective disorder indicates that the 5-HT{sub 1F} receptor is not commonly involved in the etiology of these diseases. 12 refs., 1 fig., 2 tabs.« less

  5. Sequencing and functional analysis of the nifENXorf1orf2 gene cluster of Herbaspirillum seropedicae.

    PubMed

    Klassen, G; Pedrosa, F O; Souza, E M; Yates, M G; Rigo, L U

    1999-12-01

    A 5.1-kb DNA fragment from the nifHDK region of H. seropedicae was isolated and sequenced. Sequence analysis showed the presence of nifENXorf1orf2 but nifTY were not present. No nif or consensus promoter was identified. Furthermore, orf1 expression occurred only under nitrogen-fixing conditions and no promoter activity was detected between nifK and nifE, suggesting that these genes are expressed from the upstream nifH promoter and are parts of a unique nif operon. Mutagenesis studies indicate that nifN was essential for nitrogenase activity whereas nifXorf1orf2 were not. High homology between the C-terminal region of the NifX and NifB proteins from H. seropedicae was observed. Since the NifX and NifY proteins are important for FeMo cofactor (FeMoco) synthesis, we propose that alternative proteins with similar activities exist in H. seropedicae.

  6. Active PHO5 chromatin encompasses variable numbers of nucleosomes at individual promoters.

    PubMed

    Jessen, Walter J; Hoose, Scott A; Kilgore, Jessica A; Kladde, Michael P

    2006-03-01

    Transcriptional activation is often associated with chromatin remodeling. However, little is known about the dynamics of remodeling of nucleosome arrays in vivo. Upon induction of Saccharomyces cerevisiae PHO5, a novel kinetic assay of DNA methyltransferase accessibility showed that nucleosomes adjacent to the histone-free upstream activating sequence (UASp1) are disrupted earlier and at higher frequency in the cell population than are those more distal. Individually cloned molecules, each representing the chromatin state of a full promoter from a single cell, revealed multiple promoter classes with either no remodeling or variable numbers of disrupted nucleosomes. Individual promoters in the remodeled fraction were highly enriched for contiguous blocks of disrupted nucleosomes, the majority of which overlapped the UAS region. These results support a probabilistic model in which chromatin remodeling at PHO5 spreads from sites of transactivator association with DNA and attenuates with distance.

  7. Molecular cloning and sequence analysis of the Anticarsia gemmatalis multicapsid nuclear polyhedrosis virus GP64 glycoprotein.

    PubMed

    Pilloff, Marcela Gabriela; Bilen, Marcos Fabián; Belaich, Mariano Nicolás; Lozano, Mario Enrique; Ghiringhelli, Pablo Daniel

    2003-01-01

    The gp64 locus of Anticarsia gemmatalis multicapsid nucleopolyhedrovirus isolate Santa Fe (AgMNPV-SF) was characterised molecularly in our laboratory. To this end, we have located and cloned a AgMNPV-SF genomic DNA fragment containing the gp64 gene and sequenced the complete gp64 locus. Nucleotide sequence analysis indicated that the AgMNPV gp64 gene consists of a 1500 nucleotide open reading frame (ORF), encoding a protein of 499 amino acids. Of the seven gp64 homologues identified to date, the AgMNPV gp64 ORF shared most sequence similarity with the gp64 gene of Orgyia pseudotsugata MNPV. The GP64 from AgMNPV is the smallest baculoviral envelope glycoprotein found to date, differing in 10 or more residues from the other group I nucleopolyhedroviruses. The biological activity of AgMNPV GP64 protein was assessed by cell fusion assays in UFL-AG-286 cells using the obtained recombinant plasmids. In the upstream and downstream regions, relative to the gp64 ORF, we found different conserved transcriptional and post-transcriptional regulatory elements, respectively.

  8. Improved Dual-Luciferase Reporter Assays for Nuclear Receptors

    PubMed Central

    Paguio, Aileen; Stecha, Pete; Wood, Keith V; Fan, Frank

    2010-01-01

    Nuclear receptors play important roles in many cellular functions through control of gene transcription. It is also a large target class for drug discovery. Luciferase reporter assays are frequently used to study nuclear receptor function because of their wide dynamic range, low endogenous activity, and ease of use. Recent improvements of luciferase genes and vectors have further enhanced their utilities. Here we applied these improvements to two reporter formats for studying nuclear receptors. The first assay contains a Murine Mammary Tumor Virus promoter upstream of a destabilized luciferase. The presence of response elements for nuclear hormone receptor in this promoter allows the studies of endogenous and/or exogenous full length receptors. The second assay contains a ligand binding domain (LBD) of a nuclear receptor fused to the GAL4 DNA binding domain (DBD) on one vector and multiple Gal4 Upstream Activator Sequences (UAS) upstream of luciferase reporter on another vector. We showed that codon optimization of luciferase reporter genes increased expression levels in conjunction with the incorporation of protein destabilizing sequences into luciferase led to a larger assay dynamic range in both formats. The optimum number of UAS to generate the best response was determined. The expression vector for nuclear receptor LBD/GAL4 DBD fusion also constitutively expresses a Renilla luciferase-neoR fusion protein, which provides selection capability (G418 resistance, neoR) as well as an internal control (Renilla luciferase). This dual-luciferase format allowed detecting compound cytotoxicity or off-target change in expression during drug screening, therefore improved data quality. These luciferase reporter assays provided better research and drug discovery tools for studying the functions of full length nuclear receptors and ligand binding domains. PMID:21687560

  9. Isolation of the endosperm-specific LPAAT gene promoter from coconut (Cocos nucifera L.) and its functional analysis in transgenic rice plants.

    PubMed

    Xu, Li; Ye, Rongjian; Zheng, Yusheng; Wang, Zhekui; Zhou, Peng; Lin, Yongjun; Li, Dongdong

    2010-09-01

    As one of the key tropical crops, coconut (Cocos nucifera L.) is a member of the monocotyledonous family Aracaceae (Palmaceae). In this study, we amplified the upstream region of an endosperm-specific expression gene, Lysophosphatidyl acyltransferase (LPAAT), from the coconut genomic DNA by chromosome walking. In this sequence, we found several types of promoter-related elements including TATA-box, CAAT-box and Skn1-motif. In order to further examine its function, three different 5'-deletion fragments were inserted into pBI101.3, a plant expression vector harboring the LPAAT upstream sequence, leading to pBI101.3-L1, pBI101.3-L2 and pBI101.3-L3, respectively. We obtained transgenic plants of rice by Agrobacterium-mediated callus transformation and plant regeneration and detected the expression of gus gene by histochemical staining and fluorometric determination. We found that gus gene driven by the three deletion fragments was specifically expressed in the endosperm of rice seeds, but not in the empty vector of pBI101.3 and other tissues. The highest expression level of GUS was at 15 DAF in pBI101.3-L3 and pBI101.3-L2 transgenic lines, while the same level was detected at 10 DAF in pBI101.3-L1. The expression driven by the whole fragment was up to 1.76- and 2.8-fold higher than those driven by the -817 bp and -453 bp upstream fragments, and 10.7-fold higher than that driven by the vector without the promoter. Taken together, our results strongly suggest that these promoter fragments from coconut have a significant potential in genetically improving endosperm in main crops.

  10. U6 small nuclear RNA is transcribed by RNA polymerase III.

    PubMed Central

    Kunkel, G R; Maser, R L; Calvet, J P; Pederson, T

    1986-01-01

    A DNA fragment homologous to U6 small nuclear RNA was isolated from a human genomic library and sequenced. The immediate 5'-flanking region of the U6 DNA clone had significant homology with a potential mouse U6 gene, including a "TATA box" at a position 26-29 nucleotides upstream from the transcription start site. Although this sequence element is characteristic of RNA polymerase II promoters, the U6 gene also contained a polymerase III "box A" intragenic control region and a typical run of five thymines at the 3' terminus (noncoding strand). The human U6 DNA clone was accurately transcribed in a HeLa cell S100 extract lacking polymerase II activity. U6 RNA transcription in the S100 extract was resistant to alpha-amanitin at 1 microgram/ml but was completely inhibited at 200 micrograms/ml. A comparison of fingerprints of the in vitro transcript and of U6 RNA synthesized in vivo revealed sequence congruence. U6 RNA synthesis in isolated HeLa cell nuclei also displayed low sensitivity to alpha-amanitin, in contrast to U1 and U2 RNA transcription, which was inhibited greater than 90% at 1 microgram/ml. In addition, U6 RNA synthesized in isolated nuclei was efficiently immunoprecipitated by an antibody against the La antigen, a protein known to bind most other RNA polymerase III transcripts. These results establish that, in contrast to the polymerase II-directed transcription of mammalian genes for U1-U5 small nuclear RNAs, human U6 RNA is transcribed by RNA polymerase III. Images PMID:3464970

  11. Degenerative Minimalism in the Genome of a Psyllid Endosymbiont

    PubMed Central

    Clark, Marta A.; Baumann, Linda; Thao, MyLo Ly; Moran, Nancy A.; Baumann, Paul

    2001-01-01

    Psyllids, like aphids, feed on plant phloem sap and are obligately associated with prokaryotic endosymbionts acquired through vertical transmission from an ancestral infection. We have sequenced 37 kb of DNA of the genome of Carsonella ruddii, the endosymbiont of psyllids, and found that it has a number of unusual properties revealing a more extreme case of degeneration than was previously reported from studies of eubacterial genomes, including that of the aphid endosymbiont Buchnera aphidicola. Among the unusual properties are an exceptionally low guanine-plus-cytosine content (19.9%), almost complete absence of intergenic spaces, operon fusion, and lack of the usual promoter sequences upstream of 16S rDNA. These features suggest the synthesis of long mRNAs and translational coupling. The most extreme instances of base compositional bias occur in the genes encoding proteins that have less highly conserved amino acid sequences; the guanine-plus-cytosine content of some protein-coding sequences is as low as 10%. The shift in base composition has a large effect on proteins: in polypeptides of C. ruddii, half of the residues consist of five amino acids with codons low in guanine plus cytosine. Furthermore, the proteins of C. ruddii are reduced in size, with an average of about 9% fewer amino acids than in homologous proteins of related bacteria. These observations suggest that the C. ruddii genome is not subject to constraints that limit the evolution of other known eubacteria. PMID:11222582

  12. Transfection and heat-inducible expression of molluscan promoter-luciferase reporter gene constructs in the Biomphalaria glabrata embryonic snail cell line.

    PubMed

    Yoshino, T P; Wu, X J; Liu, H D

    1998-09-01

    Studies were initiated to begin developing a genetic transformation system for cells derived from the freshwater gastropod, Biomphalaria glabrata, an intermediate host of the human blood fluke Schistosoma mansoni. Using a 70-kD heat-shock protein (HSP70) cDNA probe obtained from the B. glabrata embryonic (Bge) cell line, we cloned from Bge cells a complete HSP70 gene including a 1-kb genomic DNA fragment in its 5'-flanking region containing sequences indicative of a HSP promoter. Identified in the 5'-half (416 nucleotides) of this genomic fragment were TATA and CAAT boxes, two putative transcription initiation sites, and a series of palindromic DNA repeats with shared homology to the heat-shock element consensus sequence (Bge HSP70(0.5k) promoter). The 3'-half of this upstream flanking region was comprised of a 508-base intron located immediately 5' of the ATG start codon. To determine the functionality of the putative snail promoter sequence, Bge HSP promoter/luciferase (Luc) reporter gene constructs were introduced into Bge cells by N-(1-(2,3-dioleoyloxy) propyl)-N,N,N-trimethylammonium methylsulfate (DOTAP)-mediated transfection methods, and assayed for Luc activity 48 hr following a 1.5-hr heat-shock treatment (40 degrees C). Compared with control vectors or the Bge HSP70(0.5k/1.0k) promoter constructs at 26 degrees C, a 10- to 300-fold increase in Luc expression was obtained only in the Bge HSP70 promoter/Luc-transfected cells following heat-shock. Results of transfection experiments demonstrate that the Bge HSP70(0.5k) DNA segment contains appropriate promoter sequences for driving temperature-inducible gene expression in the Bge snail cell line. This report represents the first isolation and functional characterization of an inducible promoter from a freshwater gastropod mollusc. Successful transient expression of a foreign reporter gene in Bge cells using a homologous, inducible promoter sequence now paves the way for development of methods for stable integration and expression of snail genes of interest into the Bge cell line.

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schriner, J.E.; Yi, W.; Hofmann, S.L.

    Palmitoyl-protein thioesterase (PPT) is a small glycoprotein that removes palmitate groups from cysteine residues in lipid-modified proteins. We recently reported mutations in PPT in patients with infantile neuronal ceroid lipofuscinosis (INCL), a severe neurodegenerative disorder. INCL is characterized by the accumulation of proteolipid storage material in brain and other tissues, suggesting that the disease is a consequence of abnormal catabolism of acylated proteins. In the current paper, we report the sequence of the human PPT cDNA and the structure of the human PPT gene. The cDNA predicts a protein of 306 amino acids that contains a 25-amino-acid signal peptide, threemore » N-linked glycosylation sites, and consensus motifs characteristic of thioesterases. Northern analysis of a human tissue blot revealed ubiquitous expression of a single 2.5-kb mRNA, with highest expression in lung, brain, and heart. The human PPT gene spans 25 kb and is composed of seven coding exons and a large eighth exon, containing the entire 3{prime}-untranslated region of 1388 bp. An Alu repeat and promoter elements corresponding to putative binding sites for several general transcription factors were identified in the 1060 nucleotides upstream of the transcription start site. The human PPT cDNA sequence and gene structure will provide the means for the identification of further causative mutations in INCL and facilitate genetic screening in selected high-risk populations. 31 refs., 5 figs., 1 tab.« less

  14. Epigenetic Studies Point to DNA Replication/Repair Genes as a Basis for the Heritable Nature of Long Term Complications in Diabetes.

    PubMed

    Leontovich, Alexey A; Intine, Robert V; Sarras, Michael P

    2016-01-01

    Metabolic memory (MM) is defined as the persistence of diabetic (DM) complications even after glycemic control is pharmacologically achieved. Using a zebrafish diabetic model that induces a MM state, we previously reported that, in this model, tissue dysfunction was of a heritable nature based on cell proliferation studies in limb tissue and this correlated with epigenetic DNA methylation changes that paralleled alterations in gene expression. In the current study, control, DM, and MM excised fin tissues were further analyzed by MeDIP sequencing and microarray techniques. Bioinformatics analysis of the data found that genes of the DNA replication/DNA metabolism process group (with upregulation of the apex1, mcm2, mcm4, orc3, lig1, and dnmt1 genes) were altered in the DM state and these molecular changes continued into MM. Interestingly, DNA methylation changes could be found as far as 6-13 kb upstream of the transcription start site for these genes suggesting potential higher levels of epigenetic control. In conclusion, DNA methylation changes in members of the DNA replication/repair process group best explain the heritable nature of cell proliferation impairment found in the zebrafish DM/MM model. These results are consistent with human diabetic epigenetic studies and provide one explanation for the persistence of long term tissue complications as seen in diabetes.

  15. Variation of DNA methylation patterns associated with gene expression in rice (Oryza sativa) exposed to cadmium.

    PubMed

    Feng, Sheng Jun; Liu, Xue Song; Tao, Hua; Tan, Shang Kun; Chu, Shan Shan; Oono, Youko; Zhang, Xian Duo; Chen, Jian; Yang, Zhi Min

    2016-12-01

    We report genome-wide single-base resolution maps of methylated cytosines and transcriptome change in Cd-exposed rice. Widespread differences were identified in CG and non-CG methylation marks between Cd-exposed and Cd-free rice genomes. There are 2320 non-redundant differentially methylated regions detected in the genome. RNA sequencing revealed 2092 DNA methylation-modified genes differentially expressed under Cd exposure. More genes were found hypermethylated than those hypomethylated in CG, CHH and CHG (where H is A, C or T) contexts in upstream, gene body and downstream regions. Many of the genes were involved in stress response, metal transport and transcription factors. Most of the DNA methylation-modified genes were transcriptionally altered under Cd stress. A subset of loss of function mutants defective in DNA methylation and histone modification activities was used to identify transcript abundance of selected genes. Compared with wide type, mutation of MET1 and DRM2 resulted in general lower transcript levels of the genes under Cd stress. Transcripts of OsIRO2, OsPR1b and Os09g02214 in drm2 were significantly reduced. A commonly used DNA methylation inhibitor 5-azacytidine was employed to investigate whether DNA demethylation affected physiological consequences. 5-azacytidine provision decreased general DNA methylation levels of selected genes, but promoted growth of rice seedlings and Cd accumulation in rice plant. © 2016 John Wiley & Sons Ltd.

  16. Standardization and quality management in next-generation sequencing.

    PubMed

    Endrullat, Christoph; Glökler, Jörn; Franke, Philipp; Frohme, Marcus

    2016-09-01

    DNA sequencing continues to evolve quickly even after > 30 years. Many new platforms suddenly appeared and former established systems have vanished in almost the same manner. Since establishment of next-generation sequencing devices, this progress gains momentum due to the continually growing demand for higher throughput, lower costs and better quality of data. In consequence of this rapid development, standardized procedures and data formats as well as comprehensive quality management considerations are still scarce. Here, we listed and summarized current standardization efforts and quality management initiatives from companies, organizations and societies in form of published studies and ongoing projects. These comprise on the one hand quality documentation issues like technical notes, accreditation checklists and guidelines for validation of sequencing workflows. On the other hand, general standard proposals and quality metrics are developed and applied to the sequencing workflow steps with the main focus on upstream processes. Finally, certain standard developments for downstream pipeline data handling, processing and storage are discussed in brief. These standardization approaches represent a first basis for continuing work in order to prospectively implement next-generation sequencing in important areas such as clinical diagnostics, where reliable results and fast processing is crucial. Additionally, these efforts will exert a decisive influence on traceability and reproducibility of sequence data.

  17. Deep learning of the regulatory grammar of yeast 5′ untranslated regions from 500,000 random sequences

    PubMed Central

    Groves, Benjamin; Kuchina, Anna; Rosenberg, Alexander B.; Jojic, Nebojsa; Fields, Stanley; Seelig, Georg

    2017-01-01

    Our ability to predict protein expression from DNA sequence alone remains poor, reflecting our limited understanding of cis-regulatory grammar and hampering the design of engineered genes for synthetic biology applications. Here, we generate a model that predicts the protein expression of the 5′ untranslated region (UTR) of mRNAs in the yeast Saccharomyces cerevisiae. We constructed a library of half a million 50-nucleotide-long random 5′ UTRs and assayed their activity in a massively parallel growth selection experiment. The resulting data allow us to quantify the impact on protein expression of Kozak sequence composition, upstream open reading frames (uORFs), and secondary structure. We trained a convolutional neural network (CNN) on the random library and showed that it performs well at predicting the protein expression of both a held-out set of the random 5′ UTRs as well as native S. cerevisiae 5′ UTRs. The model additionally was used to computationally evolve highly active 5′ UTRs. We confirmed experimentally that the great majority of the evolved sequences led to higher protein expression rates than the starting sequences, demonstrating the predictive power of this model. PMID:29097404

  18. Authentication of meat from game and domestic species by SNaPshot minisequencing analysis.

    PubMed

    La Neve, Fabio; Civera, Tiziana; Mucci, Nadia; Bottero, Maria Teresa

    2008-10-01

    The aim of the present study is to develop an assay for the specific identification of meat from Capreolus capreolus, Cervus elaphus, Capra ibex, Rupicapra rupicapra, targeting sequences of the cytochrome b (cyt b) gene of mitochondrial DNA. The assay is also intended to enable differentiation between meat from these wild species as well as Ovis aries, Capra hircus, Bubalus bubalis, Bos taurus and Sus scrofa domestic species. The primers used in the preliminary PCR were designed in well conserved regions upstream and downstream of the diagnosis sites. They successfully amplified a conserved 232bp region from the cyt b gene of all the species taken into consideration. The sites of diagnosis have been interrogated using a minisequencing reaction and capillary electrophoresis. All the results of the multiplex PER (primer extension reaction) test were confirmed by fragment sequencing. The assay offers the possibility of discriminating nine species at the same time.

  19. Architecture of the ParF*ParG protein complex involved in prokaryotic DNA segregation.

    PubMed

    Barillà, Daniela; Hayes, Finbarr

    2003-07-01

    The mechanism by which low copy number plasmids are segregated at cell division involves the concerted action of two plasmid-encoded proteins that assemble on a centromere-like site. This study explores the topology of the DNA segregation machinery specified by the parFG locus of TP228, a partition system which is phylogenetically distinct from more well-characterized archetypes. A variety of genetic, biochemical and biophysical strategies revealed that the ParG protein is dimeric. ParF, which is more closely related to the cell division regulator MinD than to the prototypical ParA partition protein of plasmid P1, is instead multimeric and its polymeric state appears to be modulated by ATP which correlates with the proposed ATP-binding activity of ParF. ParG interacts in a sequence-specific manner with the DNA region upstream of the parFG locus and this binding is modulated by ParF. Intriguingly, the ParF and ParG proteins form at least two types of discrete complex in the absence of this region suggesting that the assembly dynamics of these proteins onto DNA is intricate.

  20. “Gate-keeper” Residues and Active-Site Rearrangements in DNA Polymerase μ Help Discriminate Non-cognate Nucleotides

    PubMed Central

    Li, Yunlang; Schlick, Tamar

    2013-01-01

    Incorporating the cognate instead of non-cognate substrates is crucial for DNA polymerase function. Here we analyze molecular dynamics simulations of DNA polymerase μ (pol μ) bound to different non-cognate incoming nucleotides including A:dCTP, A:dGTP, A(syn):dGTP, A:dATP, A(syn):dATP, T:dCTP, and T:dGTP to study the structure-function relationships involved with aberrant base pairs in the conformational pathway; while a pol μ complex with the A:dTTP base pair is available, no solved non-cognate structures are available. We observe distinct differences of the non-cognate systems compared to the cognate system. Specifically, the motions of active-site residue His329 and Asp330 distort the active site, and Trp436, Gln440, Glu443 and Arg444 tend to tighten the nucleotide-binding pocket when non-cognate nucleotides are bound; the latter effect may further lead to an altered electrostatic potential within the active site. That most of these “gate-keeper” residues are located farther apart from the upstream primer in pol μ, compared to other X family members, also suggests an interesting relation to pol μ's ability to incorporate nucleotides when the upstream primer is not paired. By examining the correlated motions within pol μ complexes, we also observe different patterns of correlations between non-cognate systems and the cognate system, especially decreased interactions between the incoming nucleotides and the nucleotide-binding pocket. Altered correlated motions in non-cognate systems agree with our recently proposed hybrid conformational selection/induced-fit models. Taken together, our studies propose the following order for difficulty of non-cognate system insertions by pol μ: T:dGTP

  1. Characterization of the Bacillus stearothermophilus manganese superoxide dismutase gene and its ability to complement copper/zinc superoxide dismutase deficiency in Saccharomyces cerevisiae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bowler, C.; Inze, D.; Van Camp, W.

    1990-03-01

    Recombinant clones containing the manganese superoxide dismutase (MnSOD) gene of Bacillus stearothermophilus were isolated with an oligonucleotide probe designed to match a part of the previously determined amino acid sequence. Complementation analyses, performed by introducing each plasmid into a superoxide dismutase-deficient mutant of Escherichia coli, allowed us to define the region of DNA which encodes the MnSOD structural gene and to identify a promoter region immediately upstream from the gene. These data were subsequently confirmed by DNA sequencing. Since MnSOD is normally restricted to the mitochondria in eucaryotes, we were interested (i) in determining whether B. stearothermophilus MnSOD could functionmore » in eucaryotic cytosol and (ii) in determining whether MnSOD could replace the structurally unrelated copper/zinc superoxide dismutase (Cu/ZnSOD) which is normally found there. To test this, the sequence encoding bacterial MnSOD was cloned into a yeast expression vector and subsequently introduced into a Cu/ZnSOD-deficient mutant of the yeast Saccharomyces cerevisiae. Functional expression of the protein was demonstrated, and complementation tests revealed that the protein was able to provide tolerance at wild-type levels to conditions which are normally restrictive for this mutant. Thus, in spite of the evolutionary unrelatedness of these two enzymes, Cu/ZnSOD can be functionally replaced by MnSOD in yeast cytosol.« less

  2. Transcripts of the NADH-dehydrogenase subunit 3 gene are differentially edited in Oenothera mitochondria.

    PubMed Central

    Schuster, W; Wissinger, B; Unseld, M; Brennicke, A

    1990-01-01

    A number of cytosines are altered to be recognized as uridines in transcripts of the nad3 locus in mitochondria of the higher plant Oenothera. Such nucleotide modifications can be found at 16 different sites within the nad3 coding region. Most of these alterations in the mRNA sequence change codon identities to specify amino acids better conserved in evolution. Individual cDNA clones differ in their degree of editing at five nucleotide positions, three of which are silent, while two lead to codon alterations specifying different amino acids. None of the cDNA clones analysed is maximally edited at all possible sites, suggesting slow processing or lowered stringency of editing at these nucleotides. Differentially edited transcripts could be editing intermediates or could code for differing polypeptides. Two edited nucleotides in an open reading frame located upstream of nad3 change two amino acids in the deduced polypeptide. Part of the well-conserved ribosomal protein gene rps12 also encoded downstream of nad3 in other plants, is lost in Oenothera mitochondria by recombination events. The functional rps12 protein must be imported from the cytoplasm since the deleted sequences of this gene are not found in the Oenothera mitochondrial genome. The pseudogene sequence is not edited at any nucleotide position. Images Fig. 3. Fig. 4. Fig. 7. PMID:1688531

  3. Mechanisms of activation of the paternally expressed genes by the Prader-Willi imprinting center in the Prader-Willi/Angelman syndromes domains

    PubMed Central

    Rabinovitz, Shiri; Kaufman, Yotam; Ludwig, Guy; Razin, Aharon; Shemer, Ruth

    2012-01-01

    The Prader-Willi syndrome/Angelman syndrome (PWS/AS) imprinted domain is regulated by a bipartite imprinting control center (IC) composed of a sequence around the SNRPN promoter (PWS-IC) and a 880-bp sequence located 35 kb upstream (AS-IC). The AS-IC imprint is established during gametogenesis and confers repression upon PWS-IC on the maternal allele. Mutation at PWS-IC on the paternal allele leads to gene silencing across the entire PWS/AS domain. This silencing implies that PWS-IC functions on the paternal allele as a bidirectional activator. Here we examine the mechanism by which PWS-IC activates the paternally expressed genes (PEGs) using transgenes that include the PWS-IC sequence in the presence or absence of AS-IC and NDN, an upstream PEG, as an experimental model. We demonstrate that PWS-IC is in fact an activator of NDN. This activation requires an unmethylated PWS-IC in the gametes and during early embryogenesis. PWS-IC is dispensable later in development. Interestingly, a similar activation of a nonimprinted gene (APOA1) was observed, implying that PWS-IC is a universal activator. To decipher the mechanism by which PWS-IC confers activation of remote genes, we performed methylated DNA immunoprecipitation (MeDIP) array analysis on lymphoblast cell lines that revealed dispersed, rather than continued differential methylation. However, chromatin conformation capture (3c) experiments revealed a physical interaction between PWS-IC and the PEGs, suggesting that activation of PEGs may require their proximity to PWS-IC. PMID:22529396

  4. Identification of a peroxisome proliferator-responsive element upstream of the gene encoding rat peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase.

    PubMed Central

    Zhang, B; Marcus, S L; Sajjadi, F G; Alvares, K; Reddy, J K; Subramani, S; Rachubinski, R A; Capone, J P

    1992-01-01

    Ciprofibrate, a hypolipidemic drug that acts as a peroxisome proliferator, induces the transcription of genes encoding peroxisomal beta-oxidation enzymes. To identify cis-acting promoter elements involved in this induction, 5.8 kilobase pairs of promoter sequence from the gene encoding rat peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase (EC 4.2.1.17/EC 1.1.1.35) was inserted upstream of a luciferase reporter gene. Transfection of this expression vector into rat hepatoma H4IIEC3 cells in the presence of ciprofibrate resulted in a 5- to 10-fold, cell type-specific increase in luciferase activity as compared to cells transfected in the absence of drug. A peroxisome proliferator-responsive element (PPRE) was localized to a 196-nucleotide region centered at position -2943 from the transcription start site. This PPRE conferred ciprofibrate responsiveness on a heterologous promoter and functioned independently of orientation or position. Gel retardation analysis with nuclear extracts demonstrated that ciprofibrate-treated or untreated H4IIEC3 cells, but not HeLa cells or monkey kidney cells, contained sequence-specific DNA binding factors that interact with the PPRE. These results have implications for understanding the mechanisms of coordinated transcriptional induction of genes encoding peroxisomal proteins by hypolipidemic agents and other peroxisome proliferators. Images PMID:1502166

  5. In vitro transcription in the presence of DNA oligonucleotides can generate strong anomalous initiation sites.

    PubMed

    Chow, C W; Clark, M P; Rinaldo, J E; Chalkley, R

    1996-03-01

    In the present study, we have explored an unexpected observation in transcription initiation that is mediated by single-stranded oligonucleotides. Initially, our goal was to understand the function of different upstream regulatory elements/initiation sites in the rat xanthine dehydrogenase/oxidase (XDH/XO) promoter. We performed in vitro transcription with HeLa nuclear extracts in the presence of different double-stranded oligonucleotides against upstream elements as competitors. A new and unusual transcription initiation site was detected by primer extension. This new initiation site maps to the downstream region of the corresponding competitor. Subsequent analyses have indicated that the induction of a new transcription initiation site is anomalous which is due to the presence of a small amount of single-stranded oligonucleotide in the competitor. We found that this anomalous initiation site is insensitive to the orientation of the promoter and requires only a small amount of single-stranded oligonucleotide (< 2-fold molar excess relative to template). We surmise that a complementary interaction between the single-stranded oligonucleotide and transiently denatured promoter template may be responsible for this sequence-specific transcription initiation artifact. To study the regulation of transcription initiation by in vitro transcription approaches, we propose that one should probe the effect of removing transacting factors by adding an excess of a cognate oligonucleotide which does not bear exact sequence identity to the template.

  6. Structural Determinants of DNA Binding by a P. falciparum ApiAP2 Transcriptional Regulator

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lindner, Scott E.; De Silva, Erandi K.; Keck, James L.

    2010-11-05

    Putative transcription factors have only recently been identified in the Plasmodium spp., with the major family of regulators comprising the Apicomplexan Apetala2 (AP2) proteins. To better understand the DNA-binding mechanisms of these transcriptional regulators, we characterized the structure and in vitro function of an AP2 DNA-binding domain from a prototypical Apicomplexan AP2 protein, PF14{_}0633 from Plasmodium falciparum. The X-ray crystal structure of the PF14{_}0633 AP2 domain bound to DNA reveals a {beta}-sheet fold that binds the DNA major groove through base-specific and backbone contacts; a prominent {alpha}-helix supports the {beta}-sheet structure. Substitution of predicted DNA-binding residues with alanine weakened ormore » eliminated DNA binding in solution. In contrast to plant AP2 domains, the PF14{_}0633 AP2 domain dimerizes upon binding to DNA through a domain-swapping mechanism in which the {alpha}-helices of the AP2 domains pack against the {beta}-sheets of the dimer mates. DNA-induced dimerization of PF14{_}0633 may be important for tethering two distal DNA loci together in the nucleus and/or for inducing functional rearrangements of its domains to facilitate transcriptional regulation. Consistent with a multisite binding mode, at least two copies of the consensus sequence recognized by PF14{_}0633 are present upstream of a previously identified group of sporozoite-stage genes. Taken together, these findings illustrate how Plasmodium has adapted the AP2 DNA-binding domain for genome-wide transcriptional regulation.« less

  7. Spatial Organization of the Core Region of Yeast TFIIIB-DNA Complexes

    PubMed Central

    Persinger, Jim; Sengupta, Sarojini M.; Bartholomew, Blaine

    1999-01-01

    The interaction of yeast TFIIIB with the region upstream of the SUP4 tRNATyr gene was extensively probed by use of photoreactive phosphodiesters, deoxyuridines, and deoxycytidines that are site specifically incorporated into DNA. The TATA binding protein (TBP) was found to be in close proximity to the minor groove of a TATA-like DNA sequence that starts 30 nucleotides upstream of the start site of transcription. TBP was cross-linked to the phosphate backbone of DNA from bp −30 to −20 in the nontranscribed strand and from bp −28 to −24 in the transcribed strand (+1 denotes the start site of transcription). Most of the major groove of DNA in this region was shown not to be in close proximity to TBP, thus resembling the binding of TBP to the TATA box, with one notable exception. TBP was shown to interact with the major groove of DNA primarily at bp −23 and to a lesser degree at bp −25 in the transcribed strand. The stable interaction of TBP with the major groove at bp −23 was shown to require the B" subunit of TFIIIB. The S4 helix and flanking region of TBP were shown to be proximal to the major groove of DNA by peptide mapping of the region of TBP cross-linked at bp −23. Thus, TBP in the TFIIIB-SUP4 gene promoter region is bound in the same direction as TBP bound to the TATA box with respect to the transcription start site. The B" and TFIIB-related factor (BRF) subunits of TFIIIB are positioned on opposite sides of the TBP-DNA core of the TFIIIB complex, as indicated by correlation of cross-linking data to the crystal structure of the TBP-TATA box complex. Evidence is given for BRF binding near the C-terminal stirrup of TBP, similar to that of TFIIB near the TBP-TATA box complex. The protein clamp formed around the TBP-DNA complex by BRF and B" would help explain the long half-life of the TFIIIB-DNA complex and its resistance to polyanions and high salt. The path of DNA traversing the surface of TBP at the 3′ end of the TATA-like element in the SUP4 tRNA gene is not the same as that of TBP bound to a TATA box element, as shown by the cross-linking of TBP at bp −23. PMID:10373570

  8. Control of DEMETER DNA demethylase gene transcription in male and female gamete companion cells in Arabidopsis thaliana.

    PubMed

    Park, Jin-Sup; Frost, Jennifer M; Park, Kyunghyuk; Ohr, Hyonhwa; Park, Guen Tae; Kim, Seohyun; Eom, Hyunjoo; Lee, Ilha; Brooks, Janie S; Fischer, Robert L; Choi, Yeonhee

    2017-02-21

    The DEMETER (DME) DNA glycosylase initiates active DNA demethylation via the base-excision repair pathway and is vital for reproduction in Arabidopsis thaliana DME-mediated DNA demethylation is preferentially targeted to small, AT-rich, and nucleosome-depleted euchromatic transposable elements, influencing expression of adjacent genes and leading to imprinting in the endosperm. In the female gametophyte, DME expression and subsequent genome-wide DNA demethylation are confined to the companion cell of the egg, the central cell. Here, we show that, in the male gametophyte, DME expression is limited to the companion cell of sperm, the vegetative cell, and to a narrow window of time: immediately after separation of the companion cell lineage from the germline. We define transcriptional regulatory elements of DME using reporter genes, showing that a small region, which surprisingly lies within the DME gene, controls its expression in male and female companion cells. DME expression from this minimal promoter is sufficient to rescue seed abortion and the aberrant DNA methylome associated with the null dme-2 mutation. Within this minimal promoter, we found short, conserved enhancer sequences necessary for the transcriptional activities of DME and combined predicted binding motifs with published transcription factor binding coordinates to produce a list of candidate upstream pathway members in the genetic circuitry controlling DNA demethylation in gamete companion cells. These data show how DNA demethylation is regulated to facilitate endosperm gene imprinting and potential transgenerational epigenetic regulation, without subjecting the germline to potentially deleterious transposable element demethylation.

  9. Differential regulation of hepatitis B virus core protein expression and genome replication by a small upstream open reading frame and naturally occurring mutations in the precore region.

    PubMed

    Zong, Li; Qin, Yanli; Jia, Haodi; Ye, Lei; Wang, Yongxiang; Zhang, Jiming; Wands, Jack R; Tong, Shuping; Li, Jisu

    2017-05-01

    Hepatitis B virus (HBV) transcribes two subsets of 3.5-kb RNAs: precore RNA for hepatitis B e antigen (HBeAg) expression, and pregenomic RNA for core and P protein translation as well as genome replication. HBeAg expression could be prevented by mutations in the precore region, while an upstream open reading frame (uORF) has been proposed as a negative regulator of core protein translation. We employed replication competent HBV DNA constructs and transient transfection experiments in Huh7 cells to verify the uORF effect and to explore the alternative function of precore RNA. Optimized Kozak sequence for the uORF or extra ATG codons as present in some HBV genotypes reduced core protein expression. G1896A nonsense mutation promoted more efficient core protein expression than mutated precore ATG, while a +1 frameshift mutation was ineffective. In conclusion, various HBeAg-negative precore mutations and mutations affecting uORF differentially regulate core protein expression and genome replication. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Residues of E. coli topoisomerase I conserved for interaction with a specific cytosine base to facilitate DNA cleavage

    PubMed Central

    Narula, Gagandeep; Tse-Dinh, Yuk-Ching

    2012-01-01

    Bacterial and archaeal topoisomerase I display selectivity for a cytosine base 4 nt upstream from the DNA cleavage site. Recently, the solved crystal structure of Escherichia coli topoisomerase I covalently linked to a single-stranded oligonucleotide revealed that R169 and R173 interact with the cytosine base at the −4 position via hydrogen bonds while the phenol ring of Y177 wedges between the bases at the −4 and the −5 position. Substituting R169 to alanine changed the selectivity of the enzyme for the base at the −4 position from a cytosine to an adenine. The R173A mutant displayed similar sequence selectivity as the wild-type enzyme, but weaker cleavage and relaxation activity. Mutation of Y177 to serine or alanine rendered the enzyme inactive. Although mutation of each of these residues led to different outcomes, R169, R173 and Y177 work together to interact with a cytosine base at the −4 position to facilitate DNA cleavage. These strictly conserved residues might act after initial substrate binding as a Molecular Ruler to form a protein–DNA complex with the scissile phosphate positioned at the active site for optimal DNA cleavage by the tyrosine hydroxyl nucleophile to facilitate DNA cleavage in the reaction pathway. PMID:22833607

  11. DLocalMotif: a discriminative approach for discovering local motifs in protein sequences.

    PubMed

    Mehdi, Ahmed M; Sehgal, Muhammad Shoaib B; Kobe, Bostjan; Bailey, Timothy L; Bodén, Mikael

    2013-01-01

    Local motifs are patterns of DNA or protein sequences that occur within a sequence interval relative to a biologically defined anchor or landmark. Current protein motif discovery methods do not adequately consider such constraints to identify biologically significant motifs that are only weakly over-represented but spatially confined. Using negatives, i.e. sequences known to not contain a local motif, can further increase the specificity of their discovery. This article introduces the method DLocalMotif that makes use of positional information and negative data for local motif discovery in protein sequences. DLocalMotif combines three scoring functions, measuring degrees of motif over-representation, entropy and spatial confinement, specifically designed to discriminatively exploit the availability of negative data. The method is shown to outperform current methods that use only a subset of these motif characteristics. We apply the method to several biological datasets. The analysis of peroxisomal targeting signals uncovers several novel motifs that occur immediately upstream of the dominant peroxisomal targeting signal-1 signal. The analysis of proline-tyrosine nuclear localization signals uncovers multiple novel motifs that overlap with C2H2 zinc finger domains. We also evaluate the method on classical nuclear localization signals and endoplasmic reticulum retention signals and find that DLocalMotif successfully recovers biologically relevant sequence properties. http://bioinf.scmb.uq.edu.au/dlocalmotif/

  12. Selection of Optimal Polypurine Tract Region Sequences during Moloney Murine Leukemia Virus Replication

    PubMed Central

    Robson, Nicole D.; Telesnitsky, Alice

    2000-01-01

    Retrovirus plus-strand synthesis is primed by a cleavage remnant of the polypurine tract (PPT) region of viral RNA. In this study, we tested replication properties for Moloney murine leukemia viruses with targeted mutations in the PPT and in conserved sequences upstream, as well as for pools of mutants with randomized sequences in these regions. The importance of maintaining some purine residues within the PPT was indicated both by examining the evolution of random PPT pools and from the replication properties of targeted mutants. Although many different PPT sequences could support efficient replication and one mutant that contained two differences in the core PPT was found to replicate as well as the wild type, some sequences in the core PPT clearly conferred advantages over others. Contributions of sequences upstream of the core PPT were examined with deletion mutants. A conserved T-stretch within the upstream sequence was examined in detail and found to be unimportant to helper functions. Evolution of virus pools containing randomized T-stretch sequences demonstrated marked preference for the wild-type sequence in six of its eight positions. These findings demonstrate that maintenance of the T-rich element is more important to viral replication than is maintenance of the core PPT. PMID:11044073

  13. Comparative analysis of Histone modifications and DNA methylation at OsBZ8 locus under salinity stress in IR64 and Nonabokra rice varieties.

    PubMed

    Paul, Amit; Dasgupta, Pratiti; Roy, Dipan; Chaudhuri, Shubho

    2017-09-01

    Rice being an important cereal crop is highly sensitive to salinity stress causing growth retardation and loss in productivity. However, certain rice genotypes like Nonabokra and Pokkali show a high level of tolerance towards salinity stress compared to IR64 variety. This differential response of tolerant varieties towards salinity stress may be a cumulative effect of genetic and epigenetic factors. In this study, we have compared the salinity-induced changes in chromatin modifications at the OsBZ8 locus in salt-tolerant Nonabokra and salt-sensitive IR64 rice varieties. Expression analysis indicates that the OsBZ8 gene is highly induced in Nonabokra plants even in the absence of salt stress, whereas in IR64, the expression significantly increases only during salt stress. Sequence analysis and nucleosomal arrangement within the region -2000 to +1000 of OsBZ8 gene show no difference between the two rice varieties. However, there was a considerable difference in histone modifications and DNA methylation at the locus between these varieties. In Nonabokra, the upstream region was hyperacetylated at H3K9 and H3K27, and this acetylation did not change during salt stress. However, in IR64, histone acetylation was observed only during salt stress. Moreover, the upstream region of OsBZ8 gene has highly dynamic nucleosome arrangement in Nonabokra, compared to IR64. Furthermore, loss of DNA methylation was observed at OsBZ8 locus in Nonabokra control plants along with low H3K27me3 and high H3K4me3. Control IR64 plants show high DNA methylation and enriched H3K27me3. Collectively these results indicate a significant difference in chromatin modifications between the rice varieties that regulates differential expression of OsBZ8 gene during salt stress.

  14. An upstream sequence modulates phenazine production at the level of transcription and translation in the biological control strain Pseudomonas chlororaphis 30-84

    PubMed Central

    Wang, Dongping; Ries, Tessa R.; Pierson, Leland S.; Pierson, Elizabeth A.

    2018-01-01

    Phenazines are bacterial secondary metabolites and play important roles in the antagonistic activity of the biological control strain P. chlororaphis 30–84 against take-all disease of wheat. The expression of the P. chlororaphis 30–84 phenazine biosynthetic operon (phzXYFABCD) is dependent on the PhzR/PhzI quorum sensing system located immediately upstream of the biosynthetic operon as well as other regulatory systems including Gac/Rsm. Bioinformatic analysis of the sequence between the divergently oriented phzR and phzX promoters identified features within the 5’-untranslated region (5’-UTR) of phzX that are conserved only among 2OHPCA producing Pseudomonas. The conserved sequence features are potentially capable of producing secondary structures that negatively modulate one or both promoters. Transcriptional and translational fusion assays revealed that deletion of 90-bp of sequence at the 5’-UTR of phzX led to up to 4-fold greater expression of the reporters with the deletion compared to the controls, which indicated this sequence negatively modulates phenazine gene expression both transcriptionally and translationally. This 90-bp sequence was deleted from the P. chlororaphis 30–84 chromosome, resulting in 30-84Enh, which produces significantly more phenazine than the wild-type while retaining quorum sensing control. The transcriptional expression of phzR/phzI and amount of AHL signal produced by 30-84Enh also were significantly greater than for the wild-type, suggesting this 90-bp sequence also negatively affects expression of the quorum sensing genes. In addition, deletion of the 90-bp partially relieved RsmE-mediated translational repression, indicating a role for Gac/RsmE interaction. Compared to the wild-type, enhanced phenazine production by 30-84Enh resulted in improvement in fungal inhibition, biofilm formation, extracellular DNA release and suppression of take-all disease of wheat in soil without negative consequences on growth or rhizosphere persistence. This work provides greater insight into the regulation of phenazine biosynthesis with potential applications for improved biological control. PMID:29451920

  15. Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.

    PubMed

    Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua

    2013-11-01

    The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.

  16. Molecular cloning of the mouse gene coding for {alpha}{sub 2}-macroglobulin and targeting of the gene in embryonic stem cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Umans, L.; Serneels, L.; Hilliker, C.

    1994-08-01

    The authors have cloned the mouse gene coding for {alpha}{sub 2}-macroglobulin in overlapping {lambda} clones and have analyzed its structure. The gene contains 36 exons, coding for the 4.8-kb cDNA that we cloned previously. Including putative control elements in the 5{prime} flanking region, the gene covers about 45 kb. A region of 3.8 kb, stretching from 835 bases upstream of the cDNA start site to exon 4, including all intervening sequences, was sequenced completely. The analysis demonstrated that the putative promoter region of the mouse A2M gene differed considerably from the known promoter sequences of the human A2M gene andmore » of the rat acute-phas A2M gene. Comparison of the exon-intron structure of all known genes of the A2M family confirmed that the rat acute phase A2M gene is more closely related to the human gene than to the mouse A2M gene. To generate mice with the A2M gene inactivated, an insertion type of construct containing 7.5 kb of genomic DNA of the mouse strain 129/J, encompassing exons 16 to 19, was synthesized. A hygromycin marker gene was embedded in intron 17. After electroporation, 198 hygromycin-resistant ES cell lines were isolated and analyzed by Southern blotting. Five ES cell lines were obtained with one allele of the mouse A2M gene targeted by this insertion construct, demonstrating that the position and the characteristics of the vector served the intended goal.« less

  17. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae).

    PubMed

    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M

    2011-08-01

    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at -25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant.

  18. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae)

    PubMed Central

    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M

    2011-01-01

    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at −25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant. PMID:21364693

  19. SPK1 is an essential S-phase-specific gene of Saccharomyces cerevisiae that encodes a nuclear serine/threonine/tyrosine kinase.

    PubMed

    Zheng, P; Fay, D S; Burton, J; Xiao, H; Pinkham, J L; Stern, D F

    1993-09-01

    SPK1 was originally discovered in an immunoscreen for tyrosine-protein kinases in Saccharomyces cerevisiae. We have used biochemical and genetic techniques to investigate the function of this gene and its encoded protein. Hybridization of an SPK1 probe to an ordered genomic library showed that SPK1 is adjacent to PEP4 (chromosome XVI L). Sporulation of spk1/+ heterozygotes gave rise to spk1 spores that grew into microcolonies but could not be further propagated. These colonies were greatly enriched for budded cells, especially those with large buds. Similarly, eviction of CEN plasmids bearing SPK1 from cells with a chromosomal SPK1 disruption yielded viable cells with only low frequency. Spk1 protein was identified by immunoprecipitation and immunoblotting. It was associated with protein-Ser, Thr, and Tyr kinase activity in immune complex kinase assays. Spk1 was localized to the nucleus by immunofluorescence. The nucleotide sequence of the SPK1 5' noncoding region revealed that SPK1 contains two MluI cell cycle box elements. These elements confer S-phase-specific transcription to many genes involved in DNA synthesis. Northern (RNA) blotting of synchronized cells verified that the SPK1 transcript is coregulated with other MluI box-regulated genes. The SPK1 upstream region also includes a domain highly homologous to sequences involved in induction of RAD2 and other excision repair genes by agents that induce DNA damage. spk1 strains were hypersensitive to UV irradiation. Taken together, these findings indicate that SPK1 is a dual-specificity (Ser/Thr and Tyr) protein kinase that is essential for viability. The cell cycle-dependent transcription, presence of DNA damage-related sequences, requirement for UV resistance, and nuclear localization of Spk1 all link this gene to a crucial S-phase-specific role, probably as a positive regulator of DNA synthesis.

  20. Synergism between a half-site and an imperfect estrogen-responsive element, and cooperation with COUP-TFI are required for estrogen receptor (ER) to achieve a maximal estrogen-stimulation of rainbow trout ER gene.

    PubMed

    Petit, F G; Métivier, R; Valotaire, Y; Pakdel, F

    1999-01-01

    In all oviparous, liver represents one of the main E2-target tissues where estrogen receptor (ER) constitutes the key mediator of estrogen action. The rainbow trout estrogen receptor (rtER) gene expression is markedly up-regulated by estrogens and the sequences responsible for this autoregulation have been located in a 0.2 kb upstream transcription start site within - 40/- 248 enhancer region. Absence of interference with steroid hormone receptors and tissue-specific factors and a conserved basal transcriptional machinery between yeast and higher eukaryotes, make yeast a simple assay system that will enable determination of important cis-acting regulatory sequences within rtER gene promoter and identification of transcription factors implicated in the regulation of this gene. Deletion analysis allowed to show a synergistic effect between an imperfect estrogen-responsive element (ERE) and a consensus half-ERE to achieve a high hormone-dependent transcriptional activation of the rtER gene promoter in the presence of stably expressed rtER. As in mammalian cells, here we observed a positive regulation of the rtER gene promoter by the chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI) through enhancing autoregulation. Using a point mutation COUP-TFI mutant unable to bind DNA demonstrates that enhancement of rtER gene autoregulation requires the interaction of COUP-TFI to the DNA. Moreover, this enhancement of transcriptional activation by COUP-TFI requires specifically the AF-1 transactivation function of ER and can be observed in the presence of E2 or 4-hydroxytamoxifen but not ICI 164384. Thus, this paper describes the reconstitution of a hormone-responsive transcription unit in yeast in which the regulation of rtER gene promoter could be enhanced by the participation of cis-elements and/or trans-acting factors, such as ER itself or COUP-TF.

  1. Correlation between ZBED6 Gene Upstream CpG Island methylation and mRNA expression in cattle.

    PubMed

    Huang, Yong-Zhen; Zhang, Zi-Jing; He, Hua; Cao, Xiu-Kai; Song, Cheng-Chuang; Liu, Kun-Peng; Lan, Xian-Yong; Lei, Chu-Zhao; Qi, Xing-Lei; Bai, Yue-Yu; Chen, Hong

    2017-04-03

    DNA methylation is essential for the regulation of gene expression and important roles in muscle development. To assess the extent of epigenetic modifications and gene expression on the differentially methylated region (DMR) in ZBED6, we simultaneously examined DNA methylation and expression in six tissues from two different developmental stages (fetal bovine and adult bovine). The DNA methylation pattern was compared using bisulfite sequencing polymerase chain reaction (BSP) and combined bisulfite restriction analysis (COBRA). The result of quantitative real-time PCR (qPCR) analysis showed that ZBED6 has a broad tissue distribution and is highly expressed in adult bovine (P < 0.05 or P < 0.01). The DNA methylation level was significantly different in liver, lung and spleen between the two cattle groups (P < 0.05 or P < 0.01). The adult bovine group exhibited a significantly higher mRNA level and lower DNA methylation level than the fetal bovine group in liver, lung, and spleen. No significant association was detected between DNA methylation level and muscle, heart, and kidney at two different stages. In this study, the statistical analyses indicated that DNA methylation patterns are associated with mRNA level in some tissues, these results may be a useful parameter to investigate muscle developmental in cattle and as a model for studies in other species, potentially contributing to an improvement of growth performance selection in beef cattle breeding program.

  2. Late-onset spastic paraplegia: Aberrant SPG11 transcripts generated by a novel splice site donor mutation.

    PubMed

    Kawarai, Toshitaka; Miyamoto, Ryosuke; Mori, Atsuko; Oki, Ryosuke; Tsukamoto-Miyashiro, Ai; Matsui, Naoko; Miyazaki, Yoshimichi; Orlacchio, Antonio; Izumi, Yuishin; Nishida, Yoshihiko; Kaji, Ryuji

    2015-12-15

    We identified a novel homozygous mutation in the splice site donor (SSD) of intron 30 (c.5866+1G>A) in consanguineous Japanese SPG11 siblings showing late-onset spastic paraplegia using the whole-exome sequencing. Phenotypic variability was observed, including age-at-onset, dysarthria and pes cavus. Coding DNA sequencing revealed that the mutation affected the recognition of the constitutive SSD of intron 30, splicing upstream onto a nearby cryptic SSD in exon 30. The use of constitutive splice sites of intron 29 was confirmed by sequencing. The mutant transcripts are mostly subject to degradation by the nonsense-mediated mRNA decay system. SPG11 transcripts, escaping from the nonsense-mediated mRNA decay pathway, would generate a truncated protein (p.Tyr1900Phefs5X) containing the first 1899 amino acids and followed by 4 aberrant amino acids. This study showed a successful clinical application of whole-exome sequencing in spastic paraplegia and demonstrated a further evidence of allelic heterogeneity in SPG11. The confirmation of aberrant transcript by splice site mutation is a prerequisite for a more precise molecular diagnosis. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Detection of DNA polymerase λ activity during seed germination and enhancement after salinity stress and dehydration in the plumules of indica rice (Oryza sativa L.

    PubMed

    Sihi, Sayantani; Bakshi, Sankar; Sengupta, Dibyendu Narayan

    2015-02-01

    DNA polymerase λ (DNA pol λ) is the only reported X-family DNA polymerases in plants and has been shown to play a significant role in dry quiescent seeds, growth, development and nuclear DNA repair. cDNA for DNA pol λ has been reported in Arabidopsis and japonica rice cultivar and has been characterized from E. coli expressed protein, but very little is known about its activity at protein level in plants. The enzymatic activity of DNA pol λ was studied in dry, imbibed and during different germination stages of indica rice IR-8 (salt sensitive) by in-gel activity assay to determine its physiological role in important stages of growth and development. The upstream sequence was also analyzed using plantCARE database and was found to contain several cis-acting elements, including light responsive elements, dehydration responsive elements, Myb binding sites, etc. Hence, 4-day-old germinating seedlings of IR29, a salt-sensitive, but high yielding indica rice cultivar and Nonabokra, a salt-tolerant, but low yielding cultivar were treated with water (control) or 250 mM NaCl or 20% polyethyleneglycol-6000 for 4 and 8 h. The protein was analyzed by in vitro DNA pol λ activity assay, in-gel activity assay and Western blot analysis. DNA pol λ was not detected in dry seeds, but enhanced after imbibition and detectable from low level to high level during subsequent germination steps. Both salinity and dehydration stress led to the enhancement of the activity and protein level of DNA pol λ, as compared to control tissues. This is the first evidence of the salinity or dehydration stress induced enhancement of DNA pol λ activity in the plumules of rice (Oryza sativa L.) cultivars.

  4. Highly conserved non-coding elements on either side of SOX9 associated with Pierre Robin sequence.

    PubMed

    Benko, Sabina; Fantes, Judy A; Amiel, Jeanne; Kleinjan, Dirk-Jan; Thomas, Sophie; Ramsay, Jacqueline; Jamshidi, Negar; Essafi, Abdelkader; Heaney, Simon; Gordon, Christopher T; McBride, David; Golzio, Christelle; Fisher, Malcolm; Perry, Paul; Abadie, Véronique; Ayuso, Carmen; Holder-Espinasse, Muriel; Kilpatrick, Nicky; Lees, Melissa M; Picard, Arnaud; Temple, I Karen; Thomas, Paul; Vazquez, Marie-Paule; Vekemans, Michel; Roest Crollius, Hugues; Hastie, Nicholas D; Munnich, Arnold; Etchevers, Heather C; Pelet, Anna; Farlie, Peter G; Fitzpatrick, David R; Lyonnet, Stanislas

    2009-03-01

    Pierre Robin sequence (PRS) is an important subgroup of cleft palate. We report several lines of evidence for the existence of a 17q24 locus underlying PRS, including linkage analysis results, a clustering of translocation breakpoints 1.06-1.23 Mb upstream of SOX9, and microdeletions both approximately 1.5 Mb centromeric and approximately 1.5 Mb telomeric of SOX9. We have also identified a heterozygous point mutation in an evolutionarily conserved region of DNA with in vitro and in vivo features of a developmental enhancer. This enhancer is centromeric to the breakpoint cluster and maps within one of the microdeletion regions. The mutation abrogates the in vitro enhancer function and alters binding of the transcription factor MSX1 as compared to the wild-type sequence. In the developing mouse mandible, the 3-Mb region bounded by the microdeletions shows a regionally specific chromatin decompaction in cells expressing Sox9. Some cases of PRS may thus result from developmental misexpression of SOX9 due to disruption of very-long-range cis-regulatory elements.

  5. Dynamic modes of the flipped-out cytosine during HhaI methyltransferase-DNA interactions in solution.

    PubMed Central

    Klimasauskas, S; Szyperski, T; Serva, S; Wüthrich, K

    1998-01-01

    Flipping of a nucleotide out of a B-DNA helix into the active site of an enzyme has been observed for the HhaI and HaeIII cytosine-5 methyltransferases (M.HhaI and M.HaeIII) and for numerous DNA repair enzymes. Here we studied the base flipping motions in the binary M. HhaI-DNA and the ternary M.HhaI-DNA-cofactor systems in solution. Two 5-fluorocytosines were introduced into the DNA in the places of the target cytosine and, as an internal control, a cytosine positioned two nucleotides upstream of the recognition sequence 5'-GCGC-3'. The 19F NMR spectra combined with gel mobility data show that interaction with the enzyme induces partition of the target base among three states, i.e. stacked in the B-DNA, an ensemble of flipped-out forms and the flipped-out form locked in the enzyme active site. Addition of the cofactor analogue S-adenosyl-L-homocysteine greatly enhances the trapping of the target cytosine in the catalytic site. Distinct dynamic modes of the target cytosine have thus been identified along the reaction pathway, which includes novel base-flipping intermediates that were not observed in previous X-ray structures. The new data indicate that flipping of the target base out of the DNA helix is not dependent on binding of the cytosine in the catalytic pocket of M.HhaI, and suggest an active role of the enzyme in the opening of the DNA duplex. PMID:9427765

  6. Transcriptional activation of transforming growth factor alpha by estradiol: requirement for both a GC-rich site and an estrogen response element half-site.

    PubMed

    Vyhlidal, C; Samudio, I; Kladde, M P; Safe, S

    2000-06-01

    17beta-Estradiol (E2) induces transforming growth factor alpha (TGFalpha) gene expression in MCF-7 cells and previous studies have identified a 53 bp (-252 to -200) sequence containing two imperfect estrogen responsive elements (EREs) that contribute to E2 responsiveness. Deletion analysis of the TGFalpha gene promoter in this study identified a second upstream region of the promoter (-623 to -549) that is also E2 responsive. This sequence contains three GC-rich sites and an imperfect ERE half-site, and the specific cis-elements and trans-acting factors were determined by promoter analysis in transient transfection experiments, gel mobility shift assays and in vitro DNA footprinting. The results are consistent with an estrogen receptor alpha (ERalpha)/Sp1 complex interacting with an Sp1(N)(30) ERE half-site ((1/2)) motif in which both ERalpha and Sp1 bind promoter DNA. The ER/Sp1-DNA complex is formed using nuclear extracts from MCF-7 cells but not with recombinant human ERalpha or Sp1 proteins, suggesting that other nuclear factor(s) are required for complex stabilization. The E2-responsive Sp1(N)(x)ERE(1/2) motif identified in the TGFalpha gene promoter has also been characterized in the cathepsin D and heat shock protein 27 gene promoters; however, in the latter two promoters the numbers of intervening nucleotides are 23 and 10 respectively.

  7. Analysis of the putative regulatory region of the gastric inhibitory polypeptide receptor gene in food-dependent Cushing's syndrome.

    PubMed

    Antonini, S R; N'Diaye, N; Baldacchino, V; Hamet, P; Tremblay, J; Lacroix, A

    2004-07-01

    Gastric inhibitory polypeptide (GIP)-dependent Cushing's syndrome (CS) results from the ectopic expression of non-mutated GIP receptor (hGIPR) in the adrenal cortex. We evaluated whether mutations or polymorphisms in the regulatory region of the GIPR gene could lead to this aberrant expression. We studied 9.0kb upstream and 1.3kb downstream of the GIPR gene putative promoter (pProm) by sequencing leukocyte DNA from controls and from adrenal tissues of GIP- and non-GIP-dependent CS patients. The putative proximal promoter region (800 bp) and the first exon and intron of the hGIPR gene were sequenced on adrenal DNA from nine GIP-dependent CS, as well as on leukocyte DNA of nine normal controls. Three variations found in this region were found in all patients and controls; at position -4/-5, an insertion of a T was seen in four out of nine patients and in five out of nine controls. Transient transfection studies conducted in rat GC and mouse Y1 cells showed that the TT allele confers loss of 40% in the promoter activity. The analysis of the 8-kb distal pProm region revealed eight distal single nucleotide polymorphisms (SNPs) without probable association with the disease, since frequencies in patients and controls were very similar. In conclusion, mutations or SNPs in the regulatory region of the GIPR gene are unlikely to underlie GIP-dependent CS. Copyright 2004 Elsevier Ltd.

  8. Magic Pools: Parallel Assessment of Transposon Delivery Vectors in Bacteria

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Hualan; Price, Morgan N.; Waters, Robert Jordan

    Transposon mutagenesis coupled to next-generation sequencing (TnSeq) is a powerful approach for discovering the functions of bacterial genes. However, the development of a suitable TnSeq strategy for a given bacterium can be costly and time-consuming. To meet this challenge, we describe a part-based strategy for constructing libraries of hundreds of transposon delivery vectors, which we term “magic pools.” Within a magic pool, each transposon vector has a different combination of upstream sequences (promoters and ribosome binding sites) and antibiotic resistance markers as well as a random DNA barcode sequence, which allows the tracking of each vector during mutagenesis experiments. Tomore » identify an efficient vector for a given bacterium, we mutagenize it with a magic pool and sequence the resulting insertions; we then use this efficient vector to generate a large mutant library. We used the magic pool strategy to construct transposon mutant libraries in five genera of bacteria, including three genera of the phylumBacteroidetes. IMPORTANCEMolecular genetics is indispensable for interrogating the physiology of bacteria. However, the development of a functional genetic system for any given bacterium can be time-consuming. Here, we present a streamlined approach for identifying an effective transposon mutagenesis system for a new bacterium. Our strategy first involves the construction of hundreds of different transposon vector variants, which we term a “magic pool.” The efficacy of each vector in a magic pool is monitored in parallel using a unique DNA barcode that is introduced into each vector design. Using archived DNA “parts,” we next reassemble an effective vector for making a whole-genome transposon mutant library that is suitable for large-scale interrogation of gene function using competitive growth assays. Here, we demonstrate the utility of the magic pool system to make mutant libraries in five genera of bacteria.« less

  9. Magic Pools: Parallel Assessment of Transposon Delivery Vectors in Bacteria

    DOE PAGES

    Liu, Hualan; Price, Morgan N.; Waters, Robert Jordan; ...

    2018-01-16

    Transposon mutagenesis coupled to next-generation sequencing (TnSeq) is a powerful approach for discovering the functions of bacterial genes. However, the development of a suitable TnSeq strategy for a given bacterium can be costly and time-consuming. To meet this challenge, we describe a part-based strategy for constructing libraries of hundreds of transposon delivery vectors, which we term “magic pools.” Within a magic pool, each transposon vector has a different combination of upstream sequences (promoters and ribosome binding sites) and antibiotic resistance markers as well as a random DNA barcode sequence, which allows the tracking of each vector during mutagenesis experiments. Tomore » identify an efficient vector for a given bacterium, we mutagenize it with a magic pool and sequence the resulting insertions; we then use this efficient vector to generate a large mutant library. We used the magic pool strategy to construct transposon mutant libraries in five genera of bacteria, including three genera of the phylumBacteroidetes. IMPORTANCEMolecular genetics is indispensable for interrogating the physiology of bacteria. However, the development of a functional genetic system for any given bacterium can be time-consuming. Here, we present a streamlined approach for identifying an effective transposon mutagenesis system for a new bacterium. Our strategy first involves the construction of hundreds of different transposon vector variants, which we term a “magic pool.” The efficacy of each vector in a magic pool is monitored in parallel using a unique DNA barcode that is introduced into each vector design. Using archived DNA “parts,” we next reassemble an effective vector for making a whole-genome transposon mutant library that is suitable for large-scale interrogation of gene function using competitive growth assays. Here, we demonstrate the utility of the magic pool system to make mutant libraries in five genera of bacteria.« less

  10. Molecular characterization of variant alpha-subunit of electron transfer flavoprotein in three patients with glutaric acidemia type II--and identification of glycine substitution for valine-157 in the sequence of the precursor, producing an unstable mature protein in a patient.

    PubMed Central

    Indo, Y; Glassberg, R; Yokota, I; Tanaka, K

    1991-01-01

    In our previous study of eight glutaric acidemia type II (GAII) fibroblast lines by using [35S]methionine labeling and immunoprecipitation, three of them had a defect in the synthesis of the alpha-subunit of electron transfer flavoprotein (alpha-ETF) (Ikeda et al. 1986). In one of them (YH1313) the labeling of the mature alpha-ETF was barely detectable, while that of the precursor (p) was stronger. In another (YH605) no synthesis of immunoreactive p alpha-ETF was detectable. In the third cell line (YH1391) the rate of variant p alpha-ETF synthesis was comparable to normal, but its electrophoretic mobility was slightly faster than normal. In the present study, the northern blot analysis revealed that all three mutant cell lines contained p alpha-ETF mRNA and that their size and amount were comparable to normal. In immunoblot analysis, both alpha- and beta-ETF bands were barely detectable in YH1313 and YH605 but were detectable in YH1391 in amounts comparable to normal. Sequencing of YH1313 p alpha-ETF cDNA via PCR identified a transversion of T-470 to G. We then devised a simple PCR method for the 119-bp section (T-443/G-561) for detecting this mutation. In the upstream primer, A-466 was artificially replaced with C, to introduce a BstNI site into the amplified copies in the presence of G-470 from the variant sequence. The genomic DNA analysis using this method demonstrated that YH1313 was homozygous for T----G-470 transversion. It was not detected either in two other alpha-ETF-deficient GAII or in seven control cell lines. The alpha-ETF cDNA sequence in YH605 was identical to normal. Images Figure 1 Figure 2 Figure 3 Figure 5 PMID:1882842

  11. Virtual Genome Walking across the 32 Gb Ambystoma mexicanum genome; assembling gene models and intronic sequence.

    PubMed

    Evans, Teri; Johnson, Andrew D; Loose, Matthew

    2018-01-12

    Large repeat rich genomes present challenges for assembly using short read technologies. The 32 Gb axolotl genome is estimated to contain ~19 Gb of repetitive DNA making an assembly from short reads alone effectively impossible. Indeed, this model species has been sequenced to 20× coverage but the reads could not be conventionally assembled. Using an alternative strategy, we have assembled subsets of these reads into scaffolds describing over 19,000 gene models. We call this method Virtual Genome Walking as it locally assembles whole genome reads based on a reference transcriptome, identifying exons and iteratively extending them into surrounding genomic sequence. These assemblies are then linked and refined to generate gene models including upstream and downstream genomic, and intronic, sequence. Our assemblies are validated by comparison with previously published axolotl bacterial artificial chromosome (BAC) sequences. Our analyses of axolotl intron length, intron-exon structure, repeat content and synteny provide novel insights into the genic structure of this model species. This resource will enable new experimental approaches in axolotl, such as ChIP-Seq and CRISPR and aid in future whole genome sequencing efforts. The assembled sequences and annotations presented here are freely available for download from https://tinyurl.com/y8gydc6n . The software pipeline is available from https://github.com/LooseLab/iterassemble .

  12. DNA polymerase ι: The long and the short of it!

    PubMed

    Frank, Ekaterina G; McLenigan, Mary P; McDonald, John P; Huston, Donald; Mead, Samantha; Woodgate, Roger

    2017-10-01

    The cDNA encoding human DNA polymerase ι (POLI) was cloned in 1999. At that time, it was believed that the POLI gene encoded a protein of 715 amino acids. Advances in DNA sequencing technologies led to the realization that there is an upstream, in-frame initiation codon that would encode a DNA polymerase ι (polι) protein of 740 amino acids. The extra 25 amino acid region is rich in acidic residues (11/25) and is reasonably conserved in eukaryotes ranging from fish to humans. As a consequence, the curated Reference Sequence (RefSeq) database identified polι as a 740 amino acid protein. However, the existence of the 740 amino acid polι has never been shown experimentally. Using highly specific antibodies to the 25 N-terminal amino acids of polι, we were unable to detect the longer 740 amino acid (ι-long) isoform in western blots. However, trace amounts of the ι-long isoform were detected after enrichment by immunoprecipitation. One might argue that the longer isoform may have a distinct biological function, if it exhibits significant differences in its enzymatic properties from the shorter, well-characterized 715 amino acid polι. We therefore purified and characterized recombinant full-length (740 amino acid) polι-long and compared it to full-length (715 amino acid) polι-short in vitro. The metal ion requirements for optimal catalytic activity differ slightly between ι-long and ι-short, but under optimal conditions, both isoforms exhibit indistinguishable enzymatic properties in vitro. We also report that like ι-short, the ι-long isoform can be monoubiquitinated and polyubiuquitinated in vivo, as well as form damage induced foci in vivo. We conclude that the predominant isoform of DNA polι in human cells is the shorter 715 amino acid protein and that if, or when, expressed, the longer 740 amino acid isoform has identical properties to the considerably more abundant shorter isoform. Published by Elsevier B.V.

  13. Mutational Analysis of TCOF1, GSC, and HOXA2 in Patients With Treacher Collins Syndrome.

    PubMed

    Hao, Shaojuan; Jin, Lei; Wang, Huijun; Li, Chenlong; Zheng, Fengyun; Ma, Duan; Zhang, Tianyu

    2016-09-01

    Treacher Collins syndrome is an autosomal dominant craniofacial malformation mainly caused by mutations in the TCOF1 gene. Few cases have been observed in the Chinese population. Herein, the authors report the mutational analysis of TCOF1, GSC, and HOXA2 to determine the mutational features of the 3 genes in Chinese patients with Treacher Collins syndrome. Genomic DNA of the patients and their parents was extracted from peripheral blood following a standard protocol. DNA sequencing analysis was performed on all exons and the exon-intron borders of TCOF1, GSC, and HOXA2 in addition to the 1200-bp upstream of TCOF1. Four novel single nucleotide polymorphisms were detected in TCOF1, one of which was in the promoter region. Mutations in GSC and HOXA2 were not found in the 3 patients. Our results suggest the possibility of genetic heterogeneity or different mechanisms leading to the disease. Further functional study of the alteration is necessary to obtain more definitive information.

  14. Mutational Analysis of TCOF1, GSC, and HOXA2 in Patients With Treacher Collins Syndrome

    PubMed Central

    Hao, Shaojuan; Jin, Lei; Wang, Huijun; Li, Chenlong; Zheng, Fengyun; Ma, Duan; Zhang, Tianyu

    2016-01-01

    Abstract Treacher Collins syndrome is an autosomal dominant craniofacial malformation mainly caused by mutations in the TCOF1 gene. Few cases have been observed in the Chinese population. Herein, the authors report the mutational analysis of TCOF1, GSC, and HOXA2 to determine the mutational features of the 3 genes in Chinese patients with Treacher Collins syndrome. Genomic DNA of the patients and their parents was extracted from peripheral blood following a standard protocol. DNA sequencing analysis was performed on all exons and the exon-intron borders of TCOF1, GSC, and HOXA2 in addition to the 1200-bp upstream of TCOF1. Four novel single nucleotide polymorphisms were detected in TCOF1, one of which was in the promoter region. Mutations in GSC and HOXA2 were not found in the 3 patients. Our results suggest the possibility of genetic heterogeneity or different mechanisms leading to the disease. Further functional study of the alteration is necessary to obtain more definitive information. PMID:27526242

  15. Pax-3, a novel murine DNA binding protein expressed during early neurogenesis.

    PubMed Central

    Goulding, M D; Chalepakis, G; Deutsch, U; Erselius, J R; Gruss, P

    1991-01-01

    We describe the isolation and characterization of Pax-3, a novel murine paired box gene expressed exclusively during embryogenesis. Pax-3 encodes a 479 amino acid protein with an Mr of 56 kd containing both a paired domain and a paired-type homeodomain. The Pax-3 protein is a DNA binding protein that specifically recognizes the e5 sequence present upstream of the Drosophila even-skipped gene. Pax-3 transcripts are first detected in 8.5 day mouse embryos where they are restricted to the dorsal part of the neuroepithelium and to the adjacent segmented dermomyotome. During early neurogenesis, Pax-3 expression is limited to mitotic cells in the ventricular zone of the developing spinal cord and to distinct regions in the hindbrain, midbrain and diencephalon. In 10-12 day embryos, expression of Pax-3 is also seen in neural crest cells of the developing spinal ganglia, the craniofacial mesectoderm and in limb mesenchyme of 10 and 11 day embryos. Images PMID:2022185

  16. LINE1 family member is negative regulator of HLA-G expression.

    PubMed

    Ikeno, Masashi; Suzuki, Nobutaka; Kamiya, Megumi; Takahashi, Yuji; Kudoh, Jun; Okazaki, Tsuneko

    2012-11-01

    Class Ia molecules of human leucocyte antigen (HLA-A, -B and -C) are widely expressed and play a central role in the immune system by presenting peptides derived from the lumen of the endoplasmic reticulum. In contrast, class Ib molecules such as HLA-G serve novel functions. The distribution of HLA-G is mostly limited to foetal trophoblastic tissues and some tumour tissues. The mechanism required for the tissue-specific regulation of the HLA-G gene has not been well understood. Here, we investigated the genomic regulation of HLA-G by manipulating one copy of a genomic DNA fragment on a human artificial chromosome. We identified a potential negative regulator of gene expression in a sequence upstream of HLA-G that overlapped with the long interspersed element (LINE1); silencing of HLA-G involved a DNA secondary structure generated in LINE1. The presence of a LINE1 gene silencer may explain the limited expression of HLA-G compared with other class I genes.

  17. Mutational Analysis of the TnrA-Binding Sites in the Bacillus subtilis nrgAB and gabP Promoter Regions

    PubMed Central

    Wray, Lewis V.; Zalieckas, Jill M.; Ferson, Amy E.; Fisher, Susan H.

    1998-01-01

    Transcription of the Bacillus subtilis nrgAB promoter is activated during nitrogen-limited growth by the TnrA protein. A common inverted repeat, TGTNAN7TNACA (TnrA site), is centered 49 to 51 bp upstream of the transcriptional start sites for the TnrA-regulated nrgAB, gabP P2, and nas promoters. Oligonucleotide-directed mutagenesis of the nrgAB promoter region showed that conserved nucleotides within the TnrA site, the A+T-rich region between the two TnrA half-sites, and an upstream A tract are all required for high-level activation of nrgAB expression. Mutations that alter the relative distance between the two half-sites of the nrgAB TnrA site abolish nitrogen regulation of nrgAB expression. Spacer mutations that change the relative distance between the TnrA site and −35 region of the nrgAB promoter reveal that activation of nrgAB expression occurs only when the TnrA site is located 49 to 51 bp upstream of the transcriptional start site. Mutational analysis of the conserved nucleotides in the gabP P2 TnrA site showed that this sequence is also required for nitrogen-regulated gabP P2 expression. The TnrA protein, expressed in an overproducing Escherichia coli strain, had a 625-fold-higher affinity for the wild-type nrgAB promoter DNA than for a mutated nrgAB promoter DNA fragment that is unable to activate nrgAB expression in vivo. These results indicate that the proposed TnrA site functions as the binding site for the TnrA protein. TnrA was found to activate nrgAB expression during late exponential growth in nutrient sporulation medium containing glucose, suggesting that cells become nitrogen limited during growth in this medium. PMID:9603886

  18. Differential splicing of human androgen receptor pre-mRNA in X-linked reifenstein syndrome, because of a deletion involving a putative branch site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ris-Stalpers, C.; Verleun-Mooijman, M.C.T.; Blaeij, T.J.P. de

    1994-04-01

    The analysis of the androgen receptor (AR) gene, mRNA, and protein in a subject with X-linked Reifenstein syndrome (partial androgen insensitivity) is reported. The presence of two mature AR transcripts in genital skin fibroblasts of the patient is established, and, by reverse transcriptase-PCR and RNase transcription analysis, the wild-type transcript and a transcript in which exon 3 sequences are absent without disruption of the translational reading frame are identified. Sequencing and hybridization analysis show a deletion of >6 kb in intron 2 of the human AR gene, starting 18 bp upstream of exon 3. The deletion includes the putative branch-pointmore » sequence (BPS) but not the acceptor splice site on the intron 2/exon 3 boundary. The deletion of the putative intron 2 BPS results in 90% inhibition of wild-type splicing. The mutant transcript encodes an AR protein lacking the second zinc finger of the DNA-binding domain. Western/immunoblotting analysis is used to show that the mutant AR protein is expressed in genital skin fibroblasts of the patient. The residual 10% wild-type transcript can be the result of the use of a cryptic BPS located 63 bp upstream of the intron 2/exon 3 boundary of the mutant AR gene. The mutated AR protein has no transcription-activating potential and does not influence the transactivating properties of the wild-type AR, as tested in cotransfection studies. It is concluded that the partial androgen-insensitivity syndrome of this patient is the consequence of the limited amount of wild-type AR protein expressed in androgen target cells, resulting from the deletion of the intron 2 putative BPS. 42 refs., 6 figs., 1 tab.« less

  19. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    PubMed

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  20. DNA double-strand break in vivo at the 3' extremity of exons located upstream of group II introns. Senescence and circular DNA introns in Podospora mitochondria.

    PubMed

    Sainsard-Chanet, A; Begel, O; Belcour, L

    1994-10-07

    In the filamentous fungus Podospora anserina, the unavoidable phenomenon of senescence is associated with the amplification of the first intron of the mitochondrial cox1 that accumulates as circular DNA molecules consisting of tandem repeats. This group II intron (cox1-i1 or alpha) is able to transpose and contains an open reading frame with significant amino acid similarity with reverse transcriptases. The generation of these intronic circular DNA molecules, their amplification and their involvement in the senescence process are unresolved questions. We demonstrate here that: (1) another group II intron, the fourth intron of gene cox1, cox1-i4, is also able to give precise DNA end to end junctions; (2) this intronic sequence can be found amplified during senescence, although to a lesser extent than cox1-i1; (3) the amplification of the DNA multimeric cox1-i1 molecules likely does not proceed by autonomous replication; (4) the generation of the DNA intronic circles does not require efficient intron splicing; (5) a DNA double-strand break occurs in vivo at the 3' extremity of the cox1-e1 and cox1-e4 exons preceding the group II introns that form circular DNAs. On the whole, these results show that the ability to form DNA circular molecules is a property of some group II introns and they demonstrate the occurrence of a specific DNA cleavage at or near the integration site of these group II introns. The results strongly suggest that this cleavage is involved in the formation of the group II intronic DNA circles and could also be involved in the phenomenon of group II intron homing.

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kerr, J.M.; Fisher, L.W.; Termine, J.D.

    The authors have isolated and partially sequenced the human bone sialoprotein gene (IBSP). IBSP has been sublocalized by in situ hybridization to chromosome 4q38-q31 and is composed of six small exons (51 to 159 bp) and 1 large exon ([approximately]2.6 kb). The intron/exon junctions defined by sequence analysis are of class O, retaining an intact coding triplet. Sequence analysis of the 5[prime] upstream region revealed a TATAA (nucleotides -30 to-25 from the transcriptional start point) and a CCAAT (nucleotides -56 to-52) box, both in the reverse orientation. Intron 1 contains interesting structural elements composed of polypyrimidine repeats followed by amore » poly(AC)[sub n] tract. Both types of structural elements have been detected in promoter regions of other genes and have been implicated in transcriptional regulation. Several differences between the previously published cDNA sequence and the authors' sequence have been identified, most of which are contained within the untranslated exon 1. Three base revisions in the coding region include a G to T (Gly to Val, amino acid 195), T to C (Val to Ala, amino acid 268), and T to A (Glu to Asp, amino acid 270). In conclusion, the genomic organization and potential regulatory elements of human IBSP have been elucidated. 42 refs., 4 figs., 1 tab.« less

  2. Conserved noncoding sequences conserve biological networks and influence genome evolution.

    PubMed

    Xie, Jianbo; Qian, Kecheng; Si, Jingna; Xiao, Liang; Ci, Dong; Zhang, Deqiang

    2018-05-01

    Comparative genomics approaches have identified numerous conserved cis-regulatory sequences near genes in plant genomes. Despite the identification of these conserved noncoding sequences (CNSs), our knowledge of their functional importance and selection remains limited. Here, we used a combination of DNA methylome analysis, microarray expression analyses, and functional annotation to study these sequences in the model tree Populus trichocarpa. Methylation in CG contexts and non-CG contexts was lower in CNSs, particularly CNSs in the 5'-upstream regions of genes, compared with other sites in the genome. We observed that CNSs are enriched in genes with transcription and binding functions, and this also associated with syntenic genes and those from whole-genome duplications, suggesting that cis-regulatory sequences play a key role in genome evolution. We detected a significant positive correlation between CNS number and protein interactions, suggesting that CNSs may have roles in the evolution and maintenance of biological networks. The divergence of CNSs indicates that duplication-degeneration-complementation drives the subfunctionalization of a proportion of duplicated genes from whole-genome duplication. Furthermore, population genomics confirmed that most CNSs are under strong purifying selection and only a small subset of CNSs shows evidence of adaptive evolution. These findings provide a foundation for future studies exploring these key genomic features in the maintenance of biological networks, local adaptation, and transcription.

  3. Genetic Rearrangements Can Modify Chromatin Features at Epialleles

    PubMed Central

    Foerster, Andrea M.; Dinh, Huy Q.; Sedman, Laura; Wohlrab, Bonnie; Mittelsten Scheid, Ortrun

    2011-01-01

    Analogous to genetically distinct alleles, epialleles represent heritable states of different gene expression from sequence-identical genes. Alleles and epialleles both contribute to phenotypic heterogeneity. While alleles originate from mutation and recombination, the source of epialleles is less well understood. We analyze active and inactive epialleles that were found at a transgenic insert with a selectable marker gene in Arabidopsis. Both converse expression states are stably transmitted to progeny. The silent epiallele was previously shown to change its state upon loss-of-function of trans-acting regulators and drug treatments. We analyzed the composition of the epialleles, their chromatin features, their nuclear localization, transcripts, and homologous small RNA. After mutagenesis by T-DNA transformation of plants carrying the silent epiallele, we found new active alleles. These switches were associated with different, larger or smaller, and non-overlapping deletions or rearrangements in the 3′ regions of the epiallele. These cis-mutations caused different degrees of gene expression stability depending on the nature of the sequence alteration, the consequences for transcription and transcripts, and the resulting chromatin organization upstream. This illustrates a tight dependence of epigenetic regulation on local structures and indicates that sequence alterations can cause epigenetic changes at some distance in regions not directly affected by the mutation. Similar effects may also be involved in gene expression and chromatin changes in the vicinity of transposon insertions or excisions, recombination events, or DNA repair processes and could contribute to the origin of new epialleles. PMID:22028669

  4. Nucleotide sequence and structural organization of the human vasopressin pituitary receptor (V3) gene.

    PubMed

    René, P; Lenne, F; Ventura, M A; Bertagna, X; de Keyzer, Y

    2000-01-04

    In the pituitary, vasopressin triggers ACTH release through a specific receptor subtype, termed V3 or V1b. We cloned the V3 cDNA and showed that its expression was almost exclusive to pituitary corticotrophs and some corticotroph tumors. To study the determinants of this tissue specificity, we have now cloned the gene for the human (h) V3 receptor and characterized its structure. It is composed of two exons, spanning 10kb, with the coding region interrupted between transmembrane domains 6 and 7. We established that the transcription initiation site is located 498 nucleotides upstream of the initiator codon and showed that two polyadenylation sites may be used, while the most frequent is the most downstream. Sequence analysis of the promoter region showed no TATA box but identified consensus binding motifs for Sp1, CREB, and half sites of the estrogen receptor binding site. However comparison with another corticotroph-specific gene, proopiomelanocortin, did not identify common regulatory elements in the two promoters except for a short GC-rich region. Unexpectedly, hV3 gene analysis revealed that a formerly cloned 'artifactual' hV3 cDNA indeed corresponded to a spliced antisense transcript, overlapping the 5' part of the coding sequence in exon 1 and the promoter region. This transcript, hV3rev, was detected in normal pituitary and in many corticotroph tumors expressing hV3 sense mRNA and may therefore play a role in hV3 gene expression.

  5. Optimization of genome editing through CRISPR-Cas9 engineering.

    PubMed

    Zhang, Jian-Hua; Adikaram, Poorni; Pandey, Mritunjay; Genis, Allison; Simonds, William F

    2016-04-01

    CRISPR (Clustered Regularly-Interspaced Short Palindromic Repeats)-Cas9 (CRISPR associated protein 9) has rapidly become the most promising genome editing tool with great potential to revolutionize medicine. Through guidance of a 20 nucleotide RNA (gRNA), CRISPR-Cas9 finds and cuts target protospacer DNA precisely 3 base pairs upstream of a PAM (Protospacer Adjacent Motif). The broken DNA ends are repaired by either NHEJ (Non-Homologous End Joining) resulting in small indels, or by HDR (Homology Directed Repair) for precise gene or nucleotide replacement. Theoretically, CRISPR-Cas9 could be used to modify any genomic sequences, thereby providing a simple, easy, and cost effective means of genome wide gene editing. However, the off-target activity of CRISPR-Cas9 that cuts DNA sites with imperfect matches with gRNA have been of significant concern because clinical applications require 100% accuracy. Additionally, CRISPR-Cas9 has unpredictable efficiency among different DNA target sites and the PAM requirements greatly restrict its genome editing frequency. A large number of efforts have been made to address these impeding issues, but much more is needed to fully realize the medical potential of CRISPR-Cas9. In this article, we summarize the existing problems and current advances of the CRISPR-Cas9 technology and provide perspectives for the ultimate perfection of Cas9-mediated genome editing.

  6. Purification and characterization of human mitochondrial transcription factor 1.

    PubMed Central

    Fisher, R P; Clayton, D A

    1988-01-01

    We purified to near homogeneity a transcription factor from human KB cell mitochondria. This factor, designated mitochondrial transcription factor 1 (mtTF1), is required for the in vitro recognition of both major promoters of human mitochondrial DNA by the homologous mitochondrial RNA polymerase. Furthermore, it has been shown to bind upstream regulatory elements of the two major promoters. After separation from RNA polymerase by phosphocellulose chromatography, mtTF1 was chromatographed on a MonoQ anion-exchange fast-performance liquid chromatography column. Analysis of mtTF1-containing fractions by sodium dodecyl sulfate-polyacrylamide gel electrophoresis revealed a single major polypeptide with an Mr of approximately 25,000. Centrifugation in analytical glycerol gradients indicated a sedimentation coefficient of approximately 2.5 S, consistent with a monomeric 25-kilodalton protein. Finally, when the 25-kilodalton polypeptide was excised from a stained sodium dodecyl sulfate-polyacrylamide gel and allowed to renature, it regained DNA-binding and transcriptional stimulatory activities at both promoters. Although mtTF1 is the only mitochondrial DNA-binding transcription factor to be purified and characterized, its properties, such as a high affinity for random DNA and a weak specificity for one of its target sequences, may typify this class of regulatory proteins. Images PMID:3211148

  7. Mechanism of Promoter Melting by the Xeroderma Pigmentosum Complementation Group B Helicase of Transcription Factor IIH Revealed by Protein-DNA Photo-Cross-Linking

    PubMed Central

    Douziech, Maxime; Coin, Frédéric; Chipoulet, Jean-Marc; Arai, Yoko; Ohkuma, Yoshiaki; Egly, Jean-Marc; Coulombe, Benoit

    2000-01-01

    The p89/xeroderma pigmentosum complementation group B (XPB) ATPase-helicase of transcription factor IIH (TFIIH) is essential for promoter melting prior to transcription initiation by RNA polymerase II (RNAPII). By studying the topological organization of the initiation complex using site-specific protein-DNA photo-cross-linking, we have shown that p89/XPB makes promoter contacts both upstream and downstream of the initiation site. The upstream contact, which is in the region where promoter melting occurs (positions −9 to +2), requires tight DNA wrapping around RNAPII. The addition of hydrolyzable ATP tethers the template strand at positions −5 and +1 to RNAPII subunits. A mutation in p89/XPB found in a xeroderma pigmentosum patient impairs the ability of TFIIH to associate correctly with the complex and thereby melt promoter DNA. A model for open complex formation is proposed. PMID:11027286

  8. DNA sequence-specific dimeric bisbenzimidazoles DBP(n) and DBPA(n) as inhibitors of H-NS silencing in bacterial cells.

    PubMed

    Melkina, Olga E; Koval, Vasilii S; Ivanov, Alexander A; Zhuze, Alexei L; Zavilgelsky, Gennadii B

    2018-03-01

    DNA sequence-specific fluorescent dimeric bisbenzimidazoles DBP(n) and DBPA(n), noncovalently interacting with A-T pairs in the minor groove of double-stranded DNA were used for studying and monitoring the expression of histone-like H-NS-dependent promoters. Histone-like H-NS selectively binds to AT-rich segments of DNA and silences a large number of genes in bacterial chromosomes. The H-NS-dependent promoters of Quorum Sensing (QS)-regulated lux operons of the marine bacteria mesophilic Aliivibrio fischeri, psychrophilic Aliivibrio logei were used. Escherichia coli lux biosensors were constructed by cloning fragments bearing QS-regulated promoters into the vector, thereby placing each fragment upstream of the promoterless Photorhabdus luminescens luxCDABE genes. It was shown that the dimeric bisbenzimidazoles DBP(n) and DBPA(n) counteract the H-NS silencing activity. Thus, the presence of DBP(n) or DBPA(n) in the medium leads to an approximately 10-100-fold increase in the level of transcription of QS promoters in E. coli hns + . The largest decrease in the level of H-NS repression was observed using ligands containing a linker with a length of ca. 18Å, such as DBP(2) and DBPA(2). Ligands containing linkers with n=1 and 3 are an order of magnitude less active; ligands with n=4 are inactive. DBPA(2) exhibits activity starting with a concentration of 0.5μM; the minimum concentration of DBP(2) is 5-7 times higher. It is suggested that A-T pairs located at five nucleotide pair intervals, which correspond to the linker length in highly active ligands with n=2, play a key role in the structure of H-NS-binding sites in QS-regulated promoters. Copyright © 2017 Elsevier GmbH. All rights reserved.

  9. Control of DEMETER DNA demethylase gene transcription in male and female gamete companion cells in Arabidopsis thaliana

    PubMed Central

    Park, Jin-Sup; Frost, Jennifer M.; Park, Kyunghyuk; Ohr, Hyonhwa; Park, Guen Tae; Kim, Seohyun; Eom, Hyunjoo; Lee, Ilha; Brooks, Janie S.; Fischer, Robert L.; Choi, Yeonhee

    2017-01-01

    The DEMETER (DME) DNA glycosylase initiates active DNA demethylation via the base-excision repair pathway and is vital for reproduction in Arabidopsis thaliana. DME-mediated DNA demethylation is preferentially targeted to small, AT-rich, and nucleosome-depleted euchromatic transposable elements, influencing expression of adjacent genes and leading to imprinting in the endosperm. In the female gametophyte, DME expression and subsequent genome-wide DNA demethylation are confined to the companion cell of the egg, the central cell. Here, we show that, in the male gametophyte, DME expression is limited to the companion cell of sperm, the vegetative cell, and to a narrow window of time: immediately after separation of the companion cell lineage from the germline. We define transcriptional regulatory elements of DME using reporter genes, showing that a small region, which surprisingly lies within the DME gene, controls its expression in male and female companion cells. DME expression from this minimal promoter is sufficient to rescue seed abortion and the aberrant DNA methylome associated with the null dme-2 mutation. Within this minimal promoter, we found short, conserved enhancer sequences necessary for the transcriptional activities of DME and combined predicted binding motifs with published transcription factor binding coordinates to produce a list of candidate upstream pathway members in the genetic circuitry controlling DNA demethylation in gamete companion cells. These data show how DNA demethylation is regulated to facilitate endosperm gene imprinting and potential transgenerational epigenetic regulation, without subjecting the germline to potentially deleterious transposable element demethylation. PMID:28130550

  10. Use of the multipurpose transposon Tn KPK2 for the mutational analysis of chromosomal regions upstream and downstream of the sipF gene in Bradyrhizobium japonicum.

    PubMed

    Müller, P

    2004-04-01

    The DNA regions upstream and downstream of the Bradyrhizobium japonicum gene sipF were cloned by in vivo techniques and subsequently sequenced. In order to study the function of the predicted genes, a new transposon for in vitro mutagenesis, Tn KPK2, was constructed. This mutagenesis system has a number of advantages over other transposons. Tn KPK2 itself has no transposase gene, making transposition events stable. Extremely short inverted repeats minimize the length of the transposable element and facilitate the determination of the nucleotide sequence of the flanking regions. Since the transposable element carries a promoterless ' phoA reporter gene, the appearance of functional PhoA fusion proteins indicates that Tn KPK2 has inserted in a gene encoding a periplasmic or secreted protein. Although such events are extremely rare, because the transposon has to insert in-frame, in the correct orientation, and at an appropriate location in the target molecule, a direct screening procedure on agar indicator plates permits the identification of candidate clones from large numbers of colonies. In this study, Tn KPK2 was used for the construction of various symbiotic mutants of B. japonicum. One of the mutant strains, A2-10, which is defective in a gene encoding a protein that comigrates with bacterioferritin ( bcpB), was found to induce the formation of small and ineffective nodules.

  11. Abundance and functional diversity of riboswitches in microbial communities

    PubMed Central

    Kazanov, Marat D; Vitreschak, Alexey G; Gelfand, Mikhail S

    2007-01-01

    Background Several recently completed large-scale enviromental sequencing projects produced a large amount of genetic information about microbial communities ('metagenomes') which is not biased towards cultured organisms. It is a good source for estimation of the abundance of genes and regulatory structures in both known and unknown members of microbial communities. In this study we consider the distribution of RNA regulatory structures, riboswitches, in the Sargasso Sea, Minnesota Soil and Whale Falls metagenomes. Results Over three hundred riboswitches were found in about 2 Gbp metagenome DNA sequences. The abundabce of riboswitches in metagenomes was highest for the TPP, B12 and GCVT riboswitches; the S-box, RFN, YKKC/YXKD, YYBP/YKOY regulatory elements showed lower but significant abundance, while the LYS, G-box, GLMS and YKOK riboswitches were rare. Regions downstream of identified riboswitches were scanned for open reading frames. Comparative analysis of identified ORFs revealed new riboswitch-regulated functions for several classes of riboswitches. In particular, we have observed phosphoserine aminotransferase serC (COG1932) and malate synthase glcB (COG2225) to be regulated by the glycine (GCVT) riboswitch; fatty acid desaturase ole1 (COG1398), by the cobalamin (B12) riboswitch; 5-methylthioribose-1-phosphate isomerase ykrS (COG0182), by the SAM-riboswitch. We also identified conserved riboswitches upstream of genes of unknown function: thiamine (TPP), cobalamine (B12), and glycine (GCVT, upstream of genes from COG4198). Conclusion This study demonstrates applicability of bioinformatics to the analysis of RNA regulatory structures in metagenomes. PMID:17908319

  12. Scapula development is governed by genetic interactions of Pbx1 with its family members and with Emx2 via their cooperative control of Alx1

    PubMed Central

    Capellini, Terence D.; Vaccari, Giulia; Ferretti, Elisabetta; Fantini, Sebastian; He, Mu; Pellegrini, Massimo; Quintana, Laura; Di Giacomo, Giuseppina; Sharpe, James; Selleri, Licia; Zappavigna, Vincenzo

    2010-01-01

    The genetic pathways underlying shoulder blade development are largely unknown, as gene networks controlling limb morphogenesis have limited influence on scapula formation. Analysis of mouse mutants for Pbx and Emx2 genes has suggested their potential roles in girdle development. In this study, by generating compound mutant mice, we examined the genetic control of scapula development by Pbx genes and their functional relationship with Emx2. Analyses of Pbx and Pbx1;Emx2 compound mutants revealed that Pbx genes share overlapping functions in shoulder development and that Pbx1 genetically interacts with Emx2 in this process. Here, we provide a biochemical basis for Pbx1;Emx2 genetic interaction by showing that Pbx1 and Emx2 can bind specific DNA sequences as heterodimers. Moreover, the expression of genes crucial for scapula development is altered in these mutants, indicating that Pbx genes act upstream of essential pathways for scapula formation. In particular, expression of Alx1, an effector of scapula blade patterning, is absent in all compound mutants. We demonstrate that Pbx1 and Emx2 bind in vivo to a conserved sequence upstream of Alx1 and cooperatively activate its transcription via this potential regulatory element. Our results establish an essential role for Pbx1 in genetic interactions with its family members and with Emx2 and delineate novel regulatory networks in shoulder girdle development. PMID:20627960

  13. The DNA Inflammasome in Human Myeloid Cells Is Initiated by a STING-Cell Death Program Upstream of NLRP3

    PubMed Central

    Gaidt, Moritz M.; Ebert, Thomas S.; Chauhan, Dhruv; Ramshorn, Katharina; Pinci, Francesca; Zuber, Sarah; O’Duill, Fionan; Schmid-Burgk, Jonathan L.; Hoss, Florian; Buhmann, Raymund; Wittmann, Georg; Latz, Eicke; Subklewe, Marion; Hornung, Veit

    2018-01-01

    Summary Detection of cytosolic DNA constitutes a central event in the context of numerous infectious and sterile inflammatory conditions. Recent studies have uncovered a bipartite mode of cytosolic DNA recognition, in which the cGAS-STING axis triggers antiviral immunity, whereas AIM2 triggers inflammasome activation. Here, we show that AIM2 is dispensable for DNA-mediated inflammasome activation in human myeloid cells. Instead, detection of cytosolic DNA by the cGAS-STING axis induces a cell death program initiating potassium efflux upstream of NLRP3. Forward genetics identified regulators of lysosomal trafficking to modulate this cell death program, and subsequent studies revealed that activated STING traffics to the lysosome, where it triggers membrane permeabilization and thus lysosomal cell death (LCD). Importantly, the cGAS-STING-NLRP3 pathway constitutes the default inflammasome response during viral and bacterial infections in human myeloid cells. We conclude that targeting the cGAS-STING-LCD-NLRP3 pathway will ameliorate pathology in inflammatory conditions that are associated with cytosolic DNA sensing. PMID:29033128

  14. Isolation of Nicotiana plumbaginifolia cDNAs encoding isoforms of serine acetyltransferase and O-acetylserine (thiol) lyase in a yeast two-hybrid system with Escherichia coli cysE and cysK genes as baits.

    PubMed

    Liszewska, Frantz; Gaganidze, Dali; Sirko, Agnieszka

    2005-01-01

    We applied the yeast two-hybrid system for screening of a cDNA library of Nicotiana plumbaginifolia for clones encoding plant proteins interacting with two proteins of Escherichia coli: serine acetyltransferase (SAT, the product of cysE gene) and O-acetylserine (thiol)lyase A, also termed cysteine synthase (OASTL-A, the product of cysK gene). Two plant cDNA clones were identified when using the cysE gene as a bait. These clones encode a probable cytosolic isoform of OASTL and an organellar isoform of SAT, respectively, as indicated by evolutionary trees. The second clone, encoding SAT, was identified independently also as a "prey" when using cysK as a bait. Our results reveal the possibility of applying the two-hybrid system for cloning of plant cDNAs encoding enzymes of the cysteine synthase complex in the two-hybrid system. Additionally, using genome walking sequences located upstream of the sat1 cDNA were identified. Subsequently, in silico analyses were performed aiming towards identification of the potential signal peptide and possible location of the deduced mature protein encoded by sat1.

  15. The prediction of human exons by oligonucleotide composition and discriminant analysis of spliceable open reading frames

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Solovyev, V.V.; Salamov, A.A.; Lawrence, C.B.

    1994-12-31

    Discriminant analysis is applied to the problem of recognition 5`-, internal and 3`-exons in human DNA sequences. Specific recognition functions were developed for revealing exons of particular types. The method based on a splice site prediction algorithm that uses the linear Fisher discriminant to combine the information about significant triplet frequencies of various functional parts of splice site regions and preferences of oligonucleotide in protein coding and nation regions. The accuracy of our splice site recognition function is about 97%. A discriminant function for 5`-exon prediction includes hexanucleotide composition of upstream region, triplet composition around the ATG codon, ORF codingmore » potential, donor splice site potential and composition of downstream introit region. For internal exon prediction, we combine in a discriminant function the characteristics describing the 5`- intron region, donor splice site, coding region, acceptor splice site and Y-intron region for each open reading frame flanked by GT and AG base pairs. The accuracy of precise internal exon recognition on a test set of 451 exon and 246693 pseudoexon sequences is 77% with a specificity of 79% and a level of pseudoexon ORF prediction of 99.96%. The recognition quality computed at the level of individual nucleotides is 89%, for exon sequences and 98% for intron sequences. A discriminant function for 3`-exon prediction includes octanucleolide composition of upstream nation region, triplet composition around the stop codon, ORF coding potential, acceptor splice site potential and hexanucleotide composition of downstream region. We unite these three discriminant functions in exon predicting program FEX (find exons). FEX exactly predicts 70% of 1016 exons from the test of 181 complete genes with specificity 73%, and 89% exons are exactly or partially predicted. On the average, 85% of nucleotides were predicted accurately with specificity 91%.« less

  16. The dynamic DNA methylation landscape of the mutL homolog 1 shore is altered by MLH1-93G>A polymorphism in normal tissues and colorectal cancer.

    PubMed

    Savio, Andrea J; Mrkonjic, Miralem; Lemire, Mathieu; Gallinger, Steven; Knight, Julia A; Bapat, Bharat

    2017-01-01

    Colorectal cancers (CRCs) undergo distinct genetic and epigenetic alterations. Expression of mutL homolog 1 ( MLH1 ), a mismatch repair gene that corrects DNA replication errors, is lost in up to 15% of sporadic tumours due to mutation or, more commonly, due to DNA methylation of its promoter CpG island. A single nucleotide polymorphism (SNP) in the CpG island of MLH1 ( MLH1 -93G>A or rs1800734) is associated with CpG island hypermethylation and decreased MLH1 expression in CRC tumours. Further, in peripheral blood mononuclear cell (PBMC) DNA of both CRC cases and non-cancer controls, the variant allele of rs1800734 is associated with hypomethylation at the MLH1 shore, a region upstream of its CpG island that is less dense in CpG sites . To determine whether this genotype-epigenotype association is present in other tissue types, including colorectal tumours, we assessed DNA methylation in matched normal colorectal tissue, tumour, and PBMC DNA from 349 population-based CRC cases recruited from the Ontario Familial Colorectal Cancer Registry. Using the semi-quantitative real-time PCR-based MethyLight assay, MLH1 shore methylation was significantly higher in tumour tissue than normal colon or PBMCs ( P  < 0.01). When shore methylation levels were stratified by SNP genotype, normal colorectal DNA and PBMC DNA were significantly hypomethylated in association with variant SNP genotype ( P  < 0.05). However, this association was lost in tumour DNA. Among distinct stages of CRC, metastatic stage IV CRC tumours incurred significant hypomethylation compared to stage I-III cases, irrespective of genotype status. Shore methylation of MLH1 was not associated with MSI status or promoter CpG island hypermethylation, regardless of genotype. To confirm these results, bisulfite sequencing was performed in matched tumour and normal colorectal specimens from six CRC cases, including two cases per genotype (wildtype, heterozygous, and homozygous variant). Bisulfite sequencing results corroborated the methylation patterns found by MethyLight, with significant hypomethylation in normal colorectal tissue of variant SNP allele carriers. These results indicate that the normal tissue types tested (colorectum and PBMC) experience dynamic genotype-associated epigenetic alterations at the MLH1 shore, whereas tumour DNA incurs aberrant hypermethylation compared to normal DNA.

  17. Multiple copies of a bile acid-inducible gene in Eubacterium sp. strain VPI 12708.

    PubMed Central

    Gopal-Srivastava, R; Mallonee, D H; White, W B; Hylemon, P B

    1990-01-01

    Eubacterium sp. strain VPI 12708 is an anaerobic intestinal bacterium which possesses inducible bile acid 7-dehydroxylation activity. Several new polypeptides are produced in this strain following induction with cholic acid. Genes coding for two copies of a bile acid-inducible 27,000-dalton polypeptide (baiA1 and baiA2) have been previously cloned and sequenced. We now report on a gene coding for a third copy of this 27,000-dalton polypeptide (baiA3). The baiA3 gene has been cloned in lambda DASH on an 11.2-kilobase DNA fragment from a partial Sau3A digest of the Eubacterium DNA. DNA sequence analysis of the baiA3 gene revealed 100% homology with the baiA1 gene within the coding region of the 27,000-dalton polypeptides. The baiA2 gene shares 81% sequence identity with the other two genes at the nucleotide level. The flanking nucleotide sequences associated with the baiA1 and baiA3 genes are identical for 930 bases in the 5' direction from the initiation codon and for at least 325 bases in the 3' direction from the stop codon, including the putative promoter regions for the genes. An additional open reading frame (occupying from 621 to 648 bases, depending on the correct start codon) was found in the identical 5' regions associated with the baiA1 and baiA3 clones. The 5' sequence 930 bases upstream from the baiA1 and baiA3 genes was totally divergent. The baiA2 gene, which is part of a large bile acid-inducible operon, showed no homology with the other two genes either in the 5' or 3' direction from the polypeptide coding region, except for a 15-base-pair presumed ribosome-binding site in the 5' region. These studies strongly suggest that a gene duplication (baiA1 and baiA3) has occurred and is stably maintained in this bacterium. Images PMID:2376563

  18. Transactivation domain of p53 regulates DNA repair and integrity in human iPS cells.

    PubMed

    Kannappan, Ramaswamy; Mattapally, Saidulu; Wagle, Pooja A; Zhang, Jianyi

    2018-05-18

    The role of p53 transactivation domain (p53-TAD), a multifunctional and dynamic domain, on DNA repair and retaining DNA integrity in human iPS cells has never been studied. p53-TAD was knocked out in iPS cells using CRISPR/Cas9 and was confirmed by DNA sequencing. p53-TAD KO cells were characterized by: accelerated proliferation, decreased population doubling time, and unaltered Bcl2, BBC3, IGF1R, Bax and altered Mdm2, p21, and PIDD transcripts expression. In p53-TAD KO cells p53 regulated DNA repair proteins XPA, DNA polH and DDB2 expression were found to be reduced compared to p53-WT cells. Exposure to low dose of doxorubicin (Doxo) induced similar DNA damage and DNA damage response (DDR) measured by RAD50 and MRE11 expression, Checkpoint kinase 2 activation and γH2A.X recruitment at DNA strand breaks in both the cell groups indicating silencing p53-TAD do not affect DDR mechanism upstream of p53. Following removal of Doxo p53-WT hiPS cells underwent DNA repair, corrected their damaged DNA and restored DNA integrity. Conversely, p53-TAD KO hiPS cells did not undergo complete DNA repair and failed to restore DNA integrity. More importantly continuous culture of p53-TAD KO hiPS cells underwent G2/M cell cycle arrest and expressed cellular senescent marker p16 INK4a . Our data clearly shows that silencing transactivation domain of p53 did not affect DDR but affected the DNA repair process implying the crucial role of p53 transactivation domain in maintaining DNA integrity. Therefore, activating p53-TAD domain using small molecules may promote DNA repair and integrity of cells and prevent senescence.

  19. Acanthamoeba castellanii contains a ribosomal RNA enhancer binding protein which stimulates TIF-IB binding and transcription under stringent conditions.

    PubMed

    Yang, Q; Radebaugh, C A; Kubaska, W; Geiss, G K; Paule, M R

    1995-11-11

    The intergenic spacer (IGS) of Acanthamoeba castellanii rRNA genes contains repeated elements which are weak enhancers for transcription by RNA polymerase I. A protein, EBF, was identified and partially purified which binds to the enhancers and to several other sequences within the IGS, but not to other DNA fragments, including the rRNA core promoter. No consensus binding sequence could be discerned in these fragments and bound factor is in rapid equilibrium with unbound. EBF has functional characteristics similar to vertebrate upstream binding factors (UBF). Not only does it bind to the enhancer and other IGS elements, but it also stimulates binding of TIF-IB, the fundamental transcription initiation factor, to the core promoter and stimulates transcription from the promoter. Attempts to identify polypeptides with epitopes similar to rat or Xenopus laevis UBF suggest that structurally the protein from A.castellanii is not closely related to vertebrate UBF.

  20. Acanthamoeba castellanii contains a ribosomal RNA enhancer binding protein which stimulates TIF-IB binding and transcription under stringent conditions.

    PubMed Central

    Yang, Q; Radebaugh, C A; Kubaska, W; Geiss, G K; Paule, M R

    1995-01-01

    The intergenic spacer (IGS) of Acanthamoeba castellanii rRNA genes contains repeated elements which are weak enhancers for transcription by RNA polymerase I. A protein, EBF, was identified and partially purified which binds to the enhancers and to several other sequences within the IGS, but not to other DNA fragments, including the rRNA core promoter. No consensus binding sequence could be discerned in these fragments and bound factor is in rapid equilibrium with unbound. EBF has functional characteristics similar to vertebrate upstream binding factors (UBF). Not only does it bind to the enhancer and other IGS elements, but it also stimulates binding of TIF-IB, the fundamental transcription initiation factor, to the core promoter and stimulates transcription from the promoter. Attempts to identify polypeptides with epitopes similar to rat or Xenopus laevis UBF suggest that structurally the protein from A.castellanii is not closely related to vertebrate UBF. Images PMID:7501455

  1. Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in

    The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitablemore » statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.« less

  2. Molecular cloning and nucleotide sequence of the alpha and beta subunits of allophycocyanin from the cyanelle genome of Cyanophora paradoxa.

    PubMed Central

    Bryant, D A; de Lorimier, R; Lambert, D H; Dubbs, J M; Stirewalt, V L; Stevens, S E; Porter, R D; Tam, J; Jay, E

    1985-01-01

    The genes for the alpha- and beta-subunit apoproteins of allophycocyanin (AP) were isolated from the cyanelle genome of Cyanophora paradoxa and subjected to nucleotide sequence analysis. The AP beta-subunit apoprotein gene was localized to a 7.8-kilobase-pair Pst I restriction fragment from cyanelle DNA by hybridization with a tetradecameric oligonucleotide probe. Sequence analysis using that oligonucleotide and its complement as primers for the dideoxy chain-termination sequencing method confirmed the presence of both AP alpha- and beta-subunit genes on this restriction fragment. Additional oligonucleotide primers were synthesized as sequencing progressed and were used to determine rapidly the nucleotide sequence of a 1336-base-pair region of this cloned fragment. This strategy allowed the sequencing to be completed without a detailed restriction map and without extensive and time-consuming subcloning. The sequenced region contains two open reading frames whose deduced amino acid sequences are 81-85% homologous to cyanobacterial and red algal AP subunits whose amino acid sequences have been determined. The two open reading frames are in the same orientation and are separated by 39 base pairs. AP alpha is 5' to AP beta and both coding sequences are preceded by a polypurine, Shine-Dalgarno-type sequence. Sequences upstream from AP alpha closely resemble the Escherichia coli consensus promoter sequences and also show considerable homology to promoter sequences for several chloroplast-encoded psbA genes. A 56-base-pair palindromic sequence downstream from the AP beta gene could play a role in the termination of transcription or translation. The allophycocyanin apoprotein subunit genes are located on the large single-copy region of the cyanelle genome. PMID:2987916

  3. Cloning and Expression of the Erwinia carotovora subsp. carotovora Gene Encoding the Low-Molecular-Weight Bacteriocin Carocin S1▿

    PubMed Central

    Chuang, Duen-yau; Chien, Yung-chei; Wu, Huang-Pin

    2007-01-01

    The purpose of this study was to clone the carocin S1 gene and express it in a non-carocin-producing strain of Erwinia carotovora. A mutant, TH22-10, which produced a high-molecular-weight bacteriocin but not a low-molecular-weight bacteriocin, was obtained by Tn5 insertional mutagenesis using H-rif-8-2 (a spontaneous rifampin-resistant mutant of Erwinia carotovora subsp. carotovora 89-H-4). Using thermal asymmetric interlaced PCR, the DNA sequence from the Tn5 insertion site and the DNA sequence of the contiguous 2,280-bp region were determined. Two complete open reading frames (ORF), designated ORF2 and ORF3, were identified within the sequence fragment. ORF2 and ORF3 were identified with the carocin S1 genes, caroS1K (ORF2) and caroS1I (ORF3), which, respectively, encode a killing protein (CaroS1K) and an immunity protein (CaroS1I). These genes were homologous to the pyocin S3 gene and the pyocin AP41 gene. Carocin S1 was expressed in E. carotovora subsp. carotovora Ea1068 and replicated in TH22-10 but could not be expressed in Escherichia coli (JM101) because a consensus sequence resembling an SOS box was absent. A putative sequence similar to the consensus sequence for the E. coli cyclic AMP receptor protein binding site (−312 bp) was found upstream of the start codon. Production of this bacteriocin was also induced by glucose and lactose. The homology search results indicated that the carocin S1 gene (between bp 1078 and bp 1704) was homologous to the pyocin S3 and pyocin AP41 genes in Pseudomonas aeruginosa. These genes encode proteins with nuclease activity (domain 4). This study found that carocin S1 also has nuclease activity. PMID:17071754

  4. Characterization of Clostridium perfringens iota-toxin genes and expression in Escherichia coli.

    PubMed

    Perelle, S; Gibert, M; Boquet, P; Popoff, M R

    1993-12-01

    The iota toxin which is produced by Clostridium perfringens type E, is a binary toxin consisting of two independent polypeptides: Ia, which is an ADP-ribosyltransferase, and Ib, which is involved in the binding and internalization of the toxin into the cell. Two degenerate oligonucleotide probes deduced from partial amino acid sequence of each component of C. spiroforme toxin, which is closely related to the iota toxin, were used to clone three overlapping DNA fragments containing the iota-toxin genes from C. perfringens type E plasmid DNA. Two genes, in the same orientation, coding for Ia (387 amino acids) and Ib (875 amino acids) and separated by 243 noncoding nucleotides were identified. A predicted signal peptide was found for each component, and the secreted Ib displays two domains, the propeptide (172 amino acids) and the mature protein (664 amino acids). The Ia gene has been expressed in Escherichia coli and C. perfringens, under the control of its own promoter. The recombinant polypeptide obtained was recognized by Ia antibodies and ADP-ribosylated actin. The expression of the Ib gene was obtained in E. coli harboring a recombinant plasmid encompassing the putative promoter upstream of the Ia gene and the Ia and Ib genes. Two residues which have been found to be involved in the NAD+ binding site of diphtheria and pseudomonas toxins are conserved in the predicted Ia sequence (Glu-14 and Trp-19). The predicted amino acid Ib sequence shows 33.9% identity with and 54.4% similarity to the protective antigen of the anthrax toxin complex. In particular, the central region of Ib, which contains a predicted transmembrane segment (Leu-292 to Ser-308), presents 45% identity with the corresponding protective antigen sequence which is involved in the translocation of the toxin across the cell membrane.

  5. Transcription activation mediated by a cyclic AMP receptor protein from Thermus thermophilus HB8.

    PubMed

    Shinkai, Akeo; Kira, Satoshi; Nakagawa, Noriko; Kashihara, Aiko; Kuramitsu, Seiki; Yokoyama, Shigeyuki

    2007-05-01

    The extremely thermophilic bacterium Thermus thermophilus HB8, which belongs to the phylum Deinococcus-Thermus, has an open reading frame encoding a protein belonging to the cyclic AMP (cAMP) receptor protein (CRP) family present in many bacteria. The protein named T. thermophilus CRP is highly homologous to the CRP family proteins from the phyla Firmicutes, Actinobacteria, and Cyanobacteria, and it forms a homodimer and interacts with cAMP. CRP mRNA and intracellular cAMP were detected in this strain, which did not drastically fluctuate during cultivation in a rich medium. The expression of several genes was altered upon disruption of the T. thermophilus CRP gene. We found six CRP-cAMP-dependent promoters in in vitro transcription assays involving DNA fragments containing the upstream regions of the genes exhibiting decreased expression in the CRP disruptant, indicating that the CRP is a transcriptional activator. The consensus T. thermophilus CRP-binding site predicted upon nucleotide sequence alignment is 5'-(C/T)NNG(G/T)(G/T)C(A/C)N(A/T)NNTCACAN(G/C)(G/C)-3'. This sequence is unique compared with the known consensus binding sequences of CRP family proteins. A putative -10 hexamer sequence resides at 18 to 19 bp downstream of the predicted T. thermophilus CRP-binding site. The CRP-regulated genes found in this study comprise clustered regularly interspaced short palindromic repeat (CRISPR)-associated (cas) ones, and the genes of a putative transcriptional regulator, a protein containing the exonuclease III-like domain of DNA polymerase, a GCN5-related acetyltransferase homolog, and T. thermophilus-specific proteins of unknown function. These results suggest a role for cAMP signal transduction in T. thermophilus and imply the T. thermophilus CRP is a cAMP-responsive regulator.

  6. Genomic structure, promoter identification, and chromosomal mapping of a mouse nuclear orphan receptor expressed in embryos and adult testes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, C.H.; Wei, Li-Na; Copeland, N.G.

    We have isolated and characterized overlapping genomic clones containing the complete transcribed region of a newly isolated mouse cDNA encoding an orphan receptor expressed specifically in midgestation embryos and adult testis. This gene spans a distance of more than 50 kb and is organized into 13 exons. The transcription initiation site is located at the 158th nucleotide upstream from the translation initiation codon. All the exon/intron junction sequences follow the GT/AG rule. Based upon Northern blot analysis and the size of the transcribed region of the gene, its transcript was determined to be approximately 2.5 kb. Within approximately 500 hpmore » upstream from the transcription initiation site, several immune response regulatory elements were identified but no TATA box was located. This gene was mapped to the distal region of mouse chromosome 10 and its locus has been designated Tr2-11. Immunohistochemical studies show that the Tr2-11 protein is present mainly in advanced germ cell populations of mature testes and that Tr2-11 gene expression is dramatically decreased in vitamin A-depleted animals. 23 refs., 7 figs.« less

  7. Cloning and functional analysis of 5'-upstream region of the Pokemon gene.

    PubMed

    Yang, Yutao; Zhou, Xiaowei; Zhu, Xudong; Zhang, Chuanfu; Yang, Zhixin; Xu, Long; Huang, Peitang

    2008-04-01

    Pokemon, the POK erythroid myeloid ontogenic factor, not only regulates the expression of many genes, but also plays an important role in cell tumorigenesis. To investigate the molecular mechanism regulating expression of the Pokemon gene in humans, its 5'-upstream region was cloned and analyzed. Transient analysis revealed that the Pokemon promoter is constitutive. Deletion analysis and a DNA decoy assay indicated that the NEG-U and NEG-D elements were involved in negative regulation of the Pokemon promoter, whereas the POS-D element was mainly responsible for its strong activity. Electrophoretic mobility shift assays suggested that the NEG-U, NEG-D and POS-D elements were specifically bound by the nuclear extract from A549 cells in vitro. Mutation analysis demonstrated that cooperation of the NEG-U and NEG-D elements led to negative regulation of the Pokemon promoter. Moreover, the NEG-U and NEG-D elements needed to be an appropriate distance apart in the Pokemon promoter in order to cooperate. Taken together, our results elucidate the mechanism underlying the regulation of Pokemon gene transcription, and also define a novel regulatory sequence that may be used to decrease expression of the Pokemon gene in cancer gene therapy.

  8. Multiple mobile promoter regions for the rare carbapenem resistance gene of Bacteroides fragilis.

    PubMed

    Podglajen, I; Breuil, J; Rohaut, A; Monsempes, C; Collatz, E

    2001-06-01

    Two novel insertion sequences (IS), IS1187 and IS1188, are described upstream from the carbapenem resistance gene cfiA in strains of Bacteroides fragilis. Mapping, with the RACE procedure, of transcription start sites of cfiA in these and two other previously reported IS showed that transcription of this rarely encountered gene is initiated close to a variety of B. fragilis consensus promoter sequences, as recently defined (D. P. Bayley, E. R. Rocha, and C. J. Smith, FEMS Microbiol. Lett. 193:149-154, 2000). In the cases of IS1186 and IS1188, these sequences overlap with putative Esigma(70) promoter sequences, while in IS942 and IS1187 such sequences can be observed either upstream or downstream of the B. fragilis promoters.

  9. Comparison of Genomic and Epigenomic Expression in Monozygotic Twins Discordant for Rett Syndrome

    PubMed Central

    Kunio, Miyake; Yang, Chunshu; Minakuchi, Yohei; Ohori, Kenta; Soutome, Masaki; Hirasawa, Takae; Kazuki, Yasuhiro; Adachi, Noboru; Suzuki, Seiko; Itoh, Masayuki; Goto, Yu-ichi; Andoh, Tomoko; Kurosawa, Hiroshi; Akamatsu, Wado; Ohyama, Manabu; Okano, Hideyuki; Oshimura, Mitsuo; Sasaki, Masayuki; Toyoda, Atsushi; Kubota, Takeo

    2013-01-01

    Monozygotic (identical) twins have been widely used in genetic studies to determine the relative contributions of heredity and the environment in human diseases. Discordance in disease manifestation between affected monozygotic twins has been attributed to either environmental factors or different patterns of X chromosome inactivation (XCI). However, recent studies have identified genetic and epigenetic differences between monozygotic twins, thereby challenging the accepted experimental model for distinguishing the effects of nature and nurture. Here, we report the genomic and epigenomic sequences in skin fibroblasts of a discordant monozygotic twin pair with Rett syndrome, an X-linked neurodevelopmental disorder characterized by autistic features, epileptic seizures, gait ataxia and stereotypical hand movements. The twins shared the same de novo mutation in exon 4 of the MECP2 gene (G269AfsX288), which was paternal in origin and occurred during spermatogenesis. The XCI patterns in the twins did not differ in lymphocytes, skin fibroblasts, and hair cells (which originate from ectoderm as does neuronal tissue). No reproducible differences were detected between the twins in single nucleotide polymorphisms (SNPs), insertion-deletion polymorphisms (indels), or copy number variations. Differences in DNA methylation between the twins were detected in fibroblasts in the upstream regions of genes involved in brain function and skeletal tissues such as Mohawk Homeobox (MKX), Brain-type Creatine Kinase (CKB), and FYN Tyrosine Kinase Protooncogene (FYN). The level of methylation in these upstream regions was inversely correlated with the level of gene expression. Thus, differences in DNA methylation patterns likely underlie the discordance in Rett phenotypes between the twins. PMID:23805272

  10. Bacillus subtilis δ Factor Functions as a Transcriptional Regulator by Facilitating the Open Complex Formation.

    PubMed

    Prajapati, Ranjit Kumar; Sengupta, Shreya; Rudra, Paulami; Mukhopadhyay, Jayanta

    2016-01-15

    Most bacterial RNA polymerases (RNAP) contain five conserved subunits, viz. 2α, β, β', and ω. However, in many Gram-positive bacteria, especially in fermicutes, RNAP is associated with an additional factor, called δ. For over three decades since its identification, it had been thought that δ functioned as a subunit of RNAP to enhance the level of transcripts by recycling RNAP. In support of the previous observations, we also find that δ is involved in recycling of RNAP by releasing the RNA from the ternary complex. We further show that δ binds to RNA and is able to recycle RNAP when the length of the nascent RNA reaches a critical length. However, in this work we decipher a new function of δ. Performing biochemical and mutational analysis, we show that Bacillus subtilis δ binds to DNA immediately upstream of the promoter element at A-rich sequences on the abrB and rrnB1 promoters and facilitates open complex formation. As a result, δ facilitates RNAP to initiate transcription in the second scale, compared with minute scale in the absence of δ. Using transcription assay, we show that δ-mediated recycling of RNAP cannot be the sole reason for the enhancement of transcript yield. Our observation that δ does not bind to RNAP holo enzyme but is required to bind to DNA upstream of the -35 promoter element for transcription activation suggests that δ functions as a transcriptional regulator. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Comparison of Genomic and Epigenomic Expression in Monozygotic Twins Discordant for Rett Syndrome.

    PubMed

    Miyake, Kunio; Yang, Chunshu; Minakuchi, Yohei; Ohori, Kenta; Soutome, Masaki; Hirasawa, Takae; Kazuki, Yasuhiro; Adachi, Noboru; Suzuki, Seiko; Itoh, Masayuki; Goto, Yu-Ichi; Andoh, Tomoko; Kurosawa, Hiroshi; Oshimura, Mitsuo; Sasaki, Masayuki; Toyoda, Atsushi; Kubota, Takeo

    2013-01-01

    Monozygotic (identical) twins have been widely used in genetic studies to determine the relative contributions of heredity and the environment in human diseases. Discordance in disease manifestation between affected monozygotic twins has been attributed to either environmental factors or different patterns of X chromosome inactivation (XCI). However, recent studies have identified genetic and epigenetic differences between monozygotic twins, thereby challenging the accepted experimental model for distinguishing the effects of nature and nurture. Here, we report the genomic and epigenomic sequences in skin fibroblasts of a discordant monozygotic twin pair with Rett syndrome, an X-linked neurodevelopmental disorder characterized by autistic features, epileptic seizures, gait ataxia and stereotypical hand movements. The twins shared the same de novo mutation in exon 4 of the MECP2 gene (G269AfsX288), which was paternal in origin and occurred during spermatogenesis. The XCI patterns in the twins did not differ in lymphocytes, skin fibroblasts, and hair cells (which originate from ectoderm as does neuronal tissue). No reproducible differences were detected between the twins in single nucleotide polymorphisms (SNPs), insertion-deletion polymorphisms (indels), or copy number variations. Differences in DNA methylation between the twins were detected in fibroblasts in the upstream regions of genes involved in brain function and skeletal tissues such as Mohawk Homeobox (MKX), Brain-type Creatine Kinase (CKB), and FYN Tyrosine Kinase Protooncogene (FYN). The level of methylation in these upstream regions was inversely correlated with the level of gene expression. Thus, differences in DNA methylation patterns likely underlie the discordance in Rett phenotypes between the twins.

  12. A new double digestion ligation mediated suppression PCR method for simultaneous bacteria DNA-typing and confirmation of species: an Acinetobacter sp. model.

    PubMed

    Stojowska, Karolina; Krawczyk, Beata

    2014-01-01

    We have designed a new ddLMS PCR (double digestion Ligation Mediated Suppression PCR) method based on restriction site polymorphism upstream from the specific target sequence for the simultaneous identification and differentiation of bacterial strains. The ddLMS PCR combines a simple PCR used for species or genus identification and the LM PCR strategy for strain differentiation. The bacterial identification is confirmed in the form of the PCR product(s), while the length of the PCR product makes it possible to differentiate between bacterial strains. If there is a single copy of the target sequence within genomic DNA, one specific PCR product is created (simplex ddLMS PCR), whereas for multiple copies of the gene the fingerprinting patterns can be obtained (multiplex ddLMS PCR). The described ddLMS PCR method is designed for rapid and specific strain differentiation in medical and microbiological studies. In comparison to other LM PCR it has substantial advantages: enables specific species' DNA-typing without the need for pure bacterial culture selection, is not sensitive to contamination with other cells or genomic DNA, and gives univocal "band-based" results, which are easy to interpret. The utility of ddLMS PCR was shown for Acinetobacter calcoaceticus-baumannii (Acb) complex, the genetically closely related and phenotypically similar species and also important nosocomial pathogens, for which currently, there are no recommended methods for screening, typing and identification. In this article two models are proposed: 3' recA-ddLMS PCR-MaeII/RsaI for Acb complex interspecific typing and 5' rrn-ddLMS PCR-HindIII/ApaI for Acinetobacter baumannii intraspecific typing. ddLMS PCR allows not only for DNA-typing but also for confirmation of species in one reaction. Also, practical guidelines for designing a diagnostic test based on ddLMS PCR for genotyping different species of bacteria are provided.

  13. Immunogenicity of DNA Vaccine against H5N1 Containing Extended Kappa B Site: In Vivo Study in Mice and Chickens

    PubMed Central

    Redkiewicz, Patrycja; Stachyra, Anna; Sawicka, Róz∙a; Bocian, Katarzyna; Góra-Sochacka, Anna; Kosson, Piotr; Sirko, Agnieszka

    2017-01-01

    Influenza is one of the most important illnesses in the modern world, causing great public health losses each year due to the lack of medication and broadly protective, long-lasting vaccines. The development of highly immunogenic and safe vaccines is currently one of the major problems encountered in efficient influenza prevention. DNA vaccines represent a novel and powerful alternative to the conventional vaccine approaches. To improve the efficacy of the DNA vaccine against influenza H5N1, we inserted three repeated kappa B (κB) motifs, separated by a 5-bp nucleotide spacer, upstream of the cytomegalovirus promoter and downstream of the SV40 late polyadenylation signal. The κB motif is a specific DNA element (10pb-long) recognized by one of the most important transcription factors NFκB. NFκB is present in almost all animal cell types and upon cell stimulation under a variety of pathogenic conditions. NFκB is released from IκB and translocates to the nucleus and binds to κB sites, thereby leading to enhanced transcription and expression of downstream genes. We tested the variants of DNA vaccine with κB sites flanking the antigen expression cassette and without such sites in two animal models: chickens (broilers and layers) and mice (BALB/c). In chickens, the variant with κB sites stimulated stronger humoral response against the target antigen. In mice, the differences in humoral response were less apparent. Instead, it was possible to spot several gene expression differences in the spleens isolated from mice immunized with both variants. The results of our study indicate that modification of the sequence outside of the sequence encoding the antigen might enhance the immune response to the target but understanding the mechanisms responsible for this process requires further analysis. PMID:28883819

  14. A New Double Digestion Ligation Mediated Suppression PCR Method for Simultaneous Bacteria DNA-Typing and Confirmation of Species: An Acinetobacter sp. Model

    PubMed Central

    Stojowska, Karolina; Krawczyk, Beata

    2014-01-01

    We have designed a new ddLMS PCR (double digestion Ligation Mediated Suppression PCR) method based on restriction site polymorphism upstream from the specific target sequence for the simultaneous identification and differentiation of bacterial strains. The ddLMS PCR combines a simple PCR used for species or genus identification and the LM PCR strategy for strain differentiation. The bacterial identification is confirmed in the form of the PCR product(s), while the length of the PCR product makes it possible to differentiate between bacterial strains. If there is a single copy of the target sequence within genomic DNA, one specific PCR product is created (simplex ddLMS PCR), whereas for multiple copies of the gene the fingerprinting patterns can be obtained (multiplex ddLMS PCR). The described ddLMS PCR method is designed for rapid and specific strain differentiation in medical and microbiological studies. In comparison to other LM PCR it has substantial advantages: enables specific species' DNA-typing without the need for pure bacterial culture selection, is not sensitive to contamination with other cells or genomic DNA, and gives univocal “band-based” results, which are easy to interpret. The utility of ddLMS PCR was shown for Acinetobacter calcoaceticus-baumannii (Acb) complex, the genetically closely related and phenotypically similar species and also important nosocomial pathogens, for which currently, there are no recommended methods for screening, typing and identification. In this article two models are proposed: 3′ recA-ddLMS PCR-MaeII/RsaI for Acb complex interspecific typing and 5′ rrn-ddLMS PCR-HindIII/ApaI for Acinetobacter baumannii intraspecific typing. ddLMS PCR allows not only for DNA-typing but also for confirmation of species in one reaction. Also, practical guidelines for designing a diagnostic test based on ddLMS PCR for genotyping different species of bacteria are provided. PMID:25522278

  15. Chromosome segregation in Archaea mediated by a hybrid DNA partition machine

    PubMed Central

    Kalliomaa-Sanford, Anne K.; Rodriguez-Castañeda, Fernando A.; McLeod, Brett N.; Latorre-Roselló, Victor; Smith, Jasmine H.; Reimann, Julia; Albers, Sonja V.; Barillà, Daniela

    2012-01-01

    Eukarya and, more recently, some bacteria have been shown to rely on a cytoskeleton-based apparatus to drive chromosome segregation. In contrast, the factors and mechanisms underpinning this fundamental process are underexplored in archaea, the third domain of life. Here we establish that the archaeon Sulfolobus solfataricus harbors a hybrid segrosome consisting of two interacting proteins, SegA and SegB, that play a key role in genome segregation in this organism. SegA is an ortholog of bacterial, Walker-type ParA proteins, whereas SegB is an archaea-specific factor lacking sequence identity to either eukaryotic or bacterial proteins, but sharing homology with a cluster of uncharacterized factors conserved in both crenarchaea and euryarchaea, the two major archaeal sub-phyla. We show that SegA is an ATPase that polymerizes in vitro and that SegB is a site-specific DNA-binding protein contacting palindromic sequences located upstream of the segAB cassette. SegB interacts with SegA in the presence of nucleotides and dramatically affects its polymerization dynamics. Our data demonstrate that SegB strongly stimulates SegA polymerization, possibly by promoting SegA nucleation and accelerating polymer growth. Increased expression levels of segAB resulted in severe growth and chromosome segregation defects, including formation of anucleate cells, compact nucleoids confined to one half of the cell compartment and fragmented nucleoids. The overall picture emerging from our findings indicates that the SegAB complex fulfills a crucial function in chromosome segregation and is the prototype of a DNA partition machine widespread across archaea. PMID:22355141

  16. Chromosome segregation in Archaea mediated by a hybrid DNA partition machine.

    PubMed

    Kalliomaa-Sanford, Anne K; Rodriguez-Castañeda, Fernando A; McLeod, Brett N; Latorre-Roselló, Victor; Smith, Jasmine H; Reimann, Julia; Albers, Sonja V; Barillà, Daniela

    2012-03-06

    Eukarya and, more recently, some bacteria have been shown to rely on a cytoskeleton-based apparatus to drive chromosome segregation. In contrast, the factors and mechanisms underpinning this fundamental process are underexplored in archaea, the third domain of life. Here we establish that the archaeon Sulfolobus solfataricus harbors a hybrid segrosome consisting of two interacting proteins, SegA and SegB, that play a key role in genome segregation in this organism. SegA is an ortholog of bacterial, Walker-type ParA proteins, whereas SegB is an archaea-specific factor lacking sequence identity to either eukaryotic or bacterial proteins, but sharing homology with a cluster of uncharacterized factors conserved in both crenarchaea and euryarchaea, the two major archaeal sub-phyla. We show that SegA is an ATPase that polymerizes in vitro and that SegB is a site-specific DNA-binding protein contacting palindromic sequences located upstream of the segAB cassette. SegB interacts with SegA in the presence of nucleotides and dramatically affects its polymerization dynamics. Our data demonstrate that SegB strongly stimulates SegA polymerization, possibly by promoting SegA nucleation and accelerating polymer growth. Increased expression levels of segAB resulted in severe growth and chromosome segregation defects, including formation of anucleate cells, compact nucleoids confined to one half of the cell compartment and fragmented nucleoids. The overall picture emerging from our findings indicates that the SegAB complex fulfills a crucial function in chromosome segregation and is the prototype of a DNA partition machine widespread across archaea.

  17. WRNIP1 functions upstream of DNA polymerase η in the UV-induced DNA damage response

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yoshimura, Akari, E-mail: akari_yo@stu.musashino-u.ac.jp; Kobayashi, Yume; Tada, Shusuke

    2014-09-12

    Highlights: • The UV sensitivity of POLH{sup −/−} cells was suppressed by disruption of WRNIP1. • In WRNIP1{sup −/−/−}/POLH{sup −/−} cells, mutation frequencies and SCE after irradiation reduced. • WRNIP1 defect recovered rate of fork progression after irradiation in POLH{sup −/−} cells. • WRNIP1 functions upstream of Polη in the translesion DNA synthesis pathway. - Abstract: WRNIP1 (WRN-interacting protein 1) was first identified as a factor that interacts with WRN, the protein that is defective in Werner syndrome (WS). WRNIP1 associates with DNA polymerase η (Polη), but the biological significance of this interaction remains unknown. In this study, we analyzedmore » the functional interaction between WRNIP1 and Polη by generating knockouts of both genes in DT40 chicken cells. Disruption of WRNIP1 in Polη-disrupted (POLH{sup −/−}) cells suppressed the phenotypes associated with the loss of Polη: sensitivity to ultraviolet light (UV), delayed repair of cyclobutane pyrimidine dimers (CPD), elevated frequency of mutation, elevated levels of UV-induced sister chromatid exchange (SCE), and reduced rate of fork progression after UV irradiation. These results suggest that WRNIP1 functions upstream of Polη in the response to UV irradiation.« less

  18. The F-ATPase operon from the oral streptococci S. mutans and S. sanguis: How structure relates to function

    NASA Astrophysics Data System (ADS)

    Kuhnert, Wendi Lee

    1999-10-01

    The oral microbe, Streptococcus mutans is known to be a primary contributor to the most common infection in humans, dental caries. In the plaque environment, resident bacteria metabolize dietary sucrose which results in the production of organic acids and a decrease in plaque pH. The proton-translocating ATPase (F-ATPase) protects the bacteria from acidification by extruding protons, at the expense of ATP, to maintain an internal pH which is more neutral than the external environment. Examination of this enzyme will help us to gain insight regarding its contribution to the aciduricity characteristics of oral bacteria. In this work, our goal was to begin the molecular dissection of the mechanism by which streptococcal ATPases are regulated and function enzymatically. Sequence analysis of the F-ATPase from the non-pathogenic S. sanguis revealed that the structural genes are homologous to S. mutans as well as other sequenced F-ATPases. Cloned subunits were functionally similar as shown by complementing E. coli ATPase mutants. S. sanguis/E. coli hybrid enzymes hydrolyzed ATP, but proton conduction was uncoupled as demonstrated with inhibition studies. Transcriptional regulation of the F-ATPase operon from S. mutans was examined using chloramphenicol acetyltransferase gene fusions. Fusions containing 136 bp of DNA upstream of the promoter showed higher levels of expression as compared to those with only 16 bp. Similar to ATPase enzymatic activity, CAT expression also increased during growth at low pH. Analysis of RNA demonstrated that ATPase mRNA levels were higher at low pH, which supported the CAT activity data. Therefore, the F-ATPase from S. mutans was regulated, at least partially, by both the DNA located upstream of the promoter as well as by pH. Examination of structural models of the F-ATPase from the pathogenic oral organisms S. mutans and Lactobacillus casei and the non- pathogenic S. sanguis showed that the differences noted in the sequence of the catalytic β subunit do not result in structural alterations. Therefore, the contribution that the F-ATPase makes towards the aciduricity of the oral streptococci is linked to its increased expression at low pH or perhaps to structural differences in the other, less-conserved, domains of the enzyme.

  19. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging themore » ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.« less

  20. Differential effects of simple repeating DNA sequences on gene expression from the SV40 early promoter.

    PubMed

    Amirhaeri, S; Wohlrab, F; Wells, R D

    1995-02-17

    The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.

  1. Bidirectional Retroviral Integration Site PCR Methodology and Quantitative Data Analysis Workflow.

    PubMed

    Suryawanshi, Gajendra W; Xu, Song; Xie, Yiming; Chou, Tom; Kim, Namshin; Chen, Irvin S Y; Kim, Sanggu

    2017-06-14

    Integration Site (IS) assays are a critical component of the study of retroviral integration sites and their biological significance. In recent retroviral gene therapy studies, IS assays, in combination with next-generation sequencing, have been used as a cell-tracking tool to characterize clonal stem cell populations sharing the same IS. For the accurate comparison of repopulating stem cell clones within and across different samples, the detection sensitivity, data reproducibility, and high-throughput capacity of the assay are among the most important assay qualities. This work provides a detailed protocol and data analysis workflow for bidirectional IS analysis. The bidirectional assay can simultaneously sequence both upstream and downstream vector-host junctions. Compared to conventional unidirectional IS sequencing approaches, the bidirectional approach significantly improves IS detection rates and the characterization of integration events at both ends of the target DNA. The data analysis pipeline described here accurately identifies and enumerates identical IS sequences through multiple steps of comparison that map IS sequences onto the reference genome and determine sequencing errors. Using an optimized assay procedure, we have recently published the detailed repopulation patterns of thousands of Hematopoietic Stem Cell (HSC) clones following transplant in rhesus macaques, demonstrating for the first time the precise time point of HSC repopulation and the functional heterogeneity of HSCs in the primate system. The following protocol describes the step-by-step experimental procedure and data analysis workflow that accurately identifies and quantifies identical IS sequences.

  2. The legumin gene family: structure of a B type gene of Vicia faba and a possible legumin gene specific regulatory element.

    PubMed Central

    Bäumlein, H; Wobus, U; Pustell, J; Kafatos, F C

    1986-01-01

    The field bean, Vicia faba L. var. minor, possesses two sub-families of 11 S legumin genes named A and B. We isolated from a genomic library a B-type gene (LeB4) and determined its primary DNA sequence. Gene LeB4 codes for a 484 amino acid residue prepropolypeptide, encompassing a signal peptide of 22 amino acid residues, an acidic, very hydrophilic alpha-chain of 281 residues and a basic, somewhat hydrophobic beta-chain of 181 residues. The latter two coding regions are immediately contiguous, but each is interrupted by a short intron. Type A legumin genes from soybean and pea are known to have introns in the same two positions, in addition to an extra intron (within the alpha-coding sequence). Sequence comparisons of legumin genes from these three plants revealed a highly conserved sequence element of at least 28 bp, centered at approximately 100 bp upstream of each cap site. The element is absent from the equivalent position of all non-legumin and other plant and fungal genes examined. We tentatively name this element "legumin box" and suggest that it may have a function in the regulation of legumin gene expression. PMID:3960730

  3. Biochemical and Genetic Evidence that Enterococcus faecium L50 Produces Enterocins L50A and L50B, the sec-Dependent Enterocin P, and a Novel Bacteriocin Secreted without an N-Terminal Extension Termed Enterocin Q

    PubMed Central

    Cintas, Luis M.; Casaus, Pilar; Herranz, Carmen; Håvarstein, Leiv Sigve; Holo, Helge; Hernández, Pablo E.; Nes, Ingolf F.

    2000-01-01

    Enterococcus faecium L50 grown at 16 to 32°C produces enterocin L50 (EntL50), consisting of EntL50A and EntL50B, two unmodified non-pediocin-like peptides synthesized without an N-terminal leader sequence or signal peptide. However, the bacteriocin activity found in the cell-free culture supernatants following growth at higher temperatures (37 to 47°C) is not due to EntL50. A purification procedure including cation-exchange, hydrophobic interaction, and reverse-phase liquid chromatography has shown that the antimicrobial activity is due to two different bacteriocins. Amino acid sequences obtained by Edman degradation and DNA sequencing analyses revealed that one is identical to the sec-dependent pediocin-like enterocin P produced by E. faecium P13 (L. M. Cintas, P. Casaus, L. S. Håvarstein, P. E. Hernández, and I. F. Nes, Appl. Environ. Microbiol. 63:4321–4330, 1997) and the other is a novel unmodified non-pediocin-like bacteriocin termed enterocin Q (EntQ), with a molecular mass of 3,980. DNA sequencing analysis of a 963-bp region of E. faecium L50 containing the enterocin P structural gene (entP) and the putative immunity protein gene (entiP) reveals a genetic organization identical to that previously found in E. faecium P13. DNA sequencing analysis of a 1,448-bp region identified two consecutive but diverging open reading frames (ORFs) of which one, termed entQ, encodes a 34-amino-acid protein whose deduced amino acid sequence was identical to that obtained for EntQ by amino acid sequencing, showing that EntQ, similarly to EntL50A and EntL50B, is synthesized without an N-terminal leader sequence or signal peptide. The second ORF, termed orf2, was located immediately upstream of and in opposite orientation to entQ and encodes a putative immunity protein composed of 221 amino acids. Bacteriocin production by E. faecium L50 showed that EntP and EntQ are produced in the temperature range from 16 to 47°C and maximally detected at 47 and 37 to 47°C, respectively, while EntL50A and EntL50B are maximally synthesized at 16 to 25°C and are not detected at 37°C or above. PMID:11073927

  4. Biochemical and structural characterization of a novel cooperative binding mode by Pit-1 with CATT repeats in the macrophage migration inhibitory factor promoter

    PubMed Central

    Agarwal, Sorabh

    2018-01-01

    Abstract Overexpression of the proinflammatory cytokine macrophage migration inhibitory factor (MIF) is linked to a number of autoimmune diseases and cancer. MIF production has been correlated to the number of CATT repeats in a microsatellite region upstream of the MIF gene. We have characterized the interaction of pituitary-specific positive transcription factor 1 (Pit-1) with a portion of the MIF promoter region flanking a microsatellite polymorphism (−794 CATT5–8). Using fluorescence anisotropy, we quantified tight complex formation between Pit-1 and an oligonucleotide consisting of eight consecutive CATT repeats (8xCATT) with an apparent Kd of 35 nM. Using competition experiments we found a 23 base pair oligonucleotide with 4xCATT repeats to be the minimum DNA sequence necessary for high affinity interaction with Pit-1. The stoichiometry of the Pit-1 DNA interaction was determined to be 2:1 and binding is cooperative in nature. We subsequently structurally characterized the complex and discovered a completely novel binding mode for Pit-1 in contrast to previously described Pit-1 complex structures. The affinity of Pit-1 for the CATT target sequence was found to be highly dependent on cooperativity. This work lays the groundwork for understanding transcriptional regulation of MIF and pursuing Pit-1 as a therapeutic target to treat MIF-mediated inflammatory disorders. PMID:29186613

  5. Molecular mechanisms of ribosomal protein gene coregulation

    PubMed Central

    Reja, Rohit; Vinayachandran, Vinesh; Ghosh, Sujana; Pugh, B. Franklin

    2015-01-01

    The 137 ribosomal protein genes (RPGs) of Saccharomyces provide a model for gene coregulation. We examined the positional and functional organization of their regulators (Rap1 [repressor activator protein 1], Fhl1, Ifh1, Sfp1, and Hmo1), the transcription machinery (TFIIB, TFIID, and RNA polymerase II), and chromatin at near-base-pair resolution using ChIP-exo, as RPGs are coordinately reprogrammed. Where Hmo1 is enriched, Fhl1, Ifh1, Sfp1, and Hmo1 cross-linked broadly to promoter DNA in an RPG-specific manner and demarcated by general minor groove widening. Importantly, Hmo1 extended 20–50 base pairs (bp) downstream from Fhl1. Upon RPG repression, Fhl1 remained in place. Hmo1 dissociated, which was coupled to an upstream shift of the +1 nucleosome, as reflected by the Hmo1 extension and core promoter region. Fhl1 and Hmo1 may create two regulatable and positionally distinct barriers, against which chromatin remodelers position the +1 nucleosome into either an activating or a repressive state. Consistent with in vitro studies, we found that specific TFIID subunits, in addition to cross-linking at the core promoter, made precise cross-links at Rap1 sites, which we interpret to reflect native Rap1–TFIID interactions. Our findings suggest how sequence-specific DNA binding regulates nucleosome positioning and transcription complex assembly >300 bp away and how coregulation coevolved with coding sequences. PMID:26385964

  6. The Near Naked Hairless (HrN) Mutation Disrupts Hair Formation but is not Due to a Mutation in the Hairless Coding Region

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Yutao; Das, Suchita; Olszewski, Robert Edward

    Near naked hairless (HrN) is a semi-dominant mutation that arose spontaneously and was suggested by allelism testing to be an allele of mouse Hairless (Hr). HrN mice differ from other Hr mutants in that hair loss appears as the postnatal coat begins to emerge, as opposed to failure to initiate the first postnatal hair cycle, and that the mutation displays semi-dominant inheritance. We sequenced the Hr cDNA in HrN/HrN mice and characterized the pathological and molecular phenotypes to identify the basis for hair loss in this model. HrN/HrN mice exhibit dystrophic hairs that are unable to consistently emerge from themore » hair follicle, while HrN/+ mice display a sparse coat of hair and a milder degree of follicular dystrophy than their homozygous littermates. DNA microarray analysis of cutaneous gene expression demonstrates that numerous genes are downregulated in HrN/HrN mice, primarily genes important for hair structure. By contrast, Hr expression is significantly increased. Sequencing the Hr coding region, intron-exon boundaries, 5'- and 3'- UTR and immediate upstream region did not reveal the underlying mutation. Therefore HrN does not appear to be an allele of Hr but may result from a mutation in a closely linked gene or from a regulatory mutation in Hr.« less

  7. Lyn tyrosine kinase promotes silencing of ATM-dependent checkpoint signaling during recovery from DNA double-strand breaks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fukumoto, Yasunori, E-mail: fukumoto@faculty.chiba-u.jp; Kuki, Kazumasa; Morii, Mariko

    2014-09-26

    Highlights: • Inhibition of Src family kinases decreased γ-H2AX signal. • Inhibition of Src family increased ATM-dependent phosphorylation of Chk2 and Kap1. • shRNA-mediated knockdown of Lyn increased phosphorylation of Kap1 by ATM. • Ectopic expression of Src family kinase suppressed ATM-mediated Kap1 phosphorylation. • Src is involved in upstream signaling for inactivation of ATM signaling. - Abstract: DNA damage activates the DNA damage checkpoint and the DNA repair machinery. After initial activation of DNA damage responses, cells recover to their original states through completion of DNA repair and termination of checkpoint signaling. Currently, little is known about the processmore » by which cells recover from the DNA damage checkpoint, a process called checkpoint recovery. Here, we show that Src family kinases promote inactivation of ataxia telangiectasia mutated (ATM)-dependent checkpoint signaling during recovery from DNA double-strand breaks. Inhibition of Src activity increased ATM-dependent phosphorylation of Chk2 and Kap1. Src inhibition increased ATM signaling both in G2 phase and during asynchronous growth. shRNA knockdown of Lyn increased ATM signaling. Src-dependent nuclear tyrosine phosphorylation suppressed ATM-mediated Kap1 phosphorylation. These results suggest that Src family kinases are involved in upstream signaling that leads to inactivation of the ATM-dependent DNA damage checkpoint.« less

  8. Quantifying the Effect of DNA Packaging on Gene Expression Level

    NASA Astrophysics Data System (ADS)

    Kim, Harold

    2010-10-01

    Gene expression, the process by which the genetic code comes alive in the form of proteins, is one of the most important biological processes in living cells, and begins when transcription factors bind to specific DNA sequences in the promoter region upstream of a gene. The relationship between gene expression output and transcription factor input which is termed the gene regulation function is specific to each promoter, and predicting this gene regulation function from the locations of transcription factor binding sites is one of the challenges in biology. In eukaryotic organisms (for example, animals, plants, fungi etc), DNA is highly compacted into nucleosomes, 147-bp segments of DNA tightly wrapped around histone protein core, and therefore, the accessibility of transcription factor binding sites depends on their locations with respect to nucleosomes - sites inside nucleosomes are less accessible than those outside nucleosomes. To understand how transcription factor binding sites contribute to gene expression in a quantitative manner, we obtain gene regulation functions of promoters with various configurations of transcription factor binding sites by using fluorescent protein reporters to measure transcription factor input and gene expression output in single yeast cells. In this talk, I will show that the affinity of a transcription factor binding site inside and outside the nucleosome controls different aspects of the gene regulation function, and explain this finding based on a mass-action kinetic model that includes competition between nucleosomes and transcription factors.

  9. Optimization of genome editing through CRISPR-Cas9 engineering

    PubMed Central

    Zhang, Jian-Hua; Adikaram, Poorni; Pandey, Mritunjay; Genis, Allison; Simonds, William F.

    2016-01-01

    ABSTRACT CRISPR (Clustered Regularly-Interspaced Short Palindromic Repeats)-Cas9 (CRISPR associated protein 9) has rapidly become the most promising genome editing tool with great potential to revolutionize medicine. Through guidance of a 20 nucleotide RNA (gRNA), CRISPR-Cas9 finds and cuts target protospacer DNA precisely 3 base pairs upstream of a PAM (Protospacer Adjacent Motif). The broken DNA ends are repaired by either NHEJ (Non-Homologous End Joining) resulting in small indels, or by HDR (Homology Directed Repair) for precise gene or nucleotide replacement. Theoretically, CRISPR-Cas9 could be used to modify any genomic sequences, thereby providing a simple, easy, and cost effective means of genome wide gene editing. However, the off-target activity of CRISPR-Cas9 that cuts DNA sites with imperfect matches with gRNA have been of significant concern because clinical applications require 100% accuracy. Additionally, CRISPR-Cas9 has unpredictable efficiency among different DNA target sites and the PAM requirements greatly restrict its genome editing frequency. A large number of efforts have been made to address these impeding issues, but much more is needed to fully realize the medical potential of CRISPR-Cas9. In this article, we summarize the existing problems and current advances of the CRISPR-Cas9 technology and provide perspectives for the ultimate perfection of Cas9-mediated genome editing. PMID:27340770

  10. Bacterio-opsin mutants of Halobacterium halobium

    PubMed Central

    Betlach, Mary; Pfeifer, Felicitas; Friedman, James; Boyer, Herbert W.

    1983-01-01

    The bacterio-opsin (bop) gene of Halobacterium halobium R1 has been cloned with about 40 kilobases of flanking genomic sequence. The 40-kilobase segment is derived from the (G+C)-rich fraction of the chromosome and is not homologous to the major (pHH1) or minor endogenous covalently closed circular DNA species of H. halobium. A 5.1-kilobase Pst I fragment containing the bop gene was subcloned in pBR322 and a partial restriction map was determined. Defined restriction fragments of this clone were used as probes to analyze the defects associated with the bop gene in 12 bacterio-opsin mutants. Eleven out of 12 of the mutants examined had inserts ranging from 350 to 3,000 base pairs either in the bop gene or up to 1,400 base pairs upstream. The positions of the inserts were localized to four regions in the 5.1-kilobase genomic fragment: within the gene (one mutant), in a region that overlaps the 5′ end of the gene (seven mutants), and in two different upstream regions (three mutants). Two revertants of the mutant with the most distal insert had an additional insert in the same region. The polar effects of these inserts are discussed in terms of inactivation of a regulatory gene or disruption of part of a coordinately expressed operon. Given the defined nature of the bop mRNA—i.e., it has a 5′ leader sequence of three ribonucleotides—these observations indicate that the bop mRNA might be processed from a large mRNA transcript. Images PMID:16593291

  11. Characterizing the distribution of an endangered salmonid using environmental DNA analysis

    USGS Publications Warehouse

    Laramie, Matthew B.; Pilliod, David S.; Goldberg, Caren S.

    2015-01-01

    Determining species distributions accurately is crucial to developing conservation and management strategies for imperiled species, but a challenging task for small populations. We evaluated the efficacy of environmental DNA (eDNA) analysis for improving detection and thus potentially refining the known distribution of Chinook salmon (Oncorhynchus tshawytscha) in the Methow and Okanogan Subbasins of the Upper Columbia River, which span the border between Washington, USA and British Columbia, Canada. We developed an assay to target a 90 base pair sequence of Chinook DNA and used quantitative polymerase chain reaction (qPCR) to quantify the amount of Chinook eDNA in triplicate 1-L water samples collected at 48 stream locations in June and again in August 2012. The overall probability of detecting Chinook with our eDNA method in areas within the known distribution was 0.77 (±0.05 SE). Detection probability was lower in June (0.62, ±0.08 SE) during high flows and at the beginning of spring Chinook migration than during base flows in August (0.93, ±0.04 SE). In the Methow subbasin, mean eDNA concentration was higher in August compared to June, especially in smaller tributaries, probably resulting from the arrival of spring Chinook adults, reduced discharge, or both. Chinook eDNA concentrations did not appear to change in the Okanogan subbasin from June to August. Contrary to our expectations about downstream eDNA accumulation, Chinook eDNA did not decrease in concentration in upstream reaches (0–120 km). Further examination of factors influencing spatial distribution of eDNA in lotic systems may allow for greater inference of local population densities along stream networks or watersheds. These results demonstrate the potential effectiveness of eDNA detection methods for determining landscape-level distribution of anadromous salmonids in large river systems.

  12. Dynamic DNA-controlled "stop-and-go" assembly of well-defined protein domains on RNA-scaffolded TMV-like nanotubes.

    PubMed

    Schneider, Angela; Eber, Fabian J; Wenz, Nana L; Altintoprak, Klara; Jeske, Holger; Eiben, Sabine; Wege, Christina

    2016-12-01

    A DNA-based approach allows external control over the self-assembly process of tobacco mosaic virus (TMV)-like ribonucleoprotein nanotubes: their growth from viral coat protein (CP) subunits on five distinct RNA scaffolds containing the TMV origin of assembly (OAs) could be temporarily blocked by a stopper DNA oligomer hybridized downstream (3') of the OAs. At two upstream (5') sites tested, simple hybridization was not sufficient for stable stalling, which correlates with previous findings on a non-symmetric assembly of TMV. The growth of DNA-arrested particles could be restarted efficiently by displacement of the stopper via its toehold by using a release DNA oligomer, even after storage for twelve days. This novel strategy for growing proteinaceous tubes under tight kinetic and spatial control combines RNA guidance and its site-specific but reversible interruption by DNA blocking elements. As three of the RNA scaffolds contained long heterologous non-TMV sequence portions that included the stopping sites, this method is applicable to all RNAs amenable to TMV CP encapsidation, albeit with variable efficiency most likely depending on the scaffolds' secondary structures. The use of two distinct, selectively addressable CP variants during the serial assembly stages finally enabled an externally configured fabrication of nanotubes with highly defined subdomains. The "stop-and-go" strategy thus might pave the way towards production routines of TMV-like particles with variable aspect ratios from a single RNA scaffold, and of nanotubes with two or even more adjacent protein domains of tightly pre-defined lengths.

  13. Identification of novel craniofacial regulatory domains located far upstream of SOX9 and disrupted in Pierre Robin sequence

    PubMed Central

    Gordon, Christopher T.; Attanasio, Catia; Bhatia, Shipra; Benko, Sabina; Ansari, Morad; Tan, Tiong Y.; Munnich, Arnold; Pennacchio, Len A.; Abadie, Véronique; Temple, I. Karen; Goldenberg, Alice; van Heyningen, Veronica; Amiel, Jeanne; FitzPatrick, David; Kleinjan, Dirk A.; Visel, Axel; Lyonnet, Stanislas

    2015-01-01

    Mutations in the coding sequence of SOX9 cause campomelic dysplasia (CD), a disorder of skeletal development associated with 46,XY disorders of sex development (DSDs). Translocations, deletions and duplications within a ~2 Mb region upstream of SOX9 can recapitulate the CD-DSD phenotype fully or partially, suggesting the existence of an unusually large cis-regulatory control region. Pierre Robin sequence (PRS) is a craniofacial disorder that is frequently an endophenotype of CD and a locus for isolated PRS at ~1.2-1.5 Mb upstream of SOX9 has been previously reported. The craniofacial regulatory potential within this locus, and within the greater genomic domain surrounding SOX9, remains poorly defined. We report two novel deletions upstream of SOX9 in families with PRS, allowing refinement of the regions harbouring candidate craniofacial regulatory elements. In parallel, ChIP-Seq for p300 binding sites in mouse craniofacial tissue led to the identification of several novel craniofacial enhancers at the SOX9 locus, which were validated in transgenic reporter mice and zebrafish. Notably, some of the functionally validated elements fall within the PRS deletions. These studies suggest that multiple non-coding elements contribute to the craniofacial regulation of SOX9 expression, and that their disruption results in PRS. PMID:24934569

  14. Scar-less multi-part DNA assembly design automation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hillson, Nathan J.

    The present invention provides a method of a method of designing an implementation of a DNA assembly. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding flanking homology sequences to each of the DNA oligos. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which tomore » assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding optimized overhang sequences to each of the DNA oligos.« less

  15. Regulation of a Glycerol-Induced Quinoprotein Alcohol Dehydrogenase by σ54 and a LuxR-Type Regulator in Azospirillum brasilense Sp7

    PubMed Central

    Singh, Vijay Shankar; Dubey, Ashutosh Prakash; Gupta, Ankush; Singh, Sudhir; Singh, Bhupendra Narain

    2017-01-01

    ABSTRACT Azospirillum brasilense Sp7 uses glycerol as a carbon source for growth and nitrogen fixation. When grown in medium containing glycerol as a source of carbon, it upregulates the expression of a protein which was identified as quinoprotein alcohol dehydrogenase (ExaA). Inactivation of exaA adversely affects the growth of A. brasilense on glycerol. A determination of the transcription start site of exaA revealed an RpoN-dependent −12/−24 promoter consensus. The expression of an exaA::lacZ fusion was induced maximally by glycerol and was dependent on σ54. Bioinformatic analysis of the sequence flanking the −12/−24 promoter revealed a 17-bp sequence motif with a dyad symmetry of 6 nucleotides upstream of the promoter, the disruption of which caused a drastic reduction in promoter activity. The electrophoretic mobility of a DNA fragment containing the 17-bp sequence motif was retarded by purified EraR, a LuxR-type transcription regulator that is transcribed divergently from exaA. EraR also showed a positive interaction with RpoN in two-hybrid and pulldown assays. IMPORTANCE Quinoprotein alcohol dehydrogenase (ExaA) plays an important role in the catabolism of alcohols in bacteria. Although exaA expression is thought to be regulated by a two-component system consisting of EraS and EraR, the mechanism of regulation was not known. This study shows the details of the regulation of expression of the exaA gene in A. brasilense. We have shown here that exaA of A. brasilense is maximally induced by glycerol and harbors a σ54-dependent promoter. The response regulator EraR binds to an inverted repeat located upstream of the exaA promoter. This study shows that a LuxR-type response regulator (EraR) binds upstream of the exaA gene and physically interacts with σ54. The unique feature of this regulation is that EraR is a LuxR-type transcription regulator that lacks the GAFTGA motif, a characteristic feature of the enhancer binding proteins that are known to interact with σ54 in other bacteria. PMID:28439037

  16. Regulation of a Glycerol-Induced Quinoprotein Alcohol Dehydrogenase by σ54 and a LuxR-Type Regulator in Azospirillum brasilense Sp7.

    PubMed

    Singh, Vijay Shankar; Dubey, Ashutosh Prakash; Gupta, Ankush; Singh, Sudhir; Singh, Bhupendra Narain; Tripathi, Anil Kumar

    2017-07-01

    Azospirillum brasilense Sp7 uses glycerol as a carbon source for growth and nitrogen fixation. When grown in medium containing glycerol as a source of carbon, it upregulates the expression of a protein which was identified as quinoprotein alcohol dehydrogenase (ExaA). Inactivation of exaA adversely affects the growth of A. brasilense on glycerol. A determination of the transcription start site of exaA revealed an RpoN-dependent -12/-24 promoter consensus. The expression of an exaA :: lacZ fusion was induced maximally by glycerol and was dependent on σ 54 Bioinformatic analysis of the sequence flanking the -12/-24 promoter revealed a 17-bp sequence motif with a dyad symmetry of 6 nucleotides upstream of the promoter, the disruption of which caused a drastic reduction in promoter activity. The electrophoretic mobility of a DNA fragment containing the 17-bp sequence motif was retarded by purified EraR, a LuxR-type transcription regulator that is transcribed divergently from exaA EraR also showed a positive interaction with RpoN in two-hybrid and pulldown assays. IMPORTANCE Quinoprotein alcohol dehydrogenase (ExaA) plays an important role in the catabolism of alcohols in bacteria. Although exaA expression is thought to be regulated by a two-component system consisting of EraS and EraR, the mechanism of regulation was not known. This study shows the details of the regulation of expression of the exaA gene in A. brasilense We have shown here that exaA of A. brasilense is maximally induced by glycerol and harbors a σ 54 -dependent promoter. The response regulator EraR binds to an inverted repeat located upstream of the exaA promoter. This study shows that a LuxR-type response regulator (EraR) binds upstream of the exaA gene and physically interacts with σ 54 The unique feature of this regulation is that EraR is a LuxR-type transcription regulator that lacks the GAFTGA motif, a characteristic feature of the enhancer binding proteins that are known to interact with σ 54 in other bacteria. Copyright © 2017 American Society for Microbiology.

  17. A duplication upstream of SOX9 was not positively correlated with the SRY-negative 46,XX testicular disorder of sex development: A case report and literature review

    PubMed Central

    XIA, XIN-YI; ZHANG, CUI; LI, TIAN-FU; WU, QIU-YUE; LI, NA; LI, WEI-WEI; CUI, YING-XIA; LI, XIAO-JUN; SHI, YI-CHAO

    2015-01-01

    The 46,XX male disorder of sex development (DSD) is rarely observed in humans. Patients with DSD are all male with testicular tissue differentiation. The mechanism of sex determination and differentiation remains to be elucidated. In the present case report, an 46,XX inv (9) infertile male negative for the sex-determining region of the Y chromosome (SRY) gene was examined. This infertile male was systemically assessed by semen analysis, serum hormone testing and gonadal biopsy. Formalin-fixed and paraffin-embedded gonad tissues were assessed histochemically. The SRY gene was analyzed by fluorescence in situ hybridization (FISH) and polymerase chain reaction (PCR). The other 23 specific loci, including the azoospermia factor region on the Y chromosome and the sequence-targeted sites of the SRY-box 9 (SOX9) gene were analyzed by PCR. The genes RSPO1, DAX1, SOX3, ROCK, DMRT1, SPRY2 and FGF9 were also assessed using sequencing analysis. Affymetrix Cytogenetics Whole Genome 2.7 M Arrays were used for detecting the genomic DNA from the patient and the parents. The patient with the 46,XX inv (9) (p11q13) karyotype exhibited male primary, however, not secondary sexual characteristics. However, the patient's mother with the 46, XX inv (9) karyotype was unaffected. The testicular tissue dysplasia of the patient was confirmed by tissue biopsy and absence of the SRY gene, and the other 23 loci on the Y chromosome were confirmed by FISH and/or PCR. The RSPO1, DAX1, SOX3, ROCK, DMRT1, SPRY2 and FGF9 genes were sequenced and no mutations were detected. A duplication on the 3 M site in the upstream region of SOX9 was identified in the patient as well as in the mother. The patient with the 46,XX testicular DSD and SRY-negative status was found to be infertile. The duplication on the 3 M site in the upstream region of SOX9 was a polymorphism, which indicated that the change was not a cause of 46,XX male SDS. These clinical, molecular and cytogenetic findings suggested that other unidentified genetic or environmental factors are significant in the regulation of SDS. PMID:26260363

  18. A duplication upstream of SOX9 was not positively correlated with the SRY‑negative 46,XX testicular disorder of sex development: A case report and literature review.

    PubMed

    Xia, Xin-Yi; Zhang, Cui; Li, Tian-Fu; Wu, Qiu-Yue; Li, Na; Li, Wei-Wei; Cui, Ying-Xia; Li, Xiao-Jun; Shi, Yi-Chao

    2015-10-01

    The 46,XX male disorder of sex development (DSD) is rarely observed in humans. Patients with DSD are all male with testicular tissue differentiation. The mechanism of sex determination and differentiation remains to be elucidated. In the present case report, an 46,XX inv (9) infertile male negative for the sex‑determining region of the Y chromosome (SRY) gene was examined. This infertile male was systemically assessed by semen analysis, serum hormone testing and gonadal biopsy. Formalin‑fixed and paraffin‑embedded gonad tissues were assessed histochemically. The SRY gene was analyzed by fluorescence in situ hybridization (FISH) and polymerase chain reaction (PCR). The other 23 specific loci, including the azoospermia factor region on the Y chromosome and the sequence-targeted sites of the SRY‑box 9 (SOX9) gene were analyzed by PCR. The genes RSPO1, DAX1, SOX3, ROCK, DMRT1, SPRY2 and FGF9 were also assessed using sequencing analysis. Affymetrix Cytogenetics Whole Genome 2.7 M Arrays were used for detecting the genomic DNA from the patient and the parents. The patient with the 46,XX inv (9) (p11q13) karyotype exhibited male primary, however, not secondary sexual characteristics. However, the patient's mother with the 46, XX inv (9) karyotype was unaffected. The testicular tissue dysplasia of the patient was confirmed by tissue biopsy and absence of the SRY gene, and the other 23 loci on the Y chromosome were confirmed by FISH and/or PCR. The RSPO1, DAX1, SOX3, ROCK, DMRT1, SPRY2 and FGF9 genes were sequenced and no mutations were detected. A duplication on the 3 M site in the upstream region of SOX9 was identified in the patient as well as in the mother. The patient with the 46,XX testicular DSD and SRY‑negative status was found to be infertile. The duplication on the 3 M site in the upstream region of SOX9 was a polymorphism, which indicated that the change was not a cause of 46,XX male SDS. These clinical, molecular and cytogenetic findings suggested that other unidentified genetic or environmental factors are significant in the regulation of SDS.

  19. Partial Shotgun Sequencing of the Boechera stricta Genome Reveals Extensive Microsynteny and Promoter Conservation with Arabidopsis1[W

    PubMed Central

    Windsor, Aaron J.; Schranz, M. Eric; Formanová, Nataša; Gebauer-Jung, Steffi; Bishop, John G.; Schnabelrauch, Domenica; Kroymann, Juergen; Mitchell-Olds, Thomas

    2006-01-01

    Comparative genomics provides insight into the evolutionary dynamics that shape discrete sequences as well as whole genomes. To advance comparative genomics within the Brassicaceae, we have end sequenced 23,136 medium-sized insert clones from Boechera stricta, a wild relative of Arabidopsis (Arabidopsis thaliana). A significant proportion of these sequences, 18,797, are nonredundant and display highly significant similarity (BLASTn e-value ≤ 10−30) to low copy number Arabidopsis genomic regions, including more than 9,000 annotated coding sequences. We have used this dataset to identify orthologous gene pairs in the two species and to perform a global comparison of DNA regions 5′ to annotated coding regions. On average, the 500 nucleotides upstream to coding sequences display 71.4% identity between the two species. In a similar analysis, 61.4% identity was observed between 5′ noncoding sequences of Brassica oleracea and Arabidopsis, indicating that regulatory regions are not as diverged among these lineages as previously anticipated. By mapping the B. stricta end sequences onto the Arabidopsis genome, we have identified nearly 2,000 conserved blocks of microsynteny (bracketing 26% of the Arabidopsis genome). A comparison of fully sequenced B. stricta inserts to their homologous Arabidopsis genomic regions indicates that indel polymorphisms >5 kb contribute substantially to the genome size difference observed between the two species. Further, we demonstrate that microsynteny inferred from end-sequence data can be applied to the rapid identification and cloning of genomic regions of interest from nonmodel species. These results suggest that among diploid relatives of Arabidopsis, small- to medium-scale shotgun sequencing approaches can provide rapid and cost-effective benefits to evolutionary and/or functional comparative genomic frameworks. PMID:16607030

  20. Transcriptional activation of the Escherichia coli adaptive response gene aidB is mediated by binding of methylated Ada protein. Evidence for a new consensus sequence for Ada-binding sites.

    PubMed

    Landini, P; Volkert, M R

    1995-04-07

    The Escherichia coli aidB gene is part of the adaptive response to DNA methylation damage. Genes belonging to the adaptive response are positively regulated by the ada gene; the Ada protein acts as a transcriptional activator when methylated in one of its cysteine residues at position 69. Through DNaseI protection assays, we show that methylated Ada (meAda) is able to bind a DNA sequence between 40 and 60 base pairs upstream of the aidB transcriptional startpoint. Binding of meAda is necessary to activate transcription of the adaptive response genes; accordingly, in vitro transcription of aidB is dependent on the presence of meAda. Unmethylated Ada protein shows no protection against DNaseI digestion in the aidB promoter region nor does it promote aidB in vitro transcription. The aidB Ada-binding site shows only weak homology to the proposed consensus sequences for Ada-binding sites in E. coli (AAANNAA and AAAGCGCA) but shares a higher degree of similarity with the Ada-binding regions from other bacterial species, such as Salmonella typhimurium and Bacillus subtilis. Based on the comparison of five different Ada-dependent promoter regions, we suggest that a possible recognition sequence for meAda might be AATnnnnnnG-CAA. Higher concentrations of Ada are required for the binding of aidB than for the ada promoter, suggesting lower affinity of the protein for the aidB Ada-binding site. Common features in the Ada-binding regions of ada and aidB are a high A/T content, the presence of an inverted repeat structure, and their position relative to the transcriptional start site. We propose that these elements, in addition to the proposed recognition sequence, are important for binding of the Ada protein.

  1. The hetC Gene Is a Direct Target of the NtcA Transcriptional Regulator in Cyanobacterial Heterocyst Development

    PubMed Central

    Muro-Pastor, Alicia M.; Valladares, Ana; Flores, Enrique; Herrero, Antonia

    1999-01-01

    The heterocyst is the site of nitrogen fixation in aerobically grown cultures of some filamentous cyanobacteria. Heterocyst development in Anabaena sp. strain PCC 7120 is dependent on the global nitrogen regulator NtcA and requires, among others, the products of the hetR and hetC genes. Expression of hetC, tested by RNA- DNA hybridization, was impaired in an ntcA mutant. A nitrogen-regulated, NtcA-dependent putative transcription start point was localized at nucleotide −571 with respect to the hetC translational start. Sequences upstream from this transcription start point exhibit the structure of the canonical cyanobacterial promoter activated by NtcA, and purified NtcA protein specifically bound to a DNA fragment containing this promoter. Activation of expression of hetC during heterocyst development appears thus to be directly operated by NtcA. NtcA-mediated activation of hetR expression was not impaired in a hetC mutant, indicating that HetC is not an NtcA-dependent element required for hetR induction. PMID:10542167

  2. Physical map location of the multicopy genes coding for ammonia monooxygenase and hydroxylamine oxidoreductase in the ammonia-oxidizing bacterium Nitrosomonas sp. strain ENI-11.

    PubMed

    Hirota, R; Yamagata, A; Kato, J; Kuroda, A; Ikeda, T; Takiguchi, N; Ohtake, H

    2000-02-01

    Pulsed-field gel electrophoresis of PmeI digests of the Nitrosomonas sp. strain ENI-11 chromosome produced four bands ranging from 1,200 to 480 kb in size. Southern hybridizations suggested that a 487-kb PmeI fragment contained two copies of the amoCAB genes, coding for ammonia monooxygenase (designated amoCAB(1) and amoCAB(2)), and three copies of the hao gene, coding for hydroxylamine oxidoreductase (hao(1), hao(2), and hao(3)). In this DNA fragment, amoCAB(1) and amoCAB(2) were about 390 kb apart, while hao(1), hao(2), and hao(3) were separated by at least about 100 kb from each other. Interestingly, hao(1) and hao(2) were located relatively close to amoCAB(1) and amoCAB(2), respectively. DNA sequence analysis revealed that hao(1) and hao(2) shared 160 identical nucleotides immediately upstream of each translation initiation codon. However, hao(3) showed only 30% nucleotide identity in the 160-bp corresponding region.

  3. Physical Map Location of the Multicopy Genes Coding for Ammonia Monooxygenase and Hydroxylamine Oxidoreductase in the Ammonia-Oxidizing Bacterium Nitrosomonas sp. Strain ENI-11

    PubMed Central

    Hirota, Ryuichi; Yamagata, Akira; Kato, Junichi; Kuroda, Akio; Ikeda, Tsukasa; Takiguchi, Noboru; Ohtake, Hisao

    2000-01-01

    Pulsed-field gel electrophoresis of PmeI digests of the Nitrosomonas sp. strain ENI-11 chromosome produced four bands ranging from 1,200 to 480 kb in size. Southern hybridizations suggested that a 487-kb PmeI fragment contained two copies of the amoCAB genes, coding for ammonia monooxygenase (designated amoCAB1 and amoCAB2), and three copies of the hao gene, coding for hydroxylamine oxidoreductase (hao1, hao2, and hao3). In this DNA fragment, amoCAB1 and amoCAB2 were about 390 kb apart, while hao1, hao2, and hao3 were separated by at least about 100 kb from each other. Interestingly, hao1 and hao2 were located relatively close to amoCAB1 and amoCAB2, respectively. DNA sequence analysis revealed that hao1 and hao2 shared 160 identical nucleotides immediately upstream of each translation initiation codon. However, hao3 showed only 30% nucleotide identity in the 160-bp corresponding region. PMID:10633121

  4. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    PubMed

    Wang, Cheng; Yu, Jie; Kallen, Caleb B

    2008-01-01

    The proliferating cell nuclear antigen (PCNA) is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE) sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2) enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  5. CalA, a Cyanobacterial AbrB Protein, Interacts with the Upstream Region of hypC and Acts as a Repressor of Its Transcription in the Cyanobacterium Nostoc sp. Strain PCC 7120▿ †

    PubMed Central

    Agervald, Åsa; Zhang, Xiaohui; Stensjö, Karin; Devine, Ellenor; Lindblad, Peter

    2010-01-01

    The filamentous, heterocystous, nitrogen-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain, depending on growth conditions, up to two hydrogenases directly involved in hydrogen metabolism. HypC is one out of at least seven auxiliary gene products required for synthesis of a functional hydrogenase, specifically involved in the maturation of the large subunit. In this study we present a protein, CalA (Alr0946 in the genome), belonging to the transcription regulator family AbrB, which in protein-DNA assays was found to interact with the upstream region of hypC. Transcriptional investigations showed that calA is cotranscribed with the downstream gene alr0947, which encodes a putative protease from the abortive infection superfamily, Abi. CalA was shown to interact specifically not only with the upstream region of hypC but also with its own upstream region, acting as a repressor on hypC. The bidirectional hydrogenase activity was significantly downregulated when CalA was overexpressed, demonstrating a correlation with the transcription factor, either direct or indirect. In silico studies showed that homologues to both CalA and Alr0947 are highly conserved proteins within cyanobacteria with very similar physical organizations of the corresponding structural genes. Possible functions of the cotranscribed downstream protein Alr0947 are presented. In addition, we present a three-dimensional (3D) model of the DNA binding domain of CalA and putative DNA binding mechanisms are discussed. PMID:20023111

  6. Conditional Inactivation of Upstream Binding Factor Reveals Its Epigenetic Functions and the Existence of a Somatic Nucleolar Precursor Body

    PubMed Central

    Hamdane, Nourdine; Stefanovsky, Victor Y.; Tremblay, Michel G.; Németh, Attila; Paquet, Eric; Lessard, Frédéric; Sanij, Elaine; Hannan, Ross; Moss, Tom

    2014-01-01

    Upstream Binding Factor (UBF) is a unique multi-HMGB-box protein first identified as a co-factor in RNA polymerase I (RPI/PolI) transcription. However, its poor DNA sequence selectivity and its ability to generate nucleosome-like nucleoprotein complexes suggest a more generalized role in chromatin structure. We previously showed that extensive depletion of UBF reduced the number of actively transcribed ribosomal RNA (rRNA) genes, but had little effect on rRNA synthesis rates or cell proliferation, leaving open the question of its requirement for RPI transcription. Using gene deletion in mouse, we now show that UBF is essential for embryo development beyond morula. Conditional deletion in cell cultures reveals that UBF is also essential for transcription of the rRNA genes and that it defines the active chromatin conformation of both gene and enhancer sequences. Loss of UBF prevents formation of the SL1/TIF1B pre-initiation complex and recruitment of the RPI-Rrn3/TIF1A complex. It is also accompanied by recruitment of H3K9me3, canonical histone H1 and HP1α, but not by de novo DNA methylation. Further, genes retain penta-acetyl H4 and H2A.Z, suggesting that even in the absence of UBF the rRNA genes can maintain a potentially active state. In contrast to canonical histone H1, binding of H1.4 is dependent on UBF, strongly suggesting that it plays a positive role in gene activity. Unexpectedly, arrest of rRNA synthesis does not suppress transcription of the 5S, tRNA or snRNA genes, nor expression of the several hundred mRNA genes implicated in ribosome biogenesis. Thus, rRNA gene activity does not coordinate global gene expression for ribosome biogenesis. Loss of UBF also unexpectedly induced the formation in cells of a large sub-nuclear structure resembling the nucleolar precursor body (NPB) of oocytes and early embryos. These somatic NPBs contain rRNA synthesis and processing factors but do not associate with the rRNA gene loci (NORs). PMID:25121932

  7. Regulation of zebrafish CYP3A65 transcription by AHR2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chang, Chin-Teng; Chung, Hsin-Yu; Su, Hsiao-Ting

    2013-07-15

    CYP3A proteins are the most abundant CYPs in the liver and intestines, and they play a pivotal role in drug metabolism. In mammals, CYP3A genes are induced by various xenobiotics through processes mediated by PXR. We previously identified zebrafish CYP3A65 as a CYP3A ortholog that is constitutively expressed in gastrointestinal tissues, and is upregulated by treatment with dexamethasone, rifampicin or tetrachlorodibenzo-p-dioxin (TCDD). However, the underlying mechanism of TCDD-mediated CYP3A65 transcription is unclear. Here we generated two transgenic zebrafish, Tg(CYP3A65S:EGFP) and Tg(CYP3A65L:EGFP), which contain 2.1 and 5.4 kb 5′ flanking sequences, respectively, of the CYP3A65 gene upstream of EGFP. Both transgenicmore » lines express EGFP in larval gastrointestinal tissues in a pattern similar to that of the endogenous CYP3A65 gene. Moreover, EGFP expression can be significantly induced by TCDD exposure during the larval stage. In addition, EGFP expression can be stimulated by kynurenine, a putative AHR ligand produced during tryptophan metabolism. AHRE elements in the upstream regulatory region of the CYP3A65 gene are indispensible for basal and TCDD-induced transcription. Furthermore, the AHR2 DNA and ligand-binding domains are required to mediate effective CYP3A65 transcription. AHRE sequences are present in the promoters of many teleost CYP3 genes, but not of mammalian CYP3 genes, suggesting that AHR/AHR2-mediated transcription is likely a common regulatory mechanism for teleost CYP3 genes. It may also reflect the different environments that terrestrial and aquatic organisms encounter. - Highlights: • Tg(CYP3A65:EGFP) and CYP3A65 exhibits identical expression pattern. • CYP3A65 can be significantly induced by TCDD or kynurenine. • The AHRE elements are required to mediate CYP3A65 transcription. • The AHR2 DNA and ligand-binding domains are required for CYP3A65 transcription. • AHRE elements are present in many teleost CYP3 genes, but not in mammalian CYP3 genes.« less

  8. Effects of Homology Length in the Repeat Region on Minus-Strand DNA Transfer and Retroviral Replication

    PubMed Central

    Dang, Que; Hu, Wei-Shau

    2001-01-01

    Homology between the two repeat (R) regions in the retroviral genome mediates minus-strand DNA transfer during reverse transcription. We sought to define the effects of R homology lengths on minus-strand DNA transfer. We generated five murine leukemia virus (MLV)-based vectors that contained identical sequences but different lengths of the 3′ R (3, 6, 12, 24 and 69 nucleotides [nt]); 69 nt is the full-length MLV R. After one round of replication, viral titers from the vector with a full-length downstream R were compared with viral titers generated from the other four vectors with reduced R lengths. Viral titers generated from vectors with R lengths reduced to one-third (24 nt) or one-sixth (12 nt) that of the wild type were not significantly affected; however, viral titers generated from vectors with only 3- or 6-nt homology in the R region were significantly lower. Because expression and packaging of the RNA were similar among all the vectors, the differences in the viral titers most likely reflected the impact of the homology lengths on the efficiency of minus-strand DNA transfer. The molecular nature of minus-strand DNA transfer was characterized in 63 proviruses. Precise R-to-R transfer was observed in most proviruses generated from vectors with 12-, 24-, or 69-nt homology in R, whereas aberrant transfers were predominantly used to generate proviruses from vectors with 3- or 6-nt homology. Reverse transcription using RNA transcribed from an upstream promoter, termed read-in RNA transcripts, resulted in most of the aberrant transfers. These data demonstrate that minus-strand DNA transfer is homology driven and a minimum homology length is required for accurate and efficient minus-strand DNA transfer. PMID:11134294

  9. Overexpression of OsSAP16 Regulates Photosynthesis and the Expression of a Broad Range of Stress Response Genes in Rice (Oryza sativa L.).

    PubMed

    Wang, Fei; Coe, Robert A; Karki, Shanta; Wanchana, Samart; Thakur, Vivek; Henry, Amelia; Lin, Hsiang-Chun; Huang, Jianliang; Peng, Shaobing; Quick, William Paul

    2016-01-01

    This study set out to identify and characterize transcription factors regulating photosynthesis in rice. Screening populations of rice T-DNA activation lines led to the identification of a T-DNA mutant with an increase in intrinsic water use efficiency (iWUE) under well-watered conditions. Flanking sequence analysis showed that the T-DNA construct was located upstream of LOC_Os07g38240 (OsSAP16) encoding for a stress-associated protein (SAP). A second mutant identified with activation in the same gene exhibited the same phenotype; expression of OsSAP16 was shown to be enhanced in both lines. There were no differences in stomatal development or morphology in either of these mutants, although overexpression of OsSAP16 reduced stomatal conductance. This phenotype limited CO2 uptake and the rate of photosynthesis, which resulted in the accumulation of less biomass in the two mutants. Whole transcriptome analysis showed that overexpression of OsSAP16 led to global changes in gene expression consistent with the function of zinc-finger transcription factors. These results show that the gene is involved in modulating the response of rice to drought stress through regulation of the expression of a set of stress-associated genes.

  10. Overexpression of OsSAP16 Regulates Photosynthesis and the Expression of a Broad Range of Stress Response Genes in Rice (Oryza sativa L.)

    PubMed Central

    Wang, Fei; Coe, Robert A.; Karki, Shanta; Wanchana, Samart; Thakur, Vivek; Henry, Amelia; Lin, Hsiang-Chun; Huang, Jianliang; Peng, Shaobing; Quick, William Paul

    2016-01-01

    This study set out to identify and characterize transcription factors regulating photosynthesis in rice. Screening populations of rice T-DNA activation lines led to the identification of a T-DNA mutant with an increase in intrinsic water use efficiency (iWUE) under well-watered conditions. Flanking sequence analysis showed that the T-DNA construct was located upstream of LOC_Os07g38240 (OsSAP16) encoding for a stress-associated protein (SAP). A second mutant identified with activation in the same gene exhibited the same phenotype; expression of OsSAP16 was shown to be enhanced in both lines. There were no differences in stomatal development or morphology in either of these mutants, although overexpression of OsSAP16 reduced stomatal conductance. This phenotype limited CO2 uptake and the rate of photosynthesis, which resulted in the accumulation of less biomass in the two mutants. Whole transcriptome analysis showed that overexpression of OsSAP16 led to global changes in gene expression consistent with the function of zinc-finger transcription factors. These results show that the gene is involved in modulating the response of rice to drought stress through regulation of the expression of a set of stress-associated genes. PMID:27303811

  11. Upregulated LINE-1 Activity in the Fanconi Anemia Cancer Susceptibility Syndrome Leads to Spontaneous Pro-inflammatory Cytokine Production.

    PubMed

    Brégnard, Christelle; Guerra, Jessica; Déjardin, Stéphanie; Passalacqua, Frank; Benkirane, Monsef; Laguette, Nadine

    2016-06-01

    Fanconi Anemia (FA) is a genetic disorder characterized by elevated cancer susceptibility and pro-inflammatory cytokine production. Using SLX4(FANCP) deficiency as a working model, we questioned the trigger for chronic inflammation in FA. We found that absence of SLX4 caused cytoplasmic DNA accumulation, including sequences deriving from active Long INterspersed Element-1 (LINE-1), triggering the cGAS-STING pathway to elicit interferon (IFN) expression. In agreement, absence of SLX4 leads to upregulated LINE-1 retrotransposition. Importantly, similar results were obtained with the FANCD2 upstream activator of SLX4. Furthermore, treatment of FA cells with the Tenofovir reverse transcriptase inhibitor (RTi), that prevents endogenous retrotransposition, decreased both accumulation of cytoplasmic DNA and pro-inflammatory signaling. Collectively, our data suggest a contribution of endogenous RT activities to the generation of immunogenic cytoplasmic nucleic acids responsible for inflammation in FA. The additional observation that RTi decreased pro-inflammatory cytokine production induced by DNA replication stress-inducing drugs further demonstrates the contribution of endogenous RTs to sustaining chronic inflammation. Altogether, our data open perspectives in the prevention of adverse effects of chronic inflammation in tumorigenesis. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  12. Nucleosome exclusion from the interspecies-conserved central AT-rich region of the Ars insulator.

    PubMed

    Takagi, Haruna; Inai, Yuta; Watanabe, Shun-ichiro; Tatemoto, Sayuri; Yajima, Mamiko; Akasaka, Koji; Yamamoto, Takashi; Sakamoto, Naoaki

    2012-01-01

    The Ars insulator is a boundary element identified in the upstream region of the arylsulfatase (HpArs) gene in the sea urchin, Hemicentrotus pulcherrimus, and possesses the ability to both block enhancer-promoter communications and protect transgenes from silent chromatin. To understand the molecular mechanism of the Ars insulator, we investigated the correlation between chromatin structure, DNA structure and insulator activity. Nuclease digestion of nuclei isolated from sea urchin embryos revealed the presence of a nuclease-hypersensitive site within the Ars insulator. Analysis of micrococcal nuclease-sensitive sites in the Ars insulator, reconstituted with nucleosomes, showed the exclusion of nucleosomes from the central AT-rich region. Furthermore, the central AT-rich region in naked DNA was sensitive to nucleotide base modification by diethylpyrocarbonate (DEPC). These observations suggest that non-B-DNA structures in the central AT-rich region may inhibit nucleosomal formation, which leads to nuclease hypersensitivity. Furthermore, comparison of nucleotide sequences between the HpArs gene and its ortholog in Strongylocentrotus purpuratus revealed that the central AT-rich region of the Ars insulator is conserved, and this conserved region showed significant enhancer blocking activity. These results suggest that the central AT-rich nucleosome-free region plays an important role in the function of the Ars insulator.

  13. The COUP-TFs compose a family of functionally related transcription factors

    PubMed Central

    Wang, Lee-Ho; Ing, Nancy H.; Tsai, Sophia Y.; O’Malley, Bert W.; Tsai, Ming-Jer

    1991-01-01

    The chicken ovalbumin upstream promoter transcription factors (COUP-TFs) are members of the steroid/thyroid hormone receptor superfamily and function in transcriptional regulation of a wide variety of genes. The COUP-TFs purified from HeLa nuclear extract by COUP-affinity chromatography are composed of multiple Mr forms. The Low Mr COUP-TFs (43,000, 44,000, 46,000, and 47,000 Mr) produce a relatively fast migrating complex (Cl) with DNA in electrophoresis mobility shift assays, while the high Mr forms (66,000, 68,000, 72,000, and 74,000 Mr) produce a slower migrating (C2) complex. The high Mr COUP-TFs were purified by gel filtration chromatography and independently formed the C2 DNA complex, probably acting as dimers. The high Mr forms are indistinguishable from the low Mr COUP-TFs in DNA binding and in enhancement of in vitro transcription from the ovalbumin promoter. The finding of multiple COUP-TF forms led us to clone a second low Mr COUP-TF, “COUP-TF2.” The COUP-TF2 sequence has very strong homology with COUP-TF1. The N-termini of COUP-TF1 and COUP-TF2 are least similar, but both contain glutamine-rich and proline-rich motifs, putative activation domains. PMID:1820218

  14. Single tube genotyping of sickle cell anaemia using PCR-based SNP analysis

    PubMed Central

    Waterfall, Christy M.; Cobb, Benjamin D.

    2001-01-01

    Allele-specific amplification (ASA) is a generally applicable technique for the detection of known single nucleotide polymorphisms (SNPs), deletions, insertions and other sequence variations. Conventionally, two reactions are required to determine the zygosity of DNA in a two-allele system, along with significant upstream optimisation to define the specific test conditions. Here, we combine single tube bi-directional ASA with a ‘matrix-based’ optimisation strategy, speeding up the whole process in a reduced reaction set. We use sickle cell anaemia as our model SNP system, a genetic disease that is currently screened using ASA methods. Discriminatory conditions were rapidly optimised enabling the unambiguous identification of DNA from homozygous sickle cell patients (HbS/S), heterozygous carriers (HbA/S) or normal DNA in a single tube. Simple downstream mathematical analyses based on product yield across the optimisation set allow an insight into the important aspects of priming competition and component interactions in this competitive PCR. This strategy can be applied to any polymorphism, defining specific conditions using a multifactorial approach. The inherent simplicity and low cost of this PCR-based method validates bi-directional ASA as an effective tool in future clinical screening and pharmacogenomic research where more expensive fluorescence-based approaches may not be desirable. PMID:11726702

  15. Single tube genotyping of sickle cell anaemia using PCR-based SNP analysis.

    PubMed

    Waterfall, C M; Cobb, B D

    2001-12-01

    Allele-specific amplification (ASA) is a generally applicable technique for the detection of known single nucleotide polymorphisms (SNPs), deletions, insertions and other sequence variations. Conventionally, two reactions are required to determine the zygosity of DNA in a two-allele system, along with significant upstream optimisation to define the specific test conditions. Here, we combine single tube bi-directional ASA with a 'matrix-based' optimisation strategy, speeding up the whole process in a reduced reaction set. We use sickle cell anaemia as our model SNP system, a genetic disease that is currently screened using ASA methods. Discriminatory conditions were rapidly optimised enabling the unambiguous identification of DNA from homozygous sickle cell patients (HbS/S), heterozygous carriers (HbA/S) or normal DNA in a single tube. Simple downstream mathematical analyses based on product yield across the optimisation set allow an insight into the important aspects of priming competition and component interactions in this competitive PCR. This strategy can be applied to any polymorphism, defining specific conditions using a multifactorial approach. The inherent simplicity and low cost of this PCR-based method validates bi-directional ASA as an effective tool in future clinical screening and pharmacogenomic research where more expensive fluorescence-based approaches may not be desirable.

  16. Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

    DOEpatents

    Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S

    2013-06-25

    A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.

  17. Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

    DOEpatents

    Gardner, Shea N [San Leandro, CA; Mariella, Jr., Raymond P.; Christian, Allen T [Tracy, CA; Young, Jennifer A [Berkeley, CA; Clague, David S [Livermore, CA

    2011-01-18

    A method of fabricating a DNA molecule of user-defined sequence. The method comprises the steps of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an even or odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths. In one embodiment starting sequence fragments are of different lengths, n, n+1, n+2, etc.

  18. The muscle creatine kinase gene is regulated by multiple upstream elements, including a muscle-specific enhancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jaynes, J.B.; Johnson, J.E.; Buskin, J.N.

    1988-01-01

    Muscle creatine kinase (MCK) is induced to high levels during skeletal muscle differentiation. The authors examined the upstream regulatory elements of the mouse MCK gene which specify its activation during myogenesis in culture. Fusion genes containing up to 3,300 nucleotides (nt) of MCK 5' flanking DNA in various positions and orientations relative to the bacterial chloramphenicol acetyltransferase (CAT) structural gene were transfected into cultured cells. Transient expression of CAT was compared between proliferating and differentiated MM14 mouse myoblasts and with nonmyogenic mouse L cells. The major effector of high-level expression was found to have the properties of a transcriptional enhancer.more » This element, located between 1,050 and 1,256 nt upstream of the transcription start site, was also found to have a major influence on the tissue and differentiation specificity of MCK expression; it activated either the MCK promoter or heterologous promoters only in differentiated muscle cells. Comparisons of viral and cellular enhancer sequences with the MCK enhancer revealed some similarities to essential regions of the simian virus 40 enhancer as well as to a region of the immunoglobulin heavy-chain enhancer, which has been implicated in tissue-specific protein binding. Even in the absence of the enhancer, low-level expression from a 776-nt MCK promoter retained differentiation specificity. In addition to positive regulatory elements, our data provide some evidence for negative regulatory elements with activity in myoblasts. These may contribute to the cell type and differentiation specificity of MCK expression.« less

  19. Effect of CpG dinucleotides within IgH switch region repeats on immunoglobulin class switch recombination.

    PubMed

    Zhang, Zheng Z; Hsieh, Chih-Lin; Okitsu, Cindy Yen; Han, Li; Yu, Kefei; Lieber, Michael R

    2015-08-01

    Immunoglobulin (Ig) heavy chains undergo class switch recombination (CSR) to change the heavy chain isotype from IgM to IgG, A or E. The switch regions are several kilobases long, repetitive, and G-rich on the nontemplate strand. They are also relatively depleted of CpG (also called CG) sites for unknown reasons. Here we use synthetic switch regions at the IgH switch alpha (Sα) locus to test the effect of CpG sites and to try to understand why the IgH switch sequences evolved to be relatively depleted of CpG. We find that even just two CpG sites within an 80 bp synthetic switch repeat iterated 15 times (total switch region length of 1200 bp containing 30 CpG sites) are sufficient to dramatically reduce both Ig CSR and transcription through the switch region from the upstream Iα sterile transcript promoter, which is the promoter that directs transcripts through the Sα region. De novo DNA methylation occurs at the four CpG sites in and around the Iα promoter when each 80 bp Iα switch repeat contains the two CpG sites. Thus, a relatively low density of CpG sites within the switch repeats can induce upstream CpG methylation at the IgH alpha locus, and cause a substantial decrease in transcription from the sterile transcript promoter. This effect is likely the reason that switch regions evolved to contain very few CpG sites. We discuss these findings as they relate to DNA methylation and to Ig CSR. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Analysis of cagA in Helicobacter pylori strains from Colombian populations with contrasting gastric cancer risk reveals a biomarker for disease severity

    PubMed Central

    Loh, John T.; Shaffer, Carrie L.; Piazuelo, M. Blanca; Bravo, Luis E.; McClain, Mark S.; Correa, Pelayo; Cover, Timothy L.

    2011-01-01

    BACKGROUND Helicobacter pylori infection is a risk factor for the development of gastric cancer, and the bacterial oncoprotein CagA contributes to gastric carcinogenesis. METHODS We analyzed H. pylori isolates from persons in Colombia and observed that there was marked variation among strains in levels of CagA expression. To elucidate the basis for this variation, we analyzed sequences upstream from the CagA translational initiation site in each strain. RESULTS A DNA motif (AATAAGATA) upstream of the translational initiation site of CagA was associated with high levels of CagA expression. Experimental studies showed that this motif was necessary but not sufficient for high-level CagA expression. H. pylori strains from a region of Colombia with high gastric cancer rates expressed higher levels of CagA than did strains from a region with lower gastric cancer rates, and Colombian strains of European phylogeographic origin expressed higher levels of CagA than did strains of African origin. Histopathological analysis of gastric biopsy specimens revealed that strains expressing high levels of CagA or containing the AATAAGATA motif were associated with more advanced precancerous lesions than those found in persons infected with strains expressing low levels of CagA or lacking the AATAAGATA motif. CONCLUSIONS CagA expression varies greatly among H. pylori strains. The DNA motif identified in this study is associated with high levels of CagA expression, and may be a useful biomarker to predict gastric cancer risk. IMPACT These findings help to explain why some persons infected with cagA-positive H. pylori develop gastric cancer and others do not. PMID:21859954

  1. Isolation of a thyroid hormone-responsive gene by immunoprecipitation of thyroid hormone receptor-DNA complexes.

    PubMed Central

    Bigler, J; Eisenman, R N

    1994-01-01

    Thyroid hormone (T3) receptor (TR) is a ligand-dependent transcription factor that acts through specific binding sites in the promoter region of target genes. In order to identify new genes that are regulated by T3, we used anti-TR antiserum to immunoprecipitate TR-DNA complexes from GH4 cell nuclei that had previously been treated with a restriction enzyme. Screening of the immunopurified, cloned DNA for TR binding sites by electrophoretic mobility shift assay yielded 53 positive clones. A subset of these clones was specifically immunoprecipitated with anti-TR antiserum and may therefore represent biologically significant binding sites. One of these clones, clone 122, was characterized in detail. It includes sequences highly related to the NICER long terminal repeat-like element and contains three TR binding sites as determined by DNase I footprinting. Two of the clone 122 TR binding sites are located upstream of the TATA box, and one is located downstream. The TR binding site downstream from the promoter was necessary and sufficient to confer T3-dependent regulation in transient transfection experiments. Expression of a reporter construct under the control of the clone 122 promoter region was activated by TR in the absence of ligand and returned to basal levels after T3 addition. Clone 122 sequences hybridize to at least two different mRNAs of approximately 6 and 10 kb from GH4 cells. The levels of both of these mRNAs increased upon removal of T3. Our studies suggest that specific immunoprecipitation of chromatin allows identification of binding sites and target genes for transcription factors. Images PMID:7935476

  2. A novel mode for transcription inhibition mediated by PNA-induced R-loops with a model in vitro system.

    PubMed

    D'Souza, Alicia D; Belotserkovskii, Boris P; Hanawalt, Philip C

    2018-02-01

    The selective inhibition of transcription of a chosen gene by an artificial agent has numerous applications. Usually, these agents are designed to bind a specific nucleotide sequence in the promoter or within the transcribed region of the chosen gene. However, since optimal binding sites might not exist within the gene, it is of interest to explore the possibility of transcription inhibition when the agent is designed to bind at other locations. One of these possibilities arises when an additional transcription initiation site (e.g. secondary promoter) is present upstream from the primary promoter of the target gene. In this case, transcription inhibition might be achieved by inducing the formation of an RNA-DNA hybrid (R-loop) upon transcription from the secondary promoter. The R-loop could extend into the region of the primary promoter, to interfere with promoter recognition by RNA polymerase and thereby inhibit transcription. As a sequence-specific R-loop-inducing agent, a peptide nucleic acid (PNA) could be designed to facilitate R-loop formation by sequestering the non-template DNA strand. To investigate this mode for transcription inhibition, we have employed a model system in which a PNA binding site is localized between the T3 and T7 phage RNA polymerase promoters, which respectively assume the roles of primary and secondary promoters. In accord with our model, we have demonstrated that with PNA-bound DNA substrates, transcription from the T7 promoter reduces transcription from the T3 promoter by 30-fold, while in the absence of PNA binding there is no significant effect of T7 transcription upon T3 transcription. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. Target gene analysis by microarrays and chromatin immunoprecipitation identifies HEY proteins as highly redundant bHLH repressors.

    PubMed

    Heisig, Julia; Weber, David; Englberger, Eva; Winkler, Anja; Kneitz, Susanne; Sung, Wing-Kin; Wolf, Elmar; Eilers, Martin; Wei, Chia-Lin; Gessler, Manfred

    2012-01-01

    HEY bHLH transcription factors have been shown to regulate multiple key steps in cardiovascular development. They can be induced by activated NOTCH receptors, but other upstream stimuli mediated by TGFß and BMP receptors may elicit a similar response. While the basic and helix-loop-helix domains exhibit strong similarity, large parts of the proteins are still unique and may serve divergent functions. The striking overlap of cardiac defects in HEY2 and combined HEY1/HEYL knockout mice suggested that all three HEY genes fulfill overlapping function in target cells. We therefore sought to identify target genes for HEY proteins by microarray expression and ChIPseq analyses in HEK293 cells, cardiomyocytes, and murine hearts. HEY proteins were found to modulate expression of their target gene to a rather limited extent, but with striking functional interchangeability between HEY factors. Chromatin immunoprecipitation revealed a much greater number of potential binding sites that again largely overlap between HEY factors. Binding sites are clustered in the proximal promoter region especially of transcriptional regulators or developmental control genes. Multiple lines of evidence suggest that HEY proteins primarily act as direct transcriptional repressors, while gene activation seems to be due to secondary or indirect effects. Mutagenesis of putative DNA binding residues supports the notion of direct DNA binding. While class B E-box sequences (CACGYG) clearly represent preferred target sequences, there must be additional and more loosely defined modes of DNA binding since many of the target promoters that are efficiently bound by HEY proteins do not contain an E-box motif. These data clearly establish the three HEY bHLH factors as highly redundant transcriptional repressors in vitro and in vivo, which explains the combinatorial action observed in different tissues with overlapping expression.

  4. Target Gene Analysis by Microarrays and Chromatin Immunoprecipitation Identifies HEY Proteins as Highly Redundant bHLH Repressors

    PubMed Central

    Englberger, Eva; Winkler, Anja; Kneitz, Susanne; Sung, Wing-Kin; Wolf, Elmar; Eilers, Martin; Wei, Chia-Lin; Gessler, Manfred

    2012-01-01

    HEY bHLH transcription factors have been shown to regulate multiple key steps in cardiovascular development. They can be induced by activated NOTCH receptors, but other upstream stimuli mediated by TGFß and BMP receptors may elicit a similar response. While the basic and helix-loop-helix domains exhibit strong similarity, large parts of the proteins are still unique and may serve divergent functions. The striking overlap of cardiac defects in HEY2 and combined HEY1/HEYL knockout mice suggested that all three HEY genes fulfill overlapping function in target cells. We therefore sought to identify target genes for HEY proteins by microarray expression and ChIPseq analyses in HEK293 cells, cardiomyocytes, and murine hearts. HEY proteins were found to modulate expression of their target gene to a rather limited extent, but with striking functional interchangeability between HEY factors. Chromatin immunoprecipitation revealed a much greater number of potential binding sites that again largely overlap between HEY factors. Binding sites are clustered in the proximal promoter region especially of transcriptional regulators or developmental control genes. Multiple lines of evidence suggest that HEY proteins primarily act as direct transcriptional repressors, while gene activation seems to be due to secondary or indirect effects. Mutagenesis of putative DNA binding residues supports the notion of direct DNA binding. While class B E-box sequences (CACGYG) clearly represent preferred target sequences, there must be additional and more loosely defined modes of DNA binding since many of the target promoters that are efficiently bound by HEY proteins do not contain an E-box motif. These data clearly establish the three HEY bHLH factors as highly redundant transcriptional repressors in vitro and in vivo, which explains the combinatorial action observed in different tissues with overlapping expression. PMID:22615585

  5. Genomic organization and expression of the human MSH3 gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Watanabe, Atsushi; Ikejima, Miyoko; Suzuki, Noriko

    1996-02-01

    We have studied the expression and genomic organization of the human MSH3 gene, which encodes a human homologue of the bacterial DNA mismatch repair protein MutS. This gene is located upstream of the dihydrofolate reductase (DHFR) gene. Northern analysis has demonstrated that the hMSH3 gene is expressed in a variety of human tissues at low levels, like the DHFR gene. Characterization of cosmid clones has shown that the hMSH3 gene consists of 24 exons spanning at least 160 kb. All exon-intron junction sequences match the classical GT/AG rule, except that intron 6 has AT and AA at the ends. Twomore » major transcripts of 5.0 and 3.8 kb have been shown to be derived from the differential use of two polyadenylation sites. Elucidation of the complete genomic organization and the nucleotide sequences of the introns of the hMSH3 gene should be useful for studying the function of this gene and the possible involvement of specific mutations of the hMSH3 gene in some diseases. 34 refs., 5 figs., 1 tab.« less

  6. Application of Quaternion in improving the quality of global sequence alignment scores for an ambiguous sequence target in Streptococcus pneumoniae DNA

    NASA Astrophysics Data System (ADS)

    Lestari, D.; Bustamam, A.; Novianti, T.; Ardaneswari, G.

    2017-07-01

    DNA sequence can be defined as a succession of letters, representing the order of nucleotides within DNA, using a permutation of four DNA base codes including adenine (A), guanine (G), cytosine (C), and thymine (T). The precise code of the sequences is determined using DNA sequencing methods and technologies, which have been developed since the 1970s and currently become highly developed, advanced and highly throughput sequencing technologies. So far, DNA sequencing has greatly accelerated biological and medical research and discovery. However, in some cases DNA sequencing could produce any ambiguous and not clear enough sequencing results that make them quite difficult to be determined whether these codes are A, T, G, or C. To solve these problems, in this study we can introduce other representation of DNA codes namely Quaternion Q = (PA, PT, PG, PC), where PA, PT, PG, PC are the probability of A, T, G, C bases that could appear in Q and PA + PT + PG + PC = 1. Furthermore, using Quaternion representations we are able to construct the improved scoring matrix for global sequence alignment processes, by applying a dot product method. Moreover, this scoring matrix produces better and higher quality of the match and mismatch score between two DNA base codes. In implementation, we applied the Needleman-Wunsch global sequence alignment algorithm using Octave, to analyze our target sequence which contains some ambiguous sequence data. The subject sequences are the DNA sequences of Streptococcus pneumoniae families obtained from the Genebank, meanwhile the target DNA sequence are received from our collaborator database. As the results we found the Quaternion representations improve the quality of the sequence alignment score and we can conclude that DNA sequence target has maximum similarity with Streptococcus pneumoniae.

  7. Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

    PubMed

    Withey, Jeffrey H; DiRita, Victor J

    2005-05-01

    The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

  8. Molecular characterization of a genomic region in a Lactococcus bacteriophage that is involved in its sensitivity to the phage defense mechanism AbiA.

    PubMed

    Dinsmore, P K; Klaenhammer, T R

    1997-05-01

    A spontaneous mutant of the lactococcal phage phi31 that is insensitive to the phage defense mechanism AbiA was characterized in an effort to identify the phage factor(s) involved in sensitivity of phi31 to AbiA. A point mutation was localized in the genome of the AbiA-insensitive phage (phi31A) by heteroduplex analysis of a 9-kb region. The mutation (G to T) was within a 738-bp open reading frame (ORF245) and resulted in an arginine-to-leucine change in the predicted amino acid sequence of the protein. The mutant phi31A-ORF245 reduced the sensitivity of phi31 to AbiA when present in trans, indicating that the mutation in ORF245 is responsible for the AbiA insensitivity of phi31A. Transcription of ORF245 occurs early in the phage infection cycles of phi31 and phi31A and is unaffected by AbiA. Expansion of the phi31 sequence revealed ORF169 (immediately upstream of ORF245) and ORF71 (which ends 84 bp upstream of ORF169). Two inverted repeats lie within the 84-bp region between ORF71 and ORF169. Sequence analysis of an independently isolated AbiA-insensitive phage, phi31B, identified a mutation (G to A) in one of the inverted repeats. A 118-bp fragment from phi31, encompassing the 84-bp region between ORF71 and ORF169, eliminates AbiA activity against phi31 when present in trans, establishing a relationship between AbiA and this fragment. The study of this region of phage phi31 has identified an open reading frame (ORF245) and a 118-bp DNA fragment that interact with AbiA and are likely to be involved in the sensitivity of this phage to AbiA.

  9. Transcription factor GATA-1 regulates human HOXB2 gene expression in erythroid cells.

    PubMed

    Vieille-Grosjean, I; Huber, P

    1995-03-03

    The human HOXB2 gene is a member of the vertebrate Hox gene family that contains genes coding for specific developmental stage DNA-binding proteins. Remarkably, within the hematopoietic compartment, genes of the HOXB complex are expressed specifically in erythromegakaryocytic cell lines and, for some of them, in hematopoietic progenitors. Here, we report the study of HOXB2 gene transcriptional regulation in hematopoietic cells, an initial step in understanding the lineage-specific expression of the whole HOXB complex in these cells. We have isolated the HOXB2 5'-flanking sequence and have characterized a promoter fragment extending 323 base pairs upstream from the transcriptional start site, which, in transfection experiments, was sufficient to direct the tissue-specific expression of HOXB2 in the erythroid cell line K562. In this fragment, we have identified a potential GATA-binding site that is essential to the promoter activity as demonstrated by point mutation experiments. Gel shift analysis revealed the formation of a specific complex in both erythroleukemic lines K562 and HEL that could be prevented by the addition of a specific antiserum raised against GATA-1 protein. These findings suggest a regulatory hierarchy in which GATA-1 is upstream of the HOXB2 gene in erythroid cells.

  10. Genomic fragmentation and extrachromosomal telomeric repeats impact assessment of telomere length in human spermatozoa: quantitative experiments and systematic review.

    PubMed

    Kurjanowicz, P; Moskovtsev, S; Librach, C

    2017-11-01

    Can differences in DNA isolation alter assessment of sperm telomere length (spTL) and do they account for conflicting results in the literature on spTL and male fertility? DNA isolation methods preferentially include or exclude short, extrachromosomal (EC) telomere-specific sequences that alter spTL measurements, and are responsible for a proportion of the disparity observed between investigations. The relationship between spTL and male fertility has become an active area of research. The results across investigations, however, have been discordant, generating a need to critically evaluate the existing body of knowledge to guide future investigations. Quantitative experiments determined the effect of DNA isolation on the integrity of sperm DNA and measures of spTL, while a systematic analysis of the current literature evaluated the effect of DNA isolation and study design on experimental outcomes. Two DNA isolation methods were compared: Genomic Tips which isolate 'High Molecular Weight' (HMW) DNA exclusively, and QIAamp® DNA Mini which isolates 'Total' genomic DNA irrespective of size. DNA quality was assessed via field inversion gel electrophoresis (FIGE) and spTL was measured via terminal restriction fragment analysis. In addition, major databases in medicine, health and the life sciences were subject to a targeted search, and results were independently screened according to defined exclusion/inclusion criterion. Findings from primary articles were analyzed for concordance and study designs were compared across six moderator variables (sample size, participant age, fertility status, semen fraction, telomere population and type of analysis). HMW DNA spTL was significantly longer than spTL measured from total DNA (P < 0.01), indicating that Total DNA contained short, EC telomeric repeats that shifted downstream assessment towards shorter spTL. HMW DNA spTL reflected the length of intact, chromosomal telomeres. Major findings on spTL showed the greatest concordance amongst studies that implemented HMW DNA isolation prior to spTL assessment. Studies that utilized Total DNA varied in concordance, but outcomes were similar if (i) a comparative analysis was applied or (ii) a sample size threshold of 81 was achieved for correlative analysis. Chromosomal and EC telomeric DNA were distinguished based on outcomes of HMW DNA isolation and size. Further experiments are required to determine the nature and function of these two types of telomeric sequences. This study reveals a dramatic impact of upstream DNA processing and study design on measurements of spTL, which accounts for conflicting results in the literature. Future assessments of spTL should incorporate independent detection of chromosomal and EC telomeric DNA and specific experimental planning. This study was funded by CReATe Fertility Centre, Toronto, Ontario, Canada. The authors have declared no conflict of interest. N/A. © The Author 2017. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  11. Functional identification and regulatory analysis of Δ6-fatty acid desaturase from the oleaginous fungus Mucor sp. EIM-10.

    PubMed

    Jiang, Xianzhang; Liu, Hongjiao; Niu, Yongchao; Qi, Feng; Zhang, Mingliang; Huang, Jianzhong

    2017-03-01

    To enlarge the diversity of the desaturases associated with PUFA biosynthesis and to better understand the transcriptional regulation of desaturases, a Δ 6 -desaturase gene (Md6) from Mucor sp. and its 5'-upstream sequence was functionally identified in Saccharomyces cerevisiae. Expression of the Δ 6 -fatty acid desaturase (Md6) in S. cerevisiae showed that Md6 could convert linolenic acid to γ-linolenic acid. Computational analysis of the promoter of Md6 suggested it contains several eukaryotic fundamental transcription regulatory elements. In vivo functional analysis of the promoter showed the 5'-upstream sequence of Md6 could initiate expression of GFP and Md6 itself in S. cerevisiae. A series deletion analysis of the promoter suggested that sequence between -919 to -784 bp (relative to start site) named as eMd6 is the key factor for high activity of Δ 6 -desaturase. The activity of Δ 6 -desaturase was increased by 2.8-fold and 2.5-fold when the eMd6 sequence was placed upstream of -434 with forward or reverse orientations respectively. To our best knowledge, the native promoter of Md6 from Mucor is the strongest promoter for Δ 6 -desaturase reported so far and the sequence between -919 to -784 bp is an enhancer for Δ 6 -desaturase activity.

  12. Large-Scale Concatenation cDNA Sequencing

    PubMed Central

    Yu, Wei; Andersson, Björn; Worley, Kim C.; Muzny, Donna M.; Ding, Yan; Liu, Wen; Ricafrente, Jennifer Y.; Wentland, Meredith A.; Lennon, Greg; Gibbs, Richard A.

    1997-01-01

    A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7–2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (>20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (≥98% identity), and 16 clones generated nonexact matches (57%–97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching. [All 65 cDNA clone sequences described in this paper have been submitted to the GenBank data library under accession nos. U79240–U79304.] PMID:9110174

  13. Synthesis of DNA

    DOEpatents

    Mariella, Jr., Raymond P.

    2008-11-18

    A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

  14. Adenovirus E1A and E1B-19K Proteins Protect Human Hepatoma Cells from Transforming Growth Factor β1-induced Apoptosis

    PubMed Central

    Tarakanova, Vera L.; Wold, William S. M.

    2009-01-01

    Primary and some transformed hepatocytes undergo apoptosis in response to transforming growth factor β1 (TGFβ). We report that infection with species C human adenovirus conferred resistance to TGFβ-induced apoptosis in human hepatocellular carcinoma cells (Huh-7). Protection against TGFβ-mediated cell death in adenovirus-infected cells correlated with the maintenance of normal nuclear morphology, lack of pro-caspases 8 and 3 processing, maintenance of the mitochondrial membrane potential, and lack of cellular DNA degradation. The TGFβ pro-apoptotic signaling pathway was blocked upstream of mitochondria in adenovirus-infected cells. Both the N-terminal sequences of the E1A proteins and the E1B-19K protein were necessary to protect infected cells against TGFβ-induced apoptosis. PMID:19854227

  15. Nanopore Technology: A Simple, Inexpensive, Futuristic Technology for DNA Sequencing.

    PubMed

    Gupta, P D

    2016-10-01

    In health care, importance of DNA sequencing has been fully established. Sanger's Capillary Electrophoresis DNA sequencing methodology is time consuming, cumbersome, hence become more expensive. Lately, because of its versatility DNA sequencing became house hold name, and therefore, there is an urgent need of simple, fast, inexpensive, DNA sequencing technology. In the beginning of this century efforts were made, and Nanopore DNA sequencing technology was developed; still it is infancy, nevertheless, it is the futuristic technology.

  16. The genome-wide DNA sequence specificity of the anti-tumour drug bleomycin in human cells.

    PubMed

    Murray, Vincent; Chen, Jon K; Tanaka, Mark M

    2016-07-01

    The cancer chemotherapeutic agent, bleomycin, cleaves DNA at specific sites. For the first time, the genome-wide DNA sequence specificity of bleomycin breakage was determined in human cells. Utilising Illumina next-generation DNA sequencing techniques, over 200 million bleomycin cleavage sites were examined to elucidate the bleomycin genome-wide DNA selectivity. The genome-wide bleomycin cleavage data were analysed by four different methods to determine the cellular DNA sequence specificity of bleomycin strand breakage. For the most highly cleaved DNA sequences, the preferred site of bleomycin breakage was at 5'-GT* dinucleotide sequences (where the asterisk indicates the bleomycin cleavage site), with lesser cleavage at 5'-GC* dinucleotides. This investigation also determined longer bleomycin cleavage sequences, with preferred cleavage at 5'-GT*A and 5'- TGT* trinucleotide sequences, and 5'-TGT*A tetranucleotides. For cellular DNA, the hexanucleotide DNA sequence 5'-RTGT*AY (where R is a purine and Y is a pyrimidine) was the most highly cleaved DNA sequence. It was striking that alternating purine-pyrimidine sequences were highly cleaved by bleomycin. The highest intensity cleavage sites in cellular and purified DNA were very similar although there were some minor differences. Statistical nucleotide frequency analysis indicated a G nucleotide was present at the -3 position (relative to the cleavage site) in cellular DNA but was absent in purified DNA.

  17. Sequence Requirements of the 5-Enolpyruvylshikimate-3-phosphate Synthase 5[prime]-Upstream Region for Tissue-Specific Expression in Flowers and Seedlings.

    PubMed Central

    Benfey, PN; Takatsuji, H; Ren, L; Shah, DM; Chua, NH

    1990-01-01

    We have analyzed expression from deletion derivatives of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) 5[prime]-upstream region in transgenic petunia flowers and seedlings. In seedlings, expression was strongest in root cortex cells and in trichomes. High-level expression in petals and in seedling roots was conferred by large (>500 base-pair) stretches of sequence, but was lost when smaller fragments were analyzed individually. This apparent requirement for extensive sequence suggests that combinations of cis-elements that are widely separated control tissue-specific expression from the EPSPS promoter. We have also used the high-level, petal-specific expression of the EPSPS promoter to change petal color in two mutant petunia lines. PMID:12354968

  18. Gene conversion as a secondary mechanism of short interspersed element (SINE) evolution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kass, D.H.; Batzer, M.A.; Deininger, P.L.

    The Alu repetitive family of short interspersed elements (SINEs) in primates can be subdivided into distinct subfamilies by specific diagnostic nucleotide changes. The older subfamilies are generally very abundant, while the younger subfamilies have fewer copies. Some of the youngest Alu elements are absent in the orthologous loci of nonhuman primates, indicative of recent retroposition events, the primary mode of SINE evolutions. PCR analysis of one young Alu subfamily (Sb2) member found in the low-density lipoprotein receptor gene apparently revealed the presence of this element in the green monkey, orangutan, gorilla, and chimpanzee genomes, as well as the human genome.more » However, sequence analysis of these genomes revealed a highly mutated, older, primate-specific Alu element was present at this position in the nonhuman primates. Comparison of the flanking DNA sequences upstream of this Alu insertion corresponded to evolution expected for standard primate phylogeny, but comparison of the Alu repeat sequences revealed that the human element departed from this phylogeny. The change in the human sequence apparently occurred by a gene conversion event only within the Alu element itself, converting it from one of the oldest to one of the youngest Alu subfamilies. Although gene conversions of Alu elements are clearly very rare, this finding shows that such events can occur and contribute to specific cases of SINE subfamily evolution.« less

  19. Partial characterization of the lettuce infectious yellows virus genomic RNAs, identification of the coat protein gene and comparison of its amino acid sequence with those of other filamentous RNA plant viruses.

    PubMed

    Klaassen, V A; Boeshore, M; Dolja, V V; Falk, B W

    1994-07-01

    Purified virions of lettuce infectious yellows virus (LIYV), a tentative member of the closterovirus group, contained two RNAs of approximately 8500 and 7300 nucleotides (RNAs 1 and 2 respectively) and a single coat protein species with M(r) of approximately 28,000. LIYV-infected plants contained multiple dsRNAs. The two largest were the correct size for the replicative forms of LIYV virion RNAs 1 and 2. To assess the relationships between LIYV RNAs 1 and 2, cDNAs corresponding to the virion RNAs were cloned. Northern blot hybridization analysis showed no detectable sequence homology between these RNAs. A partial amino acid sequence obtained from purified LIYV coat protein was found to align in the most upstream of four complete open reading frames (ORFs) identified in a LIYV RNA 2 cDNA clone. The identity of this ORF was confirmed as the LIYV coat protein gene by immunological analysis of the gene product expressed in vitro and in Escherichia coli. Computer analysis of the LIYV coat protein amino acid sequence indicated that it belongs to a large family of proteins forming filamentous capsids of RNA plant viruses. The LIYV coat protein appears to be most closely related to the coat proteins of two closteroviruses, beet yellows virus and citrus tristeza virus.

  20. Distant sequences determine 5′ end formation of cox3 transcripts in Arabidopsis thaliana ecotype C24

    PubMed Central

    Forner, Joachim; Weber, Bärbel; Wiethölter, Caterina; Meyer, Rhonda C.; Binder, Stefan

    2005-01-01

    The genomic environments and the transcripts of the mitochondrial cox3 gene are investigated in three Arabidopsis thaliana ecotypes. While the proximate 5′ sequences up to nucleotide position −584, the coding regions and the 3′ flanking regions are identical in Columbia (Col), C24 and Landsberg erecta (Ler), genomic variation is detected in regions further upstream. In the mitochondrial DNA of Col, a 1790 bp fragment flanked by a nonanucleotide direct repeat is present beyond position −584 with respect to the ATG. While in Ler only part of this insertion is conserved, this sequence is completely absent in C24, except for a single copy of the nonanucleotide direct repeat. Northern hybridization reveals identical major transcripts in the three ecotypes, but identifies an additional abundant 60 nt larger mRNA species in C24. The extremities of the most abundant mRNA species are identical in the three ecotypes. In C24, an extra major 5′ end is abundant. This terminus and the other major 5′ ends are located in identical sequence regions. Inspection of Atcox3 transcripts in C24/Col hybrids revealed a female inheritance of the mRNA species with the extra 5′ terminus. Thus, a mitochondrially encoded factor determines the generation of an extra 5′ mRNA end. PMID:16107557

  1. A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

    PubMed Central

    Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C

    1992-01-01

    Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867

  2. Growth rate regulation of Escherichia coli acetyl coenzyme A carboxylase, which catalyzes the first committed step of lipid biosynthesis.

    PubMed Central

    Li, S J; Cronan, J E

    1993-01-01

    Acetyl coenzyme A (CoA) carboxylase catalyzes the synthesis of malonyl-CoA, the first intermediate of fatty acid synthesis. The Escherichia coli enzyme is encoded by four subunits located at three different positions on the E. coli chromosome. The accBC genes lie in a small operon at min 72, whereas accA and accD are located at min 4.3 and 50, respectively. We examined the expression of the genes that encode the E. coli acetyl-CoA carboxylase subunits (accA, accBC, and accD) under a variety of growth conditions by quantitative Northern (RNA) blot analysis. We found a direct correlation between the levels of transcription of the acc genes and the rate of cellular growth. Consistent results were also obtained upon nutritional upshift and downshift experiments and upon dilution of stationary-phase cultures into fresh media. We also determined the 5' end of the accA and accD mRNAs by primer extension and did transcriptional fusion analysis of the previously reported accBC promoter. Several interesting features were found in the promoter regions of these genes, including a bent DNA sequence and an open reading frame within the unusually long leader mRNA of the accBC operon, potential stem-loop structures in the accA and accD mRNA leader regions, and a stretch of GC-rich sequences followed by AT-rich sequences common to all three promoters. In addition, both accA and accD are located in complex gene clusters. For example, the accA promoter was localized within the upstream polC gene (which encodes the DNA polymerase III catalytic subunit), suggesting that additional regulatory mechanisms exist. Images PMID:7678242

  3. Sequence and Structure Dependent DNA-DNA Interactions

    NASA Astrophysics Data System (ADS)

    Kopchick, Benjamin; Qiu, Xiangyun

    Molecular forces between dsDNA strands are largely dominated by electrostatics and have been extensively studied. Quantitative knowledge has been accumulated on how DNA-DNA interactions are modulated by varied biological constituents such as ions, cationic ligands, and proteins. Despite its central role in biology, the sequence of DNA has not received substantial attention and ``random'' DNA sequences are typically used in biophysical studies. However, ~50% of human genome is composed of non-random-sequence DNAs, particularly repetitive sequences. Furthermore, covalent modifications of DNA such as methylation play key roles in gene functions. Such DNAs with specific sequences or modifications often take on structures other than the canonical B-form. Here we present series of quantitative measurements of the DNA-DNA forces with the osmotic stress method on different DNA sequences, from short repeats to the most frequent sequences in genome, and to modifications such as bromination and methylation. We observe peculiar behaviors that appear to be strongly correlated with the incurred structural changes. We speculate the causalities in terms of the differences in hydration shell and DNA surface structures.

  4. Identification of a functional element in the promoter of the silkworm (Bombyx mori) fat body-specific gene Bmlp3.

    PubMed

    Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou

    2014-08-01

    30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.

  5. DNA methylation changes at infertility genes in newborn twins conceived by in vitro fertilisation.

    PubMed

    Castillo-Fernandez, Juan E; Loke, Yuk Jing; Bass-Stringer, Sebastian; Gao, Fei; Xia, Yudong; Wu, Honglong; Lu, Hanlin; Liu, Yuan; Wang, Jun; Spector, Tim D; Saffery, Richard; Craig, Jeffrey M; Bell, Jordana T

    2017-03-24

    The association of in vitro fertilisation (IVF) and DNA methylation has been studied predominantly at regulatory regions of imprinted genes and at just thousands of the ~28 million CpG sites in the human genome. We investigated the links between IVF and DNA methylation patterns in whole cord blood cells (n = 98) and cord blood mononuclear cells (n = 82) from newborn twins using genome-wide methylated DNA immunoprecipitation coupled with deep sequencing. At a false discovery rate (FDR) of 5%, we identified one significant whole blood DNA methylation change linked to conception via IVF, which was located ~3 kb upstream of TNP1, a gene previously linked to male infertility. The 46 most strongly associated signals (FDR of 25%) included a second region in a gene also previously linked to infertility, C9orf3, suggesting that our findings may in part capture the effect of parental subfertility. Using twin modelling, we observed that individual-specific environmental factors appear to be the main overall contributors of methylation variability at the FDR 25% IVF-associated differentially methylated regions, although evidence for methylation heritability was also obtained at several of these regions. We replicated previous findings of differential methylation associated with IVF at the H19/IGF2 region in cord blood mononuclear cells, and we validated the signal at C9orf3 in monozygotic twins. We also explored the impact of intracytoplasmic sperm injection on the FDR 25% signals for potential effects specific to male or female infertility factors. To our knowledge, this is the most comprehensive study of DNA methylation profiles at birth and IVF conception to date, and our results show evidence for epigenetic modifications that may in part reflect parental subfertility.

  6. Disturbance of DNA methylation patterns in the early phase of hepatocarcinogenesis induced by a choline-deficient L-amino acid-defined diet in rats.

    PubMed

    Shimizu, Kyoko; Onishi, Mariko; Sugata, Eriko; Sokuza, Yui; Mori, Chiharu; Nishikawa, Tomoki; Honoki, Kanya; Tsujiuchi, Toshifumi

    2007-09-01

    The authors investigated the DNA methylation patterns of the E-cadherin, Connexin 26 (Cx26), Rassf1a and c-fos genes in the early phase of rat hepatocarcinogenesis induced by a choline-deficient L-amino acid-defined (CDAA) diet. Six-week-old F344 male rats were continuously fed with the CDAA diet, and three animals were then killed at each of 4 and 8 days and 3 weeks. Genomic DNA was extracted from livers for assessment of methylation status in the 5' upstream regions of E-cadherin, Cx26, Rassf1a and c-fos genes by bisulfite sequencing, compared with normal livers. The livers of rats fed the CDAA diet for 4 and 8 days and 3 weeks were methylated in E-cadherin, Cx26 and Rassf1a genes, while normal livers were all unmethylated. In contrast, normal livers were highly methylated in c-fos gene. Although the livers at 4 days were weakly methylated, those at 8 days and 3 weeks were markedly unmethylated. Methylation patterns of CpG sites in E-cadherin, Cx26 and Rassf1a were sparse and the methylation was not associated with gene repression. These results indicate that gene-specific DNA methylation patterns were found in livers of rats after short-term feeding of the CDAA diet, suggesting gene-specific hypermethylation might be involved in the early phase of rat hepatocarcinogenesis induced by the CDAA diet.

  7. Cloning of a promoter-like soybean DNA sequence responding to IAA induction in Escherichia coli K12.

    PubMed

    Kline, E L; Chiang, S J; Lattora, D; Chaung, W

    1992-02-01

    We have constructed a soybean genomic DNA library in Escherichia coli K12 strain KC13 using plasmid pPV33, which consists of a promoter-less tetracycline resistance (Tcr) gene. A recombinant clone, KC13(pAU-SB1)+, was obtained by selecting for resistance to tetracycline in the presence of indole-3-acetic acid (IAA). Restriction enzyme cleavage and Southern hybridization analysis revealed that the pAU-SB1 plasmid has a 250 bp soybean DNA insert fused with the Tcr gene. In the presence of a selected group of auxins, induction of the Tcr phenotype and mRNA synthesis of the Tcr gene are observed only in KC13(pAU-SB1)+ cultures. On the other hand, induction of the Tcr phenotype and mRNA synthesis of the Tcr gene are absent in cells harboring the cloning vector pPV33 or a recombinant plasmid containing the 250 bp insert in the reverse orientation, pAU-SB1ro. This demonstrated a need for the insertion of the 250 bp soybean DNA and the specificity of its orientation in response to IAA induction. The start point of mRNA transcription in response to IAA, IBA, IPA, 2,4,5-T, and a-NAP is at base pair -96 or -95 upstream of the translational start site of the Tcr gene and base pair -98 with 2,4-D.

  8. The positive regulatory function of the 5'-proximal open reading frames in GCN4 mRNA can be mimicked by heterologous, short coding sequences.

    PubMed Central

    Williams, N P; Mueller, P P; Hinnebusch, A G

    1988-01-01

    Translational control of GCN4 expression in the yeast Saccharomyces cerevisiae is mediated by multiple AUG codons present in the leader of GCN4 mRNA, each of which initiates a short open reading frame of only two or three codons. Upstream AUG codons 3 and 4 are required to repress GCN4 expression in normal growth conditions; AUG codons 1 and 2 are needed to overcome this repression in amino acid starvation conditions. We show that the regulatory function of AUG codons 1 and 2 can be qualitatively mimicked by the AUG codons of two heterologous upstream open reading frames (URFs) containing the initiation regions of the yeast genes PGK and TRP1. These AUG codons inhibit GCN4 expression when present singly in the mRNA leader; however, they stimulate GCN4 expression in derepressing conditions when inserted upstream from AUG codons 3 and 4. This finding supports the idea that AUG codons 1 and 2 function in the control mechanism as translation initiation sites and further suggests that suppression of the inhibitory effects of AUG codons 3 and 4 is a general consequence of the translation of URF 1 and 2 sequences upstream. Several observations suggest that AUG codons 3 and 4 are efficient initiation sites; however, these sequences do not act as positive regulatory elements when placed upstream from URF 1. This result suggests that efficient translation is only one of the important properties of the 5' proximal URFs in GCN4 mRNA. We propose that a second property is the ability to permit reinitiation following termination of translation and that URF 1 is optimized for this regulatory function. Images PMID:3065626

  9. Molecular mechanisms of ribosomal protein gene coregulation.

    PubMed

    Reja, Rohit; Vinayachandran, Vinesh; Ghosh, Sujana; Pugh, B Franklin

    2015-09-15

    The 137 ribosomal protein genes (RPGs) of Saccharomyces provide a model for gene coregulation. We examined the positional and functional organization of their regulators (Rap1 [repressor activator protein 1], Fhl1, Ifh1, Sfp1, and Hmo1), the transcription machinery (TFIIB, TFIID, and RNA polymerase II), and chromatin at near-base-pair resolution using ChIP-exo, as RPGs are coordinately reprogrammed. Where Hmo1 is enriched, Fhl1, Ifh1, Sfp1, and Hmo1 cross-linked broadly to promoter DNA in an RPG-specific manner and demarcated by general minor groove widening. Importantly, Hmo1 extended 20-50 base pairs (bp) downstream from Fhl1. Upon RPG repression, Fhl1 remained in place. Hmo1 dissociated, which was coupled to an upstream shift of the +1 nucleosome, as reflected by the Hmo1 extension and core promoter region. Fhl1 and Hmo1 may create two regulatable and positionally distinct barriers, against which chromatin remodelers position the +1 nucleosome into either an activating or a repressive state. Consistent with in vitro studies, we found that specific TFIID subunits, in addition to cross-linking at the core promoter, made precise cross-links at Rap1 sites, which we interpret to reflect native Rap1-TFIID interactions. Our findings suggest how sequence-specific DNA binding regulates nucleosome positioning and transcription complex assembly >300 bp away and how coregulation coevolved with coding sequences. © 2015 Reja et al.; Published by Cold Spring Harbor Laboratory Press.

  10. Molecular Cloning, Expression Analysis, and Functional Characterization of the H(+)-Pyrophosphatase from Jatropha curcas.

    PubMed

    Yang, Yumei; Luo, Zhu; Zhang, Mengru; Liu, Chang; Gong, Ming; Zou, Zhurong

    2016-04-01

    H(+)-pyrophosphatase (H(+)-PPase) is a primary pyrophosphate (PPi)-energized proton pump to generate electrochemical H(+) gradient for ATP production and substance translocations across membranes. It plays an important role in stress adaptation that was intensively substantiated by numerous transgenic plants overexpressing H(+)-PPases yet devoid of any correlated studies pointing to the elite energy plant, Jatropha curcas. Herein, we cloned the full length of J. curcas H(+)-PPase (JcVP1) complementary DNA (cDNA) by reverse transcription PCR, based on the assembled sequence of its ESTs highly matched to Hevea brasiliensis H(+)-PPase. This gene encodes a polypeptide of 765 amino acids that was predicted as a K(+)-dependent H(+)-PPase evolutionarily closest to those of other Euphorbiaceae plants. Many cis-regulatory elements relevant to environmental stresses, molecular signals, or tissue-specificity were identified by promoter prediction within the 1.5-kb region upstream of JcVP1 coding sequence. Meanwhile, the responses of JcVP1 expression to several common abiotic stresses (salt, drought, heat, cold) were characterized with a considerable accordance with the inherent stress tolerance of J. curcas. Moreover, we found that the heterologous expression of JcVP1 could significantly improve the salt tolerance in both recombinant Escherichia coli and Saccharomyces cerevisiae, and this effect could be further fortified in yeast by N-terminal addition of a vacuole-targeting signal peptide from the H(+)-PPase of Trypanosoma cruzi.

  11. Regulation of early gene expression from the bovine papillomavirus genome in transiently transfected C127 cells.

    PubMed Central

    Szymanski, P; Stenlund, A

    1991-01-01

    Expression of bovine papillomavirus (BPV) early gene products is required for viral DNA replication and establishment of the transformed phenotype. By the use of a highly efficient electroporation system, we have examined for the first time the transcriptional activity of BPV promoters in their natural genomic context in a replication-permissive cell line. We have determined that a qualitatively distinct stage of transcription is not detectable prior to DNA replication in transiently transfected cells. This suggests that the transcriptional activity of the BPV genome in stably transformed cells represents the early stage of BPV gene expression. Quantitative differences in promoter activity between transiently transfected and stably transformed cells suggest that subtle changes in gene expression may control progression of the viral life cycle. Deletion analysis demonstrated that the E2 transactivator protein stimulates all of the early promoters through sequences located in the upstream regulatory region. This E2-dependent enhancer was found to be highly redundant, and particular E2 binding sites did not display a preference for particular promoters. Despite this dependence on a common cis-acting sequence, the various promoters displayed different sensitivities to the E2 transactivator. The findings that E2 regulates all promoters and, with the exception of the E2 repressors, that no other known viral gene product appears to affect transcription indicate that the E2 system functions as the master regulator of BPV early gene expression. Images PMID:1656065

  12. Hot Spots of Recombination in Fission Yeast: Inactivation of the M26 Hot Spot by Deletion of the Ade6 Promoter and the Novel Hotspot Ura4-Aim

    PubMed Central

    Zahn-Zabal, M.; Lehmann, E.; Kohli, J.

    1995-01-01

    The M26 mutation in the ade6 gene of Schizosaccharomyces pombe creates a hot spot of meiotic recombination. A single base substitution, the M26 mutation is situated within the open reading frame, near the 5' end. It has previously been shown that the heptanucleotide sequence 5' ATGACGT 3', which includes the M26 mutation, is required for hot spot activity. The 510-bp ade6-delXB deletion encompasses the promoter and the first 23 bp of the open reading frame, ending 112 bp upstream of M26. Deletion of the promoter in cis to M26 abolishes hot spot activity, while deletion in trans to M26 has no effect. Homozygous deletion of the promoter also eliminates M26 hot spot activity, indicating that the heterology created through deletion of the promoter per se is not responsible for the loss of hot spot activity. Thus, DNA sequences other than the heptanucleotide 5' ATGACGT 3', which must be located at the 5' end of the ade6 gene, appear to be required for hot spot activity. While the M26 hotspot stimulates crossovers associated with M26 conversion, it does not affect the crossover frequency in the intervals adjacent to ade6. The flanking marker ura4-aim, a heterology created by insertion of the ura4(+) gene upstream of ade6, turned out to be a hot spot itself. It shows disparity of conversion with preferential loss of the insertion. The frequency of conversion at ura4-aim is reduced when the M26 hot spot is active 15 kb away, indicating competition for recombination factors by hot spots in close proximity. PMID:7498729

  13. ERalpha and AP-1 interact in vivo with a specific sequence of the F promoter of the human ERalpha gene in osteoblasts.

    PubMed

    Lambertini, Elisabetta; Tavanti, Elisa; Torreggiani, Elena; Penolazzi, Letizia; Gambari, Roberto; Piva, Roberta

    2008-07-01

    Estrogen-responsive genes often have an estrogen response element (ERE) positioned next to activator protein-1 (AP-1) binding sites. Considering that the interaction between ERE and AP-1 elements has been described for the modulation of bone-specific genes, we investigated the 17-beta-estradiol responsiveness and the role of these cis-elements present in the F promoter of the human estrogen receptor alpha (ERalpha) gene. The F promoter, containing the sequence analyzed here, is one of the multiple promoters of the human ERalpha gene and is the only active promoter in bone tissue. Through electrophoretic mobility shift (EMSA), chromatin immunoprecipitation (ChIP), and re-ChIP assays, we investigated the binding of ERalpha and four members of the AP-1 family (c-Jun, c-fos, Fra-2, and ATF2) to a region located approximately 800 bp upstream of the transcriptional start site of exon F of the human ERalpha gene in SaOS-2 osteoblast-like cells. Reporter gene assay experiments in combination with DNA binding assays demonstrated that F promoter activity is under the control of upstream cis-acting elements which are recognized by specific combinations of ERalpha, c-Jun, c-fos, and ATF2 homo- and heterodimers. Moreover, ChIP and re-ChIP experiments showed that these nuclear factors bind the F promoter in vivo with a simultaneous occupancy stimulated by 17-beta-estradiol. Taken together, our findings support a model in which ERalpha/AP-1 complexes modulate F promoter activity under conditions of 17-beta-estradiol stimulation. (c) 2008 Wiley-Liss, Inc.

  14. A gene-specific non-enhancer sequence is critical for expression from the promoter of the small heat shock protein gene αB-crystallin

    PubMed Central

    2014-01-01

    Background Deciphering of the information content of eukaryotic promoters has remained confined to universal landmarks and conserved sequence elements such as enhancers and transcription factor binding motifs, which are considered sufficient for gene activation and regulation. Gene-specific sequences, interspersed between the canonical transacting factor binding sites or adjoining them within a promoter, are generally taken to be devoid of any regulatory information and have therefore been largely ignored. An unanswered question therefore is, do gene-specific sequences within a eukaryotic promoter have a role in gene activation? Here, we present an exhaustive experimental analysis of a gene-specific sequence adjoining the heat shock element (HSE) in the proximal promoter of the small heat shock protein gene, αB-crystallin (cryab). These sequences are highly conserved between the rodents and the humans. Results Using human retinal pigment epithelial cells in culture as the host, we have identified a 10-bp gene-specific promoter sequence (GPS), which, unlike an enhancer, controls expression from the promoter of this gene, only when in appropriate position and orientation. Notably, the data suggests that GPS in comparison with the HSE works in a context-independent fashion. Additionally, when moved upstream, about a nucleosome length of DNA (−154 bp) from the transcription start site (TSS), the activity of the promoter is markedly inhibited, suggesting its involvement in local promoter access. Importantly, we demonstrate that deletion of the GPS results in complete loss of cryab promoter activity in transgenic mice. Conclusions These data suggest that gene-specific sequences such as the GPS, identified here, may have critical roles in regulating gene-specific activity from eukaryotic promoters. PMID:24589182

  15. Identification of a cis-Regulatory Element Involved in Phytochrome Down-Regulated Expression of the Pea Small GTPase Gene pra21

    PubMed Central

    Inaba, Takehito; Nagano, Yukio; Sakakibara, Toshihiro; Sasaki, Yukiko

    1999-01-01

    The pra2 gene encodes a pea (Pisum sativum) small GTPase belonging to the YPT/rab family, and its expression is down-regulated by light, mediated by phytochrome. We have isolated and characterized a genomic clone of this gene and constructed a fusion DNA of its 5′-upstream region in front of the gene for firefly luciferase. Using this construct in a transient assay, we determined a pra2 cis-regulatory region sufficient to direct the light down-regulation of the luciferase reporter gene. Both 5′- and internal deletion analyses revealed that the 93-bp sequence between −734 and −642 from the transcriptional start site was important for phytochrome down-regulation. Gain-of-function analysis showed that this 93-bp region could confer light down-regulation when fused to the cauliflower mosaic virus 35S promoter. Furthermore, linker-scanning analysis showed that a 12-bp sequence within the 93-bp region mediated phytochrome down-regulation. Gel-retardation analysis showed the presence of a nuclear factor that was specifically bound to the 12-bp sequence in vitro. These results indicate that this element is a cis-regulatory element involved in phytochrome down-regulated expression. PMID:10364400

  16. [Analysis of cis-regulatory element distribution in gene promoters of Gossypium raimondii and Arabidopsis thaliana].

    PubMed

    Sun, Gao-Fei; He, Shou-Pu; Du, Xiong-Ming

    2013-10-01

    Cotton genomic studies have boomed since the release of Gossypium raimondii draft genome. In this study, cis-regulatory element (CRE) in 1 kb length sequence upstream 5' UTR of annotated genes were selected and scanned in the Arabidopsis thaliana (At) and Gossypium raimondii (Gr) genomes, based on the database of PLACE (Plant cis-acting Regulatory DNA Elements). According to the definition of this study, 44 (12.3%) and 57 (15.5%) CREs presented "peak-like" distribution in the 1 kb selected sequences of both genomes, respectively. Thirty-four of them were peak-like distributed in both genomes, which could be further categorized into 4 types based on their core sequences. The coincidence of TATABOX peak position and their actual position ((-) -30 bp) indicated that the position of a common CRE was conservative in different genes, which suggested that the peak position of these CREs was their possible actual position of transcription factors. The position of a common CRE was also different between the two genomes due to stronger length variation of 5' UTR in Gr than At. Furthermore, most of the peak-like CREs were located in the region of -110 bp-0 bp, which suggested that concentrated distribution might be conductive to the interaction of transcription factors, and then regulate the gene expression in downstream.

  17. The Diversity of Prokaryotic DDE Transposases of the Mutator Superfamily, Insertion Specificity, and Association with Conjugation Machineries

    PubMed Central

    Guérillot, Romain; Siguier, Patricia; Gourbeyre, Edith; Chandler, Michael; Glaser, Philippe

    2014-01-01

    Transposable elements (TEs) are major components of both prokaryotic and eukaryotic genomes and play a significant role in their evolution. In this study, we have identified new prokaryotic DDE transposase families related to the eukaryotic Mutator-like transposases. These genes were retrieved by cascade PSI-Blast using as initial query the transposase of the streptococcal integrative and conjugative element (ICE) TnGBS2. By combining secondary structure predictions and protein sequence alignments, we predicted the DDE catalytic triad and the DNA-binding domain recognizing the terminal inverted repeats. Furthermore, we systematically characterized the organization and the insertion specificity of the TEs relying on these prokaryotic Mutator-like transposases (p-MULT) for their mobility. Strikingly, two distant TE families target their integration upstream σA dependent promoters. This allowed us to identify a transposase sequence signature associated with this unique insertion specificity and to show that the dissymmetry between the two inverted repeats is responsible for the orientation of the insertion. Surprisingly, while DDE transposases are generally associated with small and simple transposons such as insertion sequences (ISs), p-MULT encoding TEs show an unprecedented diversity with several families of IS, transposons, and ICEs ranging in size from 1.1 to 52 kb. PMID:24418649

  18. A Comprehensive Analysis of Transcript-Supported De Novo Genes in Saccharomyces sensu stricto Yeasts

    PubMed Central

    Lu, Tzu-Chiao; Leu, Jun-Yi; Lin, Wen-Chang

    2017-01-01

    Abstract Novel genes arising from random DNA sequences (de novo genes) have been suggested to be widespread in the genomes of different organisms. However, our knowledge about the origin and evolution of de novo genes is still limited. To systematically understand the general features of de novo genes, we established a robust pipeline to analyze >20,000 transcript-supported coding sequences (CDSs) from the budding yeast Saccharomyces cerevisiae. Our analysis pipeline combined phylogeny, synteny, and sequence alignment information to identify possible orthologs across 20 Saccharomycetaceae yeasts and discovered 4,340 S. cerevisiae-specific de novo genes and 8,871 S. sensu stricto-specific de novo genes. We further combine information on CDS positions and transcript structures to show that >65% of de novo genes arose from transcript isoforms of ancient genes, especially in the upstream and internal regions of ancient genes. Fourteen identified de novo genes with high transcript levels were chosen to verify their protein expressions. Ten of them, including eight transcript isoform-associated CDSs, showed translation signals and five proteins exhibited specific cytosolic localizations. Our results suggest that de novo genes frequently arise in the S. sensu stricto complex and have the potential to be quickly integrated into ancient cellular network. PMID:28981695

  19. EnsMart: A Generic System for Fast and Flexible Access to Biological Data

    PubMed Central

    Kasprzyk, Arek; Keefe, Damian; Smedley, Damian; London, Darin; Spooner, William; Melsopp, Craig; Hammond, Martin; Rocca-Serra, Philippe; Cox, Tony; Birney, Ewan

    2004-01-01

    The EnsMart system (www.ensembl.org/EnsMart) provides a generic data warehousing solution for fast and flexible querying of large biological data sets and integration with third-party data and tools. The system consists of a query-optimized database and interactive, user-friendly interfaces. EnsMart has been applied to Ensembl, where it extends its genomic browser capabilities, facilitating rapid retrieval of customized data sets. A wide variety of complex queries, on various types of annotations, for numerous species are supported. These can be applied to many research problems, ranging from SNP selection for candidate gene screening, through cross-species evolutionary comparisons, to microarray annotation. Users can group and refine biological data according to many criteria, including cross-species analyses, disease links, sequence variations, and expression patterns. Both tabulated list data and biological sequence output can be generated dynamically, in HTML, text, Microsoft Excel, and compressed formats. A wide range of sequence types, such as cDNA, peptides, coding regions, UTRs, and exons, with additional upstream and downstream regions, can be retrieved. The EnsMart database can be accessed via a public Web site, or through a Java application suite. Both implementations and the database are freely available for local installation, and can be extended or adapted to `non-Ensembl' data sets. PMID:14707178

  20. A High-Throughput Process for the Solid-Phase Purification of Synthetic DNA Sequences

    PubMed Central

    Grajkowski, Andrzej; Cieślak, Jacek; Beaucage, Serge L.

    2017-01-01

    An efficient process for the purification of synthetic phosphorothioate and native DNA sequences is presented. The process is based on the use of an aminopropylated silica gel support functionalized with aminooxyalkyl functions to enable capture of DNA sequences through an oximation reaction with the keto function of a linker conjugated to the 5′-terminus of DNA sequences. Deoxyribonucleoside phosphoramidites carrying this linker, as a 5′-hydroxyl protecting group, have been synthesized for incorporation into DNA sequences during the last coupling step of a standard solid-phase synthesis protocol executed on a controlled pore glass (CPG) support. Solid-phase capture of the nucleobase- and phosphate-deprotected DNA sequences released from the CPG support is demonstrated to proceed near quantitatively. Shorter than full-length DNA sequences are first washed away from the capture support; the solid-phase purified DNA sequences are then released from this support upon reaction with tetra-n-butylammonium fluoride in dry dimethylsulfoxide (DMSO) and precipitated in tetrahydrofuran (THF). The purity of solid-phase-purified DNA sequences exceeds 98%. The simulated high-throughput and scalability features of the solid-phase purification process are demonstrated without sacrificing purity of the DNA sequences. PMID:28628204

  1. Differential expression of upstream stimulatory factor (USF) 2 variants in eutopic endometria from women with endometriosis: estradiol regulation.

    PubMed

    Castro, Jazmin; Araya, Germán; Inostroza, Pamela; Hidalgo, Paulina; González-Ramos, Reinaldo; Sovino, Hugo; Boric, M Angélica; Fuentes, Ariel; Johnson, M Cecilia

    2015-10-09

    Endometriosis, pro-inflammatory and invasive benign disease estrogen dependent, abnormally express in endometria the enzyme P450Arom, positively regulated by steroid factor-1 (SF-1). Our objective was to study the nuclear protein contents of upstream stimulating factor 2 (USF2a and USF2b), a positive regulator of SF-1, throughout the menstrual cycle in eutopic endometria from women with and without (control) endometriosis and the involvement of nuclear estrogen receptors (ER) and G-coupled protein estrogen receptor (GPER)-1. Upstream stimulating factor 2 protein contents were higher in mid (USF2b) and late (USF2a and USF2b) secretory phase in eutopic endometria from endometriosis than control (p < 0.05). In isolated control epithelial cells incubated with E2 and PGE2, to resemble the endometriosis condition, the data showed: (a) significant increase of USF2a and USF2b nuclear protein contents when treated with E2, PPT (specific agonist for ERα) or G1 (specific agonist for GPER1); (b) no increase in USF2 binding to SF-1 E-Box/DNA consensus sequence in E2-treated cells; (c) USF2 variants protein contents were not modified by PGE2; (d) SF-1 nuclear protein content was significantly higher than basal when treated with PGE2, E2 or G1, stimulation unaffected by ICI (nuclear ER antagonist); and (e) increased (p < 0.05) cytosolic protein contents of P450Arom when treated with PGE2, E2, PPT or G1 compared to basal, effect that was additive with E2 + PGE2 together. Nevertheless, in endometriosis cells, the high USF2, SF-1 and P450Arom protein contents in basal condition were unmodified. These data strongly suggest that USF2 variants and P450Arom are regulated by E2 through ERα and GPER1, whereas SF-1 through GPER1, visualized by the response of the cells obtained from control endometria, being unaffected the endogenously stimulated cells from endometriosis origin. The lack of E2 stimulation on USF2/SF-1 E-Box/DNA-sequence binding and the absence of PGE2 effect on USF2 variants opposite to the strong induction that they exert on SF1 and P450 proteins suggest different mechanisms and indirect regulations. The sustained USF2 variants protein expression during the secretory phase in eutopic endometria from women with endometriosis may participate in the pathophysiology of this disease strongly associated with infertility and its characteristic endometrial invasion to ectopic sites in the pelvic cavity.

  2. An improved model for whole genome phylogenetic analysis by Fourier transform.

    PubMed

    Yin, Changchuan; Yau, Stephen S-T

    2015-10-07

    DNA sequence similarity comparison is one of the major steps in computational phylogenetic studies. The sequence comparison of closely related DNA sequences and genomes is usually performed by multiple sequence alignments (MSA). While the MSA method is accurate for some types of sequences, it may produce incorrect results when DNA sequences undergone rearrangements as in many bacterial and viral genomes. It is also limited by its computational complexity for comparing large volumes of data. Previously, we proposed an alignment-free method that exploits the full information contents of DNA sequences by Discrete Fourier Transform (DFT), but still with some limitations. Here, we present a significantly improved method for the similarity comparison of DNA sequences by DFT. In this method, we map DNA sequences into 2-dimensional (2D) numerical sequences and then apply DFT to transform the 2D numerical sequences into frequency domain. In the 2D mapping, the nucleotide composition of a DNA sequence is a determinant factor and the 2D mapping reduces the nucleotide composition bias in distance measure, and thus improving the similarity measure of DNA sequences. To compare the DFT power spectra of DNA sequences with different lengths, we propose an improved even scaling algorithm to extend shorter DFT power spectra to the longest length of the underlying sequences. After the DFT power spectra are evenly scaled, the spectra are in the same dimensionality of the Fourier frequency space, then the Euclidean distances of full Fourier power spectra of the DNA sequences are used as the dissimilarity metrics. The improved DFT method, with increased computational performance by 2D numerical representation, can be applicable to any DNA sequences of different length ranges. We assess the accuracy of the improved DFT similarity measure in hierarchical clustering of different DNA sequences including simulated and real datasets. The method yields accurate and reliable phylogenetic trees and demonstrates that the improved DFT dissimilarity measure is an efficient and effective similarity measure of DNA sequences. Due to its high efficiency and accuracy, the proposed DFT similarity measure is successfully applied on phylogenetic analysis for individual genes and large whole bacterial genomes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. The katG mRNA of Mycobacterium tuberculosis and Mycobacterium smegmatis is processed at its 5' end and is stabilized by both a polypurine sequence and translation initiation

    PubMed Central

    Sala, Claudia; Forti, Francesca; Magnoni, Francesca; Ghisotti, Daniela

    2008-01-01

    Background In Mycobacterium tuberculosis and in Mycobacterium smegmatis the furA-katG loci, encoding the FurA regulatory protein and the KatG catalase-peroxidase, are highly conserved. In M. tuberculosis furA-katG constitute a single operon, whereas in M. smegmatis a single mRNA covering both genes could not be found. In both species, specific 5' ends have been identified: the first one, located upstream of the furA gene, corresponds to transcription initiation from the furA promoter; the second one is the katG mRNA 5' end, located in the terminal part of furA. Results In this work we demonstrate by in vitro transcription and by RNA polymerase Chromatin immunoprecipitation that no promoter is present in the M. smegmatis region covering the latter 5' end, suggesting that it is produced by specific processing of longer transcripts. Several DNA fragments of M. tuberculosis and M. smegmatis were inserted in a plasmid between the sigA promoter and the lacZ reporter gene, and expression of the reporter gene was measured. A polypurine sequence, located four bp upstream of the katG translation start codon, increased beta-galactosidase activity and stabilized the lacZ transcript. Mutagenesis of this sequence led to destabilization of the mRNA. Analysis of constructs, in which the polypurine sequence of M. smegmatis was followed by an increasing number of katG codons, demonstrated that mRNA stability requires translation of at least 20 amino acids. In order to define the requirements for the 5' processing of the katG transcript, we created several mutations in this region and analyzed the 5' ends of the transcripts: the distance from the polypurine sequence does not seem to influence the processing, neither the sequence around the cutting point. Only mutations which create a double stranded region around the processing site prevented RNA processing. Conclusion This is the first reported case in mycobacteria, in which both a polypurine sequence and translation initiation are shown to contribute to mRNA stability. The furA-katG mRNA is transcribed from the furA promoter and immediately processed; this processing is prevented by a double stranded RNA at the cutting site, suggesting that the endoribonuclease responsible for the cleavage cuts single stranded RNA. PMID:18394163

  4. Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

    PubMed Central

    Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.

    2011-01-01

    Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

  5. Hormone-induced modifications of the chromatin structure surrounding upstream regulatory regions conserved between the mouse and rabbit whey acidic protein genes.

    PubMed Central

    Millot, Benjamin; Montoliu, Lluís; Fontaine, Marie-Louise; Mata, Teresa; Devinoy, Eve

    2003-01-01

    The upstream regulatory regions of the mouse and rabbit whey acidic protein (WAP) genes have been used extensively to target the efficient expression of foreign genes into the mammary gland of transgenic animals. Therefore both regions have been studied to elucidate fully the mechanisms controlling WAP gene expression. Three DNase I-hypersensitive sites (HSS0, HSS1 and HSS2) have been described upstream of the rabbit WAP gene in the lactating mammary gland and correspond to important regulatory regions. These sites are surrounded by variable chromatin structures during mammary-gland development. In the present study, we describe the upstream sequence of the mouse WAP gene. Analysis of genomic sequences shows that the mouse WAP gene is situated between two widely expressed genes (Cpr2 and Ramp3). We show that the hypersensitive sites found upstream of the rabbit WAP gene are also detected in the mouse WAP gene. Further, they encompass functional signal transducer and activator of transcription 5-binding sites, as has been observed in the rabbit. A new hypersensitive site (HSS3), not specific to the mammary gland, was mapped 8 kb upstream of the rabbit WAP gene. Unlike the three HSSs described above, HSS3 is also detected in the liver, but similar to HSS1, it does not depend on lactogenic hormone treatments during cell culture. The region surrounding HSS3 encompasses a potential matrix attachment region, which is also conserved upstream of the mouse WAP gene and contains a functional transcription factor Ets-1 (E26 transformation-specific-1)-binding site. Finally, we demonstrate for the first time that variations in the chromatin structure are dependent on prolactin alone. PMID:12580766

  6. Ribosomal RNA Genes Contribute to the Formation of Pseudogenes and Junk DNA in the Human Genome.

    PubMed

    Robicheau, Brent M; Susko, Edward; Harrigan, Amye M; Snyder, Marlene

    2017-02-01

    Approximately 35% of the human genome can be identified as sequence devoid of a selected-effect function, and not derived from transposable elements or repeated sequences. We provide evidence supporting a known origin for a fraction of this sequence. We show that: 1) highly degraded, but near full length, ribosomal DNA (rDNA) units, including both 45S and Intergenic Spacer (IGS), can be found at multiple sites in the human genome on chromosomes without rDNA arrays, 2) that these rDNA sequences have a propensity for being centromere proximal, and 3) that sequence at all human functional rDNA array ends is divergent from canonical rDNA to the point that it is pseudogenic. We also show that small sequence strings of rDNA (from 45S + IGS) can be found distributed throughout the genome and are identifiable as an "rDNA-like signal", representing 0.26% of the q-arm of HSA21 and ∼2% of the total sequence of other regions tested. The size of sequence strings found in the rDNA-like signal intergrade into the size of sequence strings that make up the full-length degrading rDNA units found scattered throughout the genome. We conclude that the displaced and degrading rDNA sequences are likely of a similar origin but represent different stages in their evolution towards random sequence. Collectively, our data suggests that over vast evolutionary time, rDNA arrays contribute to the production of junk DNA. The concept that the production of rDNA pseudogenes is a by-product of concerted evolution represents a previously under-appreciated process; we demonstrate here its importance. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  7. Representation of DNA sequences in genetic codon context with applications in exon and intron prediction.

    PubMed

    Yin, Changchuan

    2015-04-01

    To apply digital signal processing (DSP) methods to analyze DNA sequences, the sequences first must be specially mapped into numerical sequences. Thus, effective numerical mappings of DNA sequences play key roles in the effectiveness of DSP-based methods such as exon prediction. Despite numerous mappings of symbolic DNA sequences to numerical series, the existing mapping methods do not include the genetic coding features of DNA sequences. We present a novel numerical representation of DNA sequences using genetic codon context (GCC) in which the numerical values are optimized by simulation annealing to maximize the 3-periodicity signal to noise ratio (SNR). The optimized GCC representation is then applied in exon and intron prediction by Short-Time Fourier Transform (STFT) approach. The results show the GCC method enhances the SNR values of exon sequences and thus increases the accuracy of predicting protein coding regions in genomes compared with the commonly used 4D binary representation. In addition, this study offers a novel way to reveal specific features of DNA sequences by optimizing numerical mappings of symbolic DNA sequences.

  8. Single-cell genomic sequencing using Multiple Displacement Amplification.

    PubMed

    Lasken, Roger S

    2007-10-01

    Single microbial cells can now be sequenced using DNA amplified by the Multiple Displacement Amplification (MDA) reaction. The few femtograms of DNA in a bacterium are amplified into micrograms of high molecular weight DNA suitable for DNA library construction and Sanger sequencing. The MDA-generated DNA also performs well when used directly as template for pyrosequencing by the 454 Life Sciences method. While MDA from single cells loses some of the genomic sequence, this approach will greatly accelerate the pace of sequencing from uncultured microbes. The genetically linked sequences from single cells are also a powerful tool to be used in guiding genomic assembly of shotgun sequences of multiple organisms from environmental DNA extracts (metagenomic sequences).

  9. Randomization and In Vivo Selection Reveal a GGRG Motif Essential for Packaging Human Immunodeficiency Virus Type 2 RNA ▿ †

    PubMed Central

    Baig, Tayyba T.; Lanchy, Jean-Marc; Lodmell, J. Stephen

    2009-01-01

    The packaging signal (ψ) of human immunodeficiency virus type 2 (HIV-2) is present in the 5′ noncoding region of RNA and contains a 10-nucleotide palindrome (pal; 5′-392-GGAGUGCUCC) located upstream of the dimerization signal stem-loop 1 (SL1). pal has been shown to be functionally important in vitro and in vivo. We previously showed that the 3′ side of pal (GCUCC-3′) is involved in base-pairing interactions with a sequence downstream of SL1 to make an extended SL1, which is important for replication in vivo and the regulation of dimerization in vitro. However, the role of the 5′ side of pal (5′-GGAGU) was less clear. Here, we characterized this role using an in vivo SELEX approach. We produced a population of HIV-2 DNA genomes with random sequences within the 5′ side of pal and transfected these into COS-7 cells. Viruses from COS-7 cells were used to infect C8166 permissive cells. After several weeks of serial passage in C8166 cells, surviving viruses were sequenced. On the 5′ side of pal there was a striking convergence toward a GGRGN consensus sequence. Individual clones with consensus and nonconsensus sequences were tested in infectivity and packaging assays. Analysis of individuals that diverged from the consensus sequence showed normal viral RNA and protein synthesis but had replication defects and impaired RNA packaging. These findings clearly indicate that the GGRG motif is essential for viral replication and genomic RNA packaging. PMID:18971263

  10. Alu sequence involvement in transcriptional insulation of the keratin 18 gene in transgenic mice.

    PubMed Central

    Thorey, I S; Ceceña, G; Reynolds, W; Oshima, R G

    1993-01-01

    The human keratin 18 (K18) gene is expressed in a variety of adult simple epithelial tissues, including liver, intestine, lung, and kidney, but is not normally found in skin, muscle, heart, spleen, or most of the brain. Transgenic animals derived from the cloned K18 gene express the transgene in appropriate tissues at levels directly proportional to the copy number and independently of the sites of integration. We have investigated in transgenic mice the dependence of K18 gene expression on the distal 5' and 3' flanking sequences and upon the RNA polymerase III promoter of an Alu repetitive DNA transcription unit immediately upstream of the K18 promoter. Integration site-independent expression of tandemly duplicated K18 transgenes requires the presence of either an 825-bp fragment of the 5' flanking sequence or the 3.5-kb 3' flanking sequence. Mutation of the RNA polymerase III promoter of the Alu element within the 825-bp fragment abolishes copy number-dependent expression in kidney but does not abolish integration site-independent expression when assayed in the absence of the 3' flanking sequence of the K18 gene. The characteristics of integration site-independent expression and copy number-dependent expression are separable. In addition, the formation of the chromatin state of the K18 gene, which likely restricts the tissue-specific expression of this gene, is not dependent upon the distal flanking sequences of the 10-kb K18 gene but rather may depend on internal regulatory regions of the gene. Images PMID:7692231

  11. Major versus minor groove DNA binding of a bisarginylporphyrin hybrid molecule: A molecular mechanics investigation

    NASA Astrophysics Data System (ADS)

    Gresh, Nohad; Perrée-fauvet, Martine

    1999-03-01

    On the basis of theoretical computations, we have recently synthesised [Perrée-Fauvet, M. and Gresh, N., Tetrahedron Lett., 36 (1995) 4227] a bisarginyl conjugate of a tricationic porphyrin (BAP), designed to target, in the major groove of DNA, the d(GGC GCC)2 sequence which is part of the primary binding site of the HIV-1 retrovirus site [Wain-Hobson, S. et al., Cell, 40 (1985) 9]. In the theoretical model, the chromophore intercalates at the central d(CpG)2 step and each of the arginyl arms targets O6/N7belonging to guanine bases flanking the intercalation site. Recent IR and UV-visible spectroscopic studies have confirmed the essential features of these theoretical predictions [Mohammadi, S. et al., Biochemistry, 37 (1998) 6165]. In the present study, we compare the energies of competing intercalation modes of BAP to several double-stranded oligonucleotides, according to whether one, two or three N- methylpyridinium rings project into the major groove. Correspondingly, three minor groove binding modes were considered, the arginyl arms now targeting N3, O2 sites belonging to the purine or pyrimidine bases flanking the intercalation site. This investigation has shown that: (i) in both the major and minor grooves, the best-bound complexes have the three N-methylpyridinium rings in the groove opposite to that of the phenyl group bearing the arginyl arms; (ii) major groove binding is preferred over minor groove binding by a significant energy (29 kcal/mol); and (iii) the best-bound sequence in the major groove is d(GGC GCC)2 with two successive guanines upstream from the intercalation. On the other hand, due to the flexibility of the arginyl arms, other GC-rich sequences have close binding energies, two of them being less stable than it by less than 8 kcal/mol. These results serve as the basis for the design of derivatives of BAP with enhanced sequence selectivities in the major groove.

  12. Characterization of Clostridium perfringens iota-toxin genes and expression in Escherichia coli.

    PubMed Central

    Perelle, S; Gibert, M; Boquet, P; Popoff, M R

    1993-01-01

    The iota toxin which is produced by Clostridium perfringens type E, is a binary toxin consisting of two independent polypeptides: Ia, which is an ADP-ribosyltransferase, and Ib, which is involved in the binding and internalization of the toxin into the cell. Two degenerate oligonucleotide probes deduced from partial amino acid sequence of each component of C. spiroforme toxin, which is closely related to the iota toxin, were used to clone three overlapping DNA fragments containing the iota-toxin genes from C. perfringens type E plasmid DNA. Two genes, in the same orientation, coding for Ia (387 amino acids) and Ib (875 amino acids) and separated by 243 noncoding nucleotides were identified. A predicted signal peptide was found for each component, and the secreted Ib displays two domains, the propeptide (172 amino acids) and the mature protein (664 amino acids). The Ia gene has been expressed in Escherichia coli and C. perfringens, under the control of its own promoter. The recombinant polypeptide obtained was recognized by Ia antibodies and ADP-ribosylated actin. The expression of the Ib gene was obtained in E. coli harboring a recombinant plasmid encompassing the putative promoter upstream of the Ia gene and the Ia and Ib genes. Two residues which have been found to be involved in the NAD+ binding site of diphtheria and pseudomonas toxins are conserved in the predicted Ia sequence (Glu-14 and Trp-19). The predicted amino acid Ib sequence shows 33.9% identity with and 54.4% similarity to the protective antigen of the anthrax toxin complex. In particular, the central region of Ib, which contains a predicted transmembrane segment (Leu-292 to Ser-308), presents 45% identity with the corresponding protective antigen sequence which is involved in the translocation of the toxin across the cell membrane. Images PMID:8225592

  13. Opposite consequences of two transcription pauses caused by an intrinsic terminator oligo(U): antitermination versus termination by bacteriophage T7 RNA polymerase.

    PubMed

    Lee, Sooncheol; Kang, Changwon

    2011-05-06

    The RNA oligo(U) sequence, along with an immediately preceding RNA hairpin structure, is an essential cis-acting element for bacterial class I intrinsic termination. This sequence not only causes a pause in transcription during the beginning of the termination process but also facilitates transcript release at the end of the process. In this study, the oligo(U) sequence of the bacteriophage T7 intrinsic terminator Tφ, rather than the hairpin structure, induced pauses of phage T7 RNA polymerase not only at the termination site, triggering a termination process, but also 3 bp upstream, exerting an antitermination effect. The upstream pause presumably allowed RNA to form a thermodynamically more stable secondary structure rather than a terminator hairpin and to persist because the 5'-half of the terminator hairpin-forming sequence could be sequestered by a farther upstream sequence via sequence-specific hybridization, prohibiting formation of the terminator hairpin and termination. The putative antiterminator RNA structure lacked several base pairs essential for termination when probed using RNases A, T1, and V1. When the antiterminator was destabilized by incorporation of IMP into nascent RNA at G residue positions, antitermination was abolished. Furthermore, antitermination strength increased with more stable antiterminator secondary structures and longer pauses. Thus, the oligo(U)-mediated pause prior to the termination site can exert a cis-acting antitermination activity on intrinsic terminator Tφ, and the termination efficiency depends primarily on the termination-interfering pause that precedes the termination-facilitating pause at the termination site.

  14. Acquisition of New DNA Sequences After Infection of Chicken Cells with Avian Myeloblastosis Virus

    PubMed Central

    Shoyab, M.; Baluda, M. A.; Evans, R.

    1974-01-01

    DNA-RNA hybridization studies between 70S RNA from avian myeloblastosis virus (AMV) and an excess of DNA from (i) AMV-induced leukemic chicken myeloblasts or (ii) a mixture of normal and of congenitally infected K-137 chicken embryos producing avian leukosis viruses revealed the presence of fast- and slow-hybridizing virus-specific DNA sequences. However, the leukemic cells contained twice the level of AMV-specific DNA sequences observed in normal chicken embryonic cells. The fast-reacting sequences were two to three times more numerous in leukemic DNA than in DNA from the mixed embryos. The slow-reacting sequences had a reiteration frequency of approximately 9 and 6, in the two respective systems. Both the fast- and the slow-reacting DNA sequences in leukemic cells exhibited a higher Tm (2 C) than the respective DNA sequences in normal cells. In normal and leukemic cells the slow hybrid sequences appeared to have a Tm which was 2 C higher than that of the fast hybrid sequences. Individual non-virus-producing chicken embryos, either group-specific antigen positive or negative, contained 40 to 100 copies of the fast sequences and 2 to 6 copies of the slowly hybridizing sequences per cell genome. Normal rat cells did not contain DNA that hybridized with AMV RNA, whereas non-virus-producing rat cells transformed by B-77 avian sarcoma virus contained only the slowly reacting sequences. The results demonstrate that leukemic cells transformed by AMV contain new AMV-specific DNA sequences which were not present before infection. PMID:16789139

  15. Transcription of the Streptococcus pyogenes Hyaluronic Acid Capsule Biosynthesis Operon Is Regulated by Previously Unknown Upstream Elements

    PubMed Central

    Falaleeva, Marina; Zurek, Oliwia W.; Watkins, Robert L.; Reed, Robert W.; Ali, Hadeel; Sumby, Paul; Voyich, Jovanka M.

    2014-01-01

    The important human pathogen Streptococcus pyogenes (group A Streptococcus [GAS]) produces a hyaluronic acid (HA) capsule that plays critical roles in immune evasion. Previous studies showed that the hasABC operon encoding the capsule biosynthesis enzymes is under the control of a single promoter, P1, which is negatively regulated by the two-component regulatory system CovR/S. In this work, we characterize the sequence upstream of P1 and identify a novel regulatory region controlling transcription of the capsule biosynthesis operon in the M1 serotype strain MGAS2221. This region consists of a promoter, P2, which initiates transcription of a novel small RNA, HasS, an intrinsic transcriptional terminator that inefficiently terminates HasS, permitting read-through transcription of hasABC, and a putative promoter which lies upstream of P2. Electrophoretic mobility shift assays, quantitative reverse transcription-PCR, and transcriptional reporter data identified CovR as a negative regulator of P2. We found that the P1 and P2 promoters are completely repressed by CovR, and capsule expression is regulated by the putative promoter upstream of P2. Deletion of hasS or of the terminator eliminates CovR-binding sequences, relieving repression and increasing read-through, hasA transcription, and capsule production. Sequence analysis of 44 GAS genomes revealed a high level of polymorphism in the HasS sequence region. Most of the HasS variations were located in the terminator sequences, suggesting that this region is under strong selective pressure. We discovered that the terminator deletion mutant is highly resistant to neutrophil-mediated killing and is significantly more virulent in a mouse model of GAS invasive disease than the wild-type strain. Together, these results are consistent with the naturally occurring mutations in this region modulating GAS virulence. PMID:25287924

  16. Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

    PubMed Central

    Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

    2006-01-01

    Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

  17. Differential Penicillin-Binding Protein 5 (PBP5) Levels in the Enterococcus faecium Clades with Different Levels of Ampicillin Resistance.

    PubMed

    Montealegre, Maria Camila; Roh, Jung Hyeob; Rae, Meredith; Davlieva, Milya G; Singh, Kavindra V; Shamoo, Yousif; Murray, Barbara E

    2017-01-01

    Ampicillin resistance in Enterococcus faecium is a serious concern worldwide, complicating the treatment of E. faecium infections. Penicillin-binding protein 5 (PBP5) is considered the main ampicillin resistance determinant in E. faecium The three known E. faecium clades showed sequence variations in the pbp5 gene that are associated with their ampicillin resistance phenotype; however, these changes alone do not explain the array of resistance levels observed among E. faecium clinical strains. We aimed to determine if the levels of PBP5 are differentially regulated between the E. faecium clades, with the hypothesis that variations in PBP5 levels could help account for the spectrum of ampicillin MICs seen in E. faecium We studied pbp5 mRNA levels and PBP5 protein levels as well as the genetic environment upstream of pbp5 in 16 E. faecium strains that belong to the different E. faecium clades and for which the ampicillin MICs covered a wide range. Our results found that pbp5 and PBP5 levels are increased in subclade A1 and A2 ampicillin-resistant strains compared to those in clade B and subclade A2 ampicillin-susceptible strains. Furthermore, we found evidence of major clade-associated rearrangements in the region upstream of pbp5, including large DNA fragment insertions, deletions, and single nucleotide polymorphisms, that may be associated with the differential regulation of PBP5 levels between the E. faecium clades. Overall, these findings highlight the contribution of the clade background to the regulation of PBP5 abundance and point to differences in the region upstream of pbp5 as likely contributors to the differential expression of ampicillin resistance. Copyright © 2016 American Society for Microbiology.

  18. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  19. Self-regulation of 70-kilodalton heat shock proteins in Saccharomyces cerevisiae.

    PubMed Central

    Stone, D E; Craig, E A

    1990-01-01

    To determine whether the 70-kilodalton heat shock proteins of Saccharomyces cerevisiae play a role in regulating their own synthesis, we studied the effect of overexpressing the SSA1 protein on the activity of the SSA1 5'-regulatory region. The constitutive level of Ssa1p was increased by fusing the SSA1 structural gene to the GAL1 promoter. A reporter vector consisting of an SSA1-lacZ translational fusion was used to assess SSA1 promoter activity. In a strain producing approximately 10-fold the normal heat shock level of Ssa1p, induction of beta-galactosidase activity by heat shock was almost entirely blocked. Expression of a transcriptional fusion vector in which the CYC1 upstream activating sequence of a CYC1-lacZ chimera was replaced by a sequence containing a heat shock upstream activating sequence (heat shock element 2) from the 5'-regulatory region of SSA1 was inhibited by excess Ssa1p. The repression of an SSA1 upstream activating sequence by the SSA1 protein indicates that SSA1 self-regulation is at least partially mediated at the transcriptional level. The expression of another transcriptional fusion vector, containing heat shock element 2 and a lesser amount of flanking sequence, is not inhibited when Ssa1p is overexpressed. This suggests the existence of an element, proximal to or overlapping heat shock element 2, that confers sensitivity to the SSA1 protein. Images PMID:2181281

  20. A Novel RNA Polymerase I Transcription Initiation Factor, TIF-IE, Commits rRNA Genes by Interaction with TIF-IB, Not by DNA Binding

    PubMed Central

    Al-Khouri, Anna Maria; Paule, Marvin R.

    2002-01-01

    In the small, free-living amoeba Acanthamoeba castellanii, rRNA transcription requires, in addition to RNA polymerase I, a single DNA-binding factor, transcription initiation factor IB (TIF-IB). TIF-IB is a multimeric protein that contains TATA-binding protein (TBP) and four TBP-associated factors that are specific for polymerase I transcription. TIF-IB is required for accurate and promoter-specific initiation of rRNA transcription, recruiting and positioning the polymerase on the start site by protein-protein interaction. In A. castellanii, partially purified TIF-IB can form a persistent complex with the ribosomal DNA (rDNA) promoter while homogeneous TIF-IB cannot. An additional factor, TIF-IE, is required along with homogeneous TIF-IB for the formation of a stable complex on the rDNA core promoter. We show that TIF-IE by itself, however, does not bind to the rDNA promoter and thus differs in its mechanism from the upstream binding factor and upstream activating factor, which carry out similar complex-stabilizing functions in vertebrates and yeast, respectively. In addition to its presence in impure TIF-IB, TIF-IE is found in highly purified fractions of polymerase I, with which it associates. Renaturation of polypeptides excised from sodium dodecyl sulfate-polyacrylamide gels showed that a 141-kDa polypeptide possesses all the known activities of TIF-IE. PMID:11784852

  1. A novel RNA polymerase I transcription initiation factor, TIF-IE, commits rRNA genes by interaction with TIF-IB, not by DNA binding.

    PubMed

    Al-Khouri, Anna Maria; Paule, Marvin R

    2002-02-01

    In the small, free-living amoeba Acanthamoeba castellanii, rRNA transcription requires, in addition to RNA polymerase I, a single DNA-binding factor, transcription initiation factor IB (TIF-IB). TIF-IB is a multimeric protein that contains TATA-binding protein (TBP) and four TBP-associated factors that are specific for polymerase I transcription. TIF-IB is required for accurate and promoter-specific initiation of rRNA transcription, recruiting and positioning the polymerase on the start site by protein-protein interaction. In A. castellanii, partially purified TIF-IB can form a persistent complex with the ribosomal DNA (rDNA) promoter while homogeneous TIF-IB cannot. An additional factor, TIF-IE, is required along with homogeneous TIF-IB for the formation of a stable complex on the rDNA core promoter. We show that TIF-IE by itself, however, does not bind to the rDNA promoter and thus differs in its mechanism from the upstream binding factor and upstream activating factor, which carry out similar complex-stabilizing functions in vertebrates and yeast, respectively. In addition to its presence in impure TIF-IB, TIF-IE is found in highly purified fractions of polymerase I, with which it associates. Renaturation of polypeptides excised from sodium dodecyl sulfate-polyacrylamide gels showed that a 141-kDa polypeptide possesses all the known activities of TIF-IE.

  2. Methylation patterns of repetitive DNA sequences in germ cells of Mus musculus.

    PubMed

    Sanford, J; Forrester, L; Chapman, V; Chandley, A; Hastie, N

    1984-03-26

    The major and the minor satellite sequences of Mus musculus were undermethylated in both sperm and oocyte DNAs relative to the amount of undermethylation observed in adult somatic tissue DNA. This hypomethylation was specific for satellite sequences in sperm DNA. Dispersed repetitive and low copy sequences show a high degree of methylation in sperm DNA; however, a dispersed repetitive sequence was undermethylated in oocyte DNA. This finding suggests a difference in the amount of total genomic DNA methylation between sperm and oocyte DNA. The methylation levels of the minor satellite sequences did not change during spermiogenesis, and were not associated with the onset of meiosis or a specific stage in sperm development.

  3. Process of labeling specific chromosomes using recombinant repetitive DNA

    DOEpatents

    Moyzis, R.K.; Meyne, J.

    1988-02-12

    Chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family members and consensus sequences of the repetitive DNA families for the chromosome preferential sequences. The selected low homology regions are then hybridized with chromosomes to determine those low homology regions hybridized with a specific chromosome under normal stringency conditions.

  4. Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.

    PubMed

    Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook

    2014-11-01

    As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of our knowledge, this is the first attempt to predict protein-binding nucleotides in a given DNA sequence from the sequence data alone. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  5. Signaling coupled epigenomic regulation of gene expression.

    PubMed

    Kumar, R; Deivendran, S; Santhoshkumar, T R; Pillai, M R

    2017-10-26

    Inheritance of genomic information independent of the DNA sequence, the epigenetics, as well as gene transcription are profoundly shaped by serine/threonine and tyrosine signaling kinases and components of the chromatin remodeling complexes. To precisely respond to a changing external milieu, human cells efficiently translate upstream signals into post-translational modifications (PTMs) on histones and coregulators such as corepressors, coactivators, DNA-binding factors and PTM modifying enzymes. Because a protein with multiple residues for putative PTMs is expected to undergo more than one PTM in cells stimulated with growth factors, the outcome of combinational PTM codes on histones and coregulators is profoundly shaped by regulatory interplays between PTMs. The genomic functions of signaling kinases in cancer cells are manifested by the downstream effectors of cytoplasmic signaling cascades as well as translocation of the cytoplasmic signaling kinases to the nucleus. Signaling-mediated phosphorylation of histones serves as a regulatory switch for other PTMs, and connects chromatin remodeling complexes into gene transcription and gene activity. Here, we will discuss the recent advances in signaling-dependent epigenomic regulation of gene transcription using a few representative cancer-relevant serine/threonine and tyrosine kinases and their interplay with chromatin remodeling factors in cancer cells.

  6. A murC gene in Porphyromonas gingivalis 381.

    PubMed

    Ansai, T; Yamashita, Y; Awano, S; Shibata, Y; Wachi, M; Nagai, K; Takehara, T

    1995-09-01

    The gene encoding a 51 kDa polypeptide of Porphyromonas gingivalis 381 was isolated by immunoblotting using an antiserum raised against P. gingivalis alkaline phosphatase. DNA sequence analysis of a 2.5 kb DNA fragment containing a gene encoding the 51 kDa protein revealed one complete and two incomplete ORFs. Database searches using the FASTA program revealed significant homology between the P. gingivalis 51 kDa protein and the MurC protein of Escherichia coli, which functions in peptidoglycan synthesis. The cloned 51 kDa protein encoded a functional product that complemented an E. coli murC mutant. Moreover, the ORF just upstream of murC coded for a protein that was 31% homologous with the E. coli MurG protein. The ORF just downstream of murC coded for a protein that was 17% homologous with the Streptococcus pneumoniae penicillin-binding protein 2B (PBP2B), which functions in peptidoglycan synthesis and is responsible for antibiotic resistance. These results suggest that P. gingivalis contains a homologue of the E. coli peptidoglycan synthesis gene murC and indicate the possibility of a cluster of genes responsible for cell division and cell growth, as in the E. coli mra region.

  7. Deletion of transcription factor binding motifs using the CRISPR/spCas9 system in the β-globin LCR.

    PubMed

    Kim, Yea Woon; Kim, AeRi

    2017-07-20

    Transcription factors play roles in gene transcription through direct binding to their motifs in genome, and inhibiting this binding provides an effective strategy for studying their roles. Here we applied the CRISPR/spCas9 system to mutate the binding motifs of transcription factors. Binding motifs for erythroid specific transcription factors were mutated in the locus control region hypersensitive sites of the human β-globin locus. Guide RNAs targeting binding motifs were cloned into lentiviral CRISPR vector containing the spCas9 gene, and transduced into MEL/ch11 cells carrying a human chromosome 11. DNA mutations in clonal cells were initially screened by quantitative PCR in genomic DNA and then clarified by sequencing. Mutations in binding motifs reduced occupancy by transcription factors in a chromatin environment. Characterization of mutations revealed that the CRISPR/spCas9 system mainly induced deletions in short regions of <20 bp and preferentially deleted nucleotides around the fifth nucleotide upstream of Protospacer adjacent motifs. These results indicate that the CRISPR/Cas9 system is suitable for mutating the binding motifs of transcription factors, and, consequently, would contribute to elucidate the direct roles of transcription factors. ©2017 The Author(s).

  8. Specific DNA binding of a potential transcriptional regulator, inosine 5'-monophosphate dehydrogenase-related protein VII, to the promoter region of a methyl coenzyme m reductase I-encoding operon retrieved from Methanothermobacter thermautotrophicus strain DeltaH.

    PubMed

    Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi

    2008-10-01

    Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.

  9. Identification of a common single nucleotide polymorphism at the primer binding site of D2S1360 that causes heterozygote peak imbalance when using the Investigator HDplex Kit.

    PubMed

    Inokuchi, Shota; Yamashita, Yasuhiro; Nishimura, Kazuma; Nakanishi, Hiroaki; Saito, Kazuyuki

    2017-11-01

    Phenomena known as null alleles and peak imbalance can occur because of mutations in the primer binding sites used for DNA typing. In these cases, an accurate statistical evaluation of DNA typing is difficult. The estimated likelihood ratio is incorrectly calculated because of the null allele and allele dropout caused by mutation-induced peak imbalance. Although a number of studies have attempted to uncover examples of these phenomena, few reports are available on the human identification kit manufactured by Qiagen. In this study, 196 Japanese individuals who were heterozygous at D2S1360 were genotyped using an Investigator HDplex Kit with optimal amounts of DNA. A peak imbalance was frequently observed at the D2S1360 locus. We performed a sequencing analysis of the area surrounding the D2S1360 repeat motif to identify the cause for peak imbalance. A point mutation (G>A transition) 136 nucleotides upstream from the D2S1360 repeat motif was discovered in a number of samples. The allele frequency of the mutation was 0.0566 in the Japanese population. Therefore, human identification or kinship testing using the Investigator HDplex Kit requires caution because of the higher frequency of single nucleotide polymorphisms at the primer binding site of D2S1360 locus in the Japanese population.

  10. Retrotransposon profiling of RNA polymerase III initiation sites.

    PubMed

    Qi, Xiaojie; Daily, Kenneth; Nguyen, Kim; Wang, Haoyi; Mayhew, David; Rigor, Paul; Forouzan, Sholeh; Johnston, Mark; Mitra, Robi David; Baldi, Pierre; Sandmeyer, Suzanne

    2012-04-01

    Although retroviruses are relatively promiscuous in choice of integration sites, retrotransposons can display marked integration specificity. In yeast and slime mold, some retrotransposons are associated with tRNA genes (tDNAs). In the Saccharomyces cerevisiae genome, the long terminal repeat retrotransposon Ty3 is found at RNA polymerase III (Pol III) transcription start sites of tDNAs. Ty1, 2, and 4 elements also cluster in the upstream regions of these genes. To determine the extent to which other Pol III-transcribed genes serve as genomic targets for Ty3, a set of 10,000 Ty3 genomic retrotranspositions were mapped using high-throughput DNA sequencing. Integrations occurred at all known tDNAs, two tDNA relics (iYGR033c and ZOD1), and six non-tDNA, Pol III-transcribed types of genes (RDN5, SNR6, SNR52, RPR1, RNA170, and SCR1). Previous work in vitro demonstrated that the Pol III transcription factor (TF) IIIB is important for Ty3 targeting. However, seven loci that bind the TFIIIB loader, TFIIIC, were not targeted, underscoring the unexplained absence of TFIIIB at those sites. Ty3 integrations also occurred in two open reading frames not previously associated with Pol III transcription, suggesting the existence of a small number of additional sites in the yeast genome that interact with Pol III transcription complexes.

  11. Enlightenment of Yeast Mitochondrial Homoplasmy: Diversified Roles of Gene Conversion

    PubMed Central

    Ling, Feng; Mikawa, Tsutomu; Shibata, Takehiko

    2011-01-01

    Mitochondria have their own genomic DNA. Unlike the nuclear genome, each cell contains hundreds to thousands of copies of mitochondrial DNA (mtDNA). The copies of mtDNA tend to have heterogeneous sequences, due to the high frequency of mutagenesis, but are quickly homogenized within a cell (“homoplasmy”) during vegetative cell growth or through a few sexual generations. Heteroplasmy is strongly associated with mitochondrial diseases, diabetes and aging. Recent studies revealed that the yeast cell has the machinery to homogenize mtDNA, using a common DNA processing pathway with gene conversion; i.e., both genetic events are initiated by a double-stranded break, which is processed into 3′ single-stranded tails. One of the tails is base-paired with the complementary sequence of the recipient double-stranded DNA to form a D-loop (homologous pairing), in which repair DNA synthesis is initiated to restore the sequence lost by the breakage. Gene conversion generates sequence diversity, depending on the divergence between the donor and recipient sequences, especially when it occurs among a number of copies of a DNA sequence family with some sequence variations, such as in immunoglobulin diversification in chicken. MtDNA can be regarded as a sequence family, in which the members tend to be diversified by a high frequency of spontaneous mutagenesis. Thus, it would be interesting to determine why and how double-stranded breakage and D-loop formation induce sequence homogenization in mitochondria and sequence diversification in nuclear DNA. We will review the mechanisms and roles of mtDNA homoplasmy, in contrast to nuclear gene conversion, which diversifies gene and genome sequences, to provide clues toward understanding how the common DNA processing pathway results in such divergent outcomes. PMID:24710143

  12. Structural Confirmation of a Bent and Open Model for the Initiation Complex of T7 RNA Polymerase

    PubMed Central

    Turingan, Rosemary S.; Liu, Cuihua; Hawkins, Mary E.; Martin, Craig T.

    2008-01-01

    T7 RNA polymerase is known to induce bending of its promoter DNA upon binding, as evidenced by gel-shift assays and by recent end-to-end fluorescence energy transfer distance measurements. Crystal structures of promoter-bound and initially transcribing complexes, however, lack downstream DNA, providing no information on the overall path of the DNA through the protein. Crystal structures of the elongation complex do include downstream DNA and provide valuable guidance in the design of models for the complete melted bubble structure at initiation. In the current study, we test a specific structural model for the initiation complex, obtained by alignment of the C-terminal regions of the protein structures from both initiation and elongation and then simple transferal of the downstream DNA from the elongation complex onto the initiation complex. FRET measurement of distances from a point upstream on the promoter DNA to various points along the downstream helix reproduce the expected helical periodicity in the distances and support the model’s orientation and phasing of the downstream DNA. The model also makes predictions about the extent of melting downstream of the active site. By monitoring fluorescent base analogs incorporated at various positions in the DNA we have mapped the downstream edge of the bubble, confirming the model. The initially melted bubble, in the absence of substrate, encompasses 7–8 bases and is sufficient to allow synthesis of a 3 base transcript before further melting is required. The results demonstrate that despite massive changes in the N-terminal portion of the protein and in the DNA upstream of the active site, the DNA downstream of the active site is virtually identical in both initiation and elongation complexes. PMID:17253774

  13. "First generation" automated DNA sequencing technology.

    PubMed

    Slatko, Barton E; Kieleczawa, Jan; Ju, Jingyue; Gardner, Andrew F; Hendrickson, Cynthia L; Ausubel, Frederick M

    2011-10-01

    Beginning in the 1980s, automation of DNA sequencing has greatly increased throughput, reduced costs, and enabled large projects to be completed more easily. The development of automation technology paralleled the development of other aspects of DNA sequencing: better enzymes and chemistry, separation and imaging technology, sequencing protocols, robotics, and computational advancements (including base-calling algorithms with quality scores, database developments, and sequence analysis programs). Despite the emergence of high-throughput sequencing platforms, automated Sanger sequencing technology remains useful for many applications. This unit provides background and a description of the "First-Generation" automated DNA sequencing technology. It also includes protocols for using the current Applied Biosystems (ABI) automated DNA sequencing machines. © 2011 by John Wiley & Sons, Inc.

  14. Bacteroides fragilis mobilizable transposon Tn5520 requires a 71 base pair origin of transfer sequence and a single mobilization protein for relaxosome formation during conjugation.

    PubMed

    Vedantam, Gayatri; Knopf, Sarah; Hecht, David W

    2006-01-01

    Tn5520 is the smallest known bacterial mobilizable transposon and was isolated from an antibiotic resistant Bacteroides fragilis clinical isolate. When a conjugation apparatus is provided in trans, Tn5520 is mobilized (transferred) efficiently within, and from, both Bacteroides spp. and Escherichia coli. Only two genes are present on Tn5520; one encodes an integrase, and the other a multifunctional mobilization (Mob) protein BmpH. BmpH is essential for Tn5520 mobility. The focus of this study was to identify the Tn5520 origin of conjugative transfer (oriT) and to study BmpH-oriT binding. We delimited the functional Tn5520 oriT to a 71 bp sequence upstream of the bmpH gene. A plasmid vector harbouring this minimal 71 bp oriT was mobilized at the same frequency as that of intact Tn5520. The minimal oriT contains one 17 bp inverted repeat (IR) sequence. We constructed and tested multiple IR mutants and showed that the IR was essential in its entirety for mobilization. A nick site sequence (5'-GCTAC-3') was also identified within the minimal oriT; this sequence resembled nick sites found in plasmids of Gram positive origin. We further showed that mutation of a highly conserved GC dinucleotide in the nick site sequence completely abolished mobilization. We also purified BmpH and showed that it specifically bound a Tn5520 oriT fragment in electrophoretic mobility shift assays. We also identified non-nick site sequences within the minimal oriT that were essential for mobilization. We hypothesize that transposon-based single Mob protein systems may contribute to efficient gene dissemination from Bacteroides spp., because fewer DNA processing proteins are required for relaxosome formation.

  15. Analysis of the vhoGAC and vhtGAC operons from Methanosarcina mazei strain Gö1, both encoding a membrane-bound hydrogenase and a cytochrome b.

    PubMed

    Deppenmeier, U; Blaut, M; Lentes, S; Herzberg, C; Gottschalk, G

    1995-01-15

    DNA encompassing the structural genes of two membrane-bound hydrogenases from Methanosarcina mazei Gö1 was cloned and sequenced. The genes, arranged in the order vhoG and vhoA as well as vhtG and vhtA, were identified as those encoding the small and the large subunits of the NiFe hydrogenases [Deppenmeier, U., Blaut, M., Schmidt, B. & Gottschalk, G. (1992) Arch. Microbiol. 157, 505-511]. Northern-blot analysis revealed that the structural genes formed part of two operons, both containing one additional open reading frame (vhoC and vhtC) which codes for a cytochrome b. This conclusion was drawn from the homology of the deduced N-terminal amino acid sequences of vhoC and vhtC and the N-terminus of a 27-kDa cytochrome isolated from Ms. mazei C16. VhoC and VhtC contain four tentative hydrophobic segments which might span the cytoplasmic membrane. Hydropathy plots suggest that His23 and His50 are involved in heme coordination. The comparison of the sequencing data of vhoG and vhtG with the experimentally determined N-terminus of the small subunit indicate the presence of a 48-amino-acid leader peptide in front of the polypeptides. VhoA and VhtA contained the conserved sequence DPCXXC in the C-terminal region, which excludes the presence of a selenocysteine residue in these hydrogenases. Promoter sequences were found upstream of vhoG and vhtG, respectively. Downstream of vhoC, a putative terminator sequence was identified. Alignments of the deduced amino acid sequences of the gene clusters vhoGAC and vhtGAC showed 92-97% identity. Only the C-termini of VhoC and VhtC were not similar.

  16. Characterization of ROP18 alleles in human toxoplasmosis.

    PubMed

    Sánchez, Víctor; de-la-Torre, Alejandra; Gómez-Marín, Jorge Enrique

    2014-04-01

    The role of the virulent gene ROP18 polymorphisms is not known in human toxoplasmosis. A total of 320 clinical samples were analyzed. In samples positive for ROP18 gene, we determined by an allele specific PCR, if patients got the upstream insertion positive ROP18 sequence Toxoplasma strain (mouse avirulent strain) or the upstream insertion negative ROP18 sequence Toxoplasma strain (mouse virulent strain). We designed an ELISA assay for antibodies against ROP18 derived peptides from the three major clonal lineages of Toxoplasma. 20 clinical samples were of quality for ROP18 allele analysis. In patients with ocular toxoplasmosis, a higher inflammatory reaction on eye was associated to a PCR negative result for the upstream region of ROP18. 23.3%, 33% and 16.6% of serums from individuals with ocular toxoplasmosis were positive for type I, type II and type III ROP18 derived peptides, respectively but this assay was affected by cross reaction. The absence of Toxoplasma ROP18 promoter insertion sequence in ocular toxoplasmosis was correlated with severe ocular inflammatory response. Determination of antibodies against ROP18 protein was not useful for serotyping in human toxoplasmosis. © 2013.

  17. Influence of DNA sequence on the structure of minicircles under torsional stress

    PubMed Central

    Wang, Qian; Irobalieva, Rossitza N.; Chiu, Wah; Schmid, Michael F.; Fogg, Jonathan M.; Zechiedrich, Lynn

    2017-01-01

    Abstract The sequence dependence of the conformational distribution of DNA under various levels of torsional stress is an important unsolved problem. Combining theory and coarse-grained simulations shows that the DNA sequence and a structural correlation due to topology constraints of a circle are the main factors that dictate the 3D structure of a 336 bp DNA minicircle under torsional stress. We found that DNA minicircle topoisomers can have multiple bend locations under high torsional stress and that the positions of these sharp bends are determined by the sequence, and by a positive mechanical correlation along the sequence. We showed that simulations and theory are able to provide sequence-specific information about individual DNA minicircles observed by cryo-electron tomography (cryo-ET). We provided a sequence-specific cryo-ET tomogram fitting of DNA minicircles, registering the sequence within the geometric features. Our results indicate that the conformational distribution of minicircles under torsional stress can be designed, which has important implications for using minicircle DNA for gene therapy. PMID:28609782

  18. Integrating DNA strand-displacement circuitry with DNA tile self-assembly

    PubMed Central

    Zhang, David Yu; Hariadi, Rizal F.; Choi, Harry M.T.; Winfree, Erik

    2013-01-01

    DNA nanotechnology has emerged as a reliable and programmable way of controlling matter at the nanoscale through the specificity of Watson–Crick base pairing, allowing both complex self-assembled structures with nanometer precision and complex reaction networks implementing digital and analog behaviors. Here we show how two well-developed frameworks, DNA tile self-assembly and DNA strand-displacement circuits, can be systematically integrated to provide programmable kinetic control of self-assembly. We demonstrate the triggered and catalytic isothermal self-assembly of DNA nanotubes over 10 μm long from precursor DNA double-crossover tiles activated by an upstream DNA catalyst network. Integrating more sophisticated control circuits and tile systems could enable precise spatial and temporal organization of dynamic molecular structures. PMID:23756381

  19. Analysis of DNA Sequences by an Optical Time-Integrating Correlator: Proof-of-Concept Experiments.

    DTIC Science & Technology

    1992-05-01

    DNA ANALYSIS STRATEGY 4 2.1 Representation of DNA Bases 4 2.2 DNA Analysis Strategy 6 3.0 CUSTOM GENERATORS FOR DNA SEQUENCES 10 3.1 Hardware Design 10...of the DNA bases where each base is represented by a 7-bits long pseudorandom sequence. 5 Figure 4: Coarse analysis of a DNA sequence. 7 Figure 5: Fine...a 20-bases long database. 32 xiii LIST OF TABLES PAGE Table 1: Short representations of the DNA bases where each base is represented by 7-bits long

  20. Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu Yan; Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031; Yu Lian

    The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat bodymore » nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.« less

  1. Production of human monoclonal antibody in eggs of chimeric chickens.

    PubMed

    Zhu, Lei; van de Lavoir, Marie-Cecile; Albanese, Jenny; Beenhouwer, David O; Cardarelli, Pina M; Cuison, Severino; Deng, David F; Deshpande, Shrikant; Diamond, Jennifer H; Green, Lynae; Halk, Edward L; Heyer, Babette S; Kay, Robert M; Kerchner, Allyn; Leighton, Philip A; Mather, Christine M; Morrison, Sherie L; Nikolov, Zivko L; Passmore, David B; Pradas-Monne, Alicia; Preston, Benjamin T; Rangan, Vangipuram S; Shi, Mingxia; Srinivasan, Mohan; White, Steven G; Winters-Digiacinto, Peggy; Wong, Susan; Zhou, Wen; Etches, Robert J

    2005-09-01

    The tubular gland of the chicken oviduct is an attractive system for protein expression as large quantities of proteins are deposited in the egg, the production of eggs is easily scalable and good manufacturing practices for therapeutics from eggs have been established. Here we examined the ability of upstream and downstream DNA sequences of ovalbumin, a protein produced exclusively in very high quantities in chicken egg white, to drive tissue-specific expression of human mAb in chicken eggs. To accommodate these large regulatory regions, we established and transfected lines of chicken embryonic stem (cES) cells and formed chimeras that express mAb from cES cell-derived tubular gland cells. Eggs from high-grade chimeras contained up to 3 mg of mAb that possesses enhanced antibody-dependent cellular cytotoxicity (ADCC), nonantigenic glycosylation, acceptable half-life, excellent antigen recognition and good rates of internalization.

  2. The human immunodeficiency virus type 1 long terminal repeat specifies two different transcription complexes, only one of which is regulated by Tat.

    PubMed Central

    Lu, X; Welsh, T M; Peterlin, B M

    1993-01-01

    The human immunodeficiency virus type 1 long terminal repeat sets up two different transcription complexes, which have been called processive and nonprocessive complexes. By mutating and substituting cis-acting sequences, we mapped elements of the human immunodeficiency virus long terminal repeat that are responsible for creating each transcription complex. Whereas processive complexes are efficiently assembled by upstream promoter elements in the absence of the TATA box, nonprocessive complexes absolutely require the TATA box. Moreover, the TATA box alone can set up these nonprocessive complexes, and nonprocessive but not processive complexes are trans activated by Tat. Finally, a strong DNA-binding site between the TATA box and trans-activation-responsive region interferes with either the assembly or movement of these nonprocessive complexes and diminishes the effects of Tat. Thus, Tat affects a critical step in the formation of elongation-competent transcription complexes. Images PMID:8445708

  3. Laser mass spectrometry for DNA sequencing, disease diagnosis, and fingerprinting

    NASA Astrophysics Data System (ADS)

    Chen, C. H. Winston; Taranenko, N. I.; Zhu, Y. F.; Chung, C. N.; Allman, S. L.

    1997-05-01

    Since laser mass spectrometry has the potential for achieving very fast DNA analysis, we recently applied it to DNA sequencing, DNA typing for fingerprinting, and DNA screening for disease diagnosis. Two different approaches for sequencing DNA have been successfully demonstrated. One is to sequence DNA with DNA ladders produced from Sanger's enzymatic method. The other is to do direct sequencing without DNA ladders. The need for quick DNA typing for identification purposes is critical for forensic application. Our preliminary results indicate laser mass spectrometry can possible be used for rapid DNA fingerprinting applications at a much lower cost than gel electrophoresis. Population screening for certain genetic disease can be a very efficient step to reducing medical costs through prevention. Since laser mass spectrometry can provide very fast DNA analysis, we applied laser mass spectrometry to disease diagnosis. Clinical samples with both base deletion and point mutation have been tested with complete success.

  4. Micronuclear DNA of Oxytricha nova contains sequences with autonomously replicating activity in Saccharomyces cerevisiae.

    PubMed Central

    Colombo, M M; Swanton, M T; Donini, P; Prescott, D M

    1984-01-01

    Oxytricha nova is a hypotrichous ciliate with micronuclei and macronuclei. Micronuclei, which contain large, chromosomal-sized DNA, are genetically inert but undergo meiosis and exchange during cell mating. Macronuclei, which contain only small, gene-sized DNA molecules, provide all of the nuclear RNA needed to run the cell. After cell mating the macronucleus is derived from a micronucleus, a derivation that includes excision of the genes from chromosomes and elimination of the remaining DNA. The eliminated DNA includes all of the repetitious sequences and approximately 95% of the unique sequences. We cloned large restriction fragments from the micronucleus that confer replication ability on a replication-deficient plasmid in Saccharomyces cerevisiae. Sequences that confer replication ability are called autonomously replicating sequences. The frequency and effectiveness of autonomously replicating sequences in micronuclear DNA are similar to those reported for DNAs of other organisms introduced into yeast cells. Of the 12 micronuclear fragments with autonomously replicating sequence activity, 9 also showed homology to macronuclear DNA, indicating that they contain a macronuclear gene sequence. We conclude from this that autonomously replicating sequence activity is nonrandomly distributed throughout micronuclear DNA and is preferentially associated with those regions of micronuclear DNA that contain genes. Images PMID:6092934

  5. DNA sequence-dependent mechanics and protein-assisted bending in repressor-mediated loop formation

    PubMed Central

    Boedicker, James Q.; Garcia, Hernan G.; Johnson, Stephanie; Phillips, Rob

    2014-01-01

    As the chief informational molecule of life, DNA is subject to extensive physical manipulations. The energy required to deform double-helical DNA depends on sequence, and this mechanical code of DNA influences gene regulation, such as through nucleosome positioning. Here we examine the sequence-dependent flexibility of DNA in bacterial transcription factor-mediated looping, a context for which the role of sequence remains poorly understood. Using a suite of synthetic constructs repressed by the Lac repressor and two well-known sequences that show large flexibility differences in vitro, we make precise statistical mechanical predictions as to how DNA sequence influences loop formation and test these predictions using in vivo transcription and in vitro single-molecule assays. Surprisingly, sequence-dependent flexibility does not affect in vivo gene regulation. By theoretically and experimentally quantifying the relative contributions of sequence and the DNA-bending protein HU to DNA mechanical properties, we reveal that bending by HU dominates DNA mechanics and masks intrinsic sequence-dependent flexibility. Such a quantitative understanding of how mechanical regulatory information is encoded in the genome will be a key step towards a predictive understanding of gene regulation at single-base pair resolution. PMID:24231252

  6. Divergent nuclear 18S rDNA paralogs in a turkey coccidium, Eimeria meleagrimitis, complicate molecular systematics and identification.

    PubMed

    El-Sherry, Shiem; Ogedengbe, Mosun E; Hafeez, Mian A; Barta, John R

    2013-07-01

    Multiple 18S rDNA sequences were obtained from two single-oocyst-derived lines of each of Eimeria meleagrimitis and Eimeria adenoeides. After analysing the 15 new 18S rDNA sequences from two lines of E. meleagrimitis and 17 new sequences from two lines of E. adenoeides, there were clear indications that divergent, paralogous 18S rDNA copies existed within the nuclear genome of E. meleagrimitis. In contrast, mitochondrial cytochrome c oxidase subunit I (COI) partial sequences from all lines of a particular Eimeria sp. were identical and, in phylogenetic analyses, COI sequences clustered unambiguously in monophyletic and highly-supported clades specific to individual Eimeria sp. Phylogenetic analysis of the new 18S rDNA sequences from E. meleagrimitis showed that they formed two distinct clades: Type A with four new sequences; and Type B with nine new sequences; both Types A and B sequences were obtained from each of the single-oocyst-derived lines of E. meleagrimitis. Together these rDNA types formed a well-supported E. meleagrimitis clade. Types A and B 18S rDNA sequences from E. meleagrimitis had a mean sequence identity of only 97.4% whereas mean sequence identity within types was 99.1-99.3%. The observed intraspecific sequence divergence among E. meleagrimitis 18S rDNA sequence types was even higher (approximately 2.6%) than the interspecific sequence divergence present between some well-recognized species such as Eimeria tenella and Eimeria necatrix (1.1%). Our observations suggest that, unlike COI sequences, 18S rDNA sequences are not reliable molecular markers to be used alone for species identification with coccidia, although 18S rDNA sequences have clear utility for phylogenetic reconstruction of apicomplexan parasites at the genus and higher taxonomic ranks. Copyright © 2013. Published by Elsevier Ltd.

  7. Affordable hands-on DNA sequencing and genotyping: an exercise for teaching DNA analysis to undergraduates.

    PubMed

    Shah, Kushani; Thomas, Shelby; Stein, Arnold

    2013-01-01

    In this report, we describe a 5-week laboratory exercise for undergraduate biology and biochemistry students in which students learn to sequence DNA and to genotype their DNA for selected single nucleotide polymorphisms (SNPs). Students use miniaturized DNA sequencing gels that require approximately 8 min to run. The students perform G, A, T, C Sanger sequencing reactions. They prepare and run the gels, perform Southern blots (which require only 10 min), and detect sequencing ladders using a colorimetric detection system. Students enlarge their sequencing ladders from digital images of their small nylon membranes, and read the sequence manually. They compare their reads with the actual DNA sequence using BLAST2. After mastering the DNA sequencing system, students prepare their own DNA from a cheek swab, polymerase chain reaction-amplify a region of their DNA that encompasses a SNP of interest, and perform sequencing to determine their genotype at the SNP position. A family pedigree can also be constructed. The SNP chosen by the instructor was rs17822931, which is in the ABCC11 gene and is the determinant of human earwax type. Genotypes at the rs178229931 site vary in different ethnic populations. © 2013 by The International Union of Biochemistry and Molecular Biology.

  8. Phylogenetic characterization of a biogas plant microbial community integrating clone library 16S-rDNA sequences and metagenome sequence data obtained by 454-pyrosequencing.

    PubMed

    Kröber, Magdalena; Bekel, Thomas; Diaz, Naryttza N; Goesmann, Alexander; Jaenicke, Sebastian; Krause, Lutz; Miller, Dimitri; Runte, Kai J; Viehöver, Prisca; Pühler, Alfred; Schlüter, Andreas

    2009-06-01

    The phylogenetic structure of the microbial community residing in a fermentation sample from a production-scale biogas plant fed with maize silage, green rye and liquid manure was analysed by an integrated approach using clone library sequences and metagenome sequence data obtained by 454-pyrosequencing. Sequencing of 109 clones from a bacterial and an archaeal 16S-rDNA amplicon library revealed that the obtained nucleotide sequences are similar but not identical to 16S-rDNA database sequences derived from different anaerobic environments including digestors and bioreactors. Most of the bacterial 16S-rDNA sequences could be assigned to the phylum Firmicutes with the most abundant class Clostridia and to the class Bacteroidetes, whereas most archaeal 16S-rDNA sequences cluster close to the methanogen Methanoculleus bourgensis. Further sequences of the archaeal library most probably represent so far non-characterised species within the genus Methanoculleus. A similar result derived from phylogenetic analysis of mcrA clone sequences. The mcrA gene product encodes the alpha-subunit of methyl-coenzyme-M reductase involved in the final step of methanogenesis. BLASTn analysis applying stringent settings resulted in assignment of 16S-rDNA metagenome sequence reads to 62 16S-rDNA amplicon sequences thus enabling frequency of abundance estimations for 16S-rDNA clone library sequences. Ribosomal Database Project (RDP) Classifier processing of metagenome 16S-rDNA reads revealed abundance of the phyla Firmicutes, Bacteroidetes and Euryarchaeota and the orders Clostridiales, Bacteroidales and Methanomicrobiales. Moreover, a large fraction of 16S-rDNA metagenome reads could not be assigned to lower taxonomic ranks, demonstrating that numerous microorganisms in the analysed fermentation sample of the biogas plant are still unclassified or unknown.

  9. A real-time control system of gene expression using ligand-bound nucleic acid aptamer for metabolic engineering.

    PubMed

    Wang, Jing; Cui, Xun; Yang, Le; Zhang, Zhe; Lv, Liping; Wang, Haoyuan; Zhao, Zhenmin; Guan, Ningzi; Dong, Lichun; Chen, Rachel

    2017-07-01

    Artificial control of bio-functions through regulating gene expression is one of the most important and attractive technologies to build novel living systems that are useful in the areas of chemical synthesis, nanotechnology, pharmacology, cell biology. Here, we present a novel real-time control system of gene regulation that includes an enhancement element by introducing duplex DNA aptamers upstream promoter and a repression element by introducing a RNA aptamer upstream ribosome binding site. With the presence of ligands corresponding to the DNA aptamers, the expression of the target gene can be potentially enhanced at the transcriptional level by strengthening the recognition capability of RNAP to the recognition region and speeding up the separation efficiency of the unwinding region due to the induced DNA bubble around the thrombin-bound aptamers; while with the presence of RNA aptamer ligand, the gene expression can be repressed at the translational level by weakening the recognition capability of ribosome to RBS due to the shielding of RBS by the formed aptamer-ligand complex upstream RBS. The effectiveness and potential utility of the developed gene regulation system were demonstrated by regulating the expression of ecaA gene in the cell-free systems. The realistic metabolic engineering application of the system has also tested by regulating the expression of mgtC gene and thrombin cDNA in Escherichia coli JD1021 for controlling metabolic flux and improving thrombin production, verifying that the real-time control system of gene regulation is able to realize the dynamic regulation of gene expression with potential applications in bacterial physiology studies and metabolic engineering. Copyright © 2017. Published by Elsevier Inc.

  10. DNA capture and next-generation sequencing can recover whole mitochondrial genomes from highly degraded samples for human identification

    PubMed Central

    2013-01-01

    Background Mitochondrial DNA (mtDNA) typing can be a useful aid for identifying people from compromised samples when nuclear DNA is too damaged, degraded or below detection thresholds for routine short tandem repeat (STR)-based analysis. Standard mtDNA typing, focused on PCR amplicon sequencing of the control region (HVS I and HVS II), is limited by the resolving power of this short sequence, which misses up to 70% of the variation present in the mtDNA genome. Methods We used in-solution hybridisation-based DNA capture (using DNA capture probes prepared from modern human mtDNA) to recover mtDNA from post-mortem human remains in which the majority of DNA is both highly fragmented (<100 base pairs in length) and chemically damaged. The method ‘immortalises’ the finite quantities of DNA in valuable extracts as DNA libraries, which is followed by the targeted enrichment of endogenous mtDNA sequences and characterisation by next-generation sequencing (NGS). Results We sequenced whole mitochondrial genomes for human identification from samples where standard nuclear STR typing produced only partial profiles or demonstrably failed and/or where standard mtDNA hypervariable region sequences lacked resolving power. Multiple rounds of enrichment can substantially improve coverage and sequencing depth of mtDNA genomes from highly degraded samples. The application of this method has led to the reliable mitochondrial sequencing of human skeletal remains from unidentified World War Two (WWII) casualties approximately 70 years old and from archaeological remains (up to 2,500 years old). Conclusions This approach has potential applications in forensic science, historical human identification cases, archived medical samples, kinship analysis and population studies. In particular the methodology can be applied to any case, involving human or non-human species, where whole mitochondrial genome sequences are required to provide the highest level of maternal lineage discrimination. Multiple rounds of in-solution hybridisation-based DNA capture can retrieve whole mitochondrial genome sequences from even the most challenging samples. PMID:24289217

  11. RDNAnalyzer: A tool for DNA secondary structure prediction and sequence analysis.

    PubMed

    Afzal, Muhammad; Shahid, Ahmad Ali; Shehzadi, Abida; Nadeem, Shahid; Husnain, Tayyab

    2012-01-01

    RDNAnalyzer is an innovative computer based tool designed for DNA secondary structure prediction and sequence analysis. It can randomly generate the DNA sequence or user can upload the sequences of their own interest in RAW format. It uses and extends the Nussinov dynamic programming algorithm and has various application for the sequence analysis. It predicts the DNA secondary structure and base pairings. It also provides the tools for routinely performed sequence analysis by the biological scientists such as DNA replication, reverse compliment generation, transcription, translation, sequence specific information as total number of nucleotide bases, ATGC base contents along with their respective percentages and sequence cleaner. RDNAnalyzer is a unique tool developed in Microsoft Visual Studio 2008 using Microsoft Visual C# and Windows Presentation Foundation and provides user friendly environment for sequence analysis. It is freely available. http://www.cemb.edu.pk/sw.html RDNAnalyzer - Random DNA Analyser, GUI - Graphical user interface, XAML - Extensible Application Markup Language.

  12. Direct Detection and Sequencing of Damaged DNA Bases

    PubMed Central

    2011-01-01

    Products of various forms of DNA damage have been implicated in a variety of important biological processes, such as aging, neurodegenerative diseases, and cancer. Therefore, there exists great interest to develop methods for interrogating damaged DNA in the context of sequencing. Here, we demonstrate that single-molecule, real-time (SMRT®) DNA sequencing can directly detect damaged DNA bases in the DNA template - as a by-product of the sequencing method - through an analysis of the DNA polymerase kinetics that are altered by the presence of a modified base. We demonstrate the sequencing of several DNA templates containing products of DNA damage, including 8-oxoguanine, 8-oxoadenine, O6-methylguanine, 1-methyladenine, O4-methylthymine, 5-hydroxycytosine, 5-hydroxyuracil, 5-hydroxymethyluracil, or thymine dimers, and show that these base modifications can be readily detected with single-modification resolution and DNA strand specificity. We characterize the distinct kinetic signatures generated by these DNA base modifications. PMID:22185597

  13. Direct detection and sequencing of damaged DNA bases.

    PubMed

    Clark, Tyson A; Spittle, Kristi E; Turner, Stephen W; Korlach, Jonas

    2011-12-20

    Products of various forms of DNA damage have been implicated in a variety of important biological processes, such as aging, neurodegenerative diseases, and cancer. Therefore, there exists great interest to develop methods for interrogating damaged DNA in the context of sequencing. Here, we demonstrate that single-molecule, real-time (SMRT®) DNA sequencing can directly detect damaged DNA bases in the DNA template - as a by-product of the sequencing method - through an analysis of the DNA polymerase kinetics that are altered by the presence of a modified base. We demonstrate the sequencing of several DNA templates containing products of DNA damage, including 8-oxoguanine, 8-oxoadenine, O6-methylguanine, 1-methyladenine, O4-methylthymine, 5-hydroxycytosine, 5-hydroxyuracil, 5-hydroxymethyluracil, or thymine dimers, and show that these base modifications can be readily detected with single-modification resolution and DNA strand specificity. We characterize the distinct kinetic signatures generated by these DNA base modifications.

  14. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.

    1987-01-01

    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3575113

  15. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.

    1990-01-01

    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2333227

  16. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.

    1988-01-01

    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3368330

  17. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.

    1989-01-01

    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2654889

  18. Kilo-sequencing: an ordered strategy for rapid DNA sequence data acquisition.

    PubMed Central

    Barnes, W M; Bevan, M

    1983-01-01

    A strategy for rapid DNA sequence acquisition in an ordered, nonrandom manner, while retaining all of the conveniences of the dideoxy method with M13 transducing phage DNA template, is described. Target DNA 3 to 14 kb in size can be stably carried by our M13 vectors. Suitable targets are stretches of DNA which lack an enzyme recognition site which is unique on our cloning vectors and adjacent to the sequencing primer; current sites that are so useful when lacking are Pst, Xba, HindIII, BglII, EcoRI. By an in vitro procedure, we cut RF DNA once randomly and once specifically, to create thousands of deletions which start at the unique restriction site adjacent to the dideoxy sequencing primer and extend various distances across the target DNA. Phage carrying a desired size of deletions, whose DNA as template will give rise to DNA sequence data in a desired location along the target DNA, may be purified by electrophoresis alive on agarose gels. Phage running in the same location on the agarose gel thus conveniently give rise to nucleotide sequence data from the same kilobase of target DNA. Images PMID:6298723

  19. Silicene nanoribbon as a new DNA sequencing device

    NASA Astrophysics Data System (ADS)

    Alesheikh, Sara; Shahtahmassebi, Nasser; Roknabadi, Mahmood Rezaee; Pilevar Shahri, Raheleh

    2018-02-01

    The importance of applying DNA sequencing in different fields, results in looking for fast and cheap methods. Nanotechnology helps this development by introducing nanostructures used for DNA sequencing. In this work we study the interaction between zigzag silicene nanoribbon and DNA nucleobases using DFT and non equilibrium Green's function approach, to investigate the possibility of using zigzag silicene nanoribbons as a biosensor for DNA sequencing.

  20. Isolation and characterization of target sequences of the chicken CdxA homeobox gene.

    PubMed Central

    Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A

    1993-01-01

    The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943

  1. Sequence periodicity in nucleosomal DNA and intrinsic curvature.

    PubMed

    Nair, T Murlidharan

    2010-05-17

    Most eukaryotic DNA contained in the nucleus is packaged by wrapping DNA around histone octamers. Histones are ubiquitous and bind most regions of chromosomal DNA. In order to achieve smooth wrapping of the DNA around the histone octamer, the DNA duplex should be able to deform and should possess intrinsic curvature. The deformability of DNA is a result of the non-parallelness of base pair stacks. The stacking interaction between base pairs is sequence dependent. The higher the stacking energy the more rigid the DNA helix, thus it is natural to expect that sequences that are involved in wrapping around the histone octamer should be unstacked and possess intrinsic curvature. Intrinsic curvature has been shown to be dictated by the periodic recurrence of certain dinucleotides. Several genome-wide studies directed towards mapping of nucleosome positions have revealed periodicity associated with certain stretches of sequences. In the current study, these sequences have been analyzed with a view to understand their sequence-dependent structures. Higher order DNA structures and the distribution of molecular bend loci associated with 146 base nucleosome core DNA sequence from C. elegans and chicken have been analyzed using the theoretical model for DNA curvature. The curvature dispersion calculated by cyclically permuting the sequences revealed that the molecular bend loci were delocalized throughout the nucleosome core region and had varying degrees of intrinsic curvature. The higher order structures associated with nucleosomes of C.elegans and chicken calculated from the sequences revealed heterogeneity with respect to the deviation of the DNA axis. The results points to the possibility of context dependent curvature of varying degrees to be associated with nucleosomal DNA.

  2. Assessing the Fidelity of Ancient DNA Sequences Amplified From Nuclear Genes

    PubMed Central

    Binladen, Jonas; Wiuf, Carsten; Gilbert, M. Thomas P.; Bunce, Michael; Barnett, Ross; Larson, Greger; Greenwood, Alex D.; Haile, James; Ho, Simon Y. W.; Hansen, Anders J.; Willerslev, Eske

    2006-01-01

    To date, the field of ancient DNA has relied almost exclusively on mitochondrial DNA (mtDNA) sequences. However, a number of recent studies have reported the successful recovery of ancient nuclear DNA (nuDNA) sequences, thereby allowing the characterization of genetic loci directly involved in phenotypic traits of extinct taxa. It is well documented that postmortem damage in ancient mtDNA can lead to the generation of artifactual sequences. However, as yet no one has thoroughly investigated the damage spectrum in ancient nuDNA. By comparing clone sequences from 23 fossil specimens, recovered from environments ranging from permafrost to desert, we demonstrate the presence of miscoding lesion damage in both the mtDNA and nuDNA, resulting in insertion of erroneous bases during amplification. Interestingly, no significant differences in the frequency of miscoding lesion damage are recorded between mtDNA and nuDNA despite great differences in cellular copy numbers. For both mtDNA and nuDNA, we find significant positive correlations between total sequence heterogeneity and the rates of type 1 transitions (adenine → guanine and thymine → cytosine) and type 2 transitions (cytosine → thymine and guanine → adenine), respectively. Type 2 transitions are by far the most dominant and increase relative to those of type 1 with damage load. The results suggest that the deamination of cytosine (and 5-methyl cytosine) to uracil (and thymine) is the main cause of miscoding lesions in both ancient mtDNA and nuDNA sequences. We argue that the problems presented by postmortem damage, as well as problems with contamination from exogenous sources of conserved nuclear genes, allelic variation, and the reliance on single nucleotide polymorphisms, call for great caution in studies relying on ancient nuDNA sequences. PMID:16299392

  3. [Current applications of high-throughput DNA sequencing technology in antibody drug research].

    PubMed

    Yu, Xin; Liu, Qi-Gang; Wang, Ming-Rong

    2012-03-01

    Since the publication of a high-throughput DNA sequencing technology based on PCR reaction was carried out in oil emulsions in 2005, high-throughput DNA sequencing platforms have been evolved to a robust technology in sequencing genomes and diverse DNA libraries. Antibody libraries with vast numbers of members currently serve as a foundation of discovering novel antibody drugs, and high-throughput DNA sequencing technology makes it possible to rapidly identify functional antibody variants with desired properties. Herein we present a review of current applications of high-throughput DNA sequencing technology in the analysis of antibody library diversity, sequencing of CDR3 regions, identification of potent antibodies based on sequence frequency, discovery of functional genes, and combination with various display technologies, so as to provide an alternative approach of discovery and development of antibody drugs.

  4. A distinct class of homeodomain proteins is encoded by two sequentially expressed Drosophila genes from the 93D/E cluster.

    PubMed Central

    Jagla, K; Stanceva, I; Dretzen, G; Bellard, F; Bellard, M

    1994-01-01

    Homeodomains appear to be one of the most frequently employed DNA-binding domains in a superfamily of transacting factors. It is likely that during evolution several sub-types of homeodomain have evolved from a common ancestral domain, resulting in distinct but closely related DNA-binding preferences. Here we describe the conservation of a distinct type of homeodomain encoded by the Drosophila lady-bird-late (lbl) gene, previously named nkch4 (1). Using degenerate PCR primers corresponding to the most divergent regions of the first and third helix of the Lbl homeodomain we have amplified, from genomic DNA of the fly, a lady-bird-like homeobox fragment. The Drosophila PCR products contained both the lbl (1) and a highly related homeobox sequence, which we named lady-bird-early (lbe). This new Drosophila gene resides directly upstream to lbl and together with tinman/NK4 (2, 3, 4, 5), bagpipe/NK3 (2, 4) S59/NK1 (4, 6) and 93Bal (7) compose the 93D/E homeobox gene cluster. Ibe and lbl are transcribed from the same strand and in a temporal order corresponding to their 5'-3' chromosomal location. Transcripts of both genes are found in the epiderm of Drosophila embryos, in cells known to express a segment polarity gene wingless (8), and their spatial and temporal colinearity of expression strongly suggests that they cooperate during segmentation. The amino-acid composition of both Lady-bird homeodomains differ from that of Antp-type at several positions involved in DNA recognition. These substitutions appear to modify DNA-binding preferences since Lbl homeodomain is unable to recognize the most common homeodomain binding TAAT motif in gel retardation experiments. Images PMID:7909370

  5. DNA fingerprinting, DNA barcoding, and next generation sequencing technology in plants.

    PubMed

    Sucher, Nikolaus J; Hennell, James R; Carles, Maria C

    2012-01-01

    DNA fingerprinting of plants has become an invaluable tool in forensic, scientific, and industrial laboratories all over the world. PCR has become part of virtually every variation of the plethora of approaches used for DNA fingerprinting today. DNA sequencing is increasingly used either in combination with or as a replacement for traditional DNA fingerprinting techniques. A prime example is the use of short, standardized regions of the genome as taxon barcodes for biological identification of plants. Rapid advances in "next generation sequencing" (NGS) technology are driving down the cost of sequencing and bringing large-scale sequencing projects into the reach of individual investigators. We present an overview of recent publications that demonstrate the use of "NGS" technology for DNA fingerprinting and DNA barcoding applications.

  6. Mammalian DNA enriched for replication origins is enriched for snap-back sequences.

    PubMed

    Zannis-Hadjopoulos, M; Kaufmann, G; Martin, R G

    1984-11-15

    Using the instability of replication loops as a method for the isolation of double-stranded nascent DNA, extruded DNA enriched for replication origins was obtained and denatured. Snap-back DNA, single-stranded DNA with inverted repeats (palindromic sequences), reassociates rapidly into stem-loop structures with zero-order kinetics when conditions are changed from denaturing to renaturing, and can be assayed by chromatography on hydroxyapatite. Origin-enriched nascent DNA strands from mouse, rat and monkey cells growing either synchronously or asynchronously were purified and assayed for the presence of snap-back sequences. The results show that origin-enriched DNA is also enriched for snap-back sequences, implying that some origins for mammalian DNA replication contain or lie near palindromic sequences.

  7. B-Bolivia, an Allele of the Maize b1 Gene with Variable Expression, Contains a High Copy Retrotransposon-Related Sequence Immediately Upstream1

    PubMed Central

    Selinger, David A.; Chandler, Vicki L.

    2001-01-01

    The maize (Zea mays) b1 gene encodes a transcription factor that regulates the anthocyanin pigment pathway. Of the b1 alleles with distinct tissue-specific expression, B-Peru and B-Bolivia are the only alleles that confer seed pigmentation. B-Bolivia produces variable and weaker seed expression but darker, more regular plant expression relative to B-Peru. Our experiments demonstrated that B-Bolivia is not expressed in the seed when transmitted through the male. When transmitted through the female the proportion of kernels pigmented and the intensity of pigment varied. Molecular characterization of B-Bolivia demonstrated that it shares the first 530 bp of the upstream region with B-Peru, a region sufficient for seed expression. Immediately upstream of 530 bp, B-Bolivia is completely divergent from B-Peru. These sequences share sequence similarity to retrotransposons. Transient expression assays of various promoter constructs identified a 33-bp region in B-Bolivia that can account for the reduced aleurone pigment amounts (40%) observed with B-Bolivia relative to B-Peru. Transgenic plants carrying the B-Bolivia promoter proximal region produced pigmented seeds. Similar to native B-Bolivia, some transgene loci are variably expressed in seeds. In contrast to native B-Bolivia, the transgene loci are expressed in seeds when transmitted through both the male and female. Some transgenic lines produced pigment in vegetative tissues, but the tissue-specificity was different from B-Bolivia, suggesting the introduced sequences do not contain the B-Bolivia plant-specific regulatory sequences. We hypothesize that the chromatin context of the B-Bolivia allele controls its epigenetic seed expression properties, which could be influenced by the adjacent highly repeated retrotransposon sequence. PMID:11244116

  8. Two alternative ways of start site selection in human norovirus reinitiation of translation.

    PubMed

    Luttermann, Christine; Meyers, Gregor

    2014-04-25

    The calicivirus minor capsid protein VP2 is expressed via termination/reinitiation. This process depends on an upstream sequence element denoted termination upstream ribosomal binding site (TURBS). We have shown for feline calicivirus and rabbit hemorrhagic disease virus that the TURBS contains three sequence motifs essential for reinitiation. Motif 1 is conserved among caliciviruses and is complementary to a sequence in the 18 S rRNA leading to the model that hybridization between motif 1 and 18 S rRNA tethers the post-termination ribosome to the mRNA. Motif 2 and motif 2* are proposed to establish a secondary structure positioning the ribosome relative to the start site of the terminal ORF. Here, we analyzed human norovirus (huNV) sequences for the presence and importance of these motifs. The three motifs were identified by sequence analyses in the region upstream of the VP2 start site, and we showed that these motifs are essential for reinitiation of huNV VP2 translation. More detailed analyses revealed that the site of reinitiation is not fixed to a single codon and does not need to be an AUG, even though this codon is clearly preferred. Interestingly, we were able to show that reinitiation can occur at AUG codons downstream of the canonical start/stop site in huNV and feline calicivirus but not in rabbit hemorrhagic disease virus. Although reinitiation at the original start site is independent of the Kozak context, downstream initiation exhibits requirements for start site sequence context known for linear scanning. These analyses on start codon recognition give a more detailed insight into this fascinating mechanism of gene expression.

  9. Specific minor groove solvation is a crucial determinant of DNA binding site recognition

    PubMed Central

    Harris, Lydia-Ann; Williams, Loren Dean; Koudelka, Gerald B.

    2014-01-01

    The DNA sequence preferences of nearly all sequence specific DNA binding proteins are influenced by the identities of bases that are not directly contacted by protein. Discrimination between non-contacted base sequences is commonly based on the differential abilities of DNA sequences to allow narrowing of the DNA minor groove. However, the factors that govern the propensity of minor groove narrowing are not completely understood. Here we show that the differential abilities of various DNA sequences to support formation of a highly ordered and stable minor groove solvation network are a key determinant of non-contacted base recognition by a sequence-specific binding protein. In addition, disrupting the solvent network in the non-contacted region of the binding site alters the protein's ability to recognize contacted base sequences at positions 5–6 bases away. This observation suggests that DNA solvent interactions link contacted and non-contacted base recognition by the protein. PMID:25429976

  10. A Method for Preparing DNA Sequencing Templates Using a DNA-Binding Microplate

    PubMed Central

    Yang, Yu; Hebron, Haroun R.; Hang, Jun

    2009-01-01

    A DNA-binding matrix was immobilized on the surface of a 96-well microplate and used for plasmid DNA preparation for DNA sequencing. The same DNA-binding plate was used for bacterial growth, cell lysis, DNA purification, and storage. In a single step using one buffer, bacterial cells were lysed by enzymes, and released DNA was captured on the plate simultaneously. After two wash steps, DNA was eluted and stored in the same plate. Inclusion of phosphates in the culture medium was found to enhance the yield of plasmid significantly. Purified DNA samples were used successfully in DNA sequencing with high consistency and reproducibility. Eleven vectors and nine libraries were tested using this method. In 10 μl sequencing reactions using 3 μl sample and 0.25 μl BigDye Terminator v3.1, the results from a 3730xl sequencer gave a success rate of 90–95% and read-lengths of 700 bases or more. The method is fully automatable and convenient for manual operation as well. It enables reproducible, high-throughput, rapid production of DNA with purity and yields sufficient for high-quality DNA sequencing at a substantially reduced cost. PMID:19568455

  11. Dendritic Cell-Based Immunotherapy of Breast Cancer: Modulation by CpG DNA

    DTIC Science & Technology

    2005-09-01

    tumor-associated antigens and bacterial DNA oligodeoxynucleotides containing unmethylated CpG sequences (CpG DNA) further augment the immune priming...associated antigens by cytotoxic T lymphocytes, and bacterial DNA oligodeoxy- nucleotides containing unmethylated CpG sequences (CpG DNA) can further...further amplify their immunostimulatory capacity and bacterial DNA oligodeoxynucleotides (ODN) containing unmethylated CpG sequences (CpG DNA) provide such

  12. The presence of both negative and positive elements in the 5'-flanking sequence of the rat Na,K-ATPase alpha 3 subunit gene are required for brain expression in transgenic mice.

    PubMed Central

    Pathak, B G; Neumann, J C; Croyle, M L; Lingrel, J B

    1994-01-01

    The Na,K-ATPase is an integral plasma membrane protein consisting of alpha and beta subunits, each of which has discrete isoforms expressed in a tissue-specific manner. Of the three functional alpha isoform genes, the one encoding the alpha 3 isoform is the most tissue-restricted in its expression, being found primarily in the brain. To identify regions of the alpha 3 isoform gene that are involved in directing expression in the brain, a 1.6 kb 5'-flanking sequence was attached to a reporter gene, chloramphenicol acetyltransferase (CAT). The alpha 3-CAT chimeric gene construct was microinjected into fertilized mouse eggs, and transgenic mice were produced. Analysis of adult transgenic mice from different lines revealed that the transgene is expressed primarily in the brain. To further delineate regions that are needed for conferring expression in this tissue, systematic deletions of the 5'-flanking sequence of the alpha 3-CAT fusion constructs were made and analyzed, again using transgenic mice. The results from these analyses indicate that DNA sequences required for mediating brain-specific expression of the alpha 3 isoform gene are present within 210 bp upstream of the transcription initiation site. alpha 3-CAT promoter constructs containing scanning mutations in this region were also assayed in transgenic mice. These studies have identified both a functional neural-restrictive silencer element as well as a positively acting cis element. Images PMID:7984427

  13. Biochemical and Genetic Characterization of Coagulin, a New Antilisterial Bacteriocin in the Pediocin Family of Bacteriocins, Produced by Bacillus coagulans I4

    PubMed Central

    Le Marrec, Claire; Hyronimus, Bertrand; Bressollier, Philippe; Verneuil, Bernard; Urdaci, Maria C.

    2000-01-01

    A plasmid-linked antimicrobial peptide, named coagulin, produced by Bacillus coagulans I4 has recently been reported (B. Hyronimus, C. Le Marrec and M. C. Urdaci, J. Appl. Microbiol. 85:42–50, 1998). In the present study, the complete, unambiguous primary amino acid sequence of the peptide was obtained by a combination of both N-terminal sequencing of purified peptide and the complete sequence deduced from the structural gene harbored by plasmid I4. Data revealed that this peptide of 44 residues has an amino acid sequence similar to that described for pediocins AcH and PA-1, produced by different Pediococcus acidilactici strains and 100% identical. Coagulin and pediocin differed only by a single amino acid at their C terminus. Analysis of the genetic determinants revealed the presence, on the pI4 DNA, of the entire 3.5-kb operon of four genes described for pediocin AcH and PA-1 production. No extended homology was observed between pSMB74 from P. acidilactici and pI4 when analyzing the regions upstream and downstream of the operon. An oppositely oriented gene immediately dowstream of the bacteriocin operon specifies a 474-amino-acid protein which shows homology to Mob-Pre (plasmid recombination enzyme) proteins encoded by several small plasmids extracted from gram-positive bacteria. This is the first report of a pediocin-like peptide appearing naturally in a non-lactic acid bacterium genus. PMID:11097892

  14. Genetic characterization of UCS region of Pneumocystis jirovecii and construction of allelic profiles of Indian isolates based on sequence typing at three regions.

    PubMed

    Gupta, Rashmi; Mirdha, Bijay Ranjan; Guleria, Randeep; Kumar, Lalit; Luthra, Kalpana; Agarwal, Sanjay Kumar; Sreenivas, Vishnubhatla

    2013-01-01

    Pneumocystis jirovecii is an opportunistic pathogen that causes severe pneumonia in immunocompromised patients. To study the genetic diversity of P. jirovecii in India the upstream conserved sequence (UCS) region of Pneumocystis genome was amplified, sequenced and genotyped from a set of respiratory specimens obtained from 50 patients with a positive result for nested mitochondrial large subunit ribosomal RNA (mtLSU rRNA) PCR during the years 2005-2008. Of these 50 cases, 45 showed a positive PCR for UCS region. Variations in the tandem repeats in UCS region were characterized by sequencing all the positive cases. Of the 45 cases, one case showed five repeats, 11 cases showed four repeats, 29 cases showed three repeats and four cases showed two repeats. By running amplified DNA from all these cases on a high-resolution gel, mixed infection was observed in 12 cases (26.7%, 12/45). Forty three of 45 cases included in this study had previously been typed at mtLSU rRNA and internal transcribed spacer (ITS) region by our group. In the present study, the genotypes at those two regions were combined with UCS repeat patterns to construct allelic profiles of 43 cases. A total of 36 allelic profiles were observed in 43 isolates indicating high genetic variability. A statistically significant association was observed between mtLSU rRNA genotype 1, ITS type Ea and UCS repeat pattern 4. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. A rapid and cost-effective method for sequencing pooled cDNA clones by using a combination of transposon insertion and Gateway technology.

    PubMed

    Morozumi, Takeya; Toki, Daisuke; Eguchi-Ogawa, Tomoko; Uenishi, Hirohide

    2011-09-01

    Large-scale cDNA-sequencing projects require an efficient strategy for mass sequencing. Here we describe a method for sequencing pooled cDNA clones using a combination of transposon insertion and Gateway technology. Our method reduces the number of shotgun clones that are unsuitable for reconstruction of cDNA sequences, and has the advantage of reducing the total costs of the sequencing project.

  16. Biological sequence compression algorithms.

    PubMed

    Matsumoto, T; Sadakane, K; Imai, H

    2000-01-01

    Today, more and more DNA sequences are becoming available. The information about DNA sequences are stored in molecular biology databases. The size and importance of these databases will be bigger and bigger in the future, therefore this information must be stored or communicated efficiently. Furthermore, sequence compression can be used to define similarities between biological sequences. The standard compression algorithms such as gzip or compress cannot compress DNA sequences, but only expand them in size. On the other hand, CTW (Context Tree Weighting Method) can compress DNA sequences less than two bits per symbol. These algorithms do not use special structures of biological sequences. Two characteristic structures of DNA sequences are known. One is called palindromes or reverse complements and the other structure is approximate repeats. Several specific algorithms for DNA sequences that use these structures can compress them less than two bits per symbol. In this paper, we improve the CTW so that characteristic structures of DNA sequences are available. Before encoding the next symbol, the algorithm searches an approximate repeat and palindrome using hash and dynamic programming. If there is a palindrome or an approximate repeat with enough length then our algorithm represents it with length and distance. By using this preprocessing, a new program achieves a little higher compression ratio than that of existing DNA-oriented compression algorithms. We also describe new compression algorithm for protein sequences.

  17. KpnBI is the prototype of a new family (IE) of bacterial type I restriction-modification system

    PubMed Central

    Chin, V.; Valinluck, V.; Magaki, S.; Ryu, J.

    2004-01-01

    KpnBI is a restriction-modification (R-M) system recognized in the GM236 strain of Klebsiella pneumoniae. Here, the KpnBI modification genes were cloned into a plasmid using a modification expression screening method. The modification genes that consist of both hsdM (2631 bp) and hsdS (1344 bp) genes were identified on an 8.2 kb EcoRI chromosomal fragment. These two genes overlap by one base and share the same promoter located upstream of the hsdM gene. Using recently developed plasmid R-M tests and a computer program RM Search, the DNA recognition sequence for the KpnBI enzymes was identified as a new 8 nt sequence containing one degenerate base with a 6 nt spacer, CAAANNNNNNRTCA. From Dam methylation and HindIII sensitivity tests, the methylation loci were predicted to be the italicized third adenine in the 5′ specific region and the adenine opposite the italicized thymine in the 3′ specific region. Combined with previous sequence data for hsdR, we concluded that the KpnBI system is a typical type I R-M system. The deduced amino acid sequences of the three subunits of the KpnBI system show only limited homologies (25 to 33% identity) at best, to the four previously categorized type I families (IA, IB, IC, and ID). Furthermore, their identity scores to other uncharacterized putative genome type I sequences were 53% at maximum. Therefore, we propose that KpnBI is the prototype of a new ‘type IE’ family. PMID:15475385

  18. Detection of DNA Methylation by Whole-Genome Bisulfite Sequencing.

    PubMed

    Li, Qing; Hermanson, Peter J; Springer, Nathan M

    2018-01-01

    DNA methylation plays an important role in the regulation of the expression of transposons and genes. Various methods have been developed to assay DNA methylation levels. Bisulfite sequencing is considered to be the "gold standard" for single-base resolution measurement of DNA methylation levels. Coupled with next-generation sequencing, whole-genome bisulfite sequencing (WGBS) allows DNA methylation to be evaluated at a genome-wide scale. Here, we described a protocol for WGBS in plant species with large genomes. This protocol has been successfully applied to assay genome-wide DNA methylation levels in maize and barley. This protocol has also been successfully coupled with sequence capture technology to assay DNA methylation levels in a targeted set of genomic regions.

  19. Single-Molecule Electrical Random Resequencing of DNA and RNA

    NASA Astrophysics Data System (ADS)

    Ohshiro, Takahito; Matsubara, Kazuki; Tsutsui, Makusu; Furuhashi, Masayuki; Taniguchi, Masateru; Kawai, Tomoji

    2012-07-01

    Two paradigm shifts in DNA sequencing technologies--from bulk to single molecules and from optical to electrical detection--are expected to realize label-free, low-cost DNA sequencing that does not require PCR amplification. It will lead to development of high-throughput third-generation sequencing technologies for personalized medicine. Although nanopore devices have been proposed as third-generation DNA-sequencing devices, a significant milestone in these technologies has been attained by demonstrating a novel technique for resequencing DNA using electrical signals. Here we report single-molecule electrical resequencing of DNA and RNA using a hybrid method of identifying single-base molecules via tunneling currents and random sequencing. Our method reads sequences of nine types of DNA oligomers. The complete sequence of 5'-UGAGGUA-3' from the let-7 microRNA family was also identified by creating a composite of overlapping fragment sequences, which was randomly determined using tunneling current conducted by single-base molecules as they passed between a pair of nanoelectrodes.

  20. Transcriptional regulation of podoplanin expression by Prox1 in lymphatic endothelial cells.

    PubMed

    Pan, Yanfang; Wang, Wen-di; Yago, Tadayuki

    2014-07-01

    Transcription factor prospero homeobox 1 (Prox-1) and podoplanin (PDPN), mucin-type transmembane protein, are both constantly expressed in lymphatic endothelial cells (LECs) and appear to function in an LEC-autonomous manner. Mice globally lacking PDPN (Pdpn(-/-)) develop abnormal and blood-filled lymphatic vessels that highly resemble those in inducible mice lacking Prox-1 (Prox1(-/-)). Prox1 has also been reported to induce PDPN expression in cultured ECs. Thus, we hypothesize that PDPN functions downstream of Prox1 and that its expression is regulated by Prox1 in LECs at the transcriptional level. We first identified four putative binding elements for Prox1 in the 5' upstream regulatory region of Pdpn gene and found that Prox1 directly binds to the 5' regulatory sequence of Pdpn gene in LECs by chromatin immunoprecipitation assay. DNA pull down assay confirmed that Prox1 binds to the putative binding element. In addition, luciferase reporter assay indicated that Prox1 binding to the 5' regulatory sequence of Pdpn regulates Pdpn gene expression. We are therefore the first to experimentally demonstrate that Prox1 regulates PDPN expression at the transcriptional level in the lymphatic vascular system. Copyright © 2014 Elsevier Inc. All rights reserved.

Top